Voice and silence in organizations

Directory of Open Access Journals (Sweden)

Moaşa, H.

2011-01-01

Full Text Available Unlike previous research on voice and silence, this article breaksthe distance between the two and declines to treat them as opposites. Voice and silence are interrelated and intertwined strategic forms ofcommunication which presuppose each other in such a way that the absence of one would minimize completely the other’s presence. Social actors are not voice, or silence. Social actors can have voice or silence, they can do both because they operate at multiple levels and deal with multiple issues at different moments in time.

Midgut microbiota and host immunocompetence underlie Bacillus thuringiensis killing mechanism

Science.gov (United States)

Caccia, Silvia; Di Lelio, Ilaria; La Storia, Antonietta; Marinelli, Adriana; Varricchio, Paola; Franzetti, Eleonora; Banyuls, Núria; Tettamanti, Gianluca; Casartelli, Morena; Giordana, Barbara; Ferré, Juan; Gigliotti, Silvia; Pennacchio, Francesco

2016-01-01

Bacillus thuringiensis is a widely used bacterial entomopathogen producing insecticidal toxins, some of which are expressed in insect-resistant transgenic crops. Surprisingly, the killing mechanism of B. thuringiensis remains controversial. In particular, the importance of the septicemia induced by the host midgut microbiota is still debated as a result of the lack of experimental evidence obtained without drastic manipulation of the midgut and its content. Here this key issue is addressed by RNAi-mediated silencing of an immune gene in a lepidopteran host Spodoptera littoralis, leaving the midgut microbiota unaltered. The resulting cellular immunosuppression was characterized by a reduced nodulation response, which was associated with a significant enhancement of host larvae mortality triggered by B. thuringiensis and a Cry toxin. This was determined by an uncontrolled proliferation of midgut bacteria, after entering the body cavity through toxin-induced epithelial lesions. Consequently, the hemolymphatic microbiota dramatically changed upon treatment with Cry1Ca toxin, showing a remarkable predominance of Serratia and Clostridium species, which switched from asymptomatic gut symbionts to hemocoelic pathogens. These experimental results demonstrate the important contribution of host enteric flora in B. thuringiensis-killing activity and provide a sound foundation for developing new insect control strategies aimed at enhancing the impact of biocontrol agents by reducing the immunocompetence of the host. PMID:27506800

Gender Differences in Self-Silencing and Psychological Distress in Informal Cancer Carers

Science.gov (United States)

Ussher, Jane M.; Perz, Janette

2010-01-01

This study examined gender differences in self-silencing, the relationship between self-silencing and psychological distress, and reasons for self-silencing in informal cancer carers (329 women, 155 men), using a mixed-method design. Men reported greater self-silencing than women on the Silencing the Self Scale; however, women reported higher…

The physics of chromatin silencing: Bi-stability and front propagation

Science.gov (United States)

Sedighi, Mohammad

A mean-field dynamical model of chromatin silencing in budding yeast is provided and the conditions giving rise to two states: one silenced and another un-silenced, is studied. Based on these conditions, the space of control parameters is divided into two distinct regions of mono-stable and bi-stable solutions (the bifurcation diagram). Then, considering both the discrete and continuous versions of the model, the formation of a stable boundary between the silenced and un-silenced areas on DNA is investigated. As a result, a richer phase diagram is provided. The dynamics of the boundary is also studied under different conditions. Consequently, assuming negative feedback due to possible depletion of silencing proteins, the model explains a paradoxical epigenetic behavior of yeast that happens under some mutation. A stochastic treatment of the model is also considered to verify the results of the mean-field approximation and also to understand the role of intrinsic noise at single cell level. This model could be used as a general guide to discuss chromatin silencing in many organisms.

Transcriptional Silencing of Retroviral Vectors

DEFF Research Database (Denmark)

Lund, Anders Henrik; Duch, M.; Pedersen, F.S.

1996-01-01

. Extinction of long-term vector expression has been observed after implantation of transduced hematopoietic cells as well as fibroblasts, myoblasts and hepatocytes. Here we review the influence of vector structure, integration site and cell type on transcriptional silencing. While down-regulation of proviral...... transcription is known from a number of cellular and animal models, major insight has been gained from studies in the germ line and embryonal cells of the mouse. Key elements for the transfer and expression of retroviral vectors, such as the viral transcriptional enhancer and the binding site for the t......RNA primer for reverse transcription may have a major influence on transcriptional silencing. Alterations of these elements of the vector backbone as well as the use of internal promoter elements from housekeeping genes may contribute to reduce transcriptional silencing. The use of cell culture and animal...

Silence, an Eye of Knowledge

Directory of Open Access Journals (Sweden)

Mehdi Aghamohammadi

2017-04-01

Full Text Available One of the conspicuous features of the twentieth-century West was silence. This idea could be supported by examining reflections of Ludwig Wittgenstein, Fritz Mauthner, John Cage, Samuel Beckett, Ihab Hassan, Franz Kafka, Wassily Kandinsky, Jean-Paul Sartre, Virginia Woolf, Wolfgang Iser, Jacques Derrida, and Pierre Macherey. To me, silence is not a mere theory, but rather a phenomenon from which we can get practical benefits. I believe silence is an eye, eye of knowledge. We can broaden our knowledge of the world through silence. To convey the idea that silence is an eye, I have concocted the word slence, where  has replaced the letter i and stands for the eye. This means knowledge can enable us to see, thereby acquiring knowledge of, what used to be invisible, and accordingly unknowable. In other words, through silence, we can achieve a certain type of literacy. I substantiate this claim by exploring the Horus myth, Ojo de Dios, John Cage’s 4' 33", the nature of Expressionist paintings, Hinduism, thoughts of Hermes Trismegistus and Ibn al-Arabi, and practices of Mohammad, the prophet of Islam.

Antisense gene silencing

DEFF Research Database (Denmark)

Nielsen, Troels T; Nielsen, Jørgen E

2013-01-01

Since the first reports that double-stranded RNAs can efficiently silence gene expression in C. elegans, the technology of RNA interference (RNAi) has been intensively exploited as an experimental tool to study gene function. With the subsequent discovery that RNAi could also be applied...

[E. M. Jellinek's silenced and silencing transgenerational story].

Science.gov (United States)

Kelemen, Gábor; Márk, Mónika

2013-01-01

Jellinek is a kind of archetypal character for future generations in the field of addiction studies. His implosion in the arena of alcoholism around the age of 50 was an unexpected challenge to medical science. We know very little about his own role models giving an intellectual and moral compass to his pragmatic creativity. More than 30 years has passed since Jellinek's death when an American sociologist Ron Roizen started unearthing his silent story. Roizen discerned that there are a lot of unsaid and muted issues in his personal Hungarian past. Our paper, based on the authors' research in Hungarian archives and other sources reveals that not just Jellinek's personal but his transgenerational narrative has been not-yet-said. This silenced and silencing history appears an unfinished business of acculturation of the family, which started prior to four generations. Authors have been concluding that the issue of religious conversion is a critical point in the process of acculturation. They examine the counter move of loyalty to family values and driving force of assimilation making their story unspeakable.

Ombuds’ corner: Employee silence

CERN Multimedia

Vincent Vuillemin

2013-01-01

Although around a hundred cases a year are reported to the Ombuds, several issues may still not be disclosed due to employee silence*. The deliberate withholding of concerns, escalating misunderstandings or genuine conflicts can impede the global process of learning and development of a better respectful organizational workplace environment, and prevent the detection and correction of acts violating the CERN Code of Conduct.   For the employee him/herself, such silence can lead to feelings of anger, resentment, helplessness and humiliation. These feelings will inevitably contaminate personal and interpersonal relations, and poison creativity and effectiveness. Employee silence can be explained by many factors; sometimes it is connected to organizational forces. In their published paper*, authors Michael Knoll and Rolf van Dick found four forms of employee silence. People may stay silent if they feel that their opinion is neither welcomed nor valued by their management. They have gi...

Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing.

Science.gov (United States)

Hedil, Marcio; Sterken, Mark G; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard

2015-01-01

RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silencing has only been studied to a limited extent. Here, the NSs proteins of TSWV, groundnut ringspot virus (GRSV) and tomato yellow ring virus (TYRV), representatives for three distinct tospovirus species, have been studied on their ability and strength to suppress local and systemic silencing. A system has been developed to quantify suppression of GFP silencing in Nicotiana benthamiana 16C lines, to allow a comparison of relative RNA silencing suppressor strength. It is shown that NSs of all three tospoviruses are suppressors of local and systemic silencing. Unexpectedly, suppression of systemic RNA silencing by NSsTYRV was just as strong as those by NSsTSWV and NSsGRSV, even though NSsTYRV was expressed in lower amounts. Using the system established, a set of selected NSsTSWV gene constructs mutated in predicted RNA binding domains, as well as NSs from TSWV isolates 160 and 171 (resistance breakers of the Tsw resistance gene), were analyzed for their ability to suppress systemic GFP silencing. The results indicate another mode of RNA silencing suppression by NSs that acts further downstream the biogenesis of siRNAs and their sequestration. The findings are discussed in light of the affinity of NSs for small and long dsRNA, and recent mutant screen of NSsTSWV to map domains required for RSS activity and triggering of Tsw-governed resistance.

Organizational Silence in Universities as the Predictor of Organizational Culture

Directory of Open Access Journals (Sweden)

Erkan YAMAN

2014-04-01

Full Text Available The aim of this study is to determine the relationship between the sense of organizational silence and the organizational culture the instructors perceived. In this study, the scale for determining organizational culture developed by İpek (1999 and the scale for measuring organizational silence developed by Çakıcı (2007 and adapted by Soycan (2010 are used. No remarkable difference was found in the academic staff's sense of organizational silence degree according to their genders and educational backgrounds. It was seen that the instructors' sense of organizational silence had remarkable differences according to their age group, faculty, sense of administration type in their institutions, frequency of their face-to-face communication with their administrators and their thoughts of speaking clearly with their administrators. It was observed that research assistants had a significantly higher sense of organizational silence than the lecturers in the sense of ‘Lack of Experience'. It was seen that academicians who had 1-5 years of employment period had the highest sense of organizational silence while those who had 21 years or more employment period had the lowest sense of organizational silence in the sense of ‘Lack of Experience' of organizational silence. When the points that participant academicians got from organizational silence and organizational culture scales analyzed in the correlation table, it was found out that there was a remarkable relationship between the academicians' sense of organizational silence and sense of organizational culture. This relationship was a medium-level negative relationship between subdimensions of two scales. A medium-level negative relationship between the organizational silence (total and the organizational culture was also seen. Based on the findings, university administrators were proposed to create a participant culture in their institutions as well as to encourage instructors to speak clearly and

The silence.

Science.gov (United States)

Millenson, Michael L

2003-01-01

Despite several well-crafted Institute of Medicine (IOM) reports, there remains within health care a persistent refusal to confront providers' responsibility for severe quality problems. There is a silence of deed--failing to take corrective actions--and of word--failing to discuss openly the true consequences of that inertia. These silences distort public policy, delay change, and, by leading (albeit inadvertently) to thousands of patient deaths, undermine professionalism. The IOM quality committee, to retain its moral authority, should forgo issuing more reports and instead lead an emergency corrective-action campaign comparable to Flexner's crusade against charlatan medical schools.

The organisational silence of midwives and nurses: reasons and results.

Science.gov (United States)

Yurdakul, Mine; Beşen, Meltem Aydin; Erdoğan, Semra

2016-07-01

The study was conducted to determine the issues about which nurses and midwives remain silent and the reasons for it and the perceived results of silence. Organisational silence is a vitally important issue in the health sector, due to the risks and mistakes that are not reported, and proposals for improvement that are not made. The sample of this descriptive survey, which investigated a cause and effect relationship, was 159 nurses and midwives. The data were collected using a questionnaire and the organisational silence scale. Of the study participants, 84.9% were nurses and 15.1% were midwives. Of all participants 88.7% were women. 8.8% of participants stated that they never remained silent about issues related to work and the workplace. Respondents most often remained silent about issues related to ethics and responsibility. 'Limited improvement and development' was frequently mentioned as a perceived result of organisational silence. Our study determined that organisational silence is quite common among nurses and midwives. Activities that raise the awareness of hospital administrations and employees about preventing the factors that cause and maintain silence in hospitals should be planned. © 2016 John Wiley & Sons Ltd.

The Killing

DEFF Research Database (Denmark)

Agger, Gunhild

2013-01-01

This article tracks the uncanny locations of The Killing (2007–2012), relating them to place, space and atmosphere, putting bits and pieces from the topographic puzzle together with cues from the symbolic space in order to see how they fit into the overall pattern of Nordic Noir. In The Killing......, the abstract level of space and atmosphere meets the concrete level of place, both influencing the notion of location. This meeting, I suggest, has contributed towards the simultaneous domestic and international appeal of The Killing....

Evaluation of Honour Killings in Turkey

OpenAIRE

Celbis, Osman; Ozdemir, Bora; Oruc, Mucahit; Dogan, Mustafa; Egri, Mucahit

2013-01-01

Honour killings are still pervasive in many societies.  The aim of this study is to reveal the characteristics of the victims of honour killings and honour killers in Malatya province between 2000 and 2004, and to review the concept of honour killings in Turkey.  Data are collected from the records of Malatya Higher Criminal Court.  The results are discussed in the light of the data obtained from Turkish Republic Ministry of Justice.  There were 36 honour killings in Malatya between 2000 and ...

Notes on super Killing tensors

Energy Technology Data Exchange (ETDEWEB)

Howe, P.S. [Department of Mathematics, King’s College London,The Strand, London WC2R 2LS (United Kingdom); Lindström, University [Department of Physics and Astronomy, Theoretical Physics, Uppsala University,SE-751 20 Uppsala (Sweden); Theoretical Physics, Imperial College London,Prince Consort Road, London SW7 2AZ (United Kingdom)

2016-03-14

The notion of a Killing tensor is generalised to a superspace setting. Conserved quantities associated with these are defined for superparticles and Poisson brackets are used to define a supersymmetric version of the even Schouten-Nijenhuis bracket. Superconformal Killing tensors in flat superspaces are studied for spacetime dimensions 3,4,5,6 and 10. These tensors are also presented in analytic superspaces and super-twistor spaces for 3,4 and 6 dimensions. Algebraic structures associated with superconformal Killing tensors are also briefly discussed.

Stability of RNA silencing-based traits after virus infection

DEFF Research Database (Denmark)

Jørgensen, Bodil; Albrechtsen, Merete

2007-01-01

with constructs based on virus coat protein (CP) genes or other viral genes has been successfully used to engineer PTGS-mediated virus resistance into a large number of crop plants and some transgenic lines have been commercially exploited. However the discovery that plant viruses encode suppressors of gene...... silencing has raised concerns that virus infection of crop plants might reverse the new silencing-based traits. Most studies of virus suppression of silencing have used model systems based on silencing of reporter genes. A few studies have analysed the effects of virus infections on plants with genetically...... engineered virus resistance based on either a simple sense or an inverted repeat construct. We decided to use genetically engineered virus resistance in potato as a model system for further studies of the effect of virus infection on genetically engineered traits. We present for the first time a comparison...

Anti-viral RNA silencing: do we look like plants ?

Directory of Open Access Journals (Sweden)

Lecellier Charles-Henri

2006-01-01

Full Text Available Abstract The anti-viral function of RNA silencing was first discovered in plants as a natural manifestation of the artificial 'co-suppression', which refers to the extinction of endogenous gene induced by homologous transgene. Because silencing components are conserved among most, if not all, eukaryotes, the question rapidly arose as to determine whether this process fulfils anti-viral functions in animals, such as insects and mammals. It appears that, whereas the anti-viral process seems to be similarly conserved from plants to insects, even in worms, RNA silencing does influence the replication of mammalian viruses but in a particular mode: micro(miRNAs, endogenous small RNAs naturally implicated in translational control, rather than virus-derived small interfering (siRNAs like in other organisms, are involved. In fact, these recent studies even suggest that RNA silencing may be beneficial for viral replication. Accordingly, several large DNA mammalian viruses have been shown to encode their own miRNAs. Here, we summarize the seminal studies that have implicated RNA silencing in viral infection and compare the different eukaryotic responses.

How Silent is the Right to Silence?

Directory of Open Access Journals (Sweden)

Katherine Biber

2012-11-01

Full Text Available A long-held and fundamental principle of our criminal justice system is that people accused of crimes have a right to silence, arising from the presumption of innocence. Rules of evidence try to protect this ‘right’ during trial, by ensuring that juries understand that adverse inferences cannot be drawn from the silence of the accused. Silence, in court, can mean nothing, and we are not to speculate about what might motivate an accused person to remain silent, or what they might have said had they spoken. However, an examination of the jurisprudence in this area shows that the law is often not dealing with actual silence; sometimes when the law refers to the ‘right to silence’, it seems to mean a ‘refusal to hear’. In other instances, there is actual silence, and yet the law refuses to subject that silence to any critical interpretation, insisting that we cannot infer anything from it. While we have learned, from theatre, music, linguistics, religion and psychology, to develop sophisticated means for interpreting silence, the law demands that we set aside these interpretive tools, hearing silence that isn’t there, and inferring nothing about something.

33 CFR 117.801 - Newtown Creek, Dutch Kills, English Kills and their tributaries.

Science.gov (United States)

2010-07-01

... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Newtown Creek, Dutch Kills, English Kills and their tributaries. 117.801 Section 117.801 Navigation and Navigable Waters COAST GUARD....801 Newtown Creek, Dutch Kills, English Kills and their tributaries. (a) The following requirements...

Drosophila PAF1 Modulates PIWI/piRNA Silencing Capacity.

Science.gov (United States)

Clark, Josef P; Rahman, Reazur; Yang, Nachen; Yang, Linda H; Lau, Nelson C

2017-09-11

To test the directness of factors in initiating PIWI-directed gene silencing, we employed a Piwi-interacting RNA (piRNA)-targeted reporter assay in Drosophila ovary somatic sheet (OSS) cells [1]. This assay confirmed direct silencing roles for piRNA biogenesis factors and PIWI-associated factors [2-12] but suggested that chromatin-modifying proteins may act downstream of the initial silencing event. Our data also revealed that RNA-polymerase-II-associated proteins like PAF1 and RTF1 antagonize PIWI-directed silencing. PAF1 knockdown enhances PIWI silencing of reporters when piRNAs target the transcript region proximal to the promoter. Loss of PAF1 suppresses endogenous transposable element (TE) transcript maturation, whereas a subset of gene transcripts and long-non-coding RNAs adjacent to TE insertions are affected by PAF1 knockdown in a similar fashion to piRNA-targeted reporters. Additionally, transcription activation at specific TEs and TE-adjacent loci during PIWI knockdown is suppressed when PIWI and PAF1 levels are both reduced. Our study suggests a mechanistic conservation between fission yeast PAF1 repressing AGO1/small interfering RNA (siRNA)-directed silencing [13, 14] and Drosophila PAF1 opposing PIWI/piRNA-directed silencing. Copyright © 2017 Elsevier Ltd. All rights reserved.

Judicial review of administrative silence

Directory of Open Access Journals (Sweden)

Radošević Ratko S.

2015-01-01

Full Text Available Administrative silence is a situation in which the competent authority, within the statutory deadline, has not issued an administrative act at the request of the party. In the case of administrative silence, given the fact that the citizens are unable to protect their rights and legal interests without an administrative act, they are provided with legal protection. In this case, the same legal relationship is created, directly on the basis of the statute, as in the situation in which the party's request is rejected. This means that the party may, under the conditions prescribed by the statute, initiate the procedure of judicial review of administrative silence. In the paper, the author explains the conditions under which the judicial review of administrative silence can be initiated and the role of the court in this judicial procedure.

Durability of timber silencers at Wairakei geothermal steam field

Energy Technology Data Exchange (ETDEWEB)

Hedley, M E

1979-02-01

After early failures of reinforced concrete silencers and because of high costs of concrete-lined steel structures, preliminary tests were undertaken to assess the suitability of timber for silencer construction. Tests indicated that radiata pine treated with pentachlorophenol/oil or untreated red beech had most potential for timber silencer fabrication. One prototype silencer of each material was constructed and both were installed on operational bores in 1965. The red beech silencer had a service life of 4 years. The radiata pine silencer operated for 12/sup 1///sub 2/ years, although replacement had been recommended 1 year before this time expired. The performance of this silencer encouraged the general use of timber for silencer construction and further units were built. Procurement of satisfactory grades of timber has proved difficult and has limited silencer fabrication. Ways of improving timber supply, which require modification of silencer design, are discussed.

Locus-specific ribosomal RNA gene silencing in nucleolar dominance.

Directory of Open Access Journals (Sweden)

Michelle S Lewis

2007-08-01

Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.

Timelike Killing spinors in seven dimensions

International Nuclear Information System (INIS)

Cariglia, Marco; Conamhna, Oisin A.P. Mac

2004-01-01

We employ the G-structure formalism to study supersymmetric solutions of minimal and SU(2) gauged supergravities in seven dimensions admitting Killing spinors with an associated timelike Killing vector. The most general such Killing spinor defines a SU(3) structure. We deduce necessary and sufficient conditions for the existence of a timelike Killing spinor on the bosonic fields of the theories, and find that such configurations generically preserve one out of 16 supersymmetries. Using our general supersymmetric ansatz we obtain numerous new solutions, including squashed or deformed anti-de Sitter solutions of the gauged theory, and a large class of Goedel-like solutions with closed timelike curves

Traffics and wildlife: A preliminary study on road-kill

OpenAIRE

Rustiati, Elly Lestari

2012-01-01

This paper presents the preliminary finding on road kill survey by direct observations onthe high ways. The road-kills recorded of small wildlife, including medium size-mammal (2.50%, n =1), birds (5.00%, n = 2) and small mammals (92.50%, n = 37). The small mammals include the mostcommon mammals in the areas, squirrels, raccoons, skunks and woodchuck. Of mammals, squirrels(35.00%) were the highest recorded, followed by woodchucks (25.00%), mice/shrew (17.50%),raccoons (10.00%), skunk (5.00%) ...

Speaking of Silence: Comments from an Irish Studies Perspective

DEFF Research Database (Denmark)

McQuaid, Sara Dybris; Beville, Maria

2012-01-01

argue that silence in its own right is a unique and important route to understanding the complexities of modern Ireland in cultural, contemporary and historical terms. This is true, not least in the case of Northern Ireland where the difficult struggle to construct a unified political consciousness...

Killing Range

Science.gov (United States)

Asal, Victor; Rethemeyer, R. Karl; Horgan, John

2015-01-01

This paper presents an analysis of the Provisional Irish Republican Army's (PIRA) brigade level behavior during the Northern Ireland Conflict (1970-1998) and identifies the organizational factors that impact a brigade's lethality as measured via terrorist attacks. Key independent variables include levels of technical expertise, cadre age, counter-terrorism policies experienced, brigade size, and IED components and delivery methods. We find that technical expertise within a brigade allows for careful IED usage, which significantly minimizes civilian casualties (a specific strategic goal of PIRA) while increasing the ability to kill more high value targets with IEDs. Lethal counter-terrorism events also significantly affect a brigade's likelihood of killing both civilians and high-value targets but in different ways. Killing PIRA members significantly decreases IED fatalities but also significantly decreases the possibility of zero civilian IED-related deaths in a given year. Killing innocent Catholics in a Brigade's county significantly increases total and civilian IED fatalities. Together the results suggest the necessity to analyze dynamic situational variables that impact terrorist group behavior at the sub-unit level. PMID:25838603

Gendered Communication in Iranian University Classrooms: The Relationship between Politeness and Silence in Persian Culture

Directory of Open Access Journals (Sweden)

Saeedeh Shafiee Nahrkhalaji

2013-05-01

Full Text Available This study examined naturally-occurring university classroominteractions at Iranian universities and provided an analysis ofsilence patterns as politeness strategies used by male andfemale students. Since empirical studies of silence inclassroom settings are scarce, this paper aimed to explainsuch phenomena using participant interviews, classroomobservation and detailed discourse analysis of classroominteraction. Silence patterns and their interpretations werescrutinized in these observations and were discussed inrelation to specific conceptualization of politeness anddevices employed to exercise it. The study found that femalesseem to be the most silent in the cross-sex classrooms, whilethe distribution of silence is more nearly equal in the same sexclassrooms. Based on the comments from follow-upinterviews, reasons for intentional silence as a politenessstrategy were categorized into four groups: silence as a face savingstrategy, silence as a ‘don’t do the FTA’ strategy,silence as a power strategy, and silence as an off-recordstrategy.

L’architecture du silence de la Shoah dans les fictions de Sylvie Germain

Directory of Open Access Journals (Sweden)

José Luis Arráez Llobregat

2015-11-01

Full Text Available Silences concerning the Shoah constitute a leitmotiv in Sylvie Germain’s narrative work. Motive and motivation intentionally emerge as a proteiform phenomenon from the writer-philosopher’s genius and from the historical and ideological substance, which imbue the novelist in every sec-tion of her literary creation. The pur-pose of this study is to interpret those silences in a set of selected novels where the Shoah takes up either a primary or a secondary role, but in any case a relevant one. To this end this study carries out a detailed study of the silence coming from the narrator’s origin, the victims, the murderers or God. Beyond the silence in humans and supreme beings, this study also investigates the spatial silence in that apocalyptic world.

Killing-Yano tensors, rank-2 Killing tensors, and conserved quantities in higher dimensions

Energy Technology Data Exchange (ETDEWEB)

Krtous, Pavel [Institute of Theoretical Physics, Charles University, V Holesovickach 2, Prague (Czech Republic); Kubiznak, David [Institute of Theoretical Physics, Charles University, V Holesovickach 2, Prague (Czech Republic); Page, Don N. [Theoretical Physics Institute, University of Alberta, Edmonton T6G 2G7, Alberta (Canada); Frolov, Valeri P. [Theoretical Physics Institute, University of Alberta, Edmonton T6G 2G7, Alberta (Canada)

2007-02-15

From the metric and one Killing-Yano tensor of rank D-2 in any D-dimensional spacetime with such a principal Killing-Yano tensor, we show how to generate k = [(D+1)/2] Killing-Yano tensors, of rank D-2j for all 0 {<=} j {<=} k-1, and k rank-2 Killing tensors, giving k constants of geodesic motion that are in involution. For the example of the Kerr-NUT-AdS spacetime (hep-th/0604125) with its principal Killing-Yano tensor (gr-qc/0610144), these constants and the constants from the k Killing vectors give D independent constants in involution, making the geodesic motion completely integrable (hep-th/0611083). The constants of motion are also related to the constants recently obtained in the separation of the Hamilton-Jacobi and Klein-Gordon equations (hep-th/0611245)

Killing-Yano tensors, rank-2 Killing tensors, and conserved quantities in higher dimensions

International Nuclear Information System (INIS)

Krtous, Pavel; Kubiznak, David; Page, Don N.; Frolov, Valeri P.

2007-01-01

From the metric and one Killing-Yano tensor of rank D-2 in any D-dimensional spacetime with such a principal Killing-Yano tensor, we show how to generate k = [(D+1)/2] Killing-Yano tensors, of rank D-2j for all 0 ≤ j ≤ k-1, and k rank-2 Killing tensors, giving k constants of geodesic motion that are in involution. For the example of the Kerr-NUT-AdS spacetime (hep-th/0604125) with its principal Killing-Yano tensor (gr-qc/0610144), these constants and the constants from the k Killing vectors give D independent constants in involution, making the geodesic motion completely integrable (hep-th/0611083). The constants of motion are also related to the constants recently obtained in the separation of the Hamilton-Jacobi and Klein-Gordon equations (hep-th/0611245)

RELATIONSHIP BETWEEN AFFECTIVE COMMITMENT ANDORGANIZATIONAL SILENCE: A CONCEPTUAL DISCUSSION

Directory of Open Access Journals (Sweden)

Fitnat Nazlı Sayğan

2011-07-01

Full Text Available In this study, the affective commitment that is oneof the components oforganizational commitment put forth by Allen and Meyer (Allen, Meyer 1996will be differentiated from the other commitment components. The importance ofcreating an emotional commitment to organizations will be examined and theorganizational factors needed to form organizational commitment will beinvestigated. Also, organizational silence is a situation that the company avoided.In the study, the reasons and the drawbacks of silence are focused on and thefactors that cause employees to remain silent are discussed.The aim of this study is intended to manifest the relationship of ‘organizationalsilence' with affective commitment’ which is one ofthe components of‘organizational commitment’ on the basis of literature. In this study, a negativecorrelation between affective commitment and organizational silence is suggested

Breaching cultural silence: enhancing resilience among Ugandan ...

African Journals Online (AJOL)

Cultural silence is frequently the outcome of deep-seated taboos regarding adults talking to children about sex and death. This paper examines the impact of cultural silence on the resilience of children orphaned by AIDS in Uganda. Cultural silence is often linked with denial. This article explores the complexities of cultural ...

Cryptococcus neoformans modulates extracellular killing by neutrophils

Directory of Open Access Journals (Sweden)

Asfia eQureshi

2011-09-01

Full Text Available We recently established a key role for host sphingomyelin synthase (SMS in the regulation of the killing activity of neutrophils against Cryptococcus neoformans. In this work, we studied the effect of C. neoformans on the killing activity of neutrophils and whether SMS would still be a player against C. neoformans in immunocompromised mice lacking T and NK cells (Tgε26 mice. To this end, we analyzed whether C. neoformans would have any effect on neutrophil survival and killing in vitro and in vivo. We show that unlike C. albicans, neither the presence nor the capsule size of C. neoformans cells have any effect on neutrophil viability. Interestingly, melanized C. neoformans cells totally abrogated the killing activity of neutrophils. Next, we monitored how exposure of neutrophils to C. neoformans cells would interfere with any further killing activity of the medium and found that pre-incubation with live but not heat-killed fungal cells significantly inhibits further killing activity of the medium. We next studied whether activation of SMS at the site of C. neoformans infection is dependent on T and NK cells. Using matrix-assisted laser desorption-ionization (MALDI tissue imaging in infected lung we found that similarly to previous observations in the isogenic wild type CBA/J mice, SM 16:0 levels are significantly elevated at the site of infection in mice lacking T and NK cells but only at early time points. This study highlights that C. neoformans may negatively regulate the killing activity of neutrophils and that SMS activation in neutrophils appears to be partially independent of T and/or NK cells.

Organizational Silence in Sports Employees

Science.gov (United States)

Bastug, Gulsum; Pala, Adem; Yilmaz, Taner; Duyan, Mehdi; Gunel, Ilker

2016-01-01

Organizational silence can be defined as a way of behaviour belonging to men and women employees in the organization exhibited without reflecting their feelings, ideas, concerns and suggestions related with their workplaces, works for which they are responsible or other activities of the organization. In the period of organizational silence,…

Calcium signalling silencing in atrial fibrillation.

Science.gov (United States)

Greiser, Maura

2017-06-15

Subcellular calcium signalling silencing is a novel and distinct cellular and molecular adaptive response to rapid cardiac activation. Calcium signalling silencing develops during short-term sustained rapid atrial activation as seen clinically during paroxysmal atrial fibrillation (AF). It is the first 'anti-arrhythmic' adaptive response in the setting of AF and appears to counteract the maladaptive changes that lead to intracellular Ca 2+ signalling instability and Ca 2+ -based arrhythmogenicity. Calcium signalling silencing results in a failed propagation of the [Ca 2+ ] i signal to the myocyte centre both in patients with AF and in a rabbit model. This adaptive mechanism leads to a substantial reduction in the expression levels of calcium release channels (ryanodine receptors, RyR2) in the sarcoplasmic reticulum, and the frequency of Ca 2+ sparks and arrhythmogenic Ca 2+ waves remains low. Less Ca 2+ release per [Ca 2+ ] i transient, increased fast Ca 2+ buffering strength, shortened action potentials and reduced L-type Ca 2+ current contribute to a substantial reduction of intracellular [Na + ]. These features of Ca 2+ signalling silencing are distinct and in contrast to the changes attributed to Ca 2+ -based arrhythmogenicity. Some features of Ca 2+ signalling silencing prevail in human AF suggesting that the Ca 2+ signalling 'phenotype' in AF is a sum of Ca 2+ stabilizing (Ca 2+ signalling silencing) and Ca 2+ destabilizing (arrhythmogenic unstable Ca 2+ signalling) factors. Calcium signalling silencing is a part of the mechanisms that contribute to the natural progression of AF and may limit the role of Ca 2+ -based arrhythmogenicity after the onset of AF. © 2017 The Authors. The Journal of Physiology © 2017 The Physiological Society.

Silence, an Eye of Knowledge

Science.gov (United States)

Aghamohammadi, Mehdi

2017-01-01

One of the conspicuous features of the twentieth-century West was silence. This idea could be supported by examining reflections of Ludwig Wittgenstein, Fritz Mauthner, John Cage, Samuel Beckett, Ihab Hassan, Franz Kafka, Wassily Kandinsky, Jean-Paul Sartre, Virginia Woolf, Wolfgang Iser, Jacques Derrida, and Pierre Macherey. To me, silence is not…

The Enamovirus P0 protein is a silencing suppressor which inhibits local and systemic RNA silencing through AGO1 degradation

International Nuclear Information System (INIS)

Fusaro, Adriana F.; Correa, Regis L.; Nakasugi, Kenlee; Jackson, Craig; Kawchuk, Lawrence; Vaslin, Maite F.S.; Waterhouse, Peter M.

2012-01-01

The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0 PE , in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0 PE has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0 PE destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.

The Enamovirus P0 protein is a silencing suppressor which inhibits local and systemic RNA silencing through AGO1 degradation

Energy Technology Data Exchange (ETDEWEB)

Fusaro, Adriana F. [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Correa, Regis L. [CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Nakasugi, Kenlee; Jackson, Craig [University of Sydney, NSW 2006 (Australia); Kawchuk, Lawrence [Research Centre, Agriculture and Agri-Food Canada, Lethbridge, AB T1J4B1 (Canada); Vaslin, Maite F.S. [Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Waterhouse, Peter M., E-mail: peter.waterhouse@sydney.edu.au [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia)

2012-05-10

The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0{sup PE}, in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0{sup PE} has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0{sup PE} destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.

Small RNA-Mediated Epigenetic Myostatin Silencing

Directory of Open Access Journals (Sweden)

Thomas C Roberts

2012-01-01

Full Text Available Myostatin (Mstn is a secreted growth factor that negatively regulates muscle mass and is therefore a potential pharmacological target for the treatment of muscle wasting disorders such as Duchenne muscular dystrophy. Here we describe a novel Mstn blockade approach in which small interfering RNAs (siRNAs complementary to a promoter-associated transcript induce transcriptional gene silencing (TGS in two differentiated mouse muscle cell lines. Silencing is sensitive to treatment with the histone deacetylase inhibitor trichostatin A, and the silent state chromatin mark H3K9me2 is enriched at the Mstn promoter following siRNA transfection, suggesting epigenetic remodeling underlies the silencing effect. These observations suggest that long-term epigenetic silencing may be feasible for Mstn and that TGS is a promising novel therapeutic strategy for the treatment of muscle wasting disorders.

The Nuclear Cap-Binding Complex Mediates Meiotic Silencing by Unpaired DNA

Directory of Open Access Journals (Sweden)

Logan M. Decker

2017-04-01

Full Text Available In the filamentous fungus Neurospora crassa, cross walls between individual cells are normally incomplete, making the entire fungal network vulnerable to attack by viruses and selfish DNAs. Accordingly, several genome surveillance mechanisms are maintained to help the fungus combat these repetitive elements. One of these defense mechanisms is called meiotic silencing by unpaired DNA (MSUD, which identifies and silences unpaired genes during meiosis. Utilizing common RNA interference (RNAi proteins, such as Dicer and Argonaute, MSUD targets mRNAs homologous to the unpaired sequence to achieve silencing. In this study, we have identified an additional silencing component, namely the cap-binding complex (CBC. Made up of cap-binding proteins CBP20 and CBP80, CBC associates with the 5′ cap of mRNA transcripts in eukaryotes. The loss of CBC leads to a deficiency in MSUD activity, suggesting its role in mediating silencing. As confirmed in this study, CBC is predominantly nuclear, although it is known to travel in and out of the nucleus to facilitate RNA transport. As seen in animals but not in plants, CBP20’s robust nuclear import depends on CBP80 in Neurospora. CBC interacts with a component (Argonaute of the perinuclear meiotic silencing complex (MSC, directly linking the two cellular factors.

Chronic diseases kill on silence

Directory of Open Access Journals (Sweden)

Querubina Bringel Olinda

2009-09-01

Full Text Available Há uma diferença acentuada na determinação das prioridades, não no planejamento, mas na execução dos serviços, na materialização do fato e na importância da informação perante os meios de comunicação entre as duas categorias fundamentais de doenças – infecciosas e não infecciosas(1 .Em repasse às estatísticas de mortalidade proporcional, do Ministério da Saúde, em série histórica, constatam-se profundas mudanças no quadro, que há muito tempo constitui matéria discutida na literatura especializada. As causas determinantes da referida alteração foram citadas e reproduzidas em um número finito de artigos especializados, portanto, por demais conhecidas de todos.Em 2006, o grande grupo das doenças infecciosas e parasitárias representou 4,92% de todos os óbitos. Entretanto, somente o das doenças do aparelho circulatório contribuiu com 32,01% das mortes ocorridas naquele ano. É a estatística mais representativa da mortalidade dentre as principais causas de morte.(2As doenças do aparelho circulatório, isoladas, costumam atingir um quinto de todos os óbitos. No entanto, elas matam no silêncio. Os óbitos são notificados e registrados sem alarde.Ao olhar com mais detalhe o sistema de mortalidade do Ministério da Saúde, ele exibe registro na distribuição etária, e neste seu agrupamento há óbitos prematuros que se fazem presentes nas estatísticas de mortalidade por doenças do aparelho circulatório. Há de se ter uma análise estatística esclarecedora nesse grande grupo de doença da necessidade de investimento como medida necessária para prorrogar a idade do desfecho gerador da morte. O adoecer e o morrer prematuro devem ter uma abordagem inquirida e uma resposta à altura. No final da vida a morte é uma certeza para todos, tem-se que morrer de algo, é a lei biológica – nascer, viver e morrer.Para todas as doenças crônicas não transmissíveis, constata-se que elas ocupam os três principais grupos de causa de morte. Quando se soma a contribuição da carga que tem cada um dos seus componentes no total de óbitos, as estatísticas são por demais expressivas – elas canalizam para ser uma das grandes prioridades nos serviços de saúde e nos afins ao combate da causa ou na mundança do estilo de vida para hábitos saudáveis.As neoplasias malignas representaram, no mesmo ano, 16,47%, as causas externas 14,36%, que somados aos 32,01% acima mencionados, redundaram em 62,05% dos óbitos notificados no País, em 2006 (2.Com certeza, essas estatísticas ainda contêm omissão no tocante à causa básica, porém serão a favor das crônicas. O contingente populacional de idosos tem os maiores percentuais de morte sem diagnósticos, por causas sem assistência médica e por causas mal definidas. Provavelmente, grande parte desses óbitos deve aumentar as estatísticas das doenças crônicas, alguns para as doenças do aparelho respiratório e outros, em menor escala, para o restante das causas(2.No caso das doenças crônicas tem-se que dar mais ênfase na informação a mudanças positivas no estilo de vida, na complexidade hospitalar e nas condições imprescíndiveis ao diagnóstico precoce. Tem-se que assumir que, apesar de apresentar soluções em um grande percentual de casos, o programa de saúde da família ainda não resolve problemas complexos.A capacidade de diagnóstico precoce e a resolutividade da rede são importantes para todos nós, seres humanos. Nemtodos os problemas de saúde podem, devem e conseguem ser resolvidos em unidades de menor complexidade.O atendimento terciário é um suporte imprescindível à manutenção da vida e ao respeito à dignidade do ser humano. O hospital deve também ser revitalizado. O ser “paciente” com este nome tão apropriado, é angustiante. Quanto aos principais tipos de câncer, também ainda há muito o que informar, e requer um trabalho mais sistemático de incentivo à procura de sua prevenção e uma maior cobertura de atendimentos.Nas causas externas, os meios de comunicação fazem uma verdadeira apologia à violência. Vive-se a síndrome do medo. O homicídio difere em suas causas determinantes e no seu combate aos acidentes do trânsito. Nesse bloco, entra a ação do estado em todas as esferas de governo, da engenharia de trânsito e principalmente da família – há de se voltar para os valores da pessoa humana. Não se constrói a paz semeando o medo e a violência.O Brasil espalhou medo sobre a influenza ou gripe causada pelo A(H1N1, em que a sobrevivência do vírus no ambiente é em torno de uma hora(2,3. Talvez, perpassando a linha do tempo das grandes epidemias da história no mundo, mormente as provocadas pela influenza, gripe espanhola, gripe russa e outras mais, não aqui citadas, que dizimaram milhões de pessoas(4, fizeram o sistema de comunicação sacudir as escolas com o alarme sobre a transmissibilidade da influenza e, por colocá-la isolada no foco da transmissão, esquecendo a família, o lazer, o trabalho, as viagens e, enfim, a normalidade da vida. Os serviços de saúde voltaram-se inteiramente para esse fim.As doenças transmissíveis são sempre amedrontadoras pelo seu poder de propagação e, em potencial, de causarem epidemias, em qualquer momento, desde que não lhes faltem condições para fazê-la.Os óbitos em epidemias são contados em público até a saturação da notícia, ao contrário das doenças crônicas não transmissíveis. As suas estatísticas são apenas registradas e manuseadas por técnicos, excluídas do clamor social. Há necessidade de um novo olhar, em se tratando de doenças crônicas. Os definidores de politicas públicas devem ter em mente dois fatos norteadores para o planejamento de ações de intervenção nas referidas doenças. O primeiro de que os futuros idosos brasileiros, dentro de, sessenta anos de idade, referencial da velhice no País, já foram nascidos; e o outro, de que a expectativa de vida brasileira aumentou, o que tornará as doenças crônicas ainda em mais evidência no setor saúde.REFERÊNCIAS1. Rouquayrol MZ, Almeida-Filho N. Epidemiologia eSaúde, 2ª - ed. Rio de Janeiro: (BR Medsi; 2008.570 p.2. Brasil, Ministério da Saúde. Influenza humana:perguntas e respostas. (acesso em 2009 Ago 29.Disponível em: http://portal.saude.gov.br/portal/saude/profissional/area.cfm?id_area=15343. Ministério da Saúde (BR. Influenza humana: perguntase respostas. (acesso em 2009 ago 29. Disponívelem: http://portal.saude.gov.br/portal/saude/profissional/visualizar_texto.cfm?idtxt=31244 acesso em 2009.4. Bueno WC. A “gripe suína” e a pandemia da informação.Portal imprensa. (acesso em 2009 Jun. 20. Disponívelem: http://portalimprensa.uol.com.br/colunistas/colunas/2009/05/05/imprensa406.shtml .

Chinanteco children’s silences in different classroom situations

Directory of Open Access Journals (Sweden)

Valeria Rebolledo Angulo

2016-01-01

Full Text Available This article analyzes, from an ethnographic perspective and a sociocultural framework, the construction of silences in the interaction between students and teachers in a multilingual classroom situation in an indigenous community in méxico. the analysis reveals how the silence of the chinanteco speaking children when asked to answer certain questions in class is not always due to their failure to understand spoken and written spanish that is used in class. their silences are responses taking different meanings in specific situations. the silence of the children can be a way of resisting, a way of hiding, and, sometimes, their voices are silenced.

Arabidopsis HDA6 regulates locus-directed heterochromatin silencing in cooperation with MET1.

OpenAIRE

Taiko Kim To; Jong-Myong Kim; Akihiro Matsui; Yukio Kurihara; Taeko Morosawa; Junko Ishida; Maho Tanaka; Takaho Endo; Tetsuji Kakutani; Tetsuro Toyoda; Hiroshi Kimura; Shigeyuki Yokoyama; Kazuo Shinozaki; Motoaki Seki

2011-01-01

Heterochromatin silencing is pivotal for genome stability in eukaryotes. In Arabidopsis, a plant-specific mechanism called RNA–directed DNA methylation (RdDM) is involved in heterochromatin silencing. Histone deacetylase HDA6 has been identified as a component of such machineries; however, its endogenous targets and the silencing mechanisms have not been analyzed globally. In this study, we investigated the silencing mechanism mediated by HDA6. Genome-wide transcript profiling revealed that t...

MLH1-Silenced and Non-Silenced Subgroups of Hypermutated Colorectal Carcinomas Have Distinct Mutational Landscapes

Science.gov (United States)

Donehower, Lawrence A.; Creighton, Chad J.; Schultz, Nikolaus; Shinbrot, Eve; Chang, Kyle; Gunaratne, Preethi H.; Muzny, Donna; Sander, Chris; Hamilton, Stanley R.; Gibbs, Richard A.; Wheeler, David

2014-01-01

Approximately 15% of colorectal carcinomas (CRC) exhibit a hypermutated genotype accompanied by high levels of microsatellite instability (MSI-H) and defects in DNA mismatch repair. These tumors, unlike the majority of colorectal carcinomas, are often diploid, exhibit frequent epigenetic silencing of the MLH1 DNA mismatch repair gene, and have a better clinical prognosis. As an adjunct study to The Cancer Genome Atlas consortium that recently analyzed 224 colorectal cancers by whole exome sequencing, we compared the 35 CRC (15.6%) with a hypermutated genotype to those with a non-hypermutated genotype. We found that 22 (63%) of hypermutated CRC exhibited transcriptional silencing of the MLH1 gene, a high frequency of BRAF V600E gene mutations and infrequent APC and KRAS mutations, a mutational pattern significantly different from their non-hypermutated counterparts. However, the remaining 13 (37%) hypermutated CRC lacked MLH1 silencing, contained tumors with the highest mutation rates (“ultramutated” CRC), and exhibited higher incidences of APC and KRAS mutations, but infrequent BRAF mutations. These patterns were confirmed in an independent validation set of 250 exome-sequenced CRC. Analysis of mRNA and microRNA expression signatures revealed that hypermutated CRC with MLH1 silencing had greatly reduced levels of WNT signaling and increased BRAF signaling relative non-hypermutated CRC. Our findings suggest that hypermutated CRC include one subgroup with fundamentally different pathways to malignancy than the majority of CRC. Examination of MLH1 expression status and frequencies of APC, KRAS, and BRAF mutation in CRC may provide a useful diagnostic tool that could supplement the standard microsatellite instability assays and influence therapeutic decisions. PMID:22899370

RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops.

Science.gov (United States)

Guo, Qigao; Liu, Qing; Smith, Neil A; Liang, Guolu; Wang, Ming-Bo

2016-12-01

Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing artificial RNA silencing technologies such as hairpin RNA, artificial microRNA, intrinsic direct repeat, 3' UTR inverted repeat, artificial trans-acting siRNA, and virus-induced gene silencing technologies. Some of these RNA silencing technologies, such as the hairpin RNA technology, have already been widely used for genetic improvement of crop plants in agriculture. For horticultural plants, RNA silencing technologies have been used to increase disease and pest resistance, alter plant architecture and flowering time, improve commercial traits of fruits and flowers, enhance nutritional values, remove toxic compounds and allergens, and develop high-value industrial products. In this article we aim to provide an overview of the RNA silencing pathways in plants, summarize the existing RNA silencing technologies, and review the current progress in applying these technologies for the improvement of agricultural crops particularly horticultural crops.

Analysing the Wrongness of Killing

DEFF Research Database (Denmark)

Di Nucci, Ezio

2014-01-01

This article provides an in-depth analysis of the wrongness of killing by comparing different versions of three influential views: the traditional view that killing is always wrong; the liberal view that killing is wrong if and only if the victim does not want to be killed; and Don Marquis‟ future...... of value account of the wrongness of killing. In particular, I illustrate the advantages that a basic version of the liberal view and a basic version of the future of value account have over competing alternatives. Still, ultimately none of the views analysed here are satisfactory; but the different...

Alfalfa dwarf cytorhabdovirus P protein is a local and systemic RNA silencing supressor which inhibits programmed RISC activity and prevents transitive amplification of RNA silencing.

Science.gov (United States)

Bejerman, Nicolás; Mann, Krin S; Dietzgen, Ralf G

2016-09-15

Plants employ RNA silencing as an innate defense mechanism against viruses. As a counter-defense, plant viruses have evolved to express RNA silencing suppressor proteins (RSS), which target one or more steps of the silencing pathway. In this study, we show that the phosphoprotein (P) encoded by the negative-sense RNA virus alfalfa dwarf virus (ADV), a species of the genus Cytorhabdovirus, family Rhabdoviridae, is a suppressor of RNA silencing. ADV P has a relatively weak local RSS activity, and does not prevent siRNA accumulation. On the other hand, ADV P strongly suppresses systemic RNA silencing, but does not interfere with the short-distance spread of silencing, which is consistent with its lack of inhibition of siRNA accumulation. The mechanism of suppression appears to involve ADV P binding to RNA-induced silencing complex proteins AGO1 and AGO4 as shown in protein-protein interaction assays when ectopically expressed. In planta, we demonstrate that ADV P likely functions by inhibiting miRNA-guided AGO1 cleavage and prevents transitive amplification by repressing the production of secondary siRNAs. As recently described for lettuce necrotic yellows cytorhabdovirus P, but in contrast to other viral RSS known to disrupt AGO activity, ADV P sequence does not contain any recognizable GW/WG or F-box motifs, which suggests that cytorhabdovirus P proteins may use alternative motifs to bind to AGO proteins. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.

Selective killing of cancer cells by leaf extract of Ashwagandha: components, activity and pathway analyses.

Science.gov (United States)

Widodo, Nashi; Takagi, Yasuomi; Shrestha, Bhupal G; Ishii, Tetsuro; Kaul, Sunil C; Wadhwa, Renu

2008-04-08

Ashwagandha, also called as "Queen of Ayurveda" and "Indian ginseng", is a commonly used plant in Indian traditional medicine, Ayurveda. Its roots have been used as herb remedy to treat a variety of ailments and to promote general wellness. However, scientific evidence to its effects is limited to only a small number of studies. We had previously identified anti-cancer activity in the leaf extract (i-Extract) of Ashwagandha and demonstrated withanone as a cancer inhibitory factor (i-Factor). In the present study, we fractionated the i-Extract to its components by silica gel column chromatography and subjected them to cell based activity analyses. We found that the cancer inhibitory leaf extract (i-Extract) has, at least, seven components that could cause cancer cell killing; i-Factor showed the highest selectivity for cancer cells and i-Factor rich Ashwagandha leaf powder was non-toxic and anti-tumorigenic in mice assays. We undertook a gene silencing and pathway analysis approach and found that i-Extract and its components kill cancer cells by at least five different pathways, viz. p53 signaling, GM-CFS signaling, death receptor signaling, apoptosis signaling and G2-M DNA damage regulation pathway. p53 signaling was most common. Visual analysis of p53 and mortalin staining pattern further revealed that i-Extract, fraction F1, fraction F4 and i-Factor caused an abrogation of mortalin-p53 interactions and reactivation of p53 function while the fractions F2, F3, F5 work through other mechanisms.

Phantom metrics with Killing spinors

Directory of Open Access Journals (Sweden)

W.A. Sabra

2015-11-01

Full Text Available We study metric solutions of Einstein–anti-Maxwell theory admitting Killing spinors. The analogue of the IWP metric which admits a space-like Killing vector is found and is expressed in terms of a complex function satisfying the wave equation in flat (2+1-dimensional space–time. As examples, electric and magnetic Kasner spaces are constructed by allowing the solution to depend only on the time coordinate. Euclidean solutions are also presented.

Cloning, killing, and identity.

Science.gov (United States)

McMahan, J

1999-01-01

One potentially valuable use of cloning is to provide a source of tissues or organs for transplantation. The most important objection to this use of cloning is that a human clone would be the sort of entity that it would be seriously wrong to kill. I argue that entities of the sort that you and I essentially are do not begin to exist until around the seventh month of fetal gestation. Therefore to kill a clone prior to that would not be to kill someone like you or me but would be only to prevent one of us from existing. And even after one of us begins to exist, the objections to killing it remain comparatively weak until its psychological capacities reach a certain level of maturation. These claims support the permissibility of killing a clone during the early stages of its development in order to use its organs for transplantation. PMID:10226909

Choosing Silence for Equality in and through Schooling

Science.gov (United States)

Lees, Helen E.

2016-01-01

This article considers silences and equality as combined from a theoretical perspective. Equality in and through chosen, deliberate and regular silence experience is seen as an equaliser: if no one is speaking no one can dominate. The article uses a bifurcated concept of silence: weak, negative forms and strong, positive forms. Only the strong…

Technical advances in trigger-induced RNA interference gene silencing in the parasite Entamoeba histolytica.

Science.gov (United States)

Khalil, Mohamed I; Foda, Bardees M; Suresh, Susmitha; Singh, Upinder

2016-03-01

Entamoeba histolytica has a robust endogenous RNA interference (RNAi) pathway. There are abundant 27 nucleotide (nt) anti-sense small RNAs (AS sRNAs) that target genes for silencing and the genome encodes many genes involved in the RNAi pathway such as Argonaute proteins. Importantly, an E. histolytica gene with numerous AS sRNAs can function as a "trigger" to induce silencing of a gene that is fused to the trigger. Thus, the amebic RNAi pathway regulates gene expression relevant to amebic biology and has additionally been harnessed as a tool for genetic manipulation. In this study we have further improved the trigger-induced gene silencing method. We demonstrate that rather than using the full-length gene, a short portion of the coding region fused to a trigger is sufficient to induce silencing; the first 537 bp of the E. histolytica rhomboid gene (EhROM1) fused in-frame to the trigger was sufficient to silence EhROM1. We also demonstrated that the trigger method could silence two amebic genes concomitantly; fusion of the coding regions of EhROM1 and transcription factor, EhMyb, in-frame to a trigger gene resulted in both genes being silenced. Alternatively, two genes can be silenced sequentially: EhROM1-silenced parasites with no drug selection plasmid were transfected with trigger-EhMyb, resulting in parasites with both EhROM1 and EhMyb silenced. With all approaches tested, the trigger-mediated silencing was substantive and silencing was maintained despite loss of the G418 selectable marker. All gene silencing was associated with generation of AS sRNAs to the silenced gene. We tested the reversibility of the trigger system using inhibitors of histone modifications but found that the silencing was highly stable. This work represents a technical advance in the trigger gene silencing method in E. histolytica. Approaches that readily silence multiple genes add significantly to the genetic toolkit available to the ameba research community. Copyright © 2016

"Guns do not kill, people do!"

DEFF Research Database (Denmark)

Lemche, Niels Peter

2011-01-01

The Bible does not kill, but many people who have read the Bible (in their way) have killed, virtually or in real.......The Bible does not kill, but many people who have read the Bible (in their way) have killed, virtually or in real....

Some basic properties of Killing spinors

International Nuclear Information System (INIS)

Hacyan, S.; Plebanski, J.

1976-01-01

The concept of Killing spinor is analyzed in a general way by using the spinorial formalism. It is shown, among other things, that higher derivatives of Killing spinors can be expressed in terms of lower order derivatives. Conformal Killing vectors are studied in some detail in the light of spinorial analysis: Classical results are formulated in terms of spinors. A theorem on Lie derivatives of Debever--Penrose vectors is proved, and it is shown that conformal motion in vacuum with zero cosmological constant must be homothetic, unless the conformal tensor vanishes or is of type N. Our results are valid for either real or complex space--time manifolds

Things talked about while we remain silence and things we’re silence about while talking: The starting assumptions for an anthropology of silence about the nearest past

Directory of Open Access Journals (Sweden)

Đerić Gordana

2007-01-01

Full Text Available Wars of the last decade of the 20th century in former Yugoslavia have brought the whole region into the center of media attention and, accordingly, have aroused interest of the western academic theory. Since the latest ′discovery of the Balkans′ was brought into being precisely due to wars, one shouldn’t be surprised to find that many academic approaches to questions of Yugoslavia dismemberment are biased, superficial or exotic. On the other hand, Serbian academic auditorium was far from being active in elaborating questions of its own contemporality and closest past - for various reasons, but mostly because of its detachment from systematic explorations. Thus, acknowledgement and presentations of mentioned issues were left to be the job of media publicists, others outside of academic community or were left to be treated in the time to come. Domestic scholars were rarely intrigued to deal with these matters, despite the fact that images of recent wars were often built on stereotypes and propaganda and that the formed knowledge of the entire subject suffered from severe simplification. The themes of great violence were particularly avoided which left some of the crucial war events out of the academic focus - the reason being, very probably, the estimation that what made Serbia and the region worldwide known is best to be forgotten. Contemporary academic silence on recent wars, in retrospection, could easily be placed within the continuum of silence during the socialist period and war which preceded it. Having all mentioned in mind, this paper not only investigates reasons for avoiding the issues of the nearest past and influences of silence in socialism on what came afterwards, but also highlights the importance of exploring semantics and functions of silence and silencing in recent wars, as well as the relationship between silence and social memory constructions.

Listen and the question of silence

DEFF Research Database (Denmark)

Doubinsky, Sebastien

2018-01-01

Listen is a film about words, but around words. The words become useless and are surrounded by silence. And the whole film is constructed on this silence, which builds up like an unbreakable wall. The question is thus: what are we listening to? What should we listen to? And maybe, even more crucial...

Precedents and consequences of prosocial behaviors of voice and silence

Directory of Open Access Journals (Sweden)

Alicia Omar

2015-09-01

Full Text Available Prosocial behavior is that which that encourages solidarity and harmony in interpersonal relationships, and produce personal or collective benefits. Although early research on job prosociality was focused on the study of conventional behaviors such as help, courtesy and sportsmanship, the identification and operationalization of new dimensions is rapidly expanding this nomological network. Such is the case of prosocial voice and prosocial silence, recently introduced in the scientific literature. The aim of this study is to explore possible relationships between employee’s voice and employee’s silence, and their personality structure; and examine the role of interpersonal justice perceptions on such relationships. We worked with a sample of 316 employees- aged 37 years and holding a 4.2-year signority working at public and private companies in southern and central Rosario (Argentina. The subjects completed Colquitt’ Justice Organizational Scale, Eysenck Personality Questionnaire, and Van Dyne’s Prosocial Voice and Prosocial Silence Scales. Extraversion and neuroticism emerged as the strongest predictors of prosocial voice and prosocial silence, respectively. Interpersonal justice perceptions emerged as moderators of the ‘natural’ tendency of extraverted workers to engage in prosocial voice, and emotionally controlled workers to engage in prosocial silence. Such findings would indicate that the promotion of high levels of interpersonal justice on job contexts could help workers to engage in more prosocial behavior with positive effects for the organization. 

Silence, Speech and Gender in Shakespeare’s Othello: A Presentist, Palestinian Perspective

Directory of Open Access Journals (Sweden)

Bilal M.T. Hamamra

2015-10-01

Full Text Available This paper follows the critical lines of feminism and psychoanalysis to argue that Othello is a conflict between female characters' moral voices and male figures' treacherous voices. Drawing on the concepts of Jungian and Freudian psychoanalysis, I argue that the association of female speech and silence with sexuality is a projection of misogynist and racist discourses. I read Iago's projection of his evil onto Othello as a verbal intercourse of homosexuality.  The cause of tragedy emanates from the fact that Othello weds his shadow, Iago and ignores his anima, Desdemona. While the verbal marriage between Othello and Iago results in Othello's accusation of Desdemona of being a whore, I argue that Desdemona escapes this category because a boy actor impersonates her physically and vocally. I argue that Othello stages for audiences in contemporary Palestine male figures’ deafness to feminist views. While Othello’s marriage to Desdemona symbolizes his integration into Venetian society, his murder of Desdemona signals the loss of his heroic identity and the dissolution of his link to Venice. In contrast, killing the supposedly aggressive female figures in Palestine marks the public respect of the killer. Furthermore, I use the romance of Antar (525-608 as a Palestinian literary intertext to scrutinize the significance of female figures in constructing male figures’ heroic identity and the racial discourse that the Romance of Antar and Othello embodies. Key words: Racism, Misogyny, Projection, Honour Killing, Gender Difference, Boy Actor

The ethics of silence: Does conflict of interest explain employee silence?

Science.gov (United States)

Anderson, James

2018-03-01

Employee silence constitutes a significant threat to organizational success. This article argues that silence is a by-product of a structural Conflict of Interest (COI) between employees and their employers. This argument turns on the claim, also defended here, that employees are in a privileged position vis-à-vis knowledge of their work and that leaders-whether they recognize it or not-are dependent on their employees for reliable information about the work they are doing. Employee voice, therefore, is an organizational necessity. It is also a moral achievement as it involves risking one's personal interests for the sake of the organization. Leaders must take steps to mitigate COI and encourage employee voice; this article provides several strategies for doing exactly that.

Silence as a Response to Everyday Violence

DEFF Research Database (Denmark)

Gammeltoft, Tine

2016-01-01

Across the world, existing research indicates that many women respond with silence to marital abuse. This article offers an ethnographic investigation of the social and psychic forces behind Vietnamese women’s silencing of violence and a theoretical exploration of how the psychoanalytic concept...... of fantasy—understood as unconscious or subconscious mental processes—may contribute to the analysis of everyday violence and psychic distress. Distinguishing between what I term deliberate and subconscious silence, I explore the role that fantasy plays when Vietnamese women silently endure intimate partner...

Impact of target mRNA structure on siRNA silencing efficiency: A large-scale study.

Science.gov (United States)

Gredell, Joseph A; Berger, Angela K; Walton, S Patrick

2008-07-01

The selection of active siRNAs is generally based on identifying siRNAs with certain sequence and structural properties. However, the efficiency of RNA interference has also been shown to depend on the structure of the target mRNA, primarily through studies using exogenous transcripts with well-defined secondary structures in the vicinity of the target sequence. While these studies provide a means for examining the impact of target sequence and structure independently, the predicted secondary structures for these transcripts are often not reflective of structures that form in full-length, native mRNAs where interactions can occur between relatively remote segments of the mRNAs. Here, using a combination of experimental results and analysis of a large dataset, we demonstrate that the accessibility of certain local target structures on the mRNA is an important determinant in the gene silencing ability of siRNAs. siRNAs targeting the enhanced green fluorescent protein were chosen using a minimal siRNA selection algorithm followed by classification based on the predicted minimum free energy structures of the target transcripts. Transfection into HeLa and HepG2 cells revealed that siRNAs targeting regions of the mRNA predicted to have unpaired 5'- and 3'-ends resulted in greater gene silencing than regions predicted to have other types of secondary structure. These results were confirmed by analysis of gene silencing data from previously published siRNAs, which showed that mRNA target regions unpaired at either the 5'-end or 3'-end were silenced, on average, approximately 10% more strongly than target regions unpaired in the center or primarily paired throughout. We found this effect to be independent of the structure of the siRNA guide strand. Taken together, these results suggest minimal requirements for nucleation of hybridization between the siRNA guide strand and mRNA and that both mRNA and guide strand structure should be considered when choosing candidate si

Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

Science.gov (United States)

Travella, Silvia; Keller, Beat

Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

Psychological traits underlying different killing methods among Malaysian male murderers.

Science.gov (United States)

Kamaluddin, Mohammad Rahim; Shariff, Nadiah Syariani; Nurfarliza, Siti; Othman, Azizah; Ismail, Khaidzir H; Mat Saat, Geshina Ayu

2014-04-01

Murder is the most notorious crime that violates religious, social and cultural norms. Examining the types and number of different killing methods that used are pivotal in a murder case. However, the psychological traits underlying specific and multiple killing methods are still understudied. The present study attempts to fill this gap in knowledge by identifying the underlying psychological traits of different killing methods among Malaysian murderers. The study adapted an observational cross-sectional methodology using a guided self-administered questionnaire for data collection. The sampling frame consisted of 71 Malaysian male murderers from 11 Malaysian prisons who were selected using purposive sampling method. The participants were also asked to provide the types and number of different killing methods used to kill their respective victims. An independent sample t-test was performed to establish the mean score difference of psychological traits between the murderers who used single and multiple types of killing methods. Kruskal-Wallis tests were carried out to ascertain the psychological trait differences between specific types of killing methods. The results suggest that specific psychological traits underlie the type and number of different killing methods used during murder. The majority (88.7%) of murderers used a single method of killing. Multiple methods of killing was evident in 'premeditated' murder compared to 'passion' murder, and revenge was a common motive. Examples of multiple methods are combinations of stabbing and strangulation or slashing and physical force. An exception was premeditated murder committed with shooting, when it was usually a single method, attributed to the high lethality of firearms. Shooting was also notable when the motive was financial gain or related to drug dealing. Murderers who used multiple killing methods were more aggressive and sadistic than those who used a single killing method. Those who used multiple methods or

A conversation analysis of the function of silence in writing conferences

Directory of Open Access Journals (Sweden)

Milad Mirzaee

2016-07-01

Full Text Available One of the recent issues in English as a Second/Foreign Language (ESL/EFL writing instruction has been the quest for a more effective way to give feedback to L2 learners’ writing drafts. Although teacher- learner writing conferences have been increasingly used for providing ample opportunity for negotiating revisions, relatively little attention has been given to actual teacher-learner conversation. Drawing on sociocultural theory, which holds that all cognitive developments are results of ‘social interactions’, and drawing on conversation analysis as an analytical tool, this study attempts to explore the different functions of ‘silence’ in writing conferences during teacher-learner conversation. The data comes from transcripts of six 1-hour writing conferences video-recorded in a graduate program with 7 candidates in Iran. During the writing conferences, learners’ drafts were discussed. Findings of the study demonstrated that teacher’s silence can play a key role in the management of turns in writing conferences, thereby providing the parties with various opportunities for accomplishing intersubjectivity: the teacher used silence to rethink the information provided during writing conferences, and the learner exploited silence to revise the writing draft. The current study, reporting a range of functions of silence in writing conferences, offers an extension to the existing literature and draws language teachers’, specifically writing instructors’, attention to different functions of silence in writing conferences.

Adaptation of the Four Forms of Employee Silence Scale in a Polish sample

Directory of Open Access Journals (Sweden)

Krystyna Adamska

2017-06-01

Full Text Available Background Silence is understood as a decision not to speak up in situations of observed irregularities both in productivity and ethics. The study examined the validity of the Four Forms of Employee Silence Scale (FFESS in the Polish population. The scale is a four-factor measure designed to capture differently motivated tendencies to be silent in organizations. The scale distinguishes acquiescent, quiescent, prosocial and opportunistic silence. Employee silence has been linked to many important individual outcomes: failure to react to ethical transgressions, stress and depression, and lower creativity and productivity. Participants and procedure A total of 1044 employees of various organizations working for at least six months at a given position provided the responses for the validation study. Results The results confirmed the superiority of the four-factor model shown by adequate fit indexes: The FFESS has adequate internal consistency at both the scale and item levels. The criterion-related validity of the scale was established by correlating four forms of silence with measures of emotional attitude toward organization, procedural justice, relational contract and turnover intention. Conclusions The four forms of employee silence are empirically distinct concepts in the Polish sample. The scale may be used as the measurement of individual differences. It can also serve as a tool for diagnosing a climate of silence in an organization.

Identification and characterization of two RNA silencing suppressors encoded by ophioviruses

NARCIS (Netherlands)

Robles Luna, Gabriel; Reyes, Carina A.; Peña, Eduardo J.; Ocolotobiche, Eliana; Baeza, Cecilia; Borniego, Maria Belén; Kormelink, Richard; García, María Laura

2017-01-01

Citrus psorosis virus and Mirafiori lettuce big-vein virus are two members of the genus Ophiovirus, family Ophioviridae. So far, how these viruses can interfere in the antiviral RNA silencing pathway is not known. In this study, using a local GFP silencing assay on Nicotiana benthamiana, the

Identifying Silence Climate in Organizations in the Framework of Contemporary Management Approaches

Directory of Open Access Journals (Sweden)

Mustafa Emre Civelek

2015-10-01

Full Text Available Dynamic competition conditions in present day, bring about the consequence for businesses to face varied problems with each passing day. At this point, current management approaches include studies that would shed light on the new problems of businesses. Organizational Silence, a concept that has recently been being voiced in business world, has come up in such context. Organizational silence could be expressed as the employee behavior of keeping silent about certain negativities due to various reasons in an organization. Since knowledge sharing in modern organizations is of capital importance in terms of responding hastily to the changes in a competitive environment, spread of this behavior of employees to organization culture and climate presents a threat of indifference. In this study, the concept of Organizational Silence is defined and the effects of conceived silence climate on management of organizations are discussed.

Identifying Silence Climate in Organizations in the Framework of Contemporary Management Approaches

Directory of Open Access Journals (Sweden)

Mustafa Emre Civelek

2015-12-01

Full Text Available Dynamic competition conditions in present day bring about the consequence for businesses to face varied problems with each passing day. At this point, current management approaches include studies that would shed light on the new problems of businesses. Organizational Silence, a concept that has recently been being voiced in business world, has come up in such context. Organizational silence could be expressed as the employee behavior of keeping silent about certain negativities due to various reasons in an organization. Since knowledge sharing in modern organizations is of capital importance in terms of responding hastily to the changes in a competitive environment, spread of this behavior of employees to organization culture and climate presents a threat of indifference. In this study, the concept of Organizational Silence is defined and the effects of conceived silence climate on management of organizations are discussed.

Killing-Yano tensors and Nambu mechanics

International Nuclear Information System (INIS)

Baleanu, D.

1998-01-01

Killing-Yano tensors were introduced in 1952 by Kentaro-Yano from mathematical point of view. The physical interpretation of Killing-Yano tensors of rank higher than two was unclear. We found that all Killing-Yano tensors η i 1 i 2 . .. i n with covariant derivative zero are Nambu tensors. We found that in the case of flat space case all Killing-Yano tensors are Nambu tensors. In the case of Taub-NUT and Kerr-Newmann metric Killing-Yano tensors of order two generate Nambu tensors of rank 3

Protocol: using virus-induced gene silencing to study the arbuscular mycorrhizal symbiosis in Pisum sativum

DEFF Research Database (Denmark)

Grønlund, Mette; Olsen, Anne; Johansen, Elisabeth

2010-01-01

, the available PEBV-VIGS protocols are inadequate for studying genes involved in the symbiosis with arbuscular mycorrhizal fungi (AMF). Here we describe a PEBV-VIGS protocol suitable for reverse genetics studies in pea of genes involved in the symbiosis with AMF and show its effectiveness in silencing genes...... involved in the early and late stages of AMF symbiosis....

Chemically enhanced sunlight for killing bacteria

International Nuclear Information System (INIS)

Block, S.S.; Goswami, D.Y.

1995-01-01

Solar ultraviolet (UV) photocatalyzed oxidation of chemicals with titanium dioxide (TiO 2 ) has received considerable attention. Much less recognized, however, is the ability of the same system to destroy bacteria. This study examined this phenomenon and the conditions that affect it. Bacteria in aqueous solution were given solar exposure with titanium dioxide and their survival with time was determined. Lamps with a predominantly solar ultraviolet spectrum were also used in the experiments. Without exposure to UV light, TiO 2 had no deleterious effect on the bacteria. However, several common bacteria on solar exposure in the presence of TiO 2 were killed in just a few minutes, whereas without TiO 2 it took over an hour to destroy them. A concentration of 0.01% TiO 2 was most effective in killing bacteria and 10-fold concentrations lower or higher were successively less effective. Inorganic and organic compounds in solution, even in small amounts, interfered with the efficiency of killing. Alkaline solution also reduced the bactericidal activity. Circulation and agitation provided by stirring to keep the TiO 2 particles suspended reduced the time necessary to kill the bacteria. Time-intensity curves for killing bacteria were the same general shape with or without TiO 2 , indicating that TiO 2 served merely as a catalyst to increase the rate of the reaction but that the mechanism of action was not changed. The shape of the curves show that the organisms are sensitized with a minimum intensity of radiation and that an increase doesn't greatly increase the rate of kill. Below this critical intensity, however, the time required for killing markedly increases as the intensity is decreased

After the Blackbird Whistles: Listening to Silence in Classrooms

Science.gov (United States)

Schultz, Katherine

2010-01-01

Background/Context: Students spend a large part of their time in schools in silence. However, teachers tend to spend most of their time attending to student talk. Anthropological and linguistic research has contributed to an understanding of silence in particular communities, offering explanations for students' silence in school. This research…

Memories Persist in Silence

Directory of Open Access Journals (Sweden)

Sandra Patricia Arenas Grisales

2012-08-01

Full Text Available This article exposes the hypothesis that memory artifacts, created to commemorate the victims of armed conflict in Colombia, are an expression of the underground memories and a way of political action in the midst of war. We analyze three cases of creations of memory artifacts in Medellín, Colombia, as forms of suffering, perceiving and resisting the power of armed groups in Medellín. The silence, inherent in these objects, should not be treated as an absence of language, but as another form of expression of memory. Silence is a tactic used to overcome losses and reset everyday life in contexts of protracted violence.

"The Killing Fields" of Innovation

DEFF Research Database (Denmark)

Ingerslev, Karen

2014-01-01

to clustering of ideas, a design strategy which seemed to kill unique ideas. The reframing of innovation as a radical endeavor killed learning from others for being not innovative. The findings of this paper supplement theories of deliberate killing of ideas by suggesting framing, design and facilitation......This paper points to seemingly contradicted processes of framing innovation, idea generation and killing ideas. It reports from a yearlong innovation project, where health care professionals explored problems and tested ideas for solutions, regarding a future downsizing of the case hospital....... Theories in various ways describe the opening and closing phases of innovation. Exploration and idea generation opens a field of interest, which is then closed by making choices of ideas to further explore in the next opening phase. These choices deliberately kill a lot of ideas. In the innovation project...

Tospovirus : induction and suppression of RNA silencing

NARCIS (Netherlands)

Hedil, Marcio

2016-01-01

While infecting their hosts, viruses must deal with host immunity. In plants the antiviral RNA silencing pathway is an important part of plant innate immunity. Tospoviruses are segmented negative-stranded RNA viruses of plants. To counteract the antiviral RNA silencing response in plants,

Insights on ornithine decarboxylase silencing as a potential strategy for targeting retinoblastoma.

Science.gov (United States)

Muthukumaran, Sivashanmugam; Bhuvanasundar, Renganathan; Umashankar, Vetrivel; Sulochana, K N

2018-02-01

Ornithine Decarboxylase (ODC) is a key enzyme involved in polyamine synthesis and is reported to be up regulated in several cancers. However, the effect of ODC gene silencing in retinoblastoma is to be understood for utilization in therapeutic applications. Hence, in this study, a novel siRNA (small interference RNA) targeting ODC was designed and validated in Human Y79 retinoblastoma cells for its effects on intracellular polyamine levels, Matrix Metalloproteinase 2 & 9 activity and Cell cycle. The designed siRNA showed efficient silencing of ODC mRNA expression and protein levels in Y79 cells. It also showed significant reduction of intracellular polyamine levels and altered levels of oncogenic LIN28b expression. By this study, a regulatory loop is proposed, wherein, ODC silencing in Y79 cells to result in decreased polyamine levels, thereby, leading to altered protein levels of Lin28b, MMP-2 and MMP-9, which falls in line with earlier studies in neuroblastoma. Thus, by this study, we propose ODC silencing as a prospective strategy for targeting retinoblastoma. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Driving in unheard silence: Disability and the politics of shutting up.

Science.gov (United States)

Lourens, Heidi

2018-03-01

The politics of silence is central to disability experience and the field of disability studies. In this analytical autoethnography, I write about my silences as a visually impaired woman. I explore and make sense of personal life stories through a theoretical perspective. The analysis of these personal experiences lead me to argue that disability-related silences are mostly created through the confluence of inaccessible physical and social environments and the psychological internalisation of these worlds. I also discuss the ways in which I am currently regaining my voice. Further research on resistance by disabled persons is recommended.

Pseudomonas piscicida kills vibrios by two distinct mechanisms

Science.gov (United States)

Pseudoalteromonas piscicida is a naturally-occurring marine bacterium which kills competing bacteria, including vibrios. In studies by Richards et al. (AEM00175-17), three strains of P. piscicida were isolated and characterized. Strains secreted proteolytic enzymes which likely killed competing or...

Killing a Peacock: A Case Study of the Targeted Killing of Admiral Isoroku Yamamoto

Science.gov (United States)

2015-03-24

assertions by-in-large fell on deaf ears in the United States, Yamamoto nevertheless took special interest in Mitchell’s claims, and returned to Japan in...deliberations on April 17.106 Upon receiving an update brief of the planning order, Viccellio immediately identified a problem . He knew that the P-38’s fuel...what, it all happened all too fast to know and he was content on calling it a “team kill.”152 Instead, he left resolution of the issue to Barber and

Control of thermoacoustic instability with a drum-like silencer

Science.gov (United States)

Zhang, Guangyu; Wang, Xiaoyu; Li, Lei; Jing, Xiaodong; Sun, Xiaofeng

2017-10-01

Theoretical investigation is carried out by a novel method of controlling thermoacoustic instability with a drum-like silencer. It is shown that by decreasing the frequency of thermoacoustic system, the instability can be suppressed with the help of drum-like silencer. The purely reactive silencer, which is composed of a flexible membrane and a backing cavity, is usually known as a noise control device that works effectively in low frequency bandwidth without any aerodynamic loss. In present research, the silencer is exploited in a Rijke tube, as a means of decreasing the natural frequency of the system, and consequently changing the resonance period of the system. The "transfer element method" (TEM) is used to consider the interactions between the acoustic waves and the flexible membranes of the silencer. The effects of all possible properties of the silencer on the growth rate and resonance frequency of the thermoacoustic system are explored. According to the calculation results, it is found that for some properties of the silencer, the resonance frequencies are greatly decreased and then the phase difference between the unsteady heat release and the pressure fluctuation is increased. Consequently, the instability is suppressed with some dissipation that can not be able to control its onset in the original system. Therefore, when the damping is low, but not zero, it is effective to control thermoacoustic instability with this technique.

Histone Methylation and Epigenetic Silencing in Breast Cancer

National Research Council Canada - National Science Library

Simon, Jeffrey A; Lange, Carol A

2008-01-01

.... EZH2 is a histone methyltransferase which modifies lysine-27 of histone H3 an epigenetic mark which is generally linked to gene silencing and is implicated in tumor suppressor silencing during breast cancer progression...

Supervised learning classification models for prediction of plant virus encoded RNA silencing suppressors.

Directory of Open Access Journals (Sweden)

Zeenia Jagga

Full Text Available Viral encoded RNA silencing suppressor proteins interfere with the host RNA silencing machinery, facilitating viral infection by evading host immunity. In plant hosts, the viral proteins have several basic science implications and biotechnology applications. However in silico identification of these proteins is limited by their high sequence diversity. In this study we developed supervised learning based classification models for plant viral RNA silencing suppressor proteins in plant viruses. We developed four classifiers based on supervised learning algorithms: J48, Random Forest, LibSVM and Naïve Bayes algorithms, with enriched model learning by correlation based feature selection. Structural and physicochemical features calculated for experimentally verified primary protein sequences were used to train the classifiers. The training features include amino acid composition; auto correlation coefficients; composition, transition, and distribution of various physicochemical properties; and pseudo amino acid composition. Performance analysis of predictive models based on 10 fold cross-validation and independent data testing revealed that the Random Forest based model was the best and achieved 86.11% overall accuracy and 86.22% balanced accuracy with a remarkably high area under the Receivers Operating Characteristic curve of 0.95 to predict viral RNA silencing suppressor proteins. The prediction models for plant viral RNA silencing suppressors can potentially aid identification of novel viral RNA silencing suppressors, which will provide valuable insights into the mechanism of RNA silencing and could be further explored as potential targets for designing novel antiviral therapeutics. Also, the key subset of identified optimal features may help in determining compositional patterns in the viral proteins which are important determinants for RNA silencing suppressor activities. The best prediction model developed in the study is available as a

Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing

NARCIS (Netherlands)

Hedil, M.; Sterken, M.G.; Ronde, de D.; Lohuis, D.; Kormelink, R.

2015-01-01

RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS.

No-Big-Silence teeb klubituuri / Urmas Hännile

Index Scriptorium Estoniae

Hännile, Urmas

2009-01-01

Rockansamblist No-Big-Silence ja dark-popansamblist Sinine, nende kontsertttuurist mööda Eestimaad, tutvustamisel bändide uued albumid (No-Big-Silence "Starstealer" ja Sinine "Butterflies"), Pärnus on kontsert 24. oktoobril klubis Sugar

Breaking the silence

DEFF Research Database (Denmark)

Konradsen, Hanne; Kirkevold, Marit; McCallin, Antoinette

2012-01-01

and individual interviews were analyzed using the grounded theory method. The findings revealed that the main concern of the patients was feeling isolated, which was resolved using a process of interactional integration. Interactional integration begins by breaking the silence to enable the progression from...

Toward a science of silence: The consequences of leaving a memory unsaid

DEFF Research Database (Denmark)

Stone, Charles; Coman, Alin; Brown, Adam

2012-01-01

of the silence—and listeners—those attending to the speaker. Although the topic of silence is widely discussed, it is rarely mentioned in the empirical literature on memory. Three factors are employed to classify silence into different types: whether a silence is accompanied by covert remembering, whether...... the silence is intentional or unintentional, and whether the silenced memory is related or unrelated to the memories emerging in a conversation. These factors appear to be critical when considering the mnemonic consequences. Moreover, the influence of silence on memory varies between speaker and listener...

The molecular basis for stability of heterochromatin-mediated silencing in mammals.

Science.gov (United States)

Hiragami-Hamada, Kyoko; Xie, Sheila Q; Saveliev, Alexander; Uribe-Lewis, Santiago; Pombo, Ana; Festenstein, Richard

2009-11-04

The archetypal epigenetic phenomenon of position effect variegation (PEV) in Drosophila occurs when a gene is brought abnormally close to heterochromatin, resulting in stochastic silencing of the affected gene in a proportion of cells that would normally express it. PEV has been instrumental in unraveling epigenetic mechanisms. Using an in vivo mammalian model for PEV we have extensively investigated the molecular basis for heterochromatin-mediated gene silencing. Here we distinguish 'epigenetic effects' from other cellular differences by studying ex vivo cells that are identical, apart from the expression of the variegating gene which is silenced in a proportion of the cells. By separating cells according to transgene expression we show here that silencing appears to be associated with histone H3 lysine 9 trimethylation (H3K9me3), DNA methylation and the localization of the silenced gene to a specific nuclear compartment enriched in these modifications. In contrast, histone H3 acetylation (H3Ac) and lysine 4 di or tri methylation (H3K4me2/3) are the predominant modifications associated with expression where we see the gene in a euchromatic compartment. Interestingly, DNA methylation and inaccessibility, rather than H3K9me3, correlated most strongly with resistance to de-repression by cellular activation. These results have important implications for understanding the contribution of specific factors involved in the establishment and maintenance of gene silencing and activation in vivo.

The molecular basis for stability of heterochromatin-mediated silencing in mammals

Directory of Open Access Journals (Sweden)

Hiragami-Hamada Kyoko

2009-11-01

Full Text Available Abstract The archetypal epigenetic phenomenon of position effect variegation (PEV in Drosophila occurs when a gene is brought abnormally close to heterochromatin, resulting in stochastic silencing of the affected gene in a proportion of cells that would normally express it. PEV has been instrumental in unraveling epigenetic mechanisms. Using an in vivo mammalian model for PEV we have extensively investigated the molecular basis for heterochromatin-mediated gene silencing. Here we distinguish 'epigenetic effects' from other cellular differences by studying ex vivo cells that are identical, apart from the expression of the variegating gene which is silenced in a proportion of the cells. By separating cells according to transgene expression we show here that silencing appears to be associated with histone H3 lysine 9 trimethylation (H3K9me3, DNA methylation and the localization of the silenced gene to a specific nuclear compartment enriched in these modifications. In contrast, histone H3 acetylation (H3Ac and lysine 4 di or tri methylation (H3K4me2/3 are the predominant modifications associated with expression where we see the gene in a euchromatic compartment. Interestingly, DNA methylation and inaccessibility, rather than H3K9me3, correlated most strongly with resistance to de-repression by cellular activation. These results have important implications for understanding the contribution of specific factors involved in the establishment and maintenance of gene silencing and activation in vivo.

Killing, letting die and euthanasia.

Science.gov (United States)

Husak, D N

1979-12-01

Medical ethicists debate whether or not the moral assessment of cases of euthanasia should depend on whether the patient is 'killed' or 'allowed to die'. The usual presupposition is that a clear distinction between killing and letting die can be drawn so that this substantive question is not begged. I contend that the categorisation of cases of instances of killing rather than as instances of letting die depends in part on a prior moral assessment of the case. Hence is it trivially rather than substantively true that the distinction has moral significance. But even if a morally neutral (ie non-question begging) distinction could be drawn, its application to the euthanasia controversy is problematic. I illustrate the difficulties of employing this distinction to reach moral conclusions by critically discussing Philippa Foot's recent treatment of euthanasia. I conclude that even if an act of euthanasia is an instance of killing, and there exists a prima facie moral duty not to kill, and no more stringent duty overrides this duty, one still cannot determine such an act to be morally impermissible.

Killing, letting die and euthanasia.

Science.gov (United States)

Husak, D N

1979-01-01

Medical ethicists debate whether or not the moral assessment of cases of euthanasia should depend on whether the patient is 'killed' or 'allowed to die'. The usual presupposition is that a clear distinction between killing and letting die can be drawn so that this substantive question is not begged. I contend that the categorisation of cases of instances of killing rather than as instances of letting die depends in part on a prior moral assessment of the case. Hence is it trivially rather than substantively true that the distinction has moral significance. But even if a morally neutral (ie non-question begging) distinction could be drawn, its application to the euthanasia controversy is problematic. I illustrate the difficulties of employing this distinction to reach moral conclusions by critically discussing Philippa Foot's recent treatment of euthanasia. I conclude that even if an act of euthanasia is an instance of killing, and there exists a prima facie moral duty not to kill, and no more stringent duty overrides this duty, one still cannot determine such an act to be morally impermissible. PMID:541821

Silencing of Taxol-Sensitizer Genes in Cancer Cells: Lack of Sensitization Effects

International Nuclear Information System (INIS)

Huang, Shang-Lang; Chao, Chuck C.-K.

2015-01-01

A previous genome-wide screening analysis identified a panel of genes that sensitize the human non-small-cell lung carcinoma cell line NCI-H1155 to taxol. However, whether the identified genes sensitize other cancer cells to taxol has not been examined. Here, we silenced the taxol-sensitizer genes identified (acrbp, atp6v0d2, fgd4, hs6st2, psma6, and tubgcp2) in nine other cancer cell types (including lung, cervical, ovarian, and hepatocellular carcinoma cell lines) that showed reduced cell viability in the presence of a sub-lethal concentration of taxol. Surprisingly, none of the genes studied increased sensitivity to taxol in the tested panel of cell lines. As observed in H1155 cells, SKOV3 cells displayed induction of five of the six genes studied in response to a cell killing dose of taxol. The other cell types were much less responsive to taxol. Notably, four of the five inducible taxol-sensitizer genes tested (acrbp, atp6v0d2, psma6, and tubgcp2) were upregulated in a taxol-resistant ovarian cancer cell line. These results indicate that the previously identified taxol-sensitizer loci are not conserved genetic targets involved in inhibiting cell proliferation in response to taxol. Our findings also suggest that regulation of taxol-sensitizer genes by taxol may be critical for acquired cell resistance to the drug

Silencing of Taxol-Sensitizer Genes in Cancer Cells: Lack of Sensitization Effects

Energy Technology Data Exchange (ETDEWEB)

Huang, Shang-Lang [Department of Biochemistry and Molecular Biology, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Chao, Chuck C.-K., E-mail: cckchao@mail.cgu.edu.tw [Department of Biochemistry and Molecular Biology, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Graduate Institute of Biomedical Sciences, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Department of Medical Research and Development, Chang Gung Memorial Hospital, Taoyuan 333, Taiwan (China)

2015-06-16

A previous genome-wide screening analysis identified a panel of genes that sensitize the human non-small-cell lung carcinoma cell line NCI-H1155 to taxol. However, whether the identified genes sensitize other cancer cells to taxol has not been examined. Here, we silenced the taxol-sensitizer genes identified (acrbp, atp6v0d2, fgd4, hs6st2, psma6, and tubgcp2) in nine other cancer cell types (including lung, cervical, ovarian, and hepatocellular carcinoma cell lines) that showed reduced cell viability in the presence of a sub-lethal concentration of taxol. Surprisingly, none of the genes studied increased sensitivity to taxol in the tested panel of cell lines. As observed in H1155 cells, SKOV3 cells displayed induction of five of the six genes studied in response to a cell killing dose of taxol. The other cell types were much less responsive to taxol. Notably, four of the five inducible taxol-sensitizer genes tested (acrbp, atp6v0d2, psma6, and tubgcp2) were upregulated in a taxol-resistant ovarian cancer cell line. These results indicate that the previously identified taxol-sensitizer loci are not conserved genetic targets involved in inhibiting cell proliferation in response to taxol. Our findings also suggest that regulation of taxol-sensitizer genes by taxol may be critical for acquired cell resistance to the drug.

Co-evolution of transcriptional silencing proteins and the DNA elements specifying their assembly.

Directory of Open Access Journals (Sweden)

Oliver A Zill

Full Text Available Co-evolution of transcriptional regulatory proteins and their sites of action has been often hypothesized but rarely demonstrated. Here we provide experimental evidence of such co-evolution in yeast silent chromatin, a finding that emerged from studies of hybrids formed between two closely related Saccharomyces species. A unidirectional silencing incompatibility between S. cerevisiae and S. bayanus led to a key discovery: asymmetrical complementation of divergent orthologs of the silent chromatin component Sir4. In S. cerevisiae/S. bayanus interspecies hybrids, ChIP-Seq analysis revealed a restriction against S. cerevisiae Sir4 associating with most S. bayanus silenced regions; in contrast, S. bayanus Sir4 associated with S. cerevisiae silenced loci to an even greater degree than did S. cerevisiae's own Sir4. Functional changes in silencer sequences paralleled changes in Sir4 sequence and a reduction in Sir1 family members in S. cerevisiae. Critically, species-specific silencing of the S. bayanus HMR locus could be reconstituted in S. cerevisiae by co-transfer of the S. bayanus Sir4 and Kos3 (the ancestral relative of Sir1 proteins. As Sir1/Kos3 and Sir4 bind conserved silencer-binding proteins, but not specific DNA sequences, these rapidly evolving proteins served to interpret differences in the two species' silencers presumably involving emergent features created by the regulatory proteins that bind sequences within silencers. The results presented here, and in particular the high resolution ChIP-Seq localization of the Sir4 protein, provided unanticipated insights into the mechanism of silent chromatin assembly in yeast.

75 FR 62469 - Drawbridge Operation Regulations; Newtown Creek, Dutch Kills, English Kills, and Their...

Science.gov (United States)

2010-10-12

... DEPARTMENT OF HOMELAND SECURITY Coast Guard 33 CFR Part 117 [Docket No. USCG-2010-0907] Drawbridge Operation Regulations; Newtown Creek, Dutch Kills, English Kills, and Their Tributaries, NY, Maintenance AGENCY: Coast Guard, DHS. ACTION: Notice of temporary deviation from regulations. SUMMARY: The Commander...

75 FR 30299 - Drawbridge Operation Regulations; Newtown Creek, Dutch Kills, English Kills, and Their...

Science.gov (United States)

2010-06-01

... DEPARTMENT OF HOMELAND SECURITY Coast Guard 33 CFR Part 117 [Docket No. USCG-2010-0355] Drawbridge Operation Regulations; Newtown Creek, Dutch Kills, English Kills, and Their Tributaries, NY, Maintenance AGENCY: Coast Guard, DHS. ACTION: Notice of temporary deviation from regulations. SUMMARY: The Commander...

On integrability of the Killing equation

Science.gov (United States)

Houri, Tsuyoshi; Tomoda, Kentaro; Yasui, Yukinori

2018-04-01

Killing tensor fields have been thought of as describing the hidden symmetry of space(-time) since they are in one-to-one correspondence with polynomial first integrals of geodesic equations. Since many problems in classical mechanics can be formulated as geodesic problems in curved space and spacetime, solving the defining equation for Killing tensor fields (the Killing equation) is a powerful way to integrate equations of motion. Thus it has been desirable to formulate the integrability conditions of the Killing equation, which serve to determine the number of linearly independent solutions and also to restrict the possible forms of solutions tightly. In this paper, we show the prolongation for the Killing equation in a manner that uses Young symmetrizers. Using the prolonged equations, we provide the integrability conditions explicitly.

Cancelation and its simulation using Matlab according to active noise control case study of automotive noise silencer

Science.gov (United States)

Alfisyahrin; Isranuri, I.

2018-02-01

Active Noise Control is a technique to overcome noisy with noise or sound countered with sound in scientific terminology i.e signal countered with signals. This technique can be used to dampen relevant noise in accordance with the wishes of the engineering task and reducing automotive muffler noise to a minimum. Objective of this study is to develop a Active Noise Control which should cancel the noise of automotive Exhaust (Silencer) through Signal Processing Simulation methods. Noise generator of Active Noise Control is to make the opponent signal amplitude and frequency of the automotive noise. The steps are: Firstly, the noise of automotive silencer was measured to characterize the automotive noise that its amplitude and frequency which intended to be expressed. The opposed sound which having similar character with the signal source should be generated by signal function. A comparison between the data which has been completed with simulation calculations Fourier transform field data is data that has been captured on the muffler (noise silencer) Toyota Kijang Capsule assembly 2009. MATLAB is used to simulate how the signal processing noise generated by exhaust (silencer) using FFT. This opponent is inverted phase signal from the signal source 180° conducted by Instruments of Signal Noise Generators. The process of noise cancelation examined through simulation using computer software simulation. The result is obtained that attenuation of sound (noise cancellation) has a difference of 33.7%. This value is obtained from the comparison of the value of the signal source and the signal value of the opponent. So it can be concluded that the noisy signal can be attenuated by 33.7%.

Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

National Research Council Canada - National Science Library

Issa, Jean-Pierre

2004-01-01

...). In this project, we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases, and that reversal of silencing by decitabine...

Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

National Research Council Canada - National Science Library

Issa, Jean-Pierre

2005-01-01

...). In this project, we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases, and that reversal of silencing by decitabine...

Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

National Research Council Canada - National Science Library

Issa, Jean-Pierre

2006-01-01

...). In this project we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases and that reversal of silencing by decitabine...

Prairie dogs increase fitness by killing interspecific competitors.

Science.gov (United States)

Hoogland, John L; Brown, Charles R

2016-03-30

Interspecific competition commonly selects for divergence in ecology, morphology or physiology, but direct observation of interspecific competition under natural conditions is difficult. Herbivorous white-tailed prairie dogs (Cynomys leucurus) employ an unusual strategy to reduce interspecific competition: they kill, but do not consume, herbivorous Wyoming ground squirrels (Urocitellus elegans) encountered in the prairie dog territories. Results from a 6-year study in Colorado, USA, revealed that interspecific killing of ground squirrels by prairie dogs was common, involving 47 different killers; 19 prairie dogs were serial killers in the same or consecutive years, and 30% of female prairie dogs killed at least one ground squirrel over their lifetimes. Females that killed ground squirrels had significantly higher annual and lifetime fitness than non-killers, probably because of decreased interspecific competition for vegetation. Our results document the first case of interspecific killing of competing individuals unrelated to predation (IK) among herbivorous mammals in the wild, and show that IK enhances fitness for animals living under natural conditions. © 2016 The Author(s).

Patterns and Composition of Road-Killed Wildlife in Northwest Argentina

Science.gov (United States)

Cuyckens, Griet An Erica; Mochi, Lucía Sol; Vallejos, María; Perovic, Pablo Gastón; Biganzoli, Fernando

2016-11-01

Roads have important effects on wildlife, such as natural habitat fragmentation and degradation and direct killing of fauna, which leads to reductions in wildlife population size. We focused on a principal road in Northwest Argentina to test for the effect of seasonality and landscape features on the composition of road-killed wildlife. We conducted regularly scheduled road trips during the dry and wet seasons. We recorded the presence or absence of a vegetation curtain or hedge along the road. We measured land use by remote sensing in a 500 m buffer along the road. We compared the abundance of animals killed between seasons (dry and wet) for different taxonomic groups (mammals, birds and reptiles) and for different origins (domestic and native). We built linear mixed models to test the effect of landscape features on the abundance of killed animals. Two hundred and ninety-three individuals were killed, belonging to 35 species; 75.8 % were native and 24.2 % domestic species. The majority of animals killed were mid-sized mammals. More animals were killed during the dry season. The most important factors to explain the wildlife road-killing were the season and the proportion of agricultural landscape. The composition of the killed animals changed with the season. The proportion of agricultural landscape incremented the number of killed birds and mammals during both seasons, without affecting reptiles. The ratio of wild to domestic animals killed was dependent on the season. This study sets a precedent as the first in road ecology in Northwest Argentina and should be taken into account for road planning and regulation.

The Application of Coconut Fiber as Dissipative Silencer

Science.gov (United States)

Madlan, M. A.; Ghazali, M. I.; Zaman, I.; Kasron, M. Z.; Ying, T. C.

2017-01-01

Heat ventilation air conditioning system (HVAC) is one of the ducting systems that broadly applied in the building. There are HVAC silencers in the market, however the sound absorptive material commonly used is mineral wool. In this research study, a sound absorptive material made of coconut fiber was tested to identify its performance as a potential replacement of green material for ducting silencer. The experiment was carried out in a testing apparatus that follows the BS EN ISO 11691:2009 standard. Different configurations of sound absorptive material and contents of coconut fiber were investigated in the study. The trend of insertion loss at 1/3 octave frequency was identified where at frequency below 3000Hz, the insertion loss of dissipative silencer is observed high at certain frequency with a very narrow range. At 3000Hz, the insertion loss of 4dB to 6dB is constant until 4000Hz and drops until 5000Hz before it increases again steadily up to 13dB at 10000Hz. A similar trend was observed for different configuration of sound absorptive material. Despite the configuration different, the outcome shows that the insertion loss is increasing with higher content of coconut fiber.

Spacetimes foliated by Killing horizons

International Nuclear Information System (INIS)

Pawlowski, Tomasz; Lewandowski, Jerzy; Jezierski, Jacek

2004-01-01

It seems to be expected that a horizon of a quasi-local type, such as a Killing or an isolated horizon, by analogy with a globally defined event horizon, should be unique in some open neighbourhood in the spacetime, provided the vacuum Einstein or the Einstein-Maxwell equations are satisfied. The aim of our paper is to verify whether that intuition is correct. If one can extend a so-called Kundt metric, in such a way that its null, shear-free surfaces have spherical spacetime sections, the resulting spacetime is foliated by so-called non-expanding horizons. The obstacle is Kundt's constraint induced at the surfaces by the Einstein or the Einstein-Maxwell equations, and the requirement that a solution be globally defined on the sphere. We derived a transformation (reflection) that creates a solution to Kundt's constraint out of data defining an extremal isolated horizon. Using that transformation, we derived a class of exact solutions to the Einstein or Einstein-Maxwell equations of very special properties. Each spacetime we construct is foliated by a family of the Killing horizons. Moreover, it admits another, transversal Killing horizon. The intrinsic and extrinsic geometries of the transversal Killing horizon coincide with the one defined on the event horizon of the extremal Kerr-Newman solution. However, the Killing horizon in our example admits yet another Killing vector tangent to and null at it. The geometries of the leaves are given by the reflection

PESAN MORAL DALAM FILM TO KILL A MOCKINGBIRD (ANALISIS SEMIOTIKA PADA FILM TO KILL A MOCKINGBIRD

OpenAIRE

RENYOET, JAQUILINE MELISSA

2014-01-01

2014 JAQUILINE MELISSA RENYOET. Pesan Moral Dalam Film To Kill A Mockingbird (Analisis Semiotika Pada Film To Kill A Mockingbird). (Dibimbing oleh Muh. Nadjib dan Alem Febri Sonni). Tujuan Penelitian ini adalah mengidentifikasi bentuk pesan moral dan memahami makna pesan moral dalam film To Kill A Mockingbird. Penelitian ini dilakukan selama kurang lebih 2 bulan yaitu Maret ??? Mei 2014. Metode yang digunakan untuk penelitian ini adalah metode penelitian kualitatif den...

The Silencing of a 14-3-3ɛ Homolog in Tenebrio molitor Leads to Increased Antimicrobial Activity in Hemocyte and Reduces Larval Survivability.

Science.gov (United States)

Seo, Gi Won; Jo, Yong Hun; Seong, Jeong Hwan; Park, Ki Beom; Patnaik, Bharat Bhusan; Tindwa, Hamisi; Kim, Sun-Am; Lee, Yong Seok; Kim, Yu Jung; Han, Yeon Soo

2016-08-20

The 14-3-3 family of phosphorylated serine-binding proteins acts as signaling molecules in biological processes such as metabolism, division, differentiation, autophagy, and apoptosis. Herein, we report the requirement of 14-3-3ɛ isoform from Tenebrio molitor (Tm14-3-3ɛ) in the hemocyte antimicrobial activity. The Tm14-3-3ɛ transcript is 771 nucleotides in length and encodes a polypeptide of 256 amino acid residues. The protein has the typical 14-3-3 domain, the nuclear export signal (NES) sequence, and the peptide binding residues. The Tm14-3-3ɛ transcript shows a significant three-fold expression in the hemocyte of T. molitor larvae when infected with Escherichia coli Tm14-3-3ɛ silenced larvae show significantly lower survival rates when infected with E. coli. Under Tm14-3-3ɛ silenced condition, a strong antimicrobial activity is elicited in the hemocyte of the host inoculated with E. coli. This suggests impaired secretion of antimicrobial peptides (AMP) into the hemolymph. Furthermore, a reduction in AMP secretion under Tm14-3-3ɛ silenced condition would be responsible for loss in the capacity to kill bacteria and might explain the reduced survivability of the larvae upon E. coli challenge. This shows that Tm14-3-3ɛ is required to maintain innate immunity in T. molitor by enabling antimicrobial secretion into the hemolymph and explains the functional specialization of the isoform.

The Silencing of a 14-3-3ɛ Homolog in Tenebrio molitor Leads to Increased Antimicrobial Activity in Hemocyte and Reduces Larval Survivability

Directory of Open Access Journals (Sweden)

Gi Won Seo

2016-08-01

Full Text Available The 14-3-3 family of phosphorylated serine-binding proteins acts as signaling molecules in biological processes such as metabolism, division, differentiation, autophagy, and apoptosis. Herein, we report the requirement of 14-3-3ɛ isoform from Tenebrio molitor (Tm14-3-3ɛ in the hemocyte antimicrobial activity. The Tm14-3-3ɛ transcript is 771 nucleotides in length and encodes a polypeptide of 256 amino acid residues. The protein has the typical 14-3-3 domain, the nuclear export signal (NES sequence, and the peptide binding residues. The Tm14-3-3ɛ transcript shows a significant three-fold expression in the hemocyte of T. molitor larvae when infected with Escherichia coli Tm14-3-3ɛ silenced larvae show significantly lower survival rates when infected with E. coli. Under Tm14-3-3ɛ silenced condition, a strong antimicrobial activity is elicited in the hemocyte of the host inoculated with E. coli. This suggests impaired secretion of antimicrobial peptides (AMP into the hemolymph. Furthermore, a reduction in AMP secretion under Tm14-3-3ɛ silenced condition would be responsible for loss in the capacity to kill bacteria and might explain the reduced survivability of the larvae upon E. coli challenge. This shows that Tm14-3-3ɛ is required to maintain innate immunity in T. molitor by enabling antimicrobial secretion into the hemolymph and explains the functional specialization of the isoform.

Antiviral RNA silencing viral counter defense in plants

NARCIS (Netherlands)

Bucher, E.C.

2006-01-01

The research described in this thesis centres around the mechanism of RNA silencing in relation to virus-host interaction, an area of increasing importance. It shows how this recently disclosed mechanism can be used to produce virus-resistant plants. Based on the activity of the RNA silencing

Control of Influenza and Poliomyelitis with Killed Virus Vaccines

Science.gov (United States)

Salk, Jonas; Salk, Darrell

1977-01-01

Discusses control of poliomyelitis and influenza by live and killed virus vaccines. Considered are the etiological agents, pathogenic mechanisms and epidemiology of each disease. Reviews recent scientific studies of the diseases. Recommends use of killed virus vaccines in controlling both diseases. (CS)

The Role of Silence at the Retreats of a Buddhist Community

Directory of Open Access Journals (Sweden)

Orsolya Huszár

2016-12-01

Full Text Available The purpose of the study is to establish that the definition of silence as simply an absence of something or as the background of communication proves to be inadequate in a number of communicative instances. The interpretation of silence is culturally determined, and the underappreciation of its role is typical in low-context Western cultures; this is also evinced by the neglect of the topic in the literature. The present study will describe the communicative functions of silence through the findings of field work conducted at the retreats of a Buddhist community in Hungary, providing empirical input for the relevant theoretical constructs. The research findings show that silence is accorded a central role in essentially every component of the retreat (meditations, relaxation, ceremonies, teachings, small-group sharings, meals and rest; and while each event at the retreat focuses primarily on a different specific function of communication, the entire retreat does involve the linkage, affecting, revelational and – to a certain extent – activating functions (to follow the five-element typology of J. Vernon Jensen, as well as – to a lesser extent – the judgmental function. The research also shows that it requires time for individuals in a low-context culture to recognize the “point” of silence – something that the retreats provide the right opportunity for. In fact, the insights the individuals arrived at through these occasions could be put to use in their daily lives, helping their problem-solving and social relationships and in general improving their quality of life.

Relationship between Organizational Silence and Organizational Citizenship Behavior: A Case Study on Five Stars Hotels in Antalya

Directory of Open Access Journals (Sweden)

Arzu Kılıçlar

2014-03-01

Full Text Available In this study, it was aimed to determine the relationship between organizational silence and organizational citizenship behavior in accommodation establishments. For this purpose, questionnaire was applied to 392 people working in five-star accommodation establishments in Antalya. T-test, ANOVA and correlation analysis was performed by using the data obtained from the questionnaire. As a result of these analyzes, it was determined that most of the employees remained silent concern of not to be supported by the peo ple when he/she speaks clearly, exposure to ill-treatment and losing his/her job. At the same time, it was detected that employees exhibit courtesy behavior most, sportsmanship behavior least among organizational citizenship behaviors. According to correlation analysis, a weak negative relationship was found between organizational silence and organizational citizenship behavio.

Eloquent silences: A musical and lexical analysis of conversation between oncologists and their patients.

Science.gov (United States)

Bartels, Josef; Rodenbach, Rachel; Ciesinski, Katherine; Gramling, Robert; Fiscella, Kevin; Epstein, Ronald

2016-10-01

Silences in doctor-patient communication can be "connectional" and communicative, in contrast to silences that indicate awkwardness or distraction. Musical and lexical analyses can identify and characterize connectional silences in consultations between oncologists and patients. Two medical students and a professor of voice screened all 1211 silences over 2s in length from 124 oncology office visits. We developed a "strength of connection" taxonomy and examined ten connectional silences for lexical and musical features including pitch, volume, and speaker turn-taking rhythm. We identified connectional silences with good reliability. Typical dialog rhythms surrounding connectional silences are characterized by relatively equal turn lengths and frequent short vocalizations. We found no pattern of volume and pitch variability around these silences. Connectional silences occurred in a wide variety of lexical contexts. Particular patterns of dialog rhythm mark connectional silences. Exploring structures of connectional silence extends our understanding of the audio-linguistic conditions that mark patient-clinician connection. Communicating with an awareness of pitch, rhythm, and silence - in addition to lexical content - can facilitate shared understanding and emotional connection. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

MicroRNA-Mediated Myostatin Silencing in Caprine Fetal Fibroblasts

Science.gov (United States)

Zhong, Bushuai; Zhang, Yanli; Yan, Yibo; Wang, Ziyu; Ying, Shijia; Huang, Mingrui; Wang, Feng

2014-01-01

Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi) mediated by microRNAs (miRNAs) is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF) was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN) response genes, such as interferon beta (IFN-β) and 2′-5′-oligoadenylate synthetase 2 (OAS2), were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats. PMID:25244645

MicroRNA-mediated myostatin silencing in caprine fetal fibroblasts.

Directory of Open Access Journals (Sweden)

Bushuai Zhong

Full Text Available Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi mediated by microRNAs (miRNAs is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN response genes, such as interferon beta (IFN-β and 2'-5'-oligoadenylate synthetase 2 (OAS2, were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats.

Gray Wolf (Canis lupus) movements and behavior around a kill site and implications for GPS collar studies

Science.gov (United States)

Mech, L. David

2011-01-01

Global Positioning System (GPS) radio-collars are increasingly used to estimate Gray Wolf (Canis lupus) kill rates. In interpreting results from this technology, researchers make various assumptions about wolf behavior around kills, yet no detailed description of this behavior has been published. This article describes the behavior of six wolves in an area of constant daylight during 30 hours, from when the pack killed a Muskox (Ovibos moschatus) calf and yearling on Ellesmere Island, Nunavut, Canada, to when they abandoned the kill remains. Although this is only a single incident, it demonstrates one possible scenario of pack behavior around a kill. Combined with the literature, this observation supports placing a radio-collar on the breeding male to maximize finding kills via GPS collars and qualifying results depending on whatever other information is available about the collared wolf's pack.

Archivists Killed for Political Reasons

NARCIS (Netherlands)

de Baets, Antoon

2015-01-01

This essay, Archivists Killed for Political Reasons, offers an overview of archivists who were killed for political reasons through the ages. After determining the criteria for inclusion, sixteen such political murders of archivists are briefly discussed. These cases were distributed over six

The RNA silencing pathway: the bits and pieces that matter.

Directory of Open Access Journals (Sweden)

2005-07-01

Full Text Available Cellular pathways are generally proposed on the basis of available experimental knowledge. The proposed pathways, however, may be inadequate to describe the phenomena they are supposed to explain. For instance, by means of concise mathematical models we are able to reveal shortcomings in the current description of the pathway of RNA silencing. The silencing pathway operates by cleaving siRNAs from dsRNA. siRNAs can associate with RISC, leading to the degradation of the target mRNA. We propose and analyze a few small extensions to the pathway: a siRNA degrading RNase, primed amplification of aberrant RNA pieces, and cooperation between aberrant RNA to trigger amplification. These extensions allow for a consistent explanation for various types of silencing phenomena, such as virus induced silencing, transgene and transposon induced silencing, and avoidance of self-reactivity, as well as for differences found between species groups.

9 CFR 113.213 - Pseudorabies Vaccine, Killed Virus.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Pseudorabies Vaccine, Killed Virus..., DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.213 Pseudorabies Vaccine, Killed Virus. Pseudorabies Vaccine, Killed...

Ways to Promote the Classroom Participation of International Students by Understanding the Silence of Japanese University Students

Science.gov (United States)

Kim, Soonhyang; Ates, Burcu; Grigsby, Yurimi; Kraker, Stefani; Micek, Timothy A.

2016-01-01

The authors explored the role of silence and deciphered its meaning and usefulness as a teaching and learning strategy for Japanese students through a survey of Japanese university students in their home country. This study has revealed that participant responses were evenly divided among comfortable with silence, uncomfortable with silence, and…

Homology-dependent Gene Silencing in Paramecium

Science.gov (United States)

Ruiz, Françoise; Vayssié, Laurence; Klotz, Catherine; Sperling, Linda; Madeddu, Luisa

1998-01-01

Microinjection at high copy number of plasmids containing only the coding region of a gene into the Paramecium somatic macronucleus led to a marked reduction in the expression of the corresponding endogenous gene(s). The silencing effect, which is stably maintained throughout vegetative growth, has been observed for all Paramecium genes examined so far: a single-copy gene (ND7), as well as members of multigene families (centrin genes and trichocyst matrix protein genes) in which all closely related paralogous genes appeared to be affected. This phenomenon may be related to posttranscriptional gene silencing in transgenic plants and quelling in Neurospora and allows the efficient creation of specific mutant phenotypes thus providing a potentially powerful tool to study gene function in Paramecium. For the two multigene families that encode proteins that coassemble to build up complex subcellular structures the analysis presented herein provides the first experimental evidence that the members of these gene families are not functionally redundant. PMID:9529389

Killing superalgebras for Lorentzian four-manifolds

International Nuclear Information System (INIS)

Medeiros, Paul de; Figueroa-O’Farrill, José; Santi, Andrea

2016-01-01

We determine the Killing superalgebras underpinning field theories with rigid unextended supersymmetry on Lorentzian four-manifolds by re-interpreting them as filtered deformations of ℤ-graded subalgebras with maximum odd dimension of the N=1 Poincaré superalgebra in four dimensions. Part of this calculation involves computing a Spencer cohomology group which, by analogy with a similar result in eleven dimensions, prescribes a notion of Killing spinor, which we identify with the defining condition for bosonic supersymmetric backgrounds of minimal off-shell supergravity in four dimensions. We prove that such Killing spinors always generate a Lie superalgebra, and that this Lie superalgebra is a filtered deformation of a subalgebra of the N=1 Poincaré superalgebra in four dimensions. Demanding the flatness of the connection defining the Killing spinors, we obtain equations satisfied by the maximally supersymmetric backgrounds. We solve these equations, arriving at the classification of maximally supersymmetric backgrounds whose associated Killing superalgebras are precisely the filtered deformations we classify in this paper.

Killing superalgebras for Lorentzian four-manifolds

Energy Technology Data Exchange (ETDEWEB)

Medeiros, Paul de [Department of Mathematics and Natural Sciences, University of Stavanger,4036 Stavanger (Norway); Figueroa-O’Farrill, José; Santi, Andrea [Maxwell Institute and School of Mathematics, The University of Edinburgh,James Clerk Maxwell Building, Peter Guthrie Tait Road, Edinburgh EH9 3FD, Scotland (United Kingdom)

2016-06-20

We determine the Killing superalgebras underpinning field theories with rigid unextended supersymmetry on Lorentzian four-manifolds by re-interpreting them as filtered deformations of ℤ-graded subalgebras with maximum odd dimension of the N=1 Poincaré superalgebra in four dimensions. Part of this calculation involves computing a Spencer cohomology group which, by analogy with a similar result in eleven dimensions, prescribes a notion of Killing spinor, which we identify with the defining condition for bosonic supersymmetric backgrounds of minimal off-shell supergravity in four dimensions. We prove that such Killing spinors always generate a Lie superalgebra, and that this Lie superalgebra is a filtered deformation of a subalgebra of the N=1 Poincaré superalgebra in four dimensions. Demanding the flatness of the connection defining the Killing spinors, we obtain equations satisfied by the maximally supersymmetric backgrounds. We solve these equations, arriving at the classification of maximally supersymmetric backgrounds whose associated Killing superalgebras are precisely the filtered deformations we classify in this paper.

Silencing criticism in Mexico

Directory of Open Access Journals (Sweden)

Ximena Suárez

2017-10-01

Full Text Available Journalists and human rights defenders in Mexico are being attacked in an attempt to silence their criticism. Many are forced to flee or risk being assassinated. The consequences are both personal and of wider social significance.

Isolated Horizon, Killing Horizon and Event Horizon

OpenAIRE

Date, G.

2001-01-01

We consider space-times which in addition to admitting an isolated horizon also admit Killing horizons with or without an event horizon. We show that an isolated horizon is a Killing horizon provided either (1) it admits a stationary neighbourhood or (2) it admits a neighbourhood with two independent, commuting Killing vectors. A Killing horizon is always an isolated horizon. For the case when an event horizon is definable, all conceivable relative locations of isolated horizon and event hori...

Conformal Killing vectors in Robertson-Walker spacetimes

International Nuclear Information System (INIS)

Maartens, R.; Maharaj, S.d.

1986-01-01

It is well known that Robertson-Walker spacetimes admit a conformal Killingl vector normal to the spacelike homogeneous hypersurfaces. Because these spacetimes are conformally flat, there are a further eight conformal Killing vectors, which are neither normal nor tangent to the homogeneous hypersurfaces. The authors find these further conformal Killing vectors and the Lie algebra of the full G 15 of conformal motions. Conditions on the metric scale factor are determined which reduce some of the conformal Killing vectors to homothetic Killing vectors or Killing vectors, allowing one to regain in a unified way the known special geometries. The non-normal conformal Killing vectors provide a counter-example to show that conformal motions do not, in general, map a fluid flow conformally. These non-normal vectors are also used to find the general solution of the null geodesic equation and photon Liouville equation. (author)

Identification of Novel Fibrosis Modifiers by In Vivo siRNA Silencing

Directory of Open Access Journals (Sweden)

Elisabeth H. Vollmann

2017-06-01

Full Text Available Fibrotic diseases contribute to 45% of deaths in the industrialized world, and therefore a better understanding of the pathophysiological mechanisms underlying tissue fibrosis is sorely needed. We aimed to identify novel modifiers of tissue fibrosis expressed by myofibroblasts and their progenitors in their disease microenvironment through RNA silencing in vivo. We leveraged novel biology, targeting genes upregulated during liver and kidney fibrosis in this cell lineage, and employed small interfering RNA (siRNA-formulated lipid nanoparticles technology to silence these genes in carbon-tetrachloride-induced liver fibrosis in mice. We identified five genes, Egr2, Atp1a2, Fkbp10, Fstl1, and Has2, which modified fibrogenesis based on their silencing, resulting in reduced Col1a1 mRNA levels and collagen accumulation in the liver. These genes fell into different groups based on the effects of their silencing on a transcriptional mini-array and histological outcomes. Silencing of Egr2 had the broadest effects in vivo and also reduced fibrogenic gene expression in a human fibroblast cell line. Prior to our study, Egr2, Atp1a2, and Fkbp10 had not been functionally validated in fibrosis in vivo. Thus, our results provide a major advance over the existing knowledge of fibrogenic pathways. Our study is the first example of a targeted siRNA assay to identify novel fibrosis modifiers in vivo.

9 CFR 113.206 - Wart Vaccine, Killed Virus.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Wart Vaccine, Killed Virus. 113.206... AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.206 Wart Vaccine, Killed Virus. Wart Vaccine, Killed Virus, shall be prepared...

Suppressors of RNA silencing encoded by tomato leaf curl ...

Indian Academy of Sciences (India)

2013-01-06

Jan 6, 2013 ... Virus encoded RNA-silencing suppressors (RSSs) are the key components evolved by the viruses to ... severe disease symptom in the host (Briddon et al. ..... Voinnet O 2001 RNA silencing as a plant immune system against.

9 CFR 113.209 - Rabies Vaccine, Killed Virus.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Rabies Vaccine, Killed Virus. 113.209... Killed Virus Vaccines § 113.209 Rabies Vaccine, Killed Virus. Rabies Vaccine (Killed Virus) shall be prepared from virus-bearing cell cultures or nerve tissues obtained from animals that have developed rabies...

Excavating silences and tensions of agency|passivity in science education reform

Science.gov (United States)

Rivera Maulucci, Maria S.

2010-12-01

I reflect on studies by Rodriguez and Carlone, Haun-Frank, and Kimmel to emphasize the ways in which they excavate silences in the science education literature related to linguistic and cultural diversity and situating the problem of reform in teachers rather than contextual factors, such as traditional schooling discourses and forces that serve to marginalize science. I propose that the current push for top-down reform and accountability diminishes opportunities for receptivity, learning with and from students in order to transform teachers' practices and promote equity in science education. I discuss tensions of agency and passivity in science education reform and argue that attention to authentic caring constitutes another silence in the science education literature. I conclude that the current policy context positions teachers and science education researchers as tempered radicals struggling against opp(reg)ressive reforms and that there is a need for more studies to excavate these and other silences.

The Shadow of Silence on the Sexual Rights of Married Iranian Women

Directory of Open Access Journals (Sweden)

Roksana Janghorban

2015-01-01

Full Text Available There has been a recent shift in the field of sexual health, representing a move away from biomedical concerns to sexual rights frameworks. However, few studies on sexuality are based on a rights framework. The unspoken nature of sexuality in Iranian culture has led to a lack of national studies on the topic. The objective of this study was to explore the perceptions and experiences of married Iranian women on sexual rights in their sexual relationships. In this grounded theory study, 37 participants (25 married women, 5 husbands, and 7 midwives were selected. Data were collected through in-depth interviews and analyzed through open, axial, and selective coding using MAXQDA software version 2007. The analysis revealed the core category of “sexual interaction in the shadow of silence.” The interrelated categories subsumed under the core category included adopting a strategy of silence, trying to negotiate sex, seeking help, and sexual adjustment. The silence originating from women’s interactions with their families and society, from girlhood to womanhood, was identified as the core concept in Iranian women’s experiences of sexual rights. A focus on husbands’ roles seems salient because they can direct or alter some learned feminine roles, especially silence regarding sexual matters, which then affects the realization of women’s sexual rights.

Gene silencing activity of siRNA polyplexes based on thiolated N,N,N-trimethylated chitosan.

Science.gov (United States)

Varkouhi, Amir K; Verheul, Rolf J; Schiffelers, Raymond M; Lammers, Twan; Storm, Gert; Hennink, Wim E

2010-12-15

N,N,N-Trimethylated chitosan (TMC) is a biodegradable polymer emerging as a promising nonviral vector for nucleic acid and protein delivery. In the present study, we investigated whether the introduction of thiol groups in TMC enhances the extracellular stability of the complexes based on this polymer and promotes the intracellular release of siRNA. The gene silencing activity and the cellular cytotoxicity of polyplexes based on thiolated TMC were compared with those based on the nonthiolated counterpart and the regularly used lipidic transfection agent Lipofectamine. Incubation of H1299 human lung cancer cells expressing firefly luciferase with siRNA/thiolated TMC polyplexes resulted in 60-80% gene silencing activity, whereas complexes based on nonthiolated TMC showed less silencing (40%). The silencing activity of the complexes based on Lipofectamine 2000 was about 60-70%. Importantly, the TMC-SH polyplexes retained their silencing activity in the presence of hyaluronic acid, while nonthiolated TMC polyplexes hardly showed any silencing activity, demonstrating their stability against competing anionic macromolecules. Under the experimental conditions tested, the cytotoxicity of the thiolated and nonthiolated siRNA complexes was lower than those based on Lipofectamine. Given the good extracellular stability and good silencing activity, it is concluded that polyplexes based on TMC-SH are attractive systems for further in vivo evaluations.

Contagion in Mass Killings and School Shootings

OpenAIRE

Towers, Sherry; Gomez-Lievano, Andres; Khan, Maryam; Mubayi, Anuj; Castillo-Chavez, Carlos

2015-01-01

Background Several past studies have found that media reports of suicides and homicides appear to subsequently increase the incidence of similar events in the community, apparently due to the coverage planting the seeds of ideation in at-risk individuals to commit similar acts. Methods Here we explore whether or not contagion is evident in more high-profile incidents, such as school shootings and mass killings (incidents with four or more people killed). We fit a contagion model to recent dat...

Prediction of the diffuse-field transmission loss of interior natural-ventilation openings and silencers.

Science.gov (United States)

Bibby, Chris; Hodgson, Murray

2017-01-01

The work reported here, part of a study on the performance and optimal design of interior natural-ventilation openings and silencers ("ventilators"), discusses the prediction of the acoustical performance of such ventilators, and the factors that affect it. A wave-based numerical approach-the finite-element method (FEM)-is applied. The development of a FEM technique for the prediction of ventilator diffuse-field transmission loss is presented. Model convergence is studied with respect to mesh, frequency-sampling and diffuse-field convergence. The modeling technique is validated by way of predictions and the comparison of them to analytical and experimental results. The transmission-loss performance of crosstalk silencers of four shapes, and the factors that affect it, are predicted and discussed. Performance increases with flow-path length for all silencer types. Adding elbows significantly increases high-frequency transmission loss, but does not increase overall silencer performance which is controlled by low-to-mid-frequency transmission loss.

WOMEN'S RIGHTS VIOLATION: HONOUR KILLINGS

Directory of Open Access Journals (Sweden)

CRISTINA OTOVESCU FRASIE

2011-04-01

Full Text Available In this study I have presented the domestic violence concept and the situation regarding the observing of woman’s rights in Syria. We have also evidenced the juridical aspects regarding the honor killing directed against women after the modification of the article 548 from the Penal Code changed by the President al-Asad on July the 1st 2009. The data offered by NGOs have been of great help for the elaboration of the study as also the statistic data presented in Thara E-Magazine regarding the cities where had been done the honor killings and their number, the instrument of the murder, the age of the victim, and the motives for the murders. It must be noticed that, lately, the Government fought for the observing of the woman’s rights and promoted he gender equality by appointing women in leading positions, including the vice-president one.

The P0 protein encoded by cotton leafroll dwarf virus (CLRDV) inhibits local but not systemic RNA silencing.

Science.gov (United States)

Delfosse, Verónica C; Agrofoglio, Yamila C; Casse, María F; Kresic, Iván Bonacic; Hopp, H Esteban; Ziegler-Graff, Véronique; Distéfano, Ana J

2014-02-13

Plants employ RNA silencing as a natural defense mechanism against viruses. As a counter-defense, viruses encode silencing suppressor proteins (SSPs) that suppress RNA silencing. Most, but not all, the P0 proteins encoded by poleroviruses have been identified as SSP. In this study, we demonstrated that cotton leafroll dwarf virus (CLRDV, genus Polerovirus) P0 protein suppressed local silencing that was induced by sense or inverted repeat transgenes in Agrobacterium co-infiltration assay in Nicotiana benthamiana plants. A CLRDV full-length infectious cDNA clone that is able to infect N. benthamiana through Agrobacterium-mediated inoculation also inhibited local silencing in co-infiltration assays, suggesting that the P0 protein exhibits similar RNA silencing suppression activity when expressed from the full-length viral genome. On the other hand, the P0 protein did not efficiently inhibit the spread of systemic silencing signals. Moreover, Northern blotting indicated that the P0 protein inhibits the generation of secondary but not primary small interfering RNAs. The study of CLRDV P0 suppression activity may contribute to understanding the molecular mechanisms involved in the induction of cotton blue disease by CLRDV infection. Copyright © 2013 Elsevier B.V. All rights reserved.

It's not just conflict that motivates killing of orangutans.

Directory of Open Access Journals (Sweden)

Jacqueline T Davis

Full Text Available We investigated why orangutans are being killed in Kalimantan, Indonesia, and the role of conflict in these killings. Based on an analysis of interview data from over 5,000 respondents in over 450 villages, we also assessed the socio-ecological factors associated with conflict and non-conflict killings. Most respondents never kill orangutans. Those who reported having personally killed an orangutan primarily did so for non-conflict reasons; for example, 56% of these respondents said that the reason they had killed an orangutan was to eat it. Of the conflict-related reasons for killing, the most common reasons orangutans were killed was fear of orangutans or in self-defence. A similar pattern was evident among reports of orangutan killing by other people in the villages. Regression analyses indicated that religion and the percentage of intact forest around villages were the strongest socio-ecological predictors of whether orangutans were killed for conflict or non-conflict related reasons. Our data indicate that between 44,170 and 66,570 orangutans were killed in Kalimantan within the respondents' active hunting lifetimes: between 12,690 and 29,024 for conflict reasons (95%CI and between 26,361 and 41,688 for non-conflict reasons (95% CI. These findings confirm that habitat protection alone will not ensure the survival of orangutans in Indonesian Borneo, and that effective reduction of orangutan killings is urgently needed.

It's not just conflict that motivates killing of orangutans.

Science.gov (United States)

Davis, Jacqueline T; Mengersen, Kerrie; Abram, Nicola K; Ancrenaz, Marc; Wells, Jessie A; Meijaard, Erik

2013-01-01

We investigated why orangutans are being killed in Kalimantan, Indonesia, and the role of conflict in these killings. Based on an analysis of interview data from over 5,000 respondents in over 450 villages, we also assessed the socio-ecological factors associated with conflict and non-conflict killings. Most respondents never kill orangutans. Those who reported having personally killed an orangutan primarily did so for non-conflict reasons; for example, 56% of these respondents said that the reason they had killed an orangutan was to eat it. Of the conflict-related reasons for killing, the most common reasons orangutans were killed was fear of orangutans or in self-defence. A similar pattern was evident among reports of orangutan killing by other people in the villages. Regression analyses indicated that religion and the percentage of intact forest around villages were the strongest socio-ecological predictors of whether orangutans were killed for conflict or non-conflict related reasons. Our data indicate that between 44,170 and 66,570 orangutans were killed in Kalimantan within the respondents' active hunting lifetimes: between 12,690 and 29,024 for conflict reasons (95%CI) and between 26,361 and 41,688 for non-conflict reasons (95% CI). These findings confirm that habitat protection alone will not ensure the survival of orangutans in Indonesian Borneo, and that effective reduction of orangutan killings is urgently needed.

Comparing Road-Kill Datasets from Hunters and Citizen Scientists in a Landscape Context

OpenAIRE

Florian Heigl; Carina R. Stretz; Wolfgang Steiner; Franz Suppan; Thomas Bauer; Gregor Laaha; Johann G. Zaller

2016-01-01

Road traffic has severe effects on animals, especially when road-kills are involved. In many countries, official road-kill data are provided by hunters or police; there are also road-kill observations reported by citizen scientists. The aim of the current study was to test whether road-kill reports by hunters stem from similar landscapes than those reported by citizen scientists. We analysed the surrounding landscapes of 712 road-kill reportings of European hares in the province of Lower Aust...

Designing and Manufacturing a Noise Controlling Silencer for the Cooling Tower Pump of Sarcheshmeh Copper Power Station

Directory of Open Access Journals (Sweden)

Sajad Zare

2017-08-01

Full Text Available Background One of the most common harmful factors in the workplace is noise. Noise control is a factor beneficial for health and safety in the workplace. Objectives The current study aimed to design and manufacture a silencer for the cooling tower pump of Sarcheshmeh Copper power station in order to control noise. Methods In this study, sound pressure level was measured by the use of a sound level meter (B & K 2260. Measurement was carried out in the light of ISO 1996 standard. After studying technical and acoustic features of the noise source, a dispersive-absorptive silencer was designed to control noise pollution generated by the cooling tower pump of the thermal station. After analyzing the frequencies of sound pressure level and using available data, a cylindrical silencer (with a diameter of 1.5 m and height of 3 m was designed and manufactured. The internal part of the silencer was filled with different columns of absorbent material covered with punched metal. Therefore, the silencer consisted of (1 acoustic diffuser, (2 acoustic chamber, and (3 acoustic channels. Results Measurements showed that, at a distance of 1 m from the source, sound pressure level reduced from 127 dBA before installing the silencer to 79 dBA after the installation, resulting in a reduction of 48 dBA. Conclusions Using a silencer with absorbent material (glass wool is very effective in reducing the noise generated by the pump.

Antiviral RNA silencing suppression activity of Tomato spotted wilt virus NSs protein.

Science.gov (United States)

Ocampo Ocampo, T; Gabriel Peralta, S M; Bacheller, N; Uiterwaal, S; Knapp, A; Hennen, A; Ochoa-Martinez, D L; Garcia-Ruiz, H

2016-06-17

In addition to regulating gene expression, RNA silencing is an essential antiviral defense system in plants. Triggered by double-stranded RNA, silencing results in degradation or translational repression of target transcripts. Viruses are inducers and targets of RNA silencing. To condition susceptibility, most plant viruses encode silencing suppressors that interfere with this process, such as the Tomato spotted wilt virus (TSWV) NSs protein. The mechanism by which NSs suppresses RNA silencing and its role in viral infection and movement remain to be determined. We cloned NSs from the Hawaii isolate of TSWV and using two independent assays show for the first time that this protein restored pathogenicity and supported the formation of local infection foci by suppressor-deficient Turnip mosaic virus and Turnip crinkle virus. Demonstrating the suppression of RNA silencing directed against heterologous viruses establishes the foundation to determine the means used by NSs to block this antiviral process.

Wind power and bird kills

International Nuclear Information System (INIS)

Raynolds, M.

1998-01-01

The accidental killing of birds by wind generators, and design improvements in the towers that support the turbines that might cut down on the bird killings were discussed. The first problem for the industry began in the late 1980s when the California Energy Commission reported as many as 160 birds (the majority being raptors, including the protected golden eagle) killed in one year in the vicinity of wind power plants. The key factor identified was the design of the towers as birds of prey are attracted to lattice towers as a place to hunt from. Tubular towers do not provide a place for the birds to perch, therefore they reduce the potential for bird strikes. Bird strikes also have been reported in Spain and the siting of the towers have been considered as the principal cause of the bird strikes. In view of these incidents, the wind power industry is developing standards for studying the potential of bird strikes and is continuing to study bird behaviour leading to collisions, the impact of topography, cumulative impacts and new techniques to reduce bird strikes. Despite the reported incidents, the risk of bird strikes by wind turbines, compared to other threats to birds such as pollution, oil spills, and other threats from fossil and nuclear fuels, is considered to be negligible. With continuing efforts to minimize incidents by proper design and siting, wind power can continue to grow as an environmentally sound and efficient source of energy

Wind power and bird kills

Energy Technology Data Exchange (ETDEWEB)

Raynolds, M.

1998-12-01

The accidental killing of birds by wind generators, and design improvements in the towers that support the turbines that might cut down on the bird killings were discussed. The first problem for the industry began in the late 1980s when the California Energy Commission reported as many as 160 birds (the majority being raptors, including the protected golden eagle) killed in one year in the vicinity of wind power plants. The key factor identified was the design of the towers as birds of prey are attracted to lattice towers as a place to hunt from. Tubular towers do not provide a place for the birds to perch, therefore they reduce the potential for bird strikes. Bird strikes also have been reported in Spain and the siting of the towers have been considered as the principal cause of the bird strikes. In view of these incidents, the wind power industry is developing standards for studying the potential of bird strikes and is continuing to study bird behaviour leading to collisions, the impact of topography, cumulative impacts and new techniques to reduce bird strikes. Despite the reported incidents, the risk of bird strikes by wind turbines, compared to other threats to birds such as pollution, oil spills, and other threats from fossil and nuclear fuels, is considered to be negligible. With continuing efforts to minimize incidents by proper design and siting, wind power can continue to grow as an environmentally sound and efficient source of energy.

Silence of the Genes

Indian Academy of Sciences (India)

Home; Journals; Resonance – Journal of Science Education; Volume 12; Issue 4. Silence of the Genes - 2006 Nobel Prize in Physiology or Medicine. Utpal Nath Saumitra Das. General Article Volume 12 Issue 4 April 2007 pp 6-18. Fulltext. Click here to view fulltext PDF. Permanent link:

Conifers have a unique small RNA silencing signature.

Science.gov (United States)

Dolgosheina, Elena V; Morin, Ryan D; Aksay, Gozde; Sahinalp, S Cenk; Magrini, Vincent; Mardis, Elaine R; Mattsson, Jim; Unrau, Peter J

2008-08-01

Plants produce small RNAs to negatively regulate genes, viral nucleic acids, and repetitive elements at either the transcriptional or post-transcriptional level in a process that is referred to as RNA silencing. While RNA silencing has been extensively studied across the different phyla of the animal kingdom (e.g., mouse, fly, worm), similar studies in the plant kingdom have focused primarily on angiosperms, thus limiting evolutionary studies of RNA silencing in plants. Here we report on an unexpected phylogenetic difference in the size distribution of small RNAs among the vascular plants. By extracting total RNA from freshly growing shoot tissue, we conducted a survey of small RNAs in 24 vascular plant species. We find that conifers, which radiated from the other seed-bearing plants approximately 260 million years ago, fail to produce significant amounts of 24-nucleotide (nt) RNAs that are known to guide DNA methylation and heterochromatin formation in angiosperms. Instead, they synthesize a diverse population of small RNAs that are exactly 21-nt long. This finding was confirmed by high-throughput sequencing of the small RNA sequences from a conifer, Pinus contorta. A conifer EST search revealed the presence of a novel Dicer-like (DCL) family, which may be responsible for the observed change in small RNA expression. No evidence for DCL3, an enzyme that matures 24-nt RNAs in angiosperms, was found. We hypothesize that the diverse class of 21-nt RNAs found in conifers may help to maintain organization of their unusually large genomes.

Maternal Silences: Motherhood and Voluntary Childlessness in Contemporary Christianity

Directory of Open Access Journals (Sweden)

Dawn Llewellyn

2016-06-01

Full Text Available In Christianity, there is an ideology of motherhood that pervades scripture, ritual, and doctrine, yet there is an academic silence that means relatively little space has been given to motherhood and mothering, and even less to voluntary childlessness, from a faith perspective. By drawing on qualitative in-depth interviews with Christian women living in Britain, narrating their experiences of motherhood and voluntary childlessness, I suggest there are also lived maternal silences encountered by women in contemporary Christianity. There is a maternal expectation produced through church teaching, liturgy and culture that constructs women as ‘maternal bodies’ (Gatrell 2008; this silences and marginalises women from articulating their complex relationship with religion, motherhood, and childlessness in ways that challenge their spiritual development. However, this article also introduces the everyday and intentional tactics women employ to disrupt the maternal expectation, and hereby interrupt the maternal silence.

The VP3 factor from viruses of Birnaviridae family suppresses RNA silencing by binding both long and small RNA duplexes.

Science.gov (United States)

Valli, Adrian; Busnadiego, Idoia; Maliogka, Varvara; Ferrero, Diego; Castón, José R; Rodríguez, José Francisco; García, Juan Antonio

2012-01-01

RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV) displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.

Bodies, Spaces, Voices, Silences

Directory of Open Access Journals (Sweden)

Donatella Mazzoleni

2013-07-01

Full Text Available A good architecture should not only allow functional, formal and technical quality for urban spaces, but also let the voice of the city be perceived, listened, enjoyed. Every city has got its specific sound identity, or “ISO” (R. O. Benenzon, made up of a complex texture of background noises and fluctuation of sound figures emerging and disappearing in a game of continuous fadings. For instance, the ISO of Naples is characterized by a spread need of hearing the sound return of one’s/others voices, by a hate of silence. Cities may fall ill: illness from noise, within super-crowded neighbourhoods, or illness from silence, in the forced isolation of peripheries. The proposal of an urban music therapy denotes an unpublished and innovative enlarged interdisciplinary research path, where architecture, music, medicine, psychology, communication science may converge, in order to work for rebalancing spaces and relation life of the urban collectivity, through the care of body and sound dimensions.

Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing

OpenAIRE

Hedil, Marcio; Sterken, Mark G.; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard

2015-01-01

RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silen...

DNA triplet repeats mediate heterochromatin-protein-1-sensitive variegated gene silencing.

Science.gov (United States)

Saveliev, Alexander; Everett, Christopher; Sharpe, Tammy; Webster, Zoë; Festenstein, Richard

2003-04-24

Gene repression is crucial to the maintenance of differentiated cell types in multicellular organisms, whereas aberrant silencing can lead to disease. The organization of DNA into chromatin and heterochromatin is implicated in gene silencing. In chromatin, DNA wraps around histones, creating nucleosomes. Further condensation of chromatin, associated with large blocks of repetitive DNA sequences, is known as heterochromatin. Position effect variegation (PEV) occurs when a gene is located abnormally close to heterochromatin, silencing the affected gene in a proportion of cells. Here we show that the relatively short triplet-repeat expansions found in myotonic dystrophy and Friedreich's ataxia confer variegation of expression on a linked transgene in mice. Silencing was correlated with a decrease in promoter accessibility and was enhanced by the classical PEV modifier heterochromatin protein 1 (HP1). Notably, triplet-repeat-associated variegation was not restricted to classical heterochromatic regions but occurred irrespective of chromosomal location. Because the phenomenon described here shares important features with PEV, the mechanisms underlying heterochromatin-mediated silencing might have a role in gene regulation at many sites throughout the mammalian genome and modulate the extent of gene silencing and hence severity in several triplet-repeat diseases.

DICER-LIKE2 plays a primary role in transitive silencing of transgenes in Arabidopsis.

Directory of Open Access Journals (Sweden)

Sizolwenkosi Mlotshwa

2008-03-01

Full Text Available Dicer-like (DCL enzymes play a pivotal role in RNA silencing in plants, processing the long double-stranded RNA (dsRNA that triggers silencing into the primary short interfering RNAs (siRNAs that mediate it. The siRNA population can be augmented and silencing amplified via transitivity, an RNA-dependent RNA polymerase (RDR-dependent pathway that uses the target RNA as substrate to generate secondary siRNAs. Here we report that Arabidopsis DCL2-but not DCL4-is required for transitivity in cell-autonomous, post-transcriptional silencing of transgenes. An insertion mutation in DCL2 blocked sense transgene-induced silencing and eliminated accumulation of the associated RDR-dependent siRNAs. In hairpin transgene-induced silencing, the dcl2 mutation likewise eliminated accumulation of secondary siRNAs and blocked transitive silencing, but did not block silencing mediated by primary siRNAs. Strikingly, in all cases, the dcl2 mutation eliminated accumulation of all secondary siRNAs, including those generated by other DCL enzymes. In contrast, mutations in DCL4 promoted a dramatic shift to transitive silencing in the case of the hairpin transgene and enhanced silencing induced by the sense transgene. Suppression of hairpin and sense transgene silencing by the P1/HC-Pro and P38 viral suppressors was associated with elimination of secondary siRNA accumulation, but the suppressors did not block processing of the stem of the hairpin transcript into primary siRNAs. Thus, these viral suppressors resemble the dcl2 mutation in their effects on siRNA biogenesis. We conclude that DCL2 plays an essential, as opposed to redundant, role in transitive silencing of transgenes and may play a more important role in silencing of viruses than currently thought.

Genome-wide methylation analysis identifies genes silenced in non-seminoma cell lines.

Science.gov (United States)

Noor, Dzul Azri Mohamed; Jeyapalan, Jennie N; Alhazmi, Safiah; Carr, Matthew; Squibb, Benjamin; Wallace, Claire; Tan, Christopher; Cusack, Martin; Hughes, Jaime; Reader, Tom; Shipley, Janet; Sheer, Denise; Scotting, Paul J

2016-01-01

Silencing of genes by DNA methylation is a common phenomenon in many types of cancer. However, the genome-wide effect of DNA methylation on gene expression has been analysed in relatively few cancers. Germ cell tumours (GCTs) are a complex group of malignancies. They are unique in developing from a pluripotent progenitor cell. Previous analyses have suggested that non-seminomas exhibit much higher levels of DNA methylation than seminomas. The genomic targets that are methylated, the extent to which this results in gene silencing and the identity of the silenced genes most likely to play a role in the tumours' biology have not yet been established. In this study, genome-wide methylation and expression analysis of GCT cell lines was combined with gene expression data from primary tumours to address this question. Genome methylation was analysed using the Illumina infinium HumanMethylome450 bead chip system and gene expression was analysed using Affymetrix GeneChip Human Genome U133 Plus 2.0 arrays. Regulation by methylation was confirmed by demethylation using 5-aza-2-deoxycytidine and reverse transcription-quantitative PCR. Large differences in the level of methylation of the CpG islands of individual genes between tumour cell lines correlated well with differential gene expression. Treatment of non-seminoma cells with 5-aza-2-deoxycytidine verified that methylation of all genes tested played a role in their silencing in yolk sac tumour cells and many of these genes were also differentially expressed in primary tumours. Genes silenced by methylation in the various GCT cell lines were identified. Several pluripotency-associated genes were identified as a major functional group of silenced genes.

The number of killings in southern rural Norway, 1300–1569

OpenAIRE

Kadane, Joseph B.; Næshagen, Ferdinand L.

2013-01-01

Three dual systems estimates are employed to study the number of killings in southern rural Norway in a period of slightly over 250 years. The first system is a set of five letters sent to each killer as part of the legal process. The second system is the mention of killings from all other contemporary sources. The posterior distributions derived suggest fewer such killings than rough demographic estimates.

Breaking an epigenetic chromatin switch: curious features of hysteresis in Saccharomyces cerevisiae telomeric silencing.

Directory of Open Access Journals (Sweden)

Vijayalakshmi H Nagaraj

Full Text Available In addition to gene network switches, local epigenetic modifications to DNA and histones play an important role in all-or-none cellular decision-making. Here, we study the dynamical design of a well-characterized epigenetic chromatin switch: the yeast SIR system, in order to understand the origin of the stability of epigenetic states. We study hysteresis in this system by perturbing it with a histone deacetylase inhibitor. We find that SIR silencing has many characteristics of a non-linear bistable system, as observed in conventional genetic switches, which are based on activities of a few promoters affecting each other through the abundance of their gene products. Quite remarkably, our experiments in yeast telomeric silencing show a very distinctive pattern when it comes to the transition from bistability to monostability. In particular, the loss of the stable silenced state, upon increasing the inhibitor concentration, does not seem to show the expected saddle node behavior, instead looking like a supercritical pitchfork bifurcation. In other words, the 'off' state merges with the 'on' state at a threshold concentration leading to a single state, as opposed to the two states remaining distinct up to the threshold and exhibiting a discontinuous jump from the 'off' to the 'on' state. We argue that this is an inevitable consequence of silenced and active regions coexisting with dynamic domain boundaries. The experimental observations in our study therefore have broad implications for the understanding of chromatin silencing in yeast and beyond.

How Effective Is Road Mitigation at Reducing Road-Kill? A Meta-Analysis.

Science.gov (United States)

Rytwinski, Trina; Soanes, Kylie; Jaeger, Jochen A G; Fahrig, Lenore; Findlay, C Scott; Houlahan, Jeff; van der Ree, Rodney; van der Grift, Edgar A

2016-01-01

Road traffic kills hundreds of millions of animals every year, posing a critical threat to the populations of many species. To address this problem there are more than forty types of road mitigation measures available that aim to reduce wildlife mortality on roads (road-kill). For road planners, deciding on what mitigation method to use has been problematic because there is little good information about the relative effectiveness of these measures in reducing road-kill, and the costs of these measures vary greatly. We conducted a meta-analysis using data from 50 studies that quantified the relationship between road-kill and a mitigation measure designed to reduce road-kill. Overall, mitigation measures reduce road-kill by 40% compared to controls. Fences, with or without crossing structures, reduce road-kill by 54%. We found no detectable effect on road-kill of crossing structures without fencing. We found that comparatively expensive mitigation measures reduce large mammal road-kill much more than inexpensive measures. For example, the combination of fencing and crossing structures led to an 83% reduction in road-kill of large mammals, compared to a 57% reduction for animal detection systems, and only a 1% for wildlife reflectors. We suggest that inexpensive measures such as reflectors should not be used until and unless their effectiveness is tested using a high-quality experimental approach. Our meta-analysis also highlights the fact that there are insufficient data to answer many of the most pressing questions that road planners ask about the effectiveness of road mitigation measures, such as whether other less common mitigation measures (e.g., measures to reduce traffic volume and/or speed) reduce road mortality, or to what extent the attributes of crossing structures and fences influence their effectiveness. To improve evaluations of mitigation effectiveness, studies should incorporate data collection before the mitigation is applied, and we recommend a

How Effective Is Road Mitigation at Reducing Road-Kill? A Meta-Analysis.

Directory of Open Access Journals (Sweden)

Trina Rytwinski

Full Text Available Road traffic kills hundreds of millions of animals every year, posing a critical threat to the populations of many species. To address this problem there are more than forty types of road mitigation measures available that aim to reduce wildlife mortality on roads (road-kill. For road planners, deciding on what mitigation method to use has been problematic because there is little good information about the relative effectiveness of these measures in reducing road-kill, and the costs of these measures vary greatly. We conducted a meta-analysis using data from 50 studies that quantified the relationship between road-kill and a mitigation measure designed to reduce road-kill. Overall, mitigation measures reduce road-kill by 40% compared to controls. Fences, with or without crossing structures, reduce road-kill by 54%. We found no detectable effect on road-kill of crossing structures without fencing. We found that comparatively expensive mitigation measures reduce large mammal road-kill much more than inexpensive measures. For example, the combination of fencing and crossing structures led to an 83% reduction in road-kill of large mammals, compared to a 57% reduction for animal detection systems, and only a 1% for wildlife reflectors. We suggest that inexpensive measures such as reflectors should not be used until and unless their effectiveness is tested using a high-quality experimental approach. Our meta-analysis also highlights the fact that there are insufficient data to answer many of the most pressing questions that road planners ask about the effectiveness of road mitigation measures, such as whether other less common mitigation measures (e.g., measures to reduce traffic volume and/or speed reduce road mortality, or to what extent the attributes of crossing structures and fences influence their effectiveness. To improve evaluations of mitigation effectiveness, studies should incorporate data collection before the mitigation is applied, and we

How Effective Is Road Mitigation at Reducing Road-Kill? A Meta-Analysis

Science.gov (United States)

Rytwinski, Trina; Soanes, Kylie; Jaeger, Jochen A. G.; Fahrig, Lenore; Findlay, C. Scott; Houlahan, Jeff; van der Ree, Rodney; van der Grift, Edgar A

2016-01-01

Road traffic kills hundreds of millions of animals every year, posing a critical threat to the populations of many species. To address this problem there are more than forty types of road mitigation measures available that aim to reduce wildlife mortality on roads (road-kill). For road planners, deciding on what mitigation method to use has been problematic because there is little good information about the relative effectiveness of these measures in reducing road-kill, and the costs of these measures vary greatly. We conducted a meta-analysis using data from 50 studies that quantified the relationship between road-kill and a mitigation measure designed to reduce road-kill. Overall, mitigation measures reduce road-kill by 40% compared to controls. Fences, with or without crossing structures, reduce road-kill by 54%. We found no detectable effect on road-kill of crossing structures without fencing. We found that comparatively expensive mitigation measures reduce large mammal road-kill much more than inexpensive measures. For example, the combination of fencing and crossing structures led to an 83% reduction in road-kill of large mammals, compared to a 57% reduction for animal detection systems, and only a 1% for wildlife reflectors. We suggest that inexpensive measures such as reflectors should not be used until and unless their effectiveness is tested using a high-quality experimental approach. Our meta-analysis also highlights the fact that there are insufficient data to answer many of the most pressing questions that road planners ask about the effectiveness of road mitigation measures, such as whether other less common mitigation measures (e.g., measures to reduce traffic volume and/or speed) reduce road mortality, or to what extent the attributes of crossing structures and fences influence their effectiveness. To improve evaluations of mitigation effectiveness, studies should incorporate data collection before the mitigation is applied, and we recommend a

Silencing of the rotavirus NSP4 protein decreases the incidence of biliary atresia in murine model.

Directory of Open Access Journals (Sweden)

Jiexiong Feng

Full Text Available Biliary atresia is a common disease in neonates which causes obstructive jaundice and progressive hepatic fibrosis. Our previous studies indicate that rotavirus infection is an initiator in the pathogenesis of experimental biliary atresia (BA through the induction of increased nuclear factor-kappaB and abnormal activation of the osteopontin inflammation pathway. In the setting of rotavirus infection, rotavirus nonstructural protein 4 (NSP4 serves as an important immunogen, viral protein 7 (VP7 is necessary in rotavirus maturity and viral protein 4 (VP4 is a virulence determiner. The purpose of the current study is to clarify the roles of NSP4, VP7 and VP4 in the pathogenesis of experimental BA. Primary cultured extrahepatic biliary epithelia were infected with Rotavirus (mmu18006. Small interfering RNA targeting NSP4, VP7 or VP4 was transfected before rotavirus infection both in vitro and in vivo. We analyzed the incidence of BA, morphological change, morphogenesis of viral particles and viral mRNA and protein expression. The in vitro experiments showed NSP4 silencing decreased the levels of VP7 and VP4, reduced viral particles and decreased cytopathic effect. NSP4-positive cells had strongly positive expression of integrin subunit α2. Silencing of VP7 or VP4 partially decreased epithelial injury. Animal experiments indicated after NSP4 silencing, mouse pups had lower incidence of BA than after VP7 or VP4 silencing. However, 33.3% of VP4-silenced pups (N = 6 suffered BA and 50% of pups (N = 6 suffered biliary injury after VP7 silencing. Hepatic injury was decreased after NSP4 or VP4 silencing. Neither VP4 nor VP7 were detected in the biliary ducts after NSP4. All together, NSP4 silencing down-regulates VP7 and VP4, resulting in decreased incidence of BA.

Dirac operators and Killing spinors with torsion; Dirac-Operatoren und Killing-Spinoren mit Torsion

Energy Technology Data Exchange (ETDEWEB)

Becker-Bender, Julia

2012-12-17

On a Riemannian spin manifold with parallel skew torsion, we use the twistor operator to obtain an eigenvalue estimate for the Dirac operator with torsion. We consider the equality case in dimensions four and six. In odd dimensions we describe Sasaki manifolds on which equality in the estimate is realized by Killing spinors with torsion. In dimension five we characterize all Killing spinors with torsion and obtain certain naturally reductive spaces as exceptional cases.

The VP3 factor from viruses of Birnaviridae family suppresses RNA silencing by binding both long and small RNA duplexes.

Directory of Open Access Journals (Sweden)

Adrian Valli

Full Text Available RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.

The Curious Silence of the Dog and Paul of Tarsus; Revisiting The Argument from Silence

Directory of Open Access Journals (Sweden)

Michael Gary Duncan

2012-03-01

Full Text Available In this essay I propose an interpretative and explanatory structure for the so-called argumentum ex silento, or argument from silence (henceforth referred to as the AFS. To this end, I explore two examples, namely, Sherlock Holmes’s oft-quoted notice of the “curious incident of the dog in the night-time” from Arthur Conan Doyle’s short story “Silver Blaze,” and the historical question of Paul of Tarsus’s silence on biographical details of the historical Jesus. Through these cases, I conclude that the AFS serves as a dialogical topos best evaluated and understood through the perceived authority of the arguer and the willingness of the audience to accept that authority, due to the “curious” nature of the negative evidence that the argument employed.

Mitochondrial calcium uniporter silencing potentiates caspase-independent cell death in MDA-MB-231 breast cancer cells

Energy Technology Data Exchange (ETDEWEB)

Curry, Merril C.; Peters, Amelia A. [School of Pharmacy, The University of Queensland, Brisbane, Queensland 4072 (Australia); Kenny, Paraic A. [Department of Developmental and Molecular Biology, Albert Einstein College of Medicine, Bronx, New York 10461 (United States); Roberts-Thomson, Sarah J. [School of Pharmacy, The University of Queensland, Brisbane, Queensland 4072 (Australia); Monteith, Gregory R., E-mail: gregm@uq.edu.au [School of Pharmacy, The University of Queensland, Brisbane, Queensland 4072 (Australia)

2013-05-10

Highlights: •Some clinical breast cancers are associated with MCU overexpression. •MCU silencing did not alter cell death initiated with the Bcl-2 inhibitor ABT-263. •MCU silencing potentiated caspase-independent cell death initiated by ionomycin. •MCU silencing promoted ionomycin-mediated cell death without changes in bulk Ca{sup 2+}. -- Abstract: The mitochondrial calcium uniporter (MCU) transports free ionic Ca{sup 2+} into the mitochondrial matrix. We assessed MCU expression in clinical breast cancer samples using microarray analysis and the consequences of MCU silencing in a breast cancer cell line. Our results indicate that estrogen receptor negative and basal-like breast cancers are characterized by elevated levels of MCU. Silencing of MCU expression in the basal-like MDA-MB-231 breast cancer cell line produced no change in proliferation or cell viability. However, distinct consequences of MCU silencing were seen on cell death pathways. Caspase-dependent cell death initiated by the Bcl-2 inhibitor ABT-263 was not altered by MCU silencing; whereas caspase-independent cell death induced by the calcium ionophore ionomycin was potentiated by MCU silencing. Measurement of cytosolic Ca{sup 2+} levels showed that the promotion of ionomycin-induced cell death by MCU silencing occurs independently of changes in bulk cytosolic Ca{sup 2+} levels. This study demonstrates that MCU overexpression is a feature of some breast cancers and that MCU overexpression may offer a survival advantage against some cell death pathways. MCU inhibitors may be a strategy to increase the effectiveness of therapies that act through the induction of caspase-independent cell death pathways in estrogen receptor negative and basal-like breast cancers.

γ-rays kill grasshopper primary spermatocytes in groups

International Nuclear Information System (INIS)

Al-Taweel, A.A.; Shawkit, M.A.; Fox, D.P.

1985-01-01

Primary spermatocyte killing by γ-rays was studied in the grasshopper Heteracris littoralis in which spermatogenic development occurs in cysts containing a maximum of 64 cells during the first meiotic division. Cell killing at this stage is not random and mainly involves the death of whole cysts. The dose-response curve for cell killing has complex kinetics with at least two components but lacks any shoulder at low doses, thus indicating no repair of the lethal damage. Cell loss is apparent from surviving cysts as early as 45 min post irradiation but loss of > 24 cells is incompatible with cyst survival. Loss of fewer than 24 cells also is not random since certain values for cell loss are frequently observed while other, interspersed values are not seen at all. (Auth.)

Surprised by Bird, Bard, and Bach: Language, Silence, and Transcendence.

Science.gov (United States)

Suhor, Charles

1991-01-01

Argues the importance of the relationships among silence and literature, the arts, and other experiences that point toward transcendence. Suggests that English teachers can expand the repertoire of classroom activities and teaching techniques that make use of silence. (KEH)

Comparison of two mathematical models for describing heat-induced cell killing

International Nuclear Information System (INIS)

Roti Roti, J.L.; Henle, K.J.

1980-01-01

A computer-based minimization algorithm is utilized to obtain the optimum fits of two models to hyperthermic cell killing data. The models chosen are the multitarget, single-hit equation, which is in general use, and the linear-quadratic equation, which has been applied to cell killing by ionizing irradiation but not to heat-induced cell killing. The linear-quadratic equation fits hyperthermic cell killing data as well as the multitarget, single-hit equation. Both parameters of the linear-quadratic equation obey the Arrhenius law, whereas only one of the two parameters of the multitarget, single-hit equation obeys the Arrhenius law. Thus the linear-quadratic function can completely define cell killing as a function of both time and temperature. In addition, the linear-quadratic model will provide a simplified approach to the study of the synergism between heat and X irradiation

Strategy of gene silencing in cassava for validation of resistance genes

International Nuclear Information System (INIS)

Cortes, Simon; Lopez, Camilo

2010-01-01

Cassava (Manihot esculenta) is a major source of food for more than 1000 million people in the world and constitutes an important staple crop. Cassava bacterial blight, caused by the gram negative bacterium Xanthomonas axonopodis pv. manihotis, is one of the most important constraints for this crop. A candidate resistance gene against cassava bacterial blight, named RXam1, has been identified previously. In this work, we employed the gene silencing approach using the African cassava mosaic virus (ACMV) to validate the function of the RXam1 gene. We used as positive control the su gen, which produce photo blanching in leaves when is silenced. Plants from the SG10735 variety were bombardment with the ACMV-A-SU+ACMV-B y ACMV-A-RXam1+ACMV-B constructions. The silencing efficiency employing the su gene was low, only one of seven plants showed photo blanching. In the putative silenced plants for the RXam1 gene, no presence of siRNAs corresponding to RXam1 was observed; although a low diminution of the RXam1 gene expression was obtained. The growth curves for the Xam strain CIO136 in cassava plants inoculated showing a little but no significance difference in the susceptibility in the silenced plants compared to not silenced

SAD-3, a Putative Helicase Required for Meiotic Silencing by Unpaired DNA, Interacts with Other Components of the Silencing Machinery

Science.gov (United States)

Hammond, Thomas M.; Xiao, Hua; Boone, Erin C.; Perdue, Tony D.; Pukkila, Patricia J.; Shiu, Patrick K. T.

2011-01-01

In Neurospora crassa, genes lacking a pairing partner during meiosis are suppressed by a process known as meiotic silencing by unpaired DNA (MSUD). To identify novel MSUD components, we have developed a high-throughput reverse-genetic screen for use with the N. crassa knockout library. Here we describe the screening method and the characterization of a gene (sad-3) subsequently discovered. SAD-3 is a putative helicase required for MSUD and sexual spore production. It exists in a complex with other known MSUD proteins in the perinuclear region, a center for meiotic silencing activity. Orthologs of SAD-3 include Schizosaccharomyces pombe Hrr1, a helicase required for RNAi-induced heterochromatin formation. Both SAD-3 and Hrr1 interact with an RNA-directed RNA polymerase and an Argonaute, suggesting that certain aspects of silencing complex formation may be conserved between the two fungal species. PMID:22384347

Active compressor engine silencer reduces exhaust noise

International Nuclear Information System (INIS)

Denenberg, J.N.; Miller, S.K.; Jay, M.A.

1994-01-01

An active industrial silencer on a compressor engine at a Tenneco Gas station has reduced low-frequency 'rumbling' noise by 8 dB during trials while lowering backpressure about 90$. This 8 dB reduction of the piston firing frequency corresponds to a more than 80% decrease in emitted acoustic power. The silencing unit, installed on one of six engines at the station near Eden, N.Y., continues in operation. Based on the results, the manufacturer is identifying additional compressor sites for further tests. This paper reviews this project

Honor Killing: Where Pride Defeats Reason.

Science.gov (United States)

Kanchan, Tanuj; Tandon, Abhishek; Krishan, Kewal

2016-12-01

Honor killings are graceless and ferocious murders by chauvinists with an antediluvian mind. These are categorized separately because these killings are committed for the prime reason of satisfying the ego of the people whom the victim trusts and always looks up to for support and protection. It is for this sole reason that honor killings demand strict and stern punishment, not only for the person who committed the murder but also for any person who contributed or was party to the act. A positive change can occur with stricter legislation and changes in the ethos of the society we live in today.

Contagion in Mass Killings and School Shootings.

Directory of Open Access Journals (Sweden)

Sherry Towers

Full Text Available Several past studies have found that media reports of suicides and homicides appear to subsequently increase the incidence of similar events in the community, apparently due to the coverage planting the seeds of ideation in at-risk individuals to commit similar acts.Here we explore whether or not contagion is evident in more high-profile incidents, such as school shootings and mass killings (incidents with four or more people killed. We fit a contagion model to recent data sets related to such incidents in the US, with terms that take into account the fact that a school shooting or mass murder may temporarily increase the probability of a similar event in the immediate future, by assuming an exponential decay in contagiousness after an event.We find significant evidence that mass killings involving firearms are incented by similar events in the immediate past. On average, this temporary increase in probability lasts 13 days, and each incident incites at least 0.30 new incidents (p = 0.0015. We also find significant evidence of contagion in school shootings, for which an incident is contagious for an average of 13 days, and incites an average of at least 0.22 new incidents (p = 0.0001. All p-values are assessed based on a likelihood ratio test comparing the likelihood of a contagion model to that of a null model with no contagion. On average, mass killings involving firearms occur approximately every two weeks in the US, while school shootings occur on average monthly. We find that state prevalence of firearm ownership is significantly associated with the state incidence of mass killings with firearms, school shootings, and mass shootings.

Contagion in Mass Killings and School Shootings.

Science.gov (United States)

Towers, Sherry; Gomez-Lievano, Andres; Khan, Maryam; Mubayi, Anuj; Castillo-Chavez, Carlos

2015-01-01

Several past studies have found that media reports of suicides and homicides appear to subsequently increase the incidence of similar events in the community, apparently due to the coverage planting the seeds of ideation in at-risk individuals to commit similar acts. Here we explore whether or not contagion is evident in more high-profile incidents, such as school shootings and mass killings (incidents with four or more people killed). We fit a contagion model to recent data sets related to such incidents in the US, with terms that take into account the fact that a school shooting or mass murder may temporarily increase the probability of a similar event in the immediate future, by assuming an exponential decay in contagiousness after an event. We find significant evidence that mass killings involving firearms are incented by similar events in the immediate past. On average, this temporary increase in probability lasts 13 days, and each incident incites at least 0.30 new incidents (p = 0.0015). We also find significant evidence of contagion in school shootings, for which an incident is contagious for an average of 13 days, and incites an average of at least 0.22 new incidents (p = 0.0001). All p-values are assessed based on a likelihood ratio test comparing the likelihood of a contagion model to that of a null model with no contagion. On average, mass killings involving firearms occur approximately every two weeks in the US, while school shootings occur on average monthly. We find that state prevalence of firearm ownership is significantly associated with the state incidence of mass killings with firearms, school shootings, and mass shootings.

Marie Nimier, au cœur du silence

Directory of Open Access Journals (Sweden)

Joëlle Papillon

2012-01-01

Full Text Available Dans La Reine du silence, Marie Nimier se confronte à la figure de son père, l’écrivain Roger Nimier, mort lorsqu’elle avait cinq ans. Elle y montre le poids qui pèse sur l’enfant d’écrivain, mais aussi celui de l’héritage du secret familial et de l’injonction au silence. La difficulté de l’élaboration de son récit de filiation se révèle dans les constants recommencements et reformulations, qui constituent la marque de la tension angoissante entre l’obligation de dire et celle de taire. In La Reine du silence, Marie Nimier confronts her father’s memory – the writer Roger Nimier, who died when she was five years old. The novel describes the burden of being a writer’s child, along with that of inheriting family secrets and submitting to a code of silence. The difficulty of recounting her relationship with her late father is evidenced by the narrator’s numerous “false starts” and her constant rewritings. The hesitant nature of the narration captures an anguish born of two irreconcilable obligations : the need to put things into words and the pressure to remain silent.

Leadership Matters : The Effects of Targeted Killings on Militant Group Tactics

NARCIS (Netherlands)

Abrahms, Max; Mierau, Jochen

2017-01-01

Targeted killings have become a central component of counter-terrorism strategy. In response to the unprecedented prevalence of this strategy around the world, numerous empirical studies have recently examined whether "decapitating" militant groups with targeted killings is strategically effective.

Vertebrate road kill survey on a highway in southern Brazil

Directory of Open Access Journals (Sweden)

Luiz Liberato Costa Corrêa

2017-06-01

Full Text Available Highways are a major factor acting in the decline of several wildlife populations. Impact occurs due to the continuous flow of motor vehicles over tracks and collision with animals using the same area. This study aimed to list road killed wild vertebrates found in highways in the Pampa Biome, state of Rio Grande do Sul, over an entire year. The taxa found (amphibians, reptiles, birds and mammals were identified to species level and their frequency of occurrence was seasonally registered. Along 2,160 km, we found 318 road killed individuals, totaling 65 species. This number represents an average of 0.147 road killed specimens by kilometer (that is, 1 individual each 7 km. Of these, seven species are under threat of extinction in the state of Rio Grande do Sul. We also found a seasonal pattern among road kills, in which the highest number of road killed animals was registered in the summer and spring months. These results contribute to increase knowledge about which species are most impacted by road kill on highways of the Pampa Biome. Such data can be used as an indicator for the implementation of measures by competent bodies to mitigate impacts of highways in the state of Rio Grande do Sul.

Development of a virus-induced gene silencing (VIGS) system for Spinacia oleracea L

DEFF Research Database (Denmark)

Lee, Jungmin; Cao, Dang Viet; Kim, Jiwon

2017-01-01

Virus-induced gene silencing (VIGS) is known as a rapid and efficient system for studying functions of interesting genes in plants. Tobacco rattle virus (TRV) is widely applied for the gene silencing of many plants. Although spinach is a TRV-susceptible plant, a TRV-based VIGS system has not yet ...

Opinions of university students on honour killings: Perspective from Islamabad and Rawalpindi.

Science.gov (United States)

Shaikh, Masood Ali; Kamal, Anila; Naqvi, Irum

2015-04-01

Honour killing incidents have been reported from every province of Pakistan. In 2014 a pregnant woman was killed in front of Lahore High Court, by her family members, in the name of honour. This study was conducted to determine the perspective of university students on honour killing with specific reference to one such killing incident in Lahore. Cumulatively, 989 students participated in the survey. Compared with female students, male students were less likely to agree and were more unequivocal that a woman has a right to marry any man she wants despite her family's disapproval, in a statistically significant manner. Similarly, male students were statistically significantly more likely to report that killing in the name of honour is always justified and were less equivocal about it compared to female students. Nonetheless, cumulatively 824 (83.3%) students believed that killing in the name of honour is not always justified.

Strain Specific Factors Control Effector Gene Silencing in Phytophthora sojae.

Directory of Open Access Journals (Sweden)

Sirjana Devi Shrestha

Full Text Available The Phytophthora sojae avirulence gene Avr3a encodes an effector that is capable of triggering immunity on soybean plants carrying the resistance gene Rps3a. P. sojae strains that express Avr3a are avirulent to Rps3a plants, while strains that do not are virulent. To study the inheritance of Avr3a expression and virulence towards Rps3a, genetic crosses and self-fertilizations were performed. A cross between P. sojae strains ACR10 X P7076 causes transgenerational gene silencing of Avr3a allele, and this effect is meiotically stable up to the F5 generation. However, test-crosses of F1 progeny (ACR10 X P7076 with strain P6497 result in the release of silencing of Avr3a. Expression of Avr3a in the progeny is variable and correlates with the phenotypic penetrance of the avirulence trait. The F1 progeny from a direct cross of P6497 X ACR10 segregate for inheritance for Avr3a expression, a result that could not be explained by parental imprinting or heterozygosity. Analysis of small RNA arising from the Avr3a gene sequence in the parental strains and hybrid progeny suggests that the presence of small RNA is necessary but not sufficient for gene silencing. Overall, we conclude that inheritance of the Avr3a gene silenced phenotype relies on factors that are variable among P. sojae strains.

Competition between apex predators? Brown bears decrease wolf kill rate on two continents.

Science.gov (United States)

Tallian, Aimee; Ordiz, Andrés; Metz, Matthew C; Milleret, Cyril; Wikenros, Camilla; Smith, Douglas W; Stahler, Daniel R; Kindberg, Jonas; MacNulty, Daniel R; Wabakken, Petter; Swenson, Jon E; Sand, Håkan

2017-02-08

Trophic interactions are a fundamental topic in ecology, but we know little about how competition between apex predators affects predation, the mechanism driving top-down forcing in ecosystems. We used long-term datasets from Scandinavia (Europe) and Yellowstone National Park (North America) to evaluate how grey wolf ( Canis lupus ) kill rate was affected by a sympatric apex predator, the brown bear ( Ursus arctos ). We used kill interval (i.e. the number of days between consecutive ungulate kills) as a proxy of kill rate. Although brown bears can monopolize wolf kills, we found no support in either study system for the common assumption that they cause wolves to kill more often. On the contrary, our results showed the opposite effect. In Scandinavia, wolf packs sympatric with brown bears killed less often than allopatric packs during both spring (after bear den emergence) and summer. Similarly, the presence of bears at wolf-killed ungulates was associated with wolves killing less often during summer in Yellowstone. The consistency in results between the two systems suggests that brown bear presence actually reduces wolf kill rate. Our results suggest that the influence of predation on lower trophic levels may depend on the composition of predator communities. © 2017 The Authors.

ANALYZE THE IMPACT OF HABITAT PATCHES ON WILDLIFE ROAD-KILL

Directory of Open Access Journals (Sweden)

S. Seok

2015-10-01

Full Text Available The ecosystem fragmentation due to transportation infrastructure causes a road-kill phenomenon. When making policies for mitigating road-kill it is important to select target-species in order to enhance its efficiency. However, many wildlife crossing structures have been questioned regarding their effectiveness due to lack of considerations such as target-species selection, site selection, management, etc. The purpose of this study is to analyse the impact of habitat patches on wildlife road-kill and to suggest that spatial location of habitat patches should be considered as one of the important factors when making policies for mitigating road-kill. Habitat patches were presumed from habitat variables and a suitability index on target-species that was chosen by literature review. The road-kill hotspot was calculated using Getis-Ord Gi*. After that, we performed a correlation analysis between Gi Z-score and the distance from habitat patches to the roads. As a result, there is a low negative correlation between two variables and it increases the Gi Z-score if the habitat patches and the roads become closer.

Analyze the Impact of Habitat Patches on Wildlife Road-Kill

Science.gov (United States)

Seok, S.; Lee, J.

2015-10-01

The ecosystem fragmentation due to transportation infrastructure causes a road-kill phenomenon. When making policies for mitigating road-kill it is important to select target-species in order to enhance its efficiency. However, many wildlife crossing structures have been questioned regarding their effectiveness due to lack of considerations such as target-species selection, site selection, management, etc. The purpose of this study is to analyse the impact of habitat patches on wildlife road-kill and to suggest that spatial location of habitat patches should be considered as one of the important factors when making policies for mitigating road-kill. Habitat patches were presumed from habitat variables and a suitability index on target-species that was chosen by literature review. The road-kill hotspot was calculated using Getis-Ord Gi*. After that, we performed a correlation analysis between Gi Z-score and the distance from habitat patches to the roads. As a result, there is a low negative correlation between two variables and it increases the Gi Z-score if the habitat patches and the roads become closer.

The great silence science and philosophy of Fermi's paradox

CERN Document Server

Cirkovic, Milan M

2018-01-01

The Great Silence explores the multifaceted problem named after the great Italian physicist Enrico Fermi and his legendary 1950 lunchtime question "Where is everybody?" In many respects, Fermi's paradox is the richest and the most challenging problem for the entire field of astrobiology and the Search for ExtraTerrestrial Intelligence (SETI) studies. This book shows how Fermi's paradox is intricately connected with many fields of learning, technology, arts, and even everyday life. It aims to establish the strongest possible version of the problem, to dispel many related confusions, obfuscations, and prejudices, as well as to offer a novel point of entry to the many solutions proposed in existing literature. Cirkovic argues that any evolutionary worldview cannot avoid resolving the Great Silence problem in one guise or another.

Validation of RNAi Silencing Efficiency Using Gene Array Data shows 18.5% Failure Rate across 429 Independent Experiments

Directory of Open Access Journals (Sweden)

Gyöngyi Munkácsy

2016-01-01

Full Text Available No independent cross-validation of success rate for studies utilizing small interfering RNA (siRNA for gene silencing has been completed before. To assess the influence of experimental parameters like cell line, transfection technique, validation method, and type of control, we have to validate these in a large set of studies. We utilized gene chip data published for siRNA experiments to assess success rate and to compare methods used in these experiments. We searched NCBI GEO for samples with whole transcriptome analysis before and after gene silencing and evaluated the efficiency for the target and off-target genes using the array-based expression data. Wilcoxon signed-rank test was used to assess silencing efficacy and Kruskal–Wallis tests and Spearman rank correlation were used to evaluate study parameters. All together 1,643 samples representing 429 experiments published in 207 studies were evaluated. The fold change (FC of down-regulation of the target gene was above 0.7 in 18.5% and was above 0.5 in 38.7% of experiments. Silencing efficiency was lowest in MCF7 and highest in SW480 cells (FC = 0.59 and FC = 0.30, respectively, P = 9.3E−06. Studies utilizing Western blot for validation performed better than those with quantitative polymerase chain reaction (qPCR or microarray (FC = 0.43, FC = 0.47, and FC = 0.55, respectively, P = 2.8E−04. There was no correlation between type of control, transfection method, publication year, and silencing efficiency. Although gene silencing is a robust feature successfully cross-validated in the majority of experiments, efficiency remained insufficient in a significant proportion of studies. Selection of cell line model and validation method had the highest influence on silencing proficiency.

"To Kill A Mockingbird": Then and Now--A 35th Anniversary Celebration. Teacher Study Guide.

Science.gov (United States)

National Council of Teachers of English, Urbana, IL.

This study guide offers a different approach, teleconferencing, to new information, ideas, and resources on the film, "To Kill a Mockingbird." Following general information on "then and now," the guide consists of sections entitled: Preparing to Teach TKM: Special Considerations (by Charles Suhor and Larry Bell); Historical…

It’s Not Just Conflict That Motivates Killing of Orangutans

Science.gov (United States)

Davis, Jacqueline T.; Mengersen, Kerrie; Abram, Nicola K.; Ancrenaz, Marc; Wells, Jessie A.; Meijaard, Erik

2013-01-01

We investigated why orangutans are being killed in Kalimantan, Indonesia, and the role of conflict in these killings. Based on an analysis of interview data from over 5,000 respondents in over 450 villages, we also assessed the socio-ecological factors associated with conflict and non-conflict killings. Most respondents never kill orangutans. Those who reported having personally killed an orangutan primarily did so for non-conflict reasons; for example, 56% of these respondents said that the reason they had killed an orangutan was to eat it. Of the conflict-related reasons for killing, the most common reasons orangutans were killed was fear of orangutans or in self-defence. A similar pattern was evident among reports of orangutan killing by other people in the villages. Regression analyses indicated that religion and the percentage of intact forest around villages were the strongest socio-ecological predictors of whether orangutans were killed for conflict or non-conflict related reasons. Our data indicate that between 44,170 and 66,570 orangutans were killed in Kalimantan within the respondents’ active hunting lifetimes: between 12,690 and 29,024 for conflict reasons (95%CI) and between 26,361 and 41,688 for non-conflict reasons (95% CI). These findings confirm that habitat protection alone will not ensure the survival of orangutans in Indonesian Borneo, and that effective reduction of orangutan killings is urgently needed. PMID:24130707

Strategies for Improving siRNA-Induced Gene Silencing Efficiency.

Science.gov (United States)

Safari, Fatemeh; Rahmani Barouji, Solmaz; Tamaddon, Ali Mohammad

2017-12-01

Purpose: Human telomerase reverse transcriptase (hTERT) plays a crucial role in tumorigenesis and progression of cancers. Gene silencing of hTERT by short interfering RNA (siRNA) is considered as a promising strategy for cancer gene therapy. Various algorithms have been devised for designing a high efficient siRNA which is a significant issue in the clinical usage. Thereby, in the present study, the relation of siRNA designing criteria and the gene silencing efficiency was evaluated. Methods: The siRNA sequences were designed and characterized by using on line soft wares. Cationic co-polymer (polyethylene glycol-g-polyethylene imine (PEG-g-PEI)) was used for the construction of polyelectrolyte complexes (PECs) containing siRNAs. The cellular uptake of the PECs was evaluated. The gene silencing efficiency of different siRNA sequences was investigated and the effect of observing the rational designing on the functionality of siRNAs was assessed. Results: The size of PEG-g-PEI siRNA with N/P (Nitrogen/Phosphate) ratio of 2.5 was 114 ± 0.645 nm. The transfection efficiency of PECs was desirable (95.5% ± 2.4%.). The results of Real-Time PCR showed that main sequence (MS) reduced the hTERT expression up to 90% and control positive sequence (CPS) up to 63%. These findings demonstrated that the accessibility to the target site has priority than the other criteria such as sequence preferences and thermodynamic features. Conclusion: siRNA opens a hopeful window in cancer therapy which provides a convenient and tolerable therapeutic approach. Thereby, using the set of criteria and rational algorithms in the designing of siRNA remarkably affect the gene silencing efficiency.

Communicative Silences: Forms and Functions

Science.gov (United States)

Bruneau, Thomas J.

1973-01-01

The nature of silence is discussed as an imposition of mind, as an interdependent signification ground for speech signs, as a relationship to mental time (as opposed to artificial time), and as it relates to sensation, perception and metaphorical movement. (Author)

Killing vectors in algebraically special space-times

International Nuclear Information System (INIS)

Torres del Castillo, G.F.

1984-01-01

The form of the isometric, homothetic, and conformal Killing vectors for algebraically special metrics which admit a shear-free congruence of null geodesics is obtained by considering their complexification, using the existence of a congruence of null strings. The Killing equations are partially integrated and the reasons which permit this reduction are exhibited. In the case where the congruence of null strings has a vanishing expansion, the Killing equations are reduced to a single master equation

Quantifying Killing of Orangutans and Human-Orangutan Conflict in Kalimantan, Indonesia

Science.gov (United States)

Meijaard, Erik; Buchori, Damayanti; Hadiprakarsa, Yokyok; Utami-Atmoko, Sri Suci; Nurcahyo, Anton; Tjiu, Albertus; Prasetyo, Didik; Nardiyono; Christie, Lenny; Ancrenaz, Marc; Abadi, Firman; Antoni, I Nyoman Gede; Armayadi, Dedy; Dinato, Adi; Ella; Gumelar, Pajar; Indrawan, Tito P.; Kussaritano; Munajat, Cecep; Priyono, C. Wawan Puji; Purwanto, Yadi; Puspitasari, Dewi; Putra, M. Syukur Wahyu; Rahmat, Abdi; Ramadani, Harri; Sammy, Jim; Siswanto, Dedi; Syamsuri, Muhammad; Andayani, Noviar; Wu, Huanhuan; Wells, Jessie Anne; Mengersen, Kerrie

2011-01-01

Human-orangutan conflict and hunting are thought to pose a serious threat to orangutan existence in Kalimantan, the Indonesian part of Borneo. No data existed prior to the present study to substantiate these threats. We investigated the rates, spatial distribution and causes of conflict and hunting through an interview-based survey in the orangutan's range in Kalimantan, Indonesia. Between April 2008 and September 2009, we interviewed 6983 respondents in 687 villages to obtain socio-economic information, assess knowledge of local wildlife in general and orangutan encounters specifically, and to query respondents about their knowledge on orangutan conflicts and killing, and relevant laws. This survey revealed estimated killing rates of between 750 and 1800 animals killed in the last year, and between 1950 and 3100 animals killed per year on average within the lifetime of the survey respondents. These killing rates are higher than previously thought and are high enough to pose a serious threat to the continued existence of orangutans in Kalimantan. Importantly, the study contributes to our understanding of the spatial variation in threats, and the underlying causes of those threats, which can be used to facilitate the development of targeted conservation management. PMID:22096582

Quantifying killing of orangutans and human-orangutan conflict in Kalimantan, Indonesia.

Directory of Open Access Journals (Sweden)

Erik Meijaard

Full Text Available Human-orangutan conflict and hunting are thought to pose a serious threat to orangutan existence in Kalimantan, the Indonesian part of Borneo. No data existed prior to the present study to substantiate these threats. We investigated the rates, spatial distribution and causes of conflict and hunting through an interview-based survey in the orangutan's range in Kalimantan, Indonesia. Between April 2008 and September 2009, we interviewed 6983 respondents in 687 villages to obtain socio-economic information, assess knowledge of local wildlife in general and orangutan encounters specifically, and to query respondents about their knowledge on orangutan conflicts and killing, and relevant laws. This survey revealed estimated killing rates of between 750 and 1800 animals killed in the last year, and between 1950 and 3100 animals killed per year on average within the lifetime of the survey respondents. These killing rates are higher than previously thought and are high enough to pose a serious threat to the continued existence of orangutans in Kalimantan. Importantly, the study contributes to our understanding of the spatial variation in threats, and the underlying causes of those threats, which can be used to facilitate the development of targeted conservation management.

The effects of thinking in silence on creativity and innovation

NARCIS (Netherlands)

de Vet, A.J.

2007-01-01

This dissertation consists of three empirical studies on the effects of thinking in silence on creativity and innovation. In these studies I use a social psychology and cognitive psychology lens to study creativity and innovation at the individual and at the team level of analysis, using randomized

ORGANIZATIONAL SILENCE: SUATU PENGHAMBAT DALAM MEWUJUDKAN KREATIFITAS ORGANISASIONAL

Directory of Open Access Journals (Sweden)

Berta Bekti Retnawati

2016-11-01

Full Text Available There are powerful forces in many organzations that cause widespread withholding of information about potential problems or issues by employess, this collective-level phenomenon as ‘organizational silence’. One significant effect of organizational silence relates to lack of organizational creativity.There are five major organizational factors that enhance creativity in a work environment: organizational climate, leadership style, organizational culture, resources and skills, the structure and system of an organization. Keywords: organizational silence, organizational creativity

Generalized Killing-Yano equations in D=5 gauged supergravity

International Nuclear Information System (INIS)

Kubiznak, David; Kunduri, Hari K.; Yasui, Yukinori

2009-01-01

We propose a generalization of the (conformal) Killing-Yano equations relevant to D=5 minimal gauged supergravity. The generalization stems from the fact that the dual of the Maxwell flux, the 3-form *F, couples naturally to particles in the background as a 'torsion'. Killing-Yano tensors in the presence of torsion preserve most of the properties of the standard Killing-Yano tensors - exploited recently for the higher-dimensional rotating black holes of vacuum gravity with cosmological constant. In particular, the generalized closed conformal Killing-Yano 2-form gives rise to the tower of generalized closed conformal Killing-Yano tensors of increasing rank which in turn generate the tower of Killing tensors. An example of a generalized Killing-Yano tensor is found for the Chong-Cvetic-Lue-Pope black hole spacetime [Z.W. Chong, M. Cvetic, H. Lu, C.N. Pope, (hep-th/0506029)]. Such a tensor stands behind the separability of the Hamilton-Jacobi, Klein-Gordon, and Dirac equations in this background.

The Gift of Silence

Science.gov (United States)

Haskins, Cathleen

2011-01-01

Slowing down, quieting the mind and body, and experiencing silence nourishes the spirit. Montessori educators are mandated to cultivate not just the intellect but the whole child. They recognize that nurturing the spirit of the child is part of what makes this form of education work so well. This article discusses the benefits of stillness and…

Post-transcriptional silencing of flavonol synthase mRNA in tobacco leads to fruits with arrested seed set.

Directory of Open Access Journals (Sweden)

Monika Mahajan

Full Text Available Flavonoids are synthesized by phenylpropanoid pathway. They are known to participate in large number of physiological and biochemical processes in plants. Parthenocarpy and male sterility has earlier been reported by silencing chalcone synthase (CHS encoding gene. Silencing of CHS has blocked the synthesis of most of useful flavonoids including flavan-3-ols and flavonols. Also, these studies could not identify whether parthenocarpy/male sterility were due to lack of flavan-3-ols or flavonols or both. Flavonol synthase (FLS is an important enzyme of flavonoid pathway that catalyzes the formation of flavonols. In this article, we propose a novel strategy towards the generation of seedless or less-seeded fruits by downregulation of flavonol biosynthesis in tobacco (Nicotiana tabacum cv Xanthi through post-transcriptional gene silencing (PTGS of FLS encoding mRNA. The FLS silenced lines were observed for 20-80% reduction in FLS encoding gene expression and 25-93% reduction in flavonol (quercetin content. Interestingly, these FLS silenced tobacco lines also showed reduction in their anthocyanidins content. While the content of flavan-3-ols (catechin, epi-catechin and epi-gallocatechin was found to be increased in FLS silenced lines. The delayed flowering in FLS silenced lines could be due to decrease in level of indole acetic acid (IAA at apical region of their shoots. Furthermore, the pollen germination was hampered and pollens were unable to produce functional pollen tube in FLS silenced tobacco lines. Pods of FLS silenced lines contained significantly less number of seeds. The in vitro and in vivo studies where 1 µM quercetin was supplied to germination media, documented the restoration of normal pollen germination and pollen tube growth. This finding identified the role of flavonols particularly quercetin in pollen germination as well as in the regulation of plant fertility. Results also suggest a novel approach towards generation of seedless

Sounds and silence: An optical topography study of language recognition at birth

Science.gov (United States)

Peña, Marcela; Maki, Atsushi; Kovaic, Damir; Dehaene-Lambertz, Ghislaine; Koizumi, Hideaki; Bouquet, Furio; Mehler, Jacques

2003-09-01

Does the neonate's brain have left hemisphere (LH) dominance for speech? Twelve full-term neonates participated in an optical topography study designed to assess whether the neonate brain responds specifically to linguistic stimuli. Participants were tested with normal infant-directed speech, with the same utterances played in reverse and without auditory stimulation. We used a 24-channel optical topography device to assess changes in the concentration of total hemoglobin in response to auditory stimulation in 12 areas of the right hemisphere and 12 areas of the LH. We found that LH temporal areas showed significantly more activation when infants were exposed to normal speech than to backward speech or silence. We conclude that neonates are born with an LH superiority to process specific properties of speech.

Simultaneous Silencing of Xylanase Genes in Botrytis cinerea

Directory of Open Access Journals (Sweden)

Néstor García

2017-12-01

Full Text Available The endo-β-1,4-xylanase BcXyn11A is one of several plant cell-wall degrading enzymes that the phytopathogenic fungus Botrytis cinerea secretes during interaction with its hosts. In addition to its enzymatic activity, this protein also acts as an elicitor of the defense response in plants and has been identified as a virulence factor. In the present work, other four endoxylanase coding genes (Bcxyn11B, Bcxyn11C, Bcxyn10A, and Bcxyn10B were identified in the B. cinerea genome and the expression of all five genes was analyzed by Q-RT- PCR in vitro and in planta. A cross-regulation between xylanase genes was identified analyzing their expression pattern in the ΔBcxyn11A mutant strain and a putative BcXyn11A-dependt induction of Bcxyn10B gene was found. In addition, multiple knockdown strains were obtained for the five endoxylanase genes by transformation of B. cinerea with a chimeric DNA construct composed of 50-nt sequences from the target genes. The silencing of each xylanase gene was analyzed in axenic cultures and during infection and the results showed that the efficiency of the multiple silencing depends on the growth conditions and on the cross-regulation between them. Although the simultaneous silencing of the five genes was observed by Q-RT-PCR when the silenced strains were grown on medium supplemented with tomato extract, the endoxylanase activity measured in the supernatants was reduced only by 40%. Unexpectedly, the silenced strains overexpressed the Bcxyn11A and Bcxyn11C genes during the infection of tomato leaves, making difficult the analysis of the role of the endo-β-1,4-xylanases in the virulence of the fungus.

Strategies underlying RNA silencing suppression by negative strand RNA viruses

NARCIS (Netherlands)

Hemmes, J.C.

2007-01-01

The research described in this thesis focused on the strategies of negative strand RNA viruses to counteract antiviral RNA silencing. In plants and insects, RNA silencing has been shown to act as a sequence specific antiviral defence mechanism that is characterised by the processing of double

Le silence, ce cri qui résonne dans l’écriture de Viviane Forrester

Directory of Open Access Journals (Sweden)

Amelia Peral Crespo

2015-11-01

Full Text Available The Holocaust Literature is tied to Silence from its beginning as the writing to silence. Write about the Holocaust and relate the experiences lived in first person or transmit them to the coming generations means leaving the silence which, for years, was the ideal refuge. This research focuses on the literary production of Viviane Forrester. The different expressions of silence that characterize her writings are analyzed. Silence is the cry that underlies in the most profound of the human being that return from the concentration camps, as Lazarus from the dead. It is a silence that grows to a cry because Forrester’s writing, almost in parallel to the fragmentary writing of Blanchot, an-nounces livre à venir, expressing the cry in silence without the ending of the word

Silence and Memories of War: An Autoethnographic Exploration of Family Secrecy.

Science.gov (United States)

Rober, Peter; Rosenblatt, Paul C

2017-03-01

A personal journey and a scientific challenge, this is an autoethnographic study about my own family's secrecy. I knew my grandfather had been a German prisoner of war during World War II. We all knew. But nobody talked about it. Then one day I decided I wanted to do systematic research on the issue of family secrecy around my grandfather's war experiences. Researching one's own family can be called autoethnography. It could be said that autoethnography is an approach to research that aims to describe and systemically analyze (graphy) personal experience (auto) to understand social and cultural phenomena (ethno). This scientific approach is quite new in the field of family therapy. This study has been an important personal quest, but it also led to important reflections on silences in families, on my own professional development, and on methodological issues concerning autoethnographical research. For one thing, it highlights some of the positive aspects of family secrecy and silences, and invites us-when confronted with family secrecy in clinical practice-to carefully consider the potential destructive and life-giving aspects of the silence. © 2015 Family Process Institute.

Relationship between Organizational Mobbing and Silence Behavior among Teachers

Science.gov (United States)

Hüsrevsahi, Selda Polat

2015-01-01

This study mainly aims to investigate the correlation between teachers' exposure to mobbing in their workplaces and their display of the act of silence. This study is based on a survey design where data from 312 teachers were collected and analyzed using correlation and regression analyses. Specifically, "The Structure and Dimensions of…

Simultaneous gene silencing of Bcl-2, XIAP and Survivin re-sensitizes pancreatic cancer cells towards apoptosis

International Nuclear Information System (INIS)

Rückert, Felix; Samm, Nicole; Lehner, Anne-Kathrin; Saeger, Hans-Detlev; Grützmann, Robert; Pilarsky, Christian

2010-01-01

Pancreatic ductal adenocarcinoma shows a distinct apoptosis resistance, which contributes significantly to the aggressive nature of this tumor and constrains the effectiveness of new therapeutic strategies. Apoptosis resistance is determined by the net balance of the cells pro-and anti-apoptotic 'control mechanisms'. Numerous dysregulated anti-apoptotic genes have been identified in pancreatic cancer and seem to contribute to the high anti-apoptotic buffering capacity. We aimed to compare the benefit of simultaneous gene silencing (SGS) of several candidate genes with conventional gene silencing of single genes. From literature search we identified the anti-apoptotic genes XIAP, Survivin and Bcl-2 as commonly upregulated in pancreatic cancer. We performed SGS and silencing of single candidate genes using siRNA molecules in two pancreatic cancer cell lines. Effectiveness of SGS was assessed by qRT-PCR and western blotting. Apoptosis induction was measured by flow cytometry and caspase activation. Simultaneous gene silencing reduced expression of the three target genes effectively. Compared to silencing of a single target or control, SGS of these genes resulted in a significant higher induction of apoptosis in pancreatic cancer cells. In the present study we performed a subliminal silencing of different anti-apoptotic target genes simultaneously. Compared to silencing of single target genes, SGS had a significant higher impact on apoptosis induction in pancreatic cancer cells. Thereby, we give further evidence for the concept of an anti-apoptotic buffering capacity of pancreatic cancer cells

A case study of butterfly road kills from Anaikatty Hills, Western Ghats, Tamil Nadu, India

Directory of Open Access Journals (Sweden)

R. K. Sony

2015-11-01

Full Text Available  Anaikatty Hills of the Western Ghats in Tamil Nadu witness the annual spectacle of mass movement of lakhs of butterflies.  The present paper examines the impact of vehicular traffic on this ‘butterfly migration’ through a survey of butterfly mortality along a road stretch in Anaikatty Hills.  A high rate of mortality due to road traffic was observed during the mass movement of butterflies.  One-hundred-and-thirty-five butterfly road kills belonging to three families, nine genera and 12 species were recorded during the study.  The proportion of nymphalid butterflies among the road kills (70% was very high compared to their respective share in the background population (39%, indicating a higher road mortality risk for nymphalids.  The conservation significance of the road traffic impact on butterfly assemblage and management options are discussed. 

Habitat or matrix: which is more relevant to predict road-kill of vertebrates?

Science.gov (United States)

Bueno, C; Sousa, C O M; Freitas, S R

2015-11-01

We believe that in tropics we need a community approach to evaluate road impacts on wildlife, and thus, suggest mitigation measures for groups of species instead a focal-species approach. Understanding which landscape characteristics indicate road-kill events may also provide models that can be applied in other regions. We intend to evaluate if habitat or matrix is more relevant to predict road-kill events for a group of species. Our hypothesis is: more permeable matrix is the most relevant factor to explain road-kill events. To test this hypothesis, we chose vertebrates as the studied assemblage and a highway crossing in an Atlantic Forest region in southeastern Brazil as the study site. Logistic regression models were designed using presence/absence of road-kill events as dependent variables and landscape characteristics as independent variables, which were selected by Akaike's Information Criterion. We considered a set of candidate models containing four types of simple regression models: Habitat effect model; Matrix types effect models; Highway effect model; and, Reference models (intercept and buffer distance). Almost three hundred road-kills and 70 species were recorded. River proximity and herbaceous vegetation cover, both matrix effect models, were associated to most road-killed vertebrate groups. Matrix was more relevant than habitat to predict road-kill of vertebrates. The association between river proximity and road-kill indicates that rivers may be a preferential route for most species. We discuss multi-species mitigation measures and implications to movement ecology and conservation strategies.

An efficient viral vector for functional genomic studies of Prunus fruit trees and its induced resistance to Plum pox virus via silencing of a host factor gene.

Science.gov (United States)

Cui, Hongguang; Wang, Aiming

2017-03-01

RNA silencing is a powerful technology for molecular characterization of gene functions in plants. A commonly used approach to the induction of RNA silencing is through genetic transformation. A potent alternative is to use a modified viral vector for virus-induced gene silencing (VIGS) to degrade RNA molecules sharing similar nucleotide sequence. Unfortunately, genomic studies in many allogamous woody perennials such as peach are severely hindered because they have a long juvenile period and are recalcitrant to genetic transformation. Here, we report the development of a viral vector derived from Prunus necrotic ringspot virus (PNRSV), a widespread fruit tree virus that is endemic in all Prunus fruit production countries and regions in the world. We show that the modified PNRSV vector, harbouring the sense-orientated target gene sequence of 100-200 bp in length in genomic RNA3, could efficiently trigger the silencing of a transgene or an endogenous gene in the model plant Nicotiana benthamiana. We further demonstrate that the PNRSV-based vector could be manipulated to silence endogenous genes in peach such as eukaryotic translation initiation factor 4E isoform (eIF(iso)4E), a host factor of many potyviruses including Plum pox virus (PPV). Moreover, the eIF(iso)4E-knocked down peach plants were resistant to PPV. This work opens a potential avenue for the control of virus diseases in perennial trees via viral vector-mediated silencing of host factors, and the PNRSV vector may serve as a powerful molecular tool for functional genomic studies of Prunus fruit trees. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Giving Voice: Narrating silence, history and memory in André Brink ...

African Journals Online (AJOL)

Giving Voice: Narrating silence, history and memory in André Brink\\'s The Other Side of Silence and Before I Forget. ... Both narrators, though, draw attention to the problems associated with this reconstructive and potentially ... Article Metrics.

Optical silencing of C. elegans cells with arch proton pump.

Directory of Open Access Journals (Sweden)

Ayako Okazaki

Full Text Available BACKGROUND: Optogenetic techniques using light-driven ion channels or ion pumps for controlling excitable cells have greatly facilitated the investigation of nervous systems in vivo. A model organism, C. elegans, with its small transparent body and well-characterized neural circuits, is especially suitable for optogenetic analyses. METHODOLOGY/PRINCIPAL FINDINGS: We describe the application of archaerhodopsin-3 (Arch, a recently reported optical neuronal silencer, to C. elegans. Arch::GFP expressed either in all neurons or body wall muscles of the entire body by means of transgenes were localized, at least partially, to the cell membrane without adverse effects, and caused locomotory paralysis of worms when illuminated by green light (550 nm. Pan-neuronal expression of Arch endowed worms with quick and sustained responsiveness to such light. Worms reliably responded to repeated periods of illumination and non-illumination, and remained paralyzed under continuous illumination for 30 seconds. Worms expressing Arch in different subsets of motor neurons exhibited distinct defects in the locomotory behavior under green light: selective silencing of A-type motor neurons affected backward movement while silencing of B-type motor neurons affected forward movement more severely. Our experiments using a heat-shock-mediated induction system also indicate that Arch becomes fully functional only 12 hours after induction and remains functional for more than 24 hour. CONCLUSIONS/SGNIFICANCE: Arch can be used for silencing neurons and muscles, and may be a useful alternative to currently widely used halorhodopsin (NpHR in optogenetic studies of C. elegans.

Self-Silencing, Emotional Awareness, and Eating Behaviors in College Women

Science.gov (United States)

Shouse, Sarah H.; Nilsson, Johanna

2011-01-01

Self-silencing (or the suppression of expressing one's thoughts, feelings, and needs) can have a negative impact on the mental health of women, from depression to disordered eating behaviors. The authors examined the relationship between self-silencing and disordered eating as well as intuitive eating. The authors also explored whether emotional…

Peptidoglycan recognition proteins kill bacteria by inducing oxidative, thiol, and metal stress.

Directory of Open Access Journals (Sweden)

Des Raj Kashyap

2014-07-01

Full Text Available Mammalian Peptidoglycan Recognition Proteins (PGRPs are a family of evolutionary conserved bactericidal innate immunity proteins, but the mechanism through which they kill bacteria is unclear. We previously proposed that PGRPs are bactericidal due to induction of reactive oxygen species (ROS, a mechanism of killing that was also postulated, and later refuted, for several bactericidal antibiotics. Here, using whole genome expression arrays, qRT-PCR, and biochemical tests we show that in both Escherichia coli and Bacillus subtilis PGRPs induce a transcriptomic signature characteristic of oxidative stress, as well as correlated biochemical changes. However, induction of ROS was required, but not sufficient for PGRP killing. PGRPs also induced depletion of intracellular thiols and increased cytosolic concentrations of zinc and copper, as evidenced by transcriptome changes and supported by direct measurements. Depletion of thiols and elevated concentrations of metals were also required, but by themselves not sufficient, for bacterial killing. Chemical treatment studies demonstrated that efficient bacterial killing can be recapitulated only by the simultaneous addition of agents leading to production of ROS, depletion of thiols, and elevation of intracellular metal concentrations. These results identify a novel mechanism of bacterial killing by innate immunity proteins, which depends on synergistic effect of oxidative, thiol, and metal stress and differs from bacterial killing by antibiotics. These results offer potential targets for developing new antibacterial agents that would kill antibiotic-resistant bacteria.

Assessment of RNAi-induced silencing in banana (Musa spp.).

Science.gov (United States)

Dang, Tuong Vi T; Windelinckx, Saskia; Henry, Isabelle M; De Coninck, Barbara; Cammue, Bruno P A; Swennen, Rony; Remy, Serge

2014-09-18

In plants, RNA- based gene silencing mediated by small RNAs functions at the transcriptional or post-transcriptional level to negatively regulate target genes, repetitive sequences, viral RNAs and/or transposon elements. Post-transcriptional gene silencing (PTGS) or the RNA interference (RNAi) approach has been achieved in a wide range of plant species for inhibiting the expression of target genes by generating double-stranded RNA (dsRNA). However, to our knowledge, successful RNAi-application to knock-down endogenous genes has not been reported in the important staple food crop banana. Using embryogenic cell suspension (ECS) transformed with ß-glucuronidase (GUS) as a model system, we assessed silencing of gusAINT using three intron-spliced hairpin RNA (ihpRNA) constructs containing gusAINT sequences of 299-nt, 26-nt and 19-nt, respectively. Their silencing potential was analysed in 2 different experimental set-ups. In the first, Agrobacterium-mediated co-transformation of banana ECS with a gusAINT containing vector and an ihpRNA construct resulted in a significantly reduced GUS enzyme activity 6-8 days after co-cultivation with either the 299-nt and 19-nt ihpRNA vectors. In the second approach, these ihpRNA constructs were transferred to stable GUS-expressing ECS and their silencing potential was evaluated in the regenerated in vitro plants. In comparison to control plants, transgenic plants transformed with the 299-nt gusAINT targeting sequence showed a 4.5 fold down-regulated gusA mRNA expression level, while GUS enzyme activity was reduced by 9 fold. Histochemical staining of plant tissues confirmed these findings. Northern blotting used to detect the expression of siRNA in the 299-nt ihpRNA vector transgenic in vitro plants revealed a negative relationship between siRNA expression and GUS enzyme activity. In contrast, no reduction in GUS activity or GUS mRNA expression occurred in the regenerated lines transformed with either of the two gusAINT oligo target

AGO/RISC-mediated antiviral RNA silencing in a plant in vitro system.

Science.gov (United States)

Schuck, Jana; Gursinsky, Torsten; Pantaleo, Vitantonio; Burgyán, Jozsef; Behrens, Sven-Erik

2013-05-01

AGO/RISC-mediated antiviral RNA silencing, an important component of the plant's immune response against RNA virus infections, was recapitulated in vitro. Cytoplasmic extracts of tobacco protoplasts were applied that supported Tombusvirus RNA replication, as well as the formation of RNA-induced silencing complexes (RISC) that could be functionally reconstituted with various plant ARGONAUTE (AGO) proteins. For example, when RISC containing AGO1, 2, 3 or 5 were programmed with exogenous siRNAs that specifically targeted the viral RNA, endonucleolytic cleavages occurred and viral replication was inhibited. Antiviral RNA silencing was disabled by the viral silencing suppressor p19 when this was present early during RISC formation. Notably, with replicating viral RNA, only (+)RNA molecules were accessible to RISC, whereas (-)RNA replication intermediates were not. The vulnerability of viral RNAs to RISC activity also depended on the RNA structure of the target sequence. This was most evident when we characterized viral siRNAs (vsiRNAs) that were particularly effective in silencing with AGO1- or AGO2/RISC. These vsiRNAs targeted similar sites, suggesting that accessible parts of the viral (+)RNA may be collectively attacked by different AGO/RISC. The in vitro system was, hence, established as a valuable tool to define and characterize individual molecular determinants of antiviral RNA silencing.

Gas turbine exhaust system silencing design

International Nuclear Information System (INIS)

Ozgur, D.

1991-01-01

Gas turbines are the preferred prime mover in many applications because of their high efficiency, fuel flexibility, and low environmental impact. A typical mid-size machine might have a power rating of 80 MW, a flow of about 1000 kg/hr, and an exhaust temperature of over 500C. The most powerful single source of noise is generally the exhaust, which may generate over a kilowatt of acoustic energy. This paper reports that there are two important ways in which exhaust systems can radiate noise. The first is through the discharge of the exhaust duct, with the exhaust gas. Because of the large quantity of hot gas, the duct exit is always oriented vertically; it may be fairly high in the air in order to promote dispersion of the exhaust plume. This source is almost always attenuated by means of a silencer located somewhere in the ductwork. The second source of noise is often called breakout; it is the radiation of exhaust noise through the walls of the ducting. Breakout is most important for those sections of the exhaust duct which lie upstream of the silencer, where sound levels inside the ducting are highest. Both exhaust duct exit noise and breakout noise can be calculated from the sound power level of the gas turbine exhaust and the sound transmission loss (TL) of the silencer and ducting

The development and application of a multiple gene co-silencing system using endogenous URA3 as a reporter gene in Ganoderma lucidum.

Directory of Open Access Journals (Sweden)

Dashuai Mu

Full Text Available Ganoderma lucidum is one of the most important medicinal mushrooms; however, molecular genetics research on this species has been limited due to a lack of reliable reverse genetic tools. In this study, the endogenous orotidine 5'-monophosphate decarboxylase gene (URA3 was cloned as a silencing reporter, and four gene-silencing methods using hairpin, sense, antisense, and dual promoter constructs, were introduced into G. lucidum through a simple electroporation procedure. A comparison and evaluation of silencing efficiency demonstrated that all of the four methods differentially suppressed the expression of URA3. Our data unequivocally indicate that the dual promoter silencing vector yields the highest rate of URA3 silencing compared with other vectors (up to 81.9%. To highlight the advantages of the dual promoter system, we constructed a co-silencing system based on the dual promoter method and succeeded in co-silencing URA3 and laccase in G. lucidum. The reduction of the mRNA levels of the two genes were correlated. Thus, the screening efficiency for RNAi knockdown of multiple genes may be improved by the co-silencing of an endogenous reporter gene. The molecular tools developed in this study should facilitate the isolation of genes and the characterization of the functions of multiple genes in this pharmaceutically important species, and these tools should be highly useful for the study of other basidiomycetes.

It?s Not Just Conflict That Motivates Killing of Orangutans

OpenAIRE

Davis, Jacqueline T.; Mengersen, Kerrie; Abram, Nicola K.; Ancrenaz, Marc; Wells, Jessie A.; Meijaard, Erik

2013-01-01

We investigated why orangutans are being killed in Kalimantan, Indonesia, and the role of conflict in these killings. Based on an analysis of interview data from over 5,000 respondents in over 450 villages, we also assessed the socio-ecological factors associated with conflict and non-conflict killings. Most respondents never kill orangutans. Those who reported having personally killed an orangutan primarily did so for non-conflict reasons; for example, 56% of these respondents said that the ...

Commuting symmetry operators of the Dirac equation, Killing-Yano and Schouten-Nijenhuis brackets

International Nuclear Information System (INIS)

Cariglia, Marco; Krtous, Pavel; Kubiznak, David

2011-01-01

In this paper we derive the most general first-order symmetry operator commuting with the Dirac operator in all dimensions and signatures. Such an operator splits into Clifford even and Clifford odd parts which are given in terms of odd Killing-Yano and even closed conformal Killing-Yano inhomogeneous forms, respectively. We study commutators of these symmetry operators and give necessary and sufficient conditions under which they remain of the first-order. In this specific setting we can introduce a Killing-Yano bracket, a bilinear operation acting on odd Killing-Yano and even closed conformal Killing-Yano forms, and demonstrate that it is closely related to the Schouten-Nijenhuis bracket. An important nontrivial example of vanishing Killing-Yano brackets is given by Dirac symmetry operators generated from the principal conformal Killing-Yano tensor [hep-th/0612029]. We show that among these operators one can find a complete subset of mutually commuting operators. These operators underlie separability of the Dirac equation in Kerr-NUT-(A)dS spacetimes in all dimensions [arXiv:0711.0078].

9 CFR 113.208 - Avian Encephalomyelitis Vaccine, Killed Virus.

Science.gov (United States)

2010-01-01

..., Killed Virus. 113.208 Section 113.208 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.208 Avian Encephalomyelitis Vaccine, Killed Virus. Avian...

Where and How Wolves (Canis lupus Kill Beavers (Castor canadensis.

Directory of Open Access Journals (Sweden)

Thomas D Gable

Full Text Available Beavers (Castor canadensis can be a significant prey item for wolves (Canis lupus in boreal ecosystems due to their abundance and vulnerability on land. How wolves hunt beavers in these systems is largely unknown, however, because observing predation is challenging. We inferred how wolves hunt beavers by identifying kill sites using clusters of locations from GPS-collared wolves in Voyageurs National Park, Minnesota. We identified 22 sites where wolves from 4 different packs killed beavers. We classified these kill sites into 8 categories based on the beaver-habitat type near which each kill occurred. Seasonal variation existed in types of kill sites as 7 of 12 (58% kills in the spring occurred at sites below dams and on shorelines, and 8 of 10 (80% kills in the fall occurred near feeding trails and canals. From these kill sites we deduced that the typical hunting strategy has 3 components: 1 waiting near areas of high beaver use (e.g., feeding trails until a beaver comes near shore or ashore, 2 using vegetation, the dam, or other habitat features for concealment, and 3 immediately attacking the beaver, or ambushing the beaver by cutting off access to water. By identifying kill sites and inferring hunting behavior we have provided the most complete description available of how and where wolves hunt and kill beavers.

Conformal Killing horizons and their thermodynamics

Science.gov (United States)

Nielsen, Alex B.; Shoom, Andrey A.

2018-05-01

Certain dynamical black hole solutions can be mapped to static spacetimes by conformal metric transformations. This mapping provides a physical link between the conformal Killing horizon of the dynamical black hole and the Killing horizon of the static spacetime. Using the Vaidya spacetime as an example, we show how this conformal relation can be used to derive thermodynamic properties of such dynamical black holes. Although these horizons are defined quasi-locally and can be located by local experiments, they are distinct from other popular notions of quasi-local horizons such as apparent horizons. Thus in the dynamical Vaidya spacetime describing constant accretion of null dust, the conformal Killing horizon, which is null by construction, is the natural horizon to describe the black hole.

Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins

Directory of Open Access Journals (Sweden)

Marcio Hedil

2016-07-01

Full Text Available The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.

Two classes of silencing RNAs move between C. elegans tissues

Science.gov (United States)

Jose, Antony M; Garcia, Giancarlo A; Hunter, Craig P

2011-01-01

Summary Organism-wide RNA interference (RNAi) is due to the transport of mobile silencing RNA throughout the organism but the identities of these mobile RNA species in animals are unknown. Here we present genetic evidence that both the initial double-stranded RNA (dsRNA), which triggers RNAi, and at least one dsRNA intermediate produced during RNAi can act as or generate mobile silencing RNA in Caenorhabditis elegans. This dsRNA intermediate requires the long dsRNA-binding protein RDE-4, the endonuclease DCR-1, which cleaves long dsRNA into double-stranded short-interfering RNA (ds-siRNA), and the putative nucleotidyltransferase MUT-2 (RDE-3). However, single-stranded siRNA and downstream secondary siRNA produced upon amplification by the RNA-dependent RNA Polymerase RRF-1 do not generate mobile silencing RNA. Restricting inter-tissue transport to long dsRNA and directly processed siRNA intermediates rather than amplified siRNA may serve to modulate the extent of systemic silencing in proportion to available dsRNA. PMID:21984186

Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins.

Science.gov (United States)

Hedil, Marcio; Kormelink, Richard

2016-07-23

The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.

Thermodynamic control of small RNA-mediated gene silencing

Directory of Open Access Journals (Sweden)

Kumiko eUi-Tei

2012-06-01

Full Text Available Small interfering RNAs (siRNAs and microRNAs (miRNAs are crucial regulators of posttranscriptional gene silencing, which is referred to as RNA interference (RNAi or RNA silencing. In RNAi, siRNA loaded onto the RNA-induced silencing complex (RISC downregulates target gene expression by cleaving mRNA whose sequence is perfectly complementary to the siRNA guide strand. We previously showed that highly functional siRNAs possessed the following characteristics: A or U residues at nucleotide position 1 measured from the 5’ terminal, four to seven A/Us in positions 1–7, and G or C residues at position 19. This finding indicated that an RNA strand with a thermodynamically unstable 5’ terminal is easily retained in the RISC and functions as a guide strand. In addition, it is clear that unintended genes with complementarities only in the seed region (positions 2–8 are also downregulated by off-target effects. siRNA efficiency is mainly determined by the Watson-Crick base-pairing stability formed between the siRNA seed region and target mRNA. siRNAs with a low seed-target duplex melting temperature (Tm have little or no seed-dependent off-target activity. Thus, important parts of the RNA silencing machinery may be regulated by nucleotide base-pairing thermodynamic stability. A mechanistic understanding of thermodynamic control may enable an efficient target gene-specific RNAi for functional genomics and safe therapeutic applications.

Photoexcited quantum dots for killing multidrug-resistant bacteria

Science.gov (United States)

Courtney, Colleen M.; Goodman, Samuel M.; McDaniel, Jessica A.; Madinger, Nancy E.; Chatterjee, Anushree; Nagpal, Prashant

2016-05-01

Multidrug-resistant bacterial infections are an ever-growing threat because of the shrinking arsenal of efficacious antibiotics. Metal nanoparticles can induce cell death, yet the toxicity effect is typically nonspecific. Here, we show that photoexcited quantum dots (QDs) can kill a wide range of multidrug-resistant bacterial clinical isolates, including methicillin-resistant Staphylococcus aureus, carbapenem-resistant Escherichia coli, and extended-spectrum β-lactamase-producing Klebsiella pneumoniae and Salmonella typhimurium. The killing effect is independent of material and controlled by the redox potentials of the photogenerated charge carriers, which selectively alter the cellular redox state. We also show that the QDs can be tailored to kill 92% of bacterial cells in a monoculture, and in a co-culture of E. coli and HEK 293T cells, while leaving the mammalian cells intact, or to increase bacterial proliferation. Photoexcited QDs could be used in the study of the effect of redox states on living systems, and lead to clinical phototherapy for the treatment of infections.

Habitat or matrix: which is more relevant to predict road-kill of vertebrates?

Directory of Open Access Journals (Sweden)

C. Bueno

Full Text Available Abstract We believe that in tropics we need a community approach to evaluate road impacts on wildlife, and thus, suggest mitigation measures for groups of species instead a focal-species approach. Understanding which landscape characteristics indicate road-kill events may also provide models that can be applied in other regions. We intend to evaluate if habitat or matrix is more relevant to predict road-kill events for a group of species. Our hypothesis is: more permeable matrix is the most relevant factor to explain road-kill events. To test this hypothesis, we chose vertebrates as the studied assemblage and a highway crossing in an Atlantic Forest region in southeastern Brazil as the study site. Logistic regression models were designed using presence/absence of road-kill events as dependent variables and landscape characteristics as independent variables, which were selected by Akaike’s Information Criterion. We considered a set of candidate models containing four types of simple regression models: Habitat effect model; Matrix types effect models; Highway effect model; and, Reference models (intercept and buffer distance. Almost three hundred road-kills and 70 species were recorded. River proximity and herbaceous vegetation cover, both matrix effect models, were associated to most road-killed vertebrate groups. Matrix was more relevant than habitat to predict road-kill of vertebrates. The association between river proximity and road-kill indicates that rivers may be a preferential route for most species. We discuss multi-species mitigation measures and implications to movement ecology and conservation strategies.

Decreasing erucic acid level by RNAi-mediated silencing of fatty ...

African Journals Online (AJOL)

To develop low level of erucic acid in rapeseeds by intron-spliced hairpin RNA, an inverted repeat unit of a partial BnFAE1.1 gene interrupted by a spliceable intron ... In conclusion, the expression of endogenous BnFAE1.1 was efficiently silenced by the designed RNAi silencer, causing a significant down-regulation in the ...

9 CFR 113.204 - Mink Enteritis Vaccine, Killed Virus.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Mink Enteritis Vaccine, Killed Virus..., DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.204 Mink Enteritis Vaccine, Killed Virus. Mink Enteritis Vaccine...

9 CFR 113.212 - Bursal Disease Vaccine, Killed Virus.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Bursal Disease Vaccine, Killed Virus..., DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.212 Bursal Disease Vaccine, Killed Virus. Bursal Disease Vaccine...

Mass killings and detection of impacts

Science.gov (United States)

McLaren, Digby J.

Highly energetic bolide impacts occur and their flux is known. For larger bodies the energy release is greater than for any other short-term global phenomenon. Such impacts produce or release a large variety of shock induced changes including major atmospheric, sedimentologic, seismic and volcanic events. These events must necessarily leave a variety of records in the stratigraphic column, including mass killings resulting in major changes in population density and reduction or extinction of many taxonomic groups, followed by characteristic patterns of faunal and flora replacement. Of these effects, mass killings, marked by large-scale loss of biomass, are the most easily detected evidence in the field but must be manifest on a near-global scale. Such mass killings that appear to be approximately synchronous and involve disappearance of biomass at a bedding plane in many sedimentologically independent sections globally suggest a common cause and probable synchroneity. Mass killings identify an horizon which may be examined for evidence of cause. Geochemical markers may be ephemeral and absence may not be significant. There appears to be no reason why ongoing phenomena such as climate and sea-level changes are primary causes of anomolous episodic events.

The eyeball killer: serial killings with postmortem globe enucleation.

Science.gov (United States)

Coyle, Julie; Ross, Karen F; Barnard, Jeffrey J; Peacock, Elizabeth; Linch, Charles A; Prahlow, Joseph A

2015-05-01

Although serial killings are relatively rare, they can be the cause of a great deal of anxiety while the killer remains at-large. Despite the fact that the motivations for serial killings are typically quite complex, the psychological analysis of a serial killer can provide valuable insight into how and why certain individuals become serial killers. Such knowledge may be instrumental in preventing future serial killings or in solving ongoing cases. In certain serial killings, the various incidents have a variety of similar features. Identification of similarities between separate homicidal incidents is necessary to recognize that a serial killer may be actively killing. In this report, the authors present a group of serial killings involving three prostitutes who were shot to death over a 3-month period. Scene and autopsy findings, including the unusual finding of postmortem enucleation of the eyes, led investigators to recognize the serial nature of the homicides. © 2015 American Academy of Forensic Sciences.

Managing Threat, Cost, and Incentive to Kill: The Short- and Long-Term Effects of Intervention in Mass Killings

Science.gov (United States)

Kathman, Jacob D.; Wood, Reed M.

2011-01-01

How do third-party interventions affect the severity of mass killings? The authors theorize that episodes of mass killing are the consequence of two factors: (1) the threat perceptions of the perpetrators and (2) the cost of implementing genocidal policies relative to other alternatives. To reduce genocidal hostilities, interveners must address…

Composite potato plants with transgenic roots on non-transgenic shoots: a model system for studying gene silencing in roots.

Science.gov (United States)

Horn, Patricia; Santala, Johanna; Nielsen, Steen Lykke; Hühns, Maja; Broer, Inge; Valkonen, Jari P T

2014-12-01

Composite potato plants offer an extremely fast, effective and reliable system for studies on gene functions in roots using antisense or inverted-repeat but not sense constructs for gene inactivation. Composite plants, with transgenic roots on a non-transgenic shoot, can be obtained by shoot explant transformation with Agrobacterium rhizogenes. The aim of this study was to generate composite potato plants (Solanum tuberosum) to be used as a model system in future studies on root-pathogen interactions and gene silencing in the roots. The proportion of transgenic roots among the roots induced was high (80-100%) in the four potato cultivars tested (Albatros, Desirée, Sabina and Saturna). No wild-type adventitious roots were formed at mock inoculation site. All strains of A. rhizogenes tested induced phenotypically normal roots which, however, showed a reduced response to cytokinin as compared with non-transgenic roots. Nevertheless, both types of roots were infected to a similar high rate with the zoospores of Spongospora subterranea, a soilborne potato pathogen. The transgenic roots of composite potato plants expressed significantly higher amounts of β-glucuronidase (GUS) than the roots of a GUS-transgenic potato line event. Silencing of the uidA transgene (GUS) was tested by inducing roots on the GUS-transgenic cv. Albatros event with strains of A. rhizogenes over-expressing either the uidA sense or antisense transcripts, or inverted-repeat or hairpin uidA RNA. The three last mentioned constructs caused 2.5-4.0 fold reduction in the uidA mRNA expression. In contrast, over-expression of uidA resulted in over 3-fold increase in the uidA mRNA and GUS expression, indicating that sense-mediated silencing (co-suppression) was not functional in roots. The results suggest that composite plants offer a useful experimental system for potato research, which has gained little previous attention.

RNA silencing is required for Arabidopsis defence against Verticillium wilt disease

NARCIS (Netherlands)

Ellendorff, U.; Fradin, E.F.; Jonge, de R.; Thomma, B.P.H.J.

2009-01-01

RNA silencing is a conserved mechanism in eukaryotes that plays an important role in various biological processes including regulation of gene expression. RNA silencing also plays a role in genome stability and protects plants against invading nucleic acids such as transgenes and viruses. Recently,

9 CFR 113.201 - Canine Distemper Vaccine, Killed Virus.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine, Killed Virus... REQUIREMENTS Killed Virus Vaccines § 113.201 Canine Distemper Vaccine, Killed Virus. Canine Distemper Vaccine... canine distemper susceptible dogs (20 vaccinates and 5 controls) shall be used as test animals. Blood...

Piecing Together Past and Present in Bhutan: Narration, Silence and Forgetting in Conflict

Directory of Open Access Journals (Sweden)

Line Kikkenborg Christensen

2018-02-01

Full Text Available What happens when conflict is silenced in official narratives but not forgotten among a population? This article explores this question using interview data from anthropological fieldwork in Bhutan. In Bhutan, the ethnic conflict of the early 1990s is surrounded by silence and is not openly discussed. Despite this silence, young Bhutanese have formed a multiplicity of narratives about the conflict. The article highlights three different narratives of conflict, as well as the oblivion found among informants. The main argument is that the silence surrounding the conflict in Bhutan has contributed to two forms of societal rift: between the authorities and the people, and between people themselves. The article contributes to the discussion about what role social memories play in conflicts, by suggesting that silence may cause wariness and hinder processes that help societies to move past conflict in a constructive way.

Musashi-2 Silencing Exerts Potent Activity against Acute Myeloid Leukemia and Enhances Chemosensitivity to Daunorubicin.

Directory of Open Access Journals (Sweden)

Yixiang Han

Full Text Available RNA-binding protein Musashi-2 (Msi2 is known to play a critical role in leukemogenesis and contributes to poor clinical prognosis in acute myeloid leukemia (AML. However, the effect of Msi2 silencing on treatment for AML still remains poorly understood. In this study, we used lentivirus-mediated RNA interference targeting Msi2 to investigate the resulting changes in cellular processes and the underlying mechanisms in AML cell lines as well as primary AML cells isolated from AML patients. We found that Msi2 was highly expressed in AML cells, and its depletion inhibited Ki-67 expression and resulted in decreased in vitro and in vivo proliferation. Msi2 silencing induced cell cycle arrest in G0/G1 phase, with decreased Cyclin D1 and increased p21 expression. Msi2 silencing induced apoptosis through down-regulation of Bcl-2 expression and up-regulation of Bax expression. Suppression of Akt, Erk1/2 and p38 phosphorylation also contributed to apoptosis mediated by Msi2 silencing. Finally, Msi2 silencing in AML cells also enhanced their chemosensitivity to daunorubicin. Conclusively, our data suggest that Msi2 is a promising target for gene therapy to optimize conventional chemotherapeutics in AML treatment.

Time-kill studies of the antianaerobe activity of garenoxacin compared with those of nine other agents.

Science.gov (United States)

Credito, Kim L; Jacobs, Michael R; Appelbaum, Peter C

2003-04-01

The activities of garenoxacin, ciprofloxacin, levofloxacin, moxifloxacin, trovafloxacin, amoxicillin-clavulanate, piperacillin-tazobactam, imipenem, clindamycin, and metronidazole against 20 anaerobes were tested. At two times the MIC, garenoxacin was bactericidal against 19 of 20 strains after 48 h and against 17 of 20 after 24 h. Other drugs, except clindamycin (which gave lower killing rates), gave killing rates similar to those for garenoxacin.

Role of copper oxides in contact killing of bacteria.

Science.gov (United States)

Hans, Michael; Erbe, Andreas; Mathews, Salima; Chen, Ying; Solioz, Marc; Mücklich, Frank

2013-12-31

The potential of metallic copper as an intrinsically antibacterial material is gaining increasing attention in the face of growing antibiotics resistance of bacteria. However, the mechanism of the so-called "contact killing" of bacteria by copper surfaces is poorly understood and requires further investigation. In particular, the influences of bacteria-metal interaction, media composition, and copper surface chemistry on contact killing are not fully understood. In this study, copper oxide formation on copper during standard antimicrobial testing was measured in situ by spectroscopic ellipsometry. In parallel, contact killing under these conditions was assessed with bacteria in phosphate buffered saline (PBS) or Tris-Cl. For comparison, defined Cu2O and CuO layers were thermally generated and characterized by grazing incidence X-ray diffraction. The antibacterial properties of these copper oxides were tested under the conditions used above. Finally, copper ion release was recorded for both buffer systems by inductively coupled plasma atomic absorption spectroscopy, and exposed copper samples were analyzed for topographical surface alterations. It was found that there was a fairly even growth of CuO under wet plating conditions, reaching 4-10 nm in 300 min, but no measurable Cu2O was formed during this time. CuO was found to significantly inhibit contact killing, compared to pure copper. In contrast, thermally generated Cu2O was essentially as effective in contact killing as pure copper. Copper ion release from the different surfaces roughly correlated with their antibacterial efficacy and was highest for pure copper, followed by Cu2O and CuO. Tris-Cl induced a 10-50-fold faster copper ion release compared to PBS. Since the Cu2O that primarily forms on copper under ambient conditions is as active in contact killing as pure copper, antimicrobial objects will retain their antimicrobial properties even after oxide formation.

PhCESA3 silencing inhibits elongation and stimulates radial expansion in petunia.

Science.gov (United States)

Yang, Weiyuan; Cai, Yuanping; Hu, Li; Wei, Qian; Chen, Guoju; Bai, Mei; Wu, Hong; Liu, Juanxu; Yu, Yixun

2017-02-02

Cellulose synthase catalytic subunits (CESAs) play important roles in plant growth, development and disease resistance. Previous studies have shown an essential role of Arabidopsis thaliana CESA3 in plant growth. However, little is known about the role of CESA3 in species other than A. thaliana. To gain a better understanding of CESA3, the petunia (Petunia hybrida) PhCESA3 gene was isolated, and the role of PhCESA3 in plant growth was analyzed in a wide range of plants. PhCESA3 mRNA was present at varying levels in tissues examined. VIGS-mediated PhCESA3 silencing resulted in dwarfing of plant height, which was consistent with the phenotype of the A. thaliana rsw1 mutant (a temperature-sensitive allele of AtCESA1), the A. thaliana cev1 mutant (the AtCESA3 mild mutant), and the antisense AtCESA3 line. However, PhCESA3 silencing led to swollen stems, pedicels, filaments, styles and epidermal hairs as well as thickened leaves and corollas, which were not observed in the A. thaliana cev1 mutant, the rsw1 mutant and the antisense AtCESA3 line. Further micrographs showed that PhCESA3 silencing reduced the length and increased the width of cells, suggesting that PhCESA3 silencing inhibits elongation and stimulates radial expansion in petunia.

Between the Unbearable Weight and Lightness of the Past. Banal Silence in Spain's Post-Dictatorship Memory Politics.

Science.gov (United States)

Brescó de Luna, Ignacio

2018-05-04

This paper explores the role of silence in Spain's post-dictatorship memory politics. More specifically, the paper examines the forgotten Spanish colonial past in North Africa vis-à-vis the so-called pact of silence that accompanied Spain's transition to democracy after the Franco dictatorship. Drawing on various theoretical approaches in relation to collective memory, traditionally assumed associations between silence and forgetting are questioned. As is argued, silence may nurture and preserve memory just as it may also feed into forgetting. In the former case, silence typically enshrouds a living memory of a past that still weighs on the present, as the pact of silence in Spain clearly illustrates. In the latter case, silence signals a past perceived as already left behind and alien to society's current problems, as is the case of the Spanish colonial past in North Africa. In order to further explore the latter case, the notion of banal silence is introduced. Such notion points to cases where silence over certain contentious historical issues goes unnoticed by society, thus becoming naturalized. The paper concludes with some final reflexions on memory, banal silence and political change.

Silence in liturgy as the space for the Holy Ghost’s activity

Directory of Open Access Journals (Sweden)

Adelajda Sielepin

2006-06-01

Full Text Available The aim of this article is to clarify the essential and often neglected function of liturgical silence. In practice silence is usually intended to prepare the participants for listening or reflecting upon the word, especially when proclaimed by the minister. Whereas it is vital to know that silence constitutes a creative element of the liturgy, because the involvement of the Holy Spirit. In His action and cooperation with the participants He enables them to get into communion with Christ the Word and the Person and eventually to join effectively His mission. In that sense silence helps the Holy Ghost to fulfill His function in continuing the dialogue between God and man as well as in enhancing one’s spiritual skills for the fruitful participation in the Mystery of Christ and the Church.

From Attitudes to Actions: Predictors of Lion Killing by Maasai Warriors.

Science.gov (United States)

Hazzah, Leela; Bath, Alistair; Dolrenry, Stephanie; Dickman, Amy; Frank, Laurence

2017-01-01

Despite legal protection, deliberate killing by local people is one of the major threats to the conservation of lions and other large carnivores in Africa. Addressing this problem poses particular challenges, mainly because it is difficult to uncover illicit behavior. This article examined two groups of Maasai warriors: individuals who have killed African lions (Panthera leo) and those who have not. We conducted interviews to explore the relationship between attitudes, intentions and known lion killing behavior. Factor analysis and logistic regression revealed that lion killing was mainly determined by: (a) general attitudes toward lions, (b) engagement in traditional customs, (c) lion killing intentions to defend property, and (d) socio-cultural killing intentions. Our results indicated that general attitudes toward lions were the strongest predictor of lion killing behavior. Influencing attitudes to encourage pro-conservation behavior may help reduce killing.

RNA-Interference Components Are Dispensable for Transcriptional Silencing of the Drosophila Bithorax-Complex

KAUST Repository

Cernilogar, Filippo M.

2013-06-13

Background:Beyond their role in post-transcriptional gene silencing, Dicer and Argonaute, two components of the RNA interference (RNAi) machinery, were shown to be involved in epigenetic regulation of centromeric heterochromatin and transcriptional gene silencing. In particular, RNAi mechanisms appear to play a role in repeat induced silencing and some aspects of Polycomb-mediated gene silencing. However, the functional interplay of RNAi mechanisms and Polycomb group (PcG) pathways at endogenous loci remains to be elucidated.Principal Findings:Here we show that the endogenous Dicer-2/Argonaute-2 RNAi pathway is dispensable for the PcG mediated silencing of the homeotic Bithorax Complex (BX-C). Although Dicer-2 depletion triggers mild transcriptional activation at Polycomb Response Elements (PREs), this does not induce transcriptional changes at PcG-repressed genes. Moreover, Dicer-2 is not needed to maintain global levels of methylation of lysine 27 of histone H3 and does not affect PRE-mediated higher order chromatin structures within the BX-C. Finally bioinformatic analysis, comparing published data sets of PcG targets with Argonaute-2-bound small RNAs reveals no enrichment of these small RNAs at promoter regions associated with PcG proteins.Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.

The Luteovirus P4 Movement Protein Is a Suppressor of Systemic RNA Silencing.

Science.gov (United States)

Fusaro, Adriana F; Barton, Deborah A; Nakasugi, Kenlee; Jackson, Craig; Kalischuk, Melanie L; Kawchuk, Lawrence M; Vaslin, Maite F S; Correa, Regis L; Waterhouse, Peter M

2017-10-10

The plant viral family Luteoviridae is divided into three genera: Luteovirus , Polerovirus and Enamovirus . Without assistance from another virus, members of the family are confined to the cells of the host plant's vascular system. The first open reading frame (ORF) of poleroviruses and enamoviruses encodes P0 proteins which act as silencing suppressor proteins (VSRs) against the plant's viral defense-mediating RNA silencing machinery. Luteoviruses, such as barley yellow dwarf virus-PAV (BYDV-PAV), however, have no P0 to carry out the VSR role, so we investigated whether other proteins or RNAs encoded by BYDV-PAV confer protection against the plant's silencing machinery. Deep-sequencing of small RNAs from plants infected with BYDV-PAV revealed that the virus is subjected to RNA silencing in the phloem tissues and there was no evidence of protection afforded by a possible decoy effect of the highly abundant subgenomic RNA3. However, analysis of VSR activity among the BYDV-PAV ORFs revealed systemic silencing suppression by the P4 movement protein, and a similar, but weaker, activity by P6. The closely related BYDV-PAS P4, but not the polerovirus potato leafroll virus P4, also displayed systemic VSR activity. Both luteovirus and the polerovirus P4 proteins also showed transient, weak local silencing suppression. This suggests that systemic silencing suppression is the principal mechanism by which the luteoviruses BYDV-PAV and BYDV-PAS minimize the effects of the plant's anti-viral defense.

Killing vectors in empty space algebraically special metrics. II

International Nuclear Information System (INIS)

Held, A.

1976-01-01

Empty space algebraically special metrics possessing an expanding degenerate principal null vector and Killing vectors are investigated. Attention is centered on that class of Killing vector (called nonpreferred) which is necessarily spacelike in the asymptotic region. A detailed analysis of the relationship between the Petrov--Penrose classification and these Killing vectors is carried out

Neutrophils kill the parasite Trichomonas vaginalis using trogocytosis

Science.gov (United States)

Mercer, Frances; Ng, Shek Hang; Brown, Taylor M.; Boatman, Grace; Johnson, Patricia J.

2018-01-01

T. vaginalis, a human-infective parasite, causes the most common nonviral sexually transmitted infection (STI) worldwide and contributes to adverse inflammatory disorders. The immune response to T. vaginalis is poorly understood. Neutrophils (polymorphonuclear cells [PMNs]) are the major immune cell present at the T. vaginalis–host interface and are thought to clear T. vaginalis. However, the mechanism of PMN clearance of T. vaginalis has not been characterized. We demonstrate that human PMNs rapidly kill T. vaginalis in a dose-dependent, contact-dependent, and neutrophil extracellular trap (NET)-independent manner. In contrast to phagocytosis, we observed that PMN killing of T. vaginalis involves taking “bites” of T. vaginalis prior to parasite death, using trogocytosis to achieve pathogen killing. Both trogocytosis and parasite killing are dependent on the presence of PMN serine proteases and human serum factors. Our analyses provide the first demonstration, to our knowledge, of a mammalian phagocyte using trogocytosis for pathogen clearance and reveal a novel mechanism used by PMNs to kill a large, highly motile target. PMID:29408891

Silencing the epigenetic silencer KDM4A for TRAIL and DR5 simultaneous induction and antitumor therapy.

Science.gov (United States)

Wang, Junjian; Wang, Haibin; Wang, Ling-Yu; Cai, Demin; Duan, Zhijian; Zhang, Yanhong; Chen, Peng; Zou, June X; Xu, Jianzhen; Chen, Xinbin; Kung, Hsing-Jien; Chen, Hong-Wu

2016-11-01

Recombinant TRAIL and agonistic antibodies to death receptors (DRs) have been in clinical trial but displayed limited anti-cancer efficacy. Lack of functional DR expression in tumors is a major limiting factor. We report here that chromatin regulator KDM4A/JMJD2A, not KDM4B, has a pivotal role in silencing tumor cell expression of both TRAIL and its receptor DR5. In TRAIL-sensitive and -resistant cancer cells of lung, breast and prostate, KDM4A small-molecule inhibitor compound-4 (C-4) or gene silencing strongly induces TRAIL and DR5 expression, and causes TRAIL-dependent apoptotic cell death. KDM4A inhibition also strongly sensitizes cells to TRAIL. C-4 alone potently inhibits tumor growth with marked induction of TRAIL and DR5 expression in the treated tumors and effectively sensitizes them to the newly developed TRAIL-inducer ONC201. Mechanistically, C-4 does not appear to act through the Akt-ERK-FOXO3a pathway. Instead, it switches histone modifying enzyme complexes at promoters of TRAIL and DR5 transcriptional activator CHOP gene by dissociating KDM4A and nuclear receptor corepressor (NCoR)-HDAC complex and inducing the recruitment of histone acetylase CBP. Thus, our results reveal KDM4A as a key epigenetic silencer of TRAIL and DR5 in tumors and establish inhibitors of KDM4A as a novel strategy for effectively sensitizing tumors to TRAIL pathway-based therapeutics.

Mobile gene silencing in Arabidopsis is regulated by hydrogen peroxide

Directory of Open Access Journals (Sweden)

Dacheng Liang

2014-12-01

Full Text Available In plants and nematodes, RNAi can spread from cells from which it is initiated to other cells in the organism. The underlying mechanism controlling the mobility of RNAi signals is not known, especially in the case of plants. A genetic screen designed to recover plants impaired in the movement but not the production or effectiveness of the RNAi signal identified RCI3, which encodes a hydrogen peroxide (H2O2-producing type III peroxidase, as a key regulator of silencing mobility in Arabidopsis thaliana. Silencing initiated in the roots of rci3 plants failed to spread into leaf tissue or floral tissue. Application of exogenous H2O2 reinstated the spread in rci3 plants and accelerated it in wild-type plants. The addition of catalase or MnO2, which breaks down H2O2, slowed the spread of silencing in wild-type plants. We propose that endogenous H2O2, under the control of peroxidases, regulates the spread of gene silencing by altering plasmodesmata permeability through remodelling of local cell wall structure, and may play a role in regulating systemic viral defence.

[Killing effect of polymorphonuclear neutrophils on Trichomonas vaginalis].

Science.gov (United States)

Zhao, Jian-Ling; Gao, Xing-Zheng; Qu, Ming

2008-10-30

To study the killing effect of polymorphonuclear neutrophils (PMNs) on Trichomonas vaginalis. The vaginal secretion from a patient with vaginitis was incubated in the liver infusion liquid medium to get T. vaginalis. One ml serum was collected from the patient and heated for 30 min at 56 degrees C to inactivate complement in serum, and was absorbed three times with the parasites at 0 degree C to make the serum free of antibodies. PMNs were separated from the patient's blood and purified with density gradient centrifugation and polymer accelerating sedimentation. NBT and safranin O were used to stain the sample. The interaction between PMNs and the parasites was observed under microscope. 300 trichomonads and 3x10(4) PMNs were incubated for 10, 20, 30, 40, 50, 60 minutes under the conditions of aerobic or anaerobic, with superoxide dismutase (SOD) and catalase (CAT) or without SOD and CAT, and with complement or without complement. They were then inoculated in solid medium for another five days under the anaerobic condition, and surviving organisms were enumerated. PMNs were observed to surround and kill a single trichomonad. In the petri-dish containing PMNs, the surviving rate of the parasites in anaerobic condition was 85%, only 3% in aerobic condition (P<0.01). SOD and CAT reduced the killing effect of PMNs, with a surviving rate of 98% and 94% respectively after 60 min incubation. Without SOD and CAT, the surviving rate is only 2% (P<0.05). PMNs in the serum without antibodies killed all the parasites, while the complement-inactivated serum fail to kill them. The trichomonacidal activity of PMNs relies on the presence of oxygen and complement in the serum of patient.

Prevalence of alcohol and other psychoactive substances in injured and killed drivers

DEFF Research Database (Denmark)

Isalberti, Cristina; Linden, Trudy Van der; Legrand, Sara-Ann

2011-01-01

regarding the prevalence of alcohol and other psychoactive substances in drivers who have been injured/killed in traffic accidents. Part 1 of this report presents the general results of the hospital & killed driver studies. After a short introduction, the representativeness of the populations in the EU...... countries as well as the representativeness of hospitalised and killed driver samples are addressed. An overview of the non-response issues in the various countries is also included. Based on the toxicological findings, a general summary of the prevalence of drug use is given for the 9 participating...

Female serial killing: review and case report.

Science.gov (United States)

Frei, Andreas; Völlm, Birgit; Graf, Marc; Dittmann, Volker

2006-01-01

Single homicide committed by women is rare. Serial killing is very infrequent, and the perpetrators are usually white, intelligent males with sadistic tendencies. Serial killing by women has, however, also been described. To conduct a review of published literature on female serial killers and consider its usefulness in assessing a presenting case. A literature review was conducted, after searching EMBASE, MEDLINE and PsycINFO. The presenting clinical case is described in detail in the context of the literature findings. Results The literature search revealed few relevant publications. Attempts to categorize the phenomenon of female serial killing according to patterns of and motives for the homicides have been made by some authors. The most common motive identified was material gain or similar extrinsic gratification while the 'hedonistic' sadistic or sexual serial killer seems to be extremely rare in women. There is no consistent theory of serial killing by women, but psychopathic personality traits and abusive childhood experiences have consistently been observed. The authors' case did not fit the description of a 'typical' female serial killer. In such unusual circumstances as serial killing by a woman, detailed individual case formulation is required to make sense of the psychopathology in each case. Publication of cases in scientific journals should be encouraged to advance our understanding of this phenomenon. Copyright (c) 2006 John Wiley & Sons, Ltd.

Welfare Risks of Repeated Application of On-Farm Killing Methods for Poultry

Directory of Open Access Journals (Sweden)

Jessica E. Martin

2018-03-01

Full Text Available Council Regulation (EC no. 1099/2009 on the protection of animals at the time of killing restricts the use of manual cervical dislocation in poultry on farms in the European Union (EU to birds weighing up to 3 kg and 70 birds per person per day. However, few studies have examined whether repeated application of manual cervical dislocation has welfare implications and whether these are dependent on individual operator skill or susceptibility to fatigue. We investigated the effects of repeated application (100 birds at a fixed killing rate of 1 bird per 2 min and multiple operators on two methods of killing of broilers, laying hens, and turkeys in commercial settings. We compared the efficacy and welfare impact of repeated application of cervical dislocation and a percussive killer (Cash Poultry Killer, CPK, using 12 male stockworkers on three farms (one farm per bird type. Both methods achieved over 96% kill success at the first attempt. The killing methods were equally effective for each bird type and there was no evidence of reduced performance with time and/or bird number. Both methods of killing caused a rapid loss of reflexes, indicating loss of brain function. There was more variation in reflex durations and post-mortem damage in birds killed by cervical dislocation than that found using CPK. High neck dislocation was associated with improved kill success and more rapid loss of reflexes. The CPK caused damage to multiple brain areas with little variation. Overall, the CPK was associated with faster abolition of reflexes, with fewer birds exhibiting them at all, suggestive of better welfare outcomes. However, technical difficulties with the CPK highlighted the advantages of cervical dislocation, which can be performed immediately with no equipment. At the killing rates tested, we did not find evidence to justify the current EU limit on the number of birds that one operator can kill on–farm by manual cervical dislocation.

ANALYZE THE IMPACT OF HABITAT PATCHES ON WILDLIFE ROAD-KILL

OpenAIRE

Seok, S.; Lee, J.

2015-01-01

The ecosystem fragmentation due to transportation infrastructure causes a road-kill phenomenon. When making policies for mitigating road-kill it is important to select target-species in order to enhance its efficiency. However, many wildlife crossing structures have been questioned regarding their effectiveness due to lack of considerations such as target-species selection, site selection, management, etc. The purpose of this study is to analyse the impact of habitat patches on wildlife road-...

Analysing the significance of silence in qualitative interviewing: questioning and shifting power relations

DEFF Research Database (Denmark)

Bengtsson, Tea Torbenfeldt; Fynbo, Lars

2017-01-01

In this article we analyse the significance of silence in qualitative interviews with 36 individuals interviewed about high-risk, illegal activities. We describe how silence expresses a dynamic power relationship between interviewer and interviewee. In the analysis, we focus on two different types...... significant data. We conclude that silence constitutes possibilities for interviewees and interviewers to handle the complex power at play in qualitative interviewing either by maintaining or by losing control of the situation....

The Luteovirus P4 Movement Protein Is a Suppressor of Systemic RNA Silencing

Directory of Open Access Journals (Sweden)

Adriana F. Fusaro

2017-10-01

Full Text Available The plant viral family Luteoviridae is divided into three genera: Luteovirus, Polerovirus and Enamovirus. Without assistance from another virus, members of the family are confined to the cells of the host plant’s vascular system. The first open reading frame (ORF of poleroviruses and enamoviruses encodes P0 proteins which act as silencing suppressor proteins (VSRs against the plant’s viral defense-mediating RNA silencing machinery. Luteoviruses, such as barley yellow dwarf virus-PAV (BYDV-PAV, however, have no P0 to carry out the VSR role, so we investigated whether other proteins or RNAs encoded by BYDV-PAV confer protection against the plant’s silencing machinery. Deep-sequencing of small RNAs from plants infected with BYDV-PAV revealed that the virus is subjected to RNA silencing in the phloem tissues and there was no evidence of protection afforded by a possible decoy effect of the highly abundant subgenomic RNA3. However, analysis of VSR activity among the BYDV-PAV ORFs revealed systemic silencing suppression by the P4 movement protein, and a similar, but weaker, activity by P6. The closely related BYDV-PAS P4, but not the polerovirus potato leafroll virus P4, also displayed systemic VSR activity. Both luteovirus and the polerovirus P4 proteins also showed transient, weak local silencing suppression. This suggests that systemic silencing suppression is the principal mechanism by which the luteoviruses BYDV-PAV and BYDV-PAS minimize the effects of the plant’s anti-viral defense.

ABCE1 is a highly conserved RNA silencing suppressor.

Directory of Open Access Journals (Sweden)

Kairi Kärblane

Full Text Available ATP-binding cassette sub-family E member 1 (ABCE1 is a highly conserved protein among eukaryotes and archaea. Recent studies have identified ABCE1 as a ribosome-recycling factor important for translation termination in mammalian cells, yeast and also archaea. Here we report another conserved function of ABCE1. We have previously described AtRLI2, the homolog of ABCE1 in the plant Arabidopsis thaliana, as an endogenous suppressor of RNA silencing. In this study we show that this function is conserved: human ABCE1 is able to suppress RNA silencing in Nicotiana benthamiana plants, in mammalian HEK293 cells and in the worm Caenorhabditis elegans. Using co-immunoprecipitation and mass spectrometry, we found a number of potential ABCE1-interacting proteins that might support its function as an endogenous suppressor of RNA interference. The interactor candidates are associated with epigenetic regulation, transcription, RNA processing and mRNA surveillance. In addition, one of the identified proteins is translin, which together with its binding partner TRAX supports RNA interference.

Is our knowledge of voice and silence in organizations growing?

DEFF Research Database (Denmark)

Knoll, Michael; Wegge, Jürgen; Unterrainer, Christine

2016-01-01

This article has three objectives. Firstly, we seek to demonstrate the relevance of voice and silence – that is, whether employees contribute or withhold information, ideas, views and/or concerns at work – for the sustainable development of individuals, organizations and societies. Our second...... objective is to identify emerging (and enduring) issues – conceptual, theoretical and methodological – that have not yet been adequately addressed in voice and silence research. These issues include the relationship between voice and silence, how they may manifest in organizations, their manifold...... antecedents inside and beyond organizational boundaries, their potentially positive and negative effects for internal and external stakeholders, and methodological questions. The third objective is to propose opportunities for addressing these issues with the ultimate aim to build a broader and more...

Reexamining the P-Element Invasion of Drosophila melanogaster Through the Lens of piRNA Silencing

Science.gov (United States)

Kelleher, Erin S.

2016-01-01

Transposable elements (TEs) are both important drivers of genome evolution and genetic parasites with potentially dramatic consequences for host fitness. The recent explosion of research on regulatory RNAs reveals that small RNA-mediated silencing is a conserved genetic mechanism through which hosts repress TE activity. The invasion of the Drosophila melanogaster genome by P elements, which happened on a historical timescale, represents an incomparable opportunity to understand how small RNA-mediated silencing of TEs evolves. Repression of P-element transposition emerged almost concurrently with its invasion. Recent studies suggest that this repression is implemented in part, and perhaps predominantly, by the Piwi-interacting RNA (piRNA) pathway, a small RNA-mediated silencing pathway that regulates TE activity in many metazoan germlines. In this review, I consider the P-element invasion from both a molecular and evolutionary genetic perspective, reconciling classic studies of P-element regulation with the new mechanistic framework provided by the piRNA pathway. I further explore the utility of the P-element invasion as an exemplar of the evolution of piRNA-mediated silencing. In light of the highly-conserved role for piRNAs in regulating TEs, discoveries from this system have taxonomically broad implications for the evolution of repression. PMID:27516614

FXR silencing in human colon cancer by DNA methylation and KRAS signaling.

Science.gov (United States)

Bailey, Ann M; Zhan, Le; Maru, Dipen; Shureiqi, Imad; Pickering, Curtis R; Kiriakova, Galina; Izzo, Julie; He, Nan; Wei, Caimiao; Baladandayuthapani, Veerabhadran; Liang, Han; Kopetz, Scott; Powis, Garth; Guo, Grace L

2014-01-01

Farnesoid X receptor (FXR) is a bile acid nuclear receptor described through mouse knockout studies as a tumor suppressor for the development of colon adenocarcinomas. This study investigates the regulation of FXR in the development of human colon cancer. We used immunohistochemistry of FXR in normal tissue (n = 238), polyps (n = 32), and adenocarcinomas, staged I-IV (n = 43, 39, 68, and 9), of the colon; RT-quantitative PCR, reverse-phase protein array, and Western blot analysis in 15 colon cancer cell lines; NR1H4 promoter methylation and mRNA expression in colon cancer samples from The Cancer Genome Atlas; DNA methyltransferase inhibition; methyl-DNA immunoprecipitation (MeDIP); bisulfite sequencing; and V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) knockdown assessment to investigate FXR regulation in colon cancer development. Immunohistochemistry and quantitative RT-PCR revealed that expression and function of FXR was reduced in precancerous lesions and silenced in a majority of stage I-IV tumors. FXR expression negatively correlated with phosphatidylinositol-4, 5-bisphosphate 3 kinase signaling and the epithelial-to-mesenchymal transition. The NR1H4 promoter is methylated in ~12% colon cancer The Cancer Genome Atlas samples, and methylation patterns segregate with tumor subtypes. Inhibition of DNA methylation and KRAS silencing both increased FXR expression. FXR expression is decreased early in human colon cancer progression, and both DNA methylation and KRAS signaling may be contributing factors to FXR silencing. FXR potentially suppresses epithelial-to-mesenchymal transition and other oncogenic signaling cascades, and restoration of FXR activity, by blocking silencing mechanisms or increasing residual FXR activity, represents promising therapeutic options for the treatment of colon cancer.

Silencing the Girdin gene enhances radio-sensitivity of hepatocellular carcinoma via suppression of glycolytic metabolism.

Science.gov (United States)

Yu, Li; Sun, Yifan; Li, Jingjing; Wang, Yan; Zhu, Yuxing; Shi, Yong; Fan, Xiaojun; Zhou, Jianda; Bao, Ying; Xiao, Jie; Cao, Ke; Cao, Peiguo

2017-08-15

Radiotherapy has been used increasingly to treat primary hepatocellular carcinoma. Clinically, the main cause of radiotherapy failure is cellular radioresistance, conferred via glycolytic metabolism. Our previous study demonstrated that Girdin is upregulated in primary hepatocellular carcinoma and promotes the invasion and metastasis of tumor cells. However, whether Girdin underlies the radio-sensitivity of hepatocellular carcinoma remains unclear. A short hairpin RNA (shRNA) was used to silence CCDC88A (encoding Girdin), and real-time PCR was performed to determine CCDC88A mRNA expression. Then, cell proliferation, colony formation, flow cytometric, scratch, and transwell assays were to examine the influence of Girdin silencing on cellular radiosensitivity. Glycolysis assays were conducted to exam cell glycolysis process. Western blotting was performed to explore the signaling pathway downstream of Girdin. Finally, animal experiments were performed to demonstrate the effect of CCDC88A silencing on the radiosensitivity of hepatoma in vivo. shRNA-induced Girdin silencing suppressed glycolysis and enhanced the radio-sensitivity of hepatic cell lines, HepG2 and Huh-7. Furthermore, silencing of Girdin inhibited the PI3K/AKT/HIF-1α signaling pathway, which is a central regulator of glycolysis. Girdin can regulate glycolysis in hepatocellular carcinoma cells through the PI3K/AKT/HIF-1α signaling pathway, which decreases the sensitivity of tumor cells to radiotherapy.

RNAi-mediated silencing of enolase confirms its biological importance in Clonorchis sinensis.

Science.gov (United States)

Wang, Xiaoyun; Chen, Wenjun; Tian, Yanli; Huang, Yan; Li, Xuerong; Yu, Xinbing

2014-04-01

Clonorchis sinensis (C. sinensis) infection is still a common public health problem in freshwater fish consumption areas in Asian countries. More molecular evidence are required to speed up the prevention strategies to control this kind of infectious disease. In the present study, to confirm the biological importance of Csenolase followed by our previous observations of the key metabolic enzyme, we explored the RNA silence effect of the Csenolase-derived RNA interference (RNAi) in C. sinensis. The extramembranous region aa105-226 was selected as the target sequence of RNA silence. Csenolase-derived double strand RNA (dsRNA-Csenolase, 366 bp) was synthetized and delivered into C. sinensis by soaking approach. The penetration of dsRNA into adult worms and metacercariae was tracked using fluorescently labeled RNA. Western blotting and qRT-PCR experiments were performed to determine dsRNA-Csenolase-silencing effect. Our results showed that, after incubating for 120 h, dsRNA-Csenolase could effectively target and downregulate the expression of Csenolase in both adult worms (P sinensis adult worms (P sinensis, allowing further applications in identifying functional genes in C. sinensis.

Dynamics of human complement-mediated killing of Klebsiella pneumoniae.

Science.gov (United States)

Nypaver, Christina M; Thornton, Margaret M; Yin, Suellen M; Bracho, David O; Nelson, Patrick W; Jones, Alan E; Bortz, David M; Younger, John G

2010-11-01

With an in vitro system that used a luminescent strain of Klebsiella pneumoniae to assess bacterial metabolic activity in near-real-time, we investigated the dynamics of complement-mediated attack in healthy individuals and in patients presenting to the emergency department with community-acquired severe sepsis. A novel mathematical/statistical model was developed to simplify light output trajectories over time into two fitted parameters, the rate of complement activation and the delay from activation to the onset of killing. Using Factor B-depleted serum, the alternative pathway was found to be the primary bactericidal effector: In the absence of B, C3 opsonization as measured by flow cytometry did not progress and bacteria proliferated near exponentially. Defects in bacterial killing were easily demonstrable in patients with severe sepsis compared with healthy volunteers. In most patients with sepsis, the rate of activation was higher than in normal subjects but was associated with a prolonged delay between activation and bacterial killing (P < 0.05 for both). Theoretical modeling suggested that this combination of accentuated but delayed function should allow successful bacterial killing but with significantly greater complement activation. The use of luminescent bacteria allowed for the development of a novel and powerful tool for assessing complement immunology for the purposes of mechanistic study and patient evaluation.

Broadening the future of value account of the wrongness of killing

DEFF Research Database (Denmark)

Di Nucci, Ezio

2015-01-01

On Don Marquis's future of value account of the wrongness of killing, 'what makes it wrong to kill those individuals we all believe it is wrong to kill, is that killing them deprives them of their future of value'. Marquis has recently argued for a narrow interpretation of his future of value...... account of the wrongness of killing and against the broad interpretation that I had put forward in response to Carson Strong. In this article I argue that the narrow view is problematic because it violates some basic principles of equality and because it allows for some of the very killing that Marquis...

On the Threshold: Time and the Speaking Subject in Harold Pinter’s Silence

Directory of Open Access Journals (Sweden)

Beatrice Nori

2017-07-01

Full Text Available The article investigates Harold Pinter’s play Silence from a linguistic and phenomenological point of view. Silence is probably one of the least studied – though one of the most difficult and compelling – of Pinter’s plays. The author iden­tifies the broken syntax and the combi­nation of utterances and silences as indicators of time and space shifts. She claims that the patchwork which appears from the structure of the play depicts the loss of logic, and that the abandonmen­t of chronological time in linguistic terms conveys the subjecti­ve, circular, and illogical elemen­t of the human experience of time. Characters’ bodies and utterances materialize both their own past recollections and their presen­t experiences. The presen­t work may be useful to theatre scholars as an example of drama as a portrayal of philosophical and linguistic theories about time and discourse.

Fractional Killing-Yano Tensors and Killing Vectors Using the Caputo Derivative in Some One- and Two-Dimensional Curved Space

Directory of Open Access Journals (Sweden)

Ehab Malkawi

2014-01-01

Full Text Available The classical free Lagrangian admitting a constant of motion, in one- and two-dimensional space, is generalized using the Caputo derivative of fractional calculus. The corresponding metric is obtained and the fractional Christoffel symbols, Killing vectors, and Killing-Yano tensors are derived. Some exact solutions of these quantities are reported.

Comparing Road-Kill Datasets from Hunters and Citizen Scientists in a Landscape Context

Directory of Open Access Journals (Sweden)

Florian Heigl

2016-10-01

Full Text Available Road traffic has severe effects on animals, especially when road-kills are involved. In many countries, official road-kill data are provided by hunters or police; there are also road-kill observations reported by citizen scientists. The aim of the current study was to test whether road-kill reports by hunters stem from similar landscapes than those reported by citizen scientists. We analysed the surrounding landscapes of 712 road-kill reportings of European hares in the province of Lower Austria. Our data showed that road-killed hares reported both by hunters and citizens are predominantly surrounded by arable land. No difference of hedges and solitary trees could be found between the two datasets. However, significant differences in landcover classes and surrounding road networks indicate that hunters’ and citizen scientists’ data are different. Hunters reported hares from landscapes with significantly higher percentages of arable land, and greater lengths of secondary roads. In contrast, citizens reported hares from landscapes with significantly higher percentages of urban or industrial areas and greater lengths of motorways, primary roads, and residential roads. From this we argue that hunters tend to report data mainly from their hunting areas, whereas citizens report data during their daily routine on the way to/from work. We conclude that a citizen science approach is an important source for road-kill data when used in addition to official data with the aim of obtaining an overview of road-kill events on a landscape scale.

Antibacterial activity of silver-killed bacteria: the "zombies" effect

Science.gov (United States)

Wakshlak, Racheli Ben-Knaz; Pedahzur, Rami; Avnir, David

2015-04-01

We report a previously unrecognized mechanism for the prolonged action of biocidal agents, which we denote as the zombies effect: biocidally-killed bacteria are capable of killing living bacteria. The concept is demonstrated by first killing Pseudomonas aeruginosa PAO1 with silver nitrate and then challenging, with the dead bacteria, a viable culture of the same bacterium: Efficient antibacterial activity of the killed bacteria is observed. A mechanism is suggested in terms of the action of the dead bacteria as a reservoir of silver, which, due to Le-Chatelier's principle, is re-targeted to the living bacteria. Langmuirian behavior, as well as deviations from it, support the proposed mechanism.

Some spacetimes with higher rank Killing-Staeckel tensors

International Nuclear Information System (INIS)

Gibbons, G.W.; Houri, T.; Kubiznak, D.; Warnick, C.M.

2011-01-01

By applying the lightlike Eisenhart lift to several known examples of low-dimensional integrable systems admitting integrals of motion of higher-order in momenta, we obtain four- and higher-dimensional Lorentzian spacetimes with irreducible higher-rank Killing tensors. Such metrics, we believe, are first examples of spacetimes admitting higher-rank Killing tensors. Included in our examples is a four-dimensional supersymmetric pp-wave spacetime, whose geodesic flow is superintegrable. The Killing tensors satisfy a non-trivial Poisson-Schouten-Nijenhuis algebra. We discuss the extension to the quantum regime.

Giving Voice: Narrating silence, history and memory in André Brink ...

African Journals Online (AJOL)

This essay examines André Brink's two most recent novels, The Other Side of Silence (2002) and Before I Forget (2004), in terms of their voicing of silence and the rewriting of history and memory. Each has a theme familiar to Brink's readers – an historical story of colonial violence and violation avenged; and the recounting ...

In vitro studies: The role of immunological cells in Indonesian thin tail sheep in the killing of the liver fluke, Fasciola

Directory of Open Access Journals (Sweden)

S.E Estuningsih

2002-06-01

Full Text Available Previous studies have shown that Indonesian Thin Tail (ET sheep exhibit high resistance to challenge with Fasciola gigantica when compared with Merino sheep, and this resistance is expressed in early infection. In order to study the role of the immune system in this resistance to ET sheep, in vitro studies were undertaken in the laboratory. In vitro study to confirm the ability of immune cells from ET sheep in the killing of F. gigantica larvae has been done by incubating immune cells and F. gigantica larvae together with immune sera or normal sera. The viability of the larvae was observed over a period 3 days incubation by observing their motility. The results showed that the cells isolated from F. gigantica- challenged ET sheep in the presence of immune sera from ET were able to kill 70% of the larvae. In contrast, cells from infected Merino were unable to kill a significant number of F. gigantica using the same sera source. It seems that the cytotoxicity was dependent on the presence of immune sera and ET peritoneal cells, suggesting the potential role of an antibody-dependent cell cytotoxic (ADCC mechanism in the resistant ET sheep.

Can patriotism justify killing in defense of one’s country?

Directory of Open Access Journals (Sweden)

Pavković Aleksandar

2007-01-01

Full Text Available Cosmopolitan liberals would be ready to fight - and to kill and be killed for the sake of restoring international justice or for the abolition of profoundly unjust political institutions. Patriots are ready to do the same for their own country. Sometimes the cosmopolitan liberals and patriots would fight on the same side and sometimes on the opposite sides of the conflict. Thus the former would join the latter in the defense of Serbia against Austria-Hungary (in 1914 but would oppose the white Southerner patriots in the American Civil War (in 1861. In this paper I argue that fighting and killing for one’s country is, in both of those cases, different from the defense of one’s own life and the lives of those who cannot defend themselves. Killing for one’s country is killing in order to fulfill a particular political preference. The same is the case with fighting for the abolition of a profoundly unjust political institution. It is not amoral or immoral to refuse to kill for any one of these two political preferences because there is no reason to believe that either political preference trumps our moral constraints against killing.

SGS3 Cooperates with RDR6 in Triggering Geminivirus-Induced Gene Silencing and in Suppressing Geminivirus Infection in Nicotiana Benthamiana

Directory of Open Access Journals (Sweden)

Fangfang Li

2017-09-01

Full Text Available RNA silencing has an important role in defending against virus infection in plants. Plants with the deficiency of RNA silencing components often show enhanced susceptibility to viral infections. RNA-dependent RNA polymerase (RDRs mediated-antiviral defense has a pivotal role in resistance to many plant viruses. In RDR6-mediated defense against viral infection, a plant-specific RNA binding protein, Suppressor of Gene Silencing 3 (SGS3, was also found to fight against some viruses in Arabidopsis. In this study, we showed that SGS3 from Nicotiana benthamiana (NbSGS3 is required for sense-RNA induced post-transcriptional gene silencing (S-PTGS and initiating sense-RNA-triggered systemic silencing. Further, the deficiency of NbSGS3 inhibited geminivirus-induced endogenous gene silencing (GIEGS and promoted geminivirus infection. During TRV-mediated NbSGS3 or N. benthamiana RDR6 (NbRDR6 silencing process, we found that their expression can be effectively fine-tuned. Plants with the knock-down of both NbSGS3 and NbRDR6 almost totally blocked GIEGS, and were more susceptible to geminivirus infection. These data suggest that NbSGS3 cooperates with NbRDR6 against GIEGS and geminivirus infection in N. benthamiana, which provides valuable information for breeding geminivirus-resistant plants.

The Silence of Michelangelo

DEFF Research Database (Denmark)

Foote, Jonathan

2016-01-01

In one of the many anecdotes about Michelangelo, the master neared completion of his colossal Moses, tapped him on the knee with his hammer and exclaimed,"Perché non parli?" As an act that liberates latent thoughts or material potentials, his cadenced hammer spoke through careful, repetitive, and...... and distractive, instead activate a contemplative place of silence. Perhaps more than merely a tool for removing stone, the hammer was an instrument for sonorous meditation with materials and thinking....

RNA interference silencing of CHS greatly alters the growth pattern of apple (Malus x domestica).

Science.gov (United States)

Dare, Andrew P; Hellens, Roger P

2013-08-01

Plants produce a vast array of phenolic compounds which are essential for their survival on land. One major class of polyphenols are the flavonoids and their formation is dependent on the enzyme chalcone synthase (CHS). In a recent study we silenced the CHS genes of apple (Malus × domestica Borkh.) and observed a loss of pigmentation in the fruit skin, flowers and stems. More surprisingly, highly silenced lines were significantly reduced in size, with small leaves and shortened internode lengths. Chemical analysis also revealed that the transgenic shoots contained greatly reduced concentrations of flavonoids which are known to modulate auxin flow. An auxin transport study verified this, with an increased auxin transport in the CHS-silenced lines. Overall, these findings suggest that auxin transport in apple has adapted to take place in the presence of high endogenous concentrations of flavonoids. Removal of these compounds therefore results in abnormal auxin movement and a highly disrupted growth pattern.

Technical Aspects of Cyber Kill Chain

OpenAIRE

Yadav, Tarun; Mallari, Rao Arvind

2016-01-01

Recent trends in targeted cyber-attacks has increased the interest of research in the field of cyber security. Such attacks have massive disruptive effects on rganizations, enterprises and governments. Cyber kill chain is a model to describe cyber-attacks so as to develop incident response and analysis capabilities. Cyber kill chain in simple terms is an attack chain, the path that an intruder takes to penetrate information systems over time to execute an attack on the target. This paper broa...

Structural equations for Killing tensors of order two. II

International Nuclear Information System (INIS)

Hauser, I.; Malhiot, R.J.

1975-01-01

In a preceding paper, a new form of the structural equations for any Killing tensor of order two have been derived; these equations constitute a system analogous to the Killing vector equations Nabla/sub alpha/ K/sub beta/ = ω/sub alpha beta/ = -ω/sub beta alpha/ and Nabla/sub gamma/ ω/sub alpha beta = R/sub alpha beta gamma delta/ K/sup delta/. The first integrability condition for the Killing tensor structural equations is now derived. The structural equations and the integrability condition have forms which can readily be expressed in terms of a null tetrad to furnish a Killing tensor parallel of the Newman--Penrose equations; this is briefly described. The integrability condition implies the new result, for any given space--time, that the dimension of the set of second-order Killing tensors attains its maximum possible value of 50 only if the space--time is of constant curvature. Potential applications of the structural equations are discussed

Veiled Word(s) – Sacred Silence

DEFF Research Database (Denmark)

Isar, Nicoletta

2014-01-01

or secret prayer, and divine silence, which are at the very centre of the Byzantine altar. The main focus is to investigate the liminal nature of the Mystery, manifested through concealing-revealing devices, which are thresholds in the liturgical participation of the Byzantine subject. Fear and secrecy...

Silencing of the PiAvr3a effector-encoding gene from Phytophthora infestans by transcriptional fusion to a short interspersed element.

Science.gov (United States)

Vetukuri, Ramesh R; Tian, Zhendong; Avrova, Anna O; Savenkov, Eugene I; Dixelius, Christina; Whisson, Stephen C

2011-12-01

Phytophthora infestans is the notorious oomycete causing late blight of potato and tomato. A large proportion of the P. infestans genome is composed of transposable elements, the activity of which may be controlled by RNA silencing. Accumulation of small RNAs is one of the hallmarks of RNA silencing. Here we demonstrate the presence of small RNAs corresponding to the sequence of a short interspersed retrotransposable element (SINE) suggesting that small RNAs might be involved in silencing of SINEs in P. infestans. This notion was exploited to develop novel tools for gene silencing in P. infestans by engineering transcriptional fusions of the PiAvr3a gene, encoding an RXLR avirulence effector, to the infSINEm retroelement. Transgenic P. infestans lines expressing either 5'-infSINEm::PiAvr3a-3' or 5'-PiAvr3a::SINEm-3' chimeric transcripts initially exhibited partial silencing of PiAvr3a. Over time, PiAvr3a either recovered wild type transcript levels in some lines, or became fully silenced in others. Introduction of an inverted repeat construct was also successful in yielding P. infestans transgenic lines silenced for PiAvr3a. In contrast, constructs expressing antisense or aberrant RNA transcripts failed to initiate silencing of PiAvr3a. Lines exhibiting the most effective silencing of PiAvr3a were either weakly or non-pathogenic on susceptible potato cv. Bintje. This study expands the repertoire of reverse genetics tools available for P. infestans research, and provides insights into a possible mode of variation in effector expression through spread of silencing from adjacent retroelements. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

Perturbative stability of the approximate Killing field eigenvalue problem

International Nuclear Information System (INIS)

Beetle, Christopher; Wilder, Shawn

2014-01-01

An approximate Killing field may be defined on a compact, Riemannian geometry by solving an eigenvalue problem for a certain elliptic operator. This paper studies the effect of small perturbations in the Riemannian metric on the resulting vector field. It shows that small metric perturbations, as measured using a Sobolev-type supremum norm on the space of Riemannian geometries on a fixed manifold, yield small perturbations in the approximate Killing field, as measured using a Hilbert-type square integral norm. It also discusses applications to the problem of computing the spin of a generic black hole in general relativity. (paper)

Phenotyping of VIGS-mediated gene silencing in rice using a vector derived from a DNA virus.

Science.gov (United States)

Kant, Ravi; Dasgupta, Indranil

2017-07-01

Target genes in rice can be optimally silenced if inserted in antisense or hairpin orientation in the RTBV-derived VIGS vector and plants grown at 28 °C and 80% humidity after inoculation. Virus induced gene silencing (VIGS) is a method used to transiently silence genes in dicot as well as monocot plants. For the important monocot species rice, the Rice tungro bacilliform virus (RTBV)-derived VIGS system (RTBV-VIGS), which uses agroinoculation to initiate silencing, has not been standardized for optimal use. Here, using RTBV-VIGS, three sets of conditions were tested to achieve optimal silencing of the rice marker gene phytoene desaturase (pds). The effect of orientation of the insert in the RTBV-VIGS plasmid (sense, antisense and hairpin) on the silencing of the target gene was then evaluated using rice magnesium chelatase subunit H (chlH). Finally, the rice Xa21 gene, conferring resistance against bacterial leaf blight disease (BLB) was silenced using RTBV-VIGS system. In each case, real-time PCR-based assessment indicated approximately 40-80% fall in the accumulation levels of the transcripts of pds, chlH and Xa21. In the case of pds, the appearance of white streaks in the emerging leaves, and for chlH, chlorophyll levels and F v /F m ratio were assessed as phenotypes for silencing. For Xa21, the resistance levels to BLB were assessed by measuring the lesion length and the percent diseased areas of leaves, following challenge inoculation with Xanthomonas oryzae. In each case, the RTBV-MVIGS system gave rise to a discernible phenotype indicating the silencing of the respective target gene using condition III (temperature 28 °C, humidity 80% and 1 mM MES and 20 µM acetosyringone in secondary agrobacterium culture), which revealed the robustness of this gene silencing system for rice.

Killing spinors as a characterisation of rotating black hole spacetimes

International Nuclear Information System (INIS)

Cole, Michael J; Kroon, Juan A Valiente

2016-01-01

We investigate the implications of the existence of Killing spinors in a spacetime. In particular, we show that in vacuum and electrovacuum a Killing spinor, along with some assumptions on the associated Killing vector in an asymptotic region, guarantees that the spacetime is locally isometric to the Kerr or Kerr–Newman solutions. We show that the characterisation of these spacetimes in terms of Killing spinors is an alternative expression of characterisation results of Mars (Kerr) and Wong (Kerr–Newman) involving restrictions on the Weyl curvature and matter content. (paper)

RNA-mediated gene silencing signals are not graft transmissible from the rootstock to the scion in greenhouse-grown apple plants Malus sp.

Science.gov (United States)

Flachowsky, Henryk; Tränkner, Conny; Szankowski, Iris; Waidmann, Sascha; Hanke, Magda-Viola; Treutter, Dieter; Fischer, Thilo C

2012-01-01

RNA silencing describes the sequence specific degradation of RNA targets. Silencing is a non-cell autonomous event that is graft transmissible in different plant species. The present study is the first report on systemic acquired dsRNA-mediated gene silencing of transgenic and endogenous gene sequences in a woody plant like apple. Transgenic apple plants overexpressing a hairpin gene construct of the gusA reporter gene were produced. These plants were used as rootstocks and grafted with scions of the gusA overexpressing transgenic apple clone T355. After grafting, we observed a reduction of the gusA gene expression in T355 scions in vitro, but not in T355 scions grown in the greenhouse. Similar results were obtained after silencing of the endogenous Mdans gene in apple that is responsible for anthocyanin biosynthesis. Subsequently, we performed grafting experiments with Mdans silenced rootstocks and red leaf scions of TNR31-35 in order to evaluate graft transmitted silencing of the endogenous Mdans. The results obtained suggested a graft transmission of silencing signals in in vitro shoots. In contrast, no graft transmission of dsRNA-mediated gene silencing signals was detectable in greenhouse-grown plants and in plants grown in an insect protection tent.

Silencing of the SlNAP7 gene influences plastid development and lycopene accumulation in tomato

Science.gov (United States)

Fu, Da-Qi; Meng, Lan-Huan; Zhu, Ben-Zhong; Zhu, Hong-Liang; Yan, Hua-Xue; Luo, Yun-Bo

2016-12-01

Ripening is an important stage of fruit development. To screen the genes associated with pigment formation in tomato fruit, a suppression subtractive hybridization (SSH) cDNA library was constructed by using tomato fruit in the green ripe and break ripe stages, and 129 differential genes were obtained. Using redness as a screening marker, virus-induced gene silencing (VIGS) of the differential genes was performed with a sprout vacuum-infiltration system (SVI). The results showed that silencing the SlNAP7 gene affected the chloroplast development of tomato leaves, manifesting as a photo-bleaching phenotype, and silenced fruit significantly affected the accumulation of lycopene, manifested as a yellow phenotype. In our study, we found that silencing the SlNAP7 gene downregulates the expression of the POR and PORA genes and destroys the normal development of the chloroplast. The expression of related genes included in the lycopene biosynthesis pathway was not significantly changed, but lycopene accumulation was significantly reduced in tomato fruit. Perhaps it was caused by the destruction of the chromoplast, which leads to the oxidation of lycopene. The results show that the SlNAP7 gene influences chloroplast development and lycopene accumulation in tomato.

Dynamics of Human Complement–Mediated Killing of Klebsiella pneumoniae

Science.gov (United States)

Nypaver, Christina M.; Thornton, Margaret M.; Yin, Suellen M.; Bracho, David O.; Nelson, Patrick W.; Jones, Alan E.; Bortz, David M.; Younger, John G.

2010-01-01

With an in vitro system that used a luminescent strain of Klebsiella pneumoniae to assess bacterial metabolic activity in near-real-time, we investigated the dynamics of complement-mediated attack in healthy individuals and in patients presenting to the emergency department with community-acquired severe sepsis. A novel mathematical/statistical model was developed to simplify light output trajectories over time into two fitted parameters, the rate of complement activation and the delay from activation to the onset of killing. Using Factor B–depleted serum, the alternative pathway was found to be the primary bactericidal effector: In the absence of B, C3 opsonization as measured by flow cytometry did not progress and bacteria proliferated near exponentially. Defects in bacterial killing were easily demonstrable in patients with severe sepsis compared with healthy volunteers. In most patients with sepsis, the rate of activation was higher than in normal subjects but was associated with a prolonged delay between activation and bacterial killing (P < 0.05 for both). Theoretical modeling suggested that this combination of accentuated but delayed function should allow successful bacterial killing but with significantly greater complement activation. The use of luminescent bacteria allowed for the development of a novel and powerful tool for assessing complement immunology for the purposes of mechanistic study and patient evaluation. PMID:20008281

The effects of sedative music, arousal music, and silence on electrocardiography signals.

Science.gov (United States)

Dousty, Mehdy; Daneshvar, Sabalan; Haghjoo, Majid

2011-01-01

Research indicates that music can affect heart rate, blood pressure, and skin conductance. Music can stimulate central emotions in the brain and release biochemical materials that change the physiologic state. We sought to compare changes in the electrical function of the heart in response to music. Subjects were asked to listen to 2 types of music, namely, sedative and arousal music, in conjunction with two 30-second periods of complete silence. The experiment was conducted in 4 segments: the first and third parts were silence, and the second and fourth parts were music. First, the response to each type of music was compared with that to the preceding period of silence. Next, the responses to both types of music were compared. Finally, the response to music regardless of the type was compared with that to silence. The amplitude of polarization and depolarization changed in response to different kinds of music. The electrical function of the heart in response to music, irrespective of the music type, differed from that in response to silence. The 2 types of music impacted the electrical function of the heart in different ways: the arousal music influenced T-wave maximum amplitude, whereas no such change was recorded in response to the sedative music. The bandwidth of the polarization and depolarization of the heart rate and R-wave amplitude increased in response to music by comparison with silence. In addition, the heart did not seem to try to synchronize with music. The mean R-wave amplitude in sedative music is higher than the arousal music, so our heart works differently when different types of music are heard. Copyright © 2011 Elsevier Inc. All rights reserved.

Nicotinamide clearance by Pnc1 directly regulates Sir2-mediated silencing and longevity.

Science.gov (United States)

Gallo, Christopher M; Smith, Daniel L; Smith, Jeffrey S

2004-02-01

The Saccharomyces cerevisiae Sir2 protein is an NAD(+)-dependent histone deacetylase (HDAC) that functions in transcriptional silencing and longevity. The NAD(+) salvage pathway protein, Npt1, regulates Sir2-mediated processes by maintaining a sufficiently high intracellular NAD(+) concentration. However, another NAD(+) salvage pathway component, Pnc1, modulates silencing independently of the NAD(+) concentration. Nicotinamide (NAM) is a by-product of the Sir2 deacetylase reaction and is a natural Sir2 inhibitor. Pnc1 is a nicotinamidase that converts NAM to nicotinic acid. Here we show that recombinant Pnc1 stimulates Sir2 HDAC activity in vitro by preventing the accumulation of NAM produced by Sir2. In vivo, telomeric, rDNA, and HM silencing are differentially sensitive to inhibition by NAM. Furthermore, PNC1 overexpression suppresses the inhibitory effect of exogenously added NAM on silencing, life span, and Hst1-mediated transcriptional repression. Finally, we show that stress suppresses the inhibitory effect of NAM through the induction of PNC1 expression. Pnc1, therefore, positively regulates Sir2-mediated silencing and longevity by preventing the accumulation of intracellular NAM during times of stress.

Age and sex composition of seals killed by polar bears in the eastern Beaufort Sea.

Science.gov (United States)

Pilfold, Nicholas W; Derocher, Andrew E; Stirling, Ian; Richardson, Evan; Andriashek, Dennis

2012-01-01

Polar bears (Ursus maritimus) of the Beaufort Sea enter hyperphagia in spring and gain fat reserves to survive periods of low prey availability. We collected information on seals killed by polar bears (n=650) and hunting attempts on ringed seal (Pusa hispida) lairs (n=1396) observed from a helicopter during polar bear mark-recapture studies in the eastern Beaufort Sea in spring in 1985-2011. We investigated how temporal shifts in ringed seal reproduction affect kill composition and the intraspecific vulnerabilities of ringed seals to polar bear predation. Polar bears primarily preyed on ringed seals (90.2%) while bearded seals (Erignathus barbatus) only comprised 9.8% of the kills, but 33% of the biomass. Adults comprised 43.6% (150/344) of the ringed seals killed, while their pups comprised 38.4% (132/344). Juvenile ringed seals were killed at the lowest proportion, comprising 18.0% (62/344) of the ringed seal kills. The proportion of ringed seal pups was highest between 2007-2011, in association with high ringed seal productivity. Half of the adult ringed seal kills were ≥ 21 years (60/121), and kill rates of adults increased following the peak of parturition. Determination of sex from DNA revealed that polar bears killed adult male and adult female ringed seals equally (0.50, n=78). The number of hunting attempts at ringed seal subnivean lair sites was positively correlated with the number of pup kills (r(2) =0.30, P=0.04), but was not correlated with the number of adult kills (P=0.37). Results are consistent with decadal trends in ringed seal productivity, with low numbers of pups killed by polar bears in spring in years of low pup productivity, and conversely when pup productivity was high. Vulnerability of adult ringed seals to predation increased in relation to reproductive activities and age, but not gender.

Activity of telithromycin (HMR 3647) against anaerobic bacteria compared to those of eight other agents by time-kill methodology.

Science.gov (United States)

Credito, K L; Ednie, L M; Jacobs, M R; Appelbaum, P C

1999-08-01

Time-kill studies examined the activities of telithromycin (HMR 3647), erythromycin A, azithromycin, clarithromycin, roxithromycin, clindamycin, pristinamycin, amoxicillin-clavulanate, and metronidazole against 11 gram-positive and gram-negative anaerobic bacteria. Time-kill studies were carried out with the addition of Oxyrase in order to prevent the introduction of CO(2). Macrolide-azalide-ketolide MICs were 0.004 to 32.0 microg/ml. Of the latter group, telithromycin had the lowest MICs, especially against non-Bacteroides fragilis group strains, followed by azithromycin, clarithromycin, erythromycin A, and roxithromycin. Clindamycin was active (MIC /=99.9% killing) against 6 strains, with 99% killing of 9 strains and 90% killing of 10 strains. After 24 h at twice the MIC, 90, 99, and 99.9% killing of nine, six, and three strains, respectively, occurred. Lower rates of killing were seen at earlier times. Similar kill kinetics relative to the MIC were seen with other macrolides. After 48 h at the MIC, clindamycin was bactericidal against 8 strains, with 99 and 90% killing of 9 and 10 strains, respectively. After 24 h, 90% killing of 10 strains occurred at the MIC. The kinetics of clindamycin were similar to those of pristinamycin. After 48 h at the MIC, amoxicillin-clavulanate showed 99.9% killing of seven strains, with 99% killing of eight strains and 90% killing of nine strains. At four times the MIC, metronidazole was bactericidal against 8 of 10 strains tested after 48 h and against all 10 strains after 24 h; after 12 h, 99% killing of all 10 strains occurred.

Duplication of an upstream silencer of FZP increases grain yield in rice.

Science.gov (United States)

Bai, Xufeng; Huang, Yong; Hu, Yong; Liu, Haiyang; Zhang, Bo; Smaczniak, Cezary; Hu, Gang; Han, Zhongmin; Xing, Yongzhong

2017-11-01

Transcriptional silencer and copy number variants (CNVs) are associated with gene expression. However, their roles in generating phenotypes have not been well studied. Here we identified a rice quantitative trait locus, SGDP7 (Small Grain and Dense Panicle 7). SGDP7 is identical to FZP (FRIZZY PANICLE), which represses the formation of axillary meristems. The causal mutation of SGDP7 is an 18-bp fragment, named CNV-18bp, which was inserted ~5.3 kb upstream of FZP and resulted in a tandem duplication in the cultivar Chuan 7. The CNV-18bp duplication repressed FZP expression, prolonged the panicle branching period and increased grain yield by more than 15% through substantially increasing the number of spikelets per panicle (SPP) and slightly decreasing the 1,000-grain weight (TGW). The transcription repressor OsBZR1 binds the CGTG motifs in CNV-18bp and thereby represses FZP expression, indicating that CNV-18bp is the upstream silencer of FZP. These findings showed that the silencer CNVs coordinate a trade-off between SPP and TGW by fine-tuning FZP expression, and balancing the trade-off could enhance yield potential.

Theriocide: Naming Animal Killing

Directory of Open Access Journals (Sweden)

Piers Beirne

2014-08-01

Full Text Available In this essay I recommend ‘theriocide’ as the name for those diverse human actions that cause the deaths of animals. Like the killing of one human by another, theriocide may be socially acceptable or unacceptable, legal or illegal. It may be intentional or unintentional and may involve active maltreatment or passive neglect. Theriocide may occur one-on-one, in small groups or in large-scale social institutions. The numerous and sometimes intersecting sites of theriocide include intensive rearing regimes; hunting and fishing; trafficking; vivisection; militarism; pollution; and human-induced climate change. If the killing of animals by humans is as harmful to them as homicide is to humans, then the proper naming of such deaths offers a remedy, however small, to the extensive privileging of human lives over those of other animals. Inevitably, the essay leads to a shocking question: Is theriocide murder?

Silencing Deafness: Displacing Disability in the Nineteenth Century

Directory of Open Access Journals (Sweden)

Esme Cleall

2015-03-01

Full Text Available This article traces the way in which the language of displacement and silence were used in nineteenth-century discussions of deafness and connects this tendency to the marginalised place deaf experience occupies historically. Throughout the nineteenth century, a period which saw the consolidation of ‘the deaf and dumb’ as a social category, the word ‘forgetting’ crept into numerous discussions of deafness by both deaf and hearing commentators. Some, such as the educationalist Alexander Graeme Bell, were overt in their desire to forget deafness, demanding disability was ‘bred out’ and deaf culture condemned to the forgotten past. Others used the term ambivalently and sometimes metaphorically discussing the deaf as ‘forgotten’ by society, and ‘children of silence’. Some even pleaded that people who were deaf were not forgotten. But, though varied, the use of the imagery of forgetting and silence to evoke deafness is recurrent, and may, therefore, be seen to reveal something about how deaf experience can be approached as a displacement where deafness was spatially and imaginatively marginalised. I argue that one of the consequences of the conceptual framing of deafness through the language of forgetting was actively to silence deafness and to neutralise the idea that disability should be marginal and could be forgotten.

An albumin-mediated cholesterol design-based strategy for tuning siRNA pharmacokinetics and gene silencing.

Science.gov (United States)

Bienk, Konrad; Hvam, Michael Lykke; Pakula, Malgorzata Maria; Dagnæs-Hansen, Frederik; Wengel, Jesper; Malle, Birgitte Mølholm; Kragh-Hansen, Ulrich; Cameron, Jason; Bukrinski, Jens Thostrup; Howard, Kenneth A

2016-06-28

Major challenges for the clinical translation of small interfering RNA (siRNA) include overcoming the poor plasma half-life, site-specific delivery and modulation of gene silencing. In this work, we exploit the intrinsic transport properties of human serum albumin to tune the blood circulatory half-life, hepatic accumulation and gene silencing; based on the number of siRNA cholesteryl modifications. We demonstrate by a gel shift assay a strong and specific affinity of recombinant human serum albumin (rHSA) towards cholesteryl-modified siRNA (Kd>1×10(-7)M) dependent on number of modifications. The rHSA/siRNA complex exhibited reduced nuclease degradation and reduced induction of TNF-α production by human peripheral blood mononuclear cells. The increased solubility of heavily cholesteryl modified siRNA in the presence of rHSA facilitated duplex annealing and consequent interaction that allowed in vivo studies using multiple cholesteryl modifications. A structural-activity-based screen of in vitro EGFP-silencing was used to select optimal siRNA designs containing cholesteryl modifications within the sense strand that were used for in vivo studies. We demonstrate plasma half-life extension in NMRI mice from t1/2 12min (naked) to t1/2 45min (single cholesteryl) and t1/2 71min (double cholesteryl) using fluorescent live bioimaging. The biodistribution showed increased accumulation in the liver for the double cholesteryl modified siRNA that correlated with an increase in hepatic Factor VII gene silencing of 28% (rHSA/siRNA) compared to 4% (naked siRNA) 6days post-injection. This work presents a novel albumin-mediated cholesteryl design-based strategy for tuning pharmacokinetics and systemic gene silencing. Copyright © 2016 Elsevier B.V. All rights reserved.

Friction coefficient measurements of silencers on specialized duct tract

Directory of Open Access Journals (Sweden)

Sehnalek Stanislav

2016-01-01

Full Text Available This article describes test methods on air duct track in Laboratory of Environmental Engineering. It focuses on measurement of silencer parameter like is pressure loss coeffcient. Firstly, the paper describe the measurement apparatus with description of calculation method by standard ISO 7235 and energy equation. Then the paper presents three ways how to accomplish measurement because such way is not covered by procedure in standard. Then follows the evaluation of results of measurements on three types of silencer designed for HVAC applications. The article is concluded with discussion over measured data with outline for further research.

Silence in the second language classroom

CERN Document Server

King, J

2013-01-01

Why are second language learners in Japan's universities so silent? This book investigates the perplexing but intriguing phenomenon of classroom silence and draws on ideas from psychology, sociolinguistics and anthropology to offer a unique insight into the reasons why some learners are either unable or unwilling to speak in a foreign language.

Development of Agrobacterium-mediated virus-induced gene silencing and performance evaluation of four marker genes in Gossypium barbadense.

Directory of Open Access Journals (Sweden)

Jinhuan Pang

Full Text Available Gossypiumbarbadense is a cultivated cotton species and possesses many desirable traits, including high fiber quality and resistance to pathogens, especially Verticilliumdahliae (a devastating pathogen of Gossypium hirsutum, the main cultivated species. These elite traits are difficult to be introduced into G. hirsutum through classical breeding methods. In addition, genetic transformation of G. barbadense has not been successfully performed. It is therefore important to develop methods for evaluating the function and molecular mechanism of genes in G. barbadense. In this study, we had successfully introduced a virus-induced gene silencing (VIGS system into three cultivars of G. barbadense by inserting marker genes into the tobacco rattle virus (TRV vector. After we optimized the VIGS conditions, including light intensity, photoperiod, seedling age and Agrobacterium strain, 100% of plants agroinfiltrated with the GaPDS silencing vector showed white colored leaves. Three other marker genes, GaCLA1, GaANS and GaANR, were employed to further test this VIGS system in G. barbadense. The transcript levels of the endogenous genes in the silenced plants were reduced by more than 99% compared to control plants; these plants presented phenotypic symptoms 2 weeks after inoculation. We introduced a fusing sequence fragment of GaPDS and GaANR gene silencing vectors into a single plant, which resulted in both photobleaching and brownish coloration. The extent of silencing in plants agroinfiltrated with fusing two-gene-silencing vector was consistent with plants harboring a single gene silencing vector. The development of this VIGS system should promote analysis of gene function in G. barbadense, and help to contribute desirable traits for breeding of G. barbadense and G. hirsutum.

A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes

KAUST Repository

Jin, Hailing; Zhu, Jian-Kang

2010-01-01

RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904-915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host's essential effector of RNA silencing. Several GW motif-containing cellular proteins are known to be important partners of AGOs in RNA silencing effector complexes in yeast, plants, and animals. The GW motif appears to be a versatile and effective tool for regulating the activities of RNA silencing pathways, and the use of GW mimicry to compete for and inhibit host AGOs may be a strategy used by many pathogens to counteract host RNAi-based defenses. © 2010 by Cold Spring Harbor Laboratory Press.

Transgene-induced gene silencing is not affected by a change in ploidy level.

Directory of Open Access Journals (Sweden)

Daniela Pignatta

Full Text Available BACKGROUND: Whole genome duplication, which results in polyploidy, is a common feature of plant populations and a recurring event in the evolution of flowering plants. Polyploidy can result in changes to gene expression and epigenetic instability. Several epigenetic phenomena, occurring at the transcriptional or post-transcriptional level, have been documented in allopolyploids (polyploids derived from species hybrids of Arabidopsis thaliana, yet findings in autopolyploids (polyploids derived from the duplication of the genome of a single species are limited. Here, we tested the hypothesis that an increase in ploidy enhances transgene-induced post-transcriptional gene silencing using autopolyploids of A. thaliana. METHODOLOGY/PRINCIPAL FINDINGS: Diploid and tetraploid individuals of four independent homozygous transgenic lines of A. thaliana transformed with chalcone synthase (CHS inverted repeat (hairpin constructs were generated. For each line diploids and tetraploids were compared for efficiency in post-transcriptional silencing of the endogenous CHS gene. The four lines differed substantially in their silencing efficiency. Yet, diploid and tetraploid plants derived from these plants and containing therefore identical transgene insertions showed no difference in the efficiency silencing CHS as assayed by visual scoring, anthocyanin assays and quantification of CHS mRNA. CONCLUSIONS/SIGNIFICANCE: Our results in A. thaliana indicated that there is no effect of ploidy level on transgene-induced post-transcriptional gene silencing. Our findings that post-transcriptional mechanisms were equally effective in diploids and tetraploids supports the use of transgene-driven post-transcriptional gene silencing as a useful mechanism to modify gene expression in polyploid species.

Predator-dependent functional response in wolves: from food limitation to surplus killing.

Science.gov (United States)

Zimmermann, Barbara; Sand, Håkan; Wabakken, Petter; Liberg, Olof; Andreassen, Harry Peter

2015-01-01

The functional response of a predator describes the change in per capita kill rate to changes in prey density. This response can be influenced by predator densities, giving a predator-dependent functional response. In social carnivores which defend a territory, kill rates also depend on the individual energetic requirements of group members and their contribution to the kill rate. This study aims to provide empirical data for the functional response of wolves Canis lupus to the highly managed moose Alces alces population in Scandinavia. We explored prey and predator dependence, and how the functional response relates to the energetic requirements of wolf packs. Winter kill rates of GPS-collared wolves and densities of cervids were estimated for a total of 22 study periods in 15 wolf territories. The adult wolves were identified as the individuals responsible for providing kills to the wolf pack, while pups could be described as inept hunters. The predator-dependent, asymptotic functional response models (i.e. Hassell-Varley type II and Crowley-Martin) performed best among a set of 23 competing linear, asymptotic and sigmoid models. Small wolf packs acquired >3 times as much moose biomass as required to sustain their field metabolic rate (FMR), even at relatively low moose abundances. Large packs (6-9 wolves) acquired less biomass than required in territories with low moose abundance. We suggest the surplus killing by small packs is a result of an optimal foraging strategy to consume only the most nutritious parts of easy accessible prey while avoiding the risk of being detected by humans. Food limitation may have a stabilizing effect on pack size in wolves, as supported by the observed negative relationship between body weight of pups and pack size. © 2014 The Authors. Journal of Animal Ecology published by John Wiley & Sons Ltd on behalf of British Ecological Society.

Estimated Number of Birds Killed by House Cats (Felis catus in Canada

Directory of Open Access Journals (Sweden)

Peter Blancher

2013-12-01

Full Text Available Predation by house cats (Felis catus is one of the largest human-related sources of mortality for wild birds in the United States and elsewhere, and has been implicated in extinctions and population declines of several species. However, relatively little is known about this topic in Canada. The objectives of this study were to provide plausible estimates for the number of birds killed by house cats in Canada, identify information that would help improve those estimates, and identify species potentially vulnerable to population impacts. In total, cats are estimated to kill between 100 and 350 million birds per year in Canada (> 95% of estimates were in this range, with the majority likely to be killed by feral cats. This range of estimates is based on surveys indicating that Canadians own about 8.5 million pet cats, a rough approximation of 1.4 to 4.2 million feral cats, and literature values of predation rates from studies conducted elsewhere. Reliability of the total kill estimate would be improved most by better knowledge of feral cat numbers and diet in Canada, though any data on birds killed by cats in Canada would be helpful. These estimates suggest that 2-7% of birds in southern Canada are killed by cats per year. Even at the low end, predation by house cats is probably the largest human-related source of bird mortality in Canada. Many species of birds are potentially vulnerable to at least local population impacts in southern Canada, by virtue of nesting or feeding on or near ground level, and habitat choices that bring them into contact with human-dominated landscapes where cats are abundant. Because cat predation is likely to remain a primary source of bird mortality in Canada for some time, this issue needs more scientific attention in Canada.

Reptile road-kills in Southern Brazil: Composition, hot moments and hotspots.

Science.gov (United States)

Gonçalves, Larissa Oliveira; Alvares, Diego Janisch; Teixeira, Fernanda Zimmermann; Schuck, Gabriela; Coelho, Igor Pfeifer; Esperandio, Isadora Beraldi; Anza, Juan; Beduschi, Júlia; Bastazini, Vinicius Augusto Galvão; Kindel, Andreas

2018-02-15

Understanding road-kill patterns is the first step to assess the potential effects of road mortality on wildlife populations, as well as to define the need for mitigation and support its planning. Reptiles are one of the vertebrate groups most affected by roads through vehicle collisions, both because they are intentionally killed by drivers, and due to their biological needs, such as thermoregulation, which make them more prone to collisions. We conducted monthly road surveys (33months), searching for carcasses of freshwater turtles, lizards, and snakes on a 277-km stretch of BR-101 road in Southernmost Brazil to estimate road-kill composition and magnitude and to describe the main periods and locations of road-kills. We modeled the distribution of road-kills in space according to land cover classes and local traffic volume. Considering the detection capacity of our method and carcass persistence probability, we estimated that 15,377 reptiles are road-killed per year (55reptiles/km/year). Road-kills, especially lizards and snakes, were concentrated during summer, probably due to their higher activity in this period. Road-kill hotspots were coincident among freshwater turtles, lizards, and snakes. Road-kill distribution was negatively related to pine plantations, and positively related to rice plantations and traffic volume. A cost-benefit analysis highlighted that if mitigation measures were installed at road-kill hotspots, which correspond to 21% of the road, they could have avoided up to 45% of recorded reptile fatalities, assuming a 100% mitigation effectiveness. Given the congruent patterns found for all three taxa, the same mitigation measures could be used to minimize the impacts of collision on local herpetofauna. Copyright © 2017 Elsevier B.V. All rights reserved.

Integrating Poetry and "To Kill a Mockingbird."

Science.gov (United States)

Jolley, Susan Arpajian

2002-01-01

Outlines a method of teaching "To Kill a Mockingbird" along with the study of poetry. Notes that this method allows students to consider the themes of courage and developing compassion. Concludes that teaching such a multigenre unit allows students to look for connections among fact and fiction, the past and present, their own lives and…

Comparative antianaerobic activities of doripenem determined by MIC and time-kill analysis.

Science.gov (United States)

Credito, Kim L; Ednie, Lois M; Appelbaum, Peter C

2008-01-01

Against 447 anaerobe strains, the investigational carbapenem doripenem had an MIC 50 of 0.125 microg/ml and an MIC 90 of 1 microg/ml. Results were similar to those for imipenem, meropenem, and ertapenem. Time-kill studies showed that doripenem had very good bactericidal activity compared to other carbapenems, with 99.9% killing of 11 strains at 2x MIC after 48 h.

RNA-Interference Components Are Dispensable for Transcriptional Silencing of the Drosophila Bithorax-Complex

KAUST Repository

Cernilogar, Filippo M.; Burroughs, A. Maxwell; Lanzuolo, Chiara; Breiling, Achim; Imhof, Axel; Orlando, Valerio

2013-01-01

.Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.

Studies of killing effect of ionization radiation associated with As2O3 on SHG44 human glioma cells

International Nuclear Information System (INIS)

Huang Hui; Liu Fenju; Chen Jian; Ning Ping

2004-01-01

Objective: To study the effect of ionization radiation combined with As 2 O 3 on the killing of SHG44 human glioma cells. Methods: The survival rates of SHG44 cells treated with different doses of ionization radiation, As 2 O 3 respectively and radiation associated were determined with As 2 O 3 by MTT assay. The change of cell morphology was observed by confocal laser scanning microscopy. Results: (1) The survival rate of the group treated with ionization radiation combined with As 2 O 3 was significantly lower than that of the group treated with radiation or As 2 O 3 only (P 2 O 3 was significantly lower than that of the group treated with 6 Gy radiation (P 0.05); (3) Cells treated with radiation or As 2 O 3 had a morphological change indicating the apoptosis of SHG44 cells. Conclusion: The killing effect of ionization radiation combined with As 2 O 3 on the SHG44 cells is stronger than that of radiation or As 2 O 3 only. Inducing SHG44 cells' apoptosis may be the mechanism of As 2 O 3 killing effects on SHG44 cells. (authors)

The killing of African trypanosomes by ethidium bromide.

Directory of Open Access Journals (Sweden)

Arnab Roy Chowdhury

2010-12-01

Full Text Available Introduced in the 1950s, ethidium bromide (EB is still used as an anti-trypanosomal drug for African cattle although its mechanism of killing has been unclear and controversial. EB has long been known to cause loss of the mitochondrial genome, named kinetoplast DNA (kDNA, a giant network of interlocked minicircles and maxicircles. However, the existence of viable parasites lacking kDNA (dyskinetoplastic led many to think that kDNA loss could not be the mechanism of killing. When recent studies indicated that kDNA is indeed essential in bloodstream trypanosomes and that dyskinetoplastic cells survive only if they have a compensating mutation in the nuclear genome, we investigated the effect of EB on kDNA and its replication. We here report some remarkable effects of EB. Using EM and other techniques, we found that binding of EB to network minicircles is low, probably because of their association with proteins that prevent helix unwinding. In contrast, covalently-closed minicircles that had been released from the network for replication bind EB extensively, causing them, after isolation, to become highly supertwisted and to develop regions of left-handed Z-DNA (without EB, these circles are fully relaxed. In vivo, EB causes helix distortion of free minicircles, preventing replication initiation and resulting in kDNA loss and cell death. Unexpectedly, EB also kills dyskinetoplastic trypanosomes, lacking kDNA, by inhibiting nuclear replication. Since the effect on kDNA occurs at a >10-fold lower EB concentration than that on nuclear DNA, we conclude that minicircle replication initiation is likely EB's most vulnerable target, but the effect on nuclear replication may also contribute to cell killing.

Evolution equations for Killing fields

International Nuclear Information System (INIS)

Coll, B.

1977-01-01

The problem of finding necessary and sufficient conditions on the Cauchy data for Einstein equations which insure the existence of Killing fields in a neighborhood of an initial hypersurface has been considered recently by Berezdivin, Coll, and Moncrief. Nevertheless, it can be shown that the evolution equations obtained in all these cases are of nonstrictly hyperbolic type, and, thus, the Cauchy data must belong to a special class of functions. We prove here that, for the vacuum and Einstein--Maxwell space--times and in a coordinate independent way, one can always choose, as evolution equations for the Killing fields, a strictly hyperbolic system: The above theorems can be thus extended to all Cauchy data for which the Einstein evolution problem has been proved to be well set

Dirac operators and Killing spinors with torsion

International Nuclear Information System (INIS)

Becker-Bender, Julia

2012-01-01

On a Riemannian spin manifold with parallel skew torsion, we use the twistor operator to obtain an eigenvalue estimate for the Dirac operator with torsion. We consider the equality case in dimensions four and six. In odd dimensions we describe Sasaki manifolds on which equality in the estimate is realized by Killing spinors with torsion. In dimension five we characterize all Killing spinors with torsion and obtain certain naturally reductive spaces as exceptional cases.

Two Novel Motifs of Watermelon Silver Mottle Virus NSs Protein Are Responsible for RNA Silencing Suppression and Pathogenicity.

Science.gov (United States)

Huang, Chung-Hao; Hsiao, Weng-Rong; Huang, Ching-Wen; Chen, Kuan-Chun; Lin, Shih-Shun; Chen, Tsung-Chi; Raja, Joseph A J; Wu, Hui-Wen; Yeh, Shyi-Dong

2015-01-01

The NSs protein of Watermelon silver mottle virus (WSMoV) is the RNA silencing suppressor and pathogenicity determinant. In this study, serial deletion and point-mutation mutagenesis of conserved regions (CR) of NSs protein were performed, and the silencing suppression function was analyzed through agroinfiltration in Nicotiana benthamiana plants. We found two amino acid (aa) residues, H113 and Y398, are novel functional residues for RNA silencing suppression. Our further analyses demonstrated that H113 at the common epitope (CE) ((109)KFTMHNQ(117)), which is highly conserved in Asia type tospoviruses, and the benzene ring of Y398 at the C-terminal β-sheet motif ((397)IYFL(400)) affect NSs mRNA stability and protein stability, respectively, and are thus critical for NSs RNA silencing suppression. Additionally, protein expression of other six deleted (ΔCR1-ΔCR6) and five point-mutated (Y15A, Y27A, G180A, R181A and R212A) mutants were hampered and their silencing suppression ability was abolished. The accumulation of the mutant mRNAs and proteins, except Y398A, could be rescued or enhanced by co-infiltration with potyviral suppressor HC-Pro. When assayed with the attenuated Zucchini yellow mosaic virus vector in squash plants, the recombinants carrying individual seven point-mutated NSs proteins displayed symptoms much milder than the recombinant carrying the wild type NSs protein, suggesting that these aa residues also affect viral pathogenicity by suppressing the host silencing mechanism.

5-Azacytidine mediated reactivation of silenced transgenes in potato (Solanum tuberosum) at the whole plant level.

Science.gov (United States)

Tyč, Dimitrij; Nocarová, Eva; Sikorová, Lenka; Fischer, Lukáš

2017-08-01

Transient 5-azacytidine treatment of leaf explants from potato plants with transcriptionally silenced transgenes allows de novo regeneration of plants with restored transgene expression at the whole plant level. Transgenes introduced into plant genomes frequently become silenced either at the transcriptional or the posttranscriptional level. Transcriptional silencing is usually associated with DNA methylation in the promoter region. Treatments with inhibitors of maintenance DNA methylation were previously shown to allow reactivation of transcriptionally silenced transgenes in single cells or tissues, but not at the whole plant level. Here we analyzed the effect of DNA methylation inhibitor 5-azacytidine (AzaC) on the expression of two silenced reporter genes encoding green fluorescent protein (GFP) and neomycin phosphotransferase (NPTII) in potato plants. Whereas no obvious reactivation was observed in AzaC-treated stem cuttings, transient treatment of leaf segments with 10 μM AzaC and subsequent de novo regeneration of shoots on the selective medium with kanamycin resulted in the production of whole plants with clearly reactivated expression of previously silenced transgenes. Reactivation of nptII expression was accompanied by a decrease in cytosine methylation in the promoter region of the gene. Using the plants with reactivated GFP expression, we found that re-silencing of this transgene can be accidentally triggered by de novo regeneration. Thus, testing the incidence of transgene silencing during de novo regeneration could be a suitable procedure for negative selection of transgenic lines (insertion events) which have an inclination to be silenced. Based on our analysis of non-specific inhibitory effects of AzaC on growth of potato shoots in vitro, we estimated that AzaC half-life in the culture media is approximately 2 days.

An Algorithm for Generating Small RNAs Capable of Epigenetically Modulating Transcriptional Gene Silencing and Activation in Human Cells

Directory of Open Access Journals (Sweden)

Amanda Ackley

2013-01-01

Full Text Available Small noncoding antisense RNAs (sasRNAs guide epigenetic silencing complexes to target loci in human cells and modulate gene transcription. When these targeted loci are situated within a promoter, long-term, stable epigenetic silencing of transcription can occur. Recent studies suggest that there exists an endogenous form of such epigenetic regulation in human cells involving long noncoding RNAs. In this article, we present and validate an algorithm for the generation of highly effective sasRNAs that can mimic the endogenous noncoding RNAs involved in the epigenetic regulation of gene expression. We validate this algorithm by targeting several oncogenes including AKT-1, c-MYC, K-RAS, and H-RAS. We also target a long antisense RNA that mediates the epigenetic repression of the tumor suppressor gene DUSP6, silenced in pancreatic cancer. An algorithm that can efficiently design small noncoding RNAs for the epigenetic transcriptional silencing or activation of specific genes has potential therapeutic and experimental applications.

Targeted killing with drones? Old arguments, new technologies

Directory of Open Access Journals (Sweden)

Meisels Tamar

2018-01-01

Full Text Available The question of how to contend with terrorism in keeping with our preexisting moral and legal commitments now challenges Europe as well as Israel and the United States: how do we apply Just War Theory and International Law to asymmetrical warfare, specifically to our counter terrorism measures? What can the classic moral argument in Just and Unjust Wars teach us about contemporary targeted killings with drones? I begin with a defense of targeted killing, arguing for the advantages of pin pointed attacks over any alternative measure available for combatting terrorism. Assuming the legitimacy of killing combatants in wartime, I argue, there is nothing wrong, and in fact much that is right, with targeting particular terrorists selected by name, as long as their assassinations can be reasonably expected to reduce terrorist hostilities rather than increase it. Subsequently, I offer some further thoughts and comments on the use of remotely piloted aircrafts to carry out targeted killings, and address the various sources for discomfort with this practice identified by Michael Walzer and others.

Age and sex composition of seals killed by polar bears in the eastern Beaufort Sea.

Directory of Open Access Journals (Sweden)

Nicholas W Pilfold

Full Text Available Polar bears (Ursus maritimus of the Beaufort Sea enter hyperphagia in spring and gain fat reserves to survive periods of low prey availability. We collected information on seals killed by polar bears (n=650 and hunting attempts on ringed seal (Pusa hispida lairs (n=1396 observed from a helicopter during polar bear mark-recapture studies in the eastern Beaufort Sea in spring in 1985-2011. We investigated how temporal shifts in ringed seal reproduction affect kill composition and the intraspecific vulnerabilities of ringed seals to polar bear predation.Polar bears primarily preyed on ringed seals (90.2% while bearded seals (Erignathus barbatus only comprised 9.8% of the kills, but 33% of the biomass. Adults comprised 43.6% (150/344 of the ringed seals killed, while their pups comprised 38.4% (132/344. Juvenile ringed seals were killed at the lowest proportion, comprising 18.0% (62/344 of the ringed seal kills. The proportion of ringed seal pups was highest between 2007-2011, in association with high ringed seal productivity. Half of the adult ringed seal kills were ≥ 21 years (60/121, and kill rates of adults increased following the peak of parturition. Determination of sex from DNA revealed that polar bears killed adult male and adult female ringed seals equally (0.50, n=78. The number of hunting attempts at ringed seal subnivean lair sites was positively correlated with the number of pup kills (r(2 =0.30, P=0.04, but was not correlated with the number of adult kills (P=0.37.Results are consistent with decadal trends in ringed seal productivity, with low numbers of pups killed by polar bears in spring in years of low pup productivity, and conversely when pup productivity was high. Vulnerability of adult ringed seals to predation increased in relation to reproductive activities and age, but not gender.

A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes

KAUST Repository

Jin, Hailing

2010-05-01

RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904-915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host\\'s essential effector of RNA silencing. Several GW motif-containing cellular proteins are known to be important partners of AGOs in RNA silencing effector complexes in yeast, plants, and animals. The GW motif appears to be a versatile and effective tool for regulating the activities of RNA silencing pathways, and the use of GW mimicry to compete for and inhibit host AGOs may be a strategy used by many pathogens to counteract host RNAi-based defenses. © 2010 by Cold Spring Harbor Laboratory Press.

Heterologous RNA-silencing suppressors from both plant- and animal-infecting viruses support plum pox virus infection.

Science.gov (United States)

Maliogka, Varvara I; Calvo, María; Carbonell, Alberto; García, Juan Antonio; Valli, Adrian

2012-07-01

HCPro, the RNA-silencing suppressor (RSS) of viruses belonging to the genus Potyvirus in the family Potyviridae, is a multifunctional protein presumably involved in all essential steps of the viral infection cycle. Recent studies have shown that plum pox potyvirus (PPV) HCPro can be replaced successfully by cucumber vein yellowing ipomovirus P1b, a sequence-unrelated RSS from a virus of the same family. In order to gain insight into the requirement of a particular RSS to establish a successful potyviral infection, we tested the ability of different heterologous RSSs from both plant- and animal-infecting viruses to substitute for HCPro. Making use of engineered PPV chimeras, we show that PPV HCPro can be replaced functionally by some, but not all, unrelated RSSs, including the NS1 protein of the mammal-infecting influenza A virus. Interestingly, the capacity of a particular RSS to replace HCPro does not correlate strictly with its RNA silencing-suppression strength. Altogether, our results suggest that not all suppression strategies are equally suitable for efficient escape of PPV from the RNA-silencing machinery. The approach followed here, based on using PPV chimeras in which an under-consideration RSS substitutes for HCPro, could further help to study the function of diverse RSSs in a 'highly sensitive' RNA-silencing context, such as that taking place in plant cells during the process of a viral infection.

9 CFR 113.214 - Parvovirus Vaccine, Killed Virus (Canine).

Science.gov (United States)

2010-01-01

... REQUIREMENTS Killed Virus Vaccines § 113.214 Parvovirus Vaccine, Killed Virus (Canine). Parvovirus Vaccine... antibody against canine parvovirus to determine susceptibility. A constant virus-varying serum... vaccinates and the controls shall be challenged with virulent canine parvovirus furnished or approved by...

Comparative Antianaerobic Activities of Doripenem Determined by MIC and Time-Kill Analysis▿

Science.gov (United States)

Credito, Kim L.; Ednie, Lois M.; Appelbaum, Peter C.

2008-01-01

Against 447 anaerobe strains, the investigational carbapenem doripenem had an MIC50 of 0.125 μg/ml and an MIC90 of 1 μg/ml. Results were similar to those for imipenem, meropenem, and ertapenem. Time-kill studies showed that doripenem had very good bactericidal activity compared to other carbapenems, with 99.9% killing of 11 strains at 2× MIC after 48 h. PMID:17938185

The 1990 Arthur Kill oil spills

International Nuclear Information System (INIS)

Astor, P.H.

1990-01-01

On January 1-2, 1990, Exxon discharged 567,000 gallons of No. 2 heating oil in the Arthur Kill, the strait separating Staten Island, New York from New Jersey. Lawsuits against Exxon were filed by the State of New Jersey, New York City, and the City of Elizabeth. They seek to force Exxon to reimburse the municipalities and the state for cleanup costs and to restore damaged wetlands and other natural resources. The three plaintiffs, joined by New York State and the federal government, initiated a three-tiered natural resource damage assessment study (Tier II), currently underway, includes sampling and chemical analysis of sediments and benthic invertebrates, mapping of impacted wetlands and measurement of direct impacts on water birds and their prey. The purposes of the study are to quantify the damages and determine the presence of Exxon's oil in the sediments. Since the Exxon spill, there have been two major spills and an intermediate-size spill. During the first size months of 1990, over one million gallons of petroleum products have been discharged into the Arthur Kill and nearby waters. This paper reports that a review of these incidents provides lessons for the prevention, investigation, and cleanup of spills in urban estuaries

Polycomb complexes and silencing mechanisms

DEFF Research Database (Denmark)

Lund, Anders H; van Lohuizen, Maarten

2004-01-01

Advances in the past couple of years have brought important new knowledge on the mechanisms by which Polycomb-group proteins regulate gene expression and on the consequences of their actions. The discovery of histone methylation imprints specific for Polycomb and Trithorax complexes has provided...... mechanistic insight on how this ancient epigenetic memory system acts to repress and indicates that it may share mechanistic aspects with other silencing and genome-protective processes, such as RNA interference....

Development of a gene silencing DNA vector derived from a broad host range geminivirus

Directory of Open Access Journals (Sweden)

Hancock Leandria C

2009-07-01

Full Text Available Abstract Background Gene silencing is proving to be a powerful tool for genetic, developmental, and physiological analyses. The use of viral induced gene silencing (VIGS offers advantages to transgenic approaches as it can be potentially applied to non-model systems for which transgenic techniques are not readily available. However, many VIGS vectors are derived from Gemini viruses that have limited host ranges. We present a new, unipartite vector that is derived from a curtovirus that has a broad host range and will be amenable to use in many non-model systems. Results The construction of a gene silencing vector derived from the geminivirus Beet curly top virus (BCTV, named pWSRi, is reported. Two versions of the vector have been developed to allow application by biolistic techniques or by agro-infiltration. We demonstrate its ability to silence nuclear genes including ribulose bisphosphate carboxylase small subunit (rbcS, transketolase, the sulfur allele of magnesium chelatase (ChlI, and two homeotic transcription factors in spinach or tomato by generating gene-specific knock-down phenotypes. Onset of phenotypes occurred 3 to 12 weeks post-inoculation, depending on the target gene, in organs that developed after the application. The vector lacks movement genes and we found no evidence for significant spread from the site of inoculation. However, viral amplification in inoculated tissue was detected and is necessary for systemic silencing, suggesting that signals generated from active viral replicons are efficiently transported within the plant. Conclusion The unique properties of the pWSRi vector, the ability to silence genes in meristem tissue, the separation of virus and silencing phenotypes, and the broad natural host range of BCTV, suggest that it will have wide utility.

9 CFR 113.210 - Feline Calicivirus Vaccine, Killed Virus.

Science.gov (United States)

2010-01-01

... Virus. 113.210 Section 113.210 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.210 Feline Calicivirus Vaccine, Killed Virus. Feline Calicivirus...

9 CFR 113.211 - Feline Rhinotracheitis Vaccine, Killed Virus.

Science.gov (United States)

2010-01-01

... Virus. 113.211 Section 113.211 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.211 Feline Rhinotracheitis Vaccine, Killed Virus. Feline...

9 CFR 113.216 - Bovine Rhinotracheitis Vaccine, Killed Virus.

Science.gov (United States)

2010-01-01

... Virus. 113.216 Section 113.216 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.216 Bovine Rhinotracheitis Vaccine, Killed Virus. Infectious Bovine...

9 CFR 113.203 - Feline Panleukopenia Vaccine, Killed Virus.

Science.gov (United States)

2010-01-01

... Virus. 113.203 Section 113.203 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.203 Feline Panleukopenia Vaccine, Killed Virus. Feline Panleukopenia...

Role of nitric oxide and superoxide in Giardia lamblia killing

Directory of Open Access Journals (Sweden)

P.D. Fernandes

1997-01-01

Full Text Available Giardia lamblia trophozoites were incubated for 2 h with activated murine macrophages, nitric oxide (NO donors or a superoxide anion generator (20 mU/ml xanthine oxidase plus 1 mM xanthine. Activated macrophages were cytotoxic to Giardia trophozoites (~60% dead trophozoites. This effect was inhibited (>90% by an NO synthase inhibitor (200 µM and unaffected by superoxide dismutase (SOD, 300 U/ml. Giardia trophozoites were killed by the NO donors, S-nitroso-acetyl-penicillamine (SNAP and sodium nitroprusside (SNP in a dose-dependent manner (LD50 300 and 50 µM, respectively. A dual NO-superoxide anion donor, 3-morpholino-sydnonimine hydrochloride (SIN-1, did not have a killing effect in concentrations up to 1 mM. However, when SOD (300 U/ml was added simultaneously with SIN-1 to Giardia, a significant trophozoite-killing effect was observed (~35% dead trophozoites at 1 mM. The mixture of SNAP or SNP with superoxide anion, which yields peroxynitrite, abolished the trophozoite killing induced by NO donors. Authentic peroxynitrite only killed trophozoites at very high concentrations (3 mM. These results indicate that NO accounts for Giardia trophozoite killing and this effect is not mediated by peroxynitrite

A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize.

Science.gov (United States)

Mei, Yu; Zhang, Chunquan; Kernodle, Bliss M; Hill, John H; Whitham, Steven A

2016-06-01

Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. © 2016 American Society of Plant Biologists. All Rights Reserved.

Targeted Killings in Bangladesh: Diversity at Stake

OpenAIRE

Syed, Jawad

2016-01-01

Since 2013, Bangladesh has repeatedly been in headline news across the world due to systematic and incessant targeted killings. In the mainstream media, both in South Asia and the West, the focus has been generally on high profile murders of secular and progressive bloggers. This includes the recent worldwide broad coverage on the tragic murder of Xulhaz Mannan, editor of Bangladesh's first LGBT rights magazine. However, not many know that these killings are only one part of the story. Secula...

Silencing of OSBP-related protein 8 (ORP8) modifies the macrophage transcriptome, nucleoporin p62 distribution, and migration capacity

International Nuclear Information System (INIS)

Béaslas, Olivier; Vihervaara, Terhi; Li, Jiwei; Laurila, Pirkka-Pekka; Yan, Daoguang; Olkkonen, Vesa M.

2012-01-01

ORP8 is an oxysterol/cholesterol binding protein anchored to the endoplasmic reticulum and the nuclear envelope, and is abundantly expressed in the macrophage. We created and characterized mouse RAW264.7 macrophages with ORP8 stably silenced using shRNA lentiviruses. A microarray transcriptome and gene ontology pathway analysis revealed significant alterations in several nuclear pathways and ones associated with centrosome and microtubule organization. ORP8 knockdown resulted in increased expression and altered subcellular distribution of an interaction partner of ORP8, nucleoporin NUP62, with an intranuclear localization aspect and association with cytoplasmic vesicular structures and lamellipodial edges of the cells. Moreover, ORP8 silenced cells displayed enhanced migration, and a more pronounced microtubule cytoskeleton than controls expressing a non-targeting shRNA. ORP8 was shown to compete with Exo70 for interaction with NUP62, and NUP62 knockdown abolished the migration enhancement of ORP8-silenced cells, suggesting that the endogenous ORP8 suppresses migration via binding to NUP62. As a conclusion, the present study reveals new, unexpected aspects of ORP8 function in macrophages not directly involving lipid metabolism, but rather associated with nuclear functions, microtubule organization, and migration capacity. -- Highlights: ► The phenotype of Raw264.7 macrophage with ORP8 silenced is characterized. ► ORP8 silencing alters mRNA levels of nuclear and microtubule/centrosome pathways. ► ORP8 silencing results in increased expression and altered distribution of NUP62. ► ORP8 silenced macrophages show enhanced migration and altered microtubule cytoskeleton. ► ORP8 competes in vitro with Exo70 for binding to NUP62.

Transcriptome and proteome analyses and the role of atypical calpain protein and autophagy in the spliced leader silencing pathway in Trypanosoma brucei.

Science.gov (United States)

Hope, Ronen; Egarmina, Katarina; Voloshin, Konstantin; Waldman Ben-Asher, Hiba; Carmi, Shai; Eliaz, Dror; Drori, Yaron; Michaeli, Shulamit

2016-10-01

Under persistent ER stress, Trypanosoma brucei parasites induce the spliced leader silencing (SLS) pathway. In SLS, transcription of the SL RNA gene, the SL donor to all mRNAs, is extinguished, arresting trans-splicing and leading to programmed cell death (PCD). In this study, we investigated the transcriptome following silencing of SEC63, a factor essential for protein translocation across the ER membrane, and whose silencing induces SLS. The proteome of SEC63-silenced cells was analyzed with an emphasis on SLS-specific alterations in protein expression, and modifications that do not directly result from perturbations in trans-splicing. One such protein identified is an atypical calpain SKCRP7.1/7.2. Co-silencing of SKCRP7.1/7.2 and SEC63 eliminated SLS induction due its role in translocating the PK3 kinase. This kinase initiates SLS by migrating to the nucleus and phosphorylating TRF4 leading to shut-off of SL RNA transcription. Thus, SKCRP7.1 is involved in SLS signaling and the accompanying PCD. The role of autophagy in SLS was also investigated; eliminating autophagy through VPS34 or ATG7 silencing demonstrated that autophagy is not essential for SLS induction, but is associated with PCD. Thus, this study identified factors that are used by the parasite to cope with ER stress and to induce SLS and PCD. © 2016 John Wiley & Sons Ltd.

Research on killing Escherichia Coli by reactive oxygen species based on strong ionization discharging plasma

International Nuclear Information System (INIS)

Li, Y J; Tian, Y P; Zhang, Z T; Li, R H; Cai, L J; Gao, J Y

2013-01-01

Reactive oxygen species solution produced by strong ionization discharging plasma was used to kill Escherichia coli by spraying. Several effect factors such as pH value, solution temperature, spraying time and exposure time were observed in this study, and their effects on killing rate of Escherichia coli were discussed and analysed. Results show that the treating efficiency of ROS solution for Escherichia coli is higher in alkaline solution than that in acid solution. The killing rate of Escherichia coli increases while the spraying time and exposure time are longer and the temperature is lower. The effects of different factors on killing rate of Escherichia coli are as follows: spraying time > pH value > exposure time > solution temperature.

[Effects of ezrin silencing on pancreatic cancer cell line Panc-1].

Science.gov (United States)

Meng, Yun-xiao; Yu, Shuang-ni; Lu, Zhao-hui; Chen, Jie

2012-12-01

To explore the effects of ezrin silencing on pancreatic cancer cell line Panc-1. Pancreatic cancer cell line Panc-1 was transfected with ezrin silencing plasmid. The proliferation and the cell cycle status were determined by CCK-8 assay and flow cytometry analysis, respectively. Cellular membrane protrusions/microvilli formation were visualized by scanning election microscopy. Colony formation assay was used to determine the cell anchor-independent growth ability in vitro. Trans-filter migration and invasion assays were performed with 8 µm pore inserts in a 24-well BioCoat chamber with/without Matrigel. Ezrin silencing decreased cellular protrusions/microvilli formation, anchorage-independent growth, cell migration and invasion, but had no effects on cell proliferation in vitro and cell cycle, in pancreatic cancer cell line Panc-1. Ezrin expression affects the cellular protrusions/microvilli formation, anchorage-independent growth, cell migration and invasion in pancreatic cancer cell line Panc-1.

9 CFR 113.205 - Newcastle Disease Vaccine, Killed Virus.

Science.gov (United States)

2010-01-01

... Virus. 113.205 Section 113.205 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.205 Newcastle Disease Vaccine, Killed Virus. Newcastle Disease Vaccine...

Agrobacterium mediated transient gene silencing (AMTS in Stevia rebaudiana: insights into steviol glycoside biosynthesis pathway.

Directory of Open Access Journals (Sweden)

Praveen Guleria

Full Text Available Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi based Agrobacterium mediated transient gene silencing (AMTS approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1 genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins.RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3 content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes.SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route.

Mitigation options for fish kills in L Lake and Pond C

International Nuclear Information System (INIS)

Paller, M.H.

1989-11-01

This report concerns mitigation options for reducing or eliminating the fish kills that occur in L Lake and Pond C as a result of reactor operations. These kills occur when fish that have entered the discharge areas during outages are killed by the rapid rises in temperature that follow reactor re-starts. Factors that have been observed to influence the severity of the kills include the length of the outage, season during which the outage occurs, reactor power level, and size of the fish in the discharge area. Without mitigation, fish kills can be expected to occur in Pond C with approximately the same frequency and severity as in the past. Even in the absence of mitigation, however, it is unlikely that future fish kills in L Lake will be as severe as the large kill that occurred in December 1986. Fish abundance in Region 2 of L Lake (where severe kills occurred in the past) has declined over 90% since 1986, largely due to a reduction in the abundance of juvenile sunfish (which constituted approximately 99% of past kills). There are basically three categories of mitigation options: changes in reactor operations, methods to exclude fish from time discharge areas, and methods to promote the escapement of fish from the discharge area. These options vary in approach, scope, and anticipated expense. Most would need to be researched in greater depth before it would be possible to predict their effectiveness more definitively. While the options have the potential to greatly reduce mortalities, none can totally eliminate mortalities. The only way of ensuring the elimination of all mortalities is to reduce effluent temperatures to sublethal levels with properly designed and operated cooling technology. 18 refs., 2 figs., 1 tab

Gated audiovisual speech identification in silence vs. noise: effects on time and accuracy

Science.gov (United States)

Moradi, Shahram; Lidestam, Björn; Rönnberg, Jerker

2013-01-01

This study investigated the degree to which audiovisual presentation (compared to auditory-only presentation) affected isolation point (IPs, the amount of time required for the correct identification of speech stimuli using a gating paradigm) in silence and noise conditions. The study expanded on the findings of Moradi et al. (under revision), using the same stimuli, but presented in an audiovisual instead of an auditory-only manner. The results showed that noise impeded the identification of consonants and words (i.e., delayed IPs and lowered accuracy), but not the identification of final words in sentences. In comparison with the previous study by Moradi et al., it can be concluded that the provision of visual cues expedited IPs and increased the accuracy of speech stimuli identification in both silence and noise. The implication of the results is discussed in terms of models for speech understanding. PMID:23801980

Excavating Silences and Tensions of Agency|Passivity in Science Education Reform

Science.gov (United States)

Rivera Maulucci, Maria S.

2010-01-01

I reflect on studies by Rodriguez and Carlone, Haun-Frank, and Kimmel to emphasize the ways in which they excavate silences in the science education literature related to linguistic and cultural diversity and situating the problem of reform in teachers rather than contextual factors, such as traditional schooling discourses and forces that serve…

"Was it something I said?" "No, it was something you posted!" A study of the spiral of silence theory in social media contexts.

Science.gov (United States)

Gearhart, Sherice; Zhang, Weiwu

2015-04-01

New media technologies make it necessary for scholars to reassess mass communication theories developed among legacy media. One such theory is the spiral of silence theory originally proposed by Noelle-Neumann in the 1970s. Increasing diversity of media content, selectivity, social networking site (SNS) interactivity, and the potential for anonymity have posed various challenges to its theoretical assumptions. While application of the spiral of silence in SNS contexts has been theorized, its empirical testing is scarce. To fill this void, the Pew 2012 Search, Social Networks, and Politics survey is used to test the theory. Results reveal that encountering agreeable political content predicts speaking out, while encountering disagreeable postings stifles opinion expression, supporting the spiral of silence theory in the SNS environment. However, certain uses of SNSs and psychological factors demonstrate a liberating effect on opinion expression.

Plasmodium falciparum var Gene Silencing Is Determined by cis DNA Elements That Form Stable and Heritable Interactions ▿

Science.gov (United States)

Swamy, Lakshmi; Amulic, Borko; Deitsch, Kirk W.

2011-01-01

Antigenic variation in the human malaria parasite Plasmodium falciparum depends on the transcriptional regulation of the var gene family. In each individual parasite, mRNA is expressed exclusively from 1 var gene out of ∼60, while the rest of the genes are transcriptionally silenced. Both modifications to chromatin structure and DNA regulatory elements associated with each var gene have been implicated in the organization and maintenance of the silent state. Whether silencing is established at the level of entire chromosomal regions via heterochromatin spreading or at the level of individual var promoters through the action of a silencing element within each var intron has been debated. Here, we consider both possibilities, using clonal parasite lines carrying chromosomally integrated transgenes. We confirm a previous finding that the loss of an adjacent var intron results in var promoter activation and further show that transcriptional activation of a var promoter within a cluster does not affect the transcriptional activity of neighboring var promoters. Our results provide more evidence for the hypothesis that var genes are primarily silenced at the level of an individual gene, rather than by heterochromatin spreading. We also tested the intrinsic directionality of an intron's silencing effect on upstream or downstream var promoters. We found that an intron is capable of silencing in either direction and that, once established, a var promoter-intron pair is stably maintained through many generations, suggesting a possible role in epigenetic memory. This study provides insights into the regulation of endogenous var gene clusters. PMID:21317310

Mechanism of killing of streptococcus mutans by light-activated drugs

Science.gov (United States)

Burns, Tracy; Wilson, Michael; Pearson, G. J.

1996-01-01

Recent studies have shown that cariogenic bacteria can be killed when exposed to low power laser light in the presence of a photosensitizing agent. The purpose of this study was to determine the mechanism by which the cariogenic bacterium Streptococcus mutans can be killed by toluidine blue O and helium neon laser light. To determine whether membrane damage occurred, suspensions of sensitized S. mutans were exposed to a 7.3 mW HeNe laser for 30 mins and samples removed every 5 mins. Survivors were enumerated by viable counting on tryptone soya agar plates and cell free filtrates were assayed for phosphate and (beta) -galactosidase. Lipid peroxidation was assessed by assaying for malondialdehyde, a by- product of lipid peroxidation. The role of oxygen and reactive oxygen species was studied by exposing sensitized bacteria to laser light (1) under different atmospheric conditions, (2) in the presence of deuterium oxide, and (3) in the presence of inhibitors of reactive oxygen species. Following exposure of sensitizede S. mutans to 13.2 J of HeNe laser light, 2.6 nmoles of phosphate and 228 nmoles of (beta) -galactosidase were detected in the cell free filtrates. Ten micrometers oles of malondialdehyde were also detected. When the sensitized bacteria were exposed to laser light under anaerobic conditions there was no significant decrease in the viable count compared to a 60% kill in the presence of oxygen. In the presence of D2O there was a 15-fold increase in the numbers of bacteria killed. O.1 M methionine and 0.5 M sodium azide each afforded 98% protection from lethal photosensitization. These results imply that lethal photosensitization results from membrane damage due to lipid peroxidation and that reactive oxygen species are mediators of this process.

flp-32 Ligand/receptor silencing phenocopy faster plant pathogenic nematodes.

Science.gov (United States)

Atkinson, Louise E; Stevenson, Michael; McCoy, Ciaran J; Marks, Nikki J; Fleming, Colin; Zamanian, Mostafa; Day, Tim A; Kimber, Michael J; Maule, Aaron G; Mousley, Angela

2013-02-01

Restrictions on nematicide usage underscore the need for novel control strategies for plant pathogenic nematodes such as Globodera pallida (potato cyst nematode) that impose a significant economic burden on plant cultivation activities. The nematode neuropeptide signalling system is an attractive resource for novel control targets as it plays a critical role in sensory and motor functions. The FMRFamide-like peptides (FLPs) form the largest and most diverse family of neuropeptides in invertebrates, and are structurally conserved across nematode species, highlighting the utility of the FLPergic system as a broad-spectrum control target. flp-32 is expressed widely across nematode species. This study investigates the role of flp-32 in G. pallida and shows that: (i) Gp-flp-32 encodes the peptide AMRNALVRFamide; (ii) Gp-flp-32 is expressed in the brain and ventral nerve cord of G. pallida; (iii) migration rate increases in Gp-flp-32-silenced worms; (iv) the ability of G. pallida to infect potato plant root systems is enhanced in Gp-flp-32-silenced worms; (v) a novel putative Gp-flp-32 receptor (Gp-flp-32R) is expressed in G. pallida; and, (vi) Gp-flp-32R-silenced worms also display an increase in migration rate. This work demonstrates that Gp-flp-32 plays an intrinsic role in the modulation of locomotory behaviour in G. pallida and putatively interacts with at least one novel G-protein coupled receptor (Gp-flp-32R). This is the first functional characterisation of a parasitic nematode FLP-GPCR.

flp-32 Ligand/receptor silencing phenocopy faster plant pathogenic nematodes.

Directory of Open Access Journals (Sweden)

Louise E Atkinson

2013-02-01

Full Text Available Restrictions on nematicide usage underscore the need for novel control strategies for plant pathogenic nematodes such as Globodera pallida (potato cyst nematode that impose a significant economic burden on plant cultivation activities. The nematode neuropeptide signalling system is an attractive resource for novel control targets as it plays a critical role in sensory and motor functions. The FMRFamide-like peptides (FLPs form the largest and most diverse family of neuropeptides in invertebrates, and are structurally conserved across nematode species, highlighting the utility of the FLPergic system as a broad-spectrum control target. flp-32 is expressed widely across nematode species. This study investigates the role of flp-32 in G. pallida and shows that: (i Gp-flp-32 encodes the peptide AMRNALVRFamide; (ii Gp-flp-32 is expressed in the brain and ventral nerve cord of G. pallida; (iii migration rate increases in Gp-flp-32-silenced worms; (iv the ability of G. pallida to infect potato plant root systems is enhanced in Gp-flp-32-silenced worms; (v a novel putative Gp-flp-32 receptor (Gp-flp-32R is expressed in G. pallida; and, (vi Gp-flp-32R-silenced worms also display an increase in migration rate. This work demonstrates that Gp-flp-32 plays an intrinsic role in the modulation of locomotory behaviour in G. pallida and putatively interacts with at least one novel G-protein coupled receptor (Gp-flp-32R. This is the first functional characterisation of a parasitic nematode FLP-GPCR.

Holocaust and strategic bombing: case studies in the psychology, organization, and technology of mass killing in the twentieth century

Energy Technology Data Exchange (ETDEWEB)

Markusen, E.R.

1986-01-01

After preliminary discussion of the unprecedented scale of mass killing in the twentieth century, the threat of nuclear war, and the widespread neglect of these issues, the literature on two major types of government sanctioned mass killing is reviewed; genocide, in which a government slaughters its own citizens or subjects, and total war, in which two or more governments slaughter each other's civilian citizens or subjects. This literature review reaches two basic conclusions: (1) there is considerable inconsistency and ambiguity among definitions of genocide and total war; and (2) there is a controversy regarding how distinct or similar the two forms of mass killing actually are. A comparative historical analysis was undertaken in which the Nazi Holocaust was selected as an example of genocide, and the Allied strategic bombing campaigns during World War II were selected to exemplify total war. The two cases are compared in terms of a conceptual framework of five hypothesized facilitating factors. On the basis of this comparative analysis, four or the five hypothesized facilitating factors are found to have played important roles in both cases. The findings of the study are discussed, and their implications for the threat of nuclear holocaust are explored.

"Drone Killings in Principle and in Practice"

DEFF Research Database (Denmark)

Dige, Morten

2017-01-01

to argue that what we see in the real world cases of drone killings is not merely an accidental or contingent use of drone technology. The real life use reflects to a large extent features that are inherent of the dominant drone systems that has been developed to date. What is being imagined "in principle......" is thus to a large extent drone killings in dreamland. I use an historic example as a point of reference and departure: the debate over the lawfulness of nuclear weapons....

PhOBF1, a petunia ocs element binding factor, plays an important role in antiviral RNA silencing.

Science.gov (United States)

Sun, Daoyang; Li, Shaohua; Niu, Lixin; Reid, Michael S; Zhang, Yanlong; Jiang, Cai-Zhong

2017-02-01

Virus-induced gene silencing (VIGS) is a common reverse genetics strategy for characterizing the function of genes in plants. The detailed mechanism governing RNA silencing efficiency triggered by viruses is largely unclear. Here, we reveal that a petunia (Petunia hybrida) ocs element binding factor, PhOBF1, one of the basic leucine zipper (bZIP) transcription factors, was up-regulated by Tobacco rattle virus (TRV) infection. Simultaneous silencing of PhOBF1 and a reporter gene, phytoene desaturase (PDS) or chalcone synthase (CHS), by TRV-based VIGS led to a failure of the development of leaf photobleaching or the white-corollas phenotype. PhOBF1 silencing caused down-regulation of RNA silencing-related genes, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonautes (AGOs). After inoculation with the TRV-PhPDS, PhOBF1-RNAi lines exhibited a substantially impaired PDS silencing efficiency, whereas overexpression of PhOBF1 resulted in a recovery of the silencing phenotype (photobleaching) in systemic leaves. A compromised resistance to TRV and Tobacco mosaic virus was found in PhOBF1-RNAi lines, while PhOBF1-overexpressing lines displayed an enhanced resistance to their infections. Compared with wild-type plants, PhOBF1-silenced plants accumulated lower levels of free salicylic acid (SA), salicylic acid glucoside, and phenylalanine, contrarily to higher levels of those in plants overexpressing PhOBF1. Furthermore, transcripts of a number of genes associated with the shikimate and phenylpropanoid pathways were decreased or increased in PhOBF1-RNAi or PhOBF1-overexpressing lines, respectively. Taken together, the data suggest that PhOBF1 regulates TRV-induced RNA silencing efficiency through modulation of RDRs, DCLs, and AGOs mediated by the SA biosynthesis pathway. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Silencing Agrobacterium oncogenes in transgenic grapevine results in strain-specific crown gall resistance.

Science.gov (United States)

Galambos, A; Zok, A; Kuczmog, A; Oláh, R; Putnoky, P; Ream, W; Szegedi, E

2013-11-01

Grapevine rootstock transformed with an Agrobacterium oncogene-silencing transgene was resistant to certain Agrobacterium strains but sensitive to others. Thus, genetic diversity of Agrobacterium oncogenes may limit engineering crown gall resistance. Crown gall disease of grapevine induced by Agrobacterium vitis or Agrobacterium tumefaciens causes serious economic losses in viticulture. To establish crown gall-resistant lines, somatic proembryos of Vitis berlandieri × V. rupestris cv. 'Richter 110' rootstock were transformed with an oncogene-silencing transgene based on iaaM and ipt oncogene sequences from octopine-type, tumor-inducing (Ti) plasmid pTiA6. Twenty-one transgenic lines were selected, and their transgenic nature was confirmed by polymerase chain reaction (PCR). These lines were inoculated with two A. tumefaciens and three A. vitis strains. Eight lines showed resistance to octopine-type A. tumefaciens A348. Resistance correlated with the expression of the silencing genes. However, oncogene silencing was mostly sequence specific because these lines did not abolish tumorigenesis by A. vitis strains or nopaline-type A. tumefaciens C58.

H3K9me-independent gene silencing in fission yeast heterochromatin by Clr5 and histone deacetylases

DEFF Research Database (Denmark)

Hansen, Klavs R; Hazan, Idit; Shanker, Sreenath

2011-01-01

organisms such as fission yeast. In spite of numerous studies, the relative contributions of the various heterochromatic histone marks to the properties of heterochromatin remain largely undefined. Here, we report that silencing of the fission yeast mating-type cassettes, which are located in a well......, our results point to histone deacetylases as prominent repressors of gene expression in fission yeast heterochromatin. These deacetylases can act in concert with, or independently of, the widely studied H3K9me mark to influence gene silencing at heterochromatic loci....

Activity of Telithromycin (HMR 3647) against Anaerobic Bacteria Compared to Those of Eight Other Agents by Time-Kill Methodology†

Science.gov (United States)

Credito, Kim L.; Ednie, Lois M.; Jacobs, Michael R.; Appelbaum, Peter C.

1999-01-01

Time-kill studies examined the activities of telithromycin (HMR 3647), erythromycin A, azithromycin, clarithromycin, roxithromycin, clindamycin, pristinamycin, amoxicillin-clavulanate, and metronidazole against 11 gram-positive and gram-negative anaerobic bacteria. Time-kill studies were carried out with the addition of Oxyrase in order to prevent the introduction of CO2. Macrolide-azalide-ketolide MICs were 0.004 to 32.0 μg/ml. Of the latter group, telithromycin had the lowest MICs, especially against non-Bacteroides fragilis group strains, followed by azithromycin, clarithromycin, erythromycin A, and roxithromycin. Clindamycin was active (MIC ≤ 2.0 μg/ml) against all anaerobes except Peptostreptococcus magnus and Bacteroides thetaiotaomicron, while pristinamycin MICs were 0.06 to 4.0 μg/ml. Amoxicillin-clavulanate had MICs of ≤1.0 μg/ml, while metronidazole was active (MICs, 0.03 to 2.0 μg/ml) against all except Propionibacterium acnes. After 48 h at twice the MIC, telithromycin was bactericidal (≥99.9% killing) against 6 strains, with 99% killing of 9 strains and 90% killing of 10 strains. After 24 h at twice the MIC, 90, 99, and 99.9% killing of nine, six, and three strains, respectively, occurred. Lower rates of killing were seen at earlier times. Similar kill kinetics relative to the MIC were seen with other macrolides. After 48 h at the MIC, clindamycin was bactericidal against 8 strains, with 99 and 90% killing of 9 and 10 strains, respectively. After 24 h, 90% killing of 10 strains occurred at the MIC. The kinetics of clindamycin were similar to those of pristinamycin. After 48 h at the MIC, amoxicillin-clavulanate showed 99.9% killing of seven strains, with 99% killing of eight strains and 90% killing of nine strains. At four times the MIC, metronidazole was bactericidal against 8 of 10 strains tested after 48 h and against all 10 strains after 24 h; after 12 h, 99% killing of all 10 strains occurred. PMID:10428930

A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing.

Science.gov (United States)

Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S; Niu, Lixin; Jiang, Cai-Zhong

2016-05-01

Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2 Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Epigenetic silencing of CYP24 in the tumor microenvironment

Science.gov (United States)

Johnson, Candace S.; Chung, Ivy; Trump, Donald L.

2010-01-01

Calcitriol (1,25 dihydroxycholecalciferol) has significant antitumor activity in vitro and in vivo in a number of tumor model systems. We developed a system for isolation of fresh endothelial cells from tumors and Matrigel environments which demonstrate that CYP24, the catabolic enzyme involved in vitamin D signaling, is epigenetically silenced selectively in tumor-derived endothelial cells (TDEC). TDEC maintain phenotypic characteristics which are distinct from endothelial cells isolated from normal tissues and from Matrigel plugs (MDEC). In TDEC, calcitriol induces G0/G1 arrest, modulates p27 and p21, and induces apoptotic cell death and decreases P-Erk and P-Akt. In contrast, endothelial cells isolated from normal tissues and MDEC are unresponsive to calcitriol-mediated anti-proliferative effects despite intact signaling through the vitamin D receptor (VDR). In TDEC, which is sensitive to calcitriol, the CYP24 promoter is hypermethylated in two CpG island regions located at the 5′end; this hypermethylation may contribute to gene silencing of CYP24. The extent of methylation in these two regions is significantly less in MDEC. Lastly, treatment of TDEC with a DNA methyltransferase inhibitor restores calcitriol-mediated induction of CYP24 and resistance to calcitriol. These data suggest that epigenetic silencing of CYP24 modulates cellular responses to calcitriol. PMID:20304059

F-box-like domain in the polerovirus protein P0 is required for silencing suppressor function

Science.gov (United States)

Pazhouhandeh, Maghsoud; Dieterle, Monika; Marrocco, Katia; Lechner, Esther; Berry, Bassam; Brault, Véronique; Hemmer, Odile; Kretsch, Thomas; Richards, Kenneth E.; Genschik, Pascal; Ziegler-Graff, Véronique

2006-01-01

Plants employ small RNA-mediated posttranscriptional gene silencing as a virus defense mechanism. In response, plant viruses encode proteins that can suppress RNA silencing, but the mode of action of most such proteins is poorly understood. Here, we show that the silencing suppressor protein P0 of two Arabidopsis-infecting poleroviruses interacts by means of a conserved minimal F-box motif with Arabidopsis thaliana orthologs of S-phase kinase-related protein 1 (SKP1), a component of the SCF family of ubiquitin E3 ligases. Point mutations in the F-box-like motif abolished the P0–SKP1 ortholog interaction, diminished virus pathogenicity, and inhibited the silencing suppressor activity of P0. Knockdown of expression of a SKP1 ortholog in Nicotiana benthamiana rendered the plants resistant to polerovirus infection. Together, the results support a model in which P0 acts as an F-box protein that targets an essential component of the host posttranscriptional gene silencing machinery. PMID:16446454

Klotho gene silencing promotes pathology in the mdx mouse model of Duchenne muscular dystrophy

Science.gov (United States)

Wehling-Henricks, Michelle; Li, Zhenzhi; Lindsey, Catherine; Wang, Ying; Welc, Steven S.; Ramos, Julian N.; Khanlou, Négar; Kuro-o, Makoto; Tidball, James G.

2016-01-01

Duchenne muscular dystrophy (DMD) is a lethal muscle disease involving progressive loss of muscle regenerative capacity and increased fibrosis. We tested whether epigenetic silencing of the klotho gene occurs in the mdx mouse model of DMD and whether klotho silencing is an important feature of the disease. Our findings show that klotho undergoes muscle-specific silencing at the acute onset of mdx pathology. Klotho experiences increased methylation of CpG sites in its promoter region, which is associated with gene silencing, and increases in a repressive histone mark, H3K9me2. Expression of a klotho transgene in mdx mice restored their longevity, reduced muscle wasting, improved function and greatly increased the pool of muscle-resident stem cells required for regeneration. Reductions of fibrosis in late, progressive stages of the mdx pathology achieved by transgene expression were paralleled by reduced expression of Wnt target genes (axin-2), transforming growth factor-beta (TGF-β1) and collagens types 1 and 3, indicating that Klotho inhibition of the profibrotic Wnt/TGFβ axis underlies its anti-fibrotic effect in aging, dystrophic muscle. Thus, epigenetic silencing of klotho during muscular dystrophy contributes substantially to lost regenerative capacity and increased fibrosis of dystrophic muscle during late progressive stages of the disease. PMID:27154199

Killing Horizons as Equipotential Hypersurfaces

OpenAIRE

Smolić, Ivica

2012-01-01

In this note we present a new proof that Killing horizons are equipotential hypersurfaces for the electric and the magnetic scalar potential, that makes no use of gravitational field equations or the assumption about the existence of bifurcation surface.

'David and Goliath' of the soil food web - Flagellates that kill nematodes

DEFF Research Database (Denmark)

Strandmark, Lisa Bjørnlund; Rønn, Regin

2008-01-01

Nematodes and flagellates are important bacterial predators in soil and sediments. Generally, these organisms are considered to be competitors for bacterial food. We studied the interaction among flagellates and nematodes using axenic liquid cultures amended with heat-killed bacteria as food...... and showed for the first time that a small and common soil flagellate (Cercomonas sp.) is able to attack and kill the much larger nematode Caenorhabditis elegans. The killing process is not caused by soluble metabolites but requires direct contact between the flagellate cells and the nematode surface...... and occurs rapidly (within a few hours) at high flagellate density. At lower flagellate density, adult nematodes sometimes avoid attachment of flagellates, feed on them and become the dominant bacterial predator. Considering that bacterial feeders affect bacterial communities differently, and that one...

Silencing of OSBP-related protein 8 (ORP8) modifies the macrophage transcriptome, nucleoporin p62 distribution, and migration capacity

Energy Technology Data Exchange (ETDEWEB)

Beaslas, Olivier; Vihervaara, Terhi [Minerva Foundation Institute for Medical Research, FI-00290 Helsinki (Finland); Li, Jiwei [Department of Biology, Jinan University, Guangzhou 510632 (China); Laurila, Pirkka-Pekka [FIMM, Institute for Molecular Medicine Finland, FI-00290 Helsinki (Finland); National Institute for Health and Welfare, Public Health Genomics Unit, FI-00290 Helsinki (Finland); Yan, Daoguang [Department of Biology, Jinan University, Guangzhou 510632 (China); Olkkonen, Vesa M., E-mail: vesa.olkkonen@helsinki.fi [Minerva Foundation Institute for Medical Research, FI-00290 Helsinki (Finland); Institute of Biomedicine, Anatomy, University of Helsinki, FI-00014 (Finland)

2012-09-10

ORP8 is an oxysterol/cholesterol binding protein anchored to the endoplasmic reticulum and the nuclear envelope, and is abundantly expressed in the macrophage. We created and characterized mouse RAW264.7 macrophages with ORP8 stably silenced using shRNA lentiviruses. A microarray transcriptome and gene ontology pathway analysis revealed significant alterations in several nuclear pathways and ones associated with centrosome and microtubule organization. ORP8 knockdown resulted in increased expression and altered subcellular distribution of an interaction partner of ORP8, nucleoporin NUP62, with an intranuclear localization aspect and association with cytoplasmic vesicular structures and lamellipodial edges of the cells. Moreover, ORP8 silenced cells displayed enhanced migration, and a more pronounced microtubule cytoskeleton than controls expressing a non-targeting shRNA. ORP8 was shown to compete with Exo70 for interaction with NUP62, and NUP62 knockdown abolished the migration enhancement of ORP8-silenced cells, suggesting that the endogenous ORP8 suppresses migration via binding to NUP62. As a conclusion, the present study reveals new, unexpected aspects of ORP8 function in macrophages not directly involving lipid metabolism, but rather associated with nuclear functions, microtubule organization, and migration capacity. -- Highlights: Black-Right-Pointing-Pointer The phenotype of Raw264.7 macrophage with ORP8 silenced is characterized. Black-Right-Pointing-Pointer ORP8 silencing alters mRNA levels of nuclear and microtubule/centrosome pathways. Black-Right-Pointing-Pointer ORP8 silencing results in increased expression and altered distribution of NUP62. Black-Right-Pointing-Pointer ORP8 silenced macrophages show enhanced migration and altered microtubule cytoskeleton. Black-Right-Pointing-Pointer ORP8 competes in vitro with Exo70 for binding to NUP62.

Intestinal mucus protects Giardia lamblia from killing by human milk.

Science.gov (United States)

Zenian, A J; Gillin, F D

1987-02-01

We have previously shown that nonimmune human milk kills Giardia lamblia trophozoites in vitro. Killing requires a bile salt and the activity of the milk bile salt-stimulated lipase. We now show that human small-intestinal mucus protects trophozoites from killing by milk. Parasite survival increased with mucus concentration, but protection was overcome during longer incubation times or with greater milk concentrations. Trophozoites preincubated with mucus and then washed were not protected. Protective activity was associated with non-mucin CsCl density gradient fractions. Moreover, it was heat-stable, non-dialyzable, and non-lipid. Whereas whole mucus inhibited milk lipolytic activity, protective mucus fractions did not inhibit the enzyme. Furthermore, mucus partially protected G. lamblia trophozoites against the toxicity of oleic acid, a fatty acid which is released from milk triglycerides by lipase. These studies show that mucus protects G. lamblia both by inhibiting lipase activity and by decreasing the toxicity of products of lipolysis. The ability of mucus to protect G. lamblia from toxic lipolytic products may help to promote intestinal colonization by this parasite.

political killings in South Africa

African Journals Online (AJOL)

mainly occurred in KwaZulu-Natal, with a much smaller number occurring in Mpumalanga and ... Though the problem is concentrated in specific provinces it is likely to impact on political life ... killings that are the focus of the article, including.

Killing horizons as equipotential hypersurfaces

International Nuclear Information System (INIS)

Smolić, Ivica

2012-01-01

In this note we present a new proof that Killing horizons are equipotential hypersurfaces for the electric and the magnetic scalar potential, which makes no use of gravitational field equations or the assumption about the existence of a bifurcation surface. (note)

Virus-induced gene silencing (VIGS) as a reverse genetic tool to study development of symbiotic root nodules

DEFF Research Database (Denmark)

Kjær, Gabriela Didina Constantin; Grønlund, Mette; Stougaard, Jens

2008-01-01

Virus-induced gene silencing (VIGS) can provide a shortcut to plants with altered expression of specific genes. Here, we report that VIGS of the Nodule inception gene (Nin) can alter the nodulation phenotype and Nin gene expression in Pisum sativum. PsNin was chosen as target because of the disti...

A Day of Silence, a Day of Truth, and a Lawsuit

Science.gov (United States)

Fusarelli, Bonnie C.; Eaton, Lucy E.

2011-01-01

This case study focuses on issues of freedom of speech and freedom of religion in public schools. It involves a rural, southern high school where a group of students participated in a Day of Silence. The school allowed the students to participate based on the principal's understanding of the students' First Amendment rights. However, the next day,…

Kill rate of mastitis pathogens by a combination of cefalexin and kanamycin.

Science.gov (United States)

Maneke, E; Pridmore, A; Goby, L; Lang, I

2011-01-01

To assess the bacterial killing rate produced by a combination of cefalexin and kanamycin at two different concentration ratios. Time-kill kinetics of cefalexin and kanamycin, individually and in combination, were determined against one strain each of Escherichia coli, Staphylococcus aureus, Streptococcus agalactiae, Streptococcus dysgalactiae and Streptococcus uberis. The combination was tested using two fixed ratios (cefalexin : kanamycin ratios of 1·25 : 1 and 1 : 2·3) and two concentrations of each ratio. Time-kill curves produced with either ratio were quite similar. Against most bacterial species, higher concentrations produced faster kill. In all cases, the combination of cefalexin and kanamycin showed faster and greater kill at lower antibiotic concentrations than those observed with either drug alone. The combination of cefalexin and kanamycin results in a fast initial killing of major mastitis pathogens at both concentration ratios. The combination of cefalexin and kanamycin achieved rapid bacterial kill at concentrations and ratios that can be achieved in vivo following intramammary infusion of a mastitis treatment. © 2010 Boehringer Ingelheim Vetmedica GmbH. Journal of Applied Microbiology © 2010 The Society for Applied Microbiology.

Factors Affecting Zebra Mussel Kill by the Bacterium Pseudomonas fluorescens

Energy Technology Data Exchange (ETDEWEB)

Daniel P. Molloy

2004-02-24

The specific purpose of this research project was to identify factors that affect zebra mussel kill by the bacterium Pseudomonas fluorescens. Test results obtained during this three-year project identified the following key variables as affecting mussel kill: treatment concentration, treatment duration, mussel siphoning activity, dissolved oxygen concentration, water temperature, and naturally suspended particle load. Using this latter information, the project culminated in a series of pipe tests which achieved high mussel kill inside power plants under once-through conditions using service water in artificial pipes.

A novel bispecific antibody, S-Fab, induces potent cancer cell killing.

Science.gov (United States)

Li, Li; He, Ping; Zhou, Changhua; Jing, Li; Dong, Bin; Chen, Siqi; Zhang, Ning; Liu, Yawei; Miao, Ji; Wang, Zhong; Li, Qing

2015-01-01

Bispecific antibodies that engage immune cells to kill cancer cells have been actively studied in cancer immunotherapy. In this study, we present a novel bispecific format, S-Fab, fabricated by linking a single-domain anti-carcinoembryonic antigen VHH to a conventional anti-CD3 Fab. In contrast to most bispecific antibodies, the S-Fab bispecific antibody can be efficiently expressed and purified from bacteria. The purified S-Fab is stable in serum and is able to recruit T cells to drive potent cancer cell killing. In xenograft models, the S-Fab antibody suppresses tumor growth in the presence of human immune cells. Our study suggested that the bispecific S-Fab format can be applied to a wide range of immunotherapies.

Illegal killing for ivory drives global decline in African elephants.

Science.gov (United States)

Wittemyer, George; Northrup, Joseph M; Blanc, Julian; Douglas-Hamilton, Iain; Omondi, Patrick; Burnham, Kenneth P

2014-09-09

Illegal wildlife trade has reached alarming levels globally, extirpating populations of commercially valuable species. As a driver of biodiversity loss, quantifying illegal harvest is essential for conservation and sociopolitical affairs but notoriously difficult. Here we combine field-based carcass monitoring with fine-scale demographic data from an intensively studied wild African elephant population in Samburu, Kenya, to partition mortality into natural and illegal causes. We then expand our analytical framework to model illegal killing rates and population trends of elephants at regional and continental scales using carcass data collected by a Convention on International Trade in Endangered Species program. At the intensively monitored site, illegal killing increased markedly after 2008 and was correlated strongly with the local black market ivory price and increased seizures of ivory destined for China. More broadly, results from application to continental data indicated illegal killing levels were unsustainable for the species between 2010 and 2012, peaking to ∼ 8% in 2011 which extrapolates to ∼ 40,000 elephants illegally killed and a probable species reduction of ∼ 3% that year. Preliminary data from 2013 indicate overharvesting continued. In contrast to the rest of Africa, our analysis corroborates that Central African forest elephants experienced decline throughout the last decade. These results provide the most comprehensive assessment of illegal ivory harvest to date and confirm that current ivory consumption is not sustainable. Further, our approach provides a powerful basis to determine cryptic mortality and gain understanding of the demography of at-risk species.

The impact of organizational culture on employees’ organizational silence In Shiraz University of Medical Sciences

Directory of Open Access Journals (Sweden)

Ebrahim Parcham

2017-01-01

Full Text Available Introduction: Organizational Culture is one of the most important factors that can change the climate of silence. The main aim of this research was to investigate the influence of organizational culture on employees’ organizational silence in Shiraz University of Medical Sciences. Method: This research was a descriptive-correlation one. The target population was chosen from 1900 staff of the University of Medical sciences and Health Care headquarter in Shiraz. Thus 311 employees were selected using the Krejcie and Morgan sampling table. The instrument used in this research was Denison (2006 organizational culture questionnaire and Dimitris Buratas and Maria Vacula (2007 organizational culture. Cornbrash’s alpha method was used to calculate the reliability. The Item analysis and expert consensus were applied to calculate the validity of instruments. All gathered data analyzed with PLS software. Results: The results showed that the four dimensions of organizational culture include organizational involvement, organizational adaptability, organizational concistency and organizational mission was moderate and the mean scores obtained for each factor were 2.85, 2.82, 2.94 and 2.93 respectively. Structural equation model showed Organizational culture has a significant positive impact on organizational silence (β=0.68; P<.001. Conclusion: Based on the results and impact of organizational culture on organizational silence that is positive and significant; The organization further efforts to strengthen various aspects of organizational culture, especially the employees’ involvement in decision making; Employees can better express their opinions and thus reduced their organizational silence. In other words strengthening corporate culture is combined with the reduction of organizational silence. Medical organizations can establish appropriate reward system for creative ideas and suggestions to encourage people express their ideas As a result, reduced

Identification and characterization of a silencer regulatory element in the 3'-flanking region of the murine CD46 gene.

Science.gov (United States)

Nomura, M; Tsujimura, A; Begum, N A; Matsumoto, M; Wabiko, H; Toyoshima, K; Seya, T

2000-01-01

The murine membrane cofactor protein (CD46) gene is expressed exclusively in testis, in contrast to human CD46, which is expressed ubiquitously. To elucidate the mechanism of differential CD46 gene expression among species, we cloned entire murine CD46 genomic DNA and possible regulatory regions were placed in the flanking region of the luciferase reporter gene. The reporter gene assay revealed a silencing activity not in the promoter, but in the 3'-flanking region of the gene and the silencer-like element was identified within a 0.2-kb region between 0.6 and 0.8 kb downstream of the stop codon. This silencer-like element was highly similar to that of the pig MHC class-I gene. The introduction of a mutation into this putative silencer element of murine CD46 resulted in an abrogation of the silencing effect. Electrophoretic mobility-shift assay indicated the presence of the binding molecule(s) for this silencer sequence in murine cell lines and tissues. A size difference of the protein-silencer-element complex was observed depending upon the solubilizers used for preparation of the nuclear extracts. A mutated silencer sequence failed to interact with the binding molecules. The level of the binding factor was lower in the testicular germ cells compared with other organs. Thus the silencer element and its binding factor may play a role in transcriptional regulation of murine CD46 gene expression. These results imply that the effects of the CD46 silencer element encompass the innate immune and reproductive systems, and in mice may determine the testicular germ-cell-dominant expression of CD46. PMID:11023821

Agrobacterium Mediated Transient Gene Silencing (AMTS) in Stevia rebaudiana: Insights into Steviol Glycoside Biosynthesis Pathway

Science.gov (United States)

Guleria, Praveen; Yadav, Sudesh Kumar

2013-01-01

Background Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi) based Agrobacterium mediated transient gene silencing (AMTS) approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1) genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins. Methodology/Principal Findings RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3) content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes. Conclusions SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route. PMID:24023961

Designing Antibacterial Peptides with Enhanced Killing Kinetics

Directory of Open Access Journals (Sweden)

Faiza H. Waghu

2018-02-01

Full Text Available Antimicrobial peptides (AMPs are gaining attention as substitutes for antibiotics in order to combat the risk posed by multi-drug resistant pathogens. Several research groups are engaged in design of potent anti-infective agents using natural AMPs as templates. In this study, a library of peptides with high sequence similarity to Myeloid Antimicrobial Peptide (MAP family were screened using popular online prediction algorithms. These peptide variants were designed in a manner to retain the conserved residues within the MAP family. The prediction algorithms were found to effectively classify peptides based on their antimicrobial nature. In order to improve the activity of the identified peptides, molecular dynamics (MD simulations, using bilayer and micellar systems could be used to design and predict effect of residue substitution on membranes of microbial and mammalian cells. The inference from MD simulation studies well corroborated with the wet-lab observations indicating that MD-guided rational design could lead to discovery of potent AMPs. The effect of the residue substitution on membrane activity was studied in greater detail using killing kinetic analysis. Killing kinetics studies on Gram-positive, negative and human erythrocytes indicated that a single residue change has a drastic effect on the potency of AMPs. An interesting outcome was a switch from monophasic to biphasic death rate constant of Staphylococcus aureus due to a single residue mutation in the peptide.

Effects of neoliberal rationality in speeches on inclusion: the teacher’s silence

Directory of Open Access Journals (Sweden)

Leandra Boer Possa

2013-06-01

Full Text Available This text, which makes use of the National Policy on Special Education in the Perspective of Inclusive Education and the programs that embrace the training of teachers for diversity/ inclusion, puts the discursive effects of these documents in analytic sets. Without attempting at doing an exhaustive analysis, this study aims at problematizing the effect of teacher’s silence that the neoliberal policy has been producing on teachers who work in municipal and state education systems in Santa Maria area. The conceptual and methodological tool of governmentality is used in this enterprise in order to think that the discourses of inclusion have convinced and subjectivized teachers, because in the face of the irreducibility of this discursive network the silence is an effect of the production and consumption of the principle of inclusion and enterprise itself.

Nucleases as a barrier to gene silencing in the cotton boll weevil, Anthonomus grandis.

Science.gov (United States)

Almeida Garcia, Rayssa; Lima Pepino Macedo, Leonardo; Cabral do Nascimento, Danila; Gillet, François-Xavier; Moreira-Pinto, Clidia Eduarda; Faheem, Muhammad; Moreschi Basso, Angelina Maria; Mattar Silva, Maria Cristina; Grossi-de-Sa, Maria Fatima

2017-01-01

RNA interference (RNAi) approaches have been applied as a biotechnological tool for controlling plant insect pests via selective gene down regulation. However, the inefficiency of RNAi mechanism in insects is associated with several barriers, including dsRNA delivery and uptake by the cell, dsRNA interaction with the cellular membrane receptor and dsRNA exposure to insect gut nucleases during feeding. The cotton boll weevil (Anthonomus grandis) is a coleopteran in which RNAi-mediated gene silencing does not function efficiently through dsRNA feeding, and the factors involved in the mechanism remain unknown. Herein, we identified three nucleases in the cotton boll weevil transcriptome denoted AgraNuc1, AgraNuc2, and AgraNuc3, and the influences of these nucleases on the gene silencing of A. grandis chitin synthase II (AgraChSII) were evaluated through oral dsRNA feeding trials. A phylogenetic analysis showed that all three nucleases share high similarity with the DNA/RNA non-specific endonuclease family of other insects. These nucleases were found to be mainly expressed in the posterior midgut region of the insect. Two days after nuclease RNAi-mediated gene silencing, dsRNA degradation by the gut juice was substantially reduced. Notably, after nucleases gene silencing, the orally delivered dsRNA against the AgraChSII gene resulted in improved gene silencing efficiency when compared to the control (non-silenced nucleases). The data presented here demonstrates that A. grandis midgut nucleases are effectively one of the main barriers to dsRNA delivery and emphasize the need to develop novel RNAi delivery strategies focusing on protecting the dsRNA from gut nucleases and enhancing its oral delivery and uptake to crop insect pests.

Efficacy of Killed Adjuvanted FMD Vaccine Developed with ...

African Journals Online (AJOL)

In this study the potency of killed Foot and Mouth Disease (FMD) vaccines serotypes SAT1 (Nig 1/98) and SAT 2 (Nig 2/97) virus isolates, formulated with montanide ISA 206 adjuvant was determined in guinea pigs and cattle by antibody assay using Complement Fixation and Serum Neutralization tests. The antibody titres ...

NH125 kills methicillin-resistant Staphylococcus aureus persisters by lipid bilayer disruption.

Science.gov (United States)

Kim, Wooseong; Fricke, Nico; Conery, Annie L; Fuchs, Beth Burgwyn; Rajamuthiah, Rajmohan; Jayamani, Elamparithi; Vlahovska, Petia M; Ausubel, Frederick M; Mylonakis, Eleftherios

2016-01-01

NH125, a known WalK inhibitor kills MRSA persisters. However, its precise mode of action is still unknown. The mode of action of NH125 was investigated by comparing its spectrum of antimicrobial activity and its effects on membrane permeability and giant unilamellar vesicles (GUVs) with walrycin B, a WalR inhibitor and benzyldimethylhexadecylammonium chloride (16-BAC), a cationic surfactant. NH125 killed persister cells of a variety of Staphylococcus aureus strains. Similar to 16-BAC, NH125 killed MRSA persisters by inducing rapid membrane permeabilization and caused the rupture of GUVs, whereas walrycin B did not kill MRSA persisters or induce membrane permeabilization and did not affect GUVs. NH125 kills MRSA persisters by interacting with and disrupting membranes in a detergent-like manner.

Single-hit mechanism of tumour cell killing by radiation.

Science.gov (United States)

Chapman, J D

2003-02-01

To review the relative importance of the single-hit mechanism of radiation killing for tumour response to 1.8-2.0 Gy day(-1) fractions and to low dose-rate brachytherapy. Tumour cell killing by ionizing radiation is well described by the linear-quadratic equation that contains two independent components distinguished by dose kinetics. Analyses of tumour cell survival curves that contain six or more dose points usually provide good estimates of the alpha- and beta-inactivation coefficients. Superior estimates of tumour cell intrinsic radiosensitivity are obtained when synchronized populations are employed. The characteristics of single-hit inactivation of tumour cells are reviewed and compared with the characteristics of beta-inactivation. Potential molecular targets associated with single-hit inactivation are discussed along with strategies for potentiating cell killing by this mechanism. The single-hit mechanism of tumour cell killing shows no dependence on dose-rate and, consequently, no evidence of sublethal damage repair. It is uniquely potentiated by high linear-energy-transfer radiation, exhibits a smaller oxygen enhancement ratio and exhibits a larger indirect effect by hydroxyl radicals than the beta-mechanism. alpha-inactivation coefficients vary slightly throughout interphase but mitotic cells exhibit extremely high alpha-coefficients in the range of those observed for lymphocytes and some repair-deficient cells. Evidence is accumulating to suggest that chromatin in compacted form could be a radiation-hypersensitive target associated with single-hit radiation killing. Analyses of tumour cell survival curves demonstrate that it is the single-hit mechanism (alpha) that determines the majority of cell killing after doses of 2Gy and that this mechanism is highly variable between tumour cell lines. The characteristics of single-hit inactivation are qualitatively and quantitatively distinct from those of beta-inactivation. Compacted chromatin in tumour cells

Targeted transfection increases siRNA uptake and gene silencing of primary endothelial cells in vitro--a quantitative study.

Science.gov (United States)

Asgeirsdóttir, Sigridur A; Talman, Eduard G; de Graaf, Inge A; Kamps, Jan A A M; Satchell, Simon C; Mathieson, Peter W; Ruiters, Marcel H J; Molema, Grietje

2010-01-25

Applications of small-interfering RNA (siRNA) call for specific and efficient delivery of siRNA into particular cell types. We developed a novel, non-viral targeting system to deliver siRNA specifically into inflammation-activated endothelial cells. This was achieved by conjugating the cationic amphiphilic lipid SAINT to antibodies recognizing the inflammatory cell adhesion molecule E-selectin. These anti-E-selectin-SAINT lipoplexes (SAINTarg) maintained antigen recognition capacity of the parental antibody in vitro, and ex vivo in human kidney tissue slices subjected to inflammatory conditions. Regular SAINT mediated transfection resulted in efficient gene silencing in human microvascular endothelial cells (HMEC-1) and conditionally immortalized glomerular endothelial cells (ciGEnC). However, primary human umbilical vein endothelial cells (HUVEC) transfected poorly, a phenomenon that we could quantitatively correlate with a cell-type specific capacity to facilitate siRNA uptake. Importantly, SAINTarg increased siRNA uptake and transfection specificity for activated endothelial cells. Transfection with SAINTarg delivered significantly more siRNA into activated HUVEC, compared to transfection with non-targeted SAINT. The enhanced uptake of siRNA was corroborated by improved silencing of both gene- and protein expression of VE-cadherin in activated HUVEC, indicating that SAINTarg delivered functionally active siRNA into endothelial cells. The obtained results demonstrate a successful design of a small nucleotide carrier system with improved and specific siRNA delivery into otherwise difficult-to-transfect primary endothelial cells, which in addition reduced considerably the amount of siRNA needed for gene silencing. Copyright 2009 Elsevier B.V. All rights reserved.

Default risk modeling with position-dependent killing

Science.gov (United States)

Katz, Yuri A.

2013-04-01

Diffusion in a linear potential in the presence of position-dependent killing is used to mimic a default process. Different assumptions regarding transport coefficients, initial conditions, and elasticity of the killing measure lead to diverse models of bankruptcy. One “stylized fact” is fundamental for our consideration: empirically default is a rather rare event, especially in the investment grade categories of credit ratings. Hence, the action of killing may be considered as a small parameter. In a number of special cases we derive closed-form expressions for the entire term structure of the cumulative probability of default, its hazard rate, and intensity. Comparison with historical data on aggregate global corporate defaults confirms the validity of the perturbation method for estimations of long-term probability of default for companies with high credit quality. On a single company level, we implement the derived formulas to estimate the one-year likelihood of default of Enron on a daily basis from August 2000 to August 2001, three months before its default, and compare the obtained results with forecasts of traditional structural models.

Comparisons of boll weevil (Coleoptera: Curculionidae) pheromone traps with and without kill strips.

Science.gov (United States)

Suh, C P C; Armstrong, J S; Spurgeon, D W; Duke, S

2009-02-01

Boll weevil, Anthonomus grandis grandis Boheman (Coleoptera: Curculionidae), eradication programs typically equip pheromone traps with an insecticide-impregnated kill strip. These strips are intended to kill captured insects, thereby simplifying trap servicing and reducing the loss of weevils from predation and escape. However, the effectiveness of kill strips has not been extensively evaluated. We examined the influences of kill strips on weevil captures, trap servicing, and the incidences of weevil predation and trap obstruction (e.g., by spider webs). Evaluations were conducted weekly during three different production periods (pre- to early-, late-, and postseason) of cotton, Gossypium hirsutum L., to represent different environmental conditions and weevil population levels. Within each period, mean weekly captures of weevils in traps with and without kill strips were statistically similar. On average, traps with kill strips took 9 s longer to service than traps without kill strips, but statistical differences were only detected during the late-season period. Overall, the mean weekly proportion of traps with evidence of weevil predation or trap obstruction was significantly lower for traps with kill strips (0.25) than for traps without kill strips (0.37). However, this reduction in the frequency of weevil predation or trap obstruction was too small to produce a corresponding increase in the numbers of weevils captured. In light of these findings, the use of kill strips is likely unnecessary in eradication programs, but may be a consideration in situations when the numbers of deployed traps are reduced and chronic problems with weevil predation or trap obstruction exist.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

Energy Technology Data Exchange (ETDEWEB)

Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

2014-11-14

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Paired methods to measure biofilm killing and removal: a case study with Penicillin G treatment of Staphylococcus aureus biofilm.

Science.gov (United States)

Ausbacher, D; Lorenz, L; Pitts, B; Stewart, P S; Goeres, D M

2018-03-01

Biofilms are microbial aggregates that show high tolerance to antibiotic treatments in vitro and in vivo. Killing and removal are both important in biofilm control, therefore methods that measure these two mechanisms were evaluated in a parallel experimental design. Kill was measured using the single tube method (ASTM method E2871) and removal was determined by video microscopy and image analysis using a new treatment flow cell. The advantage of the parallel test design is that both methods used biofilm covered coupons harvested from a CDC biofilm reactor, a well-established and standardized biofilm growth method. The control Staphylococcus aureus biofilms treated with growth medium increased by 0·6 logs during a 3-h contact time. Efficacy testing showed biofilms exposed to 400 μmol l -1 penicillin G decreased by only 0·3 logs. Interestingly, time-lapse confocal scanning laser microscopy revealed that penicillin G treatment dispersed the biofilm despite being an ineffective killing agent. In addition, no biofilm removal was detected when assays were performed in 96-well plates. These results illustrate that biofilm behaviour and impact of treatments can vary substantially when assayed by different methods. Measuring both killing and removal with well-characterized methods will be crucial for the discovery of new anti-biofilm strategies. Biofilms are tolerant to antimicrobial treatments and can lead to persistent infections. Finding new anti-biofilm strategies and understanding their mode-of-action is therefore of high importance. Historically, antimicrobial testing has focused on measuring the decrease in viability. While kill data are undeniably important, measuring biofilm disruption provides equally useful information. Starting with biofilm grown in the same reactor, we paired assessment of biofilm removal using a new treatment-flow-cell and real-time microscopy with kill data collected using the single tube method (ASTM E2871). Pairing these two methods

RNA interference-mediated silencing of speckle-type POZ protein promotes apoptosis of renal cell cancer cells.

Science.gov (United States)

Liu, Xiaoxia; Sun, Guiling; Sun, Xiuju

2016-01-01

This study aimed to investigate the effects of silencing the speckle-type POZ protein (SPOP) gene on renal cell cancer (RCC) cells and to explore its possible mechanism. The A498 and ACHN RCC cells were transfected with small interference RNA (siRNA)-SPOP by lipofection methods. The silencing efficiency was monitored by quantitative real-time polymerase chain reaction and Western blot. The effects of SPOP silencing on cell apoptosis, cell viability, colony formation ability, cell migration ability, and chemosensitivity to Sorafenib were assessed by flow cytometry, an MTT assay, a colony formation assay, a trans-well migration assay, and a CCK-8 assay, respectively. Its effects on the expression of several cytokines were determined by a protein microarray. Relevant signaling pathways were also analyzed. Compared with the control group, the cell apoptosis rate was significantly higher; the cell viability, the colony formation, and migration ability were significantly decreased in the siRNA-SPOP group. The protein microarray screening showed that the expression of vascular endothelial growth factor receptor, matrix metallopeptidase-9, vascular cell adhesion molecule-1, and stromal cell-derived factor-1 in the siRNA group was significantly decreased and that the expression of granulocyte-macrophage colony-stimulating factor and E-cadherin was significantly increased (Pmatrix organization signal pathway. SPOP gene silencing induced cell apoptosis, decreased cell viability, colony formation, and migration ability, and elevated the drug sensitivity in the RCC cells. A possible mechanism is that silencing SPOP induces the differential expression of E-cadherin, vascular endothelial growth factor receptor, matrix metallopeptidase-9, and vascular cell adhesion molecule, which are related to the integrin-mediated cell surface interactions and extracellular matrix organization signaling pathway.

A systemic gene silencing method suitable for high throughput, reverse genetic analyses of gene function in fern gametophytes

Directory of Open Access Journals (Sweden)

Tanurdzic Milos

2004-04-01

Full Text Available Abstract Background Ceratopteris richardii is a useful experimental system for studying gametophyte development and sexual reproduction in plants. However, few tools for cloning mutant genes or disrupting gene function exist for this species. The feasibility of systemic gene silencing as a reverse genetics tool was examined in this study. Results Several DNA constructs targeting a Ceratopteris protoporphyrin IX magnesium chelatase (CrChlI gene that is required for chlorophyll biosynthesis were each introduced into young gametophytes by biolistic delivery. Their transient expression in individual cells resulted in a colorless cell phenotype that affected most cells of the mature gametophyte, including the meristem and gametangia. The colorless phenotype was associated with a 7-fold decrease in the abundance of the endogenous transcript. While a construct designed to promote the transient expression of a CrChlI double stranded, potentially hairpin-forming RNA was found to be the most efficient in systemically silencing the endogenous gene, a plasmid containing the CrChlI cDNA insert alone was sufficient to induce silencing. Bombarded, colorless hermaphroditic gametophytes produced colorless embryos following self-fertilization, demonstrating that the silencing signal could be transmitted through gametogenesis and fertilization. Bombardment of young gametophytes with constructs targeting the Ceratopteris filamentous temperature sensitive (CrFtsZ and uroporphyrin dehydrogenase (CrUrod genes also produced the expected mutant phenotypes. Conclusion A method that induces the systemic silencing of target genes in the Ceratopteris gametophyte is described. It provides a simple, inexpensive and rapid means to test the functions of genes involved in gametophyte development, especially those involved in cellular processes common to all plants.

Killing malignant melanoma cells with protoporphyrin IX-loaded polymersome-mediated photodynamic therapy and cold atmospheric plasma

Directory of Open Access Journals (Sweden)

Wang M

2017-05-01

Full Text Available Mian Wang,1 Benjamin M Geilich,2 Michael Keidar,3 Thomas J Webster1,4 1Department of Chemical Engineering, 2Department of Bioengineering, Northeastern University, Boston, MA, 3Department of Mechanical and Aerospace Engineering, George Washington University, Washington, DC, USA; 4Wenzhou Institute of Biomaterials and Engineering, Wenzhou Medical University, Wenzhou, People’s Republic of China Abstract: Traditional cancer treatments contain several limitations such as incomplete ablation and multidrug resistance. It is known that photodynamic therapy (PDT is an effective treatment for several tumor types especially melanoma cells. During the PDT process, protoporphyrin IX (PpIX, an effective photosensitizer, can selectively kill cancer cells by activating a special light source. When tumor cells encapsulate a photosensitizer, they can be easily excited into an excited state by a light source. In this study, cold atmospheric plasma (CAP was used as a novel light source. Results of some studies have showed that cancer cells can be effectively killed by using either a light source or an individual treatment due to the generation of reactive oxygen species and electrons from a wide range of wavelengths, which suggest that CAP can act as a potential light source for anticancer applications compared with UV light sources. Results of the present in vitro study indicated for the first time that PpIX can be successfully loaded into polymersomes. Most importantly, cell viability studies revealed that PpIX-loaded polymersomes had a low toxicity to healthy fibroblasts (20% were killed at a concentration of 400 µg/mL, but they showed a great potential to selectively kill melanoma cells (almost 50% were killed. With the application of CAP posttreatment, melanoma cell viability significantly decreased (80% were killed compared to not using a light source (45% were killed or using a UV light source (65% were killed. In summary, these results indicated for the

Epigenetic silencing of serine protease HTRA1 drives polyploidy

International Nuclear Information System (INIS)

Schmidt, Nina; Irle, Inga; Ripkens, Kamilla; Lux, Vanda; Nelles, Jasmin; Johannes, Christian; Parry, Lee; Greenow, Kirsty; Amir, Sarah; Campioni, Mara; Baldi, Alfonso; Oka, Chio; Kawaichi, Masashi; Clarke, Alan R.; Ehrmann, Michael

2016-01-01

Increased numbers and improperly positioned centrosomes, aneuploidy or polyploidy, and chromosomal instability are frequently observed characteristics of cancer cells. While some aspects of these events and the checkpoint mechanisms are well studied, not all players have yet been identified. As the role of proteases other than the proteasome in tumorigenesis is an insufficiently addressed question, we investigated the epigenetic control of the widely conserved protease HTRA1 and the phenotypes of deregulation. Mouse embryonal fibroblasts and HCT116 and SW480 cells were used to study the mechanism of epigenetic silencing of HTRA1. In addition, using cell biological and genetic methods, the phenotypes of downregulation of HTRA1 expression were investigated. HTRA1 is epigenetically silenced in HCT116 colon carcinoma cells via the epigenetic adaptor protein MBD2. On the cellular level, HTRA1 depletion causes multiple phenotypes including acceleration of cell growth, centrosome amplification and polyploidy in SW480 colon adenocarcinoma cells as well as in primary mouse embryonic fibroblasts (MEFs). Downregulation of HTRA1 causes a number of phenotypes that are hallmarks of cancer cells suggesting that the methylation state of the HtrA1 promoter may be used as a biomarker for tumour cells or cells at risk of transformation. The online version of this article (doi:10.1186/s12885-016-2425-8) contains supplementary material, which is available to authorized users

Surface functionalisation of PLGA nanoparticles for gene silencing

DEFF Research Database (Denmark)

Andersen, Morten Østergaard; Lichawska, Agata; Arpanaei, Ayyoob

2010-01-01

. In addition, particles containing cetylated-PEI achieved 64% silencing of TNFα in J774.1 cells. This rapid method for surface modification of PLGA nanoparticles promotes its application for alternative cetylated functional derivatives as a strategy to control specific biological properties of nanoparticles....

Killing in More-than-human Spaces: Pasteurisation, Fungi, and the Metabolic Lives of Wine

Directory of Open Access Journals (Sweden)

Brice, Jeremy

2014-05-01

Full Text Available What place might killing occupy in a more-than-human world, where human life is always-already entangled among nonhumans? In this article I attempt to unsettle the assumption that only individual organisms can be killed, and to render other sites and spaces of killing visible. Drawing on ethnographic fieldwork among winemakers in South Australia I examine pasteurisation, a killing practice that acts not on organisms but on the fluids within which they live. Examining the pasteurisation of wine damaged by the fungus Botrytis cinerea, I argue that this practice shifts the locus of killing from botrytis’ body to metabolic life processes which embrace extracellular enzymes diffused throughout the wine. I suggest that pasteurisation thus displaces killing into spaces, such as wine-in-the-making, within which many metabolic lives coexist and interpenetrate. Pasteurisation therefore renders killing an intervention into the metabolic relationships that tie together numerous species of microbes living within wine. In acting on wine as a whole it kills rather indiscriminately, simultaneously terminating multiple lives that relate to humans in different ways. Pasteurisation therefore both protects and spoils wine, reconfiguring multiple human-nonhuman relationships in conflicting and sometimes economically costly ways. In so doing, it illustrates that in a more-than-human world killing becomes difficult to confine to a single unwanted organism or species. Killing instead becomes disturbingly mobile and communicable, prone to rebound upon the valued human lives of those who kill in unsettling and potentially harmful ways.

Novel RNA Duplex Locks HIV-1 in a Latent State via Chromatin-mediated Transcriptional Silencing

Directory of Open Access Journals (Sweden)

Chantelle Ahlenstiel

2015-01-01

Full Text Available Transcriptional gene silencing (TGS of mammalian genes can be induced by short interfering RNA (siRNA targeting promoter regions. We previously reported potent TGS of HIV-1 by siRNA (PromA, which targets tandem NF-κB motifs within the viral 5′LTR. In this study, we screened a siRNA panel with the aim of identifying novel 5′LTR targets, to provide multiplexing potential with enhanced viral silencing and application toward developing alternate therapeutic strategies. Systematic examination identified a novel siRNA target, si143, confirmed to induce TGS as the silencing mechanism. TGS was prolonged with virus suppression >12 days, despite a limited ability to induce post- TGS. Epigenetic changes associated with silencing were suggested by partial reversal by histone deacetylase inhibitors and confirmed by chromatin immunoprecipitation analyses, which showed induction of H3K27me3 and H3K9me3, reduction in H3K9Ac, and recruitment of argonaute-1, all characteristic marks of heterochromatin and TGS. Together, these epigenetic changes mimic those associated with HIV-1 latency. Further, robust resistance to reactivation was observed in the J-Lat 9.2 cell latency model, when transduced with shPromA and/or sh143. These data support si/shRNA-mediated TGS approaches to HIV-1 and provide alternate targets to pursue a functional cure, whereby the viral reservoir is locked in latency following antiretroviral therapy cessation.

Establishment of an efficient virus-induced gene silencing (VIGS) assay in Arabidopsis by Agrobacterium-mediated rubbing infection.

Science.gov (United States)

Manhães, Ana Marcia E de A; de Oliveira, Marcos V V; Shan, Libo

2015-01-01

Several VIGS protocols have been established for high-throughput functional genomic screens as it bypasses the time-consuming and laborious process of generation of transgenic plants. The silencing efficiency in this approach is largely hindered by a technically demanding step in which the first pair of newly emerged true leaves at the 2-week-old stage are infiltrated with a needleless syringe. To further optimize VIGS efficiency and achieve rapid inoculation for a large-scale functional genomic study, here we describe a protocol of an efficient VIGS assay in Arabidopsis using Agrobacterium-mediated rubbing infection. The Agrobacterium inoculation is performed by simply rubbing the leaves with Filter Agent Celite(®) 545. The highly efficient and uniform silencing effect was indicated by the development of a visibly albino phenotype due to silencing of the Cloroplastos alterados 1 (CLA1) gene in the newly emerged leaves. In addition, the albino phenotype could be observed in stems and flowers, indicating its potential application for gene functional studies in the late vegetative development and flowering stages.

An investigation of noise produced by unsteady gas flow through silencer elements

Science.gov (United States)

Mawhinney, Graeme Hugh

This thesis presents an investigation of the noise produced by unsteady gas flow through silencer elements. The central aim of the research project was to produce a tool for assistance in the design of the exhaust systems of diesel powered electrical generator sets, with the modelling techniques developed having a much wider application in reciprocating internal combustion engine exhaust systems. An automotive cylinder head was incorporated in a purpose built test rig to supply exhaust pulses, typical of those found in the exhaust system of four stroke diesel engines, to various experimental exhaust systems. Exhaust silencer elements evaluated included expansion, re- entrant, concentric tube resonator and absorptive elements. Measurements taken on the test rig included, unsteady superposition pressure in the exhaust ducting, cyclically averaged mass flow rate through the system and exhaust noise levels radiated into a semi-anechoic measurement chamber. The entire test rig was modelled using the 1D finite volume method developed previously developed at Queen's University Belfast. Various boundary conditions, developed over the years, were used to model the various silencer elements being evaluated. The 1D gas dynamic simulation thus estimated the mass flux history at the open end of the exhaust system. The mass flux history was then broken into its harmonic components and an acoustic radiation model was developed to model the sound pressure level produced by an acoustic monopole over a reflecting plane. The accuracy of the simulation technique was evaluated by correlation of measured and simulated superposition pressure and noise data. In general correlation of superposition pressure was excellent for all of the silencer elements tested. Predicted sound pressure level radiated from the open end of the exhaust tailpipe was seen to be accurate in the 100 Hz to 1 kHz frequency range for all of the silencer elements tested.

A Novel AT-Rich DNA Recognition Mechanism for Bacterial Xenogeneic Silencer MvaT.

Directory of Open Access Journals (Sweden)

Pengfei Ding

2015-06-01

Full Text Available Bacterial xenogeneic silencing proteins selectively bind to and silence expression from many AT rich regions of the chromosome. They serve as master regulators of horizontally acquired DNA, including a large number of virulence genes. To date, three distinct families of xenogeneic silencers have been identified: H-NS of Proteobacteria, Lsr2 of the Actinomycetes, and MvaT of Pseudomonas sp. Although H-NS and Lsr2 family proteins are structurally different, they all recognize the AT-rich DNA minor groove through a common AT-hook-like motif, which is absent in the MvaT family. Thus, the DNA binding mechanism of MvaT has not been determined. Here, we report the characteristics of DNA sequences targeted by MvaT with protein binding microarrays, which indicates that MvaT prefers binding flexible DNA sequences with multiple TpA steps. We demonstrate that there are clear differences in sequence preferences between MvaT and the other two xenogeneic silencer families. We also determined the structure of the DNA-binding domain of MvaT in complex with a high affinity DNA dodecamer using solution NMR. This is the first experimental structure of a xenogeneic silencer in complex with DNA, which reveals that MvaT recognizes the AT-rich DNA both through base readout by an "AT-pincer" motif inserted into the minor groove and through shape readout by multiple lysine side chains interacting with the DNA sugar-phosphate backbone. Mutations of key MvaT residues for DNA binding confirm their importance with both in vitro and in vivo assays. This novel DNA binding mode enables MvaT to better tolerate GC-base pair interruptions in the binding site and less prefer A tract DNA when compared to H-NS and Lsr2. Comparison of MvaT with other bacterial xenogeneic silencers provides a clear picture that nature has evolved unique solutions for different bacterial genera to distinguish foreign from self DNA.

Sabretoothed carnivores and the killing of large prey.

Directory of Open Access Journals (Sweden)

Ki Andersson

Full Text Available Sabre-like canines clearly have the potential to inflict grievous wounds leading to massive blood loss and rapid death. Hypotheses concerning sabretooth killing modes include attack to soft parts such as the belly or throat, where biting deep is essential to generate strikes reaching major blood vessels. Sabretoothed carnivorans are widely interpreted as hunters of larger and more powerful prey than that of their present-day nonsabretoothed relatives. However, the precise functional advantage of the sabretooth bite, particularly in relation to prey size, is unknown. Here, we present a new point-to-point bite model and show that, for sabretooths, depth of the killing bite decreases dramatically with increasing prey size. The extended gape of sabretooths only results in considerable increase in bite depth when biting into prey with a radius of less than ∼10 cm. For sabretooths, this size-reversed functional advantage suggests predation on species within a similar size range to those attacked by present-day carnivorans, rather than "megaherbivores" as previously believed. The development of the sabretooth condition appears to represent a shift in function and killing behaviour, rather than one in predator-prey relations. Furthermore, our results demonstrate how sabretoothed carnivorans are likely to have evolved along a functionally continuous trajectory: beginning as an extension of a jaw-powered killing bite, as adopted by present-day pantherine cats, followed by neck-powered biting and thereafter shifting to neck-powered shear-biting. We anticipate this new insight to be a starting point for detailed study of the evolution of pathways that encompass extreme specialisation, for example, understanding how neck-powered biting shifts into shear-biting and its significance for predator-prey interactions. We also expect that our model for point-to-point biting and bite depth estimations will yield new insights into the behaviours of a broad range of

Efficient Kill-Save Ratios Ease Up the Cognitive Demands on Counterintuitive Moral Utilitarianism.

Science.gov (United States)

Trémolière, Bastien; Bonnefon, Jean-François

2014-07-01

The dual-process model of moral judgment postulates that utilitarian responses to moral dilemmas (e.g., accepting to kill one to save five) are demanding of cognitive resources. Here we show that utilitarian responses can become effortless, even when they involve to kill someone, as long as the kill-save ratio is efficient (e.g., 1 is killed to save 500). In Experiment 1, participants responded to moral dilemmas featuring different kill-save ratios under high or low cognitive load. In Experiments 2 and 3, participants responded at their own pace or under time pressure. Efficient kill-save ratios promoted utilitarian responding and neutered the effect of load or time pressure. We discuss whether this effect is more easily explained by a parallel-activation model or by a default-interventionist model. © 2014 by the Society for Personality and Social Psychology, Inc.

Increased RNA-induced silencing complex (RISC) activity contributes to hepatocellular carcinoma.

Science.gov (United States)

Yoo, Byoung Kwon; Santhekadur, Prasanna K; Gredler, Rachel; Chen, Dong; Emdad, Luni; Bhutia, Sujit; Pannell, Lewis; Fisher, Paul B; Sarkar, Devanand

2011-05-01

There is virtually no effective treatment for advanced hepatocellular carcinoma (HCC) and novel targets need to be identified to develop effective treatment. We recently documented that the oncogene Astrocyte elevated gene-1 (AEG-1) plays a seminal role in hepatocarcinogenesis. Employing yeast two-hybrid assay and coimmunoprecipitation followed by mass spectrometry, we identified staphylococcal nuclease domain containing 1 (SND1), a nuclease in the RNA-induced silencing complex (RISC) facilitating RNAi-mediated gene silencing, as an AEG-1 interacting protein. Coimmunoprecipitation and colocalization studies confirmed that AEG-1 is also a component of RISC and both AEG-1 and SND1 are required for optimum RISC activity facilitating small interfering RNA (siRNA) and micro RNA (miRNA)-mediated silencing of luciferase reporter gene. In 109 human HCC samples SND1 was overexpressed in ≈74% cases compared to normal liver. Correspondingly, significantly higher RISC activity was observed in human HCC cells compared to immortal normal hepatocytes. Increased RISC activity, conferred by AEG-1 or SND1, resulted in increased degradation of tumor suppressor messenger RNAs (mRNAs) that are target of oncomiRs. Inhibition of enzymatic activity of SND1 significantly inhibited proliferation of human HCC cells. As a corollary, stable overexpression of SND1 augmented and siRNA-mediated inhibition of SND1 abrogated growth of human HCC cells in vitro and in vivo, thus revealing a potential role of SND1 in hepatocarcinogenesis. We unravel a novel mechanism that overexpression of AEG-1 and SND1 leading to increased RISC activity might contribute to hepatocarcinogenesis. Targeted inhibition of SND1 enzymatic activity might be developed as an effective therapy for HCC. Copyright © 2011 American Association for the Study of Liver Diseases.

Tacit Authorization : A Legal Solution for Administrative Silence

NARCIS (Netherlands)

Hoogstra, Nicole; de Graaf, K.J.

2016-01-01

This article discusses one of the current legal instruments to stimulate timely decision-making by administrative authorities, namely the ‘Lex silencio positivo’ or the ‘Silence is Consent’ rule. Tacit authorization prescribes that the license sought by the applicant will be granted automatically if

Killing Unwanted West Indies Mahogany Trees by Peeling and Frilling

Science.gov (United States)

R. W. Nobles; C. B. Briscoe

1966-01-01

Peeling and frilling each killed approximately 70 percent of treated West Indies mahogany, but peeling killed a higher percentage of trees between 18 and 33 centimeters (7 and 13 inches) than did frilling. Essentially all mortality occurred within the first 15 months following treatment.

Uudised : Rannap sai raha lõpuks kätte. No Big Silence esitleb uut heliplaati

Index Scriptorium Estoniae

2000-01-01

Pärnus toimunud lühima öö laulukonkursil võitis peaauhinna R. Rannap. Ans. No-Big-Silence on soojendusbändiks 2. juulil Tallinna Lauluväljakul toimuval Iron Maideni kontserdil. Ans. No-Big-Silence esitleb oma uut heliplaati "successful, bitch and beautiful"

HIV transcription is induced with some forms of cell killing

International Nuclear Information System (INIS)

Woloschak, G.E.; Schreck, S.; Chang-Liu, C.-M.; Libertin, C.R.

1996-01-01

Using HeLa cells stably transfected with an HIV-LTR-CAT construct', we demonstrated a peak in CAT induction that occurs in viable (but not necessarily cell-division-competent) cells 24 h following exposure to some cell-killing agents. Γ rays were the only cell-killing agent which did not induce HIV transcription; this can be attributed to the fact that γ-ray-induced apoptotic death requires function p53, which is missing in HeLa cells. For all other agents, HIV-LTR induction was dose-dependent and correlated with the amount of cell killing that occurred in the culture

Kill Shakespeare – This Bard contains graphic language!

Directory of Open Access Journals (Sweden)

Mauro Gentile

2017-11-01

Full Text Available Today, adapting Shakespearean plays into comic books or graphic novels appears to be a well-established literary practice in contemporary storytelling. One of the most interesting examples is ÒKill ShakespeareÓ, a graphic novel written by Anthony Del Col and Conor McCreery and illustrated by Andy Belanger. In ÒKill ShakespeareÓ, the authors abandon the idea of adapting a single play to create a Shakespearian mashup in which Hamlet and Juliet fight such villains as Richard III and Lady Macbeth who try to kill a wizard named William Shakespeare.This is the premise for a compelling narration that intertwines various elements of the Shakespearean tradition and attempts to convey an idea of Elizabethan language to contemporary readers. While the characters are familiar, the quest is wholly new and triggers a series of transformations in the narrative, turning upside down the well-established images of Hamlet, Juliet and Othello. Beside the intriguing depictions of the female characters, especially Lady Macbeth,whose image poses questions about the representation of women in comic books, one of the most fertile narrative elements in Kill Shakespeare is the actual presence of William Shakespeare as a character. In conclusion, Del Col and McCreery prove they know their Shakespeare, surprising readers with a fresh approach which, hopefully, will enlarge the Shakespearean audience.

Efficacy of cleansing agents in killing microorganisms in mixed species biofilms present on silicone facial prostheses-an in vitro study

NARCIS (Netherlands)

Ariani, Nina; Visser, Anita; Teulings, Margot R. I. M.; Dijk, Melissa; Rahardjo, Tri Budi W.; Vissink, Arjan; van der Mei, Henny C.

2015-01-01

The purpose of this study was to assess the efficacy of different cleansing agents in killing mixed species biofilms on silicone facial prostheses. Two bacterial and three yeast strains, isolated from silicone facial prostheses, were selected for the mixed species biofilms. A variety of agents used

Platinum Interference with siRNA Non-seed Regions Fine-Tunes Silencing Capacity

DEFF Research Database (Denmark)

Hedman, Hanna K; Kirpekar, Finn; Elmroth, Sofi K C

2011-01-01

expression, and the other one focused on the function of endogenous miRNAs. In both cases, the active molecule consists of a ∼20-nucleotide-long RNA duplex. In the siRNA case, improved systemic stability is of central interest for its further development toward clinical applications. With respect to mi......RNA processing and function, understanding its influence on mRNA targeting and the silencing ability of individual miRNAs, e.g., under pathological conditions, remains a scientific challenge. In the present study, a model system is presented where the influence of the two clinically used anticancer drugs......, cisplatin and oxaliplatin, on siRNA's silencing capacity has been evaluated. More specifically, siRNAs targeting the 3' UTR region of Wnt-5a mRNA (NM_003352) were constructed, and the biologically active antisense RNA strand was pre-platinated. Platinum adducts were detected and characterized...

Does host complement kill Borrelia burgdorferi within ticks?

Science.gov (United States)

Rathinavelu, Sivaprakash; Broadwater, Anne; de Silva, Aravinda M

2003-02-01

The Lyme disease spirochete, Borrelia burgdorferi, inhabits the gut lumen of the tick vector. At this location the spirochete is exposed to host blood when a tick feeds. We report here on studies that were done with normal and complement-deficient (C3-knockout) mice to determine if the host complement system killed spirochetes within the vector. We found that spirochete numbers within feeding nymphs were not influenced by complement, most likely because host complement was inactivated within the vector. The Lyme disease outer surface protein A (OspA) vaccine is a transmission-blocking vaccine that targets spirochetes in the vector. In experiments with mice hyperimmunized with OspA, complement was not required to kill spirochetes within nymphs and to block transmission from nymphs to the vaccinated host. However, host complement did enhance the ability of OspA antibody to block larvae from acquiring spirochetes. Thus, the effects of OspA antibody on nymphal transmission and larval acquisition appear to be based on different mechanisms.

Anuran road-kills neighboring a peri-urban reserve in the Atlantic Forest, Brazil.

Science.gov (United States)

Coelho, Igor Pfeifer; Teixeira, Fernanda Zimmermann; Colombo, Patrick; Coelho, Artur Vicente Pfeifer; Kindel, Andreas

2012-12-15

Mortality from road-kills may figure among the important causes of decline in amphibian populations and species extinctions worldwide. Evaluation of the magnitude, composition, and temporal and spatial distributions of amphibian road-kills is a key step for mitigation planning, especially in peri-urban reserves. Once a month for 16 months, we surveyed, on foot, a 4.4 km section of state road ERS-389 bordering the Itapeva reserve in the southern Atlantic Forest. We recorded 1433 anuran road-kills and estimated a mortality rate of 9002 road-kills/km/year. The species most often recorded were the largest ones: Leptodactylus latrans, Rhinella icterica, Leptodactylus gracilis and Hypsiboas faber; 54.5% of the carcasses could not be identified. Anuran mortality was concentrated in summer, and was associated with temperature, rainfall and photoperiod. Leptodactylus road-kills were strongly influenced by vehicle traffic, probably because of its high abundance during the entire study period. Road-kill hotspots differed for anurans as a group and for single species, and we found an association among spatial patterns of mortality and types of land cover, distance from the nearest waterbody, roadside ditches, and artificial light. Traffic should be banned temporarily during periods of high mortality, which can be forecasted based on meteorological data. A comprehensive mitigation approach should take into account hotspots of all anuran records, and also of target species for selecting locations for amphibian passages and fencing. Roadside ditches, artificial waterbodies, and conventional street lights should be reduced as much as possible, since they may represent ecological traps for anuran populations. Copyright © 2012 Elsevier Ltd. All rights reserved.

Involvement of Multiple Gene-Silencing Pathways in a Paramutation-like Phenomenon in Arabidopsis

Directory of Open Access Journals (Sweden)

Zhimin Zheng

2015-05-01

Full Text Available Paramutation is an epigenetic phenomenon that has been observed in a number of multicellular organisms. The epigenetically silenced state of paramutated alleles is not only meiotically stable but also “infectious” to active homologous alleles. The molecular mechanism of paramutation remains unclear, but components involved in RNA-directed DNA methylation (RdDM are required. Here, we report a multi-copy pRD29A-LUC transgene in Arabidopsis thaliana that behaves like a paramutation locus. The silent state of LUC is induced by mutations in the DNA glycosylase gene ROS1. The silent alleles of LUC are not only meiotically stable but also able to transform active LUC alleles into silent ones, in the absence of ros1 mutations. Maintaining silencing at the LUC gene requires action of multiple pathways besides RdDM. Our study identified specific factors that are involved in the paramutation-like phenomenon and established a model system for the study of paramutation in Arabidopsis.

The Relationship among Interactional Justice, Manager Trust and Teachers' Organizational Silence Behavior

Science.gov (United States)

Yangin, Demet; Elma, Cevat

2017-01-01

The purpose of this study was to determine the relationship between the manager trust and interactional justice perceptions and organizational silence behaviors of those teachers who work in primary and secondary schools. The research is based on the survey model and the population consists of 4761 teachers who worked in Samsun, Turkey. The sample…

Emergence of Buprestidae, Cerambycidae, and Scolytinae (Coleoptera) from mountain pine beetle-killed and fire-killed ponderosa pines in the Black Hills, South Dakota, USA

Science.gov (United States)

Sheryl L. Costello; William R. Jacobi; Jose F. Negron

2013-01-01

Wood borers (Coleoptera: Cerambycidae and Buprestidae) and bark beetles (Coleoptera: Curculionidae) infest ponderosa pines, Pinus ponderosa P. Lawson and C. Lawson, killed by mountain pine beetle (MPB), Dendroctonus ponderosae Hopkins, and fire. No data is available comparing wood borer and bark beetle densities or species guilds associated with MPB-killed or fire-...

What does it take to break the silence in teams: Authentic leadership or proactive followership?

NARCIS (Netherlands)

Günter, Hannes; Schreurs, Bert; van Emmerik, Hetty; Sun, Shuhua

2017-01-01

Leadership may help break the silence in teams, but this may not be equally true for all employees. Using behavioral plasticity theory, we propose that authentic leadership—a set of leadership behaviors through which leaders enact their true selves—reduces silence and motivates speaking up in

LNA-antisense rivals siRNA for gene silencing

DEFF Research Database (Denmark)

Jepsen, Jan Stenvang; Wengel, Jesper; Stenvang, Jan

2004-01-01

Locked nucleic acid (LNA) is a class of nucleic acid analogs possessing unprecedented binding affinity toward complementary DNA and RNA while obeying the Watson-Crick base-pairing rules. For efficient gene silencing in vitro and in vivo, fully modified or chimeric LNA oligonucleotides have been a...

Resounding Silences : Subtle Norm Regulation in Everyday Interactions

NARCIS (Netherlands)

Koudenburg, Namkje; Postmes, Tom; Gordijn, Ernestine H.

In this article we suggest a mechanism for norm regulation that does not rely on explicit information exchange or costly reinforcement, but rather on the sensitivity of group members to social cues in their environment. We examine whether brief conversational silences can (a) signal a threat to

Homefucking is Killing Prostitution / Taavi Eelmaa

Index Scriptorium Estoniae

Eelmaa, Taavi, 1971-

2008-01-01

Mis jääb vaatajale teatrietendusest meelde? Ilmus Kris Moori raamat "Homefucking is Killing Prostitution". Raamat sisaldab tekste ja Erki Lauri fotosid Von Krahli Teatri samanimelisest etendusest, mida kordagi ei mängitud

Silence about encounters with dying among healthcare professionals in a society that ‘de-tabooises’ death

Directory of Open Access Journals (Sweden)

Ellen Ramvi

2017-09-01

Full Text Available Background: Empirical studies on healthcare personnel indicate that professionals’ experiences with dying and death become silenced and unutterable within the healthcare service. Aim: To explore and interpret silence about encounters with death and dying among healthcare professionals in Norway. Method: The method used was theoretical exploration, using a psychosocial approach. Findings: This analysis reveals complex interrelations and two-way dynamics between subject-worlds, sociocultural and societal worlds when it comes to dealing with death and dying at work. A performance culture saturates these worlds, and may be implicated in silencing death within the healthcare institutions of the Norwegian welfare state. Conclusions: This article suggests that silence about death and dying among healthcare professionals is indicative of crucial emerging and unresolved tensions in the neoliberal episteme, accompanied and reinforced by the ineluctable basic conditions of life and intrapsychic defence against threats towards the self. Implications for practice: Silence about death and dying presents a serious challenge for dying patients and next of kin. Healthcare professionals should be enabled to acknowledge their thoughts and emotions about death in order to be able to support and contain patients and next of kin Learning activities such as peer support and supervision can help the processing of difficult psychological content and allow for emotional aspects of professionals’ work to be acknowledged and thought about in a way that encourages reflective and sound practice Clinical managers should address whether performance pressures induce shameful feelings in staff, who may believe that by providing appropriate levels of care they are compromising productivity. Shame in turn, may undermine professionals’ emotional wellbeing and ability to continue to provide attuned and adequate care for dying patients Creative approaches to facilitate

Systemic RNAi-mediated Gene Silencing in Nonhuman Primate and Rodent Myeloid Cells

Directory of Open Access Journals (Sweden)

Tatiana I Novobrantseva

2012-01-01

Full Text Available Leukocytes are central regulators of inflammation and the target cells of therapies for key diseases, including autoimmune, cardiovascular, and malignant disorders. Efficient in vivo delivery of small interfering RNA (siRNA to immune cells could thus enable novel treatment strategies with broad applicability. In this report, we develop systemic delivery methods of siRNA encapsulated in lipid nanoparticles (LNP for durable and potent in vivo RNA interference (RNAi-mediated silencing in myeloid cells. This work provides the first demonstration of siRNA-mediated silencing in myeloid cell types of nonhuman primates (NHPs and establishes the feasibility of targeting multiple gene targets in rodent myeloid cells. The therapeutic potential of these formulations was demonstrated using siRNA targeting tumor necrosis factor-α (TNFα which induced substantial attenuation of disease progression comparable to a potent antibody treatment in a mouse model of rheumatoid arthritis (RA. In summary, we demonstrate a broadly applicable and therapeutically relevant platform for silencing disease genes in immune cells.

Effects of Vegetation Structure on the Location of Lion Kill Sites in African Thicket.

Directory of Open Access Journals (Sweden)

Andrew B Davies

Full Text Available Predator-prey relationships are integral to ecosystem stability and functioning. These relationships are, however, difficult to maintain in protected areas where large predators are increasingly being reintroduced and confined. Where predators make kills has a profound influence on their role in ecosystems, but the relative importance of environmental variables in determining kill sites, and how these might vary across ecosystems is poorly known. We investigated kill sites for lions in South Africa's thicket biome, testing the importance of vegetation structure for kill site locations compared to other environmental variables. Kill sites were located over four years using GPS telemetry and compared to non-kill sites that had been occupied by lions, as well as to random sites within lion ranges. Measurements of 3D vegetation structure obtained from Light Detection and Ranging (LiDAR were used to calculate the visible area (viewshed around each site and, along with wind and moonlight data, used to compare kill sites between lion sexes, prey species and prey sexes. Viewshed area was the most important predictor of kill sites (sites in dense vegetation were twice as likely to be kill sites compared to open areas, followed by wind speed and, less so, moonlight. Kill sites for different prey species varied with vegetation structure, and male prey were killed when wind speeds were higher compared to female prey of the same species. Our results demonstrate that vegetation structure is an important component of predator-prey interactions, with varying effects across ecosystems. Such differences require consideration in terms of the ecological roles performed by predators, and in predator and prey conservation.

Effects of Vegetation Structure on the Location of Lion Kill Sites in African Thicket.

Science.gov (United States)

Davies, Andrew B; Tambling, Craig J; Kerley, Graham I H; Asner, Gregory P

2016-01-01

Predator-prey relationships are integral to ecosystem stability and functioning. These relationships are, however, difficult to maintain in protected areas where large predators are increasingly being reintroduced and confined. Where predators make kills has a profound influence on their role in ecosystems, but the relative importance of environmental variables in determining kill sites, and how these might vary across ecosystems is poorly known. We investigated kill sites for lions in South Africa's thicket biome, testing the importance of vegetation structure for kill site locations compared to other environmental variables. Kill sites were located over four years using GPS telemetry and compared to non-kill sites that had been occupied by lions, as well as to random sites within lion ranges. Measurements of 3D vegetation structure obtained from Light Detection and Ranging (LiDAR) were used to calculate the visible area (viewshed) around each site and, along with wind and moonlight data, used to compare kill sites between lion sexes, prey species and prey sexes. Viewshed area was the most important predictor of kill sites (sites in dense vegetation were twice as likely to be kill sites compared to open areas), followed by wind speed and, less so, moonlight. Kill sites for different prey species varied with vegetation structure, and male prey were killed when wind speeds were higher compared to female prey of the same species. Our results demonstrate that vegetation structure is an important component of predator-prey interactions, with varying effects across ecosystems. Such differences require consideration in terms of the ecological roles performed by predators, and in predator and prey conservation.

Silencing the Honey Bee (Apis mellifera) Naked Cuticle Gene (nkd) Improves Host Immune Function and Reduces Nosema ceranae Infections

Science.gov (United States)

Li, Wenfeng; Evans, Jay D.; Huang, Qiang; Rodríguez-García, Cristina; Liu, Jie; Hamilton, Michele; Grozinger, Christina M.; Webster, Thomas C.; Su, Songkun

2016-01-01

ABSTRACT Nosema ceranae is a new and emerging microsporidian parasite of European honey bees, Apis mellifera, that has been implicated in colony losses worldwide. RNA interference (RNAi), a posttranscriptional gene silencing mechanism, has emerged as a potent and specific strategy for controlling infections of parasites and pathogens in honey bees. While previous studies have focused on the silencing of parasite/pathogen virulence factors, we explore here the possibility of silencing a host factor as a mechanism for reducing parasite load. Specifically, we used an RNAi strategy to reduce the expression of a honey bee gene, naked cuticle (nkd), which is a negative regulator of host immune function. Our studies found that nkd mRNA levels in adult bees were upregulated by N. ceranae infection (and thus, the parasite may use this mechanism to suppress host immune function) and that ingestion of double-stranded RNA (dsRNA) specific to nkd efficiently silenced its expression. Furthermore, we found that RNAi-mediated knockdown of nkd transcripts in Nosema-infected bees resulted in upregulation of the expression of several immune genes (Abaecin, Apidaecin, Defensin-1, and PGRP-S2), reduction of Nosema spore loads, and extension of honey bee life span. The results of our studies clearly indicate that silencing the host nkd gene can activate honey bee immune responses, suppress the reproduction of N. ceranae, and improve the overall health of honey bees. This study represents a novel host-derived therapeutic for honey bee disease treatment that merits further exploration. IMPORTANCE Given the critical role of honey bees in the pollination of agricultural crops, it is urgent to develop strategies to prevent the colony decline induced by the infection of parasites/pathogens. Targeting parasites and pathogens directly by RNAi has been proven to be useful for controlling infections in honey bees, but little is known about the disease impacts of RNAi silencing of host factors

Silencing the Honey Bee (Apis mellifera) Naked Cuticle Gene (nkd) Improves Host Immune Function and Reduces Nosema ceranae Infections.

Science.gov (United States)

Li, Wenfeng; Evans, Jay D; Huang, Qiang; Rodríguez-García, Cristina; Liu, Jie; Hamilton, Michele; Grozinger, Christina M; Webster, Thomas C; Su, Songkun; Chen, Yan Ping

2016-11-15

Nosema ceranae is a new and emerging microsporidian parasite of European honey bees, Apis mellifera, that has been implicated in colony losses worldwide. RNA interference (RNAi), a posttranscriptional gene silencing mechanism, has emerged as a potent and specific strategy for controlling infections of parasites and pathogens in honey bees. While previous studies have focused on the silencing of parasite/pathogen virulence factors, we explore here the possibility of silencing a host factor as a mechanism for reducing parasite load. Specifically, we used an RNAi strategy to reduce the expression of a honey bee gene, naked cuticle (nkd), which is a negative regulator of host immune function. Our studies found that nkd mRNA levels in adult bees were upregulated by N. ceranae infection (and thus, the parasite may use this mechanism to suppress host immune function) and that ingestion of double-stranded RNA (dsRNA) specific to nkd efficiently silenced its expression. Furthermore, we found that RNAi-mediated knockdown of nkd transcripts in Nosema-infected bees resulted in upregulation of the expression of several immune genes (Abaecin, Apidaecin, Defensin-1, and PGRP-S2), reduction of Nosema spore loads, and extension of honey bee life span. The results of our studies clearly indicate that silencing the host nkd gene can activate honey bee immune responses, suppress the reproduction of N. ceranae, and improve the overall health of honey bees. This study represents a novel host-derived therapeutic for honey bee disease treatment that merits further exploration. Given the critical role of honey bees in the pollination of agricultural crops, it is urgent to develop strategies to prevent the colony decline induced by the infection of parasites/pathogens. Targeting parasites and pathogens directly by RNAi has been proven to be useful for controlling infections in honey bees, but little is known about the disease impacts of RNAi silencing of host factors. Here, we demonstrate

Silencing of copine genes confers common wheat enhanced resistance to powdery mildew.

Science.gov (United States)

Zou, Baohong; Ding, Yuan; Liu, He; Hua, Jian

2018-06-01

Powdery mildew, caused by the biotrophic fungal pathogen Blumeria graminis f. sp. tritici (Bgt), is a major threat to the production of wheat (Triticum aestivum). It is of great importance to identify new resistance genes for the generation of Bgt-resistant or Bgt-tolerant wheat varieties. Here, we show that the wheat copine genes TaBON1 and TaBON3 negatively regulate wheat disease resistance to Bgt. Two copies of TaBON1 and three copies of TaBON3, located on chromosomes 6AS, 6BL, 1AL, 1BL and 1DL, respectively, were identified from the current common wheat genome sequences. The expression of TaBON1 and TaBON3 is responsive to both pathogen infection and temperature changes. Knocking down of TaBON1 or TaBON3 by virus-induced gene silencing (VIGS) induces the up-regulation of defence responses in wheat. These TaBON1- or TaBON3-silenced plants exhibit enhanced wheat disease resistance to Bgt, accompanied by greater accumulation of hydrogen peroxide and heightened cell death. In addition, high temperature has little effect on the up-regulation of defence response genes conferred by the silencing of TaBON1 or TaBON3. Our study shows a conserved function of plant copine genes in plant immunity and provides new genetic resources for the improvement of resistance to powdery mildew in wheat. © 2017 BSPP AND JOHN WILEY & SONS LTD.

Charge properties and bacterial contact-killing of hyperbranched polyurea-polyethyleneimine coatings with various degrees of alkylation

International Nuclear Information System (INIS)

Roest, Steven; Mei, Henny C. van der; Loontjens, Ton J.A.; Busscher, Henk J.

2015-01-01

Highlights: • Cationic charge density does not reflect bacterial contact-killing by QUAT coatings. • Charge carrier and density reflect bacterial killing by QUAT coatings. • Fluorescein staining cannot distinguish charge carriers in cationic coatings. • Charge carrier and density of QUAT coatings are reflected in the N401.3 eV XPS peak. • The at.% N401.3 eV should be more than 0.45% for effective bacterial contact-killing. - Abstract: Coatings of immobilized-quaternary-ammonium-ions (QUAT) uniquely kill adhering bacteria upon contact. QUAT-coatings require a minimal cationic-charge surface density for effective contact-killing of adhering bacteria of around 10 14 cm −2 . Quaternization of nitrogen is generally achieved through alkylation. Here, we investigate the contribution of additional alkylation with methyl-iodide to the cationic-charge density of hexyl-bromide alkylated, hyperbranched polyurea-polyethyleneimine coatings measuring charge density with fluorescein staining. X-ray-photoelectron-spectroscopy was used to determine the at.% alkylated-nitrogen. Also streaming potentials, water contact-angles and bacterial contact-killing were measured. Cationic-charge density increased with methyl-iodide alkylation times up to 18 h, accompanied by an increase in the at.% alkylated-nitrogen. Zeta-potentials became more negative upon alkylation as a result of shielding of cationiccharges by hydrophobic alkyl-chains. Contact-killing of Gram-positive Staphylococci only occurred when the cationic-charge density exceeded 10 16 cm −2 and was carried by alkylated-nitrogen (electron-binding energy 401.3 eV). Gram-negative Escherichia coli was not killed upon contact with the coatings. There with this study reveals that cationic-charge density is neither appropriate nor sufficient to determine the ability of QUAT-coatings to kill adhering bacteria. Alternatively, the at.% of alkylated-nitrogen at 401.3 eV is proposed, as it reflects both cationic-charge and its

Charge properties and bacterial contact-killing of hyperbranched polyurea-polyethyleneimine coatings with various degrees of alkylation

Energy Technology Data Exchange (ETDEWEB)

Roest, Steven [University of Groningen, University Medical Center Groningen, Department of Biomedical Engineering, AntoniusDeusinglaan 1, 9713 AV Groningen (Netherlands); Mei, Henny C. van der, E-mail: h.c.van.der.mei@umcg.nl [University of Groningen, University Medical Center Groningen, Department of Biomedical Engineering, AntoniusDeusinglaan 1, 9713 AV Groningen (Netherlands); Loontjens, Ton J.A. [University of Groningen, Zernike Institute for Advanced Materials, Department of Polymer Chemistry, Nijenborgh 4, 9747 AG Groningen (Netherlands); Busscher, Henk J. [University of Groningen, University Medical Center Groningen, Department of Biomedical Engineering, AntoniusDeusinglaan 1, 9713 AV Groningen (Netherlands)

2015-11-30

Highlights: • Cationic charge density does not reflect bacterial contact-killing by QUAT coatings. • Charge carrier and density reflect bacterial killing by QUAT coatings. • Fluorescein staining cannot distinguish charge carriers in cationic coatings. • Charge carrier and density of QUAT coatings are reflected in the N401.3 eV XPS peak. • The at.% N401.3 eV should be more than 0.45% for effective bacterial contact-killing. - Abstract: Coatings of immobilized-quaternary-ammonium-ions (QUAT) uniquely kill adhering bacteria upon contact. QUAT-coatings require a minimal cationic-charge surface density for effective contact-killing of adhering bacteria of around 10{sup 14} cm{sup −2}. Quaternization of nitrogen is generally achieved through alkylation. Here, we investigate the contribution of additional alkylation with methyl-iodide to the cationic-charge density of hexyl-bromide alkylated, hyperbranched polyurea-polyethyleneimine coatings measuring charge density with fluorescein staining. X-ray-photoelectron-spectroscopy was used to determine the at.% alkylated-nitrogen. Also streaming potentials, water contact-angles and bacterial contact-killing were measured. Cationic-charge density increased with methyl-iodide alkylation times up to 18 h, accompanied by an increase in the at.% alkylated-nitrogen. Zeta-potentials became more negative upon alkylation as a result of shielding of cationiccharges by hydrophobic alkyl-chains. Contact-killing of Gram-positive Staphylococci only occurred when the cationic-charge density exceeded 10{sup 16} cm{sup −2} and was carried by alkylated-nitrogen (electron-binding energy 401.3 eV). Gram-negative Escherichia coli was not killed upon contact with the coatings. There with this study reveals that cationic-charge density is neither appropriate nor sufficient to determine the ability of QUAT-coatings to kill adhering bacteria. Alternatively, the at.% of alkylated-nitrogen at 401.3 eV is proposed, as it reflects both

Efficient ethanol production from beetle-killed lodgepole pine using SPORL technology and Saccharomyces cerevisiae without detoxification

Science.gov (United States)

Junyong Zhu; Xiaolin Luo; Shen Tian; Roland Gleisner; Jose Negron; Eric Horn

2011-01-01

This study applied Sulfite Pretreatment to Overcome Recalcitrance of Lignocelluloses (SPORL) to evaluate the potential of mountain pine beetle-killed lodgepole pine for ethanol production using conventional Saccharomyces cerevisiae without hydrolysate detoxification. The results indicate that the beetle-killed trees are more susceptible to SPORL pretreatment than live...

Male-killing bacteria as agents of insect pest control

International Nuclear Information System (INIS)

Berec, Ludek; Maxin, Daniel; Bernhauerová, Veronika

2016-01-01

1. Continual effort is needed to reduce the impact of exotic species in the context of increased globalization. Any innovation in this respect would be an asset. 2. We assess the potential of combining two pest control techniques: the well-established sterile insect technique (SIT) and a novel male-killing technique (MKT), which comprises inoculation of a pest population with bacteria that kill the infected male embryos. 3. Population models are developed to assess the efficiency of using the MKT for insect pest control, either alone or together with the SIT. We seek for conditions under which the MKT weakens requirements on the SIT. 4. Regarding the SIT, we consider both non-heritable and inherited sterility. In both cases, the MKT and SIT benefit one another. The MKT may prevent the SIT from failing when not enough sterilized males are released due to high production costs and/or uncertainty on their mating ability following a high irradiation dose. Conversely, with already established SIT, pest eradication can be achieved after introduction of male-killing bacteria with lower vertical transmission efficiency than if the MKT was applied alone. 5. For tephritid fruit flies with non-heritable sterility, maximal impact of the SIT is achieved when the released males are fully sterile. Conversely, for lepidopterans with inherited sterility, maximal impact of the SIT is achieved for intermediate irradiation doses. In both cases, increasing vertical transmission efficiency of male-killing bacteria benefits the SIT; high enough vertical transmission efficiency allows for pest eradication where the SIT is absent or induces only pest suppression when used alone. 6. Synthesis and applications. While both techniques can suppress or eliminate the pest on their own, combined application of the male-killing technique and the sterile insect technique substantially increases pest control efficiency. If male-killing bacteria are already established in the pest, any assessment of

Epigenetic silencing of nucleolar rRNA genes in Alzheimer's disease.

Directory of Open Access Journals (Sweden)

Maciej Pietrzak

Full Text Available Ribosomal deficits are documented in mild cognitive impairment (MCI, which often represents an early stage Alzheimer's disease (AD, as well as in advanced AD. The nucleolar rRNA genes (rDNA, transcription of which is critical for ribosomal biogenesis, are regulated by epigenetic silencing including promoter CpG methylation.To assess whether CpG methylation of the rDNA promoter was dysregulated across the AD spectrum, we analyzed brain samples from 10 MCI-, 23 AD-, and, 24 age-matched control individuals using bisulfite mapping. The rDNA promoter became hypermethylated in cerebro-cortical samples from MCI and AD groups. In parietal cortex, the rDNA promoter was hypermethylated more in MCI than in advanced AD. The cytosine methylation of total genomic DNA was similar in AD, MCI, and control samples. Consistent with a notion that hypermethylation-mediated silencing of the nucleolar chromatin stabilizes rDNA loci, preventing their senescence-associated loss, genomic rDNA content was elevated in cerebrocortical samples from MCI and AD groups.In conclusion, rDNA hypermethylation could be a new epigenetic marker of AD. Moreover, silencing of nucleolar chromatin may occur during early stages of AD pathology and play a role in AD-related ribosomal deficits and, ultimately, dementia.

Sumoylation of Sir2 differentially regulates transcriptional silencing in yeast.

Science.gov (United States)

Hannan, Abdul; Abraham, Neethu Maria; Goyal, Siddharth; Jamir, Imlitoshi; Priyakumar, U Deva; Mishra, Krishnaveni

2015-12-02

Silent information regulator 2 (Sir2), the founding member of the conserved sirtuin family of NAD(+)-dependent histone deacetylase, regulates several physiological processes including genome stability, gene silencing, metabolism and life span in yeast. Within the nucleus, Sir2 is associated with telomere clusters in the nuclear periphery and rDNA in the nucleolus and regulates gene silencing at these genomic sites. How distribution of Sir2 between telomere and rDNA is regulated is not known. Here we show that Sir2 is sumoylated and this modification modulates the intra-nuclear distribution of Sir2. We identify Siz2 as the key SUMO ligase and show that multiple lysines in Sir2 are subject to this sumoylation activity. Mutating K215 alone counteracts the inhibitory effect of Siz2 on telomeric silencing. SUMO modification of Sir2 impairs interaction with Sir4 but not Net1 and, furthermore, SUMO modified Sir2 shows predominant nucleolar localization. Our findings demonstrate that sumoylation of Sir2 modulates distribution between telomeres and rDNA and this is likely to have implications for Sir2 function in other loci as well. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

PCA3 Silencing Sensitizes Prostate Cancer Cells to Enzalutamide-mediated Androgen Receptor Blockade.

Science.gov (United States)

Özgür, Emre; Celik, Ayca Iribas; Darendeliler, Emin; Gezer, Ugur

2017-07-01

Prostate cancer (PCa) is an androgen-dependent disease. Novel anti-androgens (i.e. enzalutamide) have recently been developed for the treatment of patients with metastatic castration-resistant prostate cancer (CRPC). Evidence is accumulating that prostate cancer antigen 3 (PCA3) is involved in androgen receptor (AR) signaling. Here, in combination with enzalutamide-mediated AR blockade, we investigated the effect of PCA3 targeting on the viability of PCa cells. In hormone-sensitive LNCaP cells, AR-overexpressing LNCaP-AR + cells and VCaP cells (representing CRPC), PCA3 was silenced using siRNA oligonucleotides. Gene expression and cell viability was assessed in PCA3-silenced and/or AR-blocked cells. PCA3 targeting reduced the expression of AR-related genes (i.e. prostate-specific antigen (PSA) and prostate-specific transcript 1 (non-protein coding) (PCGEM1)) and potentiated the effect of enzalutamide. Proliferation of PCa cells was suppressed upon PCA3 silencing with a greater effect in LNCaP-AR + cells. Furthermore, PCA3 silencing sensitized PCa cells to enzalutamide-induced loss of cell growth. PCA3, as a therapeutic target in PCa, might be used to potentiate AR antagonists. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Antibody drug conjugates and bystander killing: is antigen-dependent internalisation required?

Science.gov (United States)

Staudacher, Alexander H; Brown, Michael P

2017-12-05

Antibody drug conjugates (ADCs) employ the exquisite specificity of tumour-specific monoclonal antibodies (mAb) for the targeted delivery of highly potent cytotoxic drugs to the tumour site. The chemistry of the linker, which connects the drug to the mAb, determines how and when the drug is released from the mAb. This, as well as the chemistry of the drug, can dictate whether the drug can diffuse into surrounding cells, resulting in 'bystander killing'. Initially, any bystander killing mechanism of action of an ADC was understood to involve an essential sequence of steps beginning with surface antigen targeting, internalisation, intracellular linker cleavage, drug release, and diffusion of drug away from the targeted cell. However, recent studies indicate that, depending on the linker and drug combination, this mechanism may not be essential and ADCs can be cleaved extracellularly or via other mechanisms. In this minireview, we will examine the role of bystander killing by ADCs and explore the emerging evidence of how this can occur independently of internalisation.

Silencing of beta-carotene hydroxylase increases total carotenoid and beta-carotene levels in potato tubers

Directory of Open Access Journals (Sweden)

Pizzichini Daniele

2007-03-01

Full Text Available Abstract Background Beta-carotene is the main dietary precursor of vitamin A. Potato tubers contain low levels of carotenoids, composed mainly of the xanthophylls lutein (in the beta-epsilon branch and violaxanthin (in the beta-beta branch. None of these carotenoids have provitamin A activity. We have previously shown that tuber-specific silencing of the first step in the epsilon-beta branch, LCY-e, redirects metabolic flux towards beta-beta carotenoids, increases total carotenoids up to 2.5-fold and beta-carotene up to 14-fold. Results In this work, we silenced the non-heme beta-carotene hydroxylases CHY1 and CHY2 in the tuber. Real Time RT-PCR measurements confirmed the tuber-specific silencing of both genes . CHY silenced tubers showed more dramatic changes in carotenoid content than LCY-e silenced tubers, with beta-carotene increasing up to 38-fold and total carotenoids up to 4.5-fold. These changes were accompanied by a decrease in the immediate product of beta-carotene hydroxylation, zeaxanthin, but not of the downstream xanthophylls, viola- and neoxanthin. Changes in endogenous gene expression were extensive and partially overlapping with those of LCY-e silenced tubers: CrtISO, LCY-b and ZEP were induced in both cases, indicating that they may respond to the balance between individual carotenoid species. Conclusion Together with epsilon-cyclization of lycopene, beta-carotene hydroxylation is another regulatory step in potato tuber carotenogenesis. The data are consistent with a prevalent role of CHY2, which is highly expressed in tubers, in the control of this step. Combination of different engineering strategies holds good promise for the manipulation of tuber carotenoid content.

Breaking Classroom Silences: A View from Linguistic Ethnography

Science.gov (United States)

Rampton, Ben; Charalambous, Constadina

2016-01-01

This paper addresses potentially problematic classroom episodes in which someone foregrounds a social division that is normally taken for granted. It illustrates the way in which linguistic ethnography can unpack the layered processes that collide in the breaking of silence, showing how linguistic form and practice, individual positioning, local…

Breaking the Silence Surrounding Mental Health on Campus

Science.gov (United States)

Roper, Larry D.

2013-01-01

Mentally ill students are able to participate in higher education at unprecedented rates. While colleges and universities have been responsive to the therapeutic needs, we have failed to successfully create supportive campus climates. Campus leaders are challenged to demonstrate ethical leadership that breaks the silence and confronts the stigma…

A New Calculation Method of Dynamic Kill Fluid Density Variation during Deep Water Drilling

Directory of Open Access Journals (Sweden)

Honghai Fan

2017-01-01

Full Text Available There are plenty of uncertainties and enormous challenges in deep water drilling due to complicated shallow flow and deep strata of high temperature and pressure. This paper investigates density of dynamic kill fluid and optimum density during the kill operation process in which dynamic kill process can be divided into two stages, that is, dynamic stable stage and static stable stage. The dynamic kill fluid consists of a single liquid phase and different solid phases. In addition, liquid phase is a mixture of water and oil. Therefore, a new method in calculating the temperature and pressure field of deep water wellbore is proposed. The paper calculates the changing trend of kill fluid density under different temperature and pressure by means of superposition method, nonlinear regression, and segment processing technique. By employing the improved model of kill fluid density, deep water kill operation in a well is investigated. By comparison, the calculated density results are in line with the field data. The model proposed in this paper proves to be satisfactory in optimizing dynamic kill operations to ensure the safety in deep water.

Get real!

DEFF Research Database (Denmark)

Hyldgaard, Kirsten

2017-01-01

This chapter examines what can be learned from Joshua Oppenheimer’s The Act of Killing and The Look of Silence which document the mass killing of up to one million Indonesians in connection with the military coup in 1965. The opposition between fiction and reality is discussed on the foundation o...

An intronic microRNA silences genes that are functionally antagonistic to its host gene.

Science.gov (United States)

Barik, Sailen

2008-09-01

MicroRNAs (miRNAs) are short noncoding RNAs that down-regulate gene expression by silencing specific target mRNAs. While many miRNAs are transcribed from their own genes, nearly half map within introns of 'host' genes, the significance of which remains unclear. We report that transcriptional activation of apoptosis-associated tyrosine kinase (AATK), essential for neuronal differentiation, also generates miR-338 from an AATK gene intron that silences a family of mRNAs whose protein products are negative regulators of neuronal differentiation. We conclude that an intronic miRNA, transcribed together with the host gene mRNA, may serve the interest of its host gene by silencing a cohort of genes that are functionally antagonistic to the host gene itself.

To kill a mockingbird robot

NARCIS (Netherlands)

Bartneck, C.; Verbunt, M.N.C.; Mubin, O.; Al Mahmud, A.

2007-01-01

Robots are being introduced in our society but their social status is still unclear. A critical issue is if the robot's exhibition of intelligent life-like behavior leads to the users' perception of animacy. The ultimate test for the life-likeness of a robot is to kill it. We therefore conducted an

Simultaneous silencing of multiple genes in the apple scab fungus, Venturia inaequalis, by expression of RNA with chimeric inverted repeats

NARCIS (Netherlands)

Fitzgerald, A.; Kan, van J.A.L.; Plummer, K.M.

2004-01-01

RNA-mediated gene silencing has been demonstrated in plants, animals, and more recently in filamentous fungi. Here, we report high frequency, RNA-mediated gene silencing in the apple scab fungus, Venturia inaequalis. The green fluorescent protein (GFP) transgene was silenced in a GFP-expressing

Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality.

Science.gov (United States)

Lu, Sha; Yin, Xiaoyan; Spollen, William; Zhang, Ning; Xu, Dong; Schoelz, James; Bilyeu, Kristin; Zhang, Zhanyuan J

2015-01-01

In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

Underground laboratories: Cosmic silence, loud science

Energy Technology Data Exchange (ETDEWEB)

Coccia, Eugenio, E-mail: coccia@lngs.infn.i [Department of Physics, University of Rome ' Tor Vergata' and INFN Gran Sasso National Laboratory (Italy)

2010-01-01

Underground laboratories provide the low radioactive background environment necessary to host key experiments in the field of particle and astroparticle physics, nuclear astrophysics and other disciplines that can profit of their characteristics and of their infrastructures. The cosmic silence condition existing in these laboratories allows the search for extremely rare phenomena and the exploration of the highest energy scales that cannot be reached with accelerators. I briefly describe all the facilities that are presently in operation around the world.

Charge properties and bacterial contact-killing of hyperbranched polyurea-polyethyleneimine coatings with various degrees of alkylation

Science.gov (United States)

Roest, Steven; van der Mei, Henny C.; Loontjens, Ton J. A.; Busscher, Henk J.

2015-11-01

Coatings of immobilized-quaternary-ammonium-ions (QUAT) uniquely kill adhering bacteria upon contact. QUAT-coatings require a minimal cationic-charge surface density for effective contact-killing of adhering bacteria of around 1014 cm-2. Quaternization of nitrogen is generally achieved through alkylation. Here, we investigate the contribution of additional alkylation with methyl-iodide to the cationic-charge density of hexyl-bromide alkylated, hyperbranched polyurea-polyethyleneimine coatings measuring charge density with fluorescein staining. X-ray-photoelectron-spectroscopy was used to determine the at.% alkylated-nitrogen. Also streaming potentials, water contact-angles and bacterial contact-killing were measured. Cationic-charge density increased with methyl-iodide alkylation times up to 18 h, accompanied by an increase in the at.% alkylated-nitrogen. Zeta-potentials became more negative upon alkylation as a result of shielding of cationiccharges by hydrophobic alkyl-chains. Contact-killing of Gram-positive Staphylococci only occurred when the cationic-charge density exceeded 1016 cm-2 and was carried by alkylated-nitrogen (electron-binding energy 401.3 eV). Gram-negative Escherichia coli was not killed upon contact with the coatings. There with this study reveals that cationic-charge density is neither appropriate nor sufficient to determine the ability of QUAT-coatings to kill adhering bacteria. Alternatively, the at.% of alkylated-nitrogen at 401.3 eV is proposed, as it reflects both cationic-charge and its carrier. The at.% N401.3 eV should be above 0.45 at.% for Gram-positive bacterial contact-killing.

A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize1[OPEN

Science.gov (United States)

Mei, Yu; Kernodle, Bliss M.; Hill, John H.

2016-01-01

Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. PMID:27208311

Pnc1p-mediated nicotinamide clearance modifies the epigenetic properties of rDNA silencing in Saccharomyces cerevisiae.

Science.gov (United States)

McClure, Julie M; Gallo, Christopher M; Smith, Daniel L; Matecic, Mirela; Hontz, Robert D; Buck, Stephen W; Racette, Frances G; Smith, Jeffrey S

2008-10-01

The histone deacetylase activity of Sir2p is dependent on NAD(+) and inhibited by nicotinamide (NAM). As a result, Sir2p-regulated processes in Saccharomyces cerevisiae such as silencing and replicative aging are susceptible to alterations in cellular NAD(+) and NAM levels. We have determined that high concentrations of NAM in the growth medium elevate the intracellular NAD(+) concentration through a mechanism that is partially dependent on NPT1, an important gene in the Preiss-Handler NAD(+) salvage pathway. Overexpression of the nicotinamidase, Pnc1p, prevents inhibition of Sir2p by the excess NAM while maintaining the elevated NAD(+) concentration. This growth condition alters the epigenetics of rDNA silencing, such that repression of a URA3 reporter gene located at the rDNA induces growth on media that either lacks uracil or contains 5-fluoroorotic acid (5-FOA), an unusual dual phenotype that is reminiscent of telomeric silencing (TPE) of URA3. Despite the similarities to TPE, the modified rDNA silencing phenotype does not require the SIR complex. Instead, it retains key characteristics of typical rDNA silencing, including RENT and Pol I dependence, as well as a requirement for the Preiss-Handler NAD(+) salvage pathway. Exogenous nicotinamide can therefore have negative or positive impacts on rDNA silencing, depending on the PNC1 expression level.

Simulation and Measurements of Small Arms Blast Wave Overpressure in the Process of Designing a Silencer

Directory of Open Access Journals (Sweden)

Hristov Nebojša

2015-02-01

Full Text Available Simulation and measurements of muzzle blast overpressure and its physical manifestations are studied in this paper. The use of a silencer can have a great influence on the overpressure intensity. A silencer is regarded as an acoustic transducer and a waveguide. Wave equations for an acoustic dotted source of directed effect are used for physical interpretation of overpressure as an acoustic phenomenon. Decomposition approach has proven to be suitable to describe the formation of the output wave of the wave transducer. Electroacoustic analogies are used for simulations. A measurement chain was used to compare the simulation results with the experimental ones.

Efficient transformation and artificial miRNA gene silencing in Lemna minor.

Science.gov (United States)

Cantó-Pastor, A; Mollá-Morales, A; Ernst, E; Dahl, W; Zhai, J; Yan, Y; Meyers, B C; Shanklin, J; Martienssen, R

2015-01-01

Despite rapid doubling time, simple architecture and ease of metabolic labelling, a lack of genetic tools in the Lemnaceae (duckweed) has impeded the full implementation of this organism as a model for biological research. Here, we present technologies to facilitate high-throughput genetic studies in duckweed. We developed a fast and efficient method for producing Lemna minor stable transgenic fronds via Agrobacterium-mediated transformation and regeneration from tissue culture. Additionally, we engineered an artificial microRNA (amiRNA) gene silencing system. We identified a Lemna gibba endogenous miR166 precursor and used it as a backbone to produce amiRNAs. As a proof of concept we induced the silencing of CH42, a magnesium chelatase subunit, using our amiRNA platform. Expression of CH42 in transgenic L. minor fronds was significantly reduced, which resulted in reduction of chlorophyll pigmentation. The techniques presented here will enable tackling future challenges in the biology and biotechnology of Lemnaceae. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

Host-Induced Gene Silencing of Rice Blast Fungus Magnaporthe oryzae Pathogenicity Genes Mediated by the Brome Mosaic Virus.

Science.gov (United States)

Zhu, Lin; Zhu, Jian; Liu, Zhixue; Wang, Zhengyi; Zhou, Cheng; Wang, Hong

2017-09-26

Magnaporthe oryzae is a devastating plant pathogen, which has a detrimental impact on rice production worldwide. Despite its agronomical importance, some newly-emerging pathotypes often overcome race-specific disease resistance rapidly. It is thus desirable to develop a novel strategy for the long-lasting resistance of rice plants to ever-changing fungal pathogens. Brome mosaic virus (BMV)-induced RNA interference (RNAi) has emerged as a useful tool to study host-resistance genes for rice blast protection. Planta-generated silencing of targeted genes inside biotrophic pathogens can be achieved by expression of M. oryzae -derived gene fragments in the BMV-mediated gene silencing system, a technique termed host-induced gene silencing (HIGS). In this study, the effectiveness of BMV-mediated HIGS in M. oryzae was examined by targeting three predicted pathogenicity genes, MoABC1, MoMAC1 and MoPMK1 . Systemic generation of fungal gene-specific small interfering RNA (siRNA) molecules induced by inoculation of BMV viral vectors inhibited disease development and reduced the transcription of targeted fungal genes after subsequent M. oryzae inoculation. Combined introduction of fungal gene sequences in sense and antisense orientation mediated by the BMV silencing vectors significantly enhanced the efficiency of this host-generated trans-specific RNAi, implying that these fungal genes played crucial roles in pathogenicity. Collectively, our results indicated that BMV-HIGS system was a great strategy for protecting host plants against the invasion of pathogenic fungi.

Interplays between soil-borne plant viruses and RNA silencing-mediated antiviral defense in roots

Directory of Open Access Journals (Sweden)

Ida Bagus Andika

2016-09-01

Full Text Available Although the majority of plant viruses are transmitted by arthropod vectors and invade the host plants through the aerial parts, there is a considerable number of plant viruses that infect roots via soil-inhabiting vectors such as plasmodiophorids, chytrids, and nematodes. These soil-borne viruses belong to diverse families, and many of them cause serious diseases in major crop plants. Thus, roots are important organs for the life cycle of many viruses. Compared to shoots, roots have a distinct metabolism and particular physiological characteristics due to the differences in development, cell composition, gene expression patterns, and surrounding environmental conditions. RNA silencing is an important innate defense mechanism to combat virus infection in plants, but the specific information on the activities and molecular mechanism of RNA silencing-mediated viral defense in root tissue is still limited. In this review, we summarize and discuss the current knowledge regarding RNA silencing aspects of the interactions between soil-borne viruses and host plants. Overall, research evidence suggests that soil-borne viruses have evolved to adapt to the distinct mechanism of antiviral RNA silencing in roots.

47 CFR 80.304 - Watch requirement during silence periods.

Science.gov (United States)

2010-10-01

....304 Section 80.304 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL RADIO SERVICES STATIONS IN THE MARITIME SERVICES Safety Watch Requirements and Procedures Ship Station Safety Watches § 80.304 Watch requirement during silence periods. Each ship station operating on...

Supersymmetric backgrounds, the Killing superalgebra, and generalised special holonomy

Energy Technology Data Exchange (ETDEWEB)

Coimbra, André [Institut des Hautes Études Scientifiques, Le Bois-Marie,35 route de Chartres, F-91440 Bures-sur-Yvette (France); Strickland-Constable, Charles [Institut des Hautes Études Scientifiques, Le Bois-Marie,35 route de Chartres, F-91440 Bures-sur-Yvette (France); Institut de physique théorique, Université Paris Saclay, CEA, CNRS,Orme des Merisiers, F-91191 Gif-sur-Yvette (France)

2016-11-10

We prove that, for M theory or type II, generic Minkowski flux backgrounds preserving N supersymmetries in dimensions D≥4 correspond precisely to integrable generalised G{sub N} structures, where G{sub N} is the generalised structure group defined by the Killing spinors. In other words, they are the analogues of special holonomy manifolds in E{sub d(d)}×ℝ{sup +} generalised geometry. In establishing this result, we introduce the Kosmann-Dorfman bracket, a generalisation of Kosmann’s Lie derivative of spinors. This allows us to write down the internal sector of the Killing superalgebra, which takes a rather simple form and whose closure is the key step in proving the main result. In addition, we find that the eleven-dimensional Killing superalgebra of these backgrounds is necessarily the supertranslational part of the N-extended super-Poincaré algebra.

Sound attenuation of a finite length dissipative flow duct silencer with internal mean flow in the absorbent

Science.gov (United States)

Cummings, A.; Chang, I.-J.

1988-11-01

Internal mean flow within the pores of a bulk-reacting porous acoustic absorbent, driven by mean static pressure gradients, is shown here to be an important feature of the acoustics of dissipative silencers in flow ducts, particularly in the case of internal combustion engine exhaust silencers. Theoretical treatments are presented here, both to describe the effect of internal flow on the bulk acoustic perties of the porous medium and to find the effect of the absorbent in situ, in the form of the sound transmission loss of the silencer. The measured transmission loss of an experimental silencer is compared to predicted data and good agreement between the two is obtained. The effects of mean fluid flow in the central passage and internal flow in the absorbent are separately demonstrated.

Effects of lead on the killing mechanisms of polymorphonuclear leukocytes

International Nuclear Information System (INIS)

Silberstein, C.F.

1984-01-01

The effects of lead on the killing mechanisms of rat polymorphonuclear leukocytes (PMN) were investigated, using male Long-Evans rats exposed to 1% lead acetate in the drinking water for varying periods of time to achieve blood lead levels ranging from 20-200 μg/dl. Studies of PMN bacterial and fungal killing activity, chemotaxis and phagocytosis demonstrated that: 1) bactericidal activity of PMN from rats exposed to lead was not altered; 2) chemotactic activity remained within normal limits; 3) the phagocytic ability of the PMN also remained unaltered. In addition to these normal findings, one major abnormality was demonstrated: a significant decrease in the ability of PMN from rats exposed to lead to kill Candida albicans. This defect was not related to age or to length of exposure. It could not be produced by addition of lead to the test system in vitro. Further investigation revealed significant decreases in PMN glucose-6-phosphate dehydrogenase, catalase, and myeloperoxidase activities. These data support two possible mechanisms for the abnormal fungicidal activity of PMN from lead-exposed rats: decrease in ability to reduce oxygen to active metabolites, or reduction in myeloperoxidase activity due to diminshed synthesis of the heme moiety required for its function

Carbon stocks of trees killed by bark beetles and wildfire in the western United States

International Nuclear Information System (INIS)

Hicke, Jeffrey A; Meddens, Arjan J H; Kolden, Crystal A; Allen, Craig D

2013-01-01

Forests are major components of the carbon cycle, and disturbances are important influences of forest carbon. Our objective was to contribute to the understanding of forest carbon cycling by quantifying the amount of carbon in trees killed by two disturbance types, fires and bark beetles, in the western United States in recent decades. We combined existing spatial data sets of forest biomass, burn severity, and beetle-caused tree mortality to estimate the amount of aboveground and belowground carbon in killed trees across the region. We found that during 1984–2010, fires killed trees that contained 5–11 Tg C year −1 and during 1997–2010, beetles killed trees that contained 2–24 Tg C year −1 , with more trees killed since 2000 than in earlier periods. Over their periods of record, amounts of carbon in trees killed by fires and by beetle outbreaks were similar, and together these disturbances killed trees representing 9% of the total tree carbon in western forests, a similar amount to harvesting. Fires killed more trees in lower-elevation forest types such as Douglas-fir than higher-elevation forest types, whereas bark beetle outbreaks also killed trees in higher-elevation forest types such as lodgepole pine and Engelmann spruce. Over 15% of the carbon in lodgepole pine and spruce/fir forest types was in trees killed by beetle outbreaks; other forest types had 5–10% of the carbon in killed trees. Our results document the importance of these natural disturbances in the carbon budget of the western United States. (letter)