WorldWideScience

Sample records for silence kills study

  1. Silence that Kills

    OpenAIRE

    Cairns, John

    2009-01-01

    All of humankind has remained silent about a serious problem _ the overpopulation of Earth. With the amount of people on Earth exponentially growing, food production for the growing population has become an increasing problem. The only alternatives to population stabilization are to 10 permit the population to grow unchecked until it exceeds the bare subsistence level and natural law controls the population by means of disease, starvation, and death or 2) estimate optimum population size base...

  2. Silence multiple

    DEFF Research Database (Denmark)

    Søndergaard, Katia Dupret

    The article highlights the importance of silences in the processes of innovation in organizations, and the claim is that silence and the absence of talk distribute authority, responsibility and decisions. The act of silencing is conceptualised as a central “configurating actor”. Using an Actor......-Network Theoretical approach to organization studies silence is conceptualised as both a means and an effect of innovative efforts. It is a way of ordering practices. Thus silencing is thought of as a central potential change agent both in composing a kind of specific organizational collectivity and in composing new...... working practices more generally. In line with the approach to destabilise the mundane, invisible and taken-for-granted aspects of innovative efforts in organisations (crucial for ANT and foucauldian post-structuralism more broadly), this article suggests to non-silence the silence and make...

  3. Chronic diseases kill on silence

    Directory of Open Access Journals (Sweden)

    Querubina Bringel Olinda

    2009-09-01

    Full Text Available Há uma diferença acentuada na determinação das prioridades, não no planejamento, mas na execução dos serviços, na materialização do fato e na importância da informação perante os meios de comunicação entre as duas categorias fundamentais de doenças – infecciosas e não infecciosas(1 .Em repasse às estatísticas de mortalidade proporcional, do Ministério da Saúde, em série histórica, constatam-se profundas mudanças no quadro, que há muito tempo constitui matéria discutida na literatura especializada. As causas determinantes da referida alteração foram citadas e reproduzidas em um número finito de artigos especializados, portanto, por demais conhecidas de todos.Em 2006, o grande grupo das doenças infecciosas e parasitárias representou 4,92% de todos os óbitos. Entretanto, somente o das doenças do aparelho circulatório contribuiu com 32,01% das mortes ocorridas naquele ano. É a estatística mais representativa da mortalidade dentre as principais causas de morte.(2As doenças do aparelho circulatório, isoladas, costumam atingir um quinto de todos os óbitos. No entanto, elas matam no silêncio. Os óbitos são notificados e registrados sem alarde.Ao olhar com mais detalhe o sistema de mortalidade do Ministério da Saúde, ele exibe registro na distribuição etária, e neste seu agrupamento há óbitos prematuros que se fazem presentes nas estatísticas de mortalidade por doenças do aparelho circulatório. Há de se ter uma análise estatística esclarecedora nesse grande grupo de doença da necessidade de investimento como medida necessária para prorrogar a idade do desfecho gerador da morte. O adoecer e o morrer prematuro devem ter uma abordagem inquirida e uma resposta à altura. No final da vida a morte é uma certeza para todos, tem-se que morrer de algo, é a lei biológica – nascer, viver e morrer.Para todas as doenças crônicas não transmissíveis, constata-se que elas ocupam os três principais grupos de causa de morte. Quando se soma a contribuição da carga que tem cada um dos seus componentes no total de óbitos, as estatísticas são por demais expressivas – elas canalizam para ser uma das grandes prioridades nos serviços de saúde e nos afins ao combate da causa ou na mundança do estilo de vida para hábitos saudáveis.As neoplasias malignas representaram, no mesmo ano, 16,47%, as causas externas 14,36%, que somados aos 32,01% acima mencionados, redundaram em 62,05% dos óbitos notificados no País, em 2006 (2.Com certeza, essas estatísticas ainda contêm omissão no tocante à causa básica, porém serão a favor das crônicas. O contingente populacional de idosos tem os maiores percentuais de morte sem diagnósticos, por causas sem assistência médica e por causas mal definidas. Provavelmente, grande parte desses óbitos deve aumentar as estatísticas das doenças crônicas, alguns para as doenças do aparelho respiratório e outros, em menor escala, para o restante das causas(2.No caso das doenças crônicas tem-se que dar mais ênfase na informação a mudanças positivas no estilo de vida, na complexidade hospitalar e nas condições imprescíndiveis ao diagnóstico precoce. Tem-se que assumir que, apesar de apresentar soluções em um grande percentual de casos, o programa de saúde da família ainda não resolve problemas complexos.A capacidade de diagnóstico precoce e a resolutividade da rede são importantes para todos nós, seres humanos. Nemtodos os problemas de saúde podem, devem e conseguem ser resolvidos em unidades de menor complexidade.O atendimento terciário é um suporte imprescindível à manutenção da vida e ao respeito à dignidade do ser humano. O hospital deve também ser revitalizado. O ser “paciente” com este nome tão apropriado, é angustiante. Quanto aos principais tipos de câncer, também ainda há muito o que informar, e requer um trabalho mais sistemático de incentivo à procura de sua prevenção e uma maior cobertura de atendimentos.Nas causas externas, os meios de comunicação fazem uma verdadeira apologia à violência. Vive-se a síndrome do medo. O homicídio difere em suas causas determinantes e no seu combate aos acidentes do trânsito. Nesse bloco, entra a ação do estado em todas as esferas de governo, da engenharia de trânsito e principalmente da família – há de se voltar para os valores da pessoa humana. Não se constrói a paz semeando o medo e a violência.O Brasil espalhou medo sobre a influenza ou gripe causada pelo A(H1N1, em que a sobrevivência do vírus no ambiente é em torno de uma hora(2,3. Talvez, perpassando a linha do tempo das grandes epidemias da história no mundo, mormente as provocadas pela influenza, gripe espanhola, gripe russa e outras mais, não aqui citadas, que dizimaram milhões de pessoas(4, fizeram o sistema de comunicação sacudir as escolas com o alarme sobre a transmissibilidade da influenza e, por colocá-la isolada no foco da transmissão, esquecendo a família, o lazer, o trabalho, as viagens e, enfim, a normalidade da vida. Os serviços de saúde voltaram-se inteiramente para esse fim.As doenças transmissíveis são sempre amedrontadoras pelo seu poder de propagação e, em potencial, de causarem epidemias, em qualquer momento, desde que não lhes faltem condições para fazê-la.Os óbitos em epidemias são contados em público até a saturação da notícia, ao contrário das doenças crônicas não transmissíveis. As suas estatísticas são apenas registradas e manuseadas por técnicos, excluídas do clamor social. Há necessidade de um novo olhar, em se tratando de doenças crônicas. Os definidores de politicas públicas devem ter em mente dois fatos norteadores para o planejamento de ações de intervenção nas referidas doenças. O primeiro de que os futuros idosos brasileiros, dentro de, sessenta anos de idade, referencial da velhice no País, já foram nascidos; e o outro, de que a expectativa de vida brasileira aumentou, o que tornará as doenças crônicas ainda em mais evidência no setor saúde.REFERÊNCIAS1. Rouquayrol MZ, Almeida-Filho N. Epidemiologia eSaúde, 2ª - ed. Rio de Janeiro: (BR Medsi; 2008.570 p.2. Brasil, Ministério da Saúde. Influenza humana:perguntas e respostas. (acesso em 2009 Ago 29.Disponível em: http://portal.saude.gov.br/portal/saude/profissional/area.cfm?id_area=15343. Ministério da Saúde (BR. Influenza humana: perguntase respostas. (acesso em 2009 ago 29. Disponívelem: http://portal.saude.gov.br/portal/saude/profissional/visualizar_texto.cfm?idtxt=31244 acesso em 2009.4. Bueno WC. A “gripe suína” e a pandemia da informação.Portal imprensa. (acesso em 2009 Jun. 20. Disponívelem: http://portalimprensa.uol.com.br/colunistas/colunas/2009/05/05/imprensa406.shtml .

  4. Road-Killed Animals as Resources for Ecological Studies.

    Science.gov (United States)

    Adams, Clark E.

    1983-01-01

    Summarizes 19 literature sources identifying road-killed vertebrates and frequency of kill by numbers. Examples of how these animals can be incorporated into curricula (integrating biology, society, people, and values) are given, followed by an illustrated example of how a road-killed raccoon's skull demonstrated a human/wildlife interaction prior…

  5. Performative Silences

    DEFF Research Database (Denmark)

    Dupret, Katia

    2018-01-01

    static nor neutral. It has performative effects. Silencing as an act, rather than a noun, is conceptualised as a central ‘configurating actor’ of change. Through the description of minute details from a videotaped supervision session in the mental healthcare sector, it is shown how different performative...... configurations of silence makes people relate to each other in new ways and influence new work practices. In spite of its somewhat immaterial connotations, using an Actor-Network Theory approach to organization studies, silencing is conceptualised as both a means and an effect of change efforts, which are socio...

  6. Killing a Peacock: A Case Study of the Targeted Killing of Admiral Isoroku Yamamoto

    Science.gov (United States)

    2015-03-24

    assertions by-in-large fell on deaf ears in the United States, Yamamoto nevertheless took special interest in Mitchell’s claims, and returned to Japan in...deliberations on April 17.106 Upon receiving an update brief of the planning order, Viccellio immediately identified a problem . He knew that the P-38’s fuel...what, it all happened all too fast to know and he was content on calling it a “team kill.”152 Instead, he left resolution of the issue to Barber and

  7. An Empirical Study to Determine The Relationship between Occupational Self-Efficacy and Organizational Silence

    Directory of Open Access Journals (Sweden)

    Cem KAHYA

    2015-06-01

    Full Text Available The concept of occupational self-efficacy means the efficacy perceptions of employees in their occupational fields, and the concept of organizational silence means the employees avoid to voice their ideas and suggestions about organizational issues. The main aim of this study is to examine the relationship between the concepts of occupational self-efficacy and organizational silence by revealing employees’ perceptions of occupational self-efficacy and organizational silence level. With this aim, the survey study was conducted on total 114 academicians who work in University of Bayburt. As a result of research, while the significant relationship was found between employees’ perceptions of occupational self-efficacy and organizational silence level, there was reached a result that this relationship incurred the negatively relationship between perceptions of occupational self-efficacy and negative silence.

  8. Preliminary study of killing the larva of plodia interpunella by irradiation

    International Nuclear Information System (INIS)

    Wang Jide; Ma Xiaoping

    1994-01-01

    The results of killing the larva of plodia interpunella in the fruit by 60 Co γ-irradiation are described. The lowest effective dose for killing larva by irradiation is ca. 2000 Gy; the effective dose for immediately killing larva is 3000 Gy. The method is simple and easy and also suitable for the study of commercial irradiation of dry-fruit

  9. Speaking of Silence: Comments from an Irish Studies Perspective

    DEFF Research Database (Denmark)

    McQuaid, Sara Dybris; Beville, Maria

    2012-01-01

    argue that silence in its own right is a unique and important route to understanding the complexities of modern Ireland in cultural, contemporary and historical terms. This is true, not least in the case of Northern Ireland where the difficult struggle to construct a unified political consciousness...

  10. Organizational Silence, from Roots to Solutions: A Case Study in Iran Petroleum Industry

    Directory of Open Access Journals (Sweden)

    Mehdi Afkhami Ardakani

    2015-05-01

    Full Text Available Organizational silence is defined as the lack of effective interactions among staff and it stands opposite to the concept of organizational voice. In the present research, the purpose is to measure the silence behavior among the Research Institute of Petroleum Industry (RIPI staff before and after the implementation of a comprehensive suggestion system. A suggestion system is an internal structure easily accessed by all the staff to state their suggestions in a pre-structured format. The roots of silence behavior are studied based on a deep literature review to find out possible solutions to improve organizational voice. To conduct the research, a self-structured questionnaire has been developed and distributed among all the staff. A quasi-experimental methodology has been adopted to compare pretest and post-test results of silence status before and after implementing the suggestion system. The results show that the silence behavior has been meaningfully reduced. This is based on a simple t-test performed by SPSS software, where there is a meaningful difference between the silence status of pre-test and post-test. In other words, a suggestion system could be a communication opportunity to encourage staff to provide suggestions and to cooperate for promoting the organization, which will finally reduce the organization silence. A major gap within the studies of Iranian scholars about organizational silence is the failure to introduce effective solutions to reduce it. However, this research is innovative in the sense that it fills the mentioned gap. This research shows that large scale organizations like RIPI need to consider methods like suggestion systems to break bureaucratic obstacles so that their staff can easily find open routes to share their ideas and suggestions in a prestructured format. This cooperating will lead to mutual benefits for both parts, since suggestions could be used to enhance organizational structure and performance and

  11. Traffics and wildlife: A preliminary study on road-kill

    OpenAIRE

    Rustiati, Elly Lestari

    2012-01-01

    This paper presents the preliminary finding on road kill survey by direct observations onthe high ways. The road-kills recorded of small wildlife, including medium size-mammal (2.50%, n =1), birds (5.00%, n = 2) and small mammals (92.50%, n = 37). The small mammals include the mostcommon mammals in the areas, squirrels, raccoons, skunks and woodchuck. Of mammals, squirrels(35.00%) were the highest recorded, followed by woodchucks (25.00%), mice/shrew (17.50%),raccoons (10.00%), skunk (5.00%) ...

  12. Protocol: using virus-induced gene silencing to study the arbuscular mycorrhizal symbiosis in Pisum sativum

    DEFF Research Database (Denmark)

    Grønlund, Mette; Olsen, Anne; Johansen, Elisabeth

    2010-01-01

    , the available PEBV-VIGS protocols are inadequate for studying genes involved in the symbiosis with arbuscular mycorrhizal fungi (AMF). Here we describe a PEBV-VIGS protocol suitable for reverse genetics studies in pea of genes involved in the symbiosis with AMF and show its effectiveness in silencing genes...... involved in the early and late stages of AMF symbiosis....

  13. "Listening Silence" and Its Discursive Effects

    Science.gov (United States)

    Applebaum, Barbara

    2016-01-01

    While researchers have studied how white silence protects white innocence and white ignorance, in this essay Barbara Applebaum explores a form of white silence that she refers to as "listening silence" in which silence protects white innocence but does not necessarily promote resistance to learning. White listening silence can appear to…

  14. Muertes silenciadas: Problemática del suicidio en los campesinos de La Unión (Antioquia / Silenced Kills: Problems of farmers suicide in La Union, Antioquia

    Directory of Open Access Journals (Sweden)

    Andrea L. Pérez

    2014-05-01

    Full Text Available Durante las últimas dos décadas se han incrementado notoriamente las tasas de suicidio en la población campesina colombiana. Objetivo: explicar los componentes sociales que contribuyen a la configuración de conductas suicidas recurrentes en ciertas poblaciones rurales a través de un estudio de caso del municipio de La Unión (Antioquia, cuyas tasas de suicidio han sido bastante elevadas durante ese período, encima de 20 sobre cien mil habitantes, mientras las tasas nacionales oscilan entre 4 y 5. Metodología: se utilizaron estrategias metodológicas cualitativas y cuantitativas a fin de realizar lecturas integrales de la problemática (datos estadísticos del suicidio en los años 1990-2000, encuestas, entrevistas y etnografía. Se privilegia el análisis sociológico, de entender el suicidio como fenómeno colectivo que depende de ciertas condiciones sociales y apropiaciones subjetivas. Resultados y discusión: se obtuvieron las siguientes dimensiones sociales que caracterizan el fenómeno estudiado: (a intensificación del modelo neoliberal que devastó la economía campesina local; (b agudización del conflicto armado que desestructuró la vida social; (c vulnerabilidad de los jóvenes campesinos, mayores receptores de las carencias del campo; (d subjetividades de género que inciden en la conducta suicida de manera inversa: más hombres que se suicidan por más mujeres que lo intenta Over the last two decades the problem of suicide among the Colombian peasant farmer population has seen a marked increase. Objective: to explain the social components that contribute to recurring suicidal behavior in certain rural populations though a case study of the La Union (Antioquia municipality, the suicide rates of which have been evidently higher during this period at over 20 in every thousand inhabitants, while the national rate fluctuates between 4 and 5. Methodology: quantitative and qualitative methodological strategies were used with the aim

  15. Homophobic Bullying and Cyberbullying: Study of a Silenced Problem.

    Science.gov (United States)

    Elipe, Paz; de la Oliva Muñoz, María; Del Rey, Rosario

    2018-01-01

    Bullying and cyberbullying have been studied extensively. In lesbian, gay, bisexual, and questioning (LGBQ) students, these phenomena seem to be overrepresented so that, although they share some common elements, homophobic bullying and cyberbullying could be considered as specific phenomena. This study analyzed homophobic bullying and cyberbullying, with the participation of 533 Spanish secondary school students aged from 12 to 20 (M = 14.9, SD = 1.7). The results showed that students identified as non-heterosexual experienced a higher level of being targeted with bullying and cyberbullying, almost one half of them declaring that they had been victimized and more than 20% cybervictimized. Many stated they had suffered both kinds of harassment. In addition, the prevalence of all kinds of bullying was higher among non-heterosexual students. Regression analyses showed that sexual orientation could be considered a risk factor for suffering these aggressions. We discuss results in relation to previous research and look at their practical implications.

  16. "To Kill A Mockingbird": Then and Now--A 35th Anniversary Celebration. Teacher Study Guide.

    Science.gov (United States)

    National Council of Teachers of English, Urbana, IL.

    This study guide offers a different approach, teleconferencing, to new information, ideas, and resources on the film, "To Kill a Mockingbird." Following general information on "then and now," the guide consists of sections entitled: Preparing to Teach TKM: Special Considerations (by Charles Suhor and Larry Bell); Historical…

  17. A case study of butterfly road kills from Anaikatty Hills, Western Ghats, Tamil Nadu, India

    Directory of Open Access Journals (Sweden)

    R. K. Sony

    2015-11-01

    Full Text Available  Anaikatty Hills of the Western Ghats in Tamil Nadu witness the annual spectacle of mass movement of lakhs of butterflies.  The present paper examines the impact of vehicular traffic on this ‘butterfly migration’ through a survey of butterfly mortality along a road stretch in Anaikatty Hills.  A high rate of mortality due to road traffic was observed during the mass movement of butterflies.  One-hundred-and-thirty-five butterfly road kills belonging to three families, nine genera and 12 species were recorded during the study.  The proportion of nymphalid butterflies among the road kills (70% was very high compared to their respective share in the background population (39%, indicating a higher road mortality risk for nymphalids.  The conservation significance of the road traffic impact on butterfly assemblage and management options are discussed. 

  18. The silence.

    Science.gov (United States)

    Millenson, Michael L

    2003-01-01

    Despite several well-crafted Institute of Medicine (IOM) reports, there remains within health care a persistent refusal to confront providers' responsibility for severe quality problems. There is a silence of deed--failing to take corrective actions--and of word--failing to discuss openly the true consequences of that inertia. These silences distort public policy, delay change, and, by leading (albeit inadvertently) to thousands of patient deaths, undermine professionalism. The IOM quality committee, to retain its moral authority, should forgo issuing more reports and instead lead an emergency corrective-action campaign comparable to Flexner's crusade against charlatan medical schools.

  19. Sounds and silence: An optical topography study of language recognition at birth

    Science.gov (United States)

    Peña, Marcela; Maki, Atsushi; Kovaic, Damir; Dehaene-Lambertz, Ghislaine; Koizumi, Hideaki; Bouquet, Furio; Mehler, Jacques

    2003-09-01

    Does the neonate's brain have left hemisphere (LH) dominance for speech? Twelve full-term neonates participated in an optical topography study designed to assess whether the neonate brain responds specifically to linguistic stimuli. Participants were tested with normal infant-directed speech, with the same utterances played in reverse and without auditory stimulation. We used a 24-channel optical topography device to assess changes in the concentration of total hemoglobin in response to auditory stimulation in 12 areas of the right hemisphere and 12 areas of the LH. We found that LH temporal areas showed significantly more activation when infants were exposed to normal speech than to backward speech or silence. We conclude that neonates are born with an LH superiority to process specific properties of speech.

  20. The Killing

    DEFF Research Database (Denmark)

    Agger, Gunhild

    2013-01-01

    This article tracks the uncanny locations of The Killing (2007–2012), relating them to place, space and atmosphere, putting bits and pieces from the topographic puzzle together with cues from the symbolic space in order to see how they fit into the overall pattern of Nordic Noir. In The Killing......, the abstract level of space and atmosphere meets the concrete level of place, both influencing the notion of location. This meeting, I suggest, has contributed towards the simultaneous domestic and international appeal of The Killing....

  1. The dynamics and efficacy of antiviral RNA silencing: A model study

    Directory of Open Access Journals (Sweden)

    Hogeweg Paulien

    2008-03-01

    Full Text Available Abstract Background Mathematical modeling is important to provide insight in the complicated pathway of RNA silencing. RNA silencing is an RNA based mechanism that is widely used by eukaryotes to fight viruses, and to control gene expression. Results We here present the first mathematical model that combines viral growth with RNA silencing. The model involves a plus-strand RNA virus that replicates through a double-strand RNA intermediate. The model of the RNA silencing pathway consists of cleavage of viral RNA into siRNA by Dicer, target cleavage of viral RNA via the RISC complex, and a secondary response. We found that, depending on the strength of the silencing response, different viral growth patterns can occur. Silencing can decrease viral growth, cause oscillations, or clear the virus completely. Our model can explain various observed phenomena, even when they seem contradictory at first: the diverse responses to the removal of RNA dependent RNA polymerase; different viral growth curves; and the great diversity in observed siRNA ratios. Conclusion The model presented here is an important step in the understanding of the natural functioning of RNA silencing in viral infections.

  2. Killing Range

    Science.gov (United States)

    Asal, Victor; Rethemeyer, R. Karl; Horgan, John

    2015-01-01

    This paper presents an analysis of the Provisional Irish Republican Army's (PIRA) brigade level behavior during the Northern Ireland Conflict (1970-1998) and identifies the organizational factors that impact a brigade's lethality as measured via terrorist attacks. Key independent variables include levels of technical expertise, cadre age, counter-terrorism policies experienced, brigade size, and IED components and delivery methods. We find that technical expertise within a brigade allows for careful IED usage, which significantly minimizes civilian casualties (a specific strategic goal of PIRA) while increasing the ability to kill more high value targets with IEDs. Lethal counter-terrorism events also significantly affect a brigade's likelihood of killing both civilians and high-value targets but in different ways. Killing PIRA members significantly decreases IED fatalities but also significantly decreases the possibility of zero civilian IED-related deaths in a given year. Killing innocent Catholics in a Brigade's county significantly increases total and civilian IED fatalities. Together the results suggest the necessity to analyze dynamic situational variables that impact terrorist group behavior at the sub-unit level. PMID:25838603

  3. Antisense gene silencing

    DEFF Research Database (Denmark)

    Nielsen, Troels T; Nielsen, Jørgen E

    2013-01-01

    Since the first reports that double-stranded RNAs can efficiently silence gene expression in C. elegans, the technology of RNA interference (RNAi) has been intensively exploited as an experimental tool to study gene function. With the subsequent discovery that RNAi could also be applied...

  4. Killing tensors and conformal Killing tensors from conformal Killing vectors

    International Nuclear Information System (INIS)

    Rani, Raffaele; Edgar, S Brian; Barnes, Alan

    2003-01-01

    Koutras has proposed some methods to construct reducible proper conformal Killing tensors and Killing tensors (which are, in general, irreducible) when a pair of orthogonal conformal Killing vectors exist in a given space. We give the completely general result demonstrating that this severe restriction of orthogonality is unnecessary. In addition, we correct and extend some results concerning Killing tensors constructed from a single conformal Killing vector. A number of examples demonstrate that it is possible to construct a much larger class of reducible proper conformal Killing tensors and Killing tensors than permitted by the Koutras algorithms. In particular, by showing that all conformal Killing tensors are reducible in conformally flat spaces, we have a method of constructing all conformal Killing tensors, and hence all the Killing tensors (which will in general be irreducible) of conformally flat spaces using their conformal Killing vectors

  5. Relationship between Organizational Silence and Organizational Citizenship Behavior: A Case Study on Five Stars Hotels in Antalya

    Directory of Open Access Journals (Sweden)

    Arzu Kılıçlar

    2014-03-01

    Full Text Available In this study, it was aimed to determine the relationship between organizational silence and organizational citizenship behavior in accommodation establishments. For this purpose, questionnaire was applied to 392 people working in five-star accommodation establishments in Antalya. T-test, ANOVA and correlation analysis was performed by using the data obtained from the questionnaire. As a result of these analyzes, it was determined that most of the employees remained silent concern of not to be supported by the peo ple when he/she speaks clearly, exposure to ill-treatment and losing his/her job. At the same time, it was detected that employees exhibit courtesy behavior most, sportsmanship behavior least among organizational citizenship behaviors. According to correlation analysis, a weak negative relationship was found between organizational silence and organizational citizenship behavio.

  6. Cancelation and its simulation using Matlab according to active noise control case study of automotive noise silencer

    Science.gov (United States)

    Alfisyahrin; Isranuri, I.

    2018-02-01

    Active Noise Control is a technique to overcome noisy with noise or sound countered with sound in scientific terminology i.e signal countered with signals. This technique can be used to dampen relevant noise in accordance with the wishes of the engineering task and reducing automotive muffler noise to a minimum. Objective of this study is to develop a Active Noise Control which should cancel the noise of automotive Exhaust (Silencer) through Signal Processing Simulation methods. Noise generator of Active Noise Control is to make the opponent signal amplitude and frequency of the automotive noise. The steps are: Firstly, the noise of automotive silencer was measured to characterize the automotive noise that its amplitude and frequency which intended to be expressed. The opposed sound which having similar character with the signal source should be generated by signal function. A comparison between the data which has been completed with simulation calculations Fourier transform field data is data that has been captured on the muffler (noise silencer) Toyota Kijang Capsule assembly 2009. MATLAB is used to simulate how the signal processing noise generated by exhaust (silencer) using FFT. This opponent is inverted phase signal from the signal source 180° conducted by Instruments of Signal Noise Generators. The process of noise cancelation examined through simulation using computer software simulation. The result is obtained that attenuation of sound (noise cancellation) has a difference of 33.7%. This value is obtained from the comparison of the value of the signal source and the signal value of the opponent. So it can be concluded that the noisy signal can be attenuated by 33.7%.

  7. Composite potato plants with transgenic roots on non-transgenic shoots: a model system for studying gene silencing in roots.

    Science.gov (United States)

    Horn, Patricia; Santala, Johanna; Nielsen, Steen Lykke; Hühns, Maja; Broer, Inge; Valkonen, Jari P T

    2014-12-01

    Composite potato plants offer an extremely fast, effective and reliable system for studies on gene functions in roots using antisense or inverted-repeat but not sense constructs for gene inactivation. Composite plants, with transgenic roots on a non-transgenic shoot, can be obtained by shoot explant transformation with Agrobacterium rhizogenes. The aim of this study was to generate composite potato plants (Solanum tuberosum) to be used as a model system in future studies on root-pathogen interactions and gene silencing in the roots. The proportion of transgenic roots among the roots induced was high (80-100%) in the four potato cultivars tested (Albatros, Desirée, Sabina and Saturna). No wild-type adventitious roots were formed at mock inoculation site. All strains of A. rhizogenes tested induced phenotypically normal roots which, however, showed a reduced response to cytokinin as compared with non-transgenic roots. Nevertheless, both types of roots were infected to a similar high rate with the zoospores of Spongospora subterranea, a soilborne potato pathogen. The transgenic roots of composite potato plants expressed significantly higher amounts of β-glucuronidase (GUS) than the roots of a GUS-transgenic potato line event. Silencing of the uidA transgene (GUS) was tested by inducing roots on the GUS-transgenic cv. Albatros event with strains of A. rhizogenes over-expressing either the uidA sense or antisense transcripts, or inverted-repeat or hairpin uidA RNA. The three last mentioned constructs caused 2.5-4.0 fold reduction in the uidA mRNA expression. In contrast, over-expression of uidA resulted in over 3-fold increase in the uidA mRNA and GUS expression, indicating that sense-mediated silencing (co-suppression) was not functional in roots. The results suggest that composite plants offer a useful experimental system for potato research, which has gained little previous attention.

  8. Study of cell killing effect on S180 by ultrasound activating protoporphyrin IX.

    Science.gov (United States)

    Wang, Xiao Bing; Liu, Quan Hong; Wang, Pan; Tang, Wei; Hao, Qiao

    2008-04-01

    The present study was initiated to investigate the potential biological mechanism of cell killing effect on isolate sarcoma 180 (S180) cells induced by ultrasound activating protoporphyrin IX (PPIX). S180 cells were exposed to ultrasound for 30s duration, at a frequency of 2.2 MHz and an acoustic power of 3 W/cm(2) in the presence of 120 microM PPIX. The viability of cells was evaluated using trypan blue staining. The generation of oxygen free radicals in cell suspensions was detected immediately after treatment using a reactive oxygen detection kit. A copper reagent colorimetry method was used to measure the level of FFAs released into cell suspensions by the process of cell damage induced by ultrasound and PPIX treatment. Oxidative stress was assessed by measuring the activities of key antioxidant enzymes (i.e., SOD, CAT, GSH-PX) in S180 tumor cells. Treatment with ultrasound and PPIX together increased the cell damage rate to 50.91%, while treatment with ultrasound alone gave a cell damage rate to 24.24%, and PPIX alone kept this rate unchanged. Colorimetry and enzymatic chemical methods showed that the level of FFAs in cell suspension increased significantly after the treatment, while the activity of all the above enzymes decreased in tumor cells at different levels, and were associated with the generation of oxygen free radicals in cell suspension after treatment. The results indicate that oxygen free radicals may play an important role in improving the membrane lipid peroxidation, degrading membrane phospholipids to release FFAs, and decreasing the activities of the key antioxidant enzymes in cells. This biological mechanism might be involved in mediating the effects on S180 cells and resulting in the cell damage seen with SDT.

  9. Impact of target mRNA structure on siRNA silencing efficiency: A large-scale study.

    Science.gov (United States)

    Gredell, Joseph A; Berger, Angela K; Walton, S Patrick

    2008-07-01

    The selection of active siRNAs is generally based on identifying siRNAs with certain sequence and structural properties. However, the efficiency of RNA interference has also been shown to depend on the structure of the target mRNA, primarily through studies using exogenous transcripts with well-defined secondary structures in the vicinity of the target sequence. While these studies provide a means for examining the impact of target sequence and structure independently, the predicted secondary structures for these transcripts are often not reflective of structures that form in full-length, native mRNAs where interactions can occur between relatively remote segments of the mRNAs. Here, using a combination of experimental results and analysis of a large dataset, we demonstrate that the accessibility of certain local target structures on the mRNA is an important determinant in the gene silencing ability of siRNAs. siRNAs targeting the enhanced green fluorescent protein were chosen using a minimal siRNA selection algorithm followed by classification based on the predicted minimum free energy structures of the target transcripts. Transfection into HeLa and HepG2 cells revealed that siRNAs targeting regions of the mRNA predicted to have unpaired 5'- and 3'-ends resulted in greater gene silencing than regions predicted to have other types of secondary structure. These results were confirmed by analysis of gene silencing data from previously published siRNAs, which showed that mRNA target regions unpaired at either the 5'-end or 3'-end were silenced, on average, approximately 10% more strongly than target regions unpaired in the center or primarily paired throughout. We found this effect to be independent of the structure of the siRNA guide strand. Taken together, these results suggest minimal requirements for nucleation of hybridization between the siRNA guide strand and mRNA and that both mRNA and guide strand structure should be considered when choosing candidate si

  10. The Absence of NOD1 Enhances Killing of Aspergillus fumigatus Through Modulation of Dectin-1 Expression

    Directory of Open Access Journals (Sweden)

    Mark S. Gresnigt

    2017-12-01

    Full Text Available One of the major life-threatening infections for which severely immunocompromised patients are at risk is invasive aspergillosis (IA. Despite the current treatment options, the increasing antifungal resistance and poor outcome highlight the need for novel therapeutic strategies to improve outcome of patients with IA. In the current study, we investigated whether and how the intracellular pattern recognition receptor NOD1 is involved in host defense against Aspergillus fumigatus. When exploring the role of NOD1 in an experimental mouse model, we found that Nod1−/− mice were protected against IA and demonstrated reduced fungal outgrowth in the lungs. We found that macrophages derived from bone marrow of Nod1−/− mice were more efficiently inducing reactive oxygen species and cytokines in response to Aspergillus. Most strikingly, these cells were highly potent in killing A. fumigatus compared with wild-type cells. In line, human macrophages in which NOD1 was silenced demonstrated augmented Aspergillus killing and NOD1 stimulation decreased fungal killing. The differentially altered killing capacity of NOD1 silencing versus NOD1 activation was associated with alterations in dectin-1 expression, with activation of NOD1 reducing dectin-1 expression. Furthermore, we were able to demonstrate that Nod1−/− mice have elevated dectin-1 expression in the lung and bone marrow, and silencing of NOD1 gene expression in human macrophages increases dectin-1 expression. The enhanced dectin-1 expression may be the mechanism of enhanced fungal killing of Nod1−/− cells and human cells in which NOD1 was silenced, since blockade of dectin-1 reversed the augmented killing in these cells. Collectively, our data demonstrate that NOD1 receptor plays an inhibitory role in the host defense against Aspergillus. This provides a rationale to develop novel immunotherapeutic strategies for treatment of aspergillosis that target the NOD1 receptor, to enhance the

  11. Single cell low dose studies of bystander cell killing with targeted ultrasoft x-rays

    International Nuclear Information System (INIS)

    Schettino, G.; Prise, K.M.; Folkard, M.; Vojnovic, B.; Michael, B.D.; Wu, L.; Held, K.D.

    2003-01-01

    Full text: Bystander responses have attracted considerable interest in the recent years and several investigations have reported a binary behavior with the effect triggered by very small doses and immediately reaching a plateau. The Ultrasoft X-ray Microprobe in operation at the GCI is a facility designed to precisely assess the biological response of individual cells in vitro irradiated with a sub-micron size X-ray beam . Although recent improvements have upgrade the facility with AlK and TiK X-rays, most of the bystander studies have been performed using CK X-rays of 278 eV. The high sensitivity and the accurate irradiation and revisiting of the individual samples allowed us to investigate specific characteristics of the bystander phenomenon. In particular, evidences of a dose dependency of cell killing by bystander effect have been found at doses below 0.2 Gy where no differences is observed between all cell and single cell irradiation. Recent improvements have also allowed us to individually identify the phase of the cell cycle of all samples exposed. Although the G2-S phase have been found the most sensitive in responding to the bystander signal (a factor of 1.3), cells in the G1 phase also respond significantly while the phase of the irradiated cell doesn't seem to play a critical role. The time scale of the bystander effect has also been investigated by irradiating the same sample(s) twice with a few hours gap between exposures. Results indicate that the bystander signal is transmitted within a few minutes from the irradiation as replacing the medium immediately after irradiation does not influence the response, and it doesn't depend on the number of cells irradiated (up to 5). However, after a resting time of a few hours (3 h), the system seems to reset itself and a second irradiation has been shown to trigger a further bystander effect. Finally, by considering the total amount of energy deposited in to the sample population as critical parameter (instead

  12. Studies of killing effect of ionization radiation associated with As2O3 on SHG44 human glioma cells

    International Nuclear Information System (INIS)

    Huang Hui; Liu Fenju; Chen Jian; Ning Ping

    2004-01-01

    Objective: To study the effect of ionization radiation combined with As 2 O 3 on the killing of SHG44 human glioma cells. Methods: The survival rates of SHG44 cells treated with different doses of ionization radiation, As 2 O 3 respectively and radiation associated were determined with As 2 O 3 by MTT assay. The change of cell morphology was observed by confocal laser scanning microscopy. Results: (1) The survival rate of the group treated with ionization radiation combined with As 2 O 3 was significantly lower than that of the group treated with radiation or As 2 O 3 only (P 2 O 3 was significantly lower than that of the group treated with 6 Gy radiation (P 0.05); (3) Cells treated with radiation or As 2 O 3 had a morphological change indicating the apoptosis of SHG44 cells. Conclusion: The killing effect of ionization radiation combined with As 2 O 3 on the SHG44 cells is stronger than that of radiation or As 2 O 3 only. Inducing SHG44 cells' apoptosis may be the mechanism of As 2 O 3 killing effects on SHG44 cells. (authors)

  13. Holocaust and strategic bombing: case studies in the psychology, organization, and technology of mass killing in the twentieth century

    Energy Technology Data Exchange (ETDEWEB)

    Markusen, E.R.

    1986-01-01

    After preliminary discussion of the unprecedented scale of mass killing in the twentieth century, the threat of nuclear war, and the widespread neglect of these issues, the literature on two major types of government sanctioned mass killing is reviewed; genocide, in which a government slaughters its own citizens or subjects, and total war, in which two or more governments slaughter each other's civilian citizens or subjects. This literature review reaches two basic conclusions: (1) there is considerable inconsistency and ambiguity among definitions of genocide and total war; and (2) there is a controversy regarding how distinct or similar the two forms of mass killing actually are. A comparative historical analysis was undertaken in which the Nazi Holocaust was selected as an example of genocide, and the Allied strategic bombing campaigns during World War II were selected to exemplify total war. The two cases are compared in terms of a conceptual framework of five hypothesized facilitating factors. On the basis of this comparative analysis, four or the five hypothesized facilitating factors are found to have played important roles in both cases. The findings of the study are discussed, and their implications for the threat of nuclear holocaust are explored.

  14. Gender Differences in Self-Silencing and Psychological Distress in Informal Cancer Carers

    Science.gov (United States)

    Ussher, Jane M.; Perz, Janette

    2010-01-01

    This study examined gender differences in self-silencing, the relationship between self-silencing and psychological distress, and reasons for self-silencing in informal cancer carers (329 women, 155 men), using a mixed-method design. Men reported greater self-silencing than women on the Silencing the Self Scale; however, women reported higher…

  15. The Analysis of The Phenomenon of Silence in Organizational Investigated in the Context of Personal Characteristics: A Qualitative Study

    Directory of Open Access Journals (Sweden)

    Zeki Uçar

    2016-06-01

    Full Text Available In this study, it is aimed to reveal personal characteristics of employees (depending on psychological and demographic that affect their openly speech and these characteristics in what way effect the silence behavior of employees. In the study was designed as a qualitative research, data were obtained semi structured interviews and focus group techniques. The research sample is consists of fourtyone participants have assignmen at different levels in different organizational structure. The result of research show that in addition to personal characteristics reveal struggle for life style of individuals like “locus of control”, “self-esteem” some demographic characteristics of the individuals like gender, education effect their decisions they have given direction to remain silent.

  16. An efficient viral vector for functional genomic studies of Prunus fruit trees and its induced resistance to Plum pox virus via silencing of a host factor gene.

    Science.gov (United States)

    Cui, Hongguang; Wang, Aiming

    2017-03-01

    RNA silencing is a powerful technology for molecular characterization of gene functions in plants. A commonly used approach to the induction of RNA silencing is through genetic transformation. A potent alternative is to use a modified viral vector for virus-induced gene silencing (VIGS) to degrade RNA molecules sharing similar nucleotide sequence. Unfortunately, genomic studies in many allogamous woody perennials such as peach are severely hindered because they have a long juvenile period and are recalcitrant to genetic transformation. Here, we report the development of a viral vector derived from Prunus necrotic ringspot virus (PNRSV), a widespread fruit tree virus that is endemic in all Prunus fruit production countries and regions in the world. We show that the modified PNRSV vector, harbouring the sense-orientated target gene sequence of 100-200 bp in length in genomic RNA3, could efficiently trigger the silencing of a transgene or an endogenous gene in the model plant Nicotiana benthamiana. We further demonstrate that the PNRSV-based vector could be manipulated to silence endogenous genes in peach such as eukaryotic translation initiation factor 4E isoform (eIF(iso)4E), a host factor of many potyviruses including Plum pox virus (PPV). Moreover, the eIF(iso)4E-knocked down peach plants were resistant to PPV. This work opens a potential avenue for the control of virus diseases in perennial trees via viral vector-mediated silencing of host factors, and the PNRSV vector may serve as a powerful molecular tool for functional genomic studies of Prunus fruit trees. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  17. Fresh Kills leachate treatment and minimization study. Volume 1, Characteristics and treatment alternatives: Final report

    Energy Technology Data Exchange (ETDEWEB)

    Fillos, J.; Khanbilvardi, R.

    1993-09-01

    The New York City Department of Sanitation is developing a comprehensive landfill leachate management plan for the Fresh Kills Landfill. The leachate was first analyzed for conventional and priority pollutants. The leachate was well buffered at pH 7 to 8 with an alkalinity of 5,000 to 6,000 mg/L. The BOD was low, usually less than 100 mg/L, but the COD was as high as 1,800 mg/L. Ammonia concentrations were around 700 mg/L and the color resembled strong tea at 3,000 colorimetric units. Only few of the priority pollutants were present, and at extremely low concentrations. Based on the chemical characteristics of the leachate, the primary environmental impact would be on the oxygen balance of the receiving surface waters.

  18. Transcriptional Silencing of Retroviral Vectors

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M.; Pedersen, F.S.

    1996-01-01

    . Extinction of long-term vector expression has been observed after implantation of transduced hematopoietic cells as well as fibroblasts, myoblasts and hepatocytes. Here we review the influence of vector structure, integration site and cell type on transcriptional silencing. While down-regulation of proviral...... transcription is known from a number of cellular and animal models, major insight has been gained from studies in the germ line and embryonal cells of the mouse. Key elements for the transfer and expression of retroviral vectors, such as the viral transcriptional enhancer and the binding site for the t......RNA primer for reverse transcription may have a major influence on transcriptional silencing. Alterations of these elements of the vector backbone as well as the use of internal promoter elements from housekeeping genes may contribute to reduce transcriptional silencing. The use of cell culture and animal...

  19. Fresh Kills leachate treatment and minimization study: Volume 2, Modeling, monitoring and evaluation. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Fillos, J.; Khanbilvardi, R.

    1993-09-01

    The New York City Department of Sanitation is developing a comprehensive landfill leachate management plan for the Fresh Kills landfill, located on the western shore of Staten Island, New York. The 3000-acre facility, owned and operated by the City of New York, has been developed into four distinct mounds that correspond to areas designated as Sections 1/9, 2/8, 3/4 and 6/7. In developing a comprehensive leachate management plan, the estimating leachate flow rates is important in designing appropriate treatment alternatives to reduce the offsite migration that pollutes both surface water and groundwater resources.Estimating the leachate flow rates from Sections 1/9 and 6/7 was given priority using an available model, hydrologic evaluation of landfill performance (HELP), and a new model, flow investigation for landfill leachate (FILL). The field-scale analysis for leachate flow included data collection of the leachate mound-level from piezometers and monitoring wells installed on-site, for six months period. From the leachate mound-head contours and flow-gradients, Leachate flow rates were computed using Darcy`s Law.

  20. Notes on super Killing tensors

    Energy Technology Data Exchange (ETDEWEB)

    Howe, P.S. [Department of Mathematics, King’s College London,The Strand, London WC2R 2LS (United Kingdom); Lindström, University [Department of Physics and Astronomy, Theoretical Physics, Uppsala University,SE-751 20 Uppsala (Sweden); Theoretical Physics, Imperial College London,Prince Consort Road, London SW7 2AZ (United Kingdom)

    2016-03-14

    The notion of a Killing tensor is generalised to a superspace setting. Conserved quantities associated with these are defined for superparticles and Poisson brackets are used to define a supersymmetric version of the even Schouten-Nijenhuis bracket. Superconformal Killing tensors in flat superspaces are studied for spacetime dimensions 3,4,5,6 and 10. These tensors are also presented in analytic superspaces and super-twistor spaces for 3,4 and 6 dimensions. Algebraic structures associated with superconformal Killing tensors are also briefly discussed.

  1. Gray Wolf (Canis lupus) movements and behavior around a kill site and implications for GPS collar studies

    Science.gov (United States)

    Mech, L. David

    2011-01-01

    Global Positioning System (GPS) radio-collars are increasingly used to estimate Gray Wolf (Canis lupus) kill rates. In interpreting results from this technology, researchers make various assumptions about wolf behavior around kills, yet no detailed description of this behavior has been published. This article describes the behavior of six wolves in an area of constant daylight during 30 hours, from when the pack killed a Muskox (Ovibos moschatus) calf and yearling on Ellesmere Island, Nunavut, Canada, to when they abandoned the kill remains. Although this is only a single incident, it demonstrates one possible scenario of pack behavior around a kill. Combined with the literature, this observation supports placing a radio-collar on the breeding male to maximize finding kills via GPS collars and qualifying results depending on whatever other information is available about the collared wolf's pack.

  2. Mutuality, Self-Silencing, and Disordered Eating in College Women

    Science.gov (United States)

    Wechsler, Lisa S.; Riggs, Shelley A.; Stabb, Sally D.; Marshall, David M.

    2006-01-01

    The current study examined patterns of association among mutuality, self-silencing, and disordered eating in an ethnically diverse sample of college women (N = 149). Partner mutuality and overall self-silencing were negatively correlated and together were associated with six disordered eating indices. All four self-silencing subscales were…

  3. Phantom metrics with Killing spinors

    Directory of Open Access Journals (Sweden)

    W.A. Sabra

    2015-11-01

    Full Text Available We study metric solutions of Einstein–anti-Maxwell theory admitting Killing spinors. The analogue of the IWP metric which admits a space-like Killing vector is found and is expressed in terms of a complex function satisfying the wave equation in flat (2+1-dimensional space–time. As examples, electric and magnetic Kasner spaces are constructed by allowing the solution to depend only on the time coordinate. Euclidean solutions are also presented.

  4. Time-kill studies of the antianaerobe activity of garenoxacin compared with those of nine other agents.

    Science.gov (United States)

    Credito, Kim L; Jacobs, Michael R; Appelbaum, Peter C

    2003-04-01

    The activities of garenoxacin, ciprofloxacin, levofloxacin, moxifloxacin, trovafloxacin, amoxicillin-clavulanate, piperacillin-tazobactam, imipenem, clindamycin, and metronidazole against 20 anaerobes were tested. At two times the MIC, garenoxacin was bactericidal against 19 of 20 strains after 48 h and against 17 of 20 after 24 h. Other drugs, except clindamycin (which gave lower killing rates), gave killing rates similar to those for garenoxacin.

  5. Silencing criticism in Mexico

    Directory of Open Access Journals (Sweden)

    Ximena Suárez

    2017-10-01

    Full Text Available Journalists and human rights defenders in Mexico are being attacked in an attempt to silence their criticism. Many are forced to flee or risk being assassinated. The consequences are both personal and of wider social significance.

  6. Ombuds’ corner: Employee silence

    CERN Multimedia

    Vincent Vuillemin

    2013-01-01

    Although around a hundred cases a year are reported to the Ombuds, several issues may still not be disclosed due to employee silence*. The deliberate withholding of concerns, escalating misunderstandings or genuine conflicts can impede the global process of learning and development of a better respectful organizational workplace environment, and prevent the detection and correction of acts violating the CERN Code of Conduct.   For the employee him/herself, such silence can lead to feelings of anger, resentment, helplessness and humiliation. These feelings will inevitably contaminate personal and interpersonal relations, and poison creativity and effectiveness. Employee silence can be explained by many factors; sometimes it is connected to organizational forces. In their published paper*, authors Michael Knoll and Rolf van Dick found four forms of employee silence. People may stay silent if they feel that their opinion is neither welcomed nor valued by their management. They have gi...

  7. News Media Framing of Preventable Crisis Clusters. Case Study: Newborn Babies Killed in the Fire at a Romanian Hospital

    Directory of Open Access Journals (Sweden)

    Camelia CMECIU

    2015-02-01

    Full Text Available In crisis situations, public or private organi-zations become vulnerable. When organizations adopt the silence strategy, the public seeks in-formation in the news media which may induce the attribution of crisis responsibility. The crisis managers should check the news media framing of the (organizational and/or individual respon-sibility level, the news practices of daily and tabloid press and the journalists’ use of the cri-sis issues and news frames of the situation. Our study will focus on one of the greatest tragedies in Romania, the newborn babies’ death during the 2010 fre at the Giuleşti Maternity Hospital in Bucharest. The comparative analysis focuses on the news media coverage of this crisis in the online versions of four national newspapers with the largest circulation. The content analysis high-lights the crisis news frames and issues in Roma-nian daily and tabloid newspapers. The fndings suggest that, despite the same salience of crisis frames (attribution of responsibility, human inter-est, economic consequences, confict, morality, the sensationalist and sober news stories differ in three ways: the assigning of the level of re-sponsibility, the crisis issues associated with the fve frames, and the coverage of the micro and macro-relations established between the organi-zations during the crisis situation.

  8. Virus-induced gene silencing (VIGS) as a reverse genetic tool to study development of symbiotic root nodules

    DEFF Research Database (Denmark)

    Kjær, Gabriela Didina Constantin; Grønlund, Mette; Stougaard, Jens

    2008-01-01

    Virus-induced gene silencing (VIGS) can provide a shortcut to plants with altered expression of specific genes. Here, we report that VIGS of the Nodule inception gene (Nin) can alter the nodulation phenotype and Nin gene expression in Pisum sativum. PsNin was chosen as target because of the disti...

  9. His Trail of Silence: A Case Study in Reaching a Child Who Refused To Speak.

    Science.gov (United States)

    Van Antwerp, Kathleen

    1999-01-01

    Discusses selective mutism, a childhood disorder characterized by persistent failure to speak in specific social situations. Details a case study of one boy from kindergarten until treatment was received in 8th grade. Discusses techniques used in the communication process between the boy and his counselor. (Author/JDM)

  10. Struggling in Silence: A Qualitative Study of Six African American Male Stutterers in Educational Settings

    Science.gov (United States)

    Ellis, Antonio L.; Hartlep, Nicholas D.

    2017-01-01

    Stuttering places students at-risk for being stereotyped and experiencing identity difficulties in school. This study hoped to fill a lacuna in the literature on the educational experiences of African American male stutterers. Six African American adult males who stuttered and lived in Washington, DC; Maryland; and/or Virginia participated in this…

  11. Between Silence and Salience. A Multimethod Model to Study Frame Building from a Journalistic Perspective

    NARCIS (Netherlands)

    Boesman, J.L.J.; Van Gorp, B.; d'Haenens, L.

    2016-01-01

    Research into frame building, which aims to investigate the development of news framing in the journalistic realm, is on the rise. While most frame-building studies focus on the relative contribution of journalists or sources to news frames, this article presents and evaluates an integrated

  12. Comparative nucleic acid transfection efficacy in primary hepatocytes for gene silencing and functional studies

    Directory of Open Access Journals (Sweden)

    Morral Núria

    2011-01-01

    Full Text Available Abstract Background Primary hepatocytes are the best resource for in vitro studies directed at understanding hepatic processes at the cellular and molecular levels, necessary for novel drug development to treat highly prevalent diseases such as non-alcoholic steatohepatitis, cardiovascular disease and type 2 diabetes. There is a need to identify simple methods to genetically manipulate primary hepatocytes and conduct functional studies with plasmids, small interfering RNA (siRNA or microRNA (miRNA. New lipofection reagents are available that have the potential to yield higher levels of transfection with reduced toxicity. Findings We have tested several liposome-based transfection reagents used in molecular biology research. We show that transfection efficiency with one of the most recently developed formulations, Metafectene Pro, is high with plasmid DNA (>45% cells as well as double stranded RNA (>90% with siRNA or microRNA. In addition, negligible cytotoxicity was present with all of these nucleic acids, even if cells were incubated with the DNA:lipid complex for 16 hours. To provide the proof of concept that these conditions can be used not only for overexpression of a gene of interest, but also in RNA interference applications, we targeted two liver expressed genes, Sterol Regulatory Element-Binding Protein-1 and Fatty Acid Binding Protein 5 using plasmid-mediated short hairpin RNA expression. In addition, similar transfection conditions were used to optimally deliver siRNA and microRNA. Conclusions We have identified a lipid-based reagent for primary hepatocyte transfection of nucleic acids currently used in molecular biology laboratories. The conditions described here can be used to expedite a large variety of research applications, from gene function studies to microRNA target identification.

  13. "Should We Kill the Grey Squirrels?" A Study Exploring Students' Justifications and Decision-Making

    Science.gov (United States)

    Evagorou, Maria; Jimenez-Aleixandre, Maria Pilar; Osborne, Jonathan

    2012-01-01

    A problem that is still unexplored in the field of socioscientific issues (SSI) and that was explored in this study is how different students decide upon a SSI they are discussing, how their justifications change during the instruction and how they use (or not) the evidence from the learning environment to support their justifications. For the…

  14. A Study of the Relationship between Organizational Identity and Organizational Silence among Employees of the University of Isfahan

    OpenAIRE

    Ali Nasr Isfahani; Tahereh Aghababapoor Dehkordi

    2014-01-01

    Introduction As a competitive advantage in organizations, identity has become significant in recent years. It is a unique quality that distinguishes one person from others and is communicated through appearance, behavior and values of the person; the concept can be equally applied for an organization as well. Positive identity can help an organization to prevent a phenomenon which is called isolation of internal staff or organizational silence, that is, refraining from expressing ideas and...

  15. Studi Resepsi Mahasiswa Broadcasting Universitas Mercu Buana Pada Film Journalism “Kill The Messenger”

    Directory of Open Access Journals (Sweden)

    Ahmad Toni

    2017-12-01

    Full Text Available This study seeks to reveal receptions university student broadcasting beacon globe on film journalism. The purpose of this study to determine the meaning construction contents journalism-themed films through the movie shows them. The relations of meaning to the theme of movies they watch give you an idea about their opinions on the meanings contained in the movie scene. This study uses analysis reception Stuart Hall stated on the three main elements of meaning that is, the dominant meaning, the opposition of meaning and significance negotiations conducted by the subject studied. Construction of meaning built by the subject of research conducted with data triangulation technique, namely written questionnaires, interviews and discussions after watching the film so we get a more comprehensive picture of signification. The results showed that there are different meanings in one scene to scene ten dominated the meaning opposition to the meanings that awakened nature did the film. Next is the meaning of meaning on meaning construction negotiations in the tenth scene. Meaning become dominant meaning that does not give meaning to the subject of study of journalism movie theme. Penelitian ini berupaya untuk mengungkapkan resepsi mahasiswa broadcasting universitas mercu buana pada film jurnalistik, tujuan penelitian ini untuk mengetahui konstruksi makna isi film bertema journalism melalui tayangan film yang ditonton mereka, relasi pemaknaan dengan tema film yang mereka tonton memberikan gambaran tentang pendapat mereka pada makna-makna yang terdapat di dalam scene film. Penelitian ini menggunakan metode analisis resepsi Stuart Hall yang dinyatakan pada tiga elemen utama pemaknaan yakni, dominan makna, oposisi makna dan negosiasi makna yang dilakukan oleh subjek yang diteliti, konstruksi makna yang dibangun oleh subjek penelitian dilakukan dengan teknik triangulasi data, yakni daftar pertanyaan tertulis, wawancara dan diskusi setelah menonton film sehingga

  16. [Studies on calf salmonellosis. 4. Oral and parenteral immunization with live (Smd) and killed antigens].

    Science.gov (United States)

    Meyer, H; Steinbach, G; Hartmann, H; Hauke, H; Koch, H; Stelzner, A; Linde, K; Schmerbauch, A; Kiupel, H

    1977-01-01

    Reported are results obtained from studies into oral and parenteral immunisation of calf. The approaches had included the use of live (Smd) or dead antigen from Salmonella (S.) dublin and a combination of the two immunisation methods. Live antigen (Smd) was superior to thermally activated dead antigen, when the oral route was used to prevent S.-dublin injection of calves. The above findings were supported by results from analogous studies in which S. typhimurium and S. dublin or live antigen (Smd) or dead antigen, made of the two, had been applied to mice. (One single subcutaneous) parenteral administration did hardly reveal any difference in favour of live vaccine (Smd). Parenteral administration of live or dead antigen proved to be less effective than repeated oral immunisation, particularly when live vaccine (Smd) was used. Immunity not less than up to six months of age against S. dublin wild strain infection can be provided for young calves by oral immunisation, with Smd vaccine (5. 1010 to 1. 1011 live germs/d) being given on ten consecutive days. Calves orally immunised with live antigen (ten repetitive applications of Smd mutants) are likely to develop an antibody titre (H-agglutinins) against S. dublin. Parenteral boostering,using live antigen, has been accompanied by sensitisation due to oral live antigen administration as well as by dose dependence, as was seen from the bactericidal values. Sensitisation was established from orally immunised calves up to three months old (typical booster reaction). Some of it was attributabale to confrontation with wild strains of Salmonella. The H-agglutinin titres of animals aged threemonths in a calf herd with salmonelloses in which all animals had been orally Smd-immunised were close to those recorded from calves in stocks with no salmonellosis occurrence. Under the conditions of oral immunisation, there had obviously been no action of the wild strain which might have triggered intensive antibody formation.

  17. Efficacy of cleansing agents in killing microorganisms in mixed species biofilms present on silicone facial prostheses-an in vitro study

    NARCIS (Netherlands)

    Ariani, Nina; Visser, Anita; Teulings, Margot R. I. M.; Dijk, Melissa; Rahardjo, Tri Budi W.; Vissink, Arjan; van der Mei, Henny C.

    2015-01-01

    The purpose of this study was to assess the efficacy of different cleansing agents in killing mixed species biofilms on silicone facial prostheses. Two bacterial and three yeast strains, isolated from silicone facial prostheses, were selected for the mixed species biofilms. A variety of agents used

  18. Cloning, killing, and identity.

    Science.gov (United States)

    McMahan, J

    1999-01-01

    One potentially valuable use of cloning is to provide a source of tissues or organs for transplantation. The most important objection to this use of cloning is that a human clone would be the sort of entity that it would be seriously wrong to kill. I argue that entities of the sort that you and I essentially are do not begin to exist until around the seventh month of fetal gestation. Therefore to kill a clone prior to that would not be to kill someone like you or me but would be only to prevent one of us from existing. And even after one of us begins to exist, the objections to killing it remain comparatively weak until its psychological capacities reach a certain level of maturation. These claims support the permissibility of killing a clone during the early stages of its development in order to use its organs for transplantation. PMID:10226909

  19. Silêncios Silences

    Directory of Open Access Journals (Sweden)

    Luciano Marcondes Godoy

    1999-01-01

    Full Text Available Muitas são as vivências que se expressarão em SILÊNCIOS. Muitos são os silêncios. No Bloco A, o silêncio denuncia a retirada para um outro mundo, a queda num abismo. No bloco B, o silêncio é controlador, exigindo a fala do analista, um jogo em que o que é falado não tem a menor importância. Surge ainda como expressão da necessidade de discriminar-se do analista e, na sua evolução, como um enfrentamento a um estado sem sentido. No Bloco C, o silêncio é agressivo, e a sobrevivência do analisando e analista ao mesmo criará um espaço que propiciará sonhos que surgirão no Bloco D. Esses momentos de silêncio-sonho são situações em que não há discriminação eu-não eu.Many are the experiences which are expressed through silences. Many are the silences. In Block A, silence denounces a pretreatment to another world, a fall into an abysm. In Block B, silence is a controlling factor, demanding the words of the analyst, a game where what is said does not have any importance what so ever. It emerges also as an expression of the analyst's necessity to discriminate himself, and within his evolution the revision of a senseless state. In Block C, the silence is aggressive. As a response, the survival of the patient and of the analyst will create a place in which dreams will come up. Block D analyses these moments of dream-silence situations, where there aren't any forms of self-non self discrimination.

  20. Titration and hysteresis in epigenetic chromatin silencing

    International Nuclear Information System (INIS)

    Dayarian, Adel; Sengupta, Anirvan M

    2013-01-01

    Epigenetic mechanisms of silencing via heritable chromatin modifications play a major role in gene regulation and cell fate specification. We consider a model of epigenetic chromatin silencing in budding yeast and study the bifurcation diagram and characterize the bistable and the monostable regimes. The main focus of this paper is to examine how the perturbations altering the activity of histone modifying enzymes affect the epigenetic states. We analyze the implications of having the total number of silencing proteins, given by the sum of proteins bound to the nucleosomes and the ones available in the ambient, to be constant. This constraint couples different regions of chromatin through the shared reservoir of ambient silencing proteins. We show that the response of the system to perturbations depends dramatically on the titration effect caused by the above constraint. In particular, for a certain range of overall abundance of silencing proteins, the hysteresis loop changes qualitatively with certain jump replaced by continuous merger of different states. In addition, we find a nonmonotonic dependence of gene expression on the rate of histone deacetylation activity of Sir2. We discuss how these qualitative predictions of our model could be compared with experimental studies of the yeast system under anti-silencing drugs. (paper)

  1. Spermatogonial cell killing by radiolabeled methionine: a comparative study of the effects of Se-17, S-35, and H-3

    International Nuclear Information System (INIS)

    Rao, D.V.; Govelitz, G.F.; Sastry, K.S.R.; Howell, R.W.

    1986-01-01

    Spermatogenesis in the testes of mice offers an effective experimental model to investigate the biological effects and the dosimetry of Auger electron emitters in vivo, aspects that are not yet well understood. Killing of the radiosensitive spermatogonia by intratesticularly localized radionuclides is the biological effect of interest, manifesting as reduced sperm-head population four to six weeks after the initial administration of the radionuclides. The authors present here results of a comparative study of the effects of the Auger-emitter, 75 Se, and the beta-emitters, 35 S and 3 H, when these radionuclides are attached to methionine, and hence distributed similarly in the testis and in the cytoplasmic protein fractions of the spermatogonial cells. The sperm-head survival is assayed on the 36th day post-injection, when the sperm-head population reaches its minimum after the initial intratesticular administration of the radionuclides. In all the three cases, the survival fractions display similar dependence on the conventionally calculated average dose to the organ. These results show the adequacy of conventional dosimetry when 75 Se is localized in the cytoplasm of the cells, and emphasize the relative inefficiency of Auger electrons emitted from cytoplasmic decay sites in irradiating the radiosensitive DNA in the cells. 21 references, 4 figures, 4 tables

  2. Memories Persist in Silence

    Directory of Open Access Journals (Sweden)

    Sandra Patricia Arenas Grisales

    2012-08-01

    Full Text Available This article exposes the hypothesis that memory artifacts, created to commemorate the victims of armed conflict in Colombia, are an expression of the underground memories and a way of political action in the midst of war. We analyze three cases of creations of memory artifacts in Medellín, Colombia, as forms of suffering, perceiving and resisting the power of armed groups in Medellín. The silence, inherent in these objects, should not be treated as an absence of language, but as another form of expression of memory. Silence is a tactic used to overcome losses and reset everyday life in contexts of protracted violence.

  3. Timelike Killing spinors in seven dimensions

    International Nuclear Information System (INIS)

    Cariglia, Marco; Conamhna, Oisin A.P. Mac

    2004-01-01

    We employ the G-structure formalism to study supersymmetric solutions of minimal and SU(2) gauged supergravities in seven dimensions admitting Killing spinors with an associated timelike Killing vector. The most general such Killing spinor defines a SU(3) structure. We deduce necessary and sufficient conditions for the existence of a timelike Killing spinor on the bosonic fields of the theories, and find that such configurations generically preserve one out of 16 supersymmetries. Using our general supersymmetric ansatz we obtain numerous new solutions, including squashed or deformed anti-de Sitter solutions of the gauged theory, and a large class of Goedel-like solutions with closed timelike curves

  4. Evaluation of Honour Killings in Turkey

    OpenAIRE

    Celbis, Osman; Ozdemir, Bora; Oruc, Mucahit; Dogan, Mustafa; Egri, Mucahit

    2013-01-01

    Honour killings are still pervasive in many societies.  The aim of this study is to reveal the characteristics of the victims of honour killings and honour killers in Malatya province between 2000 and 2004, and to review the concept of honour killings in Turkey.  Data are collected from the records of Malatya Higher Criminal Court.  The results are discussed in the light of the data obtained from Turkish Republic Ministry of Justice.  There were 36 honour killings in Malatya between 2000 and ...

  5. Conifers have a unique small RNA silencing signature

    OpenAIRE

    Dolgosheina, Elena V.; Morin, Ryan D.; Aksay, Gozde; Sahinalp, S. Cenk; Magrini, Vincent; Mardis, Elaine R.; Mattsson, Jim; Unrau, Peter J.

    2008-01-01

    Plants produce small RNAs to negatively regulate genes, viral nucleic acids, and repetitive elements at either the transcriptional or post-transcriptional level in a process that is referred to as RNA silencing. While RNA silencing has been extensively studied across the different phyla of the animal kingdom (e.g., mouse, fly, worm), similar studies in the plant kingdom have focused primarily on angiosperms, thus limiting evolutionary studies of RNA silencing in plants. Here we report on an u...

  6. The Gift of Silence

    Science.gov (United States)

    Haskins, Cathleen

    2011-01-01

    Slowing down, quieting the mind and body, and experiencing silence nourishes the spirit. Montessori educators are mandated to cultivate not just the intellect but the whole child. They recognize that nurturing the spirit of the child is part of what makes this form of education work so well. This article discusses the benefits of stillness and…

  7. Breaking the silence

    DEFF Research Database (Denmark)

    Konradsen, Hanne; Kirkevold, Marit; McCallin, Antoinette

    2012-01-01

    and individual interviews were analyzed using the grounded theory method. The findings revealed that the main concern of the patients was feeling isolated, which was resolved using a process of interactional integration. Interactional integration begins by breaking the silence to enable the progression from...

  8. Silence of the Genes

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 12; Issue 4. Silence of the Genes - 2006 Nobel Prize in Physiology or Medicine. Utpal Nath Saumitra Das. General Article Volume 12 Issue 4 April 2007 pp 6-18. Fulltext. Click here to view fulltext PDF. Permanent link:

  9. Targeted transfection increases siRNA uptake and gene silencing of primary endothelial cells in vitro--a quantitative study.

    Science.gov (United States)

    Asgeirsdóttir, Sigridur A; Talman, Eduard G; de Graaf, Inge A; Kamps, Jan A A M; Satchell, Simon C; Mathieson, Peter W; Ruiters, Marcel H J; Molema, Grietje

    2010-01-25

    Applications of small-interfering RNA (siRNA) call for specific and efficient delivery of siRNA into particular cell types. We developed a novel, non-viral targeting system to deliver siRNA specifically into inflammation-activated endothelial cells. This was achieved by conjugating the cationic amphiphilic lipid SAINT to antibodies recognizing the inflammatory cell adhesion molecule E-selectin. These anti-E-selectin-SAINT lipoplexes (SAINTarg) maintained antigen recognition capacity of the parental antibody in vitro, and ex vivo in human kidney tissue slices subjected to inflammatory conditions. Regular SAINT mediated transfection resulted in efficient gene silencing in human microvascular endothelial cells (HMEC-1) and conditionally immortalized glomerular endothelial cells (ciGEnC). However, primary human umbilical vein endothelial cells (HUVEC) transfected poorly, a phenomenon that we could quantitatively correlate with a cell-type specific capacity to facilitate siRNA uptake. Importantly, SAINTarg increased siRNA uptake and transfection specificity for activated endothelial cells. Transfection with SAINTarg delivered significantly more siRNA into activated HUVEC, compared to transfection with non-targeted SAINT. The enhanced uptake of siRNA was corroborated by improved silencing of both gene- and protein expression of VE-cadherin in activated HUVEC, indicating that SAINTarg delivered functionally active siRNA into endothelial cells. The obtained results demonstrate a successful design of a small nucleotide carrier system with improved and specific siRNA delivery into otherwise difficult-to-transfect primary endothelial cells, which in addition reduced considerably the amount of siRNA needed for gene silencing. Copyright 2009 Elsevier B.V. All rights reserved.

  10. Nonmarket benefits of reducing environmental effects of potential wildfires in beetle-killed trees: A contingent valuation study

    Science.gov (United States)

    Maryam Tabatabaei; John B. Loomis; Daniel W. McCollum

    2015-01-01

    We estimated Colorado households’ nonmarket values for two forest management options for reducing intensity of future wildfires and associated nonmarket environmental effects wildfires. The first policy is the traditional harvesting of pine beetle-killed trees and burning of the slash piles of residual materials on-site. The second involves harvesting but moving the...

  11. Small interfering RNA-mediated silencing of nicotinamide phosphoribosyltransferase (NAMPT and lysosomal trafficking regulator (LYST induce growth inhibition and apoptosis in human multiple myeloma cells: A preliminary study

    Directory of Open Access Journals (Sweden)

    Ivyna Pau Ni Bong

    2016-11-01

    Full Text Available Multiple myeloma (MM is a malignancy of B lymphocytes or plasma cells. Our array-based comparative genomic hybridization findings revealed chromosomal gains at 7q22.3 and 1q42.3, where nicotinamide (NAM phosphoribosyltransferase (NAMPT and lysosomal trafficking regulator (LYST genes are localized, respectively. This led us to further study the functions of these genes in myeloma cells. NAMPT is a key enzyme involved in nicotinamide adenine dinucleotide salvage pathway, and it is frequently overexpressed in human cancers. In contrast, little is known about the function of LYST in cancer. The expression of LYST is shown to affect lysosomal size, granule size, and autophagy in human cells. In this study, the effects of small interfering RNA (siRNA-mediated silencing of NAMPT and LYST on cell proliferation and apoptosis were evaluated in RPMI 8226 myeloma cells. Transfection efficiencies were determined by quantitative real time reverse transcriptase PCR. Cell proliferation was determined using MTT assay, while apoptosis was analyzed with flow cytometry using Annexin V-fluorescein isothiocyanate/propidium iodide assay. The NAMPT protein expression in siRNA-treated cells was estimated by enzyme-linked immunosorbent assay. Our results showed that NAMPT and LYST were successfully knockdown by siRNA transfection (p < 0.05. NAMPT or LYST gene silencing significantly inhibited cell proliferation and induced apoptosis in RPMI 8226 cells (p < 0.05. Silencing of NAMPT gene also decreased NAMPT protein levels (p < 0.01. Our study demonstrated that NAMPT and LYST play pivotal roles in the molecular pathogenesis of MM. This is the first report describing the possible functions of LYST in myelomagenesis and its potential role as a therapeutic target in MM.

  12. Small interfering RNA-mediated silencing of nicotinamide phosphoribosyltransferase (NAMPT) and lysosomal trafficking regulator (LYST) induce growth inhibition and apoptosis in human multiple myeloma cells: A preliminary study

    Science.gov (United States)

    Bong, Ivyna Pau Ni; Ng, Ching Ching; Fakiruddin, Shaik Kamal; Lim, Moon Nian; Zakaria, Zubaidah

    2016-01-01

    Multiple myeloma (MM) is a malignancy of B lymphocytes or plasma cells. Our array-based comparative genomic hybridization findings revealed chromosomal gains at 7q22.3 and 1q42.3, where nicotinamide (NAM) phosphoribosyltransferase (NAMPT) and lysosomal trafficking regulator (LYST) genes are localized, respectively. This led us to further study the fprotein expression in unctions of these genes in myeloma cells. NAMPT is a key enzyme involved in nicotinamide adenine dinucleotide salvage pathway, and it is frequently overexpressed in human cancers. In contrast, little is known about the function of LYST in cancer. The expression of LYST is shown to affect lysosomal size, granule size, and autophagy in human cells. In this study, the effects of small interfering RNA (siRNA)-mediated silencing of NAMPT and LYST on cell proliferation and apoptosis were evaluated in RPMI 8226 myeloma cells. Transfection efficiencies were determined by quantitative real time reverse transcriptase PCR. Cell proliferation was determined using MTT assay, while apoptosis was analyzed with flow cytometry using Annexin V-fluorescein isothiocyanate/propidium iodide assay. The NAMPT protein expression in siRNA-treated cells was estimated by enzyme-linked immunosorbent assay. Our results showed that NAMPT and LYST were successfully knockdown by siRNA transfection (p < 0.05). NAMPT or LYST gene silencing significantly inhibited cell proliferation and induced apoptosis in RPMI 8226 cells (p < 0.05). Silencing of NAMPT gene also decreased NAMPT protein levels (p < 0.01). Our study demonstrated that NAMPT and LYST play pivotal roles in the molecular pathogenesis of MM. This is the first report describing the possible functions of LYST in myelomagenesis and its potential role as a therapeutic target in MM. PMID:27754828

  13. Hypermetabolism of compensatory laryngeal muscles in unilateral vocal cord palsy: comparison study between speech and silence with normal subjects by co-registered PET-CT fusion images

    International Nuclear Information System (INIS)

    Pai, Moon Sun; Kim, Hyon Kyong; Kim, Han Su; Chung, Sung Min

    2005-01-01

    There are a few case reports on asymmetric vocal cord uptake on FDG-PET in patients with unilateral vocal cord paralysis, which could be a potential pitfall in the interpretation of FDG-PET images. We evaluated the metabolic activity of laryngeal muscles of patients with unilateral vocal cord paralysis in comparison to normal controls during both speech and silence. Eleven patients with iatrogenic unilateral vocal cord palsy(thyroidectomy 7, lung cancer = 1, others = 3) and 12 normal controls underwent FDG-PET with usual protocol. They were divided into two groups respectively; one group read books aloud for 20 minutes (phonation group) and the other kept silence (non-phonation groups) after FDG injection. Recent neck CT scan were co-registered with FDG-PET to produce PET-CT fusion images to elaborate small laryngeal muscles. In patients with unilateral vocal cord palsy, contralateral non-paralyzed vocal cord showed increased FDG uptake, more intense with phonation group (SUV =5.88, n =5) than non-phonation group (SUV =2.33, n =6) --mainly on thyroarytenoid muscle. Normal control subjects showed symmetric mildly increased FDG uptake (SUV=1.92, n=6) only in phonation group, which was significantly low against patient groups and was localized in lateral cricoarytenoid muscle. Hypermetabolism of contralateral thyroarytenoid muscle in patients with unilateral vocal cord paralysis could be encountered during FDG-PET imaging even with keeping silence. Phonation during FDG-PET study enhance FDG uptake on different laryngeal muscles between unilateral vocal cord paralysis and normal subjects

  14. Paired methods to measure biofilm killing and removal: a case study with Penicillin G treatment of Staphylococcus aureus biofilm.

    Science.gov (United States)

    Ausbacher, D; Lorenz, L; Pitts, B; Stewart, P S; Goeres, D M

    2018-03-01

    Biofilms are microbial aggregates that show high tolerance to antibiotic treatments in vitro and in vivo. Killing and removal are both important in biofilm control, therefore methods that measure these two mechanisms were evaluated in a parallel experimental design. Kill was measured using the single tube method (ASTM method E2871) and removal was determined by video microscopy and image analysis using a new treatment flow cell. The advantage of the parallel test design is that both methods used biofilm covered coupons harvested from a CDC biofilm reactor, a well-established and standardized biofilm growth method. The control Staphylococcus aureus biofilms treated with growth medium increased by 0·6 logs during a 3-h contact time. Efficacy testing showed biofilms exposed to 400 μmol l -1 penicillin G decreased by only 0·3 logs. Interestingly, time-lapse confocal scanning laser microscopy revealed that penicillin G treatment dispersed the biofilm despite being an ineffective killing agent. In addition, no biofilm removal was detected when assays were performed in 96-well plates. These results illustrate that biofilm behaviour and impact of treatments can vary substantially when assayed by different methods. Measuring both killing and removal with well-characterized methods will be crucial for the discovery of new anti-biofilm strategies. Biofilms are tolerant to antimicrobial treatments and can lead to persistent infections. Finding new anti-biofilm strategies and understanding their mode-of-action is therefore of high importance. Historically, antimicrobial testing has focused on measuring the decrease in viability. While kill data are undeniably important, measuring biofilm disruption provides equally useful information. Starting with biofilm grown in the same reactor, we paired assessment of biofilm removal using a new treatment-flow-cell and real-time microscopy with kill data collected using the single tube method (ASTM E2871). Pairing these two methods

  15. The Silence of Michelangelo

    DEFF Research Database (Denmark)

    Foote, Jonathan

    2016-01-01

    In one of the many anecdotes about Michelangelo, the master neared completion of his colossal Moses, tapped him on the knee with his hammer and exclaimed,"Perché non parli?" As an act that liberates latent thoughts or material potentials, his cadenced hammer spoke through careful, repetitive, and...... and distractive, instead activate a contemplative place of silence. Perhaps more than merely a tool for removing stone, the hammer was an instrument for sonorous meditation with materials and thinking....

  16. In vitro studies: The role of immunological cells in Indonesian thin tail sheep in the killing of the liver fluke, Fasciola

    Directory of Open Access Journals (Sweden)

    S.E Estuningsih

    2002-06-01

    Full Text Available Previous studies have shown that Indonesian Thin Tail (ET sheep exhibit high resistance to challenge with Fasciola gigantica when compared with Merino sheep, and this resistance is expressed in early infection. In order to study the role of the immune system in this resistance to ET sheep, in vitro studies were undertaken in the laboratory. In vitro study to confirm the ability of immune cells from ET sheep in the killing of F. gigantica larvae has been done by incubating immune cells and F. gigantica larvae together with immune sera or normal sera. The viability of the larvae was observed over a period 3 days incubation by observing their motility. The results showed that the cells isolated from F. gigantica- challenged ET sheep in the presence of immune sera from ET were able to kill 70% of the larvae. In contrast, cells from infected Merino were unable to kill a significant number of F. gigantica using the same sera source. It seems that the cytotoxicity was dependent on the presence of immune sera and ET peritoneal cells, suggesting the potential role of an antibody-dependent cell cytotoxic (ADCC mechanism in the resistant ET sheep.

  17. Silence in the Communication or Communicating through Silence: Silence in Psychoanalysis

    Directory of Open Access Journals (Sweden)

    Rita Marta

    2014-10-01

    Full Text Available This paper is a reflection upon the meaning and importance of silence in the psychoanalytical relationship. Beginning with the silence in the “normal” relationship between people, we show how silence can be experienced as confortable or unconfortable, and how it can be used to achieve a bigger proximity or distance in the relationship with others. We show these same aspects in the psychoanalytical relationship, and the evolution of the regard towards silence along the development of psychoanalysis. We end, presenting the Nacht’s thinking about silence, who emphasizes its integrative and fundamental role in the psychoanalytical relationship. Thus, only through silence certain affects can be born, and silence allows the patient to internalize the analyst.

  18. [E. M. Jellinek's silenced and silencing transgenerational story].

    Science.gov (United States)

    Kelemen, Gábor; Márk, Mónika

    2013-01-01

    Jellinek is a kind of archetypal character for future generations in the field of addiction studies. His implosion in the arena of alcoholism around the age of 50 was an unexpected challenge to medical science. We know very little about his own role models giving an intellectual and moral compass to his pragmatic creativity. More than 30 years has passed since Jellinek's death when an American sociologist Ron Roizen started unearthing his silent story. Roizen discerned that there are a lot of unsaid and muted issues in his personal Hungarian past. Our paper, based on the authors' research in Hungarian archives and other sources reveals that not just Jellinek's personal but his transgenerational narrative has been not-yet-said. This silenced and silencing history appears an unfinished business of acculturation of the family, which started prior to four generations. Authors have been concluding that the issue of religious conversion is a critical point in the process of acculturation. They examine the counter move of loyalty to family values and driving force of assimilation making their story unspeakable.

  19. WOMEN'S RIGHTS VIOLATION: HONOUR KILLINGS

    Directory of Open Access Journals (Sweden)

    CRISTINA OTOVESCU FRASIE

    2011-04-01

    Full Text Available In this study I have presented the domestic violence concept and the situation regarding the observing of woman’s rights in Syria. We have also evidenced the juridical aspects regarding the honor killing directed against women after the modification of the article 548 from the Penal Code changed by the President al-Asad on July the 1st 2009. The data offered by NGOs have been of great help for the elaboration of the study as also the statistic data presented in Thara E-Magazine regarding the cities where had been done the honor killings and their number, the instrument of the murder, the age of the victim, and the motives for the murders. It must be noticed that, lately, the Government fought for the observing of the woman’s rights and promoted he gender equality by appointing women in leading positions, including the vice-president one.

  20. Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing.

    Science.gov (United States)

    Hedil, Marcio; Sterken, Mark G; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard

    2015-01-01

    RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silencing has only been studied to a limited extent. Here, the NSs proteins of TSWV, groundnut ringspot virus (GRSV) and tomato yellow ring virus (TYRV), representatives for three distinct tospovirus species, have been studied on their ability and strength to suppress local and systemic silencing. A system has been developed to quantify suppression of GFP silencing in Nicotiana benthamiana 16C lines, to allow a comparison of relative RNA silencing suppressor strength. It is shown that NSs of all three tospoviruses are suppressors of local and systemic silencing. Unexpectedly, suppression of systemic RNA silencing by NSsTYRV was just as strong as those by NSsTSWV and NSsGRSV, even though NSsTYRV was expressed in lower amounts. Using the system established, a set of selected NSsTSWV gene constructs mutated in predicted RNA binding domains, as well as NSs from TSWV isolates 160 and 171 (resistance breakers of the Tsw resistance gene), were analyzed for their ability to suppress systemic GFP silencing. The results indicate another mode of RNA silencing suppression by NSs that acts further downstream the biogenesis of siRNAs and their sequestration. The findings are discussed in light of the affinity of NSs for small and long dsRNA, and recent mutant screen of NSsTSWV to map domains required for RSS activity and triggering of Tsw-governed resistance.

  1. Organizational Silence in Universities as the Predictor of Organizational Culture

    Directory of Open Access Journals (Sweden)

    Erkan YAMAN

    2014-04-01

    Full Text Available The aim of this study is to determine the relationship between the sense of organizational silence and the organizational culture the instructors perceived. In this study, the scale for determining organizational culture developed by İpek (1999 and the scale for measuring organizational silence developed by Çakıcı (2007 and adapted by Soycan (2010 are used. No remarkable difference was found in the academic staff's sense of organizational silence degree according to their genders and educational backgrounds. It was seen that the instructors' sense of organizational silence had remarkable differences according to their age group, faculty, sense of administration type in their institutions, frequency of their face-to-face communication with their administrators and their thoughts of speaking clearly with their administrators. It was observed that research assistants had a significantly higher sense of organizational silence than the lecturers in the sense of ‘Lack of Experience'. It was seen that academicians who had 1-5 years of employment period had the highest sense of organizational silence while those who had 21 years or more employment period had the lowest sense of organizational silence in the sense of ‘Lack of Experience' of organizational silence. When the points that participant academicians got from organizational silence and organizational culture scales analyzed in the correlation table, it was found out that there was a remarkable relationship between the academicians' sense of organizational silence and sense of organizational culture. This relationship was a medium-level negative relationship between subdimensions of two scales. A medium-level negative relationship between the organizational silence (total and the organizational culture was also seen. Based on the findings, university administrators were proposed to create a participant culture in their institutions as well as to encourage instructors to speak clearly and

  2. Voice and silence in organizations

    Directory of Open Access Journals (Sweden)

    Moaşa, H.

    2011-01-01

    Full Text Available Unlike previous research on voice and silence, this article breaksthe distance between the two and declines to treat them as opposites. Voice and silence are interrelated and intertwined strategic forms ofcommunication which presuppose each other in such a way that the absence of one would minimize completely the other’s presence. Social actors are not voice, or silence. Social actors can have voice or silence, they can do both because they operate at multiple levels and deal with multiple issues at different moments in time.

  3. Study on the killing of oceanic harmful micro-organisms in ship's ballast water using oxygen active particles

    International Nuclear Information System (INIS)

    Chen, C; Meng, X Y; Bai, M D; Tian, Y P; Jing, Y

    2013-01-01

    Global Environment Facility has identified that the spread of marine invasive alien species is one of the four major risk factors threatening the safety of global marine environments. Ballast water discharge is the main cause of biological invasion. With physical methods of strong electric field ionization discharge at atmospheric pressure, O 2 and sea water (gaseous) were ionized, and then dissociated to a number of oxygen active particles (ROS) such as ·OH, O 2 + , H 2 O + , etc. ROS was injected into 0.6 t h −1 ballast water treatment system to form high concentration ROS solution in order to kill the harmful micro-organisms in ballast water. According to the land-based test standard of International Maritime Organization (IMO) Guidelines for Approval of Ballast Water Management Systems (G8), this paper concludes that single-cell algae of 3.0 × 10 4 cell ml −1 and bacteria of 2.0 × 10 4 cfu ml −1 were killed by ROS solution of 2.0 ppm. Death rate could reach almost 100%. The results meet the requirements of Regulation D-2 of International Convention for the Control and Management of Ships' Ballast Water and Sediments completely.

  4. Gendered Communication in Iranian University Classrooms: The Relationship between Politeness and Silence in Persian Culture

    Directory of Open Access Journals (Sweden)

    Saeedeh Shafiee Nahrkhalaji

    2013-05-01

    Full Text Available This study examined naturally-occurring university classroominteractions at Iranian universities and provided an analysis ofsilence patterns as politeness strategies used by male andfemale students. Since empirical studies of silence inclassroom settings are scarce, this paper aimed to explainsuch phenomena using participant interviews, classroomobservation and detailed discourse analysis of classroominteraction. Silence patterns and their interpretations werescrutinized in these observations and were discussed inrelation to specific conceptualization of politeness anddevices employed to exercise it. The study found that femalesseem to be the most silent in the cross-sex classrooms, whilethe distribution of silence is more nearly equal in the same sexclassrooms. Based on the comments from follow-upinterviews, reasons for intentional silence as a politenessstrategy were categorized into four groups: silence as a face savingstrategy, silence as a ‘don’t do the FTA’ strategy,silence as a power strategy, and silence as an off-recordstrategy.

  5. Wind power and bird kills

    International Nuclear Information System (INIS)

    Raynolds, M.

    1998-01-01

    The accidental killing of birds by wind generators, and design improvements in the towers that support the turbines that might cut down on the bird killings were discussed. The first problem for the industry began in the late 1980s when the California Energy Commission reported as many as 160 birds (the majority being raptors, including the protected golden eagle) killed in one year in the vicinity of wind power plants. The key factor identified was the design of the towers as birds of prey are attracted to lattice towers as a place to hunt from. Tubular towers do not provide a place for the birds to perch, therefore they reduce the potential for bird strikes. Bird strikes also have been reported in Spain and the siting of the towers have been considered as the principal cause of the bird strikes. In view of these incidents, the wind power industry is developing standards for studying the potential of bird strikes and is continuing to study bird behaviour leading to collisions, the impact of topography, cumulative impacts and new techniques to reduce bird strikes. Despite the reported incidents, the risk of bird strikes by wind turbines, compared to other threats to birds such as pollution, oil spills, and other threats from fossil and nuclear fuels, is considered to be negligible. With continuing efforts to minimize incidents by proper design and siting, wind power can continue to grow as an environmentally sound and efficient source of energy

  6. Wind power and bird kills

    Energy Technology Data Exchange (ETDEWEB)

    Raynolds, M.

    1998-12-01

    The accidental killing of birds by wind generators, and design improvements in the towers that support the turbines that might cut down on the bird killings were discussed. The first problem for the industry began in the late 1980s when the California Energy Commission reported as many as 160 birds (the majority being raptors, including the protected golden eagle) killed in one year in the vicinity of wind power plants. The key factor identified was the design of the towers as birds of prey are attracted to lattice towers as a place to hunt from. Tubular towers do not provide a place for the birds to perch, therefore they reduce the potential for bird strikes. Bird strikes also have been reported in Spain and the siting of the towers have been considered as the principal cause of the bird strikes. In view of these incidents, the wind power industry is developing standards for studying the potential of bird strikes and is continuing to study bird behaviour leading to collisions, the impact of topography, cumulative impacts and new techniques to reduce bird strikes. Despite the reported incidents, the risk of bird strikes by wind turbines, compared to other threats to birds such as pollution, oil spills, and other threats from fossil and nuclear fuels, is considered to be negligible. With continuing efforts to minimize incidents by proper design and siting, wind power can continue to grow as an environmentally sound and efficient source of energy.

  7. Virus-induced gene silencing in diverse maize lines using the Brome Mosaic virus-based silencing vector

    Science.gov (United States)

    Virus-induced gene silencing (VIGS) is a widely used tool for gene function studies in many plant species, though its use in monocots has been limited. Using a Brome mosaic virus (BMV) vector designed to silence the maize phytoene desaturase gene, a genetically diverse set of maize inbred lines was ...

  8. Bodies, Spaces, Voices, Silences

    Directory of Open Access Journals (Sweden)

    Donatella Mazzoleni

    2013-07-01

    Full Text Available A good architecture should not only allow functional, formal and technical quality for urban spaces, but also let the voice of the city be perceived, listened, enjoyed. Every city has got its specific sound identity, or “ISO” (R. O. Benenzon, made up of a complex texture of background noises and fluctuation of sound figures emerging and disappearing in a game of continuous fadings. For instance, the ISO of Naples is characterized by a spread need of hearing the sound return of one’s/others voices, by a hate of silence. Cities may fall ill: illness from noise, within super-crowded neighbourhoods, or illness from silence, in the forced isolation of peripheries. The proposal of an urban music therapy denotes an unpublished and innovative enlarged interdisciplinary research path, where architecture, music, medicine, psychology, communication science may converge, in order to work for rebalancing spaces and relation life of the urban collectivity, through the care of body and sound dimensions.

  9. Some basic properties of Killing spinors

    International Nuclear Information System (INIS)

    Hacyan, S.; Plebanski, J.

    1976-01-01

    The concept of Killing spinor is analyzed in a general way by using the spinorial formalism. It is shown, among other things, that higher derivatives of Killing spinors can be expressed in terms of lower order derivatives. Conformal Killing vectors are studied in some detail in the light of spinorial analysis: Classical results are formulated in terms of spinors. A theorem on Lie derivatives of Debever--Penrose vectors is proved, and it is shown that conformal motion in vacuum with zero cosmological constant must be homothetic, unless the conformal tensor vanishes or is of type N. Our results are valid for either real or complex space--time manifolds

  10. Organizational Silence in Sports Employees

    Science.gov (United States)

    Bastug, Gulsum; Pala, Adem; Yilmaz, Taner; Duyan, Mehdi; Gunel, Ilker

    2016-01-01

    Organizational silence can be defined as a way of behaviour belonging to men and women employees in the organization exhibited without reflecting their feelings, ideas, concerns and suggestions related with their workplaces, works for which they are responsible or other activities of the organization. In the period of organizational silence,…

  11. Silence, an Eye of Knowledge

    Science.gov (United States)

    Aghamohammadi, Mehdi

    2017-01-01

    One of the conspicuous features of the twentieth-century West was silence. This idea could be supported by examining reflections of Ludwig Wittgenstein, Fritz Mauthner, John Cage, Samuel Beckett, Ihab Hassan, Franz Kafka, Wassily Kandinsky, Jean-Paul Sartre, Virginia Woolf, Wolfgang Iser, Jacques Derrida, and Pierre Macherey. To me, silence is not…

  12. Telomeric trans-silencing: an epigenetic repression combining RNA silencing and heterochromatin formation.

    Directory of Open Access Journals (Sweden)

    Thibaut Josse

    2007-09-01

    Full Text Available The study of P-element repression in Drosophila melanogaster led to the discovery of the telomeric Trans-Silencing Effect (TSE, a repression mechanism by which a transposon or a transgene inserted in subtelomeric heterochromatin (Telomeric Associated Sequence or TAS has the capacity to repress in trans in the female germline, a homologous transposon, or transgene located in euchromatin. TSE shows variegation among egg chambers in ovaries when silencing is incomplete. Here, we report that TSE displays an epigenetic transmission through meiosis, which involves an extrachromosomal maternally transmitted factor. We show that this silencing is highly sensitive to mutations affecting both heterochromatin formation (Su(var205 encoding Heterochromatin Protein 1 and Su(var3-7 and the repeat-associated small interfering RNA (or rasiRNA silencing pathway (aubergine, homeless, armitage, and piwi. In contrast, TSE is not sensitive to mutations affecting r2d2, which is involved in the small interfering RNA (or siRNA silencing pathway, nor is it sensitive to a mutation in loquacious, which is involved in the micro RNA (or miRNA silencing pathway. These results, taken together with the recent discovery of TAS homologous small RNAs associated to PIWI proteins, support the proposition that TSE involves a repeat-associated small interfering RNA pathway linked to heterochromatin formation, which was co-opted by the P element to establish repression of its own transposition after its recent invasion of the D. melanogaster genome. Therefore, the study of TSE provides insight into the genetic properties of a germline-specific small RNA silencing pathway.

  13. Arabidopsis HDA6 regulates locus-directed heterochromatin silencing in cooperation with MET1.

    OpenAIRE

    Taiko Kim To; Jong-Myong Kim; Akihiro Matsui; Yukio Kurihara; Taeko Morosawa; Junko Ishida; Maho Tanaka; Takaho Endo; Tetsuji Kakutani; Tetsuro Toyoda; Hiroshi Kimura; Shigeyuki Yokoyama; Kazuo Shinozaki; Motoaki Seki

    2011-01-01

    Heterochromatin silencing is pivotal for genome stability in eukaryotes. In Arabidopsis, a plant-specific mechanism called RNA–directed DNA methylation (RdDM) is involved in heterochromatin silencing. Histone deacetylase HDA6 has been identified as a component of such machineries; however, its endogenous targets and the silencing mechanisms have not been analyzed globally. In this study, we investigated the silencing mechanism mediated by HDA6. Genome-wide transcript profiling revealed that t...

  14. Hypermetabolism of compensatory laryngeal muscles in unilateral vocal cord palsy: comparison study between speech and silence with normal subjects by co-registered PET-CT fusion images

    International Nuclear Information System (INIS)

    Pai, Moon Sun; Kim, Hyon Kyong; Kim, Han Su

    2006-01-01

    There are a few case report on asymmetric vocal cord uptake on FDG-PET in patients with unilateral vocal cord paralysis, which could be a potential pitfall in the interpretation of FDG-PET images. We evaluated the metabolic activity of laryngeal muscles of patients with unilateral vocal cord paralysis in comparison to normal controls during both speech and silence. Eleven patients with unilateral vocal cord palsy (thyroidectomy=7, lung cancer=1, other=3) and 12 normal controls underwent FDG-PET with usual protocol. They were divided into two groups respectively; one group read books aloud for 20 minutes (phonation group) and the other kept silence (non-phonation groups) after FDG injection. Recent neck CT scan were co-registered with FDG-PET to produce PET-CT fusion images to elaborate small laryngeal muscles. In patients with unilateral vocal cord palsy, contralateral non-paralyzed vocal cord showed hypermetabolism mainly on thyroarytenoid muscle, more intensely with phonation group (SUV=5.88±2.65) than with non-phonation group (SUV=2.30±0.39). Normal control subjects showed hypermetabolism (3.68± 0.96) in interarytenoid muscle and symmetric mild hypermetabolism in both lateral cricoarytenoid muscles in only phonation group. FDG-PET with fusion images using CT scan in patients with unilateral vocal cord paralysis showed hypermetabolism of contralateral non-paralyzed thyroarytedoid muscle, suggesting compensatory action during phonation. Phonation during FDG-PET study enhanced FDG uptake on different laryngeal muscles between patients with unilateral vocal cord paralysis and normal subjects

  15. Theriocide: Naming Animal Killing

    Directory of Open Access Journals (Sweden)

    Piers Beirne

    2014-08-01

    Full Text Available In this essay I recommend ‘theriocide’ as the name for those diverse human actions that cause the deaths of animals. Like the killing of one human by another, theriocide may be socially acceptable or unacceptable, legal or illegal. It may be intentional or unintentional and may involve active maltreatment or passive neglect. Theriocide may occur one-on-one, in small groups or in large-scale social institutions. The numerous and sometimes intersecting sites of theriocide include intensive rearing regimes; hunting and fishing; trafficking; vivisection; militarism; pollution; and human-induced climate change. If the killing of animals by humans is as harmful to them as homicide is to humans, then the proper naming of such deaths offers a remedy, however small, to the extensive privileging of human lives over those of other animals. Inevitably, the essay leads to a shocking question: Is theriocide murder?

  16. Oil is killing Africa

    International Nuclear Information System (INIS)

    Paris, H.

    2007-09-01

    Sub-Saharan Africa, with its mining and petroleum resources, is still the object of covetous desires from developed countries. The Gulf of Guinea is a promising area and probably the future battlefield of the 21. century. The fighters of this war are the African people and the big powers, the USA and China at the head, who call upon mercenaries to get their share of this fabulous treasure. Oil was a chance for Africa, but now oil is killing it

  17. Contagion in Mass Killings and School Shootings

    OpenAIRE

    Towers, Sherry; Gomez-Lievano, Andres; Khan, Maryam; Mubayi, Anuj; Castillo-Chavez, Carlos

    2015-01-01

    Background Several past studies have found that media reports of suicides and homicides appear to subsequently increase the incidence of similar events in the community, apparently due to the coverage planting the seeds of ideation in at-risk individuals to commit similar acts. Methods Here we explore whether or not contagion is evident in more high-profile incidents, such as school shootings and mass killings (incidents with four or more people killed). We fit a contagion model to recent dat...

  18. Studies on the surface antigenicity and susceptibility to antibody-dependent killing of developing schistosomula using sera from chronically infected mice and mice vaccinated with irradiated cercariae

    International Nuclear Information System (INIS)

    Bickle, Q.D.; Ford, M.J.

    1982-01-01

    Changes in the surface antigenicity and susceptibility to in vitro killing during development of schistosomula of Schistosoma mansoni were studied using serum from chronically infected mice (CIS) and from mice vaccinated with highly irradiated (20 krad) cercariae (VS). Binding of these sera was quantitated by counting the number of P388D 1 cells (a transformed, macrophage-like cell of mouse origin, bearing Fc receptors for IgG) binding to the parasite surface. Compared with schistosomula derived in vitro by mechanical transformation (MS), schistosomula recovered 3 hr after skin penetration in vitro (SS) showed a significant loss in surface binding of CIS. Schistosomula recovered 3 hr after skin penetration in vivo (SRS) showed even less binding, and this trend continued such that parasites recovered from the lungs 5 days after infection (LS) showed only minimal binding, and 10-day-old worms from the portal system showed no significant binding. In contrast, VS, which bound significantly less well to MS than CIS, showed enhanced binding to SS, and in the face of their declining antigenicity with respect to CIS, 3- to 24-hr SRS maintained this raised level of antigenicity. Although there appeared to be a decline in binding of VS thereafter, LS remained antigenic, still binding as many cells as MS did despite the fact that they also expressed host antigens detected usng antisera raised against mouse RBC. In spite of this persistence of VS binding up to the lung stage, resistance to eosinophil-mediated killing in vitro had developed by 48 hr post-infection, and LS were totally resistant to both eosinophil- and C-mediated killing

  19. Cryptococcus neoformans modulates extracellular killing by neutrophils

    Directory of Open Access Journals (Sweden)

    Asfia eQureshi

    2011-09-01

    Full Text Available We recently established a key role for host sphingomyelin synthase (SMS in the regulation of the killing activity of neutrophils against Cryptococcus neoformans. In this work, we studied the effect of C. neoformans on the killing activity of neutrophils and whether SMS would still be a player against C. neoformans in immunocompromised mice lacking T and NK cells (Tgε26 mice. To this end, we analyzed whether C. neoformans would have any effect on neutrophil survival and killing in vitro and in vivo. We show that unlike C. albicans, neither the presence nor the capsule size of C. neoformans cells have any effect on neutrophil viability. Interestingly, melanized C. neoformans cells totally abrogated the killing activity of neutrophils. Next, we monitored how exposure of neutrophils to C. neoformans cells would interfere with any further killing activity of the medium and found that pre-incubation with live but not heat-killed fungal cells significantly inhibits further killing activity of the medium. We next studied whether activation of SMS at the site of C. neoformans infection is dependent on T and NK cells. Using matrix-assisted laser desorption-ionization (MALDI tissue imaging in infected lung we found that similarly to previous observations in the isogenic wild type CBA/J mice, SM 16:0 levels are significantly elevated at the site of infection in mice lacking T and NK cells but only at early time points. This study highlights that C. neoformans may negatively regulate the killing activity of neutrophils and that SMS activation in neutrophils appears to be partially independent of T and/or NK cells.

  20. Analysing the Wrongness of Killing

    DEFF Research Database (Denmark)

    Di Nucci, Ezio

    2014-01-01

    This article provides an in-depth analysis of the wrongness of killing by comparing different versions of three influential views: the traditional view that killing is always wrong; the liberal view that killing is wrong if and only if the victim does not want to be killed; and Don Marquis‟ future...... of value account of the wrongness of killing. In particular, I illustrate the advantages that a basic version of the liberal view and a basic version of the future of value account have over competing alternatives. Still, ultimately none of the views analysed here are satisfactory; but the different...

  1. Experimental study on the killing effects of 125IUdR to human glioma cells in vitro

    International Nuclear Information System (INIS)

    Li Jinquan; Bao Yaodong; Zhou Dai; Cui Gang; Wang Bocheng; Jiang Yimin; Wang Haiqiu; Wu Yiwei

    2001-01-01

    The 125 IUdR-uptake profile and the cytocidal effects of 125 IUdR on human cerebral glioma (SHG44) cells were estimated after incubation with 125 IUdR. The killing effects of 125 IUdR comparing with Na 125 I on SHG44 were estimated by colony forming method. The results showed that the amounts of 125 IUdR uptake by SHG44 were growing with the rate of dose of 125 IUdR in the medium, relation factor r = 0.9917. Also the concentration of 125 IUdR uptake by SHG44 was time-dependent, relation factor r = 0.9859. As the concentration in SHG44 growing, the inhibition effects became stronger, relation factor r = - 0.9736. The LD 50 was 8.7 +- 0.12 kBq/ml. The concentration of radioactivity ingestion was significantly stronger in 125 IUdR group than that in Na 125 I group. The surviving fraction was significantly different between in the 125 IUdR group and in Na 125 I group at the concentration point 9.0 kBq/ml. 125 IUdR may be incorporated in SHG44 cell, and the concentration of 125 IUdR ingestion by SHG44 was influenced with the dose in the medium and the culturing time. The prohibitive effects of 125 IUdR on SHG44 cell were obvious. The prohibition effects were significantly stronger in 125 IUdR group than that in Na 125 I group. 125 IUdR may be a kind of potential drug in the therapy of human cerebral glioma

  2. Judicial review of administrative silence

    Directory of Open Access Journals (Sweden)

    Radošević Ratko S.

    2015-01-01

    Full Text Available Administrative silence is a situation in which the competent authority, within the statutory deadline, has not issued an administrative act at the request of the party. In the case of administrative silence, given the fact that the citizens are unable to protect their rights and legal interests without an administrative act, they are provided with legal protection. In this case, the same legal relationship is created, directly on the basis of the statute, as in the situation in which the party's request is rejected. This means that the party may, under the conditions prescribed by the statute, initiate the procedure of judicial review of administrative silence. In the paper, the author explains the conditions under which the judicial review of administrative silence can be initiated and the role of the court in this judicial procedure.

  3. Drosophila PAF1 Modulates PIWI/piRNA Silencing Capacity.

    Science.gov (United States)

    Clark, Josef P; Rahman, Reazur; Yang, Nachen; Yang, Linda H; Lau, Nelson C

    2017-09-11

    To test the directness of factors in initiating PIWI-directed gene silencing, we employed a Piwi-interacting RNA (piRNA)-targeted reporter assay in Drosophila ovary somatic sheet (OSS) cells [1]. This assay confirmed direct silencing roles for piRNA biogenesis factors and PIWI-associated factors [2-12] but suggested that chromatin-modifying proteins may act downstream of the initial silencing event. Our data also revealed that RNA-polymerase-II-associated proteins like PAF1 and RTF1 antagonize PIWI-directed silencing. PAF1 knockdown enhances PIWI silencing of reporters when piRNAs target the transcript region proximal to the promoter. Loss of PAF1 suppresses endogenous transposable element (TE) transcript maturation, whereas a subset of gene transcripts and long-non-coding RNAs adjacent to TE insertions are affected by PAF1 knockdown in a similar fashion to piRNA-targeted reporters. Additionally, transcription activation at specific TEs and TE-adjacent loci during PIWI knockdown is suppressed when PIWI and PAF1 levels are both reduced. Our study suggests a mechanistic conservation between fission yeast PAF1 repressing AGO1/small interfering RNA (siRNA)-directed silencing [13, 14] and Drosophila PAF1 opposing PIWI/piRNA-directed silencing. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Silence, an Eye of Knowledge

    Directory of Open Access Journals (Sweden)

    Mehdi Aghamohammadi

    2017-04-01

    Full Text Available One of the conspicuous features of the twentieth-century West was silence. This idea could be supported by examining reflections of Ludwig Wittgenstein, Fritz Mauthner, John Cage, Samuel Beckett, Ihab Hassan, Franz Kafka, Wassily Kandinsky, Jean-Paul Sartre, Virginia Woolf, Wolfgang Iser, Jacques Derrida, and Pierre Macherey. To me, silence is not a mere theory, but rather a phenomenon from which we can get practical benefits. I believe silence is an eye, eye of knowledge. We can broaden our knowledge of the world through silence. To convey the idea that silence is an eye, I have concocted the word slence, where  has replaced the letter i and stands for the eye. This means knowledge can enable us to see, thereby acquiring knowledge of, what used to be invisible, and accordingly unknowable. In other words, through silence, we can achieve a certain type of literacy. I substantiate this claim by exploring the Horus myth, Ojo de Dios, John Cage’s 4' 33", the nature of Expressionist paintings, Hinduism, thoughts of Hermes Trismegistus and Ibn al-Arabi, and practices of Mohammad, the prophet of Islam.

  5. How to kill creativity.

    Science.gov (United States)

    Amabile, T M

    1998-01-01

    In today's knowledge economy, creativity is more important than ever. But many companies unwittingly employ managerial practices that kill it. How? By crushing their employees' intrinsic motivation--the strong internal desire to do something based on interests and passions. Managers don't kill creativity on purpose. Yet in the pursuit of productivity, efficiency, and control--all worthy business imperatives--they undermine creativity. It doesn't have to be that way, says Teresa Amabile. Business imperatives can comfortably coexist with creativity. But managers will have to change their thinking first. Specifically, managers will need to understand that creativity has three parts: expertise, the ability to think flexibly and imaginatively, and motivation. Managers can influence the first two, but doing so is costly and slow. It would be far more effective to increase employees' intrinsic motivation. To that end, managers have five levers to pull: the amount of challenge they give employees, the degree of freedom they grant around process, the way they design work groups, the level of encouragement they give, and the nature of organizational support. Take challenge as an example. Intrinsic motivation is high when employees feel challenged but not overwhelmed by their work. The task for managers, therefore, becomes matching people to the right assignments. Consider also freedom. Intrinsic motivation--and thus creativity--soars when managers let people decide how to achieve goals, not what goals to achieve. Managers can make a difference when it comes to employee creativity. The result can be truly innovative companies in which creativity doesn't just survive but actually thrives.

  6. Stability of RNA silencing-based traits after virus infection

    DEFF Research Database (Denmark)

    Jørgensen, Bodil; Albrechtsen, Merete

    2007-01-01

    with constructs based on virus coat protein (CP) genes or other viral genes has been successfully used to engineer PTGS-mediated virus resistance into a large number of crop plants and some transgenic lines have been commercially exploited. However the discovery that plant viruses encode suppressors of gene...... silencing has raised concerns that virus infection of crop plants might reverse the new silencing-based traits. Most studies of virus suppression of silencing have used model systems based on silencing of reporter genes. A few studies have analysed the effects of virus infections on plants with genetically...... engineered virus resistance based on either a simple sense or an inverted repeat construct. We decided to use genetically engineered virus resistance in potato as a model system for further studies of the effect of virus infection on genetically engineered traits. We present for the first time a comparison...

  7. "Was it something I said?" "No, it was something you posted!" A study of the spiral of silence theory in social media contexts.

    Science.gov (United States)

    Gearhart, Sherice; Zhang, Weiwu

    2015-04-01

    New media technologies make it necessary for scholars to reassess mass communication theories developed among legacy media. One such theory is the spiral of silence theory originally proposed by Noelle-Neumann in the 1970s. Increasing diversity of media content, selectivity, social networking site (SNS) interactivity, and the potential for anonymity have posed various challenges to its theoretical assumptions. While application of the spiral of silence in SNS contexts has been theorized, its empirical testing is scarce. To fill this void, the Pew 2012 Search, Social Networks, and Politics survey is used to test the theory. Results reveal that encountering agreeable political content predicts speaking out, while encountering disagreeable postings stifles opinion expression, supporting the spiral of silence theory in the SNS environment. However, certain uses of SNSs and psychological factors demonstrate a liberating effect on opinion expression.

  8. Chemically enhanced sunlight for killing bacteria

    International Nuclear Information System (INIS)

    Block, S.S.; Goswami, D.Y.

    1995-01-01

    Solar ultraviolet (UV) photocatalyzed oxidation of chemicals with titanium dioxide (TiO 2 ) has received considerable attention. Much less recognized, however, is the ability of the same system to destroy bacteria. This study examined this phenomenon and the conditions that affect it. Bacteria in aqueous solution were given solar exposure with titanium dioxide and their survival with time was determined. Lamps with a predominantly solar ultraviolet spectrum were also used in the experiments. Without exposure to UV light, TiO 2 had no deleterious effect on the bacteria. However, several common bacteria on solar exposure in the presence of TiO 2 were killed in just a few minutes, whereas without TiO 2 it took over an hour to destroy them. A concentration of 0.01% TiO 2 was most effective in killing bacteria and 10-fold concentrations lower or higher were successively less effective. Inorganic and organic compounds in solution, even in small amounts, interfered with the efficiency of killing. Alkaline solution also reduced the bactericidal activity. Circulation and agitation provided by stirring to keep the TiO 2 particles suspended reduced the time necessary to kill the bacteria. Time-intensity curves for killing bacteria were the same general shape with or without TiO 2 , indicating that TiO 2 served merely as a catalyst to increase the rate of the reaction but that the mechanism of action was not changed. The shape of the curves show that the organisms are sensitized with a minimum intensity of radiation and that an increase doesn't greatly increase the rate of kill. Below this critical intensity, however, the time required for killing markedly increases as the intensity is decreased

  9. Homology-dependent Gene Silencing in Paramecium

    Science.gov (United States)

    Ruiz, Françoise; Vayssié, Laurence; Klotz, Catherine; Sperling, Linda; Madeddu, Luisa

    1998-01-01

    Microinjection at high copy number of plasmids containing only the coding region of a gene into the Paramecium somatic macronucleus led to a marked reduction in the expression of the corresponding endogenous gene(s). The silencing effect, which is stably maintained throughout vegetative growth, has been observed for all Paramecium genes examined so far: a single-copy gene (ND7), as well as members of multigene families (centrin genes and trichocyst matrix protein genes) in which all closely related paralogous genes appeared to be affected. This phenomenon may be related to posttranscriptional gene silencing in transgenic plants and quelling in Neurospora and allows the efficient creation of specific mutant phenotypes thus providing a potentially powerful tool to study gene function in Paramecium. For the two multigene families that encode proteins that coassemble to build up complex subcellular structures the analysis presented herein provides the first experimental evidence that the members of these gene families are not functionally redundant. PMID:9529389

  10. Archivists Killed for Political Reasons

    NARCIS (Netherlands)

    de Baets, Antoon

    2015-01-01

    This essay, Archivists Killed for Political Reasons, offers an overview of archivists who were killed for political reasons through the ages. After determining the criteria for inclusion, sixteen such political murders of archivists are briefly discussed. These cases were distributed over six

  11. Solanum venturii, a suitable model system for virus-induced gene silencing studies in potato reveals StMKK6 as an important player in plant immunity

    NARCIS (Netherlands)

    Dobnik, David; Lazar, Ana; Stare, Tjaša; Gruden, Kristina; Vleeshouwers, Vivianne G.A.A.; Žel, Jana

    2016-01-01

    Background: Virus-induced gene silencing (VIGS) is an optimal tool for functional analysis of genes in plants, as the viral vector spreads throughout the plant and causes reduced expression of selected gene over the whole plant. Potato (Solanum tuberosum) is one of the most important food crops,

  12. The organisational silence of midwives and nurses: reasons and results.

    Science.gov (United States)

    Yurdakul, Mine; Beşen, Meltem Aydin; Erdoğan, Semra

    2016-07-01

    The study was conducted to determine the issues about which nurses and midwives remain silent and the reasons for it and the perceived results of silence. Organisational silence is a vitally important issue in the health sector, due to the risks and mistakes that are not reported, and proposals for improvement that are not made. The sample of this descriptive survey, which investigated a cause and effect relationship, was 159 nurses and midwives. The data were collected using a questionnaire and the organisational silence scale. Of the study participants, 84.9% were nurses and 15.1% were midwives. Of all participants 88.7% were women. 8.8% of participants stated that they never remained silent about issues related to work and the workplace. Respondents most often remained silent about issues related to ethics and responsibility. 'Limited improvement and development' was frequently mentioned as a perceived result of organisational silence. Our study determined that organisational silence is quite common among nurses and midwives. Activities that raise the awareness of hospital administrations and employees about preventing the factors that cause and maintain silence in hospitals should be planned. © 2016 John Wiley & Sons Ltd.

  13. "The Killing Fields" of Innovation

    DEFF Research Database (Denmark)

    Ingerslev, Karen

    2014-01-01

    to clustering of ideas, a design strategy which seemed to kill unique ideas. The reframing of innovation as a radical endeavor killed learning from others for being not innovative. The findings of this paper supplement theories of deliberate killing of ideas by suggesting framing, design and facilitation......This paper points to seemingly contradicted processes of framing innovation, idea generation and killing ideas. It reports from a yearlong innovation project, where health care professionals explored problems and tested ideas for solutions, regarding a future downsizing of the case hospital....... Theories in various ways describe the opening and closing phases of innovation. Exploration and idea generation opens a field of interest, which is then closed by making choices of ideas to further explore in the next opening phase. These choices deliberately kill a lot of ideas. In the innovation project...

  14. Locus-specific ribosomal RNA gene silencing in nucleolar dominance.

    Directory of Open Access Journals (Sweden)

    Michelle S Lewis

    2007-08-01

    Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.

  15. Nurses Writing about Psychiatric Nurses' Involvement in Killings during the Nazi Era: A Preliminary Discourse Analysis.

    Science.gov (United States)

    Holmes, Colin A; McAllister, Margaret; Crowther, Andrew

    2016-01-01

    Nurses actively killed people in Nazi Europe between 1939 and 1945. The so-called ‘science of eugenics’ underpinned Nazi ideology, used to further the Nazi racist agenda. Edicts sanctioned selection and medically supervised killing of people, and nurses, principally in mental hospitals, participated in the killing of between 100–300 thousand patients. Erroneously termed ‘euthanasia', there were three phases: the initial programme involving children, the T4 adult programme, and ‘wild euthanasia'. Unofficial killings also took place before 1939. This paper uses discourse analysis to map and analyse published texts which explore the role of nurses in Nazi Germany. The aim is to identify its characteristics as a body of literature, to note strengths and weaknesses, emphases and silences, and to note aspects that need further exploration. It acknowledges that how these events are to be understood and represented in contemporary discourse constitutes a significant problem for historians of nursing.

  16. Ways to Promote the Classroom Participation of International Students by Understanding the Silence of Japanese University Students

    Science.gov (United States)

    Kim, Soonhyang; Ates, Burcu; Grigsby, Yurimi; Kraker, Stefani; Micek, Timothy A.

    2016-01-01

    The authors explored the role of silence and deciphered its meaning and usefulness as a teaching and learning strategy for Japanese students through a survey of Japanese university students in their home country. This study has revealed that participant responses were evenly divided among comfortable with silence, uncomfortable with silence, and…

  17. Communicative Silences: Forms and Functions

    Science.gov (United States)

    Bruneau, Thomas J.

    1973-01-01

    The nature of silence is discussed as an imposition of mind, as an interdependent signification ground for speech signs, as a relationship to mental time (as opposed to artificial time), and as it relates to sensation, perception and metaphorical movement. (Author)

  18. Integrating Poetry and "To Kill a Mockingbird."

    Science.gov (United States)

    Jolley, Susan Arpajian

    2002-01-01

    Outlines a method of teaching "To Kill a Mockingbird" along with the study of poetry. Notes that this method allows students to consider the themes of courage and developing compassion. Concludes that teaching such a multigenre unit allows students to look for connections among fact and fiction, the past and present, their own lives and…

  19. Breaching cultural silence: enhancing resilience among Ugandan ...

    African Journals Online (AJOL)

    Cultural silence is frequently the outcome of deep-seated taboos regarding adults talking to children about sex and death. This paper examines the impact of cultural silence on the resilience of children orphaned by AIDS in Uganda. Cultural silence is often linked with denial. This article explores the complexities of cultural ...

  20. Killing Horizons as Equipotential Hypersurfaces

    OpenAIRE

    Smolić, Ivica

    2012-01-01

    In this note we present a new proof that Killing horizons are equipotential hypersurfaces for the electric and the magnetic scalar potential, that makes no use of gravitational field equations or the assumption about the existence of bifurcation surface.

  1. Does comedy kill? A retrospective, longitudinal cohort, nested case-control study of humour and longevity in 53 British comedians.

    Science.gov (United States)

    Stewart, Simon; Thompson, David R

    2015-02-01

    This work aims to test the hypothesis that the funniest comedians are most at risk of a premature death and reduced longevity compared to their relatively less funny counterparts. A retrospective longitudinal cohort study with a nested case-control analysis of longevity of 53 male British comedians born between 1900 and 1954 was conducted. All comedians were given a subjective score from 1 (relatively funny) to 10 (hilariously funny) by the study investigators. The survival profile of all comedians was then examined adjusting for decade of birth, whether they worked in a comedy team and their comedy score. A nested case-control analysis examined the longevity of those comedians working in teams according to their pre-specified status within the team (straight/less funny versus funny team member). On an adjusted basis, there was no correlation between the decade of birth (HR 0.94, 95% 0.65 to 1.38 per incremental decade; p=0.763) and comedy team status (HR 1.13, 95% 0.51 to 2.48 versus independent comedian; p=0.761) with longevity. However, an increasingly funny comedy score was associated with increased mortality (HR 1.24, 95% CI 1.06 to 1.44 per unit funny score; p=0.006). Of the 23 comedians adjudged to be very funny (score 8-10), 18 (78%) had died versus 12 (40%) of the rest; mean age at death 63.3±12.2 versus 72.3±14.7 (p=0.079). Within comedy teams, those identified as the funnier member(s) of the partnership were, on an adjusted basis, more than three times more likely to die prematurely when compared to their more serious comedy partners (HR 3.52, 95% CI 1.22, 10.1; p=0.020). These data suggest that elite comedians are at increased risk of premature death compared to their less funny counterparts. Mental health issues and personality characteristics that help shape their comedic talent and success may well explain their reduced longevity and raises serious issues for identifying and mitigating their risk of a premature death. Copyright © 2014 Elsevier

  2. The web of silence: a qualitative case study of early intervention and support for healthcare workers with mental ill-health.

    Science.gov (United States)

    Moll, Sandra E

    2014-02-08

    There is a high rate of stress and mental illness among healthcare workers, yet many continue to work despite symptoms that affect their performance. Workers with mental health issues are typically ostracized and do not get the support that they need. If issues are not addressed, however, they could become worse and compromise the health and safety, not only of the worker, but his/her colleagues and patients. Early identification and support can improve work outcomes and facilitate recovery, but more information is needed about how to facilitate this process in the context of healthcare work. The purpose of this study was to explore the key individual and organizational forces that shape early intervention and support for healthcare workers who are struggling with mental health issues, and to identify barriers and opportunities for change. A qualitative, case study in a large, urban healthcare organization was conducted in order to explore the perceptions and experiences of employees across the organization. In-depth interviews were conducted with eight healthcare workers who had experienced mental health issues at work as well as eight workplace stakeholders who interacted with workers who were struggling (managers, coworkers, union leaders). An online survey was completed by an additional 67 employees. Analysis of the interviews and surveys was guided by a process of interpretive description to identify key barriers to early intervention and support. There were many reports of silence and inaction in response to employee mental health issues. Uncertainty in identifying mental health problems, stigma regarding mental ill health, a discourse of professional competence, social tensions, workload pressures, confidentiality expectations and lack of timely access to mental health supports were key forces in preventing employees from getting the help that they needed. Although there were a few exceptions, the overall study findings point to many barriers to supporting

  3. The web of silence: a qualitative case study of early intervention and support for healthcare workers with mental ill-health

    Science.gov (United States)

    2014-01-01

    Background There is a high rate of stress and mental illness among healthcare workers, yet many continue to work despite symptoms that affect their performance. Workers with mental health issues are typically ostracized and do not get the support that they need. If issues are not addressed, however, they could become worse and compromise the health and safety, not only of the worker, but his/her colleagues and patients. Early identification and support can improve work outcomes and facilitate recovery, but more information is needed about how to facilitate this process in the context of healthcare work. The purpose of this study was to explore the key individual and organizational forces that shape early intervention and support for healthcare workers who are struggling with mental health issues, and to identify barriers and opportunities for change. Methods A qualitative, case study in a large, urban healthcare organization was conducted in order to explore the perceptions and experiences of employees across the organization. In-depth interviews were conducted with eight healthcare workers who had experienced mental health issues at work as well as eight workplace stakeholders who interacted with workers who were struggling (managers, coworkers, union leaders). An online survey was completed by an additional 67 employees. Analysis of the interviews and surveys was guided by a process of interpretive description to identify key barriers to early intervention and support. Results There were many reports of silence and inaction in response to employee mental health issues. Uncertainty in identifying mental health problems, stigma regarding mental ill health, a discourse of professional competence, social tensions, workload pressures, confidentiality expectations and lack of timely access to mental health supports were key forces in preventing employees from getting the help that they needed. Although there were a few exceptions, the overall study findings point to

  4. Spacetimes foliated by Killing horizons

    International Nuclear Information System (INIS)

    Pawlowski, Tomasz; Lewandowski, Jerzy; Jezierski, Jacek

    2004-01-01

    It seems to be expected that a horizon of a quasi-local type, such as a Killing or an isolated horizon, by analogy with a globally defined event horizon, should be unique in some open neighbourhood in the spacetime, provided the vacuum Einstein or the Einstein-Maxwell equations are satisfied. The aim of our paper is to verify whether that intuition is correct. If one can extend a so-called Kundt metric, in such a way that its null, shear-free surfaces have spherical spacetime sections, the resulting spacetime is foliated by so-called non-expanding horizons. The obstacle is Kundt's constraint induced at the surfaces by the Einstein or the Einstein-Maxwell equations, and the requirement that a solution be globally defined on the sphere. We derived a transformation (reflection) that creates a solution to Kundt's constraint out of data defining an extremal isolated horizon. Using that transformation, we derived a class of exact solutions to the Einstein or Einstein-Maxwell equations of very special properties. Each spacetime we construct is foliated by a family of the Killing horizons. Moreover, it admits another, transversal Killing horizon. The intrinsic and extrinsic geometries of the transversal Killing horizon coincide with the one defined on the event horizon of the extremal Kerr-Newman solution. However, the Killing horizon in our example admits yet another Killing vector tangent to and null at it. The geometries of the leaves are given by the reflection

  5. Control of Influenza and Poliomyelitis with Killed Virus Vaccines

    Science.gov (United States)

    Salk, Jonas; Salk, Darrell

    1977-01-01

    Discusses control of poliomyelitis and influenza by live and killed virus vaccines. Considered are the etiological agents, pathogenic mechanisms and epidemiology of each disease. Reviews recent scientific studies of the diseases. Recommends use of killed virus vaccines in controlling both diseases. (CS)

  6. Pseudomonas piscicida kills vibrios by two distinct mechanisms

    Science.gov (United States)

    Pseudoalteromonas piscicida is a naturally-occurring marine bacterium which kills competing bacteria, including vibrios. In studies by Richards et al. (AEM00175-17), three strains of P. piscicida were isolated and characterized. Strains secreted proteolytic enzymes which likely killed competing or...

  7. Technical advances in trigger-induced RNA interference gene silencing in the parasite Entamoeba histolytica.

    Science.gov (United States)

    Khalil, Mohamed I; Foda, Bardees M; Suresh, Susmitha; Singh, Upinder

    2016-03-01

    Entamoeba histolytica has a robust endogenous RNA interference (RNAi) pathway. There are abundant 27 nucleotide (nt) anti-sense small RNAs (AS sRNAs) that target genes for silencing and the genome encodes many genes involved in the RNAi pathway such as Argonaute proteins. Importantly, an E. histolytica gene with numerous AS sRNAs can function as a "trigger" to induce silencing of a gene that is fused to the trigger. Thus, the amebic RNAi pathway regulates gene expression relevant to amebic biology and has additionally been harnessed as a tool for genetic manipulation. In this study we have further improved the trigger-induced gene silencing method. We demonstrate that rather than using the full-length gene, a short portion of the coding region fused to a trigger is sufficient to induce silencing; the first 537 bp of the E. histolytica rhomboid gene (EhROM1) fused in-frame to the trigger was sufficient to silence EhROM1. We also demonstrated that the trigger method could silence two amebic genes concomitantly; fusion of the coding regions of EhROM1 and transcription factor, EhMyb, in-frame to a trigger gene resulted in both genes being silenced. Alternatively, two genes can be silenced sequentially: EhROM1-silenced parasites with no drug selection plasmid were transfected with trigger-EhMyb, resulting in parasites with both EhROM1 and EhMyb silenced. With all approaches tested, the trigger-mediated silencing was substantive and silencing was maintained despite loss of the G418 selectable marker. All gene silencing was associated with generation of AS sRNAs to the silenced gene. We tested the reversibility of the trigger system using inhibitors of histone modifications but found that the silencing was highly stable. This work represents a technical advance in the trigger gene silencing method in E. histolytica. Approaches that readily silence multiple genes add significantly to the genetic toolkit available to the ameba research community. Copyright © 2016

  8. Polycomb complexes and silencing mechanisms

    DEFF Research Database (Denmark)

    Lund, Anders H; van Lohuizen, Maarten

    2004-01-01

    Advances in the past couple of years have brought important new knowledge on the mechanisms by which Polycomb-group proteins regulate gene expression and on the consequences of their actions. The discovery of histone methylation imprints specific for Polycomb and Trithorax complexes has provided...... mechanistic insight on how this ancient epigenetic memory system acts to repress and indicates that it may share mechanistic aspects with other silencing and genome-protective processes, such as RNA interference....

  9. Contagion in Mass Killings and School Shootings.

    Directory of Open Access Journals (Sweden)

    Sherry Towers

    Full Text Available Several past studies have found that media reports of suicides and homicides appear to subsequently increase the incidence of similar events in the community, apparently due to the coverage planting the seeds of ideation in at-risk individuals to commit similar acts.Here we explore whether or not contagion is evident in more high-profile incidents, such as school shootings and mass killings (incidents with four or more people killed. We fit a contagion model to recent data sets related to such incidents in the US, with terms that take into account the fact that a school shooting or mass murder may temporarily increase the probability of a similar event in the immediate future, by assuming an exponential decay in contagiousness after an event.We find significant evidence that mass killings involving firearms are incented by similar events in the immediate past. On average, this temporary increase in probability lasts 13 days, and each incident incites at least 0.30 new incidents (p = 0.0015. We also find significant evidence of contagion in school shootings, for which an incident is contagious for an average of 13 days, and incites an average of at least 0.22 new incidents (p = 0.0001. All p-values are assessed based on a likelihood ratio test comparing the likelihood of a contagion model to that of a null model with no contagion. On average, mass killings involving firearms occur approximately every two weeks in the US, while school shootings occur on average monthly. We find that state prevalence of firearm ownership is significantly associated with the state incidence of mass killings with firearms, school shootings, and mass shootings.

  10. Contagion in Mass Killings and School Shootings.

    Science.gov (United States)

    Towers, Sherry; Gomez-Lievano, Andres; Khan, Maryam; Mubayi, Anuj; Castillo-Chavez, Carlos

    2015-01-01

    Several past studies have found that media reports of suicides and homicides appear to subsequently increase the incidence of similar events in the community, apparently due to the coverage planting the seeds of ideation in at-risk individuals to commit similar acts. Here we explore whether or not contagion is evident in more high-profile incidents, such as school shootings and mass killings (incidents with four or more people killed). We fit a contagion model to recent data sets related to such incidents in the US, with terms that take into account the fact that a school shooting or mass murder may temporarily increase the probability of a similar event in the immediate future, by assuming an exponential decay in contagiousness after an event. We find significant evidence that mass killings involving firearms are incented by similar events in the immediate past. On average, this temporary increase in probability lasts 13 days, and each incident incites at least 0.30 new incidents (p = 0.0015). We also find significant evidence of contagion in school shootings, for which an incident is contagious for an average of 13 days, and incites an average of at least 0.22 new incidents (p = 0.0001). All p-values are assessed based on a likelihood ratio test comparing the likelihood of a contagion model to that of a null model with no contagion. On average, mass killings involving firearms occur approximately every two weeks in the US, while school shootings occur on average monthly. We find that state prevalence of firearm ownership is significantly associated with the state incidence of mass killings with firearms, school shootings, and mass shootings.

  11. RELATIONSHIP BETWEEN AFFECTIVE COMMITMENT ANDORGANIZATIONAL SILENCE: A CONCEPTUAL DISCUSSION

    Directory of Open Access Journals (Sweden)

    Fitnat Nazlı Sayğan

    2011-07-01

    Full Text Available In this study, the affective commitment that is oneof the components oforganizational commitment put forth by Allen and Meyer (Allen, Meyer 1996will be differentiated from the other commitment components. The importance ofcreating an emotional commitment to organizations will be examined and theorganizational factors needed to form organizational commitment will beinvestigated. Also, organizational silence is a situation that the company avoided.In the study, the reasons and the drawbacks of silence are focused on and thefactors that cause employees to remain silent are discussed.The aim of this study is intended to manifest the relationship of ‘organizationalsilence' with affective commitment’ which is one ofthe components of‘organizational commitment’ on the basis of literature. In this study, a negativecorrelation between affective commitment and organizational silence is suggested

  12. Anti-viral RNA silencing: do we look like plants ?

    Directory of Open Access Journals (Sweden)

    Lecellier Charles-Henri

    2006-01-01

    Full Text Available Abstract The anti-viral function of RNA silencing was first discovered in plants as a natural manifestation of the artificial 'co-suppression', which refers to the extinction of endogenous gene induced by homologous transgene. Because silencing components are conserved among most, if not all, eukaryotes, the question rapidly arose as to determine whether this process fulfils anti-viral functions in animals, such as insects and mammals. It appears that, whereas the anti-viral process seems to be similarly conserved from plants to insects, even in worms, RNA silencing does influence the replication of mammalian viruses but in a particular mode: micro(miRNAs, endogenous small RNAs naturally implicated in translational control, rather than virus-derived small interfering (siRNAs like in other organisms, are involved. In fact, these recent studies even suggest that RNA silencing may be beneficial for viral replication. Accordingly, several large DNA mammalian viruses have been shown to encode their own miRNAs. Here, we summarize the seminal studies that have implicated RNA silencing in viral infection and compare the different eukaryotic responses.

  13. Precedents and consequences of prosocial behaviors of voice and silence

    Directory of Open Access Journals (Sweden)

    Alicia Omar

    2015-09-01

    Full Text Available Prosocial behavior is that which that encourages solidarity and harmony in interpersonal relationships, and produce personal or collective benefits. Although early research on job prosociality was focused on the study of conventional behaviors such as help, courtesy and sportsmanship, the identification and operationalization of new dimensions is rapidly expanding this nomological network. Such is the case of prosocial voice and prosocial silence, recently introduced in the scientific literature. The aim of this study is to explore possible relationships between employee’s voice and employee’s silence, and their personality structure; and examine the role of interpersonal justice perceptions on such relationships. We worked with a sample of 316 employees- aged 37 years and holding a 4.2-year signority working at public and private companies in southern and central Rosario (Argentina. The subjects completed Colquitt’ Justice Organizational Scale, Eysenck Personality Questionnaire, and Van Dyne’s Prosocial Voice and Prosocial Silence Scales. Extraversion and neuroticism emerged as the strongest predictors of prosocial voice and prosocial silence, respectively. Interpersonal justice perceptions emerged as moderators of the ‘natural’ tendency of extraverted workers to engage in prosocial voice, and emotionally controlled workers to engage in prosocial silence. Such findings would indicate that the promotion of high levels of interpersonal justice on job contexts could help workers to engage in more prosocial behavior with positive effects for the organization. 

  14. Killing, letting die and euthanasia.

    Science.gov (United States)

    Husak, D N

    1979-12-01

    Medical ethicists debate whether or not the moral assessment of cases of euthanasia should depend on whether the patient is 'killed' or 'allowed to die'. The usual presupposition is that a clear distinction between killing and letting die can be drawn so that this substantive question is not begged. I contend that the categorisation of cases of instances of killing rather than as instances of letting die depends in part on a prior moral assessment of the case. Hence is it trivially rather than substantively true that the distinction has moral significance. But even if a morally neutral (ie non-question begging) distinction could be drawn, its application to the euthanasia controversy is problematic. I illustrate the difficulties of employing this distinction to reach moral conclusions by critically discussing Philippa Foot's recent treatment of euthanasia. I conclude that even if an act of euthanasia is an instance of killing, and there exists a prima facie moral duty not to kill, and no more stringent duty overrides this duty, one still cannot determine such an act to be morally impermissible.

  15. Killing, letting die and euthanasia.

    Science.gov (United States)

    Husak, D N

    1979-01-01

    Medical ethicists debate whether or not the moral assessment of cases of euthanasia should depend on whether the patient is 'killed' or 'allowed to die'. The usual presupposition is that a clear distinction between killing and letting die can be drawn so that this substantive question is not begged. I contend that the categorisation of cases of instances of killing rather than as instances of letting die depends in part on a prior moral assessment of the case. Hence is it trivially rather than substantively true that the distinction has moral significance. But even if a morally neutral (ie non-question begging) distinction could be drawn, its application to the euthanasia controversy is problematic. I illustrate the difficulties of employing this distinction to reach moral conclusions by critically discussing Philippa Foot's recent treatment of euthanasia. I conclude that even if an act of euthanasia is an instance of killing, and there exists a prima facie moral duty not to kill, and no more stringent duty overrides this duty, one still cannot determine such an act to be morally impermissible. PMID:541821

  16. Playing the 'Silence' Card

    DEFF Research Database (Denmark)

    Pantelli, Niki; Lee, Joyce y. H.; Bülow, Anne Marie

    2014-01-01

    In this paper, we argue that the international business (IB) literature has given only limited attention to the technologymediated context of language. We find, through a case study of an international inter-organizational partnership where the use of English language was the lingua franca......, that email not only had a dominant role but also created several possibilities for interaction. The findings show the relevance of email affordances to inter-cultural studies. Further, the study makes a contribution by repositioning communication technology within the language stream of IB research....

  17. "Guns do not kill, people do!"

    DEFF Research Database (Denmark)

    Lemche, Niels Peter

    2011-01-01

    The Bible does not kill, but many people who have read the Bible (in their way) have killed, virtually or in real.......The Bible does not kill, but many people who have read the Bible (in their way) have killed, virtually or in real....

  18. Silence in Intercultural Collaboration

    NARCIS (Netherlands)

    Verouden, Nick W.; Sanden, Van der Maarten C.A.; Aarts, Noelle

    2018-01-01

    China is widely recognized as a significant scientific partner for Western universities. Given that many Western universities are now operating in the Chinese context, this study investigates the everyday conversations in which international partnerships are collaboratively developed and

  19. Leadership Matters : The Effects of Targeted Killings on Militant Group Tactics

    NARCIS (Netherlands)

    Abrahms, Max; Mierau, Jochen

    2017-01-01

    Targeted killings have become a central component of counter-terrorism strategy. In response to the unprecedented prevalence of this strategy around the world, numerous empirical studies have recently examined whether "decapitating" militant groups with targeted killings is strategically effective.

  20. Darkness, Silence and Emptiness

    OpenAIRE

    Margarita Rojas

    2017-01-01

    A general interpretation is proposed of Los detectives salvajes, by Roberto Bolaño, beginning with the analysis of its structure. Other aspects studied include games, the opposition between loyalty and betrayal, and verosimilitude based on repetitions in the interviews. Mention is also made of other works by Roberto Bolaño, such as Amuleto, Estrella distante y 2666.

  1. Darkness, Silence and Emptiness

    Directory of Open Access Journals (Sweden)

    Margarita Rojas

    2017-02-01

    Full Text Available A general interpretation is proposed of Los detectives salvajes, by Roberto Bolaño, beginning with the analysis of its structure. Other aspects studied include games, the opposition between loyalty and betrayal, and verosimilitude based on repetitions in the interviews. Mention is also made of other works by Roberto Bolaño, such as Amuleto, Estrella distante y 2666.

  2. Making the Silence Visible

    Science.gov (United States)

    Keshavarz, Fatemeh

    2006-01-01

    This article discusses the vulnerability of U.S. professors of Islamic and Near Eastern studies, particularly if they are of Muslim origin. The author, a scholar of subjects related to literatures and cultures of the Muslim world, who is herself of Muslim origin, has found it more difficult in recent years to bring many topics to the classroom.…

  3. MLH1-Silenced and Non-Silenced Subgroups of Hypermutated Colorectal Carcinomas Have Distinct Mutational Landscapes

    Science.gov (United States)

    Donehower, Lawrence A.; Creighton, Chad J.; Schultz, Nikolaus; Shinbrot, Eve; Chang, Kyle; Gunaratne, Preethi H.; Muzny, Donna; Sander, Chris; Hamilton, Stanley R.; Gibbs, Richard A.; Wheeler, David

    2014-01-01

    Approximately 15% of colorectal carcinomas (CRC) exhibit a hypermutated genotype accompanied by high levels of microsatellite instability (MSI-H) and defects in DNA mismatch repair. These tumors, unlike the majority of colorectal carcinomas, are often diploid, exhibit frequent epigenetic silencing of the MLH1 DNA mismatch repair gene, and have a better clinical prognosis. As an adjunct study to The Cancer Genome Atlas consortium that recently analyzed 224 colorectal cancers by whole exome sequencing, we compared the 35 CRC (15.6%) with a hypermutated genotype to those with a non-hypermutated genotype. We found that 22 (63%) of hypermutated CRC exhibited transcriptional silencing of the MLH1 gene, a high frequency of BRAF V600E gene mutations and infrequent APC and KRAS mutations, a mutational pattern significantly different from their non-hypermutated counterparts. However, the remaining 13 (37%) hypermutated CRC lacked MLH1 silencing, contained tumors with the highest mutation rates (“ultramutated” CRC), and exhibited higher incidences of APC and KRAS mutations, but infrequent BRAF mutations. These patterns were confirmed in an independent validation set of 250 exome-sequenced CRC. Analysis of mRNA and microRNA expression signatures revealed that hypermutated CRC with MLH1 silencing had greatly reduced levels of WNT signaling and increased BRAF signaling relative non-hypermutated CRC. Our findings suggest that hypermutated CRC include one subgroup with fundamentally different pathways to malignancy than the majority of CRC. Examination of MLH1 expression status and frequencies of APC, KRAS, and BRAF mutation in CRC may provide a useful diagnostic tool that could supplement the standard microsatellite instability assays and influence therapeutic decisions. PMID:22899370

  4. Darkness, Silence and Emptiness

    OpenAIRE

    Rojas, Margarita

    2017-01-01

    A general interpretation is proposed of Los detectives salvajes, by Roberto Bolaño, beginning with the analysis of its structure. Other aspects studied include games, the opposition between loyalty and betrayal, and verosimilitude based on repetitions in the interviews. Mention is also made of other works by Roberto Bolaño, such as Amuleto, Estrella distante y 2666.  Se ofrece una interpretación general de Los detectives salvajes, de Roberto Bolaño, a partir del análisis de su estructura. ...

  5. Revival of silenced echo and quantum memory for light

    Energy Technology Data Exchange (ETDEWEB)

    Damon, V; Bonarota, M; Louchet-Chauvet, A; Chaneliere, T; Le Gouet, J-L, E-mail: jean-louis.legouet@lac.u-psud.fr [Laboratoire Aime Cotton, CNRS-UPR 3321, Univ. Paris-Sud, Bat. 505, 91405 Orsay cedex (France)

    2011-09-15

    We propose an original quantum memory protocol. It belongs to the class of rephasing processes and is closely related to two-pulse photon echo. It is known that the strong population inversion produced by the rephasing pulse prevents the plain two-pulse photon echo from serving as a quantum memory scheme. Indeed, gain and spontaneous emission generate prohibitive noise. A second {pi}-pulse can be used to simultaneously reverse the atomic phase and bring the atoms back into the ground state. Then a secondary echo is radiated from a non-inverted medium, avoiding contamination by gain and spontaneous emission noise. However, one must kill the primary echo, in order to preserve all the information for the secondary signal. In the present work, spatial phase mismatching is used to silence the standard two-pulse echo. An experimental demonstration is presented.

  6. Psychological traits underlying different killing methods among Malaysian male murderers.

    Science.gov (United States)

    Kamaluddin, Mohammad Rahim; Shariff, Nadiah Syariani; Nurfarliza, Siti; Othman, Azizah; Ismail, Khaidzir H; Mat Saat, Geshina Ayu

    2014-04-01

    Murder is the most notorious crime that violates religious, social and cultural norms. Examining the types and number of different killing methods that used are pivotal in a murder case. However, the psychological traits underlying specific and multiple killing methods are still understudied. The present study attempts to fill this gap in knowledge by identifying the underlying psychological traits of different killing methods among Malaysian murderers. The study adapted an observational cross-sectional methodology using a guided self-administered questionnaire for data collection. The sampling frame consisted of 71 Malaysian male murderers from 11 Malaysian prisons who were selected using purposive sampling method. The participants were also asked to provide the types and number of different killing methods used to kill their respective victims. An independent sample t-test was performed to establish the mean score difference of psychological traits between the murderers who used single and multiple types of killing methods. Kruskal-Wallis tests were carried out to ascertain the psychological trait differences between specific types of killing methods. The results suggest that specific psychological traits underlie the type and number of different killing methods used during murder. The majority (88.7%) of murderers used a single method of killing. Multiple methods of killing was evident in 'premeditated' murder compared to 'passion' murder, and revenge was a common motive. Examples of multiple methods are combinations of stabbing and strangulation or slashing and physical force. An exception was premeditated murder committed with shooting, when it was usually a single method, attributed to the high lethality of firearms. Shooting was also notable when the motive was financial gain or related to drug dealing. Murderers who used multiple killing methods were more aggressive and sadistic than those who used a single killing method. Those who used multiple methods or

  7. The effects of thinking in silence on creativity and innovation

    NARCIS (Netherlands)

    de Vet, A.J.

    2007-01-01

    This dissertation consists of three empirical studies on the effects of thinking in silence on creativity and innovation. In these studies I use a social psychology and cognitive psychology lens to study creativity and innovation at the individual and at the team level of analysis, using randomized

  8. Family Violence in Domestic Homicides: A Case Study of Women Who Killed Intimate Partners Post-Legislative Reform in Victoria, Australia.

    Science.gov (United States)

    Tyson, Danielle; Kirkwood, Deborah; Mckenzie, Mandy

    2016-05-18

    This article examines the impact of legislative reforms enacted in 2005 in Victoria, Australia, on legal responses to women charged with murder for killing their intimate partner. The reforms provided for a broader understanding of the context of family violence to be considered in such cases, but we found little evidence of this in practice. This is partly attributable to persistent misconceptions among the legal profession about family violence and why women may believe it necessary to kill a partner. We recommend specialized training for legal professionals and increased use of family violence evidence to help ensure women's claims of self-defense receive appropriate responses from Victorian courts. © The Author(s) 2016.

  9. political killings in South Africa

    African Journals Online (AJOL)

    mainly occurred in KwaZulu-Natal, with a much smaller number occurring in Mpumalanga and ... Though the problem is concentrated in specific provinces it is likely to impact on political life ... killings that are the focus of the article, including.

  10. To kill a mockingbird robot

    NARCIS (Netherlands)

    Bartneck, C.; Verbunt, M.N.C.; Mubin, O.; Al Mahmud, A.

    2007-01-01

    Robots are being introduced in our society but their social status is still unclear. A critical issue is if the robot's exhibition of intelligent life-like behavior leads to the users' perception of animacy. The ultimate test for the life-likeness of a robot is to kill it. We therefore conducted an

  11. Killing horizons as equipotential hypersurfaces

    International Nuclear Information System (INIS)

    Smolić, Ivica

    2012-01-01

    In this note we present a new proof that Killing horizons are equipotential hypersurfaces for the electric and the magnetic scalar potential, which makes no use of gravitational field equations or the assumption about the existence of a bifurcation surface. (note)

  12. L’architecture du silence de la Shoah dans les fictions de Sylvie Germain

    Directory of Open Access Journals (Sweden)

    José Luis Arráez Llobregat

    2015-11-01

    Full Text Available Silences concerning the Shoah constitute a leitmotiv in Sylvie Germain’s narrative work. Motive and motivation intentionally emerge as a proteiform phenomenon from the writer-philosopher’s genius and from the historical and ideological substance, which imbue the novelist in every sec-tion of her literary creation. The pur-pose of this study is to interpret those silences in a set of selected novels where the Shoah takes up either a primary or a secondary role, but in any case a relevant one. To this end this study carries out a detailed study of the silence coming from the narrator’s origin, the victims, the murderers or God. Beyond the silence in humans and supreme beings, this study also investigates the spatial silence in that apocalyptic world.

  13. Identification and characterization of two RNA silencing suppressors encoded by ophioviruses

    NARCIS (Netherlands)

    Robles Luna, Gabriel; Reyes, Carina A.; Peña, Eduardo J.; Ocolotobiche, Eliana; Baeza, Cecilia; Borniego, Maria Belén; Kormelink, Richard; García, María Laura

    2017-01-01

    Citrus psorosis virus and Mirafiori lettuce big-vein virus are two members of the genus Ophiovirus, family Ophioviridae. So far, how these viruses can interfere in the antiviral RNA silencing pathway is not known. In this study, using a local GFP silencing assay on Nicotiana benthamiana, the

  14. Silence

    Science.gov (United States)

    Cogswell, J.

    2011-06-01

    On the occasion of the International Year of Astronomy, I was commissioned to create a mural for the University of Michigan Department of Astronomy, responding to an array of scientific images based on astronomical research, with special focus on the work of University of Michigan astronomers carried out within the building. My paper illustrates the development of this and several subsequent projects, explaining the implications for my artistic practice of entering into this conversation with astronomers and their work.

  15. Relationship between Organizational Mobbing and Silence Behavior among Teachers

    Science.gov (United States)

    Hüsrevsahi, Selda Polat

    2015-01-01

    This study mainly aims to investigate the correlation between teachers' exposure to mobbing in their workplaces and their display of the act of silence. This study is based on a survey design where data from 312 teachers were collected and analyzed using correlation and regression analyses. Specifically, "The Structure and Dimensions of…

  16. Characterization of immune response to killed leishmania major promastigotes plus BCG vaccine in Sudanese volunteers: a double-blind placebo controlled study

    International Nuclear Information System (INIS)

    Sati, Iman Nasr Eldin

    1996-12-01

    This work was examined whether intradermal immunization of healthy adult Sudanese volunteers with killed leishmania major (KLM) promastigotes plus BCG would induce antigen-specific T cell responses. Only healthy Sudanese volunteers with negative reactivity to leishmania skin test and with ≤20 mm induration of reactivity to purified protein derivative (PPD) were included in the trial. Group (A) (n=3): received a single dose (0.1ml) at a concentration of 10 mg protein of a whole cell component of KLM promastigotes/ml BCG, group (B) (n=12): received as a single dose of viable attenuated BCG alone (0.1 ml) at a concentration of 1 mg protein/ml diluent, group (C) (n=11): received the vaccine diluent only (Placebo) (o.1 ml). Study subjects were tested for their immunological and clinical responses before intervention, . Following vaccination 65% of group (A) subjects converted in their reactivity to leishmanin skin testing,non of the BCG vaccinated subjects converted in leishmanin skin test and only one subject of group (C) became leishmanin positive. Levels of Interferon-gamma (IFN-γ), interleukin-5 (IL-5) and interleukin-10 (IL-10) were measured by a double sandwich enzyme-linked immunosorbent assay (ELISA). A vaccine was considered as a positive responder in terms of cytokine production when the level of the produced cytokine was equal to the 80th percentile of the levels produced by the volunteers in the placebo group. 92% of the group vaccinated with KLM=BCG had circulating T cells. No significant of IL-5 or Il-10 was reported in any of the volunteers in the three group. Levels of anti l eishmania specific IgG were measured by ELISA in optical densities. Volunteers with mean antibody titre above the cut-off point (mean=3X standard deviation) were considered to have positive scores. Accordingly after vaccination 7.69% one volunteers in group (A) had a positive antibody response corresponding to 0% in the other two groups. No serious side effects were reported

  17. Selective killing of cancer cells by leaf extract of Ashwagandha: components, activity and pathway analyses.

    Science.gov (United States)

    Widodo, Nashi; Takagi, Yasuomi; Shrestha, Bhupal G; Ishii, Tetsuro; Kaul, Sunil C; Wadhwa, Renu

    2008-04-08

    Ashwagandha, also called as "Queen of Ayurveda" and "Indian ginseng", is a commonly used plant in Indian traditional medicine, Ayurveda. Its roots have been used as herb remedy to treat a variety of ailments and to promote general wellness. However, scientific evidence to its effects is limited to only a small number of studies. We had previously identified anti-cancer activity in the leaf extract (i-Extract) of Ashwagandha and demonstrated withanone as a cancer inhibitory factor (i-Factor). In the present study, we fractionated the i-Extract to its components by silica gel column chromatography and subjected them to cell based activity analyses. We found that the cancer inhibitory leaf extract (i-Extract) has, at least, seven components that could cause cancer cell killing; i-Factor showed the highest selectivity for cancer cells and i-Factor rich Ashwagandha leaf powder was non-toxic and anti-tumorigenic in mice assays. We undertook a gene silencing and pathway analysis approach and found that i-Extract and its components kill cancer cells by at least five different pathways, viz. p53 signaling, GM-CFS signaling, death receptor signaling, apoptosis signaling and G2-M DNA damage regulation pathway. p53 signaling was most common. Visual analysis of p53 and mortalin staining pattern further revealed that i-Extract, fraction F1, fraction F4 and i-Factor caused an abrogation of mortalin-p53 interactions and reactivation of p53 function while the fractions F2, F3, F5 work through other mechanisms.

  18. Alfalfa dwarf cytorhabdovirus P protein is a local and systemic RNA silencing supressor which inhibits programmed RISC activity and prevents transitive amplification of RNA silencing.

    Science.gov (United States)

    Bejerman, Nicolás; Mann, Krin S; Dietzgen, Ralf G

    2016-09-15

    Plants employ RNA silencing as an innate defense mechanism against viruses. As a counter-defense, plant viruses have evolved to express RNA silencing suppressor proteins (RSS), which target one or more steps of the silencing pathway. In this study, we show that the phosphoprotein (P) encoded by the negative-sense RNA virus alfalfa dwarf virus (ADV), a species of the genus Cytorhabdovirus, family Rhabdoviridae, is a suppressor of RNA silencing. ADV P has a relatively weak local RSS activity, and does not prevent siRNA accumulation. On the other hand, ADV P strongly suppresses systemic RNA silencing, but does not interfere with the short-distance spread of silencing, which is consistent with its lack of inhibition of siRNA accumulation. The mechanism of suppression appears to involve ADV P binding to RNA-induced silencing complex proteins AGO1 and AGO4 as shown in protein-protein interaction assays when ectopically expressed. In planta, we demonstrate that ADV P likely functions by inhibiting miRNA-guided AGO1 cleavage and prevents transitive amplification by repressing the production of secondary siRNAs. As recently described for lettuce necrotic yellows cytorhabdovirus P, but in contrast to other viral RSS known to disrupt AGO activity, ADV P sequence does not contain any recognizable GW/WG or F-box motifs, which suggests that cytorhabdovirus P proteins may use alternative motifs to bind to AGO proteins. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.

  19. How Silent is the Right to Silence?

    Directory of Open Access Journals (Sweden)

    Katherine Biber

    2012-11-01

    Full Text Available A long-held and fundamental principle of our criminal justice system is that people accused of crimes have a right to silence, arising from the presumption of innocence. Rules of evidence try to protect this ‘right’ during trial, by ensuring that juries understand that adverse inferences cannot be drawn from the silence of the accused. Silence, in court, can mean nothing, and we are not to speculate about what might motivate an accused person to remain silent, or what they might have said had they spoken. However, an examination of the jurisprudence in this area shows that the law is often not dealing with actual silence; sometimes when the law refers to the ‘right to silence’, it seems to mean a ‘refusal to hear’. In other instances, there is actual silence, and yet the law refuses to subject that silence to any critical interpretation, insisting that we cannot infer anything from it. While we have learned, from theatre, music, linguistics, religion and psychology, to develop sophisticated means for interpreting silence, the law demands that we set aside these interpretive tools, hearing silence that isn’t there, and inferring nothing about something.

  20. Tospovirus : induction and suppression of RNA silencing

    NARCIS (Netherlands)

    Hedil, Marcio

    2016-01-01

    While infecting their hosts, viruses must deal with host immunity. In plants the antiviral RNA silencing pathway is an important part of plant innate immunity. Tospoviruses are segmented negative-stranded RNA viruses of plants. To counteract the antiviral RNA silencing response in plants,

  1. Listen and the question of silence

    DEFF Research Database (Denmark)

    Doubinsky, Sebastien

    2018-01-01

    Listen is a film about words, but around words. The words become useless and are surrounded by silence. And the whole film is constructed on this silence, which builds up like an unbreakable wall. The question is thus: what are we listening to? What should we listen to? And maybe, even more crucial...

  2. Silencing of Taxol-Sensitizer Genes in Cancer Cells: Lack of Sensitization Effects

    International Nuclear Information System (INIS)

    Huang, Shang-Lang; Chao, Chuck C.-K.

    2015-01-01

    A previous genome-wide screening analysis identified a panel of genes that sensitize the human non-small-cell lung carcinoma cell line NCI-H1155 to taxol. However, whether the identified genes sensitize other cancer cells to taxol has not been examined. Here, we silenced the taxol-sensitizer genes identified (acrbp, atp6v0d2, fgd4, hs6st2, psma6, and tubgcp2) in nine other cancer cell types (including lung, cervical, ovarian, and hepatocellular carcinoma cell lines) that showed reduced cell viability in the presence of a sub-lethal concentration of taxol. Surprisingly, none of the genes studied increased sensitivity to taxol in the tested panel of cell lines. As observed in H1155 cells, SKOV3 cells displayed induction of five of the six genes studied in response to a cell killing dose of taxol. The other cell types were much less responsive to taxol. Notably, four of the five inducible taxol-sensitizer genes tested (acrbp, atp6v0d2, psma6, and tubgcp2) were upregulated in a taxol-resistant ovarian cancer cell line. These results indicate that the previously identified taxol-sensitizer loci are not conserved genetic targets involved in inhibiting cell proliferation in response to taxol. Our findings also suggest that regulation of taxol-sensitizer genes by taxol may be critical for acquired cell resistance to the drug

  3. Silencing of Taxol-Sensitizer Genes in Cancer Cells: Lack of Sensitization Effects

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Shang-Lang [Department of Biochemistry and Molecular Biology, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Chao, Chuck C.-K., E-mail: cckchao@mail.cgu.edu.tw [Department of Biochemistry and Molecular Biology, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Graduate Institute of Biomedical Sciences, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Department of Medical Research and Development, Chang Gung Memorial Hospital, Taoyuan 333, Taiwan (China)

    2015-06-16

    A previous genome-wide screening analysis identified a panel of genes that sensitize the human non-small-cell lung carcinoma cell line NCI-H1155 to taxol. However, whether the identified genes sensitize other cancer cells to taxol has not been examined. Here, we silenced the taxol-sensitizer genes identified (acrbp, atp6v0d2, fgd4, hs6st2, psma6, and tubgcp2) in nine other cancer cell types (including lung, cervical, ovarian, and hepatocellular carcinoma cell lines) that showed reduced cell viability in the presence of a sub-lethal concentration of taxol. Surprisingly, none of the genes studied increased sensitivity to taxol in the tested panel of cell lines. As observed in H1155 cells, SKOV3 cells displayed induction of five of the six genes studied in response to a cell killing dose of taxol. The other cell types were much less responsive to taxol. Notably, four of the five inducible taxol-sensitizer genes tested (acrbp, atp6v0d2, psma6, and tubgcp2) were upregulated in a taxol-resistant ovarian cancer cell line. These results indicate that the previously identified taxol-sensitizer loci are not conserved genetic targets involved in inhibiting cell proliferation in response to taxol. Our findings also suggest that regulation of taxol-sensitizer genes by taxol may be critical for acquired cell resistance to the drug.

  4. Evolution equations for Killing fields

    International Nuclear Information System (INIS)

    Coll, B.

    1977-01-01

    The problem of finding necessary and sufficient conditions on the Cauchy data for Einstein equations which insure the existence of Killing fields in a neighborhood of an initial hypersurface has been considered recently by Berezdivin, Coll, and Moncrief. Nevertheless, it can be shown that the evolution equations obtained in all these cases are of nonstrictly hyperbolic type, and, thus, the Cauchy data must belong to a special class of functions. We prove here that, for the vacuum and Einstein--Maxwell space--times and in a coordinate independent way, one can always choose, as evolution equations for the Killing fields, a strictly hyperbolic system: The above theorems can be thus extended to all Cauchy data for which the Einstein evolution problem has been proved to be well set

  5. Isolated Horizon, Killing Horizon and Event Horizon

    OpenAIRE

    Date, G.

    2001-01-01

    We consider space-times which in addition to admitting an isolated horizon also admit Killing horizons with or without an event horizon. We show that an isolated horizon is a Killing horizon provided either (1) it admits a stationary neighbourhood or (2) it admits a neighbourhood with two independent, commuting Killing vectors. A Killing horizon is always an isolated horizon. For the case when an event horizon is definable, all conceivable relative locations of isolated horizon and event hori...

  6. Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

    National Research Council Canada - National Science Library

    Issa, Jean-Pierre

    2004-01-01

    ...). In this project, we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases, and that reversal of silencing by decitabine...

  7. Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

    National Research Council Canada - National Science Library

    Issa, Jean-Pierre

    2005-01-01

    ...). In this project, we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases, and that reversal of silencing by decitabine...

  8. Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

    National Research Council Canada - National Science Library

    Issa, Jean-Pierre

    2006-01-01

    ...). In this project we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases and that reversal of silencing by decitabine...

  9. Midgut microbiota and host immunocompetence underlie Bacillus thuringiensis killing mechanism

    Science.gov (United States)

    Caccia, Silvia; Di Lelio, Ilaria; La Storia, Antonietta; Marinelli, Adriana; Varricchio, Paola; Franzetti, Eleonora; Banyuls, Núria; Tettamanti, Gianluca; Casartelli, Morena; Giordana, Barbara; Ferré, Juan; Gigliotti, Silvia; Pennacchio, Francesco

    2016-01-01

    Bacillus thuringiensis is a widely used bacterial entomopathogen producing insecticidal toxins, some of which are expressed in insect-resistant transgenic crops. Surprisingly, the killing mechanism of B. thuringiensis remains controversial. In particular, the importance of the septicemia induced by the host midgut microbiota is still debated as a result of the lack of experimental evidence obtained without drastic manipulation of the midgut and its content. Here this key issue is addressed by RNAi-mediated silencing of an immune gene in a lepidopteran host Spodoptera littoralis, leaving the midgut microbiota unaltered. The resulting cellular immunosuppression was characterized by a reduced nodulation response, which was associated with a significant enhancement of host larvae mortality triggered by B. thuringiensis and a Cry toxin. This was determined by an uncontrolled proliferation of midgut bacteria, after entering the body cavity through toxin-induced epithelial lesions. Consequently, the hemolymphatic microbiota dramatically changed upon treatment with Cry1Ca toxin, showing a remarkable predominance of Serratia and Clostridium species, which switched from asymptomatic gut symbionts to hemocoelic pathogens. These experimental results demonstrate the important contribution of host enteric flora in B. thuringiensis-killing activity and provide a sound foundation for developing new insect control strategies aimed at enhancing the impact of biocontrol agents by reducing the immunocompetence of the host. PMID:27506800

  10. Comparing Road-Kill Datasets from Hunters and Citizen Scientists in a Landscape Context

    OpenAIRE

    Florian Heigl; Carina R. Stretz; Wolfgang Steiner; Franz Suppan; Thomas Bauer; Gregor Laaha; Johann G. Zaller

    2016-01-01

    Road traffic has severe effects on animals, especially when road-kills are involved. In many countries, official road-kill data are provided by hunters or police; there are also road-kill observations reported by citizen scientists. The aim of the current study was to test whether road-kill reports by hunters stem from similar landscapes than those reported by citizen scientists. We analysed the surrounding landscapes of 712 road-kill reportings of European hares in the province of Lower Aust...

  11. Phylogenetic Studies of the Three RNA Silencing Suppressor Genes of South American CTV Isolates Reveal the Circulation of a Novel Genetic Lineage

    Directory of Open Access Journals (Sweden)

    María José Benítez-Galeano

    2015-07-01

    Full Text Available Citrus Tristeza Virus (CTV is the most economically important virus of citrus worldwide. Genetic diversity and population structure of CTV isolates from all citrus growing areas from Uruguay were analyzed by RT-PCR and cloning of the three RNA silencing suppressor genes (p25, p20 and p23. Bayesian phylogenetic analysis revealed the circulation of three known genotypes (VT, T3, T36 in the country, and the presence of a new genetic lineage composed by isolates from around the world, mainly from South America. Nucleotide and amino acid identity values for this new genetic lineage were both higher than 97% for the three analyzed regions. Due to incongruent phylogenetic relationships, recombination analysis was performed using Genetic Algorithms for Recombination Detection (GARD and SimPlot software. Recombination events between previously described CTV isolates were detected. High intra-sample variation was found, confirming the co-existence of different genotypes into the same plant. This is the first report describing: (1 the genetic diversity of Uruguayan CTV isolates circulating in the country and (2 the circulation of a novel CTV genetic lineage, highly present in the South American region. This information may provide assistance to develop an effective cross-protection program.

  12. 33 CFR 117.801 - Newtown Creek, Dutch Kills, English Kills and their tributaries.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Newtown Creek, Dutch Kills, English Kills and their tributaries. 117.801 Section 117.801 Navigation and Navigable Waters COAST GUARD....801 Newtown Creek, Dutch Kills, English Kills and their tributaries. (a) The following requirements...

  13. Strain Specific Factors Control Effector Gene Silencing in Phytophthora sojae.

    Directory of Open Access Journals (Sweden)

    Sirjana Devi Shrestha

    Full Text Available The Phytophthora sojae avirulence gene Avr3a encodes an effector that is capable of triggering immunity on soybean plants carrying the resistance gene Rps3a. P. sojae strains that express Avr3a are avirulent to Rps3a plants, while strains that do not are virulent. To study the inheritance of Avr3a expression and virulence towards Rps3a, genetic crosses and self-fertilizations were performed. A cross between P. sojae strains ACR10 X P7076 causes transgenerational gene silencing of Avr3a allele, and this effect is meiotically stable up to the F5 generation. However, test-crosses of F1 progeny (ACR10 X P7076 with strain P6497 result in the release of silencing of Avr3a. Expression of Avr3a in the progeny is variable and correlates with the phenotypic penetrance of the avirulence trait. The F1 progeny from a direct cross of P6497 X ACR10 segregate for inheritance for Avr3a expression, a result that could not be explained by parental imprinting or heterozygosity. Analysis of small RNA arising from the Avr3a gene sequence in the parental strains and hybrid progeny suggests that the presence of small RNA is necessary but not sufficient for gene silencing. Overall, we conclude that inheritance of the Avr3a gene silenced phenotype relies on factors that are variable among P. sojae strains.

  14. Killing-Yano tensors and Nambu mechanics

    International Nuclear Information System (INIS)

    Baleanu, D.

    1998-01-01

    Killing-Yano tensors were introduced in 1952 by Kentaro-Yano from mathematical point of view. The physical interpretation of Killing-Yano tensors of rank higher than two was unclear. We found that all Killing-Yano tensors η i 1 i 2 . .. i n with covariant derivative zero are Nambu tensors. We found that in the case of flat space case all Killing-Yano tensors are Nambu tensors. In the case of Taub-NUT and Kerr-Newmann metric Killing-Yano tensors of order two generate Nambu tensors of rank 3

  15. Silence as a Response to Everyday Violence

    DEFF Research Database (Denmark)

    Gammeltoft, Tine

    2016-01-01

    Across the world, existing research indicates that many women respond with silence to marital abuse. This article offers an ethnographic investigation of the social and psychic forces behind Vietnamese women’s silencing of violence and a theoretical exploration of how the psychoanalytic concept...... of fantasy—understood as unconscious or subconscious mental processes—may contribute to the analysis of everyday violence and psychic distress. Distinguishing between what I term deliberate and subconscious silence, I explore the role that fantasy plays when Vietnamese women silently endure intimate partner...

  16. Vertebrate road kill survey on a highway in southern Brazil

    Directory of Open Access Journals (Sweden)

    Luiz Liberato Costa Corrêa

    2017-06-01

    Full Text Available Highways are a major factor acting in the decline of several wildlife populations. Impact occurs due to the continuous flow of motor vehicles over tracks and collision with animals using the same area. This study aimed to list road killed wild vertebrates found in highways in the Pampa Biome, state of Rio Grande do Sul, over an entire year. The taxa found (amphibians, reptiles, birds and mammals were identified to species level and their frequency of occurrence was seasonally registered. Along 2,160 km, we found 318 road killed individuals, totaling 65 species. This number represents an average of 0.147 road killed specimens by kilometer (that is, 1 individual each 7 km. Of these, seven species are under threat of extinction in the state of Rio Grande do Sul. We also found a seasonal pattern among road kills, in which the highest number of road killed animals was registered in the summer and spring months. These results contribute to increase knowledge about which species are most impacted by road kill on highways of the Pampa Biome. Such data can be used as an indicator for the implementation of measures by competent bodies to mitigate impacts of highways in the state of Rio Grande do Sul.

  17. Adaptation of the Four Forms of Employee Silence Scale in a Polish sample

    Directory of Open Access Journals (Sweden)

    Krystyna Adamska

    2017-06-01

    Full Text Available Background Silence is understood as a decision not to speak up in situations of observed irregularities both in productivity and ethics. The study examined the validity of the Four Forms of Employee Silence Scale (FFESS in the Polish population. The scale is a four-factor measure designed to capture differently motivated tendencies to be silent in organizations. The scale distinguishes acquiescent, quiescent, prosocial and opportunistic silence. Employee silence has been linked to many important individual outcomes: failure to react to ethical transgressions, stress and depression, and lower creativity and productivity. Participants and procedure A total of 1044 employees of various organizations working for at least six months at a given position provided the responses for the validation study. Results The results confirmed the superiority of the four-factor model shown by adequate fit indexes: The FFESS has adequate internal consistency at both the scale and item levels. The criterion-related validity of the scale was established by correlating four forms of silence with measures of emotional attitude toward organization, procedural justice, relational contract and turnover intention. Conclusions The four forms of employee silence are empirically distinct concepts in the Polish sample. The scale may be used as the measurement of individual differences. It can also serve as a tool for diagnosing a climate of silence in an organization.

  18. The physics of chromatin silencing: Bi-stability and front propagation

    Science.gov (United States)

    Sedighi, Mohammad

    A mean-field dynamical model of chromatin silencing in budding yeast is provided and the conditions giving rise to two states: one silenced and another un-silenced, is studied. Based on these conditions, the space of control parameters is divided into two distinct regions of mono-stable and bi-stable solutions (the bifurcation diagram). Then, considering both the discrete and continuous versions of the model, the formation of a stable boundary between the silenced and un-silenced areas on DNA is investigated. As a result, a richer phase diagram is provided. The dynamics of the boundary is also studied under different conditions. Consequently, assuming negative feedback due to possible depletion of silencing proteins, the model explains a paradoxical epigenetic behavior of yeast that happens under some mutation. A stochastic treatment of the model is also considered to verify the results of the mean-field approximation and also to understand the role of intrinsic noise at single cell level. This model could be used as a general guide to discuss chromatin silencing in many organisms.

  19. Designing Antibacterial Peptides with Enhanced Killing Kinetics

    Directory of Open Access Journals (Sweden)

    Faiza H. Waghu

    2018-02-01

    Full Text Available Antimicrobial peptides (AMPs are gaining attention as substitutes for antibiotics in order to combat the risk posed by multi-drug resistant pathogens. Several research groups are engaged in design of potent anti-infective agents using natural AMPs as templates. In this study, a library of peptides with high sequence similarity to Myeloid Antimicrobial Peptide (MAP family were screened using popular online prediction algorithms. These peptide variants were designed in a manner to retain the conserved residues within the MAP family. The prediction algorithms were found to effectively classify peptides based on their antimicrobial nature. In order to improve the activity of the identified peptides, molecular dynamics (MD simulations, using bilayer and micellar systems could be used to design and predict effect of residue substitution on membranes of microbial and mammalian cells. The inference from MD simulation studies well corroborated with the wet-lab observations indicating that MD-guided rational design could lead to discovery of potent AMPs. The effect of the residue substitution on membrane activity was studied in greater detail using killing kinetic analysis. Killing kinetics studies on Gram-positive, negative and human erythrocytes indicated that a single residue change has a drastic effect on the potency of AMPs. An interesting outcome was a switch from monophasic to biphasic death rate constant of Staphylococcus aureus due to a single residue mutation in the peptide.

  20. Small RNA-Mediated Epigenetic Myostatin Silencing

    Directory of Open Access Journals (Sweden)

    Thomas C Roberts

    2012-01-01

    Full Text Available Myostatin (Mstn is a secreted growth factor that negatively regulates muscle mass and is therefore a potential pharmacological target for the treatment of muscle wasting disorders such as Duchenne muscular dystrophy. Here we describe a novel Mstn blockade approach in which small interfering RNAs (siRNAs complementary to a promoter-associated transcript induce transcriptional gene silencing (TGS in two differentiated mouse muscle cell lines. Silencing is sensitive to treatment with the histone deacetylase inhibitor trichostatin A, and the silent state chromatin mark H3K9me2 is enriched at the Mstn promoter following siRNA transfection, suggesting epigenetic remodeling underlies the silencing effect. These observations suggest that long-term epigenetic silencing may be feasible for Mstn and that TGS is a promising novel therapeutic strategy for the treatment of muscle wasting disorders.

  1. The VP3 factor from viruses of Birnaviridae family suppresses RNA silencing by binding both long and small RNA duplexes.

    Directory of Open Access Journals (Sweden)

    Adrian Valli

    Full Text Available RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.

  2. The VP3 factor from viruses of Birnaviridae family suppresses RNA silencing by binding both long and small RNA duplexes.

    Science.gov (United States)

    Valli, Adrian; Busnadiego, Idoia; Maliogka, Varvara; Ferrero, Diego; Castón, José R; Rodríguez, José Francisco; García, Juan Antonio

    2012-01-01

    RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV) displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.

  3. Public privacy: Reciprocity and Silence

    Directory of Open Access Journals (Sweden)

    Jenny Kennedy

    2014-10-01

    Full Text Available In his 1958 poem 'Dedication to my Wife' TS Eliot proclaims "these are private words addressed to you in public". Simultaneously written for his wife, Valerie Fletcher, and to the implied you of a discourse network, Eliot's poem helps to illustrate the narrative voices and silences that are constitutive of an intimate public sphere. This paper situates reciprocity as a condition of possibility for public privacy. It shows how reciprocity is enabled by systems of code operating through material and symbolic registers. Code promises to control communication, to produce neutral, systemic forms of meaning. Yet such automation is challenged by uneven and fragmented patterns of reciprocity. Moreover, examining the media of public privacy reveals historical trajectories important for understanding contemporary socio­technical platforms of reciprocity. To explore the implicit requirement of reciprocity in publicly private practices, three sites of communication are investigated framed by a media archaeology perspective: postal networks, the mail­art project PostSecret and the anonymous zine 'You'.

  4. RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops.

    Science.gov (United States)

    Guo, Qigao; Liu, Qing; Smith, Neil A; Liang, Guolu; Wang, Ming-Bo

    2016-12-01

    Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing artificial RNA silencing technologies such as hairpin RNA, artificial microRNA, intrinsic direct repeat, 3' UTR inverted repeat, artificial trans-acting siRNA, and virus-induced gene silencing technologies. Some of these RNA silencing technologies, such as the hairpin RNA technology, have already been widely used for genetic improvement of crop plants in agriculture. For horticultural plants, RNA silencing technologies have been used to increase disease and pest resistance, alter plant architecture and flowering time, improve commercial traits of fruits and flowers, enhance nutritional values, remove toxic compounds and allergens, and develop high-value industrial products. In this article we aim to provide an overview of the RNA silencing pathways in plants, summarize the existing RNA silencing technologies, and review the current progress in applying these technologies for the improvement of agricultural crops particularly horticultural crops.

  5. Durability of timber silencers at Wairakei geothermal steam field

    Energy Technology Data Exchange (ETDEWEB)

    Hedley, M E

    1979-02-01

    After early failures of reinforced concrete silencers and because of high costs of concrete-lined steel structures, preliminary tests were undertaken to assess the suitability of timber for silencer construction. Tests indicated that radiata pine treated with pentachlorophenol/oil or untreated red beech had most potential for timber silencer fabrication. One prototype silencer of each material was constructed and both were installed on operational bores in 1965. The red beech silencer had a service life of 4 years. The radiata pine silencer operated for 12/sup 1///sub 2/ years, although replacement had been recommended 1 year before this time expired. The performance of this silencer encouraged the general use of timber for silencer construction and further units were built. Procurement of satisfactory grades of timber has proved difficult and has limited silencer fabrication. Ways of improving timber supply, which require modification of silencer design, are discussed.

  6. Driving in unheard silence: Disability and the politics of shutting up.

    Science.gov (United States)

    Lourens, Heidi

    2018-03-01

    The politics of silence is central to disability experience and the field of disability studies. In this analytical autoethnography, I write about my silences as a visually impaired woman. I explore and make sense of personal life stories through a theoretical perspective. The analysis of these personal experiences lead me to argue that disability-related silences are mostly created through the confluence of inaccessible physical and social environments and the psychological internalisation of these worlds. I also discuss the ways in which I am currently regaining my voice. Further research on resistance by disabled persons is recommended.

  7. The 1990 Arthur Kill oil spills

    International Nuclear Information System (INIS)

    Astor, P.H.

    1990-01-01

    On January 1-2, 1990, Exxon discharged 567,000 gallons of No. 2 heating oil in the Arthur Kill, the strait separating Staten Island, New York from New Jersey. Lawsuits against Exxon were filed by the State of New Jersey, New York City, and the City of Elizabeth. They seek to force Exxon to reimburse the municipalities and the state for cleanup costs and to restore damaged wetlands and other natural resources. The three plaintiffs, joined by New York State and the federal government, initiated a three-tiered natural resource damage assessment study (Tier II), currently underway, includes sampling and chemical analysis of sediments and benthic invertebrates, mapping of impacted wetlands and measurement of direct impacts on water birds and their prey. The purposes of the study are to quantify the damages and determine the presence of Exxon's oil in the sediments. Since the Exxon spill, there have been two major spills and an intermediate-size spill. During the first size months of 1990, over one million gallons of petroleum products have been discharged into the Arthur Kill and nearby waters. This paper reports that a review of these incidents provides lessons for the prevention, investigation, and cleanup of spills in urban estuaries

  8. A comparison study on of tumor cell-killing effects between low-dose-rate β-irradiation of 32P and γ-irradiation of 60Co

    International Nuclear Information System (INIS)

    Feng Huiru; Tian Jiahe; Ding Weimin; Zhang Jinming; Chen Yingmao

    2004-01-01

    The paper is to elucidate radiobiological characteristics and radiobiological mechanism in killing tumor cells with low dose rate β-rays and high dose rate γ-rays. HeLa cells were exposed to low-rate β-irradiation of 32 P or high-dose-rate γ-irradiation of 60 Co. Cell response-patterns were compared between two the types of radiations in terms of their inhibition of cell proliferation and cell cycle blockage, evaluated by trypanblue excluded method and flow cytometry, respectively. Results show that there is a different way in growth inhibition effect on HeLa cells between low-dose-rate irradiation of 32 P and high-dose-rate irradiation of 60 Co γ. In exposure to 32 P, the inhibition of cell proliferation in HeLa cell was a prolong course, whereas and the effect was in a more serious and quick way in 60 Co irradiation. Cell cycle arrest in G 2 phase induced by 32 P was lower and more prolong than that induced by 60 Co. The inhibition effect on tumor cells between the two types of radiations is different. Impaired DNA repair system by continuous low-dose-rate radiation might contribute to the final radiation effect of 32 P

  9. Calcium signalling silencing in atrial fibrillation.

    Science.gov (United States)

    Greiser, Maura

    2017-06-15

    Subcellular calcium signalling silencing is a novel and distinct cellular and molecular adaptive response to rapid cardiac activation. Calcium signalling silencing develops during short-term sustained rapid atrial activation as seen clinically during paroxysmal atrial fibrillation (AF). It is the first 'anti-arrhythmic' adaptive response in the setting of AF and appears to counteract the maladaptive changes that lead to intracellular Ca 2+ signalling instability and Ca 2+ -based arrhythmogenicity. Calcium signalling silencing results in a failed propagation of the [Ca 2+ ] i signal to the myocyte centre both in patients with AF and in a rabbit model. This adaptive mechanism leads to a substantial reduction in the expression levels of calcium release channels (ryanodine receptors, RyR2) in the sarcoplasmic reticulum, and the frequency of Ca 2+ sparks and arrhythmogenic Ca 2+ waves remains low. Less Ca 2+ release per [Ca 2+ ] i transient, increased fast Ca 2+ buffering strength, shortened action potentials and reduced L-type Ca 2+ current contribute to a substantial reduction of intracellular [Na + ]. These features of Ca 2+ signalling silencing are distinct and in contrast to the changes attributed to Ca 2+ -based arrhythmogenicity. Some features of Ca 2+ signalling silencing prevail in human AF suggesting that the Ca 2+ signalling 'phenotype' in AF is a sum of Ca 2+ stabilizing (Ca 2+ signalling silencing) and Ca 2+ destabilizing (arrhythmogenic unstable Ca 2+ signalling) factors. Calcium signalling silencing is a part of the mechanisms that contribute to the natural progression of AF and may limit the role of Ca 2+ -based arrhythmogenicity after the onset of AF. © 2017 The Authors. The Journal of Physiology © 2017 The Physiological Society.

  10. Identifying Silence Climate in Organizations in the Framework of Contemporary Management Approaches

    Directory of Open Access Journals (Sweden)

    Mustafa Emre Civelek

    2015-10-01

    Full Text Available Dynamic competition conditions in present day, bring about the consequence for businesses to face varied problems with each passing day. At this point, current management approaches include studies that would shed light on the new problems of businesses. Organizational Silence, a concept that has recently been being voiced in business world, has come up in such context. Organizational silence could be expressed as the employee behavior of keeping silent about certain negativities due to various reasons in an organization. Since knowledge sharing in modern organizations is of capital importance in terms of responding hastily to the changes in a competitive environment, spread of this behavior of employees to organization culture and climate presents a threat of indifference. In this study, the concept of Organizational Silence is defined and the effects of conceived silence climate on management of organizations are discussed.

  11. Identifying Silence Climate in Organizations in the Framework of Contemporary Management Approaches

    Directory of Open Access Journals (Sweden)

    Mustafa Emre Civelek

    2015-12-01

    Full Text Available Dynamic competition conditions in present day bring about the consequence for businesses to face varied problems with each passing day. At this point, current management approaches include studies that would shed light on the new problems of businesses. Organizational Silence, a concept that has recently been being voiced in business world, has come up in such context. Organizational silence could be expressed as the employee behavior of keeping silent about certain negativities due to various reasons in an organization. Since knowledge sharing in modern organizations is of capital importance in terms of responding hastily to the changes in a competitive environment, spread of this behavior of employees to organization culture and climate presents a threat of indifference. In this study, the concept of Organizational Silence is defined and the effects of conceived silence climate on management of organizations are discussed.

  12. Competition between apex predators? Brown bears decrease wolf kill rate on two continents.

    Science.gov (United States)

    Tallian, Aimee; Ordiz, Andrés; Metz, Matthew C; Milleret, Cyril; Wikenros, Camilla; Smith, Douglas W; Stahler, Daniel R; Kindberg, Jonas; MacNulty, Daniel R; Wabakken, Petter; Swenson, Jon E; Sand, Håkan

    2017-02-08

    Trophic interactions are a fundamental topic in ecology, but we know little about how competition between apex predators affects predation, the mechanism driving top-down forcing in ecosystems. We used long-term datasets from Scandinavia (Europe) and Yellowstone National Park (North America) to evaluate how grey wolf ( Canis lupus ) kill rate was affected by a sympatric apex predator, the brown bear ( Ursus arctos ). We used kill interval (i.e. the number of days between consecutive ungulate kills) as a proxy of kill rate. Although brown bears can monopolize wolf kills, we found no support in either study system for the common assumption that they cause wolves to kill more often. On the contrary, our results showed the opposite effect. In Scandinavia, wolf packs sympatric with brown bears killed less often than allopatric packs during both spring (after bear den emergence) and summer. Similarly, the presence of bears at wolf-killed ungulates was associated with wolves killing less often during summer in Yellowstone. The consistency in results between the two systems suggests that brown bear presence actually reduces wolf kill rate. Our results suggest that the influence of predation on lower trophic levels may depend on the composition of predator communities. © 2017 The Authors.

  13. A case study of an unknown mass grave - Hostages killed 70 years ago by a Nazi firing squad identified thanks to genetics.

    Science.gov (United States)

    Ossowski, Andrzej; Diepenbroek, Marta; Zwolski, Marcin; Falis, Adam; Wróbel, Maria; Bykowska-Witowska, Milena; Zielińska, Grażyna; Szargut, Maria; Kupiec, Tomasz

    2017-09-01

    Almost 6 million people died in Poland during the Nazi occupation and about 570 thousand during the Soviet occupation. But the end of the war was not the end of the trauma. Historians estimate that at least 30 thousand people were killed during the Stalinist regime in Poland. In 2012 the Institute of National Remembrance started to search for hidden burials of victims of communism. Many exhumations were carried out under the project. One of them took place in Białystok, eastern Poland. According to information gathered by local historians, a detention centre in the heart of city was the place of secret burials of victims of the communist regime. During the exhumation work a burial pit with the remains of 24 victims was found. It's characteristics supported the hypothesis that these people were shot on the spot, in a mass execution during the Nazi occupation. Historians knew of only one such execution, but its victims - according to the available records - were supposed to have been exhumed at the end of the war. Exhumation works and the discovery of the discussed mass grave put in question the events of 1944, which would have been impossible without the field work. The first identifications confirmed the doubts of historians, since both the results of genetic profiling and the conducted anthropological analysis revealed that at the end of the war a mistake was made, and bodies other than those suspected had been exhumed. Having established this fact, the mass grave created at that time should be investigated to reveal the identity of the remains uncovered then. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Prairie dogs increase fitness by killing interspecific competitors.

    Science.gov (United States)

    Hoogland, John L; Brown, Charles R

    2016-03-30

    Interspecific competition commonly selects for divergence in ecology, morphology or physiology, but direct observation of interspecific competition under natural conditions is difficult. Herbivorous white-tailed prairie dogs (Cynomys leucurus) employ an unusual strategy to reduce interspecific competition: they kill, but do not consume, herbivorous Wyoming ground squirrels (Urocitellus elegans) encountered in the prairie dog territories. Results from a 6-year study in Colorado, USA, revealed that interspecific killing of ground squirrels by prairie dogs was common, involving 47 different killers; 19 prairie dogs were serial killers in the same or consecutive years, and 30% of female prairie dogs killed at least one ground squirrel over their lifetimes. Females that killed ground squirrels had significantly higher annual and lifetime fitness than non-killers, probably because of decreased interspecific competition for vegetation. Our results document the first case of interspecific killing of competing individuals unrelated to predation (IK) among herbivorous mammals in the wild, and show that IK enhances fitness for animals living under natural conditions. © 2016 The Author(s).

  15. Development of a virus-induced gene silencing (VIGS) system for Spinacia oleracea L

    DEFF Research Database (Denmark)

    Lee, Jungmin; Cao, Dang Viet; Kim, Jiwon

    2017-01-01

    Virus-induced gene silencing (VIGS) is known as a rapid and efficient system for studying functions of interesting genes in plants. Tobacco rattle virus (TRV) is widely applied for the gene silencing of many plants. Although spinach is a TRV-susceptible plant, a TRV-based VIGS system has not yet ...

  16. Conifers have a unique small RNA silencing signature.

    Science.gov (United States)

    Dolgosheina, Elena V; Morin, Ryan D; Aksay, Gozde; Sahinalp, S Cenk; Magrini, Vincent; Mardis, Elaine R; Mattsson, Jim; Unrau, Peter J

    2008-08-01

    Plants produce small RNAs to negatively regulate genes, viral nucleic acids, and repetitive elements at either the transcriptional or post-transcriptional level in a process that is referred to as RNA silencing. While RNA silencing has been extensively studied across the different phyla of the animal kingdom (e.g., mouse, fly, worm), similar studies in the plant kingdom have focused primarily on angiosperms, thus limiting evolutionary studies of RNA silencing in plants. Here we report on an unexpected phylogenetic difference in the size distribution of small RNAs among the vascular plants. By extracting total RNA from freshly growing shoot tissue, we conducted a survey of small RNAs in 24 vascular plant species. We find that conifers, which radiated from the other seed-bearing plants approximately 260 million years ago, fail to produce significant amounts of 24-nucleotide (nt) RNAs that are known to guide DNA methylation and heterochromatin formation in angiosperms. Instead, they synthesize a diverse population of small RNAs that are exactly 21-nt long. This finding was confirmed by high-throughput sequencing of the small RNA sequences from a conifer, Pinus contorta. A conifer EST search revealed the presence of a novel Dicer-like (DCL) family, which may be responsible for the observed change in small RNA expression. No evidence for DCL3, an enzyme that matures 24-nt RNAs in angiosperms, was found. We hypothesize that the diverse class of 21-nt RNAs found in conifers may help to maintain organization of their unusually large genomes.

  17. The great silence science and philosophy of Fermi's paradox

    CERN Document Server

    Cirkovic, Milan M

    2018-01-01

    The Great Silence explores the multifaceted problem named after the great Italian physicist Enrico Fermi and his legendary 1950 lunchtime question "Where is everybody?" In many respects, Fermi's paradox is the richest and the most challenging problem for the entire field of astrobiology and the Search for ExtraTerrestrial Intelligence (SETI) studies. This book shows how Fermi's paradox is intricately connected with many fields of learning, technology, arts, and even everyday life. It aims to establish the strongest possible version of the problem, to dispel many related confusions, obfuscations, and prejudices, as well as to offer a novel point of entry to the many solutions proposed in existing literature. Cirkovic argues that any evolutionary worldview cannot avoid resolving the Great Silence problem in one guise or another.

  18. Engineering nanoparticles to silence bacterial communication

    Directory of Open Access Journals (Sweden)

    Kristen Publicover Miller

    2015-03-01

    Full Text Available The alarming spread of bacterial resistance to traditional antibiotics has warranted the study of alternative antimicrobial agents. Quorum sensing is a chemical cell-to-cell communication mechanism utilized by bacteria to coordinate group behaviors and establish infections. Quorum sensing is integral to bacterial survival, and therefore provides a unique target for antimicrobial therapy. In this study, silicon dioxide nanoparticles (Si-NP were engineered to target the signaling molecules (i.e. acylhomoserine lactones (HSL used for quorum sensing in order to halt bacterial communication. Specifically, when Si-NP were surface functionalized with beta-cyclodextrin (beta-CD, then added to cultures of bacteria (Vibrio fischeri, whose luminous output depends upon HSL-mediated quorum sensing, the cell-to-cell communication was dramatically reduced. Reductions in luminescence were further verified by quantitative polymerase chain reaction (qPCR analyses of luminescence genes. Binding of AHLs to Si-NPs was examined using nuclear magnetic resonance (NMR spectroscopy. The results indicated that by delivering high concentrations of engineered NPs with associated quenching compounds, the chemical signals were removed from the immediate bacterial environment. In actively-metabolizing cultures, this treatment blocked the ability of bacteria to communicate and regulate quorum sensing, effectively silencing and isolating the cells. Si-NPs provide a scaffold and critical stepping-stone for more pointed developments in antimicrobial therapy, especially with regard to quorum sensing – a target that will reduce resistance pressures imposed by traditional antibiotics.

  19. The Application of Coconut Fiber as Dissipative Silencer

    Science.gov (United States)

    Madlan, M. A.; Ghazali, M. I.; Zaman, I.; Kasron, M. Z.; Ying, T. C.

    2017-01-01

    Heat ventilation air conditioning system (HVAC) is one of the ducting systems that broadly applied in the building. There are HVAC silencers in the market, however the sound absorptive material commonly used is mineral wool. In this research study, a sound absorptive material made of coconut fiber was tested to identify its performance as a potential replacement of green material for ducting silencer. The experiment was carried out in a testing apparatus that follows the BS EN ISO 11691:2009 standard. Different configurations of sound absorptive material and contents of coconut fiber were investigated in the study. The trend of insertion loss at 1/3 octave frequency was identified where at frequency below 3000Hz, the insertion loss of dissipative silencer is observed high at certain frequency with a very narrow range. At 3000Hz, the insertion loss of 4dB to 6dB is constant until 4000Hz and drops until 5000Hz before it increases again steadily up to 13dB at 10000Hz. A similar trend was observed for different configuration of sound absorptive material. Despite the configuration different, the outcome shows that the insertion loss is increasing with higher content of coconut fiber.

  20. MicroRNA-Mediated Myostatin Silencing in Caprine Fetal Fibroblasts

    Science.gov (United States)

    Zhong, Bushuai; Zhang, Yanli; Yan, Yibo; Wang, Ziyu; Ying, Shijia; Huang, Mingrui; Wang, Feng

    2014-01-01

    Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi) mediated by microRNAs (miRNAs) is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF) was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN) response genes, such as interferon beta (IFN-β) and 2′-5′-oligoadenylate synthetase 2 (OAS2), were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats. PMID:25244645

  1. MicroRNA-mediated myostatin silencing in caprine fetal fibroblasts.

    Directory of Open Access Journals (Sweden)

    Bushuai Zhong

    Full Text Available Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi mediated by microRNAs (miRNAs is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN response genes, such as interferon beta (IFN-β and 2'-5'-oligoadenylate synthetase 2 (OAS2, were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats.

  2. The number of killings in southern rural Norway, 1300–1569

    OpenAIRE

    Kadane, Joseph B.; Næshagen, Ferdinand L.

    2013-01-01

    Three dual systems estimates are employed to study the number of killings in southern rural Norway in a period of slightly over 250 years. The first system is a set of five letters sent to each killer as part of the legal process. The second system is the mention of killings from all other contemporary sources. The posterior distributions derived suggest fewer such killings than rough demographic estimates.

  3. On integrability of the Killing equation

    Science.gov (United States)

    Houri, Tsuyoshi; Tomoda, Kentaro; Yasui, Yukinori

    2018-04-01

    Killing tensor fields have been thought of as describing the hidden symmetry of space(-time) since they are in one-to-one correspondence with polynomial first integrals of geodesic equations. Since many problems in classical mechanics can be formulated as geodesic problems in curved space and spacetime, solving the defining equation for Killing tensor fields (the Killing equation) is a powerful way to integrate equations of motion. Thus it has been desirable to formulate the integrability conditions of the Killing equation, which serve to determine the number of linearly independent solutions and also to restrict the possible forms of solutions tightly. In this paper, we show the prolongation for the Killing equation in a manner that uses Young symmetrizers. Using the prolonged equations, we provide the integrability conditions explicitly.

  4. Antibacterial surface design - Contact kill

    Science.gov (United States)

    Kaur, Rajbir; Liu, Song

    2016-08-01

    Designing antibacterial surfaces has become extremely important to minimize Healthcare Associated Infections which are a major cause of mortality worldwide. A previous biocide-releasing approach is based on leaching of encapsulated biocides such as silver and triclosan which exerts negative impacts on the environment and potentially contributes to the development of bacterial resistance. This drawback of leachable compounds led to the shift of interest towards a more sustainable and environmentally friendly approach: contact-killing surfaces. Biocides that can be bound onto surfaces to give the substrates contact-active antibacterial activity include quaternary ammonium compounds (QACs), quaternary phosphoniums (QPs), carbon nanotubes, antibacterial peptides, and N-chloramines. Among the above, QACs and N-chloramines are the most researched contact-active biocides. We review the engineering of contact-active surfaces using QACs or N-chloramines, the modes of actions as well as the test methods. The charge-density threshold of cationic surfaces for desired antibacterial efficacy and attempts to combine various biocides for the generation of new contact-active surfaces are discussed in detail. Surface positive charge density is identified as a key parameter to define antibacterial efficacy. We expect that this research field will continue to attract more research interest in view of the potential impact of self-disinfective surfaces on healthcare-associated infections, food safety and corrosion/fouling resistance required on industrial surfaces such as oil pipes and ship hulls.

  5. Germ killing by ultraviolet radiation

    International Nuclear Information System (INIS)

    Wawrik, O.

    1975-01-01

    Short-wave UV radiation, in particular the range about 250 nm, has a high germ reducing effect. Corresponding UV burners which above all emit radiation at the line of 254 nm can therefore be used effectively in all cases where the least possible content of germs in the air is aimed at. Apart from this it is also possible to reduce by this process the germs on surfaces and liquids. Especially in the most various ranges of pharmaceutical production one is steadily striving for efficient and last not least economic procedures by which it is possible to reduce the germs present in the air of a room. Numerous scientific investigations have sufficiently proved that short-wave UV radiation is extremely well appropriate for such purposes. Absolutely germ-free air in a room can only be obtained under laboratory conditions. In practice, however, the aim is not to achieve a 100 per cent killing of the germs present in a room but to make sure that the germ rate in certain rooms is constantly reduced to the lowest possible level. If in this connection it is referred to a germ reduction of 100 or 99 per cent this is but theory. (orig.) [de

  6. Opinions of university students on honour killings: Perspective from Islamabad and Rawalpindi.

    Science.gov (United States)

    Shaikh, Masood Ali; Kamal, Anila; Naqvi, Irum

    2015-04-01

    Honour killing incidents have been reported from every province of Pakistan. In 2014 a pregnant woman was killed in front of Lahore High Court, by her family members, in the name of honour. This study was conducted to determine the perspective of university students on honour killing with specific reference to one such killing incident in Lahore. Cumulatively, 989 students participated in the survey. Compared with female students, male students were less likely to agree and were more unequivocal that a woman has a right to marry any man she wants despite her family's disapproval, in a statistically significant manner. Similarly, male students were statistically significantly more likely to report that killing in the name of honour is always justified and were less equivocal about it compared to female students. Nonetheless, cumulatively 824 (83.3%) students believed that killing in the name of honour is not always justified.

  7. γ-rays kill grasshopper primary spermatocytes in groups

    International Nuclear Information System (INIS)

    Al-Taweel, A.A.; Shawkit, M.A.; Fox, D.P.

    1985-01-01

    Primary spermatocyte killing by γ-rays was studied in the grasshopper Heteracris littoralis in which spermatogenic development occurs in cysts containing a maximum of 64 cells during the first meiotic division. Cell killing at this stage is not random and mainly involves the death of whole cysts. The dose-response curve for cell killing has complex kinetics with at least two components but lacks any shoulder at low doses, thus indicating no repair of the lethal damage. Cell loss is apparent from surviving cysts as early as 45 min post irradiation but loss of > 24 cells is incompatible with cyst survival. Loss of fewer than 24 cells also is not random since certain values for cell loss are frequently observed while other, interspersed values are not seen at all. (Auth.)

  8. Supervised learning classification models for prediction of plant virus encoded RNA silencing suppressors.

    Directory of Open Access Journals (Sweden)

    Zeenia Jagga

    Full Text Available Viral encoded RNA silencing suppressor proteins interfere with the host RNA silencing machinery, facilitating viral infection by evading host immunity. In plant hosts, the viral proteins have several basic science implications and biotechnology applications. However in silico identification of these proteins is limited by their high sequence diversity. In this study we developed supervised learning based classification models for plant viral RNA silencing suppressor proteins in plant viruses. We developed four classifiers based on supervised learning algorithms: J48, Random Forest, LibSVM and Naïve Bayes algorithms, with enriched model learning by correlation based feature selection. Structural and physicochemical features calculated for experimentally verified primary protein sequences were used to train the classifiers. The training features include amino acid composition; auto correlation coefficients; composition, transition, and distribution of various physicochemical properties; and pseudo amino acid composition. Performance analysis of predictive models based on 10 fold cross-validation and independent data testing revealed that the Random Forest based model was the best and achieved 86.11% overall accuracy and 86.22% balanced accuracy with a remarkably high area under the Receivers Operating Characteristic curve of 0.95 to predict viral RNA silencing suppressor proteins. The prediction models for plant viral RNA silencing suppressors can potentially aid identification of novel viral RNA silencing suppressors, which will provide valuable insights into the mechanism of RNA silencing and could be further explored as potential targets for designing novel antiviral therapeutics. Also, the key subset of identified optimal features may help in determining compositional patterns in the viral proteins which are important determinants for RNA silencing suppressor activities. The best prediction model developed in the study is available as a

  9. Silencing of the rotavirus NSP4 protein decreases the incidence of biliary atresia in murine model.

    Directory of Open Access Journals (Sweden)

    Jiexiong Feng

    Full Text Available Biliary atresia is a common disease in neonates which causes obstructive jaundice and progressive hepatic fibrosis. Our previous studies indicate that rotavirus infection is an initiator in the pathogenesis of experimental biliary atresia (BA through the induction of increased nuclear factor-kappaB and abnormal activation of the osteopontin inflammation pathway. In the setting of rotavirus infection, rotavirus nonstructural protein 4 (NSP4 serves as an important immunogen, viral protein 7 (VP7 is necessary in rotavirus maturity and viral protein 4 (VP4 is a virulence determiner. The purpose of the current study is to clarify the roles of NSP4, VP7 and VP4 in the pathogenesis of experimental BA. Primary cultured extrahepatic biliary epithelia were infected with Rotavirus (mmu18006. Small interfering RNA targeting NSP4, VP7 or VP4 was transfected before rotavirus infection both in vitro and in vivo. We analyzed the incidence of BA, morphological change, morphogenesis of viral particles and viral mRNA and protein expression. The in vitro experiments showed NSP4 silencing decreased the levels of VP7 and VP4, reduced viral particles and decreased cytopathic effect. NSP4-positive cells had strongly positive expression of integrin subunit α2. Silencing of VP7 or VP4 partially decreased epithelial injury. Animal experiments indicated after NSP4 silencing, mouse pups had lower incidence of BA than after VP7 or VP4 silencing. However, 33.3% of VP4-silenced pups (N = 6 suffered BA and 50% of pups (N = 6 suffered biliary injury after VP7 silencing. Hepatic injury was decreased after NSP4 or VP4 silencing. Neither VP4 nor VP7 were detected in the biliary ducts after NSP4. All together, NSP4 silencing down-regulates VP7 and VP4, resulting in decreased incidence of BA.

  10. Optical silencing of C. elegans cells with arch proton pump.

    Directory of Open Access Journals (Sweden)

    Ayako Okazaki

    Full Text Available BACKGROUND: Optogenetic techniques using light-driven ion channels or ion pumps for controlling excitable cells have greatly facilitated the investigation of nervous systems in vivo. A model organism, C. elegans, with its small transparent body and well-characterized neural circuits, is especially suitable for optogenetic analyses. METHODOLOGY/PRINCIPAL FINDINGS: We describe the application of archaerhodopsin-3 (Arch, a recently reported optical neuronal silencer, to C. elegans. Arch::GFP expressed either in all neurons or body wall muscles of the entire body by means of transgenes were localized, at least partially, to the cell membrane without adverse effects, and caused locomotory paralysis of worms when illuminated by green light (550 nm. Pan-neuronal expression of Arch endowed worms with quick and sustained responsiveness to such light. Worms reliably responded to repeated periods of illumination and non-illumination, and remained paralyzed under continuous illumination for 30 seconds. Worms expressing Arch in different subsets of motor neurons exhibited distinct defects in the locomotory behavior under green light: selective silencing of A-type motor neurons affected backward movement while silencing of B-type motor neurons affected forward movement more severely. Our experiments using a heat-shock-mediated induction system also indicate that Arch becomes fully functional only 12 hours after induction and remains functional for more than 24 hour. CONCLUSIONS/SGNIFICANCE: Arch can be used for silencing neurons and muscles, and may be a useful alternative to currently widely used halorhodopsin (NpHR in optogenetic studies of C. elegans.

  11. Strategies for Improving siRNA-Induced Gene Silencing Efficiency.

    Science.gov (United States)

    Safari, Fatemeh; Rahmani Barouji, Solmaz; Tamaddon, Ali Mohammad

    2017-12-01

    Purpose: Human telomerase reverse transcriptase (hTERT) plays a crucial role in tumorigenesis and progression of cancers. Gene silencing of hTERT by short interfering RNA (siRNA) is considered as a promising strategy for cancer gene therapy. Various algorithms have been devised for designing a high efficient siRNA which is a significant issue in the clinical usage. Thereby, in the present study, the relation of siRNA designing criteria and the gene silencing efficiency was evaluated. Methods: The siRNA sequences were designed and characterized by using on line soft wares. Cationic co-polymer (polyethylene glycol-g-polyethylene imine (PEG-g-PEI)) was used for the construction of polyelectrolyte complexes (PECs) containing siRNAs. The cellular uptake of the PECs was evaluated. The gene silencing efficiency of different siRNA sequences was investigated and the effect of observing the rational designing on the functionality of siRNAs was assessed. Results: The size of PEG-g-PEI siRNA with N/P (Nitrogen/Phosphate) ratio of 2.5 was 114 ± 0.645 nm. The transfection efficiency of PECs was desirable (95.5% ± 2.4%.). The results of Real-Time PCR showed that main sequence (MS) reduced the hTERT expression up to 90% and control positive sequence (CPS) up to 63%. These findings demonstrated that the accessibility to the target site has priority than the other criteria such as sequence preferences and thermodynamic features. Conclusion: siRNA opens a hopeful window in cancer therapy which provides a convenient and tolerable therapeutic approach. Thereby, using the set of criteria and rational algorithms in the designing of siRNA remarkably affect the gene silencing efficiency.

  12. The Nuclear Cap-Binding Complex Mediates Meiotic Silencing by Unpaired DNA

    Directory of Open Access Journals (Sweden)

    Logan M. Decker

    2017-04-01

    Full Text Available In the filamentous fungus Neurospora crassa, cross walls between individual cells are normally incomplete, making the entire fungal network vulnerable to attack by viruses and selfish DNAs. Accordingly, several genome surveillance mechanisms are maintained to help the fungus combat these repetitive elements. One of these defense mechanisms is called meiotic silencing by unpaired DNA (MSUD, which identifies and silences unpaired genes during meiosis. Utilizing common RNA interference (RNAi proteins, such as Dicer and Argonaute, MSUD targets mRNAs homologous to the unpaired sequence to achieve silencing. In this study, we have identified an additional silencing component, namely the cap-binding complex (CBC. Made up of cap-binding proteins CBP20 and CBP80, CBC associates with the 5′ cap of mRNA transcripts in eukaryotes. The loss of CBC leads to a deficiency in MSUD activity, suggesting its role in mediating silencing. As confirmed in this study, CBC is predominantly nuclear, although it is known to travel in and out of the nucleus to facilitate RNA transport. As seen in animals but not in plants, CBP20’s robust nuclear import depends on CBP80 in Neurospora. CBC interacts with a component (Argonaute of the perinuclear meiotic silencing complex (MSC, directly linking the two cellular factors.

  13. Perturbative stability of the approximate Killing field eigenvalue problem

    International Nuclear Information System (INIS)

    Beetle, Christopher; Wilder, Shawn

    2014-01-01

    An approximate Killing field may be defined on a compact, Riemannian geometry by solving an eigenvalue problem for a certain elliptic operator. This paper studies the effect of small perturbations in the Riemannian metric on the resulting vector field. It shows that small metric perturbations, as measured using a Sobolev-type supremum norm on the space of Riemannian geometries on a fixed manifold, yield small perturbations in the approximate Killing field, as measured using a Hilbert-type square integral norm. It also discusses applications to the problem of computing the spin of a generic black hole in general relativity. (paper)

  14. Active compressor engine silencer reduces exhaust noise

    International Nuclear Information System (INIS)

    Denenberg, J.N.; Miller, S.K.; Jay, M.A.

    1994-01-01

    An active industrial silencer on a compressor engine at a Tenneco Gas station has reduced low-frequency 'rumbling' noise by 8 dB during trials while lowering backpressure about 90$. This 8 dB reduction of the piston firing frequency corresponds to a more than 80% decrease in emitted acoustic power. The silencing unit, installed on one of six engines at the station near Eden, N.Y., continues in operation. Based on the results, the manufacturer is identifying additional compressor sites for further tests. This paper reviews this project

  15. Co-evolution of transcriptional silencing proteins and the DNA elements specifying their assembly.

    Directory of Open Access Journals (Sweden)

    Oliver A Zill

    Full Text Available Co-evolution of transcriptional regulatory proteins and their sites of action has been often hypothesized but rarely demonstrated. Here we provide experimental evidence of such co-evolution in yeast silent chromatin, a finding that emerged from studies of hybrids formed between two closely related Saccharomyces species. A unidirectional silencing incompatibility between S. cerevisiae and S. bayanus led to a key discovery: asymmetrical complementation of divergent orthologs of the silent chromatin component Sir4. In S. cerevisiae/S. bayanus interspecies hybrids, ChIP-Seq analysis revealed a restriction against S. cerevisiae Sir4 associating with most S. bayanus silenced regions; in contrast, S. bayanus Sir4 associated with S. cerevisiae silenced loci to an even greater degree than did S. cerevisiae's own Sir4. Functional changes in silencer sequences paralleled changes in Sir4 sequence and a reduction in Sir1 family members in S. cerevisiae. Critically, species-specific silencing of the S. bayanus HMR locus could be reconstituted in S. cerevisiae by co-transfer of the S. bayanus Sir4 and Kos3 (the ancestral relative of Sir1 proteins. As Sir1/Kos3 and Sir4 bind conserved silencer-binding proteins, but not specific DNA sequences, these rapidly evolving proteins served to interpret differences in the two species' silencers presumably involving emergent features created by the regulatory proteins that bind sequences within silencers. The results presented here, and in particular the high resolution ChIP-Seq localization of the Sir4 protein, provided unanticipated insights into the mechanism of silent chromatin assembly in yeast.

  16. The molecular basis for stability of heterochromatin-mediated silencing in mammals

    Directory of Open Access Journals (Sweden)

    Hiragami-Hamada Kyoko

    2009-11-01

    Full Text Available Abstract The archetypal epigenetic phenomenon of position effect variegation (PEV in Drosophila occurs when a gene is brought abnormally close to heterochromatin, resulting in stochastic silencing of the affected gene in a proportion of cells that would normally express it. PEV has been instrumental in unraveling epigenetic mechanisms. Using an in vivo mammalian model for PEV we have extensively investigated the molecular basis for heterochromatin-mediated gene silencing. Here we distinguish 'epigenetic effects' from other cellular differences by studying ex vivo cells that are identical, apart from the expression of the variegating gene which is silenced in a proportion of the cells. By separating cells according to transgene expression we show here that silencing appears to be associated with histone H3 lysine 9 trimethylation (H3K9me3, DNA methylation and the localization of the silenced gene to a specific nuclear compartment enriched in these modifications. In contrast, histone H3 acetylation (H3Ac and lysine 4 di or tri methylation (H3K4me2/3 are the predominant modifications associated with expression where we see the gene in a euchromatic compartment. Interestingly, DNA methylation and inaccessibility, rather than H3K9me3, correlated most strongly with resistance to de-repression by cellular activation. These results have important implications for understanding the contribution of specific factors involved in the establishment and maintenance of gene silencing and activation in vivo.

  17. The molecular basis for stability of heterochromatin-mediated silencing in mammals.

    Science.gov (United States)

    Hiragami-Hamada, Kyoko; Xie, Sheila Q; Saveliev, Alexander; Uribe-Lewis, Santiago; Pombo, Ana; Festenstein, Richard

    2009-11-04

    The archetypal epigenetic phenomenon of position effect variegation (PEV) in Drosophila occurs when a gene is brought abnormally close to heterochromatin, resulting in stochastic silencing of the affected gene in a proportion of cells that would normally express it. PEV has been instrumental in unraveling epigenetic mechanisms. Using an in vivo mammalian model for PEV we have extensively investigated the molecular basis for heterochromatin-mediated gene silencing. Here we distinguish 'epigenetic effects' from other cellular differences by studying ex vivo cells that are identical, apart from the expression of the variegating gene which is silenced in a proportion of the cells. By separating cells according to transgene expression we show here that silencing appears to be associated with histone H3 lysine 9 trimethylation (H3K9me3), DNA methylation and the localization of the silenced gene to a specific nuclear compartment enriched in these modifications. In contrast, histone H3 acetylation (H3Ac) and lysine 4 di or tri methylation (H3K4me2/3) are the predominant modifications associated with expression where we see the gene in a euchromatic compartment. Interestingly, DNA methylation and inaccessibility, rather than H3K9me3, correlated most strongly with resistance to de-repression by cellular activation. These results have important implications for understanding the contribution of specific factors involved in the establishment and maintenance of gene silencing and activation in vivo.

  18. Role of copper oxides in contact killing of bacteria.

    Science.gov (United States)

    Hans, Michael; Erbe, Andreas; Mathews, Salima; Chen, Ying; Solioz, Marc; Mücklich, Frank

    2013-12-31

    The potential of metallic copper as an intrinsically antibacterial material is gaining increasing attention in the face of growing antibiotics resistance of bacteria. However, the mechanism of the so-called "contact killing" of bacteria by copper surfaces is poorly understood and requires further investigation. In particular, the influences of bacteria-metal interaction, media composition, and copper surface chemistry on contact killing are not fully understood. In this study, copper oxide formation on copper during standard antimicrobial testing was measured in situ by spectroscopic ellipsometry. In parallel, contact killing under these conditions was assessed with bacteria in phosphate buffered saline (PBS) or Tris-Cl. For comparison, defined Cu2O and CuO layers were thermally generated and characterized by grazing incidence X-ray diffraction. The antibacterial properties of these copper oxides were tested under the conditions used above. Finally, copper ion release was recorded for both buffer systems by inductively coupled plasma atomic absorption spectroscopy, and exposed copper samples were analyzed for topographical surface alterations. It was found that there was a fairly even growth of CuO under wet plating conditions, reaching 4-10 nm in 300 min, but no measurable Cu2O was formed during this time. CuO was found to significantly inhibit contact killing, compared to pure copper. In contrast, thermally generated Cu2O was essentially as effective in contact killing as pure copper. Copper ion release from the different surfaces roughly correlated with their antibacterial efficacy and was highest for pure copper, followed by Cu2O and CuO. Tris-Cl induced a 10-50-fold faster copper ion release compared to PBS. Since the Cu2O that primarily forms on copper under ambient conditions is as active in contact killing as pure copper, antimicrobial objects will retain their antimicrobial properties even after oxide formation.

  19. Age and sex composition of seals killed by polar bears in the eastern Beaufort Sea.

    Directory of Open Access Journals (Sweden)

    Nicholas W Pilfold

    Full Text Available Polar bears (Ursus maritimus of the Beaufort Sea enter hyperphagia in spring and gain fat reserves to survive periods of low prey availability. We collected information on seals killed by polar bears (n=650 and hunting attempts on ringed seal (Pusa hispida lairs (n=1396 observed from a helicopter during polar bear mark-recapture studies in the eastern Beaufort Sea in spring in 1985-2011. We investigated how temporal shifts in ringed seal reproduction affect kill composition and the intraspecific vulnerabilities of ringed seals to polar bear predation.Polar bears primarily preyed on ringed seals (90.2% while bearded seals (Erignathus barbatus only comprised 9.8% of the kills, but 33% of the biomass. Adults comprised 43.6% (150/344 of the ringed seals killed, while their pups comprised 38.4% (132/344. Juvenile ringed seals were killed at the lowest proportion, comprising 18.0% (62/344 of the ringed seal kills. The proportion of ringed seal pups was highest between 2007-2011, in association with high ringed seal productivity. Half of the adult ringed seal kills were ≥ 21 years (60/121, and kill rates of adults increased following the peak of parturition. Determination of sex from DNA revealed that polar bears killed adult male and adult female ringed seals equally (0.50, n=78. The number of hunting attempts at ringed seal subnivean lair sites was positively correlated with the number of pup kills (r(2 =0.30, P=0.04, but was not correlated with the number of adult kills (P=0.37.Results are consistent with decadal trends in ringed seal productivity, with low numbers of pups killed by polar bears in spring in years of low pup productivity, and conversely when pup productivity was high. Vulnerability of adult ringed seals to predation increased in relation to reproductive activities and age, but not gender.

  20. Age and sex composition of seals killed by polar bears in the eastern Beaufort Sea.

    Science.gov (United States)

    Pilfold, Nicholas W; Derocher, Andrew E; Stirling, Ian; Richardson, Evan; Andriashek, Dennis

    2012-01-01

    Polar bears (Ursus maritimus) of the Beaufort Sea enter hyperphagia in spring and gain fat reserves to survive periods of low prey availability. We collected information on seals killed by polar bears (n=650) and hunting attempts on ringed seal (Pusa hispida) lairs (n=1396) observed from a helicopter during polar bear mark-recapture studies in the eastern Beaufort Sea in spring in 1985-2011. We investigated how temporal shifts in ringed seal reproduction affect kill composition and the intraspecific vulnerabilities of ringed seals to polar bear predation. Polar bears primarily preyed on ringed seals (90.2%) while bearded seals (Erignathus barbatus) only comprised 9.8% of the kills, but 33% of the biomass. Adults comprised 43.6% (150/344) of the ringed seals killed, while their pups comprised 38.4% (132/344). Juvenile ringed seals were killed at the lowest proportion, comprising 18.0% (62/344) of the ringed seal kills. The proportion of ringed seal pups was highest between 2007-2011, in association with high ringed seal productivity. Half of the adult ringed seal kills were ≥ 21 years (60/121), and kill rates of adults increased following the peak of parturition. Determination of sex from DNA revealed that polar bears killed adult male and adult female ringed seals equally (0.50, n=78). The number of hunting attempts at ringed seal subnivean lair sites was positively correlated with the number of pup kills (r(2) =0.30, P=0.04), but was not correlated with the number of adult kills (P=0.37). Results are consistent with decadal trends in ringed seal productivity, with low numbers of pups killed by polar bears in spring in years of low pup productivity, and conversely when pup productivity was high. Vulnerability of adult ringed seals to predation increased in relation to reproductive activities and age, but not gender.

  1. Spacelike conformal Killing vectors and spacelike congruences

    International Nuclear Information System (INIS)

    Mason, D.P.; Tsamparlis, M.

    1985-01-01

    Necessary and sufficient conditions are derived for space-time to admit a spacelike conformal motion with symmetry vector parallel to a unit spacelike vector field n/sup a/. These conditions are expressed in terms of the shear and expansion of the spacelike congruence generated by n/sup a/ and in terms of the four-velocity of the observer employed at any given point of the congruence. It is shown that either the expansion or the rotation of this spacelike congruence must vanish if Dn/sup a//dp = 0, where p denotes arc length measured along the integral curves of n/sup a/, and also that there exist no proper spacelike homothetic motions with constant expansion. Propagation equations for the projection tensor and the rotation tensor are derived and it is proved that every isometric spacelike congruence is rigid. Fluid space-times are studied in detail. A relation is established between spacelike conformal motions and material curves in the fluid: if a fluid space-time admits a spacelike conformal Killing vector parallel to n/sup a/ and n/sub a/u/sup a/ = 0, where u/sup a/ is the fluid four-velocity, then the integral curves of n/sup a/ are material curves in an irrotational fluid, while if the fluid vorticity is nonzero, then the integral curves of n/sup a/ are material curves if and only if they are vortex lines. An alternative derivation, based on the theory of spacelike congruences, of some of the results of Collins [J. Math. Phys. 25, 995 (1984)] on conformal Killing vectors parallel to the local vorticity vector in shear-free perfect fluids with zero magnetic Weyl tensor is given

  2. Suppressors of RNA silencing encoded by tomato leaf curl ...

    Indian Academy of Sciences (India)

    2013-01-06

    Jan 6, 2013 ... Virus encoded RNA-silencing suppressors (RSSs) are the key components evolved by the viruses to ... severe disease symptom in the host (Briddon et al. ..... Voinnet O 2001 RNA silencing as a plant immune system against.

  3. Surprised by Bird, Bard, and Bach: Language, Silence, and Transcendence.

    Science.gov (United States)

    Suhor, Charles

    1991-01-01

    Argues the importance of the relationships among silence and literature, the arts, and other experiences that point toward transcendence. Suggests that English teachers can expand the repertoire of classroom activities and teaching techniques that make use of silence. (KEH)

  4. Histone Methylation and Epigenetic Silencing in Breast Cancer

    National Research Council Canada - National Science Library

    Simon, Jeffrey A; Lange, Carol A

    2008-01-01

    .... EZH2 is a histone methyltransferase which modifies lysine-27 of histone H3 an epigenetic mark which is generally linked to gene silencing and is implicated in tumor suppressor silencing during breast cancer progression...

  5. Honor Killing: Where Pride Defeats Reason.

    Science.gov (United States)

    Kanchan, Tanuj; Tandon, Abhishek; Krishan, Kewal

    2016-12-01

    Honor killings are graceless and ferocious murders by chauvinists with an antediluvian mind. These are categorized separately because these killings are committed for the prime reason of satisfying the ego of the people whom the victim trusts and always looks up to for support and protection. It is for this sole reason that honor killings demand strict and stern punishment, not only for the person who committed the murder but also for any person who contributed or was party to the act. A positive change can occur with stricter legislation and changes in the ethos of the society we live in today.

  6. Efficacy of Killed Adjuvanted FMD Vaccine Developed with ...

    African Journals Online (AJOL)

    In this study the potency of killed Foot and Mouth Disease (FMD) vaccines serotypes SAT1 (Nig 1/98) and SAT 2 (Nig 2/97) virus isolates, formulated with montanide ISA 206 adjuvant was determined in guinea pigs and cattle by antibody assay using Complement Fixation and Serum Neutralization tests. The antibody titres ...

  7. Silence in the second language classroom

    CERN Document Server

    King, J

    2013-01-01

    Why are second language learners in Japan's universities so silent? This book investigates the perplexing but intriguing phenomenon of classroom silence and draws on ideas from psychology, sociolinguistics and anthropology to offer a unique insight into the reasons why some learners are either unable or unwilling to speak in a foreign language.

  8. Veiled Word(s) – Sacred Silence

    DEFF Research Database (Denmark)

    Isar, Nicoletta

    2014-01-01

    or secret prayer, and divine silence, which are at the very centre of the Byzantine altar. The main focus is to investigate the liminal nature of the Mystery, manifested through concealing-revealing devices, which are thresholds in the liturgical participation of the Byzantine subject. Fear and secrecy...

  9. Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing

    NARCIS (Netherlands)

    Hedil, M.; Sterken, M.G.; Ronde, de D.; Lohuis, D.; Kormelink, R.

    2015-01-01

    RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS.

  10. After the Blackbird Whistles: Listening to Silence in Classrooms

    Science.gov (United States)

    Schultz, Katherine

    2010-01-01

    Background/Context: Students spend a large part of their time in schools in silence. However, teachers tend to spend most of their time attending to student talk. Anthropological and linguistic research has contributed to an understanding of silence in particular communities, offering explanations for students' silence in school. This research…

  11. Choosing Silence for Equality in and through Schooling

    Science.gov (United States)

    Lees, Helen E.

    2016-01-01

    This article considers silences and equality as combined from a theoretical perspective. Equality in and through chosen, deliberate and regular silence experience is seen as an equaliser: if no one is speaking no one can dominate. The article uses a bifurcated concept of silence: weak, negative forms and strong, positive forms. Only the strong…

  12. Homefucking is Killing Prostitution / Taavi Eelmaa

    Index Scriptorium Estoniae

    Eelmaa, Taavi, 1971-

    2008-01-01

    Mis jääb vaatajale teatrietendusest meelde? Ilmus Kris Moori raamat "Homefucking is Killing Prostitution". Raamat sisaldab tekste ja Erki Lauri fotosid Von Krahli Teatri samanimelisest etendusest, mida kordagi ei mängitud

  13. KILLING, VIEWED FROM A CONFLICT RESOLUTION PERSPECTIVE

    African Journals Online (AJOL)

    DODO

    2017-07-01

    Jul 1, 2017 ... ... million people were killed as part of the industrial policy of Belgium's ..... the seeds of hate and further conspiracies against others, the entire .... International Commission On Intervention and State Sovereignty (ICISS) 2001.

  14. Targeted Killings in Bangladesh: Diversity at Stake

    OpenAIRE

    Syed, Jawad

    2016-01-01

    Since 2013, Bangladesh has repeatedly been in headline news across the world due to systematic and incessant targeted killings. In the mainstream media, both in South Asia and the West, the focus has been generally on high profile murders of secular and progressive bloggers. This includes the recent worldwide broad coverage on the tragic murder of Xulhaz Mannan, editor of Bangladesh's first LGBT rights magazine. However, not many know that these killings are only one part of the story. Secula...

  15. Dirac operators and Killing spinors with torsion

    International Nuclear Information System (INIS)

    Becker-Bender, Julia

    2012-01-01

    On a Riemannian spin manifold with parallel skew torsion, we use the twistor operator to obtain an eigenvalue estimate for the Dirac operator with torsion. We consider the equality case in dimensions four and six. In odd dimensions we describe Sasaki manifolds on which equality in the estimate is realized by Killing spinors with torsion. In dimension five we characterize all Killing spinors with torsion and obtain certain naturally reductive spaces as exceptional cases.

  16. Technical Aspects of Cyber Kill Chain

    OpenAIRE

    Yadav, Tarun; Mallari, Rao Arvind

    2016-01-01

    Recent trends in targeted cyber-attacks has increased the interest of research in the field of cyber security. Such attacks have massive disruptive effects on rganizations, enterprises and governments. Cyber kill chain is a model to describe cyber-attacks so as to develop incident response and analysis capabilities. Cyber kill chain in simple terms is an attack chain, the path that an intruder takes to penetrate information systems over time to execute an attack on the target. This paper broa...

  17. Killing-Yano tensors, rank-2 Killing tensors, and conserved quantities in higher dimensions

    Energy Technology Data Exchange (ETDEWEB)

    Krtous, Pavel [Institute of Theoretical Physics, Charles University, V Holesovickach 2, Prague (Czech Republic); Kubiznak, David [Institute of Theoretical Physics, Charles University, V Holesovickach 2, Prague (Czech Republic); Page, Don N. [Theoretical Physics Institute, University of Alberta, Edmonton T6G 2G7, Alberta (Canada); Frolov, Valeri P. [Theoretical Physics Institute, University of Alberta, Edmonton T6G 2G7, Alberta (Canada)

    2007-02-15

    From the metric and one Killing-Yano tensor of rank D-2 in any D-dimensional spacetime with such a principal Killing-Yano tensor, we show how to generate k = [(D+1)/2] Killing-Yano tensors, of rank D-2j for all 0 {<=} j {<=} k-1, and k rank-2 Killing tensors, giving k constants of geodesic motion that are in involution. For the example of the Kerr-NUT-AdS spacetime (hep-th/0604125) with its principal Killing-Yano tensor (gr-qc/0610144), these constants and the constants from the k Killing vectors give D independent constants in involution, making the geodesic motion completely integrable (hep-th/0611083). The constants of motion are also related to the constants recently obtained in the separation of the Hamilton-Jacobi and Klein-Gordon equations (hep-th/0611245)

  18. Killing-Yano tensors, rank-2 Killing tensors, and conserved quantities in higher dimensions

    International Nuclear Information System (INIS)

    Krtous, Pavel; Kubiznak, David; Page, Don N.; Frolov, Valeri P.

    2007-01-01

    From the metric and one Killing-Yano tensor of rank D-2 in any D-dimensional spacetime with such a principal Killing-Yano tensor, we show how to generate k = [(D+1)/2] Killing-Yano tensors, of rank D-2j for all 0 ≤ j ≤ k-1, and k rank-2 Killing tensors, giving k constants of geodesic motion that are in involution. For the example of the Kerr-NUT-AdS spacetime (hep-th/0604125) with its principal Killing-Yano tensor (gr-qc/0610144), these constants and the constants from the k Killing vectors give D independent constants in involution, making the geodesic motion completely integrable (hep-th/0611083). The constants of motion are also related to the constants recently obtained in the separation of the Hamilton-Jacobi and Klein-Gordon equations (hep-th/0611245)

  19. PESAN MORAL DALAM FILM TO KILL A MOCKINGBIRD (ANALISIS SEMIOTIKA PADA FILM TO KILL A MOCKINGBIRD

    OpenAIRE

    RENYOET, JAQUILINE MELISSA

    2014-01-01

    2014 JAQUILINE MELISSA RENYOET. Pesan Moral Dalam Film To Kill A Mockingbird (Analisis Semiotika Pada Film To Kill A Mockingbird). (Dibimbing oleh Muh. Nadjib dan Alem Febri Sonni). Tujuan Penelitian ini adalah mengidentifikasi bentuk pesan moral dan memahami makna pesan moral dalam film To Kill A Mockingbird. Penelitian ini dilakukan selama kurang lebih 2 bulan yaitu Maret ??? Mei 2014. Metode yang digunakan untuk penelitian ini adalah metode penelitian kualitatif den...

  20. Dynamics of Human Complement–Mediated Killing of Klebsiella pneumoniae

    Science.gov (United States)

    Nypaver, Christina M.; Thornton, Margaret M.; Yin, Suellen M.; Bracho, David O.; Nelson, Patrick W.; Jones, Alan E.; Bortz, David M.; Younger, John G.

    2010-01-01

    With an in vitro system that used a luminescent strain of Klebsiella pneumoniae to assess bacterial metabolic activity in near-real-time, we investigated the dynamics of complement-mediated attack in healthy individuals and in patients presenting to the emergency department with community-acquired severe sepsis. A novel mathematical/statistical model was developed to simplify light output trajectories over time into two fitted parameters, the rate of complement activation and the delay from activation to the onset of killing. Using Factor B–depleted serum, the alternative pathway was found to be the primary bactericidal effector: In the absence of B, C3 opsonization as measured by flow cytometry did not progress and bacteria proliferated near exponentially. Defects in bacterial killing were easily demonstrable in patients with severe sepsis compared with healthy volunteers. In most patients with sepsis, the rate of activation was higher than in normal subjects but was associated with a prolonged delay between activation and bacterial killing (P < 0.05 for both). Theoretical modeling suggested that this combination of accentuated but delayed function should allow successful bacterial killing but with significantly greater complement activation. The use of luminescent bacteria allowed for the development of a novel and powerful tool for assessing complement immunology for the purposes of mechanistic study and patient evaluation. PMID:20008281

  1. Dynamics of human complement-mediated killing of Klebsiella pneumoniae.

    Science.gov (United States)

    Nypaver, Christina M; Thornton, Margaret M; Yin, Suellen M; Bracho, David O; Nelson, Patrick W; Jones, Alan E; Bortz, David M; Younger, John G

    2010-11-01

    With an in vitro system that used a luminescent strain of Klebsiella pneumoniae to assess bacterial metabolic activity in near-real-time, we investigated the dynamics of complement-mediated attack in healthy individuals and in patients presenting to the emergency department with community-acquired severe sepsis. A novel mathematical/statistical model was developed to simplify light output trajectories over time into two fitted parameters, the rate of complement activation and the delay from activation to the onset of killing. Using Factor B-depleted serum, the alternative pathway was found to be the primary bactericidal effector: In the absence of B, C3 opsonization as measured by flow cytometry did not progress and bacteria proliferated near exponentially. Defects in bacterial killing were easily demonstrable in patients with severe sepsis compared with healthy volunteers. In most patients with sepsis, the rate of activation was higher than in normal subjects but was associated with a prolonged delay between activation and bacterial killing (P < 0.05 for both). Theoretical modeling suggested that this combination of accentuated but delayed function should allow successful bacterial killing but with significantly greater complement activation. The use of luminescent bacteria allowed for the development of a novel and powerful tool for assessing complement immunology for the purposes of mechanistic study and patient evaluation.

  2. Illegal killing for ivory drives global decline in African elephants.

    Science.gov (United States)

    Wittemyer, George; Northrup, Joseph M; Blanc, Julian; Douglas-Hamilton, Iain; Omondi, Patrick; Burnham, Kenneth P

    2014-09-09

    Illegal wildlife trade has reached alarming levels globally, extirpating populations of commercially valuable species. As a driver of biodiversity loss, quantifying illegal harvest is essential for conservation and sociopolitical affairs but notoriously difficult. Here we combine field-based carcass monitoring with fine-scale demographic data from an intensively studied wild African elephant population in Samburu, Kenya, to partition mortality into natural and illegal causes. We then expand our analytical framework to model illegal killing rates and population trends of elephants at regional and continental scales using carcass data collected by a Convention on International Trade in Endangered Species program. At the intensively monitored site, illegal killing increased markedly after 2008 and was correlated strongly with the local black market ivory price and increased seizures of ivory destined for China. More broadly, results from application to continental data indicated illegal killing levels were unsustainable for the species between 2010 and 2012, peaking to ∼ 8% in 2011 which extrapolates to ∼ 40,000 elephants illegally killed and a probable species reduction of ∼ 3% that year. Preliminary data from 2013 indicate overharvesting continued. In contrast to the rest of Africa, our analysis corroborates that Central African forest elephants experienced decline throughout the last decade. These results provide the most comprehensive assessment of illegal ivory harvest to date and confirm that current ivory consumption is not sustainable. Further, our approach provides a powerful basis to determine cryptic mortality and gain understanding of the demography of at-risk species.

  3. Patterns and Composition of Road-Killed Wildlife in Northwest Argentina

    Science.gov (United States)

    Cuyckens, Griet An Erica; Mochi, Lucía Sol; Vallejos, María; Perovic, Pablo Gastón; Biganzoli, Fernando

    2016-11-01

    Roads have important effects on wildlife, such as natural habitat fragmentation and degradation and direct killing of fauna, which leads to reductions in wildlife population size. We focused on a principal road in Northwest Argentina to test for the effect of seasonality and landscape features on the composition of road-killed wildlife. We conducted regularly scheduled road trips during the dry and wet seasons. We recorded the presence or absence of a vegetation curtain or hedge along the road. We measured land use by remote sensing in a 500 m buffer along the road. We compared the abundance of animals killed between seasons (dry and wet) for different taxonomic groups (mammals, birds and reptiles) and for different origins (domestic and native). We built linear mixed models to test the effect of landscape features on the abundance of killed animals. Two hundred and ninety-three individuals were killed, belonging to 35 species; 75.8 % were native and 24.2 % domestic species. The majority of animals killed were mid-sized mammals. More animals were killed during the dry season. The most important factors to explain the wildlife road-killing were the season and the proportion of agricultural landscape. The composition of the killed animals changed with the season. The proportion of agricultural landscape incremented the number of killed birds and mammals during both seasons, without affecting reptiles. The ratio of wild to domestic animals killed was dependent on the season. This study sets a precedent as the first in road ecology in Northwest Argentina and should be taken into account for road planning and regulation.

  4. Designing and Manufacturing a Noise Controlling Silencer for the Cooling Tower Pump of Sarcheshmeh Copper Power Station

    Directory of Open Access Journals (Sweden)

    Sajad Zare

    2017-08-01

    Full Text Available Background One of the most common harmful factors in the workplace is noise. Noise control is a factor beneficial for health and safety in the workplace. Objectives The current study aimed to design and manufacture a silencer for the cooling tower pump of Sarcheshmeh Copper power station in order to control noise. Methods In this study, sound pressure level was measured by the use of a sound level meter (B & K 2260. Measurement was carried out in the light of ISO 1996 standard. After studying technical and acoustic features of the noise source, a dispersive-absorptive silencer was designed to control noise pollution generated by the cooling tower pump of the thermal station. After analyzing the frequencies of sound pressure level and using available data, a cylindrical silencer (with a diameter of 1.5 m and height of 3 m was designed and manufactured. The internal part of the silencer was filled with different columns of absorbent material covered with punched metal. Therefore, the silencer consisted of (1 acoustic diffuser, (2 acoustic chamber, and (3 acoustic channels. Results Measurements showed that, at a distance of 1 m from the source, sound pressure level reduced from 127 dBA before installing the silencer to 79 dBA after the installation, resulting in a reduction of 48 dBA. Conclusions Using a silencer with absorbent material (glass wool is very effective in reducing the noise generated by the pump.

  5. Habitat or matrix: which is more relevant to predict road-kill of vertebrates?

    Science.gov (United States)

    Bueno, C; Sousa, C O M; Freitas, S R

    2015-11-01

    We believe that in tropics we need a community approach to evaluate road impacts on wildlife, and thus, suggest mitigation measures for groups of species instead a focal-species approach. Understanding which landscape characteristics indicate road-kill events may also provide models that can be applied in other regions. We intend to evaluate if habitat or matrix is more relevant to predict road-kill events for a group of species. Our hypothesis is: more permeable matrix is the most relevant factor to explain road-kill events. To test this hypothesis, we chose vertebrates as the studied assemblage and a highway crossing in an Atlantic Forest region in southeastern Brazil as the study site. Logistic regression models were designed using presence/absence of road-kill events as dependent variables and landscape characteristics as independent variables, which were selected by Akaike's Information Criterion. We considered a set of candidate models containing four types of simple regression models: Habitat effect model; Matrix types effect models; Highway effect model; and, Reference models (intercept and buffer distance). Almost three hundred road-kills and 70 species were recorded. River proximity and herbaceous vegetation cover, both matrix effect models, were associated to most road-killed vertebrate groups. Matrix was more relevant than habitat to predict road-kill of vertebrates. The association between river proximity and road-kill indicates that rivers may be a preferential route for most species. We discuss multi-species mitigation measures and implications to movement ecology and conservation strategies.

  6. Novel innate cancer killing activity in humans

    Directory of Open Access Journals (Sweden)

    Lovato James

    2011-08-01

    Full Text Available Abstract Background In this study, we pilot tested an in vitro assay of cancer killing activity (CKA in circulating leukocytes of 22 cancer cases and 25 healthy controls. Methods Using a human cervical cancer cell line, HeLa, as target cells, we compared the CKA in circulating leukocytes, as effector cells, of cancer cases and controls. The CKA was normalized as percentages of total target cells during selected periods of incubation time and at selected effector/target cell ratios in comparison to no-effector-cell controls. Results Our results showed that CKA similar to that of our previous study of SR/CR mice was present in human circulating leukocytes but at profoundly different levels in individuals. Overall, males have a significantly higher CKA than females. The CKA levels in cancer cases were lower than that in healthy controls (mean ± SD: 36.97 ± 21.39 vs. 46.28 ± 27.22. Below-median CKA was significantly associated with case status (odds ratio = 4.36; 95% Confidence Interval = 1.06, 17.88 after adjustment of gender and race. Conclusions In freshly isolated human leukocytes, we were able to detect an apparent CKA in a similar manner to that of cancer-resistant SR/CR mice. The finding of CKA at lower levels in cancer patients suggests the possibility that it may be of a consequence of genetic, physiological, or pathological conditions, pending future studies with larger sample size.

  7. The P0 protein encoded by cotton leafroll dwarf virus (CLRDV) inhibits local but not systemic RNA silencing.

    Science.gov (United States)

    Delfosse, Verónica C; Agrofoglio, Yamila C; Casse, María F; Kresic, Iván Bonacic; Hopp, H Esteban; Ziegler-Graff, Véronique; Distéfano, Ana J

    2014-02-13

    Plants employ RNA silencing as a natural defense mechanism against viruses. As a counter-defense, viruses encode silencing suppressor proteins (SSPs) that suppress RNA silencing. Most, but not all, the P0 proteins encoded by poleroviruses have been identified as SSP. In this study, we demonstrated that cotton leafroll dwarf virus (CLRDV, genus Polerovirus) P0 protein suppressed local silencing that was induced by sense or inverted repeat transgenes in Agrobacterium co-infiltration assay in Nicotiana benthamiana plants. A CLRDV full-length infectious cDNA clone that is able to infect N. benthamiana through Agrobacterium-mediated inoculation also inhibited local silencing in co-infiltration assays, suggesting that the P0 protein exhibits similar RNA silencing suppression activity when expressed from the full-length viral genome. On the other hand, the P0 protein did not efficiently inhibit the spread of systemic silencing signals. Moreover, Northern blotting indicated that the P0 protein inhibits the generation of secondary but not primary small interfering RNAs. The study of CLRDV P0 suppression activity may contribute to understanding the molecular mechanisms involved in the induction of cotton blue disease by CLRDV infection. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Activity of telithromycin (HMR 3647) against anaerobic bacteria compared to those of eight other agents by time-kill methodology.

    Science.gov (United States)

    Credito, K L; Ednie, L M; Jacobs, M R; Appelbaum, P C

    1999-08-01

    Time-kill studies examined the activities of telithromycin (HMR 3647), erythromycin A, azithromycin, clarithromycin, roxithromycin, clindamycin, pristinamycin, amoxicillin-clavulanate, and metronidazole against 11 gram-positive and gram-negative anaerobic bacteria. Time-kill studies were carried out with the addition of Oxyrase in order to prevent the introduction of CO(2). Macrolide-azalide-ketolide MICs were 0.004 to 32.0 microg/ml. Of the latter group, telithromycin had the lowest MICs, especially against non-Bacteroides fragilis group strains, followed by azithromycin, clarithromycin, erythromycin A, and roxithromycin. Clindamycin was active (MIC /=99.9% killing) against 6 strains, with 99% killing of 9 strains and 90% killing of 10 strains. After 24 h at twice the MIC, 90, 99, and 99.9% killing of nine, six, and three strains, respectively, occurred. Lower rates of killing were seen at earlier times. Similar kill kinetics relative to the MIC were seen with other macrolides. After 48 h at the MIC, clindamycin was bactericidal against 8 strains, with 99 and 90% killing of 9 and 10 strains, respectively. After 24 h, 90% killing of 10 strains occurred at the MIC. The kinetics of clindamycin were similar to those of pristinamycin. After 48 h at the MIC, amoxicillin-clavulanate showed 99.9% killing of seven strains, with 99% killing of eight strains and 90% killing of nine strains. At four times the MIC, metronidazole was bactericidal against 8 of 10 strains tested after 48 h and against all 10 strains after 24 h; after 12 h, 99% killing of all 10 strains occurred.

  9. [Killing effect of polymorphonuclear neutrophils on Trichomonas vaginalis].

    Science.gov (United States)

    Zhao, Jian-Ling; Gao, Xing-Zheng; Qu, Ming

    2008-10-30

    To study the killing effect of polymorphonuclear neutrophils (PMNs) on Trichomonas vaginalis. The vaginal secretion from a patient with vaginitis was incubated in the liver infusion liquid medium to get T. vaginalis. One ml serum was collected from the patient and heated for 30 min at 56 degrees C to inactivate complement in serum, and was absorbed three times with the parasites at 0 degree C to make the serum free of antibodies. PMNs were separated from the patient's blood and purified with density gradient centrifugation and polymer accelerating sedimentation. NBT and safranin O were used to stain the sample. The interaction between PMNs and the parasites was observed under microscope. 300 trichomonads and 3x10(4) PMNs were incubated for 10, 20, 30, 40, 50, 60 minutes under the conditions of aerobic or anaerobic, with superoxide dismutase (SOD) and catalase (CAT) or without SOD and CAT, and with complement or without complement. They were then inoculated in solid medium for another five days under the anaerobic condition, and surviving organisms were enumerated. PMNs were observed to surround and kill a single trichomonad. In the petri-dish containing PMNs, the surviving rate of the parasites in anaerobic condition was 85%, only 3% in aerobic condition (P<0.01). SOD and CAT reduced the killing effect of PMNs, with a surviving rate of 98% and 94% respectively after 60 min incubation. Without SOD and CAT, the surviving rate is only 2% (P<0.05). PMNs in the serum without antibodies killed all the parasites, while the complement-inactivated serum fail to kill them. The trichomonacidal activity of PMNs relies on the presence of oxygen and complement in the serum of patient.

  10. A conversation analysis of the function of silence in writing conferences

    Directory of Open Access Journals (Sweden)

    Milad Mirzaee

    2016-07-01

    Full Text Available One of the recent issues in English as a Second/Foreign Language (ESL/EFL writing instruction has been the quest for a more effective way to give feedback to L2 learners’ writing drafts. Although teacher- learner writing conferences have been increasingly used for providing ample opportunity for negotiating revisions, relatively little attention has been given to actual teacher-learner conversation. Drawing on sociocultural theory, which holds that all cognitive developments are results of ‘social interactions’, and drawing on conversation analysis as an analytical tool, this study attempts to explore the different functions of ‘silence’ in writing conferences during teacher-learner conversation. The data comes from transcripts of six 1-hour writing conferences video-recorded in a graduate program with 7 candidates in Iran. During the writing conferences, learners’ drafts were discussed. Findings of the study demonstrated that teacher’s silence can play a key role in the management of turns in writing conferences, thereby providing the parties with various opportunities for accomplishing intersubjectivity: the teacher used silence to rethink the information provided during writing conferences, and the learner exploited silence to revise the writing draft. The current study, reporting a range of functions of silence in writing conferences, offers an extension to the existing literature and draws language teachers’, specifically writing instructors’, attention to different functions of silence in writing conferences.

  11. Breaking an epigenetic chromatin switch: curious features of hysteresis in Saccharomyces cerevisiae telomeric silencing.

    Directory of Open Access Journals (Sweden)

    Vijayalakshmi H Nagaraj

    Full Text Available In addition to gene network switches, local epigenetic modifications to DNA and histones play an important role in all-or-none cellular decision-making. Here, we study the dynamical design of a well-characterized epigenetic chromatin switch: the yeast SIR system, in order to understand the origin of the stability of epigenetic states. We study hysteresis in this system by perturbing it with a histone deacetylase inhibitor. We find that SIR silencing has many characteristics of a non-linear bistable system, as observed in conventional genetic switches, which are based on activities of a few promoters affecting each other through the abundance of their gene products. Quite remarkably, our experiments in yeast telomeric silencing show a very distinctive pattern when it comes to the transition from bistability to monostability. In particular, the loss of the stable silenced state, upon increasing the inhibitor concentration, does not seem to show the expected saddle node behavior, instead looking like a supercritical pitchfork bifurcation. In other words, the 'off' state merges with the 'on' state at a threshold concentration leading to a single state, as opposed to the two states remaining distinct up to the threshold and exhibiting a discontinuous jump from the 'off' to the 'on' state. We argue that this is an inevitable consequence of silenced and active regions coexisting with dynamic domain boundaries. The experimental observations in our study therefore have broad implications for the understanding of chromatin silencing in yeast and beyond.

  12. Underground laboratories: Cosmic silence, loud science

    Energy Technology Data Exchange (ETDEWEB)

    Coccia, Eugenio, E-mail: coccia@lngs.infn.i [Department of Physics, University of Rome ' Tor Vergata' and INFN Gran Sasso National Laboratory (Italy)

    2010-01-01

    Underground laboratories provide the low radioactive background environment necessary to host key experiments in the field of particle and astroparticle physics, nuclear astrophysics and other disciplines that can profit of their characteristics and of their infrastructures. The cosmic silence condition existing in these laboratories allows the search for extremely rare phenomena and the exploration of the highest energy scales that cannot be reached with accelerators. I briefly describe all the facilities that are presently in operation around the world.

  13. Silencing cinema: film censorship around the world

    OpenAIRE

    Biltereyst, Daniël; Vande Winkel, Roel

    2013-01-01

    Why does oppression by censorship affect the film industry far more frequently than any other mass media? "Silencing Cinema" brings together the key issues and authors to examine instances of film censorship throughout the world. Including essays by some of today's leading film historians, the book offers groundbreaking historical research on film censorship in major film production countries, including the United States, the United Kingdom, Russia/Soviet Union, India, China, and Nigeria, amo...

  14. Peptidoglycan recognition proteins kill bacteria by inducing oxidative, thiol, and metal stress.

    Directory of Open Access Journals (Sweden)

    Des Raj Kashyap

    2014-07-01

    Full Text Available Mammalian Peptidoglycan Recognition Proteins (PGRPs are a family of evolutionary conserved bactericidal innate immunity proteins, but the mechanism through which they kill bacteria is unclear. We previously proposed that PGRPs are bactericidal due to induction of reactive oxygen species (ROS, a mechanism of killing that was also postulated, and later refuted, for several bactericidal antibiotics. Here, using whole genome expression arrays, qRT-PCR, and biochemical tests we show that in both Escherichia coli and Bacillus subtilis PGRPs induce a transcriptomic signature characteristic of oxidative stress, as well as correlated biochemical changes. However, induction of ROS was required, but not sufficient for PGRP killing. PGRPs also induced depletion of intracellular thiols and increased cytosolic concentrations of zinc and copper, as evidenced by transcriptome changes and supported by direct measurements. Depletion of thiols and elevated concentrations of metals were also required, but by themselves not sufficient, for bacterial killing. Chemical treatment studies demonstrated that efficient bacterial killing can be recapitulated only by the simultaneous addition of agents leading to production of ROS, depletion of thiols, and elevation of intracellular metal concentrations. These results identify a novel mechanism of bacterial killing by innate immunity proteins, which depends on synergistic effect of oxidative, thiol, and metal stress and differs from bacterial killing by antibiotics. These results offer potential targets for developing new antibacterial agents that would kill antibiotic-resistant bacteria.

  15. Comparing Road-Kill Datasets from Hunters and Citizen Scientists in a Landscape Context

    Directory of Open Access Journals (Sweden)

    Florian Heigl

    2016-10-01

    Full Text Available Road traffic has severe effects on animals, especially when road-kills are involved. In many countries, official road-kill data are provided by hunters or police; there are also road-kill observations reported by citizen scientists. The aim of the current study was to test whether road-kill reports by hunters stem from similar landscapes than those reported by citizen scientists. We analysed the surrounding landscapes of 712 road-kill reportings of European hares in the province of Lower Austria. Our data showed that road-killed hares reported both by hunters and citizens are predominantly surrounded by arable land. No difference of hedges and solitary trees could be found between the two datasets. However, significant differences in landcover classes and surrounding road networks indicate that hunters’ and citizen scientists’ data are different. Hunters reported hares from landscapes with significantly higher percentages of arable land, and greater lengths of secondary roads. In contrast, citizens reported hares from landscapes with significantly higher percentages of urban or industrial areas and greater lengths of motorways, primary roads, and residential roads. From this we argue that hunters tend to report data mainly from their hunting areas, whereas citizens report data during their daily routine on the way to/from work. We conclude that a citizen science approach is an important source for road-kill data when used in addition to official data with the aim of obtaining an overview of road-kill events on a landscape scale.

  16. Gas turbine exhaust system silencing design

    International Nuclear Information System (INIS)

    Ozgur, D.

    1991-01-01

    Gas turbines are the preferred prime mover in many applications because of their high efficiency, fuel flexibility, and low environmental impact. A typical mid-size machine might have a power rating of 80 MW, a flow of about 1000 kg/hr, and an exhaust temperature of over 500C. The most powerful single source of noise is generally the exhaust, which may generate over a kilowatt of acoustic energy. This paper reports that there are two important ways in which exhaust systems can radiate noise. The first is through the discharge of the exhaust duct, with the exhaust gas. Because of the large quantity of hot gas, the duct exit is always oriented vertically; it may be fairly high in the air in order to promote dispersion of the exhaust plume. This source is almost always attenuated by means of a silencer located somewhere in the ductwork. The second source of noise is often called breakout; it is the radiation of exhaust noise through the walls of the ducting. Breakout is most important for those sections of the exhaust duct which lie upstream of the silencer, where sound levels inside the ducting are highest. Both exhaust duct exit noise and breakout noise can be calculated from the sound power level of the gas turbine exhaust and the sound transmission loss (TL) of the silencer and ducting

  17. Comparison of two mathematical models for describing heat-induced cell killing

    International Nuclear Information System (INIS)

    Roti Roti, J.L.; Henle, K.J.

    1980-01-01

    A computer-based minimization algorithm is utilized to obtain the optimum fits of two models to hyperthermic cell killing data. The models chosen are the multitarget, single-hit equation, which is in general use, and the linear-quadratic equation, which has been applied to cell killing by ionizing irradiation but not to heat-induced cell killing. The linear-quadratic equation fits hyperthermic cell killing data as well as the multitarget, single-hit equation. Both parameters of the linear-quadratic equation obey the Arrhenius law, whereas only one of the two parameters of the multitarget, single-hit equation obeys the Arrhenius law. Thus the linear-quadratic function can completely define cell killing as a function of both time and temperature. In addition, the linear-quadratic model will provide a simplified approach to the study of the synergism between heat and X irradiation

  18. Killing superalgebras for Lorentzian four-manifolds

    International Nuclear Information System (INIS)

    Medeiros, Paul de; Figueroa-O’Farrill, José; Santi, Andrea

    2016-01-01

    We determine the Killing superalgebras underpinning field theories with rigid unextended supersymmetry on Lorentzian four-manifolds by re-interpreting them as filtered deformations of ℤ-graded subalgebras with maximum odd dimension of the N=1 Poincaré superalgebra in four dimensions. Part of this calculation involves computing a Spencer cohomology group which, by analogy with a similar result in eleven dimensions, prescribes a notion of Killing spinor, which we identify with the defining condition for bosonic supersymmetric backgrounds of minimal off-shell supergravity in four dimensions. We prove that such Killing spinors always generate a Lie superalgebra, and that this Lie superalgebra is a filtered deformation of a subalgebra of the N=1 Poincaré superalgebra in four dimensions. Demanding the flatness of the connection defining the Killing spinors, we obtain equations satisfied by the maximally supersymmetric backgrounds. We solve these equations, arriving at the classification of maximally supersymmetric backgrounds whose associated Killing superalgebras are precisely the filtered deformations we classify in this paper.

  19. Killing superalgebras for Lorentzian four-manifolds

    Energy Technology Data Exchange (ETDEWEB)

    Medeiros, Paul de [Department of Mathematics and Natural Sciences, University of Stavanger,4036 Stavanger (Norway); Figueroa-O’Farrill, José; Santi, Andrea [Maxwell Institute and School of Mathematics, The University of Edinburgh,James Clerk Maxwell Building, Peter Guthrie Tait Road, Edinburgh EH9 3FD, Scotland (United Kingdom)

    2016-06-20

    We determine the Killing superalgebras underpinning field theories with rigid unextended supersymmetry on Lorentzian four-manifolds by re-interpreting them as filtered deformations of ℤ-graded subalgebras with maximum odd dimension of the N=1 Poincaré superalgebra in four dimensions. Part of this calculation involves computing a Spencer cohomology group which, by analogy with a similar result in eleven dimensions, prescribes a notion of Killing spinor, which we identify with the defining condition for bosonic supersymmetric backgrounds of minimal off-shell supergravity in four dimensions. We prove that such Killing spinors always generate a Lie superalgebra, and that this Lie superalgebra is a filtered deformation of a subalgebra of the N=1 Poincaré superalgebra in four dimensions. Demanding the flatness of the connection defining the Killing spinors, we obtain equations satisfied by the maximally supersymmetric backgrounds. We solve these equations, arriving at the classification of maximally supersymmetric backgrounds whose associated Killing superalgebras are precisely the filtered deformations we classify in this paper.

  20. Female serial killing: review and case report.

    Science.gov (United States)

    Frei, Andreas; Völlm, Birgit; Graf, Marc; Dittmann, Volker

    2006-01-01

    Single homicide committed by women is rare. Serial killing is very infrequent, and the perpetrators are usually white, intelligent males with sadistic tendencies. Serial killing by women has, however, also been described. To conduct a review of published literature on female serial killers and consider its usefulness in assessing a presenting case. A literature review was conducted, after searching EMBASE, MEDLINE and PsycINFO. The presenting clinical case is described in detail in the context of the literature findings. Results The literature search revealed few relevant publications. Attempts to categorize the phenomenon of female serial killing according to patterns of and motives for the homicides have been made by some authors. The most common motive identified was material gain or similar extrinsic gratification while the 'hedonistic' sadistic or sexual serial killer seems to be extremely rare in women. There is no consistent theory of serial killing by women, but psychopathic personality traits and abusive childhood experiences have consistently been observed. The authors' case did not fit the description of a 'typical' female serial killer. In such unusual circumstances as serial killing by a woman, detailed individual case formulation is required to make sense of the psychopathology in each case. Publication of cases in scientific journals should be encouraged to advance our understanding of this phenomenon. Copyright (c) 2006 John Wiley & Sons, Ltd.

  1. Simultaneous gene silencing of Bcl-2, XIAP and Survivin re-sensitizes pancreatic cancer cells towards apoptosis

    International Nuclear Information System (INIS)

    Rückert, Felix; Samm, Nicole; Lehner, Anne-Kathrin; Saeger, Hans-Detlev; Grützmann, Robert; Pilarsky, Christian

    2010-01-01

    Pancreatic ductal adenocarcinoma shows a distinct apoptosis resistance, which contributes significantly to the aggressive nature of this tumor and constrains the effectiveness of new therapeutic strategies. Apoptosis resistance is determined by the net balance of the cells pro-and anti-apoptotic 'control mechanisms'. Numerous dysregulated anti-apoptotic genes have been identified in pancreatic cancer and seem to contribute to the high anti-apoptotic buffering capacity. We aimed to compare the benefit of simultaneous gene silencing (SGS) of several candidate genes with conventional gene silencing of single genes. From literature search we identified the anti-apoptotic genes XIAP, Survivin and Bcl-2 as commonly upregulated in pancreatic cancer. We performed SGS and silencing of single candidate genes using siRNA molecules in two pancreatic cancer cell lines. Effectiveness of SGS was assessed by qRT-PCR and western blotting. Apoptosis induction was measured by flow cytometry and caspase activation. Simultaneous gene silencing reduced expression of the three target genes effectively. Compared to silencing of a single target or control, SGS of these genes resulted in a significant higher induction of apoptosis in pancreatic cancer cells. In the present study we performed a subliminal silencing of different anti-apoptotic target genes simultaneously. Compared to silencing of single target genes, SGS had a significant higher impact on apoptosis induction in pancreatic cancer cells. Thereby, we give further evidence for the concept of an anti-apoptotic buffering capacity of pancreatic cancer cells

  2. Gene silencing activity of siRNA polyplexes based on thiolated N,N,N-trimethylated chitosan.

    Science.gov (United States)

    Varkouhi, Amir K; Verheul, Rolf J; Schiffelers, Raymond M; Lammers, Twan; Storm, Gert; Hennink, Wim E

    2010-12-15

    N,N,N-Trimethylated chitosan (TMC) is a biodegradable polymer emerging as a promising nonviral vector for nucleic acid and protein delivery. In the present study, we investigated whether the introduction of thiol groups in TMC enhances the extracellular stability of the complexes based on this polymer and promotes the intracellular release of siRNA. The gene silencing activity and the cellular cytotoxicity of polyplexes based on thiolated TMC were compared with those based on the nonthiolated counterpart and the regularly used lipidic transfection agent Lipofectamine. Incubation of H1299 human lung cancer cells expressing firefly luciferase with siRNA/thiolated TMC polyplexes resulted in 60-80% gene silencing activity, whereas complexes based on nonthiolated TMC showed less silencing (40%). The silencing activity of the complexes based on Lipofectamine 2000 was about 60-70%. Importantly, the TMC-SH polyplexes retained their silencing activity in the presence of hyaluronic acid, while nonthiolated TMC polyplexes hardly showed any silencing activity, demonstrating their stability against competing anionic macromolecules. Under the experimental conditions tested, the cytotoxicity of the thiolated and nonthiolated siRNA complexes was lower than those based on Lipofectamine. Given the good extracellular stability and good silencing activity, it is concluded that polyplexes based on TMC-SH are attractive systems for further in vivo evaluations.

  3. Post-transcriptional silencing of flavonol synthase mRNA in tobacco leads to fruits with arrested seed set.

    Directory of Open Access Journals (Sweden)

    Monika Mahajan

    Full Text Available Flavonoids are synthesized by phenylpropanoid pathway. They are known to participate in large number of physiological and biochemical processes in plants. Parthenocarpy and male sterility has earlier been reported by silencing chalcone synthase (CHS encoding gene. Silencing of CHS has blocked the synthesis of most of useful flavonoids including flavan-3-ols and flavonols. Also, these studies could not identify whether parthenocarpy/male sterility were due to lack of flavan-3-ols or flavonols or both. Flavonol synthase (FLS is an important enzyme of flavonoid pathway that catalyzes the formation of flavonols. In this article, we propose a novel strategy towards the generation of seedless or less-seeded fruits by downregulation of flavonol biosynthesis in tobacco (Nicotiana tabacum cv Xanthi through post-transcriptional gene silencing (PTGS of FLS encoding mRNA. The FLS silenced lines were observed for 20-80% reduction in FLS encoding gene expression and 25-93% reduction in flavonol (quercetin content. Interestingly, these FLS silenced tobacco lines also showed reduction in their anthocyanidins content. While the content of flavan-3-ols (catechin, epi-catechin and epi-gallocatechin was found to be increased in FLS silenced lines. The delayed flowering in FLS silenced lines could be due to decrease in level of indole acetic acid (IAA at apical region of their shoots. Furthermore, the pollen germination was hampered and pollens were unable to produce functional pollen tube in FLS silenced tobacco lines. Pods of FLS silenced lines contained significantly less number of seeds. The in vitro and in vivo studies where 1 µM quercetin was supplied to germination media, documented the restoration of normal pollen germination and pollen tube growth. This finding identified the role of flavonols particularly quercetin in pollen germination as well as in the regulation of plant fertility. Results also suggest a novel approach towards generation of seedless

  4. Identification of Novel Fibrosis Modifiers by In Vivo siRNA Silencing

    Directory of Open Access Journals (Sweden)

    Elisabeth H. Vollmann

    2017-06-01

    Full Text Available Fibrotic diseases contribute to 45% of deaths in the industrialized world, and therefore a better understanding of the pathophysiological mechanisms underlying tissue fibrosis is sorely needed. We aimed to identify novel modifiers of tissue fibrosis expressed by myofibroblasts and their progenitors in their disease microenvironment through RNA silencing in vivo. We leveraged novel biology, targeting genes upregulated during liver and kidney fibrosis in this cell lineage, and employed small interfering RNA (siRNA-formulated lipid nanoparticles technology to silence these genes in carbon-tetrachloride-induced liver fibrosis in mice. We identified five genes, Egr2, Atp1a2, Fkbp10, Fstl1, and Has2, which modified fibrogenesis based on their silencing, resulting in reduced Col1a1 mRNA levels and collagen accumulation in the liver. These genes fell into different groups based on the effects of their silencing on a transcriptional mini-array and histological outcomes. Silencing of Egr2 had the broadest effects in vivo and also reduced fibrogenic gene expression in a human fibroblast cell line. Prior to our study, Egr2, Atp1a2, and Fkbp10 had not been functionally validated in fibrosis in vivo. Thus, our results provide a major advance over the existing knowledge of fibrogenic pathways. Our study is the first example of a targeted siRNA assay to identify novel fibrosis modifiers in vivo.

  5. 75 FR 62469 - Drawbridge Operation Regulations; Newtown Creek, Dutch Kills, English Kills, and Their...

    Science.gov (United States)

    2010-10-12

    ... DEPARTMENT OF HOMELAND SECURITY Coast Guard 33 CFR Part 117 [Docket No. USCG-2010-0907] Drawbridge Operation Regulations; Newtown Creek, Dutch Kills, English Kills, and Their Tributaries, NY, Maintenance AGENCY: Coast Guard, DHS. ACTION: Notice of temporary deviation from regulations. SUMMARY: The Commander...

  6. 75 FR 30299 - Drawbridge Operation Regulations; Newtown Creek, Dutch Kills, English Kills, and Their...

    Science.gov (United States)

    2010-06-01

    ... DEPARTMENT OF HOMELAND SECURITY Coast Guard 33 CFR Part 117 [Docket No. USCG-2010-0355] Drawbridge Operation Regulations; Newtown Creek, Dutch Kills, English Kills, and Their Tributaries, NY, Maintenance AGENCY: Coast Guard, DHS. ACTION: Notice of temporary deviation from regulations. SUMMARY: The Commander...

  7. 9 CFR 113.206 - Wart Vaccine, Killed Virus.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Wart Vaccine, Killed Virus. 113.206... AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.206 Wart Vaccine, Killed Virus. Wart Vaccine, Killed Virus, shall be prepared...

  8. 9 CFR 113.213 - Pseudorabies Vaccine, Killed Virus.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Pseudorabies Vaccine, Killed Virus..., DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.213 Pseudorabies Vaccine, Killed Virus. Pseudorabies Vaccine, Killed...

  9. 9 CFR 113.209 - Rabies Vaccine, Killed Virus.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Rabies Vaccine, Killed Virus. 113.209... Killed Virus Vaccines § 113.209 Rabies Vaccine, Killed Virus. Rabies Vaccine (Killed Virus) shall be prepared from virus-bearing cell cultures or nerve tissues obtained from animals that have developed rabies...

  10. Conformal Killing horizons and their thermodynamics

    Science.gov (United States)

    Nielsen, Alex B.; Shoom, Andrey A.

    2018-05-01

    Certain dynamical black hole solutions can be mapped to static spacetimes by conformal metric transformations. This mapping provides a physical link between the conformal Killing horizon of the dynamical black hole and the Killing horizon of the static spacetime. Using the Vaidya spacetime as an example, we show how this conformal relation can be used to derive thermodynamic properties of such dynamical black holes. Although these horizons are defined quasi-locally and can be located by local experiments, they are distinct from other popular notions of quasi-local horizons such as apparent horizons. Thus in the dynamical Vaidya spacetime describing constant accretion of null dust, the conformal Killing horizon, which is null by construction, is the natural horizon to describe the black hole.

  11. Mitochondrial calcium uniporter silencing potentiates caspase-independent cell death in MDA-MB-231 breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Curry, Merril C.; Peters, Amelia A. [School of Pharmacy, The University of Queensland, Brisbane, Queensland 4072 (Australia); Kenny, Paraic A. [Department of Developmental and Molecular Biology, Albert Einstein College of Medicine, Bronx, New York 10461 (United States); Roberts-Thomson, Sarah J. [School of Pharmacy, The University of Queensland, Brisbane, Queensland 4072 (Australia); Monteith, Gregory R., E-mail: gregm@uq.edu.au [School of Pharmacy, The University of Queensland, Brisbane, Queensland 4072 (Australia)

    2013-05-10

    Highlights: •Some clinical breast cancers are associated with MCU overexpression. •MCU silencing did not alter cell death initiated with the Bcl-2 inhibitor ABT-263. •MCU silencing potentiated caspase-independent cell death initiated by ionomycin. •MCU silencing promoted ionomycin-mediated cell death without changes in bulk Ca{sup 2+}. -- Abstract: The mitochondrial calcium uniporter (MCU) transports free ionic Ca{sup 2+} into the mitochondrial matrix. We assessed MCU expression in clinical breast cancer samples using microarray analysis and the consequences of MCU silencing in a breast cancer cell line. Our results indicate that estrogen receptor negative and basal-like breast cancers are characterized by elevated levels of MCU. Silencing of MCU expression in the basal-like MDA-MB-231 breast cancer cell line produced no change in proliferation or cell viability. However, distinct consequences of MCU silencing were seen on cell death pathways. Caspase-dependent cell death initiated by the Bcl-2 inhibitor ABT-263 was not altered by MCU silencing; whereas caspase-independent cell death induced by the calcium ionophore ionomycin was potentiated by MCU silencing. Measurement of cytosolic Ca{sup 2+} levels showed that the promotion of ionomycin-induced cell death by MCU silencing occurs independently of changes in bulk cytosolic Ca{sup 2+} levels. This study demonstrates that MCU overexpression is a feature of some breast cancers and that MCU overexpression may offer a survival advantage against some cell death pathways. MCU inhibitors may be a strategy to increase the effectiveness of therapies that act through the induction of caspase-independent cell death pathways in estrogen receptor negative and basal-like breast cancers.

  12. Sharper and faster "nano darts" kill more bacteria: a study of antibacterial activity of individually dispersed pristine single-walled carbon nanotube.

    Science.gov (United States)

    Liu, Shaobin; Wei, Li; Hao, Lin; Fang, Ning; Chang, Matthew Wook; Xu, Rong; Yang, Yanhui; Chen, Yuan

    2009-12-22

    To further our understanding on the antibacterial activity of single-walled carbon nanotubes (SWCNTs), high purity SWCNTs with average diameter of 0.83 nm and (7,5) chirality as dominate (n,m) structure were dispersed in a biocompatible surfactant solution. Ultraviolet-visible-near-infrared radiation absorption spectroscopy was employed to monitor the aggregation of SWCNTs. The results demonstrated that individually dispersed SWCNTs were more toxic than SWCNT aggregates toward bacteria (gram-negative Escherichia coli, Pseudomonas aeruginosa, and gram-positive Staphylococcus aureus, Bacillus subtilis). Individually dispersed SWCNTs can be visualized as numerous moving "nano darts" in the solution, constantly attacking the bacteria; thereby, degrading the bacterial cell integrity and causing the cell death. Controlled experimental results suggested that inhibiting cell growth and oxidative stress were not the major causes responsible for the death of cells. Furthermore, the detrimental effects of Co metal residues (up to 1 mug/mL) on SWCNT samples can be ruled out. Atomic force microscope study conducted in suspension proved that the death rates of bacteria were strongly correlated with their mechanical properties; soft cells were more vulnerable to SWCNT piercing. The antibacterial activity of SWCNTs can be remarkably improved by enhancing the SWCNT physical puncture on bacteria in the following ways: (1) dispersing SWCNTs individually to sharpen the nano darts; (2) increasing SWCNT concentration to raise the population density of nano darts; and (3) elevating the shaking speed of incubation to speed up the nano darts. This study elucidated several factors controlling the antibacterial activity of pristine SWCNTs and it provided an insight in developing strategies that can maximize the SWCNT application potentials while minimizing the health and environment risks.

  13. Musashi-2 Silencing Exerts Potent Activity against Acute Myeloid Leukemia and Enhances Chemosensitivity to Daunorubicin.

    Directory of Open Access Journals (Sweden)

    Yixiang Han

    Full Text Available RNA-binding protein Musashi-2 (Msi2 is known to play a critical role in leukemogenesis and contributes to poor clinical prognosis in acute myeloid leukemia (AML. However, the effect of Msi2 silencing on treatment for AML still remains poorly understood. In this study, we used lentivirus-mediated RNA interference targeting Msi2 to investigate the resulting changes in cellular processes and the underlying mechanisms in AML cell lines as well as primary AML cells isolated from AML patients. We found that Msi2 was highly expressed in AML cells, and its depletion inhibited Ki-67 expression and resulted in decreased in vitro and in vivo proliferation. Msi2 silencing induced cell cycle arrest in G0/G1 phase, with decreased Cyclin D1 and increased p21 expression. Msi2 silencing induced apoptosis through down-regulation of Bcl-2 expression and up-regulation of Bax expression. Suppression of Akt, Erk1/2 and p38 phosphorylation also contributed to apoptosis mediated by Msi2 silencing. Finally, Msi2 silencing in AML cells also enhanced their chemosensitivity to daunorubicin. Conclusively, our data suggest that Msi2 is a promising target for gene therapy to optimize conventional chemotherapeutics in AML treatment.

  14. Silencing the Girdin gene enhances radio-sensitivity of hepatocellular carcinoma via suppression of glycolytic metabolism.

    Science.gov (United States)

    Yu, Li; Sun, Yifan; Li, Jingjing; Wang, Yan; Zhu, Yuxing; Shi, Yong; Fan, Xiaojun; Zhou, Jianda; Bao, Ying; Xiao, Jie; Cao, Ke; Cao, Peiguo

    2017-08-15

    Radiotherapy has been used increasingly to treat primary hepatocellular carcinoma. Clinically, the main cause of radiotherapy failure is cellular radioresistance, conferred via glycolytic metabolism. Our previous study demonstrated that Girdin is upregulated in primary hepatocellular carcinoma and promotes the invasion and metastasis of tumor cells. However, whether Girdin underlies the radio-sensitivity of hepatocellular carcinoma remains unclear. A short hairpin RNA (shRNA) was used to silence CCDC88A (encoding Girdin), and real-time PCR was performed to determine CCDC88A mRNA expression. Then, cell proliferation, colony formation, flow cytometric, scratch, and transwell assays were to examine the influence of Girdin silencing on cellular radiosensitivity. Glycolysis assays were conducted to exam cell glycolysis process. Western blotting was performed to explore the signaling pathway downstream of Girdin. Finally, animal experiments were performed to demonstrate the effect of CCDC88A silencing on the radiosensitivity of hepatoma in vivo. shRNA-induced Girdin silencing suppressed glycolysis and enhanced the radio-sensitivity of hepatic cell lines, HepG2 and Huh-7. Furthermore, silencing of Girdin inhibited the PI3K/AKT/HIF-1α signaling pathway, which is a central regulator of glycolysis. Girdin can regulate glycolysis in hepatocellular carcinoma cells through the PI3K/AKT/HIF-1α signaling pathway, which decreases the sensitivity of tumor cells to radiotherapy.

  15. Study of the safety, immunogenicity and efficacy of attenuated and killed Leishmania (Leishmania major vaccines in a rhesus monkey (Macaca mulatta model of the human disease

    Directory of Open Access Journals (Sweden)

    VF Amaral

    2002-10-01

    Full Text Available We have compared the efficacy of two Leishmania (Leishmania major vaccines, one genetically attenuated (DHFR-TS deficient organisms, the other inactivated [autoclaved promastigotes (ALM with bacillus Calmete-Guérin (BCG], in protecting rhesus macaques (Macaca mulatta against infection with virulent L. (L. major. Positive antigen-specific recall proliferative response was observed in vaccinees (79% in attenuated parasite-vaccinated monkeys, versus 75% in ALM-plus-BCG-vaccinated animals, although none of these animals exhibited either augmented in vitro gamma interferon (IFN-g production or positive delayed-type hypersensitivity (DTH response to the leishmanin skin test prior to the challenge. Following challenge, there were significant differences in blastogenic responses (p < 0.05 between attenuated-vaccinated monkeys and naïve controls. In both vaccinated groups very low levels of antibody were found before challenge, which increased after infective challenge. Protective immunity did not follow vaccination, in that monkeys exhibited skin lesion at the site of challenge in all the groups. The most striking result was the lack of pathogenicity of the attenuated parasite, which persisted in infected animals for up to three months, but were incapable of causing disease under the conditions employed. We concluded that both vaccine protocols used in this study are safe in primates, but require further improvement for vaccine application.

  16. "Drone Killings in Principle and in Practice"

    DEFF Research Database (Denmark)

    Dige, Morten

    2017-01-01

    to argue that what we see in the real world cases of drone killings is not merely an accidental or contingent use of drone technology. The real life use reflects to a large extent features that are inherent of the dominant drone systems that has been developed to date. What is being imagined "in principle......" is thus to a large extent drone killings in dreamland. I use an historic example as a point of reference and departure: the debate over the lawfulness of nuclear weapons....

  17. Welfare Risks of Repeated Application of On-Farm Killing Methods for Poultry

    Directory of Open Access Journals (Sweden)

    Jessica E. Martin

    2018-03-01

    Full Text Available Council Regulation (EC no. 1099/2009 on the protection of animals at the time of killing restricts the use of manual cervical dislocation in poultry on farms in the European Union (EU to birds weighing up to 3 kg and 70 birds per person per day. However, few studies have examined whether repeated application of manual cervical dislocation has welfare implications and whether these are dependent on individual operator skill or susceptibility to fatigue. We investigated the effects of repeated application (100 birds at a fixed killing rate of 1 bird per 2 min and multiple operators on two methods of killing of broilers, laying hens, and turkeys in commercial settings. We compared the efficacy and welfare impact of repeated application of cervical dislocation and a percussive killer (Cash Poultry Killer, CPK, using 12 male stockworkers on three farms (one farm per bird type. Both methods achieved over 96% kill success at the first attempt. The killing methods were equally effective for each bird type and there was no evidence of reduced performance with time and/or bird number. Both methods of killing caused a rapid loss of reflexes, indicating loss of brain function. There was more variation in reflex durations and post-mortem damage in birds killed by cervical dislocation than that found using CPK. High neck dislocation was associated with improved kill success and more rapid loss of reflexes. The CPK caused damage to multiple brain areas with little variation. Overall, the CPK was associated with faster abolition of reflexes, with fewer birds exhibiting them at all, suggestive of better welfare outcomes. However, technical difficulties with the CPK highlighted the advantages of cervical dislocation, which can be performed immediately with no equipment. At the killing rates tested, we did not find evidence to justify the current EU limit on the number of birds that one operator can kill on–farm by manual cervical dislocation.

  18. Excavating silences and tensions of agency|passivity in science education reform

    Science.gov (United States)

    Rivera Maulucci, Maria S.

    2010-12-01

    I reflect on studies by Rodriguez and Carlone, Haun-Frank, and Kimmel to emphasize the ways in which they excavate silences in the science education literature related to linguistic and cultural diversity and situating the problem of reform in teachers rather than contextual factors, such as traditional schooling discourses and forces that serve to marginalize science. I propose that the current push for top-down reform and accountability diminishes opportunities for receptivity, learning with and from students in order to transform teachers' practices and promote equity in science education. I discuss tensions of agency and passivity in science education reform and argue that attention to authentic caring constitutes another silence in the science education literature. I conclude that the current policy context positions teachers and science education researchers as tempered radicals struggling against opp(reg)ressive reforms and that there is a need for more studies to excavate these and other silences.

  19. RNA interference silencing of CHS greatly alters the growth pattern of apple (Malus x domestica).

    Science.gov (United States)

    Dare, Andrew P; Hellens, Roger P

    2013-08-01

    Plants produce a vast array of phenolic compounds which are essential for their survival on land. One major class of polyphenols are the flavonoids and their formation is dependent on the enzyme chalcone synthase (CHS). In a recent study we silenced the CHS genes of apple (Malus × domestica Borkh.) and observed a loss of pigmentation in the fruit skin, flowers and stems. More surprisingly, highly silenced lines were significantly reduced in size, with small leaves and shortened internode lengths. Chemical analysis also revealed that the transgenic shoots contained greatly reduced concentrations of flavonoids which are known to modulate auxin flow. An auxin transport study verified this, with an increased auxin transport in the CHS-silenced lines. Overall, these findings suggest that auxin transport in apple has adapted to take place in the presence of high endogenous concentrations of flavonoids. Removal of these compounds therefore results in abnormal auxin movement and a highly disrupted growth pattern.

  20. Does Host Complement Kill Borrelia burgdorferi within Ticks?

    OpenAIRE

    Rathinavelu, Sivaprakash; Broadwater, Anne; de Silva, Aravinda M.

    2003-01-01

    The Lyme disease spirochete, Borrelia burgdorferi, inhabits the gut lumen of the tick vector. At this location the spirochete is exposed to host blood when a tick feeds. We report here on studies that were done with normal and complement-deficient (C3-knockout) mice to determine if the host complement system killed spirochetes within the vector. We found that spirochete numbers within feeding nymphs were not influenced by complement, most likely because host complement was inactivated within ...

  1. ABCE1 is a highly conserved RNA silencing suppressor.

    Directory of Open Access Journals (Sweden)

    Kairi Kärblane

    Full Text Available ATP-binding cassette sub-family E member 1 (ABCE1 is a highly conserved protein among eukaryotes and archaea. Recent studies have identified ABCE1 as a ribosome-recycling factor important for translation termination in mammalian cells, yeast and also archaea. Here we report another conserved function of ABCE1. We have previously described AtRLI2, the homolog of ABCE1 in the plant Arabidopsis thaliana, as an endogenous suppressor of RNA silencing. In this study we show that this function is conserved: human ABCE1 is able to suppress RNA silencing in Nicotiana benthamiana plants, in mammalian HEK293 cells and in the worm Caenorhabditis elegans. Using co-immunoprecipitation and mass spectrometry, we found a number of potential ABCE1-interacting proteins that might support its function as an endogenous suppressor of RNA interference. The interactor candidates are associated with epigenetic regulation, transcription, RNA processing and mRNA surveillance. In addition, one of the identified proteins is translin, which together with its binding partner TRAX supports RNA interference.

  2. Epigenetic silencing of serine protease HTRA1 drives polyploidy

    International Nuclear Information System (INIS)

    Schmidt, Nina; Irle, Inga; Ripkens, Kamilla; Lux, Vanda; Nelles, Jasmin; Johannes, Christian; Parry, Lee; Greenow, Kirsty; Amir, Sarah; Campioni, Mara; Baldi, Alfonso; Oka, Chio; Kawaichi, Masashi; Clarke, Alan R.; Ehrmann, Michael

    2016-01-01

    Increased numbers and improperly positioned centrosomes, aneuploidy or polyploidy, and chromosomal instability are frequently observed characteristics of cancer cells. While some aspects of these events and the checkpoint mechanisms are well studied, not all players have yet been identified. As the role of proteases other than the proteasome in tumorigenesis is an insufficiently addressed question, we investigated the epigenetic control of the widely conserved protease HTRA1 and the phenotypes of deregulation. Mouse embryonal fibroblasts and HCT116 and SW480 cells were used to study the mechanism of epigenetic silencing of HTRA1. In addition, using cell biological and genetic methods, the phenotypes of downregulation of HTRA1 expression were investigated. HTRA1 is epigenetically silenced in HCT116 colon carcinoma cells via the epigenetic adaptor protein MBD2. On the cellular level, HTRA1 depletion causes multiple phenotypes including acceleration of cell growth, centrosome amplification and polyploidy in SW480 colon adenocarcinoma cells as well as in primary mouse embryonic fibroblasts (MEFs). Downregulation of HTRA1 causes a number of phenotypes that are hallmarks of cancer cells suggesting that the methylation state of the HtrA1 promoter may be used as a biomarker for tumour cells or cells at risk of transformation. The online version of this article (doi:10.1186/s12885-016-2425-8) contains supplementary material, which is available to authorized users

  3. Killing Hitler: A Writer's Journey and Angst.

    Science.gov (United States)

    Thaler, Paul

    2002-01-01

    Describes the author's experiences in preparing a talk that "evokes the specter" of Adolf Hitler and in writing an historical account of a British plot to kill Hitler. Address the question of why the British allowed him to live that final year of the war. Muses on why scholars write, and the impact of violence and terrorism. (SG)

  4. School Shootings; Standards Kill Students and Society

    Science.gov (United States)

    Angert, Betsy L.

    2008-01-01

    School shootings have been in the news of late. People ponder what occurs in classrooms today. Why would a young person wish to take a life? Within educational institutions, the killings are a concern. In our dire attempt to teach the children and ensure student success, it seems many of our offspring are lost. Some students feel separate from…

  5. Mass killings and detection of impacts

    Science.gov (United States)

    McLaren, Digby J.

    Highly energetic bolide impacts occur and their flux is known. For larger bodies the energy release is greater than for any other short-term global phenomenon. Such impacts produce or release a large variety of shock induced changes including major atmospheric, sedimentologic, seismic and volcanic events. These events must necessarily leave a variety of records in the stratigraphic column, including mass killings resulting in major changes in population density and reduction or extinction of many taxonomic groups, followed by characteristic patterns of faunal and flora replacement. Of these effects, mass killings, marked by large-scale loss of biomass, are the most easily detected evidence in the field but must be manifest on a near-global scale. Such mass killings that appear to be approximately synchronous and involve disappearance of biomass at a bedding plane in many sedimentologically independent sections globally suggest a common cause and probable synchroneity. Mass killings identify an horizon which may be examined for evidence of cause. Geochemical markers may be ephemeral and absence may not be significant. There appears to be no reason why ongoing phenomena such as climate and sea-level changes are primary causes of anomolous episodic events.

  6. Kill it or grow it

    DEFF Research Database (Denmark)

    Valente, Andrea; Marchetti, Emanuela

    2012-01-01

    Creating playful games to support domain-specific learning is a complex task. This paper presents the design and development of Prime Slaughter, a computer game to play with abstract mathematical concepts, like factorization and primality. The target group is composed of primary and early secondary...... school students. Following the findings of a participatory design study about children interaction in museums, our game maps operational aspects of prime factorization onto a gameplay inspired by 2D action-adventure games, where primality and factorizaton are experienced in a visual and direct way....... The museum study also suggests to support learning by multiple play styles and goal-directed activities. A new participatory design study is about to start, to validate and improve the latest prototype of the game....

  7. Slow electrons kill the ozone

    International Nuclear Information System (INIS)

    Maerk, T.

    2001-01-01

    A new method and apparatus (Trochoidal electron monochromator) to study the interactions of electrons with atoms, molecules and clusters was developed. Two applications are briefly reported: a) the ozone destruction in the atmosphere is caused by different reasons, a new mechanism is proposed, that slow thermal electrons are self added to the ozone molecule (O 3 ) with a high frequency, then O 3 is destroyed ( O 3 + e - → O - + O 2 ); b) another application is the study of the binding energy of the football molecule C60. (nevyjel)

  8. Scientific projection paper for mutagenesis, transformation and cell killing

    International Nuclear Information System (INIS)

    Todd, P.

    1980-01-01

    Our knowledge about mutagenesis, transformation, and cell killing by ionizing radiation consists of large bodies of data, which are potentially useful in terms of application to human risk assessment and to the constructive use of radiation, as in cancer treatment. The three end-points discussed above are united by at least five significant concepts in radiation research strategy: (1) The inter-relationships among the important end-points, mutation, carcinogenesis, and cell killing. Research on one is meaningful only in the context of information about the other two. (2) The interaction of radiations with other agents in producing these end-points. (3) The mechanisms of action of other environmental mutagenic, carcinogenic, and cytotoxic agents. (4) The use of repair deficient human mutant cells. (5) The study of radiation damage mechanisms. There is no better way to extrapolate laboratory data to the clinical and public worlds than to understand the underlying biological mechanisms that produced the data

  9. Small silencing RNAs: an expanding universe.

    Science.gov (United States)

    Ghildiyal, Megha; Zamore, Phillip D

    2009-02-01

    Since the discovery in 1993 of the first small silencing RNA, a dizzying number of small RNA classes have been identified, including microRNAs (miRNAs), small interfering RNAs (siRNAs) and Piwi-interacting RNAs (piRNAs). These classes differ in their biogenesis, their modes of target regulation and in the biological pathways they regulate. There is a growing realization that, despite their differences, these distinct small RNA pathways are interconnected, and that small RNA pathways compete and collaborate as they regulate genes and protect the genome from external and internal threats.

  10. The Enamovirus P0 protein is a silencing suppressor which inhibits local and systemic RNA silencing through AGO1 degradation

    International Nuclear Information System (INIS)

    Fusaro, Adriana F.; Correa, Regis L.; Nakasugi, Kenlee; Jackson, Craig; Kawchuk, Lawrence; Vaslin, Maite F.S.; Waterhouse, Peter M.

    2012-01-01

    The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0 PE , in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0 PE has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0 PE destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.

  11. Simulation and Measurements of Small Arms Blast Wave Overpressure in the Process of Designing a Silencer

    Directory of Open Access Journals (Sweden)

    Hristov Nebojša

    2015-02-01

    Full Text Available Simulation and measurements of muzzle blast overpressure and its physical manifestations are studied in this paper. The use of a silencer can have a great influence on the overpressure intensity. A silencer is regarded as an acoustic transducer and a waveguide. Wave equations for an acoustic dotted source of directed effect are used for physical interpretation of overpressure as an acoustic phenomenon. Decomposition approach has proven to be suitable to describe the formation of the output wave of the wave transducer. Electroacoustic analogies are used for simulations. A measurement chain was used to compare the simulation results with the experimental ones.

  12. The Relationship between Organizational Climate and the Organizational Silence of Administrative Staff in Education Department

    Science.gov (United States)

    Pozveh, Asghar Zamani; Karimi, Fariba

    2016-01-01

    The aim of the present study was to determine the relationship between organizational climate and the organizational silence of administrative staff in Education Department in Isfahan. The research method was descriptive and correlational-type method. The study population was administrative staff of Education Department in Isfahan during the…

  13. The development and application of a multiple gene co-silencing system using endogenous URA3 as a reporter gene in Ganoderma lucidum.

    Directory of Open Access Journals (Sweden)

    Dashuai Mu

    Full Text Available Ganoderma lucidum is one of the most important medicinal mushrooms; however, molecular genetics research on this species has been limited due to a lack of reliable reverse genetic tools. In this study, the endogenous orotidine 5'-monophosphate decarboxylase gene (URA3 was cloned as a silencing reporter, and four gene-silencing methods using hairpin, sense, antisense, and dual promoter constructs, were introduced into G. lucidum through a simple electroporation procedure. A comparison and evaluation of silencing efficiency demonstrated that all of the four methods differentially suppressed the expression of URA3. Our data unequivocally indicate that the dual promoter silencing vector yields the highest rate of URA3 silencing compared with other vectors (up to 81.9%. To highlight the advantages of the dual promoter system, we constructed a co-silencing system based on the dual promoter method and succeeded in co-silencing URA3 and laccase in G. lucidum. The reduction of the mRNA levels of the two genes were correlated. Thus, the screening efficiency for RNAi knockdown of multiple genes may be improved by the co-silencing of an endogenous reporter gene. The molecular tools developed in this study should facilitate the isolation of genes and the characterization of the functions of multiple genes in this pharmaceutically important species, and these tools should be highly useful for the study of other basidiomycetes.

  14. Commuting symmetry operators of the Dirac equation, Killing-Yano and Schouten-Nijenhuis brackets

    International Nuclear Information System (INIS)

    Cariglia, Marco; Krtous, Pavel; Kubiznak, David

    2011-01-01

    In this paper we derive the most general first-order symmetry operator commuting with the Dirac operator in all dimensions and signatures. Such an operator splits into Clifford even and Clifford odd parts which are given in terms of odd Killing-Yano and even closed conformal Killing-Yano inhomogeneous forms, respectively. We study commutators of these symmetry operators and give necessary and sufficient conditions under which they remain of the first-order. In this specific setting we can introduce a Killing-Yano bracket, a bilinear operation acting on odd Killing-Yano and even closed conformal Killing-Yano forms, and demonstrate that it is closely related to the Schouten-Nijenhuis bracket. An important nontrivial example of vanishing Killing-Yano brackets is given by Dirac symmetry operators generated from the principal conformal Killing-Yano tensor [hep-th/0612029]. We show that among these operators one can find a complete subset of mutually commuting operators. These operators underlie separability of the Dirac equation in Kerr-NUT-(A)dS spacetimes in all dimensions [arXiv:0711.0078].

  15. Genome-wide methylation analysis identifies genes silenced in non-seminoma cell lines.

    Science.gov (United States)

    Noor, Dzul Azri Mohamed; Jeyapalan, Jennie N; Alhazmi, Safiah; Carr, Matthew; Squibb, Benjamin; Wallace, Claire; Tan, Christopher; Cusack, Martin; Hughes, Jaime; Reader, Tom; Shipley, Janet; Sheer, Denise; Scotting, Paul J

    2016-01-01

    Silencing of genes by DNA methylation is a common phenomenon in many types of cancer. However, the genome-wide effect of DNA methylation on gene expression has been analysed in relatively few cancers. Germ cell tumours (GCTs) are a complex group of malignancies. They are unique in developing from a pluripotent progenitor cell. Previous analyses have suggested that non-seminomas exhibit much higher levels of DNA methylation than seminomas. The genomic targets that are methylated, the extent to which this results in gene silencing and the identity of the silenced genes most likely to play a role in the tumours' biology have not yet been established. In this study, genome-wide methylation and expression analysis of GCT cell lines was combined with gene expression data from primary tumours to address this question. Genome methylation was analysed using the Illumina infinium HumanMethylome450 bead chip system and gene expression was analysed using Affymetrix GeneChip Human Genome U133 Plus 2.0 arrays. Regulation by methylation was confirmed by demethylation using 5-aza-2-deoxycytidine and reverse transcription-quantitative PCR. Large differences in the level of methylation of the CpG islands of individual genes between tumour cell lines correlated well with differential gene expression. Treatment of non-seminoma cells with 5-aza-2-deoxycytidine verified that methylation of all genes tested played a role in their silencing in yolk sac tumour cells and many of these genes were also differentially expressed in primary tumours. Genes silenced by methylation in the various GCT cell lines were identified. Several pluripotency-associated genes were identified as a major functional group of silenced genes.

  16. Prevalence of alcohol and other psychoactive substances in injured and killed drivers

    DEFF Research Database (Denmark)

    Isalberti, Cristina; Linden, Trudy Van der; Legrand, Sara-Ann

    2011-01-01

    regarding the prevalence of alcohol and other psychoactive substances in drivers who have been injured/killed in traffic accidents. Part 1 of this report presents the general results of the hospital & killed driver studies. After a short introduction, the representativeness of the populations in the EU...... countries as well as the representativeness of hospitalised and killed driver samples are addressed. An overview of the non-response issues in the various countries is also included. Based on the toxicological findings, a general summary of the prevalence of drug use is given for the 9 participating...

  17. The killing of African trypanosomes by ethidium bromide.

    Directory of Open Access Journals (Sweden)

    Arnab Roy Chowdhury

    2010-12-01

    Full Text Available Introduced in the 1950s, ethidium bromide (EB is still used as an anti-trypanosomal drug for African cattle although its mechanism of killing has been unclear and controversial. EB has long been known to cause loss of the mitochondrial genome, named kinetoplast DNA (kDNA, a giant network of interlocked minicircles and maxicircles. However, the existence of viable parasites lacking kDNA (dyskinetoplastic led many to think that kDNA loss could not be the mechanism of killing. When recent studies indicated that kDNA is indeed essential in bloodstream trypanosomes and that dyskinetoplastic cells survive only if they have a compensating mutation in the nuclear genome, we investigated the effect of EB on kDNA and its replication. We here report some remarkable effects of EB. Using EM and other techniques, we found that binding of EB to network minicircles is low, probably because of their association with proteins that prevent helix unwinding. In contrast, covalently-closed minicircles that had been released from the network for replication bind EB extensively, causing them, after isolation, to become highly supertwisted and to develop regions of left-handed Z-DNA (without EB, these circles are fully relaxed. In vivo, EB causes helix distortion of free minicircles, preventing replication initiation and resulting in kDNA loss and cell death. Unexpectedly, EB also kills dyskinetoplastic trypanosomes, lacking kDNA, by inhibiting nuclear replication. Since the effect on kDNA occurs at a >10-fold lower EB concentration than that on nuclear DNA, we conclude that minicircle replication initiation is likely EB's most vulnerable target, but the effect on nuclear replication may also contribute to cell killing.

  18. Dirac operators and Killing spinors with torsion; Dirac-Operatoren und Killing-Spinoren mit Torsion

    Energy Technology Data Exchange (ETDEWEB)

    Becker-Bender, Julia

    2012-12-17

    On a Riemannian spin manifold with parallel skew torsion, we use the twistor operator to obtain an eigenvalue estimate for the Dirac operator with torsion. We consider the equality case in dimensions four and six. In odd dimensions we describe Sasaki manifolds on which equality in the estimate is realized by Killing spinors with torsion. In dimension five we characterize all Killing spinors with torsion and obtain certain naturally reductive spaces as exceptional cases.

  19. Killing effect of carboranyl uridine on boron neutron capture reaction

    International Nuclear Information System (INIS)

    Takagaki, M.; Oda, Y.; Zhang, Z.

    1994-01-01

    This paper deals with the killing effect of carboranyl uridine (CU) on thermal neutron capture reaction in cultured glioma cell line (C6). The tumoricidal effect of CU for boron neutron capture therapy in the cultured cell system is presented. To assess the uptake of CU, the number of germ cells was determined by comparing protein concentrations of C6 cells in vitro with that of intracranially transplanted C6 tumor cells in vivo. To assess tumoricidal effects of CU, human glioma cells (T98G), containing 25 ppm natural boron of CU, were irradiated with various doses of thermal neutrons at a constant fluence rate. The uptake and killing effects of mercaptoboron and boric acid were also investigated as controls. Subcellular boron concentrations confirmed the selective affinity to the nucleic acid synthesis. CU was found to have an affinity to nucleic acid synthesis and to be accumulated into nucleus of tumor cells. The irradiation dose which yielded 37% survival rate in the case of CU and control were 3.78+12E nvt and 5.80+12E nvt, respectively. The killing effect of CU was slightly higher than that of B-SH or BA. The effective way of CU injection should be further studied to obtain the uniform CU uptake in tumor cells. (N.K.)

  20. Intestinal mucus protects Giardia lamblia from killing by human milk.

    Science.gov (United States)

    Zenian, A J; Gillin, F D

    1987-02-01

    We have previously shown that nonimmune human milk kills Giardia lamblia trophozoites in vitro. Killing requires a bile salt and the activity of the milk bile salt-stimulated lipase. We now show that human small-intestinal mucus protects trophozoites from killing by milk. Parasite survival increased with mucus concentration, but protection was overcome during longer incubation times or with greater milk concentrations. Trophozoites preincubated with mucus and then washed were not protected. Protective activity was associated with non-mucin CsCl density gradient fractions. Moreover, it was heat-stable, non-dialyzable, and non-lipid. Whereas whole mucus inhibited milk lipolytic activity, protective mucus fractions did not inhibit the enzyme. Furthermore, mucus partially protected G. lamblia trophozoites against the toxicity of oleic acid, a fatty acid which is released from milk triglycerides by lipase. These studies show that mucus protects G. lamblia both by inhibiting lipase activity and by decreasing the toxicity of products of lipolysis. The ability of mucus to protect G. lamblia from toxic lipolytic products may help to promote intestinal colonization by this parasite.

  1. Photoexcited quantum dots for killing multidrug-resistant bacteria

    Science.gov (United States)

    Courtney, Colleen M.; Goodman, Samuel M.; McDaniel, Jessica A.; Madinger, Nancy E.; Chatterjee, Anushree; Nagpal, Prashant

    2016-05-01

    Multidrug-resistant bacterial infections are an ever-growing threat because of the shrinking arsenal of efficacious antibiotics. Metal nanoparticles can induce cell death, yet the toxicity effect is typically nonspecific. Here, we show that photoexcited quantum dots (QDs) can kill a wide range of multidrug-resistant bacterial clinical isolates, including methicillin-resistant Staphylococcus aureus, carbapenem-resistant Escherichia coli, and extended-spectrum β-lactamase-producing Klebsiella pneumoniae and Salmonella typhimurium. The killing effect is independent of material and controlled by the redox potentials of the photogenerated charge carriers, which selectively alter the cellular redox state. We also show that the QDs can be tailored to kill 92% of bacterial cells in a monoculture, and in a co-culture of E. coli and HEK 293T cells, while leaving the mammalian cells intact, or to increase bacterial proliferation. Photoexcited QDs could be used in the study of the effect of redox states on living systems, and lead to clinical phototherapy for the treatment of infections.

  2. Effects of lead on the killing mechanisms of polymorphonuclear leukocytes

    International Nuclear Information System (INIS)

    Silberstein, C.F.

    1984-01-01

    The effects of lead on the killing mechanisms of rat polymorphonuclear leukocytes (PMN) were investigated, using male Long-Evans rats exposed to 1% lead acetate in the drinking water for varying periods of time to achieve blood lead levels ranging from 20-200 μg/dl. Studies of PMN bacterial and fungal killing activity, chemotaxis and phagocytosis demonstrated that: 1) bactericidal activity of PMN from rats exposed to lead was not altered; 2) chemotactic activity remained within normal limits; 3) the phagocytic ability of the PMN also remained unaltered. In addition to these normal findings, one major abnormality was demonstrated: a significant decrease in the ability of PMN from rats exposed to lead to kill Candida albicans. This defect was not related to age or to length of exposure. It could not be produced by addition of lead to the test system in vitro. Further investigation revealed significant decreases in PMN glucose-6-phosphate dehydrogenase, catalase, and myeloperoxidase activities. These data support two possible mechanisms for the abnormal fungicidal activity of PMN from lead-exposed rats: decrease in ability to reduce oxygen to active metabolites, or reduction in myeloperoxidase activity due to diminshed synthesis of the heme moiety required for its function

  3. RNA-mediated gene silencing signals are not graft transmissible from the rootstock to the scion in greenhouse-grown apple plants Malus sp.

    Science.gov (United States)

    Flachowsky, Henryk; Tränkner, Conny; Szankowski, Iris; Waidmann, Sascha; Hanke, Magda-Viola; Treutter, Dieter; Fischer, Thilo C

    2012-01-01

    RNA silencing describes the sequence specific degradation of RNA targets. Silencing is a non-cell autonomous event that is graft transmissible in different plant species. The present study is the first report on systemic acquired dsRNA-mediated gene silencing of transgenic and endogenous gene sequences in a woody plant like apple. Transgenic apple plants overexpressing a hairpin gene construct of the gusA reporter gene were produced. These plants were used as rootstocks and grafted with scions of the gusA overexpressing transgenic apple clone T355. After grafting, we observed a reduction of the gusA gene expression in T355 scions in vitro, but not in T355 scions grown in the greenhouse. Similar results were obtained after silencing of the endogenous Mdans gene in apple that is responsible for anthocyanin biosynthesis. Subsequently, we performed grafting experiments with Mdans silenced rootstocks and red leaf scions of TNR31-35 in order to evaluate graft transmitted silencing of the endogenous Mdans. The results obtained suggested a graft transmission of silencing signals in in vitro shoots. In contrast, no graft transmission of dsRNA-mediated gene silencing signals was detectable in greenhouse-grown plants and in plants grown in an insect protection tent.

  4. Silence, Speech and Gender in Shakespeare’s Othello: A Presentist, Palestinian Perspective

    Directory of Open Access Journals (Sweden)

    Bilal M.T. Hamamra

    2015-10-01

    Full Text Available This paper follows the critical lines of feminism and psychoanalysis to argue that Othello is a conflict between female characters' moral voices and male figures' treacherous voices. Drawing on the concepts of Jungian and Freudian psychoanalysis, I argue that the association of female speech and silence with sexuality is a projection of misogynist and racist discourses. I read Iago's projection of his evil onto Othello as a verbal intercourse of homosexuality.  The cause of tragedy emanates from the fact that Othello weds his shadow, Iago and ignores his anima, Desdemona. While the verbal marriage between Othello and Iago results in Othello's accusation of Desdemona of being a whore, I argue that Desdemona escapes this category because a boy actor impersonates her physically and vocally. I argue that Othello stages for audiences in contemporary Palestine male figures’ deafness to feminist views. While Othello’s marriage to Desdemona symbolizes his integration into Venetian society, his murder of Desdemona signals the loss of his heroic identity and the dissolution of his link to Venice. In contrast, killing the supposedly aggressive female figures in Palestine marks the public respect of the killer. Furthermore, I use the romance of Antar (525-608 as a Palestinian literary intertext to scrutinize the significance of female figures in constructing male figures’ heroic identity and the racial discourse that the Romance of Antar and Othello embodies. Key words: Racism, Misogyny, Projection, Honour Killing, Gender Difference, Boy Actor

  5. Antiviral RNA silencing viral counter defense in plants

    NARCIS (Netherlands)

    Bucher, E.C.

    2006-01-01

    The research described in this thesis centres around the mechanism of RNA silencing in relation to virus-host interaction, an area of increasing importance. It shows how this recently disclosed mechanism can be used to produce virus-resistant plants. Based on the activity of the RNA silencing

  6. No-Big-Silence teeb klubituuri / Urmas Hännile

    Index Scriptorium Estoniae

    Hännile, Urmas

    2009-01-01

    Rockansamblist No-Big-Silence ja dark-popansamblist Sinine, nende kontsertttuurist mööda Eestimaad, tutvustamisel bändide uued albumid (No-Big-Silence "Starstealer" ja Sinine "Butterflies"), Pärnus on kontsert 24. oktoobril klubis Sugar

  7. Strategies underlying RNA silencing suppression by negative strand RNA viruses

    NARCIS (Netherlands)

    Hemmes, J.C.

    2007-01-01

    The research described in this thesis focused on the strategies of negative strand RNA viruses to counteract antiviral RNA silencing. In plants and insects, RNA silencing has been shown to act as a sequence specific antiviral defence mechanism that is characterised by the processing of double

  8. Plasmodium falciparum var Gene Silencing Is Determined by cis DNA Elements That Form Stable and Heritable Interactions ▿

    Science.gov (United States)

    Swamy, Lakshmi; Amulic, Borko; Deitsch, Kirk W.

    2011-01-01

    Antigenic variation in the human malaria parasite Plasmodium falciparum depends on the transcriptional regulation of the var gene family. In each individual parasite, mRNA is expressed exclusively from 1 var gene out of ∼60, while the rest of the genes are transcriptionally silenced. Both modifications to chromatin structure and DNA regulatory elements associated with each var gene have been implicated in the organization and maintenance of the silent state. Whether silencing is established at the level of entire chromosomal regions via heterochromatin spreading or at the level of individual var promoters through the action of a silencing element within each var intron has been debated. Here, we consider both possibilities, using clonal parasite lines carrying chromosomally integrated transgenes. We confirm a previous finding that the loss of an adjacent var intron results in var promoter activation and further show that transcriptional activation of a var promoter within a cluster does not affect the transcriptional activity of neighboring var promoters. Our results provide more evidence for the hypothesis that var genes are primarily silenced at the level of an individual gene, rather than by heterochromatin spreading. We also tested the intrinsic directionality of an intron's silencing effect on upstream or downstream var promoters. We found that an intron is capable of silencing in either direction and that, once established, a var promoter-intron pair is stably maintained through many generations, suggesting a possible role in epigenetic memory. This study provides insights into the regulation of endogenous var gene clusters. PMID:21317310

  9. A Day of Silence, a Day of Truth, and a Lawsuit

    Science.gov (United States)

    Fusarelli, Bonnie C.; Eaton, Lucy E.

    2011-01-01

    This case study focuses on issues of freedom of speech and freedom of religion in public schools. It involves a rural, southern high school where a group of students participated in a Day of Silence. The school allowed the students to participate based on the principal's understanding of the students' First Amendment rights. However, the next day,…

  10. Excavating Silences and Tensions of Agency|Passivity in Science Education Reform

    Science.gov (United States)

    Rivera Maulucci, Maria S.

    2010-01-01

    I reflect on studies by Rodriguez and Carlone, Haun-Frank, and Kimmel to emphasize the ways in which they excavate silences in the science education literature related to linguistic and cultural diversity and situating the problem of reform in teachers rather than contextual factors, such as traditional schooling discourses and forces that serve…

  11. An Eastern Learning Paradox: Paradoxes in Two Korean Mathematics Teachers' Pedagogy of Silence in the Classroom

    Science.gov (United States)

    Lee, Kyeonghwa; Sriraman, Bharath

    2013-01-01

    Eastern philosophies of education such as Confucianism and Taosim advocate the use of silence in the teacher-pupil tradition of pedagogy. We investigate contemporary classrooms in Korea, and study whether teachers in Korea today incorporate this method implicitly or explicitly in their classrooms. Empirical data in the form of video-taped…

  12. The Relationship among Interactional Justice, Manager Trust and Teachers' Organizational Silence Behavior

    Science.gov (United States)

    Yangin, Demet; Elma, Cevat

    2017-01-01

    The purpose of this study was to determine the relationship between the manager trust and interactional justice perceptions and organizational silence behaviors of those teachers who work in primary and secondary schools. The research is based on the survey model and the population consists of 4761 teachers who worked in Samsun, Turkey. The sample…

  13. The Shadow of Silence on the Sexual Rights of Married Iranian Women

    Directory of Open Access Journals (Sweden)

    Roksana Janghorban

    2015-01-01

    Full Text Available There has been a recent shift in the field of sexual health, representing a move away from biomedical concerns to sexual rights frameworks. However, few studies on sexuality are based on a rights framework. The unspoken nature of sexuality in Iranian culture has led to a lack of national studies on the topic. The objective of this study was to explore the perceptions and experiences of married Iranian women on sexual rights in their sexual relationships. In this grounded theory study, 37 participants (25 married women, 5 husbands, and 7 midwives were selected. Data were collected through in-depth interviews and analyzed through open, axial, and selective coding using MAXQDA software version 2007. The analysis revealed the core category of “sexual interaction in the shadow of silence.” The interrelated categories subsumed under the core category included adopting a strategy of silence, trying to negotiate sex, seeking help, and sexual adjustment. The silence originating from women’s interactions with their families and society, from girlhood to womanhood, was identified as the core concept in Iranian women’s experiences of sexual rights. A focus on husbands’ roles seems salient because they can direct or alter some learned feminine roles, especially silence regarding sexual matters, which then affects the realization of women’s sexual rights.

  14. Gene silencing of stearoyl-ACP desaturase enhances the stearic acid content in Chlamydomonas reinhardtii

    NARCIS (Netherlands)

    Jaeger, de L.; Springer, J.; Wolbert, E.J.H.; Martens, D.E.; Eggink, G.; Wijffels, R.H.

    2017-01-01

    In this study, stearoyl-ACP desaturase (SAD), the enzyme that converts stearic acid into oleic acid, is silenced by artificial microRNA in the green microalga Chlamydomonas reinhardtii. Two different constructs, which target different positions on the mRNA of stearoyl-ACP desaturase, were tested.

  15. Insights on ornithine decarboxylase silencing as a potential strategy for targeting retinoblastoma.

    Science.gov (United States)

    Muthukumaran, Sivashanmugam; Bhuvanasundar, Renganathan; Umashankar, Vetrivel; Sulochana, K N

    2018-02-01

    Ornithine Decarboxylase (ODC) is a key enzyme involved in polyamine synthesis and is reported to be up regulated in several cancers. However, the effect of ODC gene silencing in retinoblastoma is to be understood for utilization in therapeutic applications. Hence, in this study, a novel siRNA (small interference RNA) targeting ODC was designed and validated in Human Y79 retinoblastoma cells for its effects on intracellular polyamine levels, Matrix Metalloproteinase 2 & 9 activity and Cell cycle. The designed siRNA showed efficient silencing of ODC mRNA expression and protein levels in Y79 cells. It also showed significant reduction of intracellular polyamine levels and altered levels of oncogenic LIN28b expression. By this study, a regulatory loop is proposed, wherein, ODC silencing in Y79 cells to result in decreased polyamine levels, thereby, leading to altered protein levels of Lin28b, MMP-2 and MMP-9, which falls in line with earlier studies in neuroblastoma. Thus, by this study, we propose ODC silencing as a prospective strategy for targeting retinoblastoma. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  16. Bacterial Killing by Dry Metallic Copper Surfaces▿

    OpenAIRE

    Santo, Christophe Espírito; Lam, Ee Wen; Elowsky, Christian G.; Quaranta, Davide; Domaille, Dylan W.; Chang, Christopher J.; Grass, Gregor

    2010-01-01

    Metallic copper surfaces rapidly and efficiently kill bacteria. Cells exposed to copper surfaces accumulated large amounts of copper ions, and this copper uptake was faster from dry copper than from moist copper. Cells suffered extensive membrane damage within minutes of exposure to dry copper. Further, cells removed from copper showed loss of cell integrity. Acute contact with metallic copper surfaces did not result in increased mutation rates or DNA lesions. These findings are important fir...

  17. Chinanteco children’s silences in different classroom situations

    Directory of Open Access Journals (Sweden)

    Valeria Rebolledo Angulo

    2016-01-01

    Full Text Available This article analyzes, from an ethnographic perspective and a sociocultural framework, the construction of silences in the interaction between students and teachers in a multilingual classroom situation in an indigenous community in méxico. the analysis reveals how the silence of the chinanteco speaking children when asked to answer certain questions in class is not always due to their failure to understand spoken and written spanish that is used in class. their silences are responses taking different meanings in specific situations. the silence of the children can be a way of resisting, a way of hiding, and, sometimes, their voices are silenced.

  18. The RNA silencing pathway: the bits and pieces that matter.

    Directory of Open Access Journals (Sweden)

    2005-07-01

    Full Text Available Cellular pathways are generally proposed on the basis of available experimental knowledge. The proposed pathways, however, may be inadequate to describe the phenomena they are supposed to explain. For instance, by means of concise mathematical models we are able to reveal shortcomings in the current description of the pathway of RNA silencing. The silencing pathway operates by cleaving siRNAs from dsRNA. siRNAs can associate with RISC, leading to the degradation of the target mRNA. We propose and analyze a few small extensions to the pathway: a siRNA degrading RNase, primed amplification of aberrant RNA pieces, and cooperation between aberrant RNA to trigger amplification. These extensions allow for a consistent explanation for various types of silencing phenomena, such as virus induced silencing, transgene and transposon induced silencing, and avoidance of self-reactivity, as well as for differences found between species groups.

  19. ANALYZE THE IMPACT OF HABITAT PATCHES ON WILDLIFE ROAD-KILL

    OpenAIRE

    Seok, S.; Lee, J.

    2015-01-01

    The ecosystem fragmentation due to transportation infrastructure causes a road-kill phenomenon. When making policies for mitigating road-kill it is important to select target-species in order to enhance its efficiency. However, many wildlife crossing structures have been questioned regarding their effectiveness due to lack of considerations such as target-species selection, site selection, management, etc. The purpose of this study is to analyse the impact of habitat patches on wildlife road-...

  20. Comparative antianaerobic activities of doripenem determined by MIC and time-kill analysis.

    Science.gov (United States)

    Credito, Kim L; Ednie, Lois M; Appelbaum, Peter C

    2008-01-01

    Against 447 anaerobe strains, the investigational carbapenem doripenem had an MIC 50 of 0.125 microg/ml and an MIC 90 of 1 microg/ml. Results were similar to those for imipenem, meropenem, and ertapenem. Time-kill studies showed that doripenem had very good bactericidal activity compared to other carbapenems, with 99.9% killing of 11 strains at 2x MIC after 48 h.

  1. Comparative Antianaerobic Activities of Doripenem Determined by MIC and Time-Kill Analysis▿

    Science.gov (United States)

    Credito, Kim L.; Ednie, Lois M.; Appelbaum, Peter C.

    2008-01-01

    Against 447 anaerobe strains, the investigational carbapenem doripenem had an MIC50 of 0.125 μg/ml and an MIC90 of 1 μg/ml. Results were similar to those for imipenem, meropenem, and ertapenem. Time-kill studies showed that doripenem had very good bactericidal activity compared to other carbapenems, with 99.9% killing of 11 strains at 2× MIC after 48 h. PMID:17938185

  2. Vacuum spacetimes with a spacelike, hypersurface-orthogonal Killing vector: reduced equations in a canonical frame

    International Nuclear Information System (INIS)

    Bonanos, S

    2003-01-01

    The Newman-Penrose equations for spacetimes having one spacelike Killing vector are reduced-in a geometrically defined 'canonical frame' - to a minimal set, and its differential structure is studied. Expressions for the frame vectors in an arbitrary coordinate basis are given, and coordinate-independent choices of the metric functions are suggested which make the components of the Ricci tensor in the direction of the Killing vector vanish

  3. It's not just conflict that motivates killing of orangutans.

    Directory of Open Access Journals (Sweden)

    Jacqueline T Davis

    Full Text Available We investigated why orangutans are being killed in Kalimantan, Indonesia, and the role of conflict in these killings. Based on an analysis of interview data from over 5,000 respondents in over 450 villages, we also assessed the socio-ecological factors associated with conflict and non-conflict killings. Most respondents never kill orangutans. Those who reported having personally killed an orangutan primarily did so for non-conflict reasons; for example, 56% of these respondents said that the reason they had killed an orangutan was to eat it. Of the conflict-related reasons for killing, the most common reasons orangutans were killed was fear of orangutans or in self-defence. A similar pattern was evident among reports of orangutan killing by other people in the villages. Regression analyses indicated that religion and the percentage of intact forest around villages were the strongest socio-ecological predictors of whether orangutans were killed for conflict or non-conflict related reasons. Our data indicate that between 44,170 and 66,570 orangutans were killed in Kalimantan within the respondents' active hunting lifetimes: between 12,690 and 29,024 for conflict reasons (95%CI and between 26,361 and 41,688 for non-conflict reasons (95% CI. These findings confirm that habitat protection alone will not ensure the survival of orangutans in Indonesian Borneo, and that effective reduction of orangutan killings is urgently needed.

  4. It's not just conflict that motivates killing of orangutans.

    Science.gov (United States)

    Davis, Jacqueline T; Mengersen, Kerrie; Abram, Nicola K; Ancrenaz, Marc; Wells, Jessie A; Meijaard, Erik

    2013-01-01

    We investigated why orangutans are being killed in Kalimantan, Indonesia, and the role of conflict in these killings. Based on an analysis of interview data from over 5,000 respondents in over 450 villages, we also assessed the socio-ecological factors associated with conflict and non-conflict killings. Most respondents never kill orangutans. Those who reported having personally killed an orangutan primarily did so for non-conflict reasons; for example, 56% of these respondents said that the reason they had killed an orangutan was to eat it. Of the conflict-related reasons for killing, the most common reasons orangutans were killed was fear of orangutans or in self-defence. A similar pattern was evident among reports of orangutan killing by other people in the villages. Regression analyses indicated that religion and the percentage of intact forest around villages were the strongest socio-ecological predictors of whether orangutans were killed for conflict or non-conflict related reasons. Our data indicate that between 44,170 and 66,570 orangutans were killed in Kalimantan within the respondents' active hunting lifetimes: between 12,690 and 29,024 for conflict reasons (95%CI) and between 26,361 and 41,688 for non-conflict reasons (95% CI). These findings confirm that habitat protection alone will not ensure the survival of orangutans in Indonesian Borneo, and that effective reduction of orangutan killings is urgently needed.

  5. 9 CFR 113.201 - Canine Distemper Vaccine, Killed Virus.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine, Killed Virus... REQUIREMENTS Killed Virus Vaccines § 113.201 Canine Distemper Vaccine, Killed Virus. Canine Distemper Vaccine... canine distemper susceptible dogs (20 vaccinates and 5 controls) shall be used as test animals. Blood...

  6. 9 CFR 113.208 - Avian Encephalomyelitis Vaccine, Killed Virus.

    Science.gov (United States)

    2010-01-01

    ..., Killed Virus. 113.208 Section 113.208 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.208 Avian Encephalomyelitis Vaccine, Killed Virus. Avian...

  7. 9 CFR 113.204 - Mink Enteritis Vaccine, Killed Virus.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Mink Enteritis Vaccine, Killed Virus..., DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.204 Mink Enteritis Vaccine, Killed Virus. Mink Enteritis Vaccine...

  8. 9 CFR 113.212 - Bursal Disease Vaccine, Killed Virus.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Bursal Disease Vaccine, Killed Virus..., DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.212 Bursal Disease Vaccine, Killed Virus. Bursal Disease Vaccine...

  9. Killing vectors in empty space algebraically special metrics. II

    International Nuclear Information System (INIS)

    Held, A.

    1976-01-01

    Empty space algebraically special metrics possessing an expanding degenerate principal null vector and Killing vectors are investigated. Attention is centered on that class of Killing vector (called nonpreferred) which is necessarily spacelike in the asymptotic region. A detailed analysis of the relationship between the Petrov--Penrose classification and these Killing vectors is carried out

  10. The ethics of silence: Does conflict of interest explain employee silence?

    Science.gov (United States)

    Anderson, James

    2018-03-01

    Employee silence constitutes a significant threat to organizational success. This article argues that silence is a by-product of a structural Conflict of Interest (COI) between employees and their employers. This argument turns on the claim, also defended here, that employees are in a privileged position vis-à-vis knowledge of their work and that leaders-whether they recognize it or not-are dependent on their employees for reliable information about the work they are doing. Employee voice, therefore, is an organizational necessity. It is also a moral achievement as it involves risking one's personal interests for the sake of the organization. Leaders must take steps to mitigate COI and encourage employee voice; this article provides several strategies for doing exactly that.

  11. The Curious Silence of the Dog and Paul of Tarsus; Revisiting The Argument from Silence

    Directory of Open Access Journals (Sweden)

    Michael Gary Duncan

    2012-03-01

    Full Text Available In this essay I propose an interpretative and explanatory structure for the so-called argumentum ex silento, or argument from silence (henceforth referred to as the AFS. To this end, I explore two examples, namely, Sherlock Holmes’s oft-quoted notice of the “curious incident of the dog in the night-time” from Arthur Conan Doyle’s short story “Silver Blaze,” and the historical question of Paul of Tarsus’s silence on biographical details of the historical Jesus. Through these cases, I conclude that the AFS serves as a dialogical topos best evaluated and understood through the perceived authority of the arguer and the willingness of the audience to accept that authority, due to the “curious” nature of the negative evidence that the argument employed.

  12. RNA interference: ready to silence cancer?

    Science.gov (United States)

    Mocellin, Simone; Costa, Rodolfo; Nitti, Donato

    2006-01-01

    RNA interference (RNAi) is considered the most promising functional genomics tool recently developed. As in other medical fields, this biotechnology might revolutionize the approach to dissecting the biology of cancer, ultimately speeding up the discovery pace of novel targets suitable for molecularly tailored antitumor therapies. In addition, preclinical results suggest that RNAi itself might be used as a therapeutic weapon. With the aim of illustrating not only the potentials but also the current limitations of RNAi as a tool in the fight against cancer, here we summarize the physiology of RNAi, discuss the main technical issues of RNAi-based gene silencing, and review some of the most interesting preclinical results obtained so far with its implementation in the field of oncology.

  13. Research on killing Escherichia Coli by reactive oxygen species based on strong ionization discharging plasma

    International Nuclear Information System (INIS)

    Li, Y J; Tian, Y P; Zhang, Z T; Li, R H; Cai, L J; Gao, J Y

    2013-01-01

    Reactive oxygen species solution produced by strong ionization discharging plasma was used to kill Escherichia coli by spraying. Several effect factors such as pH value, solution temperature, spraying time and exposure time were observed in this study, and their effects on killing rate of Escherichia coli were discussed and analysed. Results show that the treating efficiency of ROS solution for Escherichia coli is higher in alkaline solution than that in acid solution. The killing rate of Escherichia coli increases while the spraying time and exposure time are longer and the temperature is lower. The effects of different factors on killing rate of Escherichia coli are as follows: spraying time > pH value > exposure time > solution temperature.

  14. Prediction of the diffuse-field transmission loss of interior natural-ventilation openings and silencers.

    Science.gov (United States)

    Bibby, Chris; Hodgson, Murray

    2017-01-01

    The work reported here, part of a study on the performance and optimal design of interior natural-ventilation openings and silencers ("ventilators"), discusses the prediction of the acoustical performance of such ventilators, and the factors that affect it. A wave-based numerical approach-the finite-element method (FEM)-is applied. The development of a FEM technique for the prediction of ventilator diffuse-field transmission loss is presented. Model convergence is studied with respect to mesh, frequency-sampling and diffuse-field convergence. The modeling technique is validated by way of predictions and the comparison of them to analytical and experimental results. The transmission-loss performance of crosstalk silencers of four shapes, and the factors that affect it, are predicted and discussed. Performance increases with flow-path length for all silencer types. Adding elbows significantly increases high-frequency transmission loss, but does not increase overall silencer performance which is controlled by low-to-mid-frequency transmission loss.

  15. Validation of RNAi Silencing Efficiency Using Gene Array Data shows 18.5% Failure Rate across 429 Independent Experiments

    Directory of Open Access Journals (Sweden)

    Gyöngyi Munkácsy

    2016-01-01

    Full Text Available No independent cross-validation of success rate for studies utilizing small interfering RNA (siRNA for gene silencing has been completed before. To assess the influence of experimental parameters like cell line, transfection technique, validation method, and type of control, we have to validate these in a large set of studies. We utilized gene chip data published for siRNA experiments to assess success rate and to compare methods used in these experiments. We searched NCBI GEO for samples with whole transcriptome analysis before and after gene silencing and evaluated the efficiency for the target and off-target genes using the array-based expression data. Wilcoxon signed-rank test was used to assess silencing efficacy and Kruskal–Wallis tests and Spearman rank correlation were used to evaluate study parameters. All together 1,643 samples representing 429 experiments published in 207 studies were evaluated. The fold change (FC of down-regulation of the target gene was above 0.7 in 18.5% and was above 0.5 in 38.7% of experiments. Silencing efficiency was lowest in MCF7 and highest in SW480 cells (FC = 0.59 and FC = 0.30, respectively, P = 9.3E−06. Studies utilizing Western blot for validation performed better than those with quantitative polymerase chain reaction (qPCR or microarray (FC = 0.43, FC = 0.47, and FC = 0.55, respectively, P = 2.8E−04. There was no correlation between type of control, transfection method, publication year, and silencing efficiency. Although gene silencing is a robust feature successfully cross-validated in the majority of experiments, efficiency remained insufficient in a significant proportion of studies. Selection of cell line model and validation method had the highest influence on silencing proficiency.

  16. A Resonant Silence: For an Ethnographic History of Abortion

    Directory of Open Access Journals (Sweden)

    Flávia de Mattos Motta

    2008-05-01

    Full Text Available By using methods of the fields of History and Anthropology, this study investigated the practice of abortion in southern Brazil in the first half of the twentieth century. The examination of primary sources and interviews with elderly women intended to unveil a huge silence around this practice, which leaves very few historical sources to be investigated, and hides those memories. This text presents data collected by this survey and analyzes the diversity of representations over abortion and the ambiguities that this theme causes on the subjects involved. The practice of abortion must be understood as inserted into a context of power. The subjects operate from multiple sources of knowledge and within a morality network composed of contradictory elements.

  17. Prognostic significance of aberrantly silenced ANPEP expression in prostate cancer

    DEFF Research Database (Denmark)

    Sørensen, Karina Dalsgaard; Abildgaard, Mette Opstrup; Haldrup, Christa

    2013-01-01

    Background:Novel biomarkers for prostate cancer (PC) are urgently needed. This study investigates the expression, epigenetic regulation, and prognostic potential of ANPEP in PC.Methods:Aminopeptidase N (APN; encoded by ANPEP) expression was analysed by immunohistochemistry using tissue microarrays...... in three hypermethylated prostate cell lines, suggesting epigenetic silencing. Negative APN immunoreactivity was significantly associated with short RFS and short CSS in the RP and CT cohort, respectively, independently of routine clinicopathological predictors. Combining APN with a known angiogenesis...... representing 267 radical prostatectomy (RP) and 111 conservatively treated (CT) PC patients. Clinical end points were recurrence-free survival (RFS) and cancer-specific survival (CSS), respectively. The ANPEP promoter methylation levels were determined by bisulphite sequencing or MethyLight analysis in 278...

  18. Hearing the Silence: Children’s Voices on Violence

    Directory of Open Access Journals (Sweden)

    Kathryn S. Collins

    2003-05-01

    Full Text Available Each year more than five million children in the United States are exposed to traumatizing events in their communities. This paper presents a discussion of multiple areas in violence and victimization research that needs to be continued as well as provides suggestions on how to un-silence child survivors through bridging the gaps between research and practice. It reviews the overarching problem of violence in the U.S. at the domestic and global levels and the effects of victimization. Suggestions on how to study possible mediators and moderators of victimization and individual and family adjustment, including: 1 The ecological perspective; 2 Court process and verdict; and 3Utilization of victim services, are explored. Finally, a rationale and examples of combining qualitative and quantitative methods in future research that uses children’s attributions of violence as a mediator are presented.

  19. Silencing of the PiAvr3a effector-encoding gene from Phytophthora infestans by transcriptional fusion to a short interspersed element.

    Science.gov (United States)

    Vetukuri, Ramesh R; Tian, Zhendong; Avrova, Anna O; Savenkov, Eugene I; Dixelius, Christina; Whisson, Stephen C

    2011-12-01

    Phytophthora infestans is the notorious oomycete causing late blight of potato and tomato. A large proportion of the P. infestans genome is composed of transposable elements, the activity of which may be controlled by RNA silencing. Accumulation of small RNAs is one of the hallmarks of RNA silencing. Here we demonstrate the presence of small RNAs corresponding to the sequence of a short interspersed retrotransposable element (SINE) suggesting that small RNAs might be involved in silencing of SINEs in P. infestans. This notion was exploited to develop novel tools for gene silencing in P. infestans by engineering transcriptional fusions of the PiAvr3a gene, encoding an RXLR avirulence effector, to the infSINEm retroelement. Transgenic P. infestans lines expressing either 5'-infSINEm::PiAvr3a-3' or 5'-PiAvr3a::SINEm-3' chimeric transcripts initially exhibited partial silencing of PiAvr3a. Over time, PiAvr3a either recovered wild type transcript levels in some lines, or became fully silenced in others. Introduction of an inverted repeat construct was also successful in yielding P. infestans transgenic lines silenced for PiAvr3a. In contrast, constructs expressing antisense or aberrant RNA transcripts failed to initiate silencing of PiAvr3a. Lines exhibiting the most effective silencing of PiAvr3a were either weakly or non-pathogenic on susceptible potato cv. Bintje. This study expands the repertoire of reverse genetics tools available for P. infestans research, and provides insights into a possible mode of variation in effector expression through spread of silencing from adjacent retroelements. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

  20. Habitat or matrix: which is more relevant to predict road-kill of vertebrates?

    Directory of Open Access Journals (Sweden)

    C. Bueno

    Full Text Available Abstract We believe that in tropics we need a community approach to evaluate road impacts on wildlife, and thus, suggest mitigation measures for groups of species instead a focal-species approach. Understanding which landscape characteristics indicate road-kill events may also provide models that can be applied in other regions. We intend to evaluate if habitat or matrix is more relevant to predict road-kill events for a group of species. Our hypothesis is: more permeable matrix is the most relevant factor to explain road-kill events. To test this hypothesis, we chose vertebrates as the studied assemblage and a highway crossing in an Atlantic Forest region in southeastern Brazil as the study site. Logistic regression models were designed using presence/absence of road-kill events as dependent variables and landscape characteristics as independent variables, which were selected by Akaike’s Information Criterion. We considered a set of candidate models containing four types of simple regression models: Habitat effect model; Matrix types effect models; Highway effect model; and, Reference models (intercept and buffer distance. Almost three hundred road-kills and 70 species were recorded. River proximity and herbaceous vegetation cover, both matrix effect models, were associated to most road-killed vertebrate groups. Matrix was more relevant than habitat to predict road-kill of vertebrates. The association between river proximity and road-kill indicates that rivers may be a preferential route for most species. We discuss multi-species mitigation measures and implications to movement ecology and conservation strategies.

  1. Metformin kills and radiosensitizes cancer cells and preferentially kills cancer stem cells

    Science.gov (United States)

    Song, Chang W.; Lee, Hyemi; Dings, Ruud P. M.; Williams, Brent; Powers, John; Santos, Troy Dos; Choi, Bo-Hwa; Park, Heon Joo

    2012-01-01

    The anti-cancer effects of metformin, the most widely used drug for type 2 diabetes, alone or in combination with ionizing radiation were studied with MCF-7 human breast cancer cells and FSaII mouse fibrosarcoma cells. Clinically achievable concentrations of metformin caused significant clonogenic death in cancer cells. Importantly, metformin was preferentially cytotoxic to cancer stem cells relative to non-cancer stem cells. Metformin increased the radiosensitivity of cancer cells in vitro, and significantly enhanced the radiation-induced growth delay of FSaII tumors (s.c.) in the legs of C3H mice. Both metformin and ionizing radiation activated AMPK leading to inactivation of mTOR and suppression of its downstream effectors such as S6K1 and 4EBP1, a crucial signaling pathway for proliferation and survival of cancer cells, in vitro as well as in the in vivo tumors. Conclusion: Metformin kills and radiosensitizes cancer cells and eradicates radioresistant cancer stem cells by activating AMPK and suppressing mTOR. PMID:22500211

  2. Silencing of the SlNAP7 gene influences plastid development and lycopene accumulation in tomato

    Science.gov (United States)

    Fu, Da-Qi; Meng, Lan-Huan; Zhu, Ben-Zhong; Zhu, Hong-Liang; Yan, Hua-Xue; Luo, Yun-Bo

    2016-12-01

    Ripening is an important stage of fruit development. To screen the genes associated with pigment formation in tomato fruit, a suppression subtractive hybridization (SSH) cDNA library was constructed by using tomato fruit in the green ripe and break ripe stages, and 129 differential genes were obtained. Using redness as a screening marker, virus-induced gene silencing (VIGS) of the differential genes was performed with a sprout vacuum-infiltration system (SVI). The results showed that silencing the SlNAP7 gene affected the chloroplast development of tomato leaves, manifesting as a photo-bleaching phenotype, and silenced fruit significantly affected the accumulation of lycopene, manifested as a yellow phenotype. In our study, we found that silencing the SlNAP7 gene downregulates the expression of the POR and PORA genes and destroys the normal development of the chloroplast. The expression of related genes included in the lycopene biosynthesis pathway was not significantly changed, but lycopene accumulation was significantly reduced in tomato fruit. Perhaps it was caused by the destruction of the chromoplast, which leads to the oxidation of lycopene. The results show that the SlNAP7 gene influences chloroplast development and lycopene accumulation in tomato.

  3. Novel RNA Duplex Locks HIV-1 in a Latent State via Chromatin-mediated Transcriptional Silencing

    Directory of Open Access Journals (Sweden)

    Chantelle Ahlenstiel

    2015-01-01

    Full Text Available Transcriptional gene silencing (TGS of mammalian genes can be induced by short interfering RNA (siRNA targeting promoter regions. We previously reported potent TGS of HIV-1 by siRNA (PromA, which targets tandem NF-κB motifs within the viral 5′LTR. In this study, we screened a siRNA panel with the aim of identifying novel 5′LTR targets, to provide multiplexing potential with enhanced viral silencing and application toward developing alternate therapeutic strategies. Systematic examination identified a novel siRNA target, si143, confirmed to induce TGS as the silencing mechanism. TGS was prolonged with virus suppression >12 days, despite a limited ability to induce post- TGS. Epigenetic changes associated with silencing were suggested by partial reversal by histone deacetylase inhibitors and confirmed by chromatin immunoprecipitation analyses, which showed induction of H3K27me3 and H3K9me3, reduction in H3K9Ac, and recruitment of argonaute-1, all characteristic marks of heterochromatin and TGS. Together, these epigenetic changes mimic those associated with HIV-1 latency. Further, robust resistance to reactivation was observed in the J-Lat 9.2 cell latency model, when transduced with shPromA and/or sh143. These data support si/shRNA-mediated TGS approaches to HIV-1 and provide alternate targets to pursue a functional cure, whereby the viral reservoir is locked in latency following antiretroviral therapy cessation.

  4. PhCESA3 silencing inhibits elongation and stimulates radial expansion in petunia.

    Science.gov (United States)

    Yang, Weiyuan; Cai, Yuanping; Hu, Li; Wei, Qian; Chen, Guoju; Bai, Mei; Wu, Hong; Liu, Juanxu; Yu, Yixun

    2017-02-02

    Cellulose synthase catalytic subunits (CESAs) play important roles in plant growth, development and disease resistance. Previous studies have shown an essential role of Arabidopsis thaliana CESA3 in plant growth. However, little is known about the role of CESA3 in species other than A. thaliana. To gain a better understanding of CESA3, the petunia (Petunia hybrida) PhCESA3 gene was isolated, and the role of PhCESA3 in plant growth was analyzed in a wide range of plants. PhCESA3 mRNA was present at varying levels in tissues examined. VIGS-mediated PhCESA3 silencing resulted in dwarfing of plant height, which was consistent with the phenotype of the A. thaliana rsw1 mutant (a temperature-sensitive allele of AtCESA1), the A. thaliana cev1 mutant (the AtCESA3 mild mutant), and the antisense AtCESA3 line. However, PhCESA3 silencing led to swollen stems, pedicels, filaments, styles and epidermal hairs as well as thickened leaves and corollas, which were not observed in the A. thaliana cev1 mutant, the rsw1 mutant and the antisense AtCESA3 line. Further micrographs showed that PhCESA3 silencing reduced the length and increased the width of cells, suggesting that PhCESA3 silencing inhibits elongation and stimulates radial expansion in petunia.

  5. Patterns of wolf pack movements prior to kills as read from tracks in Algonquin Provincial Park, Ont., Canada

    NARCIS (Netherlands)

    Frijlink, Jan Hilco

    1977-01-01

    From data, gathered by the author and his students, during a wolf study in Algonquin Provincial Park, Canada, six kills of white-tailed deer by wolf packs are described. Case histories are reconstructed by means of interpreting tracks. In one case a wolf was also killed, this animal turned out to

  6. Efficient ethanol production from beetle-killed lodgepole pine using SPORL technology and Saccharomyces cerevisiae without detoxification

    Science.gov (United States)

    Junyong Zhu; Xiaolin Luo; Shen Tian; Roland Gleisner; Jose Negron; Eric Horn

    2011-01-01

    This study applied Sulfite Pretreatment to Overcome Recalcitrance of Lignocelluloses (SPORL) to evaluate the potential of mountain pine beetle-killed lodgepole pine for ethanol production using conventional Saccharomyces cerevisiae without hydrolysate detoxification. The results indicate that the beetle-killed trees are more susceptible to SPORL pretreatment than live...

  7. Deterioration of beetle-killed Douglas-fir in Oregon and Washington: a summary of findings to date.

    Science.gov (United States)

    Ernest Wright; K.H. Wright

    1954-01-01

    In 1952 and 1953 cooperative research was conducted by the Pacific Northwest Forest Experiment Station and the Research Department of Weyerhaeuser Timber Company to obtain information concerning the rate of deterioration of beetle-killed Douglas-fir. The study was prompted by an outbreak of the Douglas-fir beetle that developed in 1951 and has since killed an estimated...

  8. Control of thermoacoustic instability with a drum-like silencer

    Science.gov (United States)

    Zhang, Guangyu; Wang, Xiaoyu; Li, Lei; Jing, Xiaodong; Sun, Xiaofeng

    2017-10-01

    Theoretical investigation is carried out by a novel method of controlling thermoacoustic instability with a drum-like silencer. It is shown that by decreasing the frequency of thermoacoustic system, the instability can be suppressed with the help of drum-like silencer. The purely reactive silencer, which is composed of a flexible membrane and a backing cavity, is usually known as a noise control device that works effectively in low frequency bandwidth without any aerodynamic loss. In present research, the silencer is exploited in a Rijke tube, as a means of decreasing the natural frequency of the system, and consequently changing the resonance period of the system. The "transfer element method" (TEM) is used to consider the interactions between the acoustic waves and the flexible membranes of the silencer. The effects of all possible properties of the silencer on the growth rate and resonance frequency of the thermoacoustic system are explored. According to the calculation results, it is found that for some properties of the silencer, the resonance frequencies are greatly decreased and then the phase difference between the unsteady heat release and the pressure fluctuation is increased. Consequently, the instability is suppressed with some dissipation that can not be able to control its onset in the original system. Therefore, when the damping is low, but not zero, it is effective to control thermoacoustic instability with this technique.

  9. The Role of Silence at the Retreats of a Buddhist Community

    Directory of Open Access Journals (Sweden)

    Orsolya Huszár

    2016-12-01

    Full Text Available The purpose of the study is to establish that the definition of silence as simply an absence of something or as the background of communication proves to be inadequate in a number of communicative instances. The interpretation of silence is culturally determined, and the underappreciation of its role is typical in low-context Western cultures; this is also evinced by the neglect of the topic in the literature. The present study will describe the communicative functions of silence through the findings of field work conducted at the retreats of a Buddhist community in Hungary, providing empirical input for the relevant theoretical constructs. The research findings show that silence is accorded a central role in essentially every component of the retreat (meditations, relaxation, ceremonies, teachings, small-group sharings, meals and rest; and while each event at the retreat focuses primarily on a different specific function of communication, the entire retreat does involve the linkage, affecting, revelational and – to a certain extent – activating functions (to follow the five-element typology of J. Vernon Jensen, as well as – to a lesser extent – the judgmental function. The research also shows that it requires time for individuals in a low-context culture to recognize the “point” of silence – something that the retreats provide the right opportunity for. In fact, the insights the individuals arrived at through these occasions could be put to use in their daily lives, helping their problem-solving and social relationships and in general improving their quality of life.

  10. Human Neutrophils Use Different Mechanisms To Kill Aspergillus fumigatus Conidia and Hyphae: Evidence from Phagocyte Defects.

    Science.gov (United States)

    Gazendam, Roel P; van Hamme, John L; Tool, Anton T J; Hoogenboezem, Mark; van den Berg, J Merlijn; Prins, Jan M; Vitkov, Ljubomir; van de Veerdonk, Frank L; van den Berg, Timo K; Roos, Dirk; Kuijpers, Taco W

    2016-02-01

    Neutrophils are known to play a pivotal role in the host defense against Aspergillus infections. This is illustrated by the prevalence of Aspergillus infections in patients with neutropenia or phagocyte functional defects, such as chronic granulomatous disease. However, the mechanisms by which human neutrophils recognize and kill Aspergillus are poorly understood. In this work, we have studied in detail which neutrophil functions, including neutrophil extracellular trap (NET) formation, are involved in the killing of Aspergillus fumigatus conidia and hyphae, using neutrophils from patients with well-defined genetic immunodeficiencies. Recognition of conidia involves integrin CD11b/CD18 (and not dectin-1), which triggers a PI3K-dependent nonoxidative intracellular mechanism of killing. When the conidia escape from early killing and germinate, the extracellular destruction of the Aspergillus hyphae needs opsonization by Abs and involves predominantly recognition via Fcγ receptors, signaling via Syk, PI3K, and protein kinase C to trigger the production of toxic reactive oxygen metabolites by the NADPH oxidase and myeloperoxidase. A. fumigatus induces NET formation; however, NETs did not contribute to A. fumigatus killing. Thus, our findings reveal distinct killing mechanisms of Aspergillus conidia and hyphae by human neutrophils, leading to a comprehensive insight in the innate antifungal response. Copyright © 2016 by The American Association of Immunologists, Inc.

  11. Flexible tools for gene expression and silencing in tomato.

    Science.gov (United States)

    Fernandez, Ana I; Viron, Nicolas; Alhagdow, Moftah; Karimi, Mansour; Jones, Matthew; Amsellem, Ziva; Sicard, Adrien; Czerednik, Anna; Angenent, Gerco; Grierson, Donald; May, Sean; Seymour, Graham; Eshed, Yuval; Lemaire-Chamley, Martine; Rothan, Christophe; Hilson, Pierre

    2009-12-01

    As a genetic platform, tomato (Solanum lycopersicum) benefits from rich germplasm collections and ease of cultivation and transformation that enable the analysis of biological processes impossible to investigate in other model species. To facilitate the assembly of an open genetic toolbox designed to study Solanaceae, we initiated a joint collection of publicly available gene manipulation tools. We focused on the characterization of promoters expressed at defined time windows during fruit development, for the regulated expression or silencing of genes of interest. Five promoter sequences were captured as entry clones compatible with the versatile MultiSite Gateway format: PPC2, PG, TPRP, and IMA from tomato and CRC from Arabidopsis (Arabidopsis thaliana). Corresponding transcriptional fusions were made with the GUS gene, a nuclear-localized GUS-GFP reporter, and the chimeric LhG4 transcription factor. The activity of the promoters during fruit development and in fruit tissues was confirmed in transgenic tomato lines. Novel Gateway destination vectors were generated for the transcription of artificial microRNA (amiRNA) precursors and hairpin RNAs under the control of these promoters, with schemes only involving Gateway BP and LR Clonase reactions. Efficient silencing of the endogenous phytoene desaturase gene was demonstrated in transgenic tomato lines producing a matching amiRNA under the cauliflower mosaic virus 35S or PPC2 promoter. Lastly, taking advantage of the pOP/LhG4 two-component system, we found that well-characterized flower-specific Arabidopsis promoters drive the expression of reporters in patterns generally compatible with heterologous expression. Tomato lines and plasmids will be distributed through a new Nottingham Arabidopsis Stock Centre service unit dedicated to Solanaceae resources.

  12. Roman Lyariev, How to Skin Your Kill

    OpenAIRE

    Gedeeva, Darina; Ubushieva, Bamba; Babaev, Andrei

    2016-01-01

    Roman explains how to skin a fox. First, one needs to prepare the ground by trampling it. Skinning should be done with a small sharp knife. A freshly killed fox skins easily. Then one needs to treat the skin with an anti-flea spray. At home the skin should be stretched on a triangular wooden panel called in Russian pravilka and left in a dry room for up to five days. People usually go hunting when foxes are on heat and are busy fighting with each other for females. When the wind is strong, fo...

  13. Micro-sociology of mass rampage killings.

    Science.gov (United States)

    Collins, Randall

    2014-01-01

    Spectacular but very rare violent events such as mass killings by habitual non-criminals cannot be explained by factors which are very widespread, such as possession of firearms, being a victim of bullying, an introvert, or a career failure. A stronger clue is clandestine preparation of attack by one or two individuals, against randomly chosen representatives of a hated collective identity. Mass killers develop a deep back-stage, obsessed with planning their attack, overcoming social inferiority and isolation by an emotion of clandestine excitement.

  14. Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing

    OpenAIRE

    Hedil, Marcio; Sterken, Mark G.; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard

    2015-01-01

    RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silen...

  15. Glutamate receptor antibodies in neurological diseases: anti-AMPA-GluR3 antibodies, anti-NMDA-NR1 antibodies, anti-NMDA-NR2A/B antibodies, anti-mGluR1 antibodies or anti-mGluR5 antibodies are present in subpopulations of patients with either: epilepsy, encephalitis, cerebellar ataxia, systemic lupus erythematosus (SLE) and neuropsychiatric SLE, Sjogren's syndrome, schizophrenia, mania or stroke. These autoimmune anti-glutamate receptor antibodies can bind neurons in few brain regions, activate glutamate receptors, decrease glutamate receptor's expression, impair glutamate-induced signaling and function, activate blood brain barrier endothelial cells, kill neurons, damage the brain, induce behavioral/psychiatric/cognitive abnormalities and ataxia in animal models, and can be removed or silenced in some patients by immunotherapy.

    Science.gov (United States)

    Levite, Mia

    2014-08-01

    pathological effects: they activate glutamate/AMPA receptors, kill neurons by 'Excitotoxicity', and/or by complement activation modulated by complement regulatory proteins, cause multiple brain damage, aggravate chemoconvulsant-induced seizures, and also induce behavioral/motor impairments. Some patients with 'Autoimmune Epilepsy' that have anti-AMPA-GluR3B antibodies respond well (although sometimes transiently) to immunotherapy, and thanks to that have reduced seizures and overall improved neurological functions. (2) Anti-NMDA-NR1 antibodies are present in patients with autoimmune 'Anti-NMDA-receptor Encephalitis'. In humans, in animal models and in vitro the anti-NMDA-NR1 antibodies can be very pathogenic since they can cause a pronounced decrease of surface NMDA receptors expressed in hippocampal neurons, and also decrease the cluster density and synaptic localization of the NMDA receptors. The anti-NMDA-NR1 antibodies induce these effects by crosslinking and internalization of the NMDA receptors. Such changes can impair glutamate signaling via the NMDA receptors and lead to various neuronal/behavior/cognitive/psychiatric abnormalities. Anti-NMDA-NR1 antibodies are frequently present in high levels in the CSF of the patients with 'Anti-NMDA-receptor encephalitis' due to their intrathecal production. Many patients with 'Anti-NMDA receptor Encephalitis' respond well to several modes of immunotherapy. (3) Anti-NMDA-NR2A/B antibodies are present in a substantial number of patients with Systemic Lupus Erythematosus (SLE) with or without neuropsychiatric problems. The exact percentage of SLE patients having anti-NMDA-NR2A/B antibodies varies in different studies from 14 to 35%, and in one study such antibodies were found in 81% of patients with diffuse 'Neuropshychiatric SLE', and in 44% of patients with focal 'Neuropshychiatric SLE'. Anti-NMDA-NR2A/B antibodies are also present in subpopulations of patients with Epilepsy of several types, Encephalitis of several types (e

  16. Development of Agrobacterium-mediated virus-induced gene silencing and performance evaluation of four marker genes in Gossypium barbadense.

    Directory of Open Access Journals (Sweden)

    Jinhuan Pang

    Full Text Available Gossypiumbarbadense is a cultivated cotton species and possesses many desirable traits, including high fiber quality and resistance to pathogens, especially Verticilliumdahliae (a devastating pathogen of Gossypium hirsutum, the main cultivated species. These elite traits are difficult to be introduced into G. hirsutum through classical breeding methods. In addition, genetic transformation of G. barbadense has not been successfully performed. It is therefore important to develop methods for evaluating the function and molecular mechanism of genes in G. barbadense. In this study, we had successfully introduced a virus-induced gene silencing (VIGS system into three cultivars of G. barbadense by inserting marker genes into the tobacco rattle virus (TRV vector. After we optimized the VIGS conditions, including light intensity, photoperiod, seedling age and Agrobacterium strain, 100% of plants agroinfiltrated with the GaPDS silencing vector showed white colored leaves. Three other marker genes, GaCLA1, GaANS and GaANR, were employed to further test this VIGS system in G. barbadense. The transcript levels of the endogenous genes in the silenced plants were reduced by more than 99% compared to control plants; these plants presented phenotypic symptoms 2 weeks after inoculation. We introduced a fusing sequence fragment of GaPDS and GaANR gene silencing vectors into a single plant, which resulted in both photobleaching and brownish coloration. The extent of silencing in plants agroinfiltrated with fusing two-gene-silencing vector was consistent with plants harboring a single gene silencing vector. The development of this VIGS system should promote analysis of gene function in G. barbadense, and help to contribute desirable traits for breeding of G. barbadense and G. hirsutum.

  17. Silencing of OSBP-related protein 8 (ORP8) modifies the macrophage transcriptome, nucleoporin p62 distribution, and migration capacity

    International Nuclear Information System (INIS)

    Béaslas, Olivier; Vihervaara, Terhi; Li, Jiwei; Laurila, Pirkka-Pekka; Yan, Daoguang; Olkkonen, Vesa M.

    2012-01-01

    ORP8 is an oxysterol/cholesterol binding protein anchored to the endoplasmic reticulum and the nuclear envelope, and is abundantly expressed in the macrophage. We created and characterized mouse RAW264.7 macrophages with ORP8 stably silenced using shRNA lentiviruses. A microarray transcriptome and gene ontology pathway analysis revealed significant alterations in several nuclear pathways and ones associated with centrosome and microtubule organization. ORP8 knockdown resulted in increased expression and altered subcellular distribution of an interaction partner of ORP8, nucleoporin NUP62, with an intranuclear localization aspect and association with cytoplasmic vesicular structures and lamellipodial edges of the cells. Moreover, ORP8 silenced cells displayed enhanced migration, and a more pronounced microtubule cytoskeleton than controls expressing a non-targeting shRNA. ORP8 was shown to compete with Exo70 for interaction with NUP62, and NUP62 knockdown abolished the migration enhancement of ORP8-silenced cells, suggesting that the endogenous ORP8 suppresses migration via binding to NUP62. As a conclusion, the present study reveals new, unexpected aspects of ORP8 function in macrophages not directly involving lipid metabolism, but rather associated with nuclear functions, microtubule organization, and migration capacity. -- Highlights: ► The phenotype of Raw264.7 macrophage with ORP8 silenced is characterized. ► ORP8 silencing alters mRNA levels of nuclear and microtubule/centrosome pathways. ► ORP8 silencing results in increased expression and altered distribution of NUP62. ► ORP8 silenced macrophages show enhanced migration and altered microtubule cytoskeleton. ► ORP8 competes in vitro with Exo70 for binding to NUP62.

  18. Silencing of OSBP-related protein 8 (ORP8) modifies the macrophage transcriptome, nucleoporin p62 distribution, and migration capacity

    Energy Technology Data Exchange (ETDEWEB)

    Beaslas, Olivier; Vihervaara, Terhi [Minerva Foundation Institute for Medical Research, FI-00290 Helsinki (Finland); Li, Jiwei [Department of Biology, Jinan University, Guangzhou 510632 (China); Laurila, Pirkka-Pekka [FIMM, Institute for Molecular Medicine Finland, FI-00290 Helsinki (Finland); National Institute for Health and Welfare, Public Health Genomics Unit, FI-00290 Helsinki (Finland); Yan, Daoguang [Department of Biology, Jinan University, Guangzhou 510632 (China); Olkkonen, Vesa M., E-mail: vesa.olkkonen@helsinki.fi [Minerva Foundation Institute for Medical Research, FI-00290 Helsinki (Finland); Institute of Biomedicine, Anatomy, University of Helsinki, FI-00014 (Finland)

    2012-09-10

    ORP8 is an oxysterol/cholesterol binding protein anchored to the endoplasmic reticulum and the nuclear envelope, and is abundantly expressed in the macrophage. We created and characterized mouse RAW264.7 macrophages with ORP8 stably silenced using shRNA lentiviruses. A microarray transcriptome and gene ontology pathway analysis revealed significant alterations in several nuclear pathways and ones associated with centrosome and microtubule organization. ORP8 knockdown resulted in increased expression and altered subcellular distribution of an interaction partner of ORP8, nucleoporin NUP62, with an intranuclear localization aspect and association with cytoplasmic vesicular structures and lamellipodial edges of the cells. Moreover, ORP8 silenced cells displayed enhanced migration, and a more pronounced microtubule cytoskeleton than controls expressing a non-targeting shRNA. ORP8 was shown to compete with Exo70 for interaction with NUP62, and NUP62 knockdown abolished the migration enhancement of ORP8-silenced cells, suggesting that the endogenous ORP8 suppresses migration via binding to NUP62. As a conclusion, the present study reveals new, unexpected aspects of ORP8 function in macrophages not directly involving lipid metabolism, but rather associated with nuclear functions, microtubule organization, and migration capacity. -- Highlights: Black-Right-Pointing-Pointer The phenotype of Raw264.7 macrophage with ORP8 silenced is characterized. Black-Right-Pointing-Pointer ORP8 silencing alters mRNA levels of nuclear and microtubule/centrosome pathways. Black-Right-Pointing-Pointer ORP8 silencing results in increased expression and altered distribution of NUP62. Black-Right-Pointing-Pointer ORP8 silenced macrophages show enhanced migration and altered microtubule cytoskeleton. Black-Right-Pointing-Pointer ORP8 competes in vitro with Exo70 for binding to NUP62.

  19. How Effective Is Road Mitigation at Reducing Road-Kill? A Meta-Analysis.

    Science.gov (United States)

    Rytwinski, Trina; Soanes, Kylie; Jaeger, Jochen A G; Fahrig, Lenore; Findlay, C Scott; Houlahan, Jeff; van der Ree, Rodney; van der Grift, Edgar A

    2016-01-01

    Road traffic kills hundreds of millions of animals every year, posing a critical threat to the populations of many species. To address this problem there are more than forty types of road mitigation measures available that aim to reduce wildlife mortality on roads (road-kill). For road planners, deciding on what mitigation method to use has been problematic because there is little good information about the relative effectiveness of these measures in reducing road-kill, and the costs of these measures vary greatly. We conducted a meta-analysis using data from 50 studies that quantified the relationship between road-kill and a mitigation measure designed to reduce road-kill. Overall, mitigation measures reduce road-kill by 40% compared to controls. Fences, with or without crossing structures, reduce road-kill by 54%. We found no detectable effect on road-kill of crossing structures without fencing. We found that comparatively expensive mitigation measures reduce large mammal road-kill much more than inexpensive measures. For example, the combination of fencing and crossing structures led to an 83% reduction in road-kill of large mammals, compared to a 57% reduction for animal detection systems, and only a 1% for wildlife reflectors. We suggest that inexpensive measures such as reflectors should not be used until and unless their effectiveness is tested using a high-quality experimental approach. Our meta-analysis also highlights the fact that there are insufficient data to answer many of the most pressing questions that road planners ask about the effectiveness of road mitigation measures, such as whether other less common mitigation measures (e.g., measures to reduce traffic volume and/or speed) reduce road mortality, or to what extent the attributes of crossing structures and fences influence their effectiveness. To improve evaluations of mitigation effectiveness, studies should incorporate data collection before the mitigation is applied, and we recommend a

  20. How Effective Is Road Mitigation at Reducing Road-Kill? A Meta-Analysis.

    Directory of Open Access Journals (Sweden)

    Trina Rytwinski

    Full Text Available Road traffic kills hundreds of millions of animals every year, posing a critical threat to the populations of many species. To address this problem there are more than forty types of road mitigation measures available that aim to reduce wildlife mortality on roads (road-kill. For road planners, deciding on what mitigation method to use has been problematic because there is little good information about the relative effectiveness of these measures in reducing road-kill, and the costs of these measures vary greatly. We conducted a meta-analysis using data from 50 studies that quantified the relationship between road-kill and a mitigation measure designed to reduce road-kill. Overall, mitigation measures reduce road-kill by 40% compared to controls. Fences, with or without crossing structures, reduce road-kill by 54%. We found no detectable effect on road-kill of crossing structures without fencing. We found that comparatively expensive mitigation measures reduce large mammal road-kill much more than inexpensive measures. For example, the combination of fencing and crossing structures led to an 83% reduction in road-kill of large mammals, compared to a 57% reduction for animal detection systems, and only a 1% for wildlife reflectors. We suggest that inexpensive measures such as reflectors should not be used until and unless their effectiveness is tested using a high-quality experimental approach. Our meta-analysis also highlights the fact that there are insufficient data to answer many of the most pressing questions that road planners ask about the effectiveness of road mitigation measures, such as whether other less common mitigation measures (e.g., measures to reduce traffic volume and/or speed reduce road mortality, or to what extent the attributes of crossing structures and fences influence their effectiveness. To improve evaluations of mitigation effectiveness, studies should incorporate data collection before the mitigation is applied, and we

  1. How Effective Is Road Mitigation at Reducing Road-Kill? A Meta-Analysis

    Science.gov (United States)

    Rytwinski, Trina; Soanes, Kylie; Jaeger, Jochen A. G.; Fahrig, Lenore; Findlay, C. Scott; Houlahan, Jeff; van der Ree, Rodney; van der Grift, Edgar A

    2016-01-01

    Road traffic kills hundreds of millions of animals every year, posing a critical threat to the populations of many species. To address this problem there are more than forty types of road mitigation measures available that aim to reduce wildlife mortality on roads (road-kill). For road planners, deciding on what mitigation method to use has been problematic because there is little good information about the relative effectiveness of these measures in reducing road-kill, and the costs of these measures vary greatly. We conducted a meta-analysis using data from 50 studies that quantified the relationship between road-kill and a mitigation measure designed to reduce road-kill. Overall, mitigation measures reduce road-kill by 40% compared to controls. Fences, with or without crossing structures, reduce road-kill by 54%. We found no detectable effect on road-kill of crossing structures without fencing. We found that comparatively expensive mitigation measures reduce large mammal road-kill much more than inexpensive measures. For example, the combination of fencing and crossing structures led to an 83% reduction in road-kill of large mammals, compared to a 57% reduction for animal detection systems, and only a 1% for wildlife reflectors. We suggest that inexpensive measures such as reflectors should not be used until and unless their effectiveness is tested using a high-quality experimental approach. Our meta-analysis also highlights the fact that there are insufficient data to answer many of the most pressing questions that road planners ask about the effectiveness of road mitigation measures, such as whether other less common mitigation measures (e.g., measures to reduce traffic volume and/or speed) reduce road mortality, or to what extent the attributes of crossing structures and fences influence their effectiveness. To improve evaluations of mitigation effectiveness, studies should incorporate data collection before the mitigation is applied, and we recommend a

  2. Killed oral cholera vaccines: history, development and implementation challenges.

    Science.gov (United States)

    Lopez, Anna Lena; Gonzales, Maria Liza Antoinette; Aldaba, Josephine G; Nair, G Balakrish

    2014-09-01

    Cholera is still a major global health problem, affecting mainly people living in unsanitary conditions and who are at risk for outbreaks of cholera. During the past decade, outbreaks are increasingly reported from more countries. From the early killed oral cholera vaccine, rapid improvements in vaccine development occurred as a result of a better understanding of the epidemiology of the disease, pathogenesis of cholera infection and immunity. The newer-generation oral killed cholera vaccines have been shown to be safe and effective in field trials conducted in cholera endemic areas. Likewise, they have been shown to be protective when used during outbreak settings. Aside from providing direct protection to vaccinated individuals, recent studies have demonstrated that these killed oral vaccines also confer indirect protection through herd immunity. Although new-generation oral cholera vaccines should not be considered in isolation from other preventive approaches in countries where they are most needed, especially improved water quality and sanitation, these vaccines serve as immediately available public health tools for preventing further morbidity and mortality from cholera. However, despite its availability for more than two decades, use of these vaccines has not been optimized. Although there are limitations of the currently available oral cholera vaccines, recent data show that the vaccines are safe, feasible to use even in difficult circumstances and able to provide protection in various settings. Clear identification of the areas and target population groups who will benefit from the use of the cholera vaccines will be required and strategies to facilitate accessibility and usage of these vaccines in these areas and population groups will need to be developed.

  3. Where and How Wolves (Canis lupus Kill Beavers (Castor canadensis.

    Directory of Open Access Journals (Sweden)

    Thomas D Gable

    Full Text Available Beavers (Castor canadensis can be a significant prey item for wolves (Canis lupus in boreal ecosystems due to their abundance and vulnerability on land. How wolves hunt beavers in these systems is largely unknown, however, because observing predation is challenging. We inferred how wolves hunt beavers by identifying kill sites using clusters of locations from GPS-collared wolves in Voyageurs National Park, Minnesota. We identified 22 sites where wolves from 4 different packs killed beavers. We classified these kill sites into 8 categories based on the beaver-habitat type near which each kill occurred. Seasonal variation existed in types of kill sites as 7 of 12 (58% kills in the spring occurred at sites below dams and on shorelines, and 8 of 10 (80% kills in the fall occurred near feeding trails and canals. From these kill sites we deduced that the typical hunting strategy has 3 components: 1 waiting near areas of high beaver use (e.g., feeding trails until a beaver comes near shore or ashore, 2 using vegetation, the dam, or other habitat features for concealment, and 3 immediately attacking the beaver, or ambushing the beaver by cutting off access to water. By identifying kill sites and inferring hunting behavior we have provided the most complete description available of how and where wolves hunt and kill beavers.

  4. Breaking the Silence: Feminism and Post humanism

    Directory of Open Access Journals (Sweden)

    Debika Saha

    2015-10-01

    Full Text Available Postmodernism starts its journey by challenging the master narratives of metaphysics and philosophy. In this journey the narrative get replaced either by an emancipation from narratives that claim to possess eternal truth or by a turn to a kind of informative technology. But both the ways keep at their centre the process of “denaturing” or disassociating something of its natural qualities. This postmodernist turn has now taken a new form. The choice is not limited between the natural body and the culturally constructed body, but between different areas of bodily reconstruction bearing different social and cultural implications. As Spivak in her famous writing raises the question «Can the subaltern speak?» In fact, Spivak narrates how the marginalized, the less privileged depend upon the benevolence of the more privileged. To engage with the other means not only to talk, listen, learn or know about her but also to identify with her. There must be some ways for open dialogues that can diminish the effects of cultural dominance. The imperial silence should be broken.

  5. Sabretoothed carnivores and the killing of large prey.

    Directory of Open Access Journals (Sweden)

    Ki Andersson

    Full Text Available Sabre-like canines clearly have the potential to inflict grievous wounds leading to massive blood loss and rapid death. Hypotheses concerning sabretooth killing modes include attack to soft parts such as the belly or throat, where biting deep is essential to generate strikes reaching major blood vessels. Sabretoothed carnivorans are widely interpreted as hunters of larger and more powerful prey than that of their present-day nonsabretoothed relatives. However, the precise functional advantage of the sabretooth bite, particularly in relation to prey size, is unknown. Here, we present a new point-to-point bite model and show that, for sabretooths, depth of the killing bite decreases dramatically with increasing prey size. The extended gape of sabretooths only results in considerable increase in bite depth when biting into prey with a radius of less than ∼10 cm. For sabretooths, this size-reversed functional advantage suggests predation on species within a similar size range to those attacked by present-day carnivorans, rather than "megaherbivores" as previously believed. The development of the sabretooth condition appears to represent a shift in function and killing behaviour, rather than one in predator-prey relations. Furthermore, our results demonstrate how sabretoothed carnivorans are likely to have evolved along a functionally continuous trajectory: beginning as an extension of a jaw-powered killing bite, as adopted by present-day pantherine cats, followed by neck-powered biting and thereafter shifting to neck-powered shear-biting. We anticipate this new insight to be a starting point for detailed study of the evolution of pathways that encompass extreme specialisation, for example, understanding how neck-powered biting shifts into shear-biting and its significance for predator-prey interactions. We also expect that our model for point-to-point biting and bite depth estimations will yield new insights into the behaviours of a broad range of

  6. ORGANIZATIONAL SILENCE: SUATU PENGHAMBAT DALAM MEWUJUDKAN KREATIFITAS ORGANISASIONAL

    Directory of Open Access Journals (Sweden)

    Berta Bekti Retnawati

    2016-11-01

    Full Text Available There are powerful forces in many organzations that cause widespread withholding of information about potential problems or issues by employess, this collective-level phenomenon as ‘organizational silence’. One significant effect of organizational silence relates to lack of organizational creativity.There are five major organizational factors that enhance creativity in a work environment: organizational climate, leadership style, organizational culture, resources and skills, the structure and system of an organization. Keywords: organizational silence, organizational creativity

  7. Activity of Telithromycin (HMR 3647) against Anaerobic Bacteria Compared to Those of Eight Other Agents by Time-Kill Methodology†

    Science.gov (United States)

    Credito, Kim L.; Ednie, Lois M.; Jacobs, Michael R.; Appelbaum, Peter C.

    1999-01-01

    Time-kill studies examined the activities of telithromycin (HMR 3647), erythromycin A, azithromycin, clarithromycin, roxithromycin, clindamycin, pristinamycin, amoxicillin-clavulanate, and metronidazole against 11 gram-positive and gram-negative anaerobic bacteria. Time-kill studies were carried out with the addition of Oxyrase in order to prevent the introduction of CO2. Macrolide-azalide-ketolide MICs were 0.004 to 32.0 μg/ml. Of the latter group, telithromycin had the lowest MICs, especially against non-Bacteroides fragilis group strains, followed by azithromycin, clarithromycin, erythromycin A, and roxithromycin. Clindamycin was active (MIC ≤ 2.0 μg/ml) against all anaerobes except Peptostreptococcus magnus and Bacteroides thetaiotaomicron, while pristinamycin MICs were 0.06 to 4.0 μg/ml. Amoxicillin-clavulanate had MICs of ≤1.0 μg/ml, while metronidazole was active (MICs, 0.03 to 2.0 μg/ml) against all except Propionibacterium acnes. After 48 h at twice the MIC, telithromycin was bactericidal (≥99.9% killing) against 6 strains, with 99% killing of 9 strains and 90% killing of 10 strains. After 24 h at twice the MIC, 90, 99, and 99.9% killing of nine, six, and three strains, respectively, occurred. Lower rates of killing were seen at earlier times. Similar kill kinetics relative to the MIC were seen with other macrolides. After 48 h at the MIC, clindamycin was bactericidal against 8 strains, with 99 and 90% killing of 9 and 10 strains, respectively. After 24 h, 90% killing of 10 strains occurred at the MIC. The kinetics of clindamycin were similar to those of pristinamycin. After 48 h at the MIC, amoxicillin-clavulanate showed 99.9% killing of seven strains, with 99% killing of eight strains and 90% killing of nine strains. At four times the MIC, metronidazole was bactericidal against 8 of 10 strains tested after 48 h and against all 10 strains after 24 h; after 12 h, 99% killing of all 10 strains occurred. PMID:10428930

  8. SGS3 Cooperates with RDR6 in Triggering Geminivirus-Induced Gene Silencing and in Suppressing Geminivirus Infection in Nicotiana Benthamiana

    Directory of Open Access Journals (Sweden)

    Fangfang Li

    2017-09-01

    Full Text Available RNA silencing has an important role in defending against virus infection in plants. Plants with the deficiency of RNA silencing components often show enhanced susceptibility to viral infections. RNA-dependent RNA polymerase (RDRs mediated-antiviral defense has a pivotal role in resistance to many plant viruses. In RDR6-mediated defense against viral infection, a plant-specific RNA binding protein, Suppressor of Gene Silencing 3 (SGS3, was also found to fight against some viruses in Arabidopsis. In this study, we showed that SGS3 from Nicotiana benthamiana (NbSGS3 is required for sense-RNA induced post-transcriptional gene silencing (S-PTGS and initiating sense-RNA-triggered systemic silencing. Further, the deficiency of NbSGS3 inhibited geminivirus-induced endogenous gene silencing (GIEGS and promoted geminivirus infection. During TRV-mediated NbSGS3 or N. benthamiana RDR6 (NbRDR6 silencing process, we found that their expression can be effectively fine-tuned. Plants with the knock-down of both NbSGS3 and NbRDR6 almost totally blocked GIEGS, and were more susceptible to geminivirus infection. These data suggest that NbSGS3 cooperates with NbRDR6 against GIEGS and geminivirus infection in N. benthamiana, which provides valuable information for breeding geminivirus-resistant plants.

  9. Heterosigma bloom and associated fish kill

    Science.gov (United States)

    Hershberger, P.K.; Rensel, J.E.; Postel, J.R.; Taub, F.B.

    1997-01-01

    A bloom of the harmful marine phytoplankton, Heterosigma carterae occurred in upper Case Inlet, south Puget Sound, Washington in late September, 1994, correlating with the presence of at least 35 dead salmon. This marks the first time that this alga has been closely correlated with a wild fish kill; in the past it was thought to be associated with kills of penned fish at fish farms only. We were informed of the presence of a possible harmful algal bloom and dead salinois Ilear the town of Allyn on 27 September and a team was formed to investigate. We arrived at the Allyn waterfront at 17:30 hours the same day. Prior to our arrival, state agency personnel walked approximatcly two miles of shoreline from the powerlines north of the dock, to the mouth of Sherwood Creek and conducted the only official count of dead fish present along the shore consisting of 12 coho salmon (Oncorhynchus kisutch), 11 chum salmon (Oncorhynchus keta), 12 chinook salmon (Oncorhynchus tschawytscha), one flat fish, and one sculpin on the morning of 9/27. Since previous harmful blooms of Heterosigma have resultedin the majority of net penreared salmon sinking to the bottom of pens, and only approximately two miles of shoreline were sampled, it is suspected that many more exposed fish may have succumbed than were counted. Witnesses who explored the east side of the bay reported seeing many dead salmon there as well, but no counts were made. State agency personnel who observed the fish kill reported seeing “dying fish coming to the beach, gulping at the surface, trying to get out of the water” Scavengers were seen consuming the salmon carcasses; these included two harbor seals, a house cat, and Hymenopteran insects. None suffered any noticeable acute ill effects. Although precise cause of death has not been ascertained, visual inspection of the reproductive organs from a deceased male chum salmon found on the shore at Allyn confirmed that the fish was not yet reproductively mature and

  10. Things talked about while we remain silence and things we’re silence about while talking: The starting assumptions for an anthropology of silence about the nearest past

    Directory of Open Access Journals (Sweden)

    Đerić Gordana

    2007-01-01

    Full Text Available Wars of the last decade of the 20th century in former Yugoslavia have brought the whole region into the center of media attention and, accordingly, have aroused interest of the western academic theory. Since the latest ′discovery of the Balkans′ was brought into being precisely due to wars, one shouldn’t be surprised to find that many academic approaches to questions of Yugoslavia dismemberment are biased, superficial or exotic. On the other hand, Serbian academic auditorium was far from being active in elaborating questions of its own contemporality and closest past - for various reasons, but mostly because of its detachment from systematic explorations. Thus, acknowledgement and presentations of mentioned issues were left to be the job of media publicists, others outside of academic community or were left to be treated in the time to come. Domestic scholars were rarely intrigued to deal with these matters, despite the fact that images of recent wars were often built on stereotypes and propaganda and that the formed knowledge of the entire subject suffered from severe simplification. The themes of great violence were particularly avoided which left some of the crucial war events out of the academic focus - the reason being, very probably, the estimation that what made Serbia and the region worldwide known is best to be forgotten. Contemporary academic silence on recent wars, in retrospection, could easily be placed within the continuum of silence during the socialist period and war which preceded it. Having all mentioned in mind, this paper not only investigates reasons for avoiding the issues of the nearest past and influences of silence in socialism on what came afterwards, but also highlights the importance of exploring semantics and functions of silence and silencing in recent wars, as well as the relationship between silence and social memory constructions.

  11. Conformal Killing vectors in Robertson-Walker spacetimes

    International Nuclear Information System (INIS)

    Maartens, R.; Maharaj, S.d.

    1986-01-01

    It is well known that Robertson-Walker spacetimes admit a conformal Killingl vector normal to the spacelike homogeneous hypersurfaces. Because these spacetimes are conformally flat, there are a further eight conformal Killing vectors, which are neither normal nor tangent to the homogeneous hypersurfaces. The authors find these further conformal Killing vectors and the Lie algebra of the full G 15 of conformal motions. Conditions on the metric scale factor are determined which reduce some of the conformal Killing vectors to homothetic Killing vectors or Killing vectors, allowing one to regain in a unified way the known special geometries. The non-normal conformal Killing vectors provide a counter-example to show that conformal motions do not, in general, map a fluid flow conformally. These non-normal vectors are also used to find the general solution of the null geodesic equation and photon Liouville equation. (author)

  12. The eyeball killer: serial killings with postmortem globe enucleation.

    Science.gov (United States)

    Coyle, Julie; Ross, Karen F; Barnard, Jeffrey J; Peacock, Elizabeth; Linch, Charles A; Prahlow, Joseph A

    2015-05-01

    Although serial killings are relatively rare, they can be the cause of a great deal of anxiety while the killer remains at-large. Despite the fact that the motivations for serial killings are typically quite complex, the psychological analysis of a serial killer can provide valuable insight into how and why certain individuals become serial killers. Such knowledge may be instrumental in preventing future serial killings or in solving ongoing cases. In certain serial killings, the various incidents have a variety of similar features. Identification of similarities between separate homicidal incidents is necessary to recognize that a serial killer may be actively killing. In this report, the authors present a group of serial killings involving three prostitutes who were shot to death over a 3-month period. Scene and autopsy findings, including the unusual finding of postmortem enucleation of the eyes, led investigators to recognize the serial nature of the homicides. © 2015 American Academy of Forensic Sciences.

  13. Silencing the expression of Cbl-b enhances the immune activation of T lymphocytes against RM-1 prostate cancer cells in vitro

    Directory of Open Access Journals (Sweden)

    Shu-Kui Zhou

    2014-12-01

    Conclusion: Silencing Cbl-b significantly enhanced T lymphocyte function and T lymphocyte cytotoxicity activity against a model prostate cancer cell line in vitro. This study suggests a potentially novel immunotherapeutic strategy against prostate cancer.

  14. Monoclonal TCR-redirected tumor cell killing.

    Science.gov (United States)

    Liddy, Nathaniel; Bossi, Giovanna; Adams, Katherine J; Lissina, Anna; Mahon, Tara M; Hassan, Namir J; Gavarret, Jessie; Bianchi, Frayne C; Pumphrey, Nicholas J; Ladell, Kristin; Gostick, Emma; Sewell, Andrew K; Lissin, Nikolai M; Harwood, Naomi E; Molloy, Peter E; Li, Yi; Cameron, Brian J; Sami, Malkit; Baston, Emma E; Todorov, Penio T; Paston, Samantha J; Dennis, Rebecca E; Harper, Jane V; Dunn, Steve M; Ashfield, Rebecca; Johnson, Andy; McGrath, Yvonne; Plesa, Gabriela; June, Carl H; Kalos, Michael; Price, David A; Vuidepot, Annelise; Williams, Daniel D; Sutton, Deborah H; Jakobsen, Bent K

    2012-06-01

    T cell immunity can potentially eradicate malignant cells and lead to clinical remission in a minority of patients with cancer. In the majority of these individuals, however, there is a failure of the specific T cell receptor (TCR)–mediated immune recognition and activation process. Here we describe the engineering and characterization of new reagents termed immune-mobilizing monoclonal TCRs against cancer (ImmTACs). Four such ImmTACs, each comprising a distinct tumor-associated epitope-specific monoclonal TCR with picomolar affinity fused to a humanized cluster of differentiation 3 (CD3)-specific single-chain antibody fragment (scFv), effectively redirected T cells to kill cancer cells expressing extremely low surface epitope densities. Furthermore, these reagents potently suppressed tumor growth in vivo. Thus, ImmTACs overcome immune tolerance to cancer and represent a new approach to tumor immunotherapy.

  15. Killing vectors in algebraically special space-times

    International Nuclear Information System (INIS)

    Torres del Castillo, G.F.

    1984-01-01

    The form of the isometric, homothetic, and conformal Killing vectors for algebraically special metrics which admit a shear-free congruence of null geodesics is obtained by considering their complexification, using the existence of a congruence of null strings. The Killing equations are partially integrated and the reasons which permit this reduction are exhibited. In the case where the congruence of null strings has a vanishing expansion, the Killing equations are reduced to a single master equation

  16. Sexualcoercion: Woman Subordination Undergone By Hanna X In Andre Brink's The Otherside Of Silence Novel

    OpenAIRE

    NUSANTI, RIHAN

    2014-01-01

    Nusanti, Rihan. 2014. “Sexual Coercion: Woman Subordination Undergoneby Hanna X in Andre Brink's The Otherside of Silence novel”. Study Programof English, Department of Languages and Literature, Faculty of Cultural Studies,Universitas Brawijaya. Supervisor: Fariska Pujiyanti, M.Hum; Co-supervisor: Winda Candra Hantari,M.A. Keywords: Feminist-Marxist, sexual coercion, patriarchy, women subordination,German women In traditional view, women occupy secondary position lower than men in society. It...

  17. Does host complement kill Borrelia burgdorferi within ticks?

    Science.gov (United States)

    Rathinavelu, Sivaprakash; Broadwater, Anne; de Silva, Aravinda M

    2003-02-01

    The Lyme disease spirochete, Borrelia burgdorferi, inhabits the gut lumen of the tick vector. At this location the spirochete is exposed to host blood when a tick feeds. We report here on studies that were done with normal and complement-deficient (C3-knockout) mice to determine if the host complement system killed spirochetes within the vector. We found that spirochete numbers within feeding nymphs were not influenced by complement, most likely because host complement was inactivated within the vector. The Lyme disease outer surface protein A (OspA) vaccine is a transmission-blocking vaccine that targets spirochetes in the vector. In experiments with mice hyperimmunized with OspA, complement was not required to kill spirochetes within nymphs and to block transmission from nymphs to the vaccinated host. However, host complement did enhance the ability of OspA antibody to block larvae from acquiring spirochetes. Thus, the effects of OspA antibody on nymphal transmission and larval acquisition appear to be based on different mechanisms.

  18. Identification of Pseudomonas aeruginosa phenazines that kill Caenorhabditis elegans.

    Science.gov (United States)

    Cezairliyan, Brent; Vinayavekhin, Nawaporn; Grenfell-Lee, Daniel; Yuen, Grace J; Saghatelian, Alan; Ausubel, Frederick M

    2013-01-01

    Pathogenic microbes employ a variety of methods to overcome host defenses, including the production and dispersal of molecules that are toxic to their hosts. Pseudomonas aeruginosa, a Gram-negative bacterium, is a pathogen of a diverse variety of hosts including mammals and the nematode Caenorhabditis elegans. In this study, we identify three small molecules in the phenazine class that are produced by P. aeruginosa strain PA14 that are toxic to C. elegans. We demonstrate that 1-hydroxyphenazine, phenazine-1-carboxylic acid, and pyocyanin are capable of killing nematodes in a matter of hours. 1-hydroxyphenazine is toxic over a wide pH range, whereas the toxicities of phenazine-1-carboxylic acid and pyocyanin are pH-dependent at non-overlapping pH ranges. We found that acidification of the growth medium by PA14 activates the toxicity of phenazine-1-carboxylic acid, which is the primary toxic agent towards C. elegans in our assay. Pyocyanin is not toxic under acidic conditions and 1-hydroxyphenazine is produced at concentrations too low to kill C. elegans. These results suggest a role for phenazine-1-carboxylic acid in mammalian pathogenesis because PA14 mutants deficient in phenazine production have been shown to be defective in pathogenesis in mice. More generally, these data demonstrate how diversity within a class of metabolites could affect bacterial toxicity in different environmental niches.

  19. Identification of Pseudomonas aeruginosa phenazines that kill Caenorhabditis elegans.

    Directory of Open Access Journals (Sweden)

    Brent Cezairliyan

    2013-01-01

    Full Text Available Pathogenic microbes employ a variety of methods to overcome host defenses, including the production and dispersal of molecules that are toxic to their hosts. Pseudomonas aeruginosa, a Gram-negative bacterium, is a pathogen of a diverse variety of hosts including mammals and the nematode Caenorhabditis elegans. In this study, we identify three small molecules in the phenazine class that are produced by P. aeruginosa strain PA14 that are toxic to C. elegans. We demonstrate that 1-hydroxyphenazine, phenazine-1-carboxylic acid, and pyocyanin are capable of killing nematodes in a matter of hours. 1-hydroxyphenazine is toxic over a wide pH range, whereas the toxicities of phenazine-1-carboxylic acid and pyocyanin are pH-dependent at non-overlapping pH ranges. We found that acidification of the growth medium by PA14 activates the toxicity of phenazine-1-carboxylic acid, which is the primary toxic agent towards C. elegans in our assay. Pyocyanin is not toxic under acidic conditions and 1-hydroxyphenazine is produced at concentrations too low to kill C. elegans. These results suggest a role for phenazine-1-carboxylic acid in mammalian pathogenesis because PA14 mutants deficient in phenazine production have been shown to be defective in pathogenesis in mice. More generally, these data demonstrate how diversity within a class of metabolites could affect bacterial toxicity in different environmental niches.

  20. Effect of pulsed electron beam on cell killing

    International Nuclear Information System (INIS)

    Acharya, Santhosh; Joseph, Praveen; Sanjeev, Ganesh; Narayana, Y.; Bhat, N.N.

    2009-01-01

    The extent of repairable and irreparable damage in a living cell produced by ionizing radiation depends on the quality of the radiation. In the case of sparsely ionizing radiation, the dose rate and the pattern of energy deposition of the radiation are the important physical factors which can affect the amount of damage in living cells. In the present study, radio-sensitive and radioresistive bacteria cells were exposed to 8 MeV pulsed electron beam and the efficiency of cell-killing was investigated to evaluate the Do, the mean lethal dose. The dose to the cell was delivered in micro-second pulses at an instantaneous dose rate of 2.6 x 10 5 Gy s -1 . Fricke dosimeter was used to measure the absorbed dose of electron beam. The results were compared with those of gamma rays. The survival curve of radio-resistive Deinococcus-radiodurans (DR) is found to be sigmoidal and the survival response for radio-sensitive Escherichia-coli (E-coli) is found to be exponential without any shoulder. Comparison of Do values indicate that irradiation with pulsed electron beam resulted in more cell-killing than was observed for gamma irradiation. (author)

  1. Gated audiovisual speech identification in silence vs. noise: effects on time and accuracy

    Science.gov (United States)

    Moradi, Shahram; Lidestam, Björn; Rönnberg, Jerker

    2013-01-01

    This study investigated the degree to which audiovisual presentation (compared to auditory-only presentation) affected isolation point (IPs, the amount of time required for the correct identification of speech stimuli using a gating paradigm) in silence and noise conditions. The study expanded on the findings of Moradi et al. (under revision), using the same stimuli, but presented in an audiovisual instead of an auditory-only manner. The results showed that noise impeded the identification of consonants and words (i.e., delayed IPs and lowered accuracy), but not the identification of final words in sentences. In comparison with the previous study by Moradi et al., it can be concluded that the provision of visual cues expedited IPs and increased the accuracy of speech stimuli identification in both silence and noise. The implication of the results is discussed in terms of models for speech understanding. PMID:23801980

  2. The Enamovirus P0 protein is a silencing suppressor which inhibits local and systemic RNA silencing through AGO1 degradation

    Energy Technology Data Exchange (ETDEWEB)

    Fusaro, Adriana F. [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Correa, Regis L. [CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Nakasugi, Kenlee; Jackson, Craig [University of Sydney, NSW 2006 (Australia); Kawchuk, Lawrence [Research Centre, Agriculture and Agri-Food Canada, Lethbridge, AB T1J4B1 (Canada); Vaslin, Maite F.S. [Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Waterhouse, Peter M., E-mail: peter.waterhouse@sydney.edu.au [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia)

    2012-05-10

    The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0{sup PE}, in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0{sup PE} has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0{sup PE} destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.

  3. Antibacterial activity of silver-killed bacteria: the "zombies" effect

    Science.gov (United States)

    Wakshlak, Racheli Ben-Knaz; Pedahzur, Rami; Avnir, David

    2015-04-01

    We report a previously unrecognized mechanism for the prolonged action of biocidal agents, which we denote as the zombies effect: biocidally-killed bacteria are capable of killing living bacteria. The concept is demonstrated by first killing Pseudomonas aeruginosa PAO1 with silver nitrate and then challenging, with the dead bacteria, a viable culture of the same bacterium: Efficient antibacterial activity of the killed bacteria is observed. A mechanism is suggested in terms of the action of the dead bacteria as a reservoir of silver, which, due to Le-Chatelier's principle, is re-targeted to the living bacteria. Langmuirian behavior, as well as deviations from it, support the proposed mechanism.

  4. Killing spinors as a characterisation of rotating black hole spacetimes

    International Nuclear Information System (INIS)

    Cole, Michael J; Kroon, Juan A Valiente

    2016-01-01

    We investigate the implications of the existence of Killing spinors in a spacetime. In particular, we show that in vacuum and electrovacuum a Killing spinor, along with some assumptions on the associated Killing vector in an asymptotic region, guarantees that the spacetime is locally isometric to the Kerr or Kerr–Newman solutions. We show that the characterisation of these spacetimes in terms of Killing spinors is an alternative expression of characterisation results of Mars (Kerr) and Wong (Kerr–Newman) involving restrictions on the Weyl curvature and matter content. (paper)

  5. H3K9me-independent gene silencing in fission yeast heterochromatin by Clr5 and histone deacetylases

    DEFF Research Database (Denmark)

    Hansen, Klavs R; Hazan, Idit; Shanker, Sreenath

    2011-01-01

    organisms such as fission yeast. In spite of numerous studies, the relative contributions of the various heterochromatic histone marks to the properties of heterochromatin remain largely undefined. Here, we report that silencing of the fission yeast mating-type cassettes, which are located in a well......, our results point to histone deacetylases as prominent repressors of gene expression in fission yeast heterochromatin. These deacetylases can act in concert with, or independently of, the widely studied H3K9me mark to influence gene silencing at heterochromatic loci....

  6. Quantifying Killing of Orangutans and Human-Orangutan Conflict in Kalimantan, Indonesia

    Science.gov (United States)

    Meijaard, Erik; Buchori, Damayanti; Hadiprakarsa, Yokyok; Utami-Atmoko, Sri Suci; Nurcahyo, Anton; Tjiu, Albertus; Prasetyo, Didik; Nardiyono; Christie, Lenny; Ancrenaz, Marc; Abadi, Firman; Antoni, I Nyoman Gede; Armayadi, Dedy; Dinato, Adi; Ella; Gumelar, Pajar; Indrawan, Tito P.; Kussaritano; Munajat, Cecep; Priyono, C. Wawan Puji; Purwanto, Yadi; Puspitasari, Dewi; Putra, M. Syukur Wahyu; Rahmat, Abdi; Ramadani, Harri; Sammy, Jim; Siswanto, Dedi; Syamsuri, Muhammad; Andayani, Noviar; Wu, Huanhuan; Wells, Jessie Anne; Mengersen, Kerrie

    2011-01-01

    Human-orangutan conflict and hunting are thought to pose a serious threat to orangutan existence in Kalimantan, the Indonesian part of Borneo. No data existed prior to the present study to substantiate these threats. We investigated the rates, spatial distribution and causes of conflict and hunting through an interview-based survey in the orangutan's range in Kalimantan, Indonesia. Between April 2008 and September 2009, we interviewed 6983 respondents in 687 villages to obtain socio-economic information, assess knowledge of local wildlife in general and orangutan encounters specifically, and to query respondents about their knowledge on orangutan conflicts and killing, and relevant laws. This survey revealed estimated killing rates of between 750 and 1800 animals killed in the last year, and between 1950 and 3100 animals killed per year on average within the lifetime of the survey respondents. These killing rates are higher than previously thought and are high enough to pose a serious threat to the continued existence of orangutans in Kalimantan. Importantly, the study contributes to our understanding of the spatial variation in threats, and the underlying causes of those threats, which can be used to facilitate the development of targeted conservation management. PMID:22096582

  7. Quantifying killing of orangutans and human-orangutan conflict in Kalimantan, Indonesia.

    Directory of Open Access Journals (Sweden)

    Erik Meijaard

    Full Text Available Human-orangutan conflict and hunting are thought to pose a serious threat to orangutan existence in Kalimantan, the Indonesian part of Borneo. No data existed prior to the present study to substantiate these threats. We investigated the rates, spatial distribution and causes of conflict and hunting through an interview-based survey in the orangutan's range in Kalimantan, Indonesia. Between April 2008 and September 2009, we interviewed 6983 respondents in 687 villages to obtain socio-economic information, assess knowledge of local wildlife in general and orangutan encounters specifically, and to query respondents about their knowledge on orangutan conflicts and killing, and relevant laws. This survey revealed estimated killing rates of between 750 and 1800 animals killed in the last year, and between 1950 and 3100 animals killed per year on average within the lifetime of the survey respondents. These killing rates are higher than previously thought and are high enough to pose a serious threat to the continued existence of orangutans in Kalimantan. Importantly, the study contributes to our understanding of the spatial variation in threats, and the underlying causes of those threats, which can be used to facilitate the development of targeted conservation management.

  8. Honor killings in the Middle East and North Africa: a systematic review of the literature.

    Science.gov (United States)

    Kulczycki, Andrzej; Windle, Sarah

    2011-11-01

    A systematic review of the research literature on honor killings in the Middle East and North Africa (MENA) indicates a paucity of studies relative to the presumed magnitude of the problem. Forty articles were reviewed and critically appraised, of which only 9 contained primary data and 11 presented original secondary analyses. Despite a recent increase in published studies, persistent methodological limitations restrict the generalizability of findings. Most studies focus on legal aspects, determinants, and characteristics of victims and perpetrators. Victims are mostly young females murdered by their male kin. Unambiguous evidence of a decline in tolerance of honor killings remains elusive.

  9. The Relationship between Organizational Trust and Organizational Silence with Job Satisfaction and Organizational Commitment of the Employees of University

    Science.gov (United States)

    Fard, Parastoo Gashtasebi; Karimi, Fariba

    2015-01-01

    This study aimed to investigate the structural model between organizational trust and organizational silence with job satisfaction and organizational commitment of the employees of Islamic Azad University of Isfahan, (Khorasgan) branch. The study method is descriptive-correlation. The study population is the employees of Islamic Azad University of…

  10. RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops

    OpenAIRE

    Guo, Qigao; Liu, Qing; Smith, Neil A.; Liang, Guolu; Wang, Ming-Bo

    2016-01-01

    Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing ...

  11. Speaking to the Hollow: Silence and Memory in the Last Argentine Dictatorship

    OpenAIRE

    Martínez Cabrera, Erika

    2012-01-01

    This article is an analysis of the last Argentinean dictatorship discourse and its articulation through the instances of silence and memory. To elucidate them, we deal with the technologies of violence and its discursive consequences: the exhaustion of the collective ability to tell stories, the denial of collective aberration and the perversion of language. From there, we study the discursive axes through which the fiction of the Process was built on: messianism, manichaeism and organicism. ...

  12. Silencing Dkk1 expression rescues dexamethasone-induced suppression of primary human osteoblast differentiation.

    LENUS (Irish Health Repository)

    Butler, Joseph S

    2010-09-01

    The Wnt\\/β-catenin pathway is a major signaling cascade in bone biology, playing a key role in bone development and remodeling. The objectives of this study were firstly, to determine the effects of dexamethasone exposure on Wnt\\/β-catenin signaling at an intracellular and transcriptional level, and secondly, to assess the phenotypic effects of silencing the Wnt antagonist, Dickkopf-1 (Dkk1) in the setting of dexamethasone exposure.

  13. ANALYZE THE IMPACT OF HABITAT PATCHES ON WILDLIFE ROAD-KILL

    Directory of Open Access Journals (Sweden)

    S. Seok

    2015-10-01

    Full Text Available The ecosystem fragmentation due to transportation infrastructure causes a road-kill phenomenon. When making policies for mitigating road-kill it is important to select target-species in order to enhance its efficiency. However, many wildlife crossing structures have been questioned regarding their effectiveness due to lack of considerations such as target-species selection, site selection, management, etc. The purpose of this study is to analyse the impact of habitat patches on wildlife road-kill and to suggest that spatial location of habitat patches should be considered as one of the important factors when making policies for mitigating road-kill. Habitat patches were presumed from habitat variables and a suitability index on target-species that was chosen by literature review. The road-kill hotspot was calculated using Getis-Ord Gi*. After that, we performed a correlation analysis between Gi Z-score and the distance from habitat patches to the roads. As a result, there is a low negative correlation between two variables and it increases the Gi Z-score if the habitat patches and the roads become closer.

  14. Analyze the Impact of Habitat Patches on Wildlife Road-Kill

    Science.gov (United States)

    Seok, S.; Lee, J.

    2015-10-01

    The ecosystem fragmentation due to transportation infrastructure causes a road-kill phenomenon. When making policies for mitigating road-kill it is important to select target-species in order to enhance its efficiency. However, many wildlife crossing structures have been questioned regarding their effectiveness due to lack of considerations such as target-species selection, site selection, management, etc. The purpose of this study is to analyse the impact of habitat patches on wildlife road-kill and to suggest that spatial location of habitat patches should be considered as one of the important factors when making policies for mitigating road-kill. Habitat patches were presumed from habitat variables and a suitability index on target-species that was chosen by literature review. The road-kill hotspot was calculated using Getis-Ord Gi*. After that, we performed a correlation analysis between Gi Z-score and the distance from habitat patches to the roads. As a result, there is a low negative correlation between two variables and it increases the Gi Z-score if the habitat patches and the roads become closer.

  15. Agrobacterium Mediated Transient Gene Silencing (AMTS) in Stevia rebaudiana: Insights into Steviol Glycoside Biosynthesis Pathway

    Science.gov (United States)

    Guleria, Praveen; Yadav, Sudesh Kumar

    2013-01-01

    Background Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi) based Agrobacterium mediated transient gene silencing (AMTS) approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1) genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins. Methodology/Principal Findings RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3) content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes. Conclusions SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route. PMID:24023961

  16. Agrobacterium mediated transient gene silencing (AMTS in Stevia rebaudiana: insights into steviol glycoside biosynthesis pathway.

    Directory of Open Access Journals (Sweden)

    Praveen Guleria

    Full Text Available Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi based Agrobacterium mediated transient gene silencing (AMTS approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1 genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins.RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3 content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes.SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route.

  17. Hydrophobically Modified siRNAs Silence Huntingtin mRNA in Primary Neurons and Mouse Brain

    Directory of Open Access Journals (Sweden)

    Julia F Alterman

    2015-01-01

    Full Text Available Applications of RNA interference for neuroscience research have been limited by a lack of simple and efficient methods to deliver oligonucleotides to primary neurons in culture and to the brain. Here, we show that primary neurons rapidly internalize hydrophobically modified siRNAs (hsiRNAs added directly to the culture medium without lipid formulation. We identify functional hsiRNAs targeting the mRNA of huntingtin, the mutation of which is responsible for Huntington's disease, and show that direct uptake in neurons induces potent and specific silencing in vitro. Moreover, a single injection of unformulated hsiRNA into mouse brain silences Htt mRNA with minimal neuronal toxicity. Thus, hsiRNAs embody a class of therapeutic oligonucleotides that enable simple and straightforward functional studies of genes involved in neuronal biology and neurodegenerative disorders in a native biological context.

  18. Platinum Interference with siRNA Non-seed Regions Fine-Tunes Silencing Capacity

    DEFF Research Database (Denmark)

    Hedman, Hanna K; Kirpekar, Finn; Elmroth, Sofi K C

    2011-01-01

    expression, and the other one focused on the function of endogenous miRNAs. In both cases, the active molecule consists of a ∼20-nucleotide-long RNA duplex. In the siRNA case, improved systemic stability is of central interest for its further development toward clinical applications. With respect to mi......RNA processing and function, understanding its influence on mRNA targeting and the silencing ability of individual miRNAs, e.g., under pathological conditions, remains a scientific challenge. In the present study, a model system is presented where the influence of the two clinically used anticancer drugs......, cisplatin and oxaliplatin, on siRNA's silencing capacity has been evaluated. More specifically, siRNAs targeting the 3' UTR region of Wnt-5a mRNA (NM_003352) were constructed, and the biologically active antisense RNA strand was pre-platinated. Platinum adducts were detected and characterized...

  19. Effects of neoliberal rationality in speeches on inclusion: the teacher’s silence

    Directory of Open Access Journals (Sweden)

    Leandra Boer Possa

    2013-06-01

    Full Text Available This text, which makes use of the National Policy on Special Education in the Perspective of Inclusive Education and the programs that embrace the training of teachers for diversity/ inclusion, puts the discursive effects of these documents in analytic sets. Without attempting at doing an exhaustive analysis, this study aims at problematizing the effect of teacher’s silence that the neoliberal policy has been producing on teachers who work in municipal and state education systems in Santa Maria area. The conceptual and methodological tool of governmentality is used in this enterprise in order to think that the discourses of inclusion have convinced and subjectivized teachers, because in the face of the irreducibility of this discursive network the silence is an effect of the production and consumption of the principle of inclusion and enterprise itself.

  20. Inhibition of human esophageal squamous cell carcinomas by targeted silencing of tumor enhancer genes: an overview

    International Nuclear Information System (INIS)

    Islamian, Jalil Pirayesh; Mohammadi, Mohsen; Baradaran, Behzad

    2014-01-01

    Esophageal cancer has been reported as the ninth most common malignancy and ranks as the sixth most frequent cause of death worldwide. Esophageal cancer treatment involves surgery, chemotherapy, radiation therapy, or combination therapy. Novel strategies are needed to boost the oncologic outcome. Recent advances in the molecular biology of esophageal cancer have documented the role of genetic alterations in tumorigenesis. Oncogenes serve a pivotal function in tumorigenesis. Targeted therapies are directed at the unique molecular signature of cancer cells for enhanced efficacy with low toxicity. RNA interference (RNAi) technology is a powerful tool for silencing endogenous or exogenous genes in mammalian cells. Related results have shown that targeting oncogenes with siRNAs, specifically the mRNA, effectively reduces tumor cell proliferation and induces apoptotic cell death. This article will briefly review studies on silencing tumor enhancer genes related to the induction of esophageal cancer

  1. 9 CFR 113.210 - Feline Calicivirus Vaccine, Killed Virus.

    Science.gov (United States)

    2010-01-01

    ... Virus. 113.210 Section 113.210 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.210 Feline Calicivirus Vaccine, Killed Virus. Feline Calicivirus...

  2. 9 CFR 113.205 - Newcastle Disease Vaccine, Killed Virus.

    Science.gov (United States)

    2010-01-01

    ... Virus. 113.205 Section 113.205 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.205 Newcastle Disease Vaccine, Killed Virus. Newcastle Disease Vaccine...

  3. 9 CFR 113.211 - Feline Rhinotracheitis Vaccine, Killed Virus.

    Science.gov (United States)

    2010-01-01

    ... Virus. 113.211 Section 113.211 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.211 Feline Rhinotracheitis Vaccine, Killed Virus. Feline...

  4. 9 CFR 113.216 - Bovine Rhinotracheitis Vaccine, Killed Virus.

    Science.gov (United States)

    2010-01-01

    ... Virus. 113.216 Section 113.216 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.216 Bovine Rhinotracheitis Vaccine, Killed Virus. Infectious Bovine...

  5. 9 CFR 113.203 - Feline Panleukopenia Vaccine, Killed Virus.

    Science.gov (United States)

    2010-01-01

    ... Virus. 113.203 Section 113.203 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.203 Feline Panleukopenia Vaccine, Killed Virus. Feline Panleukopenia...

  6. 9 CFR 113.214 - Parvovirus Vaccine, Killed Virus (Canine).

    Science.gov (United States)

    2010-01-01

    ... REQUIREMENTS Killed Virus Vaccines § 113.214 Parvovirus Vaccine, Killed Virus (Canine). Parvovirus Vaccine... antibody against canine parvovirus to determine susceptibility. A constant virus-varying serum... vaccinates and the controls shall be challenged with virulent canine parvovirus furnished or approved by...

  7. Killing Unwanted West Indies Mahogany Trees by Peeling and Frilling

    Science.gov (United States)

    R. W. Nobles; C. B. Briscoe

    1966-01-01

    Peeling and frilling each killed approximately 70 percent of treated West Indies mahogany, but peeling killed a higher percentage of trees between 18 and 33 centimeters (7 and 13 inches) than did frilling. Essentially all mortality occurred within the first 15 months following treatment.

  8. Sox6 directly silences epsilon globin expression in definitive erythropoiesis.

    Directory of Open Access Journals (Sweden)

    2006-02-01

    Full Text Available Sox6 is a member of the Sox transcription factor family that is defined by the conserved high mobility group (HMG DNA binding domain, first described in the testis determining gene, Sry. Previous studies have suggested that Sox6 plays a role in the development of the central nervous system, cartilage, and muscle. In the Sox6-deficient mouse, p100H, epsilony globin is persistently expressed, and increased numbers of nucleated red cells are present in the fetal circulation. Transfection assays in GM979 (erythroleukemic cells define a 36-base pair region of the epsilony proximal promoter that is critical for Sox6 mediated repression. Electrophoretic mobility shift assay (EMSA and chromatin immunoprecipitation (ChIP assays demonstrate that Sox6 acts as a repressor by directly binding to the epsilony promoter. The normal expression of Sox6 in wild-type fetal liver and the ectopic expression of epsilony in p100H homozygous fetal liver demonstrate that Sox6 functions in definitive erythropoiesis. The present study shows that Sox6 is required for silencing of epsilony globin in definitive erythropoiesis and suggests a role for Sox6 in erythroid cell maturation. Thus, Sox6 regulation of epsilony globin might provide a novel therapeutical target in the treatment of hemoglobinopathies such as sickle cell anemia and thalassemia.

  9. FXR silencing in human colon cancer by DNA methylation and KRAS signaling.

    Science.gov (United States)

    Bailey, Ann M; Zhan, Le; Maru, Dipen; Shureiqi, Imad; Pickering, Curtis R; Kiriakova, Galina; Izzo, Julie; He, Nan; Wei, Caimiao; Baladandayuthapani, Veerabhadran; Liang, Han; Kopetz, Scott; Powis, Garth; Guo, Grace L

    2014-01-01

    Farnesoid X receptor (FXR) is a bile acid nuclear receptor described through mouse knockout studies as a tumor suppressor for the development of colon adenocarcinomas. This study investigates the regulation of FXR in the development of human colon cancer. We used immunohistochemistry of FXR in normal tissue (n = 238), polyps (n = 32), and adenocarcinomas, staged I-IV (n = 43, 39, 68, and 9), of the colon; RT-quantitative PCR, reverse-phase protein array, and Western blot analysis in 15 colon cancer cell lines; NR1H4 promoter methylation and mRNA expression in colon cancer samples from The Cancer Genome Atlas; DNA methyltransferase inhibition; methyl-DNA immunoprecipitation (MeDIP); bisulfite sequencing; and V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) knockdown assessment to investigate FXR regulation in colon cancer development. Immunohistochemistry and quantitative RT-PCR revealed that expression and function of FXR was reduced in precancerous lesions and silenced in a majority of stage I-IV tumors. FXR expression negatively correlated with phosphatidylinositol-4, 5-bisphosphate 3 kinase signaling and the epithelial-to-mesenchymal transition. The NR1H4 promoter is methylated in ~12% colon cancer The Cancer Genome Atlas samples, and methylation patterns segregate with tumor subtypes. Inhibition of DNA methylation and KRAS silencing both increased FXR expression. FXR expression is decreased early in human colon cancer progression, and both DNA methylation and KRAS signaling may be contributing factors to FXR silencing. FXR potentially suppresses epithelial-to-mesenchymal transition and other oncogenic signaling cascades, and restoration of FXR activity, by blocking silencing mechanisms or increasing residual FXR activity, represents promising therapeutic options for the treatment of colon cancer.

  10. Killing (absorption) versus survival in random motion

    Science.gov (United States)

    Garbaczewski, Piotr

    2017-09-01

    We address diffusion processes in a bounded domain, while focusing on somewhat unexplored affinities between the presence of absorbing and/or inaccessible boundaries. For the Brownian motion (Lévy-stable cases are briefly mentioned) model-independent features are established of the dynamical law that underlies the short-time behavior of these random paths, whose overall lifetime is predefined to be long. As a by-product, the limiting regime of a permanent trapping in a domain is obtained. We demonstrate that the adopted conditioning method, involving the so-called Bernstein transition function, works properly also in an unbounded domain, for stochastic processes with killing (Feynman-Kac kernels play the role of transition densities), provided the spectrum of the related semigroup operator is discrete. The method is shown to be useful in the case, when the spectrum of the generator goes down to zero and no isolated minimal (ground state) eigenvalue is in existence, like in the problem of the long-term survival on a half-line with a sink at origin.

  11. Combinatorial stresses kill pathogenic Candida species

    Science.gov (United States)

    Kaloriti, Despoina; Tillmann, Anna; Cook, Emily; Jacobsen, Mette; You, Tao; Lenardon, Megan; Ames, Lauren; Barahona, Mauricio; Chandrasekaran, Komelapriya; Coghill, George; Goodman, Daniel; Gow, Neil A. R.; Grebogi, Celso; Ho, Hsueh-Lui; Ingram, Piers; McDonagh, Andrew; De Moura, Alessandro P. S.; Pang, Wei; Puttnam, Melanie; Radmaneshfar, Elahe; Romano, Maria Carmen; Silk, Daniel; Stark, Jaroslav; Stumpf, Michael; Thiel, Marco; Thorne, Thomas; Usher, Jane; Yin, Zhikang; Haynes, Ken; Brown, Alistair J. P.

    2012-01-01

    Pathogenic microbes exist in dynamic niches and have evolved robust adaptive responses to promote survival in their hosts. The major fungal pathogens of humans, Candida albicans and Candida glabrata, are exposed to a range of environmental stresses in their hosts including osmotic, oxidative and nitrosative stresses. Significant efforts have been devoted to the characterization of the adaptive responses to each of these stresses. In the wild, cells are frequently exposed simultaneously to combinations of these stresses and yet the effects of such combinatorial stresses have not been explored. We have developed a common experimental platform to facilitate the comparison of combinatorial stress responses in C. glabrata and C. albicans. This platform is based on the growth of cells in buffered rich medium at 30°C, and was used to define relatively low, medium and high doses of osmotic (NaCl), oxidative (H 2O2) and nitrosative stresses (e.g., dipropylenetriamine (DPTA)-NONOate). The effects of combinatorial stresses were compared with the corresponding individual stresses under these growth conditions. We show for the first time that certain combinations of combinatorial stress are especially potent in terms of their ability to kill C. albicans and C. glabrata and/or inhibit their growth. This was the case for combinations of osmotic plus oxidative stress and for oxidative plus nitrosative stress. We predict that combinatorial stresses may be highly signif cant in host defences against these pathogenic yeasts. PMID:22463109

  12. Protection against hyperthermic cell killing by alanine

    International Nuclear Information System (INIS)

    Cunningham, A.; Henle, K.J.; Moss, A.J.; Nagle, W.A.

    1987-01-01

    Compounds capable of protecting cells against hyperthermia may provide new insights into potential mechanisms of thermotolerance and cellular heat death. The authors characterized heat protection by alanine and related compounds as a function of concentration, temperature and preincubation time. Alanine was added either to complete medium or to HBSS before hyperthermia. Maximal heat protection required 3 hr, 37 0 ; longer preincubation intervals resulted in lower levels of protection. Addition of alanine to medium after hyperthermia had no protective effect. Protection was concentration dependent with a 20- or 200-fold increase in cell survival after 40 min, 45 0 C at 60 mM in medium or in HBSS, respectively. Higher alanine concentrations up to 120mM did not significantly increase heat protection. A 45 0 -heat survival curve showed that 100mM alanine increased the D/sub q/ by approx. 12 min with little change in the D/sub o/. Hyperthermia of 1 hr at temperatures between 42 0 and 45 0 indicated that 100mM alanine shifted the isotoxic temperature by 0.5 Celsius degrees. Polymers of either L or D,L alanine and related compounds, like pyruvate, also protected cells against heat killing. These results indicate that heat protection by alanine shows characteristics that are not shared by polyhydroxy compounds

  13. Silence and Memories of War: An Autoethnographic Exploration of Family Secrecy.

    Science.gov (United States)

    Rober, Peter; Rosenblatt, Paul C

    2017-03-01

    A personal journey and a scientific challenge, this is an autoethnographic study about my own family's secrecy. I knew my grandfather had been a German prisoner of war during World War II. We all knew. But nobody talked about it. Then one day I decided I wanted to do systematic research on the issue of family secrecy around my grandfather's war experiences. Researching one's own family can be called autoethnography. It could be said that autoethnography is an approach to research that aims to describe and systemically analyze (graphy) personal experience (auto) to understand social and cultural phenomena (ethno). This scientific approach is quite new in the field of family therapy. This study has been an important personal quest, but it also led to important reflections on silences in families, on my own professional development, and on methodological issues concerning autoethnographical research. For one thing, it highlights some of the positive aspects of family secrecy and silences, and invites us-when confronted with family secrecy in clinical practice-to carefully consider the potential destructive and life-giving aspects of the silence. © 2015 Family Process Institute.

  14. Two Novel Motifs of Watermelon Silver Mottle Virus NSs Protein Are Responsible for RNA Silencing Suppression and Pathogenicity.

    Science.gov (United States)

    Huang, Chung-Hao; Hsiao, Weng-Rong; Huang, Ching-Wen; Chen, Kuan-Chun; Lin, Shih-Shun; Chen, Tsung-Chi; Raja, Joseph A J; Wu, Hui-Wen; Yeh, Shyi-Dong

    2015-01-01

    The NSs protein of Watermelon silver mottle virus (WSMoV) is the RNA silencing suppressor and pathogenicity determinant. In this study, serial deletion and point-mutation mutagenesis of conserved regions (CR) of NSs protein were performed, and the silencing suppression function was analyzed through agroinfiltration in Nicotiana benthamiana plants. We found two amino acid (aa) residues, H113 and Y398, are novel functional residues for RNA silencing suppression. Our further analyses demonstrated that H113 at the common epitope (CE) ((109)KFTMHNQ(117)), which is highly conserved in Asia type tospoviruses, and the benzene ring of Y398 at the C-terminal β-sheet motif ((397)IYFL(400)) affect NSs mRNA stability and protein stability, respectively, and are thus critical for NSs RNA silencing suppression. Additionally, protein expression of other six deleted (ΔCR1-ΔCR6) and five point-mutated (Y15A, Y27A, G180A, R181A and R212A) mutants were hampered and their silencing suppression ability was abolished. The accumulation of the mutant mRNAs and proteins, except Y398A, could be rescued or enhanced by co-infiltration with potyviral suppressor HC-Pro. When assayed with the attenuated Zucchini yellow mosaic virus vector in squash plants, the recombinants carrying individual seven point-mutated NSs proteins displayed symptoms much milder than the recombinant carrying the wild type NSs protein, suggesting that these aa residues also affect viral pathogenicity by suppressing the host silencing mechanism.

  15. Toward a science of silence: The consequences of leaving a memory unsaid

    DEFF Research Database (Denmark)

    Stone, Charles; Coman, Alin; Brown, Adam

    2012-01-01

    of the silence—and listeners—those attending to the speaker. Although the topic of silence is widely discussed, it is rarely mentioned in the empirical literature on memory. Three factors are employed to classify silence into different types: whether a silence is accompanied by covert remembering, whether...... the silence is intentional or unintentional, and whether the silenced memory is related or unrelated to the memories emerging in a conversation. These factors appear to be critical when considering the mnemonic consequences. Moreover, the influence of silence on memory varies between speaker and listener...

  16. 'David and Goliath' of the soil food web - Flagellates that kill nematodes

    DEFF Research Database (Denmark)

    Strandmark, Lisa Bjørnlund; Rønn, Regin

    2008-01-01

    Nematodes and flagellates are important bacterial predators in soil and sediments. Generally, these organisms are considered to be competitors for bacterial food. We studied the interaction among flagellates and nematodes using axenic liquid cultures amended with heat-killed bacteria as food...... and showed for the first time that a small and common soil flagellate (Cercomonas sp.) is able to attack and kill the much larger nematode Caenorhabditis elegans. The killing process is not caused by soluble metabolites but requires direct contact between the flagellate cells and the nematode surface...... and occurs rapidly (within a few hours) at high flagellate density. At lower flagellate density, adult nematodes sometimes avoid attachment of flagellates, feed on them and become the dominant bacterial predator. Considering that bacterial feeders affect bacterial communities differently, and that one...

  17. Staphylococcus aureus virulence factors identified by using a high-throughput Caenorhabditis elegans-killing model.

    Science.gov (United States)

    Begun, Jakob; Sifri, Costi D; Goldman, Samuel; Calderwood, Stephen B; Ausubel, Frederick M

    2005-02-01

    Staphylococcus aureus is an important human pathogen that is also able to kill the model nematode Caenorhabditis elegans. We constructed a 2,950-member Tn917 transposon insertion library in S. aureus strain NCTC 8325. Twenty-one of these insertions exhibited attenuated C. elegans killing, and of these, 12 contained insertions in different genes or chromosomal locations. Ten of these 12 insertions showed attenuated killing phenotypes when transduced into two different S. aureus strains, and 5 of the 10 mutants correspond to genes that have not been previously identified in signature-tagged mutagenesis studies. These latter five mutants were tested in a murine renal abscess model, and one mutant harboring an insertion in nagD exhibited attenuated virulence. Interestingly, Tn917 was shown to have a very strong bias for insertions near the terminus of DNA replication.

  18. Is our knowledge of voice and silence in organizations growing?

    DEFF Research Database (Denmark)

    Knoll, Michael; Wegge, Jürgen; Unterrainer, Christine

    2016-01-01

    This article has three objectives. Firstly, we seek to demonstrate the relevance of voice and silence – that is, whether employees contribute or withhold information, ideas, views and/or concerns at work – for the sustainable development of individuals, organizations and societies. Our second...... objective is to identify emerging (and enduring) issues – conceptual, theoretical and methodological – that have not yet been adequately addressed in voice and silence research. These issues include the relationship between voice and silence, how they may manifest in organizations, their manifold...... antecedents inside and beyond organizational boundaries, their potentially positive and negative effects for internal and external stakeholders, and methodological questions. The third objective is to propose opportunities for addressing these issues with the ultimate aim to build a broader and more...

  19. Managing Threat, Cost, and Incentive to Kill: The Short- and Long-Term Effects of Intervention in Mass Killings

    Science.gov (United States)

    Kathman, Jacob D.; Wood, Reed M.

    2011-01-01

    How do third-party interventions affect the severity of mass killings? The authors theorize that episodes of mass killing are the consequence of two factors: (1) the threat perceptions of the perpetrators and (2) the cost of implementing genocidal policies relative to other alternatives. To reduce genocidal hostilities, interveners must address…

  20. Lactoferricin Peptides Increase Macrophages' Capacity To Kill Mycobacterium avium.

    Science.gov (United States)

    Silva, Tânia; Moreira, Ana C; Nazmi, Kamran; Moniz, Tânia; Vale, Nuno; Rangel, Maria; Gomes, Paula; Bolscher, Jan G M; Rodrigues, Pedro N; Bastos, Margarida; Gomes, Maria Salomé

    2017-01-01

    Mycobacterial infections cause a significant burden of disease and death worldwide. Their treatment is long, toxic, costly, and increasingly prone to failure due to bacterial resistance to currently available antibiotics. New therapeutic options are thus clearly needed. Antimicrobial peptides represent an important source of new antimicrobial molecules, both for their direct activity and for their immunomodulatory potential. We have previously reported that a short version of the bovine antimicrobial peptide lactoferricin with amino acids 17 to 30 (LFcin17-30), along with its variants obtained by specific amino acid substitutions, killed Mycobacterium avium in broth culture. In the present work, those peptides were tested against M. avium living inside its natural host cell, the macrophage. We found that the peptides increased the antimicrobial action of the conventional antibiotic ethambutol inside macrophages. Moreover, the d-enantiomer of the lactoferricin peptide (d-LFcin17-30) was more stable and induced significant killing of intracellular mycobacteria by itself. Interestingly, d-LFcin17-30 did not localize to M. avium -harboring phagosomes but induced the production of proinflammatory cytokines and increased the formation of lysosomes and autophagosome-like vesicles. These results lead us to conclude that d-LFcin17-30 primes macrophages for intracellular microbial digestion through phagosomal maturation and/or autophagy, culminating in mycobacterial killing. IMPORTANCE The genus Mycobacterium comprises several pathogenic species, including M. tuberculosis , M. leprae , M. avium , etc. Infections caused by these bacteria are particularly difficult to treat due to their intrinsic impermeability, low growth rate, and intracellular localization. Antimicrobial peptides are increasingly acknowledged as potential treatment tools, as they have a high spectrum of activity, low tendency to induce bacterial resistance, and immunomodulatory properties. In this study, we

  1. Terrorism as Genocide: Killing with “Intent”

    Directory of Open Access Journals (Sweden)

    Ashlie Perry

    2012-07-01

    Full Text Available It is plausible that terrorism can manifest itself as a form of genocide. Using Raphael Lemkin’s definition of genocide and the UN Genocide Convention’s definition of genocide, non-state and state terrorism are assessed as a form of genocide. Commonalities found in the definitions of both genocide and terrorism supports the argument. The psychology of terrorism and Lemkin’s psychology of genocide describe similar motivations of perpetrators. The September 11th attacks and the U.S. invasion of Iraq are used as case studies to illustrate that terrorism can result in genocide or genocidal acts. Framing acts of terrorism as genocide allows for prosecution in international courts and brings a new perspective to the concept of killing with intent.

  2. The psychological reactions after witnessing a killing in public in a Danish high school

    DEFF Research Database (Denmark)

    Elklit, A.; Kurdahl, S.

    2013-01-01

    BACKGROUND: School killings attract immense media and public attention but psychological studies surrounding these events are rare. OBJECTIVE: To examine the prevalence of posttraumatic stress disorder (PTSD) and possible risk factors of PTSD in 320 Danish high school students (mean age 18 years) 7.......5%. Furthermore, 25% had PTSD at a subclinical level. Intimacy with the deceased girl; feeling fear, helplessness, or horror during the killing; lack of expressive ability; feeling let down by others; negative affectivity; and dissociation predicted 78% of the variance of the HTQ total scores. CONCLUSION...

  3. Predator-dependent functional response in wolves: from food limitation to surplus killing.

    Science.gov (United States)

    Zimmermann, Barbara; Sand, Håkan; Wabakken, Petter; Liberg, Olof; Andreassen, Harry Peter

    2015-01-01

    The functional response of a predator describes the change in per capita kill rate to changes in prey density. This response can be influenced by predator densities, giving a predator-dependent functional response. In social carnivores which defend a territory, kill rates also depend on the individual energetic requirements of group members and their contribution to the kill rate. This study aims to provide empirical data for the functional response of wolves Canis lupus to the highly managed moose Alces alces population in Scandinavia. We explored prey and predator dependence, and how the functional response relates to the energetic requirements of wolf packs. Winter kill rates of GPS-collared wolves and densities of cervids were estimated for a total of 22 study periods in 15 wolf territories. The adult wolves were identified as the individuals responsible for providing kills to the wolf pack, while pups could be described as inept hunters. The predator-dependent, asymptotic functional response models (i.e. Hassell-Varley type II and Crowley-Martin) performed best among a set of 23 competing linear, asymptotic and sigmoid models. Small wolf packs acquired >3 times as much moose biomass as required to sustain their field metabolic rate (FMR), even at relatively low moose abundances. Large packs (6-9 wolves) acquired less biomass than required in territories with low moose abundance. We suggest the surplus killing by small packs is a result of an optimal foraging strategy to consume only the most nutritious parts of easy accessible prey while avoiding the risk of being detected by humans. Food limitation may have a stabilizing effect on pack size in wolves, as supported by the observed negative relationship between body weight of pups and pack size. © 2014 The Authors. Journal of Animal Ecology published by John Wiley & Sons Ltd on behalf of British Ecological Society.

  4. Estimated Number of Birds Killed by House Cats (Felis catus in Canada

    Directory of Open Access Journals (Sweden)

    Peter Blancher

    2013-12-01

    Full Text Available Predation by house cats (Felis catus is one of the largest human-related sources of mortality for wild birds in the United States and elsewhere, and has been implicated in extinctions and population declines of several species. However, relatively little is known about this topic in Canada. The objectives of this study were to provide plausible estimates for the number of birds killed by house cats in Canada, identify information that would help improve those estimates, and identify species potentially vulnerable to population impacts. In total, cats are estimated to kill between 100 and 350 million birds per year in Canada (> 95% of estimates were in this range, with the majority likely to be killed by feral cats. This range of estimates is based on surveys indicating that Canadians own about 8.5 million pet cats, a rough approximation of 1.4 to 4.2 million feral cats, and literature values of predation rates from studies conducted elsewhere. Reliability of the total kill estimate would be improved most by better knowledge of feral cat numbers and diet in Canada, though any data on birds killed by cats in Canada would be helpful. These estimates suggest that 2-7% of birds in southern Canada are killed by cats per year. Even at the low end, predation by house cats is probably the largest human-related source of bird mortality in Canada. Many species of birds are potentially vulnerable to at least local population impacts in southern Canada, by virtue of nesting or feeding on or near ground level, and habitat choices that bring them into contact with human-dominated landscapes where cats are abundant. Because cat predation is likely to remain a primary source of bird mortality in Canada for some time, this issue needs more scientific attention in Canada.

  5. Transcriptome and proteome analyses and the role of atypical calpain protein and autophagy in the spliced leader silencing pathway in Trypanosoma brucei.

    Science.gov (United States)

    Hope, Ronen; Egarmina, Katarina; Voloshin, Konstantin; Waldman Ben-Asher, Hiba; Carmi, Shai; Eliaz, Dror; Drori, Yaron; Michaeli, Shulamit

    2016-10-01

    Under persistent ER stress, Trypanosoma brucei parasites induce the spliced leader silencing (SLS) pathway. In SLS, transcription of the SL RNA gene, the SL donor to all mRNAs, is extinguished, arresting trans-splicing and leading to programmed cell death (PCD). In this study, we investigated the transcriptome following silencing of SEC63, a factor essential for protein translocation across the ER membrane, and whose silencing induces SLS. The proteome of SEC63-silenced cells was analyzed with an emphasis on SLS-specific alterations in protein expression, and modifications that do not directly result from perturbations in trans-splicing. One such protein identified is an atypical calpain SKCRP7.1/7.2. Co-silencing of SKCRP7.1/7.2 and SEC63 eliminated SLS induction due its role in translocating the PK3 kinase. This kinase initiates SLS by migrating to the nucleus and phosphorylating TRF4 leading to shut-off of SL RNA transcription. Thus, SKCRP7.1 is involved in SLS signaling and the accompanying PCD. The role of autophagy in SLS was also investigated; eliminating autophagy through VPS34 or ATG7 silencing demonstrated that autophagy is not essential for SLS induction, but is associated with PCD. Thus, this study identified factors that are used by the parasite to cope with ER stress and to induce SLS and PCD. © 2016 John Wiley & Sons Ltd.

  6. A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize.

    Science.gov (United States)

    Mei, Yu; Zhang, Chunquan; Kernodle, Bliss M; Hill, John H; Whitham, Steven A

    2016-06-01

    Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. © 2016 American Society of Plant Biologists. All Rights Reserved.

  7. A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize1[OPEN

    Science.gov (United States)

    Mei, Yu; Kernodle, Bliss M.; Hill, John H.

    2016-01-01

    Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. PMID:27208311

  8. On the Threshold: Time and the Speaking Subject in Harold Pinter’s Silence

    Directory of Open Access Journals (Sweden)

    Beatrice Nori

    2017-07-01

    Full Text Available The article investigates Harold Pinter’s play Silence from a linguistic and phenomenological point of view. Silence is probably one of the least studied – though one of the most difficult and compelling – of Pinter’s plays. The author iden­tifies the broken syntax and the combi­nation of utterances and silences as indicators of time and space shifts. She claims that the patchwork which appears from the structure of the play depicts the loss of logic, and that the abandonmen­t of chronological time in linguistic terms conveys the subjecti­ve, circular, and illogical elemen­t of the human experience of time. Characters’ bodies and utterances materialize both their own past recollections and their presen­t experiences. The presen­t work may be useful to theatre scholars as an example of drama as a portrayal of philosophical and linguistic theories about time and discourse.

  9. Silencing of the pentose phosphate pathway genes influences DNA replication in human fibroblasts.

    Science.gov (United States)

    Fornalewicz, Karolina; Wieczorek, Aneta; Węgrzyn, Grzegorz; Łyżeń, Robert

    2017-11-30

    Previous reports and our recently published data indicated that some enzymes of glycolysis and the tricarboxylic acid cycle can affect the genome replication process by changing either the efficiency or timing of DNA synthesis in human normal cells. Both these pathways are connected with the pentose phosphate pathway (PPP pathway). The PPP pathway supports cell growth by generating energy and precursors for nucleotides and amino acids. Therefore, we asked if silencing of genes coding for enzymes involved in the pentose phosphate pathway may also affect the control of DNA replication in human fibroblasts. Particular genes coding for PPP pathway enzymes were partially silenced with specific siRNAs. Such cells remained viable. We found that silencing of the H6PD, PRPS1, RPE genes caused less efficient enterance to the S phase and decrease in efficiency of DNA synthesis. On the other hand, in cells treated with siRNA against G6PD, RBKS and TALDO genes, the fraction of cells entering the S phase was increased. However, only in the case of G6PD and TALDO, the ratio of BrdU incorporation to DNA was significantly changed. The presented results together with our previously published studies illustrate the complexity of the influence of genes coding for central carbon metabolism on the control of DNA replication in human fibroblasts, and indicate which of them are especially important in this process. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. RNAi-mediated silencing of enolase confirms its biological importance in Clonorchis sinensis.

    Science.gov (United States)

    Wang, Xiaoyun; Chen, Wenjun; Tian, Yanli; Huang, Yan; Li, Xuerong; Yu, Xinbing

    2014-04-01

    Clonorchis sinensis (C. sinensis) infection is still a common public health problem in freshwater fish consumption areas in Asian countries. More molecular evidence are required to speed up the prevention strategies to control this kind of infectious disease. In the present study, to confirm the biological importance of Csenolase followed by our previous observations of the key metabolic enzyme, we explored the RNA silence effect of the Csenolase-derived RNA interference (RNAi) in C. sinensis. The extramembranous region aa105-226 was selected as the target sequence of RNA silence. Csenolase-derived double strand RNA (dsRNA-Csenolase, 366 bp) was synthetized and delivered into C. sinensis by soaking approach. The penetration of dsRNA into adult worms and metacercariae was tracked using fluorescently labeled RNA. Western blotting and qRT-PCR experiments were performed to determine dsRNA-Csenolase-silencing effect. Our results showed that, after incubating for 120 h, dsRNA-Csenolase could effectively target and downregulate the expression of Csenolase in both adult worms (P sinensis adult worms (P sinensis, allowing further applications in identifying functional genes in C. sinensis.

  11. Host-Induced Silencing of Pathogenicity Genes Enhances Resistance to Fusarium oxysporum Wilt in Tomato.

    Science.gov (United States)

    Bharti, Poonam; Jyoti, Poonam; Kapoor, Priya; Sharma, Vandana; Shanmugam, V; Yadav, Sudesh Kumar

    2017-08-01

    This study presents a novel approach of controlling vascular wilt in tomato by RNAi expression directed to pathogenicity genes of Fusarium oxysporum f. sp. lycopersici. Vascular wilt of tomato caused by Fusarium oxysporum f. sp. lycopersici leads to qualitative and quantitative loss of the crop. Limitation in the existing control measures necessitates the development of alternative strategies to increase resistance in the plants against pathogens. Recent findings paved way to RNAi, as a promising method for silencing of pathogenicity genes in fungus and provided effective resistance against fungal pathogens. Here, two important pathogenicity genes FOW2, a Zn(II)2Cys6 family putative transcription regulator, and chsV, a putative myosin motor and a chitin synthase domain, were used for host-induced gene silencing through hairpinRNA cassettes of these genes against Fusarium oxysporum f. sp. lycopersici. HairpinRNAs were assembled in appropriate binary vectors and transformed into tomato plant targeting FOW2 and chsV genes, for two highly pathogenic strains of Fusarium oxysporum viz. TOFOL-IHBT and TOFOL-IVRI. Transgenic tomatoes were analyzed for possible attainment of resistance in transgenic lines against fungal infection. Eight transgenic lines expressing hairpinRNA cassettes showed trivial disease symptoms after 6-8 weeks of infection. Hence, the host-induced posttranscriptional gene silencing of pathogenicity genes in transgenic tomato plants has enhanced their resistance to vascular wilt disease caused by Fusarium oxysporum.

  12. Lentiviral Vector Mediated Claudin1 Silencing Inhibits Epithelial to Mesenchymal Transition in Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Xianqi Zhao

    2015-06-01

    Full Text Available Breast cancer has a high incidence and mortality rate worldwide. Several viral vectors including lentiviral, adenoviral and adeno-associated viral vectors have been used in gene therapy for various forms of human cancer, and have shown promising effects in controlling tumor development. Claudin1 (CLDN1 is a member of the tetraspan transmembrane protein family that plays a major role in tight junctions and is associated with tumor metastasis. However, the role of CLDN1 in breast cancer is largely unexplored. In this study, we tested the therapeutic potential of silencing CLDN1 expression in two breast cancer (MDA-MB-231 and MCF7 cell lines using lentiviral vector mediated RNA interference. We found that a CLDN1 short hairpin (shRNA construct efficiently silenced CLDN1 expression in both breast cancer cell lines, and CLDN1 knockdown resulted in reduced cell proliferation, survival, migration and invasion. Furthermore, silencing CLDN1 inhibited epithelial to mesenchymal transition (EMT by upregulating the epithelial cell marker, E-cadherin, and downregulating mesenchymal markers, smooth muscle cell alpha-actin (SMA and Snai2. Our data demonstrated that lentiviral vector mediated CLDN1 RNA interference has great potential in breast cancer gene therapy by inhibiting EMT and controlling tumor cell growth.

  13. Duplication of an upstream silencer of FZP increases grain yield in rice.

    Science.gov (United States)

    Bai, Xufeng; Huang, Yong; Hu, Yong; Liu, Haiyang; Zhang, Bo; Smaczniak, Cezary; Hu, Gang; Han, Zhongmin; Xing, Yongzhong

    2017-11-01

    Transcriptional silencer and copy number variants (CNVs) are associated with gene expression. However, their roles in generating phenotypes have not been well studied. Here we identified a rice quantitative trait locus, SGDP7 (Small Grain and Dense Panicle 7). SGDP7 is identical to FZP (FRIZZY PANICLE), which represses the formation of axillary meristems. The causal mutation of SGDP7 is an 18-bp fragment, named CNV-18bp, which was inserted ~5.3 kb upstream of FZP and resulted in a tandem duplication in the cultivar Chuan 7. The CNV-18bp duplication repressed FZP expression, prolonged the panicle branching period and increased grain yield by more than 15% through substantially increasing the number of spikelets per panicle (SPP) and slightly decreasing the 1,000-grain weight (TGW). The transcription repressor OsBZR1 binds the CGTG motifs in CNV-18bp and thereby represses FZP expression, indicating that CNV-18bp is the upstream silencer of FZP. These findings showed that the silencer CNVs coordinate a trade-off between SPP and TGW by fine-tuning FZP expression, and balancing the trade-off could enhance yield potential.

  14. The Silencing of a 14-3-3ɛ Homolog in Tenebrio molitor Leads to Increased Antimicrobial Activity in Hemocyte and Reduces Larval Survivability.

    Science.gov (United States)

    Seo, Gi Won; Jo, Yong Hun; Seong, Jeong Hwan; Park, Ki Beom; Patnaik, Bharat Bhusan; Tindwa, Hamisi; Kim, Sun-Am; Lee, Yong Seok; Kim, Yu Jung; Han, Yeon Soo

    2016-08-20

    The 14-3-3 family of phosphorylated serine-binding proteins acts as signaling molecules in biological processes such as metabolism, division, differentiation, autophagy, and apoptosis. Herein, we report the requirement of 14-3-3ɛ isoform from Tenebrio molitor (Tm14-3-3ɛ) in the hemocyte antimicrobial activity. The Tm14-3-3ɛ transcript is 771 nucleotides in length and encodes a polypeptide of 256 amino acid residues. The protein has the typical 14-3-3 domain, the nuclear export signal (NES) sequence, and the peptide binding residues. The Tm14-3-3ɛ transcript shows a significant three-fold expression in the hemocyte of T. molitor larvae when infected with Escherichia coli Tm14-3-3ɛ silenced larvae show significantly lower survival rates when infected with E. coli. Under Tm14-3-3ɛ silenced condition, a strong antimicrobial activity is elicited in the hemocyte of the host inoculated with E. coli. This suggests impaired secretion of antimicrobial peptides (AMP) into the hemolymph. Furthermore, a reduction in AMP secretion under Tm14-3-3ɛ silenced condition would be responsible for loss in the capacity to kill bacteria and might explain the reduced survivability of the larvae upon E. coli challenge. This shows that Tm14-3-3ɛ is required to maintain innate immunity in T. molitor by enabling antimicrobial secretion into the hemolymph and explains the functional specialization of the isoform.

  15. The Silencing of a 14-3-3ɛ Homolog in Tenebrio molitor Leads to Increased Antimicrobial Activity in Hemocyte and Reduces Larval Survivability

    Directory of Open Access Journals (Sweden)

    Gi Won Seo

    2016-08-01

    Full Text Available The 14-3-3 family of phosphorylated serine-binding proteins acts as signaling molecules in biological processes such as metabolism, division, differentiation, autophagy, and apoptosis. Herein, we report the requirement of 14-3-3ɛ isoform from Tenebrio molitor (Tm14-3-3ɛ in the hemocyte antimicrobial activity. The Tm14-3-3ɛ transcript is 771 nucleotides in length and encodes a polypeptide of 256 amino acid residues. The protein has the typical 14-3-3 domain, the nuclear export signal (NES sequence, and the peptide binding residues. The Tm14-3-3ɛ transcript shows a significant three-fold expression in the hemocyte of T. molitor larvae when infected with Escherichia coli Tm14-3-3ɛ silenced larvae show significantly lower survival rates when infected with E. coli. Under Tm14-3-3ɛ silenced condition, a strong antimicrobial activity is elicited in the hemocyte of the host inoculated with E. coli. This suggests impaired secretion of antimicrobial peptides (AMP into the hemolymph. Furthermore, a reduction in AMP secretion under Tm14-3-3ɛ silenced condition would be responsible for loss in the capacity to kill bacteria and might explain the reduced survivability of the larvae upon E. coli challenge. This shows that Tm14-3-3ɛ is required to maintain innate immunity in T. molitor by enabling antimicrobial secretion into the hemolymph and explains the functional specialization of the isoform.

  16. Bystander Host Cell Killing Effects of Clostridium perfringens Enterotoxin

    Directory of Open Access Journals (Sweden)

    Archana Shrestha

    2016-12-01

    Full Text Available Clostridium perfringens enterotoxin (CPE binds to claudin receptors, e.g., claudin-4, and then forms a pore that triggers cell death. Pure cultures of host cells that do not express claudin receptors, e.g., fibroblasts, are unaffected by pathophysiologically relevant CPE concentrations in vitro. However, both CPE-insensitive and CPE-sensitive host cells are present in vivo. Therefore, this study tested whether CPE treatment might affect fibroblasts when cocultured with CPE-sensitive claudin-4 fibroblast transfectants or Caco-2 cells. Under these conditions, immunofluorescence microscopy detected increased death of fibroblasts. This cytotoxic effect involved release of a toxic factor from the dying CPE-sensitive cells, since it could be reproduced using culture supernatants from CPE-treated sensitive cells. Supernatants from CPE-treated sensitive cells, particularly Caco-2 cells, were found to contain high levels of membrane vesicles, often containing a CPE species. However, most cytotoxic activity remained in those supernatants even after membrane vesicle depletion, and CPE was not detected in fibroblasts treated with supernatants from CPE-treated sensitive cells. Instead, characterization studies suggest that a major cytotoxic factor present in supernatants from CPE-treated sensitive cells may be a 10- to 30-kDa host serine protease or require the action of that host serine protease. Induction of caspase-3-mediated apoptosis was found to be important for triggering release of the cytotoxic factor(s from CPE-treated sensitive host cells. Furthermore, the cytotoxic factor(s in these supernatants was shown to induce a caspase-3-mediated killing of fibroblasts. This bystander killing effect due to release of cytotoxic factors from CPE-treated sensitive cells could contribute to CPE-mediated disease.

  17. Friction coefficient measurements of silencers on specialized duct tract

    Directory of Open Access Journals (Sweden)

    Sehnalek Stanislav

    2016-01-01

    Full Text Available This article describes test methods on air duct track in Laboratory of Environmental Engineering. It focuses on measurement of silencer parameter like is pressure loss coeffcient. Firstly, the paper describe the measurement apparatus with description of calculation method by standard ISO 7235 and energy equation. Then the paper presents three ways how to accomplish measurement because such way is not covered by procedure in standard. Then follows the evaluation of results of measurements on three types of silencer designed for HVAC applications. The article is concluded with discussion over measured data with outline for further research.

  18. Phg1/TM9 proteins control intracellular killing of bacteria by determining cellular levels of the Kil1 sulfotransferase in Dictyostelium.

    Directory of Open Access Journals (Sweden)

    Marion Le Coadic

    Full Text Available Dictyostelium discoideum has largely been used to study phagocytosis and intracellular killing of bacteria. Previous studies have shown that Phg1A, Kil1 and Kil2 proteins are necessary for efficient intracellular killing of Klebsiella bacteria. Here we show that in phg1a KO cells, cellular levels of lysosomal glycosidases and lysozyme are decreased, and lysosomal pH is increased. Surprisingly, overexpression of Kil1 restores efficient killing in phg1a KO cells without correcting these lysosomal anomalies. Conversely, kil1 KO cells are defective for killing, but their enzymatic content and lysosomal pH are indistinguishable from WT cells. The killing defect of phg1a KO cells can be accounted for by the observation that in these cells the stability and the cellular amount of Kil1 are markedly reduced. Since Kil1 is the only sulfotransferase characterized in Dictyostelium, an (unidentified sulfated factor, defective in both phg1a and kil1 KO cells, may play a key role in intracellular killing of Klebsiella bacteria. In addition, Phg1B plays a redundant role with Phg1A in controlling cellular amounts of Kil1 and intracellular killing. Finally, cellular levels of Kil1 are unaffected in kil2 KO cells, and Kil1 overexpression does not correct the killing defect of kil2 KO cells, suggesting that Kil2 plays a distinct role in intracellular killing.

  19. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  20. Kill a brand, keep a customer.

    Science.gov (United States)

    Kumar, Nirmalya

    2003-12-01

    Most brands don't make much money. Year after year, businesses generate 80% to 90% of their profits from less than 20% of their brands. Yet most companies tend to ignore loss-making brands, unaware of the hidden costs they incur. That's because executives believe it's easy to erase a brand; they have only to stop investing in it, they assume, and it will die a natural death. But they're wrong. When companies drop brands clumsily, they antagonize loyal customers: Research shows that seven times out of eight, when firms merge two brands, the market share of the new brand never reaches the combined share of the two original ones. It doesn't have to be that way. Smart companies use a four-step process to kill brands methodically. First, CEOs make the case for rationalization by getting groups of senior executives to conduct joint audits of the brand portfolio. These audits make the need to prune brands apparent throughout the organization. In the next stage, executives need to decide how many brands will be retained, which they do either by setting broad parameters that all brands must meet or by identifying the brands they need in order to cater to all the customer segments in their markets. Third, executives must dispose of the brands they've decided to drop, deciding in each case whether it is appropriate to merge, sell, milk, or just eliminate the brand outright. Finally, it's critical that executives invest the resources they've freed to grow the brands they've retained. Done right, dropping brands will result in a company poised for new growth from the source where it's likely to be found--its profitable brands.

  1. Did Vertigo Kill America's Forgotten Astronaut?

    Science.gov (United States)

    Bendrick, Gregg A.; Merlin, Peter W.

    2007-01-01

    On November 15, 1967, U.S. Air Force test pilot Major Michael J. Adams was killed while flying the X-15 rocket-propelled research vehicle in a parabolic spaceflight profile. This flight was part of a joint effort with NASA. An electrical short in one of the experiments aboard the vehicle caused electrical transients, resulting in excessive workload by the pilot. At altitude Major Adams inappropriately initiated a flat spin that led to a series of unusual aircraft attitudes upon atmospheric re-entry, ultimately causing structural failure of the airframe. Major Adams was known to experience vertigo (i.e. spatial disorientation) while flying the X-15, but all X-15 pilots most likely experienced vertigo (i.e. somatogravic, or "Pitch-Up", illusion) as a normal physiologic response to the accelerative forces involved. Major Adams probably experienced vertigo to a greater degree than did others, since prior aeromedical testing for astronaut selection at Brooks AFB revealed that he had an unusually high degree of labyrinthine sensitivity. Subsequent analysis reveals that after engine burnout, and through the zenith of the flight profile, he likely experienced the oculoagravic ("Elevator") illusion. Nonetheless, painstaking investigation after the mishap revealed that spatial disorientation (Type II, Recognized) was NOT the cause, but rather, a contributing factor. The cause was in fact the misinterpretation of a dual-use flight instrument (i.e. Loss of Mode Awareness), resulting in confusion between yaw and roll indications, with subsequent flight control input that was inappropriate. Because of the altitude achieved on this flight, Major Adams was awarded Astronaut wings posthumously. Understanding the potential for spatial disorientation, particularly the oculoagravic illusion, associated with parabolic spaceflight profiles, and understanding the importance of maintaining mode awareness in the context of automated cockpit design, are two lessons that have direct

  2. SAD-3, a Putative Helicase Required for Meiotic Silencing by Unpaired DNA, Interacts with Other Components of the Silencing Machinery

    Science.gov (United States)

    Hammond, Thomas M.; Xiao, Hua; Boone, Erin C.; Perdue, Tony D.; Pukkila, Patricia J.; Shiu, Patrick K. T.

    2011-01-01

    In Neurospora crassa, genes lacking a pairing partner during meiosis are suppressed by a process known as meiotic silencing by unpaired DNA (MSUD). To identify novel MSUD components, we have developed a high-throughput reverse-genetic screen for use with the N. crassa knockout library. Here we describe the screening method and the characterization of a gene (sad-3) subsequently discovered. SAD-3 is a putative helicase required for MSUD and sexual spore production. It exists in a complex with other known MSUD proteins in the perinuclear region, a center for meiotic silencing activity. Orthologs of SAD-3 include Schizosaccharomyces pombe Hrr1, a helicase required for RNAi-induced heterochromatin formation. Both SAD-3 and Hrr1 interact with an RNA-directed RNA polymerase and an Argonaute, suggesting that certain aspects of silencing complex formation may be conserved between the two fungal species. PMID:22384347

  3. Anuran road-kills neighboring a peri-urban reserve in the Atlantic Forest, Brazil.

    Science.gov (United States)

    Coelho, Igor Pfeifer; Teixeira, Fernanda Zimmermann; Colombo, Patrick; Coelho, Artur Vicente Pfeifer; Kindel, Andreas

    2012-12-15

    Mortality from road-kills may figure among the important causes of decline in amphibian populations and species extinctions worldwide. Evaluation of the magnitude, composition, and temporal and spatial distributions of amphibian road-kills is a key step for mitigation planning, especially in peri-urban reserves. Once a month for 16 months, we surveyed, on foot, a 4.4 km section of state road ERS-389 bordering the Itapeva reserve in the southern Atlantic Forest. We recorded 1433 anuran road-kills and estimated a mortality rate of 9002 road-kills/km/year. The species most often recorded were the largest ones: Leptodactylus latrans, Rhinella icterica, Leptodactylus gracilis and Hypsiboas faber; 54.5% of the carcasses could not be identified. Anuran mortality was concentrated in summer, and was associated with temperature, rainfall and photoperiod. Leptodactylus road-kills were strongly influenced by vehicle traffic, probably because of its high abundance during the entire study period. Road-kill hotspots differed for anurans as a group and for single species, and we found an association among spatial patterns of mortality and types of land cover, distance from the nearest waterbody, roadside ditches, and artificial light. Traffic should be banned temporarily during periods of high mortality, which can be forecasted based on meteorological data. A comprehensive mitigation approach should take into account hotspots of all anuran records, and also of target species for selecting locations for amphibian passages and fencing. Roadside ditches, artificial waterbodies, and conventional street lights should be reduced as much as possible, since they may represent ecological traps for anuran populations. Copyright © 2012 Elsevier Ltd. All rights reserved.

  4. Generalized Killing-Yano equations in D=5 gauged supergravity

    International Nuclear Information System (INIS)

    Kubiznak, David; Kunduri, Hari K.; Yasui, Yukinori

    2009-01-01

    We propose a generalization of the (conformal) Killing-Yano equations relevant to D=5 minimal gauged supergravity. The generalization stems from the fact that the dual of the Maxwell flux, the 3-form *F, couples naturally to particles in the background as a 'torsion'. Killing-Yano tensors in the presence of torsion preserve most of the properties of the standard Killing-Yano tensors - exploited recently for the higher-dimensional rotating black holes of vacuum gravity with cosmological constant. In particular, the generalized closed conformal Killing-Yano 2-form gives rise to the tower of generalized closed conformal Killing-Yano tensors of increasing rank which in turn generate the tower of Killing tensors. An example of a generalized Killing-Yano tensor is found for the Chong-Cvetic-Lue-Pope black hole spacetime [Z.W. Chong, M. Cvetic, H. Lu, C.N. Pope, (hep-th/0506029)]. Such a tensor stands behind the separability of the Hamilton-Jacobi, Klein-Gordon, and Dirac equations in this background.

  5. Potentiation of radiation-induced cell kill by synthetic metalloporphyrins

    International Nuclear Information System (INIS)

    O'Hara, J.A.; Douple, E.B.; Abrams, M.J.; Picker, D.J.; Giandomenico, C.M.; Vollano, J.F.

    1989-01-01

    The effects of the combination of several meso-substituted, water soluble metalloporphyrins with ionizing radiation on hypoxic and oxic monolayers of Chinese hamster fibroblast (V79N) cells were studied. The metalloporphyrins tested included a series of cationic metalloporphyrins complexed with Co(III), Zn(II), Fe(III), Cu(II), Pd(II) or Mn(III) and a series of anionic porphyrins chelated with Co(III), Fe(III), Cu(II), Rh(III), Mn(III) or Sn(IV). Both cationic and anionic free porphyrins were also tested. Cationic ligands were tetrakis(4N-methylpyridyl)porphine [TMPyP], tetrakis(4N-trimethylamino phenyl)porphine [TMAP], tetrakis(4N-butylpyridyl)porphine [TBPyP] and tetrakis(3N-methylpyridyl)porphine [3TMPyP]. Anionic ligands tested were tetrakis(4-sulfonato phenyl)porphine [TPPS], tetrakis(biphenyl)porphine sulfonate [TBPS] and tetrakis(4-carboxyphenyl)porphine [TCPP]. SER calculated from survival curves and SFR from one radiation dose were used to assess the relative effectiveness of this class as non-cytotoxic hypoxic and oxic cell-kill potentiators. Comparisons were made at 100 microM, which was essentially non-toxic (greater than 70% survival) for all porphyrins tested except for Co[TMPyP] (approximately 50% survival after 1 hour at 37 degrees C under oxic conditions). The greatest effects on radiation-induced cell kill were achieved with Co[TPPS] and Co[TMPyP] with SER values of 2.3 and 2.4 respectively. Porphyrin analogs with no coordinated metal were found to be less active than the same compound with metal. The overall charge on the molecule did not systematically relate to the biological activity of the compounds tested

  6. Giving Voice: Narrating silence, history and memory in André Brink ...

    African Journals Online (AJOL)

    Giving Voice: Narrating silence, history and memory in André Brink\\'s The Other Side of Silence and Before I Forget. ... Both narrators, though, draw attention to the problems associated with this reconstructive and potentially ... Article Metrics.

  7. Some spacetimes with higher rank Killing-Staeckel tensors

    International Nuclear Information System (INIS)

    Gibbons, G.W.; Houri, T.; Kubiznak, D.; Warnick, C.M.

    2011-01-01

    By applying the lightlike Eisenhart lift to several known examples of low-dimensional integrable systems admitting integrals of motion of higher-order in momenta, we obtain four- and higher-dimensional Lorentzian spacetimes with irreducible higher-rank Killing tensors. Such metrics, we believe, are first examples of spacetimes admitting higher-rank Killing tensors. Included in our examples is a four-dimensional supersymmetric pp-wave spacetime, whose geodesic flow is superintegrable. The Killing tensors satisfy a non-trivial Poisson-Schouten-Nijenhuis algebra. We discuss the extension to the quantum regime.

  8. HIV transcription is induced with some forms of cell killing

    International Nuclear Information System (INIS)

    Woloschak, G.E.; Schreck, S.; Chang-Liu, C.-M.; Libertin, C.R.

    1996-01-01

    Using HeLa cells stably transfected with an HIV-LTR-CAT construct', we demonstrated a peak in CAT induction that occurs in viable (but not necessarily cell-division-competent) cells 24 h following exposure to some cell-killing agents. Γ rays were the only cell-killing agent which did not induce HIV transcription; this can be attributed to the fact that γ-ray-induced apoptotic death requires function p53, which is missing in HeLa cells. For all other agents, HIV-LTR induction was dose-dependent and correlated with the amount of cell killing that occurred in the culture

  9. Factors Affecting Zebra Mussel Kill by the Bacterium Pseudomonas fluorescens

    Energy Technology Data Exchange (ETDEWEB)

    Daniel P. Molloy

    2004-02-24

    The specific purpose of this research project was to identify factors that affect zebra mussel kill by the bacterium Pseudomonas fluorescens. Test results obtained during this three-year project identified the following key variables as affecting mussel kill: treatment concentration, treatment duration, mussel siphoning activity, dissolved oxygen concentration, water temperature, and naturally suspended particle load. Using this latter information, the project culminated in a series of pipe tests which achieved high mussel kill inside power plants under once-through conditions using service water in artificial pipes.

  10. Intergenomic arms races: detection of a nuclear rescue gene of male-killing in a ladybird.

    Directory of Open Access Journals (Sweden)

    Tamsin M O Majerus

    Full Text Available Many species of arthropod are infected by deleterious inherited micro-organisms. Typically these micro-organisms are inherited maternally. Consequently, some, particularly bacteria of the genus Wolbachia, employ a variety of strategies that favour female over male hosts. These strategies include feminisation, induction of parthenogenesis and male-killing. These strategies result in female biased sex ratios in host populations, which lead to selection for host factors that promote male production. In addition, the intra-genomic conflict produced by the difference in transmission of these cytoplasmic endosymbionts and nuclear factors will impose a pressure favouring nuclear factors that suppress the effects of the symbiont. During investigations of the diversity of male-killing bacteria in ladybirds (Coccinellidae, unexpected patterns of vertical transmission of a newly discovered male-killing taxon were observed in the ladybird Cheilomenes sexmaculata. Initial analysis suggested that the expression of the bacterial male-killing trait varies according to the male(s a female has mated with. By swapping males between females, a male influence on the expression of the male-killing trait was confirmed. Experiments were then performed to determine the nature of the interaction. These studies showed that a single dominant allele, which rescues male progeny of infected females from the pathological effect of the male-killer, exists in this species. The gene shows typical Mendelian autosomal inheritance and is expressed irrespective of the parent from which it is inherited. Presence of the rescue gene in either parent does not significantly affect the inheritance of the symbiont. We conclude that C. sexmaculata is host to a male-killing gamma-proteobacterium. Further, this beetle is polymorphic for a nuclear gene, the dominant allele of which rescues infected males from the pathogenic effects of the male-killing agent. These findings represent the first

  11. Modification of oxide inclusions in calcium-treated Al-killed high sulphur steels

    NARCIS (Netherlands)

    Gollapalli, Veerababu; Rao, M.B.Venkata; Karamched, P.S.; Borra, C.R.; Roy, G.G.; Srirangam, Prakash

    2018-01-01

    A study has been carried out to understand the modification of alumina inclusions in Al-killed high sulphur steel with calcium treatment. For calcium treatment to be effective, a general practice is to desulphurise the steel to prevent the formation of solid CaS inclusions that are harmful to

  12. Welfare assessment of gas-filled foam as an agent for killing poultry

    NARCIS (Netherlands)

    Gerritzen, M.A.; Reimert, H.G.M.; Hindle, V.A.; Mckeegan, D.E.F.; Sparrey, J.

    2010-01-01

    During outbreaks of notifiable diseases in poultry measures are taken to restrict the spread of the disease. Mass on-farm killing of birds using gasfilled foam is such a measure. This study examines the method and technologies involved using gas-filled foam and looks at the problems involved by

  13. Microglia kill amyloid-beta1-42 damaged neurons by a CD14-dependent process

    NARCIS (Netherlands)

    Bate, Clive; Veerhuis, Robert; Eikelenboom, Piet; Williams, Alun

    2004-01-01

    Activated microglia are closely associated with neuronal damage in Alzheimer's disease. In the present study, neurons exposed to low concentrations of amyloid-beta1-42, a toxic fragment of the amyloid-beta protein, were killed by microglia in a process that required cell-cell contact. Pre-treating

  14. "To Kill a Mockingbird": An Historical Perspective. Learning Page Lesson Plan.

    Science.gov (United States)

    Prody, Kathleen; Whearty, Nicolet

    Students gain from a sense of the living history that surrounds Harper Lee's novel, "To Kill a Mockingbird." Through studying primary source materials from American Memory and other online sources, students of all backgrounds may better grasp how historical events and human forces have shaped relationships between black and white and…

  15. Wood-thermoplastic composites manufactured using beetle-killed spruce from Alaska

    Science.gov (United States)

    V. Yadama; Eini Lowell; N. Petersen; D. Nicholls

    2009-01-01

    The primary objectives of the study were to characterize the critical properties of wood flour produced using highly deteriorated beetle-killed spruce for wood-plastic composite (WPC) production and evaluate important mechanical and physical properties of WPC extruded using an industry standard formulation. Chemical composition analysis indicated no significant...

  16. Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins

    Directory of Open Access Journals (Sweden)

    Marcio Hedil

    2016-07-01

    Full Text Available The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.

  17. Breaking Classroom Silences: A View from Linguistic Ethnography

    Science.gov (United States)

    Rampton, Ben; Charalambous, Constadina

    2016-01-01

    This paper addresses potentially problematic classroom episodes in which someone foregrounds a social division that is normally taken for granted. It illustrates the way in which linguistic ethnography can unpack the layered processes that collide in the breaking of silence, showing how linguistic form and practice, individual positioning, local…

  18. Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins.

    Science.gov (United States)

    Hedil, Marcio; Kormelink, Richard

    2016-07-23

    The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.

  19. Marie Nimier, au cœur du silence

    Directory of Open Access Journals (Sweden)

    Joëlle Papillon

    2012-01-01

    Full Text Available Dans La Reine du silence, Marie Nimier se confronte à la figure de son père, l’écrivain Roger Nimier, mort lorsqu’elle avait cinq ans. Elle y montre le poids qui pèse sur l’enfant d’écrivain, mais aussi celui de l’héritage du secret familial et de l’injonction au silence. La difficulté de l’élaboration de son récit de filiation se révèle dans les constants recommencements et reformulations, qui constituent la marque de la tension angoissante entre l’obligation de dire et celle de taire. In La Reine du silence, Marie Nimier confronts her father’s memory – the writer Roger Nimier, who died when she was five years old. The novel describes the burden of being a writer’s child, along with that of inheriting family secrets and submitting to a code of silence. The difficulty of recounting her relationship with her late father is evidenced by the narrator’s numerous “false starts” and her constant rewritings. The hesitant nature of the narration captures an anguish born of two irreconcilable obligations : the need to put things into words and the pressure to remain silent.

  20. Identification of a maize chlorotic dwarf virus silencing suppressor protein

    Science.gov (United States)

    Maize chlorotic dwarf virus (MCDV), a member of the genus Waikavirus, family Secoviridae, has a 11784 nt (+)ssRNA genome that encodes a 389 kDa proteolytically processed polyprotein. We show that an N-terminal 78kDa polyprotein (R78) has silencing suppressor activity, that it is cleaved by the viral...

  1. Shame and Silence | Janz | South African Journal of Philosophy

    African Journals Online (AJOL)

    Samantha Vice's proposal on how to live in 'this strange place' of contemporary South Africa, includes an appeal to the concepts of shame and silence. In this paper, I use Emmanuel Levinas and Giorgio Agamben to move the discussion of shame from a moral to an existential question. The issue is not about how one ...

  2. Bureaucratic Constructions of Sexual Diversity: "Sensitive", "Controversial" and Silencing

    Science.gov (United States)

    Ullman, Jacqueline; Ferfolja, Tania

    2015-01-01

    National research illustrates the high degree of discrimination that prevails against lesbian, gay, bisexual, transgender and queer (LGBTQ) students resulting in diminished educational outcomes, both academic and social. This phenomenon is influenced by the prevalence of whole-school silences around LGBTQ topics in many Australian schools. This…

  3. 47 CFR 80.304 - Watch requirement during silence periods.

    Science.gov (United States)

    2010-10-01

    ....304 Section 80.304 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL RADIO SERVICES STATIONS IN THE MARITIME SERVICES Safety Watch Requirements and Procedures Ship Station Safety Watches § 80.304 Watch requirement during silence periods. Each ship station operating on...

  4. LNA-antisense rivals siRNA for gene silencing

    DEFF Research Database (Denmark)

    Jepsen, Jan Stenvang; Wengel, Jesper; Stenvang, Jan

    2004-01-01

    Locked nucleic acid (LNA) is a class of nucleic acid analogs possessing unprecedented binding affinity toward complementary DNA and RNA while obeying the Watson-Crick base-pairing rules. For efficient gene silencing in vitro and in vivo, fully modified or chimeric LNA oligonucleotides have been a...

  5. Maternal Silences: Motherhood and Voluntary Childlessness in Contemporary Christianity

    Directory of Open Access Journals (Sweden)

    Dawn Llewellyn

    2016-06-01

    Full Text Available In Christianity, there is an ideology of motherhood that pervades scripture, ritual, and doctrine, yet there is an academic silence that means relatively little space has been given to motherhood and mothering, and even less to voluntary childlessness, from a faith perspective. By drawing on qualitative in-depth interviews with Christian women living in Britain, narrating their experiences of motherhood and voluntary childlessness, I suggest there are also lived maternal silences encountered by women in contemporary Christianity. There is a maternal expectation produced through church teaching, liturgy and culture that constructs women as ‘maternal bodies’ (Gatrell 2008; this silences and marginalises women from articulating their complex relationship with religion, motherhood, and childlessness in ways that challenge their spiritual development. However, this article also introduces the everyday and intentional tactics women employ to disrupt the maternal expectation, and hereby interrupt the maternal silence.

  6. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

  7. Mobile gene silencing in Arabidopsis is regulated by hydrogen peroxide

    Directory of Open Access Journals (Sweden)

    Dacheng Liang

    2014-12-01

    Full Text Available In plants and nematodes, RNAi can spread from cells from which it is initiated to other cells in the organism. The underlying mechanism controlling the mobility of RNAi signals is not known, especially in the case of plants. A genetic screen designed to recover plants impaired in the movement but not the production or effectiveness of the RNAi signal identified RCI3, which encodes a hydrogen peroxide (H2O2-producing type III peroxidase, as a key regulator of silencing mobility in Arabidopsis thaliana. Silencing initiated in the roots of rci3 plants failed to spread into leaf tissue or floral tissue. Application of exogenous H2O2 reinstated the spread in rci3 plants and accelerated it in wild-type plants. The addition of catalase or MnO2, which breaks down H2O2, slowed the spread of silencing in wild-type plants. We propose that endogenous H2O2, under the control of peroxidases, regulates the spread of gene silencing by altering plasmodesmata permeability through remodelling of local cell wall structure, and may play a role in regulating systemic viral defence.

  8. Tacit Authorization : A Legal Solution for Administrative Silence

    NARCIS (Netherlands)

    Hoogstra, Nicole; de Graaf, K.J.

    2016-01-01

    This article discusses one of the current legal instruments to stimulate timely decision-making by administrative authorities, namely the ‘Lex silencio positivo’ or the ‘Silence is Consent’ rule. Tacit authorization prescribes that the license sought by the applicant will be granted automatically if

  9. Two classes of silencing RNAs move between C. elegans tissues

    Science.gov (United States)

    Jose, Antony M; Garcia, Giancarlo A; Hunter, Craig P

    2011-01-01

    Summary Organism-wide RNA interference (RNAi) is due to the transport of mobile silencing RNA throughout the organism but the identities of these mobile RNA species in animals are unknown. Here we present genetic evidence that both the initial double-stranded RNA (dsRNA), which triggers RNAi, and at least one dsRNA intermediate produced during RNAi can act as or generate mobile silencing RNA in Caenorhabditis elegans. This dsRNA intermediate requires the long dsRNA-binding protein RDE-4, the endonuclease DCR-1, which cleaves long dsRNA into double-stranded short-interfering RNA (ds-siRNA), and the putative nucleotidyltransferase MUT-2 (RDE-3). However, single-stranded siRNA and downstream secondary siRNA produced upon amplification by the RNA-dependent RNA Polymerase RRF-1 do not generate mobile silencing RNA. Restricting inter-tissue transport to long dsRNA and directly processed siRNA intermediates rather than amplified siRNA may serve to modulate the extent of systemic silencing in proportion to available dsRNA. PMID:21984186

  10. Surface functionalisation of PLGA nanoparticles for gene silencing

    DEFF Research Database (Denmark)

    Andersen, Morten Østergaard; Lichawska, Agata; Arpanaei, Ayyoob

    2010-01-01

    . In addition, particles containing cetylated-PEI achieved 64% silencing of TNFα in J774.1 cells. This rapid method for surface modification of PLGA nanoparticles promotes its application for alternative cetylated functional derivatives as a strategy to control specific biological properties of nanoparticles....

  11. Resounding Silences : Subtle Norm Regulation in Everyday Interactions

    NARCIS (Netherlands)

    Koudenburg, Namkje; Postmes, Tom; Gordijn, Ernestine H.

    In this article we suggest a mechanism for norm regulation that does not rely on explicit information exchange or costly reinforcement, but rather on the sensitivity of group members to social cues in their environment. We examine whether brief conversational silences can (a) signal a threat to

  12. Breaking the Silence Surrounding Mental Health on Campus

    Science.gov (United States)

    Roper, Larry D.

    2013-01-01

    Mentally ill students are able to participate in higher education at unprecedented rates. While colleges and universities have been responsive to the therapeutic needs, we have failed to successfully create supportive campus climates. Campus leaders are challenged to demonstrate ethical leadership that breaks the silence and confronts the stigma…

  13. Strategic Silence as a Tool of Political Communication: A Reflection ...

    African Journals Online (AJOL)

    Politics is said to be a game of intrigues and part of that is the use of silence as a means of communication. This may sound strange as communication itself connotes the art of expression. However in politics, a political actor may chose to remain silent as a means of passing a message across to the public in a trouble ...

  14. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    2016-11-09

    Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

  15. 40 CFR 180.1107 - Delta endotoxin of Bacillus thuringiensis variety kurstaki encapsulated into killed Pseudomonas...

    Science.gov (United States)

    2010-07-01

    ... thuringiensis variety kurstaki encapsulated into killed Pseudomonas fluorescens; exemption from the requirement... killed Pseudomonas fluorescens; exemption from the requirement of a tolerance. The delta endotoxin of Bacillus thuringiensis variety kurstaki encapsulated into killed Pseudomonas fluorescens is exempt from the...

  16. Assessment of RNAi-induced silencing in banana (Musa spp.).

    Science.gov (United States)

    Dang, Tuong Vi T; Windelinckx, Saskia; Henry, Isabelle M; De Coninck, Barbara; Cammue, Bruno P A; Swennen, Rony; Remy, Serge

    2014-09-18

    In plants, RNA- based gene silencing mediated by small RNAs functions at the transcriptional or post-transcriptional level to negatively regulate target genes, repetitive sequences, viral RNAs and/or transposon elements. Post-transcriptional gene silencing (PTGS) or the RNA interference (RNAi) approach has been achieved in a wide range of plant species for inhibiting the expression of target genes by generating double-stranded RNA (dsRNA). However, to our knowledge, successful RNAi-application to knock-down endogenous genes has not been reported in the important staple food crop banana. Using embryogenic cell suspension (ECS) transformed with ß-glucuronidase (GUS) as a model system, we assessed silencing of gusAINT using three intron-spliced hairpin RNA (ihpRNA) constructs containing gusAINT sequences of 299-nt, 26-nt and 19-nt, respectively. Their silencing potential was analysed in 2 different experimental set-ups. In the first, Agrobacterium-mediated co-transformation of banana ECS with a gusAINT containing vector and an ihpRNA construct resulted in a significantly reduced GUS enzyme activity 6-8 days after co-cultivation with either the 299-nt and 19-nt ihpRNA vectors. In the second approach, these ihpRNA constructs were transferred to stable GUS-expressing ECS and their silencing potential was evaluated in the regenerated in vitro plants. In comparison to control plants, transgenic plants transformed with the 299-nt gusAINT targeting sequence showed a 4.5 fold down-regulated gusA mRNA expression level, while GUS enzyme activity was reduced by 9 fold. Histochemical staining of plant tissues confirmed these findings. Northern blotting used to detect the expression of siRNA in the 299-nt ihpRNA vector transgenic in vitro plants revealed a negative relationship between siRNA expression and GUS enzyme activity. In contrast, no reduction in GUS activity or GUS mRNA expression occurred in the regenerated lines transformed with either of the two gusAINT oligo target

  17. Heterologous RNA-silencing suppressors from both plant- and animal-infecting viruses support plum pox virus infection.

    Science.gov (United States)

    Maliogka, Varvara I; Calvo, María; Carbonell, Alberto; García, Juan Antonio; Valli, Adrian

    2012-07-01

    HCPro, the RNA-silencing suppressor (RSS) of viruses belonging to the genus Potyvirus in the family Potyviridae, is a multifunctional protein presumably involved in all essential steps of the viral infection cycle. Recent studies have shown that plum pox potyvirus (PPV) HCPro can be replaced successfully by cucumber vein yellowing ipomovirus P1b, a sequence-unrelated RSS from a virus of the same family. In order to gain insight into the requirement of a particular RSS to establish a successful potyviral infection, we tested the ability of different heterologous RSSs from both plant- and animal-infecting viruses to substitute for HCPro. Making use of engineered PPV chimeras, we show that PPV HCPro can be replaced functionally by some, but not all, unrelated RSSs, including the NS1 protein of the mammal-infecting influenza A virus. Interestingly, the capacity of a particular RSS to replace HCPro does not correlate strictly with its RNA silencing-suppression strength. Altogether, our results suggest that not all suppression strategies are equally suitable for efficient escape of PPV from the RNA-silencing machinery. The approach followed here, based on using PPV chimeras in which an under-consideration RSS substitutes for HCPro, could further help to study the function of diverse RSSs in a 'highly sensitive' RNA-silencing context, such as that taking place in plant cells during the process of a viral infection.

  18. Host-Induced Gene Silencing of Rice Blast Fungus Magnaporthe oryzae Pathogenicity Genes Mediated by the Brome Mosaic Virus.

    Science.gov (United States)

    Zhu, Lin; Zhu, Jian; Liu, Zhixue; Wang, Zhengyi; Zhou, Cheng; Wang, Hong

    2017-09-26

    Magnaporthe oryzae is a devastating plant pathogen, which has a detrimental impact on rice production worldwide. Despite its agronomical importance, some newly-emerging pathotypes often overcome race-specific disease resistance rapidly. It is thus desirable to develop a novel strategy for the long-lasting resistance of rice plants to ever-changing fungal pathogens. Brome mosaic virus (BMV)-induced RNA interference (RNAi) has emerged as a useful tool to study host-resistance genes for rice blast protection. Planta-generated silencing of targeted genes inside biotrophic pathogens can be achieved by expression of M. oryzae -derived gene fragments in the BMV-mediated gene silencing system, a technique termed host-induced gene silencing (HIGS). In this study, the effectiveness of BMV-mediated HIGS in M. oryzae was examined by targeting three predicted pathogenicity genes, MoABC1, MoMAC1 and MoPMK1 . Systemic generation of fungal gene-specific small interfering RNA (siRNA) molecules induced by inoculation of BMV viral vectors inhibited disease development and reduced the transcription of targeted fungal genes after subsequent M. oryzae inoculation. Combined introduction of fungal gene sequences in sense and antisense orientation mediated by the BMV silencing vectors significantly enhanced the efficiency of this host-generated trans-specific RNAi, implying that these fungal genes played crucial roles in pathogenicity. Collectively, our results indicated that BMV-HIGS system was a great strategy for protecting host plants against the invasion of pathogenic fungi.

  19. Reexamining the P-Element Invasion of Drosophila melanogaster Through the Lens of piRNA Silencing

    Science.gov (United States)

    Kelleher, Erin S.

    2016-01-01

    Transposable elements (TEs) are both important drivers of genome evolution and genetic parasites with potentially dramatic consequences for host fitness. The recent explosion of research on regulatory RNAs reveals that small RNA-mediated silencing is a conserved genetic mechanism through which hosts repress TE activity. The invasion of the Drosophila melanogaster genome by P elements, which happened on a historical timescale, represents an incomparable opportunity to understand how small RNA-mediated silencing of TEs evolves. Repression of P-element transposition emerged almost concurrently with its invasion. Recent studies suggest that this repression is implemented in part, and perhaps predominantly, by the Piwi-interacting RNA (piRNA) pathway, a small RNA-mediated silencing pathway that regulates TE activity in many metazoan germlines. In this review, I consider the P-element invasion from both a molecular and evolutionary genetic perspective, reconciling classic studies of P-element regulation with the new mechanistic framework provided by the piRNA pathway. I further explore the utility of the P-element invasion as an exemplar of the evolution of piRNA-mediated silencing. In light of the highly-conserved role for piRNAs in regulating TEs, discoveries from this system have taxonomically broad implications for the evolution of repression. PMID:27516614

  20. RNAi dynamics in Juvenile Fasciola spp. Liver flukes reveals the persistence of gene silencing in vitro.

    Directory of Open Access Journals (Sweden)

    Paul McVeigh

    2014-09-01

    Full Text Available Fasciola spp. liver fluke cause pernicious disease in humans and animals. Whilst current control is unsustainable due to anthelmintic resistance, gene silencing (RNA interference, RNAi has the potential to contribute to functional validation of new therapeutic targets. The susceptibility of juvenile Fasciola hepatica to double stranded (dsRNA-induced RNAi has been reported. To exploit this we probe RNAi dynamics, penetrance and persistence with the aim of building a robust platform for reverse genetics in liver fluke. We describe development of standardised RNAi protocols for a commercially-available liver fluke strain (the US Pacific North West Wild Strain, validated via robust transcriptional silencing of seven virulence genes, with in-depth experimental optimisation of three: cathepsin L (FheCatL and B (FheCatB cysteine proteases, and a σ-class glutathione transferase (FheσGST.Robust transcriptional silencing of targets in both F. hepatica and Fasciola gigantica juveniles is achievable following exposure to long (200-320 nt dsRNAs or 27 nt short interfering (siRNAs. Although juveniles are highly RNAi-susceptible, they display slower transcript and protein knockdown dynamics than those reported previously. Knockdown was detectable following as little as 4h exposure to trigger (target-dependent and in all cases silencing persisted for ≥25 days following long dsRNA exposure. Combinatorial silencing of three targets by mixing multiple long dsRNAs was similarly efficient. Despite profound transcriptional suppression, we found a significant time-lag before the occurrence of protein suppression; FheσGST and FheCatL protein suppression were only detectable after 9 and 21 days, respectively.In spite of marked variation in knockdown dynamics, we find that a transient exposure to long dsRNA or siRNA triggers robust RNAi penetrance and persistence in liver fluke NEJs supporting the development of multiple-throughput phenotypic screens for control

  1. Eloquent silences: A musical and lexical analysis of conversation between oncologists and their patients.

    Science.gov (United States)

    Bartels, Josef; Rodenbach, Rachel; Ciesinski, Katherine; Gramling, Robert; Fiscella, Kevin; Epstein, Ronald

    2016-10-01

    Silences in doctor-patient communication can be "connectional" and communicative, in contrast to silences that indicate awkwardness or distraction. Musical and lexical analyses can identify and characterize connectional silences in consultations between oncologists and patients. Two medical students and a professor of voice screened all 1211 silences over 2s in length from 124 oncology office visits. We developed a "strength of connection" taxonomy and examined ten connectional silences for lexical and musical features including pitch, volume, and speaker turn-taking rhythm. We identified connectional silences with good reliability. Typical dialog rhythms surrounding connectional silences are characterized by relatively equal turn lengths and frequent short vocalizations. We found no pattern of volume and pitch variability around these silences. Connectional silences occurred in a wide variety of lexical contexts. Particular patterns of dialog rhythm mark connectional silences. Exploring structures of connectional silence extends our understanding of the audio-linguistic conditions that mark patient-clinician connection. Communicating with an awareness of pitch, rhythm, and silence - in addition to lexical content - can facilitate shared understanding and emotional connection. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  2. Selective Killing of Prostate Tumor Cells by Cytocidal Viruses

    National Research Council Canada - National Science Library

    Lyles, Douglas

    2003-01-01

    .... The novelty in our approach is our ability to enhance the selectivity of killing of tumor cells versus normal cells by manipulating the viral genes that control the antiviral interferon response...

  3. Selective Killing of Prostate Tumor Cells by Cytocidal Viruses

    National Research Council Canada - National Science Library

    Lyles, Douglas

    2004-01-01

    .... The novelty in our approach is our ability to enhance the selectivity of killing of tumor cells versus normal cells by manipulating the viral genes that control the antiviral interferon response...

  4. On Discrete Killing Vector Fields and Patterns on Surfaces

    KAUST Repository

    Ben-Chen, Mirela; Butscher, Adrian; Solomon, Justin; Guibas, Leonidas

    2010-01-01

    , and show how to discretize these concepts for generating such vector fields on a triangulated mesh. We discuss the properties of approximate Killing Vector Fields, and propose an application to utilize them for texture and geometry synthesis. Journal

  5. Selective Killing of Prostate Tumor Cells by Cytocidal Viruses

    National Research Council Canada - National Science Library

    Lyles, Douglas S

    2005-01-01

    ...). The novelty in our approach is our ability to enhance the selectivity of VSV-induced killing of tumor cells versus normal cells by manipulating the viral genes that control the antiviral interferon response...

  6. Simultaneous Silencing of Xylanase Genes in Botrytis cinerea

    Directory of Open Access Journals (Sweden)

    Néstor García

    2017-12-01

    Full Text Available The endo-β-1,4-xylanase BcXyn11A is one of several plant cell-wall degrading enzymes that the phytopathogenic fungus Botrytis cinerea secretes during interaction with its hosts. In addition to its enzymatic activity, this protein also acts as an elicitor of the defense response in plants and has been identified as a virulence factor. In the present work, other four endoxylanase coding genes (Bcxyn11B, Bcxyn11C, Bcxyn10A, and Bcxyn10B were identified in the B. cinerea genome and the expression of all five genes was analyzed by Q-RT- PCR in vitro and in planta. A cross-regulation between xylanase genes was identified analyzing their expression pattern in the ΔBcxyn11A mutant strain and a putative BcXyn11A-dependt induction of Bcxyn10B gene was found. In addition, multiple knockdown strains were obtained for the five endoxylanase genes by transformation of B. cinerea with a chimeric DNA construct composed of 50-nt sequences from the target genes. The silencing of each xylanase gene was analyzed in axenic cultures and during infection and the results showed that the efficiency of the multiple silencing depends on the growth conditions and on the cross-regulation between them. Although the simultaneous silencing of the five genes was observed by Q-RT-PCR when the silenced strains were grown on medium supplemented with tomato extract, the endoxylanase activity measured in the supernatants was reduced only by 40%. Unexpectedly, the silenced strains overexpressed the Bcxyn11A and Bcxyn11C genes during the infection of tomato leaves, making difficult the analysis of the role of the endo-β-1,4-xylanases in the virulence of the fungus.

  7. Thou Shalt Not Kill: Conscientious Objection and the Decalogue

    Science.gov (United States)

    2012-04-01

    used to condone animal cruelty .66 Second, n¥1 (ratsach) is not used in the context of proper punishment for a crime.67 Alan Cole explains...used to refer to the killing animals for food and sacrifices.63 Scripture records that God allowed the killing of animals for food.64 God also allowed...the slaying of animals for sacrifices.65 Consequently, the sixth commandment cannot be used to support the practice of vegetarianism nor can it be

  8. An Algorithm for Generating Small RNAs Capable of Epigenetically Modulating Transcriptional Gene Silencing and Activation in Human Cells

    Directory of Open Access Journals (Sweden)

    Amanda Ackley

    2013-01-01

    Full Text Available Small noncoding antisense RNAs (sasRNAs guide epigenetic silencing complexes to target loci in human cells and modulate gene transcription. When these targeted loci are situated within a promoter, long-term, stable epigenetic silencing of transcription can occur. Recent studies suggest that there exists an endogenous form of such epigenetic regulation in human cells involving long noncoding RNAs. In this article, we present and validate an algorithm for the generation of highly effective sasRNAs that can mimic the endogenous noncoding RNAs involved in the epigenetic regulation of gene expression. We validate this algorithm by targeting several oncogenes including AKT-1, c-MYC, K-RAS, and H-RAS. We also target a long antisense RNA that mediates the epigenetic repression of the tumor suppressor gene DUSP6, silenced in pancreatic cancer. An algorithm that can efficiently design small noncoding RNAs for the epigenetic transcriptional silencing or activation of specific genes has potential therapeutic and experimental applications.

  9. Role of nitric oxide and superoxide in Giardia lamblia killing

    Directory of Open Access Journals (Sweden)

    P.D. Fernandes

    1997-01-01

    Full Text Available Giardia lamblia trophozoites were incubated for 2 h with activated murine macrophages, nitric oxide (NO donors or a superoxide anion generator (20 mU/ml xanthine oxidase plus 1 mM xanthine. Activated macrophages were cytotoxic to Giardia trophozoites (~60% dead trophozoites. This effect was inhibited (>90% by an NO synthase inhibitor (200 µM and unaffected by superoxide dismutase (SOD, 300 U/ml. Giardia trophozoites were killed by the NO donors, S-nitroso-acetyl-penicillamine (SNAP and sodium nitroprusside (SNP in a dose-dependent manner (LD50 300 and 50 µM, respectively. A dual NO-superoxide anion donor, 3-morpholino-sydnonimine hydrochloride (SIN-1, did not have a killing effect in concentrations up to 1 mM. However, when SOD (300 U/ml was added simultaneously with SIN-1 to Giardia, a significant trophozoite-killing effect was observed (~35% dead trophozoites at 1 mM. The mixture of SNAP or SNP with superoxide anion, which yields peroxynitrite, abolished the trophozoite killing induced by NO donors. Authentic peroxynitrite only killed trophozoites at very high concentrations (3 mM. These results indicate that NO accounts for Giardia trophozoite killing and this effect is not mediated by peroxynitrite

  10. Karr’s Kill Cult: Virtual Cults and Pseudo-Killing in the Digital Age

    Directory of Open Access Journals (Sweden)

    Jeremy Biles

    2012-03-01

    Full Text Available Most readers will recall the 1996 tragedy in which six-year-old beauty-pageant princess JonBenét Ramsey was found bound, gagged, and strangled in the basement of her parents’ home, inciting an orgy of media coverage. What readers may not know is that John Mark Karr—the imminently creepy individual who falsely confessed to the killing, and whose sordid past includes an arrest for possession of child pornography—has continued to make news as an alleged cyberstalker and would-be cult leader. This article claims that whereas a real serial killer is compelled to murder again and again with different victims, Karr is compelled to repeat the singular murder of JonBenét Ramsey the only way he can—in a virtual reality constituted by writing.

  11. An albumin-mediated cholesterol design-based strategy for tuning siRNA pharmacokinetics and gene silencing.

    Science.gov (United States)

    Bienk, Konrad; Hvam, Michael Lykke; Pakula, Malgorzata Maria; Dagnæs-Hansen, Frederik; Wengel, Jesper; Malle, Birgitte Mølholm; Kragh-Hansen, Ulrich; Cameron, Jason; Bukrinski, Jens Thostrup; Howard, Kenneth A

    2016-06-28

    Major challenges for the clinical translation of small interfering RNA (siRNA) include overcoming the poor plasma half-life, site-specific delivery and modulation of gene silencing. In this work, we exploit the intrinsic transport properties of human serum albumin to tune the blood circulatory half-life, hepatic accumulation and gene silencing; based on the number of siRNA cholesteryl modifications. We demonstrate by a gel shift assay a strong and specific affinity of recombinant human serum albumin (rHSA) towards cholesteryl-modified siRNA (Kd>1×10(-7)M) dependent on number of modifications. The rHSA/siRNA complex exhibited reduced nuclease degradation and reduced induction of TNF-α production by human peripheral blood mononuclear cells. The increased solubility of heavily cholesteryl modified siRNA in the presence of rHSA facilitated duplex annealing and consequent interaction that allowed in vivo studies using multiple cholesteryl modifications. A structural-activity-based screen of in vitro EGFP-silencing was used to select optimal siRNA designs containing cholesteryl modifications within the sense strand that were used for in vivo studies. We demonstrate plasma half-life extension in NMRI mice from t1/2 12min (naked) to t1/2 45min (single cholesteryl) and t1/2 71min (double cholesteryl) using fluorescent live bioimaging. The biodistribution showed increased accumulation in the liver for the double cholesteryl modified siRNA that correlated with an increase in hepatic Factor VII gene silencing of 28% (rHSA/siRNA) compared to 4% (naked siRNA) 6days post-injection. This work presents a novel albumin-mediated cholesteryl design-based strategy for tuning pharmacokinetics and systemic gene silencing. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. A systemic gene silencing method suitable for high throughput, reverse genetic analyses of gene function in fern gametophytes

    Directory of Open Access Journals (Sweden)

    Tanurdzic Milos

    2004-04-01

    Full Text Available Abstract Background Ceratopteris richardii is a useful experimental system for studying gametophyte development and sexual reproduction in plants. However, few tools for cloning mutant genes or disrupting gene function exist for this species. The feasibility of systemic gene silencing as a reverse genetics tool was examined in this study. Results Several DNA constructs targeting a Ceratopteris protoporphyrin IX magnesium chelatase (CrChlI gene that is required for chlorophyll biosynthesis were each introduced into young gametophytes by biolistic delivery. Their transient expression in individual cells resulted in a colorless cell phenotype that affected most cells of the mature gametophyte, including the meristem and gametangia. The colorless phenotype was associated with a 7-fold decrease in the abundance of the endogenous transcript. While a construct designed to promote the transient expression of a CrChlI double stranded, potentially hairpin-forming RNA was found to be the most efficient in systemically silencing the endogenous gene, a plasmid containing the CrChlI cDNA insert alone was sufficient to induce silencing. Bombarded, colorless hermaphroditic gametophytes produced colorless embryos following self-fertilization, demonstrating that the silencing signal could be transmitted through gametogenesis and fertilization. Bombardment of young gametophytes with constructs targeting the Ceratopteris filamentous temperature sensitive (CrFtsZ and uroporphyrin dehydrogenase (CrUrod genes also produced the expected mutant phenotypes. Conclusion A method that induces the systemic silencing of target genes in the Ceratopteris gametophyte is described. It provides a simple, inexpensive and rapid means to test the functions of genes involved in gametophyte development, especially those involved in cellular processes common to all plants.

  13. Heat-killed Lactobacillus spp. cells enhance survivals of Caenorhabditis elegans against Salmonella and Yersinia infections.

    Science.gov (United States)

    Lee, J; Choe, J; Kim, J; Oh, S; Park, S; Kim, S; Kim, Y

    2015-12-01

    This study examined the effect of feeding heat-killed Lactobacillus cells on the survival of Caenorhabditis elegans nematodes after Salmonella Typhimurium and Yersinia enterocolitica infection. The feeding of heat-killed Lactobacillus plantarum 133 (LP133) and Lactobacillus fermentum 21 (LP21) cells to nematodes was shown to significantly increase the survival rate as well as stimulate the expression of pmk-1 gene that key factor for C. elegans immunity upon infection compared with control nematodes that were only fed Escherichia coli OP50 (OP50) cells. These results suggest that heat-killed LP133 and LF21 cells exert preventive or protective effects against the Gram-negative bacteria Salm. Typhimurium and Y. enterocolitica. To better understand the mechanisms underlying the LF21-mediated and LP133-mediated protection against bacterial infection in nematodes, transcriptional profiling was performed for each experimental group. These experiments showed that genes related to energy generation and ageing, regulators of insulin/IGF-1-like signalling, DAF genes, oxidation and reduction processes, the defence response and/or the innate immune response, and neurological processes were upregulated in nematodes that had been fed heat-killed Lactobacillus cells compared with nematodes that had been fed E. coli cells. In this study, the feeding of heat-killed Lactobacillus bacteria to Caenorhabditis elegans nematodes was shown to decrease infection by Gram-negative bacteria and increase the host lifespan. C. elegans has a small, well-organized genome and is an excellent in vivo model organism; thus, these results will potentially shed light on important Lactobacillus-host interactions. © 2015 The Society for Applied Microbiology.

  14. Silence about encounters with dying among healthcare professionals in a society that ‘de-tabooises’ death

    Directory of Open Access Journals (Sweden)

    Ellen Ramvi

    2017-09-01

    Full Text Available Background: Empirical studies on healthcare personnel indicate that professionals’ experiences with dying and death become silenced and unutterable within the healthcare service. Aim: To explore and interpret silence about encounters with death and dying among healthcare professionals in Norway. Method: The method used was theoretical exploration, using a psychosocial approach. Findings: This analysis reveals complex interrelations and two-way dynamics between subject-worlds, sociocultural and societal worlds when it comes to dealing with death and dying at work. A performance culture saturates these worlds, and may be implicated in silencing death within the healthcare institutions of the Norwegian welfare state. Conclusions: This article suggests that silence about death and dying among healthcare professionals is indicative of crucial emerging and unresolved tensions in the neoliberal episteme, accompanied and reinforced by the ineluctable basic conditions of life and intrapsychic defence against threats towards the self. Implications for practice: Silence about death and dying presents a serious challenge for dying patients and next of kin. Healthcare professionals should be enabled to acknowledge their thoughts and emotions about death in order to be able to support and contain patients and next of kin Learning activities such as peer support and supervision can help the processing of difficult psychological content and allow for emotional aspects of professionals’ work to be acknowledged and thought about in a way that encourages reflective and sound practice Clinical managers should address whether performance pressures induce shameful feelings in staff, who may believe that by providing appropriate levels of care they are compromising productivity. Shame in turn, may undermine professionals’ emotional wellbeing and ability to continue to provide attuned and adequate care for dying patients Creative approaches to facilitate

  15. Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing

    Directory of Open Access Journals (Sweden)

    Tatsuya eKon

    2014-11-01

    Full Text Available Apple latent spherical virus (ALSV is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the CaMV 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation 0 plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification.

  16. RNA interference-mediated silencing of speckle-type POZ protein promotes apoptosis of renal cell cancer cells.

    Science.gov (United States)

    Liu, Xiaoxia; Sun, Guiling; Sun, Xiuju

    2016-01-01

    This study aimed to investigate the effects of silencing the speckle-type POZ protein (SPOP) gene on renal cell cancer (RCC) cells and to explore its possible mechanism. The A498 and ACHN RCC cells were transfected with small interference RNA (siRNA)-SPOP by lipofection methods. The silencing efficiency was monitored by quantitative real-time polymerase chain reaction and Western blot. The effects of SPOP silencing on cell apoptosis, cell viability, colony formation ability, cell migration ability, and chemosensitivity to Sorafenib were assessed by flow cytometry, an MTT assay, a colony formation assay, a trans-well migration assay, and a CCK-8 assay, respectively. Its effects on the expression of several cytokines were determined by a protein microarray. Relevant signaling pathways were also analyzed. Compared with the control group, the cell apoptosis rate was significantly higher; the cell viability, the colony formation, and migration ability were significantly decreased in the siRNA-SPOP group. The protein microarray screening showed that the expression of vascular endothelial growth factor receptor, matrix metallopeptidase-9, vascular cell adhesion molecule-1, and stromal cell-derived factor-1 in the siRNA group was significantly decreased and that the expression of granulocyte-macrophage colony-stimulating factor and E-cadherin was significantly increased (Pmatrix organization signal pathway. SPOP gene silencing induced cell apoptosis, decreased cell viability, colony formation, and migration ability, and elevated the drug sensitivity in the RCC cells. A possible mechanism is that silencing SPOP induces the differential expression of E-cadherin, vascular endothelial growth factor receptor, matrix metallopeptidase-9, and vascular cell adhesion molecule, which are related to the integrin-mediated cell surface interactions and extracellular matrix organization signaling pathway.

  17. Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality.

    Science.gov (United States)

    Lu, Sha; Yin, Xiaoyan; Spollen, William; Zhang, Ning; Xu, Dong; Schoelz, James; Bilyeu, Kristin; Zhang, Zhanyuan J

    2015-01-01

    In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

  18. Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality.

    Directory of Open Access Journals (Sweden)

    Sha Lu

    Full Text Available In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

  19. Homicide in the Canadian Prairies: elderly and nonelderly killings.

    Science.gov (United States)

    Ahmed, A G; Menzies, Robin P D

    2002-11-01

    To examine the psychosocial and clinical characteristics of male perpetrators of elderly and nonelderly homicides in the Canadian Prairies. We examined data drawn from a study of 901 adult homicide offenders who were incarcerated or on parole between 1988 and 1992 in Alberta, Saskatchewan, and Manitoba. Of those studied, 67 men were convicted of homicide involving 79 elderly victims, and 671 were convicted of homicide involving 675 nonelderly victims. Most perpetrators were single and engaged in irregular patterns of employment at the time of their index offence. Fourteen (20.8%) offenders with elderly victims had a history of psychiatric treatment, compared with 98 (14.6%) offenders with nonelderly victims; however, this difference was not statistically significant. Approximately 30% of both groups were diagnosed with personality disorders. A comparison of the index- offence characteristics showed no significant differences between the 2 groups. Our findings suggest that elderly individuals are more likely to be killed in their own homes by strangers. Social isolation appears to be a significant risk factor in cases of elderly homicide.

  20. Thermodynamic control of small RNA-mediated gene silencing

    Directory of Open Access Journals (Sweden)

    Kumiko eUi-Tei

    2012-06-01

    Full Text Available Small interfering RNAs (siRNAs and microRNAs (miRNAs are crucial regulators of posttranscriptional gene silencing, which is referred to as RNA interference (RNAi or RNA silencing. In RNAi, siRNA loaded onto the RNA-induced silencing complex (RISC downregulates target gene expression by cleaving mRNA whose sequence is perfectly complementary to the siRNA guide strand. We previously showed that highly functional siRNAs possessed the following characteristics: A or U residues at nucleotide position 1 measured from the 5’ terminal, four to seven A/Us in positions 1–7, and G or C residues at position 19. This finding indicated that an RNA strand with a thermodynamically unstable 5’ terminal is easily retained in the RISC and functions as a guide strand. In addition, it is clear that unintended genes with complementarities only in the seed region (positions 2–8 are also downregulated by off-target effects. siRNA efficiency is mainly determined by the Watson-Crick base-pairing stability formed between the siRNA seed region and target mRNA. siRNAs with a low seed-target duplex melting temperature (Tm have little or no seed-dependent off-target activity. Thus, important parts of the RNA silencing machinery may be regulated by nucleotide base-pairing thermodynamic stability. A mechanistic understanding of thermodynamic control may enable an efficient target gene-specific RNAi for functional genomics and safe therapeutic applications.