WorldWideScience

Sample records for silenced normal development

  1. Silence

    Science.gov (United States)

    Cogswell, J.

    2011-06-01

    On the occasion of the International Year of Astronomy, I was commissioned to create a mural for the University of Michigan Department of Astronomy, responding to an array of scientific images based on astronomical research, with special focus on the work of University of Michigan astronomers carried out within the building. My paper illustrates the development of this and several subsequent projects, explaining the implications for my artistic practice of entering into this conversation with astronomers and their work.

  2. Normal growth and development

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/002456.htm Normal growth and development To use the sharing features on this page, please enable JavaScript. A child's growth and development can be divided into four periods: ...

  3. Tobacco rattle virus (TRV) based silencing of cotton enoyl-CoA reductase (ECR) gene and the role of very long chain fatty acids in normal leaf development and resistance to wilt disease

    Science.gov (United States)

    A Tobacco rattle virus (TRV) based virus-induced gene silencing (VIGS) assay was employed as a reverse genetic approach to study gene function in cotton (Gossypium hirsutum). This approach was used to investigate the function of Enoyl-CoA reductase (GhECR) in pathogen defense. Amino acid sequence al...

  4. Silencing of the SlNAP7 gene influences plastid development and lycopene accumulation in tomato

    Science.gov (United States)

    Fu, Da-Qi; Meng, Lan-Huan; Zhu, Ben-Zhong; Zhu, Hong-Liang; Yan, Hua-Xue; Luo, Yun-Bo

    2016-12-01

    Ripening is an important stage of fruit development. To screen the genes associated with pigment formation in tomato fruit, a suppression subtractive hybridization (SSH) cDNA library was constructed by using tomato fruit in the green ripe and break ripe stages, and 129 differential genes were obtained. Using redness as a screening marker, virus-induced gene silencing (VIGS) of the differential genes was performed with a sprout vacuum-infiltration system (SVI). The results showed that silencing the SlNAP7 gene affected the chloroplast development of tomato leaves, manifesting as a photo-bleaching phenotype, and silenced fruit significantly affected the accumulation of lycopene, manifested as a yellow phenotype. In our study, we found that silencing the SlNAP7 gene downregulates the expression of the POR and PORA genes and destroys the normal development of the chloroplast. The expression of related genes included in the lycopene biosynthesis pathway was not significantly changed, but lycopene accumulation was significantly reduced in tomato fruit. Perhaps it was caused by the destruction of the chromoplast, which leads to the oxidation of lycopene. The results show that the SlNAP7 gene influences chloroplast development and lycopene accumulation in tomato.

  5. Normalization of Overexpressed α-Synuclein Causing Parkinson's Disease By a Moderate Gene Silencing With RNA Interference

    Directory of Open Access Journals (Sweden)

    Masaki Takahashi

    2015-01-01

    Full Text Available The α-synuclein (SNCA gene is a responsible gene for Parkinson's disease (PD; and not only nucleotide variations but also overexpression of SNCA appears to be involved in the pathogenesis of PD. A specific inhibition against mutant SNCA genes carrying nucleotide variations may be feasible by a specific silencing such as an allele-specific RNA interference (RNAi; however, there is no method for restoring the SNCA overexpression to a normal level. Here, we show that an atypical RNAi using small interfering RNAs (siRNAs that confer a moderate level of gene silencing is capable of controlling overexpressed SNCA genes to return to a normal level; named “expression-control RNAi” (ExCont-RNAi. ExCont-RNAi exhibited little or no significant off-target effects in its treated PD patient's fibroblasts that carry SNCA triplication. To further assess the therapeutic effect of ExCont-RNAi, PD-model flies that carried the human SNCA gene underwent an ExCont-RNAi treatment. The treated PD-flies demonstrated a significant improvement in their motor function. Our current findings suggested that ExCont-RNAi might be capable of becoming a novel therapeutic procedure for PD with the SNCA overexpression, and that siRNAs conferring a moderate level of gene silencing to target genes, which have been abandoned as useless siRNAs so far, might be available for controlling abnormally expressed disease-causing genes without producing adverse effects.

  6. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  7. Development of a gene silencing DNA vector derived from a broad host range geminivirus

    Directory of Open Access Journals (Sweden)

    Hancock Leandria C

    2009-07-01

    Full Text Available Abstract Background Gene silencing is proving to be a powerful tool for genetic, developmental, and physiological analyses. The use of viral induced gene silencing (VIGS offers advantages to transgenic approaches as it can be potentially applied to non-model systems for which transgenic techniques are not readily available. However, many VIGS vectors are derived from Gemini viruses that have limited host ranges. We present a new, unipartite vector that is derived from a curtovirus that has a broad host range and will be amenable to use in many non-model systems. Results The construction of a gene silencing vector derived from the geminivirus Beet curly top virus (BCTV, named pWSRi, is reported. Two versions of the vector have been developed to allow application by biolistic techniques or by agro-infiltration. We demonstrate its ability to silence nuclear genes including ribulose bisphosphate carboxylase small subunit (rbcS, transketolase, the sulfur allele of magnesium chelatase (ChlI, and two homeotic transcription factors in spinach or tomato by generating gene-specific knock-down phenotypes. Onset of phenotypes occurred 3 to 12 weeks post-inoculation, depending on the target gene, in organs that developed after the application. The vector lacks movement genes and we found no evidence for significant spread from the site of inoculation. However, viral amplification in inoculated tissue was detected and is necessary for systemic silencing, suggesting that signals generated from active viral replicons are efficiently transported within the plant. Conclusion The unique properties of the pWSRi vector, the ability to silence genes in meristem tissue, the separation of virus and silencing phenotypes, and the broad natural host range of BCTV, suggest that it will have wide utility.

  8. Hypermetabolism of compensatory laryngeal muscles in unilateral vocal cord palsy: comparison study between speech and silence with normal subjects by co-registered PET-CT fusion images

    International Nuclear Information System (INIS)

    Pai, Moon Sun; Kim, Hyon Kyong; Kim, Han Su; Chung, Sung Min

    2005-01-01

    There are a few case reports on asymmetric vocal cord uptake on FDG-PET in patients with unilateral vocal cord paralysis, which could be a potential pitfall in the interpretation of FDG-PET images. We evaluated the metabolic activity of laryngeal muscles of patients with unilateral vocal cord paralysis in comparison to normal controls during both speech and silence. Eleven patients with iatrogenic unilateral vocal cord palsy(thyroidectomy 7, lung cancer = 1, others = 3) and 12 normal controls underwent FDG-PET with usual protocol. They were divided into two groups respectively; one group read books aloud for 20 minutes (phonation group) and the other kept silence (non-phonation groups) after FDG injection. Recent neck CT scan were co-registered with FDG-PET to produce PET-CT fusion images to elaborate small laryngeal muscles. In patients with unilateral vocal cord palsy, contralateral non-paralyzed vocal cord showed increased FDG uptake, more intense with phonation group (SUV =5.88, n =5) than non-phonation group (SUV =2.33, n =6) --mainly on thyroarytenoid muscle. Normal control subjects showed symmetric mildly increased FDG uptake (SUV=1.92, n=6) only in phonation group, which was significantly low against patient groups and was localized in lateral cricoarytenoid muscle. Hypermetabolism of contralateral thyroarytenoid muscle in patients with unilateral vocal cord paralysis could be encountered during FDG-PET imaging even with keeping silence. Phonation during FDG-PET study enhance FDG uptake on different laryngeal muscles between unilateral vocal cord paralysis and normal subjects

  9. MicroRNA silencing in primates: towards development of novel therapeutics

    DEFF Research Database (Denmark)

    Petri, Andreas; Lindow, Morten; Kauppinen, Sakari

    2009-01-01

    MicroRNAs (miRNA) comprise an abundant class of small noncoding RNAs that act as important posttranscriptional regulators of gene expression. Accumulating evidence showing that aberrantly expressed miRNAs play important roles in human cancers underscores them as potential targets for therapeutic ...... intervention. Recent reports on efficient miRNA silencing in rodents and nonhuman primates using high-affinity targeting by chemically modified antisense oligonucleotides highlight the utility of such compounds in the development of miRNA-based cancer therapeutics....

  10. Simultaneous silencing of two arginine decarboxylase genes alters development in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Diana eSánchez-Rangel

    2016-03-01

    Full Text Available Polyamines (PAs are small aliphatic polycations that are found ubiquitously in all organisms. In plants, PAs are involved in diverse biological processes such as growth, development, and stress responses. In Arabidopsis thaliana, the arginine decarboxylase enzymes (ADC1 and 2 catalyze the first step of PA biosynthesis. For a better understanding of PA biological functions, mutants in PA biosynthesis have been generated; however, the double adc1/adc2 mutant is not viable in A. thaliana. In this study, we generated non-lethal A. thaliana lines through an artificial microRNA that simultaneously silenced the two ADC genes (amiR:ADC. The generated transgenic lines (amiR:ADC-L1 and -L2 showed reduced AtADC1 and AtADC2 transcript levels. For further analyses the amiR:ADC-L2 line was selected. We found that the amiR:ADC-L2 line showed a significant decrease of their PA levels. The co-silencing revealed a stunted growth in A. thaliana seedlings, plantlets and delay in its flowering rate; these phenotypes were reverted with PA treatment. In addition, amiR:ADC-L2 plants displayed two seed phenotypes, such as yellow and brownish seeds. The yellow mutant seeds were smaller than adc1, adc2 mutants and wild type seeds; however, the brownish were the smallest seeds with arrested embryos at the torpedo stage. These data reinforce the importance of PA homeostasis in the plant development processes.

  11. Silence multiple

    DEFF Research Database (Denmark)

    Søndergaard, Katia Dupret

    The article highlights the importance of silences in the processes of innovation in organizations, and the claim is that silence and the absence of talk distribute authority, responsibility and decisions. The act of silencing is conceptualised as a central “configurating actor”. Using an Actor......-Network Theoretical approach to organization studies silence is conceptualised as both a means and an effect of innovative efforts. It is a way of ordering practices. Thus silencing is thought of as a central potential change agent both in composing a kind of specific organizational collectivity and in composing new...... working practices more generally. In line with the approach to destabilise the mundane, invisible and taken-for-granted aspects of innovative efforts in organisations (crucial for ANT and foucauldian post-structuralism more broadly), this article suggests to non-silence the silence and make...

  12. Hypermetabolism of compensatory laryngeal muscles in unilateral vocal cord palsy: comparison study between speech and silence with normal subjects by co-registered PET-CT fusion images

    International Nuclear Information System (INIS)

    Pai, Moon Sun; Kim, Hyon Kyong; Kim, Han Su

    2006-01-01

    There are a few case report on asymmetric vocal cord uptake on FDG-PET in patients with unilateral vocal cord paralysis, which could be a potential pitfall in the interpretation of FDG-PET images. We evaluated the metabolic activity of laryngeal muscles of patients with unilateral vocal cord paralysis in comparison to normal controls during both speech and silence. Eleven patients with unilateral vocal cord palsy (thyroidectomy=7, lung cancer=1, other=3) and 12 normal controls underwent FDG-PET with usual protocol. They were divided into two groups respectively; one group read books aloud for 20 minutes (phonation group) and the other kept silence (non-phonation groups) after FDG injection. Recent neck CT scan were co-registered with FDG-PET to produce PET-CT fusion images to elaborate small laryngeal muscles. In patients with unilateral vocal cord palsy, contralateral non-paralyzed vocal cord showed hypermetabolism mainly on thyroarytenoid muscle, more intensely with phonation group (SUV=5.88±2.65) than with non-phonation group (SUV=2.30±0.39). Normal control subjects showed hypermetabolism (3.68± 0.96) in interarytenoid muscle and symmetric mild hypermetabolism in both lateral cricoarytenoid muscles in only phonation group. FDG-PET with fusion images using CT scan in patients with unilateral vocal cord paralysis showed hypermetabolism of contralateral non-paralyzed thyroarytedoid muscle, suggesting compensatory action during phonation. Phonation during FDG-PET study enhanced FDG uptake on different laryngeal muscles between patients with unilateral vocal cord paralysis and normal subjects

  13. Development of Agrobacterium-mediated virus-induced gene silencing and performance evaluation of four marker genes in Gossypium barbadense.

    Directory of Open Access Journals (Sweden)

    Jinhuan Pang

    Full Text Available Gossypiumbarbadense is a cultivated cotton species and possesses many desirable traits, including high fiber quality and resistance to pathogens, especially Verticilliumdahliae (a devastating pathogen of Gossypium hirsutum, the main cultivated species. These elite traits are difficult to be introduced into G. hirsutum through classical breeding methods. In addition, genetic transformation of G. barbadense has not been successfully performed. It is therefore important to develop methods for evaluating the function and molecular mechanism of genes in G. barbadense. In this study, we had successfully introduced a virus-induced gene silencing (VIGS system into three cultivars of G. barbadense by inserting marker genes into the tobacco rattle virus (TRV vector. After we optimized the VIGS conditions, including light intensity, photoperiod, seedling age and Agrobacterium strain, 100% of plants agroinfiltrated with the GaPDS silencing vector showed white colored leaves. Three other marker genes, GaCLA1, GaANS and GaANR, were employed to further test this VIGS system in G. barbadense. The transcript levels of the endogenous genes in the silenced plants were reduced by more than 99% compared to control plants; these plants presented phenotypic symptoms 2 weeks after inoculation. We introduced a fusing sequence fragment of GaPDS and GaANR gene silencing vectors into a single plant, which resulted in both photobleaching and brownish coloration. The extent of silencing in plants agroinfiltrated with fusing two-gene-silencing vector was consistent with plants harboring a single gene silencing vector. The development of this VIGS system should promote analysis of gene function in G. barbadense, and help to contribute desirable traits for breeding of G. barbadense and G. hirsutum.

  14. Identification of the TaBTF3 gene in wheat (Triticum aestivum L.) and the effect of its silencing on wheat chloroplast, mitochondria and mesophyll cell development.

    Science.gov (United States)

    Ma, Hong-Zhen; Liu, Guo-Qin; Li, Cheng-Wei; Kang, Guo-Zhang; Guo, Tian-Cai

    2012-10-05

    The full-length cDNA (882bp) and DNA (1742bp) sequences encoding a basic transcription factor 3, designated as TaBTF3, were first isolated from common wheat (Triticum aestivum L.). Subcellular localization studies revealed that the TaBTF3 protein was mainly located in the cytoplasm and nucleus. In TaBTF3-silenced transgenic wheat seedlings obtained using the Virus-induced gene silencing (VIGS) method, the chlorophyll pigment content was markedly reduced. However, the malonaldehyde (MDA) and H(2)O(2) contents were enhanced, and the structure of the wheat mesophyll cell was seriously damaged. Furthermore, transcripts of the chloroplast- and mitochondrial-encoded genes were significantly reduced in TaBTF3-silenced transgenic wheat plants. These results suggest that the TaBTF3 gene might function in the development of the wheat chloroplast, mitochondria and mesophyll cell. This paper is the first report to describe the involvement of TaBTF3 in maintaining the normal plant mesophyll cell structure. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. Physical Development: What's Normal? What's Not?

    Science.gov (United States)

    ... Stages Listen Español Text Size Email Print Share Physical Development: What’s Normal? What’s Not? Page Content Article ... growth . The timing and speed of a child's physical development can vary a lot, because it is ...

  16. Long range epigenetic silencing is a trans-species mechanism that results in cancer specific deregulation by overriding the chromatin domains of normal cells.

    Science.gov (United States)

    Forn, Marta; Muñoz, Mar; Tauriello, Daniele V F; Merlos-Suárez, Anna; Rodilla, Verónica; Bigas, Anna; Batlle, Eduard; Jordà, Mireia; Peinado, Miguel A

    2013-12-01

    DNA methylation and chromatin remodeling are frequently implicated in the silencing of genes involved in carcinogenesis. Long Range Epigenetic Silencing (LRES) is a mechanism of gene inactivation that affects multiple contiguous CpG islands and has been described in different human cancer types. However, it is unknown whether there is a coordinated regulation of the genes embedded in these regions in normal cells and in early stages of tumor progression. To better characterize the molecular events associated with the regulation and remodeling of these regions we analyzed two regions undergoing LRES in human colon cancer in the mouse model. We demonstrate that LRES also occurs in murine cancer in vivo and mimics the molecular features of the human phenomenon, namely, downregulation of gene expression, acquisition of inactive histone marks, and DNA hypermethylation of specific CpG islands. The genes embedded in these regions showed a dynamic and autonomous regulation during mouse intestinal cell differentiation, indicating that, in the framework considered here, the coordinated regulation in LRES is restricted to cancer. Unexpectedly, benign adenomas in Apc(Min/+) mice showed overexpression of most of the genes affected by LRES in cancer, which suggests that the repressive remodeling of the region is a late event. Chromatin immunoprecipitation analysis of the transcriptional insulator CTCF in mouse colon cancer cells revealed disrupted chromatin domain boundaries as compared with normal cells. Malignant regression of cancer cells by in vitro differentiation resulted in partial reversion of LRES and gain of CTCF binding. We conclude that genes in LRES regions are plastically regulated in cell differentiation and hyperproliferation, but are constrained to a coordinated repression by abolishing boundaries and the autonomous regulation of chromatin domains in cancer cells. Copyright © 2013 Federation of European Biochemical Societies. Published by Elsevier B.V. All

  17. Performative Silences

    DEFF Research Database (Denmark)

    Dupret, Katia

    2018-01-01

    static nor neutral. It has performative effects. Silencing as an act, rather than a noun, is conceptualised as a central ‘configurating actor’ of change. Through the description of minute details from a videotaped supervision session in the mental healthcare sector, it is shown how different performative...... configurations of silence makes people relate to each other in new ways and influence new work practices. In spite of its somewhat immaterial connotations, using an Actor-Network Theory approach to organization studies, silencing is conceptualised as both a means and an effect of change efforts, which are socio...

  18. Silence in the Communication or Communicating through Silence: Silence in Psychoanalysis

    Directory of Open Access Journals (Sweden)

    Rita Marta

    2014-10-01

    Full Text Available This paper is a reflection upon the meaning and importance of silence in the psychoanalytical relationship. Beginning with the silence in the “normal” relationship between people, we show how silence can be experienced as confortable or unconfortable, and how it can be used to achieve a bigger proximity or distance in the relationship with others. We show these same aspects in the psychoanalytical relationship, and the evolution of the regard towards silence along the development of psychoanalysis. We end, presenting the Nacht’s thinking about silence, who emphasizes its integrative and fundamental role in the psychoanalytical relationship. Thus, only through silence certain affects can be born, and silence allows the patient to internalize the analyst.

  19. Ombuds’ corner: Employee silence

    CERN Multimedia

    Vincent Vuillemin

    2013-01-01

    Although around a hundred cases a year are reported to the Ombuds, several issues may still not be disclosed due to employee silence*. The deliberate withholding of concerns, escalating misunderstandings or genuine conflicts can impede the global process of learning and development of a better respectful organizational workplace environment, and prevent the detection and correction of acts violating the CERN Code of Conduct.   For the employee him/herself, such silence can lead to feelings of anger, resentment, helplessness and humiliation. These feelings will inevitably contaminate personal and interpersonal relations, and poison creativity and effectiveness. Employee silence can be explained by many factors; sometimes it is connected to organizational forces. In their published paper*, authors Michael Knoll and Rolf van Dick found four forms of employee silence. People may stay silent if they feel that their opinion is neither welcomed nor valued by their management. They have gi...

  20. siRNA-Mediated Silencing of doublesex during Female Development of the Dengue Vector Mosquito Aedes aegypti.

    Directory of Open Access Journals (Sweden)

    Keshava Mysore

    2015-11-01

    Full Text Available The development of sex-specific traits, including the female-specific ability to bite humans and vector disease, is critical for vector mosquito reproduction and pathogen transmission. Doublesex (Dsx, a terminal transcription factor in the sex determination pathway, is known to regulate sex-specific gene expression during development of the dengue fever vector mosquito Aedes aegypti. Here, the effects of developmental siRNA-mediated dsx silencing were assessed in adult females. Targeting of dsx during A. aegypti development resulted in decreased female wing size, a correlate for body size, which is typically larger in females. siRNA-mediated targeting of dsx also resulted in decreased length of the adult female proboscis. Although dsx silencing did not impact female membrane blood feeding or mating behavior in the laboratory, decreased fecundity and fertility correlated with decreased ovary length, ovariole length, and ovariole number in dsx knockdown females. Dsx silencing also resulted in disruption of olfactory system development, as evidenced by reduced length of the female antenna and maxillary palp and the sensilla present on these structures, as well as disrupted odorant receptor expression. Female lifespan, a critical component of the ability of A. aegypti to transmit pathogens, was also significantly reduced in adult females following developmental targeting of dsx. The results of this investigation demonstrate that silencing of dsx during A. aegypti development disrupts multiple sex-specific morphological, physiological, and behavioral traits of adult females, a number of which are directly or indirectly linked to mosquito reproduction and pathogen transmission. Moreover, the olfactory phenotypes observed connect Dsx to development of the olfactory system, suggesting that A. aegypti will be an excellent system in which to further assess the developmental genetics of sex-specific chemosensation.

  1. The development and application of a multiple gene co-silencing system using endogenous URA3 as a reporter gene in Ganoderma lucidum.

    Directory of Open Access Journals (Sweden)

    Dashuai Mu

    Full Text Available Ganoderma lucidum is one of the most important medicinal mushrooms; however, molecular genetics research on this species has been limited due to a lack of reliable reverse genetic tools. In this study, the endogenous orotidine 5'-monophosphate decarboxylase gene (URA3 was cloned as a silencing reporter, and four gene-silencing methods using hairpin, sense, antisense, and dual promoter constructs, were introduced into G. lucidum through a simple electroporation procedure. A comparison and evaluation of silencing efficiency demonstrated that all of the four methods differentially suppressed the expression of URA3. Our data unequivocally indicate that the dual promoter silencing vector yields the highest rate of URA3 silencing compared with other vectors (up to 81.9%. To highlight the advantages of the dual promoter system, we constructed a co-silencing system based on the dual promoter method and succeeded in co-silencing URA3 and laccase in G. lucidum. The reduction of the mRNA levels of the two genes were correlated. Thus, the screening efficiency for RNAi knockdown of multiple genes may be improved by the co-silencing of an endogenous reporter gene. The molecular tools developed in this study should facilitate the isolation of genes and the characterization of the functions of multiple genes in this pharmaceutically important species, and these tools should be highly useful for the study of other basidiomycetes.

  2. The silence.

    Science.gov (United States)

    Millenson, Michael L

    2003-01-01

    Despite several well-crafted Institute of Medicine (IOM) reports, there remains within health care a persistent refusal to confront providers' responsibility for severe quality problems. There is a silence of deed--failing to take corrective actions--and of word--failing to discuss openly the true consequences of that inertia. These silences distort public policy, delay change, and, by leading (albeit inadvertently) to thousands of patient deaths, undermine professionalism. The IOM quality committee, to retain its moral authority, should forgo issuing more reports and instead lead an emergency corrective-action campaign comparable to Flexner's crusade against charlatan medical schools.

  3. A Medicago truncatula rdr6 allele impairs transgene silencing and endogenous phased siRNA production but not development.

    Science.gov (United States)

    Bustos-Sanmamed, Pilar; Hudik, Elodie; Laffont, Carole; Reynes, Christelle; Sallet, Erika; Wen, Jiangqi; Mysore, Kirankumar S; Camproux, Anne-Claude; Hartmann, Caroline; Gouzy, Jérome; Frugier, Florian; Crespi, Martin; Lelandais-Brière, Christine

    2014-12-01

    RNA-dependent RNA polymerase 6 (RDR6) and suppressor of gene silencing 3 (SGS3) act together in post-transcriptional transgene silencing mediated by small interfering RNAs (siRNAs) and in biogenesis of various endogenous siRNAs including the tasiARFs, known regulators of auxin responses and plant development. Legumes, the third major crop family worldwide, has been widely improved through transgenic approaches. Here, we isolated rdr6 and sgs3 mutants in the model legume Medicago truncatula. Two sgs3 and one rdr6 alleles led to strong developmental defects and impaired biogenesis of tasiARFs. In contrast, the rdr6.1 homozygous plants produced sufficient amounts of tasiARFs to ensure proper development. High throughput sequencing of small RNAs from this specific mutant identified 354 potential MtRDR6 substrates, for which siRNA production was significantly reduced in the mutant. Among them, we found a large variety of novel phased loci corresponding to protein-encoding genes or transposable elements. Interestingly, measurement of GFP expression revealed that post-transcriptional transgene silencing was reduced in rdr6.1 roots. Hence, this novel mis-sense mutation, affecting a highly conserved amino acid residue in plant RDR6s, may be an interesting tool both to analyse endogenous pha-siRNA functions and to improve transgene expression, at least in legume species. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  4. Switching of dominant retrotransposon silencing strategies from posttranscriptional to transcriptional mechanisms during male germ-cell development in mice.

    Directory of Open Access Journals (Sweden)

    Kota Inoue

    2017-07-01

    Full Text Available Mammalian genomes harbor millions of retrotransposon copies, some of which are transpositionally active. In mouse prospermatogonia, PIWI-interacting small RNAs (piRNAs combat retrotransposon activity to maintain the genomic integrity. The piRNA system destroys retrotransposon-derived RNAs and guides de novo DNA methylation at some retrotransposon promoters. However, it remains unclear whether DNA methylation contributes to retrotransposon silencing in prospermatogonia. We have performed comprehensive studies of DNA methylation and polyA(+ RNAs (transcriptome in developing male germ cells from Pld6/Mitopld and Dnmt3l knockout mice, which are defective in piRNA biogenesis and de novo DNA methylation, respectively. The Dnmt3l mutation greatly reduced DNA methylation levels at most retrotransposons, but its impact on their RNA abundance was limited in prospermatogonia. In Pld6 mutant germ cells, although only a few retrotransposons exhibited reduced DNA methylation, many showed increased expression at the RNA level. More detailed analysis of RNA sequencing, nascent RNA quantification, profiling of cleaved RNA ends, and the results obtained from double knockout mice suggest that PLD6 works mainly at the posttranscriptional level. The increase in retrotransposon expression was larger in Pld6 mutants than it was in Dnmt3l mutants, suggesting that RNA degradation by the piRNA system plays a more important role than does DNA methylation in prospermatogonia. However, DNA methylation had a long-term effect: hypomethylation caused by the Pld6 or Dnmt3l mutation resulted in increased retrotransposon expression in meiotic spermatocytes. Thus, posttranscriptional silencing plays an important role in the early stage of germ cell development, then transcriptional silencing becomes important in later stages. In addition, intergenic and intronic retrotransposon sequences, in particular those containing the antisense L1 promoters, drove ectopic expression of nearby

  5. Role of DNA methylation and epigenetic silencing of HAND2 in endometrial cancer development.

    Directory of Open Access Journals (Sweden)

    Allison Jones

    2013-11-01

    Full Text Available Endometrial cancer incidence is continuing to rise in the wake of the current ageing and obesity epidemics. Much of the risk for endometrial cancer development is influenced by the environment and lifestyle. Accumulating evidence suggests that the epigenome serves as the interface between the genome and the environment and that hypermethylation of stem cell polycomb group target genes is an epigenetic hallmark of cancer. The objective of this study was to determine the functional role of epigenetic factors in endometrial cancer development.Epigenome-wide methylation analysis of >27,000 CpG sites in endometrial cancer tissue samples (n = 64 and control samples (n = 23 revealed that HAND2 (a gene encoding a transcription factor expressed in the endometrial stroma is one of the most commonly hypermethylated and silenced genes in endometrial cancer. A novel integrative epigenome-transcriptome-interactome analysis further revealed that HAND2 is the hub of the most highly ranked differential methylation hotspot in endometrial cancer. These findings were validated using candidate gene methylation analysis in multiple clinical sample sets of tissue samples from a total of 272 additional women. Increased HAND2 methylation was a feature of premalignant endometrial lesions and was seen to parallel a decrease in RNA and protein levels. Furthermore, women with high endometrial HAND2 methylation in their premalignant lesions were less likely to respond to progesterone treatment. HAND2 methylation analysis of endometrial secretions collected using high vaginal swabs taken from women with postmenopausal bleeding specifically identified those patients with early stage endometrial cancer with both high sensitivity and high specificity (receiver operating characteristics area under the curve = 0.91 for stage 1A and 0.97 for higher than stage 1A. Finally, mice harbouring a Hand2 knock-out specifically in their endometrium were shown to develop

  6. [Psychomotor development and its disorders: between normal and pathological development].

    Science.gov (United States)

    Vericat, Agustina; Bibiana Orden, Alicia

    2013-10-01

    This article discusses some aspects of psychomotor development and its disorders, with special emphasis on psychomotor retardation. Diagnostic classifications of psychomotor problems, such as DSM-IV and CIE-10, are referred to and their advantages and disadvantages are analyzed. The concept of normality as a synonym for the statistical mean in the context of psychomotor disorders is also analyzed in order to consider its dynamic and variability, thereby avoiding the normality/pathology opposition, while some issues, such as the social and cultural aspects, are highlighted, making it possible to rethink the universality and relativity of psychomotor development.

  7. MRI of normal fetal brain development

    International Nuclear Information System (INIS)

    Prayer, Daniela; Kasprian, Gregor; Krampl, Elisabeth; Ulm, Barbara; Witzani, Linde; Prayer, Lucas; Brugger, Peter C.

    2006-01-01

    Normal fetal brain maturation can be studied by in vivo magnetic resonance imaging (MRI) from the 18th gestational week (GW) to term, and relies primarily on T2-weighted and diffusion-weighted (DW) sequences. These maturational changes must be interpreted with a knowledge of the histological background and the temporal course of the respective developmental steps. In addition, MR presentation of developing and transient structures must be considered. Signal changes associated with maturational processes can mainly be ascribed to the following changes in tissue composition and organization, which occur at the histological level: (1) a decrease in water content and increasing cell-density can be recognized as a shortening of T1- and T2-relaxation times, leading to increased T1-weighted and decreased T2-weighted intensity, respectively; (2) the arrangement of microanatomical structures to create a symmetrical or asymmetrical environment, leading to structural differences that may be demonstrated by DW-anisotropy; (3) changes in non-structural qualities, such as the onset of a membrane potential in premyelinating axons. The latter process also influences the appearance of a structure on DW sequences. Thus, we will review the in vivo MR appearance of different maturational states of the fetal brain and relate these maturational states to anatomical, histological, and in vitro MRI data. Then, the development of the cerebral cortex, white matter, temporal lobe, and cerebellum will be reviewed, and the MR appearance of transient structures of the fetal brain will be shown. Emphasis will be placed on the appearance of the different structures with the various sequences. In addition, the possible utility of dynamic fetal sequences in assessing spontaneous fetal movements is discussed

  8. MRI of normal fetal brain development

    Energy Technology Data Exchange (ETDEWEB)

    Prayer, Daniela [Department of Radiodiagnostics, Medical University of Vienna, Vienna (Austria)]. E-mail: Daniela.prayer@meduniwien.ac.at; Kasprian, Gregor [Department of Radiodiagnostics, Medical University of Vienna, Vienna (Austria); Krampl, Elisabeth [Department of Obstetrics and Gynecology, Medical University of Vienna, Vienna (Austria); Ulm, Barbara [Department of Prenatal Diagnosis, Medical University of Vienna, Vienna (Austria); Witzani, Linde [Department of Radiodiagnostics, Medical University of Vienna, Vienna (Austria); Prayer, Lucas [Diagnosezentrum Urania, Vienna (Austria); Brugger, Peter C. [Center of Anatomy and Cell Biology, Medical University of Vienna, Vienna (Austria)

    2006-02-15

    Normal fetal brain maturation can be studied by in vivo magnetic resonance imaging (MRI) from the 18th gestational week (GW) to term, and relies primarily on T2-weighted and diffusion-weighted (DW) sequences. These maturational changes must be interpreted with a knowledge of the histological background and the temporal course of the respective developmental steps. In addition, MR presentation of developing and transient structures must be considered. Signal changes associated with maturational processes can mainly be ascribed to the following changes in tissue composition and organization, which occur at the histological level: (1) a decrease in water content and increasing cell-density can be recognized as a shortening of T1- and T2-relaxation times, leading to increased T1-weighted and decreased T2-weighted intensity, respectively; (2) the arrangement of microanatomical structures to create a symmetrical or asymmetrical environment, leading to structural differences that may be demonstrated by DW-anisotropy; (3) changes in non-structural qualities, such as the onset of a membrane potential in premyelinating axons. The latter process also influences the appearance of a structure on DW sequences. Thus, we will review the in vivo MR appearance of different maturational states of the fetal brain and relate these maturational states to anatomical, histological, and in vitro MRI data. Then, the development of the cerebral cortex, white matter, temporal lobe, and cerebellum will be reviewed, and the MR appearance of transient structures of the fetal brain will be shown. Emphasis will be placed on the appearance of the different structures with the various sequences. In addition, the possible utility of dynamic fetal sequences in assessing spontaneous fetal movements is discussed.

  9. Silencing of the Drosophila ortholog of SOX5 leads to abnormal neuronal development and behavioral impairment.

    Science.gov (United States)

    Li, Airong; Hooli, Basavaraj; Mullin, Kristina; Tate, Rebecca E; Bubnys, Adele; Kirchner, Rory; Chapman, Brad; Hofmann, Oliver; Hide, Winston; Tanzi, Rudolph E

    2017-04-15

    SOX5 encodes a transcription factor that is expressed in multiple tissues including heart, lung and brain. Mutations in SOX5 have been previously found in patients with amyotrophic lateral sclerosis (ALS) and developmental delay, intellectual disability and dysmorphic features. To characterize the neuronal role of SOX5, we silenced the Drosophila ortholog of SOX5, Sox102F, by RNAi in various neuronal subtypes in Drosophila. Silencing of Sox102F led to misorientated and disorganized michrochaetes, neurons with shorter dendritic arborization (DA) and reduced complexity, diminished larval peristaltic contractions, loss of neuromuscular junction bouton structures, impaired olfactory perception, and severe neurodegeneration in brain. Silencing of SOX5 in human SH-SY5Y neuroblastoma cells resulted in a significant repression of WNT signaling activity and altered expression of WNT-related genes. Genetic association and meta-analyses of the results in several large family-based and case-control late-onset familial Alzheimer's disease (LOAD) samples of SOX5 variants revealed several variants that show significant association with AD disease status. In addition, analysis for rare and highly penetrate functional variants revealed four novel variants/mutations in SOX5, which taken together with functional prediction analysis, suggests a strong role of SOX5 causing AD in the carrier families. Collectively, these findings indicate that SOX5 is a novel candidate gene for LOAD with an important role in neuronal function. The genetic findings warrant further studies to identify and characterize SOX5 variants that confer risk for AD, ALS and intellectual disability. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  10. Enhancer-driven chromatin interactions during development promote escape from silencing by a long non-coding RNA

    Directory of Open Access Journals (Sweden)

    Korostowski Lisa

    2011-11-01

    Full Text Available Abstract Background Gene regulation in eukaryotes is a complex process entailing the establishment of transcriptionally silent chromatin domains interspersed with regions of active transcription. Imprinted domains consist of clusters of genes, some of which exhibit parent-of-origin dependent monoallelic expression, while others are biallelic. The Kcnq1 imprinted domain illustrates the complexities of long-range regulation that coexists with local exceptions. A paternally expressed repressive non-coding RNA, Kcnq1ot1, regulates a domain of up to 750 kb, encompassing 14 genes. We study how the Kcnq1 gene, initially silenced by Kcnq1ot1, undergoes tissue-specific escape from imprinting during development. Specifically, we uncover the role of chromosome conformation during these events. Results We show that Kcnq1 transitions from monoallelic to biallelic expression during mid gestation in the developing heart. This transition is not associated with the loss of methylation on the Kcnq1 promoter. However, by exploiting chromosome conformation capture (3C technology, we find tissue-specific and stage-specific chromatin loops between the Kcnq1 promoter and newly identified DNA regulatory elements. These regulatory elements showed in vitro activity in a luciferase assay and in vivo activity in transgenic embryos. Conclusions By exploring the spatial organization of the Kcnq1 locus, our results reveal a novel mechanism by which local activation of genes can override the regional silencing effects of non-coding RNAs.

  11. Expression profiling of c-kit and its impact after esiRNA silencing during gonadal development in catfish.

    Science.gov (United States)

    Laldinsangi, C; Senthilkumaran, B

    2018-04-03

    C-kit receptor is a member of a family of growth factor receptors that have tyrosine kinase activity, and are involved in the transduction of growth regulatory signals across plasma membrane by activation of its ligand, kitl/scf. The present study analysed mRNA and protein expression profiles of c-kit in the gonads of catfish, Clarias gariepinus, using real time PCR, in situ hybridization and immunohistochemistry. Tissue distribution analysis revealed higher expression mainly in the catfish gonads. Ontogeny studies showed minimal expression during early developmental stages and highest during 50-75 days post hatch, and the dimorphic expression in gonads decreased gradually till adulthood, which might suggest an important role for this gene around later stages of sex differentiation and gonadal development. Expression of C-kit was analysed at various phases of gonadal cycle in both male and female, which showed minimal expression during the resting phase, and higher expression in male compared to females during the pre-spawning phase. In vitro and in vivo induction using human chorionic gonadotropin elevated the expression of c-kit indicating the regulatory influence of hypothalamo-hypophyseal axis. In vivo transient gene silencing using c-kit-esiRNA in adult catfish during gonadal recrudescence showed a decrease in c-kit expression, which affected the expression level of germ cell meiotic marker sycp3, as well as several factors and steroidogenic enzyme genes involved in germ cell development. Decrease in the levels of serum 11-KT and T were also observed after esiRNA silencing. The findings of this study suggest that c-kit has an important role in the process of germ cell proliferation, development and maturation during gonadal development and recrudescence in catfish. Copyright © 2018. Published by Elsevier Inc.

  12. Normal development of the female reproductive system

    Science.gov (United States)

    The embryonic development of the female reproductive system involves a progression of events that is conserved across vertebrate species. The early gonad progresses from a form that is undifferentiated in both genotypic males and females. Rudimentary male (Wolffian) and female (M...

  13. Silencing of ABCC13 transporter in wheat reveals its involvement in grain development, phytic acid accumulation and lateral root formation.

    Science.gov (United States)

    Bhati, Kaushal Kumar; Alok, Anshu; Kumar, Anil; Kaur, Jagdeep; Tiwari, Siddharth; Pandey, Ajay Kumar

    2016-07-01

    Low phytic acid is a trait desired in cereal crops and can be achieved by manipulating the genes involved either in its biosynthesis or its transport in the vacuoles. Previously, we have demonstrated that the wheat TaABCC13 protein is a functional transporter, primarily involved in heavy metal tolerance, and a probable candidate gene to achieve low phytate wheat. In the current study, RNA silencing was used to knockdown the expression of TaABCC13 in order to evaluate its functional importance in wheat. Transgenic plants with significantly reduced TaABCC13 transcripts in either seeds or roots were selected for further studies. Homozygous RNAi lines K1B4 and K4G7 exhibited 34-22% reduction of the phytic acid content in the mature grains (T4 seeds). These transgenic lines were defective for spike development, as characterized by reduced grain filling and numbers of spikelets. The seeds of transgenic wheat had delayed germination, but the viability of the seedlings was unaffected. Interestingly, early emergence of lateral roots was observed in TaABCC13-silenced lines as compared to non-transgenic lines. In addition, these lines also had defects in metal uptake and development of lateral roots in the presence of cadmium stress. Our results suggest roles of TaABCC13 in lateral root initiation and enhanced sensitivity towards heavy metals. Taken together, these data demonstrate that wheat ABCC13 is functionally important for grain development and plays an important role during detoxification of heavy metals. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  14. Development of a virus-induced gene silencing (VIGS) system for Spinacia oleracea L

    DEFF Research Database (Denmark)

    Lee, Jungmin; Cao, Dang Viet; Kim, Jiwon

    2017-01-01

    Virus-induced gene silencing (VIGS) is known as a rapid and efficient system for studying functions of interesting genes in plants. Tobacco rattle virus (TRV) is widely applied for the gene silencing of many plants. Although spinach is a TRV-susceptible plant, a TRV-based VIGS system has not yet ...

  15. Silencing p75NTR prevents proNGF-induced endothelial cell death and development of acellular capillaries in rat retina

    Directory of Open Access Journals (Sweden)

    Ahmed Y Shanab

    Full Text Available Accumulation of the nerve growth factor precursor (proNGF and its receptor p75NTR have been associated with several neurodegenerative diseases in both brain and retina. However, whether proNGF contributes to microvascular degeneration remain unexplored. This study seeks to investigate the mechanism by which proNGF/p75NTR induce endothelial cell (EC death and development of acellular capillaries, a surrogate marker of retinal ischemia. Stable overexpression of the cleavage-resistant proNGF and molecular silencing of p75NTR were utilized in human retinal EC and rat retinas in vivo. Stable overexpression of proNGF decreased NGF levels and induced retinal vascular cell death evident by 1.9-fold increase in acellular capillaries and activation of JNK and cleaved-PARP that were mitigated by p75NTRshRNA. In vitro, overexpression of proNGF did not alter TNF-α level, reduced NGF, however induced EC apoptosis evident by activation of JNK and p38 MAPK, cleaved-PARP. Silencing p75NTR using siRNA restored expression of NGF and TrkA activation and prevented EC apoptosis. Treatment of EC with human-mutant proNGF induced apoptosis that coincided with marked protein interaction and nuclear translocation of p75NTR and the neurotrophin receptor interacting factor. These effects were abolished by a selective p75NTR antagonist. Therefore, targeting p75NTR represents a potential therapeutic strategy for diseases associated with aberrant expression of proNGF.

  16. "Differently normal" and "normally different": negotiations of female embodiment in women's accounts of 'atypical' sex development.

    Science.gov (United States)

    Guntram, Lisa

    2013-12-01

    During recent decades numerous feminist scholars have scrutinized the two-sex model and questioned its status in Western societies and medicine. Along the same line, increased attention has been paid to individuals' experiences of atypical sex development, also known as intersex or 'disorders of sex development' (DSD). Yet research on individuals' experiences of finding out about their atypical sex development in adolescence has been scarce. Against this backdrop, the present article analyses 23 in-depth interviews with women who in their teens found out about their atypical sex development. The interviews were conducted during 2009-2012 and the interviewees were all Swedish. Drawing on feminist research on female embodiment and social scientific studies on diagnosis, I examine how the women make sense of their bodies and situations. First, I aim to explore how the women construe normality as they negotiate female embodiment. Second, I aim to investigate how the divergent manners in which these negotiations are expressed can be further understood via the women's different access to a diagnosis. Through a thematic and interpretative analysis, I outline two negotiation strategies: the "differently normal" and the "normally different" strategy. In the former, the women present themselves as just slightly different from 'normal' women. In the latter, they stress that everyone is different in some manner and thereby claim normalcy. The analysis shows that access to diagnosis corresponds to the ways in which the women present themselves as "differently normal" and "normally different", thus shedding light on the complex role of diagnosis in their negotiations of female embodiment. It also reveals that the women make use of what they do have and how alignments with and work on norms interplay as normality is construed. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Silencing abnormal wing disc gene of the Asian citrus psyllid, Diaphorina citri disrupts adult wing development and increases nymph mortality.

    Directory of Open Access Journals (Sweden)

    Ibrahim El-Shesheny

    Full Text Available Huanglongbing (HLB causes considerable economic losses to citrus industries worldwide. Its management depends on controlling of the Asian citrus Psyllid (ACP, the vector of the bacterium, Candidatus Liberibacter asiaticus (CLas, the causal agent of HLB. Silencing genes by RNA interference (RNAi is a promising tool to explore gene functions as well as control pests. In the current study, abnormal wing disc (awd gene associated with wing development in insects is used to interfere with the flight of psyllids. Our study showed that transcription of awd is development-dependent and the highest level was found in the last instar (5(th of the nymphal stage. Micro-application (topical application of dsRNA to 5(th instar of nymphs caused significant nymphal mortality and adult wing-malformation. These adverse effects in ACP were positively correlated with the amounts of dsRNA used. A qRT-PCR analysis confirmed the dsRNA-mediated transcriptional down-regulation of the awd gene. Significant down-regulation was required to induce a wing-malformed phenotype. No effect was found when dsRNA-gfp was used, indicating the specific effect of dsRNA-awd. Our findings suggest a role for awd in ACP wing development and metamorphosis. awd could serve as a potential target for insect management either via direct application of dsRNA or by producing transgenic plants expressing dsRNA-awd. These strategies will help to mitigate HLB by controlling ACP.

  18. Developing Visualization Support System for Teaching/Learning Database Normalization

    Science.gov (United States)

    Folorunso, Olusegun; Akinwale, AdioTaofeek

    2010-01-01

    Purpose: In tertiary institution, some students find it hard to learn database design theory, in particular, database normalization. The purpose of this paper is to develop a visualization tool to give students an interactive hands-on experience in database normalization process. Design/methodology/approach: The model-view-controller architecture…

  19. In vitro silencing of Brugia malayi trehalose-6-phosphate phosphatase impairs embryogenesis and in vivo development of infective larvae in jirds.

    Directory of Open Access Journals (Sweden)

    Susheela Kushwaha

    Full Text Available The trehalose metabolic enzymes have been considered as potential targets for drug or vaccine in several organisms such as Mycobacterium, plant nematodes, insects and fungi due to crucial role of sugar trehalose in embryogenesis, glucose uptake and protection from stress. Trehalose-6-phosphate phosphatase (TPP is one of the enzymes of trehalose biosynthesis that has not been reported in mammals. Silencing of tpp gene in Caenorhabditis elegans revealed an indispensable functional role of TPP in nematodes.In the present study, functional role of B. malayi tpp gene was investigated by siRNA mediated silencing which further validated this enzyme to be a putative antifilarial drug target. The silencing of tpp gene in adult female B. malayi brought about severe phenotypic deformities in the intrauterine stages such as distortion and embryonic development arrest. The motility of the parasites was significantly reduced and the microfilarial production as well as their in vitro release from the female worms was also drastically abridged. A majority of the microfilariae released in to the culture medium were found dead. B. malayi infective larvae which underwent tpp gene silencing showed 84.9% reduced adult worm establishment after inoculation into the peritoneal cavity of naïve jirds.The present findings suggest that B. malayi TPP plays an important role in the female worm embryogenesis, infectivity of the larvae and parasite viability. TPP enzyme of B. malayi therefore has the potential to be exploited as an antifilarial drug target.

  20. Delivery of chitosan/dsRNA nanoparticles for silencing of wing development vestigial (vg) gene in Aedes aegypti mosquitoes.

    Science.gov (United States)

    Ramesh Kumar, D; Saravana Kumar, P; Gandhi, M Rajiv; Al-Dhabi, Naif Abdullah; Paulraj, M Gabriel; Ignacimuthu, S

    2016-05-01

    RNA interference (RNAi) has been used as a gene silencing strategy by the introduction of long double stranded RNA (dsRNA) for the control of pest insects. The aim of the present study was to examine whether the expression of vg gene which is responsible for wing development, can be repressed by chitosan/dsRNA based nanoparticles in Aedes aegypti. The vestigial gene (vg) was amplified from adult mosquito and cloned in pLitmus28i vector. Genetically engineered recombinant plasmid was transformed into RNase III deficient strain for synthesis of bacterially expressed dsRNA. Nanoparticles were prepared via electrostatic interaction between cationic polymer chitosan and anionic nucleic acids (dsRNA). The formation of chitosan/dsRNAnanoparticles and their size were confirmed by Atomic force microscopy (AFM). Chitosan/dsRNA mediated knockdown of Enhanced Green Fluorescence Protein (EGFP) was demonstrated in Sf21 cells. Further, we tested whether such an approach could be used to target vg gene in Ae. aegypti. The results showed that chitosan/dsRNA caused significant mortality, delayed growth development and caused adult wing-malformation. A qRT-PCR analysis confirmed that the chitosan/dsRNA mediated transcriptional level was downregulated. Our findings suggest that vg gene intervention strategies through RNAi can emerge as viable option for pest control. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Development of Gold Nanoparticle towards Radioenhancement Therapy, Renal Clearance, siRNA Delivery and Light-Controlled Gene Silencing

    Science.gov (United States)

    Wang, Jianxin

    Gold nanoparticles (GNPs) have been widely studied and used in research for diagnostic, prophylactic or therapeutic purposes. However, they still face many technical challenges before they can be used to effectively address unmet biomedical needs. The theme of this dissertation is focused on addressing challenges of GNPs in clinical translation, and to improve their potential for application in radioenhancement therapy and siRNA delivery. We demonstrate the facile self-assembly of micellar gold nanocapsules using zwitterionic surfactants, with hydrodynamic diameters below 10 nm, which holds promise for good renal clearance to promote the excretion of GNPs in human body. We also prepared PEI- and PEG-coated GNPs and demonstrated their uptake into HeLa cells with exposure to soft X-rays (120 kVp), based on the consideration that the proximity of GNPs to nuclear DNA may be beneficial for enhancing low-energy ionizing radiotherapy. GNP-mediated siRNA delivery may be challenged by nonspecific siRNA desorption during circulation, which can cause off-target effects and immunogenicity. The use of gold nanorods (GNRs) for siRNA delivery also faces challenges like reduced dispersion stability during siRNA functionalization. We developed an effective way to load siRNA onto GNRs at high density, using oleylsulfobetaine (OSB) as an intermediate surfactant and dithiocarbamates (DTCs) as desorption-resistant anchors for siRNA. The GNR?siRNA complexes provided excellent control for laser-triggered gene silencing.

  2. Development of male sterility by silencing Bcp1 gene of Arabidopsis ...

    African Journals Online (AJOL)

    Transgenic plants were phenotypically indistinguishable from nontransgenic plants and by crossing with non-transgenic fertile pollens successful seed set was observed. The Bcp1 gene was also amplified from chilies, tomato and brassica. The present study resulted in developing male sterile A. thaliana (Eco. Columbia) ...

  3. Virus-induced gene silencing (VIGS) as a reverse genetic tool to study development of symbiotic root nodules

    DEFF Research Database (Denmark)

    Kjær, Gabriela Didina Constantin; Grønlund, Mette; Stougaard, Jens

    2008-01-01

    Virus-induced gene silencing (VIGS) can provide a shortcut to plants with altered expression of specific genes. Here, we report that VIGS of the Nodule inception gene (Nin) can alter the nodulation phenotype and Nin gene expression in Pisum sativum. PsNin was chosen as target because of the disti...

  4. Dental Development: Normal Variations and Disturbances of the Developing Dentition

    NARCIS (Netherlands)

    B. Dhamo (Brunilda)

    2017-01-01

    markdownabstractDental development is defined as a progressive and continuous process determined by epithelial-mesenchymal interactions and controlled by genetic, epigenetic and environmental factors over time. In this thesis we built three main objectives. The _first objective_ was to assess

  5. Olfactory granule cell development in normal and hyperthyroid rats.

    Science.gov (United States)

    Brunjes, P C; Schwark, H D; Greenough, W T

    1982-10-01

    Dendritic development was examined in olfactory bulbs of both normal 7-, 14-, 21- and 60-day-old rats and littermates treated on postnatal days 1-4 with 1 microgram/g body weight of L-thyroxine sodium. Tissue was processed via the Golgi-Cox technique and subjected to quantitative analyses of mitral and internal layer granule cell development. These populations of granule cells were selected because their pattern of late proliferation suggested potentially greater susceptibility to postnatal hormonal alterations. Although neonatal hyperthyroidism induces widespread acceleration of maturation, including precocious chemosensitivity, granule cell development was unaffected relative to littermate controls. Both normal and hyperthyroid groups exhibited an inverted U-shaped pattern of cellular development, with rapid dendritic dendritic growth and expansion occurring during the earliest ages tested, but with loss of processes and dendritic field size occurring after day 21.

  6. Investigation of normal organ development with fetal MRI

    International Nuclear Information System (INIS)

    Prayer, Daniela; Brugger, Peter C.

    2007-01-01

    The understanding of the presentation of normal organ development on fetal MRI forms the basis for recognition of pathological states. During the second and third trimesters, maturational processes include changes in size, shape and signal intensities of organs. Visualization of these developmental processes requires tailored MR protocols. Further prerequisites for recognition of normal maturational states are unequivocal intrauterine orientation with respect to left and right body halves, fetal proportions, and knowledge about the MR presentation of extrafetal/intrauterine organs. Emphasis is laid on the demonstration of normal MR appearance of organs that are frequently involved in malformation syndromes. In addition, examples of time-dependent contrast enhancement of intrauterine structures are given. (orig.)

  7. Investigation of normal organ development with fetal MRI

    Energy Technology Data Exchange (ETDEWEB)

    Prayer, Daniela [Medical University of Vienna, Department of Radiology, Vienna (Austria); Brugger, Peter C. [Medical University of Vienna, Center of Anatomy and Cell Biology, Integrative Morphology Group, Vienna (Austria)

    2007-10-15

    The understanding of the presentation of normal organ development on fetal MRI forms the basis for recognition of pathological states. During the second and third trimesters, maturational processes include changes in size, shape and signal intensities of organs. Visualization of these developmental processes requires tailored MR protocols. Further prerequisites for recognition of normal maturational states are unequivocal intrauterine orientation with respect to left and right body halves, fetal proportions, and knowledge about the MR presentation of extrafetal/intrauterine organs. Emphasis is laid on the demonstration of normal MR appearance of organs that are frequently involved in malformation syndromes. In addition, examples of time-dependent contrast enhancement of intrauterine structures are given. (orig.)

  8. Normal motor milestone development for use to promote child care

    Directory of Open Access Journals (Sweden)

    Mahdin A. Husaini

    2016-10-01

    Full Text Available Background Motor behavior is an essential aspect of child development, and usually assessed in terms of age of achievement of motor milestone. The early detection of infants experiencing subtle delays in motor maturation can allow early intervention in developmental problems. Intervention can be more effective if delays are identified early. In order to facilitate the identification of early delays, the Center of Nutrition and Foods Research and Development in Bogor has designed a simple tool to monitor the child (aged 3 to 18 months motor development. Objective To develop an observable of normal gross motor maturation for use to detect deviance or motor delay. Methods A total of 2100 healthy children, aged 3-18 months, from high socio-economic group, in urban and suburban areas, were studied. Body length, weight and motor development were measured on all children. Gross motor development was measured 17 pre selected milestones: lie, sit, crawl, creep, stand Mth assistance, walk with assistance, stand alone, walk alone, and run. Results There were no differences between males and females in the comparison of attainment motor maturation therefore a sex combined curve was developed. Conclusion The curve of normal motor milestone development can be used as a tool to evaluate motor development over time, and/or as a child development card for use in primary health care.

  9. MRI of normal and pathological fetal lung development

    International Nuclear Information System (INIS)

    Kasprian, Gregor; Balassy, Csilla; Brugger, Peter C.; Prayer, Daniela

    2006-01-01

    Normal fetal lung development is a complex process influenced by mechanical and many biochemical factors. In addition to ultrasound, fetal magnetic resonance imaging (MRI) constitutes a new method to investigate this process in vivo during the second and third trimester. The techniques of MRI volumetry, assessment of signal intensities, and MRI spectroscopy of the fetal lung have been used to analyze this process and have already been applied clinically to identify abnormal fetal lung growth. Particularly in conditions such as oligohydramnios and congenital diaphragmatic hernia (CDH), pulmonary hypoplasia may be the cause of neonatal death. A precise diagnosis and quantification of compromised fetal lung development may improve post- and perinatal management. The main events in fetal lung development are reviewed and MR volumetric data from 106 normal fetuses, as well as different examples of pathological lung growth, are provided

  10. MRI of normal and pathological fetal lung development

    Energy Technology Data Exchange (ETDEWEB)

    Kasprian, Gregor [University Clinic of Radiodiagnostics, Medical University of Vienna (Austria)]. E-mail: gregor.kasprian@meduniwien.ac.at; Balassy, Csilla [University Clinic of Radiodiagnostics, Medical University of Vienna (Austria); Brugger, Peter C. [Center of Anatomy and Cell Biology, Medical University of Vienna (Austria); Prayer, Daniela [University Clinic of Radiodiagnostics, Medical University of Vienna (Austria)

    2006-02-15

    Normal fetal lung development is a complex process influenced by mechanical and many biochemical factors. In addition to ultrasound, fetal magnetic resonance imaging (MRI) constitutes a new method to investigate this process in vivo during the second and third trimester. The techniques of MRI volumetry, assessment of signal intensities, and MRI spectroscopy of the fetal lung have been used to analyze this process and have already been applied clinically to identify abnormal fetal lung growth. Particularly in conditions such as oligohydramnios and congenital diaphragmatic hernia (CDH), pulmonary hypoplasia may be the cause of neonatal death. A precise diagnosis and quantification of compromised fetal lung development may improve post- and perinatal management. The main events in fetal lung development are reviewed and MR volumetric data from 106 normal fetuses, as well as different examples of pathological lung growth, are provided.

  11. How Silent is the Right to Silence?

    Directory of Open Access Journals (Sweden)

    Katherine Biber

    2012-11-01

    Full Text Available A long-held and fundamental principle of our criminal justice system is that people accused of crimes have a right to silence, arising from the presumption of innocence. Rules of evidence try to protect this ‘right’ during trial, by ensuring that juries understand that adverse inferences cannot be drawn from the silence of the accused. Silence, in court, can mean nothing, and we are not to speculate about what might motivate an accused person to remain silent, or what they might have said had they spoken. However, an examination of the jurisprudence in this area shows that the law is often not dealing with actual silence; sometimes when the law refers to the ‘right to silence’, it seems to mean a ‘refusal to hear’. In other instances, there is actual silence, and yet the law refuses to subject that silence to any critical interpretation, insisting that we cannot infer anything from it. While we have learned, from theatre, music, linguistics, religion and psychology, to develop sophisticated means for interpreting silence, the law demands that we set aside these interpretive tools, hearing silence that isn’t there, and inferring nothing about something.

  12. Development of an imaging VUV monochromator in normal incidence region

    Energy Technology Data Exchange (ETDEWEB)

    Koog, Joong-San

    1996-07-01

    This paper describes a development of the two-dimensional imaging monochromator system. A commercial normal incidence monochromator working on off-Rowland circle mounting is used for this purpose. The imaging is achieved with utilizing the pinhole camera effect created by an entrance slit of limited height. The astigmatism in the normal incidence mounting is small compared with a grazing incidence mount, but has a finite value. The point is that for near normal incidence, the vertical focusing with a concave grating is produced at outside across the exit slit. Therefore, by putting a 2-D detector at the position away from the exit slit ({approx}30 cm), a one-to-one correspondence between the position of a point on the detector and where it originated in the source is accomplished. This paper consists of (1) the principle and development of the imaging monochromator using the off-Rowland mounting, including the 2-D detector system, (2) a computer simulation by ray tracing for investigations of the imaging properties of imaging system, and aberration from the spherical concave grating on the exit slit, (3) the plasma light source (TPD-S) for the test experiments, (4) Performances of the imaging monochromator system on the spatial resolution and sensitivity, and (5) the use of this system for diagnostic studies on the JIPP T-IIU tokamak. (J.P.N.)

  13. Development of an imaging VUV monochromator in normal incidence region

    International Nuclear Information System (INIS)

    Koog, Joong-San.

    1996-07-01

    This paper describes a development of the two-dimensional imaging monochromator system. A commercial normal incidence monochromator working on off-Rowland circle mounting is used for this purpose. The imaging is achieved with utilizing the pinhole camera effect created by an entrance slit of limited height. The astigmatism in the normal incidence mounting is small compared with a grazing incidence mount, but has a finite value. The point is that for near normal incidence, the vertical focusing with a concave grating is produced at outside across the exit slit. Therefore, by putting a 2-D detector at the position away from the exit slit (∼30 cm), a one-to-one correspondence between the position of a point on the detector and where it originated in the source is accomplished. This paper consists of 1) the principle and development of the imaging monochromator using the off-Rowland mounting, including the 2-D detector system, 2) a computer simulation by ray tracing for investigations of the imaging properties of imaging system, and aberration from the spherical concave grating on the exit slit, 3) the plasma light source (TPD-S) for the test experiments, 4) Performances of the imaging monochromator system on the spatial resolution and sensitivity, and 5) the use of this system for diagnostic studies on the JIPP T-IIU tokamak. (J.P.N.)

  14. Emotion processes in normal and abnormal development and preventive intervention.

    Science.gov (United States)

    Izard, Carroll E; Fine, Sarah; Mostow, Allison; Trentacosta, Christopher; Campbell, Jan

    2002-01-01

    We present an analysis of the role of emotions in normal and abnormal development and preventive intervention. The conceptual framework stems from three tenets of differential emotions theory (DET). These principles concern the constructs of emotion utilization; intersystem connections among modular emotion systems, cognition, and action; and the organizational and motivational functions of discrete emotions. Particular emotions and patterns of emotions function differentially in different periods of development and in influencing the cognition and behavior associated with different forms of psychopathology. Established prevention programs have not emphasized the concept of emotion as motivation. It is even more critical that they have generally neglected the idea of modulating emotions, not simply to achieve self-regulation, but also to utilize their inherently adaptive functions as a means of facilitating the development of social competence and preventing psychopathology. The paper includes a brief description of a theory-based prevention program and suggestions for complementary targeted interventions to address specific externalizing and internalizing problems. In the final section, we describe ways in which emotion-centered preventions can provide excellent opportunities for research on the development of normal and abnormal behavior.

  15. Expressive vocabulary of children with normal and deviant phonological development.

    Science.gov (United States)

    Athayde, Marcia de Lima; Mota, Helena Bolli; Mezzomo, Carolina Lisbôa

    2010-01-01

    expressive vocabulary of children with normal and deviant phonological development. to determine whether alterations presented by children with phonological disorders occur only at the phonological level or if there are any impacts on lexical acquisition; to compare the vocabulary performance of children with phonological disorders to reference values presented by the used test. participants of the study were 36 children of both genders, 14 with phonological disorders (Study group) and 22 with typical language development (Control Group). The ABFW - Vocabulary Test (Befi-Lopes, 2000) was used for assessing the expressive vocabulary of children and later to compare the performance of both groups. the performance of children with phonological disorder in the expressive vocabulary test is similar to that of children with normal phonological development. Most of the children of both groups reached the benchmarks proposed by the test for the different semantic fields. The semantic field Places demonstrated to be the most complex for both groups. the alterations presented by children with phonological disorder area limited to the phonological level, having no impact on the lexical aspect of language.

  16. Is phonology bypassed in normal or dyslexic development?

    Science.gov (United States)

    Pennington, B F; Lefly, D L; Van Orden, G C; Bookman, M O; Smith, S D

    1987-01-01

    A pervasive assumption in most accounts of normal reading and spelling development is that phonological coding is important early in development but is subsequently superseded by faster, orthographic coding which bypasses phonology. We call this assumption, which derives from dual process theory, the developmental bypass hypothesis. The present study tests four specific predictions of the developmental bypass hypothesis by comparing dyslexics and nondyslexics from the same families in a cross-sectional design. The four predictions are: 1) That phonological coding skill develops early in normal readers and soon reaches asymptote, whereas orthographic coding skill has a protracted course of development; 2) that the correlation of adult reading or spelling performance with phonological coding skill is considerably less than the correlation with orthographic coding skill; 3) that dyslexics who are mainly deficient in phonological coding skill should be able to bypass this deficit and eventually close the gap in reading and spelling performance; and 4) that the greatest differences between dyslexics and developmental controls on measures of phonological coding skill should be observed early rather than late in development.None of the four predictions of the developmental bypass hypothesis were upheld. Phonological coding skill continued to develop in nondyslexics until adulthood. It accounted for a substantial (32-53 percent) portion of the variance in reading and spelling performance in adult nondyslexics, whereas orthographic coding skill did not account for a statistically reliable portion of this variance. The dyslexics differed little across age in phonological coding skill, but made linear progress in orthographic coding skill, surpassing spelling-age (SA) controls by adulthood. Nonetheless, they didnot close the gap in reading and spelling performance. Finally, dyslexics were significantly worse than SA (and Reading Age [RA]) controls in phonological coding skill

  17. Epigenetic silencing of CYP24 in the tumor microenvironment

    Science.gov (United States)

    Johnson, Candace S.; Chung, Ivy; Trump, Donald L.

    2010-01-01

    Calcitriol (1,25 dihydroxycholecalciferol) has significant antitumor activity in vitro and in vivo in a number of tumor model systems. We developed a system for isolation of fresh endothelial cells from tumors and Matrigel environments which demonstrate that CYP24, the catabolic enzyme involved in vitamin D signaling, is epigenetically silenced selectively in tumor-derived endothelial cells (TDEC). TDEC maintain phenotypic characteristics which are distinct from endothelial cells isolated from normal tissues and from Matrigel plugs (MDEC). In TDEC, calcitriol induces G0/G1 arrest, modulates p27 and p21, and induces apoptotic cell death and decreases P-Erk and P-Akt. In contrast, endothelial cells isolated from normal tissues and MDEC are unresponsive to calcitriol-mediated anti-proliferative effects despite intact signaling through the vitamin D receptor (VDR). In TDEC, which is sensitive to calcitriol, the CYP24 promoter is hypermethylated in two CpG island regions located at the 5′end; this hypermethylation may contribute to gene silencing of CYP24. The extent of methylation in these two regions is significantly less in MDEC. Lastly, treatment of TDEC with a DNA methyltransferase inhibitor restores calcitriol-mediated induction of CYP24 and resistance to calcitriol. These data suggest that epigenetic silencing of CYP24 modulates cellular responses to calcitriol. PMID:20304059

  18. The normal development of Platynereis dumerilii (Nereididae, Annelida

    Directory of Open Access Journals (Sweden)

    Henrich Thorsten

    2010-12-01

    Full Text Available Abstract Background The polychaete annelid Platynereis dumerilii is an emerging model organism for the study of molecular developmental processes, evolution, neurobiology and marine biology. Annelids belong to the Lophotrochozoa, the so far understudied third major branch of bilaterian animals besides deuterostomes and ecdysozoans. P. dumerilii has proven highly relevant to explore ancient bilaterian conditions via comparison to the deuterostomes, because it has accumulated less evolutionary change than conventional ecdysozoan models. Previous staging was mainly referring to hours post fertilization but did not allow matching stages between studies performed at (even slightly different temperatures. To overcome this, and to provide a first comprehensive description of P. dumerilii normal development, a temperature-independent staging system is needed. Results Platynereis dumerilii normal development is subdivided into 16 stages, starting with the zygote and ending with the death of the mature worms after delivering their gametes. The stages described can be easily identified by conventional light microscopy or even by dissecting scope. Developmental landmarks such as the beginning of phototaxis, the visibility of the stomodeal opening and of the chaetae, the first occurrence of the ciliary bands, the formation of the parapodia, the extension of antennae and cirri, the onset of feeding and other characteristics are used to define different developmental stages. The morphology of all larval stages as well as of juveniles and adults is documented by light microscopy. We also provide an overview of important steps in the development of the nervous system and of the musculature, using fluorescent labeling techniques and confocal laser-scanning microscopy. Timing of each developmental stage refers to hours post fertilization at 18 ± 0.1°C. For comparison, we determined the pace of development of larvae raised at 14°C, 16°C, 20°C, 25°C, 28°C and

  19. Silencing criticism in Mexico

    Directory of Open Access Journals (Sweden)

    Ximena Suárez

    2017-10-01

    Full Text Available Journalists and human rights defenders in Mexico are being attacked in an attempt to silence their criticism. Many are forced to flee or risk being assassinated. The consequences are both personal and of wider social significance.

  20. Normal Conducting Deflecting Cavity Development at the Cockcroft Institute

    CERN Document Server

    Burt, G; Dexter, A C; Woolley, B; Jones, R M; Grudiev, A; Dolgashev, V; Wheelhouse, A; Mackenzie, J; McIntosh, P A; Hill, C; Goudket, P; Buckley, S; Lingwood, C

    2013-01-01

    Two normal conducting deflecting structures are currently being developed at the Cockcroft Institute, one as a crab cavity for CERN linear collider CLIC and one for bunch slice diagnostics on low energy electron beams for Electron Beam Test Facility EBTF at Daresbury. Each has its own challenges that need overcome. For CLIC the phase and amplitude tolerances are very stringent and hence beamloading effects and wakefields must be minimised. Significant work has been undertook to understand the effect of the couplers on beamloading and the effect of the couplers on the wakefields. For EBTF the difficulty is avoiding the large beam offset caused by the cavities internal deflecting voltage at the low beam energy. Prototypes for both cavities have been manufactured and results will be presented.

  1. Do early premalignant changes in normal breast epithelial cells predict cancer development?

    International Nuclear Information System (INIS)

    Clarke, Robert B; Bundred, Nigel J

    2005-01-01

    A recent report suggests that, in an in vitro model of premalignant breast cells (vHMECs), silencing of INK4A gene is accompanied by over-expression of cyclo-oxygenase (COX)-2. This suggests that COX-2 over-expression may be an early event in breast cancer aetiology permitting clones within the normal epithelium to evade apoptosis, to increase their numbers and perhaps acquire further changes that promote the formation of hyperplasias, and eventually carcinomas. While COX-2 expression in normal breast epithelium in vivo has not been proven to be linked to an increased risk of breast cancer, its over-expression in the premalignant model in vitro does provide preliminary evidence that COX-2 inhibition may be a useful chemoprevention strategy

  2. Normal development of paranasal sinuses in children: A CT study

    International Nuclear Information System (INIS)

    Kim, Hyung Jin; Park, Eui Dong; Choi, Pil Youb; Kim, Jae Hyoung; Chung, Sung Hoon; Chung, Hae Gyeong

    1993-01-01

    To evaluate the normal development of the paranasal sinuses in children with CT, authors prospectively studied with brain CT scans of 260 children without known sinus disease, ranging image from 7 days to 16 years. Maximal anteroposterior and transverse diameters(mm) and maximal cross- sectional area(mm 2 ) of both sides of the maxillary sinus were measured with the aid of computer device. As to the ethmoidal and spheroidal sinuses, we simply documented the presence of the aplastic ethmoidal sinus and calculated the age-incidence of the spheroidal sinus pneumatization, respectively.There noted three phases in the development of the maxillary sinus. The anteroposterior and transverse diameters of the maxillary sinus increased nearly in parallel. The former was always greater than the latter. In no cases was the edathamil sinus aplastic and almost all sinuses were pneumatized even in infants as early as 7 old days. CT identified the conchal pattern of sphenoidal sinus pneumatization infants as early as 11 days old. Sphenoidal sinus pneumatization was seen in 38% of the children under the age of 1 year, 82% of the children between the age of 1 and 2 years, and almost all children older than 2 years. The anteroposterior and transverse diameters of the maxillary sinus seem to reach the adult size by 8 years of age, and the conchal pattern of sphemoidal sinus pneumatization can be recognized earlier with CT than on the plain radiographs

  3. Target normal sheath acceleration analytical modeling, comparative study and developments

    International Nuclear Information System (INIS)

    Perego, C.; Batani, D.; Zani, A.; Passoni, M.

    2012-01-01

    Ultra-intense laser interaction with solid targets appears to be an extremely promising technique to accelerate ions up to several MeV, producing beams that exhibit interesting properties for many foreseen applications. Nowadays, most of all the published experimental results can be theoretically explained in the framework of the target normal sheath acceleration (TNSA) mechanism proposed by Wilks et al. [Phys. Plasmas 8(2), 542 (2001)]. As an alternative to numerical simulation various analytical or semi-analytical TNSA models have been published in the latest years, each of them trying to provide predictions for some of the ion beam features, given the initial laser and target parameters. However, the problem of developing a reliable model for the TNSA process is still open, which is why the purpose of this work is to enlighten the present situation of TNSA modeling and experimental results, by means of a quantitative comparison between measurements and theoretical predictions of the maximum ion energy. Moreover, in the light of such an analysis, some indications for the future development of the model proposed by Passoni and Lontano [Phys. Plasmas 13(4), 042102 (2006)] are then presented.

  4. What Drives Embryo Development? Chromosomal Normality or Mitochondria?

    Directory of Open Access Journals (Sweden)

    A. Bayram

    2017-01-01

    Full Text Available Objective. To report the arrest of euploid embryos with high mtDNA content. Design. A report of 2 cases. Setting. Private fertility clinic. Patients. 2 patients, 45 and 40 years old undergoing IVF treatment. Interventions. Mature oocytes were collected and vitrified from two ovarian stimulations. Postthaw, survived mature oocytes underwent fertilization by intracytoplasmic sperm injection (ICSI. Preimplantation genetic screening (PGS and mitochondrial DNA (mtDNA copy number were done using next generation sequencing (NGS. The only normal embryo among the all-biopsied embryos had the highest “Mitoscore” value and was the only arrested embryo in both cases. Therefore, the embryo transfer was cancelled. Main Outcome Measures. Postthaw survival and fertilization rate, embryo euploidy, mtDNA copy number, and embryo development. Results. In both patients, after PGS only 1 embryo was euploid. Both embryos had the highest mtDNA copy number from all tested embryos and both embryos were arrested on further development. Conclusions. These cases clearly demonstrate the lack of correlation between mtDNA value (Mitoscore and chromosomal status of embryo.

  5. MRS of normal and impaired fetal brain development

    International Nuclear Information System (INIS)

    Girard, Nadine; Fogliarini, Celine; Viola, Angele; Confort-Gouny, Sylviane; Le Fur, Yann; Viout, Patrick; Chapon, Frederique; Levrier, Olivier; Cozzone, Patrick

    2006-01-01

    Cerebral maturation in the human fetal brain was investigated by in utero localized proton magnetic resonance spectroscopy (MRS). Spectra were acquired on a clinical MR system operating at 1.5 T. Body phased array coils (four coils) were used in combination with spinal coils (two coils). The size of the nominal volume of interest (VOI) was 4.5 cm 3 (20 mm x 15 mm x 15 mm). The MRS acquisitions were performed using a spin echo sequence at short and long echo times (TE = 30 ms and 135 ms) with a VOI located within the cerebral hemisphere at the level of the centrum semiovale. A significant reduction in myo-inositol and choline and an increase in N-acetylaspartate were observed with progressive age. The normal MR spectroscopy data reported here will help to determine whether brain metabolism is altered, especially when subtle anatomic changes are observed on conventional images. Some examples of impaired fetal brain development studied by MRS are illustrated

  6. MRS of normal and impaired fetal brain development

    Energy Technology Data Exchange (ETDEWEB)

    Girard, Nadine [Service de Neuroradiologie, Assistance Publique-Hopitaux de Marseille, Hopital la Timone, Universite de la Mediterranee, Marseille (France)]. E-mail: nadine.girard@ap-hm.fr; Fogliarini, Celine [Centre de Resonance Magnetique Biologique et Medicale, UMR CNRS 6612, Universite de la Mediterranee, Faculte de Medecine la Timone, Marseille (France); Viola, Angele [Centre de Resonance Magnetique Biologique et Medicale, UMR CNRS 6612, Universite de la Mediterranee, Faculte de Medecine la Timone, Marseille (France); Confort-Gouny, Sylviane [Centre de Resonance Magnetique Biologique et Medicale, UMR CNRS 6612, Universite de la Mediterranee, Faculte de Medecine la Timone, Marseille (France); Le Fur, Yann [Centre de Resonance Magnetique Biologique et Medicale, UMR CNRS 6612, Universite de la Mediterranee, Faculte de Medecine la Timone, Marseille (France); Viout, Patrick [Centre de Resonance Magnetique Biologique et Medicale, UMR CNRS 6612, Universite de la Mediterranee, Faculte de Medecine la Timone, Marseille (France); Chapon, Frederique [Service de Neuroradiologie, Assistance Publique-Hopitaux de Marseille, Hopital la Timone, Universite de la Mediterranee, Marseille (France); Levrier, Olivier [Service de Neuroradiologie, Assistance Publique-Hopitaux de Marseille, Hopital la Timone, Universite de la Mediterranee, Marseille (France); Cozzone, Patrick [Centre de Resonance Magnetique Biologique et Medicale, UMR CNRS 6612, Universite de la Mediterranee, Faculte de Medecine la Timone, Marseille (France)

    2006-02-15

    Cerebral maturation in the human fetal brain was investigated by in utero localized proton magnetic resonance spectroscopy (MRS). Spectra were acquired on a clinical MR system operating at 1.5 T. Body phased array coils (four coils) were used in combination with spinal coils (two coils). The size of the nominal volume of interest (VOI) was 4.5 cm{sup 3} (20 mm x 15 mm x 15 mm). The MRS acquisitions were performed using a spin echo sequence at short and long echo times (TE = 30 ms and 135 ms) with a VOI located within the cerebral hemisphere at the level of the centrum semiovale. A significant reduction in myo-inositol and choline and an increase in N-acetylaspartate were observed with progressive age. The normal MR spectroscopy data reported here will help to determine whether brain metabolism is altered, especially when subtle anatomic changes are observed on conventional images. Some examples of impaired fetal brain development studied by MRS are illustrated.

  7. Development of marker-free transgenic Jatropha curcas producing curcin-deficient seeds through endosperm-specific RNAi-mediated gene silencing.

    Science.gov (United States)

    Gu, Keyu; Tian, Dongsheng; Mao, Huizhu; Wu, Lifang; Yin, Zhongchao

    2015-10-08

    Jatropha curcas L. is a potential biofuel plant and its seed oil is suitable for biodiesel production. Despite this promising application, jatropha seeds contain two major toxic components, namely phorbol esters and curcins. These compounds would reduce commercial value of seed cake and raise safety and environment concerns on jatropha plantation and processing. Curcins are Type I ribosome inactivating proteins. Several curcin genes have been identified in the jatropha genome. Among which, the Curcin 1 (C1) gene is identified to be specifically expressed in endosperm, whereas the Curcin 2A (C2A) is mainly expressed in young leaves. A marker-free RNAi construct carrying a β-estradiol-regulated Cre/loxP system and a C1 promoter-driven RNAi cassette for C1 gene was made and used to generate marker-free transgenic RNAi plants to specifically silence the C1 gene in the endosperm of J. curcas. Plants of transgenic line L1, derived from T0-1, carry two copies of marker-free RNAi cassette, whereas plants of L35, derived from T0-35, harbored one copy of marker-free RNAi cassette and three copies of closely linked and yet truncated Hpt genes. The C1 protein content in endosperm of L1 and L35 seeds was greatly reduced or undetectable, while the C2A proteins in young leaves of T0-1 and T0-35 plants were unaffected. In addition, the C1 mRNA transcripts were undetectable in the endosperm of T3 seeds of L1 and L35. The results demonstrated that the expression of the C1 gene was specifically down-regulated or silenced by the double-stranded RNA-mediated RNA interference generated from the RNAi cassette. The C1 promoter-driven RNAi cassette for the C1 gene in transgenic plants was functional and heritable. Both C1 transcripts and C1 proteins were greatly down-regulated or silenced in the endosperm of transgenic J. curcas. The marker-free transgenic plants and curcin-deficient seeds developed in this study provided a solution for the toxicity of curcins in jatropha seeds and

  8. Silêncios Silences

    Directory of Open Access Journals (Sweden)

    Luciano Marcondes Godoy

    1999-01-01

    Full Text Available Muitas são as vivências que se expressarão em SILÊNCIOS. Muitos são os silêncios. No Bloco A, o silêncio denuncia a retirada para um outro mundo, a queda num abismo. No bloco B, o silêncio é controlador, exigindo a fala do analista, um jogo em que o que é falado não tem a menor importância. Surge ainda como expressão da necessidade de discriminar-se do analista e, na sua evolução, como um enfrentamento a um estado sem sentido. No Bloco C, o silêncio é agressivo, e a sobrevivência do analisando e analista ao mesmo criará um espaço que propiciará sonhos que surgirão no Bloco D. Esses momentos de silêncio-sonho são situações em que não há discriminação eu-não eu.Many are the experiences which are expressed through silences. Many are the silences. In Block A, silence denounces a pretreatment to another world, a fall into an abysm. In Block B, silence is a controlling factor, demanding the words of the analyst, a game where what is said does not have any importance what so ever. It emerges also as an expression of the analyst's necessity to discriminate himself, and within his evolution the revision of a senseless state. In Block C, the silence is aggressive. As a response, the survival of the patient and of the analyst will create a place in which dreams will come up. Block D analyses these moments of dream-silence situations, where there aren't any forms of self-non self discrimination.

  9. Memories Persist in Silence

    Directory of Open Access Journals (Sweden)

    Sandra Patricia Arenas Grisales

    2012-08-01

    Full Text Available This article exposes the hypothesis that memory artifacts, created to commemorate the victims of armed conflict in Colombia, are an expression of the underground memories and a way of political action in the midst of war. We analyze three cases of creations of memory artifacts in Medellín, Colombia, as forms of suffering, perceiving and resisting the power of armed groups in Medellín. The silence, inherent in these objects, should not be treated as an absence of language, but as another form of expression of memory. Silence is a tactic used to overcome losses and reset everyday life in contexts of protracted violence.

  10. The Gift of Silence

    Science.gov (United States)

    Haskins, Cathleen

    2011-01-01

    Slowing down, quieting the mind and body, and experiencing silence nourishes the spirit. Montessori educators are mandated to cultivate not just the intellect but the whole child. They recognize that nurturing the spirit of the child is part of what makes this form of education work so well. This article discusses the benefits of stillness and…

  11. Breaking the silence

    DEFF Research Database (Denmark)

    Konradsen, Hanne; Kirkevold, Marit; McCallin, Antoinette

    2012-01-01

    and individual interviews were analyzed using the grounded theory method. The findings revealed that the main concern of the patients was feeling isolated, which was resolved using a process of interactional integration. Interactional integration begins by breaking the silence to enable the progression from...

  12. Silence of the Genes

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 12; Issue 4. Silence of the Genes - 2006 Nobel Prize in Physiology or Medicine. Utpal Nath Saumitra Das. General Article Volume 12 Issue 4 April 2007 pp 6-18. Fulltext. Click here to view fulltext PDF. Permanent link:

  13. Antisense gene silencing

    DEFF Research Database (Denmark)

    Nielsen, Troels T; Nielsen, Jørgen E

    2013-01-01

    Since the first reports that double-stranded RNAs can efficiently silence gene expression in C. elegans, the technology of RNA interference (RNAi) has been intensively exploited as an experimental tool to study gene function. With the subsequent discovery that RNAi could also be applied...

  14. Calcium signalling silencing in atrial fibrillation.

    Science.gov (United States)

    Greiser, Maura

    2017-06-15

    Subcellular calcium signalling silencing is a novel and distinct cellular and molecular adaptive response to rapid cardiac activation. Calcium signalling silencing develops during short-term sustained rapid atrial activation as seen clinically during paroxysmal atrial fibrillation (AF). It is the first 'anti-arrhythmic' adaptive response in the setting of AF and appears to counteract the maladaptive changes that lead to intracellular Ca 2+ signalling instability and Ca 2+ -based arrhythmogenicity. Calcium signalling silencing results in a failed propagation of the [Ca 2+ ] i signal to the myocyte centre both in patients with AF and in a rabbit model. This adaptive mechanism leads to a substantial reduction in the expression levels of calcium release channels (ryanodine receptors, RyR2) in the sarcoplasmic reticulum, and the frequency of Ca 2+ sparks and arrhythmogenic Ca 2+ waves remains low. Less Ca 2+ release per [Ca 2+ ] i transient, increased fast Ca 2+ buffering strength, shortened action potentials and reduced L-type Ca 2+ current contribute to a substantial reduction of intracellular [Na + ]. These features of Ca 2+ signalling silencing are distinct and in contrast to the changes attributed to Ca 2+ -based arrhythmogenicity. Some features of Ca 2+ signalling silencing prevail in human AF suggesting that the Ca 2+ signalling 'phenotype' in AF is a sum of Ca 2+ stabilizing (Ca 2+ signalling silencing) and Ca 2+ destabilizing (arrhythmogenic unstable Ca 2+ signalling) factors. Calcium signalling silencing is a part of the mechanisms that contribute to the natural progression of AF and may limit the role of Ca 2+ -based arrhythmogenicity after the onset of AF. © 2017 The Authors. The Journal of Physiology © 2017 The Physiological Society.

  15. The Silence of Michelangelo

    DEFF Research Database (Denmark)

    Foote, Jonathan

    2016-01-01

    In one of the many anecdotes about Michelangelo, the master neared completion of his colossal Moses, tapped him on the knee with his hammer and exclaimed,"Perché non parli?" As an act that liberates latent thoughts or material potentials, his cadenced hammer spoke through careful, repetitive, and...... and distractive, instead activate a contemplative place of silence. Perhaps more than merely a tool for removing stone, the hammer was an instrument for sonorous meditation with materials and thinking....

  16. Normal and abnormal neuronal migration in the developing cerebral cortex.

    Science.gov (United States)

    Sun, Xue-Zhi; Takahashi, Sentaro; Cui, Chun; Zhang, Rui; Sakata-Haga, Hiromi; Sawada, Kazuhiko; Fukui, Yoshihiro

    2002-08-01

    Neuronal migration is the critical cellular process which initiates histogenesis of cerebral cortex. Migration involves a series of complex cell interactions and transformation. After completing their final mitosis, neurons migrate from the ventricular zone into the cortical plate, and then establish neuronal lamina and settle onto the outermost layer, forming an "inside-out" gradient of maturation. This process is guided by radial glial fibers, requires proper receptors, ligands, other unknown extracellular factors, and local signaling to stop neuronal migration. This process is also highly sensitive to various physical, chemical and biological agents as well as to genetic mutations. Any disturbance of the normal process may result in neuronal migration disorder. Such neuronal migration disorder is believed as major cause of both gross brain malformation and more special cerebral structural and functional abnormalities in experimental animals and in humans. An increasing number of instructive studies on experimental models and several genetic model systems of neuronal migration disorder have established the foundation of cortex formation and provided deeper insights into the genetic and molecular mechanisms underlying normal and abnormal neuronal migration.

  17. Hemoglobin is essential for normal growth of Arabidopsis organs

    DEFF Research Database (Denmark)

    Hebelstrup, Kim Henrik; Hunt, Peter; Dennis, Elizabeth

    2006-01-01

    In Arabidopsis thaliana, the class I hemoglobin AHb1 is transiently expressed in the hydathodes of leaves and in floral buds from young inflorescences. Nitric oxide (NO) accumulates to high levels in these organs when AHb1 is silenced, indicating an important role in metabolizing NO. AHb1-silenced...... lines are viable but show a mutant phenotype affecting the regions where AHb1 is expressed. Arabidopsis lines with an insertional knockout or overexpression of AHb2, a class II 3-on-3 hemoglobin, were generated. Seedlings overexpressing AHb2 show enhanced survival of hypoxic stress. The AHb2 knockout...... lines develop normally. However, when AHb2 knockout is combined with AHb1 silencing, seedlings die at an early vegetative stage suggesting that the two 3-on-3 hemoglobins, AHb1 and AHb2, together play an essential role for normal development of Arabidopsis seedlings. In conclusion, these results...

  18. Organizational Silence in Universities as the Predictor of Organizational Culture

    Directory of Open Access Journals (Sweden)

    Erkan YAMAN

    2014-04-01

    Full Text Available The aim of this study is to determine the relationship between the sense of organizational silence and the organizational culture the instructors perceived. In this study, the scale for determining organizational culture developed by İpek (1999 and the scale for measuring organizational silence developed by Çakıcı (2007 and adapted by Soycan (2010 are used. No remarkable difference was found in the academic staff's sense of organizational silence degree according to their genders and educational backgrounds. It was seen that the instructors' sense of organizational silence had remarkable differences according to their age group, faculty, sense of administration type in their institutions, frequency of their face-to-face communication with their administrators and their thoughts of speaking clearly with their administrators. It was observed that research assistants had a significantly higher sense of organizational silence than the lecturers in the sense of ‘Lack of Experience'. It was seen that academicians who had 1-5 years of employment period had the highest sense of organizational silence while those who had 21 years or more employment period had the lowest sense of organizational silence in the sense of ‘Lack of Experience' of organizational silence. When the points that participant academicians got from organizational silence and organizational culture scales analyzed in the correlation table, it was found out that there was a remarkable relationship between the academicians' sense of organizational silence and sense of organizational culture. This relationship was a medium-level negative relationship between subdimensions of two scales. A medium-level negative relationship between the organizational silence (total and the organizational culture was also seen. Based on the findings, university administrators were proposed to create a participant culture in their institutions as well as to encourage instructors to speak clearly and

  19. Development of Novel Antisense Oligonucleotides for the Functional Regulation of RNA-Induced Silencing Complex (RISC) by Promoting the Release of microRNA from RISC.

    Science.gov (United States)

    Ariyoshi, Jumpei; Momokawa, Daiki; Eimori, Nao; Kobori, Akio; Murakami, Akira; Yamayoshi, Asako

    2015-12-16

    MicroRNAs (miRNAs) are known to be important post-transcription regulators of gene expression. Aberrant miRNA expression is associated with pathological disease processes, including carcinogenesis. Therefore, miRNAs are considered significant therapeutic targets for cancer therapy. MiRNAs do not act alone, but exhibit their functions by forming RNA-induced silencing complex (RISC). Thus, the regulation of RISC activity is a promising approach for cancer therapy. MiRNA is a core component of RISC and is an essential to RISC for recognizing target mRNA. Thereby, it is expected that development of the method to promote the release of miRNA from RISC would be an effective approach for inhibition of RISC activity. In this study, we synthesized novel peptide-conjugated oligonucleotides (RINDA-as) to promote the release of miRNA from RISC. RINDA-as showed a high rate of miRNA release from RISC and high level of inhibitory effect on RISC activity.

  20. Transcription factors: normal and malignant development of blood cells

    National Research Council Canada - National Science Library

    Ravid, Katya; Licht, Jonathan

    2001-01-01

    ... and the Development of the Erythroid Lineage James J. Bieker 71 II TRANSCRIPTION FACTORS AND THE MYELOID LINEAGE 85 6 RUNX1(AML1) and CBFB: Genes Required for the Development of All Definitive Hematopoietic Lineages 87 Nancy A. Speck and Elaine Dzierzak 7 PU.1 and the Development of the Myeloid Lineage Daniel G. Tenen 103 vvi CONTENTS 8 CCAAT/Enhancer-...

  1. Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing.

    Science.gov (United States)

    Hedil, Marcio; Sterken, Mark G; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard

    2015-01-01

    RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silencing has only been studied to a limited extent. Here, the NSs proteins of TSWV, groundnut ringspot virus (GRSV) and tomato yellow ring virus (TYRV), representatives for three distinct tospovirus species, have been studied on their ability and strength to suppress local and systemic silencing. A system has been developed to quantify suppression of GFP silencing in Nicotiana benthamiana 16C lines, to allow a comparison of relative RNA silencing suppressor strength. It is shown that NSs of all three tospoviruses are suppressors of local and systemic silencing. Unexpectedly, suppression of systemic RNA silencing by NSsTYRV was just as strong as those by NSsTSWV and NSsGRSV, even though NSsTYRV was expressed in lower amounts. Using the system established, a set of selected NSsTSWV gene constructs mutated in predicted RNA binding domains, as well as NSs from TSWV isolates 160 and 171 (resistance breakers of the Tsw resistance gene), were analyzed for their ability to suppress systemic GFP silencing. The results indicate another mode of RNA silencing suppression by NSs that acts further downstream the biogenesis of siRNAs and their sequestration. The findings are discussed in light of the affinity of NSs for small and long dsRNA, and recent mutant screen of NSsTSWV to map domains required for RSS activity and triggering of Tsw-governed resistance.

  2. Normal feline behaviour: … and why problem behaviours develop.

    Science.gov (United States)

    Bradshaw, John

    2018-05-01

    Practical relevance: Cats are descended from a solitary, territorial ancestor, and while domestication has reduced their inherited tendency to be antagonistic towards all animals larger than their typical prey, they still place more reliance on the security of their territory than on psychological attachments to people or other cats, the exact opposite to dogs. Many feline problem behaviours stem from perceived threats to this security, often due to conflicts with other cats. Others are more developmental in origin, often caused by inadequate exposure to crucial stimuli, especially people, during the socialisation period. Strongly aversive events experienced at any age can also contribute. A third category comprises normal behaviour that owners deem unacceptable, such as scratching of furniture. Evidence base: This review identifies three areas in which basic research is inadequate to support widely employed concepts and practices in feline behavioural medicine. First, classification of cats' problem behaviours relies heavily on approaches derived from studies of their behavioural ecology and, to some extent, extrapolation from canine studies. Few studies have focused on cats in the home, the environment in which most behavioural disorders are expressed. Secondly, cats' chemical senses (olfactory and vomeronasal) are far more sensitive than our own, making it difficult for owners or clinicians to fully comprehend the sensory information upon which they base their behaviour. Thirdly, although the concept of psychological distress is widely invoked as an intervening variable in behavioural disorders, there are still no reliable measures of distress for pet cats in the home. Global importance: Psychological distress of some kind is the primary cause of many of the behavioural problems presented to clinicians, but surveys indicate that many more cats display the same clinical signs without their owners ever seeking help. The welfare of this 'invisible' group could be

  3. Voice and silence in organizations

    Directory of Open Access Journals (Sweden)

    Moaşa, H.

    2011-01-01

    Full Text Available Unlike previous research on voice and silence, this article breaksthe distance between the two and declines to treat them as opposites. Voice and silence are interrelated and intertwined strategic forms ofcommunication which presuppose each other in such a way that the absence of one would minimize completely the other’s presence. Social actors are not voice, or silence. Social actors can have voice or silence, they can do both because they operate at multiple levels and deal with multiple issues at different moments in time.

  4. Brain connectivity in normally developing children and adolescents.

    Science.gov (United States)

    Khundrakpam, Budhachandra S; Lewis, John D; Zhao, Lu; Chouinard-Decorte, François; Evans, Alan C

    2016-07-01

    The developing human brain undergoes an astonishing sequence of events that continuously shape the structural and functional brain connectivity. Distinct regional variations in the timelines of maturational events (synaptogenesis and synaptic pruning) occurring at the synaptic level are reflected in brain measures at macroscopic resolution (cortical thickness and gray matter density). Interestingly, the observed brain changes coincide with cognitive milestones suggesting that the changing scaffold of brain circuits may subserve cognitive development. Recent advances in connectivity analysis propelled by graph theory have allowed, on one hand, the investigation of maturational changes in global organization of structural and functional brain networks; and on the other hand, the exploration of specific networks within the context of global brain networks. An emerging picture from several connectivity studies is a system-level rewiring that constantly refines the connectivity of the developing brain. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Dynamic Alu Methylation during Normal Development, Aging, and Tumorigenesis

    Directory of Open Access Journals (Sweden)

    Yanting Luo

    2014-01-01

    Full Text Available DNA methylation primarily occurs on CpG dinucleotides and plays an important role in transcriptional regulations during tissue development and cell differentiation. Over 25% of CpG dinucleotides in the human genome reside within Alu elements, the most abundant human repeats. The methylation of Alu elements is an important mechanism to suppress Alu transcription and subsequent retrotransposition. Decades of studies revealed that Alu methylation is highly dynamic during early development and aging. Recently, many environmental factors were shown to have a great impact on Alu methylation. In addition, aberrant Alu methylation has been documented to be an early event in many tumors and Alu methylation levels have been associated with tumor aggressiveness. The assessment of the Alu methylation has become an important approach for early diagnosis and/or prognosis of cancer. This review focuses on the dynamic Alu methylation during development, aging, and tumor genesis. The cause and consequence of Alu methylation changes will be discussed.

  6. "Listening Silence" and Its Discursive Effects

    Science.gov (United States)

    Applebaum, Barbara

    2016-01-01

    While researchers have studied how white silence protects white innocence and white ignorance, in this essay Barbara Applebaum explores a form of white silence that she refers to as "listening silence" in which silence protects white innocence but does not necessarily promote resistance to learning. White listening silence can appear to…

  7. Normal and Abnormal Embryonic Development in Virtual Reality

    NARCIS (Netherlands)

    L. Baken (Leonie)

    2014-01-01

    markdownabstract__Abstract__ Research of the past years indicates that the periconception period, the period including gametogenesis and embryogenesis, determines growth and development of the embryo and subsequent pregnancy outcome. Prenatal care starts to focus more on the first-trimester of

  8. Bodies, Spaces, Voices, Silences

    Directory of Open Access Journals (Sweden)

    Donatella Mazzoleni

    2013-07-01

    Full Text Available A good architecture should not only allow functional, formal and technical quality for urban spaces, but also let the voice of the city be perceived, listened, enjoyed. Every city has got its specific sound identity, or “ISO” (R. O. Benenzon, made up of a complex texture of background noises and fluctuation of sound figures emerging and disappearing in a game of continuous fadings. For instance, the ISO of Naples is characterized by a spread need of hearing the sound return of one’s/others voices, by a hate of silence. Cities may fall ill: illness from noise, within super-crowded neighbourhoods, or illness from silence, in the forced isolation of peripheries. The proposal of an urban music therapy denotes an unpublished and innovative enlarged interdisciplinary research path, where architecture, music, medicine, psychology, communication science may converge, in order to work for rebalancing spaces and relation life of the urban collectivity, through the care of body and sound dimensions.

  9. Organizational Silence in Sports Employees

    Science.gov (United States)

    Bastug, Gulsum; Pala, Adem; Yilmaz, Taner; Duyan, Mehdi; Gunel, Ilker

    2016-01-01

    Organizational silence can be defined as a way of behaviour belonging to men and women employees in the organization exhibited without reflecting their feelings, ideas, concerns and suggestions related with their workplaces, works for which they are responsible or other activities of the organization. In the period of organizational silence,…

  10. Silence, an Eye of Knowledge

    Science.gov (United States)

    Aghamohammadi, Mehdi

    2017-01-01

    One of the conspicuous features of the twentieth-century West was silence. This idea could be supported by examining reflections of Ludwig Wittgenstein, Fritz Mauthner, John Cage, Samuel Beckett, Ihab Hassan, Franz Kafka, Wassily Kandinsky, Jean-Paul Sartre, Virginia Woolf, Wolfgang Iser, Jacques Derrida, and Pierre Macherey. To me, silence is not…

  11. Biomechanical Analysis of Normal Brain Development during the First Year of Life Using Finite Strain Theory

    OpenAIRE

    Kim, Jeong Chul; Wang, Li; Shen, Dinggang; Lin, Weili

    2016-01-01

    The first year of life is the most critical time period for structural and functional development of the human brain. Combining longitudinal MR imaging and finite strain theory, this study aimed to provide new insights into normal brain development through a biomechanical framework. Thirty-three normal infants were longitudinally imaged using MRI from 2 weeks to 1 year of age. Voxel-wise Jacobian determinant was estimated to elucidate volumetric changes while Lagrange strains (both normal and...

  12. Eloquent silences: A musical and lexical analysis of conversation between oncologists and their patients.

    Science.gov (United States)

    Bartels, Josef; Rodenbach, Rachel; Ciesinski, Katherine; Gramling, Robert; Fiscella, Kevin; Epstein, Ronald

    2016-10-01

    Silences in doctor-patient communication can be "connectional" and communicative, in contrast to silences that indicate awkwardness or distraction. Musical and lexical analyses can identify and characterize connectional silences in consultations between oncologists and patients. Two medical students and a professor of voice screened all 1211 silences over 2s in length from 124 oncology office visits. We developed a "strength of connection" taxonomy and examined ten connectional silences for lexical and musical features including pitch, volume, and speaker turn-taking rhythm. We identified connectional silences with good reliability. Typical dialog rhythms surrounding connectional silences are characterized by relatively equal turn lengths and frequent short vocalizations. We found no pattern of volume and pitch variability around these silences. Connectional silences occurred in a wide variety of lexical contexts. Particular patterns of dialog rhythm mark connectional silences. Exploring structures of connectional silence extends our understanding of the audio-linguistic conditions that mark patient-clinician connection. Communicating with an awareness of pitch, rhythm, and silence - in addition to lexical content - can facilitate shared understanding and emotional connection. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  13. Gap-Junctional communication between developing Drosophila muscles is essential for their normal development.

    Science.gov (United States)

    Todman, M G; Baines, R A; Stebbings, L A; Davies, J A; Bacon, J P

    1999-01-01

    Recent experiments have demonstrated that a family of proteins, known as the innexins, are structural components of invertebrate gap junctions. The shaking-B (shak-B) locus of Drosophila encodes two members of this emerging family, Shak-B(lethal) and Shak-B(neural). This study focuses on the role of Shak-B gap junctions in the development of embryonic and larval muscle. During embryogenesis, shak-B transcripts are expressed in a subset of the somatic muscles; expression is strong in ventral oblique muscles (VO4-6) but only weak in ventral longitudinals (VL3 and 4). Carboxyfluorescein injected into VO4 of wild-type early stage 16 embryos spreads, via gap junctions, to label adjacent muscles, including VL3 and 4. In shak-B2 embryos (in which the shak-B(neural) function is disrupted), dye injected into VO4 fails to spread into other muscles. In the first instar larva, when dye coupling between muscles is no longer present, another effect of the shak-B2 mutation is revealed by whole-cell voltage clamp. In a calcium-free saline, only two voltage-activated potassium currents are present in wild-type muscles; a fast IA and a slow IK current. In shak-B2 larvae, these two currents are significantly reduced in magnitude in VO4 and 5, but remain normal in VL3. Expression of shak-B(neural) in a shak-B2 background fully rescues both dye coupling in embryonic muscle and whole-cell currents in first instar VO4 and 5. Our observations show that Shak-B(neural) is one of a set of embryonic gap-junction proteins, and that it is required for the normal temporal development of potassium currents in some larval muscles.

  14. Judicial review of administrative silence

    Directory of Open Access Journals (Sweden)

    Radošević Ratko S.

    2015-01-01

    Full Text Available Administrative silence is a situation in which the competent authority, within the statutory deadline, has not issued an administrative act at the request of the party. In the case of administrative silence, given the fact that the citizens are unable to protect their rights and legal interests without an administrative act, they are provided with legal protection. In this case, the same legal relationship is created, directly on the basis of the statute, as in the situation in which the party's request is rejected. This means that the party may, under the conditions prescribed by the statute, initiate the procedure of judicial review of administrative silence. In the paper, the author explains the conditions under which the judicial review of administrative silence can be initiated and the role of the court in this judicial procedure.

  15. Computerized tomography and head growth curve infantile macrocephaly with normal psychomotor development

    International Nuclear Information System (INIS)

    Eda, Isematsu; Kitahara, Tadashi; Takashima, Sachio; Takeshita, Kenzo

    1982-01-01

    Macrocephaly was defined as a head measuring larger than 98th percentile. We have evaluated CT findings and head growth curves in 25 infants with large heads. Ten (40%) of 25 infants with large heads were normal developmentally and neurologically. Five (20%) of those were mentally retarded. The other 10 infants (40%) included hydrocephalus (4 cases), malformation syndrome (3 cases), brain tumor (1 case), metabolic disorder (1 case) and degenerative disorder (1 case). Their head growth curves were typed as (I), (II) and (III): Type (I) (excessive head growth curve to 2 SDs above normal); Type (II) (head growth curve gradually approached to 2 SDs above normal); Type (III) (head growth curve parallel to 2 SDs above normal). Ten of macrocephaly with normal psychomotor development were studied clinically and radiologically in details. They were all male. CT pictures of those showed normal or various abnormal findings: ventricular dilatations, wide frontal and temporal subdural spaces, wide interhemispheric fissures, wide cerebral sulci, and large sylvian fissures. CT findings in 2 of those, which because normal after repeated CT examinations, resembled benign subdural collection. CT findings in one of those were external hydrocephalus. Head growth curves were obtained from 8 of those. Six cases revealed type (II) and two cases did type (III). The remaining 2 cases could not be followed up. We consider that CT findings of infants showed macrocephaly with normal psychomotor development reveals normal or various abnormal (ventricular dilatations, benign subdural collection, external hydrocephalus) and their head growth curves are not at least excessive. Infants with mental retardation showed similar CT findings and head growth curves as those with normal psychomotor development. It was difficult to distinguish normal from mentally retarded infants by either CT findings or head growth curves. (author)

  16. Silence, an Eye of Knowledge

    Directory of Open Access Journals (Sweden)

    Mehdi Aghamohammadi

    2017-04-01

    Full Text Available One of the conspicuous features of the twentieth-century West was silence. This idea could be supported by examining reflections of Ludwig Wittgenstein, Fritz Mauthner, John Cage, Samuel Beckett, Ihab Hassan, Franz Kafka, Wassily Kandinsky, Jean-Paul Sartre, Virginia Woolf, Wolfgang Iser, Jacques Derrida, and Pierre Macherey. To me, silence is not a mere theory, but rather a phenomenon from which we can get practical benefits. I believe silence is an eye, eye of knowledge. We can broaden our knowledge of the world through silence. To convey the idea that silence is an eye, I have concocted the word slence, where  has replaced the letter i and stands for the eye. This means knowledge can enable us to see, thereby acquiring knowledge of, what used to be invisible, and accordingly unknowable. In other words, through silence, we can achieve a certain type of literacy. I substantiate this claim by exploring the Horus myth, Ojo de Dios, John Cage’s 4' 33", the nature of Expressionist paintings, Hinduism, thoughts of Hermes Trismegistus and Ibn al-Arabi, and practices of Mohammad, the prophet of Islam.

  17. Breaking Classroom Silences: A View from Linguistic Ethnography

    Science.gov (United States)

    Rampton, Ben; Charalambous, Constadina

    2016-01-01

    This paper addresses potentially problematic classroom episodes in which someone foregrounds a social division that is normally taken for granted. It illustrates the way in which linguistic ethnography can unpack the layered processes that collide in the breaking of silence, showing how linguistic form and practice, individual positioning, local…

  18. FXR silencing in human colon cancer by DNA methylation and KRAS signaling.

    Science.gov (United States)

    Bailey, Ann M; Zhan, Le; Maru, Dipen; Shureiqi, Imad; Pickering, Curtis R; Kiriakova, Galina; Izzo, Julie; He, Nan; Wei, Caimiao; Baladandayuthapani, Veerabhadran; Liang, Han; Kopetz, Scott; Powis, Garth; Guo, Grace L

    2014-01-01

    Farnesoid X receptor (FXR) is a bile acid nuclear receptor described through mouse knockout studies as a tumor suppressor for the development of colon adenocarcinomas. This study investigates the regulation of FXR in the development of human colon cancer. We used immunohistochemistry of FXR in normal tissue (n = 238), polyps (n = 32), and adenocarcinomas, staged I-IV (n = 43, 39, 68, and 9), of the colon; RT-quantitative PCR, reverse-phase protein array, and Western blot analysis in 15 colon cancer cell lines; NR1H4 promoter methylation and mRNA expression in colon cancer samples from The Cancer Genome Atlas; DNA methyltransferase inhibition; methyl-DNA immunoprecipitation (MeDIP); bisulfite sequencing; and V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) knockdown assessment to investigate FXR regulation in colon cancer development. Immunohistochemistry and quantitative RT-PCR revealed that expression and function of FXR was reduced in precancerous lesions and silenced in a majority of stage I-IV tumors. FXR expression negatively correlated with phosphatidylinositol-4, 5-bisphosphate 3 kinase signaling and the epithelial-to-mesenchymal transition. The NR1H4 promoter is methylated in ~12% colon cancer The Cancer Genome Atlas samples, and methylation patterns segregate with tumor subtypes. Inhibition of DNA methylation and KRAS silencing both increased FXR expression. FXR expression is decreased early in human colon cancer progression, and both DNA methylation and KRAS signaling may be contributing factors to FXR silencing. FXR potentially suppresses epithelial-to-mesenchymal transition and other oncogenic signaling cascades, and restoration of FXR activity, by blocking silencing mechanisms or increasing residual FXR activity, represents promising therapeutic options for the treatment of colon cancer.

  19. Polycystic ovarian morphology in normal women does not predict the development of polycystic ovary syndrome.

    Science.gov (United States)

    Murphy, M K; Hall, J E; Adams, J M; Lee, H; Welt, C K

    2006-10-01

    Polycystic ovarian morphology (PCOM) is present in 25% of normal women in the absence of polycystic ovary syndrome (PCOS); however, the natural history of PCOM is unknown. We hypothesized that the presence of PCOM predisposes the development of PCOS. The study was a longitudinal follow-up study over 8.2 +/- 5.2 yr (mean +/- sd; range 1.7-17.5 yr). The study took place in an outpatient setting. Women who took part in a previous study as a normal control and had an ultrasound examination (n = 40) participated. Subjects underwent an interval menstrual history, physical exam, blood sampling, and repeat ultrasound in the follicular phase. Development of PCOS was diagnosed by irregular menses and hyperandrogenism, in the absence of other disorders. Changes in ovarian morphology over time were evaluated. At the baseline visit, 23 women (57.5%) had PCOM and 17 (42.5%) had normal ovarian morphology. One subject with PCOM developed irregular menses and presumptive PCOS. Eleven subjects with PCOM no longer met the criteria for PCOM at follow-up. There was no factor that predicted the change to normal ovarian morphology at the follow-up visit. These data suggest that PCOM in women with regular ovulatory cycles does not commonly predispose the development of PCOS. Although it is unusual to develop PCOM if the ovaries are normal on first assessment, ovaries in women with PCOM no longer meet the criteria for PCOM in approximately half of cases over time.

  20. The organisational silence of midwives and nurses: reasons and results.

    Science.gov (United States)

    Yurdakul, Mine; Beşen, Meltem Aydin; Erdoğan, Semra

    2016-07-01

    The study was conducted to determine the issues about which nurses and midwives remain silent and the reasons for it and the perceived results of silence. Organisational silence is a vitally important issue in the health sector, due to the risks and mistakes that are not reported, and proposals for improvement that are not made. The sample of this descriptive survey, which investigated a cause and effect relationship, was 159 nurses and midwives. The data were collected using a questionnaire and the organisational silence scale. Of the study participants, 84.9% were nurses and 15.1% were midwives. Of all participants 88.7% were women. 8.8% of participants stated that they never remained silent about issues related to work and the workplace. Respondents most often remained silent about issues related to ethics and responsibility. 'Limited improvement and development' was frequently mentioned as a perceived result of organisational silence. Our study determined that organisational silence is quite common among nurses and midwives. Activities that raise the awareness of hospital administrations and employees about preventing the factors that cause and maintain silence in hospitals should be planned. © 2016 John Wiley & Sons Ltd.

  1. Postnatal development of the hippocampal dentate gyrus under normal and experimental conditions

    International Nuclear Information System (INIS)

    Altman, J.; Bayer, S.

    Studies on postnatal maturation of the dentate gyrus are reviewed. Some topics discussed are: normal development of the dentate gyrus, cytogenesis, morphogenesis, synaptogenesis, gleogenesis, myelogenesis, development of the gyrus under experimental conditions, and effects of x radiation on cytogenesis and morphogenesis

  2. Transcriptional Silencing of Retroviral Vectors

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M.; Pedersen, F.S.

    1996-01-01

    . Extinction of long-term vector expression has been observed after implantation of transduced hematopoietic cells as well as fibroblasts, myoblasts and hepatocytes. Here we review the influence of vector structure, integration site and cell type on transcriptional silencing. While down-regulation of proviral...... transcription is known from a number of cellular and animal models, major insight has been gained from studies in the germ line and embryonal cells of the mouse. Key elements for the transfer and expression of retroviral vectors, such as the viral transcriptional enhancer and the binding site for the t......RNA primer for reverse transcription may have a major influence on transcriptional silencing. Alterations of these elements of the vector backbone as well as the use of internal promoter elements from housekeeping genes may contribute to reduce transcriptional silencing. The use of cell culture and animal...

  3. Working memory in Farsi-speaking children with normal development and cochlear implant.

    Science.gov (United States)

    Soleymani, Zahra; Amidfar, Meysam; Dadgar, Hooshang; Jalaie, Shohre

    2014-04-01

    Working memory has an important role in language acquisition and development of cognition skills. The ability of encoding, storage and retrieval of phonological codes, as activities of working memory, acquired by audition sense. Children with cochlear implant experience a period that they are not able to perceive sounds. In order to assess the effect of hearing on working memory, we investigated working memory as a cognition skill in children with normal development and cochlear implant. Fifty students with normal hearing and 50 students with cochlear implant aged 5-7 years participated in this study. Children educated in the preschool, the first and second grades. Children with normal development were matched based on age, gender, and grade of education with cochlear implant. Two components of working memory including phonological loop and central executive were compared between two groups. Phonological loop assessed by nonword repetition task and forward digit span. To assess central executive component backward digit span was used. The developmental trend was studied in children with normal development and cochlear implant as well. The effect of age at implantation in children with cochlear implants on components of working memory was investigated. There are significant differences between children with normal development and cochlear implant in all tasks that assess working memory (p memory between different grades showed significant differences both in children with normal development and in children with cochlear implant (p implied that children with cochlear implant may experience difficulties in working memory. Therefore, these children have problems in encoding, practicing, and repeating phonological units. The results also suggested working memory develops when the child grows up. In cochlear implant children, with decreasing age at implantation and increasing their experience in perceiving sound, working memory skills improved. Copyright © 2014 Elsevier

  4. Development of in-situ rock shear test under low compressive to tensile normal stress

    International Nuclear Information System (INIS)

    Nozaki, Takashi; Shin, Koichi

    2003-01-01

    The purpose of this study is to develop an in-situ rock shear testing method to evaluate the shear strength under low normal stress condition including tensile stress, which is usually ignored in the assessment of safety factor of the foundations for nuclear power plants against sliding. The results are as follows. (1) A new in-situ rock shear testing method is devised, in which tensile normal stress can be applied on the shear plane of a specimen by directly pulling up a steel box bonded to the specimen. By applying the counter shear load to cancel the moment induced by the main shear load, it can obtain shear strength under low normal stress. (2) Some model tests on Oya tuff and diatomaceous mudstone have been performed using the developed test method. The shear strength changed smoothly from low values at tensile normal stresses to higher values at compressive normal stresses. The failure criterion has been found to be bi-linear on the shear stress vs normal stress plane. (author)

  5. Silencing of HaAce1 gene by host-delivered artificial microRNA disrupts growth and development of Helicoverpa armigera.

    Science.gov (United States)

    Saini, Ravi Prakash; Raman, Venkat; Dhandapani, Gurusamy; Malhotra, Era Vaidya; Sreevathsa, Rohini; Kumar, Polumetla Ananda; Sharma, Tilak R; Pattanayak, Debasis

    2018-01-01

    The polyphagous insect-pest, Helicoverpa armigera, is a serious threat to a number of economically important crops. Chemical application and/or cultivation of Bt transgenic crops are the two strategies available now for insect-pest management. However, environmental pollution and long-term sustainability are major concerns against these two options. RNAi is now considered as a promising technology to complement Bt to tackle insect-pests menace. In this study, we report host-delivered silencing of HaAce1 gene, encoding the predominant isoform of H. armigera acetylcholinesterase, by an artificial microRNA, HaAce1-amiR1. Arabidopsis pre-miRNA164b was modified by replacing miR164b/miR164b* sequences with HaAce1-amiR1/HaAce1-amiR1* sequences. The recombinant HaAce1-preamiRNA1 was put under the control of CaMV 35S promoter and NOS terminator of plant binary vector pBI121, and the resultant vector cassette was used for tobacco transformation. Two transgenic tobacco lines expressing HaAce1-amiR1 was used for detached leaf insect feeding bioassays. Larval mortality of 25% and adult deformity of 20% were observed in transgenic treated insect group over that control tobacco treated insect group. The reduction in the steady-state level of HaAce1 mRNA was 70-80% in the defective adults compared to control. Our results demonstrate promise for host-delivered amiRNA-mediated silencing of HaAce1 gene for H. armigera management.

  6. Overweight and obese infants present lower cognitive and motor development scores than normal-weight peers.

    Science.gov (United States)

    Camargos, Ana Cristina Resende; Mendonça, Vanessa Amaral; Andrade, Camila Alves de; Oliveira, Katherine Simone Caires; Lacerda, Ana Cristina Rodrigues

    2016-12-01

    Compare the cognitive and motor development in overweight/obese infants versus normal-weight peers and investigate the correlation of body weight, body length and body mass index with cognitive and motor development. We conducted a cross-sectional study with 28 overweight/obese infants and 28 normal-weight peers between 6 and 24 months of age. Both groups were evaluated with cognitive and motor scales of the Bayley-III infant development test. The t-test for independent samples was performed to compare the groups, and the Spearman correlation was used to verify the association between variables. Overweight/obese infants showed lower cognitive and motor composite scores than their normal-weight peers. A significant negative association was found of body weight and body length with cognitive development and of body mass index with motor development. This is the first study that found an effect on both cognitive and motor development in overweight/obese infants when compared with normal-weight peers between 6 and 24 months of age. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Abdominal aortic aneurysm development in men following a "normal" aortic ultrasound scan.

    Science.gov (United States)

    Hafez, H; Druce, P S; Ashton, H A

    2008-11-01

    To determine predictors related to abdominal aortic aneurysm (AAA) development following a "normal" aortic ultrasound scan. Over a 23-year period, 22 961 men participated in an AAA screening programme. Maximum aortic diameter of less than 30 mm was deemed "normal". 4308 of these "normal" individuals were later re-scanned at intervals for research purposes. AAA prevalence was 4.4% at initial scanning. In those with a normal scan, 46 patients subsequently presented with AAAs incidentally detected and 120 (2.8%) had AAAs identified as part of the ongoing surveillance. The median initial aortic size of these 166 men was 25 mm (range 15-29 mm). Over the follow-up period, there have been 24 (14%) AAA-related deaths, 24 patients underwent successful AAA surgery and 36 died of unrelated causes. In those with an initial aortic diameter of <25 mm who later developed an AAA, the odds ratio for AAA-related mortality was 2 (95% CI 1-4.1, p=0.03, x(2)). AAAs can develop following an initial "normal" scan and men with an aortic diameters of 25-29 mm appear to be at greater risk. Surveillance for this sub-group may further reduce the incidence of undiagnosed AAA and AAA-related mortality.

  8. Communicative Silences: Forms and Functions

    Science.gov (United States)

    Bruneau, Thomas J.

    1973-01-01

    The nature of silence is discussed as an imposition of mind, as an interdependent signification ground for speech signs, as a relationship to mental time (as opposed to artificial time), and as it relates to sensation, perception and metaphorical movement. (Author)

  9. Breaching cultural silence: enhancing resilience among Ugandan ...

    African Journals Online (AJOL)

    Cultural silence is frequently the outcome of deep-seated taboos regarding adults talking to children about sex and death. This paper examines the impact of cultural silence on the resilience of children orphaned by AIDS in Uganda. Cultural silence is often linked with denial. This article explores the complexities of cultural ...

  10. Understanding Emotions from Standardized Facial Expressions in Autism and Normal Development

    Science.gov (United States)

    Castelli, Fulvia

    2005-01-01

    The study investigated the recognition of standardized facial expressions of emotion (anger, fear, disgust, happiness, sadness, surprise) at a perceptual level (experiment 1) and at a semantic level (experiments 2 and 3) in children with autism (N= 20) and normally developing children (N= 20). Results revealed that children with autism were as…

  11. The Dens: Normal Development, Developmental Variants and Anomalies, and Traumatic Injuries

    Directory of Open Access Journals (Sweden)

    William T O′Brien

    2015-01-01

    Full Text Available Accurate interpretation of cervical spine imagining can be challenging, especially in children and the elderly. The biomechanics of the developing pediatric spine and age-related degenerative changes predispose these patient populations to injuries centered at the craniocervical junction. In addition, congenital anomalies are common in this region, especially those associated with the axis/dens, due to its complexity in terms of development compared to other vertebral levels. The most common congenital variations of the dens include the os odontoideum and a persistent ossiculum terminale. At times, it is necessary to distinguish normal development, developmental variants, and developmental anomalies from traumatic injuries in the setting of acute traumatic injury. Key imaging features are useful to differentiate between traumatic fractures and normal or variant anatomy acutely; however, the radiologist must first have a basic understanding of the spectrum of normal developmental anatomy and its anatomic variations in order to make an accurate assessment. This review article attempts to provide the basic framework required for accurate interpretation of cervical spine imaging with a focus on the dens, specifically covering the normal development and ossification of the dens, common congenital variants and their various imaging appearances, fracture classifications, imaging appearances, and treatment options.

  12. Attainment of gross motor milestones by preterm children with normal development upon school entry

    NARCIS (Netherlands)

    van Dokkum, Nienke H; de Kroon, Marlou L A; Bos, Arend F; Reijneveld, Sijmen A; Kerstjens, Jorien M

    BACKGROUND: Little is known on the motor development of moderately preterm born (MPT) children, in comparison with early preterm born (EPT) children and fullterm born (FT), for children with normal motor outcomes at school entry. AIMS: To compare attainment rates of gross motor milestones reached

  13. Role of CD56 in Normal Kidney Development and Wilms Tumorigenesis

    DEFF Research Database (Denmark)

    Yap, Li-Wei; Brok, Jesper; Pritchard-Jones, Kathy

    2017-01-01

    The cell-surface glycoprotein CD56 has three major isoforms that play important roles in cell adhesion and signaling, which may promote cell proliferation, differentiation, survival, or migration. It is an important molecule in normal kidney development and acts as a key marker in Wilms tumor stem...

  14. Estrogen and progesterone signalling in the normal breast and its implications for cancer development.

    Science.gov (United States)

    Hilton, Heidi N; Clarke, Christine L; Graham, J Dinny

    2018-05-05

    The ovarian hormones estrogen and progesterone are master regulators of the development and function of a broad spectrum of human tissues, including the breast, reproductive and cardiovascular systems, brain and bone. Acting through the nuclear estrogen (ER) and progesterone receptors (PR), both play complex and essential coordinated roles in the extensive development of the lobular alveolar epithelial structures of the normal breast during puberty, the normal menstrual cycle and pregnancy. The past decade has seen major advances in understanding the mechanisms of action of estrogen and progesterone in the normal breast and in the delineation of the complex hierarchy of cell types regulated by ovarian hormones in this tissue. There is evidence for a role for both ER and PR in driving breast cancer, and both are favourable prognostic markers with respect to outcome. In this review, we summarize current knowledge of the mechanisms of action of ER and PR in the normal breast, and implications for the development and management of breast cancer. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Microstructure, length, and connection of limbic tracts in normal human brain development

    Directory of Open Access Journals (Sweden)

    Qiaowen eYu

    2014-08-01

    Full Text Available The cingulum and fornix play an important role in memory, attention, spatial orientation and feeling functions. Both microstructure and length of these limbic tracts can be affected by mental disorders such as Alzheimer’s disease, depression, autism, anxiety, and schizophrenia. To date, there has been little systematic characterization of their microstructure, length and functional connectivity in normally developing brains. In this study, diffusion tensor imaging (DTI and resting state functional MRI (rs-fMRI data from 65 normally developing right-handed subjects from birth to young adulthood was acquired. After cingulate gyrus part of the cingulum (cgc, hippocampal part of the cingulum (cgh and fornix (fx were traced with DTI tractography, absolute and normalized tract lengths and DTI-derived metrics including fractional anisotropy, mean, axial and radial diffusivity were measured for traced limbic tracts. Free water elimination (FWE algorithm was adopted to improve accuracy of the measurements of DTI-derived metrics. The role of these limbic tracts in the functional network at birth and adulthood was explored. We found a logarithmic age-dependent trajectory for FWE-corrected DTI metric changes with fast increase of microstructural integrity from birth to 2-year-old followed by a slow increase to 25-year-old. Normalized tract length of cgc increases with age, while no significant relationship with age was found for normalized tract lengths of cgh and fx. Stronger microstructural integrity on the left side compared to that of right side was found. With integrated DTI and rs-fMRI, the key connectional role of cgc and cgh in the default mode network (DMN was confirmed as early as birth. Systematic characterization of length and DTI metrics after FWE correction of limbic tracts offers insight into their morphological and microstructural developmental trajectories. These trajectories may serve as a normal reference for pediatric patients with

  16. DISTURBANCE OF NORMAL MOTOR DEVELOPMENT IN THE FIRST YEAR OF LIFE

    Directory of Open Access Journals (Sweden)

    Lidija Dimitrijević

    2005-07-01

    Full Text Available The adoption of the basic motor skills in the first year of life (postural head control, lateral transfers into a lying position, sitting, standing, walking, crawling, grasping... goes on quite spontaneously. A child learns all the motor actions by itself and that is why it is not necessary to “teach” a child to seat, grasp, stand, walk... Teaching a child the basic motor skills stands for a rough, unnecessary and undesirable involvement into spontaneous motor development, and, due to this, the normal adoption of motor skills is slowed down. For the normal motor development, children do not need helping devices (baby buggy, baby jump.... Helping devices suppress in children their natural urge to walk, complicate its development and may have harmful effects like equinus feet, deformed feet and spine and so on.

  17. Trajectories of cortical surface area and cortical volume maturation in normal brain development

    Directory of Open Access Journals (Sweden)

    Simon Ducharme

    2015-12-01

    Full Text Available This is a report of developmental trajectories of cortical surface area and cortical volume in the NIH MRI Study of Normal Brain Development. The quality-controlled sample included 384 individual typically-developing subjects with repeated scanning (1–3 per subject, total scans n=753 from 4.9 to 22.3 years of age. The best-fit model (cubic, quadratic, or first-order linear was identified at each vertex using mixed-effects models, with statistical correction for multiple comparisons using random field theory. Analyses were performed with and without controlling for total brain volume. These data are provided for reference and comparison with other databases. Further discussion and interpretation on cortical developmental trajectories can be found in the associated Ducharme et al.׳s article “Trajectories of cortical thickness maturation in normal brain development – the importance of quality control procedures” (Ducharme et al., 2015 [1].

  18. Increased RNA-induced silencing complex (RISC) activity contributes to hepatocellular carcinoma.

    Science.gov (United States)

    Yoo, Byoung Kwon; Santhekadur, Prasanna K; Gredler, Rachel; Chen, Dong; Emdad, Luni; Bhutia, Sujit; Pannell, Lewis; Fisher, Paul B; Sarkar, Devanand

    2011-05-01

    There is virtually no effective treatment for advanced hepatocellular carcinoma (HCC) and novel targets need to be identified to develop effective treatment. We recently documented that the oncogene Astrocyte elevated gene-1 (AEG-1) plays a seminal role in hepatocarcinogenesis. Employing yeast two-hybrid assay and coimmunoprecipitation followed by mass spectrometry, we identified staphylococcal nuclease domain containing 1 (SND1), a nuclease in the RNA-induced silencing complex (RISC) facilitating RNAi-mediated gene silencing, as an AEG-1 interacting protein. Coimmunoprecipitation and colocalization studies confirmed that AEG-1 is also a component of RISC and both AEG-1 and SND1 are required for optimum RISC activity facilitating small interfering RNA (siRNA) and micro RNA (miRNA)-mediated silencing of luciferase reporter gene. In 109 human HCC samples SND1 was overexpressed in ≈74% cases compared to normal liver. Correspondingly, significantly higher RISC activity was observed in human HCC cells compared to immortal normal hepatocytes. Increased RISC activity, conferred by AEG-1 or SND1, resulted in increased degradation of tumor suppressor messenger RNAs (mRNAs) that are target of oncomiRs. Inhibition of enzymatic activity of SND1 significantly inhibited proliferation of human HCC cells. As a corollary, stable overexpression of SND1 augmented and siRNA-mediated inhibition of SND1 abrogated growth of human HCC cells in vitro and in vivo, thus revealing a potential role of SND1 in hepatocarcinogenesis. We unravel a novel mechanism that overexpression of AEG-1 and SND1 leading to increased RISC activity might contribute to hepatocarcinogenesis. Targeted inhibition of SND1 enzymatic activity might be developed as an effective therapy for HCC. Copyright © 2011 American Association for the Study of Liver Diseases.

  19. Effects of tracheal occlusion with retinoic acid administration on normal lung development.

    Science.gov (United States)

    Delabaere, Amélie; Marceau, Geoffroy; Coste, Karen; Blanchon, Loïc; Déchelotte, Pierre-Jean; Blanc, Pierre; Sapin, Vincent; Gallot, Denis

    2017-05-01

    Tracheal occlusion (TO) is an investigational therapy for severe congenital diaphragmatic hernia that decreases pulmonary hypoplasia, but sustained TO also induces deficient surfactant synthesis. Intramuscular maternal administration of retinoic acid (RA) in a surgical rabbit model of congenital diaphragmatic hernia showed a beneficial effect on lung maturation. We evaluated the potential of RA delivery into the trachea and studied the combined effects of TO and RA on normal lung development. Experiments were performed on normal rabbit fetuses. Liposomes and capric triglyceride (Miglyol ® ), alone and with RA, were administered in the trachea just before TO (d26). Lung morphology and surfactant production were studied at term (d30). Tracheal occlusion increased lung weight and enhanced alveolar development but increased apoptotic activity and decreased surfactant expression. Tracheal injection of RA improved surfactant production to levels of normal controls. We established the potential of liposome and Miglyol as RA vehicle for delivering this bioactive molecule in the fetal airways. Tracheal RA injection seems to oppose the effects of TO in fetuses with normal lungs. © 2017 John Wiley & Sons, Ltd. © 2017 John Wiley & Sons, Ltd.

  20. Biomechanical Analysis of Normal Brain Development during the First Year of Life Using Finite Strain Theory.

    Science.gov (United States)

    Kim, Jeong Chul; Wang, Li; Shen, Dinggang; Lin, Weili

    2016-12-02

    The first year of life is the most critical time period for structural and functional development of the human brain. Combining longitudinal MR imaging and finite strain theory, this study aimed to provide new insights into normal brain development through a biomechanical framework. Thirty-three normal infants were longitudinally imaged using MRI from 2 weeks to 1 year of age. Voxel-wise Jacobian determinant was estimated to elucidate volumetric changes while Lagrange strains (both normal and shear strains) were measured to reveal directional growth information every 3 months during the first year of life. Directional normal strain maps revealed that, during the first 6 months, the growth pattern of gray matter is anisotropic and spatially inhomogeneous with higher left-right stretch around the temporal lobe and interhemispheric fissure, anterior-posterior stretch in the frontal and occipital lobes, and superior-inferior stretch in right inferior occipital and right inferior temporal gyri. In contrast, anterior lateral ventricles and insula showed an isotropic stretch pattern. Volumetric and directional growth rates were linearly decreased with age for most of the cortical regions. Our results revealed anisotropic and inhomogeneous brain growth patterns of the human brain during the first year of life using longitudinal MRI and a biomechanical framework.

  1. Silence in Intercultural Collaboration

    NARCIS (Netherlands)

    Verouden, Nick W.; Sanden, Van der Maarten C.A.; Aarts, Noelle

    2018-01-01

    China is widely recognized as a significant scientific partner for Western universities. Given that many Western universities are now operating in the Chinese context, this study investigates the everyday conversations in which international partnerships are collaboratively developed and

  2. Research and analysis of contradictions and strategies of Hainan tourism development under the new normal background

    Directory of Open Access Journals (Sweden)

    Xie Xiangxiang

    2016-01-01

    Full Text Available At present, China’s economic and social development has entered into a new normal state, the construction of Hainan international tourism island also has entered into the middle and late period. Hainan tourism has made brilliant achievements, but the development contradictions have become increasingly serious. Based on the analysis of the current situation and realistic problems of Hainan tourism, this paper points out five principal problems of Hainan tourism development--industrial status, supply-demand relationship, cultural preservation, subject-object relationship and government-business relationship, and it also proposes strategic suggestions on the great tourism, large interconnection, great culture, big Hainan and big special zone.

  3. Polycomb complexes and silencing mechanisms

    DEFF Research Database (Denmark)

    Lund, Anders H; van Lohuizen, Maarten

    2004-01-01

    Advances in the past couple of years have brought important new knowledge on the mechanisms by which Polycomb-group proteins regulate gene expression and on the consequences of their actions. The discovery of histone methylation imprints specific for Polycomb and Trithorax complexes has provided...... mechanistic insight on how this ancient epigenetic memory system acts to repress and indicates that it may share mechanistic aspects with other silencing and genome-protective processes, such as RNA interference....

  4. Normal development and growth of the human neurocranium and cranial base.

    Science.gov (United States)

    Friede, H

    1981-01-01

    The literature on normal development and growth of certain areas of the human head is reviewed, starting with the early induction of the desmal neurocranium. the development of the brain capsule with its dural reinforcement bands and their connection with the basicranium is discussed, as is the primordial chondrocranium, including its bone replacement. Growth of the calvaria and the three cranial fossae is also analysed. Special interest is focused on the anterior fossa, as knowledge of the growth in this area is very important for an understanding of pathogenesis and possibilities of treating premature craniosynostosis. Finally it is stressed that close observation of the effects of treatment on this pathology may increase our knowledge of normal growth.

  5. The dentate nucleus in children: normal development and patterns of disease

    Energy Technology Data Exchange (ETDEWEB)

    McErlean, Aoife; Abdalla, Khaled; Donoghue, Veronica; Ryan, Stephanie [Children' s University Hospital, Radiology Department, Dublin (Ireland)

    2010-03-15

    The dentate nuclei lie deep within the cerebellum and play a vital role in the pathways involved in fine motor control and coordination. They are susceptible to a variety of diseases. Some pathological processes preferentially affect the dentate nuclei, while concomitant basal ganglia or white matter involvement can be a striking finding in others. A familiarity with the normal appearance of the dentate nuclei at different ages in combination with the radiological distribution of pathology in the brain allows the paediatric radiologist to develop a logical approach to the interpretation of MR imaging of these deep cerebellar nuclei. In this article we review the normal appearance and MR features of the dentate nuclei, including changes that are seen with myelination. We describe the specific imaging characteristics of childhood diseases that involve the dentate nuclei, and develop a systematic approach to the differential diagnosis of dentate nucleus abnormalities on MR imaging. (orig.)

  6. The dentate nucleus in children: normal development and patterns of disease

    International Nuclear Information System (INIS)

    McErlean, Aoife; Abdalla, Khaled; Donoghue, Veronica; Ryan, Stephanie

    2010-01-01

    The dentate nuclei lie deep within the cerebellum and play a vital role in the pathways involved in fine motor control and coordination. They are susceptible to a variety of diseases. Some pathological processes preferentially affect the dentate nuclei, while concomitant basal ganglia or white matter involvement can be a striking finding in others. A familiarity with the normal appearance of the dentate nuclei at different ages in combination with the radiological distribution of pathology in the brain allows the paediatric radiologist to develop a logical approach to the interpretation of MR imaging of these deep cerebellar nuclei. In this article we review the normal appearance and MR features of the dentate nuclei, including changes that are seen with myelination. We describe the specific imaging characteristics of childhood diseases that involve the dentate nuclei, and develop a systematic approach to the differential diagnosis of dentate nucleus abnormalities on MR imaging. (orig.)

  7. Normal Brain-Skull Development with Hybrid Deformable VR Models Simulation.

    Science.gov (United States)

    Jin, Jing; De Ribaupierre, Sandrine; Eagleson, Roy

    2016-01-01

    This paper describes a simulation framework for a clinical application involving skull-brain co-development in infants, leading to a platform for craniosynostosis modeling. Craniosynostosis occurs when one or more sutures are fused early in life, resulting in an abnormal skull shape. Surgery is required to reopen the suture and reduce intracranial pressure, but is difficult without any predictive model to assist surgical planning. We aim to study normal brain-skull growth by computer simulation, which requires a head model and appropriate mathematical methods for brain and skull growth respectively. On the basis of our previous model, we further specified suture model into fibrous and cartilaginous sutures and develop algorithm for skull extension. We evaluate the resulting simulation by comparison with datasets of cases and normal growth.

  8. Normal and abnormal fetal brain development during the third trimester as demonstrated by neurosonography

    International Nuclear Information System (INIS)

    Malinger, G.; Lev, D.; Lerman-Sagie, T.

    2006-01-01

    The multiplanar neurosonographic examination of the fetus enables superb visualization of brain anatomy during pregnancy. The examination may be performed using a transvaginal or a transfundal approach and it is indicated in patients at high risk for CNS anomalies or in those with a suspicious finding during a routine examination. The purpose of this paper is to present a description of the normal brain and of abnormal findings usually diagnosed late in pregnancy, including malformations of cortical development, infratentorial anomalies, and prenatal insults

  9. Immunohistochemical analysis of Sonic hedgehog signalling in normal human urinary tract development

    OpenAIRE

    Jenkins, Dagan; Winyard, Paul J D; Woolf, Adrian S.

    2007-01-01

    Studies of mouse mutants have demonstrated that Sonic hedgehog (SHH) signalling has a functional role in morphogenesis and differentiation at multiple sites within the forming urinary tract, and urinary tract malformations have been reported in humans with mutations that disrupt SHH signalling. However, there is only strikingly sparse and fragmentary information about the expression of SHH and associated signalling genes in normal human urinary tract development. We used immunohistochemistry ...

  10. China's natural gas exploration and development strategies under the new normal

    Directory of Open Access Journals (Sweden)

    Jialiang Lu

    2015-12-01

    Full Text Available China's natural gas industry has experienced a great leap-forward development in the past decade. Since the second half of 2014, however, international oil price has dropped sharply and global oil and gas markets have been sluggish. In China, economy growth rate slows down and resource environments tend to be more restricted. And energy production and consumption revolution speed up, and the development of natural gas industry experience profound changes internally and externally. Through review on the achievements in recent high-speed development and analysis on the future development of China's natural gas industry, it is believed that the growth rates of China's natural gas output and consumption will slow down and the supply and demand fundamentals present loose states. Low-permeability tight, deep–extra deep and unconventional reservoirs will be the principal targets of natural gas exploration and development and the tendency of resource deterioration is inevitable. The pressure to the decrease of gas price rises due to the sustained recession of oil price and the sharp decrease of alternative energy price. The normal means to increase benefits is to control investment strictly and reduce cost greatly. As for the new normal, five suggestions are proposed for natural gas exploration and development in China. Firstly, reinforce exploration continuously by guaranteeing work load and investment at the required level, and tamp the development basis. Secondly, pay much attention to early development evaluation, give prominence to plan implementation design and control productivity construction rhythm. Thirdly, pay attention to the top-level design of mature gas field development and adjustment, with fine description and management as the priority, and improve overall development level. Fourthly, strengthen the researches on exploration and development technologies, with the simplification and practicability of technologies as the focus, and

  11. Decreasing erucic acid level by RNAi-mediated silencing of fatty ...

    African Journals Online (AJOL)

    To develop low level of erucic acid in rapeseeds by intron-spliced hairpin RNA, an inverted repeat unit of a partial BnFAE1.1 gene interrupted by a spliceable intron ... In conclusion, the expression of endogenous BnFAE1.1 was efficiently silenced by the designed RNAi silencer, causing a significant down-regulation in the ...

  12. Development of a theory of implementation and integration: Normalization Process Theory

    Directory of Open Access Journals (Sweden)

    May Carl R

    2009-05-01

    Full Text Available Abstract Background Theories are important tools in the social and natural sciences. The methods by which they are derived are rarely described and discussed. Normalization Process Theory explains how new technologies, ways of acting, and ways of working become routinely embedded in everyday practice, and has applications in the study of implementation processes. This paper describes the process by which it was built. Methods Between 1998 and 2008, we developed a theory. We derived a set of empirical generalizations from analysis of data collected in qualitative studies of healthcare work and organization. We developed an applied theoretical model through analysis of empirical generalizations. Finally, we built a formal theory through a process of extension and implication analysis of the applied theoretical model. Results Each phase of theory development showed that the constructs of the theory did not conflict with each other, had explanatory power, and possessed sufficient robustness for formal testing. As the theory developed, its scope expanded from a set of observed regularities in data with procedural explanations, to an applied theoretical model, to a formal middle-range theory. Conclusion Normalization Process Theory has been developed through procedures that were properly sceptical and critical, and which were opened to review at each stage of development. The theory has been shown to merit formal testing.

  13. Is our knowledge of voice and silence in organizations growing?

    DEFF Research Database (Denmark)

    Knoll, Michael; Wegge, Jürgen; Unterrainer, Christine

    2016-01-01

    This article has three objectives. Firstly, we seek to demonstrate the relevance of voice and silence – that is, whether employees contribute or withhold information, ideas, views and/or concerns at work – for the sustainable development of individuals, organizations and societies. Our second...... objective is to identify emerging (and enduring) issues – conceptual, theoretical and methodological – that have not yet been adequately addressed in voice and silence research. These issues include the relationship between voice and silence, how they may manifest in organizations, their manifold...... antecedents inside and beyond organizational boundaries, their potentially positive and negative effects for internal and external stakeholders, and methodological questions. The third objective is to propose opportunities for addressing these issues with the ultimate aim to build a broader and more...

  14. C4.4A gene ablation is compatible with normal epidermal development and causes modest overt phenotypes

    DEFF Research Database (Denmark)

    Kriegbaum, Mette Camilla; Jacobsen, Benedikte; Füchtbauer, Annette

    2016-01-01

    of C4.4A in normal physiology and cancer progression. The unchallenged C4.4A-deficient mice were viable, fertile, born in a normal Mendelian distribution and, surprisingly, displayed normal development of squamous epithelia. The C4.4A-deficient mice were, nonetheless, significantly lighter than...

  15. Persian competing word test: Development and preliminary results in normal children

    Directory of Open Access Journals (Sweden)

    Mohammad Ebrahim Mahdavi

    2008-12-01

    Full Text Available Background and Aim: Assessment of central auditory processing skills needs various behavioral tests in format of a test battery. There is a few Persian speech tests for documenting central auditory processing disorders. The purpose of this study was developing a dichotic test formed of one-syllabic words suitable for evaluation of central auditory processing in Persian language children and reporting its preliminary results in a group of normal children.Materials and Methods: Persian words in competing manner test was developed utilizing most frequent monosyllabic words in children storybooks reported in the previous researches. The test was performed at MCL on forty-five normal children (39 right-handed and 6 left-handed aged 5-11 years. The children did not show any obvious problem in hearing, speech, language and learning. Free (n=28 and directed listening (n=17 tasks were investigated.Results: The results show that in directed listening task, there is significant advantage for performance of pre-cued ear relative to opposite side. Right ear advantage is evident in free recall condition. Average performance of the children in directed recall is significantly better than free recall. Average row score of the test increases with the children age.Conclusion: Persian words in competing manner test as a dichotic test, can show major characteristics of dichotic listening and effect of maturation of central auditory system on it in normal children.

  16. Normal and abnormal development of the kidney: a clinician's interpretation of current knowledge.

    Science.gov (United States)

    Glassberg, Kenneth I

    2002-06-01

    The recent basic science literature is replete with new discoveries in the molecular genetics of renal development. However, little of this information has filtered into urological textbooks and journals. An effort is made herein to integrate these new findings and propose a more sophisticated blueprint of renal development than the one traditionally taught in medical school and residency. To accomplish this goal the author offers simple definitions and interpretations of complicated terms and events, and points out how maldevelopment results when mutations take place. A review of recent advances in the molecular genetics of renal development and maldevelopment was done. Renal metanephric development results from the expression of many genes in the ureteral bud and metanephric blastema with each sending messages to the other to induce organogenesis. Currently an understanding of normal renal organogenesis stems from a study of disease states resulting from perturbations in molecular genetics. In turn, a better understanding of normal renal organogenesis facilitates an understanding of how dysplasia, hypoplasia, cystic disease and tumors develop when molecular genetics go awry. For each form of renal dysgenesis and for most renal tumors 1 or more gene defects are eventually identified. The young urologist based in these new discoveries would be better prepared to make the breakthroughs in the future that are necessary for advancing the prevention and management of these conditions.

  17. [Quantitative analysis method based on fractal theory for medical imaging of normal brain development in infants].

    Science.gov (United States)

    Li, Heheng; Luo, Liangping; Huang, Li

    2011-02-01

    The present paper is aimed to study the fractal spectrum of the cerebral computerized tomography in 158 normal infants of different age groups, based on the calculation of chaotic theory. The distribution range of neonatal period was 1.88-1.90 (mean = 1.8913 +/- 0.0064); It reached a stable condition at the level of 1.89-1.90 during 1-12 months old (mean = 1.8927 +/- 0.0045); The normal range of 1-2 years old infants was 1.86-1.90 (mean = 1.8863 +/- 4 0.0085); It kept the invariance of the quantitative value among 1.88-1.91(mean = 1.8958 +/- 0.0083) during 2-3 years of age. ANOVA indicated there's no significant difference between boys and girls (F = 0.243, P > 0.05), but the difference of age groups was significant (F = 8.947, P development.

  18. Hemoglobin is essential for normal growth of Arabidopsis organs

    DEFF Research Database (Denmark)

    Hebelstrup, Kim Henrik; Hunt, Peter; Dennis, Elizabeth

    2006-01-01

    In Arabidopsis thaliana, the class I hemoglobin AHb1 is transiently expressed in the hydathodes of leaves and in floral buds from young inflorescences. Nitric oxide (NO) accumulates to high levels in these organs when AHb1 is silenced, indicating an important role in metabolizing NO. AHb1-silence...... suggests that 3-on-3 hemoglobins apart from a role in hypoxic stress play a general role under non-stressed conditions where they are essential for normal development by controlling the level of NO which tends to accumulate in floral buds and leaf hydathodes of plants......In Arabidopsis thaliana, the class I hemoglobin AHb1 is transiently expressed in the hydathodes of leaves and in floral buds from young inflorescences. Nitric oxide (NO) accumulates to high levels in these organs when AHb1 is silenced, indicating an important role in metabolizing NO. AHb1-silenced...... lines are viable but show a mutant phenotype affecting the regions where AHb1 is expressed. Arabidopsis lines with an insertional knockout or overexpression of AHb2, a class II 3-on-3 hemoglobin, were generated. Seedlings overexpressing AHb2 show enhanced survival of hypoxic stress. The AHb2 knockout...

  19. SAD-3, a Putative Helicase Required for Meiotic Silencing by Unpaired DNA, Interacts with Other Components of the Silencing Machinery

    Science.gov (United States)

    Hammond, Thomas M.; Xiao, Hua; Boone, Erin C.; Perdue, Tony D.; Pukkila, Patricia J.; Shiu, Patrick K. T.

    2011-01-01

    In Neurospora crassa, genes lacking a pairing partner during meiosis are suppressed by a process known as meiotic silencing by unpaired DNA (MSUD). To identify novel MSUD components, we have developed a high-throughput reverse-genetic screen for use with the N. crassa knockout library. Here we describe the screening method and the characterization of a gene (sad-3) subsequently discovered. SAD-3 is a putative helicase required for MSUD and sexual spore production. It exists in a complex with other known MSUD proteins in the perinuclear region, a center for meiotic silencing activity. Orthologs of SAD-3 include Schizosaccharomyces pombe Hrr1, a helicase required for RNAi-induced heterochromatin formation. Both SAD-3 and Hrr1 interact with an RNA-directed RNA polymerase and an Argonaute, suggesting that certain aspects of silencing complex formation may be conserved between the two fungal species. PMID:22384347

  20. Development of advanced automatic operation system for nuclear ship. 1. Perfect automatic normal operation

    International Nuclear Information System (INIS)

    Nakazawa, Toshio; Yabuuti, Noriaki; Takahashi, Hiroki; Shimazaki, Junya

    1999-02-01

    Development of operation support system such as automatic operating system and anomaly diagnosis systems of nuclear reactor is very important in practical nuclear ship because of a limited number of operators and severe conditions in which receiving support from others in a case of accident is very difficult. The goal of development of the operation support systems is to realize the perfect automatic control system in a series of normal operation from the reactor start-up to the shutdown. The automatic control system for the normal operation has been developed based on operating experiences of the first Japanese nuclear ship 'Mutsu'. Automation technique was verified by 'Mutsu' plant data at manual operation. Fully automatic control of start-up and shutdown operations was achieved by setting the desired value of operation and the limiting value of parameter fluctuation, and by making the operation program of the principal equipment such as the main coolant pump and the heaters. This report presents the automatic operation system developed for the start-up and the shutdown of reactor and the verification of the system using the Nuclear Ship Engineering Simulator System. (author)

  1. mTOR signaling and its roles in normal and abnormal brain development.

    Directory of Open Access Journals (Sweden)

    Nobuyuki eTakei

    2014-04-01

    Full Text Available Target of rapamycin (TOR was first identified in yeast as a target molecule of rapamycin, an anti-fugal and immunosuppressant macrolide compound. In mammals, its orthologue is called mTOR (mammalian TOR. mTOR is a serine/threonine kinase that converges different extracellular stimuli, such as nutrients and growth factors, and diverges into several biochemical reactions, including translation, autophagy, transcription, and lipid synthesis among others. These biochemical reactions govern cell growth and cause cells to attain an anabolic state. Thus, the disruption of mTOR signaling is implicated in a wide array of diseases such as cancer, diabetes, and obesity. In the central nervous system (CNS, the mTOR signaling cascade is activated by nutrients, neurotrophic factors, and neurotransmitters that enhances protein (and possibly lipid synthesis and suppresses autophagy. These processes contribute to normal neuronal growth by promoting their differentiation, neurite elongation and branching, and synaptic formation during development. Therefore, disruption of mTOR signaling may cause neuronal degeneration and abnormal neural development. While reduced mTOR signaling is associated with neurodegeneration, excess activation of mTOR signaling causes abnormal development of neurons and glia, leading to brain malformation. In this review, we first introduce the current state of molecular knowledge of mTOR complexes and signaling in general. We then describe mTOR activation in neurons, which leads to translational enhancement, and finally discuss the link between mTOR and normal/abnormal neuronal growth during development.

  2. Stromal androgen receptor roles in the development of normal prostate, benign prostate hyperplasia, and prostate cancer.

    Science.gov (United States)

    Wen, Simeng; Chang, Hong-Chiang; Tian, Jing; Shang, Zhiqun; Niu, Yuanjie; Chang, Chawnshang

    2015-02-01

    The prostate is an androgen-sensitive organ that needs proper androgen/androgen receptor (AR) signals for normal development. The progression of prostate diseases, including benign prostate hyperplasia (BPH) and prostate cancer (PCa), also needs proper androgen/AR signals. Tissue recombination studies report that stromal, but not epithelial, AR plays more critical roles via the mesenchymal-epithelial interactions to influence the early process of prostate development. However, in BPH and PCa, much more attention has been focused on epithelial AR roles. However, accumulating evidence indicates that stromal AR is also irreplaceable and plays critical roles in prostate disease progression. Herein, we summarize the roles of stromal AR in the development of normal prostate, BPH, and PCa, with evidence from the recent results of in vitro cell line studies, tissue recombination experiments, and AR knockout animal models. Current evidence suggests that stromal AR may play positive roles to promote BPH and PCa progression, and targeting stromal AR selectively with AR degradation enhancer, ASC-J9, may allow development of better therapies with fewer adverse effects to battle BPH and PCa. Copyright © 2015 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  3. Psychological and emotional development, intellectual capabilities, and body image in short normal children.

    Science.gov (United States)

    Molinari, E; Sartori, A; Ceccarelli, A; Marchi, S

    2002-04-01

    It is well established that children with short stature frequently have problems in cognitive development, personality, self-esteem and social relations. This is partly due to the fact that many parents view them as more vulnerable than other children of normal stature and do not allow them to face the normal experiences that correspond to their actual age. The aim of the present study was to assess, through the administration of appropriate psychological tools, a series of psychological and cognitive characteristics [i.e. anxiety, depression, good adjustment, social functioning, feeling of guilt, interpersonal relationship, intelligence quotient (IQ)], as well as variables linked to development of body image, in a group of children suffering from normal growth variants [familial short stature (FSS), no. 10, 4 males/6 females; with constitutional growth delay (CGD), no. 4,4 males; height standard deviation score (HSDS) ranging between -2.4 and -1.9] and in a control group children of normal stature (HSDS between -0.1 and +0.1). Children with short stature significantly differed from normal statured controls as far as Colored Progressive Matrices (CPMs, centiles), IQ (IQ, obtained using the Goodenough test), "Good Adjustment" (Draw-a-Person index, DAP), "Feelings of Guilt" (DAP index), "Height" (as emerges from drawings of the body) are concerned. Significant relationships were found between the height of the subjects (in centiles) and cognitive skills, measured both using CPMs (r=0.408; p=0.017) and Draw-a-Man (DAM) (r=0.359; p=0.037) and between height and feelings of guilt (r=0.325; p=0.027), measured using DAP. CPM scores correlated positively with the "Good Adjustment" index of DAP (r=0.354; p=0.05) and negatively with Children's Depression Inventory (CDI) (r=-0.609; p=0.01), "School Anxiety" index (r=-0.427; p=0.05) and "Total Anxiety" index (r=-0.436; p=0.05) of the Anxiety Scale Questionnaire for the Age of Development, and with 2 indices of DAP, namely

  4. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    2016-11-09

    Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

  5. [E. M. Jellinek's silenced and silencing transgenerational story].

    Science.gov (United States)

    Kelemen, Gábor; Márk, Mónika

    2013-01-01

    Jellinek is a kind of archetypal character for future generations in the field of addiction studies. His implosion in the arena of alcoholism around the age of 50 was an unexpected challenge to medical science. We know very little about his own role models giving an intellectual and moral compass to his pragmatic creativity. More than 30 years has passed since Jellinek's death when an American sociologist Ron Roizen started unearthing his silent story. Roizen discerned that there are a lot of unsaid and muted issues in his personal Hungarian past. Our paper, based on the authors' research in Hungarian archives and other sources reveals that not just Jellinek's personal but his transgenerational narrative has been not-yet-said. This silenced and silencing history appears an unfinished business of acculturation of the family, which started prior to four generations. Authors have been concluding that the issue of religious conversion is a critical point in the process of acculturation. They examine the counter move of loyalty to family values and driving force of assimilation making their story unspeakable.

  6. Effective silencing of ENaC by siRNA delivered with epithelial-targeted nanocomplexes in human cystic fibrosis cells and in mouse lung.

    Science.gov (United States)

    Tagalakis, Aristides D; Munye, Mustafa M; Ivanova, Rositsa; Chen, Hanpeng; Smith, Claire M; Aldossary, Ahmad M; Rosa, Luca Z; Moulding, Dale; Barnes, Josephine L; Kafetzis, Konstantinos N; Jones, Stuart A; Baines, Deborah L; Moss, Guy W J; O'Callaghan, Christopher; McAnulty, Robin J; Hart, Stephen L

    2018-05-10

    Loss of the cystic fibrosis transmembrane conductance regulator in cystic fibrosis (CF) leads to hyperabsorption of sodium and fluid from the airway due to upregulation of the epithelial sodium channel (ENaC). Thickened mucus and depleted airway surface liquid (ASL) then lead to impaired mucociliary clearance. ENaC regulation is thus a promising target for CF therapy. Our aim was to develop siRNA nanocomplexes that mediate effective silencing of airway epithelial ENaC in vitro and in vivo with functional correction of epithelial ion and fluid transport. We investigated translocation of nanocomplexes through mucus and their transfection efficiency in primary CF epithelial cells grown at air-liquid interface (ALI).Short interfering RNA (SiRNA)-mediated silencing was examined by quantitative RT-PCR and western analysis of ENaC. Transepithelial potential (V t ), short circuit current (I sc ), ASL depth and ciliary beat frequency (CBF) were measured for functional analysis. Inflammation was analysed by histological analysis of normal mouse lung tissue sections. Nanocomplexes translocated more rapidly than siRNA alone through mucus. Transfections of primary CF epithelial cells with nanocomplexes targeting αENaC siRNA, reduced αENaC and βENaC mRNA by 30%. Transfections reduced V t , the amiloride-sensitive I sc and mucus protein concentration while increasing ASL depth and CBF to normal levels. A single dose of siRNA in mouse lung silenced ENaC by approximately 30%, which persisted for at least 7 days. Three doses of siRNA increased silencing to approximately 50%. Nanoparticle-mediated delivery of ENaCsiRNA to ALI cultures corrected aspects of the mucociliary defect in human CF cells and offers effective delivery and silencing in vivo. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  7. Kinematic differentiation of prosodic categories in normal and disordered language development.

    Science.gov (United States)

    Goffman, Lisa

    2004-10-01

    Prosody is complex and hierarchically organized but is realized as rhythmic movement sequences. Thus, observations of the development of rhythmic aspects of movement can provide insight into links between motor and language processes, specifically whether prosodic distinctions (e.g., feet and prosodic words) are instantiated in rhythmic movement output. This experiment examined 4-7-year-old children's (both normally developing and specifically language impaired) and adults' productions of prosodic sequences that were controlled for phonetic content but differed in morphosyntactic structure (i.e., content vs. function words). Primary analyses included kinematic measures of rhythmic structure (i.e., amplitude and duration of movements in weak vs. strong syllables) across content and function contexts. Findings showed that at the level of articulatory movement, adults produced distinct rhythmic categories across content and function word contexts, whereas children did not. Children with specific language impairment differed from normally developing peers only in their ability to produce well-organized and stable rhythmic movements, not in the differentiation of prosodic categories.

  8. Development of dose assessment code for release of tritium during normal operation of nuclear power plants

    International Nuclear Information System (INIS)

    Duran, J.; Malatova, I.

    2009-01-01

    A computer code PTM H TO has been developed to assess tritium doses to the general public. The code enables to simulate the behavior of tritium in the environment released into the atmosphere under normal operation of nuclear power plants. Code can calculate the doses for the three chemical and physical forms: tritium gas (HT), tritiated water vapor and water drops (HTO). The models in this code consist of the tritium transfer model including oxidation of HT to HTO and reemission of HTO from soil to the atmosphere, and the dose calculation model

  9. Bio-electrosprayed multicellular zebrafish embryos are viable and develop normally

    International Nuclear Information System (INIS)

    Clarke, Jonathan D W; Jayasinghe, Suwan N

    2008-01-01

    Bio-electrosprays are rapidly emerging as a viable protocol for directly engineering living cells. This communication reports the bio-electrospraying of multicellular organisms, namely zebrafish embryos. The results demonstrate that the bio-electrospray protocol fails to induce any embryological perturbations. In addition to analysing overall embryo morphology, we use transgenic embryos that express green fluorescent protein in specific brain neurons to determine that neuronal numbers and organization are completely normal. These results demonstrate that the bio-electrospraying protocol does not interfere with the complex gene regulation and cell movements required for the development of a multicellular organism. (communication)

  10. Identification of Optimal Reference Genes for Normalization of qPCR Analysis during Pepper Fruit Development

    Directory of Open Access Journals (Sweden)

    Yuan Cheng

    2017-06-01

    Full Text Available Due to its high sensitivity and reproducibility, quantitative real-time PCR (qPCR is practiced as a useful research tool for targeted gene expression analysis. For qPCR operations, the normalization with suitable reference genes (RGs is a crucial step that eventually determines the reliability of the obtained results. Although pepper is considered an ideal model plant for the study of non-climacteric fruit development, at present no specific RG have been developed or validated for the qPCR analyses of pepper fruit. Therefore, this study aimed to identify stably expressed genes for their potential use as RGs in pepper fruit studies. Initially, a total of 35 putative RGs were selected by mining the pepper transcriptome data sets derived from the PGP (Pepper Genome Platform and PGD (Pepper Genome Database. Their expression stabilities were further measured in a set of pepper (Capsicum annuum L. var. 007e fruit samples, which represented four different fruit developmental stages (IM: Immature; MG: Mature green; B: Break; MR: Mature red using the qPCR analysis. Then, based on the qPCR results, three different statistical algorithms, namely geNorm, Normfinder, and boxplot, were chosen to evaluate the expression stabilities of these putative RGs. It should be noted that nine genes were proven to be qualified as RGs during pepper fruit development, namely CaREV05 (CA00g79660; CaREV08 (CA06g02180; CaREV09 (CA06g05650; CaREV16 (Capana12g002666; CaREV21 (Capana10g001439; CaREV23 (Capana05g000680; CaREV26 (Capana01g002973; CaREV27 (Capana11g000123; CaREV31 (Capana04g002411; and CaREV33 (Capana08g001826. Further analysis based on geNorm suggested that the application of the two most stably expressed genes (CaREV05 and CaREV08 would provide optimal transcript normalization in the qPCR experiments. Therefore, a new and comprehensive strategy for the identification of optimal RGs was developed. This strategy allowed for the effective normalization of the q

  11. Sox6 directly silences epsilon globin expression in definitive erythropoiesis.

    Directory of Open Access Journals (Sweden)

    2006-02-01

    Full Text Available Sox6 is a member of the Sox transcription factor family that is defined by the conserved high mobility group (HMG DNA binding domain, first described in the testis determining gene, Sry. Previous studies have suggested that Sox6 plays a role in the development of the central nervous system, cartilage, and muscle. In the Sox6-deficient mouse, p100H, epsilony globin is persistently expressed, and increased numbers of nucleated red cells are present in the fetal circulation. Transfection assays in GM979 (erythroleukemic cells define a 36-base pair region of the epsilony proximal promoter that is critical for Sox6 mediated repression. Electrophoretic mobility shift assay (EMSA and chromatin immunoprecipitation (ChIP assays demonstrate that Sox6 acts as a repressor by directly binding to the epsilony promoter. The normal expression of Sox6 in wild-type fetal liver and the ectopic expression of epsilony in p100H homozygous fetal liver demonstrate that Sox6 functions in definitive erythropoiesis. The present study shows that Sox6 is required for silencing of epsilony globin in definitive erythropoiesis and suggests a role for Sox6 in erythroid cell maturation. Thus, Sox6 regulation of epsilony globin might provide a novel therapeutical target in the treatment of hemoglobinopathies such as sickle cell anemia and thalassemia.

  12. [14C]sucrose uptake and labeling of starch in developing grains of normal segl barley

    International Nuclear Information System (INIS)

    Felker, F.C.; Peterson, D.M.; Nelson, O.E.

    1984-01-01

    Previous work showed that the segl mutant of barley (Hordeum vulgare o Betzes) did not differ from normal Betzes in plant growth, photosynthesis, or fertility, but it produced only shrunken seeds regardless of pollen source. To determine whether defects in sucrose uptake or starch synthesis resulted in the shrunken condition, developing grains of Betzes and segl were cultured in [ 14 C]sucrose solutions after slicing transversely to expose the endosperm cavity and free space. In both young grains (before genotypes differed in dry weight) and older grains (17 days after anthesis, when segl grains were smaller than Betzes), sucrose uptake and starch synthesis were similar in both genotypes on a dry weight basis. To determine if sucrose was hydrolyzed during uptake, spikes of Betzes and segl were allowed to take up [fructose-U- 14 C]sucrose 14 days after anthesis and the radioactivity of endosperm sugars was examined during 3 hours of incubation. Whereas less total radioactivity entered the endosperm and the endosperm cavity (free space) of segl, in both genotypes over 96% of the label of endosperm sugars was in sucrose, and there was no apparent initial or progressive randomization of label among hexose moieties of sucrose as compared to the free space sampled after 1 hour of incubation. The authors conclude that segl endosperms are capable of normal sucrose uptake and starch synthesis and that hydrolysis of sucrose is not required for uptake in either genotype. Evidence suggests abnormal development of grain tissue of maternal origin during growth of segl grains

  13. Three families with mild PMM2-CDG and normal cognitive development.

    Science.gov (United States)

    Vals, Mari-Anne; Morava, Eva; Teeäär, Kai; Zordania, Riina; Pajusalu, Sander; Lefeber, Dirk J; Õunap, Katrin

    2017-06-01

    Congenital disorders of glycosylation (CDG) are caused by defective glycosylation of proteins and lipids. PMM2-CDG is the most common subtype among the CDG. The severity of PMM2-CDG is variable. Patients often have a recognizable phenotype with neurological and multisystem symptoms that might cause early death. We report six patients from three families who are diagnosed with a clinically mild PMM2-CDG and have normal cognitive development. All these patients had delayed gross motor skills with mild-to-moderate neurological findings. Cerebellar hypoplasia was detected in all siblings for whom brain MRI was performed. In 5/6 children the Wechsler Intelligence Scale for Children (WISC) showed normal cognitive development with full scale IQ scores ranging from borderline to average. Four patients were diagnosed with PMM2-CDG at the age of 8 years or later as their neurological symptoms were quite mild and they had been able to participate in regular school programs. We report patients with p.Val231Met/p.Arg239Trp and p.Ile120Thr/p.Gly228Cys genotypes which may cause milder variants of PMM2-CDG. © 2017 Wiley Periodicals, Inc.

  14. Tospovirus : induction and suppression of RNA silencing

    NARCIS (Netherlands)

    Hedil, Marcio

    2016-01-01

    While infecting their hosts, viruses must deal with host immunity. In plants the antiviral RNA silencing pathway is an important part of plant innate immunity. Tospoviruses are segmented negative-stranded RNA viruses of plants. To counteract the antiviral RNA silencing response in plants,

  15. Listen and the question of silence

    DEFF Research Database (Denmark)

    Doubinsky, Sebastien

    2018-01-01

    Listen is a film about words, but around words. The words become useless and are surrounded by silence. And the whole film is constructed on this silence, which builds up like an unbreakable wall. The question is thus: what are we listening to? What should we listen to? And maybe, even more crucial...

  16. RNA interference: ready to silence cancer?

    Science.gov (United States)

    Mocellin, Simone; Costa, Rodolfo; Nitti, Donato

    2006-01-01

    RNA interference (RNAi) is considered the most promising functional genomics tool recently developed. As in other medical fields, this biotechnology might revolutionize the approach to dissecting the biology of cancer, ultimately speeding up the discovery pace of novel targets suitable for molecularly tailored antitumor therapies. In addition, preclinical results suggest that RNAi itself might be used as a therapeutic weapon. With the aim of illustrating not only the potentials but also the current limitations of RNAi as a tool in the fight against cancer, here we summarize the physiology of RNAi, discuss the main technical issues of RNAi-based gene silencing, and review some of the most interesting preclinical results obtained so far with its implementation in the field of oncology.

  17. E-cadherin promotes incorporation of mouse epiblast stem cells into normal development.

    Directory of Open Access Journals (Sweden)

    Satoshi Ohtsuka

    Full Text Available Mouse epiblast stem cells (mEpiSCs are pluripotent stem cells derived from epiblasts of postimplantation mouse embryos. Their pluripotency is distinct from that of mouse embryonic stem cells (mESCs in several cell biological criteria. One of the distinctions is that mEpiSCs contribute either not at all or at much lower efficiency to chimeric embryos after blastocyst injection compared to mESCs. However, here we showed that mEpiSCs can be incorporated into normal development after blastocyst injection by forced expression of the E-cadherin transgene for 2 days in culture. Using this strategy, mEpiSCs gave rise to live-born chimeras from 5% of the manipulated blastocysts. There were no obvious signs of reprogramming of mEpiSCs toward the mESC-like state during the 2 days after induction of the E-cadherin transgene, suggesting that mEpiSCs possess latent ability to integrate into the normal developmental process as its origin, epiblasts.

  18. Evaluation of Appropriate Reference Genes for Gene Expression Normalization during Watermelon Fruit Development.

    Directory of Open Access Journals (Sweden)

    Qiusheng Kong

    Full Text Available Gene expression analysis in watermelon (Citrullus lanatus fruit has drawn considerable attention with the availability of genome sequences to understand the regulatory mechanism of fruit development and to improve its quality. Real-time quantitative reverse-transcription PCR (qRT-PCR is a routine technique for gene expression analysis. However, appropriate reference genes for transcript normalization in watermelon fruits have not been well characterized. The aim of this study was to evaluate the appropriateness of 12 genes for their potential use as reference genes in watermelon fruits. Expression variations of these genes were measured in 48 samples obtained from 12 successive developmental stages of parthenocarpic and fertilized fruits of two watermelon genotypes by using qRT-PCR analysis. Considering the effects of genotype, fruit setting method, and developmental stage, geNorm determined clathrin adaptor complex subunit (ClCAC, β-actin (ClACT, and alpha tubulin 5 (ClTUA5 as the multiple reference genes in watermelon fruit. Furthermore, ClCAC alone or together with SAND family protein (ClSAND was ranked as the single or two best reference genes by NormFinder. By using the top-ranked reference genes to normalize the transcript abundance of phytoene synthase (ClPSY1, a good correlation between lycopene accumulation and ClPSY1 expression pattern was observed in ripening watermelon fruit. These validated reference genes will facilitate the accurate measurement of gene expression in the studies on watermelon fruit biology.

  19. Evaluation of Appropriate Reference Genes for Gene Expression Normalization during Watermelon Fruit Development.

    Science.gov (United States)

    Kong, Qiusheng; Yuan, Jingxian; Gao, Lingyun; Zhao, Liqiang; Cheng, Fei; Huang, Yuan; Bie, Zhilong

    2015-01-01

    Gene expression analysis in watermelon (Citrullus lanatus) fruit has drawn considerable attention with the availability of genome sequences to understand the regulatory mechanism of fruit development and to improve its quality. Real-time quantitative reverse-transcription PCR (qRT-PCR) is a routine technique for gene expression analysis. However, appropriate reference genes for transcript normalization in watermelon fruits have not been well characterized. The aim of this study was to evaluate the appropriateness of 12 genes for their potential use as reference genes in watermelon fruits. Expression variations of these genes were measured in 48 samples obtained from 12 successive developmental stages of parthenocarpic and fertilized fruits of two watermelon genotypes by using qRT-PCR analysis. Considering the effects of genotype, fruit setting method, and developmental stage, geNorm determined clathrin adaptor complex subunit (ClCAC), β-actin (ClACT), and alpha tubulin 5 (ClTUA5) as the multiple reference genes in watermelon fruit. Furthermore, ClCAC alone or together with SAND family protein (ClSAND) was ranked as the single or two best reference genes by NormFinder. By using the top-ranked reference genes to normalize the transcript abundance of phytoene synthase (ClPSY1), a good correlation between lycopene accumulation and ClPSY1 expression pattern was observed in ripening watermelon fruit. These validated reference genes will facilitate the accurate measurement of gene expression in the studies on watermelon fruit biology.

  20. Atlas of Bone Scintigraphy in the Developing Paediatric Skeleton: The Normal Skeleton, Variants and Pitfalls

    International Nuclear Information System (INIS)

    2011-01-01

    countries. It became obvious that only physicians who were experienced in paediatric nuclear medicine could immediately recognize the appearance of a 'normal' bone scan. Maintaining high quality bone images is an important issue that needs constant attention at various operational levels of the nuclear medicine department. The above consideration provided the stimulus leading the Paediatric Task Group of the EANM in 1992 to compile and publish the first edition of the Atlas of Bone Scintigraphy in the Developing Paediatric Skeleton as one of its collaborative projects. More than 17 years later, the need for an updated edition of this reference publication is more relevant than ever

  1. Maternal Silences: Motherhood and Voluntary Childlessness in Contemporary Christianity

    Directory of Open Access Journals (Sweden)

    Dawn Llewellyn

    2016-06-01

    Full Text Available In Christianity, there is an ideology of motherhood that pervades scripture, ritual, and doctrine, yet there is an academic silence that means relatively little space has been given to motherhood and mothering, and even less to voluntary childlessness, from a faith perspective. By drawing on qualitative in-depth interviews with Christian women living in Britain, narrating their experiences of motherhood and voluntary childlessness, I suggest there are also lived maternal silences encountered by women in contemporary Christianity. There is a maternal expectation produced through church teaching, liturgy and culture that constructs women as ‘maternal bodies’ (Gatrell 2008; this silences and marginalises women from articulating their complex relationship with religion, motherhood, and childlessness in ways that challenge their spiritual development. However, this article also introduces the everyday and intentional tactics women employ to disrupt the maternal expectation, and hereby interrupt the maternal silence.

  2. Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

    National Research Council Canada - National Science Library

    Issa, Jean-Pierre

    2004-01-01

    ...). In this project, we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases, and that reversal of silencing by decitabine...

  3. Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

    National Research Council Canada - National Science Library

    Issa, Jean-Pierre

    2005-01-01

    ...). In this project, we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases, and that reversal of silencing by decitabine...

  4. Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

    National Research Council Canada - National Science Library

    Issa, Jean-Pierre

    2006-01-01

    ...). In this project we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases and that reversal of silencing by decitabine...

  5. RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops.

    Science.gov (United States)

    Guo, Qigao; Liu, Qing; Smith, Neil A; Liang, Guolu; Wang, Ming-Bo

    2016-12-01

    Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing artificial RNA silencing technologies such as hairpin RNA, artificial microRNA, intrinsic direct repeat, 3' UTR inverted repeat, artificial trans-acting siRNA, and virus-induced gene silencing technologies. Some of these RNA silencing technologies, such as the hairpin RNA technology, have already been widely used for genetic improvement of crop plants in agriculture. For horticultural plants, RNA silencing technologies have been used to increase disease and pest resistance, alter plant architecture and flowering time, improve commercial traits of fruits and flowers, enhance nutritional values, remove toxic compounds and allergens, and develop high-value industrial products. In this article we aim to provide an overview of the RNA silencing pathways in plants, summarize the existing RNA silencing technologies, and review the current progress in applying these technologies for the improvement of agricultural crops particularly horticultural crops.

  6. Neurotransmitter signaling pathways required for normal development in Xenopus laevis embryos: a pharmacological survey screen.

    Science.gov (United States)

    Sullivan, Kelly G; Levin, Michael

    2016-10-01

    Neurotransmitters are not only involved in brain function but are also important signaling molecules for many diverse cell types. Neurotransmitters are widely conserved, from evolutionarily ancient organisms lacking nervous systems through man. Here, results are reported from a loss- and gain-of-function survey, using pharmacological modulators of several neurotransmitter pathways to examine possible roles for these pathways in normal embryogenesis. Applying reagents targeting the glutamatergic, adrenergic and dopaminergic pathways to embryos of Xenopus laevis from gastrulation to organogenesis stages, we observed and quantified numerous malformations, including craniofacial defects, hyperpigmentation, muscle mispatterning and miscoiling of the gut. These data implicate several key neurotransmitters in new embryonic patterning roles, reveal novel earlier stages for processes involved in eye development, suggest new targets for subsequent molecular-genetic investigation, and highlight the necessity for in-depth toxicology studies of psychoactive compounds to which human embryos might be exposed during pregnancy. © 2016 Anatomical Society.

  7. Fetal magnetic resonance imaging of the brain: technical considerations and normal brain development

    Energy Technology Data Exchange (ETDEWEB)

    Huisman, Thierry A.G.M.; Kubik-Huch, Rahel; Marincek, Borut [Institute of Diagnostic Radiology, University Hospital Zurich, 8091 Zurich (Switzerland); Martin, Ernst [Department of Neuroradiology and Magnetic Resonance, University Children' s Hospital, 8091 Zurich (Switzerland)

    2002-08-01

    Fetal MRI examines non-invasively the unborn fetus. Ultrafast MRI sequences effectively suppress fetal motion. Multiple case reports and studies have shown that fetal MRI is particularly helpful in the evaluation of the central nervous system. The high contrast-to-noise ratio, the high spatial resolution, the multiplanar capabilities, the large field of view and the simultaneous visualisation of fetal and maternal structures have proven to be advantageous. Fetal MRI is particularly helpful in the evaluation of the normal and pathological development of the brain. Despite the fact that no side effects have been reported or are to be expected, the use of MRI during pregnancy is still limited to the second and third trimester of pregnancy. Magnetic resonance imaging contrast media are not to be used as it passes the placenta. Ultrasound remains the primary screening modality for fetal pathology; fetal MRI can serve as an adjunct or second-line imaging modality. (orig.)

  8. Fetal magnetic resonance imaging of the brain: technical considerations and normal brain development

    International Nuclear Information System (INIS)

    Huisman, Thierry A.G.M.; Kubik-Huch, Rahel; Marincek, Borut; Martin, Ernst

    2002-01-01

    Fetal MRI examines non-invasively the unborn fetus. Ultrafast MRI sequences effectively suppress fetal motion. Multiple case reports and studies have shown that fetal MRI is particularly helpful in the evaluation of the central nervous system. The high contrast-to-noise ratio, the high spatial resolution, the multiplanar capabilities, the large field of view and the simultaneous visualisation of fetal and maternal structures have proven to be advantageous. Fetal MRI is particularly helpful in the evaluation of the normal and pathological development of the brain. Despite the fact that no side effects have been reported or are to be expected, the use of MRI during pregnancy is still limited to the second and third trimester of pregnancy. Magnetic resonance imaging contrast media are not to be used as it passes the placenta. Ultrasound remains the primary screening modality for fetal pathology; fetal MRI can serve as an adjunct or second-line imaging modality. (orig.)

  9. Fetal magnetic resonance imaging of the brain: technical considerations and normal brain development.

    Science.gov (United States)

    Huisman, Thierry A G M; Martin, Ernst; Kubik-Huch, Rahel; Marincek, Borut

    2002-08-01

    Fetal MRI examines non-invasively the unborn fetus. Ultrafast MRI sequences effectively suppress fetal motion. Multiple case reports and studies have shown that fetal MRI is particularly helpful in the evaluation of the central nervous system. The high contrast-to-noise ratio, the high spatial resolution, the multiplanar capabilities, the large field of view and the simultaneous visualisation of fetal and maternal structures have proven to be advantageous. Fetal MRI is particularly helpful in the evaluation of the normal and pathological development of the brain. Despite the fact that no side effects have been reported or are to be expected, the use of MRI during pregnancy is still limited to the second and third trimester of pregnancy. Magnetic resonance imaging contrast media are not to be used as it passes the placenta. Ultrasound remains the primary screening modality for fetal pathology; fetal MRI can serve as an adjunct or second-line imaging modality.

  10. Fetal lung development on MRI. Normal course and impairment due to premature rupture of membranes

    International Nuclear Information System (INIS)

    Kasprian, G.; Zentrum fuer Anatomie und Zellbiologie der Medizinischen Universitaet Wien; Brugger, P.C.; Helmer, H.; Langer, M.; Balassy, C.; Prayer, D.

    2006-01-01

    A well-organized interplay between many molecular factors as well as mechanical forces influence fetal lung development. At the end of this complex process a sufficiently sized and structurally mature organ should ensure the postnatal survival of the newborn. Besides prenatal ultrasonography, magnetic resonance imaging (MRI) can now be used to investigate normal and pathological human lung growth in utero. Oligohydramnios, due to premature rupture of membranes (PROM), is an important risk factor for compromised fetal lung growth. In these situations MR volumetry can be used to measure the size of the fetal lung quite accurately. Together with the evaluation of lung signal intensities on T2-weighted sequences, fetuses with pulmonary hypoplasia can be readily detected. (orig.) [de

  11. Effects of attachment and rearing behavior on anxiety in normal developing youth

    DEFF Research Database (Denmark)

    Breinholst, Sonja; Esbjørn, Barbara Hoff; Reinholdt-Dunne, Marie Louise

    2015-01-01

    A few studies have examined the relative contribution of insecure attachment and negative parental rearing behaviors on childhood anxiety, but none have examined if insecure attachment mediates the association between negative parental rearing behavior and anxiety. The present study investigated...... the direct, as well as the indirect, relation between attachment to parents, parental rearing behaviors and anxiety symptoms in a sample of 1134 normal developing children and adolescent. Attachment relation was measured by the Security Scale (SEC), negative parental rearing behavior was measured...... by the Rearing Behavior Questionnaire (RBQ), and anxiety was assessed using the Screen for Anxiety Related Emotional Disorders-Revised (SCARED-R). We found, in accordance with previous research, that insecure attachment, maternal rejection and overprotection, each accounted for a significant proportion...

  12. NORMAL VALUES AND FACTORS AFFECTING FUNCTIONAL REACH TEST IN SAUDI ARABIA SCHOOL CHILDREN WITH TYPICAL DEVELOPMENT

    Directory of Open Access Journals (Sweden)

    Hatem A. Emara

    2015-10-01

    Full Text Available Background: The most critical feature of motor development is the ability to balance the body in sitting or standing. Impaired balance limits a child’s ability to recover from unexpected threats to stability. The functional reach test (FRT defines the maximal distance an individual is able to reach forward beyond arm’s length in a standing position without loss of balance, taking a step, or touching the wall. The Purpose of this study was to establish the normal values for FRT in Saudi Arabia school children with typical development and to study the correlation of anthropometric measures with FRT values. Methods: This cross-sectional study was conducted in Almadinah Almonawarah, Kingdom of Saudi Arabia. A total of 280 children without disabilities aged 6 to 12 years were randomly selected. Functional reach was assessed by having subjects extend their arms to 90 degrees and reach as far forward as they could without taking a step. Reach distance was recorded by noting the beginning and final position of the subject's extended arm parallel to a yard stick attached to the wall. Three successive trials of FRT were performed and the mean of the three trials was calculated. Pearson product moment correlation was used to examine the association of FR to age, and anthropometric measures. Results: Normal mean values of FR ranged from 24.2cm to 33.95cm. Age, height and weight significantly correlate with FRT. Conclusion: The FRT is a feasible test to examine the balance of 6-12 year-old children. FRT may be useful for detecting balance impairment, change in balance performance over time.

  13. Normal variation in early parental sensitivity predicts child structural brain development.

    Science.gov (United States)

    Kok, Rianne; Thijssen, Sandra; Bakermans-Kranenburg, Marian J; Jaddoe, Vincent W V; Verhulst, Frank C; White, Tonya; van IJzendoorn, Marinus H; Tiemeier, Henning

    2015-10-01

    Early caregiving can have an impact on brain structure and function in children. The influence of extreme caregiving experiences has been demonstrated, but studies on the influence of normal variation in parenting quality are scarce. Moreover, no studies to date have included the role of both maternal and paternal sensitivity in child brain maturation. This study examined the prospective relation between mothers' and fathers' sensitive caregiving in early childhood and brain structure later in childhood. Participants were enrolled in a population-based prenatal cohort. For 191 families, maternal and paternal sensitivity was repeatedly observed when the child was between 1 year and 4 years of age. Head circumference was assessed at 6 weeks, and brain structure was assessed using magnetic resonance imaging (MRI) measurements at 8 years of age. Higher levels of parental sensitivity in early childhood were associated with larger total brain volume (adjusted β = 0.15, p = .01) and gray matter volume (adjusted β = 0.16, p = .01) at 8 years, controlling for infant head size. Higher levels of maternal sensitivity in early childhood were associated with a larger gray matter volume (adjusted β = 0.13, p = .04) at 8 years, independent of infant head circumference. Associations with maternal versus paternal sensitivity were not significantly different. Normal variation in caregiving quality is related to markers of more optimal brain development in children. The results illustrate the important role of both mothers and fathers in child brain development. Copyright © 2015 American Academy of Child and Adolescent Psychiatry. Published by Elsevier Inc. All rights reserved.

  14. ALK1 heterozygosity delays development of late normal tissue damage in the irradiated mouse kidney

    International Nuclear Information System (INIS)

    Scharpfenecker, Marion; Floot, Ben; Korlaar, Regina; Russell, Nicola S.; Stewart, Fiona A.

    2011-01-01

    Background and Purpose: Activin receptor-like kinase 1 (ALK1) is a transforming growth factor β (TGF-β) receptor, which is mainly expressed in endothelial cells regulating proliferation and migration in vitro and angiogenesis in vivo. Endothelial cells also express the co-receptor endoglin, which modulates ALK1 effects on endothelial cells. Our previous studies showed that mice with reduced endoglin levels develop less irradiation-induced vascular damage and fibrosis, caused by an impaired inflammatory response. This study was aimed at investigating the role of ALK1 in late radiation toxicity. Material and Methods: Kidneys of ALK +/+ and ALK1 +/- mice were irradiated with 14 Gy. Mice were sacrificed at 10, 20, and 30 weeks after irradiation and gene expression and protein levels were analyzed. Results: Compared to wild type littermates, ALK1 +/- mice developed less inflammation and fibrosis at 20 weeks after irradiation, but displayed an increase in pro-inflammatory and pro-fibrotic gene expression at 30 weeks. In addition, ALK1 +/- mice showed superior vascular integrity at 10 and 20 weeks after irradiation which deteriorated at 30 weeks coinciding with changes in the VEGF pathway. Conclusions: ALK1 +/- mice develop a delayed normal tissue response by modulating the inflammatory response and growth factor expression after irradiation.

  15. The Aspergillus flavus Spermidine Synthase (spds Gene, Is Required for Normal Development, Aflatoxin Production, and Pathogenesis During Infection of Maize Kernels

    Directory of Open Access Journals (Sweden)

    Rajtilak Majumdar

    2018-03-01

    Full Text Available Aspergillus flavus is a soil-borne saprophyte and an opportunistic pathogen of both humans and plants. This fungus not only causes disease in important food and feed crops such as maize, peanut, cottonseed, and tree nuts but also produces the toxic and carcinogenic secondary metabolites (SMs known as aflatoxins. Polyamines (PAs are ubiquitous polycations that influence normal growth, development, and stress responses in living organisms and have been shown to play a significant role in fungal pathogenesis. Biosynthesis of spermidine (Spd is critical for cell growth as it is required for hypusination-mediated activation of eukaryotic translation initiation factor 5A (eIF5A, and other biochemical functions. The tri-amine Spd is synthesized from the diamine putrescine (Put by the enzyme spermidine synthase (Spds. Inactivation of spds resulted in a total loss of growth and sporulation in vitro which could be partially restored by addition of exogenous Spd. Complementation of the Δspds mutant with a wild type (WT A. flavus spds gene restored the WT phenotype. In WT A. flavus, exogenous supply of Spd (in vitro significantly increased the production of sclerotia and SMs. Infection of maize kernels with the Δspds mutant resulted in a significant reduction in fungal growth, sporulation, and aflatoxin production compared to controls. Quantitative PCR of Δspds mutant infected seeds showed down-regulation of aflatoxin biosynthetic genes in the mutant compared to WT A. flavus infected seeds. Expression analyses of PA metabolism/transport genes during A. flavus-maize interaction showed significant increase in the expression of arginine decarboxylase (Adc and S-adenosylmethionine decarboxylase (Samdc genes in the maize host and PA uptake transporters in the fungus. The results presented here demonstrate that Spd biosynthesis is critical for normal development and pathogenesis of A. flavus and pre-treatment of a Δspds mutant with Spd or Spd uptake from the

  16. Mutations in ash1 and trx enhance P-element-dependent silencing in Drosophila melanogaster.

    Science.gov (United States)

    McCracken, Allen; Locke, John

    2016-08-01

    In Drosophila melanogaster, the mini-w(+) transgene in Pci is normally expressed throughout the adult eye; however, when other P or KP elements are present, a variegated-eye phenotype results, indicating random w(+) silencing during development called P-element-dependent silencing (PDS). Mutant Su(var)205 and Su(var)3-7 alleles act as haplo-suppressors/triplo-enhancers of this variegated phenotype, indicating that these heterochromatic modifiers act dose dependently in PDS. Previously, we recovered a spontaneous mutation of P{lacW}ci(Dplac) called P{lacW}ci(DplacE1) (E1) that variegated in the absence of P elements, presumably due to the insertion of an adjacent gypsy element. From a screen for genetic modifiers of E1 variegation, we describe here the isolation of five mutations in ash1 and three in trx that enhance the E1 variegated phenotype in a dose-dependent and cumulative manner. These mutant alleles enhance PDS at E1, and in E1/P{lacW}ci(Dplac), but suppress position effect variegation (PEV) at In(1)w(m)(4). This opposite action is consistent with a model where ASH1 and TRX mark transcriptionally active chromatin domains. If ASH1 or TRX function is lost or reduced, heterochromatin can spread into these domains creating a sink that diverts heterochromatic proteins from other variegating locations, which then may express a suppressed phenotype.

  17. Application of the newly developed Japanese adenosine normal database for adenosine stress myocardial scintigraphy.

    Science.gov (United States)

    Harata, Shingo; Isobe, Satoshi; Morishima, Itsuro; Suzuki, Susumu; Tsuboi, Hideyuki; Sone, Takahito; Ishii, Hideki; Murohara, Toyoaki

    2015-10-01

    The currently available Japanese normal database (NDB) in stress myocardial perfusion scintigraphy recommended by the Japanese Society of Nuclear Medicine (JSNM-NDB) is created based on the data from exercise tests. The newly developed adenosine normal database (ADS-NDB) remains to be validated for patients undergoing adenosine stress test. We tested whether the diagnostic accuracy of adenosine stress test is improved by the use of ADS-NDB (Kanazawa University). Of 233 consecutive patients undergoing (99m)Tc-MIBI adenosine stress test, 112 patients were tested. The stress/rest myocardial (99m)Tc-MIBI single-photon emission computed tomography (SPECT) images were analyzed by AutoQUANT 7.2 with both ADS-NDB and JSNM-NDB. The summed stress score (SSS) and summed difference score (SDS) were calculated. The agreements of the post-stress defect severity between ADS-NDB and JSNM-NDB were assessed using a weighted kappa statistic. In all patients, mean SSSs of all, right coronary artery (RCA), left anterior descending (LAD), and left circumflex (LCx) territories were significantly lower with ADS-NDB than those with JSNM-NDB. Mean SDSs in all, RCA, and LAD territories were significantly lower with ADS-NDB than those with JSNM-NDB. In 28 patients with significant coronary stenosis, the mean SSS in the RCA territory was significantly lower with ADS-NDB than that with JSNM-NDB. In 84 patients without ischemia, both mean SSSs and SDSs in all, RCA, LAD, and LCx territories were significantly lower with ADS-NDB than those with JSNM-NDB. Weighted kappa values of all patients, patients with significant stenosis, and patients without ischemia were 0.89, 0.83, and 0.92, respectively. Differences were observed between results from ADS-NDB and JSNM-NDB. The diagnostic accuracy of adenosine stress myocardial perfusion scintigraphy may be improved by reducing false-positive results.

  18. The Relationship between Socioeconomic Status and Narrative Abilities in a Group of Italian Normally Developing Children.

    Science.gov (United States)

    Mozzanica, Francesco; Ambrogi, Federico; Salvadorini, Renata; Sai, Elena; Pozzoli, Raffaella; Barillari, Maria Rosaria; Scarponi, Letizia; Schindler, Antonio

    2016-01-01

    Only limited and conflicting information is available regarding the relationship between socioeconomic status (SES) and narrative abilities. Besides, the role fathers' SES plays in the development of their children's narrative abilities has never been investigated. The aim of this study was to analyze the relationship between fathers' and mothers' SES and narrative abilities of their children assessed with the Italian version of the Bus Story Test (I-BST). A total of 505 normally developing Italian children were enrolled in the study. Information regarding parents' educational level and employment was collected for each child. Narrative abilities were evaluated using the I-BST. The relationships between parents' employment, educational level, and I-BST scores were analyzed by univariate and multivariate regression analysis. In univariate analysis, both fathers' and mothers' education and employment were associated with most I-BST subscale scores, especially when higher educational and employment levels were contrasted with the lowest educational and employment levels. In multiple regression analysis, significant associations were found only between the fathers' working status and educational level and I-BST subscale scores. Parental education and employment might impact narrative abilities of children. When both fathers' and mothers' SES variables are considered together, only fathers' education and working status seemed to be associated with I-BST scores. © 2016 S. Karger AG, Basel.

  19. TGF-ß Regulates Cathepsin Activation during Normal and Pathogenic Development.

    Science.gov (United States)

    Flanagan-Steet, Heather; Christian, Courtney; Lu, Po-Nien; Aarnio-Peterson, Megan; Sanman, Laura; Archer-Hartmann, Stephanie; Azadi, Parastoo; Bogyo, Matthew; Steet, Richard A

    2018-03-13

    Cysteine cathepsins play roles during development and disease beyond their function in lysosomal protein turnover. Here, we leverage a fluorescent activity-based probe (ABP), BMV109, to track cysteine cathepsins in normal and diseased zebrafish embryos. Using this probe in a model of mucolipidosis II, we show that loss of carbohydrate-dependent lysosomal sorting alters the activity of several cathepsin proteases. The data support a pathogenic mechanism where TGF-ß signals enhance the proteolytic processing of pro-Ctsk by modulating the expression of chondroitin 4-sulfate (C4-S). In MLII, elevated C4-S corresponds with TGF-ß-mediated increases in chst11 expression. Inhibiting chst11 impairs the proteolytic activation of Ctsk and alleviates the MLII phenotypes. These findings uncover a regulatory loop between TGF-ß signaling and Ctsk activation that is altered in the context of lysosomal disease. This work highlights the power of ABPs to identify mechanisms underlying pathogenic development in living animals. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  20. Role of CXCL12 and CXCR4 in normal cerebellar development and medulloblastoma.

    Science.gov (United States)

    Ozawa, Patricia Midori Murobushi; Ariza, Carolina Batista; Ishibashi, Cintya Mayumi; Fujita, Thiago Cezar; Banin-Hirata, Bruna Karina; Oda, Julie Massayo Maeda; Watanabe, Maria Angelica Ehara

    2016-01-01

    Chemokines and its receptors have significant impact on physiological and pathological processes and studies concerning their association with tumor biology are subject of great interest in scientific community. CXCL12/CXCR4 axis has been widely studied due to its significant role in tumor microenvironment, but it is also important to development and maintenance of tissues and organs, for example, in the brain and cerebellum. Studies have demonstrated that CXCL12 and CXCR4 are required for normal cerebellar development and that dysfunction in this pathway may be involved with medulloblastoma pathogenesis. In this context, a new molecular subgroup has been suggested based on the importance of the association between CXCR4 overexpression and sonic hedgehog subgroup. Treatment using CXCR4 antagonists showed significant results, evidencing the important role and possible therapeutic capacity of CXCR4 in MB. This review summarizes studies on MB cell biology, focusing on a chemokine-receptor axis, CXCL12/CXCR4, that may have implications for treatment strategies once it can improve life expectancy and reduce neurocognitive sequelae of patients with this neoplasia. © 2014 UICC.

  1. Differentiating os acromiale from normally developing acromial ossification centers using magnetic resonance imaging

    Energy Technology Data Exchange (ETDEWEB)

    Winfeld, Matthew [Children' s National Medical Center, Department of Radiology, Washington, DC (United States); Rosenberg, Zehava Sadka; Wang, Annie; Bencardino, Jenny [New York University School of Medicine, New York, NY (United States)

    2015-05-01

    Acromial fusion may not be complete until age 18-25, making it questionable to diagnose os acromiale in adolescents. Os acromiale may exist in adolescents and can be differentiated from a developing acromial ossification center based on MRI findings. A total of 128 MRIs of the shoulder were randomly and blindly reviewed retrospectively by two musculoskeletal radiologists. The MRIs consisted of two groups: (1) 56 of os acromiale in adults (25-74 years old, mean, 50) and (2) 72 consecutive of adolescents (12-17 years old, mean, 14.5). The following were assessed at the interface between the distal acromion and os acromiale/developing ossification center(s): presence of os acromiale vs. developing acromion, orientation, margins, and edema within and adjacent to it. Fifty-one adults and 49 adolescents were included. Exclusions were due to poor image quality or confounding findings (n = 7) or complete acromial fusion (n = 21 adolescents). Utilizing accepted definitions of os acromiale, all adult cases (100 %) were accurately diagnosed as os acromiale, with transverse interface orientation and irregular margins (94 %, R = 0.86, p < 0.00001). Forty-five (92 %) adolescent cases were accurately diagnosed as normally developing acromion with arched interface and lobulated margins (92 %, R = 0.92, p < 0.000001). Four (8 %) adolescent cases were diagnosed as having os acromiale, with transverse orientation and irregular margins. Thirty-five (69 %) and 46 (90 %) adults had marrow and interface edema, respectively. Six (12 %) and eight (16 %) adolescents had marrow and interface edema, respectively, including the four concluded to be os acromiale. Adolescents may have imaging findings consistent with os acromiale. The diagnosis of os acromiale should be based on imaging features and not limited by age. (orig.)

  2. Differentiating os acromiale from normally developing acromial ossification centers using magnetic resonance imaging

    International Nuclear Information System (INIS)

    Winfeld, Matthew; Rosenberg, Zehava Sadka; Wang, Annie; Bencardino, Jenny

    2015-01-01

    Acromial fusion may not be complete until age 18-25, making it questionable to diagnose os acromiale in adolescents. Os acromiale may exist in adolescents and can be differentiated from a developing acromial ossification center based on MRI findings. A total of 128 MRIs of the shoulder were randomly and blindly reviewed retrospectively by two musculoskeletal radiologists. The MRIs consisted of two groups: (1) 56 of os acromiale in adults (25-74 years old, mean, 50) and (2) 72 consecutive of adolescents (12-17 years old, mean, 14.5). The following were assessed at the interface between the distal acromion and os acromiale/developing ossification center(s): presence of os acromiale vs. developing acromion, orientation, margins, and edema within and adjacent to it. Fifty-one adults and 49 adolescents were included. Exclusions were due to poor image quality or confounding findings (n = 7) or complete acromial fusion (n = 21 adolescents). Utilizing accepted definitions of os acromiale, all adult cases (100 %) were accurately diagnosed as os acromiale, with transverse interface orientation and irregular margins (94 %, R = 0.86, p < 0.00001). Forty-five (92 %) adolescent cases were accurately diagnosed as normally developing acromion with arched interface and lobulated margins (92 %, R = 0.92, p < 0.000001). Four (8 %) adolescent cases were diagnosed as having os acromiale, with transverse orientation and irregular margins. Thirty-five (69 %) and 46 (90 %) adults had marrow and interface edema, respectively. Six (12 %) and eight (16 %) adolescents had marrow and interface edema, respectively, including the four concluded to be os acromiale. Adolescents may have imaging findings consistent with os acromiale. The diagnosis of os acromiale should be based on imaging features and not limited by age. (orig.)

  3. The molecular basis for stability of heterochromatin-mediated silencing in mammals

    Directory of Open Access Journals (Sweden)

    Hiragami-Hamada Kyoko

    2009-11-01

    Full Text Available Abstract The archetypal epigenetic phenomenon of position effect variegation (PEV in Drosophila occurs when a gene is brought abnormally close to heterochromatin, resulting in stochastic silencing of the affected gene in a proportion of cells that would normally express it. PEV has been instrumental in unraveling epigenetic mechanisms. Using an in vivo mammalian model for PEV we have extensively investigated the molecular basis for heterochromatin-mediated gene silencing. Here we distinguish 'epigenetic effects' from other cellular differences by studying ex vivo cells that are identical, apart from the expression of the variegating gene which is silenced in a proportion of the cells. By separating cells according to transgene expression we show here that silencing appears to be associated with histone H3 lysine 9 trimethylation (H3K9me3, DNA methylation and the localization of the silenced gene to a specific nuclear compartment enriched in these modifications. In contrast, histone H3 acetylation (H3Ac and lysine 4 di or tri methylation (H3K4me2/3 are the predominant modifications associated with expression where we see the gene in a euchromatic compartment. Interestingly, DNA methylation and inaccessibility, rather than H3K9me3, correlated most strongly with resistance to de-repression by cellular activation. These results have important implications for understanding the contribution of specific factors involved in the establishment and maintenance of gene silencing and activation in vivo.

  4. The Nuclear Cap-Binding Complex Mediates Meiotic Silencing by Unpaired DNA

    Directory of Open Access Journals (Sweden)

    Logan M. Decker

    2017-04-01

    Full Text Available In the filamentous fungus Neurospora crassa, cross walls between individual cells are normally incomplete, making the entire fungal network vulnerable to attack by viruses and selfish DNAs. Accordingly, several genome surveillance mechanisms are maintained to help the fungus combat these repetitive elements. One of these defense mechanisms is called meiotic silencing by unpaired DNA (MSUD, which identifies and silences unpaired genes during meiosis. Utilizing common RNA interference (RNAi proteins, such as Dicer and Argonaute, MSUD targets mRNAs homologous to the unpaired sequence to achieve silencing. In this study, we have identified an additional silencing component, namely the cap-binding complex (CBC. Made up of cap-binding proteins CBP20 and CBP80, CBC associates with the 5′ cap of mRNA transcripts in eukaryotes. The loss of CBC leads to a deficiency in MSUD activity, suggesting its role in mediating silencing. As confirmed in this study, CBC is predominantly nuclear, although it is known to travel in and out of the nucleus to facilitate RNA transport. As seen in animals but not in plants, CBP20’s robust nuclear import depends on CBP80 in Neurospora. CBC interacts with a component (Argonaute of the perinuclear meiotic silencing complex (MSC, directly linking the two cellular factors.

  5. The molecular basis for stability of heterochromatin-mediated silencing in mammals.

    Science.gov (United States)

    Hiragami-Hamada, Kyoko; Xie, Sheila Q; Saveliev, Alexander; Uribe-Lewis, Santiago; Pombo, Ana; Festenstein, Richard

    2009-11-04

    The archetypal epigenetic phenomenon of position effect variegation (PEV) in Drosophila occurs when a gene is brought abnormally close to heterochromatin, resulting in stochastic silencing of the affected gene in a proportion of cells that would normally express it. PEV has been instrumental in unraveling epigenetic mechanisms. Using an in vivo mammalian model for PEV we have extensively investigated the molecular basis for heterochromatin-mediated gene silencing. Here we distinguish 'epigenetic effects' from other cellular differences by studying ex vivo cells that are identical, apart from the expression of the variegating gene which is silenced in a proportion of the cells. By separating cells according to transgene expression we show here that silencing appears to be associated with histone H3 lysine 9 trimethylation (H3K9me3), DNA methylation and the localization of the silenced gene to a specific nuclear compartment enriched in these modifications. In contrast, histone H3 acetylation (H3Ac) and lysine 4 di or tri methylation (H3K4me2/3) are the predominant modifications associated with expression where we see the gene in a euchromatic compartment. Interestingly, DNA methylation and inaccessibility, rather than H3K9me3, correlated most strongly with resistance to de-repression by cellular activation. These results have important implications for understanding the contribution of specific factors involved in the establishment and maintenance of gene silencing and activation in vivo.

  6. Silence as a Response to Everyday Violence

    DEFF Research Database (Denmark)

    Gammeltoft, Tine

    2016-01-01

    Across the world, existing research indicates that many women respond with silence to marital abuse. This article offers an ethnographic investigation of the social and psychic forces behind Vietnamese women’s silencing of violence and a theoretical exploration of how the psychoanalytic concept...... of fantasy—understood as unconscious or subconscious mental processes—may contribute to the analysis of everyday violence and psychic distress. Distinguishing between what I term deliberate and subconscious silence, I explore the role that fantasy plays when Vietnamese women silently endure intimate partner...

  7. Development of hypo-allergenic apples: silencing of the major allergen Mal d 1 gene in "Elstar" apple and the effect of grafting

    DEFF Research Database (Denmark)

    Krath, Britta; Eriksen, Folmer Damsted; Pedersen, Bjarne H.

    2009-01-01

    Many people who are allergic to birch pollen are also allergic to apple fruit, due to cross-allergenicity. Since apples are the most extensively consumed fruit in Europe, it is highly relevant to develop a hypo-allergenic apple. Apples with significantly reduced levels of the allergen, Mal d 1, may...

  8. Krüppel-like factor 2 is required for normal mouse cardiac development.

    Directory of Open Access Journals (Sweden)

    Aditi R Chiplunkar

    Full Text Available Krüppel-like factor 2 (KLF2 is expressed in endothelial cells in the developing heart, particularly in areas of high shear stress, such as the atrioventricular (AV canal. KLF2 ablation leads to myocardial thinning, high output cardiac failure and death by mouse embryonic day 14.5 (E14.5 in a mixed genetic background. This work identifies an earlier and more fundamental role for KLF2 in mouse cardiac development in FVB/N mice. FVB/N KLF2-/- embryos die earlier, by E11.5. E9.5 FVB/N KLF2-/- hearts have multiple, disorganized cell layers lining the AV cushions, the primordia of the AV valves, rather than the normal single layer. By E10.5, traditional and endothelial-specific FVB/N KLF2-/- AV cushions are hypocellular, suggesting that the cells accumulating at the AV canal have a defect in endothelial to mesenchymal transformation (EMT. E10.5 FVB/N KLF2-/- hearts have reduced glycosaminoglycans in the cardiac jelly, correlating with the reduced EMT. However, the number of mesenchymal cells migrating from FVB/N KLF2-/- AV explants into a collagen matrix is reduced considerably compared to wild-type, suggesting that the EMT defect is not due solely to abnormal cardiac jelly. Echocardiography of E10.5 FVB/N KLF2-/- embryos indicates that they have abnormal heart function compared to wild-type. E10.5 C57BL/6 KLF2-/- hearts have largely normal AV cushions. However, E10.5 FVB/N and C57BL/6 KLF2-/- embryos have a delay in the formation of the atrial septum that is not observed in a defined mixed background. KLF2 ablation results in reduced Sox9, UDP-glucose dehydrogenase (Ugdh, Gata4 and Tbx5 mRNA in FVB/N AV canals. KLF2 binds to the Gata4, Tbx5 and Ugdh promoters in chromatin immunoprecipitation assays, indicating that KLF2 could directly regulate these genes. In conclusion, KLF2-/- heart phenotypes are genetic background-dependent. KLF2 plays a role in EMT through its regulation of important cardiovascular genes.

  9. Expanding the Lotus japonicus reverse genetics toolbox – Development of LORE1 retrotransposon mutagenesis and artificial miRNA-mediated silencing

    DEFF Research Database (Denmark)

    Urbanski, Dorian Fabian

    2011-01-01

    . The protocols developed in the current project are now the cornerstone of a new LORE1 reverse genetics resource characterized by efficient mutant line generation and accurate mutation annotation. In parallel, artificial microRNAs (amiRNAs) were designed based on both Arabidopsis and Lotus backbones......Currently, the most common approach to studying Lotus japonicus (Lotus) genes is forward genetics in which a gene responsible for the studied phenotype is identified through map-based cloning. In reverse genetics, the activity of a gene of interest is modified to discover its mutant phenotype....... Prior to this project, the only reverse genetics resource available in Lotus was the TILLING resource. In an attempt to advance Lotus genetic studies, present study is focused on the development of two additional resources. The first is based on insertional mutagenesis and the second on harnessing post...

  10. Normal skeletal development and imaging pitfalls of the calcaneal apophysis: MRI features

    Energy Technology Data Exchange (ETDEWEB)

    Rossi, Ignacio [Musculoskeletal Research Fellow at NYU Langone Medical Center, New York, NY (United States); Centro de Diagnostico Dr. Enrique Rossi, Buenos Aires (Argentina); Rosenberg, Zehava [NYU Langone Medical Center, New York, NY (United States); Zember, Jonathan [Albert Einstein College of Medicine Jacobi Medical Center, Bronx, NY (United States)

    2016-04-15

    Heel pain in children and secondary MR imaging (MRI) of the hindfoot have been increasing in incidence. Our purpose is to illustrate the, previously unreported, MRI stages in development of the posterior calcaneal apophysis, with attention to imaging pitfalls. This should aid in distinguishing normal growth from true disease. Consecutive ankle MRIs in children <18 years, from 2008-2014, were subdivided into 0≤5, 5≤10, 10≤15 and 15≤18 age groups and retrospectively reviewed for development of the calcaneal apophysis. 204 ankle MRI studies in 188 children were identified. 40 studies were excluded with final cohort of 164 studies in 154 patients (82 boys, 72 girls). The calcaneal apophysis was cartilaginous until age 5. Foci of decreased as well as increased signal were embedded in cartilage, prior to ossification. Early, secondary ossification centers appeared in plantar third of the apophysis in 100 % of children by age 7. Increased T2 signal in the ossifications was seen in 30 % of children. Apohyseal fusion began at 12 and was complete in 78 % of 14≤15 year olds and in 88 % of 15≤18 year olds. Curvilinear low signal in the ossification centers, paralleling, but distinguished from growth plate, and not be confused with fracture line, was common. Development of the posterior calcaneus follows a unique sequence. Apophyseal fusion occurs earlier than reported in the literature. Familiarity with this maturation pattern, in particular the apophyseal increased T2 signal and the linear low signal paralleling the growth plate, will avoid misinterpreting it for pathology. (orig.)

  11. Normal skeletal development and imaging pitfalls of the calcaneal apophysis: MRI features

    International Nuclear Information System (INIS)

    Rossi, Ignacio; Rosenberg, Zehava; Zember, Jonathan

    2016-01-01

    Heel pain in children and secondary MR imaging (MRI) of the hindfoot have been increasing in incidence. Our purpose is to illustrate the, previously unreported, MRI stages in development of the posterior calcaneal apophysis, with attention to imaging pitfalls. This should aid in distinguishing normal growth from true disease. Consecutive ankle MRIs in children <18 years, from 2008-2014, were subdivided into 0≤5, 5≤10, 10≤15 and 15≤18 age groups and retrospectively reviewed for development of the calcaneal apophysis. 204 ankle MRI studies in 188 children were identified. 40 studies were excluded with final cohort of 164 studies in 154 patients (82 boys, 72 girls). The calcaneal apophysis was cartilaginous until age 5. Foci of decreased as well as increased signal were embedded in cartilage, prior to ossification. Early, secondary ossification centers appeared in plantar third of the apophysis in 100 % of children by age 7. Increased T2 signal in the ossifications was seen in 30 % of children. Apohyseal fusion began at 12 and was complete in 78 % of 14≤15 year olds and in 88 % of 15≤18 year olds. Curvilinear low signal in the ossification centers, paralleling, but distinguished from growth plate, and not be confused with fracture line, was common. Development of the posterior calcaneus follows a unique sequence. Apophyseal fusion occurs earlier than reported in the literature. Familiarity with this maturation pattern, in particular the apophyseal increased T2 signal and the linear low signal paralleling the growth plate, will avoid misinterpreting it for pathology. (orig.)

  12. Development of Normalization Factors for Canada and the United States and Comparison with European Factors

    Science.gov (United States)

    In Life Cycle Assessment (LCA), normalization calculates the magnitude of an impact (midpoint or endpoint) relative to the total effect of a given reference. Using a country or a continent as a reference system is a first step towards global normalization. The goal of this wor...

  13. Sibling violence silenced: rivalry, competition, wrestling, playing, roughhousing, benign.

    Science.gov (United States)

    Phillips, Debby A; Phillips, Kate H; Grupp, Kitty; Trigg, Lisa J

    2009-01-01

    In this article, sibling violence and the silence surrounding it is explicated through professional literature and research findings, exemplars from clinical practice, and statistics. Theoretical positions and discourse analysis have been used to help explain how regular broken bones, bruises, lacerations, and verbal humiliation can be minimized as normal sibling rivalry or roughhousing, which does not cause serious consequences. Nursing should be on the front lines of ending practices of violence. Recognizing sibling violence as such is part of this work and is a social justice issue.

  14. "Against the silence": Development and first results of a patient survey to assess experiences of safety-related events in hospital

    Directory of Open Access Journals (Sweden)

    Schwappach David LB

    2008-03-01

    Full Text Available Abstract Background Involvement of patients in the detection and prevention of safety related events and medical errors have been widely recommended. However, it has also been questioned whether patients at large are willing and able to identify safety-related events in their care. The aim of this study was to develop and pilot test a brief patient safety survey applicable to inpatient care in Swiss hospitals. Methods A survey instrument was developed in an iterative procedure. The instrument asks patients to report whether they have experienced specific undesirable events during their hospital stay. The preliminary version was developed together with experts and tested in focus groups with patients. The adapted survey instrument was pilot-tested in random samples of patients of two Swiss hospitals (n = 400. Responders to the survey that had reported experience of any incident were sampled for qualitative interviews (n = 18. Based on the interview, the researcher classified the reported incidents as confirmed or discarded. Results The survey was generally well accepted in the focus groups and interviews. In the quantitative pilot test, 125 patients returned the survey (response rate: 31%. The mean age of responders was 55 years (range 17–91, SD 18 years and 62.5% were female. The 125 participating patients reported 94 "definitive" and 34 "uncertain" events. 14% of the patients rated any of the experienced events as "serious". The definitive and uncertain events reported with highest frequency were phlebitis, missing hand hygiene, allergic drug reaction, unavailability of documents, and infection. 23% of patients reported some or serious concerns about their safety. The qualitative interviews indicate that both, the extent of patients' uncertainty in the classification of events and the likelihood of confirmation by the interviewer vary very much by type of incident. Unexpectedly, many patients reported problems and incidents related to food

  15. Metacognition and Reading: Comparing Three Forms of Metacognition in Normally Developing Readers and Readers with Dyslexia.

    Science.gov (United States)

    Furnes, Bjarte; Norman, Elisabeth

    2015-08-01

    Metacognition refers to 'cognition about cognition' and includes metacognitive knowledge, strategies and experiences (Efklides, 2008; Flavell, 1979). Research on reading has shown that better readers demonstrate more metacognitive knowledge than poor readers (Baker & Beall, 2009), and that reading ability improves through strategy instruction (Gersten, Fuchs, Williams, & Baker, 2001). The current study is the first to specifically compare the three forms of metacognition in dyslexic (N = 22) versus normally developing readers (N = 22). Participants read two factual texts, with learning outcome measured by a memory task. Metacognitive knowledge and skills were assessed by self-report. Metacognitive experiences were measured by predictions of performance and judgments of learning. Individuals with dyslexia showed insight into their reading problems, but less general knowledge of how to approach text reading. They more often reported lack of available reading strategies, but groups did not differ in the use of deep and surface strategies. Learning outcome and mean ratings of predictions of performance and judgments of learning were lower in dyslexic readers, but not the accuracy with which metacognitive experiences predicted learning. Overall, the results indicate that dyslexic reading and spelling problems are not generally associated with lower levels of metacognitive knowledge, metacognitive strategies or sensitivity to metacognitive experiences in reading situations. 2015 The Authors. Dyslexia Published by John Wiley & Sons Ltd.

  16. The normal development of proximal humeral epiphyseal ossification center in the first 2 years of life

    International Nuclear Information System (INIS)

    Kim, Seung Cheol

    1998-01-01

    The purpose of this study is to ascertain the normal maturation of proximal epiphyseal ossification centers by monthly age during the first years of life. The distribution of age was 0 to 24 months. Six hundred and seventy-five infants were male and 436 were female; their ages were measured in months, and there was no evidence of developmental problems. Proximal humeral epiphyseal ossification centers were evaluated from chest radiographs ; if not visualized, they were graded as 0, and otherwise, as follows : grade 1 : visualized with poor margin or a diameter of less than 1/4 of metaphyseal width; grade 2: visualized with good margin or a diameter of more than 1/4 of metaphyseal width; in grade 3 and 4, two ossification centers were visualized. Grade 3 indicated that one ossification center had the morphology of grade 2. Grade 5 indicated that two ossification centers were fused. We then assessed the relationship between the development of an ossification center and monthly age. A proximal humeral epiphyseal ossification center shows regular maturational features according to monthly age. 6 refs., 2 tabs., 5 figs

  17. Development and evaluation of a new contoured cushion system with an optimized normalization algorithm.

    Science.gov (United States)

    Li, Sujiao; Zhang, Zhengxiang; Wang, Jue

    2014-01-01

    Prevention of pressure sores remains a significant problem confronting spinal cord injury patients and the elderly with limited mobility. One vital aspect of this subject concerns the development of cushions to decrease pressure ulcers for seated patients, particularly those bound by wheelchairs. Here, we present a novel cushion system that employs interface pressure distribution between the cushion and the buttocks to design custom contoured foam cushion. An optimized normalization algorithm was proposed, with which interface pressure distribution was transformed into the carving depth of foam cushions according to the biomechanical characteristics of the foam. The shape and pressure-relief performance of the custom contoured foam cushions was investigated. The outcomes showed that the contoured shape of personalized cushion matched the buttock contour very well. Moreover, the custom contoured cushion could alleviate pressure under buttocks and increase subjective comfort and stability significantly. Furthermore, the fabricating method not only decreased the unit production cost but also simplified the procedure for manufacturing. All in all, this prototype seat cushion would be an effective and economical way to prevent pressure ulcers.

  18. The Effect of Executive Function on Science Achievement Among Normally Developing 10-Year Olds

    Science.gov (United States)

    Lederman, Sheri G.

    Executive function (EF) is an umbrella term used to identify a set of discrete but interrelated cognitive abilities that enable individuals to engage in goal-directed, future-oriented action in response to a novel context. Developmental studies indicate that EF is predictive of reading and math achievement in middle childhood. The purpose of this study was to identify the association between EF and science achievement among normally developing 10 year olds. A sample of fifth grade students from a Northeastern suburban community participated in tests of EF, science, and intelligence. Consistent with adult models of EF, principal components analysis identified a three-factor model of EF organization in middle childhood, including cognitive flexibility, working memory, and inhibition. Multiple regression analyses revealed that executive function processes of cognitive flexibility, working memory, and inhibition were all predictive of science performance. Post hoc analyses revealed that high-performing science students differed significantly from low-performing students in both cognitive flexibility and working memory. These findings suggest that complex academic demands specific to science achievement rely on the emergence and maturation of EF components.

  19. Small RNA-Mediated Epigenetic Myostatin Silencing

    Directory of Open Access Journals (Sweden)

    Thomas C Roberts

    2012-01-01

    Full Text Available Myostatin (Mstn is a secreted growth factor that negatively regulates muscle mass and is therefore a potential pharmacological target for the treatment of muscle wasting disorders such as Duchenne muscular dystrophy. Here we describe a novel Mstn blockade approach in which small interfering RNAs (siRNAs complementary to a promoter-associated transcript induce transcriptional gene silencing (TGS in two differentiated mouse muscle cell lines. Silencing is sensitive to treatment with the histone deacetylase inhibitor trichostatin A, and the silent state chromatin mark H3K9me2 is enriched at the Mstn promoter following siRNA transfection, suggesting epigenetic remodeling underlies the silencing effect. These observations suggest that long-term epigenetic silencing may be feasible for Mstn and that TGS is a promising novel therapeutic strategy for the treatment of muscle wasting disorders.

  20. Public privacy: Reciprocity and Silence

    Directory of Open Access Journals (Sweden)

    Jenny Kennedy

    2014-10-01

    Full Text Available In his 1958 poem 'Dedication to my Wife' TS Eliot proclaims "these are private words addressed to you in public". Simultaneously written for his wife, Valerie Fletcher, and to the implied you of a discourse network, Eliot's poem helps to illustrate the narrative voices and silences that are constitutive of an intimate public sphere. This paper situates reciprocity as a condition of possibility for public privacy. It shows how reciprocity is enabled by systems of code operating through material and symbolic registers. Code promises to control communication, to produce neutral, systemic forms of meaning. Yet such automation is challenged by uneven and fragmented patterns of reciprocity. Moreover, examining the media of public privacy reveals historical trajectories important for understanding contemporary socio­technical platforms of reciprocity. To explore the implicit requirement of reciprocity in publicly private practices, three sites of communication are investigated framed by a media archaeology perspective: postal networks, the mail­art project PostSecret and the anonymous zine 'You'.

  1. [Normal and pathologic mandible development: practical deductions in maxillo-dento-facial orthopedics].

    Science.gov (United States)

    Salagnac, Jean-Michel

    2016-09-01

    The mandible consists of different segments, each of which possess its own specific characteristics regarding emergence, ossification during growth and pathologies. Orthodontists need to be very familiar with these developmental anomalies if they are to avoid failure in their orthopedic or orthodontic treatments and in order to understand the reasons for the lack of success of "conventional" treatments. Each segment must develop correctly if the mandible is to achieve optimal development and occupy a normal position within the cranio-facial complex. The position of the mandible in the cranio-facial block is also conditioned by its attachment to the base of the skull. Combining a detailed semiologic study and a three-dimensional architectural and structural radiologic analysis of clinical cases, this article investigates the various anomalies affecting the mandibular segments and their impact on the craniofacial structure as a whole. An understanding of these anomalies and this analytical method can enable clinicians to perform early diagnosis, avoid undertaking orthopedic and orthodontic treatments which are likely to fail, understand the reasons for unsuccessful "conventional" treatments, provide an orthopedic-surgical guide and make it possible to inform patients correctly. Anomalies affecting the growth of the mandible and its position on the cranial base and their impact on cranio-facial skeletal balance are clearly revealed by structural and architectural analysis, which pinpoints the different clinical elements in skeletal Class II et III cases. In maxilla-dento-facial orthopedics when confronted with a pathology of mandibular origin, it is essential to carefully study the radiographs of each segment of the mandible, to seek out the minor forms of the anomalies and to calculate the position of the mandible on the cranial base relative to the neighboring structures; the skull, the cervical vertebrae and the maxilla. © EDP Sciences, SFODF, 2016.

  2. Fetal lung development on MRI. Normal course and impairment due to premature rupture of membranes; Fetale Lungenentwicklung in der MRT. Normaler Verlauf und Beeintraechtigung durch vorzeitigen Blasensprung

    Energy Technology Data Exchange (ETDEWEB)

    Kasprian, G. [Medizinische Universitaet Wien (Austria). Klinik fuer Radiodiagnostik; Zentrum fuer Anatomie und Zellbiologie der Medizinischen Universitaet Wien (Austria). Arbeitsgruppe Integrative Morphologie; Brugger, P.C. [Zentrum fuer Anatomie und Zellbiologie der Medizinischen Universitaet Wien (Austria). Arbeitsgruppe Integrative Morphologie; Helmer, H.; Langer, M. [Medizinische Universitaet Wien (Austria). Klinik fuer Frauenheilkunde; Balassy, C.; Prayer, D. [Medizinische Universitaet Wien (Austria). Klinik fuer Radiodiagnostik

    2006-02-15

    A well-organized interplay between many molecular factors as well as mechanical forces influence fetal lung development. At the end of this complex process a sufficiently sized and structurally mature organ should ensure the postnatal survival of the newborn. Besides prenatal ultrasonography, magnetic resonance imaging (MRI) can now be used to investigate normal and pathological human lung growth in utero. Oligohydramnios, due to premature rupture of membranes (PROM), is an important risk factor for compromised fetal lung growth. In these situations MR volumetry can be used to measure the size of the fetal lung quite accurately. Together with the evaluation of lung signal intensities on T2-weighted sequences, fetuses with pulmonary hypoplasia can be readily detected. (orig.) [German] Die fetale Lungenentwicklung wird einerseits durch eine Vielzahl molekularer Faktoren und andererseits durch mechanisch-physiologische Kraefte beeinflusst. Ein geordnetes Zusammenspiel dieser Mechanismen fuehrt zu einem ausreichend grossen und strukturell reifen Organ, das sofort nach der Geburt das Ueberleben des Neugeborenen sicherstellt. Neben der praenatalen Ultraschalluntersuchung bietet nun auch die Magnetresonanztomographie (MRT) die Moeglichkeit, die normale und pathologische fetale Lungenentwicklung zu untersuchen. Ein wesentlicher Risikofaktor fuer eine Beeintraechtigung der Lungenentwicklung ist die verminderte Fruchtwassermenge nach vorzeitigem Blasensprung. In diesen Faellen kann die MR-Volumetrie dazu eingesetzt werden, die Groesse der fetalen Lungen relativ genau zu bestimmen. Gemeinsam mit der Beurteilung der MR-Signalintensitaeten des Lungengewebes auf T2-gewichteten Sequenzen koennen Feten mit hypoplastischen Lungen mit zunehmender Sicherheit bereits praenatal identifiziert werden. (orig.)

  3. Durability of timber silencers at Wairakei geothermal steam field

    Energy Technology Data Exchange (ETDEWEB)

    Hedley, M E

    1979-02-01

    After early failures of reinforced concrete silencers and because of high costs of concrete-lined steel structures, preliminary tests were undertaken to assess the suitability of timber for silencer construction. Tests indicated that radiata pine treated with pentachlorophenol/oil or untreated red beech had most potential for timber silencer fabrication. One prototype silencer of each material was constructed and both were installed on operational bores in 1965. The red beech silencer had a service life of 4 years. The radiata pine silencer operated for 12/sup 1///sub 2/ years, although replacement had been recommended 1 year before this time expired. The performance of this silencer encouraged the general use of timber for silencer construction and further units were built. Procurement of satisfactory grades of timber has proved difficult and has limited silencer fabrication. Ways of improving timber supply, which require modification of silencer design, are discussed.

  4. Development of Normalization Factors for Canada and the United States and Comparison with European Factors

    DEFF Research Database (Denmark)

    Lautier, Anne; Rosenbaum, Ralph K.; Margni, Manuele

    2010-01-01

    In Life Cycle Assessment (LCA), normalization calculates the magnitude of an impact (midpoint or endpoint) relative to the total effect of a given reference. The goal of this work is to calculate normalization factors for Canada and the US and to compare them with existing European normalization...... factors. The differences between geographical areas were highlighted by identifying and comparing the main contributors to a given impact category in Canada, the US and Europe. This comparison verified that the main contributors in Europe and in the US are also present in the Canadian inventory. It also...

  5. Development and Evaluation of Low Phytic Acid Soybean by siRNA Triggered Seed Specific Silencing of Inositol Polyphosphate 6-/3-/5-Kinase Gene

    Directory of Open Access Journals (Sweden)

    Mansi Punjabi

    2018-06-01

    Full Text Available Soybean is one of the leading oilseed crop in the world and is showing a remarkable surge in its utilization in formulating animal feeds and supplements. Its dietary consumption, however, is incongruent with its existing industrial demand due to the presence of anti-nutritional factors in sufficiently large amounts. Phytic acid in particular raises concern as it causes a concomitant loss of indigestible complexed minerals and charged proteins in the waste and results in reduced mineral bioavailability in both livestock and humans. Reducing the seed phytate level thus seems indispensable to overcome the nutritional menace associated with soy grain consumption. In order to conceive our objective we designed and expressed a inositol polyphosphate 6-/3-/5-kinase gene-specific RNAi construct in the seeds of Pusa-16 soybean cultivar. We subsequently conducted a genotypic, phenotypic and biochemical analysis of the developed putative transgenic populations and found very low phytic acid levels, moderate accumulation of inorganic phosphate and elevated mineral content in some lines. These low phytic acid lines did not show any reduction in seedling emergence and displayed an overall good agronomic performance.

  6. Silence and Denial in Everyday Life—The Case of Animal Suffering

    Directory of Open Access Journals (Sweden)

    Deidre Wicks

    2011-02-01

    Full Text Available How can we make sense of the fact that we live in a world where good people co-exist in silence about widespread animal suffering. How is it that sites of suffering such as laboratories, factory farms, abattoirs and animal transportation are all around us and yet we ‘do not, in a certain sense, know about them’ [1]. This ‘not knowing’ is one of the most difficult barriers for animal activists who must constantly develop new strategies in an attempt to catch public attention and translate it into action. Recent contributions from the ‘sociology of denial’ have elucidated many of the mechanisms involved in ‘not knowing’ in relation to human atrocities and genocide. In this context, ‘denial’ refers to the maintenance of social worlds in which an undesirable situation is unrecognized, ignored or made to seem normal [2]. These include different types of denial: personal, official and cultural, as well as the process of normalization whereby suffering becomes invisible through routinization, tolerance, accommodation, collusion and cover up. Denial and normalization reflect both personal and collective states where suffering is not acknowledged [3]. In this paper, I will examine insights from the sociology of denial and apply them to human denial and normalization of animal suffering. This will include an examination of denial which is both individual and social and the implications of these insights for theory and practice in the human/animal relationship.

  7. An investigation into kana reading development in normal and dyslexic Japanese children using length and lexicality effects.

    Science.gov (United States)

    Sambai, Ami; Uno, Akira; Kurokawa, Suzuko; Haruhara, Noriko; Kaneko, Masato; Awaya, Noriko; Kozuka, Junko; Goto, Takashi; Tsutamori, Eishi; Nakagawa, Kazumi; Wydell, Taeko N

    2012-06-01

    This is the first study to report differences between Japanese children with and without dyslexia in the way string-length and lexicality effects are manifested when reading Japanese kana. These children were asked to read kana words and non-words consisting of either two or five kana characters. The results showed that the error rates of the normal Preschoolers and Primary-School children with dyslexia were higher than those of the normal Primary-School children. Further, the reading latencies of the normal Preschoolers, First-graders and dyslexics were significantly longer than those of the normal Second, Third and Fifth/Sixth graders. Moreover, reading latencies became shorter as the age of the participants increased. Both normal and dyslexic children showed significant effects of length and lexicality on reading latencies. However, the interaction between the length and lexicality was only seen in normal children from the Second-grade onwards. These results suggest that (1) normal First-graders reach a ceiling in terms of reading accuracy and that (2) as Japanese normal children become older, they become better at lexical reading processes, which leads to fluent kana reading, but that (3) the dyslexics, even at Fifth/Sixth grades, have not developed sufficient lexical reading processes. Copyright © 2011 The Japanese Society of Child Neurology. All rights reserved.

  8. Titration and hysteresis in epigenetic chromatin silencing

    International Nuclear Information System (INIS)

    Dayarian, Adel; Sengupta, Anirvan M

    2013-01-01

    Epigenetic mechanisms of silencing via heritable chromatin modifications play a major role in gene regulation and cell fate specification. We consider a model of epigenetic chromatin silencing in budding yeast and study the bifurcation diagram and characterize the bistable and the monostable regimes. The main focus of this paper is to examine how the perturbations altering the activity of histone modifying enzymes affect the epigenetic states. We analyze the implications of having the total number of silencing proteins, given by the sum of proteins bound to the nucleosomes and the ones available in the ambient, to be constant. This constraint couples different regions of chromatin through the shared reservoir of ambient silencing proteins. We show that the response of the system to perturbations depends dramatically on the titration effect caused by the above constraint. In particular, for a certain range of overall abundance of silencing proteins, the hysteresis loop changes qualitatively with certain jump replaced by continuous merger of different states. In addition, we find a nonmonotonic dependence of gene expression on the rate of histone deacetylation activity of Sir2. We discuss how these qualitative predictions of our model could be compared with experimental studies of the yeast system under anti-silencing drugs. (paper)

  9. Identification of early indicators of altered metabolism in normal development using a rodent model system

    Directory of Open Access Journals (Sweden)

    Ashok Daniel Prabakaran

    2018-03-01

    Full Text Available Although the existence of a close relationship between the early maternal developmental environment, fetal size at birth and the risk of developing disease in adulthood has been suggested, most studies, however, employed experimentally induced intrauterine growth restriction as a model to link this with later adult disease. Because embryonic size variation also occurs under normal growth and differentiation, elucidating the molecular mechanisms underlying these changes and their relevance to later adult disease risk becomes important. The birth weight of rat pups vary according to the uterine horn positions. Using birth weight as a marker, we compared two groups of rat pups – lower birth weight (LBW, 5th to 25th percentile and average birth weight (ABW, 50th to 75th percentile – using morphological, biochemical and molecular biology, and genetic techniques. Our results show that insulin metabolism, Pi3k/Akt and Pparγ signaling and the genes regulating growth and metabolism are significantly different in these groups. Methylation at the promoter of the InsII (Ins2 gene and DNA methyltransferase 1 in LBW pups are both increased. Additionally, the Dnmt1 repressor complex, which includes Hdac1, Rb (Rb1 and E2f1, was also upregulated in LBW pups. We conclude that the Dnmt1 repressor complex, which regulates the restriction point of the cell cycle, retards the rate at which cells traverse the G1 or G0 phase of the cell cycle in LBW pups, thereby slowing down growth. This regulatory mechanism mediated by Dnmt1 might contribute to the production of small-size pups and altered physiology and pathology in adult life.

  10. Isthmin 1 (ism1) is required for normal hematopoiesis in developing zebrafish.

    Science.gov (United States)

    Berrun, Arturo; Harris, Elena; Stachura, David L

    2018-01-01

    Hematopoiesis is an essential and highly regulated biological process that begins with hematopoietic stem cells (HSCs). In healthy organisms, HSCs are responsible for generating a multitude of mature blood cells every day, yet the molecular pathways that instruct HSCs to self-renew and differentiate into post-mitotic blood cells are not fully known. To understand these molecular pathways, we investigated novel genes expressed in hematopoietic-supportive cell lines from the zebrafish (Danio rerio), a model system increasingly utilized to uncover molecular pathways important in the development of other vertebrate species. We performed RNA sequencing of the transcriptome of three stromal cell lines derived from different stages of embryonic and adult zebrafish and identified hundreds of highly expressed transcripts. For our studies, we focused on isthmin 1 (ism1) due to its shared synteny with its human gene ortholog and because it is a secreted protein. To characterize ism1, we performed loss-of-function experiments to identify if mature blood cell production was disrupted. Myeloid and erythroid lineages were visualized and scored with transgenic zebrafish expressing lineage-specific markers. ism1 knockdown led to reduced numbers of neutrophils, macrophages, and erythrocytes. Analysis of clonal methylcellulose assays from ism1 morphants also showed a reduction in total hematopoietic stem and progenitor cells (HSPCs). Overall, we demonstrate that ism1 is required for normal generation of HSPCs and their downstream progeny during zebrafish hematopoiesis. Further investigation into ism1 and its importance in hematopoiesis may elucidate evolutionarily conserved processes in blood formation that can be further investigated for potential clinical utility.

  11. Isthmin 1 (ism1) is required for normal hematopoiesis in developing zebrafish

    Science.gov (United States)

    Berrun, Arturo; Harris, Elena

    2018-01-01

    Hematopoiesis is an essential and highly regulated biological process that begins with hematopoietic stem cells (HSCs). In healthy organisms, HSCs are responsible for generating a multitude of mature blood cells every day, yet the molecular pathways that instruct HSCs to self-renew and differentiate into post-mitotic blood cells are not fully known. To understand these molecular pathways, we investigated novel genes expressed in hematopoietic-supportive cell lines from the zebrafish (Danio rerio), a model system increasingly utilized to uncover molecular pathways important in the development of other vertebrate species. We performed RNA sequencing of the transcriptome of three stromal cell lines derived from different stages of embryonic and adult zebrafish and identified hundreds of highly expressed transcripts. For our studies, we focused on isthmin 1 (ism1) due to its shared synteny with its human gene ortholog and because it is a secreted protein. To characterize ism1, we performed loss-of-function experiments to identify if mature blood cell production was disrupted. Myeloid and erythroid lineages were visualized and scored with transgenic zebrafish expressing lineage-specific markers. ism1 knockdown led to reduced numbers of neutrophils, macrophages, and erythrocytes. Analysis of clonal methylcellulose assays from ism1 morphants also showed a reduction in total hematopoietic stem and progenitor cells (HSPCs). Overall, we demonstrate that ism1 is required for normal generation of HSPCs and their downstream progeny during zebrafish hematopoiesis. Further investigation into ism1 and its importance in hematopoiesis may elucidate evolutionarily conserved processes in blood formation that can be further investigated for potential clinical utility. PMID:29758043

  12. Instrument development in the measurement of unsupported arm exercise endurance in normal adult subjects.

    Science.gov (United States)

    Breslin, E H; Adams, E; Lutz, A; Roy, C

    1993-06-01

    Many daily activities, from basic grooming to employment tasks, require adequate unsupported arm endurance (UAE). We developed an electromechanical device to measure UAE endurance. The purpose of this study was to standardize the instrument for two rates of arm motion, moderate and slow, in 18 normal adult subjects (FEVI = 3.7L +/- .78, FVC = 4.2L +/- .74, FEV1/FVC = 1.1 +/- .08). Exercise endurance limits, and the following metabolic, ventilatory, and sensation responses were determined at rest prior to exercise and at end-exercise limits for both rates of UAE:minute ventilation (Ve), tidal volume (VT), respiratory rate (RR), duty cycle (Ti/Ttot), oxygen uptake (VO2), carbon dioxide production (VCO2), inspiratory flow (VT/Ti), heart rate (HR), and visual analog scale measurements (VAS) of dyspnea (D), respiratory effort (RE), and arm fatigue (AF). Significance increases from baseline rest were shown at the endurance limits for both rates of UAE in: VO2, VCO2, Ve, VT, RR, VT/Ti, HR, VAS-D, VAS-RE, and VAS-AF. There were no changes in Ti/Ttot and SaO2 with UAE. Peak VO2, RR, Ve, VT/Ti, and VAS-D with moderate exercise were significantly greater than slow UAE; and there was a trend increase in peak HR for moderate as opposed to slow rate UAE. Despite these differences, the endurance time between the two rates of UAE were similar. These data provide standards against which UAE in COPD can be evaluated.

  13. Supervised learning classification models for prediction of plant virus encoded RNA silencing suppressors.

    Directory of Open Access Journals (Sweden)

    Zeenia Jagga

    Full Text Available Viral encoded RNA silencing suppressor proteins interfere with the host RNA silencing machinery, facilitating viral infection by evading host immunity. In plant hosts, the viral proteins have several basic science implications and biotechnology applications. However in silico identification of these proteins is limited by their high sequence diversity. In this study we developed supervised learning based classification models for plant viral RNA silencing suppressor proteins in plant viruses. We developed four classifiers based on supervised learning algorithms: J48, Random Forest, LibSVM and Naïve Bayes algorithms, with enriched model learning by correlation based feature selection. Structural and physicochemical features calculated for experimentally verified primary protein sequences were used to train the classifiers. The training features include amino acid composition; auto correlation coefficients; composition, transition, and distribution of various physicochemical properties; and pseudo amino acid composition. Performance analysis of predictive models based on 10 fold cross-validation and independent data testing revealed that the Random Forest based model was the best and achieved 86.11% overall accuracy and 86.22% balanced accuracy with a remarkably high area under the Receivers Operating Characteristic curve of 0.95 to predict viral RNA silencing suppressor proteins. The prediction models for plant viral RNA silencing suppressors can potentially aid identification of novel viral RNA silencing suppressors, which will provide valuable insights into the mechanism of RNA silencing and could be further explored as potential targets for designing novel antiviral therapeutics. Also, the key subset of identified optimal features may help in determining compositional patterns in the viral proteins which are important determinants for RNA silencing suppressor activities. The best prediction model developed in the study is available as a

  14. A Developmental Study of Static Postural Control and Superimposed Arm Movements in Normal and Slowly Developing Children.

    Science.gov (United States)

    Fisher, Janet M.

    Selected electromyographic parameters underlying static postural control in 4, 6, and 8 year old normally and slowly developing children during performance of selected arm movements were studied. Developmental delays in balance control were assessed by the Cashin Test of Motor Development (1974) and/or the Williams Gross Motor Coordination Test…

  15. A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes

    KAUST Repository

    Jin, Hailing; Zhu, Jian-Kang

    2010-01-01

    RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904-915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host's essential effector of RNA silencing. Several GW motif-containing cellular proteins are known to be important partners of AGOs in RNA silencing effector complexes in yeast, plants, and animals. The GW motif appears to be a versatile and effective tool for regulating the activities of RNA silencing pathways, and the use of GW mimicry to compete for and inhibit host AGOs may be a strategy used by many pathogens to counteract host RNAi-based defenses. © 2010 by Cold Spring Harbor Laboratory Press.

  16. A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes

    KAUST Repository

    Jin, Hailing

    2010-05-01

    RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904-915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host\\'s essential effector of RNA silencing. Several GW motif-containing cellular proteins are known to be important partners of AGOs in RNA silencing effector complexes in yeast, plants, and animals. The GW motif appears to be a versatile and effective tool for regulating the activities of RNA silencing pathways, and the use of GW mimicry to compete for and inhibit host AGOs may be a strategy used by many pathogens to counteract host RNAi-based defenses. © 2010 by Cold Spring Harbor Laboratory Press.

  17. Subsequent development of the normal temperature fusion reaction. Joon kakuyugo sonogo no shinten

    Energy Technology Data Exchange (ETDEWEB)

    Matsumoto, T. (Hokkaido University, Sapporo (Japan). Faculty of Engineering)

    1991-04-24

    This paper reports on a NATTOH model made public in May 1989 by T. Matsumoto who took notice of abnormality of the normal temperature fusion reaction. The NATTO model is based on a chain reaction by hydrogen with a hydrogen-catalyzed fusion reaction which is the normal temperature fusion reaction as an elementary process. If a high temperature fusion reaction is a small-size simulation of the fusion reaction rising on the surface of the sparkling star like the sun, the normal temperature fusion reaction can be a small-size simulation of the phenomena in the last years of the star in the far distance of the space. This gives reality to the normal temperature fusion reaction. The reaction mechanism of the normal temperature fusion reaction is almost being clarified by a NATTOH model. There remain problems on a possibility of generation of unknown radioactive rays and identification of radioactive wastes, but it seems that a prospect of commercialization can be talked about now. As for the utilization as energy, sea water may be used as it is. 10 ref., 5 figs.

  18. Normal tissue damage in radiotherapy development of a clinical audit tool

    International Nuclear Information System (INIS)

    Barrett, A.

    2001-01-01

    Radiotherapy treatments are evaluated by two main outcomes, rates of cure or local tumour control and normal tissue complication rates. Many excellent schemes have been devised for recording the late effects of radiotherapy treatments including the RTOG and LENT SOMA Scales. These have proved invaluable in documenting the outcome of clinical trials, but have proved too complex and time consuming for routine daily use in busy departments. A group in Eindhoven led by Professor Lybeert undertook a pilot study of a potential way of auditing late radiation complications. Using a simplified form derived from the LENT SOMA scales, they collected data on grade 3 and 4 complications in a total of 675 patients and were able to correlate a number of particular complications with specific protocols, ICD codes and physician practice. Further review of the case records made it possible to identify specific factors which may have led to toxicity and could be taken into account to modify treatment protocols. From September 1999 clinicians in participating centres undertaking normal follow-up procedures were asked to identify patients who showed evidence of grade 3 or 4 toxicity as defined in the pro-forma. Date of radiotherapy was recorded so that a temporal correlation of complication with treatment could be made, but this study did not attempt to assess the incidence of complications, but to provide a cross-sectional study of prevalence. Centres participating in the study have been Eindhoven, Koeln, Gent, Brussels, Glasgow, Mount Vernon, Madrid, Geneva and Lyon. In Eindhoven 651 reports were collected between January 1995 and December 1999. 89 reports had to be discarded because complications were not validated by the reviewing radiotherapists. Dr Lybeert noticed that individual radiotherapists appeared to have different thresholds for reporting specific complications. 13 patients deaths appeared to be related to radiation problems. An overall level of detection of morbidity was

  19. Development of a reactive silencer for turbocompressors

    NARCIS (Netherlands)

    González Díez, N.; Smeulers, J.P.M.; Meulendijks, D.; König, S.

    2013-01-01

    Turbo compressors can generate tonal noise in a frequency range of 1000 to 5000 Hz, which may cause nuisance in the environment where the machine is installed. The cause of this tonal noise is the interaction between the flow and the rotating blades inside the compressor. The noise is transmitted

  20. Monocular and binocular development in children with albinism, infantile nystagmus syndrome, and normal vision.

    Science.gov (United States)

    Huurneman, Bianca; Boonstra, F Nienke

    2013-12-01

    To compare interocular acuity differences, crowding ratios, and binocular summation ratios in 4- to 8-year-old children with albinism (n = 16), children with infantile nystagmus syndrome (n = 10), and children with normal vision (n = 72). Interocular acuity differences and binocular summation ratios were compared between groups. Crowding ratios were calculated by dividing the single Landolt C decimal acuity with the crowded Landolt C decimal acuity mono- and binocularly. A linear regression analysis was conducted to investigate the contribution of 5 predictors to the monocular and binocular crowding ratio: nystagmus amplitude, nystagmus frequency, strabismus, astigmatism, and anisometropia. Crowding ratios were higher under mono- and binocular viewing conditions for children with infantile nystagmus syndrome than for children with normal vision. Children with albinism showed higher crowding ratios in their poorer eye and under binocular viewing conditions than children with normal vision. Children with albinism and children with infantile nystagmus syndrome showed larger interocular acuity differences than children with normal vision (0.1 logMAR in our clinical groups and 0.0 logMAR in children with normal vision). Binocular summation ratios did not differ between groups. Strabismus and nystagmus amplitude predicted the crowding ratio in the poorer eye (p = 0.015 and p = 0.005, respectively). The crowding ratio in the better eye showed a marginally significant relation with nystagmus frequency and depth of anisometropia (p = 0.082 and p = 0.070, respectively). The binocular crowding ratio was not predicted by any of the variables. Children with albinism and children with infantile nystagmus syndrome show larger interocular acuity differences than children with normal vision. Strabismus and nystagmus amplitude are significant predictors of the crowding ratio in the poorer eye.

  1. Developing TOPSIS method using statistical normalization for selecting knowledge management strategies

    Directory of Open Access Journals (Sweden)

    Amin Zadeh Sarraf

    2013-09-01

    Full Text Available Purpose: Numerous companies are expecting their knowledge management (KM to be performed effectively in order to leverage and transform the knowledge into competitive advantages. However, here raises a critical issue of how companies can better evaluate and select a favorable KM strategy prior to a successful KM implementation. Design/methodology/approach: An extension of TOPSIS, a multi-attribute decision making (MADM technique, to a group decision environment is investigated. TOPSIS is a practical and useful technique for ranking and selection of a number of externally determined alternatives through distance measures. The entropy method is often used for assessing weights in the TOPSIS method. Entropy in information theory is a criterion uses for measuring the amount of disorder represented by a discrete probability distribution. According to decrease resistance degree of employees opposite of implementing a new strategy, it seems necessary to spot all managers’ opinion. The normal distribution considered the most prominent probability distribution in statistics is used to normalize gathered data. Findings: The results of this study show that by considering 6 criteria for alternatives Evaluation, the most appropriate KM strategy to implement  in our company was ‘‘Personalization’’. Research limitations/implications: In this research, there are some assumptions that might affect the accuracy of the approach such as normal distribution of sample and community. These assumptions can be changed in future work. Originality/value: This paper proposes an effective solution based on combined entropy and TOPSIS approach to help companies that need to evaluate and select KM strategies. In represented solution, opinions of all managers is gathered and normalized by using standard normal distribution and central limit theorem. Keywords: Knowledge management; strategy; TOPSIS; Normal distribution; entropy

  2. Histological versus stereological methods applied at spermatogonia during normal human development

    DEFF Research Database (Denmark)

    Cortes, Dina

    1990-01-01

    The number of spermatogonia per tubular transverse section (S/T), and the percentage of seminiferous tubulus containing spermatogonia (the fertility index (FI] were measured in 40 pairs of normal autopsy testes aged 28 weeks of gestation-40 years. S/T and FI showed similar changes during the whol...

  3. Monocular and binocular development in children with albinism, infantile nystagmus syndrome and normal vision

    NARCIS (Netherlands)

    Huurneman, B.; Boonstra, F.N.

    2013-01-01

    Background/aims: To compare interocular acuity differences, crowding ratios, and binocular summation ratios in 4- to 8-year-old children with albinism (n = 16), children with infantile nystagmus syndrome (n = 10), and children with normal vision (n = 72). Methods: Interocular acuity differences and

  4. Monocular and binocular development in children with albinism, infantile nystagmus syndrome, and normal vision

    NARCIS (Netherlands)

    Huurneman, B.; Boonstra, F.N.

    2013-01-01

    Abstract Background/aims: To compare interocular acuity differences, crowding ratios, and binocular summation ratios in 4- to 8-year-old children with albinism (n = 16), children with infantile nystagmus syndrome (n = 10), and children with normal vision (n = 72). Methods: Interocular acuity

  5. Psychosocial Adaptation of Fathers of Children with Autism, Down Syndrome, and Normal Development.

    Science.gov (United States)

    Rodrigue, James R.; And Others

    1992-01-01

    This study compared fathers of 20 autistic, 20 Down's syndrome, and 20 developmentally normal children on measures of psychosocial adaptation. Groups differed on measures of intrapersonal and family functioning but not on social-ecological variables. There were few differences between fathers of children with autism and those of children with…

  6. The effects of environmental deuterium on normal and neoplastic cultured cell development

    International Nuclear Information System (INIS)

    Bild, W.; Schuller, T.; Zhihai, Qin; Blankenstein, T.; Nastasa, V.; Haulica, I.

    2000-01-01

    The powdered culture media (RPMI - 1640) were reconstituted either with normal distilled water (150 ppm deuterium) either with deuterium - depleted water (DDW) in various concentrations (30, 60, 90 ppm) and sterilized by filtration with 0.2 μm filters. The cell lines used were NIH (normal mouse fibroblasts), RAG (mouse renal carcinoma) and TS/A (mouse mammary adenocarcinoma). In auxiliary tests, BAIBC mouse splenocytes in direct culture were used, stimulated for growth with concanavalin A or LPS (bacterial lipopolysaccharide). The estimation of the growth was made using the MTT assay or direct counting with trypan blue exclusion. The following results were obtained: Deuterium - depleted water had a stimulating effect on cell growth, the most important stimulating action being from the 90 ppm deuterium-water. The growth curves show, in a first phase, a stimulation of the rapid -growing neoplastic cells, followed by a slower growth of the normal cells. Amiloride 100 mM blocking of the Na + /K + membrane pump did not affect the cell growth curves, while the lansoprazole 100 mM blocking of the K + /H + ATP-ase brought the growth curves at the level of those with normal water. This might show an eventual involvement of the K + /H + antiport in the stimulating effects of the DDW. (authors)

  7. Development of Planning Abilities in Normal Aging: Differential Effects of Specific Cognitive Demands

    Science.gov (United States)

    Köstering, Lena; Stahl, Christoph; Leonhart, Rainer; Weiller, Cornelius; Kaller, Christoph P.

    2014-01-01

    In line with the frontal hypothesis of aging, the ability to plan ahead undergoes substantial change during normal aging. Although impairments on the Tower of London planning task were reported earlier, associations between age-related declines and specific cognitive demands on planning have not been studied. Here we investigated the impact of…

  8. NEUROLOGICAL DEVELOPMENT DURING TODDLING AGE IN NORMAL-CHILDREN AND CHILDREN AT RISK OF DEVELOPMENTAL DISORDERS

    NARCIS (Netherlands)

    HEMPEL, MS

    Toddling age (1.5-4 years) is a period in which the quality rather than the quantity of motor functions changes. We examined 305 normal and 43 so called 'risk' children with an examination technique which concentrates on observations of motor functions (grasping, sitting, crawling, standing and

  9. Engineering nanoparticles to silence bacterial communication

    Directory of Open Access Journals (Sweden)

    Kristen Publicover Miller

    2015-03-01

    Full Text Available The alarming spread of bacterial resistance to traditional antibiotics has warranted the study of alternative antimicrobial agents. Quorum sensing is a chemical cell-to-cell communication mechanism utilized by bacteria to coordinate group behaviors and establish infections. Quorum sensing is integral to bacterial survival, and therefore provides a unique target for antimicrobial therapy. In this study, silicon dioxide nanoparticles (Si-NP were engineered to target the signaling molecules (i.e. acylhomoserine lactones (HSL used for quorum sensing in order to halt bacterial communication. Specifically, when Si-NP were surface functionalized with beta-cyclodextrin (beta-CD, then added to cultures of bacteria (Vibrio fischeri, whose luminous output depends upon HSL-mediated quorum sensing, the cell-to-cell communication was dramatically reduced. Reductions in luminescence were further verified by quantitative polymerase chain reaction (qPCR analyses of luminescence genes. Binding of AHLs to Si-NPs was examined using nuclear magnetic resonance (NMR spectroscopy. The results indicated that by delivering high concentrations of engineered NPs with associated quenching compounds, the chemical signals were removed from the immediate bacterial environment. In actively-metabolizing cultures, this treatment blocked the ability of bacteria to communicate and regulate quorum sensing, effectively silencing and isolating the cells. Si-NPs provide a scaffold and critical stepping-stone for more pointed developments in antimicrobial therapy, especially with regard to quorum sensing – a target that will reduce resistance pressures imposed by traditional antibiotics.

  10. Habilidades de resolução de conflito e ocorrência de disfluências comuns em crianças em desenvolvimento normal de linguagem Conflict resolution abilities and normal disfluencies in normally developing children

    Directory of Open Access Journals (Sweden)

    Debora Maria Befi-Lopes

    2008-01-01

    Full Text Available OBJETIVOS: (1 Investigar as habilidades de resolução de conflito (RC de crianças em idade escolar; (2 Verificar a relação entre a ocorrência de disfluências comuns (DC e o desenvolvimento das habilidades de RC. MÉTODOS: Participaram do estudo 20 crianças em desenvolvimento normal de linguagem, com idades entre sete e dez anos. As crianças foram submetidas a uma triagem, na qual foram realizadas as provas de Fonologia, Consciência Fonológica e Leitura e Escrita; aquelas que obtiveram desempenho esperado para sua faixa etária passaram por avaliação, sendo realizadas as provas de RC e de Fluência. Na prova de RC, as respostas foram categorizadas em 28 categorias, para então, serem pontuadas. Na prova de fluência, foi verificada a ocorrência de DC. RESULTADOS: Na prova de RC, as crianças obtiveram entre 5 e 14 pontos (M=10,7, porém não se observou correlação entre a pontuação total e a idade cronológica (p=0,361. Na prova de Fluência, a ocorrência de DC variou de 4 a 24 (M=10. Observou-se que não há correlação estatística significante entre a pontuação na prova de RC e a ocorrência de DC (p=0,899. CONCLUSÕES: Na prova de RC, as crianças utilizaram principalmente estratégias unilaterais para a resolução dos conflitos e as estratégias não se tornaram mais sofisticadas com o passar da idade. Ao comparar o desempenho das crianças na prova de RC à ocorrência de DC, não foi possível estabelecer relação direta entre as duas variáveis.PURPOSE: The aims of this study were: (1 to investigate conflict resolution (CR abilities in normally developing school-aged children; (2 to verify whether there is a relationship between the occurrence of normal disfluencies (ND and the development of conflict resolution abilities. METHODS: Twenty normally developing children, whose ages ranged between seven and ten, participated in this study. The participants underwent a language screening test, covering the following

  11. Smuggling gold nanoparticles across cell types - A new role for exosomes in gene silencing.

    Science.gov (United States)

    Roma-Rodrigues, Catarina; Pereira, Francisca; Alves de Matos, António P; Fernandes, Marta; Baptista, Pedro V; Fernandes, Alexandra R

    2017-05-01

    Once released to the extracellular space, exosomes enable the transfer of proteins, lipids and RNA between different cells, being able to modulate the recipient cells' phenotypes. Members of the Rab small GTP-binding protein family, such as RAB27A, are responsible for the coordination of several steps in vesicle trafficking, including budding, mobility, docking and fusion. The use of gold nanoparticles (AuNPs) for gene silencing is considered a cutting-edge technology. Here, AuNPs were functionalized with thiolated oligonucleotides anti-RAB27A (AuNP@PEG@anti-RAB27A) for selective silencing of the gene with a consequent decrease of exosomes´ release by MCF-7 and MDA-MB-453 cells. Furthermore, communication between tumor and normal cells was observed both in terms of alterations in c-Myc gene expression and transportation of the AuNPs, mediating gene silencing in secondary cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Organizational Silence, from Roots to Solutions: A Case Study in Iran Petroleum Industry

    Directory of Open Access Journals (Sweden)

    Mehdi Afkhami Ardakani

    2015-05-01

    Full Text Available Organizational silence is defined as the lack of effective interactions among staff and it stands opposite to the concept of organizational voice. In the present research, the purpose is to measure the silence behavior among the Research Institute of Petroleum Industry (RIPI staff before and after the implementation of a comprehensive suggestion system. A suggestion system is an internal structure easily accessed by all the staff to state their suggestions in a pre-structured format. The roots of silence behavior are studied based on a deep literature review to find out possible solutions to improve organizational voice. To conduct the research, a self-structured questionnaire has been developed and distributed among all the staff. A quasi-experimental methodology has been adopted to compare pretest and post-test results of silence status before and after implementing the suggestion system. The results show that the silence behavior has been meaningfully reduced. This is based on a simple t-test performed by SPSS software, where there is a meaningful difference between the silence status of pre-test and post-test. In other words, a suggestion system could be a communication opportunity to encourage staff to provide suggestions and to cooperate for promoting the organization, which will finally reduce the organization silence. A major gap within the studies of Iranian scholars about organizational silence is the failure to introduce effective solutions to reduce it. However, this research is innovative in the sense that it fills the mentioned gap. This research shows that large scale organizations like RIPI need to consider methods like suggestion systems to break bureaucratic obstacles so that their staff can easily find open routes to share their ideas and suggestions in a prestructured format. This cooperating will lead to mutual benefits for both parts, since suggestions could be used to enhance organizational structure and performance and

  13. Silencing the epigenetic silencer KDM4A for TRAIL and DR5 simultaneous induction and antitumor therapy.

    Science.gov (United States)

    Wang, Junjian; Wang, Haibin; Wang, Ling-Yu; Cai, Demin; Duan, Zhijian; Zhang, Yanhong; Chen, Peng; Zou, June X; Xu, Jianzhen; Chen, Xinbin; Kung, Hsing-Jien; Chen, Hong-Wu

    2016-11-01

    Recombinant TRAIL and agonistic antibodies to death receptors (DRs) have been in clinical trial but displayed limited anti-cancer efficacy. Lack of functional DR expression in tumors is a major limiting factor. We report here that chromatin regulator KDM4A/JMJD2A, not KDM4B, has a pivotal role in silencing tumor cell expression of both TRAIL and its receptor DR5. In TRAIL-sensitive and -resistant cancer cells of lung, breast and prostate, KDM4A small-molecule inhibitor compound-4 (C-4) or gene silencing strongly induces TRAIL and DR5 expression, and causes TRAIL-dependent apoptotic cell death. KDM4A inhibition also strongly sensitizes cells to TRAIL. C-4 alone potently inhibits tumor growth with marked induction of TRAIL and DR5 expression in the treated tumors and effectively sensitizes them to the newly developed TRAIL-inducer ONC201. Mechanistically, C-4 does not appear to act through the Akt-ERK-FOXO3a pathway. Instead, it switches histone modifying enzyme complexes at promoters of TRAIL and DR5 transcriptional activator CHOP gene by dissociating KDM4A and nuclear receptor corepressor (NCoR)-HDAC complex and inducing the recruitment of histone acetylase CBP. Thus, our results reveal KDM4A as a key epigenetic silencer of TRAIL and DR5 in tumors and establish inhibitors of KDM4A as a novel strategy for effectively sensitizing tumors to TRAIL pathway-based therapeutics.

  14. Implicit Attitudes towards Children with Autism versus Normally Developing Children as Predictors of Professional Burnout and Psychopathology

    Science.gov (United States)

    Kelly, Amanda; Barnes-Holmes, Dermot

    2013-01-01

    Tutors trained in applied behaviour analysis (n = 16) and mainstream school teachers (n = 16) were exposed to an Implicit Relational Assessment Procedure (IRAP) designed to assess implicit attitudes towards individuals with autism versus normally developing individuals. Participants also completed a range of explicit measures, including measures…

  15. Post-transcriptional silencing of flavonol synthase mRNA in tobacco leads to fruits with arrested seed set.

    Directory of Open Access Journals (Sweden)

    Monika Mahajan

    Full Text Available Flavonoids are synthesized by phenylpropanoid pathway. They are known to participate in large number of physiological and biochemical processes in plants. Parthenocarpy and male sterility has earlier been reported by silencing chalcone synthase (CHS encoding gene. Silencing of CHS has blocked the synthesis of most of useful flavonoids including flavan-3-ols and flavonols. Also, these studies could not identify whether parthenocarpy/male sterility were due to lack of flavan-3-ols or flavonols or both. Flavonol synthase (FLS is an important enzyme of flavonoid pathway that catalyzes the formation of flavonols. In this article, we propose a novel strategy towards the generation of seedless or less-seeded fruits by downregulation of flavonol biosynthesis in tobacco (Nicotiana tabacum cv Xanthi through post-transcriptional gene silencing (PTGS of FLS encoding mRNA. The FLS silenced lines were observed for 20-80% reduction in FLS encoding gene expression and 25-93% reduction in flavonol (quercetin content. Interestingly, these FLS silenced tobacco lines also showed reduction in their anthocyanidins content. While the content of flavan-3-ols (catechin, epi-catechin and epi-gallocatechin was found to be increased in FLS silenced lines. The delayed flowering in FLS silenced lines could be due to decrease in level of indole acetic acid (IAA at apical region of their shoots. Furthermore, the pollen germination was hampered and pollens were unable to produce functional pollen tube in FLS silenced tobacco lines. Pods of FLS silenced lines contained significantly less number of seeds. The in vitro and in vivo studies where 1 µM quercetin was supplied to germination media, documented the restoration of normal pollen germination and pollen tube growth. This finding identified the role of flavonols particularly quercetin in pollen germination as well as in the regulation of plant fertility. Results also suggest a novel approach towards generation of seedless

  16. Active compressor engine silencer reduces exhaust noise

    International Nuclear Information System (INIS)

    Denenberg, J.N.; Miller, S.K.; Jay, M.A.

    1994-01-01

    An active industrial silencer on a compressor engine at a Tenneco Gas station has reduced low-frequency 'rumbling' noise by 8 dB during trials while lowering backpressure about 90$. This 8 dB reduction of the piston firing frequency corresponds to a more than 80% decrease in emitted acoustic power. The silencing unit, installed on one of six engines at the station near Eden, N.Y., continues in operation. Based on the results, the manufacturer is identifying additional compressor sites for further tests. This paper reviews this project

  17. Cardiometabolic risks profile of normal weight obese and multi-ethnic women in a developing country.

    Science.gov (United States)

    Moy, Foong Ming; Loh, Debbie Ann

    2015-07-01

    To determine the prevalence of normal weight obesity among multi-ethnic women in Peninsular Malaysia and examine its associations with cardiometabolic risks and lifestyle behaviours. This was a cross-sectional study involving women recruited via multi-stage sampling from six states in Malaysia. Anthropometric and body composition analysis were performed. Normal weight obese (NWO) was defined as normal body mass index for Asians and the highest tertile of % body fat (BF). Biochemical measurements included fasting lipid and blood glucose levels. Metabolic syndrome was diagnosed based on the Harmonization criteria. Participants completed self-reported questionnaires that included physical activity, smoking, alcohol consumption, fruit and vegetable intake and sleep duration. Body mass index, %BF, cardiometabolic risk factors, lifestyle behaviours. A total of 6854 women were recruited and the prevalence of NWO was 19.8% (95% CI: 17.3-22.5). NWO was more prevalent among the Indians and older women. NWO women had higher odds for abdominal obesity (OR: 2.64, 95% CI: 1.73-4.04), hypertriglyceridemia (2.51, 1.47-4.29) and hypertension (1.63, 1.15-2.31) compared to women with lower % body fat after adjusted for age and ethnicity. The prevalence of metabolic syndrome among NWO women was 5.4% (95% CI: 3.0-9.8). None of the lifestyle behaviours were significantly associated with NWO. Women with NWO had cardiometabolic abnormalities including abdominal obesity, dyslipidaemia and increased blood pressure. Health promotion efforts should include NWO women who may be oblivious of their deleterious health risks. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  18. Expression of anti-Müllerian hormone during normal and pathological gonadal development

    DEFF Research Database (Denmark)

    Rajpert-De Meyts, E; Jørgensen, N; Graem, N

    1999-01-01

    an inhibitory effect on AMH. However, in adolescent boys lacking germ cells because of cancer treatment and in a majority of infertile adult men with idiopathic germ cell aplasia, AMH expression was also down-regulated despite the complete lack of spermatogenesis. The decrease in AMH expression thus reflects...... expression of AMH was observed in a 20-yr-old 46,XY female with androgen insensitivity syndrome, who retained prepubertal testicular morphology. In normal testes, the switch-off of AMH expression was usually associated with the appearance of primary spermatocytes, suggesting that their presence had...

  19. Histological versus stereological methods applied at spermatogonia during normal human development

    DEFF Research Database (Denmark)

    Cortes, D

    1990-01-01

    The number of spermatogonia per tubular transverse section (S/T), and the percentage of seminiferous tubulus containing spermatogonia (the fertility index (FI] were measured in 40 pairs of normal autopsy testes aged 28 weeks of gestation-40 years. S/T and FI showed similar changes during the whole...... period, and were minimal between 1 and 4 years. The number of spermatogonia per testis (S/testis) and the number of spermatogonia per cm3 testis tissue (S/cm3) were estimated by stereological methods in the same testes. S/T and FI respectively were significantly correlated both to S/testis and S/cm3. So...

  20. Automatic development of normal zone in composite MgB2/CuNi wires with different diameters

    Science.gov (United States)

    Jokinen, A.; Kajikawa, K.; Takahashi, M.; Okada, M.

    2010-06-01

    One of the promising applications with superconducting technology for hydrogen utilization is a sensor with a magnesium-diboride (MgB2) superconductor to detect the position of boundary between the liquid hydrogen and the evaporated gas stored in a Dewar vessel. In our previous experiment for the level sensor, the normal zone has been automatically developed and therefore any energy input with the heater has not been required for normal operation. Although the physical mechanism for such a property of the MgB2 wire has not been clarified yet, the deliberate application might lead to the realization of a simpler superconducting level sensor without heater system. In the present study, the automatic development of normal zone with increasing a transport current is evaluated for samples consisting of three kinds of MgB2 wires with CuNi sheath and different diameters immersed in liquid helium. The influences of the repeats of current excitation and heat cycle on the normal zone development are discussed experimentally. The aim of this paper is to confirm the suitability of MgB2 wire in a heater free level sensor application. This could lead to even more optimized design of the liquid hydrogen level sensor and the removal of extra heater input.

  1. Tractography of the corticospinal tracts in infants with focal perinatal injury: comparison with normal controls and to motor development

    International Nuclear Information System (INIS)

    Roze, Elise; Harris, Polly A.; Ball, Gareth; Braga, Rodrigo M.; Allsop, Joanna M.; Counsell, Serena J.; Elorza, Leire Zubiaurre; Merchant, Nazakat; Arichi, Tomoki; Edwards, A.D.; Cowan, Frances M.; Porter, Emma; Rutherford, Mary A.

    2012-01-01

    Our aims were to (1) assess the corticospinal tracts (CSTs) in infants with focal injury and healthy term controls using probabilistic tractography and (2) to correlate the conventional magnetic resonance imaging (MRI) and tractography findings in infants with focal injury with their later motor function. We studied 20 infants with focal lesions and 23 controls using MRI and diffusion tensor imaging. Tract volume, fractional anisotropy (FA), apparent diffusion coefficient (ADC) values, axial diffusivity and radial diffusivity (RD) of the CSTs were determined. Asymmetry indices (AIs) were calculated by comparing ipsilateral to contralateral CSTs. Motor outcome was assessed using a standardized neurological examination. Conventional MRI was able to predict normal motor development (n = 9) or hemiplegia (n = 6). In children who developed a mild motor asymmetry (n = 5), conventional MRI predicted a hemiplegia in two and normal motor development in three infants. The AIs for tract volume, FA, ADC and RD showed a significant difference between controls and infants who developed a hemiplegia, and RD also showed a significant difference in AI between controls and infants who developed a mild asymmetry. Conventional MRI was able to predict subsequent normal motor development or hemiplegia following focal injury in newborn infants. Measures of RD obtained from diffusion tractography may offer additional information for predicting a subsequent asymmetry in motor function. (orig.)

  2. A study on the development of normal mandible in children by skeletal scintigraphy

    International Nuclear Information System (INIS)

    Gao Yiming; Qiu Weiliu; Shen Guofang; Tang Yousheng; Tian Weijia; Wang Hui; Feng Guowei; Pu Mingfang

    2000-01-01

    Objective: To study the developmental characters of the normal mandible in growing children. Methods: Twenty growing children undergoing skeletal scintigraphic study for isolated bone disease other than bones of the head and neck at hospital and turned out with normal results finally were studied. The 99 Tc m -MDP uptakes in the mandibular condyle, ramus, body and the fourth lumbar vertebra in these cases were quantitated and a ratio of the uptake in the three mandibular regions to that in the fourth lumbar vertebra was obtained. Results: The analysis results showed that the 99 Tc m -MDP uptake ratios of the three mandibular regions decreased in linear fashion with age increasing and leveled off after age of 20. The regression equations are: the mandibular condyle, Y-circumflex = -0.052 2X + 1.792 8; the mandibular ramus, Y-circumflex = -0.015 1X + 0.766 7; the mandibular body, Y-circumflex = -0.014 2X + 0.741 0. There was no significant difference of the 99 Tc m -MDP uptake ratio between the two sides of the mandible and between the male and female. Conclusion: The results suggest that the ideal time to undergo orthognathic surgery should be at the age of 20 or so if the circumstance of the deformity is not quite clear

  3. Normal development of brainstem in childhood. Measurement of the area on mid-sagittal MR imaging

    Energy Technology Data Exchange (ETDEWEB)

    Kutomi, Kimiko [Teikyo Univ., Tokyo (Japan). Faculty of Medicine

    2005-05-01

    Developmental abnormality of brainstem is shown in pediatric patients with mental retardation, autism, periventricular leukomalacia, neurodegenerative disease, and so on. Our purpose here is to clarify the normal developmental pattern of the brainstem. We measured the area of tectum, midbrain tegmentum, pons, basis pontis and pontine tegmentum on mid-sagittal MR images in 111 children (newborn to 20 year old). Different growth patterns were shown in all parts of the brainstem. Tectum showed a subtle increase in area from the newborn to adult period, while midbrain tegmentum and pontine tegmenturn showed a mild and gradual increase in area. Pons and pontine tegmentum showed a rapid and prominent increase in area from newborn to infant period and gradual increase in area until the adult period. These different growth patterns seemed to be consistent with differences in the myelination cycles of the neuronal fibers, maturation of the nuclei and proliferation of glial cells in each part of the brainstem. Mid-sagittal MR imaging of the head is accurate and reproducible and is used conveniently in routine head MR study, making it very useful for the diagnosis of many central nervous diseases and anomalies. We believe that this new milestone provided in this study will be helpful in distinguishing normal children from those that have neurodegenerative disorders. (author)

  4. Normal development of brainstem in childhood. Measurement of the area on mid-sagittal MR imaging

    International Nuclear Information System (INIS)

    Kutomi, Kimiko

    2005-01-01

    Developmental abnormality of brainstem is shown in pediatric patients with mental retardation, autism, periventricular leukomalacia, neurodegenerative disease, and so on. Our purpose here is to clarify the normal developmental pattern of the brainstem. We measured the area of tectum, midbrain tegmentum, pons, basis pontis and pontine tegmentum on mid-sagittal MR images in 111 children (newborn to 20 year old). Different growth patterns were shown in all parts of the brainstem. Tectum showed a subtle increase in area from the newborn to adult period, while midbrain tegmentum and pontine tegmenturn showed a mild and gradual increase in area. Pons and pontine tegmentum showed a rapid and prominent increase in area from newborn to infant period and gradual increase in area until the adult period. These different growth patterns seemed to be consistent with differences in the myelination cycles of the neuronal fibers, maturation of the nuclei and proliferation of glial cells in each part of the brainstem. Mid-sagittal MR imaging of the head is accurate and reproducible and is used conveniently in routine head MR study, making it very useful for the diagnosis of many central nervous diseases and anomalies. We believe that this new milestone provided in this study will be helpful in distinguishing normal children from those that have neurodegenerative disorders. (author)

  5. Suppressors of RNA silencing encoded by tomato leaf curl ...

    Indian Academy of Sciences (India)

    2013-01-06

    Jan 6, 2013 ... Virus encoded RNA-silencing suppressors (RSSs) are the key components evolved by the viruses to ... severe disease symptom in the host (Briddon et al. ..... Voinnet O 2001 RNA silencing as a plant immune system against.

  6. Surprised by Bird, Bard, and Bach: Language, Silence, and Transcendence.

    Science.gov (United States)

    Suhor, Charles

    1991-01-01

    Argues the importance of the relationships among silence and literature, the arts, and other experiences that point toward transcendence. Suggests that English teachers can expand the repertoire of classroom activities and teaching techniques that make use of silence. (KEH)

  7. Histone Methylation and Epigenetic Silencing in Breast Cancer

    National Research Council Canada - National Science Library

    Simon, Jeffrey A; Lange, Carol A

    2008-01-01

    .... EZH2 is a histone methyltransferase which modifies lysine-27 of histone H3 an epigenetic mark which is generally linked to gene silencing and is implicated in tumor suppressor silencing during breast cancer progression...

  8. Sexuality and 'silence' among Khasi youth of Meghalaya, Northeast India.

    Science.gov (United States)

    War, Ryntihlin Jennifer; Albert, Sandra

    2013-01-01

    The importance of sex education has been well documented in the literature, but there exists a lack of research involving indigenous youth in India. This paper describes perceptions, knowledge and attitudes towards sex education, sexuality, pre-marital sex, rape and homosexuality among indigenous students from the matrilineal Khasi tribe attending a university in Meghalaya in northeast India. Qualitative and quantitative data were collected during and after reproductive health, sexuality and life skills courses. Despite the impression of sexual permissiveness of indigenous peoples that exists in India, students reported a societal silence on issues related to sexuality. Lack of appropriate words in the indigenous language potentially contributes to this silence. Although co-habitation is common and culturally acceptable, students disapproved of pre-marital sex. The influence of Christianisation was also perceived in the frequent reference to sin and guilt associated with masturbation, homosexuality, pre-marital sex and abortion. Students reported that the sex education received in school was 'childish' and inadequate for their adult needs. Many had unrealistic images of what constituted 'normal' sex and also blamed women for rape. The majority of indigenous students expressed the need for non-judgmental fora for discussions on sexual health and for sexuality education.

  9. Decreased perfusion in myocardial region of normal donor artery secondary to collateral development

    International Nuclear Information System (INIS)

    Koga, Y.; Takahashi, M.; Kojima, A.; Takaki, Y.; Tomiguchi, S.; Hirota, Y.; Kugiyama, K.; Yasue, H.; Hayasaki, K.; Kumamoto Saiseikai Hospital

    1992-01-01

    Thirty-one patients suffering from single vessel exertional angina with collaterals (Group A) were evaluated by stress 201 Tl myocardial emission CT (Tl-SPECT) with 16 controls of severely stenotic single vessel exertional angina without collaterals (Group B). Group A included 21 patients (68%) who showed an extensive perfusion defect in double artery myocardial regions, including the normal donor artery myocardial region (DMR). However, there were no such cases in Group B, giving a significant difference between these 2 groups (p < 0.001). Four patients in Group A, having a perfusion defect both in DMR and in the collateral dependent myocardial region (CMR) underwent a successful percutaneous transluminal coronary angioplasty (PTCA) with disappearance of collaterals. Tl-SPECT findings after PTCA showed no perfusion defect either in CMR or in DMR. This has been explained on the basis that the coronary collaterals stole blood and produced perfusion defect in DMR. (orig.)

  10. Development of the Parent Form of the Preschool Children's Communication Skills Scale and Comparison of the Communication Skills of Children with Normal Development and with Autism Spectrum Disorder

    Science.gov (United States)

    Aydin, Aydan

    2016-01-01

    This study aims at developing an assessment scale for identifying preschool children's communication skills, at distinguishing children with communication deficiencies and at comparing the communication skills of children with normal development (ND) and those with autism spectrum disorder (ASD). Participants were 427 children of up to 6 years of…

  11. Silence in the second language classroom

    CERN Document Server

    King, J

    2013-01-01

    Why are second language learners in Japan's universities so silent? This book investigates the perplexing but intriguing phenomenon of classroom silence and draws on ideas from psychology, sociolinguistics and anthropology to offer a unique insight into the reasons why some learners are either unable or unwilling to speak in a foreign language.

  12. Veiled Word(s) – Sacred Silence

    DEFF Research Database (Denmark)

    Isar, Nicoletta

    2014-01-01

    or secret prayer, and divine silence, which are at the very centre of the Byzantine altar. The main focus is to investigate the liminal nature of the Mystery, manifested through concealing-revealing devices, which are thresholds in the liturgical participation of the Byzantine subject. Fear and secrecy...

  13. Developing a reference of normal lung sounds in healthy Peruvian children.

    Science.gov (United States)

    Ellington, Laura E; Emmanouilidou, Dimitra; Elhilali, Mounya; Gilman, Robert H; Tielsch, James M; Chavez, Miguel A; Marin-Concha, Julio; Figueroa, Dante; West, James; Checkley, William

    2014-10-01

    Lung auscultation has long been a standard of care for the diagnosis of respiratory diseases. Recent advances in electronic auscultation and signal processing have yet to find clinical acceptance; however, computerized lung sound analysis may be ideal for pediatric populations in settings, where skilled healthcare providers are commonly unavailable. We described features of normal lung sounds in young children using a novel signal processing approach to lay a foundation for identifying pathologic respiratory sounds. 186 healthy children with normal pulmonary exams and without respiratory complaints were enrolled at a tertiary care hospital in Lima, Peru. Lung sounds were recorded at eight thoracic sites using a digital stethoscope. 151 (81%) of the recordings were eligible for further analysis. Heavy-crying segments were automatically rejected and features extracted from spectral and temporal signal representations contributed to profiling of lung sounds. Mean age, height, and weight among study participants were 2.2 years (SD 1.4), 84.7 cm (SD 13.2), and 12.0 kg (SD 3.6), respectively; and, 47% were boys. We identified ten distinct spectral and spectro-temporal signal parameters and most demonstrated linear relationships with age, height, and weight, while no differences with genders were noted. Older children had a faster decaying spectrum than younger ones. Features like spectral peak width, lower-frequency Mel-frequency cepstral coefficients, and spectro-temporal modulations also showed variations with recording site. Lung sound extracted features varied significantly with child characteristics and lung site. A comparison with adult studies revealed differences in the extracted features for children. While sound-reduction techniques will improve analysis, we offer a novel, reproducible tool for sound analysis in real-world environments.

  14. Developing a Reference of Normal Lung Sounds in Healthy Peruvian Children

    Science.gov (United States)

    Ellington, Laura E.; Emmanouilidou, Dimitra; Elhilali, Mounya; Gilman, Robert H.; Tielsch, James M.; Chavez, Miguel A.; Marin-Concha, Julio; Figueroa, Dante; West, James

    2018-01-01

    Purpose Lung auscultation has long been a standard of care for the diagnosis of respiratory diseases. Recent advances in electronic auscultation and signal processing have yet to find clinical acceptance; however, computerized lung sound analysis may be ideal for pediatric populations in settings, where skilled healthcare providers are commonly unavailable. We described features of normal lung sounds in young children using a novel signal processing approach to lay a foundation for identifying pathologic respiratory sounds. Methods 186 healthy children with normal pulmonary exams and without respiratory complaints were enrolled at a tertiary care hospital in Lima, Peru. Lung sounds were recorded at eight thoracic sites using a digital stethoscope. 151 (81 %) of the recordings were eligible for further analysis. Heavy-crying segments were automatically rejected and features extracted from spectral and temporal signal representations contributed to profiling of lung sounds. Results Mean age, height, and weight among study participants were 2.2 years (SD 1.4), 84.7 cm (SD 13.2), and 12.0 kg (SD 3.6), respectively; and, 47 % were boys. We identified ten distinct spectral and spectro-temporal signal parameters and most demonstrated linear relationships with age, height, and weight, while no differences with genders were noted. Older children had a faster decaying spectrum than younger ones. Features like spectral peak width, lower-frequency Mel-frequency cepstral coefficients, and spectro-temporal modulations also showed variations with recording site. Conclusions Lung sound extracted features varied significantly with child characteristics and lung site. A comparison with adult studies revealed differences in the extracted features for children. While sound-reduction techniques will improve analysis, we offer a novel, reproducible tool for sound analysis in real-world environments. PMID:24943262

  15. FT overexpression induces precocious flowering and normal reproductive development in Eucalyptus.

    Science.gov (United States)

    Klocko, Amy L; Ma, Cathleen; Robertson, Sarah; Esfandiari, Elahe; Nilsson, Ove; Strauss, Steven H

    2016-02-01

    Eucalyptus trees are among the most important species for industrial forestry worldwide. However, as with most forest trees, flowering does not begin for one to several years after planting which can limit the rate of conventional and molecular breeding. To speed flowering, we transformed a Eucalyptus grandis × urophylla hybrid (SP7) with a variety of constructs that enable overexpression of FLOWERING LOCUS T (FT). We found that FT expression led to very early flowering, with events showing floral buds within 1-5 months of transplanting to the glasshouse. The most rapid flowering was observed when the cauliflower mosaic virus 35S promoter was used to drive the Arabidopsis thaliana FT gene (AtFT). Early flowering was also observed with AtFT overexpression from a 409S ubiquitin promoter and under heat induction conditions with Populus trichocarpa FT1 (PtFT1) under control of a heat-shock promoter. Early flowering trees grew robustly, but exhibited a highly branched phenotype compared to the strong apical dominance of nonflowering transgenic and control trees. AtFT-induced flowers were morphologically normal and produced viable pollen grains and viable self- and cross-pollinated seeds. Many self-seedlings inherited AtFT and flowered early. FT overexpression-induced flowering in Eucalyptus may be a valuable means for accelerating breeding and genetic studies as the transgene can be easily segregated away in progeny, restoring normal growth and form. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  16. The role of bed-parallel slip in the development of complex normal fault zones

    Science.gov (United States)

    Delogkos, Efstratios; Childs, Conrad; Manzocchi, Tom; Walsh, John J.; Pavlides, Spyros

    2017-04-01

    Normal faults exposed in Kardia lignite mine, Ptolemais Basin, NW Greece formed at the same time as bed-parallel slip-surfaces, so that while the normal faults grew they were intermittently offset by bed-parallel slip. Following offset by a bed-parallel slip-surface, further fault growth is accommodated by reactivation on one or both of the offset fault segments. Where one fault is reactivated the site of bed-parallel slip is a bypassed asperity. Where both faults are reactivated, they propagate past each other to form a volume between overlapping fault segments that displays many of the characteristics of relay zones, including elevated strains and transfer of displacement between segments. Unlike conventional relay zones, however, these structures contain either a repeated or a missing section of stratigraphy which has a thickness equal to the throw of the fault at the time of the bed-parallel slip event, and the displacement profiles along the relay-bounding fault segments have discrete steps at their intersections with bed-parallel slip-surfaces. With further increase in displacement, the overlapping fault segments connect to form a fault-bound lens. Conventional relay zones form during initial fault propagation, but with coeval bed-parallel slip, relay-like structures can form later in the growth of a fault. Geometrical restoration of cross-sections through selected faults shows that repeated bed-parallel slip events during fault growth can lead to complex internal fault zone structure that masks its origin. Bed-parallel slip, in this case, is attributed to flexural-slip arising from hanging-wall rollover associated with a basin-bounding fault outside the study area.

  17. Mutuality, Self-Silencing, and Disordered Eating in College Women

    Science.gov (United States)

    Wechsler, Lisa S.; Riggs, Shelley A.; Stabb, Sally D.; Marshall, David M.

    2006-01-01

    The current study examined patterns of association among mutuality, self-silencing, and disordered eating in an ethnically diverse sample of college women (N = 149). Partner mutuality and overall self-silencing were negatively correlated and together were associated with six disordered eating indices. All four self-silencing subscales were…

  18. Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing

    NARCIS (Netherlands)

    Hedil, M.; Sterken, M.G.; Ronde, de D.; Lohuis, D.; Kormelink, R.

    2015-01-01

    RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS.

  19. After the Blackbird Whistles: Listening to Silence in Classrooms

    Science.gov (United States)

    Schultz, Katherine

    2010-01-01

    Background/Context: Students spend a large part of their time in schools in silence. However, teachers tend to spend most of their time attending to student talk. Anthropological and linguistic research has contributed to an understanding of silence in particular communities, offering explanations for students' silence in school. This research…

  20. Choosing Silence for Equality in and through Schooling

    Science.gov (United States)

    Lees, Helen E.

    2016-01-01

    This article considers silences and equality as combined from a theoretical perspective. Equality in and through chosen, deliberate and regular silence experience is seen as an equaliser: if no one is speaking no one can dominate. The article uses a bifurcated concept of silence: weak, negative forms and strong, positive forms. Only the strong…

  1. Normal values in growth and development. Base for diagnostics and therapy. 2. tot. rev. ed.

    International Nuclear Information System (INIS)

    Exner, G.U.

    2003-01-01

    This compendium provides reference values and probability distributions on the following parameters: clinical and radiological measured values relating to the growing skeleton including: growth; hand skeleton development stages with Central European deviations; hip sonography; psychomotor development; performance physiology; and lung function. Newly incorporated in this edition are, amongst other features, explanations on the clinical significance of the measured values

  2. Interpersonal Relatedness and Self-Definition in Normal and Disrupted Personality Development: Retrospect and Prospect

    Science.gov (United States)

    Luyten, Patrick; Blatt, Sidney J.

    2013-01-01

    Two-polarities models of personality propose that personality development evolves through a dialectic synergistic interaction between two fundamental developmental psychological processes across the life span--the development of interpersonal relatedness on the one hand and of self-definition on the other. This article offers a broad review of…

  3. Epigenetic silencing of miRNA-9 is associated with HES1 oncogenic activity and poor prognosis of medulloblastoma

    Science.gov (United States)

    Fiaschetti, G; Abela, L; Nonoguchi, N; Dubuc, A M; Remke, M; Boro, A; Grunder, E; Siler, U; Ohgaki, H; Taylor, M D; Baumgartner, M; Shalaby, T; Grotzer, M A

    2014-01-01

    Background: microRNA-9 is a key regulator of neuronal development aberrantly expressed in brain malignancies, including medulloblastoma. The mechanisms by which microRNA-9 contributes to medulloblastoma pathogenesis remain unclear, and factors that regulate this process have not been delineated. Methods: Expression and methylation status of microRNA-9 in medulloblastoma cell lines and primary samples were analysed. The association of microRNA-9 expression with medulloblastoma patients' clinical outcome was assessed, and the impact of microRNA-9 restoration was functionally validated in medulloblastoma cells. Results: microRNA-9 expression is repressed in a large subset of MB samples compared with normal fetal cerebellum. Low microRNA-9 expression correlates significantly with the diagnosis of unfavourable histopathological variants and with poor clinical outcome. microRNA-9 silencing occurs via cancer-specific CpG island hypermethylation. HES1 was identified as a direct target of microRNA-9 in medulloblastoma, and restoration of microRNA-9 was shown to trigger cell cycle arrest, to inhibit clonal growth and to promote medulloblastoma cell differentiation. Conclusions: microRNA-9 is a methylation-silenced tumour suppressor that could be a potential candidate predictive marker for poor prognosis of medulloblastoma. Loss of microRNA-9 may confer a proliferative advantage to tumour cells, and it could possibly contribute to disease pathogenesis. Thus, re-expression of microRNA-9 may constitute a novel epigenetic regulation strategy against medulloblastoma. PMID:24346283

  4. Epigenetic silencing of miRNA-9 is associated with HES1 oncogenic activity and poor prognosis of medulloblastoma.

    Science.gov (United States)

    Fiaschetti, G; Abela, L; Nonoguchi, N; Dubuc, A M; Remke, M; Boro, A; Grunder, E; Siler, U; Ohgaki, H; Taylor, M D; Baumgartner, M; Shalaby, T; Grotzer, M A

    2014-02-04

    microRNA-9 is a key regulator of neuronal development aberrantly expressed in brain malignancies, including medulloblastoma. The mechanisms by which microRNA-9 contributes to medulloblastoma pathogenesis remain unclear, and factors that regulate this process have not been delineated. Expression and methylation status of microRNA-9 in medulloblastoma cell lines and primary samples were analysed. The association of microRNA-9 expression with medulloblastoma patients' clinical outcome was assessed, and the impact of microRNA-9 restoration was functionally validated in medulloblastoma cells. microRNA-9 expression is repressed in a large subset of MB samples compared with normal fetal cerebellum. Low microRNA-9 expression correlates significantly with the diagnosis of unfavourable histopathological variants and with poor clinical outcome. microRNA-9 silencing occurs via cancer-specific CpG island hypermethylation. HES1 was identified as a direct target of microRNA-9 in medulloblastoma, and restoration of microRNA-9 was shown to trigger cell cycle arrest, to inhibit clonal growth and to promote medulloblastoma cell differentiation. microRNA-9 is a methylation-silenced tumour suppressor that could be a potential candidate predictive marker for poor prognosis of medulloblastoma. Loss of microRNA-9 may confer a proliferative advantage to tumour cells, and it could possibly contribute to disease pathogenesis. Thus, re-expression of microRNA-9 may constitute a novel epigenetic regulation strategy against medulloblastoma.

  5. Development of High Heat Input Welding Offshore Steel as Normalized Condition

    Science.gov (United States)

    Deng, Wei; Qin, Xiaomei

    The heavy plate used for offshore structure is one of the important strategic products. In recent years, there is an increasing demand for heavy shipbuilding steel plate with excellent weldability in high heat input welding. During the thermal cycle, the microstructure of the heat affected zone (HAZ) of plates was damaged, and this markedly reduced toughness of HAZ. So, how to improve the toughness of HAZ has been a key subject in the fields of steel research. Oxide metallurgy is considered as an effective way to improve toughness of HAZ, because it could be used to retard grain growth by fine particles, which are stable at the high temperature.The high strength steel plate, which satisfies the low temperature specification, has been applied to offshore structure. Excellent properties of the plates and welded joints were obtained by oxide metallurgy technology, latest controlled rolling and accelerated cooling technology using Ultra-Fast Cooling (an on-line accelerated cooling system). The 355MPa-grade high strength steel plates with normalizing condition were obtained, and the steels have excellent weldability with heat input energy of 79 287kJ/cm, and the nil ductility transition (NDT) temperature was -70°C, which can satisfy the construction of offshore structure in cold regions.

  6. Normal Development of Sutures and synchondroses in the central skull base : CT study

    International Nuclear Information System (INIS)

    Roh, Hong Gee; Kim, Hyung Jin; Kang, Jee Hee; Lee, Kyung Hee; Lim, Myung Kwan; Cho, Young Kuk; Ok, Cheol Su; Suh, Chang Hae

    2000-01-01

    To evaluate the developmental patterns of the sutures and synchondroses in the central skull base. We evaluated the CT scans of 109 children (age range 29 days to 15 years) with no skull base abnormality who had undergone axial CT of the skull base with 1-mm collimation. Using a five-tier scheme, we analyzed the developmental patterns of the 18 sutures and synchondroses related to the sphenoid and occipital bones. Fusion of the sutures and synchondroses related to the sphenoid bone progressed rapidly during the first two years. Thereafter, changes in the sphenoid bone were dominated by pneumatization of the sphenoid sinus. Fusion of the synchondroses within the sphenoid body, including intersphenoidal, intrapresphenoidal, intrapostsphenoidal synchondrosis occurred early and in most cases was graded ≥3D4. Fusion of the sphenosquamosal, sphenoethmoidal, and frontosphenoidal sutures was delayed, and residual sclerosis was a common finding. Except for Kerckring-supraoccipital synchondrosis, fusion of the six sutures and synchondroses related to the occipital bone occurred more gradually than that of those related to the sphenoid bone. Among these, fusion of the occipitomastoidal suture and petro-occipital synchondrosis was the last to occur. A knowledge of the developmental patterns of sutures and synchondroses can help differentiate normal conditions from those such as fracture, osseous dysplasia, or congenital malformation, which are abnormal. Our results provide certain basic information about skull base maturity in children. (author)

  7. Calcitonin gene related family peptides: importance in normal placental and fetal development.

    Science.gov (United States)

    Yallampalli, Chandra; Chauhan, Madhu; Endsley, Janice; Sathishkumar, Kunju

    2014-01-01

    Synchronized molecular and cellular events occur between the uterus and the implanting embryo to facilitate successful pregnancy outcome. Nevertheless, the molecular signaling network that coordinates strategies for successful decidualization, placentation and fetal growth are not well understood. The discovery of calcitonin/calcitonin gene-related peptides (CT/CGRP) highlighted new signaling mediators in various physiological processes, including reproduction. It is known that CGRP family peptides including CGRP, adrenomedulin and intermedin play regulatory functions during implantation, trophoblast proliferation and invasion, and fetal organogenesis. In addition, all the CGRP family peptides and their receptor components are found to be expressed in decidual, placental and fetal tissues. Additionally, plasma levels of peptides of the CGRP family were found to fluctuate during normal gestation and to induce placental cellular differentiation, proliferation, and critical hormone signaling. Moreover, aberrant signaling of these CGRP family peptides during gestation has been associated with pregnancy disorders. It indicates the existence of a possible regulatory role for these molecules during decidualization and placentation processes, which are known to be particularly vulnerable. In this review, the influence of the CGRP family peptides in these critical processes is explored and discussed.

  8. High-normal levels of hs-CRP predict the development of non-alcoholic fatty liver in healthy men.

    Directory of Open Access Journals (Sweden)

    Jieun Lee

    Full Text Available We performed a follow-up study to address whether high sensitivity C-reactive protein (hs-CRP levels within the normal range can predict the development of non-alcoholic fatty liver disease (NAFLD in healthy male subjects. Among15347 male workers between 30 and 59 years old who received annual health check-ups in 2002, a NAFLD-free cohort of 4,138 was followed through December 2009. Alcohol consumption was assessed with a questionnaire. At each visit, abdominal ultrasonography was performed to identify fatty liver disease. The COX proportional hazard model was used to evaluate the relationship between hs-CRP and incident NAFLD. During the follow-up period, 28.8% (1191 of 4138 of participants developed NAFLD. The hazard ratios of NAFLD were increased by hs-CRP categories within the normal range in the non-adjusted model and age-adjusted model. After adjusting for age, exercise, smoking, BMI, systolic BP, triglyceride, and fasting glucose, these incidences were only increased between the lowest and the highest hs-CRP categories. The risk for NAFLD increased as the hs-CRP level increased (p< 0.001. As the hs-CRP level increased within the healthy cohort, the risk of developing NAFLD increased. This trend remained true even if the hs-CRP level remained within the normal range. hs-CRP can be used as a predictor of NAFLD, as well as other obesity-associated diseases. Therefore, individuals with higher hs-CRP levels (even within the normal range may require appropriate follow-up and management to prevent NAFLD development.

  9. Towards an Explanation of Overeating Patterns Among Normal Weight College Women: Development and Validation of a Structural Equation Model

    OpenAIRE

    Russ, Christine Runyan II

    1998-01-01

    Although research describing relationships between psychosocial factors and various eating patterns is growing, a model which explains the mechanisms through which these factors may operate is lacking. A model to explain overeating patterns among normal weight college females was developed and tested. The model contained the following variables: global adjustment, eating and weight cognitions, emotional eating, and self-efficacy. Three hundred ninety-o...

  10. Validation of Tuba1a as Appropriate Internal Control for Normalization of Gene Expression Analysis during Mouse Lung Development

    Directory of Open Access Journals (Sweden)

    Aditi Mehta

    2015-02-01

    Full Text Available The expression ratio between the analysed gene and an internal control gene is the most widely used normalization method for quantitative RT-PCR (qRT-PCR expression analysis. The ideal reference gene for a specific experiment is the one whose expression is not affected by the different experimental conditions tested. In this study, we validate the applicability of five commonly used reference genes during different stages of mouse lung development. The stability of expression of five different reference genes (Tuba1a, Actb Gapdh, Rn18S and Hist4h4 was calculated within five experimental groups using the statistical algorithm of geNorm software. Overall, Tuba1a showed the least variability in expression among the different stages of lung development, while Hist4h4 and Rn18S showed the maximum variability in their expression. Expression analysis of two lung specific markers, surfactant protein C (SftpC and Clara cell-specific 10 kDA protein (Scgb1a1, normalized to each of the five reference genes tested here, confirmed our results and showed that incorrect reference gene choice can lead to artefacts. Moreover, a combination of two internal controls for normalization of expression analysis during lung development will increase the accuracy and reliability of results.

  11. Normal development of hamster and rabbit eggs fertilized by spermatozoa labelled with the fluorescent thiol alkylating agent, monobromobimane

    International Nuclear Information System (INIS)

    Fleming, A.D.; Cummins, J.M.; Kuehl, T.J.; Seidel, G.E. Jr.; Yanagimachi, R.

    1986-01-01

    Cauda epididymal spermatozoa of the golden hamster were labelled with the thiol-alkylating reagent, monobromobimane (MB). Female hamsters underwent uterine insemination with labelled spermatozoa at laparotomy under metofane anesthesia. All 12 females examined between 5 and 54 h postinsemination yielded a total of 83/100 (83%) eggs in the process of fertilization or embryos. Under ultraviolet (UV) exposure all exhibited a fluorescent tail which, in the 4- and 8-cell embryos, could be seen to be fraying or disintegrating. As cleavage progressed, labelled tail components came to be restricted among the blastomeres such that at the 4- and 8-cell stage the tail could be seen in only one to three blastomeres. To study complete development and pregnancy another 12 females received uterine insemination. After recovery from anesthesia (approximately equal to 4 h) these females were mated with a vasectomized male bearing a dominant genetic marker (black eyes) to allow unequivocal determination of paternity in the fetuses and young produced. Seven became pregnant with one female losing her pregnancy about Day 7 of gestation. Two females sacrificed on Day 13 produced 17 normal fetuses and one resorption. Four females delivered 16 young, all normal at birth and in subsequent growth and fertility. In addition, insemination of female rabbits with MB-labelled spermatozoa yielded normal embryos (50/52 96%) from 3 does on Day 2 and (38/64 60%) from 4 does on Days 4 or 5. Two normal litters (9 bunnies) have delivered from 3 does allowed to carry to term

  12. Adverse event reporting and developments in radiation biology after normal tissue injury: International Atomic Energy Agency consultation

    International Nuclear Information System (INIS)

    Chen Yuhchyau; Trotti, Andy; Coleman, C. Norman; Machtay, Mitchell; Mirimanoff, Rene O.; Hay, John; O'Brien, Peter C.; El-Gueddari, Brahim; Salvajoli, Joao V.; Jeremic, Branislav

    2006-01-01

    Purpose: Recent research has enhanced our understanding of radiation injury at the molecular-cellular and tissue levels; significant strides have occurred in standardization of adverse event reporting in clinical trials. In response, the International Atomic Energy Agency, through its Division of Human Health and its section for Applied Radiation Biology and Radiotherapy, organized a consultation meeting in Atlanta (October 2, 2004) to discuss developments in radiobiology, normal tissue reactions, and adverse event reporting. Methods and Materials: Representatives from cooperative groups of African Radiation Oncology Group, Curriculo Radioterapeutica Ibero Latino Americana, European Organization for Research and Treatment of Cancer, National Cancer Institute of Canada Clinical Trials Group, Radiation Therapy Oncology Group, and Trans-Tasman Radiation Oncology Group held the meeting discussion. Results: Representatives of major radiotherapy groups/organizations and prominent leaders in radiotherapy discussed current understanding of normal tissue radiobiologic effects, the design and implementation of future clinical and translational projects for normal tissue injury, and the standardization of adverse-event reporting worldwide. Conclusions: The consensus was to adopt NCI comprehensive adverse event reporting terminology and grading system (CTCAE v3.0) as the new standard for all cooperative group trials. Future plans included the implementation of coordinated research projects focusing on normal tissue biomarkers and data collection methods

  13. Development of Geometry Normalized Electromagnetic System (GNES) instrument for metal defect detection

    Science.gov (United States)

    Zakaria, Zakaria; Surbakti, Muhammad Syukri; Syahreza, Saumi; Mat Jafri, Mohd. Zubir; Tan, Kok Chooi

    2017-10-01

    It has been already made, calibrated and tested a geometry normalized electromagnetic system (GNES) for metal defect examination. The GNES has an automatic data acquisition system which supporting the efficiency and accuracy of the measurement. The data will be displayed on the computer monitor as a graphic display then saved automatically in the Microsoft Excel format. The transmitter will transmit the frequency pair (FP) signals i.e. 112.5 Hz and 337.5 Hz; 112.5 Hz and 1012.5 Hz; 112.5 Hz and 3037.5 Hz; 337.5 Hz and 1012.5 Hz; 337.5 Hz and 3037.5 Hz. Simultaneous transmissions of two electromagnetic waves without distortions by the transmitter will induce an eddy current in the metal. This current, in turn, will produce secondary electromagnetic fields which are measured by the receiver together with the primary fields. Measurement of percent change of a vertical component of the fields will give the percent response caused by the metal or the defect. The response examinations were performed by the models with various type of defect for the master curves. The materials of samples as a plate were using Aluminum, Brass, and Copper. The more of the defects is the more reduction of the eddy current response. The defect contrasts were tended to decrease when the more depth of the defect position. The magnitude and phase of the eddy currents will affect the loading on the coil thus its impedance. The defect must interrupt the surface eddy current flow to be detected. Defect lying parallel to the current path will not cause any significant interruption and may not be detected. The main factors which affect the eddy current response are metal conductivity, permeability, frequency, and geometry.

  14. Interpersonal relatedness and self-definition in normal and disrupted personality development: retrospect and prospect.

    Science.gov (United States)

    Luyten, Patrick; Blatt, Sidney J

    2013-04-01

    Two-polarities models of personality propose that personality development evolves through a dialectic synergistic interaction between two fundamental developmental psychological processes across the life span-the development of interpersonal relatedness on the one hand and of self-definition on the other. This article offers a broad review of extant research concerning these models, discusses their implications for psychology and psychiatry, and addresses future research perspectives deriving from these models. We first consider the implications of findings in this area for clinical research and practice. This is followed by a discussion of emerging research findings concerning the role of developmental, cross-cultural, evolutionary, and neurobiological factors influencing the development of these two fundamental personality dimensions. Taken together, this body of research suggests that theoretical formulations that focus on interpersonal relatedness and self-definition as central coordinates in personality development and psychopathology provide a comprehensive conceptual paradigm for future research in psychology and psychiatry exploring the interactions among neurobiological, psychological, and sociocultural factors in adaptive and disrupted personality development across the life span.

  15. Diffusion-tensor MR imaging of gray and white matter development during normal human brain maturation.

    Science.gov (United States)

    Mukherjee, Pratik; Miller, Jeffrey H; Shimony, Joshua S; Philip, Joseph V; Nehra, Deepika; Snyder, Abraham Z; Conturo, Thomas E; Neil, Jeffrey J; McKinstry, Robert C

    2002-10-01

    Conventional MR imaging findings of human brain development are thought to result from decreasing water content, increasing macromolecular concentration, and myelination. We use diffusion-tensor MR imaging to test theoretical models that incorporate hypotheses regarding how these maturational processes influence water diffusion in developing gray and white matter. Experimental data were derived from diffusion-tensor imaging of 167 participants, ages 31 gestational weeks to 11 postnatal years. An isotropic diffusion model was applied to the gray matter of the basal ganglia and thalamus. A model that assumes changes in the magnitude of diffusion while maintaining cylindrically symmetric anisotropy was applied to the white matter of the corpus callosum and internal capsule. Deviations of the diffusion tensor from the ideal model predictions, due to measurement noise, were estimated by using Monte Carlo simulations. Developing gray matter of the basal ganglia and developing white matter of the internal capsule and corpus callosum largely conformed to theory, with only small departures from model predictions in older children. However, data from the thalamus substantially diverged from predicted values, with progressively larger deviations from the model with increasing participant age. Changes in water diffusion during maturation of central gray and white matter structures can largely be explained by theoretical models incorporating simple assumptions regarding the influence of brain water content and myelination, although deviations from theory increase as the brain matures. Diffusion-tensor MR imaging is a powerful method for studying the process of brain development, with both scientific and clinical applications.

  16. Dicer Is Required for Normal Cerebellar Development and to Restrain Medulloblastoma Formation.

    Directory of Open Access Journals (Sweden)

    Frederique Zindy

    Full Text Available Dicer, a ribonuclease III enzyme, is required for the maturation of microRNAs. To assess its role in cerebellar and medulloblastoma development, we genetically deleted Dicer in Nestin-positive neural progenitors and in mice lacking one copy for the Sonic Hedgehog receptor, Patched 1. We found that conditional loss of Dicer in mouse neural progenitors induced massive Trp53-independent apoptosis in all proliferative zones of the brain and decreased proliferation of cerebellar granule progenitors at embryonic day 15.5 leading to abnormal cerebellar development and perinatal lethality. Loss of one copy of Dicer significantly accelerated the formation of mouse medulloblastoma of the Sonic Hedgehog subgroup in Patched1-heterozygous mice. We conclude that Dicer is required for proper cerebellar development, and to restrain medulloblastoma formation.

  17. Adenomatous polyposis coli is required for early events in the normal growth and differentiation of the developing cerebral cortex

    Directory of Open Access Journals (Sweden)

    Price David J

    2009-01-01

    Full Text Available Abstract Background Adenomatous polyposis coli (Apc is a large multifunctional protein known to be important for Wnt/β-catenin signalling, cytoskeletal dynamics, and cell polarity. In the developing cerebral cortex, Apc is expressed in proliferating cells and its expression increases as cells migrate to the cortical plate. We examined the consequences of loss of Apc function for the early development of the cerebral cortex. Results We used Emx1Cre to inactivate Apc specifically in proliferating cerebral cortical cells and their descendents starting from embryonic day 9.5. We observed reduction in the size of the mutant cerebral cortex, disruption to its organisation, and changes in the molecular identity of its cells. Loss of Apc leads to a decrease in the size of the proliferative pool, disrupted interkinetic nuclear migration, and increased apoptosis. β-Catenin, pericentrin, and N-cadherin proteins no longer adopt their normal high concentration at the apical surface of the cerebral cortical ventricular zone, indicating that cell polarity is disrupted. Consistent with enhanced Wnt/β-catenin signalling resulting from loss of Apc we found increased levels of TCF/LEF-dependent transcription and expression of endogenous Wnt/β-catenin target genes (Axin2 (conductin, Lef1, and c-myc in the mutant cerebral cortex. In the Apc mutant cerebral cortex the expression of transcription factors Foxg1, Pax6, Tbr1, and Tbr2 is drastically reduced compared to normal and many cells ectopically express Pax3, Wnt1, and Wt1 (but not Wnt2b, Wnt8b, Ptc, Gli1, Mash1, Olig2, or Islet1. This indicates that loss of Apc function causes cerebral cortical cells to lose their normal identity and redirect to fates normally found in more posterior-dorsal regions of the central nervous system. Conclusion Apc is required for multiple aspects of early cerebral cortical development, including the regulation of cell number, interkinetic nuclear migration, cell polarity, and

  18. Roles of microRNA-15 family in normal and pathological late lung development

    OpenAIRE

    Sakkas, Elpidoforos

    2016-01-01

    MicroRNAs are key regulators of organogenesis and during the last years many studies focused on microRNA expression during embryonic development. To date, there is no study to report possible roles of microRNAs in late lung development and especially during the alveolarization process. The objective of this study was to identify microRNAs that are deregulated under hyperoxic conditions and to assess whether microRNA expression can be modulated in vivo. Lung microRNA expression screening wa...

  19. BMI Development of Normal Weight and Overweight Children in the PIAMA Study

    NARCIS (Netherlands)

    Willers, Saskia M.; Brunekreef, Bert; Smit, Henriette A.; van der Beek, Eline M.; Gehring, Ulrike; de Jongste, Johan C.; Kerkhof, Marjan; Koppelman, Gerard H.; Wijga, Alet H.

    2012-01-01

    Background: There is evidence that rapid weight gain during the first year of life is associated with overweight later in life. However, results from studies exploring other critical periods for the development of overweight are inconsistent. Objective: The objective was to investigate BMI

  20. In vivo modelling of normal and pathological human T-cell development

    NARCIS (Netherlands)

    Wiekmeijer, A.S.

    2016-01-01

    This thesis describes novel insights in human T-cell development by transplanting human HSPCs in severe immunodeficient NSG mice. First, an in vivo model was optimized to allow engraftment of hematopoietic stem cells derived from human bone marrow. This model was used to study aberrant human T-cell

  1. A new Approach to the Study of Russian Language Acquisition in Preschool Children with Normal and Abnormal Development

    Directory of Open Access Journals (Sweden)

    Lebedeva T.V

    2014-11-01

    Full Text Available We discuss the possibilities of using a standardized method of psychological evaluation of the Russian language development in preschool children. We provide a rationale for the relevance of timely differentiation of children with language and speech difficulties in modern educational practice. We present the results of comparative analysis of language and speech development in the two groups of children 5-6 years old: normally developing (N=92 and with language and speech disorders (N=59. We describe the diagnostic potential of this research tool for clinical sample of children with speech and language disorders, reveal differences in the development of Russian language between the two groups of children. The data obtained can be used in solving the problems of differentiated correctional help to pre-school children with impaired language and speech development.

  2. Silence in Interdisciplinary Research Collaboration

    NARCIS (Netherlands)

    Verouden, Nick W.; Sanden, van der Maarten C.A.; Aarts, Noelle

    2016-01-01

    Solving publicly important issues asks for the development of socio-technical approaches, which demands collaboration between researchers with different perspectives, values, and interests. In these complex interdisciplinary collaborations, the course of communication is of utmost importance,

  3. Telomeric trans-silencing: an epigenetic repression combining RNA silencing and heterochromatin formation.

    Directory of Open Access Journals (Sweden)

    Thibaut Josse

    2007-09-01

    Full Text Available The study of P-element repression in Drosophila melanogaster led to the discovery of the telomeric Trans-Silencing Effect (TSE, a repression mechanism by which a transposon or a transgene inserted in subtelomeric heterochromatin (Telomeric Associated Sequence or TAS has the capacity to repress in trans in the female germline, a homologous transposon, or transgene located in euchromatin. TSE shows variegation among egg chambers in ovaries when silencing is incomplete. Here, we report that TSE displays an epigenetic transmission through meiosis, which involves an extrachromosomal maternally transmitted factor. We show that this silencing is highly sensitive to mutations affecting both heterochromatin formation (Su(var205 encoding Heterochromatin Protein 1 and Su(var3-7 and the repeat-associated small interfering RNA (or rasiRNA silencing pathway (aubergine, homeless, armitage, and piwi. In contrast, TSE is not sensitive to mutations affecting r2d2, which is involved in the small interfering RNA (or siRNA silencing pathway, nor is it sensitive to a mutation in loquacious, which is involved in the micro RNA (or miRNA silencing pathway. These results, taken together with the recent discovery of TAS homologous small RNAs associated to PIWI proteins, support the proposition that TSE involves a repeat-associated small interfering RNA pathway linked to heterochromatin formation, which was co-opted by the P element to establish repression of its own transposition after its recent invasion of the D. melanogaster genome. Therefore, the study of TSE provides insight into the genetic properties of a germline-specific small RNA silencing pathway.

  4. 'Beyond Milestones': a randomised controlled trial evaluating an innovative digital resource teaching quality observation of normal child development.

    Science.gov (United States)

    Connolly, Anne M; Cunningham, Clare; Sinclair, Adriane J; Rao, Arjun; Lonergan, Amy; Bye, Ann M E

    2014-05-01

    The study aimed to create and evaluate the educational effectiveness of a digital resource instructing paediatric trainees in a systematic approach to critical and quality observation of normal child development. A digital educational resource was developed utilising the skills of an expert developmental paediatrician who was videoed assessing normal early child development at a series of critical stages. Videos illustrated aspects of language, sophistication of play and socialisation, cognition, and motor progress. Expert commentary, teaching text and summaries were used. A randomised controlled trial evaluated the resource. Paediatric trainees were recruited from The Sydney Children's Hospitals Network. Outcome measures were repeated at three time points (pre-teaching, immediate-post and 1 month) and included self-rated attitudes, knowledge of markers of development and observational expertise. Qualitative data on teaching usefulness were obtained through open-ended questions. Fifty-six paediatric trainees (registrar 79%, women 82%; mean age 31 years) completed the pre-assessment, 46 the immediate-post and 45 the 1-month follow-up (20% attrition). Compared with the Control group, the Teaching group scored higher over time on markers of development (P = 0.006), observational expertise (P improves knowledge, increases confidence and is useful, providing a structured approach to developmental assessment. The techniques taught can be applied to every paediatric consultation. © 2013 The Authors. Journal of Paediatrics and Child Health © 2013 Paediatrics and Child Health Division (Royal Australasian College of Physicians).

  5. The hnRNP A1 homolog Hrp36 is essential for normal development ...

    Indian Academy of Sciences (India)

    2012-08-11

    Aug 11, 2012 ... Here we show that loss of both copies of hrp36 gene slows down development with .... larvae, pupae and adults were reared at 18°C or 24°C or. 30°C (±1°C) on ... of three days old 20 male and 20 female flies were set up: (a) wild type ... dissected out in Poels' salt solution (PSS; Lakhotia and. Tapadia ...

  6. Normal Development and Function of T Cells in Proline Rich 7 (Prr7) Deficient Mice

    Czech Academy of Sciences Publication Activity Database

    Hrdinka, M.; Sudan, K.; Just, S.; Drobek, Aleš; Štěpánek, Ondřej; Schlueter, D.; Reinhold, D.; Jordan, B.A.; Gintschel, P.; Schraven, B.; Kreutz, M.R.

    2016-01-01

    Roč. 11, č. 9 (2016), č. článku e0162863. E-ISSN 1932-6203 R&D Projects: GA ČR GJ16-09208Y Institutional support: RVO:68378050 Keywords : transmembrane adapter proteins * experimental autoimmune encephalomyelitis * multiple-sclerosis * listeria - monocytogenes * lymphocyte development * negative regulation * activation * receptor * neurodegeneration * apoptosis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.806, year: 2016

  7. DISTURBANCE OF NORMAL MOTOR DEVELOPMENT IN THE FIRST YEAR OF LIFE

    OpenAIRE

    Lidija Dimitrijević; Hristina Čolović

    2005-01-01

    The adoption of the basic motor skills in the first year of life (postural head control, lateral transfers into a lying position, sitting, standing, walking, crawling, grasping...) goes on quite spontaneously. A child learns all the motor actions by itself and that is why it is not necessary to “teach” a child to seat, grasp, stand, walk... Teaching a child the basic motor skills stands for a rough, unnecessary and undesirable involvement into spontaneous motor development, and, due to this, ...

  8. Overlapping Requirements for Tet2 and Tet3 in Normal Development and Hematopoietic Stem Cell Emergence

    Directory of Open Access Journals (Sweden)

    Cheng Li

    2015-08-01

    Full Text Available The Tet family of methylcytosine dioxygenases (Tet1, Tet2, and Tet3 convert 5-methylcytosine to 5-hydroxymethylcytosine. To date, functional overlap among Tet family members has not been examined systematically in the context of embryonic development. To clarify the potential for overlap among Tet enzymes during development, we mutated the zebrafish orthologs of Tet1, Tet2, and Tet3 and examined single-, double-, and triple-mutant genotypes. Here, we identify Tet2 and Tet3 as the major 5-methylcytosine dioxygenases in the zebrafish embryo and uncover a combined requirement for Tet2 and Tet3 in hematopoietic stem cell (HSC emergence. We demonstrate that Notch signaling in the hemogenic endothelium is regulated by Tet2/3 prior to HSC emergence and show that restoring expression of the downstream gata2b/scl/runx1 transcriptional network can rescue HSCs in tet2/3 double mutant larvae. Our results reveal essential, overlapping functions for tet genes during embryonic development and uncover a requirement for 5hmC in regulating HSC production.

  9. Physiological properties of afferents to the rat cerebellum during normal development and after postnatal x irradiation

    International Nuclear Information System (INIS)

    Puro, D.G.

    1975-01-01

    The consequences of an altered cerebellar cortical development on afferent transmission and terminal organization were analyzed in adult rats which had received x irradiation to the cerebellum postnatally. Rats, anesthetized with 0.5 percent halothane, were studied in various ages from day 3 to adult. The ascending mossy and climbing fiber systems were activated by electrical stimulation of the limbs with needle electrodes. Stimulation of the motor cortex activated the descending climbing fiber pathways. Extracellular responses from cerebellar Purkinje cells were observed on an oscilloscope as poststimulus time histograms were constructed ''on-line''. Conclusions and assertions include: (1) Synaptogenesis between incoming afferent fibers and target neurons takes place early in cerebellar cortical development. (2) Mossy fiber transmission is mature before the bulk of cerebellar synaptogenesis occurs. (3) The ascending and descending components of the climbing fiber system mature, with respect to latency, in synchrony. (4) The terminal synaptic organization has little effect on the development of transmission characteristics in these afferent systems. (5) One possible mechanism by which an adult neural structure can have an abnormal synaptic organization is to maintain immature synaptic relationships due to the neonatal loss of interneurons

  10. Bi-iliac distance and iliac bone position compared to the vertebral column in normal fetal development

    DEFF Research Database (Denmark)

    Hartling, U B; Fischer Hansen, B; Skovgaard, L T

    2001-01-01

    Prenatal standards of bi-iliac width were not found in the literature based on autopsy investigations, nor was the caudo-cranial position of the ilia compared to the vertebral column. The first purpose of the present study was to establish normal standard values for the bi-iliac distance in fetal...... life, the second to evaluate the level of the iliac bones proportional to the ossified vertebral column. Whole body radiographs in antero-posterior projections from 98 human fetuses (36 female and 44 male fetuses, as well as 18 fetuses on which the sex had not been determined) were analyzed...... caliper. The caudo-cranial position of the iliac bones was evaluated. The present study shows that in normal fetal development there is a continuous linear enlargement of the pelvic region in the transverse and vertical planes. The upper iliac contour stays at the level of the first sacral vertebral body...

  11. Biochemical composition of fetal fluids in at term, normal developed, healthy, viable dogs and preliminary data from pathologic littermates.

    Science.gov (United States)

    Veronesi, M C; Bolis, B; Faustini, M; Rota, A; Mollo, A

    2018-03-01

    A proper canine neonatal assistance, required to reduce the high perinatal loss rate, imply a full knowledge about the fetal-to-neonatal physiology. Because fetal fluids play an important role throughout mammals pregnancy, influencing fetal growth and development, fetal well being, and contributing to guarantee the most suitable environment for the fetus, the knowledge about fetal fluids biochemical composition is of major importance. At first, the biochemical composition of fetal fluids collected by normal developed, healthy and viable newborns, is necessary to depict the normal features, and represent the first step for the further detection of abnormalities associated to fetal/neonatal distress and useful for the early identification of newborns needing special attention, immediately after birth. The present study was aimed to define the biochemical composition of amniotic and allantoic fluids collected from fetus delivered by caesarean section at term of pregnancy. To reduce the possible confounding effect of maternal labor or troubles at parturition, fetal fluids were collected only from puppies born by elective caesaeran section, at term of normal pregnancies. Fetal fluids from 76 puppies, 70 normal and six pathologic newborns, born by elective caesarean section were collected and analyzed for alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin, lactate dehydrogenase (LDH), creatine-kinase (CK), alkaline phosphatase (ALP), creatinine, urea, amylase, lipase, gamma-glutamyl transferase (γ-GT), triglycerides, cholesterol, total proteins, albumin, globulins, glucose, magnesium, potassium, chloride, sodium, calcium, phosphorus and osmolarity. No significant differences were found between biochemical composition of amniotic or allantoic fluid in normal and pathologic newborns, maybe due to the small number of the pathologic puppies. Although some correlations between the two fluids were found (albumin, phosphorus, glucose and

  12. Homology-dependent Gene Silencing in Paramecium

    Science.gov (United States)

    Ruiz, Françoise; Vayssié, Laurence; Klotz, Catherine; Sperling, Linda; Madeddu, Luisa

    1998-01-01

    Microinjection at high copy number of plasmids containing only the coding region of a gene into the Paramecium somatic macronucleus led to a marked reduction in the expression of the corresponding endogenous gene(s). The silencing effect, which is stably maintained throughout vegetative growth, has been observed for all Paramecium genes examined so far: a single-copy gene (ND7), as well as members of multigene families (centrin genes and trichocyst matrix protein genes) in which all closely related paralogous genes appeared to be affected. This phenomenon may be related to posttranscriptional gene silencing in transgenic plants and quelling in Neurospora and allows the efficient creation of specific mutant phenotypes thus providing a potentially powerful tool to study gene function in Paramecium. For the two multigene families that encode proteins that coassemble to build up complex subcellular structures the analysis presented herein provides the first experimental evidence that the members of these gene families are not functionally redundant. PMID:9529389

  13. Fibroblast growth factor receptor signaling is essential for normal mammary gland development and stem cell function.

    Science.gov (United States)

    Pond, Adam C; Bin, Xue; Batts, Torey; Roarty, Kevin; Hilsenbeck, Susan; Rosen, Jeffrey M

    2013-01-01

    Fibroblast growth factor (FGF) signaling plays an important role in embryonic stem cells and adult tissue homeostasis, but the function of FGFs in mammary gland stem cells is less well defined. Both FGFR1 and FGFR2 are expressed in basal and luminal mammary epithelial cells (MECs), suggesting that together they might play a role in mammary gland development and stem cell dynamics. Previous studies have demonstrated that the deletion of FGFR2 resulted only in transient developmental defects in branching morphogenesis. Using a conditional deletion strategy, we investigated the consequences of FGFR1 deletion alone and then the simultaneous deletion of both FGFR1 and FGFR2 in the mammary epithelium. FGFR1 deletion using a keratin 14 promoter-driven Cre-recombinase resulted in an early, yet transient delay in development. However, no reduction in functional outgrowth potential was observed following limiting dilution transplantation analysis. In contrast, a significant reduction in outgrowth potential was observed upon the deletion of both FGFR1 and FGFR2 in MECs using adenovirus-Cre. Additionally, using a fluorescent reporter mouse model to monitor Cre-mediated recombination, we observed a competitive disadvantage following transplantation of both FGFR1/R2-null MECs, most prominently in the basal epithelial cells. This correlated with the complete loss of the mammary stem cell repopulating population in the FGFR1/R2-attenuated epithelium. FGFR1/R2-null MECs were partially rescued in chimeric outgrowths containing wild-type MECs, suggesting the potential importance of paracrine mechanisms involved in the maintenance of the basal epithelial stem cells. These studies document the requirement for functional FGFR signaling in mammary stem cells during development. Copyright © 2012 AlphaMed Press.

  14. Ubiquitin specific protease 21 is dispensable for normal development, hematopoiesis and lymphocyte differentiation.

    Directory of Open Access Journals (Sweden)

    Jaspreet Pannu

    Full Text Available USP21 is a ubiquitin specific protease that catalyzes protein deubiquitination, however the identification of its physiological substrates remains challenging. USP21 is known to deubiquitinate transcription factor GATA3 and death-domain kinase RIPK1 in vitro, however the in vivo settings where this regulation plays a biologically significant role remain unknown. In order to determine whether USP21 is an essential and non-redundant regulator of GATA3 or RIPK1 activity in vivo, we characterized Usp21-deficient mice, focusing on mouse viability and development, hematopoietic stem cell function, and lymphocyte differentiation. The Usp21-knockout mice were found to be viable and fertile, with no significant dysmorphology, in contrast to the GATA3 and RIPK1 knockout lines that exhibit embryonic or perinatal lethality. Loss of USP21 also had no effect on hematopoietic stem cell function, lymphocyte development, or the responses of antigen presenting cells to TLR and TNFR stimulation. GATA3 levels in hematopoietic stem cells or T lymphocytes remained unchanged. We observed that aged Usp21-knockout mice exhibited spontaneous T cell activation, however this was not linked to altered GATA3 levels in the affected cells. The contrast in the phenotype of the Usp21-knockout line with the previously characterized GATA3 and RIPK1 knockout mice strongly indicates that USP21 is redundant for the regulation of GATA3 and RIPK1 activity during mouse development, in hematopoietic stem cells, and in lymphocyte differentiation. The Usp21-deficient mouse line characterized in this study may serve as a useful tool for the future characterization of USP21 physiological functions.

  15. Underground laboratories: Cosmic silence, loud science

    Energy Technology Data Exchange (ETDEWEB)

    Coccia, Eugenio, E-mail: coccia@lngs.infn.i [Department of Physics, University of Rome ' Tor Vergata' and INFN Gran Sasso National Laboratory (Italy)

    2010-01-01

    Underground laboratories provide the low radioactive background environment necessary to host key experiments in the field of particle and astroparticle physics, nuclear astrophysics and other disciplines that can profit of their characteristics and of their infrastructures. The cosmic silence condition existing in these laboratories allows the search for extremely rare phenomena and the exploration of the highest energy scales that cannot be reached with accelerators. I briefly describe all the facilities that are presently in operation around the world.

  16. Silencing cinema: film censorship around the world

    OpenAIRE

    Biltereyst, Daniël; Vande Winkel, Roel

    2013-01-01

    Why does oppression by censorship affect the film industry far more frequently than any other mass media? "Silencing Cinema" brings together the key issues and authors to examine instances of film censorship throughout the world. Including essays by some of today's leading film historians, the book offers groundbreaking historical research on film censorship in major film production countries, including the United States, the United Kingdom, Russia/Soviet Union, India, China, and Nigeria, amo...

  17. PhOBF1, a petunia ocs element binding factor, plays an important role in antiviral RNA silencing.

    Science.gov (United States)

    Sun, Daoyang; Li, Shaohua; Niu, Lixin; Reid, Michael S; Zhang, Yanlong; Jiang, Cai-Zhong

    2017-02-01

    Virus-induced gene silencing (VIGS) is a common reverse genetics strategy for characterizing the function of genes in plants. The detailed mechanism governing RNA silencing efficiency triggered by viruses is largely unclear. Here, we reveal that a petunia (Petunia hybrida) ocs element binding factor, PhOBF1, one of the basic leucine zipper (bZIP) transcription factors, was up-regulated by Tobacco rattle virus (TRV) infection. Simultaneous silencing of PhOBF1 and a reporter gene, phytoene desaturase (PDS) or chalcone synthase (CHS), by TRV-based VIGS led to a failure of the development of leaf photobleaching or the white-corollas phenotype. PhOBF1 silencing caused down-regulation of RNA silencing-related genes, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonautes (AGOs). After inoculation with the TRV-PhPDS, PhOBF1-RNAi lines exhibited a substantially impaired PDS silencing efficiency, whereas overexpression of PhOBF1 resulted in a recovery of the silencing phenotype (photobleaching) in systemic leaves. A compromised resistance to TRV and Tobacco mosaic virus was found in PhOBF1-RNAi lines, while PhOBF1-overexpressing lines displayed an enhanced resistance to their infections. Compared with wild-type plants, PhOBF1-silenced plants accumulated lower levels of free salicylic acid (SA), salicylic acid glucoside, and phenylalanine, contrarily to higher levels of those in plants overexpressing PhOBF1. Furthermore, transcripts of a number of genes associated with the shikimate and phenylpropanoid pathways were decreased or increased in PhOBF1-RNAi or PhOBF1-overexpressing lines, respectively. Taken together, the data suggest that PhOBF1 regulates TRV-induced RNA silencing efficiency through modulation of RDRs, DCLs, and AGOs mediated by the SA biosynthesis pathway. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  18. A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing.

    Science.gov (United States)

    Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S; Niu, Lixin; Jiang, Cai-Zhong

    2016-05-01

    Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2 Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  19. A conversation analysis of the function of silence in writing conferences

    Directory of Open Access Journals (Sweden)

    Milad Mirzaee

    2016-07-01

    Full Text Available One of the recent issues in English as a Second/Foreign Language (ESL/EFL writing instruction has been the quest for a more effective way to give feedback to L2 learners’ writing drafts. Although teacher- learner writing conferences have been increasingly used for providing ample opportunity for negotiating revisions, relatively little attention has been given to actual teacher-learner conversation. Drawing on sociocultural theory, which holds that all cognitive developments are results of ‘social interactions’, and drawing on conversation analysis as an analytical tool, this study attempts to explore the different functions of ‘silence’ in writing conferences during teacher-learner conversation. The data comes from transcripts of six 1-hour writing conferences video-recorded in a graduate program with 7 candidates in Iran. During the writing conferences, learners’ drafts were discussed. Findings of the study demonstrated that teacher’s silence can play a key role in the management of turns in writing conferences, thereby providing the parties with various opportunities for accomplishing intersubjectivity: the teacher used silence to rethink the information provided during writing conferences, and the learner exploited silence to revise the writing draft. The current study, reporting a range of functions of silence in writing conferences, offers an extension to the existing literature and draws language teachers’, specifically writing instructors’, attention to different functions of silence in writing conferences.

  20. Associations between the size of the amygdala in infancy and language abilities during the preschool years in normally developing children.

    Science.gov (United States)

    Ortiz-Mantilla, Silvia; Choe, Myong-sun; Flax, Judy; Grant, P Ellen; Benasich, April A

    2010-02-01

    Recently, structural MRI studies in children have been used to examine relations between brain volume and behavioral measures. However, most of these studies have been done in children older than 2 years of age. Obtaining volumetric measures in infants is considerably more difficult, as structures are less well defined and largely unmyelinated, making segmentation challenging. Moreover, it is still unclear whether individual anatomic variation across development, in healthy, normally developing infants, is reflected in the configuration and function of the mature brain and, as importantly, whether variation in infant brain structure might be related to later cognitive and linguistic abilities. In this longitudinal study, using T1 structural MRI, we identified links between amygdala volume in normally developing, naturally sleeping, 6-month infants and their subsequent language abilities at 2, 3 and 4 years. The images were processed and manually segmented using Cardviews to extract volumetric measures. Intra-rater reliability for repeated segmentation was 87.73% of common voxel agreement. Standardized language assessments were administered at 6 and 12 months and at 2, 3 and 4 years. Significant and consistent correlations were found between amygdala size and language abilities. Children with larger right amygdalae at 6 months had lower scores on expressive and receptive language measures at 2, 3, and 4 years. Associations between amygdala size and language outcomes have been reported in children with autism. The findings presented here extend this association to normally developing children, supporting the idea that the amygdalae might play an important but as yet unspecified role in mediating language acquisition. Copyright (c) 2009 Elsevier Inc. All rights reserved.

  1. Gas turbine exhaust system silencing design

    International Nuclear Information System (INIS)

    Ozgur, D.

    1991-01-01

    Gas turbines are the preferred prime mover in many applications because of their high efficiency, fuel flexibility, and low environmental impact. A typical mid-size machine might have a power rating of 80 MW, a flow of about 1000 kg/hr, and an exhaust temperature of over 500C. The most powerful single source of noise is generally the exhaust, which may generate over a kilowatt of acoustic energy. This paper reports that there are two important ways in which exhaust systems can radiate noise. The first is through the discharge of the exhaust duct, with the exhaust gas. Because of the large quantity of hot gas, the duct exit is always oriented vertically; it may be fairly high in the air in order to promote dispersion of the exhaust plume. This source is almost always attenuated by means of a silencer located somewhere in the ductwork. The second source of noise is often called breakout; it is the radiation of exhaust noise through the walls of the ducting. Breakout is most important for those sections of the exhaust duct which lie upstream of the silencer, where sound levels inside the ducting are highest. Both exhaust duct exit noise and breakout noise can be calculated from the sound power level of the gas turbine exhaust and the sound transmission loss (TL) of the silencer and ducting

  2. Development of a radioreceptor assay for human chorion gonadotropin: Application in normal and pathological pregnancies

    International Nuclear Information System (INIS)

    Koch, R.

    1978-01-01

    Rats testes were homogenised, and the binding capacity of several dilutions of these were tested with iodine 125 -labelled human choriongonadotropin. Investigations about binding over a period of 36 hrs. with 3 different temperatures, inhibition tests and cross reaction analyses for determining the specificity were carried out. 2 assay systems could be developed. The highly sensitive assay was applied at early pregnancy, at suspected disturbed or ectopic gravidity and allowed to measure the hCG-serum concentration above the physiological basal secretion of hLH. The less sensitive assay was used for measuring hCG in later stages of pregnancy, chorionepitheliomas and other hCG producing tumours. With the highly sensitive and specific assay, hCG was determinable 8 to 10 days post conceptionem. (orig.) [de

  3. Oral epithelial stem cells – implications in normal development and cancer metastasis

    Science.gov (United States)

    Papagerakis, Silvana; Pannone, Giuseppe; Zheng, Li; About, Imad; Taqi, Nawar; Nguyen, Nghia P.T.; Matossian, Margarite; McAlpin, Blake; Santoro, Angela; McHugh, Jonathan; Prince, Mark E.; Papagerakis, Petros

    2014-01-01

    Oral mucosa is continuously exposed to environmental forces and has to be constantly renewed. Accordingly, the oral mucosa epithelium contains a large reservoir of epithelial stem cells necessary for tissue homeostasis. Despite considerable scientific advances in stem cell behavior in a number of tissues, fewer studies have been devoted to the stem cells in the oral epithelium. Most of oral mucosa stem cells studies are focused on identifying cancer stem cells (CSC) in oral squamous cell carcinomas (OSCCs) among other head and neck cancers. OSCCs are the most prevalent epithelial tumors of the head and neck region, marked by their aggressiveness and invasiveness. Due to their highly tumorigenic properties, it has been suggested that CSC may be the critical population of cancer cells in the development of OSCC metastasis. This review presents a brief overview of epithelium stem cells with implications in oral health, and the clinical implications of the CSC concept in OSCC metastatic dissemination. PMID:24803391

  4. Beyond Normal Competencies: Understanding Organisation Designs to Develop and Sustain IT-Related Capabilities

    Directory of Open Access Journals (Sweden)

    Acklesh Prasad

    2013-03-01

    Full Text Available It is apparent that IT resources are important for organisations. It is also clear that organisations unique competencies, their IT-related capabilities, leverage the IT resources uniquely to create and sustain competitive advantage. However, IT resources are dynamic, and evolve at an exponential rate. This means that organisations will need to sustain their competencies to leverage opportunities offered by new IT resources. Research on ways to sustain IT-related capabilities is limited and a deeper understanding of this situation is important. Amongst other factors, a possible reason for this lack of progress in this area could be due to the lack of validated measurement items of the theoretical constructs to conduct such studies. We suggest an environment in which organisations could build new and sustain their existing IT-related capabilities. We then report on the development of valid and reliable measures for this environment. The validated measures would be useful in extending our understanding on how firms could sustain their IT-related capabilities. This effort will provide a deeper understanding of how firms can secure sustainable IT-related business value from their acquired IT resources.

  5. Mice lacking glutamate carboxypeptidase II develop normally, but are less susceptible to traumatic brain injury.

    Science.gov (United States)

    Gao, Yang; Xu, Siyi; Cui, Zhenwen; Zhang, Mingkun; Lin, Yingying; Cai, Lei; Wang, Zhugang; Luo, Xingguang; Zheng, Yan; Wang, Yong; Luo, Qizhong; Jiang, Jiyao; Neale, Joseph H; Zhong, Chunlong

    2015-07-01

    Glutamate carboxypeptidase II (GCPII) is a transmembrane zinc metallopeptidase found mainly in the nervous system, prostate and small intestine. In the nervous system, glia-bound GCPII mediates the hydrolysis of the neurotransmitter N-acetylaspartylglutamate (NAAG) into glutamate and N-acetylaspartate. Inhibition of GCPII has been shown to attenuate excitotoxicity associated with enhanced glutamate transmission under pathological conditions. However, different strains of mice lacking the GCPII gene are reported to exhibit striking phenotypic differences. In this study, a GCPII gene knockout (KO) strategy involved removing exons 3-5 of GCPII. This generated a new GCPII KO mice line with no overt differences in standard neurological behavior compared to their wild-type (WT) littermates. However, GCPII KO mice were significantly less susceptible to moderate traumatic brain injury (TBI). GCPII gene KO significantly lessened neuronal degeneration and astrocyte damage in the CA2 and CA3 regions of the hippocampus 24 h after moderate TBI. In addition, GCPII gene KO reduced TBI-induced deficits in long-term spatial learning/memory tested in the Morris water maze and motor balance tested via beam walking. Knockout of the GCPII gene is not embryonic lethal and affords histopathological protection with improved long-term behavioral outcomes after TBI, a result that further validates GCPII as a target for drug development consistent with results from studies using GCPII peptidase inhibitors. © 2015 International Society for Neurochemistry.

  6. Historical notes about the development of cement normalization In European Union

    Directory of Open Access Journals (Sweden)

    Calleja, J.

    2002-12-01

    Full Text Available The European Standard EN 197-1:2000 for Cement, prepared by CEN/TC 51, is from now (2002-04-01 onwards, compulsory in all the countries of the European Union. It has been considered suitable to expose some details on the historical development of the steps and difficulties during the elaboration of the standard ENV 197-1:92 first, and of the present and final standard EN 197-1:2000 already in force, and now in Spain as Spanish Standard AENOR/UNE-EN 197-1:2000 (1.

    Al hacerse de obligado cumplimiento en todos los países de la VE a partir del 1 de abril de 2002 la Norma Europea EN 197-1:2000 para cementos, elaborada por el CEN/TC 51, se ha considerado oportuno dar una información general, muy resumida, acerca del desarrollo histórico de las etapas, vicisitudes y dificultades por las que ha pasado la culminación de la misma, hasta alcanzar, primero, la Norma Experimental ENV 197-1:92 y, finalmente, la actual y definitiva EN 197-1:2000, ya en vigor como Norma Española UNE-EN 197-1:2000, de AENOR (1.

  7. Contrast normalization contributes to a biologically-plausible model of receptive-field development in primary visual cortex (V1)

    Science.gov (United States)

    Willmore, Ben D.B.; Bulstrode, Harry; Tolhurst, David J.

    2012-01-01

    Neuronal populations in the primary visual cortex (V1) of mammals exhibit contrast normalization. Neurons that respond strongly to simple visual stimuli – such as sinusoidal gratings – respond less well to the same stimuli when they are presented as part of a more complex stimulus which also excites other, neighboring neurons. This phenomenon is generally attributed to generalized patterns of inhibitory connections between nearby V1 neurons. The Bienenstock, Cooper and Munro (BCM) rule is a neural network learning rule that, when trained on natural images, produces model neurons which, individually, have many tuning properties in common with real V1 neurons. However, when viewed as a population, a BCM network is very different from V1 – each member of the BCM population tends to respond to the same dominant features of visual input, producing an incomplete, highly redundant code for visual information. Here, we demonstrate that, by adding contrast normalization into the BCM rule, we arrive at a neurally-plausible Hebbian learning rule that can learn an efficient sparse, overcomplete representation that is a better model for stimulus selectivity in V1. This suggests that one role of contrast normalization in V1 is to guide the neonatal development of receptive fields, so that neurons respond to different features of visual input. PMID:22230381

  8. Working memory span in Persian-speaking children with speech sound disorders and normal speech development.

    Science.gov (United States)

    Afshar, Mohamad Reza; Ghorbani, Ali; Rashedi, Vahid; Jalilevand, Nahid; Kamali, Mohamad

    2017-10-01

    The aim of this study was to compare working memory span in Persian-speaking preschool children with speech sound disorder (SSD) and their typically speaking peers. Additionally, the study aimed to examine Non-Word Repetition (NWR), Forward Digit Span (FDS) and Backward Digit Span (BDS) in four groups of children with varying severity levels of SSD. The participants in this study comprised 35 children with SSD and 35 typically developing (TD) children -matched for age and sex-as a control group. The participants were between the age range of 48 and 72 months. Two components of working memory including phonological loop and central executive were compared between two groups. We used two tasks (NWR and FDS) to assess phonological loop component, and one task (BDS) to assess central executive component. Percentage of correct consonants (PCC) was used to calculate the severity of SSD. Significant differences were observed between the two groups in all tasks that assess working memory (p working memory between the various severity groups indicated significant differences between different severities of both NWR and FDS tasks among the SSD children (p  0.05). The result showed that PCC scores in TD children were associated with NWR (p  0.05). The working memory skills were weaker in SSD children, in comparison to TD children. In addition, children with varying levels of severity of SSD differed in terms of NWR and FSD, but not BDS. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Normal Pubertal Development in Daughters of Women With PCOS: A Controlled Study.

    Science.gov (United States)

    Legro, Richard S; Kunselman, Allen R; Stetter, Christy M; Gnatuk, Carol L; Estes, Stephanie J; Brindle, Eleanor; Vesper, Hubert W; Botelho, Julianne C; Lee, Peter A; Dodson, William C

    2017-01-01

    Daughters of women with polycystic ovary syndrome (PCOS) are thought to be at increased risk for developing stigmata of the syndrome, but the ontogeny during puberty is uncertain. We phenotyped daughters (n = 76) of mothers with PCOS and daughters (n = 80) from control mothers for reproductive and metabolic parameters characteristic of PCOS. We performed a matched case/control study at Penn State Hershey Medical Center that included non-Hispanic, white girls 4 to 17 years old. We obtained birth history, biometric, ovarian ultrasounds, whole-body dual-energy X-ray absorptiometry scan for body composition, 2-hour glucose challenged salivary insulin levels, and two timed urinary collections (12 hours overnight and 3 hours in the morning) for gonadotropins and sex steroids. We measured integrated urinary levels of adrenal (dehydroepiandrosterone sulfate) and ovarian [testosterone (TT)] steroids. Other endpoints included integrated salivary insulin levels and urinary luteinizing hormone levels. There were no differences in detection rates or mean levels for gonadotropins and sex steroids in timed urinary collections between PCOS daughters and control daughters, nor were there differences in integrated salivary insulin levels. Results showed that 69% of Tanner 4/5 PCOS daughters vs 31% of control daughters had hirsutism defined as a Ferriman-Gallwey score >8 (P = 0.04). There were no differences in body composition as determined by dual-energy X-ray absorptiometry between groups in the three major body contents (i.e., bone, lean body mass, and fat) or in ovarian volume between groups. Matched for pubertal stage, PCOS daughters have similar levels of urinary androgens and gonadotropins as well as glucose-challenged salivary insulin levels. Copyright © 2017 by the Endocrine Society

  10. Pkd1 and Pkd2 are required for normal placental development.

    Directory of Open Access Journals (Sweden)

    Miguel A Garcia-Gonzalez

    2010-09-01

    Full Text Available Autosomal dominant polycystic kidney disease (ADPKD is a common cause of inherited renal failure that results from mutations in PKD1 and PKD2. The disorder is characterized by focal cyst formation that involves somatic mutation of the wild type allele in a large fraction of cysts. Consistent with a two-hit mechanism, mice that are homozygous for inactivating mutations of either Pkd1 or Pkd2 develop cystic kidneys, edema and hemorrhage and typically die in midgestation. Cystic kidney disease is unlikely to be the cause of fetal loss since renal function is not required to complete gestation. One hypothesis is that embryonic demise is due to leaky vessels or cardiac pathology.In these studies we used a series of genetically modified Pkd1 and Pkd2 murine models to investigate the cause of embryonic lethality in mutant embryos. Since placental defects are a frequent cause of fetal loss, we conducted histopathologic analyses of placentas from Pkd1 null mice and detected abnormalities of the labyrinth layer beginning at E12.5. We performed placental rescue experiments using tetraploid aggregation and conditional inactivation of Pkd1 with the Meox2 Cre recombinase. We found that both strategies improved the viability of Pkd1 null embryos. Selective inactivation of Pkd1 and Pkd2 in endothelial cells resulted in polyhydramnios and abnormalities similar to those observed in Pkd1(-/- placentas. However, endothelial cell specific deletion of Pkd1 or Pkd2 did not yield the dramatic vascular phenotypes observed in null animals.Placental abnormalities contribute to the fetal demise of Pkd(-/- embryos. Endothelial cell specific deletion of Pkd1 or Pkd2 recapitulates a subset of findings seen in Pkd null animals. Our studies reveal a complex role for polycystins in maintaining vascular integrity.

  11. High-Throughput Screening of a Luciferase Reporter of Gene Silencing on the Inactive X Chromosome.

    Science.gov (United States)

    Keegan, Alissa; Plath, Kathrin; Damoiseaux, Robert

    2018-01-01

    Assays of luciferase gene activity are a sensitive and quantitative reporter system suited to high-throughput screening. We adapted a luciferase assay to a screening strategy for identifying factors that reactivate epigenetically silenced genes. This epigenetic luciferase reporter is subject to endogenous gene silencing mechanisms on the inactive X chromosome (Xi) in primary mouse cells and thus captures the multilayered nature of chromatin silencing in development. Here, we describe the optimization of an Xi-linked luciferase reactivation assay in 384-well format and adaptation of the assay for high-throughput siRNA and chemical screening. Xi-luciferase reactivation screening has applications in stem cell biology and cancer therapy. We have used the approach described here to identify chromatin-modifying proteins and to identify drug combinations that enhance the gene reactivation activity of the DNA demethylating drug 5-aza-2'-deoxycytidine.

  12. Early postnatal gentamicin and ceftazidime treatment in normal and food restricted neonatal wistar rats: Implications for kidney development.

    Science.gov (United States)

    Bueters, Ruud R G; Jeronimus-Klaasen, Annelies; Brüggemann, Roger J M; van den Heuvel, Lambertus P; Schreuder, Michiel F

    2017-09-01

    Up to two-thirds of premature born neonates are treated for infections with aminoglycosides such as gentamicin. Although acute toxicities are well described, there is uncertainty on developmental changes after treatment of premature born neonates. We studied the effect of gentamicin and ceftazidime on kidney development in the rat. Additionally, we evaluated the modulating effect of extrauterine growth restriction. On postnatal day (PND) 2, Wistar rats were cross-fostered into normal sized litters (12 pups) or large litters (20 pups) to create normal food (NF) or food restricted (FR) litters to simulate growth restriction and dosed daily intraperitoneally with placebo, 4 mg/kg of gentamicin or 50 mg/kg ceftazidime until PND 8. Gentamicin pharmacokinetics were studied in a separate group of animals. Kidneys were weighed. Renal expression of 18 developmental genes was evaluated by quantitative PCR on PND 8. On PND 35, glomerular number was assessed by stereology and glomerular generations were counted. Food restricted litters showed 22% less body weight compared with controls by day 35 (p kidney development, ceftazidime can affect Renin expression, and extrauterine growth restriction impairs kidney development, but did not modulate potential drug toxicity. Birth Defects Research 109:1228-1235, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  13. Diversification of intrinsic motoneuron electrical properties during normal development and botulinum toxin-induced muscle paralysis in early postnatal mice.

    Science.gov (United States)

    Nakanishi, S T; Whelan, P J

    2010-05-01

    During early postnatal development, between birth and postnatal days 8-11, mice start to achieve weight-bearing locomotion. In association with the progression of weight-bearing locomotion there are presumed developmental changes in the intrinsic electrical properties of spinal -motoneurons. However, these developmental changes in the properties of -motoneuron properties have not been systematically explored in mice. Here, data are presented documenting the developmental changes of selected intrinsic motoneuron electrical properties, including statistically significant changes in action potential half-width, intrinsic excitability and diversity (quantified as coefficient of variation) of rheobase current, afterhyperpolarization half-decay time, and input resistance. In various adult mammalian preparations, the maintenance of intrinsic motoneuron electrical properties is dependent on activity and/or transmission-sensitive motoneuron-muscle interactions. In this study, we show that botulinum toxin-induced muscle paralysis led to statistically significant changes in the normal development of intrinsic motoneuron electrical properties in the postnatal mouse. This suggests that muscle activity during early neonatal life contributes to the development of normal motoneuron electrical properties.

  14. How normal is grammatical development in the right hemisphere following hemispherectomy? The root infinitive stage and beyond.

    Science.gov (United States)

    Curtiss, Susan; de Bode, Stella

    2003-08-01

    We examined the morphosyntax of eight left hemispherectomized children at two different stages and compared it to MLU-matched normals. We found that the language of the hemispherectomies paralleled that of their MLU matches with respect to the specific morphosyntactic characteristics of each stage. Our findings provide strong evidence for the presence of functional categories in all early grammars and demonstrate that grammatical development, regardless of its neural substrate, is highly constrained by UG and follows a narrowly determined course. We discuss our findings within a neurobiological framework in which etiology defines the integrity of the remaining hemisphere, which in turn, determines its potential for linguistic reorganization and/or acquisition.

  15. RNAi silenced Dd-grp94 (Dictyostelium discoideum glucose-regulated protein 94 kDa) cell lines in Dictyostelium exhibit marked reduction in growth rate and delay in development.

    Science.gov (United States)

    Baviskar, Sandhya N; Shields, Malcolm S

    2010-01-01

    Glucose-regulated 94 kDa protein (Grp94) is a resident of the endoplasmic reticulum (ER) of multicellular eukaryotes. It is a constitutively expressed protein that is overexpressed in certain abnormal conditions of the cell such as depletion of glucose and calcium, and low oxygen and pH. The protein is also implicated in diseased conditions like cancer and Alzheimer's disease. In this study, the consequences of downregulation of Grp94 were investigated at both unicellular and multicellular stages of Dictyostelium discoideum. Previous studies have shown the expression of Dd-Grp94 (Dictyostelium discoideum glucose-regulated 94 kDa protein) in wild-type cells varies during development, and overexpression of Dd-Grp94 leads to abnormal cell shape and inhibition of development (i.e., formation of fruiting bodies). Grp94 is a known calcium binding protein and an efficient calcium buffer. Therefore, in the present study we hypothesized that downregulation of Dd-Grp94 protein would affect Dictyostelium cell structure, growth, and development. We found that Dd-grp94 RNAi recombinants exhibited reduced growth rate, cell size, and a subtle change in cell motility compared to the parental cells. The recombinants also exhibited a delay in development and small fruiting bodies. These results establish that Dd-grp94 plays a crucial role in determining normal cell structure, growth and differentiation.

  16. Assessment of gait in toddlers with normal motor development and in hemiplegic children with mild motor impairment: a validity study

    Directory of Open Access Journals (Sweden)

    Priscilla R. P. Figueiredo

    2013-08-01

    Full Text Available BACKGROUND: The optimization of gait performance is an important goal in the rehabilitation of children with cerebral palsy (CP who present a prognosis associated with locomotion. Gait analysis using videos captured by digital cameras requires validation. OBJECTIVE: To evaluate the validity of a method that involves the analysis of videos captured using a digital camera for quantifying the temporal parameters of gait in toddlers with normal motor development and children with CP. METHOD: Eleven toddlers with normal motor development and eight children with spastic hemiplegia who were able to walk without assistive devices were asked to walk through a space contained in the visual field of two instruments: a digital camera and a three-dimensional motion analysis system, Qualisys Pro-Reflex. The duration of the stance and swing phases of gait and of the entire gait cycle were calculated by analyzing videos captured by a digital camera and compared to those obtained by Qualisys Pro-Reflex, which is considered a highly accurate system. RESULTS: The Intraclass Correlation Coefficient (ICC demonstrated excellent agreement (ICC>0.90 between the two procedures for all measurements, except for the swing phase of the normal toddlers (ICC=0.35. The standard error of measurement was less than 0.02 seconds for all measures. CONCLUSIONS: The results reveal similarities between the two instruments, suggesting that digital cameras can be valid instruments for quantifying two temporal parameters of gait. This congruence is of clinical and scientific relevance and validates the use of digital cameras as a resource for helping the assessment and documentation of the therapeutic effects of interventions targeted at the gait of children with CP.

  17. Normal development of the muscular region of the interventricular septum--I. The significance of the ventricular trabeculations.

    Science.gov (United States)

    Contreras-Ramos, A; Sánchez-Gómez, C; García-Romero, H L; Cimarosti, L O

    2008-10-01

    The structures that participate in normal ventricular septation, and to what extent they do so, are questions not yet clarified. Even less is known about how much each of the embryonic structures contributes to the topography of the mature interventricular septum (IVS). The aim of the present paper is to investigate the significance of ventricular trabeculations in the normal development of the muscular region (the middle and apical thirds) of the IVS and to determine the direction in which it grows during cardiac septation. Anatomical studies and in vivo labelling were carried out in chicken embryo hearts at stage 18HH, tracing the labels up to stage 36HH. We analysed the results by measuring the distance between the labelled structures at the beginning and end of the experiments. We demonstrate that the muscular region of the septum originates by the fusion of the ventricular trabeculations with evidence that during cardiac development, the IVS as well as the ventricular cavities grow in opposite direction to the atria.

  18. Superconductor-normal metal-superconductor process development for the fabrication of small Josephson junctions in ramp type configuration

    International Nuclear Information System (INIS)

    Poepel, R.; Hagedorn, D.; Weimann, T.; Buchholz, F.-I.; Niemeyer, J.

    2000-01-01

    At PTB, a fabrication process has been developed in SNS Nb/PdAu/Nb technology for the verification of small Josephson junctions (JJs) in the deep sub-micron range to enable the implementation of JJs as active elements in highly integrated superconducting circuits. Two steps of this technological development are described with regard to appropriately designed circuit layouts of JJ series arrays (JJAs), the first one in a conventional window type junction (WTJ) configuration and the second one in a ramp type junction (RTJ) configuration. Test circuits of JJAs containing up to 10 000 JJs have been fabricated and experimentally tested. In WTJ configuration, the circuits proved to be sensitive to external perturbing effects affecting the stability of circuit operation. In contrast to that, in RTJ configuration, the circuits realized showed correct function and a high grade of reliability of operation. To produce RTJ circuits, the technology parameters have been set to realize JJs with contact areas of A=0.25μmx1.3μm. At a thickness of the PdAu normal metal layer of d = 40 nm, the values achieved for the critical current density and for the product of critical current and normal state resistance are about j c = 200 k Acm -2 and about I c R N = 21 μV. (author)

  19. Fundamental Study on the Development of Structural Lightweight Concrete by Using Normal Coarse Aggregate and Foaming Agent

    Science.gov (United States)

    Lee, Han-Seung; Ismail, Mohamed A.; Woo, Young-Je; Min, Tae-Beom; Choi, Hyun-Kook

    2014-01-01

    Structural lightweight concrete (SLWC) has superior properties that allow the optimization of super tall structure systems for the process of design. Because of the limited supply of lightweight aggregates in Korea, the development of structural lightweight concrete without lightweight aggregates is needed. The physical and mechanical properties of specimens that were cast using normal coarse aggregates and different mixing ratios of foaming agent to evaluate the possibility of creating structural lightweight concrete were investigated. The results show that the density of SLWC decreases as the dosage of foaming agent increases up to a dosage of 0.6%, as observed by SEM. It was also observed that the foaming agent induced well separated pores, and that the size of the pores ranged from 50 to 100 μm. Based on the porosity of concrete specimens with foaming agent, compressive strength values of structural lightweight foam concrete (SLWFC) were obtained. It was also found that the estimated values from proposed equations for compressive strength and modulus of elasticity of SLWFC, and values obtained by actual measurements were in good agreement. Thus, this study confirms that new structural lightweight concrete using normal coarse aggregates and foaming agent can be developed successfully. PMID:28788691

  20. Longitudinal motor development of "apparently normal" high-risk infants at 18 months, 3 and 5 years.

    Science.gov (United States)

    Goyen, Traci Anne; Lui, Kei

    2002-12-01

    Motor development appears to be more affected by premature birth than other developmental domains, however few studies have specifically investigated the development of gross and fine motor skills in this population. To examine longitudinal motor development in a group of "apparently normal" high-risk infants. Developmental follow-up clinic in a perinatal centre. Longitudinal observational cohort study. Fifty-eight infants born less than 29 weeks gestation and/or 1000 g and without disabilities detected at 12 months. Longitudinal gross and fine motor skills at 18 months, 3 and 5 years using the Peabody Developmental Motor Scales. The HOME scale provided information of the home environment as a stimulus for development. A large proportion (54% at 18 months, 47% at 3 years and 64% at 5 years) of children continued to have fine motor deficits from 18 months to 5 years. The proportion of infants with gross motor deficits significantly increased over this period (14%, 33% and 81%, pmotor development was positively influenced by the quality of the home environment. A large proportion of high-risk infants continued to have fine motor deficits, reflecting an underlying problem with fine motor skills. The proportion of infants with gross motor deficits significantly increased, as test demands became more challenging. In addition, the development of gross and fine motor skills appears to be influenced differently by the home environment.

  1. Snipper, an Eri1 homologue, affects histone mRNA abundance and is crucial for normal Drosophila melanogaster development.

    Science.gov (United States)

    Alexiadis, Anastasios; Delidakis, Christos; Kalantidis, Kriton

    2017-07-01

    The conserved 3'-5' RNA exonuclease ERI1 is implicated in RNA interference inhibition, 5.8S rRNA maturation and histone mRNA maturation and turnover. The single ERI1 homologue in Drosophila melanogaster Snipper (Snp) is a 3'-5' exonuclease, but its in vivo function remains elusive. Here, we report Snp requirement for normal Drosophila development, since its perturbation leads to larval arrest and tissue-specific downregulation results in abnormal tissue development. Additionally, Snp directly interacts with histone mRNA, and its depletion results in drastic reduction in histone transcript levels. We propose that Snp protects the 3'-ends of histone mRNAs and upon its absence, histone transcripts are readily degraded. This in turn may lead to cell cycle delay or arrest, causing growth arrest and developmental perturbations. © 2017 Federation of European Biochemical Societies.

  2. Conifers have a unique small RNA silencing signature

    OpenAIRE

    Dolgosheina, Elena V.; Morin, Ryan D.; Aksay, Gozde; Sahinalp, S. Cenk; Magrini, Vincent; Mardis, Elaine R.; Mattsson, Jim; Unrau, Peter J.

    2008-01-01

    Plants produce small RNAs to negatively regulate genes, viral nucleic acids, and repetitive elements at either the transcriptional or post-transcriptional level in a process that is referred to as RNA silencing. While RNA silencing has been extensively studied across the different phyla of the animal kingdom (e.g., mouse, fly, worm), similar studies in the plant kingdom have focused primarily on angiosperms, thus limiting evolutionary studies of RNA silencing in plants. Here we report on an u...

  3. Genome-wide methylation analysis identifies genes silenced in non-seminoma cell lines.

    Science.gov (United States)

    Noor, Dzul Azri Mohamed; Jeyapalan, Jennie N; Alhazmi, Safiah; Carr, Matthew; Squibb, Benjamin; Wallace, Claire; Tan, Christopher; Cusack, Martin; Hughes, Jaime; Reader, Tom; Shipley, Janet; Sheer, Denise; Scotting, Paul J

    2016-01-01

    Silencing of genes by DNA methylation is a common phenomenon in many types of cancer. However, the genome-wide effect of DNA methylation on gene expression has been analysed in relatively few cancers. Germ cell tumours (GCTs) are a complex group of malignancies. They are unique in developing from a pluripotent progenitor cell. Previous analyses have suggested that non-seminomas exhibit much higher levels of DNA methylation than seminomas. The genomic targets that are methylated, the extent to which this results in gene silencing and the identity of the silenced genes most likely to play a role in the tumours' biology have not yet been established. In this study, genome-wide methylation and expression analysis of GCT cell lines was combined with gene expression data from primary tumours to address this question. Genome methylation was analysed using the Illumina infinium HumanMethylome450 bead chip system and gene expression was analysed using Affymetrix GeneChip Human Genome U133 Plus 2.0 arrays. Regulation by methylation was confirmed by demethylation using 5-aza-2-deoxycytidine and reverse transcription-quantitative PCR. Large differences in the level of methylation of the CpG islands of individual genes between tumour cell lines correlated well with differential gene expression. Treatment of non-seminoma cells with 5-aza-2-deoxycytidine verified that methylation of all genes tested played a role in their silencing in yolk sac tumour cells and many of these genes were also differentially expressed in primary tumours. Genes silenced by methylation in the various GCT cell lines were identified. Several pluripotency-associated genes were identified as a major functional group of silenced genes.

  4. Nucleases as a barrier to gene silencing in the cotton boll weevil, Anthonomus grandis.

    Science.gov (United States)

    Almeida Garcia, Rayssa; Lima Pepino Macedo, Leonardo; Cabral do Nascimento, Danila; Gillet, François-Xavier; Moreira-Pinto, Clidia Eduarda; Faheem, Muhammad; Moreschi Basso, Angelina Maria; Mattar Silva, Maria Cristina; Grossi-de-Sa, Maria Fatima

    2017-01-01

    RNA interference (RNAi) approaches have been applied as a biotechnological tool for controlling plant insect pests via selective gene down regulation. However, the inefficiency of RNAi mechanism in insects is associated with several barriers, including dsRNA delivery and uptake by the cell, dsRNA interaction with the cellular membrane receptor and dsRNA exposure to insect gut nucleases during feeding. The cotton boll weevil (Anthonomus grandis) is a coleopteran in which RNAi-mediated gene silencing does not function efficiently through dsRNA feeding, and the factors involved in the mechanism remain unknown. Herein, we identified three nucleases in the cotton boll weevil transcriptome denoted AgraNuc1, AgraNuc2, and AgraNuc3, and the influences of these nucleases on the gene silencing of A. grandis chitin synthase II (AgraChSII) were evaluated through oral dsRNA feeding trials. A phylogenetic analysis showed that all three nucleases share high similarity with the DNA/RNA non-specific endonuclease family of other insects. These nucleases were found to be mainly expressed in the posterior midgut region of the insect. Two days after nuclease RNAi-mediated gene silencing, dsRNA degradation by the gut juice was substantially reduced. Notably, after nucleases gene silencing, the orally delivered dsRNA against the AgraChSII gene resulted in improved gene silencing efficiency when compared to the control (non-silenced nucleases). The data presented here demonstrates that A. grandis midgut nucleases are effectively one of the main barriers to dsRNA delivery and emphasize the need to develop novel RNAi delivery strategies focusing on protecting the dsRNA from gut nucleases and enhancing its oral delivery and uptake to crop insect pests.

  5. Linguistic and Psychological Perspectives on Prolonged Periods of Silence in Dual-Language Learners

    Science.gov (United States)

    Le Pichon, Emmanuelle; de Jonge, Maretha

    2016-01-01

    In this paper, we present an examination of the literature on prolonged periods of silence in children from the perspective of two different scientific fields. The aim is to call attention to the inherent complexity of the factors that may be involved in the etiology of mutistic behavior during child development. Medical and linguistic literature…

  6. Small silencing RNAs: an expanding universe.

    Science.gov (United States)

    Ghildiyal, Megha; Zamore, Phillip D

    2009-02-01

    Since the discovery in 1993 of the first small silencing RNA, a dizzying number of small RNA classes have been identified, including microRNAs (miRNAs), small interfering RNAs (siRNAs) and Piwi-interacting RNAs (piRNAs). These classes differ in their biogenesis, their modes of target regulation and in the biological pathways they regulate. There is a growing realization that, despite their differences, these distinct small RNA pathways are interconnected, and that small RNA pathways compete and collaborate as they regulate genes and protect the genome from external and internal threats.

  7. The Enamovirus P0 protein is a silencing suppressor which inhibits local and systemic RNA silencing through AGO1 degradation

    International Nuclear Information System (INIS)

    Fusaro, Adriana F.; Correa, Regis L.; Nakasugi, Kenlee; Jackson, Craig; Kawchuk, Lawrence; Vaslin, Maite F.S.; Waterhouse, Peter M.

    2012-01-01

    The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0 PE , in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0 PE has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0 PE destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.

  8. Clarifying Normalization

    Science.gov (United States)

    Carpenter, Donald A.

    2008-01-01

    Confusion exists among database textbooks as to the goal of normalization as well as to which normal form a designer should aspire. This article discusses such discrepancies with the intention of simplifying normalization for both teacher and student. This author's industry and classroom experiences indicate such simplification yields quicker…

  9. Gender Differences in Self-Silencing and Psychological Distress in Informal Cancer Carers

    Science.gov (United States)

    Ussher, Jane M.; Perz, Janette

    2010-01-01

    This study examined gender differences in self-silencing, the relationship between self-silencing and psychological distress, and reasons for self-silencing in informal cancer carers (329 women, 155 men), using a mixed-method design. Men reported greater self-silencing than women on the Silencing the Self Scale; however, women reported higher…

  10. Developmental changes in visuo-spatial working memory in normally developing children: event-related potentials study.

    Science.gov (United States)

    Myatchin, Ivan; Lagae, Lieven

    2013-10-01

    Working memory (WM) is very important for normal development. The fronto-parietal neuronal network supporting WM has already been well-studied. Less is known about the cortical activity changes during development of WM. We evaluated the maturation of visual WM network at the electrophysiological level in a group of normally developing children. Multichannel (n=31) event-related potentials (ERP) were measured during a visuo-spatial backmatching task in 69 childrens (6-16 years old). One-backmatching (BM1) and two-backmatching (BM2) tasks were performed. Age-related changes in behavioral parameters (commission and omission errors and reaction times) and ERP parameters (peak amplitudes and latencies) were analyzed between different ages. Clear improvement in performance from young childhood toward adolescence was seen at the behavioral level: decrease of errors and fastening of reaction times. At the electrophysiological level age-related changes were seen in peak latencies and especially in amplitudes. Different peaks have different dynamics in amplitudes and latencies: early peak amplitude decreased and latency shortened with age, which was not always seen in late peaks. This reflects developmental changes in intensity and speed of WM processing. Later peaks were more clearly seen over the right hemisphere in older children, illustrating hemispheric lateralization in visuo-spatial working memory. Our results indicate that not only at the behavioral but also at the electrophysiological level clear age-related dynamics in WM processing can be seen. Furthermore, with ERP we showed that different WM components follow different developmental trajectories. Our work demonstrates that age-related dynamics in intensity and speed of information processing during WM task is reflected in developmental changes in different ERP components. It also states that fronto-parietal visual WM network can be functional even before all its nodes are fully mature. Copyright © 2012 The

  11. Construction of a normalized full-length cDNA library of cephalopod Amphioctopus fangsiao and development of microsatellite markers

    Science.gov (United States)

    Feng, Yanwei; Liu, Wenfen; Xu, Xin; Yang, Jianmin; Wang, Weijun; Wei, Xiumei; Liu, Xiangquan; Sun, Guohua

    2017-10-01

    Amphioctopus fangsiao is one of the most economically important species and has been considered to be a candidate for aquaculture. In order to facilitate its fine-scale genetic analyses, we constructed a normalized full-length library successfully and developed a set of microsatellite markers in this study. The normalized full-length library had a storage capacity of 6.9×105 independent clones. The recombination efficiency was 95% and the average size of inserted fragments was longer than 1000 bp. A total of 3440 high quality ESTs were obtained, which were assembled into 1803 unigenes. Of these unigenes, 450 (25%) were assigned into 33 Gene Ontology terms, 576 (31.9%) into 153 Kyoto Encyclopedia of Genes and Genomes pathways, and 275 (15.3%) into 22 Clusters of Orthologous Groups. Seventy-six polymorphic microsatellite markers were identified. The number of alleles per locus ranged from 4 to 17, and the observed and expected heterozygosities varied between 0.167 and 0.967 and between 0.326 and 0.944, respectively. Twelve loci were significantly deviated from Hardy-Weinberg equilibrium after Bonferroni correction and no linkage disequilibrium was found between different loci. This study provided not only a useful resource for the isolation of the functional genes, but also a set of informative microsatellites for the assessment of population structure and conservation genetics of A. fangsiao.

  12. A new component of the Nasonia sex determining cascade is maternally silenced and regulates transformer expression.

    Science.gov (United States)

    Verhulst, Eveline C; Lynch, Jeremy A; Bopp, Daniel; Beukeboom, Leo W; van de Zande, Louis

    2013-01-01

    Although sex determination is a universal process in sexually reproducing organisms, sex determination pathways are among the most highly variable genetic systems found in nature. Nevertheless, general principles can be identified among the diversity, like the central role of transformer (tra) in insects. When a functional TRA protein is produced in early embryogenesis, the female sex determining route is activated, while prevention of TRA production leads to male development. In dipterans, male development is achieved by prevention of female-specific splicing of tra mRNA, either mediated by X-chromosome dose or masculinizing factors. In Hymenoptera, which have haplodiploid sex determination, complementary sex determination and maternal imprinting have been identified to regulate timely TRA production. In the parasitoid Nasonia, zygotic transformer (Nvtra) expression and splicing is regulated by a combination of maternal provision of Nvtra mRNA and silencing of Nvtra expression in unfertilized eggs. It is unclear, however, if this silencing is directly on the tra locus or whether it is mediated through maternal silencing of a trans-acting factor. Here we show that in Nasonia, female sex determination is dependent on zygotic activation of Nvtra expression by an as yet unknown factor. This factor, which we propose to term womanizer (wom), is maternally silenced during oogenesis to ensure male development in unfertilized eggs. This finding implicates the upstream recruitment of a novel gene in the Nasonia sex determining cascade and supports the notion that sex determining cascades can rapidly change by adding new components on top of existing regulators.

  13. Silencing of voices in a Swedish science classroom

    Science.gov (United States)

    Ramos de Robles, S. Lizette

    2018-03-01

    From a sociocultural perspective, I discuss data from a Swedish science classroom presented in María Gómez's article "Student Explanations of their Science Teachers' Assessments, Grading Practices, and How they learn Science". In this discussion, I focus on the need to change existing conceptions of assessment in the teaching and learning of science. Next, I talk about the importance of taking into consideration the dialectic between agency and passivity as filters in order to understand what student silence may signify in science classes as well as in relation to their perceptions of assessment. I conclude with the importance of the teacher's role in developing formative assessment, along with the challenges in developing assessments which transform science education into a relevant field of knowledge for both students and society at large.

  14. LSM Proteins Provide Accurate Splicing and Decay of Selected Transcripts to Ensure Normal Arabidopsis Development[W

    Science.gov (United States)

    Perea-Resa, Carlos; Hernández-Verdeja, Tamara; López-Cobollo, Rosa; Castellano, María del Mar; Salinas, Julio

    2012-01-01

    In yeast and animals, SM-like (LSM) proteins typically exist as heptameric complexes and are involved in different aspects of RNA metabolism. Eight LSM proteins, LSM1 to 8, are highly conserved and form two distinct heteroheptameric complexes, LSM1-7 and LSM2-8,that function in mRNA decay and splicing, respectively. A search of the Arabidopsis thaliana genome identifies 11 genes encoding proteins related to the eight conserved LSMs, the genes encoding the putative LSM1, LSM3, and LSM6 proteins being duplicated. Here, we report the molecular and functional characterization of the Arabidopsis LSM gene family. Our results show that the 11 LSM genes are active and encode proteins that are also organized in two different heptameric complexes. The LSM1-7 complex is cytoplasmic and is involved in P-body formation and mRNA decay by promoting decapping. The LSM2-8 complex is nuclear and is required for precursor mRNA splicing through U6 small nuclear RNA stabilization. More importantly, our results also reveal that these complexes are essential for the correct turnover and splicing of selected development-related mRNAs and for the normal development of Arabidopsis. We propose that LSMs play a critical role in Arabidopsis development by ensuring the appropriate development-related gene expression through the regulation of mRNA splicing and decay. PMID:23221597

  15. Amygdalo-cortical sprouting continues into early adulthood: implications for the development of normal and abnormal function during adolescence.

    Science.gov (United States)

    Cunningham, Miles Gregory; Bhattacharyya, Sujoy; Benes, Francine Mary

    2002-11-11

    Adolescence is a critical stage for the development of emotional maturity and diverse forms of psychopathology. The posterior basolateral nucleus of the amygdala is known to mediate fear and anxiety and is important in assigning emotional valence to cognitive processes. The medial prefrontal cortex, a homologue of the human anterior cingulate cortex, mediates emotional, attentional, and motivational behaviors at the cortical level. We postulate that the development of connectivity between these two corticolimbic regions contributes to an enhanced integration of emotion and cognition during the postnatal period. In order to characterize the development of this relay, injections of the anterograde tracer biocytin were stereotaxically placed within the posterior basolateral nucleus of the amygdala of rats at successive postnatal time points (postnatal days 6-120). Labeled fibers in the medial prefrontal cortex were evaluated using a combination of brightfield, confocal, and electron microscopy. We found that the density of labeled fibers originating from the posterior basolateral nucleus shows a sharp curvilinear increase within layers II and V of the anterior cingulate cortex and the infralimbic subdivisions of medial prefrontal cortex during the late postweanling period. This increase was paralleled by a linear rise in the number of axospinous and axodendritic synapses present in the neuropil. Based on these results, we propose that late maturation of amygdalo-cortical connectivity may provide an anatomical basis for the development and integration of normal and possibly abnormal emotional behavior during adolescence and early adulthood. Copyright 2002 Wiley-Liss, Inc.

  16. Arabidopsis ACA7, encoding a putative auto-regulated Ca(2+)-ATPase, is required for normal pollen development.

    Science.gov (United States)

    Lucca, Noel; León, Gabriel

    2012-04-01

    Microgametogenesis is a complex process that involves numerous well-coordinated cell activities, ending with the production of pollen grains. Pollen development has been studied at the cytological level in Arabidopsis and other plant species, where its temporal time course has been defined. However, the molecular mechanism underlying this process is still unclear, since a relative small number of genes and/or processes have been identified as essential for pollen development. We have designed a methodology to select candidate genes for functional analysis, based on transcriptomic data obtained from different stages of pollen development. From our analyses, we selected At2g22950 as a candidate gene; this gene encodes a protein belonging to the auto-regulated Ca(2+)-ATPase family, ACA7. Microarray data indicate that ACA7 is expressed exclusively in developing pollen grains, with the highest level of mRNA at the time of the second pollen mitosis. Our RT-PCR experiments showed that ACA7 mRNA is detected exclusively in developing flowers. Confocal microscopy experiments showed a plasma membrane localization for the recombinant GFP:ACA7 protein. We identified two different insertional mutant lines, aca7-1 and aca7-2; plants from both mutant lines displayed a normal vegetative development but showed large amounts of dead pollen grains in mature flowers assayed by Alexander's staining. Histological analysis indicated that abnormalities are detected after the first pollen mitosis and we found a strong correlation between ACA7 mRNA accumulation and the severity of the phenotype. Our results indicate that ACA7 is a plasma membrane protein that has an important role during pollen development, possibly through regulation of Ca(2+) homeostasis. © Springer-Verlag 2011

  17. An investigation of noise produced by unsteady gas flow through silencer elements

    Science.gov (United States)

    Mawhinney, Graeme Hugh

    This thesis presents an investigation of the noise produced by unsteady gas flow through silencer elements. The central aim of the research project was to produce a tool for assistance in the design of the exhaust systems of diesel powered electrical generator sets, with the modelling techniques developed having a much wider application in reciprocating internal combustion engine exhaust systems. An automotive cylinder head was incorporated in a purpose built test rig to supply exhaust pulses, typical of those found in the exhaust system of four stroke diesel engines, to various experimental exhaust systems. Exhaust silencer elements evaluated included expansion, re- entrant, concentric tube resonator and absorptive elements. Measurements taken on the test rig included, unsteady superposition pressure in the exhaust ducting, cyclically averaged mass flow rate through the system and exhaust noise levels radiated into a semi-anechoic measurement chamber. The entire test rig was modelled using the 1D finite volume method developed previously developed at Queen's University Belfast. Various boundary conditions, developed over the years, were used to model the various silencer elements being evaluated. The 1D gas dynamic simulation thus estimated the mass flux history at the open end of the exhaust system. The mass flux history was then broken into its harmonic components and an acoustic radiation model was developed to model the sound pressure level produced by an acoustic monopole over a reflecting plane. The accuracy of the simulation technique was evaluated by correlation of measured and simulated superposition pressure and noise data. In general correlation of superposition pressure was excellent for all of the silencer elements tested. Predicted sound pressure level radiated from the open end of the exhaust tailpipe was seen to be accurate in the 100 Hz to 1 kHz frequency range for all of the silencer elements tested.

  18. Researches Concerning to Minimize Vibrations when Processing Normal Lathe

    Directory of Open Access Journals (Sweden)

    Lenuța Cîndea

    2015-09-01

    Full Text Available In the cutting process, vibration is inevitable appearance, and in situations where the amplitude exceeds the limits of precision dimensional and shape of the surfaces generated vibrator phenomenon is detrimental.Field vibration is an issue of increasingly developed, so the futures will a better understanding of them and their use even in other sectors.The paper developed experimental measurement of vibrations at the lathe machining normal. The scheme described kinematical machine tool, cutting tool, cutting conditions, presenting experimental facility for measuring vibration occurring at turning. Experimental results have followed measurement of amplitude, which occurs during interior turning the knife without silencer incorporated. The tests were performed continuously for different speed, feed and depth of cut.

  19. The risk of newly developed visual impairment in treated normal-tension glaucoma: 10-year follow-up.

    Science.gov (United States)

    Choi, Yun Jeong; Kim, Martha; Park, Ki Ho; Kim, Dong Myung; Kim, Seok Hwan

    2014-12-01

    To investigate the risk and risk factors for newly developed visual impairment in treated patients with normal-tension glaucoma (NTG) followed up on for 10 years. Patients with NTG, who did not have visual impairment at the initial diagnosis and had undergone intraocular pressure (IOP)-lowering treatment for more than 7 years, were included on the basis of a retrospective chart review. Visual impairment was defined as either low vision (0.05 [20/400] ≤ visual acuity (VA) visual field (VF) visual impairment, Kaplan-Meier survival analysis and generalized linear mixed effects models were utilized. During the 10.8 years mean follow-up period, 20 eyes of 16 patients were diagnosed as visual impairment (12 eyes as low vision, 8 as blindness) among 623 eyes of 411 patients. The cumulative risk of visual impairment in at least one eye was 2.8% at 10 years and 8.7% at 15 years. The risk factors for visual impairment from treated NTG were worse VF mean deviation (MD) at diagnosis and longer follow-up period. The risk of newly developed visual impairment in the treated patients with NTG was relatively low. Worse VF MD at diagnosis and longer follow-up period were associated with development of visual impairment. © 2014 Acta Ophthalmologica Scandinavica Foundation. Published by John Wiley & Sons Ltd.

  20. Evaluation of the radiographic process using a experimental monobath solution compared with normal (Kodak) and rapid (RAY) developer solutions

    International Nuclear Information System (INIS)

    Baratieri, N.M.M.

    1985-01-01

    A comparative evaluation of the radiographic image quality of two dental X-ray films (Kodak's EP-21 and Agfa-Gevaert DOS-1) when processed in a normal (Kodak) a rapid (Ray) and a experimental monobath solutions, is presented. These films, processed in those solutions had their time of development, temperature and agitation performances checked by sensitometry; pH and color by routine methods and hipo rests by spectrophotometry. The radiographies were also analysed by able professionals regarding the best development time. The data so obtained allowed the conclusions that the best development time for the monobath was 3 minutes at 20 0 C but 25 or 30 0 C give also acceptable results at shorter times. The agitation of 10 seconds every minute is an important factor concerning image quality. pH and color do alter rapidally but with little influence in the final result. We found a certain amount of residual chemical compounds which were not identified but that are not hipo components, and being important to note that they seem not act upon the emulsion at least during one year after processing. (author) [pt

  1. Phenotypic changes associated with RNA interference silencing of chalcone synthase in apple (Malus × domestica).

    Science.gov (United States)

    Dare, Andrew P; Tomes, Sumathi; Jones, Midori; McGhie, Tony K; Stevenson, David E; Johnson, Ross A; Greenwood, David R; Hellens, Roger P

    2013-05-01

    We have identified in apple (Malus × domestica) three chalcone synthase (CHS) genes. In order to understand the functional redundancy of this gene family RNA interference knockout lines were generated where all three of these genes were down-regulated. These lines had no detectable anthocyanins and radically reduced concentrations of dihydrochalcones and flavonoids. Surprisingly, down-regulation of CHS also led to major changes in plant development, resulting in plants with shortened internode lengths, smaller leaves and a greatly reduced growth rate. Microscopic analysis revealed that these phenotypic changes extended down to the cellular level, with CHS-silenced lines showing aberrant cellular organisation in the leaves. Fruit collected from one CHS-silenced line was smaller than the 'Royal Gala' controls, lacked flavonoids in the skin and flesh and also had changes in cell morphology. Auxin transport experiments showed increased rates of auxin transport in a CHS-silenced line compared with the 'Royal Gala' control. As flavonoids are well known to be key modulators of auxin transport, we hypothesise that the removal of almost all flavonoids from the plant by CHS silencing creates a vastly altered environment for auxin transport to occur and results in the observed changes in growth and development. © 2013 The Authors The Plant Journal © 2013 Blackwell Publishing Ltd.

  2. Development and Implementation of Mechanistic Terry Turbine Models in RELAP-7 to Simulate RCIC Normal Operation Conditions

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Haihua [Idaho National Lab. (INL), Idaho Falls, ID (United States); Zou, Ling [Idaho National Lab. (INL), Idaho Falls, ID (United States); Zhang, Hongbin [Idaho National Lab. (INL), Idaho Falls, ID (United States); O' Brien, James Edward [Idaho National Lab. (INL), Idaho Falls, ID (United States)

    2016-09-01

    As part of the efforts to understand the unexpected “self-regulating” mode of the RCIC (Reactor Core Isolation Cooling) systems in Fukushima accidents and extend BWR RCIC and PWR AFW (Auxiliary Feed Water) operational range and flexibility, mechanistic models for the Terry turbine, based on Sandia’s original work [1], have been developed and implemented in the RELAP-7 code to simulate the RCIC system. In 2016, our effort has been focused on normal working conditions of the RCIC system. More complex off-design conditions will be pursued in later years when more data are available. In the Sandia model, the turbine stator inlet velocity is provided according to a reduced-order model which was obtained from a large number of CFD (computational fluid dynamics) simulations. In this work, we propose an alternative method, using an under-expanded jet model to obtain the velocity and thermodynamic conditions for the turbine stator inlet. The models include both an adiabatic expansion process inside the nozzle and a free expansion process outside of the nozzle to ambient pressure. The combined models are able to predict the steam mass flow rate and supersonic velocity to the Terry turbine bucket entrance, which are the necessary input information for the Terry turbine rotor model. The analytical models for the nozzle were validated with experimental data and benchmarked with CFD simulations. The analytical models generally agree well with the experimental data and CFD simulations. The analytical models are suitable for implementation into a reactor system analysis code or severe accident code as part of mechanistic and dynamical models to understand the RCIC behaviors. The newly developed nozzle models and modified turbine rotor model according to the Sandia’s original work have been implemented into RELAP-7, along with the original Sandia Terry turbine model. A new pump model has also been developed and implemented to couple with the Terry turbine model. An input

  3. Development of antimicrobial resistance in the normal anaerobic microbiota during one year after administration of clindamycin or ciprofloxacin.

    Science.gov (United States)

    Rashid, Mamun-Ur; Weintraub, Andrej; Nord, Carl Erik

    2015-02-01

    and clindamycin has an impact on the anaerobic microbiota and may have a long-term effect on the development and persistence of antibiotic-resistant anaerobes in the normal microbiota. Copyright © 2014. Published by Elsevier Ltd.

  4. Antiviral RNA silencing viral counter defense in plants

    NARCIS (Netherlands)

    Bucher, E.C.

    2006-01-01

    The research described in this thesis centres around the mechanism of RNA silencing in relation to virus-host interaction, an area of increasing importance. It shows how this recently disclosed mechanism can be used to produce virus-resistant plants. Based on the activity of the RNA silencing

  5. No-Big-Silence teeb klubituuri / Urmas Hännile

    Index Scriptorium Estoniae

    Hännile, Urmas

    2009-01-01

    Rockansamblist No-Big-Silence ja dark-popansamblist Sinine, nende kontsertttuurist mööda Eestimaad, tutvustamisel bändide uued albumid (No-Big-Silence "Starstealer" ja Sinine "Butterflies"), Pärnus on kontsert 24. oktoobril klubis Sugar

  6. Strategies underlying RNA silencing suppression by negative strand RNA viruses

    NARCIS (Netherlands)

    Hemmes, J.C.

    2007-01-01

    The research described in this thesis focused on the strategies of negative strand RNA viruses to counteract antiviral RNA silencing. In plants and insects, RNA silencing has been shown to act as a sequence specific antiviral defence mechanism that is characterised by the processing of double

  7. Effects of water pH on gamete activation, embryonic development, and larval normality in Prochilodus lineatus

    Directory of Open Access Journals (Sweden)

    Eduardo Antônio Sanches

    2015-08-01

    Full Text Available We investigated the effects of breeding water pH on the spermatic motility, artificial fertilization, and initial development of offspring in curimba, Prochilodus lineatus. After hormonal induction, we conducted gamete activation, artificial fertilization, and embryo incubation in water with pH values of 4.43 ± 0.13, 5.82 ± 0.14, 7.37 ± 0.10, 8.21 ± 0.06, and 9.57 ± 0.16. When the water pH was 6.65, spermatic motility was maintained for ?25.21 s (P < 0.05. The highest fertilization rates (P < 0.05 were obtained when the water pH ranged from 5.82 ± 0.14 to 8.21 ± 0.06, and the highest hatching rates (P < 0.05 were observed when the water pH was 7.37 ± 0.10. A water pH of between 7.37 ± 0.10 and 8.21 ± 0.06 resulted in more complete formation of the perivitelline space (P < 0.05; additionally, embryos incubated in alkaline waters produced a higher percentage of normal larvae (P < 0.05, despite increased mortality levels. Our results indicate that the pH of the water used for gamete activation, artificial oocyte fertilization, and incubation of eggs and larvae of P. lineatus should be ~7, in order to promote successful breeding and normal larval production.

  8. Normal development of human brain white matter from infancy to early adulthood: a diffusion tensor imaging study.

    Science.gov (United States)

    Uda, Satoshi; Matsui, Mie; Tanaka, Chiaki; Uematsu, Akiko; Miura, Kayoko; Kawana, Izumi; Noguchi, Kyo

    2015-01-01

    Diffusion tensor imaging (DTI), which measures the magnitude of anisotropy of water diffusion in white matter, has recently been used to visualize and quantify parameters of neural tracts connecting brain regions. In order to investigate the developmental changes and sex and hemispheric differences of neural fibers in normal white matter, we used DTI to examine 52 healthy humans ranging in age from 2 months to 25 years. We extracted the following tracts of interest (TOIs) using the region of interest method: the corpus callosum (CC), cingulum hippocampus (CGH), inferior longitudinal fasciculus (ILF), and superior longitudinal fasciculus (SLF). We measured fractional anisotropy (FA), apparent diffusion coefficient (ADC), axial diffusivity (AD), and radial diffusivity (RD). Approximate values and changes in growth rates of all DTI parameters at each age were calculated and analyzed using LOESS (locally weighted scatterplot smoothing). We found that for all TOIs, FA increased with age, whereas ADC, AD and RD values decreased with age. The turning point of growth rates was at approximately 6 years. FA in the CC was greater than that in the SLF, ILF and CGH. Moreover, FA, ADC and AD of the splenium of the CC (sCC) were greater than in the genu of the CC (gCC), whereas the RD of the sCC was lower than the RD of the gCC. The FA of right-hemisphere TOIs was significantly greater than that of left-hemisphere TOIs. In infants, growth rates of both FA and RD were larger than those of AD. Our data show that developmental patterns differ by TOIs and myelination along with the development of white matter, which can be mainly expressed as an increase in FA together with a decrease in RD. These findings clarify the long-term normal developmental characteristics of white matter microstructure from infancy to early adulthood. © 2015 S. Karger AG, Basel.

  9. Quantification of 5-hydroxytryptamine1A receptors in the cerebellum of normal and x-irradiated rats during postnatal development

    International Nuclear Information System (INIS)

    Matthiessen, L.; Daval, G.; Bailly, Y.; Gozlan, H.; Hamon, M.; Verge, D.

    1992-01-01

    5-Hydroxytryptamine 1A receptors were studied in rats during the first postnatal month in the normal cerebellum and in the granule cell-deprived cerebellum produced by X-irradiation at postnatal day 5. Quantitative autoradiographic studies on sagittal sections of cerebellar vermis, using [ 125 1]BH-8-MeO-N-PAT as radioligand or specific anti-receptor antibodies, revealed that 5-hydroxytryptamine 1A receptors existed in the molecular/Purkinje cell layer but at variable density from one lobule to another. Thus, in both normal and X-irradiated rats, the posterior lobules were more heavily labelled than the anterior ones, and the density of 5-hydroxytryptamine 1A sites decreased progressively in all the cerebellar folia down to hardly detectable levels at postnatal day 21. However, the intensity of labelling remained higher at postnatal day 8 and postnatal day 12 in X-irradiated rats than in age-paired controls. Measurements of [ 3 H]8-OH-DPAT [8-hydroxy-2-(di-n-propylamino)tetralin] specific binding to membranes from whole cerebellum confirmed that the density of 5-hydroxytryptamine 1A sites per mg membrane protein (B max ) was higher in X-irradiated animals than in age-paired controls. However, on a ''per cerebellum'' basis, no significant difference could be detected between the total number of 5-hydroxytryptamine 1A sites, which progressively increased in both control and X-irradiated animals during the first postnatal month. These results therefore show that 5-hydroxytryptamine 1A receptors are not located on developing granule cells. (author)

  10. Chinanteco children’s silences in different classroom situations

    Directory of Open Access Journals (Sweden)

    Valeria Rebolledo Angulo

    2016-01-01

    Full Text Available This article analyzes, from an ethnographic perspective and a sociocultural framework, the construction of silences in the interaction between students and teachers in a multilingual classroom situation in an indigenous community in méxico. the analysis reveals how the silence of the chinanteco speaking children when asked to answer certain questions in class is not always due to their failure to understand spoken and written spanish that is used in class. their silences are responses taking different meanings in specific situations. the silence of the children can be a way of resisting, a way of hiding, and, sometimes, their voices are silenced.

  11. The RNA silencing pathway: the bits and pieces that matter.

    Directory of Open Access Journals (Sweden)

    2005-07-01

    Full Text Available Cellular pathways are generally proposed on the basis of available experimental knowledge. The proposed pathways, however, may be inadequate to describe the phenomena they are supposed to explain. For instance, by means of concise mathematical models we are able to reveal shortcomings in the current description of the pathway of RNA silencing. The silencing pathway operates by cleaving siRNAs from dsRNA. siRNAs can associate with RISC, leading to the degradation of the target mRNA. We propose and analyze a few small extensions to the pathway: a siRNA degrading RNase, primed amplification of aberrant RNA pieces, and cooperation between aberrant RNA to trigger amplification. These extensions allow for a consistent explanation for various types of silencing phenomena, such as virus induced silencing, transgene and transposon induced silencing, and avoidance of self-reactivity, as well as for differences found between species groups.

  12. Validation and comparison of reference genes for qPCR normalization of celery (Apium graveolens at different development stages

    Directory of Open Access Journals (Sweden)

    Meng-Yao eLi

    2016-03-01

    Full Text Available A suitable reference gene is an important prerequisite for guarantying accurate and reliable results in qPCR analysis. Celery is one of the representative vegetable in Apiaceae and is widely cultivated and consumed in the world. However, no reports have been previously published concerning reference genes in celery. In this study, the expression stabilities of nine candidate reference genes in leaf blade and petiole at different development stages were evaluated using three statistics algorithms geNorm, NormFinder, and BestKeeper. Our results showed that TUB-B, TUB-A, and UBC were the most reference genes among all tested samples. GAPDH represented the maximum stability for most individual sample, while the UBQ displayed the minimum stability. To further validate the stability of reference genes, the expression pattern of AgAP2-2 was calculated by using the selected genes for normalization. In addition, the expression patterns of several development-related genes were studied using the selected reference gene. Our results will be beneficial for further studies on gene transcription in celery.

  13. Empirical analyses on the development trend of non-ferrous metal industry under China’s new normal

    Science.gov (United States)

    Li, C. X.; Liu, C. X.; Zhang, Q. L.

    2017-08-01

    The CGE model of Yunnan’s macro economy was constructed based on the input-output data of Yunnan in 2012, and the development trend of the non-ferrous metals industry (NMI) under the China’s new normal was simulated. In view of this, according to different expected economic growth, and optimized economic structure, the impact on development of Yunnan NMI was simulated. The results show that the NMI growth rate is expected to decline when the economic growth show a downward trend, but the change of the proportion is relatively small. Moreover, the structure in proportion was adjusted to realize the economic structure optimization, while the proportion of NMI in GDP will decline. In contrast, the biggest influence on the NMI is the change of economic structure. From the statistics of last two years, we can see that NMI is growing, and at the same time, its proportion is declining, which is consistent with the results of simulation. But the adjustment of economic structure will take a long time. It is need to improve the proportion of deep-processing industry, extend the industrial chain, enhance the value chain, so as to be made good use of resource advantage.

  14. Comparison of single, fractionated and hyperfractionated irradiation on the development of normal tissue damage in rat lung

    International Nuclear Information System (INIS)

    Giri, P.G.S.; Kimler, B.F.; Giri, U.P.; Cox, G.G.; Reddy, E.K.

    1985-01-01

    The effect of fractionated thoracic irradiation on the development of normal tissue damage in rats was compared to that produced by single doses. Animals received a single dose of 15 Gy, 30 Gy in 10 daily fractions of 3 Gy each (fractionation), or 30 Gy in 30 fractions of 1 Gy each 3 times a day (hyperfractionation). The treatments produced minimal lethality since a total of only 6 animals died between days 273 and 475 after the initiation of treatment, with no difference in survival observed between the control and any of the 3 treated groups. Despite the lack of lethality, evidence of lung damage was obtained by histological examination. Animals that had received either single doses or fractionated doses had more of the pulmonary parenchyma involved than did animals that had received hyperfractionated doses. The authors conclude that, in the rat lung model, a total radiation dose of 30 Gy fractionated over 14 days produces no more lethality nor damage to lung tissue than does 15 Gy delivered as a single dose. However, long-term effects as evidenced by deposits of collagen and development of fibrosis are significantly reduced by hyperfractionation when compared to single doses and daily fractionation

  15. Flexible tools for gene expression and silencing in tomato.

    Science.gov (United States)

    Fernandez, Ana I; Viron, Nicolas; Alhagdow, Moftah; Karimi, Mansour; Jones, Matthew; Amsellem, Ziva; Sicard, Adrien; Czerednik, Anna; Angenent, Gerco; Grierson, Donald; May, Sean; Seymour, Graham; Eshed, Yuval; Lemaire-Chamley, Martine; Rothan, Christophe; Hilson, Pierre

    2009-12-01

    As a genetic platform, tomato (Solanum lycopersicum) benefits from rich germplasm collections and ease of cultivation and transformation that enable the analysis of biological processes impossible to investigate in other model species. To facilitate the assembly of an open genetic toolbox designed to study Solanaceae, we initiated a joint collection of publicly available gene manipulation tools. We focused on the characterization of promoters expressed at defined time windows during fruit development, for the regulated expression or silencing of genes of interest. Five promoter sequences were captured as entry clones compatible with the versatile MultiSite Gateway format: PPC2, PG, TPRP, and IMA from tomato and CRC from Arabidopsis (Arabidopsis thaliana). Corresponding transcriptional fusions were made with the GUS gene, a nuclear-localized GUS-GFP reporter, and the chimeric LhG4 transcription factor. The activity of the promoters during fruit development and in fruit tissues was confirmed in transgenic tomato lines. Novel Gateway destination vectors were generated for the transcription of artificial microRNA (amiRNA) precursors and hairpin RNAs under the control of these promoters, with schemes only involving Gateway BP and LR Clonase reactions. Efficient silencing of the endogenous phytoene desaturase gene was demonstrated in transgenic tomato lines producing a matching amiRNA under the cauliflower mosaic virus 35S or PPC2 promoter. Lastly, taking advantage of the pOP/LhG4 two-component system, we found that well-characterized flower-specific Arabidopsis promoters drive the expression of reporters in patterns generally compatible with heterologous expression. Tomato lines and plasmids will be distributed through a new Nottingham Arabidopsis Stock Centre service unit dedicated to Solanaceae resources.

  16. Silencing of the PiAvr3a effector-encoding gene from Phytophthora infestans by transcriptional fusion to a short interspersed element.

    Science.gov (United States)

    Vetukuri, Ramesh R; Tian, Zhendong; Avrova, Anna O; Savenkov, Eugene I; Dixelius, Christina; Whisson, Stephen C

    2011-12-01

    Phytophthora infestans is the notorious oomycete causing late blight of potato and tomato. A large proportion of the P. infestans genome is composed of transposable elements, the activity of which may be controlled by RNA silencing. Accumulation of small RNAs is one of the hallmarks of RNA silencing. Here we demonstrate the presence of small RNAs corresponding to the sequence of a short interspersed retrotransposable element (SINE) suggesting that small RNAs might be involved in silencing of SINEs in P. infestans. This notion was exploited to develop novel tools for gene silencing in P. infestans by engineering transcriptional fusions of the PiAvr3a gene, encoding an RXLR avirulence effector, to the infSINEm retroelement. Transgenic P. infestans lines expressing either 5'-infSINEm::PiAvr3a-3' or 5'-PiAvr3a::SINEm-3' chimeric transcripts initially exhibited partial silencing of PiAvr3a. Over time, PiAvr3a either recovered wild type transcript levels in some lines, or became fully silenced in others. Introduction of an inverted repeat construct was also successful in yielding P. infestans transgenic lines silenced for PiAvr3a. In contrast, constructs expressing antisense or aberrant RNA transcripts failed to initiate silencing of PiAvr3a. Lines exhibiting the most effective silencing of PiAvr3a were either weakly or non-pathogenic on susceptible potato cv. Bintje. This study expands the repertoire of reverse genetics tools available for P. infestans research, and provides insights into a possible mode of variation in effector expression through spread of silencing from adjacent retroelements. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

  17. Birkhoff normalization

    NARCIS (Netherlands)

    Broer, H.; Hoveijn, I.; Lunter, G.; Vegter, G.

    2003-01-01

    The Birkhoff normal form procedure is a widely used tool for approximating a Hamiltonian systems by a simpler one. This chapter starts out with an introduction to Hamiltonian mechanics, followed by an explanation of the Birkhoff normal form procedure. Finally we discuss several algorithms for

  18. Interplays between soil-borne plant viruses and RNA silencing-mediated antiviral defense in roots

    Directory of Open Access Journals (Sweden)

    Ida Bagus Andika

    2016-09-01

    Full Text Available Although the majority of plant viruses are transmitted by arthropod vectors and invade the host plants through the aerial parts, there is a considerable number of plant viruses that infect roots via soil-inhabiting vectors such as plasmodiophorids, chytrids, and nematodes. These soil-borne viruses belong to diverse families, and many of them cause serious diseases in major crop plants. Thus, roots are important organs for the life cycle of many viruses. Compared to shoots, roots have a distinct metabolism and particular physiological characteristics due to the differences in development, cell composition, gene expression patterns, and surrounding environmental conditions. RNA silencing is an important innate defense mechanism to combat virus infection in plants, but the specific information on the activities and molecular mechanism of RNA silencing-mediated viral defense in root tissue is still limited. In this review, we summarize and discuss the current knowledge regarding RNA silencing aspects of the interactions between soil-borne viruses and host plants. Overall, research evidence suggests that soil-borne viruses have evolved to adapt to the distinct mechanism of antiviral RNA silencing in roots.

  19. Prediction of the diffuse-field transmission loss of interior natural-ventilation openings and silencers.

    Science.gov (United States)

    Bibby, Chris; Hodgson, Murray

    2017-01-01

    The work reported here, part of a study on the performance and optimal design of interior natural-ventilation openings and silencers ("ventilators"), discusses the prediction of the acoustical performance of such ventilators, and the factors that affect it. A wave-based numerical approach-the finite-element method (FEM)-is applied. The development of a FEM technique for the prediction of ventilator diffuse-field transmission loss is presented. Model convergence is studied with respect to mesh, frequency-sampling and diffuse-field convergence. The modeling technique is validated by way of predictions and the comparison of them to analytical and experimental results. The transmission-loss performance of crosstalk silencers of four shapes, and the factors that affect it, are predicted and discussed. Performance increases with flow-path length for all silencer types. Adding elbows significantly increases high-frequency transmission loss, but does not increase overall silencer performance which is controlled by low-to-mid-frequency transmission loss.

  20. PCA3 Silencing Sensitizes Prostate Cancer Cells to Enzalutamide-mediated Androgen Receptor Blockade.

    Science.gov (United States)

    Özgür, Emre; Celik, Ayca Iribas; Darendeliler, Emin; Gezer, Ugur

    2017-07-01

    Prostate cancer (PCa) is an androgen-dependent disease. Novel anti-androgens (i.e. enzalutamide) have recently been developed for the treatment of patients with metastatic castration-resistant prostate cancer (CRPC). Evidence is accumulating that prostate cancer antigen 3 (PCA3) is involved in androgen receptor (AR) signaling. Here, in combination with enzalutamide-mediated AR blockade, we investigated the effect of PCA3 targeting on the viability of PCa cells. In hormone-sensitive LNCaP cells, AR-overexpressing LNCaP-AR + cells and VCaP cells (representing CRPC), PCA3 was silenced using siRNA oligonucleotides. Gene expression and cell viability was assessed in PCA3-silenced and/or AR-blocked cells. PCA3 targeting reduced the expression of AR-related genes (i.e. prostate-specific antigen (PSA) and prostate-specific transcript 1 (non-protein coding) (PCGEM1)) and potentiated the effect of enzalutamide. Proliferation of PCa cells was suppressed upon PCA3 silencing with a greater effect in LNCaP-AR + cells. Furthermore, PCA3 silencing sensitized PCa cells to enzalutamide-induced loss of cell growth. PCA3, as a therapeutic target in PCa, might be used to potentiate AR antagonists. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  1. Novel RNA Duplex Locks HIV-1 in a Latent State via Chromatin-mediated Transcriptional Silencing

    Directory of Open Access Journals (Sweden)

    Chantelle Ahlenstiel

    2015-01-01

    Full Text Available Transcriptional gene silencing (TGS of mammalian genes can be induced by short interfering RNA (siRNA targeting promoter regions. We previously reported potent TGS of HIV-1 by siRNA (PromA, which targets tandem NF-κB motifs within the viral 5′LTR. In this study, we screened a siRNA panel with the aim of identifying novel 5′LTR targets, to provide multiplexing potential with enhanced viral silencing and application toward developing alternate therapeutic strategies. Systematic examination identified a novel siRNA target, si143, confirmed to induce TGS as the silencing mechanism. TGS was prolonged with virus suppression >12 days, despite a limited ability to induce post- TGS. Epigenetic changes associated with silencing were suggested by partial reversal by histone deacetylase inhibitors and confirmed by chromatin immunoprecipitation analyses, which showed induction of H3K27me3 and H3K9me3, reduction in H3K9Ac, and recruitment of argonaute-1, all characteristic marks of heterochromatin and TGS. Together, these epigenetic changes mimic those associated with HIV-1 latency. Further, robust resistance to reactivation was observed in the J-Lat 9.2 cell latency model, when transduced with shPromA and/or sh143. These data support si/shRNA-mediated TGS approaches to HIV-1 and provide alternate targets to pursue a functional cure, whereby the viral reservoir is locked in latency following antiretroviral therapy cessation.

  2. PhCESA3 silencing inhibits elongation and stimulates radial expansion in petunia.

    Science.gov (United States)

    Yang, Weiyuan; Cai, Yuanping; Hu, Li; Wei, Qian; Chen, Guoju; Bai, Mei; Wu, Hong; Liu, Juanxu; Yu, Yixun

    2017-02-02

    Cellulose synthase catalytic subunits (CESAs) play important roles in plant growth, development and disease resistance. Previous studies have shown an essential role of Arabidopsis thaliana CESA3 in plant growth. However, little is known about the role of CESA3 in species other than A. thaliana. To gain a better understanding of CESA3, the petunia (Petunia hybrida) PhCESA3 gene was isolated, and the role of PhCESA3 in plant growth was analyzed in a wide range of plants. PhCESA3 mRNA was present at varying levels in tissues examined. VIGS-mediated PhCESA3 silencing resulted in dwarfing of plant height, which was consistent with the phenotype of the A. thaliana rsw1 mutant (a temperature-sensitive allele of AtCESA1), the A. thaliana cev1 mutant (the AtCESA3 mild mutant), and the antisense AtCESA3 line. However, PhCESA3 silencing led to swollen stems, pedicels, filaments, styles and epidermal hairs as well as thickened leaves and corollas, which were not observed in the A. thaliana cev1 mutant, the rsw1 mutant and the antisense AtCESA3 line. Further micrographs showed that PhCESA3 silencing reduced the length and increased the width of cells, suggesting that PhCESA3 silencing inhibits elongation and stimulates radial expansion in petunia.

  3. ETS transcription factors control transcription of EZH2 and epigenetic silencing of the tumor suppressor gene Nkx3.1 in prostate cancer.

    Directory of Open Access Journals (Sweden)

    Paolo Kunderfranco

    2010-05-01

    Full Text Available ETS transcription factors regulate important signaling pathways involved in cell differentiation and development in many tissues and have emerged as important players in prostate cancer. However, the biological impact of ETS factors in prostate tumorigenesis is still debated.We performed an analysis of the ETS gene family using microarray data and real-time PCR in normal and tumor tissues along with functional studies in normal and cancer cell lines to understand the impact in prostate tumorigenesis and identify key targets of these transcription factors. We found frequent dysregulation of ETS genes with oncogenic (i.e., ERG and ESE1 and tumor suppressor (i.e., ESE3 properties in prostate tumors compared to normal prostate. Tumor subgroups (i.e., ERG(high, ESE1(high, ESE3(low and NoETS tumors were identified on the basis of their ETS expression status and showed distinct transcriptional and biological features. ERG(high and ESE3(low tumors had the most robust gene signatures with both distinct and overlapping features. Integrating genomic data with functional studies in multiple cell lines, we demonstrated that ERG and ESE3 controlled in opposite direction transcription of the Polycomb Group protein EZH2, a key gene in development, differentiation, stem cell biology and tumorigenesis. We further demonstrated that the prostate-specific tumor suppressor gene Nkx3.1 was controlled by ERG and ESE3 both directly and through induction of EZH2.These findings provide new insights into the role of the ETS transcriptional network in prostate tumorigenesis and uncover previously unrecognized links between aberrant expression of ETS factors, deregulation of epigenetic effectors and silencing of tumor suppressor genes. The link between aberrant ETS activity and epigenetic gene silencing may be relevant for the clinical management of prostate cancer and design of new therapeutic strategies.

  4. Arabidopsis RNA Polymerase V Mediates Enhanced Compaction and Silencing of Geminivirus and Transposon Chromatin during Host Recovery from Infection.

    Science.gov (United States)

    Coursey, Tami; Regedanz, Elizabeth; Bisaro, David M

    2018-04-01

    Plants employ RNA-directed DNA methylation (RdDM) and dimethylation of histone 3 lysine 9 (H3K9me2) to silence geminiviruses and transposable elements (TEs). We previously showed that canonical RdDM (Pol IV-RdDM) involving RNA polymerases IV and V (Pol IV and Pol V) is required for Arabidopsis thaliana to recover from infection with Beet curly top virus lacking a suppressor protein that inhibits methylation (BCTV L2 - ). Recovery, which is characterized by reduced viral DNA levels and symptom remission, allows normal floral development. Here, we used formaldehyde-assisted isolation of regulatory elements (FAIRE) to confirm that >90% of BCTV L2 - chromatin is highly compacted during recovery, and a micrococcal nuclease-chromatin immunoprecipitation assay showed that this is largely due to increased nucleosome occupancy. Physical compaction correlated with augmented cytosine and H3K9 methylation and with reduced viral gene expression. We additionally demonstrated that these phenomena are dependent on Pol V and by extension the Pol IV-RdDM pathway. BCTV L2 - was also used to evaluate the impact of viral infection on host loci, including repressed retrotransposons Ta3 and Athila6A Remarkably, an unexpected Pol V-dependent hypersuppression of these TEs was observed, resulting in transcript levels even lower than those detected in uninfected plants. Hypersuppression is likely to be especially important for natural recovery from wild-type geminiviruses, as viral L2 and AL2 proteins cause ectopic TE expression. Thus, Pol IV-RdDM targets both viral and TE chromatin during recovery, simultaneously silencing the majority of viral genomes and maintaining host genome integrity by enforcing tighter control of TEs in future reproductive tissues. IMPORTANCE In plants, RdDM pathways use small RNAs to target cytosine and H3K9 methylation, thereby silencing DNA virus genomes and transposable elements (TEs). Further, Pol IV-RdDM involving Pol IV and Pol V is a key aspect of host

  5. Virus-induced gene silencing in diverse maize lines using the Brome Mosaic virus-based silencing vector

    Science.gov (United States)

    Virus-induced gene silencing (VIGS) is a widely used tool for gene function studies in many plant species, though its use in monocots has been limited. Using a Brome mosaic virus (BMV) vector designed to silence the maize phytoene desaturase gene, a genetically diverse set of maize inbred lines was ...

  6. The ethics of silence: Does conflict of interest explain employee silence?

    Science.gov (United States)

    Anderson, James

    2018-03-01

    Employee silence constitutes a significant threat to organizational success. This article argues that silence is a by-product of a structural Conflict of Interest (COI) between employees and their employers. This argument turns on the claim, also defended here, that employees are in a privileged position vis-à-vis knowledge of their work and that leaders-whether they recognize it or not-are dependent on their employees for reliable information about the work they are doing. Employee voice, therefore, is an organizational necessity. It is also a moral achievement as it involves risking one's personal interests for the sake of the organization. Leaders must take steps to mitigate COI and encourage employee voice; this article provides several strategies for doing exactly that.

  7. The Curious Silence of the Dog and Paul of Tarsus; Revisiting The Argument from Silence

    Directory of Open Access Journals (Sweden)

    Michael Gary Duncan

    2012-03-01

    Full Text Available In this essay I propose an interpretative and explanatory structure for the so-called argumentum ex silento, or argument from silence (henceforth referred to as the AFS. To this end, I explore two examples, namely, Sherlock Holmes’s oft-quoted notice of the “curious incident of the dog in the night-time” from Arthur Conan Doyle’s short story “Silver Blaze,” and the historical question of Paul of Tarsus’s silence on biographical details of the historical Jesus. Through these cases, I conclude that the AFS serves as a dialogical topos best evaluated and understood through the perceived authority of the arguer and the willingness of the audience to accept that authority, due to the “curious” nature of the negative evidence that the argument employed.

  8. Evaluating Complex Interventions and Health Technologies Using Normalization Process Theory: Development of a Simplified Approach and Web-Enabled Toolkit

    LENUS (Irish Health Repository)

    May, Carl R

    2011-09-30

    Abstract Background Normalization Process Theory (NPT) can be used to explain implementation processes in health care relating to new technologies and complex interventions. This paper describes the processes by which we developed a simplified version of NPT for use by clinicians, managers, and policy makers, and which could be embedded in a web-enabled toolkit and on-line users manual. Methods Between 2006 and 2010 we undertook four tasks. (i) We presented NPT to potential and actual users in multiple workshops, seminars, and presentations. (ii) Using what we discovered from these meetings, we decided to create a simplified set of statements and explanations expressing core constructs of the theory (iii) We circulated these statements to a criterion sample of 60 researchers, clinicians and others, using SurveyMonkey to collect qualitative textual data about their criticisms of the statements. (iv) We then reconstructed the statements and explanations to meet users\\' criticisms, embedded them in a web-enabled toolkit, and beta tested this \\'in the wild\\'. Results On-line data collection was effective: over a four week period 50\\/60 participants responded using SurveyMonkey (40\\/60) or direct phone and email contact (10\\/60). An additional nine responses were received from people who had been sent the SurveyMonkey form by other respondents. Beta testing of the web enabled toolkit produced 13 responses, from 327 visits to http:\\/\\/www.normalizationprocess.org. Qualitative analysis of both sets of responses showed a high level of support for the statements but also showed that some statements poorly expressed their underlying constructs or overlapped with others. These were rewritten to take account of users\\' criticisms and then embedded in a web-enabled toolkit. As a result we were able translate the core constructs into a simplified set of statements that could be utilized by non-experts. Conclusion Normalization Process Theory has been developed through

  9. Evaluating complex interventions and health technologies using normalization process theory: development of a simplified approach and web-enabled toolkit

    Directory of Open Access Journals (Sweden)

    Murray Elizabeth

    2011-09-01

    Full Text Available Abstract Background Normalization Process Theory (NPT can be used to explain implementation processes in health care relating to new technologies and complex interventions. This paper describes the processes by which we developed a simplified version of NPT for use by clinicians, managers, and policy makers, and which could be embedded in a web-enabled toolkit and on-line users manual. Methods Between 2006 and 2010 we undertook four tasks. (i We presented NPT to potential and actual users in multiple workshops, seminars, and presentations. (ii Using what we discovered from these meetings, we decided to create a simplified set of statements and explanations expressing core constructs of the theory (iii We circulated these statements to a criterion sample of 60 researchers, clinicians and others, using SurveyMonkey to collect qualitative textual data about their criticisms of the statements. (iv We then reconstructed the statements and explanations to meet users' criticisms, embedded them in a web-enabled toolkit, and beta tested this 'in the wild'. Results On-line data collection was effective: over a four week period 50/60 participants responded using SurveyMonkey (40/60 or direct phone and email contact (10/60. An additional nine responses were received from people who had been sent the SurveyMonkey form by other respondents. Beta testing of the web enabled toolkit produced 13 responses, from 327 visits to http://www.normalizationprocess.org. Qualitative analysis of both sets of responses showed a high level of support for the statements but also showed that some statements poorly expressed their underlying constructs or overlapped with others. These were rewritten to take account of users' criticisms and then embedded in a web-enabled toolkit. As a result we were able translate the core constructs into a simplified set of statements that could be utilized by non-experts. Conclusion Normalization Process Theory has been developed through

  10. MLH1-Silenced and Non-Silenced Subgroups of Hypermutated Colorectal Carcinomas Have Distinct Mutational Landscapes

    Science.gov (United States)

    Donehower, Lawrence A.; Creighton, Chad J.; Schultz, Nikolaus; Shinbrot, Eve; Chang, Kyle; Gunaratne, Preethi H.; Muzny, Donna; Sander, Chris; Hamilton, Stanley R.; Gibbs, Richard A.; Wheeler, David

    2014-01-01

    Approximately 15% of colorectal carcinomas (CRC) exhibit a hypermutated genotype accompanied by high levels of microsatellite instability (MSI-H) and defects in DNA mismatch repair. These tumors, unlike the majority of colorectal carcinomas, are often diploid, exhibit frequent epigenetic silencing of the MLH1 DNA mismatch repair gene, and have a better clinical prognosis. As an adjunct study to The Cancer Genome Atlas consortium that recently analyzed 224 colorectal cancers by whole exome sequencing, we compared the 35 CRC (15.6%) with a hypermutated genotype to those with a non-hypermutated genotype. We found that 22 (63%) of hypermutated CRC exhibited transcriptional silencing of the MLH1 gene, a high frequency of BRAF V600E gene mutations and infrequent APC and KRAS mutations, a mutational pattern significantly different from their non-hypermutated counterparts. However, the remaining 13 (37%) hypermutated CRC lacked MLH1 silencing, contained tumors with the highest mutation rates (“ultramutated” CRC), and exhibited higher incidences of APC and KRAS mutations, but infrequent BRAF mutations. These patterns were confirmed in an independent validation set of 250 exome-sequenced CRC. Analysis of mRNA and microRNA expression signatures revealed that hypermutated CRC with MLH1 silencing had greatly reduced levels of WNT signaling and increased BRAF signaling relative non-hypermutated CRC. Our findings suggest that hypermutated CRC include one subgroup with fundamentally different pathways to malignancy than the majority of CRC. Examination of MLH1 expression status and frequencies of APC, KRAS, and BRAF mutation in CRC may provide a useful diagnostic tool that could supplement the standard microsatellite instability assays and influence therapeutic decisions. PMID:22899370

  11. DEVELOPMENT OF THE METHOD AND U.S. NORMALIZATION DATABASE FOR LIFE CYCLE IMPACT ASSESSMENT AND SUSTAINABILITY METRICS

    Science.gov (United States)

    Normalization is an optional step within Life Cycle Impact Assessment (LCIA) that may be used to assist in the interpretation of life cycle inventory data as well as, life cycle impact assessment results. Normalization transforms the magnitude of LCI and LCIA results into relati...

  12. Cell-Specific Loss of SNAP25 from Cortical Projection Neurons Allows Normal Development but Causes Subsequent Neurodegeneration.

    Science.gov (United States)

    Hoerder-Suabedissen, Anna; Korrell, Kim V; Hayashi, Shuichi; Jeans, Alexander; Ramirez, Denise M O; Grant, Eleanor; Christian, Helen C; Kavalali, Ege T; Wilson, Michael C; Molnár, Zoltán

    2018-05-30

    Synaptosomal associated protein 25 kDa (SNAP25) is an essential component of the SNARE complex regulating synaptic vesicle fusion. SNAP25 deficiency has been implicated in a variety of cognitive disorders. We ablated SNAP25 from selected neuronal populations by generating a transgenic mouse (B6-Snap25tm3mcw (Snap25-flox)) with LoxP sites flanking exon5a/5b. In the presence of Cre-recombinase, Snap25-flox is recombined to a truncated transcript. Evoked synaptic vesicle release is severely reduced in Snap25 conditional knockout (cKO) neurons as shown by live cell imaging of synaptic vesicle fusion and whole cell patch clamp recordings in cultured hippocampal neurons. We studied Snap25 cKO in subsets of cortical projection neurons in vivo (L5-Rbp4-Cre; L6-Ntsr1-Cre; L6b-Drd1a-Cre). cKO neurons develop normal axonal projections, but axons are not maintained appropriately, showing signs of swelling, fragmentation and eventually complete absence. Onset and progression of degeneration are dependent on the neuron type, with L5 cells showing the earliest and most severe axonal loss. Ultrastructural examination revealed that cKO neurites contain autophagosome/lysosome-like structures. Markers of inflammation such as Iba1 and lipofuscin are increased only in adult cKO cortex. Snap25 cKO can provide a model to study genetic interactions with environmental influences in several disorders.

  13. 'Aussie normals': an a priori study to develop clinical chemistry reference intervals in a healthy Australian population.

    Science.gov (United States)

    Koerbin, G; Cavanaugh, J A; Potter, J M; Abhayaratna, W P; West, N P; Glasgow, N; Hawkins, C; Armbruster, D; Oakman, C; Hickman, P E

    2015-02-01

    Development of reference intervals is difficult, time consuming, expensive and beyond the scope of most laboratories. The Aussie Normals study is a direct a priori study to determine reference intervals in healthy Australian adults. All volunteers completed a health and lifestyle questionnaire and exclusion was based on conditions such as pregnancy, diabetes, renal or cardiovascular disease. Up to 91 biochemical analyses were undertaken on a variety of analytical platforms using serum samples collected from 1856 volunteers. We report on our findings for 40 of these analytes and two calculated parameters performed on the Abbott ARCHITECTci8200/ci16200 analysers. Not all samples were analysed for all assays due to volume requirements or assay/instrument availability. Results with elevated interference indices and those deemed unsuitable after clinical evaluation were removed from the database. Reference intervals were partitioned based on the method of Harris and Boyd into three scenarios, combined gender, males and females and age and gender. We have performed a detailed reference interval study on a healthy Australian population considering the effects of sex, age and body mass. These reference intervals may be adapted to other manufacturer's analytical methods using method transference.

  14. Incomplete development of the spleen and the deformity in the chimeras between asplenic mutant (Dominant hemimelia) and normal mice.

    Science.gov (United States)

    Suto, J; Wakayama, T; Imamura, K; Goto, S; Fukuta, K

    1995-08-01

    The semidominant gene Dh (Dominant hemimelia) induces skeletal and visceral abnormalities of various degrees and failure of the spleen in mice. The homozygous individual (Dh/Dh) seems to be lethal. The present experiment was designed to investigate the ability Dh cells to form a spleen and the genesis of the hind limb malformations by Dh/Dh and Dh/+ cells in chimeric mice. The Dh/Dh and Dh/+ embryos were produced in the F2 progeny of a cross between inbred strains of Dh/+ and DDD mice. They were aggregated with C3H/He or C57BL/6 embryos to make chimeras. Identification of Dh/Dh or Dh/+ embryos was carried out by Pep-3, and chimerism was analyzed by Gpi-1. Of 25 chimeras carrying the Dh gene, four mice formed a small spleen, two mice had a vestigial spleen, and the others no spleen. The tissues of the incompletely developed spleens were normal histologically and Dh cells were involved in the tissues of the spleen. In the chimeric mice, hindlimb malformation by the Dh gene was reduced in severity and the lethality of the homozygote (Dh/Dh) was rescued.

  15. Interleukin-6 Regulates Adult Neural Stem Cell Numbers during Normal and Abnormal Post-natal Development

    Directory of Open Access Journals (Sweden)

    Mekayla A. Storer

    2018-05-01

    Full Text Available Summary: Circulating systemic factors can regulate adult neural stem cell (NSC biology, but the identity of these circulating cues is still being defined. Here, we have focused on the cytokine interleukin-6 (IL-6, since increased circulating levels of IL-6 are associated with neural pathologies such as autism and bipolar disorder. We show that IL-6 promotes proliferation of post-natal murine forebrain NSCs and that, when the IL-6 receptor is inducibly knocked out in post-natal or adult neural precursors, this causes a long-term decrease in forebrain NSCs. Moreover, a transient circulating surge of IL-6 in perinatal or adult mice causes an acute increase in neural precursor proliferation followed by long-term depletion of adult NSC pools. Thus, IL-6 signaling is both necessary and sufficient for adult NSC self-renewal, and acute perturbations in circulating IL-6, as observed in many pathological situations, have long-lasting effects on the size of adult NSC pools. : In this report, Storer and colleagues demonstrate that the circulating cytokine IL-6, which is elevated in humans in different pathological situations, can perturb neural stem cell biology after birth. They show that IL-6 signaling is essential for self-renewal and maintenance of post-natal and adult NSCs in the murine forebrain under normal homeostatic conditions. Keywords: interleukin-6, neural stem cell, adult neurogenesis, CNS cytokines, postnatal brain development, stem cell depletion, neural stem cell niche, circulating stem cell factors, olfactory bulb

  16. Silencing of the pentose phosphate pathway genes influences DNA replication in human fibroblasts.

    Science.gov (United States)

    Fornalewicz, Karolina; Wieczorek, Aneta; Węgrzyn, Grzegorz; Łyżeń, Robert

    2017-11-30

    Previous reports and our recently published data indicated that some enzymes of glycolysis and the tricarboxylic acid cycle can affect the genome replication process by changing either the efficiency or timing of DNA synthesis in human normal cells. Both these pathways are connected with the pentose phosphate pathway (PPP pathway). The PPP pathway supports cell growth by generating energy and precursors for nucleotides and amino acids. Therefore, we asked if silencing of genes coding for enzymes involved in the pentose phosphate pathway may also affect the control of DNA replication in human fibroblasts. Particular genes coding for PPP pathway enzymes were partially silenced with specific siRNAs. Such cells remained viable. We found that silencing of the H6PD, PRPS1, RPE genes caused less efficient enterance to the S phase and decrease in efficiency of DNA synthesis. On the other hand, in cells treated with siRNA against G6PD, RBKS and TALDO genes, the fraction of cells entering the S phase was increased. However, only in the case of G6PD and TALDO, the ratio of BrdU incorporation to DNA was significantly changed. The presented results together with our previously published studies illustrate the complexity of the influence of genes coding for central carbon metabolism on the control of DNA replication in human fibroblasts, and indicate which of them are especially important in this process. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Control of thermoacoustic instability with a drum-like silencer

    Science.gov (United States)

    Zhang, Guangyu; Wang, Xiaoyu; Li, Lei; Jing, Xiaodong; Sun, Xiaofeng

    2017-10-01

    Theoretical investigation is carried out by a novel method of controlling thermoacoustic instability with a drum-like silencer. It is shown that by decreasing the frequency of thermoacoustic system, the instability can be suppressed with the help of drum-like silencer. The purely reactive silencer, which is composed of a flexible membrane and a backing cavity, is usually known as a noise control device that works effectively in low frequency bandwidth without any aerodynamic loss. In present research, the silencer is exploited in a Rijke tube, as a means of decreasing the natural frequency of the system, and consequently changing the resonance period of the system. The "transfer element method" (TEM) is used to consider the interactions between the acoustic waves and the flexible membranes of the silencer. The effects of all possible properties of the silencer on the growth rate and resonance frequency of the thermoacoustic system are explored. According to the calculation results, it is found that for some properties of the silencer, the resonance frequencies are greatly decreased and then the phase difference between the unsteady heat release and the pressure fluctuation is increased. Consequently, the instability is suppressed with some dissipation that can not be able to control its onset in the original system. Therefore, when the damping is low, but not zero, it is effective to control thermoacoustic instability with this technique.

  18. Drosophila PAF1 Modulates PIWI/piRNA Silencing Capacity.

    Science.gov (United States)

    Clark, Josef P; Rahman, Reazur; Yang, Nachen; Yang, Linda H; Lau, Nelson C

    2017-09-11

    To test the directness of factors in initiating PIWI-directed gene silencing, we employed a Piwi-interacting RNA (piRNA)-targeted reporter assay in Drosophila ovary somatic sheet (OSS) cells [1]. This assay confirmed direct silencing roles for piRNA biogenesis factors and PIWI-associated factors [2-12] but suggested that chromatin-modifying proteins may act downstream of the initial silencing event. Our data also revealed that RNA-polymerase-II-associated proteins like PAF1 and RTF1 antagonize PIWI-directed silencing. PAF1 knockdown enhances PIWI silencing of reporters when piRNAs target the transcript region proximal to the promoter. Loss of PAF1 suppresses endogenous transposable element (TE) transcript maturation, whereas a subset of gene transcripts and long-non-coding RNAs adjacent to TE insertions are affected by PAF1 knockdown in a similar fashion to piRNA-targeted reporters. Additionally, transcription activation at specific TEs and TE-adjacent loci during PIWI knockdown is suppressed when PIWI and PAF1 levels are both reduced. Our study suggests a mechanistic conservation between fission yeast PAF1 repressing AGO1/small interfering RNA (siRNA)-directed silencing [13, 14] and Drosophila PAF1 opposing PIWI/piRNA-directed silencing. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops

    OpenAIRE

    Guo, Qigao; Liu, Qing; Smith, Neil A.; Liang, Guolu; Wang, Ming-Bo

    2016-01-01

    Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing ...

  20. The Role and Regulation of TNF-Alpha in Normal Rat Mammary Gland During Development and in Breast Cancer

    National Research Council Canada - National Science Library

    Varela, Linda

    1998-01-01

    The pleiotropic cytokine tumor necrosis factor-alpha (TNF) has previously been shown to regulate both the proliferation and differentiation of normal rat mammary epithelial cells (MEC) in primary culture...

  1. Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing

    OpenAIRE

    Hedil, Marcio; Sterken, Mark G.; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard

    2015-01-01

    RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silen...

  2. Being normal weight, but feeling overweight in adolescence may effect weight development into young adulthood - An 11-year follow-up: The HUNT Study, Norway

    OpenAIRE

    Cuypers, Koenraad; Kvaløy, Kirsti; Bratberg, Grete Helen; Midthjell, Kristian; Holmen, Jostein; Holmen, Turid Lingaas

    2012-01-01

    Objectives. To explore if self-perceived overweight in normal weight adolescents influence their weight development into young adulthood and if so, whether physical activity moderates this association. Methods. A longitudinal study of 1196 normal weight adolescents (13–19 yrs) who were followed up as young adults (24–30 yrs) in the HUNT study. Lifestyle and health issues were assessed employing questionnaires, and standardized anthropometric measurements were taken. Chi square calculations an...

  3. Relationship between pickiness and subsequent development in body mass index and diet intake in obesity prone normal weight preschool children.

    Directory of Open Access Journals (Sweden)

    Jeanett Friis Rohde

    Full Text Available Most children have periods in their life where they reject familiar as well as non-familiar food items and this is often referred to as pickiness. The consequences of pickiness may be malnutrition and, if prolonged, potentially lower body weight. However, studies investigating the consequence of pickiness on subsequent changes in diet intake and weight are limited.To examine whether pickiness influences body mass index as well as diet intake over subsequent 15 months among obesity prone normal weight children aged 2-6 years.Data was obtained from the "Healthy Start" intervention study which included 271 children aged 2-6 years susceptible to overweight later in life. Information on pickiness was obtained from a parental questionnaire. Dietary habits were collected by 4-day dietary records filled in by the parents and height and weight were measured by trained health professionals and both measured twice over a 15 month period. Linear regression models were performed to assess the influence of pickiness on body mass index and diet with adjustments for possible confounders.No differences in mean BMI Z-score were seen between picky/non-picky (P = 0.68 and little picky/non-picky (P = 0.68 children at 15 month follow-up. Picky children had a lower intake of protein (P = 0.01 than non-picky children despite no differences in total energy intake (P = 0.74, or in the other macronutrients, or the intake of fruit and vegetables, though children being a little picky had a lower intake of starch compared to non-picky children (P = 0.05. Results were essentially similar before and after adjustment for key covariates.Our study showed that BMI Z-score after 15 months follow-up was similar for picky and non-picky children. Picky children seemed to develop a lower protein intake despite similar total energy intake and diet composition.

  4. Expression of an engineered heterologous antimicrobial peptide in potato alters plant development and mitigates normal abiotic and biotic responses.

    Directory of Open Access Journals (Sweden)

    Ravinder K Goyal

    Full Text Available Antimicrobial cationic peptides (AMPs are ubiquitous small proteins used by living cells to defend against a wide spectrum of pathogens. Their amphipathic property helps their interaction with negatively charged cellular membrane of the pathogen causing cell lysis and death. AMPs also modulate signaling pathway(s and cellular processes in animal models; however, little is known of cellular processes other than the pathogen-lysis phenomenon modulated by AMPs in plants. An engineered heterologous AMP, msrA3, expressed in potato was previously shown to cause resistance of the transgenic plants against selected fungal and bacterial pathogens. These lines together with the wild type were studied for growth habits, and for inducible defense responses during challenge with biotic (necrotroph Fusarium solani and abiotic stressors (dark-induced senescence, wounding and temperature stress. msrA3-expression not only conferred protection against F. solani but also delayed development of floral buds and prolonged vegetative phase. Analysis of select gene transcript profiles showed that the transgenic potato plants were suppressed in the hypersensitive (HR and reactive oxygen species (ROS responses to both biotic and abiotic stressors. Also, the transgenic leaves accumulated lesser amounts of the defense hormone jasmonic acid upon wounding with only a slight change in salicylic acid as compared to the wild type. Thus, normal host defense responses to the pathogen and abiotic stressors were mitigated by msrA3 expression suggesting MSRA3 regulates a common step(s of these response pathways. The stemming of the pathogen growth and mitigating stress response pathways likely contributes to resource reallocation for higher tuber yield.

  5. Epigenetic Silencing of the MLH1 Promoter in Relation to the Development of Gastric Cancer and its use as a Biomarker for Patients with Microsatellite Instability: a Systematic Analysis

    Directory of Open Access Journals (Sweden)

    Guimei Hu

    2018-01-01

    Full Text Available Background/Aims: Human mutL homolog 1 (MLH1 promoter methylation was reported in gastric cancer (GC. This study determined the clinicopathological, prognostic, and diagnostic effects of MLH1 promoter methylation in GC. Methods: The combined odds ratio (OR or hazard ratio (HR and their corresponding 95% confidence intervals (95% CI were calculated. The pooled sensitivity, specificity, and area under the curve (AUC were analyzed. Results: A total of 4654 GC patients and 3669 non-malignant controls were identified in this systematic analysis. MLH1 promoter methylation was significantly higher in GC samples than in gastric adenomas, chronic gastritis, adjacent tissues, normal gastric mucosa, and normal healthy blood samples, but it exhibited a similar frequency in GC vs. intestinal metaplasia and dysplasia samples. MLH1 promoter methylation correlated with age and microsatellite instability (MSI, but it was not associated with gender, H. pylori infection, smoking, drinking behaviors, pathological histology, tumor differentiation, clinical stage, lymph node status, distant metastasis, or overall survival of GC. MLH1 promoter methylation exhibited a poor sensitivity value (< 0.5 in patients with GC compared with adjacent tissues, gastric adenomas, chronic gastritis, normal gastric mucosa, and normal healthy blood samples. The pooled sensitivity, specificity, and AUC of MLH1 promoter methylation in GC with MSI vs. GC with microsatellite stability (MSS samples were 0.64, 0.96, and 0.90, respectively. Conclusions: Our results suggest that the detection of MLH1 promoter methylation may be a potential prognostic biomarker for GC patients with MSI.

  6. TGF-β induces the expression of Nedd4 family-interacting protein 1 (Ndfip1) to silence IL-4 production during iTreg cell differentiation

    Science.gov (United States)

    Beal, Allison M.; Ramos-Hernández, Natalia; Riling, Chris R.; Nowelsky, Erin A.; Oliver, Paula M.

    2011-01-01

    Mice deficient for the adaptor Ndfip1 develop inflammation at sites of environmental antigen exposure. We show here that these animals contain fewer inducible regulatory (iTreg) cells. In vitro, Ndfip1-deficient T cells express normal levels of the transcription factor Foxp3 during the first 48 hours of iTreg cell differentiation, however this cannot be sustained. Abortive Foxp3 expression is because Ndfip1–/– cells produce interleukin 4 (IL-4). We demonstrate that Ndfip1 is transiently unregulated during iTreg cell differentiation in a transforming growth factor-β (TGF-β) dependent manner. Once expressed Ndfip1 promotes Itch-mediated degradation of the transcription factor JunB, thus preventing IL-4 production. Based on these data, we propose that TGF-β signaling induces Ndfip1 expression to silence IL-4 production, thus permitting iTreg cell differentiation. PMID:22080920

  7. Silencing CAPN2 Expression Inhibited Castration-Resistant Prostate Cancer Cells Proliferation and Invasion via AKT/mTOR Signal Pathway

    Directory of Open Access Journals (Sweden)

    Pu Li

    2017-01-01

    Full Text Available The mRNA expression of CAPN2 was upregulated in CRPC cells (DU145 and PC3 than that in non-CRPC cells. Silencing CAPN2 expression could inhibit DU145 and PC3 cells proliferation by cell cycle arrest at G1 phase. Knockdown of CPAN2 level suppressed the migration and invasion capacity of CRPC cells by reducing matrix metalloproteinase-2 (MMP-2 and MMP-9 activation, as well as repressing the phosphorylation protein expression of AKT and mTOR. In addition, we found that the expression of CAPN2 was elevated in Pca tissues than that in normal control tissues. Therefore, we showed the important roles of CAPN2 in the development and progression in CRPC cells, suggesting a new therapeutic intervention for treating castration-resistant prostate cancer patients.

  8. Stability of RNA silencing-based traits after virus infection

    DEFF Research Database (Denmark)

    Jørgensen, Bodil; Albrechtsen, Merete

    2007-01-01

    with constructs based on virus coat protein (CP) genes or other viral genes has been successfully used to engineer PTGS-mediated virus resistance into a large number of crop plants and some transgenic lines have been commercially exploited. However the discovery that plant viruses encode suppressors of gene...... silencing has raised concerns that virus infection of crop plants might reverse the new silencing-based traits. Most studies of virus suppression of silencing have used model systems based on silencing of reporter genes. A few studies have analysed the effects of virus infections on plants with genetically...... engineered virus resistance based on either a simple sense or an inverted repeat construct. We decided to use genetically engineered virus resistance in potato as a model system for further studies of the effect of virus infection on genetically engineered traits. We present for the first time a comparison...

  9. Breaking the Silence: Feminism and Post humanism

    Directory of Open Access Journals (Sweden)

    Debika Saha

    2015-10-01

    Full Text Available Postmodernism starts its journey by challenging the master narratives of metaphysics and philosophy. In this journey the narrative get replaced either by an emancipation from narratives that claim to possess eternal truth or by a turn to a kind of informative technology. But both the ways keep at their centre the process of “denaturing” or disassociating something of its natural qualities. This postmodernist turn has now taken a new form. The choice is not limited between the natural body and the culturally constructed body, but between different areas of bodily reconstruction bearing different social and cultural implications. As Spivak in her famous writing raises the question «Can the subaltern speak?» In fact, Spivak narrates how the marginalized, the less privileged depend upon the benevolence of the more privileged. To engage with the other means not only to talk, listen, learn or know about her but also to identify with her. There must be some ways for open dialogues that can diminish the effects of cultural dominance. The imperial silence should be broken.

  10. An analysis of normalization methods for Drosophila RNAi genomic screens and development of a robust validation scheme

    Science.gov (United States)

    Wiles, Amy M.; Ravi, Dashnamoorthy; Bhavani, Selvaraj; Bishop, Alexander J.R.

    2010-01-01

    Genome-wide RNAi screening is a powerful, yet relatively immature technology that allows investigation into the role of individual genes in a process of choice. Most RNAi screens identify a large number of genes with a continuous gradient in the assessed phenotype. Screeners must then decide whether to examine just those genes with the most robust phenotype or to examine the full gradient of genes that cause an effect and how to identify the candidate genes to be validated. We have used RNAi in Drosophila cells to examine viability in a 384-well plate format and compare two screens, untreated control and treatment. We compare multiple normalization methods, which take advantage of different features within the data, including quantile normalization, background subtraction, scaling, cellHTS2 1, and interquartile range measurement. Considering the false-positive potential that arises from RNAi technology, a robust validation method was designed for the purpose of gene selection for future investigations. In a retrospective analysis, we describe the use of validation data to evaluate each normalization method. While no normalization method worked ideally, we found that a combination of two methods, background subtraction followed by quantile normalization and cellHTS2, at different thresholds, captures the most dependable and diverse candidate genes. Thresholds are suggested depending on whether a few candidate genes are desired or a more extensive systems level analysis is sought. In summary, our normalization approaches and experimental design to perform validation experiments are likely to apply to those high-throughput screening systems attempting to identify genes for systems level analysis. PMID:18753689

  11. Locus-specific ribosomal RNA gene silencing in nucleolar dominance.

    Directory of Open Access Journals (Sweden)

    Michelle S Lewis

    2007-08-01

    Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.

  12. ORGANIZATIONAL SILENCE: SUATU PENGHAMBAT DALAM MEWUJUDKAN KREATIFITAS ORGANISASIONAL

    Directory of Open Access Journals (Sweden)

    Berta Bekti Retnawati

    2016-11-01

    Full Text Available There are powerful forces in many organzations that cause widespread withholding of information about potential problems or issues by employess, this collective-level phenomenon as ‘organizational silence’. One significant effect of organizational silence relates to lack of organizational creativity.There are five major organizational factors that enhance creativity in a work environment: organizational climate, leadership style, organizational culture, resources and skills, the structure and system of an organization. Keywords: organizational silence, organizational creativity

  13. Silencing Dkk1 expression rescues dexamethasone-induced suppression of primary human osteoblast differentiation.

    LENUS (Irish Health Repository)

    Butler, Joseph S

    2010-09-01

    The Wnt\\/β-catenin pathway is a major signaling cascade in bone biology, playing a key role in bone development and remodeling. The objectives of this study were firstly, to determine the effects of dexamethasone exposure on Wnt\\/β-catenin signaling at an intracellular and transcriptional level, and secondly, to assess the phenotypic effects of silencing the Wnt antagonist, Dickkopf-1 (Dkk1) in the setting of dexamethasone exposure.

  14. Things talked about while we remain silence and things we’re silence about while talking: The starting assumptions for an anthropology of silence about the nearest past

    Directory of Open Access Journals (Sweden)

    Đerić Gordana

    2007-01-01

    Full Text Available Wars of the last decade of the 20th century in former Yugoslavia have brought the whole region into the center of media attention and, accordingly, have aroused interest of the western academic theory. Since the latest ′discovery of the Balkans′ was brought into being precisely due to wars, one shouldn’t be surprised to find that many academic approaches to questions of Yugoslavia dismemberment are biased, superficial or exotic. On the other hand, Serbian academic auditorium was far from being active in elaborating questions of its own contemporality and closest past - for various reasons, but mostly because of its detachment from systematic explorations. Thus, acknowledgement and presentations of mentioned issues were left to be the job of media publicists, others outside of academic community or were left to be treated in the time to come. Domestic scholars were rarely intrigued to deal with these matters, despite the fact that images of recent wars were often built on stereotypes and propaganda and that the formed knowledge of the entire subject suffered from severe simplification. The themes of great violence were particularly avoided which left some of the crucial war events out of the academic focus - the reason being, very probably, the estimation that what made Serbia and the region worldwide known is best to be forgotten. Contemporary academic silence on recent wars, in retrospection, could easily be placed within the continuum of silence during the socialist period and war which preceded it. Having all mentioned in mind, this paper not only investigates reasons for avoiding the issues of the nearest past and influences of silence in socialism on what came afterwards, but also highlights the importance of exploring semantics and functions of silence and silencing in recent wars, as well as the relationship between silence and social memory constructions.

  15. Development and application of the analytical energy gradient for the normalized elimination of the small component method

    NARCIS (Netherlands)

    Zou, Wenli; Filatov, Michael; Cremer, Dieter

    2011-01-01

    The analytical energy gradient of the normalized elimination of the small component (NESC) method is derived for the first time and implemented for the routine calculation of NESC geometries and other first order molecular properties. Essential for the derivation is the correct calculation of the

  16. Evaluation of factors in development of Vis/NIR spectroscopy models for discriminating PSE, DFD and normal broiler breast meat

    Science.gov (United States)

    1. To evaluate the performance of visible and near-infrared (Vis/NIR) spectroscopic models for discriminating true pale, soft and exudative (PSE), normal and dark, firm and dry (DFD) broiler breast meat in different conditions of preprocessing methods, spectral ranges, characteristic wavelength sele...

  17. Epigenetic Silencing of the MLH1 Promoter in Relation to the Development of Gastric Cancer and its use as a Biomarker for Patients with Microsatellite Instability: a Systematic Analysis.

    Science.gov (United States)

    Hu, Guimei; Qin, Lijun; Zhang, Xinjun; Ye, Guoliang; Huang, Tao

    2018-01-01

    Human mutL homolog 1 (MLH1) promoter methylation was reported in gastric cancer (GC). This study determined the clinicopathological, prognostic, and diagnostic effects of MLH1 promoter methylation in GC. The combined odds ratio (OR) or hazard ratio (HR) and their corresponding 95% confidence intervals (95% CI) were calculated. The pooled sensitivity, specificity, and area under the curve (AUC) were analyzed. A total of 4654 GC patients and 3669 non-malignant controls were identified in this systematic analysis. MLH1 promoter methylation was significantly higher in GC samples than in gastric adenomas, chronic gastritis, adjacent tissues, normal gastric mucosa, and normal healthy blood samples, but it exhibited a similar frequency in GC vs. intestinal metaplasia and dysplasia samples. MLH1 promoter methylation correlated with age and microsatellite instability (MSI), but it was not associated with gender, H. pylori infection, smoking, drinking behaviors, pathological histology, tumor differentiation, clinical stage, lymph node status, distant metastasis, or overall survival of GC. MLH1 promoter methylation exhibited a poor sensitivity value (MLH1 promoter methylation in GC with MSI vs. GC with microsatellite stability (MSS) samples were 0.64, 0.96, and 0.90, respectively. Our results suggest that the detection of MLH1 promoter methylation may be a potential prognostic biomarker for GC patients with MSI. © 2018 The Author(s). Published by S. Karger AG, Basel.

  18. Malware Normalization

    OpenAIRE

    Christodorescu, Mihai; Kinder, Johannes; Jha, Somesh; Katzenbeisser, Stefan; Veith, Helmut

    2005-01-01

    Malware is code designed for a malicious purpose, such as obtaining root privilege on a host. A malware detector identifies malware and thus prevents it from adversely affecting a host. In order to evade detection by malware detectors, malware writers use various obfuscation techniques to transform their malware. There is strong evidence that commercial malware detectors are susceptible to these evasion tactics. In this paper, we describe the design and implementation of a malware normalizer ...

  19. A New Component of the Nasonia Sex Determining Cascade Is Maternally Silenced and Regulates Transformer Expression

    Science.gov (United States)

    Bopp, Daniel; Beukeboom, Leo W.; van de Zande, Louis

    2013-01-01

    Although sex determination is a universal process in sexually reproducing organisms, sex determination pathways are among the most highly variable genetic systems found in nature. Nevertheless, general principles can be identified among the diversity, like the central role of transformer (tra) in insects. When a functional TRA protein is produced in early embryogenesis, the female sex determining route is activated, while prevention of TRA production leads to male development. In dipterans, male development is achieved by prevention of female-specific splicing of tra mRNA, either mediated by X-chromosome dose or masculinizing factors. In Hymenoptera, which have haplodiploid sex determination, complementary sex determination and maternal imprinting have been identified to regulate timely TRA production. In the parasitoid Nasonia, zygotic transformer (Nvtra) expression and splicing is regulated by a combination of maternal provision of Nvtra mRNA and silencing of Nvtra expression in unfertilized eggs. It is unclear, however, if this silencing is directly on the tra locus or whether it is mediated through maternal silencing of a trans-acting factor. Here we show that in Nasonia, female sex determination is dependent on zygotic activation of Nvtra expression by an as yet unknown factor. This factor, which we propose to term womanizer (wom), is maternally silenced during oogenesis to ensure male development in unfertilized eggs. This finding implicates the upstream recruitment of a novel gene in the Nasonia sex determining cascade and supports the notion that sex determining cascades can rapidly change by adding new components on top of existing regulators. PMID:23717455

  20. Development of Flow Boiling and Condensation Experiment on the International Space Station- Normal and Low Gravity Flow Boiling Experiment Development and Test Results

    Science.gov (United States)

    Nahra, Henry K.; Hall, Nancy R.; Hasan, Mohammad M.; Wagner, James D.; May, Rochelle L.; Mackey, Jeffrey R.; Kolacz, John S.; Butcher, Robert L.; Frankenfield, Bruce J.; Mudawar, Issam; hide

    2013-01-01

    Flow boiling and condensation have been identified as two key mechanisms for heat transport that are vital for achieving weight and volume reduction as well as performance enhancement in future space systems. Since inertia driven flows are demanding on power usage, lower flows are desirable. However, in microgravity, lower flows are dominated by forces other than inertia (like the capillary force). It is of paramount interest to investigate limits of low flows beyond which the flow is inertial enough to be gravity independent. One of the objectives of the Flow Boiling and Condensation Flight Experiment sets to investigate these limits for flow boiling and condensation. A two-phase flow loop consisting of a Flow Boiling Module and two Condensation Modules has been developed to experimentally study flow boiling condensation heat transfer in the reduced gravity environment provided by the reduced gravity platform. This effort supports the development of a flow boiling and condensation facility for the International Space Station (ISS). The closed loop test facility is designed to deliver the test fluid, FC-72 to the inlet of any one of the test modules at specified thermodynamic and flow conditions. The zero-g-aircraft tests will provide subcooled and saturated flow boiling critical heat flux and flow condensation heat transfer data over wide range of flow velocities. Additionally, these tests will verify the performance of all gravity sensitive components, such as evaporator, condenser and accumulator associated with the two-phase flow loop. We will present in this paper the breadboard development and testing results which consist of detailed performance evaluation of the heater and condenser combination in reduced and normal gravity. We will also present the design of the reduced gravity aircraft rack and the results of the ground flow boiling heat transfer testing performed with the Flow Boiling Module that is designed to investigate flow boiling heat transfer and

  1. The Enamovirus P0 protein is a silencing suppressor which inhibits local and systemic RNA silencing through AGO1 degradation

    Energy Technology Data Exchange (ETDEWEB)

    Fusaro, Adriana F. [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Correa, Regis L. [CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Nakasugi, Kenlee; Jackson, Craig [University of Sydney, NSW 2006 (Australia); Kawchuk, Lawrence [Research Centre, Agriculture and Agri-Food Canada, Lethbridge, AB T1J4B1 (Canada); Vaslin, Maite F.S. [Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Waterhouse, Peter M., E-mail: peter.waterhouse@sydney.edu.au [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia)

    2012-05-10

    The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0{sup PE}, in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0{sup PE} has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0{sup PE} destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.

  2. MicroRNA-Mediated Gene Silencing in Plant Defense and Viral Counter-Defense

    Directory of Open Access Journals (Sweden)

    Sheng-Rui Liu

    2017-09-01

    Full Text Available MicroRNAs (miRNAs are non-coding RNAs of approximately 20–24 nucleotides in length that serve as central regulators of eukaryotic gene expression by targeting mRNAs for cleavage or translational repression. In plants, miRNAs are associated with numerous regulatory pathways in growth and development processes, and defensive responses in plant–pathogen interactions. Recently, significant progress has been made in understanding miRNA-mediated gene silencing and how viruses counter this defense mechanism. Here, we summarize the current knowledge and recent advances in understanding the roles of miRNAs involved in the plant defense against viruses and viral counter-defense. We also document the application of miRNAs in plant antiviral defense. This review discusses the current understanding of the mechanisms of miRNA-mediated gene silencing and provides insights on the never-ending arms race between plants and viruses.

  3. Platinum Interference with siRNA Non-seed Regions Fine-Tunes Silencing Capacity

    DEFF Research Database (Denmark)

    Hedman, Hanna K; Kirpekar, Finn; Elmroth, Sofi K C

    2011-01-01

    expression, and the other one focused on the function of endogenous miRNAs. In both cases, the active molecule consists of a ∼20-nucleotide-long RNA duplex. In the siRNA case, improved systemic stability is of central interest for its further development toward clinical applications. With respect to mi......RNA processing and function, understanding its influence on mRNA targeting and the silencing ability of individual miRNAs, e.g., under pathological conditions, remains a scientific challenge. In the present study, a model system is presented where the influence of the two clinically used anticancer drugs......, cisplatin and oxaliplatin, on siRNA's silencing capacity has been evaluated. More specifically, siRNAs targeting the 3' UTR region of Wnt-5a mRNA (NM_003352) were constructed, and the biologically active antisense RNA strand was pre-platinated. Platinum adducts were detected and characterized...

  4. Gene duplication, silencing and expression alteration govern the molecular evolution of PRC2 genes in plants.

    Science.gov (United States)

    Furihata, Hazuka Y; Suenaga, Kazuya; Kawanabe, Takahiro; Yoshida, Takanori; Kawabe, Akira

    2016-10-13

    PRC2 genes were analyzed for their number of gene duplications, d N /d S ratios and expression patterns among Brassicaceae and Gramineae species. Although both amino acid sequences and copy number of the PRC2 genes were generally well conserved in both Brassicaceae and Gramineae species, we observed that some rapidly evolving genes experienced duplications and expression pattern changes. After multiple duplication events, all but one or two of the duplicated copies tend to be silenced. Silenced copies were reactivated in the endosperm and showed ectopic expression in developing seeds. The results indicated that rapid evolution of some PRC2 genes is initially caused by a relaxation of selective constraint following the gene duplication events. Several loci could become maternally expressed imprinted genes and acquired functional roles in the endosperm.

  5. The Role and Regulation of TNF-Alpha in Normal Rat Mammary Gland During Development and in Breast Cancer.

    Science.gov (United States)

    1996-07-01

    autocrine synthesis of TNFcx by the MEC as well. Normally, there is strict control of the expression of this cytokine; however, it is possible that any...1,2-benz-anthracene (DMBA) (Sigma, St. Louis, MO) (in corn oil) p.o. using standard protocols (30) or via i.p. injection of 1-methyl-l- nitrosourea ...Beutler, B. Dexamethasone and pentoxifylline inhibit endotoxin- induced cachectin/tumor necrosis factor synthesis at separate points in the signalling

  6. IFNγ Induces DNA Methylation-Silenced GPR109A Expression via pSTAT1/p300 and H3K18 Acetylation in Colon Cancer.

    Science.gov (United States)

    Bardhan, Kankana; Paschall, Amy V; Yang, Dafeng; Chen, May R; Simon, Priscilla S; Bhutia, Yangzom D; Martin, Pamela M; Thangaraju, Muthusamy; Browning, Darren D; Ganapathy, Vadivel; Heaton, Christopher M; Gu, Keni; Lee, Jeffrey R; Liu, Kebin

    2015-07-01

    Short-chain fatty acids, metabolites produced by colonic microbiota from fermentation of dietary fiber, act as anti-inflammatory agents in the intestinal tract to suppress proinflammatory diseases. GPR109A is the receptor for short-chain fatty acids. The functions of GPR109A have been the subject of extensive studies; however, the molecular mechanisms underlying GPR109A expression is largely unknown. We show that GPR109A is highly expressed in normal human colon tissues, but is silenced in human colon carcinoma cells. The GPR109A promoter DNA is methylated in human colon carcinoma. Strikingly, we observed that IFNγ, a cytokine secreted by activated T cells, activates GPR109A transcription without altering its promoter DNA methylation. Colon carcinoma grows significantly faster in IFNγ-deficient mice than in wild-type mice in an orthotopic colon cancer mouse model. A positive correlation was observed between GPR109A protein level and tumor-infiltrating T cells in human colon carcinoma specimens, and IFNγ expression level is higher in human colon carcinoma tissues than in normal colon tissues. We further demonstrated that IFNγ rapidly activates pSTAT1 that binds to the promoter of p300 to activate its transcription. p300 then binds to the GPR109A promoter to induce H3K18 hyperacetylation, resulting in chromatin remodeling in the methylated GPR109A promoter. The IFNγ-activated pSTAT1 then directly binds to the methylated but hyperacetylated GPR109 promoter to activate its transcription. Overall, our data indicate that GPR109A acts as a tumor suppressor in colon cancer, and the host immune system might use IFNγ to counteract DNA methylation-mediated GPR109A silencing as a mechanism to suppress tumor development. ©2015 American Association for Cancer Research.

  7. IFNγ induces DNA methylation-silenced GPR109A expression via pSTAT1/p300 and H3K18 acetylation in colon cancer

    Science.gov (United States)

    Bardhan, Kankana; Paschall, Amy V.; Yang, Dafeng; Chen, May R.; Simon, Priscilla S.; Bhutia, Yangzom; Martin, Pamela M.; Thangaraju, Muthusamy; Browning, Darren D.; Ganapathy, Vadivel; Heaton, Christopher M.; Gu, Keni; Lee, Jeffrey R.; Liu, Kebin

    2015-01-01

    Short-chain fatty acids, metabolites produced by colonic microbiota from fermentation of dietary fiber, act as anti-inflammatory agents in the intestinal tract to suppress proinflammatory diseases. GPR109A is the receptor for short-chain fatty acids. The functions of GPR109A has been the subject of extensive studies, however, the molecular mechanisms underlying GPR109A expression is largely unknown. We show that GPR109A is highly expressed in normal human colon tissues, but is silenced in human colon carcinoma cells. The GPR109A promoter DNA is methylated in human colon carcinoma. Strikingly, we observed that IFNγ, a cytokine secreted by activated T cells, activates GPR109A transcription without altering its promoter DNA methylation. Colon carcinoma grows significantly faster in IFNγ-deficient mice than in wildtype mice in an orthotopic colon cancer mouse model. A positive correlation was observed between GPR109A protein level and tumor-infiltrating T cells in human colon carcinoma specimens, and IFNγ expression level is higher in human colon carcinoma tissues than in normal colon tissues. We further demonstrated that IFNγ rapidly activates pSTAT1 that binds to the promoter of p300 to activate its transcription. p300 then binds to the GPR109A promoters to induce H3K18 hyperacetylation, resulting in chromatin remodeling in the methylated GPR109A promoter. The IFNγ-activated pSTAT1 then directly binds to the methylated but hyperacetylated GPR109 promoters to activate its transcription. Overall, our data indicate that GPR109A acts as a tumor suppressor in colon cancer and the host immune system might use IFNγ to counteract DNA methylation-mediated GPR109A silencing as a mechanism to suppress tumor development. PMID:25735954

  8. A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize.

    Science.gov (United States)

    Mei, Yu; Zhang, Chunquan; Kernodle, Bliss M; Hill, John H; Whitham, Steven A

    2016-06-01

    Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. © 2016 American Society of Plant Biologists. All Rights Reserved.

  9. A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize1[OPEN

    Science.gov (United States)

    Mei, Yu; Kernodle, Bliss M.; Hill, John H.

    2016-01-01

    Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. PMID:27208311

  10. The C. elegans CSR-1 argonaute pathway counteracts epigenetic silencing to promote germline gene expression.

    Science.gov (United States)

    Seth, Meetu; Shirayama, Masaki; Gu, Weifeng; Ishidate, Takao; Conte, Darryl; Mello, Craig C

    2013-12-23

    Organisms can develop adaptive sequence-specific immunity by reexpressing pathogen-specific small RNAs that guide gene silencing. For example, the C. elegans PIWI-Argonaute/piwi-interacting RNA (piRNA) pathway recruits RNA-dependent RNA polymerase (RdRP) to foreign sequences to amplify a transgenerational small-RNA-induced epigenetic silencing signal (termed RNAe). Here, we provide evidence that, in addition to an adaptive memory of silenced sequences, C. elegans can also develop an opposing adaptive memory of expressed/self-mRNAs. We refer to this mechanism, which can prevent or reverse RNAe, as RNA-induced epigenetic gene activation (RNAa). We show that CSR-1, which engages RdRP-amplified small RNAs complementary to germline-expressed mRNAs, is required for RNAa. We show that a transgene with RNAa activity also exhibits accumulation of cognate CSR-1 small RNAs. Our findings suggest that C. elegans adaptively acquires and maintains a transgenerational CSR-1 memory that recognizes and protects self-mRNAs, allowing piRNAs to recognize foreign sequences innately, without the need for prior exposure

  11. Estimulação ambiental e uso do andador infantil por lactentes com desenvolvimento normal Environmental stimulation and use of a children's baby walkers by infants with normal development

    Directory of Open Access Journals (Sweden)

    Karolina Alves de Albuquerque

    2011-06-01

    Full Text Available OBJETIVOS: avaliar a quantidade e qualidade de estímulos ambientais disponíveis para lactentes com desenvolvimento normal que fizeram uso do andador infantil anteriormente à aquisição da marcha independente. MÉTODOS: estudo transversal, com 24 lactentes distribuídos em dois grupos, sendo 12 do grupo exposto ao andador infantil (AI e 12 do grupo não-exposto (C, mantendo-se equivalência entre grupos em idade, sexo e nível sócio econômico da família. O teste Observation for Measurement of the Environment (HOME documentou os estímulos oferecidos pelo ambiente. Teste-t de Student para amostras independentes comparou os escores médios do teste HOME de ambos os grupos, considerando o nível de significância α=0,05. RESULTADOS: diferenças no teste HOME foram observadas, tendo o grupo AI obtido escores superiores ao grupo C (p=0,014, com efeito de magnitude fraca (d=0,24. CONCLUSÕES: o uso do voador infantil no período pré-aquisição da marcha por lactentes com desenvolvimento normal, pode estar associado a ambientes domiciliares mais estimuladores.OBJECTIVES: to evaluate the quantity and quality of environmental stimuli available to infants with normal development who use a baby walkers prior to learning to walk by themselves. METHODS: a cross-sectional study was carried out with 24 infants distributed into two groups of twelve: one group of children who had used a baby walkers (BW and 12 who had not (C, with the children in both groups being of equivalent ages, sex, and socio-economic background. The Home Observation for Measurement of the Environment (HOME test provided a documentary Record of the stimuli provided by the environment. Student's t-test for independent samples was used to compare the mean scores on the HOME test of both groups, considering the level of significance to be α=0.05. RESULTS: differences in the HOME scores, with the BW group obtaining higher scores than the control group (p=0.014, with a low magnitude

  12. Normal accidents

    International Nuclear Information System (INIS)

    Perrow, C.

    1989-01-01

    The author has chosen numerous concrete examples to illustrate the hazardousness inherent in high-risk technologies. Starting with the TMI reactor accident in 1979, he shows that it is not only the nuclear energy sector that bears the risk of 'normal accidents', but also quite a number of other technologies and industrial sectors, or research fields. The author refers to the petrochemical industry, shipping, air traffic, large dams, mining activities, and genetic engineering, showing that due to the complexity of the systems and their manifold, rapidly interacting processes, accidents happen that cannot be thoroughly calculated, and hence are unavoidable. (orig./HP) [de

  13. Mechanism of right thoracic adolescent idiopathic scoliosis at risk for progression; a unifying pathway of development by normal growth and imbalance

    DEFF Research Database (Denmark)

    Wong, Christian

    2015-01-01

    Adolescent idiopathic scoliosis is regarded as a multifactorial disease and none of the many suggested causal etiologies have yet prevailed. I will suggest that adolescent idiopathic scoliosis has one common denominator, namely that initial curve development is mediated through one common normal...

  14. Genome-Wide DNA Methylation Indicates Silencing of Tumor Suppressor Genes in Uterine Leiomyoma

    Science.gov (United States)

    Navarro, Antonia; Yin, Ping; Monsivais, Diana; Lin, Simon M.; Du, Pan; Wei, Jian-Jun; Bulun, Serdar E.

    2012-01-01

    Background Uterine leiomyomas, or fibroids, represent the most common benign tumor of the female reproductive tract. Fibroids become symptomatic in 30% of all women and up to 70% of African American women of reproductive age. Epigenetic dysregulation of individual genes has been demonstrated in leiomyoma cells; however, the in vivo genome-wide distribution of such epigenetic abnormalities remains unknown. Principal Findings We characterized and compared genome-wide DNA methylation and mRNA expression profiles in uterine leiomyoma and matched adjacent normal myometrial tissues from 18 African American women. We found 55 genes with differential promoter methylation and concominant differences in mRNA expression in uterine leiomyoma versus normal myometrium. Eighty percent of the identified genes showed an inverse relationship between DNA methylation status and mRNA expression in uterine leiomyoma tissues, and the majority of genes (62%) displayed hypermethylation associated with gene silencing. We selected three genes, the known tumor suppressors KLF11, DLEC1, and KRT19 and verified promoter hypermethylation, mRNA repression and protein expression using bisulfite sequencing, real-time PCR and western blot. Incubation of primary leiomyoma smooth muscle cells with a DNA methyltransferase inhibitor restored KLF11, DLEC1 and KRT19 mRNA levels. Conclusions These results suggest a possible functional role of promoter DNA methylation-mediated gene silencing in the pathogenesis of uterine leiomyoma in African American women. PMID:22428009

  15. PLK-1 Silencing in Bladder Cancer by siRNA Delivered With Exosomes.

    Science.gov (United States)

    Greco, Kristin A; Franzen, Carrie A; Foreman, Kimberly E; Flanigan, Robert C; Kuo, Paul C; Gupta, Gopal N

    2016-05-01

    To use exosomes as a vector to deliver small interfering ribonucleic acid (siRNA) to silence the polo-like kinase 1 (PLK-1) gene in bladder cancer cells. Exosomes were isolated from both human embryonic kidney 293 (HEK293) cell and mesenchymal stem cell (MSC) conditioned media. Fluorescently labeled exosomes were co-cultured with bladder cancer and normal epithelial cells and uptake was quantified by image cytometry. PLK-1 siRNA and negative control siRNA were loaded into HEK293 and MSC exosomes using electroporation. An invasive bladder cancer cell line (UMUC3) was co-cultured with the electroporated exosomes. Quantitative reverse transcriptase polymerase chain reaction was performed. Protein analysis was performed by Western blot. Annexin V staining and MTT assays were used to investigate effects on apoptosis and viability. Bladder cancer cell lines internalize an increased percentage of HEK293 exosomes when compared to normal bladder epithelial cells. Treatment of UMUC3 cells with exosomes electroporated with PLK-1 siRNA achieved successful knockdown of PLK-1 mRNA and protein when compared to cells treated with negative control exosomes. HEK293 and MSC exosomes were effectively used as a delivery vector to transport PLK-1 siRNA to bladder cancer cells in vitro, resulting in selective gene silencing of PLK-1. The use of exosomes as a delivery vector for potential intravesical therapy is attractive. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Development of a radioimmunoassay for pregnancy-associated plasma protein A and establishment of normal levels in the first trimester of pregnancy

    Energy Technology Data Exchange (ETDEWEB)

    Anthony, F; Masson, G M; Wood, P J [Southampton Univ. (UK)

    1983-01-01

    An accelerated double antibody method has been developed for the radioimmunoassay of pregnancy-associated plasma protein A (PAPP-A) in serum. The workable range for the assay was 0.4-1.8 mg/l of serum. PAPP-A levels were determined in single serum samples from 110 women with prospective normal pregnancies of between 7 and 14 weeks' gestation. The level of pregnancy specific ..beta../sub 1/ glycoprotein (SP/sub 1/) was also measured in these samples and normal ranges for PAPP-P and SP/sub 1/ were constructed from the results obtained.

  17. Development of a radioimmunoassay for pregnancy-associated plasma protein A and establishment of normal levels in the first trimester of pregnancy

    Energy Technology Data Exchange (ETDEWEB)

    Anthony, F; Masson, G M; Wood, P J [Southampton Univ. (UK)

    1983-01-01

    An accelerated double antibody method has been developed for the radioimmunoassay of pregnancy-associated plasma protein A (PAPP-A) in serum. The workable range for the assay was 0.04-1.8 mg/l of serum. PAPP-A levels were determined in single serum samples from 110 women with prospective normal pregnancies of between 7 and 14 weeks' gestation. The level of pregnancy specific ..beta../sub 1/ glycoprotein (SP/sub 1/) was also measured in these samples and normal ranges for PAPP-A and SP/sub 1/ were constructed from the results obtained.

  18. Development of a radioimmunoassay for pregnancy-associated plasma protein A and establishment of normal levels in the first trimester of pregnancy

    International Nuclear Information System (INIS)

    Anthony, F.; Masson, G.M.; Wood, P.J.

    1983-01-01

    An accelerated double antibody method has been developed for the radioimmunoassay of pregnancy-associated plasma protein A (PAPP-A) in serum. The workable range for the assay was 0.4-1.8 mg/l of serum. PAPP-A levels were determined in single serum samples from 110 women with prospective normal pregnancies of between 7 and 14 weeks' gestation. The level of pregnancy specific #betta# 1 glycoprotein (SP 1 ) was also measured in these samples and normal ranges for PAPP-P and SP 1 were constructed from the results obtained. (author)

  19. Relationship between pickiness and subsequent development in body mass index and diet intake in obesity prone normal weight preschool children

    DEFF Research Database (Denmark)

    Rohde, Jeanett Friis; Händel, Mina Nicole; Stougaard, Maria

    2017-01-01

    the consequence of pickiness on subsequent changes in diet intake and weight are limited. Objectives: To examine whether pickiness influences body mass index as well as diet intake over subsequent 15 months among obesity prone normal weight children aged 2–6 years. Methods: Data was obtained from the “Healthy...... Start” intervention study which included 271 children aged 2–6 years susceptible to overweight later in life. Information on pickiness was obtained from a parental questionnaire. Dietary habits were collected by 4-day dietary records filled in by the parents and height and weight were measured...

  20. Evasion of short interfering RNA-directed antiviral silencing in Musa acuminata persistently infected with six distinct banana streak pararetroviruses.

    Science.gov (United States)

    Rajeswaran, Rajendran; Seguin, Jonathan; Chabannes, Matthieu; Duroy, Pierre-Olivier; Laboureau, Nathalie; Farinelli, Laurent; Iskra-Caruana, Marie-Line; Pooggin, Mikhail M

    2014-10-01

    Vegetatively propagated crop plants often suffer from infections with persistent RNA and DNA viruses. Such viruses appear to evade the plant defenses that normally restrict viral replication and spread. The major antiviral defense mechanism is based on RNA silencing generating viral short interfering RNAs (siRNAs) that can potentially repress viral genes posttranscriptionally through RNA cleavage and transcriptionally through DNA cytosine methylation. Here we examined the RNA silencing machinery of banana plants persistently infected with six pararetroviruses after many years of vegetative propagation. Using deep sequencing, we reconstructed consensus master genomes of the viruses and characterized virus-derived and endogenous small RNAs. Consistent with the presence of endogenous siRNAs that can potentially establish and maintain DNA methylation, the banana genomic DNA was extensively methylated in both healthy and virus-infected plants. A novel class of abundant 20-nucleotide (nt) endogenous small RNAs with 5'-terminal guanosine was identified. In all virus-infected plants, 21- to 24-nt viral siRNAs accumulated at relatively high levels (up to 22% of the total small RNA population) and covered the entire circular viral DNA genomes in both orientations. The hotspots of 21-nt and 22-nt siRNAs occurred within open reading frame (ORF) I and II and the 5' portion of ORF III, while 24-nt siRNAs were more evenly distributed along the viral genome. Despite the presence of abundant viral siRNAs of different size classes, the viral DNA was largely free of cytosine methylation. Thus, the virus is able to evade siRNA-directed DNA methylation and thereby avoid transcriptional silencing. This evasion of silencing likely contributes to the persistence of pararetroviruses in banana plants. We report that DNA pararetroviruses in Musa acuminata banana plants are able to evade DNA cytosine methylation and transcriptional gene silencing, despite being targeted by the host silencing

  1. Anti-viral RNA silencing: do we look like plants ?

    Directory of Open Access Journals (Sweden)

    Lecellier Charles-Henri

    2006-01-01

    Full Text Available Abstract The anti-viral function of RNA silencing was first discovered in plants as a natural manifestation of the artificial 'co-suppression', which refers to the extinction of endogenous gene induced by homologous transgene. Because silencing components are conserved among most, if not all, eukaryotes, the question rapidly arose as to determine whether this process fulfils anti-viral functions in animals, such as insects and mammals. It appears that, whereas the anti-viral process seems to be similarly conserved from plants to insects, even in worms, RNA silencing does influence the replication of mammalian viruses but in a particular mode: micro(miRNAs, endogenous small RNAs naturally implicated in translational control, rather than virus-derived small interfering (siRNAs like in other organisms, are involved. In fact, these recent studies even suggest that RNA silencing may be beneficial for viral replication. Accordingly, several large DNA mammalian viruses have been shown to encode their own miRNAs. Here, we summarize the seminal studies that have implicated RNA silencing in viral infection and compare the different eukaryotic responses.

  2. Precedents and consequences of prosocial behaviors of voice and silence

    Directory of Open Access Journals (Sweden)

    Alicia Omar

    2015-09-01

    Full Text Available Prosocial behavior is that which that encourages solidarity and harmony in interpersonal relationships, and produce personal or collective benefits. Although early research on job prosociality was focused on the study of conventional behaviors such as help, courtesy and sportsmanship, the identification and operationalization of new dimensions is rapidly expanding this nomological network. Such is the case of prosocial voice and prosocial silence, recently introduced in the scientific literature. The aim of this study is to explore possible relationships between employee’s voice and employee’s silence, and their personality structure; and examine the role of interpersonal justice perceptions on such relationships. We worked with a sample of 316 employees- aged 37 years and holding a 4.2-year signority working at public and private companies in southern and central Rosario (Argentina. The subjects completed Colquitt’ Justice Organizational Scale, Eysenck Personality Questionnaire, and Van Dyne’s Prosocial Voice and Prosocial Silence Scales. Extraversion and neuroticism emerged as the strongest predictors of prosocial voice and prosocial silence, respectively. Interpersonal justice perceptions emerged as moderators of the ‘natural’ tendency of extraverted workers to engage in prosocial voice, and emotionally controlled workers to engage in prosocial silence. Such findings would indicate that the promotion of high levels of interpersonal justice on job contexts could help workers to engage in more prosocial behavior with positive effects for the organization. 

  3. Development of normal fetal brain by MRI with a half-Fourier rapid acquisition with relaxation enhancement sequence

    International Nuclear Information System (INIS)

    Li Meilan; Liu Xuejun; Wang Jianhong; Zhao Cheng; Li Xiang

    2006-01-01

    Objective: To evaluate normal maturation of the fetal brain with half-Fourier rapid acquisition with relaxation enhancement (RARE) MRI. Methods: The normal brains of 25 fetuses of 12-38 weeks gestational age were examined in utero with half-Fourier RARE imaging. Gyrus maturation, gray and white matter differentiation, ventricle-to-brain diameter ratio, and subarachnoid space size were evaluated with respect to gestational age. Results: At 12-23 weeks, the brain had a smooth surface, and two or three layers were differentiated in the cerebral cortex. At 24-26 weeks, only a few shallow grooves were seen in the central sulcus, and three layers, including the immature cortex, intermediate zone, and germinal matrix, were differentiated in all fetuses. At 27-29 weeks, sulcus formation was observed in various regions of the brain parenchyma, and the germinal matrix became invisible. Sulcation was seen in the whole cerebral cortex from 30 weeks on. However, the cortex did not undergo infolding, and opercular formation was not seen before 33 weeks. At 23 weeks and earlier, the cerebral ventricles were large; thereafter, they gradually became smaller. The subarachnoid space overlying the cortical convexities was slightly dilated at all gestational ages, most markedly at 21-26 weeks. Conclusion: Changes in brain maturation proceed through stages in an orderly and predictable fashion and can be evaluated reliably with half-Fourier RARE MRI. (authors)

  4. Development of PC based Monte Carlo simulations for the calculation of scanner-specific normalized organ doses from CT

    International Nuclear Information System (INIS)

    Jansen, J. T. M.; Shrimpton, P. C.; Zankl, M.

    2009-01-01

    This paper discusses the simulation of contemporary computed tomography (CT) scanners using Monte Carlo calculation methods to derive normalized organ doses, which enable hospital physicists to estimate typical organ and effective doses for CT examinations. The hardware used in a small PC-cluster at the Health Protection Agency (HPA) for these calculations is described. Investigations concerning optimization of software, including the radiation transport codes MCNP5 and MCNPX, and the Intel and PGI FORTRAN compilers, are presented in relation to results and calculation speed. Differences in approach for modelling the X-ray source are described and their influences are analysed. Comparisons with previously published calculations at HPA from the early 1990's proved satisfactory for the purposes of quality assurance and are presented in terms of organ dose ratios for whole body exposure and differences in organ location. Influences on normalized effective dose are discussed in relation to choice of cross section library, CT scanner technology (contemporary multi slice versus single slice), definition for effective dose (1990 and 2007 versions) and anthropomorphic phantom (mathematical and voxel). The results illustrate the practical need for the updated scanner-specific dose coefficients presently being calculated at HPA, in order to facilitate improved dosimetry for contemporary CT practice. (authors)

  5. Genetic transformation and gene silencing mediated by multiple copies of a transgene in eastern white pine.

    Science.gov (United States)

    Tang, Wei; Newton, Ronald J; Weidner, Douglas A

    2007-01-01

    An efficient transgenic eastern white pine (Pinus strobus L.) plant regeneration system has been established using Agrobacterium tumefaciens strain GV3850-mediated transformation and the green fluorescent protein (gfp) gene as a reporter in this investigation. Stable integration of transgenes in the plant genome of pine was confirmed by polymerase chain reaction (PCR), Southern blot, and northern blot analyses. Transgene expression was analysed in pine T-DNA transformants carrying different numbers of copies of T-DNA insertions. Post-transcriptional gene silencing (PTGS) was mostly obtained in transgenic lines with more than three copies of T-DNA, but not in transgenic lines with one copy of T-DNA. In situ hybridization chromosome analysis of transgenic lines demonstrated that silenced transgenic lines had two or more T-DNA insertions in the same chromosome. These results suggest that two or more T-DNA insertions in the same chromosome facilitate efficient gene silencing in transgenic pine cells expressing green fluorescent protein. There were no differences in shoot differentiation and development between transgenic lines with multiple T-DNA copies and transgenic lines with one or two T-DNA copies.

  6. Host-Induced Silencing of Pathogenicity Genes Enhances Resistance to Fusarium oxysporum Wilt in Tomato.

    Science.gov (United States)

    Bharti, Poonam; Jyoti, Poonam; Kapoor, Priya; Sharma, Vandana; Shanmugam, V; Yadav, Sudesh Kumar

    2017-08-01

    This study presents a novel approach of controlling vascular wilt in tomato by RNAi expression directed to pathogenicity genes of Fusarium oxysporum f. sp. lycopersici. Vascular wilt of tomato caused by Fusarium oxysporum f. sp. lycopersici leads to qualitative and quantitative loss of the crop. Limitation in the existing control measures necessitates the development of alternative strategies to increase resistance in the plants against pathogens. Recent findings paved way to RNAi, as a promising method for silencing of pathogenicity genes in fungus and provided effective resistance against fungal pathogens. Here, two important pathogenicity genes FOW2, a Zn(II)2Cys6 family putative transcription regulator, and chsV, a putative myosin motor and a chitin synthase domain, were used for host-induced gene silencing through hairpinRNA cassettes of these genes against Fusarium oxysporum f. sp. lycopersici. HairpinRNAs were assembled in appropriate binary vectors and transformed into tomato plant targeting FOW2 and chsV genes, for two highly pathogenic strains of Fusarium oxysporum viz. TOFOL-IHBT and TOFOL-IVRI. Transgenic tomatoes were analyzed for possible attainment of resistance in transgenic lines against fungal infection. Eight transgenic lines expressing hairpinRNA cassettes showed trivial disease symptoms after 6-8 weeks of infection. Hence, the host-induced posttranscriptional gene silencing of pathogenicity genes in transgenic tomato plants has enhanced their resistance to vascular wilt disease caused by Fusarium oxysporum.

  7. Lentiviral Vector Mediated Claudin1 Silencing Inhibits Epithelial to Mesenchymal Transition in Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Xianqi Zhao

    2015-06-01

    Full Text Available Breast cancer has a high incidence and mortality rate worldwide. Several viral vectors including lentiviral, adenoviral and adeno-associated viral vectors have been used in gene therapy for various forms of human cancer, and have shown promising effects in controlling tumor development. Claudin1 (CLDN1 is a member of the tetraspan transmembrane protein family that plays a major role in tight junctions and is associated with tumor metastasis. However, the role of CLDN1 in breast cancer is largely unexplored. In this study, we tested the therapeutic potential of silencing CLDN1 expression in two breast cancer (MDA-MB-231 and MCF7 cell lines using lentiviral vector mediated RNA interference. We found that a CLDN1 short hairpin (shRNA construct efficiently silenced CLDN1 expression in both breast cancer cell lines, and CLDN1 knockdown resulted in reduced cell proliferation, survival, migration and invasion. Furthermore, silencing CLDN1 inhibited epithelial to mesenchymal transition (EMT by upregulating the epithelial cell marker, E-cadherin, and downregulating mesenchymal markers, smooth muscle cell alpha-actin (SMA and Snai2. Our data demonstrated that lentiviral vector mediated CLDN1 RNA interference has great potential in breast cancer gene therapy by inhibiting EMT and controlling tumor cell growth.

  8. Silence is golden : keeping a lid on noise quiets opposition to oilpatch operations

    International Nuclear Information System (INIS)

    Macedo, R.

    2006-01-01

    Record levels of drilling activity have led to denser well spacings that are often close to residential areas. Many oil and gas operators are now investing in noise suppression technology in order to suppress public concern over noise levels. This article reviewed some new silencing technologies available to the oil and gas industry. Issues concerning permissible sound levels for remote facilities were discussed. Silencing equipment details were presented for turbine exhaust engines, turbo inlet systems, reciprocating engines, and specialty silencers for ventilation systems. Issues concerning acoustical systems and retrofits for existing buildings were also examined. It was noted that a new muffler has been acoustically engineered to provide engine exhaust noise removal along with an internal acoustic treatment to eliminate radiated noise from the muffler shell. The loudest noise source at a compression station is often the engine exhaust of large reciprocating engines. Various computer programs are now available that analyze noise, create models to predict noise levels in decibels for nearby residents, and help to engineer noise control plans. It was concluded that many of the new sound-proofing technologies for the walls and roofs of buildings and enclosures were developed during the design of new compression units built by TransCanada Pipeline on main pipelines across Canada. 2 figs

  9. Silence and Memories of War: An Autoethnographic Exploration of Family Secrecy.

    Science.gov (United States)

    Rober, Peter; Rosenblatt, Paul C

    2017-03-01

    A personal journey and a scientific challenge, this is an autoethnographic study about my own family's secrecy. I knew my grandfather had been a German prisoner of war during World War II. We all knew. But nobody talked about it. Then one day I decided I wanted to do systematic research on the issue of family secrecy around my grandfather's war experiences. Researching one's own family can be called autoethnography. It could be said that autoethnography is an approach to research that aims to describe and systemically analyze (graphy) personal experience (auto) to understand social and cultural phenomena (ethno). This scientific approach is quite new in the field of family therapy. This study has been an important personal quest, but it also led to important reflections on silences in families, on my own professional development, and on methodological issues concerning autoethnographical research. For one thing, it highlights some of the positive aspects of family secrecy and silences, and invites us-when confronted with family secrecy in clinical practice-to carefully consider the potential destructive and life-giving aspects of the silence. © 2015 Family Process Institute.

  10. Systemic RNAi-mediated Gene Silencing in Nonhuman Primate and Rodent Myeloid Cells

    Directory of Open Access Journals (Sweden)

    Tatiana I Novobrantseva

    2012-01-01

    Full Text Available Leukocytes are central regulators of inflammation and the target cells of therapies for key diseases, including autoimmune, cardiovascular, and malignant disorders. Efficient in vivo delivery of small interfering RNA (siRNA to immune cells could thus enable novel treatment strategies with broad applicability. In this report, we develop systemic delivery methods of siRNA encapsulated in lipid nanoparticles (LNP for durable and potent in vivo RNA interference (RNAi-mediated silencing in myeloid cells. This work provides the first demonstration of siRNA-mediated silencing in myeloid cell types of nonhuman primates (NHPs and establishes the feasibility of targeting multiple gene targets in rodent myeloid cells. The therapeutic potential of these formulations was demonstrated using siRNA targeting tumor necrosis factor-α (TNFα which induced substantial attenuation of disease progression comparable to a potent antibody treatment in a mouse model of rheumatoid arthritis (RA. In summary, we demonstrate a broadly applicable and therapeutically relevant platform for silencing disease genes in immune cells.

  11. Reconstructing Normality

    DEFF Research Database (Denmark)

    Gildberg, Frederik Alkier; Bradley, Stephen K.; Fristed, Peter Billeskov

    2012-01-01

    Forensic psychiatry is an area of priority for the Danish Government. As the field expands, this calls for increased knowledge about mental health nursing practice, as this is part of the forensic psychiatry treatment offered. However, only sparse research exists in this area. The aim of this study...... was to investigate the characteristics of forensic mental health nursing staff interaction with forensic mental health inpatients and to explore how staff give meaning to these interactions. The project included 32 forensic mental health staff members, with over 307 hours of participant observations, 48 informal....... The intention is to establish a trusting relationship to form behaviour and perceptual-corrective care, which is characterized by staff's endeavours to change, halt, or support the patient's behaviour or perception in relation to staff's perception of normality. The intention is to support and teach the patient...

  12. Pursuing Normality

    DEFF Research Database (Denmark)

    Madsen, Louise Sofia; Handberg, Charlotte

    2018-01-01

    implying an influence on whether to participate in cancer survivorship care programs. Because of "pursuing normality," 8 of 9 participants opted out of cancer survivorship care programming due to prospects of "being cured" and perceptions of cancer survivorship care as "a continuation of the disease......BACKGROUND: The present study explored the reflections on cancer survivorship care of lymphoma survivors in active treatment. Lymphoma survivors have survivorship care needs, yet their participation in cancer survivorship care programs is still reported as low. OBJECTIVE: The aim of this study...... was to understand the reflections on cancer survivorship care of lymphoma survivors to aid the future planning of cancer survivorship care and overcome barriers to participation. METHODS: Data were generated in a hematological ward during 4 months of ethnographic fieldwork, including participant observation and 46...

  13. Sounds and silence: An optical topography study of language recognition at birth

    Science.gov (United States)

    Peña, Marcela; Maki, Atsushi; Kovaic, Damir; Dehaene-Lambertz, Ghislaine; Koizumi, Hideaki; Bouquet, Furio; Mehler, Jacques

    2003-09-01

    Does the neonate's brain have left hemisphere (LH) dominance for speech? Twelve full-term neonates participated in an optical topography study designed to assess whether the neonate brain responds specifically to linguistic stimuli. Participants were tested with normal infant-directed speech, with the same utterances played in reverse and without auditory stimulation. We used a 24-channel optical topography device to assess changes in the concentration of total hemoglobin in response to auditory stimulation in 12 areas of the right hemisphere and 12 areas of the LH. We found that LH temporal areas showed significantly more activation when infants were exposed to normal speech than to backward speech or silence. We conclude that neonates are born with an LH superiority to process specific properties of speech.

  14. Yeast Tdh3 (glyceraldehyde 3-phosphate dehydrogenase is a Sir2-interacting factor that regulates transcriptional silencing and rDNA recombination.

    Directory of Open Access Journals (Sweden)

    Alison E Ringel

    Full Text Available Sir2 is an NAD(+-dependent histone deacetylase required to mediate transcriptional silencing and suppress rDNA recombination in budding yeast. We previously identified Tdh3, a glyceraldehyde 3-phosphate dehydrogenase (GAPDH, as a high expression suppressor of the lethality caused by Sir2 overexpression in yeast cells. Here we show that Tdh3 interacts with Sir2, localizes to silent chromatin in a Sir2-dependent manner, and promotes normal silencing at the telomere and rDNA. Characterization of specific TDH3 alleles suggests that Tdh3's influence on silencing requires nuclear localization but does not correlate with its catalytic activity. Interestingly, a genetic assay suggests that Tdh3, an NAD(+-binding protein, influences nuclear NAD(+ levels; we speculate that Tdh3 links nuclear Sir2 with NAD(+ from the cytoplasm.

  15. HvCKX2 gene silencing by biolistic or Agrobacterium-mediated transformation in barley leads to different phenotypes.

    Science.gov (United States)

    Zalewski, Wojciech; Orczyk, Wacław; Gasparis, Sebastian; Nadolska-Orczyk, Anna

    2012-11-07

    CKX genes encode cytokinin dehydrogenase enzymes (CKX), which metabolize cytokinins in plants and influence developmental processes. The genes are expressed in different tissues and organs during development; however, their exact role in barley is poorly understood. It has already been proven that RNA interference (RNAi)-based silencing of HvCKX1 decreased the CKX level, especially in those organs which showed the highest expression, i.e. developing kernels and roots, leading to higher plant productivity and higher mass of the roots [1]. The same type of RNAi construct was applied to silence HvCKX2 and analyze the function of the gene. Two cultivars of barley were transformed with the same silencing and selection cassettes by two different methods: biolistic and via Agrobacterium. The mean Agrobacterium-mediated transformation efficiency of Golden Promise was 3.47% (±2.82). The transcript level of HvCKX2 in segregating progeny of T(1) lines was decreased to 34%. The reduction of the transcript in Agrobacterium-derived plants resulted in decreased CKX activity in the developing and developed leaves as well as in 7 DAP (days after pollination) spikes. The final phenotypic effect was increased productivity of T(0) plants and T(1) lines. Higher productivity was the result of the higher number of seeds and higher grain yield. It was also correlated with the higher 1000 grain weight, increased (by 7.5%) height of the plants and higher (from 0.5 to 2) numbers of spikes. The transformation efficiency of Golden Promise after biolistic transformation was more than twice as low compared to Agrobacterium. The transcript level in segregating progeny of T(1) lines was decreased to 24%. Otherwise, the enzyme activity found in the leaves of the lines after biolistic transformation, especially in cv. Golden Promise, was very high, exceeding the relative level of the control lines. These unbalanced ratios of the transcript level and the activity of the CKX enzyme negatively

  16. Differential expression and processing of transforming growth factor beta induced protein (TGFBIp) in the normal human cornea during postnatal development and aging

    DEFF Research Database (Denmark)

    Karring, Henrik; Runager, Kasper; Valnickova, Zuzana

    2010-01-01

    Transforming growth factor beta induced protein (TGFBIp, also named keratoepithelin) is an extracellular matrix protein abundant in the cornea. The purpose of this study was to determine the expression and processing of TGFBIp in the normal human cornea during postnatal development and aging...... trimming events from the N-terminus of mature TGFBIp generate TGFBIp isoforms which form a similar "zig-zag" pattern when separated by 2-D polyacrylamide gel electrophoresis (PAGE). This study shows that in humans TGFBIp is more abundant in mature corneas than in the developing cornea...... and that the processing of TGFBIp changes during postnatal development of the cornea. In addition, TGFBIp appears to be degraded in a highly orchestrated manner in the normal human cornea with the resulting C-terminal fragments being retained in the cornea. The age-related changes in the expression and processing...

  17. Toward a science of silence: The consequences of leaving a memory unsaid

    DEFF Research Database (Denmark)

    Stone, Charles; Coman, Alin; Brown, Adam

    2012-01-01

    of the silence—and listeners—those attending to the speaker. Although the topic of silence is widely discussed, it is rarely mentioned in the empirical literature on memory. Three factors are employed to classify silence into different types: whether a silence is accompanied by covert remembering, whether...... the silence is intentional or unintentional, and whether the silenced memory is related or unrelated to the memories emerging in a conversation. These factors appear to be critical when considering the mnemonic consequences. Moreover, the influence of silence on memory varies between speaker and listener...

  18. Evaluation of moving-coil loudspeaker and passive radiator parameters using normal-incidence sound transmission measurements: theoretical developments.

    Science.gov (United States)

    Leishman, Timothy W; Anderson, Brian E

    2013-07-01

    The parameters of moving-coil loudspeaker drivers are typically determined using direct electrical excitation and measurement. However, as electro-mechano-acoustical devices, their parameters should also follow from suitable mechanical or acoustical evaluations. This paper presents the theory of an acoustical method of excitation and measurement using normal-incidence sound transmission through a baffled driver as a plane-wave tube partition. Analogous circuits enable key parameters to be extracted from measurement results in terms of open and closed-circuit driver conditions. Associated tools are presented that facilitate adjacent field decompositions and derivations of sound transmission coefficients (in terms of driver parameters) directly from the circuits. The paper also clarifies the impact of nonanechoic receiving tube terminations and the specific benefits of downstream field decompositions.

  19. Early monocular defocus disrupts the normal development of receptive-field structure in V2 neurons of macaque monkeys.

    Science.gov (United States)

    Tao, Xiaofeng; Zhang, Bin; Shen, Guofu; Wensveen, Janice; Smith, Earl L; Nishimoto, Shinji; Ohzawa, Izumi; Chino, Yuzo M

    2014-10-08

    Experiencing different quality images in the two eyes soon after birth can cause amblyopia, a developmental vision disorder. Amblyopic humans show the reduced capacity for judging the relative position of a visual target in reference to nearby stimulus elements (position uncertainty) and often experience visual image distortion. Although abnormal pooling of local stimulus information by neurons beyond striate cortex (V1) is often suggested as a neural basis of these deficits, extrastriate neurons in the amblyopic brain have rarely been studied using microelectrode recording methods. The receptive field (RF) of neurons in visual area V2 in normal monkeys is made up of multiple subfields that are thought to reflect V1 inputs and are capable of encoding the spatial relationship between local stimulus features. We created primate models of anisometropic amblyopia and analyzed the RF subfield maps for multiple nearby V2 neurons of anesthetized monkeys by using dynamic two-dimensional noise stimuli and reverse correlation methods. Unlike in normal monkeys, the subfield maps of V2 neurons in amblyopic monkeys were severely disorganized: subfield maps showed higher heterogeneity within each neuron as well as across nearby neurons. Amblyopic V2 neurons exhibited robust binocular suppression and the strength of the suppression was positively correlated with the degree of hereogeneity and the severity of amblyopia in individual monkeys. Our results suggest that the disorganized subfield maps and robust binocular suppression of amblyopic V2 neurons are likely to adversely affect the higher stages of cortical processing resulting in position uncertainty and image distortion. Copyright © 2014 the authors 0270-6474/14/3413840-15$15.00/0.

  20. Normal centrolineal myelination of the callosal splenium reflects the development of the cortical origin and size of its commissural fibers

    Energy Technology Data Exchange (ETDEWEB)

    Whitehead, Matthew T. [University of Tennessee Health Science Center, Department of Radiology, Memphis, TN (United States); Le Bonheur Children' s Hospital, Le Bonheur Neuroscience Institute, Memphis, TN (United States); Children' s National Medical Center, Department of Radiology, Washington, DC (United States); Raju, Anand; Choudhri, Asim F. [University of Tennessee Health Science Center, Department of Radiology, Memphis, TN (United States); Le Bonheur Children' s Hospital, Le Bonheur Neuroscience Institute, Memphis, TN (United States)

    2014-04-15

    Commissural white matter fibers comprising the callosal splenium are diverse. Subsections of the splenium myelinate at different times, in a centrolineal manner. The aims of this study are to depict the normal callosal splenium myelination pattern and to distinguish the transient age-related mid splenium hypointensity from pathology. We reviewed 131 consecutive brain MRIs in patients between ages 3 and 6 months from a single academic children's hospital. Patients that were preterm, hydrocephalic, and/or had volume loss were excluded. Fifty total MR exams that included T1-weighted MR imaging (T1WI), T2-weighted MR imaging (T2WI), and diffusion tensor imaging (DTI) were reviewed. Regions of callosal splenium myelination manifested by T1 and T2 shortening were evaluated. Tractography was performed with seeds placed over the posterior, mid, and anterior splenium to define the origin, destination, and course of traversing fibers. Splenium signal varied significantly from 3 to 6 months, with distinct age-related trends. On T1WI, the splenium was hypointense at 3 months (12/13), centrally hypointense/peripherally hyperintense at 4 months (15/16), and hyperintense at 6 months (10/11). Tractography revealed three distinct white matter tract populations: medial occipital (posterior); precuneus, posterior cingulate, and medial temporal (middle); and postcentral gyri (anterior). Specific commissural fiber components of the splenium myelinate at different times. The transient developmental mid splenium hypointensity on T1WI corresponds to tracts from the associative cortex, principally the precuneus. Heterogeneous splenium signal alteration in patients ages 3-6 months is a normal developmental phenomenon that should not be confused with pathologic lesions. (orig.)

  1. RELATIONSHIP BETWEEN AFFECTIVE COMMITMENT ANDORGANIZATIONAL SILENCE: A CONCEPTUAL DISCUSSION

    Directory of Open Access Journals (Sweden)

    Fitnat Nazlı Sayğan

    2011-07-01

    Full Text Available In this study, the affective commitment that is oneof the components oforganizational commitment put forth by Allen and Meyer (Allen, Meyer 1996will be differentiated from the other commitment components. The importance ofcreating an emotional commitment to organizations will be examined and theorganizational factors needed to form organizational commitment will beinvestigated. Also, organizational silence is a situation that the company avoided.In the study, the reasons and the drawbacks of silence are focused on and thefactors that cause employees to remain silent are discussed.The aim of this study is intended to manifest the relationship of ‘organizationalsilence' with affective commitment’ which is one ofthe components of‘organizational commitment’ on the basis of literature. In this study, a negativecorrelation between affective commitment and organizational silence is suggested

  2. Being Normal Weight but Feeling Overweight in Adolescence May Affect Weight Development into Young Adulthood—An 11-Year Followup: The HUNT Study, Norway

    Directory of Open Access Journals (Sweden)

    Koenraad Cuypers

    2012-01-01

    Full Text Available Objectives. To explore if self-perceived overweight in normal weight adolescents influence their weight development into young adulthood and if so, whether physical activity moderates this association. Methods. A longitudinal study of 1196 normal weight adolescents (13–19 yrs who were followed up as young adults (24–30 yrs in the HUNT study. Lifestyle and health issues were assessed employing questionnaires, and standardized anthropometric measurements were taken. Chi square calculations and regression analyses were performed to investigate the associations between self-perceived overweight and change in BMI or waist circumference (WC adjusted for age, age squared, sex, and other relevant cofactors. Results. Adolescents, defined as being normal weight, but who perceived themselves as overweight had a larger weight gain into young adulthood than adolescents who perceived themselves as normal weight (difference in BMI: 0.66 units [CI95%: 0.1, 1.2] and in WC: 3.46 cm [CI95%: 1.8, 5.1]. Level of physical activity was not found to moderate this association. Conclusions. This study reveals that self-perceived overweight during adolescence may affect development of weight from adolescence into young adulthood. This highlights the importance of also focusing on body image in public health interventions against obesity, favouring a “healthy” body weight taking into account natural differences in body shapes.

  3. Being Normal Weight but Feeling Overweight in Adolescence May Affect Weight Development into Young Adulthood-An 11-Year Followup: The HUNT Study, Norway.

    Science.gov (United States)

    Cuypers, Koenraad; Kvaløy, Kirsti; Bratberg, Grete; Midthjell, Kristian; Holmen, Jostein; Holmen, Turid Lingaas

    2012-01-01

    Objectives. To explore if self-perceived overweight in normal weight adolescents influence their weight development into young adulthood and if so, whether physical activity moderates this association. Methods. A longitudinal study of 1196 normal weight adolescents (13-19 yrs) who were followed up as young adults (24-30 yrs) in the HUNT study. Lifestyle and health issues were assessed employing questionnaires, and standardized anthropometric measurements were taken. Chi square calculations and regression analyses were performed to investigate the associations between self-perceived overweight and change in BMI or waist circumference (WC) adjusted for age, age squared, sex, and other relevant cofactors. Results. Adolescents, defined as being normal weight, but who perceived themselves as overweight had a larger weight gain into young adulthood than adolescents who perceived themselves as normal weight (difference in BMI: 0.66 units [CI95%: 0.1, 1.2] and in WC: 3.46 cm [CI95%: 1.8, 5.1]). Level of physical activity was not found to moderate this association. Conclusions. This study reveals that self-perceived overweight during adolescence may affect development of weight from adolescence into young adulthood. This highlights the importance of also focusing on body image in public health interventions against obesity, favouring a "healthy" body weight taking into account natural differences in body shapes.

  4. FHL2 silencing reduces Wnt signaling and osteosarcoma tumorigenesis in vitro and in vivo.

    Directory of Open Access Journals (Sweden)

    Julia Brun

    Full Text Available BACKGROUND: The molecular mechanisms that are involved in the growth and invasiveness of osteosarcoma, an aggressive and invasive primary bone tumor, are not fully understood. The transcriptional co-factor FHL2 (four and a half LIM domains protein 2 acts as an oncoprotein or as a tumor suppressor depending on the tissue context. In this study, we investigated the role of FHL2 in tumorigenesis in osteosarcoma model. METHODOLOGY/PRINCIPAL FINDINGS: Western blot analyses showed that FHL2 is expressed above normal in most human and murine osteosarcoma cells. Tissue microarray analysis revealed that FHL2 protein expression is high in human osteosarcoma and correlates with osteosarcoma aggressiveness. In murine osteosarcoma cells, FHL2 silencing using shRNA decreased canonical Wnt/β-catenin signaling and reduced the expression of Wnt responsive genes as well as of the key Wnt molecules Wnt5a and Wnt10b. This effect resulted in inhibition of osteosarcoma cell proliferation, invasion and migration in vitro. Using xenograft experiments, we showed that FHL2 silencing markedly reduced tumor growth and lung metastasis occurence in mice. The anti-oncogenic effect of FHL2 silencing in vivo was associated with reduced cell proliferation and decreased Wnt signaling in the tumors. CONCLUSION/SIGNIFICANCE: Our findings demonstrate that FHL2 acts as an oncogene in osteosarcoma cells and contributes to tumorigenesis through Wnt signaling. More importantly, FHL2 depletion greatly reduces tumor cell growth and metastasis, which raises the potential therapeutic interest of targeting FHL2 to efficiently impact primary bone tumors.

  5. RNAi dynamics in Juvenile Fasciola spp. Liver flukes reveals the persistence of gene silencing in vitro.

    Directory of Open Access Journals (Sweden)

    Paul McVeigh

    2014-09-01

    Full Text Available Fasciola spp. liver fluke cause pernicious disease in humans and animals. Whilst current control is unsustainable due to anthelmintic resistance, gene silencing (RNA interference, RNAi has the potential to contribute to functional validation of new therapeutic targets. The susceptibility of juvenile Fasciola hepatica to double stranded (dsRNA-induced RNAi has been reported. To exploit this we probe RNAi dynamics, penetrance and persistence with the aim of building a robust platform for reverse genetics in liver fluke. We describe development of standardised RNAi protocols for a commercially-available liver fluke strain (the US Pacific North West Wild Strain, validated via robust transcriptional silencing of seven virulence genes, with in-depth experimental optimisation of three: cathepsin L (FheCatL and B (FheCatB cysteine proteases, and a σ-class glutathione transferase (FheσGST.Robust transcriptional silencing of targets in both F. hepatica and Fasciola gigantica juveniles is achievable following exposure to long (200-320 nt dsRNAs or 27 nt short interfering (siRNAs. Although juveniles are highly RNAi-susceptible, they display slower transcript and protein knockdown dynamics than those reported previously. Knockdown was detectable following as little as 4h exposure to trigger (target-dependent and in all cases silencing persisted for ≥25 days following long dsRNA exposure. Combinatorial silencing of three targets by mixing multiple long dsRNAs was similarly efficient. Despite profound transcriptional suppression, we found a significant time-lag before the occurrence of protein suppression; FheσGST and FheCatL protein suppression were only detectable after 9 and 21 days, respectively.In spite of marked variation in knockdown dynamics, we find that a transient exposure to long dsRNA or siRNA triggers robust RNAi penetrance and persistence in liver fluke NEJs supporting the development of multiple-throughput phenotypic screens for control

  6. Host-Induced Gene Silencing of Rice Blast Fungus Magnaporthe oryzae Pathogenicity Genes Mediated by the Brome Mosaic Virus.

    Science.gov (United States)

    Zhu, Lin; Zhu, Jian; Liu, Zhixue; Wang, Zhengyi; Zhou, Cheng; Wang, Hong

    2017-09-26

    Magnaporthe oryzae is a devastating plant pathogen, which has a detrimental impact on rice production worldwide. Despite its agronomical importance, some newly-emerging pathotypes often overcome race-specific disease resistance rapidly. It is thus desirable to develop a novel strategy for the long-lasting resistance of rice plants to ever-changing fungal pathogens. Brome mosaic virus (BMV)-induced RNA interference (RNAi) has emerged as a useful tool to study host-resistance genes for rice blast protection. Planta-generated silencing of targeted genes inside biotrophic pathogens can be achieved by expression of M. oryzae -derived gene fragments in the BMV-mediated gene silencing system, a technique termed host-induced gene silencing (HIGS). In this study, the effectiveness of BMV-mediated HIGS in M. oryzae was examined by targeting three predicted pathogenicity genes, MoABC1, MoMAC1 and MoPMK1 . Systemic generation of fungal gene-specific small interfering RNA (siRNA) molecules induced by inoculation of BMV viral vectors inhibited disease development and reduced the transcription of targeted fungal genes after subsequent M. oryzae inoculation. Combined introduction of fungal gene sequences in sense and antisense orientation mediated by the BMV silencing vectors significantly enhanced the efficiency of this host-generated trans-specific RNAi, implying that these fungal genes played crucial roles in pathogenicity. Collectively, our results indicated that BMV-HIGS system was a great strategy for protecting host plants against the invasion of pathogenic fungi.

  7. Friction coefficient measurements of silencers on specialized duct tract

    Directory of Open Access Journals (Sweden)

    Sehnalek Stanislav

    2016-01-01

    Full Text Available This article describes test methods on air duct track in Laboratory of Environmental Engineering. It focuses on measurement of silencer parameter like is pressure loss coeffcient. Firstly, the paper describe the measurement apparatus with description of calculation method by standard ISO 7235 and energy equation. Then the paper presents three ways how to accomplish measurement because such way is not covered by procedure in standard. Then follows the evaluation of results of measurements on three types of silencer designed for HVAC applications. The article is concluded with discussion over measured data with outline for further research.

  8. Semantic Differences of Definitional skills between Persian Speaking Children with Specific Language Impairment and Normal Language Developing Children

    Directory of Open Access Journals (Sweden)

    Mehri Mohammadi

    2011-07-01

    Full Text Available Objective: Linguistic and metalinguistic knowledge are the effective factors for definitional skills. This study investigated definitional skills both content and form in children with specific language impairment. Materials and Method: The participants were 32 Children in two groups of 16 SLI and 16 normal children, matched with age, sex and educational level. The SLI group was referred from Learning Difficulties Centers and Zarei Rehabilitation Center in Tehran, as well as the control group who was selected by randomized sampling from normal primary schools. The stimuli were 14 high frequency nouns from seven different categories. The reliability was calculated by interjudge agreement and the validity was assessed by content. Data was analyzed using independent T-test. Results: There were significant differences between mean scores of content and form of the definitional skills in two groups. The mean and SD scores of the content of word definition were M= 45.87, SD=12.22 in control group and M=33.18, SD= 17.60 for SLI one, out of possible 70 points (P= 0.025. The mean and SD scores of the form of word definition were M= 48.87, SD= 9.49 in control group and M= 38.18, SD= 12.85 for SLI one, out of 70 points (P= 0.012. Conclusion: Based on the results, it was concluded that, language problems of the SLI children may not let them semantic represention in order to form and present a complete process of word definition. Although this skill in children with SLI is inadequate, all the definitions given by SLI children were consistent with the categories of content and form of word definition used in this study. Therefore, an exact planning and intervention by speech and language pathologist can be effective for this skill. Linguistic intervention especially in semantic and grammatical aspects not only improves the definition of familiar words but also it might be useful for the definition of new words, consequently lead to educational and

  9. Normality in Analytical Psychology

    Science.gov (United States)

    Myers, Steve

    2013-01-01

    Although C.G. Jung’s interest in normality wavered throughout his career, it was one of the areas he identified in later life as worthy of further research. He began his career using a definition of normality which would have been the target of Foucault’s criticism, had Foucault chosen to review Jung’s work. However, Jung then evolved his thinking to a standpoint that was more aligned to Foucault’s own. Thereafter, the post Jungian concept of normality has remained relatively undeveloped by comparison with psychoanalysis and mainstream psychology. Jung’s disjecta membra on the subject suggest that, in contemporary analytical psychology, too much focus is placed on the process of individuation to the neglect of applications that consider collective processes. Also, there is potential for useful research and development into the nature of conflict between individuals and societies, and how normal people typically develop in relation to the spectrum between individuation and collectivity. PMID:25379262

  10. Sustaining a "culture of silence" in the neonatal intensive care unit during nonemergency situations: a grounded theory on ensuring adherence to behavioral modification to reduce noise levels.

    Science.gov (United States)

    Swathi, S; Ramesh, A; Nagapoornima, M; Fernandes, Lavina M; Jisina, C; Rao, P N Suman; Swarnarekha, A

    2014-01-01

    The aim of this study was to generate a substantive theory explaining how the staff in a resource-limited neonatal intensive care unit (NICU) of a developing nation manage to ensure adherence to behavioral modification components of a noise reduction protocol (NsRP) during nonemergency situations. The study was conducted after implementation of an NsRP in a level III NICU of south India. The normal routine of the NICU is highly dynamic because of various categories of staff conducting clinical rounds followed by care-giving activities. This is unpredictably interspersed with very noisy emergency management of neonates who suddenly fall sick. In-depth interviews were conducted with 36 staff members of the NICU (20 staff nurses, six nursing aides, and 10 physicians). Group discussions were conducted with 20 staff nurses and six nursing aides. Data analysis was done in line with the reformulated grounded theory approach, which was based on inductive examination of textual information. The results of the analysis showed that the main concern was to ensure adherence to behavioral modification components of the NsRP. This was addressed by using strategies to "sustain a culture of silence in NICU during nonemergency situations" (core category). The main strategies employed were building awareness momentum, causing awareness percolation, developing a sense of ownership, expansion of caring practices, evolution of adherence, and displaying performance indicators. The "culture of silence" reconditions the existing staff and conditions new staff members joining the NICU. During emergency situations, a "noisy culture" prevailed because of pragmatic neglect of behavioral modification when life support overrode all other concerns. In addition to this, the process of operant conditioning should be formally conducted once every 18 months. The results of this study may be adapted to create similar strategies and establish context specific NsRPs in NICUs with resource constraints.

  11. A comparison of growth and development of low birth weight and normal newborns at 5 years age

    Directory of Open Access Journals (Sweden)

    Eftekhar H

    1997-09-01

    Full Text Available The growth and developmental status of 252 children with low birth weight (<2500 gr born from 1988 to 1989 as cases were compared with 312 children with normal birth weight (>2500 gr at the fifth birthday. The results of comparing these two groups of children show that: 1 In relation to weight for age of survivors, with increasing of age, weight gaining is higher in the control group in comparison with the case group (P=0.00. 2 In relation to height for age the study revealed, that this indicator differs in two groups but the difference is not significant. 3 In regard to Gomez classification: The percentages of all grades of malnutrition (mild, moderate, severe is grater in the case group than controls. 4 By considering the developmental criteria (skipping, drawing triangle from copy, naming 5 colors, repeating sentences of 10 syllables, counting of 10 coins correctly and respectively: The study showed that developmental indicator of the case group differs from controls. The test statistic "t" showed, there is a significant difference between two variables (P=0.005. 5 By using the Riven test for evaluation of IQ, our findings characterized that, the IQ mean of the LBW and NBW are not truely different.

  12. ASCT2 (SLC1A5-Deficient Mice Have Normal B-Cell Development, Proliferation, and Antibody Production

    Directory of Open Access Journals (Sweden)

    Etienne Masle-Farquhar

    2017-05-01

    Full Text Available SLC1A5 (solute carrier family 1, member 5 is a small neutral amino acid exchanger that is upregulated in rapidly proliferating lymphocytes but also in many primary human cancers. Furthermore, cancer cell lines have been shown to require SLC1A5 for their survival in vitro. One of SLC1A5’s primary substrates is the immunomodulatory amino acid glutamine, which plays an important role in multiple key processes, such as energy supply, macromolecular synthesis, nucleotide biosynthesis, redox homeostasis, and resistance against oxidative stress. These processes are also essential to immune cells, including neutrophils, macrophages, B and T lymphocytes. We show here that mice with a stop codon in Slc1a5 have reduced glutamine uptake in activated lymphocytes and primary fibroblasts. B and T cell populations and maturation in resting mice were not affected by absence of SLC1A5. Antibody production in resting and immunized mice and the germinal center response to immunization were also found to be normal. SLC1A5 has been recently described as a novel target for the treatment of a variety of cancers, and our results indicate that inhibition of SLC1A5 in cancer therapy may be tolerated well by the immune system of cancer patients.

  13. Adipocyte Versus Pituitary Leptin in the Regulation of Pituitary Hormones: Somatotropes Develop Normally in the Absence of Circulating Leptin

    Science.gov (United States)

    Odle, Angela K.; Haney, Anessa; Allensworth-James, Melody; Akhter, Noor

    2014-01-01

    Leptin is a cytokine produced by white fat cells, skeletal muscle, the placenta, and the pituitary gland among other tissues. Best known for its role in regulating appetite and energy expenditure, leptin is produced largely by and in proportion to white fat cells. Leptin is also important to the maintenance and function of the GH cells of the pituitary. This was shown when the deletion of leptin receptors on somatotropes caused decreased numbers of GH cells, decreased circulating GH, and adult-onset obesity. To determine the source of leptin most vital to GH cells and other pituitary cell types, we compared two different leptin knockout models with Cre-lox technology. The global Lep-null model is like the ob/ob mouse, whereby only the entire exon 3 is deleted. The selective adipocyte-Lep-null model lacks adipocyte leptin but retains pituitary leptin, allowing us to investigate the pituitary as a potential source of circulating leptin. Male and female mice lacking adipocyte leptin (Adipocyte-lep-null) did not produce any detectable circulating leptin and were infertile, suggesting that the pituitary does not contribute to serum levels. In the presence of only pituitary leptin, however, these same mutants were able to maintain somatotrope numbers and GH mRNA levels. Serum GH trended low, but values were not significant. However, hypothalamic GHRH mRNA was significantly reduced in these animals. Other serum hormone and pituitary mRNA differences were observed, some of which varied from previous results reported in ob/ob animals. Whereas pituitary leptin is capable of maintaining somatotrope numbers and GH mRNA production, the decreased hypothalamic GHRH mRNA and low (but not significant) serum GH levels indicate an important role for adipocyte leptin in the regulation of GH secretion in the mouse. Thus, normal GH secretion may require the coordinated actions of both adipocyte and pituitary leptin. PMID:25116704

  14. Normal Development and Measurements of the Occipital Condyle-C1 Interval in Children and Young Adults.

    Science.gov (United States)

    Smith, P; Linscott, L L; Vadivelu, S; Zhang, B; Leach, J L

    2016-05-01

    Widening of the occipital condyle-C1 interval is the most specific and sensitive means of detecting atlanto-occipital dislocation. Recent studies attempting to define normal measurements of the condyle-C1 interval in children have varied substantially. This study was performed to test the null hypothesis that condyle-C1 interval morphology and joint measurements do not change as a function of age. Imaging review of subjects undergoing CT of the upper cervical spine for reasons unrelated to trauma or developmental abnormality was performed. Four equidistant measurements were obtained for each bilateral condyle-C1 interval on sagittal and coronal images. The cohort was divided into 7 age groups to calculate the mean, SD, and 95% CIs for the average condyle-C1 interval in both planes. The prevalence of a medial occipital condyle notch was calculated. Two hundred forty-eight joints were measured in 124 subjects with an age range of 2 days to 22 years. The condyle-C1 interval varies substantially by age. Average coronal measurements are larger and more variable than sagittal measurements. The medial occipital condyle notch is most prevalent from 1 to 12 years and is uncommon in older adolescents and young adults. The condyle-C1 interval increases during the first several years of life, is largest in the 2- to 4-year age range, and then decreases through late childhood and adolescence. A single threshold value to detect atlanto-occipital dissociation may not be sensitive and specific for all age groups. Application of this normative data to documented cases of atlanto-occipital injury is needed to determine clinical utility. © 2016 by American Journal of Neuroradiology.

  15. Giving Voice: Narrating silence, history and memory in André Brink ...

    African Journals Online (AJOL)

    Giving Voice: Narrating silence, history and memory in André Brink\\'s The Other Side of Silence and Before I Forget. ... Both narrators, though, draw attention to the problems associated with this reconstructive and potentially ... Article Metrics.

  16. Gendered Communication in Iranian University Classrooms: The Relationship between Politeness and Silence in Persian Culture

    Directory of Open Access Journals (Sweden)

    Saeedeh Shafiee Nahrkhalaji

    2013-05-01

    Full Text Available This study examined naturally-occurring university classroominteractions at Iranian universities and provided an analysis ofsilence patterns as politeness strategies used by male andfemale students. Since empirical studies of silence inclassroom settings are scarce, this paper aimed to explainsuch phenomena using participant interviews, classroomobservation and detailed discourse analysis of classroominteraction. Silence patterns and their interpretations werescrutinized in these observations and were discussed inrelation to specific conceptualization of politeness anddevices employed to exercise it. The study found that femalesseem to be the most silent in the cross-sex classrooms, whilethe distribution of silence is more nearly equal in the same sexclassrooms. Based on the comments from follow-upinterviews, reasons for intentional silence as a politenessstrategy were categorized into four groups: silence as a face savingstrategy, silence as a ‘don’t do the FTA’ strategy,silence as a power strategy, and silence as an off-recordstrategy.

  17. Annual Research Review: Growth connectomics – the organization and reorganization of brain networks during normal and abnormal development

    Science.gov (United States)

    Vértes, Petra E; Bullmore, Edward T

    2015-01-01

    Background We first give a brief introduction to graph theoretical analysis and its application to the study of brain network topology or connectomics. Within this framework, we review the existing empirical data on developmental changes in brain network organization across a range of experimental modalities (including structural and functional MRI, diffusion tensor imaging, magnetoencephalography and electroencephalography in humans). Synthesis We discuss preliminary evidence and current hypotheses for how the emergence of network properties correlates with concomitant cognitive and behavioural changes associated with development. We highlight some of the technical and conceptual challenges to be addressed by future developments in this rapidly moving field. Given the parallels previously discovered between neural systems across species and over a range of spatial scales, we also review some recent advances in developmental network studies at the cellular scale. We highlight the opportunities presented by such studies and how they may complement neuroimaging in advancing our understanding of brain development. Finally, we note that many brain and mind disorders are thought to be neurodevelopmental in origin and that charting the trajectory of brain network changes associated with healthy development also sets the stage for understanding abnormal network development. Conclusions We therefore briefly review the clinical relevance of network metrics as potential diagnostic markers and some recent efforts in computational modelling of brain networks which might contribute to a more mechanistic understanding of neurodevelopmental disorders in future. PMID:25441756

  18. Perfil comunicativo de crianças entre 1 e 3 anos com desenvolvimento normal de linguagem Communicative profile of children between 1 and 3-years old with normal language development

    Directory of Open Access Journals (Sweden)

    Mirtes Adiles Sandri

    2009-03-01

    Full Text Available OBJETIVO: traçar o perfil comunicativo (habilidades comunicativas e interacionais, compreensão verbal e aspectos do desenvolvimento cognitivo de crianças entre 1 e 3 anos com desenvolvimento normal da linguagem, correlacionando com as variáveis faixa etária e gênero. MÉTODOS: participaram do estudo 24 crianças (12 meninos e 12 meninas, divididas em dois grupos: Grupo 1 (G1 - crianças de 1 e 2 anos e Grupo 2 (G2 - crianças de 2 e 3 anos. O instrumento de avaliação utilizado foi o Protocolo de Observação Comportamental (PROC (Zorzi e Hage, 2004. RESULTADOS: na análise dos dados quantitativos houve diferença estatisticamente significante quando comparados os grupos por faixa etária (PPURPOSE: to trace the communicative profile (communicative and interactive abilities, verbal comprehension and cognitive development aspects of children with normal linguistic development between 1 and 3-year old, correlating with the variables of age groups and gender. METHODS: twenty-four children (12 boys and 12 girls took part in the study, divided in two groups: Group 1 (G1 - children between 1 and 2-year old, and Group 2 (G2 -children between 2 and 3-year old. The used protocol was Behavioral Observation Protocol ("Protocolo de Observação Comportamental - PROC" (Zorzi and Hage, 2004. RESULTS: there was a statistically significant difference in the quantitative data when the groups where compared by their age (P<0.05. When comparing qualitative data by their age group, children of the G2 were better (P<0.05, except in the item with regards to the oral language understanding, which resulted being equivalent between the groups (P=0.217. There was no significant statistical difference related to gender, however, we observed superiority in female gender. CONCLUSION: the used test was sensitive for identifying the differences in performance between the two age groups, with regards to the communicative profile of the studied children.

  19. Silencing of CXCR4 inhibits tumor cell proliferation and neural invasion in human hilar cholangiocarcinoma.

    Science.gov (United States)

    Tan, Xin-Yu; Chang, Shi; Liu, Wei; Tang, Hui-Huan

    2014-03-01

    To evaluate the expression of CXC motif chemokine receptor 4 (CXCR4) in the tissues of patients with hilar cholangiocarcinoma (hilar-CCA) and to investigate the cell proliferation and frequency of neural invasion (NI) influenced by RNAi-mediated CXCR4 silencing. An immunohistochemical technique was used to detect the expression of CXCR4 in 41 clinical tissues, including hilar-CCA, cholangitis, and normal bile duct tissues. The effects of small interference RNA (siRNA)-mediated CXCR4 silencing were detected in the hilar-CCA cell line QBC939. Cell proliferation was determined by MTT. Expression of CXCR4 was monitored by quantitative real time polymerase chain reaction and Western blot analysis. The NI ability of hilar-CCA cells was evaluated using a perineural cell and hilar-CCA cell coculture migration assay. The expression of CXCR4 was significantly induced in clinical hilar-CCA tissue. There was a positive correlation between the expression of CXCR4 and lymph node metastasis/NI in hilar-CCA patients (philar-CCA. CXCR4 is involved in the invasion and proliferation of human hilar-CCA cell line QBC939, indicating that CXCR4 could be a promising therapeutic target for hilar-CCA.

  20. Silencing the Transcriptional Repressor, ZCT1, Illustrates the Tight Regulation of Terpenoid Indole Alkaloid Biosynthesis in Catharanthus roseus Hairy Roots.

    Directory of Open Access Journals (Sweden)

    Noreen F Rizvi

    Full Text Available The Catharanthus roseus plant is the source of many valuable terpenoid indole alkaloids (TIAs, including the anticancer compounds vinblastine and vincristine. Transcription factors (TFs are promising metabolic engineering targets due to their ability to regulate multiple biosynthetic pathway genes. To increase TIA biosynthesis, we elicited the TIA transcriptional activators (ORCAs and other unidentified TFs with the plant hormone, methyl jasmonate (MJ, while simultaneously silencing the expression of the transcriptional repressor ZCT1. To silence ZCT1, we developed transgenic hairy root cultures of C. roseus that expressed an estrogen-inducible Zct1 hairpin for activating RNA interference. The presence of 17β-estradiol (5μM effectively depleted Zct1 in hairy root cultures elicited with MJ dosages that either optimize or inhibit TIA production (250 or 1000μM. However, silencing Zct1 was not sufficient to increase TIA production or the expression of the TIA biosynthetic genes (G10h, Tdc, and Str, illustrating the tight regulation of TIA biosynthesis. The repression of the TIA biosynthetic genes at the inhibitory MJ dosage does not appear to be solely regulated by ZCT1. For instance, while Zct1 and Zct2 levels decreased through activating the Zct1 hairpin, Zct3 levels remained elevated. Since ZCT repressors have redundant yet distinct functions, silencing all three ZCTs may be necessary to relieve their repression of alkaloid biosynthesis.

  1. The C. elegans H3K27 Demethylase UTX-1 Is Essential for Normal Development, Independent of Its Enzymatic Activity

    DEFF Research Database (Denmark)

    Vandamme, Julien; Buchhorn, Gaëlle Lettier; Sidoli, Simone

    2012-01-01

    specific for H3K27me2/3. We demonstrate that utx-1 is an essential gene that is required for correct embryonic and postembryonic development. Consistent with its homology to UTX, UTX-1 regulates global levels of H3K27me2/3 in C. elegans. Surprisingly, we found that the catalytic activity is not required......Epigenetic modifications influence gene expression and provide a unique mechanism for fine-tuning cellular differentiation and development in multicellular organisms. Here we report on the biological functions of UTX-1, the Caenorhabditis elegans homologue of mammalian UTX, a histone demethylase...

  2. Arabidopsis HDA6 regulates locus-directed heterochromatin silencing in cooperation with MET1.

    OpenAIRE

    Taiko Kim To; Jong-Myong Kim; Akihiro Matsui; Yukio Kurihara; Taeko Morosawa; Junko Ishida; Maho Tanaka; Takaho Endo; Tetsuji Kakutani; Tetsuro Toyoda; Hiroshi Kimura; Shigeyuki Yokoyama; Kazuo Shinozaki; Motoaki Seki

    2011-01-01

    Heterochromatin silencing is pivotal for genome stability in eukaryotes. In Arabidopsis, a plant-specific mechanism called RNA–directed DNA methylation (RdDM) is involved in heterochromatin silencing. Histone deacetylase HDA6 has been identified as a component of such machineries; however, its endogenous targets and the silencing mechanisms have not been analyzed globally. In this study, we investigated the silencing mechanism mediated by HDA6. Genome-wide transcript profiling revealed that t...

  3. Using the Optical Fractionator to Estimate Total Cell Numbers in the Normal and Abnormal Developing Human Forebrain

    DEFF Research Database (Denmark)

    Larsen, Karen B

    2017-01-01

    abnormal development. Furthermore, many studies of brain cell numbers have employed biased counting methods, whereas innovations in stereology during the past 20-30 years enable reliable and efficient estimates of cell numbers. However, estimates of cell volumes and densities in fetal brain samples...

  4. Análise dos processos fonológicos em crianças com desenvolvimento fonológico normal Phonological processes analysis in children with normal phonological development

    Directory of Open Access Journals (Sweden)

    Carla Ferrante

    2009-01-01

    Full Text Available OBJETIVO: O presente estudo teve como objetivo verificar o uso dos processos fonológicos em uma população de crianças com desenvolvimento fonológico normal. MÉTODOS: Fizeram parte da pesquisa 240 crianças, de ambos os sexos, com idades entre três e oito anos. Foram realizadas análises relativas aos processos fonológicos e os dados foram comparados em relação à faixa etária e sexo. RESULTADOS: A análise dos resultados permitiu concluir que aos três, quatro e cinco anos os processos de redução de encontro consonantal, lateralização e apagamento de consoante final foram os mais utilizados. A metátese foi o segundo processo mais utilizado na faixa etária de seis anos, aparecendo em terceiro lugar na faixa etária de sete anos. Em relação ao número de processos fonológicos utilizados por faixa etária, aos três anos de idade as crianças utilizaram um mínimo de dois processos e a partir da faixa etária de quatro anos o número mínimo de processos fonológicos utilizados foi zero e o número máximo diminuiu gradativamente de acordo com o aumento da faixa etária, assim como a média. Em relação à variável sexo, não foi observada nenhuma diferença estatisticamente significante em nenhuma das análises realizadas nesta pesquisa. CONCLUSÕES: Os dados encontrados nesta pesquisa evidenciam a dificuldade encontrada pelas crianças na produção das líquidas e nas estruturas silábicas mais complexas.PURPOSE: The aim of this study was to verify the use of phonological processes in a group of children with normal phonological development. METHODS: The participants were 240 children of both genders, aged between three and eight years. Analyses regarding phonological processes were carried out, and the data were compared considering age and gender. RESULTS: The results allowed the conclusion that at the ages of three, four and five years the most frequently used processes were cluster reduction, lateralization, and final

  5. Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins

    Directory of Open Access Journals (Sweden)

    Marcio Hedil

    2016-07-01

    Full Text Available The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.

  6. Speaking of Silence: Comments from an Irish Studies Perspective

    DEFF Research Database (Denmark)

    McQuaid, Sara Dybris; Beville, Maria

    2012-01-01

    argue that silence in its own right is a unique and important route to understanding the complexities of modern Ireland in cultural, contemporary and historical terms. This is true, not least in the case of Northern Ireland where the difficult struggle to construct a unified political consciousness...

  7. Strain Specific Factors Control Effector Gene Silencing in Phytophthora sojae.

    Directory of Open Access Journals (Sweden)

    Sirjana Devi Shrestha

    Full Text Available The Phytophthora sojae avirulence gene Avr3a encodes an effector that is capable of triggering immunity on soybean plants carrying the resistance gene Rps3a. P. sojae strains that express Avr3a are avirulent to Rps3a plants, while strains that do not are virulent. To study the inheritance of Avr3a expression and virulence towards Rps3a, genetic crosses and self-fertilizations were performed. A cross between P. sojae strains ACR10 X P7076 causes transgenerational gene silencing of Avr3a allele, and this effect is meiotically stable up to the F5 generation. However, test-crosses of F1 progeny (ACR10 X P7076 with strain P6497 result in the release of silencing of Avr3a. Expression of Avr3a in the progeny is variable and correlates with the phenotypic penetrance of the avirulence trait. The F1 progeny from a direct cross of P6497 X ACR10 segregate for inheritance for Avr3a expression, a result that could not be explained by parental imprinting or heterozygosity. Analysis of small RNA arising from the Avr3a gene sequence in the parental strains and hybrid progeny suggests that the presence of small RNA is necessary but not sufficient for gene silencing. Overall, we conclude that inheritance of the Avr3a gene silenced phenotype relies on factors that are variable among P. sojae strains.

  8. Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins.

    Science.gov (United States)

    Hedil, Marcio; Kormelink, Richard

    2016-07-23

    The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.

  9. Marie Nimier, au cœur du silence

    Directory of Open Access Journals (Sweden)

    Joëlle Papillon

    2012-01-01

    Full Text Available Dans La Reine du silence, Marie Nimier se confronte à la figure de son père, l’écrivain Roger Nimier, mort lorsqu’elle avait cinq ans. Elle y montre le poids qui pèse sur l’enfant d’écrivain, mais aussi celui de l’héritage du secret familial et de l’injonction au silence. La difficulté de l’élaboration de son récit de filiation se révèle dans les constants recommencements et reformulations, qui constituent la marque de la tension angoissante entre l’obligation de dire et celle de taire. In La Reine du silence, Marie Nimier confronts her father’s memory – the writer Roger Nimier, who died when she was five years old. The novel describes the burden of being a writer’s child, along with that of inheriting family secrets and submitting to a code of silence. The difficulty of recounting her relationship with her late father is evidenced by the narrator’s numerous “false starts” and her constant rewritings. The hesitant nature of the narration captures an anguish born of two irreconcilable obligations : the need to put things into words and the pressure to remain silent.

  10. Identification of a maize chlorotic dwarf virus silencing suppressor protein

    Science.gov (United States)

    Maize chlorotic dwarf virus (MCDV), a member of the genus Waikavirus, family Secoviridae, has a 11784 nt (+)ssRNA genome that encodes a 389 kDa proteolytically processed polyprotein. We show that an N-terminal 78kDa polyprotein (R78) has silencing suppressor activity, that it is cleaved by the viral...

  11. Shame and Silence | Janz | South African Journal of Philosophy

    African Journals Online (AJOL)

    Samantha Vice's proposal on how to live in 'this strange place' of contemporary South Africa, includes an appeal to the concepts of shame and silence. In this paper, I use Emmanuel Levinas and Giorgio Agamben to move the discussion of shame from a moral to an existential question. The issue is not about how one ...

  12. Bureaucratic Constructions of Sexual Diversity: "Sensitive", "Controversial" and Silencing

    Science.gov (United States)

    Ullman, Jacqueline; Ferfolja, Tania

    2015-01-01

    National research illustrates the high degree of discrimination that prevails against lesbian, gay, bisexual, transgender and queer (LGBTQ) students resulting in diminished educational outcomes, both academic and social. This phenomenon is influenced by the prevalence of whole-school silences around LGBTQ topics in many Australian schools. This…

  13. 47 CFR 80.304 - Watch requirement during silence periods.

    Science.gov (United States)

    2010-10-01

    ....304 Section 80.304 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL RADIO SERVICES STATIONS IN THE MARITIME SERVICES Safety Watch Requirements and Procedures Ship Station Safety Watches § 80.304 Watch requirement during silence periods. Each ship station operating on...

  14. LNA-antisense rivals siRNA for gene silencing

    DEFF Research Database (Denmark)

    Jepsen, Jan Stenvang; Wengel, Jesper; Stenvang, Jan

    2004-01-01

    Locked nucleic acid (LNA) is a class of nucleic acid analogs possessing unprecedented binding affinity toward complementary DNA and RNA while obeying the Watson-Crick base-pairing rules. For efficient gene silencing in vitro and in vivo, fully modified or chimeric LNA oligonucleotides have been a...

  15. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

  16. Relationship between Organizational Mobbing and Silence Behavior among Teachers

    Science.gov (United States)

    Hüsrevsahi, Selda Polat

    2015-01-01

    This study mainly aims to investigate the correlation between teachers' exposure to mobbing in their workplaces and their display of the act of silence. This study is based on a survey design where data from 312 teachers were collected and analyzed using correlation and regression analyses. Specifically, "The Structure and Dimensions of…

  17. Mobile gene silencing in Arabidopsis is regulated by hydrogen peroxide

    Directory of Open Access Journals (Sweden)

    Dacheng Liang

    2014-12-01

    Full Text Available In plants and nematodes, RNAi can spread from cells from which it is initiated to other cells in the organism. The underlying mechanism controlling the mobility of RNAi signals is not known, especially in the case of plants. A genetic screen designed to recover plants impaired in the movement but not the production or effectiveness of the RNAi signal identified RCI3, which encodes a hydrogen peroxide (H2O2-producing type III peroxidase, as a key regulator of silencing mobility in Arabidopsis thaliana. Silencing initiated in the roots of rci3 plants failed to spread into leaf tissue or floral tissue. Application of exogenous H2O2 reinstated the spread in rci3 plants and accelerated it in wild-type plants. The addition of catalase or MnO2, which breaks down H2O2, slowed the spread of silencing in wild-type plants. We propose that endogenous H2O2, under the control of peroxidases, regulates the spread of gene silencing by altering plasmodesmata permeability through remodelling of local cell wall structure, and may play a role in regulating systemic viral defence.

  18. Tacit Authorization : A Legal Solution for Administrative Silence

    NARCIS (Netherlands)

    Hoogstra, Nicole; de Graaf, K.J.

    2016-01-01

    This article discusses one of the current legal instruments to stimulate timely decision-making by administrative authorities, namely the ‘Lex silencio positivo’ or the ‘Silence is Consent’ rule. Tacit authorization prescribes that the license sought by the applicant will be granted automatically if

  19. Two classes of silencing RNAs move between C. elegans tissues

    Science.gov (United States)

    Jose, Antony M; Garcia, Giancarlo A; Hunter, Craig P

    2011-01-01

    Summary Organism-wide RNA interference (RNAi) is due to the transport of mobile silencing RNA throughout the organism but the identities of these mobile RNA species in animals are unknown. Here we present genetic evidence that both the initial double-stranded RNA (dsRNA), which triggers RNAi, and at least one dsRNA intermediate produced during RNAi can act as or generate mobile silencing RNA in Caenorhabditis elegans. This dsRNA intermediate requires the long dsRNA-binding protein RDE-4, the endonuclease DCR-1, which cleaves long dsRNA into double-stranded short-interfering RNA (ds-siRNA), and the putative nucleotidyltransferase MUT-2 (RDE-3). However, single-stranded siRNA and downstream secondary siRNA produced upon amplification by the RNA-dependent RNA Polymerase RRF-1 do not generate mobile silencing RNA. Restricting inter-tissue transport to long dsRNA and directly processed siRNA intermediates rather than amplified siRNA may serve to modulate the extent of systemic silencing in proportion to available dsRNA. PMID:21984186

  20. Surface functionalisation of PLGA nanoparticles for gene silencing

    DEFF Research Database (Denmark)

    Andersen, Morten Østergaard; Lichawska, Agata; Arpanaei, Ayyoob

    2010-01-01

    . In addition, particles containing cetylated-PEI achieved 64% silencing of TNFα in J774.1 cells. This rapid method for surface modification of PLGA nanoparticles promotes its application for alternative cetylated functional derivatives as a strategy to control specific biological properties of nanoparticles....

  1. The effects of thinking in silence on creativity and innovation

    NARCIS (Netherlands)

    de Vet, A.J.

    2007-01-01

    This dissertation consists of three empirical studies on the effects of thinking in silence on creativity and innovation. In these studies I use a social psychology and cognitive psychology lens to study creativity and innovation at the individual and at the team level of analysis, using randomized

  2. Resounding Silences : Subtle Norm Regulation in Everyday Interactions

    NARCIS (Netherlands)

    Koudenburg, Namkje; Postmes, Tom; Gordijn, Ernestine H.

    In this article we suggest a mechanism for norm regulation that does not rely on explicit information exchange or costly reinforcement, but rather on the sensitivity of group members to social cues in their environment. We examine whether brief conversational silences can (a) signal a threat to

  3. Breaking the Silence Surrounding Mental Health on Campus

    Science.gov (United States)

    Roper, Larry D.

    2013-01-01

    Mentally ill students are able to participate in higher education at unprecedented rates. While colleges and universities have been responsive to the therapeutic needs, we have failed to successfully create supportive campus climates. Campus leaders are challenged to demonstrate ethical leadership that breaks the silence and confronts the stigma…

  4. Strategic Silence as a Tool of Political Communication: A Reflection ...

    African Journals Online (AJOL)

    Politics is said to be a game of intrigues and part of that is the use of silence as a means of communication. This may sound strange as communication itself connotes the art of expression. However in politics, a political actor may chose to remain silent as a means of passing a message across to the public in a trouble ...

  5. A systemic gene silencing method suitable for high throughput, reverse genetic analyses of gene function in fern gametophytes

    Directory of Open Access Journals (Sweden)

    Tanurdzic Milos

    2004-04-01

    Full Text Available Abstract Background Ceratopteris richardii is a useful experimental system for studying gametophyte development and sexual reproduction in plants. However, few tools for cloning mutant genes or disrupting gene function exist for this species. The feasibility of systemic gene silencing as a reverse genetics tool was examined in this study. Results Several DNA constructs targeting a Ceratopteris protoporphyrin IX magnesium chelatase (CrChlI gene that is required for chlorophyll biosynthesis were each introduced into young gametophytes by biolistic delivery. Their transient expression in individual cells resulted in a colorless cell phenotype that affected most cells of the mature gametophyte, including the meristem and gametangia. The colorless phenotype was associated with a 7-fold decrease in the abundance of the endogenous transcript. While a construct designed to promote the transient expression of a CrChlI double stranded, potentially hairpin-forming RNA was found to be the most efficient in systemically silencing the endogenous gene, a plasmid containing the CrChlI cDNA insert alone was sufficient to induce silencing. Bombarded, colorless hermaphroditic gametophytes produced colorless embryos following self-fertilization, demonstrating that the silencing signal could be transmitted through gametogenesis and fertilization. Bombardment of young gametophytes with constructs targeting the Ceratopteris filamentous temperature sensitive (CrFtsZ and uroporphyrin dehydrogenase (CrUrod genes also produced the expected mutant phenotypes. Conclusion A method that induces the systemic silencing of target genes in the Ceratopteris gametophyte is described. It provides a simple, inexpensive and rapid means to test the functions of genes involved in gametophyte development, especially those involved in cellular processes common to all plants.

  6. Assessment of RNAi-induced silencing in banana (Musa spp.).

    Science.gov (United States)

    Dang, Tuong Vi T; Windelinckx, Saskia; Henry, Isabelle M; De Coninck, Barbara; Cammue, Bruno P A; Swennen, Rony; Remy, Serge

    2014-09-18

    In plants, RNA- based gene silencing mediated by small RNAs functions at the transcriptional or post-transcriptional level to negatively regulate target genes, repetitive sequences, viral RNAs and/or transposon elements. Post-transcriptional gene silencing (PTGS) or the RNA interference (RNAi) approach has been achieved in a wide range of plant species for inhibiting the expression of target genes by generating double-stranded RNA (dsRNA). However, to our knowledge, successful RNAi-application to knock-down endogenous genes has not been reported in the important staple food crop banana. Using embryogenic cell suspension (ECS) transformed with ß-glucuronidase (GUS) as a model system, we assessed silencing of gusAINT using three intron-spliced hairpin RNA (ihpRNA) constructs containing gusAINT sequences of 299-nt, 26-nt and 19-nt, respectively. Their silencing potential was analysed in 2 different experimental set-ups. In the first, Agrobacterium-mediated co-transformation of banana ECS with a gusAINT containing vector and an ihpRNA construct resulted in a significantly reduced GUS enzyme activity 6-8 days after co-cultivation with either the 299-nt and 19-nt ihpRNA vectors. In the second approach, these ihpRNA constructs were transferred to stable GUS-expressing ECS and their silencing potential was evaluated in the regenerated in vitro plants. In comparison to control plants, transgenic plants transformed with the 299-nt gusAINT targeting sequence showed a 4.5 fold down-regulated gusA mRNA expression level, while GUS enzyme activity was reduced by 9 fold. Histochemical staining of plant tissues confirmed these findings. Northern blotting used to detect the expression of siRNA in the 299-nt ihpRNA vector transgenic in vitro plants revealed a negative relationship between siRNA expression and GUS enzyme activity. In contrast, no reduction in GUS activity or GUS mRNA expression occurred in the regenerated lines transformed with either of the two gusAINT oligo target

  7. Model Development for Current–Voltage and Transconductance Characteristics of Normally-off AlN/GaN MOSHEMT

    International Nuclear Information System (INIS)

    Swain, R.; Jena, K.; Lenka, T. R.

    2016-01-01

    In this paper, an AlN/GaN-based MOSHEMT is proposed, in accordance to this, a charge control model has been developed analytically and simulated with MATLAB to predict the characteristics of threshold voltage, drain currents and transconductance. The physics based models for 2DEG density, threshold voltage and quantum capacitance in the channel has been put forward. By using these developed models, the drain current for both linear and saturation models is derived. The predicted threshold voltage with the variation of barrier thickness has been plotted. A positive threshold voltage can be obtained by decreasing the barrier thickness which builds up the foundation for enhancement mode MOSHEMT devices. The predicted I_d–V_g_s, I_d–V_d_s and transconductance characteristics show an excellent agreement with the experimental results and hence validate the model.

  8. AKAP13 Rho-GEF and PKD-binding domain deficient mice develop normally but have an abnormal response to β-adrenergic-induced cardiac hypertrophy.

    Directory of Open Access Journals (Sweden)

    Matthew J Spindler

    Full Text Available A-kinase anchoring proteins (AKAPs are scaffolding molecules that coordinate and integrate G-protein signaling events to regulate development, physiology, and disease. One family member, AKAP13, encodes for multiple protein isoforms that contain binding sites for protein kinase A (PKA and D (PKD and an active Rho-guanine nucleotide exchange factor (Rho-GEF domain. In mice, AKAP13 is required for development as null embryos die by embryonic day 10.5 with cardiovascular phenotypes. Additionally, the AKAP13 Rho-GEF and PKD-binding domains mediate cardiomyocyte hypertrophy in cell culture. However, the requirements for the Rho-GEF and PKD-binding domains during development and cardiac hypertrophy are unknown.To determine if these AKAP13 protein domains are required for development, we used gene-trap events to create mutant mice that lacked the Rho-GEF and/or the protein kinase D-binding domains. Surprisingly, heterozygous matings produced mutant mice at Mendelian ratios that had normal viability and fertility. The adult mutant mice also had normal cardiac structure and electrocardiograms. To determine the role of these domains during β-adrenergic-induced cardiac hypertrophy, we stressed the mice with isoproterenol. We found that heart size was increased similarly in mice lacking the Rho-GEF and PKD-binding domains and wild-type controls. However, the mutant hearts had abnormal cardiac contractility as measured by fractional shortening and ejection fraction.These results indicate that the Rho-GEF and PKD-binding domains of AKAP13 are not required for mouse development, normal cardiac architecture, or β-adrenergic-induced cardiac hypertrophic remodeling. However, these domains regulate aspects of β-adrenergic-induced cardiac hypertrophy.

  9. UV‐B is Required for Normal Development of Oil Glands in Ocimum basilicum L. (Sweet Basil)

    Science.gov (United States)

    IOANNIDIS, DAPHNE; BONNER, LYNDA; JOHNSON, CHRISTOPHER B.

    2002-01-01

    Plants of Ocimum basilicum L. grown under glass were exposed to short treatments with supplementary UV‐B. The effect of UV‐B on volatile essential oil content was analysed and compared with morphological effects on the peltate and capitate glandular trichomes. In the absence of UV‐B, both peltate and capitate glands were incompletely developed in both mature and developing leaves, the oil sacs being wrinkled and only partially filled. UV‐B was found to have two main effects on the glandular trichomes. During the first 4 d of treatment, both peltate and capitate glands filled and their morphology reflected their ‘normal’ mature development as reported in the literature. During the following days there was a large increase in the number of broken oil sacs among the peltate glands as the mature glands broke open, releasing volatiles. Neither the number of glands nor the qualitative or quantitative composition of the volatiles was affected by UV‐B. There seems to be a requirement for UV‐B for the filling of the glandular trichomes of basil. PMID:12324268

  10. Cumulative and current exposure to potentially nephrotoxic antiretrovirals and development of chronic kidney disease in HIV-positive individuals with a normal baseline estimated glomerular filtration rate

    DEFF Research Database (Denmark)

    Mocroft, Amanda; Lundgren, Jens D; Ross, Michael

    2016-01-01

    BACKGROUND: Whether or not the association between some antiretrovirals used in HIV infection and chronic kidney disease is cumulative is a controversial topic, especially in patients with initially normal renal function. In this study, we aimed to investigate the association between duration...... of exposure to antiretrovirals and the development of chronic kidney disease in people with initially normal renal function, as measured by estimated glomerular filtration rate (eGFR). METHODS: In this prospective international cohort study, HIV-positive adult participants (aged ≥16 years) from the D......:A:D study (based in Europe, the USA, and Australia) with first eGFR greater than 90 mL/min per 1·73 m(2) were followed from baseline (first eGFR measurement after Jan 1, 2004) until the occurrence of one of the following: chronic kidney disease; last eGFR measurement; Feb 1, 2014; or final visit plus 6...

  11. Development of self-image and its components during a one-year follow-up in non-referred adolescents with excess and normal weight.

    Science.gov (United States)

    Mäkinen, Mauno; Marttunen, Mauri; Komulainen, Erkki; Terevnikov, Viacheslav; Puukko-Viertomies, Leena-Riitta; Aalberg, Veikko; Lindberg, Nina

    2015-01-01

    The proportion of overweight and obese youths is high. The present study aimed to investigate the development of self-image and its components during a one-year follow-up among non-referred adolescents with excess and normal weight. Furthermore, we separately analyzed the data for girls and boys. Altogether 86 8(th) grades (41 girls and 45 boys) with a relative weight of 26% or more above the median and 91 controls (43 girls and 48 boys) with normal weight participated the follow-up. The Offer Self-Image Questionnaire, Revised (OSIQ-R) was used to assess self-image at baseline and on follow-up. In the OSIQ-R, a low total raw score implies positive adjustment, while a high raw score implies poor adjustment and a negative self-image. The study design was doubly correlated (pairs and time), and a linear mixed model was used in the statistical analysis. In OSIQ-R total scores, a comparative improvement was observed in girls with normal weight. Among these girls, significant change scores compared to zero were seen in impulse control, social functioning, vocational attitudes, self-confidence, self-reliance, body image, sexuality, and ethical values. In girls with excess weight, none of the change scores compared to zero were statistically significant. When the girls with normal and excess weight were compared, the difference in change scores was largest in sexuality and vocational attitudes. Change scores compared to zero were significant in sexuality and idealism for boys with excess weight, and in impulse control, mental health, self-reliance, and sexuality for normal weight boys. When the boys with excess and normal weight were compared, no statistically significant differences emerged in change scores. In mid-adolescent girls, the influence of overweight and obesity on the development of self-image is substantial. Weight management programs directed at overweight adolescent girls should include psychological interventions aiming to diminish self-image distress

  12. Simultaneous Silencing of Xylanase Genes in Botrytis cinerea

    Directory of Open Access Journals (Sweden)

    Néstor García

    2017-12-01

    Full Text Available The endo-β-1,4-xylanase BcXyn11A is one of several plant cell-wall degrading enzymes that the phytopathogenic fungus Botrytis cinerea secretes during interaction with its hosts. In addition to its enzymatic activity, this protein also acts as an elicitor of the defense response in plants and has been identified as a virulence factor. In the present work, other four endoxylanase coding genes (Bcxyn11B, Bcxyn11C, Bcxyn10A, and Bcxyn10B were identified in the B. cinerea genome and the expression of all five genes was analyzed by Q-RT- PCR in vitro and in planta. A cross-regulation between xylanase genes was identified analyzing their expression pattern in the ΔBcxyn11A mutant strain and a putative BcXyn11A-dependt induction of Bcxyn10B gene was found. In addition, multiple knockdown strains were obtained for the five endoxylanase genes by transformation of B. cinerea with a chimeric DNA construct composed of 50-nt sequences from the target genes. The silencing of each xylanase gene was analyzed in axenic cultures and during infection and the results showed that the efficiency of the multiple silencing depends on the growth conditions and on the cross-regulation between them. Although the simultaneous silencing of the five genes was observed by Q-RT-PCR when the silenced strains were grown on medium supplemented with tomato extract, the endoxylanase activity measured in the supernatants was reduced only by 40%. Unexpectedly, the silenced strains overexpressed the Bcxyn11A and Bcxyn11C genes during the infection of tomato leaves, making difficult the analysis of the role of the endo-β-1,4-xylanases in the virulence of the fungus.

  13. Developing Gene Silencing for the Study and Treatment of Dystonia

    Science.gov (United States)

    2017-12-01

    missense miRNA (MIS). HEK293 cells were co-transfected with human torsinA(WT) or torsinA(ΔE) cDNA and these vectors. Immunofluorecence analysis... cDNA (demonstrating allele-specificity) 18 Figure 7. Supressing striatal expression of human torsinA(ΔE) in vivo. DYT1 transgenic rats

  14. Silencing of Carbohydrate Sulfotransferase 15 Hinders Murine Pulmonary Fibrosis Development

    Directory of Open Access Journals (Sweden)

    Yoshiro Kai

    2017-03-01

    Full Text Available Pulmonary fibrosis is a progressive lung disorder characterized by interstitial fibrosis, for which no effective treatments are available. Chondroitin sulfate proteoglycan (CSPG has been shown to be a mediator, but the specific component of glycosaminoglycan chains of CSPG has not been explored. We show that chondroitin sulfate E-type (CS-E is involved in fibrogenesis. Small interfering RNA (siRNA targeting carbohydrate sulfotransferase 15 (CHST15 was designed to inhibit CHST15 mRNA and its product, CS-E. CS-E augments cell contraction and CHST15 siRNA inhibits collagen production. We found that bleomycin treatment increased CHST15 expression in interstitial fibroblasts at day 14. CHST15 siRNA was injected intranasally on days 1, 4, 8, and 11, and CHST15 mRNA was significantly suppressed by day 14. CHST15 siRNA reduced lung CSPG and the grade of fibrosis. CHST15 siRNA repressed the activation of fibroblasts, as evidenced by suppressed expression of α smooth muscle actin (αSMA, connective tissue growth factor (CTGF, lysyl oxidase like 2 (LOXL2, and CC-chemokine ligand 2 (CCL2/monocyte chemoattractant protein-1 (MCP-1. Inflammatory infiltrates in the bronchoalveolar lavage fluid (BALF and interstitium were diminished by CHST15 siRNA. These results indicate a pivotal role for CHST15 in fibroblast-mediated lung fibrosis and suggest a possible new therapeutic role for CHST15 siRNA in pulmonary fibrosis.

  15. Human CD4 restores normal T cell development and function in mice deficient in murine CD4

    OpenAIRE

    1994-01-01

    The ability of a human coreceptor to function in mice was investigated by generating human CD4 (hCD4)-expressing transgenic mice on a mouse CD4-deficient (mCD4-/-) background. From developing thymocyte to matured T lymphocyte functions, hCD4 was shown to be physiologically active. By examining the expansion and deletion of specific V beta T cell families in mutated mice with and without hCD4, it was found that hCD4 can participate in positive and negative selection. Mature hCD4 single positiv...

  16. RNAi-mediated Gene Silencing of Mutant Myotilin Improves Myopathy in LGMD1A Mice

    Directory of Open Access Journals (Sweden)

    Jian Liu

    2014-01-01

    Full Text Available Recent progress suggests gene therapy may one day be an option for treating some forms of limb girdle muscular dystrophy (LGMD. Nevertheless, approaches targeting LGMD have so far focused on gene replacement strategies for recessive forms of the disease. In contrast, no attempts have been made to develop molecular therapies for any of the eight dominantly inherited forms of LGMD. Importantly, the emergence of RNA interference (RNAi therapeutics in the last decade provided new tools to combat dominantly inherited LGMDs with molecular therapy. In this study, we describe the first RNAi-based, preclinical gene therapy approach for silencing a gene associated with dominant LGMD. To do this, we developed adeno-associated viral vectors (AAV6 carrying designed therapeutic microRNAs targeting mutant myotilin (MYOT, which is the underlying cause of LGMD type 1A (LGMD1A. Our best MYOT-targeted microRNA vector (called miMYOT significantly reduced mutant myotilin mRNA and soluble protein expression in muscles of LGMD1A mice (the TgT57I model both 3 and 9 months after delivery, demonstrating short- and long-term silencing effects. This MYOT gene silencing subsequently decreased deposition of MYOT-seeded intramuscular protein aggregates, which is the hallmark feature of LGMD1A. Histological improvements were accompanied by significant functional correction, as miMYOT-treated animals showed increased muscle weight and improved specific force in the gastrocnemius, which is one of the most severely affected muscles in TgT57I mice and patients with dominant myotilin mutations. These promising results in a preclinical model of LGMD1A support the further development of RNAi-based molecular therapy as a prospective treatment for LGMD1A. Furthermore, this study sets a foundation that may be refined and adapted to treat other dominant LGMD and related disorders.

  17. PARP inhibition versus PARP-1 silencing: different outcomes in terms of single-strand break repair and radiation susceptibility

    International Nuclear Information System (INIS)

    Godon, C.; Cordelieres, F.P.; Giocanti, N.; Megnin-Chanet, F.; Hall, J.; Favaudon, V.; Godon, C.; Giocanti, N.; Megnin-Chanet, F.; Hall, J.; Favaudon, V.; Cordelieres, F.P.; Cordelieres, F.P.; Biard, D.

    2008-01-01

    The consequences of PARP-1 disruption or inhibition on DNA single-strand break repair (SSBR) and radio-induced lethality were determined in synchronized, iso-genic HeLa cells stably silenced or not for poly(ADP-ribose) polymerase-1 (PARP-1) (PARP-1(KD)) or XRCC1 (XRCC1(KD)). PARP-1 inhibition prevented XRCC1-YFP recruitment at sites of 405 nm laser micro irradiation, slowed SSBR 10-fold and triggered the accumulation of large persistent foci of GFP-PARP-1 and GFP-PCNA at photo damaged sites. These aggregates are presumed to hinder the recruitment of other effectors of the base excision repair (BER) pathway.PARP-1 silencing also prevented XRCC1-YFP recruitment but did not lengthen the lifetime of GFP-PCNA foci. Moreover, PARP-1(KD) and XRCC1(KD) cells in S phase completed SSBR as rapidly as controls, while SSBR was delayed in G1. Taken together, the data demonstrate that a PARP-1- and XRCC1-independent SSBR pathway operates when the short patch repair branch of the BER is deficient. Long patch repair is the likely mechanism, as GFP-PCNA recruitment at photo-damaged sites was normal in PARP-1(KD) cells. PARP-1 silencing elicited hyper-radiosensitivity, while radiosensitization by a PARP inhibitor reportedly occurs only in those cells treated in S phase. PARP-1 inhibition and deletion thus have different outcomes in terms of SSBR and radiosensitivity. (authors)

  18. The bifunctional abiotic stress signalling regulator and endogenous RNA silencing suppressor FIERY1 is required for lateral root formation

    KAUST Repository

    Chen, Hao

    2010-09-28

    The Arabidopsis FIERY1 (FRY1) locus was originally identified as a negative regulator of stress-responsive gene expression and later shown to be required for suppression of RNA silencing. In this study we discovered that the FRY1 locus also regulates lateral root formation. Compared with the wild type, fry1 mutant seedlings generated significantly fewer lateral roots under normal growth conditions and also exhibited a dramatically reduced sensitivity to auxin in inducing lateral root initiation. Using transgenic plants that overexpress a yeast homolog of FRY1 that possesses only the 3\\', 5\\'-bisphosphate nucleotidase activity but not the inositol 1-phosphatase activity, we demonstrated that the lateral root phenotypes in fry1 result from loss of the nucleotidase activity. Furthermore, a T-DNA insertion mutant of another RNA silencing suppressor, XRN4 (but not XRN2 or XRN3), which is an exoribonuclease that is inhibited by the substrate of the FRY1 3\\', 5\\'-bisphosphate nucleotidase, exhibits similar lateral root defects. Although fry1 and xrn4 exhibited reduced sensitivity to ethylene, our experiments demonstrated that restoration of ethylene sensitivity in the fry1 mutant is not sufficient to rescue the lateral root phenotypes of fry1. Our results indicate that RNA silencing modulated by FRY1 and XRN4 plays an important role in shaping root architecture. © 2010 Blackwell Publishing Ltd.

  19. A novel image toggle tool for comparison of serial mammograms: automatic density normalization and alignment-development of the tool and initial experience.

    Science.gov (United States)

    Honda, Satoshi; Tsunoda, Hiroko; Fukuda, Wataru; Saida, Yukihisa

    2014-12-01

    The purpose is to develop a new image toggle tool with automatic density normalization (ADN) and automatic alignment (AA) for comparing serial digital mammograms (DMGs). We developed an ADN and AA process to compare the images of serial DMGs. In image density normalization, a linear interpolation was applied by taking two points of high- and low-brightness areas. The alignment was calculated by determining the point of the greatest correlation while shifting the alignment between the current and prior images. These processes were performed on a PC with a 3.20-GHz Xeon processor and 8 GB of main memory. We selected 12 suspected breast cancer patients who had undergone screening DMGs in the past. Automatic processing was retrospectively performed on these images. Two radiologists subjectively evaluated them. The process of the developed algorithm took approximately 1 s per image. In our preliminary experience, two images could not be aligned approximately. When they were aligned, image toggling allowed detection of differences between examinations easily. We developed a new tool to facilitate comparative reading of DMGs on a mammography viewing system. Using this tool for toggling comparisons might improve the interpretation efficiency of serial DMGs.

  20. Mild achondroplasia/hypochondroplasia with acanthosis nigricans, normal development, and a p.Ser348Cys FGFR3 mutation.

    Science.gov (United States)

    Couser, Natario L; Pande, Chetna K; Turcott, Christie M; Spector, Elaine B; Aylsworth, Arthur S; Powell, Cynthia M

    2017-04-01

    Pathogenic allelic variants in the fibroblast growth factor receptor 3 (FGFR3) gene have been associated with a number of phenotypes including achondroplasia, hypochondroplasia, thanatophoric dysplasia, Crouzon syndrome with acanthosis nigricans (Crouzonodermoskeletal syndrome), and SADDAN (severe achondroplasia with developmental delay and acanthosis nigricans). Crouzon syndrome with acanthosis nigricans is caused by the pathogenic variant c.1172C>A (p.Ala391Glu) in the FGFR3 gene. The p.Lys650Thr pathogenic variant in FGFR3 has been linked to acanthosis nigricans without significant craniofacial or skeletal abnormalities. Recently, an infant with achondroplasia and a novel p.Ser348Cys FGFR3 mutation was reported. We describe the clinical history of an 8-year-old child with a skeletal dysplasia in the achondroplasia-hypochondroplasia spectrum, acanthosis nigricans, typical development, and the recently described p.Ser348Cys FGFR3 mutation. © 2017 Wiley Periodicals, Inc.