
Sample records for significant sequence homology

  1. A remote but significant sequence homology between glycoside hydrolase clan GH-H and glycoside hydrolase family GH 31

    DEFF Research Database (Denmark)

    Janecek, S.; Svensson, Birte; MacGregor, E.A.


    Although both the α-amylase super-family, i.e. the glycoside hydrolase (GH) clan GH-H (the GH families 13, 70 and 77), and family GH31 share some characteristics, their different catalytic machinery prevents classification of GH31 in clan GH-H. A significant but remote evolutionary relatedness is...

  2. Detecting false positive sequence homology: a machine learning approach. (United States)

    Fujimoto, M Stanley; Suvorov, Anton; Jensen, Nicholas O; Clement, Mark J; Bybee, Seth M


    Accurate detection of homologous relationships of biological sequences (DNA or amino acid) amongst organisms is an important and often difficult task that is essential to various evolutionary studies, ranging from building phylogenies to predicting functional gene annotations. There are many existing heuristic tools, most commonly based on bidirectional BLAST searches that are used to identify homologous genes and combine them into two fundamentally distinct classes: orthologs and paralogs. Due to only using heuristic filtering based on significance score cutoffs and having no cluster post-processing tools available, these methods can often produce multiple clusters constituting unrelated (non-homologous) sequences. Therefore sequencing data extracted from incomplete genome/transcriptome assemblies originated from low coverage sequencing or produced by de novo processes without a reference genome are susceptible to high false positive rates of homology detection. In this paper we develop biologically informative features that can be extracted from multiple sequence alignments of putative homologous genes (orthologs and paralogs) and further utilized in context of guided experimentation to verify false positive outcomes. We demonstrate that our machine learning method trained on both known homology clusters obtained from OrthoDB and randomly generated sequence alignments (non-homologs), successfully determines apparent false positives inferred by heuristic algorithms especially among proteomes recovered from low-coverage RNA-seq data. Almost ~42 % and ~25 % of predicted putative homologies by InParanoid and HaMStR respectively were classified as false positives on experimental data set. Our process increases the quality of output from other clustering algorithms by providing a novel post-processing method that is both fast and efficient at removing low quality clusters of putative homologous genes recovered by heuristic-based approaches.

  3. Homologous Recombination—Experimental Systems, Analysis and Significance (United States)

    Kuzminov, Andrei


    Homologous recombination is the most complex of all recombination events that shape genomes and produce material for evolution. Homologous recombination events are exchanges between DNA molecules in the lengthy regions of shared identity, catalyzed by a group of dedicated enzymes. There is a variety of experimental systems in E. coli and Salmonella to detect homologous recombination events of several different kinds. Genetic analysis of homologous recombination reveals three separate phases of this process: pre-synapsis (the early phase), synapsis (homologous strand exchange) and post-synapsis (the late phase). In E. coli, there are at least two independent pathway of the early phase and at least two independent pathways of the late phase. All this complexity is incongruent with the originally ascribed role of homologous recombination as accelerator of genome evolution: there is simply not enough duplication and repetition in enterobacterial genomes for homologous recombination to have a detectable evolutionary role, and therefore not enough selection to maintain such a complexity. At the same time, the mechanisms of homologous recombination are uniquely suited for repair of complex DNA lesions called chromosomal lesions. In fact, the two major classes of chromosomal lesions are recognized and processed by the two individual pathways at the early phase of homologous recombination. It follows, therefore, that homologous recombination events are occasional reflections of the continual recombinational repair, made possible in cases of natural or artificial genome redundancy. PMID:26442506

  4. A sensitive short read homology search tool for paired-end read sequencing data. (United States)

    Techa-Angkoon, Prapaporn; Sun, Yanni; Lei, Jikai


    Homology search is still a significant step in functional analysis for genomic data. Profile Hidden Markov Model-based homology search has been widely used in protein domain analysis in many different species. In particular, with the fast accumulation of transcriptomic data of non-model species and metagenomic data, profile homology search is widely adopted in integrated pipelines for functional analysis. While the state-of-the-art tool HMMER has achieved high sensitivity and accuracy in domain annotation, the sensitivity of HMMER on short reads declines rapidly. The low sensitivity on short read homology search can lead to inaccurate domain composition and abundance computation. Our experimental results showed that half of the reads were missed by HMMER for a RNA-Seq dataset. Thus, there is a need for better methods to improve the homology search performance for short reads. We introduce a profile homology search tool named Short-Pair that is designed for short paired-end reads. By using an approximate Bayesian approach employing distribution of fragment lengths and alignment scores, Short-Pair can retrieve the missing end and determine true domains. In particular, Short-Pair increases the accuracy in aligning short reads that are part of remote homologs. We applied Short-Pair to a RNA-Seq dataset and a metagenomic dataset and quantified its sensitivity and accuracy on homology search. The experimental results show that Short-Pair can achieve better overall performance than the state-of-the-art methodology of profile homology search. Short-Pair is best used for next-generation sequencing (NGS) data that lack reference genomes. It provides a complementary paired-end read homology search tool to HMMER. The source code is freely available at .

  5. GLASSgo – Automated and Reliable Detection of sRNA Homologs From a Single Input Sequence

    Directory of Open Access Journals (Sweden)

    Steffen C. Lott


    Full Text Available Bacterial small RNAs (sRNAs are important post-transcriptional regulators of gene expression. The functional and evolutionary characterization of sRNAs requires the identification of homologs, which is frequently challenging due to their heterogeneity, short length and partly, little sequence conservation. We developed the GLobal Automatic Small RNA Search go (GLASSgo algorithm to identify sRNA homologs in complex genomic databases starting from a single sequence. GLASSgo combines an iterative BLAST strategy with pairwise identity filtering and a graph-based clustering method that utilizes RNA secondary structure information. We tested the specificity, sensitivity and runtime of GLASSgo, BLAST and the combination RNAlien/cmsearch in a typical use case scenario on 40 bacterial sRNA families. The sensitivity of the tested methods was similar, while the specificity of GLASSgo and RNAlien/cmsearch was significantly higher than that of BLAST. GLASSgo was on average ∼87 times faster than RNAlien/cmsearch, and only ∼7.5 times slower than BLAST, which shows that GLASSgo optimizes the trade-off between speed and accuracy in the task of finding sRNA homologs. GLASSgo is fully automated, whereas BLAST often recovers only parts of homologs and RNAlien/cmsearch requires extensive additional bioinformatic work to get a comprehensive set of homologs. GLASSgo is available as an easy-to-use web server to find homologous sRNAs in large databases.

  6. Sequence homology at the breakpoint and clinical phenotype of mitochondrial DNA deletion syndromes. (United States)

    Sadikovic, Bekim; Wang, Jing; El-Hattab, Ayman W; Landsverk, Megan; Douglas, Ganka; Brundage, Ellen K; Craigen, William J; Schmitt, Eric S; Wong, Lee-Jun C


    Mitochondrial DNA (mtDNA) deletions are a common cause of mitochondrial disorders. Large mtDNA deletions can lead to a broad spectrum of clinical features with different age of onset, ranging from mild mitochondrial myopathies (MM), progressive external ophthalmoplegia (PEO), and Kearns-Sayre syndrome (KSS), to severe Pearson syndrome. The aim of this study is to investigate the molecular signatures surrounding the deletion breakpoints and their association with the clinical phenotype and age at onset. MtDNA deletions in 67 patients were characterized using array comparative genomic hybridization (aCGH) followed by PCR-sequencing of the deletion junctions. Sequence homology including both perfect and imperfect short repeats flanking the deletion regions were analyzed and correlated with clinical features and patients' age group. In all age groups, there was a significant increase in sequence homology flanking the deletion compared to mtDNA background. The youngest patient group (deletion distribution in size and locations, with a significantly lower sequence homology flanking the deletion, and the highest percentage of deletion mutant heteroplasmy. The older age groups showed rather discrete pattern of deletions with 44% of all patients over 6 years old carrying the most common 5 kb mtDNA deletion, which was found mostly in muscle specimens (22/41). Only 15% (3/20) of the young patients (deletion, which is usually present in blood rather than muscle. This group of patients predominantly (16 out of 17) exhibit multisystem disorder and/or Pearson syndrome, while older patients had predominantly neuromuscular manifestations including KSS, PEO, and MM. In conclusion, sequence homology at the deletion flanking regions is a consistent feature of mtDNA deletions. Decreased levels of sequence homology and increased levels of deletion mutant heteroplasmy appear to correlate with earlier onset and more severe disease with multisystem involvement.

  7. Genetic selection and DNA sequences of 4.5S RNA homologs

    DEFF Research Database (Denmark)

    Brown, S; Thon, G; Tolentino, E


    A general strategy for cloning the functional homologs of an Escherichia coli gene was used to clone homologs of 4.5S RNA from other bacteria. The genes encoding these homologs were selected by their ability to complement a deletion of the gene for 4.5S RNA. DNA sequences of the regions encoding...

  8. Structural organization of glycophorin A and B genes: Glycophorin B gene evolved by homologous recombination at Alu repeat sequences

    International Nuclear Information System (INIS)

    Kudo, Shinichi; Fukuda, Minoru


    Glycophorins A (GPA) and B (GPB) are two major sialoglycoproteins of the human erythrocyte membrane. Here the authors present a comparison of the genomic structures of GPA and GPB developed by analyzing DNA clones isolated from a K562 genomic library. Nucleotide sequences of exon-intron junctions and 5' and 3' flanking sequences revealed that the GPA and GPB genes consist of 7 and 5 exons, respectively, and both genes have >95% identical sequence from the 5' flanking region to the region ∼ 1 kilobase downstream from the exon encoding the transmembrane regions. In this homologous part of the genes, GPB lacks one exon due to a point mutation at the 5' splicing site of the third intron, which inactivates the 5' cleavage event of splicing and leads to ligation of the second to the fourth exon. Following these very homologous sequences, the genomic sequences for GPA and GPB diverge significantly and no homology can be detected in their 3' end sequences. The analysis of the Alu sequences and their flanking direct repeat sequences suggest that an ancestral genomic structure has been maintained in the GPA gene, whereas the GPB gene has arisen from the acquisition of 3' sequences different from those of the GPA gene by homologous recombination at the Alu repeats during or after gene duplication

  9. Single-cell template strand sequencing by Strand-seq enables the characterization of individual homologs

    NARCIS (Netherlands)

    Sanders, Ashley D; Falconer, Ester; Hills, Mark; Spierings, Diana C J; Lansdorp, Peter M.

    The ability to distinguish between genome sequences of homologous chromosomes in single cells is important for studies of copy-neutral genomic rearrangements (such as inversions and translocations), building chromosome-length haplotypes, refining genome assemblies, mapping sister chromatid exchange

  10. Partial amino acid sequence of apolipoprotein(a) shows that it is homologous to plasminogen

    International Nuclear Information System (INIS)

    Eaton, D.L.; Fless, G.M.; Kohr, W.J.; McLean, J.W.; Xu, Q.T.; Miller, C.G.; Lawn, R.M.; Scanu, A.M.


    Apolipoprotein(a) [apo(a)] is a glycoprotein with M/sub r/ ∼ 280,000 that is disulfide linked to apolipoprotein B in lipoprotein(a) particles. Elevated plasma levels of lipoprotein(a) are correlated with atherosclerosis. Partial amino acid sequence of apo(a) shows that it has striking homology to plasminogen. Plasminogen is a plasma serine protease zymogen that consists of five homologous and tandemly repeated domains called kringles and a trypsin-like protease domain. The amino-terminal sequence obtained for apo(a) is homologous to the beginning of kringle 4 but not the amino terminus of plasminogen. Apo(a) was subjected to limited proteolysis by trypsin or V8 protease, and fragments generated were isolated and sequenced. Sequences obtained from several of these fragments are highly (77-100%) homologous to plasminogen residues 391-421, which reside within kringle 4. Analysis of these internal apo(a) sequences revealed that apo(a) may contain at least two kringle 4-like domains. A sequence obtained from another tryptic fragment also shows homology to the end of kringle 4 and the beginning of kringle 5. Sequence data obtained from the two tryptic fragments shows homology with the protease domain of plasminogen. One of these sequences is homologous to the sequences surrounding the activation site of plasminogen. Plasminogen is activated by the cleavage of a specific arginine residue by urokinase and tissue plasminogen activator; however, the corresponding site in apo(a) is a serine that would not be cleaved by tissue plasminogen activator or urokinase. Using a plasmin-specific assay, no proteolytic activity could be demonstrated for lipoprotein(a) particles. These results suggest that apo(a) contains kringle-like domains and an inactive protease domain

  11. The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing.

    Directory of Open Access Journals (Sweden)

    Jonas Binladen


    Full Text Available The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources.We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences. Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis.We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%. Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial

  12. Interference of Homologous Sequences on the SNP Study of CYP2A13 Gene

    Directory of Open Access Journals (Sweden)

    Qinghua ZHOU


    Full Text Available Background and objective It has been proven that cytochrome P450 enzyme 2A13 (CYP2A13 played an important role in the association between single nucleotide polymorphisms (SNP and human diseases. Cytochrome P450 enzymes are a group of isoenzymes, whose sequence homology may interfere with the study for SNP. The aim of this study is to explore the interference on the SNP study of CYP2A13 caused by homologous sequences. Methods Taqman probe was applied to detect distribution of rs8192789 sites in 573 subjects, and BLAST method was used to analyze the amplified sequences. Partial sequences of CYP2A13 were emplified by PCR from 60 cases. The emplified sequences were TA cloned and sequenced. Results For rs8192789 loci in 573 cases, only 3 cases were TT, while the rest were CT heterozygotes, which was caused by homologous sequences. There are a large number of overlapping peaks in identical sequences of 60 cases, and the SNP of 101 amino acid site reported in the SNP database is not found. The cloned sequences are 247 bp, 235 bp fragments. Conclusion The homologous sequences may interfere the study for SNP of CYP2A13, and some SNP may not exist.

  13. [Sequence analysis of LEAFY homologous gene from Dendrobium moniliforme and application for identification of medicinal Dendrobium]. (United States)

    Xing, Wen-Rui; Hou, Bei-Wei; Guan, Jing-Jiao; Luo, Jing; Ding, Xiao-Yu


    The LEAFY (LFY) homologous gene of Dendrobium moniliforme (L.) Sw. was cloned by new primers which were designed based on the conservative region of known sequences of orchid LEAFY gene. Partial LFY homologous gene was cloned by common PCR, then we got the complete LFY homologous gene Den LFY by Tail-PCR. The complete sequence of DenLFY gene was 3 575 bp which contained three exons and two introns. Using BLAST method, comparison analysis among the exon of LFY homologous gene indicted that the DenLFY gene had high identity with orchids LFY homologous, including the related fragment of PhalLFY (84%) in Phalaenopsis hybrid cultivar, LFY homologous gene in Oncidium (90%) and in other orchid (over 80%). Using MP analysis, Dendrobium is found to be the sister to Oncidium and Phalaenopsis. Homologous analysis demonstrated that the C-terminal amino acids were highly conserved. When the exons and introns were separately considered, exons and the sequence of amino acid were good markers for the function research of DenLFY gene. The second intron can be used in authentication research of Dendrobium based on the length polymorphism between Dendrobium moniliforme and Dendrobium officinale.

  14. Neural network and SVM classifiers accurately predict lipid binding proteins, irrespective of sequence homology. (United States)

    Bakhtiarizadeh, Mohammad Reza; Moradi-Shahrbabak, Mohammad; Ebrahimi, Mansour; Ebrahimie, Esmaeil


    Due to the central roles of lipid binding proteins (LBPs) in many biological processes, sequence based identification of LBPs is of great interest. The major challenge is that LBPs are diverse in sequence, structure, and function which results in low accuracy of sequence homology based methods. Therefore, there is a need for developing alternative functional prediction methods irrespective of sequence similarity. To identify LBPs from non-LBPs, the performances of support vector machine (SVM) and neural network were compared in this study. Comprehensive protein features and various techniques were employed to create datasets. Five-fold cross-validation (CV) and independent evaluation (IE) tests were used to assess the validity of the two methods. The results indicated that SVM outperforms neural network. SVM achieved 89.28% (CV) and 89.55% (IE) overall accuracy in identification of LBPs from non-LBPs and 92.06% (CV) and 92.90% (IE) (in average) for classification of different LBPs classes. Increasing the number and the range of extracted protein features as well as optimization of the SVM parameters significantly increased the efficiency of LBPs class prediction in comparison to the only previous report in this field. Altogether, the results showed that the SVM algorithm can be run on broad, computationally calculated protein features and offers a promising tool in detection of LBPs classes. The proposed approach has the potential to integrate and improve the common sequence alignment based methods. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. An HMM posterior decoder for sequence feature prediction that includes homology information

    DEFF Research Database (Denmark)

    Käll, Lukas; Krogh, Anders Stærmose; Sonnhammer, Erik L. L.


    Motivation: When predicting sequence features like transmembrane topology, signal peptides, coil-coil structures, protein secondary structure or genes, extra support can be gained from homologs. Results: We present here a general hidden Markov model (HMM) decoding algorithm that combines probabil......Motivation: When predicting sequence features like transmembrane topology, signal peptides, coil-coil structures, protein secondary structure or genes, extra support can be gained from homologs. Results: We present here a general hidden Markov model (HMM) decoding algorithm that combines......:// . An implementation of the algorithm is available on request from the authors....

  16. CPHmodels-3.0--remote homology modeling using structure-guided sequence profiles

    DEFF Research Database (Denmark)

    Nielsen, Morten; Lundegaard, Claus; Lund, Ole


    CPHmodels-3.0 is a web server predicting protein 3D structure by use of single template homology modeling. The server employs a hybrid of the scoring functions of CPHmodels-2.0 and a novel remote homology-modeling algorithm. A query sequence is first attempted modeled using the fast CPHmodels-2.......0 profile-profile scoring function suitable for close homology modeling. The new computational costly remote homology-modeling algorithm is only engaged provided that no suitable PDB template is identified in the initial search. CPHmodels-3.0 was benchmarked in the CASP8 competition and produced models.......3 A. These performance values place the CPHmodels-3.0 method in the group of high performing 3D prediction tools. Beside its accuracy, one of the important features of the method is its speed. For most queries, the response time of the server is...

  17. Using structure to explore the sequence alignment space of remote homologs.

    Directory of Open Access Journals (Sweden)

    Andrew Kuziemko


    Full Text Available Protein structure modeling by homology requires an accurate sequence alignment between the query protein and its structural template. However, sequence alignment methods based on dynamic programming (DP are typically unable to generate accurate alignments for remote sequence homologs, thus limiting the applicability of modeling methods. A central problem is that the alignment that is "optimal" in terms of the DP score does not necessarily correspond to the alignment that produces the most accurate structural model. That is, the correct alignment based on structural superposition will generally have a lower score than the optimal alignment obtained from sequence. Variations of the DP algorithm have been developed that generate alternative alignments that are "suboptimal" in terms of the DP score, but these still encounter difficulties in detecting the correct structural alignment. We present here a new alternative sequence alignment method that relies heavily on the structure of the template. By initially aligning the query sequence to individual fragments in secondary structure elements and combining high-scoring fragments that pass basic tests for "modelability", we can generate accurate alignments within a small ensemble. Our results suggest that the set of sequences that can currently be modeled by homology can be greatly extended.

  18. Using structure to explore the sequence alignment space of remote homologs. (United States)

    Kuziemko, Andrew; Honig, Barry; Petrey, Donald


    Protein structure modeling by homology requires an accurate sequence alignment between the query protein and its structural template. However, sequence alignment methods based on dynamic programming (DP) are typically unable to generate accurate alignments for remote sequence homologs, thus limiting the applicability of modeling methods. A central problem is that the alignment that is "optimal" in terms of the DP score does not necessarily correspond to the alignment that produces the most accurate structural model. That is, the correct alignment based on structural superposition will generally have a lower score than the optimal alignment obtained from sequence. Variations of the DP algorithm have been developed that generate alternative alignments that are "suboptimal" in terms of the DP score, but these still encounter difficulties in detecting the correct structural alignment. We present here a new alternative sequence alignment method that relies heavily on the structure of the template. By initially aligning the query sequence to individual fragments in secondary structure elements and combining high-scoring fragments that pass basic tests for "modelability", we can generate accurate alignments within a small ensemble. Our results suggest that the set of sequences that can currently be modeled by homology can be greatly extended.

  19. Sequence-structure relationships in RNA loops: establishing the basis for loop homology modeling. (United States)

    Schudoma, Christian; May, Patrick; Nikiforova, Viktoria; Walther, Dirk


    The specific function of RNA molecules frequently resides in their seemingly unstructured loop regions. We performed a systematic analysis of RNA loops extracted from experimentally determined three-dimensional structures of RNA molecules. A comprehensive loop-structure data set was created and organized into distinct clusters based on structural and sequence similarity. We detected clear evidence of the hallmark of homology present in the sequence-structure relationships in loops. Loops differing by structures. Thus, our results support the application of homology modeling for RNA loop model building. We established a threshold that may guide the sequence divergence-based selection of template structures for RNA loop homology modeling. Of all possible sequences that are, under the assumption of isosteric relationships, theoretically compatible with actual sequences observed in RNA structures, only a small fraction is contained in the Rfam database of RNA sequences and classes implying that the actual RNA loop space may consist of a limited number of unique loop structures and conserved sequences. The loop-structure data sets are made available via an online database, RLooM. RLooM also offers functionalities for the modeling of RNA loop structures in support of RNA engineering and design efforts.

  20. Bidirectional gene sequences with similar homology to functional proteins of alkane degrading bacterium pseudomonas fredriksbergensis DNA

    International Nuclear Information System (INIS)

    Megeed, A.A.


    The potential for two overlapping fragments of DNA from a clone of newly isolated alkanes degrading bacterium Pseudomonas frederiksbergensis encoding sequences with similar homology to two parts of functional proteins is described. One strand contains a sequence with high homology to alkanes monooxygenase (alkB), a member of the alkanes hydroxylase family, and the other strand contains a sequence with some homology to alcohol dehydrogenase gene (alkJ). Overlapping of the genes on opposite strands has been reported in eukaryotic species, and is now reported in a bacterial species. The sequence comparisons and ORFS results revealed that the regulation and the genes organization involved in alkane oxidation represented in Pseudomonas frederiksberghensis varies among the different known alkane degrading bacteria. The alk gene cluster containing homologues to the known alkane monooxygenase (alkB), and rubredoxin (alkG) are oriented in the same direction, whereas alcohol dehydrogenase (alkJ) is oriented in the opposite direction. Such genomes encode messages on both strands of the DNA, or in an overlapping but different reading frames, of the same strand of DNA. The possibility of creating novel genes from pre-existing sequences, known as overprinting, which is a widespread phenomenon in small viruses. Here, the origin and evolution of the gene overlap to bacteriophages belonging to the family Microviridae have been investigated. Such a phenomenon is most widely described in extremely small genomes such as those of viruses or small plasmids, yet here is a unique phenomenon. (author)

  1. Functional region prediction with a set of appropriate homologous sequences-an index for sequence selection by integrating structure and sequence information with spatial statistics (United States)


    Background The detection of conserved residue clusters on a protein structure is one of the effective strategies for the prediction of functional protein regions. Various methods, such as Evolutionary Trace, have been developed based on this strategy. In such approaches, the conserved residues are identified through comparisons of homologous amino acid sequences. Therefore, the selection of homologous sequences is a critical step. It is empirically known that a certain degree of sequence divergence in the set of homologous sequences is required for the identification of conserved residues. However, the development of a method to select homologous sequences appropriate for the identification of conserved residues has not been sufficiently addressed. An objective and general method to select appropriate homologous sequences is desired for the efficient prediction of functional regions. Results We have developed a novel index to select the sequences appropriate for the identification of conserved residues, and implemented the index within our method to predict the functional regions of a protein. The implementation of the index improved the performance of the functional region prediction. The index represents the degree of conserved residue clustering on the tertiary structure of the protein. For this purpose, the structure and sequence information were integrated within the index by the application of spatial statistics. Spatial statistics is a field of statistics in which not only the attributes but also the geometrical coordinates of the data are considered simultaneously. Higher degrees of clustering generate larger index scores. We adopted the set of homologous sequences with the highest index score, under the assumption that the best prediction accuracy is obtained when the degree of clustering is the maximum. The set of sequences selected by the index led to higher functional region prediction performance than the sets of sequences selected by other sequence

  2. HomPPI: a class of sequence homology based protein-protein interface prediction methods

    Directory of Open Access Journals (Sweden)

    Dobbs Drena


    Full Text Available Abstract Background Although homology-based methods are among the most widely used methods for predicting the structure and function of proteins, the question as to whether interface sequence conservation can be effectively exploited in predicting protein-protein interfaces has been a subject of debate. Results We studied more than 300,000 pair-wise alignments of protein sequences from structurally characterized protein complexes, including both obligate and transient complexes. We identified sequence similarity criteria required for accurate homology-based inference of interface residues in a query protein sequence. Based on these analyses, we developed HomPPI, a class of sequence homology-based methods for predicting protein-protein interface residues. We present two variants of HomPPI: (i NPS-HomPPI (Non partner-specific HomPPI, which can be used to predict interface residues of a query protein in the absence of knowledge of the interaction partner; and (ii PS-HomPPI (Partner-specific HomPPI, which can be used to predict the interface residues of a query protein with a specific target protein. Our experiments on a benchmark dataset of obligate homodimeric complexes show that NPS-HomPPI can reliably predict protein-protein interface residues in a given protein, with an average correlation coefficient (CC of 0.76, sensitivity of 0.83, and specificity of 0.78, when sequence homologs of the query protein can be reliably identified. NPS-HomPPI also reliably predicts the interface residues of intrinsically disordered proteins. Our experiments suggest that NPS-HomPPI is competitive with several state-of-the-art interface prediction servers including those that exploit the structure of the query proteins. The partner-specific classifier, PS-HomPPI can, on a large dataset of transient complexes, predict the interface residues of a query protein with a specific target, with a CC of 0.65, sensitivity of 0.69, and specificity of 0.70, when homologs of

  3. An artificial functional family filter in homolog searching in next-generation sequencing metagenomics.

    Directory of Open Access Journals (Sweden)

    Ruofei Du

    Full Text Available In functional metagenomics, BLAST homology search is a common method to classify metagenomic reads into protein/domain sequence families such as Clusters of Orthologous Groups of proteins (COGs in order to quantify the abundance of each COG in the community. The resulting functional profile of the community is then used in downstream analysis to correlate the change in abundance to environmental perturbation, clinical variation, and so on. However, the short read length coupled with next-generation sequencing technologies poses a barrier in this approach, essentially because similarity significance cannot be discerned by searching with short reads. Consequently, artificial functional families are produced, in which those with a large number of reads assigned decreases the accuracy of functional profile dramatically. There is no method available to address this problem. We intended to fill this gap in this paper. We revealed that BLAST similarity scores of homologues for short reads from COG protein members coding sequences are distributed differently from the scores of those derived elsewhere. We showed that, by choosing an appropriate score cut-off, we are able to filter out most artificial families and simultaneously to preserve sufficient information in order to build the functional profile. We also showed that, by incorporated application of BLAST and RPS-BLAST, some artificial families with large read counts can be further identified after the score cutoff filtration. Evaluated on three experimental metagenomic datasets with different coverages, we found that the proposed method is robust against read coverage and consistently outperforms the other E-value cutoff methods currently used in literatures.

  4. MIPS: a database for protein sequences, homology data and yeast genome information. (United States)

    Mewes, H W; Albermann, K; Heumann, K; Liebl, S; Pfeiffer, F


    The MIPS group (Martinsried Institute for Protein Sequences) at the Max-Planck-Institute for Biochemistry, Martinsried near Munich, Germany, collects, processes and distributes protein sequence data within the framework of the tripartite association of the PIR-International Protein Sequence Database (,). MIPS contributes nearly 50% of the data input to the PIR-International Protein Sequence Database. The database is distributed on CD-ROM together with PATCHX, an exhaustive supplement of unique, unverified protein sequences from external sources compiled by MIPS. Through its WWW server ( ) MIPS permits internet access to sequence databases, homology data and to yeast genome information. (i) Sequence similarity results from the FASTA program () are stored in the FASTA database for all proteins from PIR-International and PATCHX. The database is dynamically maintained and permits instant access to FASTA results. (ii) Starting with FASTA database queries, proteins have been classified into families and superfamilies (PROT-FAM). (iii) The HPT (hashed position tree) data structure () developed at MIPS is a new approach for rapid sequence and pattern searching. (iv) MIPS provides access to the sequence and annotation of the complete yeast genome (), the functional classification of yeast genes (FunCat) and its graphical display, the 'Genome Browser' (). A CD-ROM based on the JAVA programming language providing dynamic interactive access to the yeast genome and the related protein sequences has been compiled and is available on request. PMID:9016498

  5. CPHmodels-3.0--remote homology modeling using structure-guided sequence profiles. (United States)

    Nielsen, Morten; Lundegaard, Claus; Lund, Ole; Petersen, Thomas Nordahl


    CPHmodels-3.0 is a web server predicting protein 3D structure by use of single template homology modeling. The server employs a hybrid of the scoring functions of CPHmodels-2.0 and a novel remote homology-modeling algorithm. A query sequence is first attempted modeled using the fast CPHmodels-2.0 profile-profile scoring function suitable for close homology modeling. The new computational costly remote homology-modeling algorithm is only engaged provided that no suitable PDB template is identified in the initial search. CPHmodels-3.0 was benchmarked in the CASP8 competition and produced models for 94% of the targets (117 out of 128), 74% were predicted as high reliability models (87 out of 117). These achieved an average RMSD of 4.6 A when superimposed to the 3D structure. The remaining 26% low reliably models (30 out of 117) could superimpose to the true 3D structure with an average RMSD of 9.3 A. These performance values place the CPHmodels-3.0 method in the group of high performing 3D prediction tools. Beside its accuracy, one of the important features of the method is its speed. For most queries, the response time of the server is web server is available at

  6. WeederH: an algorithm for finding conserved regulatory motifs and regions in homologous sequences

    Directory of Open Access Journals (Sweden)

    Pesole Graziano


    Full Text Available Abstract Background This work addresses the problem of detecting conserved transcription factor binding sites and in general regulatory regions through the analysis of sequences from homologous genes, an approach that is becoming more and more widely used given the ever increasing amount of genomic data available. Results We present an algorithm that identifies conserved transcription factor binding sites in a given sequence by comparing it to one or more homologs, adapting a framework we previously introduced for the discovery of sites in sequences from co-regulated genes. Differently from the most commonly used methods, the approach we present does not need or compute an alignment of the sequences investigated, nor resorts to descriptors of the binding specificity of known transcription factors. The main novel idea we introduce is a relative measure of conservation, assuming that true functional elements should present a higher level of conservation with respect to the rest of the sequence surrounding them. We present tests where we applied the algorithm to the identification of conserved annotated sites in homologous promoters, as well as in distal regions like enhancers. Conclusion Results of the tests show how the algorithm can provide fast and reliable predictions of conserved transcription factor binding sites regulating the transcription of a gene, with better performances than other available methods for the same task. We also show examples on how the algorithm can be successfully employed when promoter annotations of the genes investigated are missing, or when regulatory sites and regions are located far away from the genes.

  7. Protein backbone angle restraints from searching a database for chemical shift and sequence homology

    Energy Technology Data Exchange (ETDEWEB)

    Cornilescu, Gabriel; Delaglio, Frank; Bax, Ad [National Institutes of Health, Laboratory of Chemical Physics, National Institute of Diabetes and Digestive and Kidney Diseases (United States)


    Chemical shifts of backbone atoms in proteins are exquisitely sensitive to local conformation, and homologous proteins show quite similar patterns of secondary chemical shifts. The inverse of this relation is used to search a database for triplets of adjacent residues with secondary chemical shifts and sequence similarity which provide the best match to the query triplet of interest. The database contains 13C{alpha}, 13C{beta}, 13C', 1H{alpha} and 15N chemical shifts for 20 proteins for which a high resolution X-ray structure is available. The computer program TALOS was developed to search this database for strings of residues with chemical shift and residue type homology. The relative importance of the weighting factors attached to the secondary chemical shifts of the five types of resonances relative to that of sequence similarity was optimized empirically. TALOS yields the 10 triplets which have the closest similarity in secondary chemical shift and amino acid sequence to those of the query sequence. If the central residues in these 10 triplets exhibit similar {phi} and {psi} backbone angles, their averages can reliably be used as angular restraints for the protein whose structure is being studied. Tests carried out for proteins of known structure indicate that the root-mean-square difference (rmsd) between the output of TALOS and the X-ray derived backbone angles is about 15 deg. Approximately 3% of the predictions made by TALOS are found to be in error.

  8. Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region. (United States)

    Wyszyńska-Koko, J; Kurył, J


    MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.

  9. Adhesive proteins of stalked and acorn barnacles display homology with low sequence similarities.

    Directory of Open Access Journals (Sweden)

    Jaimie-Leigh Jonker

    Full Text Available Barnacle adhesion underwater is an important phenomenon to understand for the prevention of biofouling and potential biotechnological innovations, yet so far, identifying what makes barnacle glue proteins 'sticky' has proved elusive. Examination of a broad range of species within the barnacles may be instructive to identify conserved adhesive domains. We add to extensive information from the acorn barnacles (order Sessilia by providing the first protein analysis of a stalked barnacle adhesive, Lepas anatifera (order Lepadiformes. It was possible to separate the L. anatifera adhesive into at least 10 protein bands using SDS-PAGE. Intense bands were present at approximately 30, 70, 90 and 110 kilodaltons (kDa. Mass spectrometry for protein identification was followed by de novo sequencing which detected 52 peptides of 7-16 amino acids in length. None of the peptides matched published or unpublished transcriptome sequences, but some amino acid sequence similarity was apparent between L. anatifera and closely-related Dosima fascicularis. Antibodies against two acorn barnacle proteins (ab-cp-52k and ab-cp-68k showed cross-reactivity in the adhesive glands of L. anatifera. We also analysed the similarity of adhesive proteins across several barnacle taxa, including Pollicipes pollicipes (a stalked barnacle in the order Scalpelliformes. Sequence alignment of published expressed sequence tags clearly indicated that P. pollicipes possesses homologues for the 19 kDa and 100 kDa proteins in acorn barnacles. Homology aside, sequence similarity in amino acid and gene sequences tended to decline as taxonomic distance increased, with minimum similarities of 18-26%, depending on the gene. The results indicate that some adhesive proteins (e.g. 100 kDa are more conserved within barnacles than others (20 kDa.

  10. Sequence homology and expression profile of genes associated with dna repair pathways in Mycobacterium leprae

    Directory of Open Access Journals (Sweden)

    Mukul Sharma


    Full Text Available Background: Survival of Mycobacterium leprae, the causative bacteria for leprosy, in the human host is dependent to an extent on the ways in which its genome integrity is retained. DNA repair mechanisms protect bacterial DNA from damage induced by various stress factors. The current study is aimed at understanding the sequence and functional annotation of DNA repair genes in M. leprae. Methods: T he genome of M. leprae was annotated using sequence alignment tools to identify DNA repair genes that have homologs in Mycobacterium tuberculosis and Escherichia coli. A set of 96 genes known to be involved in DNA repair mechanisms in E. coli and Mycobacteriaceae were chosen as a reference. Among these, 61 were identified in M. leprae based on sequence similarity and domain architecture. The 61 were classified into 36 characterized gene products (59%, 11 hypothetical proteins (18%, and 14 pseudogenes (23%. All these genes have homologs in M. tuberculosis and 49 (80.32% in E. coli. A set of 12 genes which are absent in E. coli were present in M. leprae and in Mycobacteriaceae. These 61 genes were further investigated for their expression profiles in the whole transcriptome microarray data of M. leprae which was obtained from the signal intensities of 60bp probes, tiling the entire genome with 10bp overlaps. Results: It was noted that transcripts corresponding to all the 61 genes were identified in the transcriptome data with varying expression levels ranging from 0.18 to 2.47 fold (normalized with 16SrRNA. The mRNA expression levels of a representative set of seven genes ( four annotated and three hypothetical protein coding genes were analyzed using quantitative Polymerase Chain Reaction (qPCR assays with RNA extracted from skin biopsies of 10 newly diagnosed, untreated leprosy cases. It was noted that RNA expression levels were higher for genes involved in homologous recombination whereas the genes with a low level of expression are involved in the

  11. Sequence homology and expression profile of genes associated with DNA repair pathways in Mycobacterium leprae. (United States)

    Sharma, Mukul; Vedithi, Sundeep Chaitanya; Das, Madhusmita; Roy, Anindya; Ebenezer, Mannam


    Survival of Mycobacterium leprae, the causative bacteria for leprosy, in the human host is dependent to an extent on the ways in which its genome integrity is retained. DNA repair mechanisms protect bacterial DNA from damage induced by various stress factors. The current study is aimed at understanding the sequence and functional annotation of DNA repair genes in M. leprae. T he genome of M. leprae was annotated using sequence alignment tools to identify DNA repair genes that have homologs in Mycobacterium tuberculosis and Escherichia coli. A set of 96 genes known to be involved in DNA repair mechanisms in E. coli and Mycobacteriaceae were chosen as a reference. Among these, 61 were identified in M. leprae based on sequence similarity and domain architecture. The 61 were classified into 36 characterized gene products (59%), 11 hypothetical proteins (18%), and 14 pseudogenes (23%). All these genes have homologs in M. tuberculosis and 49 (80.32%) in E. coli. A set of 12 genes which are absent in E. coli were present in M. leprae and in Mycobacteriaceae. These 61 genes were further investigated for their expression profiles in the whole transcriptome microarray data of M. leprae which was obtained from the signal intensities of 60bp probes, tiling the entire genome with 10bp overlaps. It was noted that transcripts corresponding to all the 61 genes were identified in the transcriptome data with varying expression levels ranging from 0.18 to 2.47 fold (normalized with 16SrRNA). The mRNA expression levels of a representative set of seven genes ( four annotated and three hypothetical protein coding genes) were analyzed using quantitative Polymerase Chain Reaction (qPCR) assays with RNA extracted from skin biopsies of 10 newly diagnosed, untreated leprosy cases. It was noted that RNA expression levels were higher for genes involved in homologous recombination whereas the genes with a low level of expression are involved in the direct repair pathway. This study provided

  12. External and semi-internal controls for PCR amplification of homologous sequences in mixed templates

    DEFF Research Database (Denmark)

    Kalle, Elena; Gulevich, Alexander; Rensing, Christopher Günther T


    as an acceptable alternative. In order to evaluate the effects of inhibitors, a model multi-template mix was amplified in a mixture with DNAse-treated sample. Semi-internal control allowed establishment of intervals for robust PCR performance for different samples, thus enabling correct comparison of the samples......In a mixed template, the presence of homologous target DNA sequences creates environments that almost inevitably give rise to artifacts and biases during PCR. Heteroduplexes, chimeras, and skewed template-to-product ratios are the exclusive attributes of mixed template PCR and never occur....... This study demonstrated the efficiency of a model mixed template as an adequate external amplification control for a particular PCR application. The conditions of multi-template PCR do not allow implementation of a classic internal control; therefore we developed a convenient semi-internal control...

  13. Homology analyses of the protein sequences of fatty acid synthases from chicken liver, rat mammary gland, and yeast

    International Nuclear Information System (INIS)

    Chang, Soo-Ik; Hammes, G.G.


    Homology analyses of the protein sequences of chicken liver and rat mammary gland fatty acid synthases were carried out. The amino acid sequences of the chicken and rat enzymes are 67% identical. If conservative substitutions are allowed, 78% of the amino acids are matched. A region of low homologies exists between the functional domains, in particular around amino acid residues 1059-1264 of the chicken enzyme. Homologies between the active sites of chicken and rat and of chicken and yeast enzymes have been analyzed by an alignment method. A high degree of homology exists between the active sites of the chicken and rat enzymes. However, the chicken and yeast enzymes show a lower degree of homology. The DADPH-binding dinucleotide folds of the β-ketoacyl reductase and the enoyl reductase sites were identified by comparison with a known consensus sequence for the DADP- and FAD-binding dinucleotide folds. The active sites of all of the enzymes are primarily in hydrophobic regions of the protein. This study suggests that the genes for the functional domains of fatty acid synthase were originally separated, and these genes were connected to each other by using different connecting nucleotide sequences in different species. An alternative explanation for the differences in rat and chicken is a common ancestry and mutations in the joining regions during evolution

  14. Cluster based on sequence comparison of homologous proteins of 95 organism species - Gclust Server | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Gclust Server Cluster based on sequence comparison of homologous proteins of 95 organism spe...cies Data detail Data name Cluster based on sequence comparison of homologous proteins of 95 organism specie...istory of This Database Site Policy | Contact Us Cluster based on sequence compariso

  15. Sequence homolog-based molecular engineering for shifting the enzymatic pH optimum

    Directory of Open Access Journals (Sweden)

    Fuqiang Ma


    Full Text Available Cell-free synthetic biology system organizes multiple enzymes (parts from different sources to implement unnatural catalytic functions. Highly adaption between the catalytic parts is crucial for building up efficient artificial biosynthetic systems. Protein engineering is a powerful technology to tailor various enzymatic properties including catalytic efficiency, substrate specificity, temperature adaptation and even achieve new catalytic functions. However, altering enzymatic pH optimum still remains a challenging task. In this study, we proposed a novel sequence homolog-based protein engineering strategy for shifting the enzymatic pH optimum based on statistical analyses of sequence-function relationship data of enzyme family. By two statistical procedures, artificial neural networks (ANNs and least absolute shrinkage and selection operator (Lasso, five amino acids in GH11 xylanase family were identified to be related to the evolution of enzymatic pH optimum. Site-directed mutagenesis of a thermophilic xylanase from Caldicellulosiruptor bescii revealed that four out of five mutations could alter the enzymatic pH optima toward acidic condition without compromising the catalytic activity and thermostability. Combination of the positive mutants resulted in the best mutant M31 that decreased its pH optimum for 1.5 units and showed increased catalytic activity at pH < 5.0 compared to the wild-type enzyme. Structure analysis revealed that all the mutations are distant from the active center, which may be difficult to be identified by conventional rational design strategy. Interestingly, the four mutation sites are clustered at a certain region of the enzyme, suggesting a potential “hot zone” for regulating the pH optima of xylanases. This study provides an efficient method of modulating enzymatic pH optima based on statistical sequence analyses, which can facilitate the design and optimization of suitable catalytic parts for the construction

  16. Amino acid sequences mediating vascular cell adhesion molecule 1 binding to integrin alpha 4: homologous DSP sequence found for JC polyoma VP1 coat protein

    Directory of Open Access Journals (Sweden)

    Michael Andrew Meyer


    Full Text Available The JC polyoma viral coat protein VP1 was analyzed for amino acid sequences homologies to the IDSP sequence which mediates binding of VLA-4 (integrin alpha 4 to vascular cell adhesion molecule 1. Although the full sequence was not found, a DSP sequence was located near the critical arginine residue linked to infectivity of the virus and binding to sialic acid containing molecules such as integrins (3. For the JC polyoma virus, a DSP sequence was found at residues 70, 71 and 72 with homology also noted for the mouse polyoma virus and SV40 virus. Three dimensional modeling of the VP1 molecule suggests that the DSP loop has an accessible site for interaction from the external side of the assembled viral capsid pentamer.

  17. A multidimensional strategy to detect polypharmacological targets in the absence of structural and sequence homology. (United States)

    Durrant, Jacob D; Amaro, Rommie E; Xie, Lei; Urbaniak, Michael D; Ferguson, Michael A J; Haapalainen, Antti; Chen, Zhijun; Di Guilmi, Anne Marie; Wunder, Frank; Bourne, Philip E; McCammon, J Andrew


    Conventional drug design embraces the "one gene, one drug, one disease" philosophy. Polypharmacology, which focuses on multi-target drugs, has emerged as a new paradigm in drug discovery. The rational design of drugs that act via polypharmacological mechanisms can produce compounds that exhibit increased therapeutic potency and against which resistance is less likely to develop. Additionally, identifying multiple protein targets is also critical for side-effect prediction. One third of potential therapeutic compounds fail in clinical trials or are later removed from the market due to unacceptable side effects often caused by off-target binding. In the current work, we introduce a multidimensional strategy for the identification of secondary targets of known small-molecule inhibitors in the absence of global structural and sequence homology with the primary target protein. To demonstrate the utility of the strategy, we identify several targets of 4,5-dihydroxy-3-(1-naphthyldiazenyl)-2,7-naphthalenedisulfonic acid, a known micromolar inhibitor of Trypanosoma brucei RNA editing ligase 1. As it is capable of identifying potential secondary targets, the strategy described here may play a useful role in future efforts to reduce drug side effects and/or to increase polypharmacology.

  18. Cloning, Expression, Sequence Analysis and Homology Modeling of the Prolyl Endoprotease from Eurygaster integriceps Puton

    Directory of Open Access Journals (Sweden)

    Ravi Chandra Yandamuri


    Full Text Available eurygaster integriceps Puton, commonly known as sunn pest, is a major pest of wheat in Northern Africa, the Middle East and Eastern Europe. This insect injects a prolyl endoprotease into the wheat, destroying the gluten. The purpose of this study was to clone the full length cDNA of the sunn pest prolyl endoprotease (spPEP for expression in E. coli and to compare the amino acid sequence of the enzyme to other known PEPs in both phylogeny and potential tertiary structure. Sequence analysis shows that the 5ꞌ UTR contains several putative transcription factor binding sites for transcription factors known to be expressed in Drosophila that might be useful targets for inhibition of the enzyme. The spPEP was first identified as a prolyl endoprotease by Darkoh et al., 2010. The enzyme is a unique serine protease of the S9A family by way of its substrate recognition of the gluten proteins, which are greater than 30 kD in size. At 51% maximum identity to known PEPs, homology modeling using SWISS-MODEL, the porcine brain PEP (PDB: 2XWD was selected in the database of known PEP structures, resulting in a predicted tertiary structure 99% identical to the porcine brain PEP structure. A Km for the recombinant spPEP was determined to be 210 ± 53 µM for the zGly-Pro-pNA substrate in 0.025 M ethanolamine, pH 8.5, containing 0.1 M NaCl at 37 °C with a turnover rate of 172 ± 47 µM Gly-Pro-pNA/s/µM of enzyme.

  19. External and semi-internal controls for PCR amplification of homologous sequences in mixed templates. (United States)

    Kalle, Elena; Gulevich, Alexander; Rensing, Christopher


    In a mixed template, the presence of homologous target DNA sequences creates environments that almost inevitably give rise to artifacts and biases during PCR. Heteroduplexes, chimeras, and skewed template-to-product ratios are the exclusive attributes of mixed template PCR and never occur in a single template assay. Yet, multi-template PCR has been used without appropriate attention to quality control and assay validation, in spite of the fact that such practice diminishes the reliability of results. External and internal amplification controls became obligatory elements of good laboratory practice in different PCR assays. We propose the inclusion of an analogous approach as a quality control system for multi-template PCR applications. The amplification controls must take into account the characteristics of multi-template PCR and be able to effectively monitor particular assay performance. This study demonstrated the efficiency of a model mixed template as an adequate external amplification control for a particular PCR application. The conditions of multi-template PCR do not allow implementation of a classic internal control; therefore we developed a convenient semi-internal control as an acceptable alternative. In order to evaluate the effects of inhibitors, a model multi-template mix was amplified in a mixture with DNAse-treated sample. Semi-internal control allowed establishment of intervals for robust PCR performance for different samples, thus enabling correct comparison of the samples. The complexity of the external and semi-internal amplification controls must be comparable with the assumed complexity of the samples. We also emphasize that amplification controls should be applied in multi-template PCR regardless of the post-assay method used to analyze products. © 2013 Elsevier B.V. All rights reserved.

  20. Identification of sequence motifs significantly associated with antisense activity

    Directory of Open Access Journals (Sweden)

    Peek Andrew S


    Full Text Available Abstract Background Predicting the suppression activity of antisense oligonucleotide sequences is the main goal of the rational design of nucleic acids. To create an effective predictive model, it is important to know what properties of an oligonucleotide sequence associate significantly with antisense activity. Also, for the model to be efficient we must know what properties do not associate significantly and can be omitted from the model. This paper will discuss the results of a randomization procedure to find motifs that associate significantly with either high or low antisense suppression activity, analysis of their properties, as well as the results of support vector machine modelling using these significant motifs as features. Results We discovered 155 motifs that associate significantly with high antisense suppression activity and 202 motifs that associate significantly with low suppression activity. The motifs range in length from 2 to 5 bases, contain several motifs that have been previously discovered as associating highly with antisense activity, and have thermodynamic properties consistent with previous work associating thermodynamic properties of sequences with their antisense activity. Statistical analysis revealed no correlation between a motif's position within an antisense sequence and that sequences antisense activity. Also, many significant motifs existed as subwords of other significant motifs. Support vector regression experiments indicated that the feature set of significant motifs increased correlation compared to all possible motifs as well as several subsets of the significant motifs. Conclusion The thermodynamic properties of the significantly associated motifs support existing data correlating the thermodynamic properties of the antisense oligonucleotide with antisense efficiency, reinforcing our hypothesis that antisense suppression is strongly associated with probe/target thermodynamics, as there are no enzymatic

  1. Finding the most significant common sequence and structure motifs in a set of RNA sequences

    DEFF Research Database (Denmark)

    Gorodkin, Jan; Heyer, L.J.; Stormo, G.D.


    We present a computational scheme to locally align a collection of RNA sequences using sequence and structure constraints, In addition, the method searches for the resulting alignments with the most significant common motifs, among all possible collections, The first part utilizes a simplified...

  2. Molecular cloning, sequence analysis and homology modeling of the first caudata amphibian antifreeze-like protein in axolotl (Ambystoma mexicanum). (United States)

    Zhang, Songyan; Gao, Jiuxiang; Lu, Yiling; Cai, Shasha; Qiao, Xue; Wang, Yipeng; Yu, Haining


    Antifreeze proteins (AFPs) refer to a class of polypeptides that are produced by certain vertebrates, plants, fungi, and bacteria and which permit their survival in subzero environments. In this study, we report the molecular cloning, sequence analysis and three-dimensional structure of the axolotl antifreeze-like protein (AFLP) by homology modeling of the first caudate amphibian AFLP. We constructed a full-length spleen cDNA library of axolotl (Ambystoma mexicanum). An EST having highest similarity (∼42%) with freeze-responsive liver protein Li16 from Rana sylvatica was identified, and the full-length cDNA was subsequently obtained by RACE-PCR. The axolotl antifreeze-like protein sequence represents an open reading frame for a putative signal peptide and the mature protein composed of 93 amino acids. The calculated molecular mass and the theoretical isoelectric point (pl) of this mature protein were 10128.6 Da and 8.97, respectively. The molecular characterization of this gene and its deduced protein were further performed by detailed bioinformatics analysis. The three-dimensional structure of current AFLP was predicted by homology modeling, and the conserved residues required for functionality were identified. The homology model constructed could be of use for effective drug design. This is the first report of an antifreeze-like protein identified from a caudate amphibian.

  3. Identification of the porcine homologous of human disease causing trinucleotide repeat sequences

    DEFF Research Database (Denmark)

    Madsen, Lone Bruhn; Thomsen, Bo; Sølvsten, Christina Ane Elisabeth


    in this paper the identification of porcine noncoding and polyglutamine-encoding TNR regions and the comparison to the homologous TNRs from human, chimpanzee, dog, opossum, rat, and mouse. Several of the porcine TNR regions are highly polymorphic both within and between different breeds. The TNR regions...

  4. The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing

    DEFF Research Database (Denmark)

    Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P


    BACKGROUND: The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine...... primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution...

  5. N-terminal sequence of human leukocyte glycoprotein Mo1: conservation across species and homology to platelet IIb/IIIa. (United States)

    Pierce, M W; Remold-O'Donnell, E; Todd, R F; Arnaout, M A


    Mo1 and gp160-gp93 are two surface membrane glycoprotein heterodimers present on granulocytes and monocytes derived from humans and guinea pigs, respectively. We purified both antigens and found that their alpha subunits had identical N-termini which were significantly homologous to the alpha subunit of the human adhesion platelet glycoprotein IIb/IIIa.

  6. CMsearch: simultaneous exploration of protein sequence space and structure space improves not only protein homology detection but also protein structure prediction

    KAUST Repository

    Cui, Xuefeng; Lu, Zhiwu; Wang, Sheng; Jing-Yan Wang, Jim; Gao, Xin


    Motivation: Protein homology detection, a fundamental problem in computational biology, is an indispensable step toward predicting protein structures and understanding protein functions. Despite the advances in recent decades on sequence alignment

  7. Nucleotide and amino acid sequences of a coat protein of an Ukrainian isolate of Potato virus Y: comparison with homologous sequences of other isolates and phylogenetic analysis

    Directory of Open Access Journals (Sweden)

    Budzanivska I. G.


    Full Text Available Aim. Identification of the widespread Ukrainian isolate(s of PVY (Potato virus Y in different potato cultivars and subsequent phylogenetic analysis of detected PVY isolates based on NA and AA sequences of coat protein. Methods. ELISA, RT-PCR, DNA sequencing and phylogenetic analysis. Results. PVY has been identified serologically in potato cultivars of Ukrainian selection. In this work we have optimized a method for total RNA extraction from potato samples and offered a sensitive and specific PCR-based test system of own design for diagnostics of the Ukrainian PVY isolates. Part of the CP gene of the Ukrainian PVY isolate has been sequenced and analyzed phylogenetically. It is demonstrated that the Ukrainian isolate of Potato virus Y (CP gene has a higher percentage of homology with the recombinant isolates (strains of this pathogen (approx. 98.8– 99.8 % of homology for both nucleotide and translated amino acid sequences of the CP gene. The Ukrainian isolate of PVY is positioned in the separate cluster together with the isolates found in Syria, Japan and Iran; these isolates possibly have common origin. The Ukrainian PVY isolate is confirmed to be recombinant. Conclusions. This work underlines the need and provides the means for accurate monitoring of Potato virus Y in the agroecosystems of Ukraine. Most importantly, the phylogenetic analysis demonstrated the recombinant nature of this PVY isolate which has been attributed to the strain group O, subclade N:O.

  8. Comparison of the degree of homology of DNA and quantity of repeated sequences in an intact plant and cell structure

    International Nuclear Information System (INIS)

    Solov'yan, V.T.; Kunaleh, V.A.; Shumnyl, V.K.; Vershinin, A.V.


    This paper attempts to assess the quantity of repeated sequences and degree of homology of DNA in the intact plant and two lines of callus tissue of Rauwolfia serpentina Benth maintained for 20 years, which differ among themselves in the level of biosynthesis of the pharmacologically valuable alkaloid ajmaline. The tritium-labeled repeats of plants and calli were used in direct and reverse hybridization on nitrocellulose filters. Hybridization of H 3-labeled repeats with phage 17 DNA was used as control. The radioactivity of filters after washing was measured in a liquid scintillation counter

  9. Structural and Sequence Similarities of Hydra Xeroderma Pigmentosum A Protein to Human Homolog Suggest Early Evolution and Conservation

    Directory of Open Access Journals (Sweden)

    Apurva Barve


    Full Text Available Xeroderma pigmentosum group A (XPA is a protein that binds to damaged DNA, verifies presence of a lesion, and recruits other proteins of the nucleotide excision repair (NER pathway to the site. Though its homologs from yeast, Drosophila, humans, and so forth are well studied, XPA has not so far been reported from protozoa and lower animal phyla. Hydra is a fresh-water cnidarian with a remarkable capacity for regeneration and apparent lack of organismal ageing. Cnidarians are among the first metazoa with a defined body axis, tissue grade organisation, and nervous system. We report here for the first time presence of XPA gene in hydra. Putative protein sequence of hydra XPA contains nuclear localization signal and bears the zinc-finger motif. It contains two conserved Pfam domains and various characterized features of XPA proteins like regions for binding to excision repair cross-complementing protein-1 (ERCC1 and replication protein A 70 kDa subunit (RPA70 proteins. Hydra XPA shows a high degree of similarity with vertebrate homologs and clusters with deuterostomes in phylogenetic analysis. Homology modelling corroborates the very close similarity between hydra and human XPA. The protein thus most likely functions in hydra in the same manner as in other animals, indicating that it arose early in evolution and has been conserved across animal phyla.

  10. CMsearch: simultaneous exploration of protein sequence space and structure space improves not only protein homology detection but also protein structure prediction

    KAUST Repository

    Cui, Xuefeng


    Motivation: Protein homology detection, a fundamental problem in computational biology, is an indispensable step toward predicting protein structures and understanding protein functions. Despite the advances in recent decades on sequence alignment, threading and alignment-free methods, protein homology detection remains a challenging open problem. Recently, network methods that try to find transitive paths in the protein structure space demonstrate the importance of incorporating network information of the structure space. Yet, current methods merge the sequence space and the structure space into a single space, and thus introduce inconsistency in combining different sources of information. Method: We present a novel network-based protein homology detection method, CMsearch, based on cross-modal learning. Instead of exploring a single network built from the mixture of sequence and structure space information, CMsearch builds two separate networks to represent the sequence space and the structure space. It then learns sequence–structure correlation by simultaneously taking sequence information, structure information, sequence space information and structure space information into consideration. Results: We tested CMsearch on two challenging tasks, protein homology detection and protein structure prediction, by querying all 8332 PDB40 proteins. Our results demonstrate that CMsearch is insensitive to the similarity metrics used to define the sequence and the structure spaces. By using HMM–HMM alignment as the sequence similarity metric, CMsearch clearly outperforms state-of-the-art homology detection methods and the CASP-winning template-based protein structure prediction methods.

  11. Top-Down-Assisted Bottom-Up Method for Homologous Protein Sequencing: Hemoglobin from 33 Bird Species (United States)

    Song, Yang; Laskay, Ünige A.; Vilcins, Inger-Marie E.; Barbour, Alan G.; Wysocki, Vicki H.


    Ticks are vectors for disease transmission because they are indiscriminant in their feeding on multiple vertebrate hosts, transmitting pathogens between their hosts. Identifying the hosts on which ticks have fed is important for disease prevention and intervention. We have previously shown that hemoglobin (Hb) remnants from a host on which a tick fed can be used to reveal the host's identity. For the present research, blood was collected from 33 bird species that are common in the U.S. as hosts for ticks but that have unknown Hb sequences. A top-down-assisted bottom-up mass spectrometry approach with a customized searching database, based on variability in known bird hemoglobin sequences, has been devised to facilitate fast and complete sequencing of hemoglobin from birds with unknown sequences. These hemoglobin sequences will be added to a hemoglobin database and used for tick host identification. The general approach has the potential to sequence any set of homologous proteins completely in a rapid manner.

  12. Detecting remote sequence homology in disordered proteins: discovery of conserved motifs in the N-termini of Mononegavirales phosphoproteins.

    Directory of Open Access Journals (Sweden)

    David Karlin

    Full Text Available Paramyxovirinae are a large group of viruses that includes measles virus and parainfluenza viruses. The viral Phosphoprotein (P plays a central role in viral replication. It is composed of a highly variable, disordered N-terminus and a conserved C-terminus. A second viral protein alternatively expressed, the V protein, also contains the N-terminus of P, fused to a zinc finger. We suspected that, despite their high variability, the N-termini of P/V might all be homologous; however, using standard approaches, we could previously identify sequence conservation only in some Paramyxovirinae. We now compared the N-termini using sensitive sequence similarity search programs, able to detect residual similarities unnoticeable by conventional approaches. We discovered that all Paramyxovirinae share a short sequence motif in their first 40 amino acids, which we called soyuz1. Despite its short length (11-16aa, several arguments allow us to conclude that soyuz1 probably evolved by homologous descent, unlike linear motifs. Conservation across such evolutionary distances suggests that soyuz1 plays a crucial role and experimental data suggest that it binds the viral nucleoprotein to prevent its illegitimate self-assembly. In some Paramyxovirinae, the N-terminus of P/V contains a second motif, soyuz2, which might play a role in blocking interferon signaling. Finally, we discovered that the P of related Mononegavirales contain similarly overlooked motifs in their N-termini, and that their C-termini share a previously unnoticed structural similarity suggesting a common origin. Our results suggest several testable hypotheses regarding the replication of Mononegavirales and suggest that disordered regions with little overall sequence similarity, common in viral and eukaryotic proteins, might contain currently overlooked motifs (intermediate in length between linear motifs and disordered domains that could be detected simply by comparing orthologous proteins.

  13. Estimates of statistical significance for comparison of individual positions in multiple sequence alignments

    Directory of Open Access Journals (Sweden)

    Sadreyev Ruslan I


    Full Text Available Abstract Background Profile-based analysis of multiple sequence alignments (MSA allows for accurate comparison of protein families. Here, we address the problems of detecting statistically confident dissimilarities between (1 MSA position and a set of predicted residue frequencies, and (2 between two MSA positions. These problems are important for (i evaluation and optimization of methods predicting residue occurrence at protein positions; (ii detection of potentially misaligned regions in automatically produced alignments and their further refinement; and (iii detection of sites that determine functional or structural specificity in two related families. Results For problems (1 and (2, we propose analytical estimates of P-value and apply them to the detection of significant positional dissimilarities in various experimental situations. (a We compare structure-based predictions of residue propensities at a protein position to the actual residue frequencies in the MSA of homologs. (b We evaluate our method by the ability to detect erroneous position matches produced by an automatic sequence aligner. (c We compare MSA positions that correspond to residues aligned by automatic structure aligners. (d We compare MSA positions that are aligned by high-quality manual superposition of structures. Detected dissimilarities reveal shortcomings of the automatic methods for residue frequency prediction and alignment construction. For the high-quality structural alignments, the dissimilarities suggest sites of potential functional or structural importance. Conclusion The proposed computational method is of significant potential value for the analysis of protein families.

  14. Comparative genomic survey, exon-intron annotation and phylogenetic analysis of NAT-homologous sequences in archaea, protists, fungi, viruses, and invertebrates (United States)

    We have previously published extensive genomic surveys [1-3], reporting NAT-homologous sequences in hundreds of sequenced bacterial, fungal and vertebrate genomes. We present here the results of our latest search of 2445 genomes, representing 1532 (70 archaeal, 1210 bacterial, 43 protist, 97 fungal,...

  15. Positive Selection or Free to Vary? Assessing the Functional Significance of Sequence Change Using Molecular Dynamics.

    Directory of Open Access Journals (Sweden)

    Jane R Allison

    Full Text Available Evolutionary arms races between pathogens and their hosts may be manifested as selection for rapid evolutionary change of key genes, and are sometimes detectable through sequence-level analyses. In the case of protein-coding genes, such analyses frequently predict that specific codons are under positive selection. However, detecting positive selection can be non-trivial, and false positive predictions are a common concern in such analyses. It is therefore helpful to place such predictions within a structural and functional context. Here, we focus on the p19 protein from tombusviruses. P19 is a homodimer that sequesters siRNAs, thereby preventing the host RNAi machinery from shutting down viral infection. Sequence analysis of the p19 gene is complicated by the fact that it is constrained at the sequence level by overprinting of a viral movement protein gene. Using homology modeling, in silico mutation and molecular dynamics simulations, we assess how non-synonymous changes to two residues involved in forming the dimer interface-one invariant, and one predicted to be under positive selection-impact molecular function. Interestingly, we find that both observed variation and potential variation (where a non-synonymous change to p19 would be synonymous for the overprinted movement protein does not significantly impact protein structure or RNA binding. Consequently, while several methods identify residues at the dimer interface as being under positive selection, MD results suggest they are functionally indistinguishable from a site that is free to vary. Our analyses serve as a caveat to using sequence-level analyses in isolation to detect and assess positive selection, and emphasize the importance of also accounting for how non-synonymous changes impact structure and function.

  16. Sequence homology: A poor predictive value for profilins cross-reactivity

    Directory of Open Access Journals (Sweden)

    Pazouki Nazanin


    Full Text Available Summary Background Profilins are highly cross-reactive allergens which bind IgE antibodies of almost 20% of plant-allergic patients. This study is aimed at investigating cross-reactivity of melon profilin with other plant profilins and the role of the linear and conformational epitopes in human IgE cross-reactivity. Methods Seventeen patients with melon allergy were selected based on clinical history and a positive skin prick test to melon extract. Melon profilin has been cloned and expressed in E. coli. The IgE binding and cross-reactivity of the recombinant profilin were measured by ELISA and inhibition ELISA. The amino acid sequence of melon profilin was compared with other profilin sequences. A combination of chemical cleavage and immunoblotting techniques were used to define the role of conformational and linear epitopes in IgE binding. Comparative modeling was used to construct three-dimensional models of profilins and to assess theoretical impact of amino acid differences on conformational structure. Results Profilin was identified as a major IgE-binding component of melon. Alignment of amino acid sequences of melon profilin with other profilins showed the most identity with watermelon profilin. This melon profilin showed substantial cross-reactivity with the tomato, peach, grape and Cynodon dactylon (Bermuda grass pollen profilins. Cantaloupe, watermelon, banana and Poa pratensis (Kentucky blue grass displayed no notable inhibition. Our experiments also indicated human IgE only react with complete melon profilin. Immunoblotting analysis with rabbit polyclonal antibody shows the reaction of the antibody to the fragmented and complete melon profilin. Although, the well-known linear epitope of profilins were identical in melon and watermelon, comparison of three-dimensional models of watermelon and melon profilins indicated amino acid differences influence the electric potential and accessibility of the solvent-accessible surface of

  17. Protein backbone chemical shifts predicted from searching a database for torsion angle and sequence homology

    International Nuclear Information System (INIS)

    Shen Yang; Bax, Ad


    Chemical shifts of nuclei in or attached to a protein backbone are exquisitely sensitive to their local environment. A computer program, SPARTA, is described that uses this correlation with local structure to predict protein backbone chemical shifts, given an input three-dimensional structure, by searching a newly generated database for triplets of adjacent residues that provide the best match in φ/ψ/χ 1 torsion angles and sequence similarity to the query triplet of interest. The database contains 15 N, 1 H N , 1 H α , 13 C α , 13 C β and 13 C' chemical shifts for 200 proteins for which a high resolution X-ray (≤2.4 A) structure is available. The relative importance of the weighting factors for the φ/ψ/χ 1 angles and sequence similarity was optimized empirically. The weighted, average secondary shifts of the central residues in the 20 best-matching triplets, after inclusion of nearest neighbor, ring current, and hydrogen bonding effects, are used to predict chemical shifts for the protein of known structure. Validation shows good agreement between the SPARTA-predicted and experimental shifts, with standard deviations of 2.52, 0.51, 0.27, 0.98, 1.07 and 1.08 ppm for 15 N, 1 H N , 1 H α , 13 C α , 13 C β and 13 C', respectively, including outliers

  18. PSI/TM-Coffee: a web server for fast and accurate multiple sequence alignments of regular and transmembrane proteins using homology extension on reduced databases. (United States)

    Floden, Evan W; Tommaso, Paolo D; Chatzou, Maria; Magis, Cedrik; Notredame, Cedric; Chang, Jia-Ming


    The PSI/TM-Coffee web server performs multiple sequence alignment (MSA) of proteins by combining homology extension with a consistency based alignment approach. Homology extension is performed with Position Specific Iterative (PSI) BLAST searches against a choice of redundant and non-redundant databases. The main novelty of this server is to allow databases of reduced complexity to rapidly perform homology extension. This server also gives the possibility to use transmembrane proteins (TMPs) reference databases to allow even faster homology extension on this important category of proteins. Aside from an MSA, the server also outputs topological prediction of TMPs using the HMMTOP algorithm. Previous benchmarking of the method has shown this approach outperforms the most accurate alignment methods such as MSAProbs, Kalign, PROMALS, MAFFT, ProbCons and PRALINE™. The web server is available at © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Detection and analysis of human papillomavirus 16 and 18 homologous DNA sequences in oral lesions. (United States)

    Wen, S; Tsuji, T; Li, X; Mizugaki, Y; Hayatsu, Y; Shinozaki, F


    The prevalence of human papillomavirus (HPV) 16 and 18 was investigated in oral lesions of the population of northeast China including squamous cell carcinomas (SCCs), candida leukoplakias, lichen planuses and papillomas, by southern blot hybridization with polymerase chain reaction (PCR). Amplified HPV16 and 18 E6 DNA was analyzed by cycle sequence. HPV DNA was detected in 14 of 45 SCCs (31.1%). HPV18 E6 DNA and HPV16 E6. DNA were detected in 24.4% and 20.0% of SCCs. respectively. Dual infection of both HPV 16 and HPV 18 was detected in 6 of 45 SCCs (13.3%), but not in other oral lesions. HPV 18 E6 DNA was also detected in 2 of 3 oral candida leukoplakias, but in none of the 5 papillomas. Our study indicated that HPV 18 infection might be more frequent than HPV 16 infection in oral SCCs in northeast Chinese, dual infection of high risk HPV types was restricted in oral SCCs, and that HPV infection might be involved in the pathogenesis of oral candida leukoplakia.

  20. Complete cDNA sequence of human complement C1s and close physical linkage of the homologous genes C1s and C1r

    International Nuclear Information System (INIS)

    Tosi, M.; Duponchel, C.; Meo, T.; Julier, C.


    Overlapping molecular clones encoding the complement subcomponent C1s were isolated from a human liver cDNA library. The nucleotide sequence reconstructed from these clones spans about 85% of the length of the liver C1s messenger RNAs, which occur in three distinct size classes around 3 kilobases in length. Comparisons with the sequence of C1r, the other enzymatic subcomponent of C1, reveal 40% amino acid identity and conservation of all the cysteine residues. Beside the serine protease domain, the following sequence motifs, previously described in C1r, were also found in C1s: (a) two repeats of the type found in the Ba fragment of complement factor B and in several other complement but also noncomplement proteins, (b) a cysteine-rich segment homologous to the repeats of epidermal growth factor precursor, and (c) a duplicated segment found only in C1r and C1s. Differences in each of these structural motifs provide significant clues for the interpretation of the functional divergence of these interacting serine protease zymogens. Hybridizations of C1r and C1s probes to restriction endonuclease fragments of genomic DNA demonstrate close physical linkage of the corresponding genes. The implications of this finding are discussed with respect to the evolution of C1r and C1s after their origin by tandem gene duplication and to the previously observed combined hereditary deficiencies of Clr and Cls

  1. Factoring local sequence composition in motif significance analysis. (United States)

    Ng, Patrick; Keich, Uri


    We recently introduced a biologically realistic and reliable significance analysis of the output of a popular class of motif finders. In this paper we further improve our significance analysis by incorporating local base composition information. Relying on realistic biological data simulation, as well as on FDR analysis applied to real data, we show that our method is significantly better than the increasingly popular practice of using the normal approximation to estimate the significance of a finder's output. Finally we turn to leveraging our reliable significance analysis to improve the actual motif finding task. Specifically, endowing a variant of the Gibbs Sampler with our improved significance analysis we demonstrate that de novo finders can perform better than has been perceived. Significantly, our new variant outperforms all the finders reviewed in a recently published comprehensive analysis of the Harbison genome-wide binding location data. Interestingly, many of these finders incorporate additional information such as nucleosome positioning and the significance of binding data.

  2. Complete Unique Genome Sequence, Expression Profile, and Salivary Gland Tissue Tropism of the Herpesvirus 7 Homolog in Pigtailed Macaques. (United States)

    Staheli, Jeannette P; Dyen, Michael R; Deutsch, Gail H; Basom, Ryan S; Fitzgibbon, Matthew P; Lewis, Patrick; Barcy, Serge


    Human herpesvirus 6A (HHV-6A), HHV-6B, and HHV-7 are classified as roseoloviruses and are highly prevalent in the human population. Roseolovirus reactivation in an immunocompromised host can cause severe pathologies. While the pathogenic potential of HHV-7 is unclear, it can reactivate HHV-6 from latency and thus contributes to severe pathological conditions associated with HHV-6. Because of the ubiquitous nature of roseoloviruses, their roles in such interactions and the resulting pathological consequences have been difficult to study. Furthermore, the lack of a relevant animal model for HHV-7 infection has hindered a better understanding of its contribution to roseolovirus-associated diseases. Using next-generation sequencing analysis, we characterized the unique genome of an uncultured novel pigtailed macaque roseolovirus. Detailed genomic analysis revealed the presence of gene homologs to all 84 known HHV-7 open reading frames. Phylogenetic analysis confirmed that the virus is a macaque homolog of HHV-7, which we have provisionally named Macaca nemestrina herpesvirus 7 (MneHV7). Using high-throughput RNA sequencing, we observed that the salivary gland tissue samples from nine different macaques had distinct MneHV7 gene expression patterns and that the overall number of viral transcripts correlated with viral loads in parotid gland tissue and saliva. Immunohistochemistry staining confirmed that, like HHV-7, MneHV7 exhibits a natural tropism for salivary gland ductal cells. We also observed staining for MneHV7 in peripheral nerve ganglia present in salivary gland tissues, suggesting that HHV-7 may also have a tropism for the peripheral nervous system. Our data demonstrate that MneHV7-infected macaques represent a relevant animal model that may help clarify the causality between roseolovirus reactivation and diseases. Human herpesvirus 6A (HHV-6A), HHV-6B, and HHV-7 are classified as roseoloviruses. We have recently discovered that pigtailed macaques are naturally

  3. In silico sequence analysis and homology modeling of predicted beta-amylase 7-like protein in Brachypodium distachyon L.

    Directory of Open Access Journals (Sweden)



    Full Text Available Beta-amylase (β-amylase, EC is an enzyme that catalyses hydrolysis of glucosidic bonds in polysaccharides. In this study, we analyzed protein sequence of predicted beta-amylase 7-like protein in Brachypodium distachyon. pI (isoelectric point value was found as 5.23 in acidic character, while the instability index (II was found as 50.28 with accepted unstable protein. The prediction of subcellular localization was revealed that the protein may reside in chloroplast by using CELLO v.2.5. The 3D structure of protein was performed using comparative homology modeling with SWISS-MODEL. The accuracy of the predicted 3D structure was checked using Ramachandran plot analysis showed that 95.4% in favored region. The results of our study contribute to understanding of β-amylase protein structure in grass species and will be scientific base for 3D modeling of beta-amylase proteins in further studies.

  4. Tracing the Evolutionary History of the CAP Superfamily of Proteins Using Amino Acid Sequence Homology and Conservation of Splice Sites. (United States)

    Abraham, Anup; Chandler, Douglas E


    Proteins of the CAP superfamily play numerous roles in reproduction, innate immune responses, cancer biology, and venom toxicology. Here we document the breadth of the CAP (Cysteine-RIch Secretory Protein (CRISP), Antigen 5, and Pathogenesis-Related) protein superfamily and trace the major events in its evolution using amino acid sequence homology and the positions of exon/intron borders within their genes. Seldom acknowledged in the literature, we find that many of the CAP subfamilies present in mammals, where they were originally characterized, have distinct homologues in the invertebrate phyla. Early eukaryotic CAP genes contained only one exon inherited from prokaryotic predecessors and as evolution progressed an increasing number of introns were inserted, reaching 2-5 in the invertebrate world and 5-15 in the vertebrate world. Focusing on the CRISP subfamily, we propose that these proteins evolved in three major steps: (1) origination of the CAP/PR/SCP domain in bacteria, (2) addition of a small Hinge domain to produce the two-domain SCP-like proteins found in roundworms and anthropoids, and (3) addition of an Ion Channel Regulatory domain, borrowed from invertebrate peptide toxins, to produce full length, three-domain CRISP proteins, first seen in insects and later to diversify into multiple subtypes in the vertebrate world.

  5. Sequence Exchange between Homologous NB-LRR Genes Converts Virus Resistance into Nematode Resistance, and Vice Versa. (United States)

    Slootweg, Erik; Koropacka, Kamila; Roosien, Jan; Dees, Robert; Overmars, Hein; Lankhorst, Rene Klein; van Schaik, Casper; Pomp, Rikus; Bouwman, Liesbeth; Helder, Johannes; Schots, Arjen; Bakker, Jaap; Smant, Geert; Goverse, Aska


    Plants have evolved a limited repertoire of NB-LRR disease resistance ( R ) genes to protect themselves against myriad pathogens. This limitation is thought to be counterbalanced by the rapid evolution of NB-LRR proteins, as only a few sequence changes have been shown to be sufficient to alter resistance specificities toward novel strains of a pathogen. However, little is known about the flexibility of NB-LRR R genes to switch resistance specificities between phylogenetically unrelated pathogens. To investigate this, we created domain swaps between the close homologs Gpa2 and Rx1 , which confer resistance in potato ( Solanum tuberosum ) to the cyst nematode Globodera pallida and Potato virus X , respectively. The genetic fusion of the CC-NB-ARC of Gpa2 with the LRR of Rx1 (Gpa2 CN /Rx1 L ) results in autoactivity, but lowering the protein levels restored its specific activation response, including extreme resistance to Potato virus X in potato shoots. The reciprocal chimera (Rx1 CN /Gpa2 L ) shows a loss-of-function phenotype, but exchange of the first three LRRs of Gpa2 by the corresponding region of Rx1 was sufficient to regain a wild-type resistance response to G. pallida in the roots. These data demonstrate that exchanging the recognition moiety in the LRR is sufficient to convert extreme virus resistance in the leaves into mild nematode resistance in the roots, and vice versa. In addition, we show that the CC-NB-ARC can operate independently of the recognition specificities defined by the LRR domain, either aboveground or belowground. These data show the versatility of NB-LRR genes to generate resistance to unrelated pathogens with completely different lifestyles and routes of invasion. © 2017 American Society of Plant Biologists. All Rights Reserved.

  6. Selective anticancer activity of a hexapeptide with sequence homology to a non-kinase domain of Cyclin Dependent Kinase 4

    Directory of Open Access Journals (Sweden)

    Agarwala Usha


    Full Text Available Abstract Background Cyclin-dependent kinases 2, 4 and 6 (Cdk2, Cdk4, Cdk6 are closely structurally homologous proteins which are classically understood to control the transition from the G1 to the S-phases of the cell cycle by combining with their appropriate cyclin D or cyclin E partners to form kinase-active holoenzymes. Deregulation of Cdk4 is widespread in human cancer, CDK4 gene knockout is highly protective against chemical and oncogene-mediated epithelial carcinogenesis, despite the continued presence of CDK2 and CDK6; and overexpresssion of Cdk4 promotes skin carcinogenesis. Surprisingly, however, Cdk4 kinase inhibitors have not yet fulfilled their expectation as 'blockbuster' anticancer agents. Resistance to inhibition of Cdk4 kinase in some cases could potentially be due to a non-kinase activity, as recently reported with epidermal growth factor receptor. Results A search for a potential functional site of non-kinase activity present in Cdk4 but not Cdk2 or Cdk6 revealed a previously-unidentified loop on the outside of the C'-terminal non-kinase domain of Cdk4, containing a central amino-acid sequence, Pro-Arg-Gly-Pro-Arg-Pro (PRGPRP. An isolated hexapeptide with this sequence and its cyclic amphiphilic congeners are selectively lethal at high doses to a wide range of human cancer cell lines whilst sparing normal diploid keratinocytes and fibroblasts. Treated cancer cells do not exhibit the wide variability of dose response typically seen with other anticancer agents. Cancer cell killing by PRGPRP, in a cyclic amphiphilic cassette, requires cells to be in cycle but does not perturb cell cycle distribution and is accompanied by altered relative Cdk4/Cdk1 expression and selective decrease in ATP levels. Morphological features of apoptosis are absent and cancer cell death does not appear to involve autophagy. Conclusion These findings suggest a potential new paradigm for the development of broad-spectrum cancer specific therapeutics with

  7. A protein with amino acid sequence homology to bovine insulin is present in the legume Vigna unguiculata (cowpea

    Directory of Open Access Journals (Sweden)

    Venâncio T.M.


    Full Text Available Since the discovery of bovine insulin in plants, much effort has been devoted to the characterization of these proteins and elucidation of their functions. We report here the isolation of a protein with similar molecular mass and same amino acid sequence to bovine insulin from developing fruits of cowpea (Vigna unguiculata genotype Epace 10. Insulin was measured by ELISA using an anti-human insulin antibody and was detected both in empty pods and seed coats but not in the embryo. The highest concentrations (about 0.5 ng/µg of protein of the protein were detected in seed coats at 16 and 18 days after pollination, and the values were 1.6 to 4.0 times higher than those found for isolated pods tested on any day. N-terminal amino acid sequencing of insulin was performed on the protein purified by C4-HPLC. The significance of the presence of insulin in these plant tissues is not fully understood but we speculate that it may be involved in the transport of carbohydrate to the fruit.

  8. De novo sequencing of two novel peptides homologous to calcitonin-like peptides, from skin secretion of the Chinese Frog, Odorrana schmackeri

    Directory of Open Access Journals (Sweden)

    Geisa P.C. Evaristo


    Full Text Available An MS/MS based analytical strategy was followed to solve the complete sequence of two new peptides from frog (Odorrana schmackeri skin secretion. This involved reduction and alkylation with two different alkylating agents followed by high resolution tandem mass spectrometry. De novo sequencing was achieved by complementary CID and ETD fragmentations of full-length peptides and of selected tryptic fragments. Heavy and light isotope dimethyl labeling assisted with annotation of sequence ion series. The identified primary structures are GCD[I/L]STCATHN[I/L]VNE[I/L]NKFDKSKPSSGGVGPESP-NH2 and SCNLSTCATHNLVNELNKFDKSKPSSGGVGPESF-NH2, i.e. two carboxyamidated 34 residue peptides with an aminoterminal intramolecular ring structure formed by a disulfide bridge between Cys2 and Cys7. Edman degradation analysis of the second peptide positively confirmed the exact sequence, resolving I/L discriminations. Both peptide sequences are novel and share homology with calcitonin, calcitonin gene related peptide (CGRP and adrenomedullin from other vertebrates. Detailed sequence analysis as well as the 34 residue length of both O. schmackeri peptides, suggest they do not fully qualify as either calcitonins (32 residues or CGRPs (37 amino acids and may justify their classification in a novel peptide family within the calcitonin gene related peptide superfamily. Smooth muscle contractility assays with synthetic replicas of the S–S linked peptides on rat tail artery, uterus, bladder and ileum did not reveal myotropic activity.

  9. Nucleotide sequences of two cellulase genes from alkalophilic Bacillus sp. strain N-4 and their strong homology.


    Fukumori, F; Sashihara, N; Kudo, T; Horikoshi, K


    Two genes for cellulases of alkalophilic Bacillus sp. strain N-4 (ATCC 21833) have been sequenced. From the DNA sequences the cellulases encoded in the plasmids pNK1 and pNK2 consist of 488 and 409 amino acids, respectively. The DNA and protein sequences of the pNK1-encoded cellulase are related to those of the pNK2-encoded cellulase. The pNK2-encoded cellulase lacks the direct repeat sequence of a stretch of 60 amino acids near the C-terminal end of the pNK1-encoded cellulase. The duplicatio...

  10. PriFi - Using a Multiple Alignment of Related Sequences to Find Primers for  Amplification of Homologs

    DEFF Research Database (Denmark)

    Fredslund, Jakob; Schauser, Leif; Madsen, Lene Heegaard


    Using a comparative approach, the web program PriFi ( designs pairs of primers useful for PCR amplification of genomic DNA in species where prior sequence information is not available. The program works with an alignment of DNA sequences from phylog...

  11. Lectures on functor homology

    CERN Document Server

    Touzé, Antoine


    This book features a series of lectures that explores three different fields in which functor homology (short for homological algebra in functor categories) has recently played a significant role. For each of these applications, the functor viewpoint provides both essential insights and new methods for tackling difficult mathematical problems. In the lectures by Aurélien Djament, polynomial functors appear as coefficients in the homology of infinite families of classical groups, e.g. general linear groups or symplectic groups, and their stabilization. Djament’s theorem states that this stable homology can be computed using only the homology with trivial coefficients and the manageable functor homology. The series includes an intriguing development of Scorichenko’s unpublished results. The lectures by Wilberd van der Kallen lead to the solution of the general cohomological finite generation problem, extending Hilbert’s fourteenth problem and its solution to the context of cohomology. The focus here is o...

  12. Chemical shift homology in proteins

    International Nuclear Information System (INIS)

    Potts, Barbara C.M.; Chazin, Walter J.


    The degree of chemical shift similarity for homologous proteins has been determined from a chemical shift database of over 50 proteins representing a variety of families and folds, and spanning a wide range of sequence homologies. After sequence alignment, the similarity of the secondary chemical shifts of C α protons was examined as a function of amino acid sequence identity for 37 pairs of structurally homologous proteins. A correlation between sequence identity and secondary chemical shift rmsd was observed. Important insights are provided by examining the sequence identity of homologous proteins versus percentage of secondary chemical shifts that fall within 0.1 and 0.3 ppm thresholds. These results begin to establish practical guidelines for the extent of chemical shift similarity to expect among structurally homologous proteins

  13. PriFi - Using a Multiple Alignment of Related Sequences to Find Primers for  Amplification of Homologs

    DEFF Research Database (Denmark)

    Fredslund, Jakob; Schauser, Leif; Madsen, Lene Heegaard


    Using a comparative approach, the web program PriFi ( designs pairs of primers useful for PCR amplification of genomic DNA in species where prior sequence information is not available. The program works with an alignment of DNA sequences from...... of a procedure for developing general markers serving as common anchor loci across species. To accommodate users with special preferences, configuration settings and criteria can be customized....

  14. Homologies between the amino acid sequences of some vertebrate peptide hormones and peptides isolated from invertebrate sources. (United States)

    De Loof, A; Schoofs, L


    1. The 4K-prothoracicotropic hormone (PTTH) or bombyxin and the melanization-reddish coloration hormone of the silkworm Bombyx mori resemble insulin and insulin-like growth factors. 2. The family of adipokinetic/red pigment concentrating hormones has some similarity with glucagon. 3. Members of the FMRFamide family are found in vertebrates as well as in invertebrates. 4. In Locusta, a molecule immunologically and biologically related to amphibian melanophore stimulating hormone has been partially characterized. 5. Enkephalins and enkephalin-related peptides occur in insects and other invertebrates. 6. Peptides belonging to the tachykinin family have been isolated from molluscan (Octopus) salivary glands and from insect nervous tissue (Locusta migratoria). 7. Invertebrate arginine-vasotocin homologs have been isolated from an insect (Locusta migratoria) and from a mollusc (Conus). 8. In Leucophaea, Locusta and Drosophila, peptides resembling those of the vertebrate gastrin/cholecystokinin family have been identified. 9. As the number of different neuro-/gut peptides with possible function(s) as hormone, neurotransmitter or neuromodulator is now estimated to be of the order of a few hundred, more similarities will probably show up in the near future.

  15. FeatureMap3D - a tool to map protein features and sequence conservation onto homologous structures in the PDB

    DEFF Research Database (Denmark)

    Wernersson, Rasmus; Rapacki, Krzysztof; Stærfeldt, Hans Henrik


    FeatureMap3D is a web-based tool that maps protein features onto 3D structures. The user provides sequences annotated with any feature of interest, such as post-translational modifications, protease cleavage sites or exonic structure and FeatureMap3D will then search the Protein Data Bank (PDB) f...

  16. BLAT2DOLite: An Online System for Identifying Significant Relationships between Genetic Sequences and Diseases.

    Directory of Open Access Journals (Sweden)

    Liang Cheng

    Full Text Available The significantly related diseases of sequences could play an important role in understanding the functions of these sequences. In this paper, we introduced BLAT2DOLite, an online system for annotating human genes and diseases and identifying the significant relationships between sequences and diseases. Currently, BLAT2DOLite integrates Entrez Gene database and Disease Ontology Lite (DOLite, which contain loci of gene and relationships between genes and diseases. It utilizes hypergeometric test to calculate P-values between genes and diseases of DOLite. The system can be accessed from: The corresponding web service is described in:

  17. The influence of selection on the evolutionary distance estimated from the base changes observed between homologous nucleotide sequences. (United States)

    Otsuka, J; Kawai, Y; Sugaya, N


    In most studies of molecular evolution, the nucleotide base at a site is assumed to change with the apparent rate under functional constraint, and the comparison of base changes between homologous genes is thought to yield the evolutionary distance corresponding to the site-average change rate multiplied by the divergence time. However, this view is not sufficiently successful in estimating the divergence time of species, but mostly results in the construction of tree topology without a time-scale. In the present paper, this problem is investigated theoretically by considering that observed base changes are the results of comparing the survivals through selection of mutated bases. In the case of weak selection, the time course of base changes due to mutation and selection can be obtained analytically, leading to a theoretical equation showing how the selection has influence on the evolutionary distance estimated from the enumeration of base changes. This result provides a new method for estimating the divergence time more accurately from the observed base changes by evaluating both the strength of selection and the mutation rate. The validity of this method is verified by analysing the base changes observed at the third codon positions of amino acid residues with four-fold codon degeneracy in the protein genes of mammalian mitochondria; i.e. the ratios of estimated divergence times are fairly well consistent with a series of fossil records of mammals. Throughout this analysis, it is also suggested that the mutation rates in mitochondrial genomes are almost the same in different lineages of mammals and that the lineage-specific base-change rates indicated previously are due to the selection probably arising from the preference of transfer RNAs to codons.

  18. Frequency and organization of papA homologous DNA sequences among uropathogenic digalactoside-binding Escherichia coli strains.


    Denich, K; Craiu, A; Rugo, H; Muralidhar, G; O'Hanley, P


    The frequency of selected papA DNA sequences among 89 digalactoside-binding, uropathogenic Escherichia coli strains was evaluated with 12 different synthetic 15-base probes corresponding to papA genes from four digalactoside-binding piliated recombinant strains (HU849, 201B, and 200A). The papA probes encode amino acids which are common at the carboxy terminus of all strains, adjacent to the proximal portion of the intramolecular disulfide loop of strain 210B, or predicted to constitute the t...

  19. Rapid allopolyploid radiation of moonwort ferns (Botrychium; Ophioglossaceae) revealed by PacBio sequencing of homologous and homeologous nuclear regions. (United States)

    Dauphin, Benjamin; Grant, Jason R; Farrar, Donald R; Rothfels, Carl J


    Polyploidy is a major speciation process in vascular plants, and is postulated to be particularly important in shaping the diversity of extant ferns. However, limitations in the availability of bi-parental markers for ferns have greatly limited phylogenetic investigation of polyploidy in this group. With a large number of allopolyploid species, the genus Botrychium is a classic example in ferns where recurrent polyploidy is postulated to have driven frequent speciation events. Here, we use PacBio sequencing and the PURC bioinformatics pipeline to capture all homeologous or allelic copies of four long (∼1 kb) low-copy nuclear regions from a sample of 45 specimens (25 diploids and 20 polyploids) representing 37 Botrychium taxa, and three outgroups. This sample includes most currently recognized Botrychium species in Europe and North America, and the majority of our specimens were genotyped with co-dominant nuclear allozymes to ensure species identification. We analyzed the sequence data using maximum likelihood (ML) and Bayesian inference (BI) concatenated-data ("gene tree") approaches to explore the relationships among Botrychium species. Finally, we estimated divergence times among Botrychium lineages and inferred the multi-labeled polyploid species tree showing the origins of the polyploid taxa, and their relationships to each other and to their diploid progenitors. We found strong support for the monophyly of the major lineages within Botrychium and identified most of the parental donors of the polyploids; these results largely corroborate earlier morphological and allozyme-based investigations. Each polyploid had at least two distinct homeologs, indicating that all sampled polyploids are likely allopolyploids (rather than autopolyploids). Our divergence-time analyses revealed that these allopolyploid lineages originated recently-within the last two million years-and thus that the genus has undergone a recent radiation, correlated with multiple independent

  20. Testing statistical significance scores of sequence comparison methods with structure similarity

    Directory of Open Access Journals (Sweden)

    Leunissen Jack AM


    Full Text Available Abstract Background In the past years the Smith-Waterman sequence comparison algorithm has gained popularity due to improved implementations and rapidly increasing computing power. However, the quality and sensitivity of a database search is not only determined by the algorithm but also by the statistical significance testing for an alignment. The e-value is the most commonly used statistical validation method for sequence database searching. The CluSTr database and the Protein World database have been created using an alternative statistical significance test: a Z-score based on Monte-Carlo statistics. Several papers have described the superiority of the Z-score as compared to the e-value, using simulated data. We were interested if this could be validated when applied to existing, evolutionary related protein sequences. Results All experiments are performed on the ASTRAL SCOP database. The Smith-Waterman sequence comparison algorithm with both e-value and Z-score statistics is evaluated, using ROC, CVE and AP measures. The BLAST and FASTA algorithms are used as reference. We find that two out of three Smith-Waterman implementations with e-value are better at predicting structural similarities between proteins than the Smith-Waterman implementation with Z-score. SSEARCH especially has very high scores. Conclusion The compute intensive Z-score does not have a clear advantage over the e-value. The Smith-Waterman implementations give generally better results than their heuristic counterparts. We recommend using the SSEARCH algorithm combined with e-values for pairwise sequence comparisons.

  1. Transcriptome Sequencing Revealed Significant Alteration of Cortical Promoter Usage and Splicing in Schizophrenia (United States)

    Wu, Jing Qin; Wang, Xi; Beveridge, Natalie J.; Tooney, Paul A.; Scott, Rodney J.; Carr, Vaughan J.; Cairns, Murray J.


    Background While hybridization based analysis of the cortical transcriptome has provided important insight into the neuropathology of schizophrenia, it represents a restricted view of disease-associated gene activity based on predetermined probes. By contrast, sequencing technology can provide un-biased analysis of transcription at nucleotide resolution. Here we use this approach to investigate schizophrenia-associated cortical gene expression. Methodology/Principal Findings The data was generated from 76 bp reads of RNA-Seq, aligned to the reference genome and assembled into transcripts for quantification of exons, splice variants and alternative promoters in postmortem superior temporal gyrus (STG/BA22) from 9 male subjects with schizophrenia and 9 matched non-psychiatric controls. Differentially expressed genes were then subjected to further sequence and functional group analysis. The output, amounting to more than 38 Gb of sequence, revealed significant alteration of gene expression including many previously shown to be associated with schizophrenia. Gene ontology enrichment analysis followed by functional map construction identified three functional clusters highly relevant to schizophrenia including neurotransmission related functions, synaptic vesicle trafficking, and neural development. Significantly, more than 2000 genes displayed schizophrenia-associated alternative promoter usage and more than 1000 genes showed differential splicing (FDRschizophrenia-associated transcriptional diversity within the STG, and revealed variants with important implications for the complex pathophysiology of schizophrenia. PMID:22558445

  2. Transcriptome sequencing revealed significant alteration of cortical promoter usage and splicing in schizophrenia.

    Directory of Open Access Journals (Sweden)

    Jing Qin Wu

    Full Text Available While hybridization based analysis of the cortical transcriptome has provided important insight into the neuropathology of schizophrenia, it represents a restricted view of disease-associated gene activity based on predetermined probes. By contrast, sequencing technology can provide un-biased analysis of transcription at nucleotide resolution. Here we use this approach to investigate schizophrenia-associated cortical gene expression.The data was generated from 76 bp reads of RNA-Seq, aligned to the reference genome and assembled into transcripts for quantification of exons, splice variants and alternative promoters in postmortem superior temporal gyrus (STG/BA22 from 9 male subjects with schizophrenia and 9 matched non-psychiatric controls. Differentially expressed genes were then subjected to further sequence and functional group analysis. The output, amounting to more than 38 Gb of sequence, revealed significant alteration of gene expression including many previously shown to be associated with schizophrenia. Gene ontology enrichment analysis followed by functional map construction identified three functional clusters highly relevant to schizophrenia including neurotransmission related functions, synaptic vesicle trafficking, and neural development. Significantly, more than 2000 genes displayed schizophrenia-associated alternative promoter usage and more than 1000 genes showed differential splicing (FDR<0.05. Both types of transcriptional isoforms were exemplified by reads aligned to the neurodevelopmentally significant doublecortin-like kinase 1 (DCLK1 gene.This study provided the first deep and un-biased analysis of schizophrenia-associated transcriptional diversity within the STG, and revealed variants with important implications for the complex pathophysiology of schizophrenia.

  3. Development of an accident sequence precursor methodology and its application to significant accident precursors

    Energy Technology Data Exchange (ETDEWEB)

    Jang, Seung Hyun; Park, Sung Hyun; Jae, Moo Sung [Dept. of of Nuclear Engineering, Hanyang University, Seoul (Korea, Republic of)


    The systematic management of plant risk is crucial for enhancing the safety of nuclear power plants and for designing new nuclear power plants. Accident sequence precursor (ASP) analysis may be able to provide risk significance of operational experience by using probabilistic risk assessment to evaluate an operational event quantitatively in terms of its impact on core damage. In this study, an ASP methodology for two operation mode, full power and low power/shutdown operation, has been developed and applied to significant accident precursors that may occur during the operation of nuclear power plants. Two operational events, loss of feedwater and steam generator tube rupture, are identified as ASPs. Therefore, the ASP methodology developed in this study may contribute to identifying plant risk significance as well as to enhancing the safety of nuclear power plants by applying this methodology systematically.

  4. Computational Approach to Annotating Variants of Unknown Significance in Clinical Next Generation Sequencing. (United States)

    Schulz, Wade L; Tormey, Christopher A; Torres, Richard


    Next generation sequencing (NGS) has become a common technology in the clinical laboratory, particularly for the analysis of malignant neoplasms. However, most mutations identified by NGS are variants of unknown clinical significance (VOUS). Although the approach to define these variants differs by institution, software algorithms that predict variant effect on protein function may be used. However, these algorithms commonly generate conflicting results, potentially adding uncertainty to interpretation. In this review, we examine several computational tools used to predict whether a variant has clinical significance. In addition to describing the role of these tools in clinical diagnostics, we assess their efficacy in analyzing known pathogenic and benign variants in hematologic malignancies. Copyright© by the American Society for Clinical Pathology (ASCP).

  5. Significance of flow clustering and sequencing on sediment transport: 1D sediment transport modelling (United States)

    Hassan, Kazi; Allen, Deonie; Haynes, Heather


    This paper considers 1D hydraulic model data on the effect of high flow clusters and sequencing on sediment transport. Using observed flow gauge data from the River Caldew, England, a novel stochastic modelling approach was developed in order to create alternative 50 year flow sequences. Whilst the observed probability density of gauge data was preserved in all sequences, the order in which those flows occurred was varied using the output from a Hidden Markov Model (HMM) with generalised Pareto distribution (GP). In total, one hundred 50 year synthetic flow series were generated and used as the inflow boundary conditions for individual flow series model runs using the 1D sediment transport model HEC-RAS. The model routed graded sediment through the case study river reach to define the long-term morphological changes. Comparison of individual simulations provided a detailed understanding of the sensitivity of channel capacity to flow sequence. Specifically, each 50 year synthetic flow sequence was analysed using a 3-month, 6-month or 12-month rolling window approach and classified for clusters in peak discharge. As a cluster is described as a temporal grouping of flow events above a specified threshold, the threshold condition used herein is considered as a morphologically active channel forming discharge event. Thus, clusters were identified for peak discharges in excess of 10%, 20%, 50%, 100% and 150% of the 1 year Return Period (RP) event. The window of above-peak flows also required cluster definition and was tested for timeframes 1, 2, 10 and 30 days. Subsequently, clusters could be described in terms of the number of events, maximum peak flow discharge, cumulative flow discharge and skewness (i.e. a description of the flow sequence). The model output for each cluster was analysed for the cumulative flow volume and cumulative sediment transport (mass). This was then compared to the total sediment transport of a single flow event of equivalent flow volume

  6. Investigating homology between proteins using energetic profiles. (United States)

    Wrabl, James O; Hilser, Vincent J


    Accumulated experimental observations demonstrate that protein stability is often preserved upon conservative point mutation. In contrast, less is known about the effects of large sequence or structure changes on the stability of a particular fold. Almost completely unknown is the degree to which stability of different regions of a protein is generally preserved throughout evolution. In this work, these questions are addressed through thermodynamic analysis of a large representative sample of protein fold space based on remote, yet accepted, homology. More than 3,000 proteins were computationally analyzed using the structural-thermodynamic algorithm COREX/BEST. Estimated position-specific stability (i.e., local Gibbs free energy of folding) and its component enthalpy and entropy were quantitatively compared between all proteins in the sample according to all-vs.-all pairwise structural alignment. It was discovered that the local stabilities of homologous pairs were significantly more correlated than those of non-homologous pairs, indicating that local stability was indeed generally conserved throughout evolution. However, the position-specific enthalpy and entropy underlying stability were less correlated, suggesting that the overall regional stability of a protein was more important than the thermodynamic mechanism utilized to achieve that stability. Finally, two different types of statistically exceptional evolutionary structure-thermodynamic relationships were noted. First, many homologous proteins contained regions of similar thermodynamics despite localized structure change, suggesting a thermodynamic mechanism enabling evolutionary fold change. Second, some homologous proteins with extremely similar structures nonetheless exhibited different local stabilities, a phenomenon previously observed experimentally in this laboratory. These two observations, in conjunction with the principal conclusion that homologous proteins generally conserved local stability, may

  7. Investigating homology between proteins using energetic profiles.

    Directory of Open Access Journals (Sweden)

    James O Wrabl


    Full Text Available Accumulated experimental observations demonstrate that protein stability is often preserved upon conservative point mutation. In contrast, less is known about the effects of large sequence or structure changes on the stability of a particular fold. Almost completely unknown is the degree to which stability of different regions of a protein is generally preserved throughout evolution. In this work, these questions are addressed through thermodynamic analysis of a large representative sample of protein fold space based on remote, yet accepted, homology. More than 3,000 proteins were computationally analyzed using the structural-thermodynamic algorithm COREX/BEST. Estimated position-specific stability (i.e., local Gibbs free energy of folding and its component enthalpy and entropy were quantitatively compared between all proteins in the sample according to all-vs.-all pairwise structural alignment. It was discovered that the local stabilities of homologous pairs were significantly more correlated than those of non-homologous pairs, indicating that local stability was indeed generally conserved throughout evolution. However, the position-specific enthalpy and entropy underlying stability were less correlated, suggesting that the overall regional stability of a protein was more important than the thermodynamic mechanism utilized to achieve that stability. Finally, two different types of statistically exceptional evolutionary structure-thermodynamic relationships were noted. First, many homologous proteins contained regions of similar thermodynamics despite localized structure change, suggesting a thermodynamic mechanism enabling evolutionary fold change. Second, some homologous proteins with extremely similar structures nonetheless exhibited different local stabilities, a phenomenon previously observed experimentally in this laboratory. These two observations, in conjunction with the principal conclusion that homologous proteins generally conserved

  8. Relative K-homology and normal operators

    DEFF Research Database (Denmark)

    Manuilov, Vladimir; Thomsen, Klaus


    -term exact sequence which generalizes the excision six-term exact sequence in the first variable of KK-theory. Subsequently we investigate the relative K-homology which arises from the group of relative extensions by specializing to abelian $C^*$-algebras. It turns out that this relative K-homology carries...

  9. Dispersed repetitive sequences in eukaryotic genomes and their possible biological significance

    International Nuclear Information System (INIS)

    Georgiev, G.P.; Kramerov, D.A.; Ryskov, A.P.; Skryabin, K.G.; Lukanidin, E.M.


    In this paper is described the properties of a novel mouse mdg-like element, the A2 sequence, which is the most abundant repetitive sequence. We also characterized an ubiquitous B2 sequence that represents, after B1, the dominant family among the short interspersed repeats of the mouse genome. The existence of some putative transposition intermediates was shown for repeats of both A and B types of the mouse genome. These are closed circular DNA of the A type and small polyadenylated B + RNAs. The fundamental question that arises is whether these sequences are simply selfish DNA capable of transpositions or do they fulfill some useful biological functions within the genome. 66 references, 11 figures, 1 table

  10. Nucleotide sequence of the hexA gene for DNA mismatch repair in Streptococcus pneumoniae and homology of hexA to mutS of Escherichia coli and Salmonella typhimurium

    International Nuclear Information System (INIS)

    Priebe, S.D.; Hadi, S.M.; Greenberg, B.; Lacks, S.A.


    The Hex system of heteroduplex DNA base mismatch repair operates in Streptococcus pneumoniae after transformation and replication to correct donor and nascent DNA strands, respectively. A functionally similar system, called Mut, operates in Escherichia coli and Salmonella typhimurium. The nucleotide sequence of a 3.8-kilobase segment from the S. pneumoniae chromosome that includes the 2.7-kilobase hexA gene was determined. Chromosomal DNA used as donor to measure Hex phenotype was irradiated with UV light. An open reading frame that could encode a 17-kilodalton polypeptide (OrfC) was located just upstream of the gene encoding a polypeptide of 95 kilodaltons corresponding to HexA. Shine-Dalgarno sequences and putative promoters were identified upstream of each protein start site. Insertion mutations showed that only HexA functioned in mismatch repair and that the promoter for hexA transcription was located within the OrfC-coding region. The HexA polypeptide contains a consensus sequence for ATP- or GTP-binding sites in proteins. Comparison of the entire HexA protein sequence to that of MutS of S. typhimurium, showed the proteins to be homologous, inasmuch as 36% of their amino acid residues were identical. This homology indicates that the Hex and Mut systems of mismatch repair evolved from an ancestor common to the gram-positive streptococci and the gram-negative enterobacteria. It is the first direct evidence linking the two systems

  11. Cognitive Processes Underlying Nonnative Speech Production: The Significance of Recurrent Sequences. (United States)

    Oppenheim, Nancy

    This study was designed to identify whether advanced nonnative speakers of English rely on recurrent sequences to produce fluent speech in conformance with neural network theories and symbolic network theories; participants were 6 advanced, speaking and listening university students, aged 18-37 years (their native countries being Korea, Japan,…

  12. Light water reactor sequence timing: its significance to probabilistic safety assessment modeling

    International Nuclear Information System (INIS)

    Bley, D.C.; Buttemer, D.R.; Stetkar, J.W.


    This paper examines event sequence timing in light water reactor plants from the viewpoint of probabilistic safety assessment (PSA). The analytical basis for the ideas presented here come primarily from the authors' work in support of more than 20 PSA studies over the past several years. Timing effects are important for establishing success criteria for support and safety system response and for identifying the time available for operator recovery actions. The principal results of this paper are as follows: 1. Analysis of event sequence timing is necessary for meaningful probabilistic safety assessment - both the success criteria for systems performance and the probability of recovery are tightly linked to sequence timing. 2. Simple engineering analyses based on first principles are often sufficient to provide adequate resolution of the time available for recovery of PSA scenarios. Only those parameters that influence sequence timing and its variability and uncertainty need be examined. 3. Time available for recovery is the basic criterion for evaluation of human performance, whether time is an explicit parameter of the operator actions analysis or not. (author)

  13. Oxidative DNA damage in lung tissue from patients with COPD is clustered in functionally significant sequences

    Directory of Open Access Journals (Sweden)

    Viktor M Pastukh


    Full Text Available Viktor M Pastukh1, Li Zhang2, Mykhaylo V Ruchko1, Olena Gorodnya1, Gina C Bardwell1, Rubin M Tuder2, Mark N Gillespie11Department of Pharmacology and Center for Lung Biology, University of South Alabama College of Medicine, Mobile, AL, USA; 2Program in Translational Lung Research, Division of Pulmonary Sciences and Critical Care Medicine, Department of Medicine, University of Colorado at Denver, Aurora, CO, USAAbstract: Lung tissue from COPD patients displays oxidative DNA damage. The present study determined whether oxidative DNA damage was randomly distributed or whether it was localized in specific sequences in either the nuclear or mitochondrial genomes. The DNA damage-specific histone, gamma-H2AX, was detected immunohistochemically in alveolar wall cells in lung tissue from COPD patients but not control subjects. A PCR-based method was used to search for oxidized purine base products in selected 200 bp sequences in promoters and coding regions of the VEGF, TGF-β1, HO-1, Egr1, and β-actin genes while quantitative Southern blot analysis was used to detect oxidative damage to the mitochondrial genome in lung tissue from control subjects and COPD patients. Among the nuclear genes examined, oxidative damage was detected in only 1 sequence in lung tissue from COPD patients: the hypoxic response element (HRE of the VEGF promoter. The content of VEGF mRNA also was reduced in COPD lung tissue. Mitochondrial DNA content was unaltered in COPD lung tissue, but there was a substantial increase in mitochondrial DNA strand breaks and/or abasic sites. These findings show that oxidative DNA damage in COPD lungs is prominent in the HRE of the VEGF promoter and in the mitochondrial genome and raise the intriguing possibility that genome and sequence-specific oxidative DNA damage could contribute to transcriptional dysregulation and cell fate decisions in COPD.Keywords: DNA damage, VEGF hypoxic response element, mtDNA, COPD

  14. Comparative genomic sequence analysis of strawberry and other rosids reveals significant microsynteny

    Directory of Open Access Journals (Sweden)

    Abbott Albert


    Full Text Available Abstract Background Fragaria belongs to the Rosaceae, an economically important family that includes a number of important fruit producing genera such as Malus and Prunus. Using genomic sequences from 50 Fragaria fosmids, we have examined the microsynteny between Fragaria and other plant models. Results In more than half of the strawberry fosmids, we found syntenic regions that are conserved in Populus, Vitis, Medicago and/or Arabidopsis with Populus containing the greatest number of syntenic regions with Fragaria. The longest syntenic region was between LG VIII of the poplar genome and the strawberry fosmid 72E18, where seven out of twelve predicted genes were collinear. We also observed an unexpectedly high level of conserved synteny between Fragaria (rosid I and Vitis (basal rosid. One of the strawberry fosmids, 34E24, contained a cluster of R gene analogs (RGAs with NBS and LRR domains. We detected clusters of RGAs with high sequence similarity to those in 34E24 in all the genomes compared. In the phylogenetic tree we have generated, all the NBS-LRR genes grouped together with Arabidopsis CNL-A type NBS-LRR genes. The Fragaria RGA grouped together with those of Vitis and Populus in the phylogenetic tree. Conclusions Our analysis shows considerable microsynteny between Fragaria and other plant genomes such as Populus, Medicago, Vitis, and Arabidopsis to a lesser degree. We also detected a cluster of NBS-LRR type genes that are conserved in all the genomes compared.

  15. Diagnostic exome sequencing provides a molecular diagnosis for a significant proportion of patients with epilepsy. (United States)

    Helbig, Katherine L; Farwell Hagman, Kelly D; Shinde, Deepali N; Mroske, Cameron; Powis, Zöe; Li, Shuwei; Tang, Sha; Helbig, Ingo


    To assess the yield of diagnostic exome sequencing (DES) and to characterize the molecular findings in characterized and novel disease genes in patients with epilepsy. In an unselected sample of 1,131 patients referred for DES, overall results were compared between patients with and without epilepsy. DES results were examined based on age of onset and epilepsy diagnosis. Positive/likely positive results were identified in 112/293 (38.2%) epilepsy patients compared with 210/732 (28.7%) patients without epilepsy (P = 0.004). The diagnostic yield in characterized disease genes among patients with epilepsy was 33.4% (105/314). KCNQ2, MECP2, FOXG1, IQSEC2, KMT2A, and STXBP1 were most commonly affected by de novo alterations. Patients with epileptic encephalopathies had the highest rate of positive findings (43.4%). A likely positive novel genetic etiology was proposed in 14/200 (7%) patients with epilepsy; this frequency was highest in patients with epileptic encephalopathies (17%). Three genes (COQ4, DNM1, and PURA) were initially reported as likely positive novel disease genes and were subsequently corroborated in independent peer-reviewed publications. DES with analysis and interpretation of both characterized and novel genetic etiologies is a useful diagnostic tool in epilepsy, particularly in severe early-onset epilepsy. The reporting on novel genetic etiologies may further increase the diagnostic yield.Genet Med 18 9, 898-905.

  16. The Clinical Significance of the MIF Homolog D-Dopachrome Tautomerase (MIF-2) and its Circulating Receptor (sCD74) in Burn Injury (United States)

    Kim, Bong-Sung; Stoppe, Christian; Grieb, Gerrit; Leng, Lin; Sauler, Maor; Assis, David; Simons, David; Boecker, Arne Hendrick; Schulte, Wibke; Piecychna, Marta; Hager, Stephan; Bernhagen, Jürgen; Pallua, Norbert; Bucala, Richard


    Background We reported earlier that the cytokine macrophage migration inhibitory factor (MIF) is a potential biomarker in burn injury. In the present study, we investigated the clinical significance in severely burned patients of expression levels the newly discovered MIF family member D-dopachrome tautomerase (DDT or MIF-2) and their common soluble receptor CD74 (sCD74). Methods DDT and sCD74 serum levels were measured 20 severely burned patients and 20 controls. Serum levels were correlated to the abbreviated burn severity index (ABSI) and TBSA followed by receiver operating characteristic (ROC) analysis. Data were supported by gene expression dataset analysis of 31 burn patients and 28 healthy controls. Results CD74 and DDT were increased in burn patients. Furthermore, CD74 and DDT also were elevated in septic non-survivors when compared to survivors. Serum levels of DDT showed a positive correlation with the ABSI and TBSA in the early stage after burn injury, and the predictive character of DDT was strongest at 24 hrs. Serum levels of CD74 only correlated with the ABSI five days post-injury. Conclusions DDT may assist in the monitoring of clinical outcome and prediction of sepsis during the early post-burn period. sCD74 and MIF, by contrast, have limited value as an early predictor of death due to their delayed response to burn injury. PMID:27209369

  17. De novo sequencing of two novel peptides homologous to calcitonin-like peptides, from skin secretion of the Chinese Frog, Odorrana schmackeri

    NARCIS (Netherlands)

    Evaristo, Geisa P C; Pinkse, Martijn W H; Chen, Tianbao; Wang, Lei; Mohammed, Shabaz; Heck, Albert J R; Mathes, Isabella; Lottspeich, Friedrich; Shaw, Chris; Albar, Juan Pablo; Verhaert, Peter D E M


    An MS/MS based analytical strategy was followed to solve the complete sequence of two new peptides from frog (Odorrana schmackeri) skin secretion. This involved reduction and alkylation with two different alkylating agents followed by high resolution tandem mass spectrometry. De novo sequencing was

  18. Prefiltering Model for Homology Detection Algorithms on GPU. (United States)

    Retamosa, Germán; de Pedro, Luis; González, Ivan; Tamames, Javier


    Homology detection has evolved over the time from heavy algorithms based on dynamic programming approaches to lightweight alternatives based on different heuristic models. However, the main problem with these algorithms is that they use complex statistical models, which makes it difficult to achieve a relevant speedup and find exact matches with the original results. Thus, their acceleration is essential. The aim of this article was to prefilter a sequence database. To make this work, we have implemented a groundbreaking heuristic model based on NVIDIA's graphics processing units (GPUs) and multicore processors. Depending on the sensitivity settings, this makes it possible to quickly reduce the sequence database by factors between 50% and 95%, while rejecting no significant sequences. Furthermore, this prefiltering application can be used together with multiple homology detection algorithms as a part of a next-generation sequencing system. Extensive performance and accuracy tests have been carried out in the Spanish National Centre for Biotechnology (NCB). The results show that GPU hardware can accelerate the execution times of former homology detection applications, such as National Centre for Biotechnology Information (NCBI), Basic Local Alignment Search Tool for Proteins (BLASTP), up to a factor of 4.

  19. Pure homology of algebraic varieties


    Weber, Andrzej


    We show that for a complete complex algebraic variety the pure component of homology coincides with the image of intersection homology. Therefore pure homology is topologically invariant. To obtain slightly more general results we introduce "image homology" for noncomplete varieties.

  20. FastBLAST: homology relationships for millions of proteins.

    Directory of Open Access Journals (Sweden)

    Morgan N Price

    Full Text Available BACKGROUND: All-versus-all BLAST, which searches for homologous pairs of sequences in a database of proteins, is used to identify potential orthologs, to find new protein families, and to provide rapid access to these homology relationships. As DNA sequencing accelerates and data sets grow, all-versus-all BLAST has become computationally demanding. METHODOLOGY/PRINCIPAL FINDINGS: We present FastBLAST, a heuristic replacement for all-versus-all BLAST that relies on alignments of proteins to known families, obtained from tools such as PSI-BLAST and HMMer. FastBLAST avoids most of the work of all-versus-all BLAST by taking advantage of these alignments and by clustering similar sequences. FastBLAST runs in two stages: the first stage identifies additional families and aligns them, and the second stage quickly identifies the homologs of a query sequence, based on the alignments of the families, before generating pairwise alignments. On 6.53 million proteins from the non-redundant Genbank database ("NR", FastBLAST identifies new families 25 times faster than all-versus-all BLAST. Once the first stage is completed, FastBLAST identifies homologs for the average query in less than 5 seconds (8.6 times faster than BLAST and gives nearly identical results. For hits above 70 bits, FastBLAST identifies 98% of the top 3,250 hits per query. CONCLUSIONS/SIGNIFICANCE: FastBLAST enables research groups that do not have supercomputers to analyze large protein sequence data sets. FastBLAST is open source software and is available at

  1. Homologous alpha satellite sequences on human acrocentric chromosomes with selectivity for chromosomes 13, 14, and 21: implications for recombination between nonhomologues and Robertsonian translocations

    Energy Technology Data Exchange (ETDEWEB)

    Choo, K H; Vissel, B; Brown, R; Filby, R G; Earle, E


    The authors report a new subfamily of alpha satellite DNA (pTRA-2) which is found on all the human acrocentric chromosomes. The alphoid nature of the cloned DNA was established by partial sequencing. Southern analysis of restriction enzyme-digested DNA fragments from mouse/human hybrid cells containing only human chromosome 21 showed that the predominant higher-order repeating unit for pTRA-2 is a 3.9 kb structure. Analysis of a consensus in situ hybridization profile derived from 13 normal individuals revealed the localization of 73% of all centromeric autoradiographic grains over the five acrocentric chromosomes, with the following distribution: 20.4%, 21.5%, 17.1%, 7.3% and 6.5% on chromosomes 13, 14, 21, 15 and 22 respectively. An average of 1.4% of grains was found on the centromere of each of the remaining 19 nonacrocentric chromosomes. These results indicate the presence of a common subfamily of alpha satellite DNA on the five acrocentric chromosomes and suggest an evolutionary process consistent with recombination exchange of sequences between the nonhomologues. The results further suggests that such exchanges are more selective for chromosomes 13, 14 and 21 than for chromosomes 15 and 22. The possible role of centromeric alpha satellite DNA in the aetiology of 13q14q and 14q21q Robertsonian translocation involving the common and nonrandom association of chromosomes 13 and 14, and 14 and 21 is discussed.

  2. Two RNAs or DNAs May Artificially Fuse Together at a Short Homologous Sequence (SHS) during Reverse Transcription or Polymerase Chain Reactions, and Thus Reporting an SHS-Containing Chimeric RNA Requires Extra Caution (United States)

    Xie, Bingkun; Yang, Wei; Ouyang, Yongchang; Chen, Lichan; Jiang, Hesheng; Liao, Yuying; Liao, D. Joshua


    Tens of thousands of chimeric RNAs have been reported. Most of them contain a short homologous sequence (SHS) at the joining site of the two partner genes but are not associated with a fusion gene. We hypothesize that many of these chimeras may be technical artifacts derived from SHS-caused mis-priming in reverse transcription (RT) or polymerase chain reactions (PCR). We cloned six chimeric complementary DNAs (cDNAs) formed by human mitochondrial (mt) 16S rRNA sequences at an SHS, which were similar to several expression sequence tags (ESTs).These chimeras, which could not be detected with cDNA protection assay, were likely formed because some regions of the 16S rRNA are reversely complementary to another region to form an SHS, which allows the downstream sequence to loop back and anneal at the SHS to prime the synthesis of its complementary strand, yielding a palindromic sequence that can form a hairpin-like structure.We identified a 16S rRNA that ended at the 4th nucleotide(nt) of the mt-tRNA-leu was dominant and thus should be the wild type. We also cloned a mouse Bcl2-Nek9 chimeric cDNA that contained a 5-nt unmatchable sequence between the two partners, contained two copies of the reverse primer in the same direction but did not contain the forward primer, making it unclear how this Bcl2-Nek9 was formed and amplified. Moreover, a cDNA was amplified because one primer has 4 nts matched to the template, suggesting that there may be many more artificial cDNAs than we have realized, because the nuclear and mt genomes have many more 4-nt than 5-nt or longer homologues. Altogether, the chimeric cDNAs we cloned are good examples suggesting that many cDNAs may be artifacts due to SHS-caused mis-priming and thus greater caution should be taken when new sequence is obtained from a technique involving DNA polymerization. PMID:27148738

  3. Dualities in persistent (co)homology

    International Nuclear Information System (INIS)

    De Silva, Vin; Morozov, Dmitriy; Vejdemo-Johansson, Mikael


    We consider sequences of absolute and relative homology and cohomology groups that arise naturally for a filtered cell complex. We establish algebraic relationships between their persistence modules, and show that they contain equivalent information. We explain how one can use the existing algorithm for persistent homology to process any of the four modules, and relate it to a recently introduced persistent cohomology algorithm. We present experimental evidence for the practical efficiency of the latter algorithm

  4. Homological stabilizer codes

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, Jonas T., E-mail:


    In this paper we define homological stabilizer codes on qubits which encompass codes such as Kitaev's toric code and the topological color codes. These codes are defined solely by the graphs they reside on. This feature allows us to use properties of topological graph theory to determine the graphs which are suitable as homological stabilizer codes. We then show that all toric codes are equivalent to homological stabilizer codes on 4-valent graphs. We show that the topological color codes and toric codes correspond to two distinct classes of graphs. We define the notion of label set equivalencies and show that under a small set of constraints the only homological stabilizer codes without local logical operators are equivalent to Kitaev's toric code or to the topological color codes. - Highlights: Black-Right-Pointing-Pointer We show that Kitaev's toric codes are equivalent to homological stabilizer codes on 4-valent graphs. Black-Right-Pointing-Pointer We show that toric codes and color codes correspond to homological stabilizer codes on distinct graphs. Black-Right-Pointing-Pointer We find and classify all 2D homological stabilizer codes. Black-Right-Pointing-Pointer We find optimal codes among the homological stabilizer codes.

  5. Statistically significant dependence of the Xaa-Pro peptide bond conformation on secondary structure and amino acid sequence

    Directory of Open Access Journals (Sweden)

    Leitner Dietmar


    Full Text Available Abstract Background A reliable prediction of the Xaa-Pro peptide bond conformation would be a useful tool for many protein structure calculation methods. We have analyzed the Protein Data Bank and show that the combined use of sequential and structural information has a predictive value for the assessment of the cis versus trans peptide bond conformation of Xaa-Pro within proteins. For the analysis of the data sets different statistical methods such as the calculation of the Chou-Fasman parameters and occurrence matrices were used. Furthermore we analyzed the relationship between the relative solvent accessibility and the relative occurrence of prolines in the cis and in the trans conformation. Results One of the main results of the statistical investigations is the ranking of the secondary structure and sequence information with respect to the prediction of the Xaa-Pro peptide bond conformation. We observed a significant impact of secondary structure information on the occurrence of the Xaa-Pro peptide bond conformation, while the sequence information of amino acids neighboring proline is of little predictive value for the conformation of this bond. Conclusion In this work, we present an extensive analysis of the occurrence of the cis and trans proline conformation in proteins. Based on the data set, we derived patterns and rules for a possible prediction of the proline conformation. Upon adoption of the Chou-Fasman parameters, we are able to derive statistically relevant correlations between the secondary structure of amino acid fragments and the Xaa-Pro peptide bond conformation.

  6. Gene silencing of mannose 6-phosphate reductase in the parasitic weed Orobanche aegyptiaca through the production of homologous dsRNA sequences in the host plant. (United States)

    Aly, Radi; Cholakh, Hila; Joel, Daniel M; Leibman, Diana; Steinitz, Benjamin; Zelcer, Aaron; Naglis, Anna; Yarden, Oded; Gal-On, Amit


    Orobanche spp. (broomrape) are parasitic plants which subsist on the roots of a wide range of hosts, including tomato, causing severe losses in yield quality and quantity. Large amounts of mannitol accumulate in this parasitic weed during development. Mannose 6-phosphate reductase (M6PR) is a key enzyme in mannitol biosynthesis, and it has been suggested that mannitol accumulation may be very important for Orobanche development. Therefore, the Orobanche M6PR gene is a potential target for efforts to control this parasite. Transgenic tomato plants were produced bearing a gene construct containing a specific 277-bp fragment from Orobanche aegyptiaca M6PR-mRNA, in an inverted-repeat configuration. M6PR-siRNA was detected in three independent transgenic tomato lines in the R1 generation, but was not detected in the parasite. Quantitative RT-PCR analysis showed that the amount of endogenous M6PR mRNA in the tubercles and underground shoots of O. aegyptiaca grown on transgenic host plants was reduced by 60%-80%. Concomitant with M6PR mRNA suppression, there was a significant decrease in mannitol level and a significant increase in the percentage of dead O. aegyptiaca tubercles on the transgenic host plants. The detection of mir390, which is involved with cytoplasmic dsRNA processing, is the first indication of the existence of gene-silencing mechanisms in Orobanche spp. Gene silencing mechanisms are probably involved with the production of decreased levels of M6PR mRNA in the parasites grown on the transformed tomato lines.

  7. Syntenic homology of human unique DNA sequences within chromossome regions 5q31, 10q22, 13q32-33 and 19q13.1 in the great apes

    Directory of Open Access Journals (Sweden)

    Rhea U. Vallente-Samonte


    Full Text Available Homologies between chromosome banding patterns and DNA sequences in the great apes and humans suggest an apparent common origin for these two lineages. The availability of DNA probes for specific regions of human chromosomes (5q31, 10q22, 13q32-33 and 19q13.1 led us to cross-hybridize these to chimpanzee (Pan troglodytes, PTR, gorilla (Gorilla gorilla, GGO and orangutan (Pongo pygmaeus, PPY chromosomes in a search for equivalent regions in the great apes. Positive hybridization signals to the chromosome 5q31-specific DNA probe were observed at HSA 5q31, PTR 4q31, GGO 4q31 and PPY 4q31, while fluorescent signals using the chromosome 10q22-specific DNA probe were noted at HSA 10q22, PTR 8q22, GGO 8q22 and PPY 7q22. The chromosome arms showing hybridization signals to the Quint-EssentialTM 13-specific DNA probe were identified as HSA 13q32-33, PTR 14q32-33, GGO 14q32-33 and PPY 14q32-33, while those presenting hybridization signals to the chromosome 19q13.1-specific DNA probe were identified as HSA 19q13.1, PTR 20q13, GGO 20q13 and PPY 20q13. All four probes presumably hybridized to homologous chromosomal locations in the apes, which suggests a homology of certain unique DNA sequences among hominoid species.Homologias entre os padrões de bandamento de cromossomos e seqüências de DNA em grandes macacos e humanos sugerem uma aparente origem comum para estas duas linhagens. A disponibilidade de sondas de DNA para regiões específicas de cromossomos humanos (5q31, 10q22, 13q32-33 e 19q13.1 nos levou a realizar hibridação cruzada com cromossomos de chimpanzé (Pan troglodytes, PTR, gorila (Gorilla gorilla, GGO e orangotango (Pongo pygmaeus, PPY em um pesquisa de regiões equivalentes em grandes macacos. Sinais positivos de hibridação para a sonda de DNA específica para o cromossomo 5q31 foram observados em HSA 5q31, PTR 4q31, GGO 4q31 e PPY 4q31, enquanto que sinais fluorescentes usando a sonda de DNA específica para o cromossomo 10q22 foram

  8. On the long-lasting sequences of coral reef terraces from SE Sulawesi (Indonesia): Distribution, formation, and global significance (United States)

    Pedoja, Kevin; Husson, Laurent; Bezos, Antoine; Pastier, Anne-Morwenn; Imran, Andy Muhammad; Arias-Ruiz, Camilo; Sarr, Anta-Clarisse; Elliot, Mary; Pons-Branchu, Edwige; Nexer, Maëlle; Regard, Vincent; Hafidz, Abdul; Robert, Xavier; Benoit, Laurent; Delcaillau, Bernard; Authemayou, Christine; Dumoulin, Caroline; Choblet, Gaël


    Many islands of the eastern Indonesian Archipelago exhibit Late Cenozoic sequences of coral reef terraces. In SE Sulawesi, on the Tukang Besi and Buton archipelagos, we identified 23 islands bearing such sequences. Remote sensing imagery and field mapping combined to U/Th and 14C dating enable to establish a chronologic framework of the reef terrace sequences from Wangi-Wangi, Buton as well as on the neighbouring, smaller islands of Ular, Siumpu and Kadatua. We identified the terraces from the last interglacial maximum (MIS 5e) at elevations lower than 20 m except on W Kadatua where it is raised at 34 ± 5 m. Such elevations yield low to moderate Upper Pleistocene uplift rates (<0.3 mm yr-1). On SE Buton Island, a sequence culminates at 650 m and includes at least 40 undated strandlines. Next to this exceptional sequence, on the Sampolawa Peninsula, 18 strandlines culminate at 430 m. Dated samples at the base of this sequence (<40 m) yield mean Middle Pleistocene uplift rates of 0.14 ± 0.09 mm yr-1. Extrapolation of these uplift rates compared to the geological setting suggests that the sequences of the Sampolawa Peninsula provide a record of sea-level high-stands for the last 3.8 ± 0.6 Ma. The sequences on SE Buton Island therefore constitute the best preserved long-lasting geomorphic record of Plio-Quaternary sea-level stands worldwide.

  9. Molecular Cloning and Sequence Analysis of the Sta58 Major Antigen Gene of Rickettsia tsutsugamushi: Sequence homology and Antigenic Comparison of Sta58 to the 60-Kilodalton Family of Stress Proteins (United States)


    encoding the animals have shown that both cellular and humoral immune Sta58 protein antigen in E. coli. DNA sequence analysis of a responses occur after...infection, with the cellular immune 2.9-kilobase (kb) HindIl fragment carrying the Sta58 gene response being required for protection (16, 19, 25, 42...The first evidence of a 60-kDa common HtpB antigen) reacted strongly with protein antigens in the antigen family (Hsp6O) among procaryotes was based

  10. Geometric homology revisited


    Ruffino, Fabio Ferrari


    Given a cohomology theory, there is a well-known abstract way to define the dual homology theory using the theory of spectra. In [4] the author provides a more geometric construction of the homology theory, using a generalization of the bordism groups. Such a generalization involves in its definition the vector bundle modification, which is a particular case of the Gysin map. In this paper we provide a more natural variant of that construction, which replaces the vector bundle modification wi...

  11. CBH1 homologs and varian CBH1 cellulase

    Energy Technology Data Exchange (ETDEWEB)

    Goedegebuur, Frits; Gualfetti, Peter; Mitchinson, Colin; Neefe, Paulien


    Disclosed are a number of homologs and variants of Hypocrea jecorina Cel7A (formerly Trichoderma reesei cellobiohydrolase I or CBH1), nucleic acids encoding the same and methods for producing the same. The homologs and variant cellulases have the amino acid sequence of a glycosyl hydrolase of family 7A wherein one or more amino acid residues are substituted and/or deleted.

  12. Minimotif Miner 3.0: database expansion and significantly improved reduction of false-positive predictions from consensus sequences. (United States)

    Mi, Tian; Merlin, Jerlin Camilus; Deverasetty, Sandeep; Gryk, Michael R; Bill, Travis J; Brooks, Andrew W; Lee, Logan Y; Rathnayake, Viraj; Ross, Christian A; Sargeant, David P; Strong, Christy L; Watts, Paula; Rajasekaran, Sanguthevar; Schiller, Martin R


    Minimotif Miner (MnM available at or is an online database for identifying new minimotifs in protein queries. Minimotifs are short contiguous peptide sequences that have a known function in at least one protein. Here we report the third release of the MnM database which has now grown 60-fold to approximately 300,000 minimotifs. Since short minimotifs are by their nature not very complex we also summarize a new set of false-positive filters and linear regression scoring that vastly enhance minimotif prediction accuracy on a test data set. This online database can be used to predict new functions in proteins and causes of disease.

  13. Induction of homologous recombination in Saccharomyces cerevisiae. (United States)

    Simon, J R; Moore, P D


    We have investigated the effects of UV irradiation of Saccharomyces cerevisiae in order to distinguish whether UV-induced recombination results from the induction of enzymes required for homologous recombination, or the production of substrate sites for recombination containing regions of DNA damage. We utilized split-dose experiments to investigate the induction of proteins required for survival, gene conversion, and mutation in a diploid strain of S. cerevisiae. We demonstrate that inducing doses of UV irradiation followed by a 6 h period of incubation render the cells resistant to challenge doses of UV irradiation. The effects of inducing and challenge doses of UV irradiation upon interchromosomal gene conversion and mutation are strictly additive. Using the yeast URA3 gene cloned in non-replicating single- and double-stranded plasmid vectors that integrate into chromosomal genes upon transformation, we show that UV irradiation of haploid yeast cells and homologous plasmid DNA sequences each stimulate homologous recombination approximately two-fold, and that these effects are additive. Non-specific DNA damage has little effect on the stimulation of homologous recombination, as shown by studies in which UV-irradiated heterologous DNA was included in transformation/recombination experiments. We further demonstrate that the effect of competing single- and double-stranded heterologous DNA sequences differs in UV-irradiated and unirradiated cells, suggesting an induction of recombinational machinery in UV-irradiated S. cerevisiae cells.


    Directory of Open Access Journals (Sweden)

    Tatyana Victorovna Kozhanova


    Full Text Available Epilepsy is the most common serious neurological disorder, and there is a genetic basis in almost 50% of people with epilepsy. The diagnosis of genetic epilepsies makes to estimate reasons of seizures in the patient. Last decade has shown tremendous growth in gene sequencing technologies, which have made genetic tests available. The aim is to show significance of targeted exome sequencing and methods of data analysis in the diagnosis of hereditary syndromes leading to the development of epileptic encephalopathy. We examined 27 patients with с early EE (resistant to antiepileptic drugs, psychomotor and speech development delay in the psycho-neurological department. Targeted exome sequencing was performed for patients without a previously identified molecular diagnosis using 454 Sequencing GS Junior sequencer (Roche and IlluminaNextSeq 500 platform. As a result of the analysis, specific epilepsy genetic variants were diagnosed in 27 patients. The greatest number of cases was due to mutations in the SCN1A gene (7/27. The structure of mutations for other genes (mutations with a minor allele frequency of less than 0,5% are presented: ALDH7A1 (n=1, CACNA1C (n=1, CDKL5 (n=1, CNTNAP2 (n=2, DLGAP2 (n=2, DOCK7 (n=2, GRIN2B (n=2, HCN1 (n=1, NRXN1 (n=3, PCDH19 (n=1, RNASEH2B (n=2, SLC2A1 (n=1, UBE3A (n=1. The use of the exome sequencing in the genetic practice allows to significantly improve the effectiveness of medical genetic counseling, as it made possible to diagnose certain variants of genetically heterogeneous groups of diseases with similar of clinical manifestations.

  15. SANSparallel: interactive homology search against Uniprot. (United States)

    Somervuo, Panu; Holm, Liisa


    Proteins evolve by mutations and natural selection. The network of sequence similarities is a rich source for mining homologous relationships that inform on protein structure and function. There are many servers available to browse the network of homology relationships but one has to wait up to a minute for results. The SANSparallel webserver provides protein sequence database searches with immediate response and professional alignment visualization by third-party software. The output is a list, pairwise alignment or stacked alignment of sequence-similar proteins from Uniprot, UniRef90/50, Swissprot or Protein Data Bank. The stacked alignments are viewed in Jalview or as sequence logos. The database search uses the suffix array neighborhood search (SANS) method, which has been re-implemented as a client-server, improved and parallelized. The method is extremely fast and as sensitive as BLAST above 50% sequence identity. Benchmarks show that the method is highly competitive compared to previously published fast database search programs: UBLAST, DIAMOND, LAST, LAMBDA, RAPSEARCH2 and BLAT. The web server can be accessed interactively or programmatically at It can be used to make protein functional annotation pipelines more efficient, and it is useful in interactive exploration of the detailed evidence supporting the annotation of particular proteins of interest. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Regulation of homologous recombination at telomeres in budding yeast

    DEFF Research Database (Denmark)

    Eckert-Boulet, Nadine; Lisby, Michael


    Homologous recombination is suppressed at normal length telomere sequences. In contrast, telomere recombination is allowed when telomeres erode in the absence of telomerase activity or as a consequence of nucleolytic degradation or incomplete replication. Here, we review the mechanisms that contr...... that contribute to regulating mitotic homologous recombination at telomeres and the role of these mechanisms in signalling short telomeres in the budding yeast Saccharomyces cerevisiae....

  17. Characterization of a novel arginine catabolic mobile element (ACME) and staphylococcal chromosomal cassette mec composite island with significant homology to Staphylococcus epidermidis ACME type II in methicillin-resistant Staphylococcus aureus genotype ST22-MRSA-IV.

    LENUS (Irish Health Repository)

    Shore, Anna C


    The arginine catabolic mobile element (ACME) is prevalent among methicillin-resistant Staphylococcus aureus (MRSA) isolates of sequence type 8 (ST8) and staphylococcal chromosomal cassette mec (SCCmec) type IVa (USA300) (ST8-MRSA-IVa isolates), and evidence suggests that ACME enhances the ability of ST8-MRSA-IVa to grow and survive on its host. ACME has been identified in a small number of isolates belonging to other MRSA clones but is widespread among coagulase-negative staphylococci (CoNS). This study reports the first description of ACME in two distinct strains of the pandemic ST22-MRSA-IV clone. A total of 238 MRSA isolates recovered in Ireland between 1971 and 2008 were investigated for ACME using a DNA microarray. Twenty-three isolates (9.7%) were ACME positive, and all were either MRSA genotype ST8-MRSA-IVa (7\\/23, 30%) or MRSA genotype ST22-MRSA-IV (16\\/23, 70%). Whole-genome sequencing and comprehensive molecular characterization revealed the presence of a novel 46-kb ACME and staphylococcal chromosomal cassette mec (SCCmec) composite island (ACME\\/SCCmec-CI) in ST22-MRSA-IVh isolates (n=15). This ACME\\/SCCmec-CI consists of a 12-kb DNA region previously identified in ACME type II in S. epidermidis ATCC 12228, a truncated copy of the J1 region of SCCmec type I, and a complete SCCmec type IVh element. The composite island has a novel genetic organization, with ACME located within orfX and SCCmec located downstream of ACME. One PVL locus-positive ST22-MRSA-IVa isolate carried ACME located downstream of SCCmec type IVa, as previously described in ST8-MRSA-IVa. These results suggest that ACME has been acquired by ST22-MRSA-IV on two independent occasions. At least one of these instances may have involved horizontal transfer and recombination events between MRSA and CoNS. The presence of ACME may enhance dissemination of ST22-MRSA-IV, an already successful MRSA clone.

  18. Clustering evolving proteins into homologous families. (United States)

    Chan, Cheong Xin; Mahbob, Maisarah; Ragan, Mark A


    Clustering sequences into groups of putative homologs (families) is a critical first step in many areas of comparative biology and bioinformatics. The performance of clustering approaches in delineating biologically meaningful families depends strongly on characteristics of the data, including content bias and degree of divergence. New, highly scalable methods have recently been introduced to cluster the very large datasets being generated by next-generation sequencing technologies. However, there has been little systematic investigation of how characteristics of the data impact the performance of these approaches. Using clusters from a manually curated dataset as reference, we examined the performance of a widely used graph-based Markov clustering algorithm (MCL) and a greedy heuristic approach (UCLUST) in delineating protein families coded by three sets of bacterial genomes of different G+C content. Both MCL and UCLUST generated clusters that are comparable to the reference sets at specific parameter settings, although UCLUST tends to under-cluster compositionally biased sequences (G+C content 33% and 66%). Using simulated data, we sought to assess the individual effects of sequence divergence, rate heterogeneity, and underlying G+C content. Performance decreased with increasing sequence divergence, decreasing among-site rate variation, and increasing G+C bias. Two MCL-based methods recovered the simulated families more accurately than did UCLUST. MCL using local alignment distances is more robust across the investigated range of sequence features than are greedy heuristics using distances based on global alignment. Our results demonstrate that sequence divergence, rate heterogeneity and content bias can individually and in combination affect the accuracy with which MCL and UCLUST can recover homologous protein families. For application to data that are more divergent, and exhibit higher among-site rate variation and/or content bias, MCL may often be the better

  19. Characterization of a Novel Arginine Catabolic Mobile Element (ACME) and Staphylococcal Chromosomal Cassette mec Composite Island with Significant Homology to Staphylococcus epidermidis ACME type II in Methicillin-Resistant Staphylococcus aureus Genotype ST22-MRSA-IV.

    LENUS (Irish Health Repository)

    Shore, Anna C


    The arginine catabolic mobile element (ACME) is prevalent among ST8-MRSA-IVa (USA300) isolates and evidence suggests that ACME enhances the ability of ST8-MRSA-IVa to grow and survive on its host. ACME has been identified in a small number of isolates belonging to other MRSA clones but is widespread among coagulase-negative staphylococci (CoNS). This study reports the first description of ACME in two distinct strains of the pandemic ST22-MRSA-IV clone. A total of 238 MRSA isolates recovered in Ireland between 1971 and 2008 were investigated for ACME using a DNA microarray. Twenty-three isolates (9.7%) were ACME-positive, all were either MRSA genotype ST8-MRSA-IVa (7\\/23, 30%) or ST22-MRSA-IV (16\\/23, 70%). Whole-genome sequencing and comprehensive molecular characterization revealed the presence of a novel 46-kb ACME and SCCmec composite island (ACME\\/SCCmec-CI) in ST22-MRSA-IVh isolates (n = 15). This ACME\\/SCCmec-CI consists of a 12-kb DNA region previously identified in ACME type II in S. epidermidis ATCC 12228, a truncated copy of the J1 region of SCCmec I and a complete SCCmec IVh element. The composite island has a novel genetic organization with ACME located within orfX and SCCmec located downstream of ACME. One pvl-positive ST22-MRSA-IVa isolate carried ACME located downstream of SCCmec IVa as previously described in ST8-MRSA-IVa. These results suggest that ACME has been acquired by ST22-MRSA-IV on two independent occasions. At least one of these instances may have involved horizontal transfer and recombination events between MRSA and CoNS. The presence of ACME may enhance dissemination of ST22-MRSA-IV, an already successful MRSA clone.

  20. Nucleotide sequence analysis of the Legionella micdadei mip gene, encoding a 30-kilodalton analog of the Legionella pneumophila Mip protein

    DEFF Research Database (Denmark)

    Bangsborg, Jette Marie; Cianciotto, N P; Hindersson, P


    After the demonstration of analogs of the Legionella pneumophila macrophage infectivity potentiator (Mip) protein in other Legionella species, the Legionella micdadei mip gene was cloned and expressed in Escherichia coli. DNA sequence analysis of the L. micdadei mip gene contained in the plasmid p...... homology with the mip-like genes of several Legionella species. Furthermore, amino acid sequence comparisons revealed significant homology to two eukaryotic proteins with isomerase activity (FK506-binding proteins)....

  1. A novel mutation in TFL1 homolog affecting determinacy in cowpea (Vigna unguiculata). (United States)

    Dhanasekar, P; Reddy, K S


    Mutations in the widely conserved Arabidopsis Terminal Flower 1 (TFL1) gene and its homologs have been demonstrated to result in determinacy across genera, the knowledge of which is lacking in cowpea. Understanding the molecular events leading to determinacy of apical meristems could hasten development of cowpea varieties with suitable ideotypes. Isolation and characterization of a novel mutation in cowpea TFL1 homolog (VuTFL1) affecting determinacy is reported here for the first time. Cowpea TFL1 homolog was amplified using primers designed based on conserved sequences in related genera and sequence variation was analysed in three gamma ray-induced determinate mutants, their indeterminate parent "EC394763" and two indeterminate varieties. The analyses of sequence variation exposed a novel SNP distinguishing the determinate mutants from the indeterminate types. The non-synonymous point mutation in exon 4 at position 1,176 resulted from transversion of cytosine (C) to adenine (A) leading to an amino acid change (Pro-136 to His) in determinate mutants. The effect of the mutation on protein function and stability was predicted to be detrimental using different bioinformatics/computational tools. The functionally significant novel substitution mutation is hypothesized to affect determinacy in the cowpea mutants. Development of suitable regeneration protocols in this hitherto recalcitrant crop and subsequent complementation assay in mutants or over-expressing assay in parents could decisively conclude the role of the SNP in regulating determinacy in these cowpea mutants.

  2. Cloning and characterization of the ddc homolog encoding L-2,4-diaminobutyrate decarboxylase in Enterobacter aerogenes. (United States)

    Yamamoto, S; Mutoh, N; Tsuzuki, D; Ikai, H; Nakao, H; Shinoda, S; Narimatsu, S; Miyoshi, S I


    L-2,4-diaminobutyrate decarboxylase (DABA DC) catalyzes the formation of 1,3-diaminopropane (DAP) from DABA. In the present study, the ddc gene encoding DABA DC from Enterobacter aerogenes ATCC 13048 was cloned and characterized. Determination of the nucleotide sequence revealed an open reading frame of 1470 bp encoding a 53659-Da protein of 490 amino acids, whose deduced NH2-terminal sequence was identical to that of purified DABA DC from E. aerogenes. The deduced amino acid sequence was highly similar to those of Acinetobacter baumannii and Haemophilus influenzae DABA DCs encoded by the ddc genes. The lysine-307 of the E. aerogenes DABA DC was identified as the pyridoxal 5'-phosphate binding residue by site-directed mutagenesis. Furthermore, PCR analysis revealed the distribution of E. aerogenes ddc homologs in some other species of Enterobacteriaceae. Such a relatively wide occurrence of the ddc homologs implies biological significance of DABA DC and its product DAP.

  3. Gene Discovery through Genomic Sequencing of Brucella abortus (United States)

    Sánchez, Daniel O.; Zandomeni, Ruben O.; Cravero, Silvio; Verdún, Ramiro E.; Pierrou, Ester; Faccio, Paula; Diaz, Gabriela; Lanzavecchia, Silvia; Agüero, Fernán; Frasch, Alberto C. C.; Andersson, Siv G. E.; Rossetti, Osvaldo L.; Grau, Oscar; Ugalde, Rodolfo A.


    Brucella abortus is the etiological agent of brucellosis, a disease that affects bovines and human. We generated DNA random sequences from the genome of B. abortus strain 2308 in order to characterize molecular targets that might be useful for developing immunological or chemotherapeutic strategies against this pathogen. The partial sequencing of 1,899 clones allowed the identification of 1,199 genomic sequence surveys (GSSs) with high homology (BLAST expect value < 10−5) to sequences deposited in the GenBank databases. Among them, 925 represent putative novel genes for the Brucella genus. Out of 925 nonredundant GSSs, 470 were classified in 15 categories based on cellular function. Seven hundred GSSs showed no significant database matches and remain available for further studies in order to identify their function. A high number of GSSs with homology to Agrobacterium tumefaciens and Rhizobium meliloti proteins were observed, thus confirming their close phylogenetic relationship. Among them, several GSSs showed high similarity with genes related to nodule nitrogen fixation, synthesis of nod factors, nodulation protein symbiotic plasmid, and nodule bacteroid differentiation. We have also identified several B. abortus homologs of virulence and pathogenesis genes from other pathogens, including a homolog to both the Shda gene from Salmonella enterica serovar Typhimurium and the AidA-1 gene from Escherichia coli. Other GSSs displayed significant homologies to genes encoding components of the type III and type IV secretion machineries, suggesting that Brucella might also have an active type III secretion machinery. PMID:11159979

  4. Significant strain accumulation between the deformation front and landward out-of-sequence thrusts in accretionary wedge of SW Taiwan revealed by cGPS and SAR interferometry (United States)

    Tsai, M. C.


    High strain accumulation across the fold-and-thrust belt in Southwestern Taiwan are revealed by the Continuous GPS (cGPS) and SAR interferometry. This high strain is generally accommodated by the major active structures in fold-and-thrust belt of western Foothills in SW Taiwan connected to the accretionary wedge in the incipient are-continent collision zone. The active structures across the high strain accumulation include the deformation front around the Tainan Tableland, the Hochiali, Hsiaokangshan, Fangshan and Chishan faults. Among these active structures, the deformation pattern revealed from cGPS and SAR interferometry suggest that the Fangshan transfer fault may be a left-lateral fault zone with thrust component accommodating the westward differential motion of thrust sheets on both side of the fault. In addition, the Chishan fault connected to the splay fault bordering the lower-slope and upper-slope of the accretionary wedge which could be the major seismogenic fault and an out-of-sequence thrust fault in SW Taiwan. The big earthquakes resulted from the reactivation of out-of-sequence thrusts have been observed along the Nankai accretionary wedge, thus the assessment of the major seismogenic structures by strain accumulation between the frontal décollement and out-of-sequence thrusts is a crucial topic. According to the background seismicity, the low seismicity and mid-crust to mantle events are observed inland and the lower- and upper- slope domain offshore SW Taiwan, which rheologically implies the upper crust of the accretionary wedge is more or less aseimic. This result may suggest that the excess fluid pressure from the accretionary wedge not only has significantly weakened the prism materials as well as major fault zone, but also makes the accretionary wedge landward extension, which is why the low seismicity is observed in SW Taiwan area. Key words: Continuous GPS, SAR interferometry, strain rate, out-of-sequence thrust.

  5. MetaGO: Predicting Gene Ontology of Non-homologous Proteins Through Low-Resolution Protein Structure Prediction and Protein-Protein Network Mapping. (United States)

    Zhang, Chengxin; Zheng, Wei; Freddolino, Peter L; Zhang, Yang


    Homology-based transferal remains the major approach to computational protein function annotations, but it becomes increasingly unreliable when the sequence identity between query and template decreases below 30%. We propose a novel pipeline, MetaGO, to deduce Gene Ontology attributes of proteins by combining sequence homology-based annotation with low-resolution structure prediction and comparison, and partner's homology-based protein-protein network mapping. The pipeline was tested on a large-scale set of 1000 non-redundant proteins from the CAFA3 experiment. Under the stringent benchmark conditions where templates with >30% sequence identity to the query are excluded, MetaGO achieves average F-measures of 0.487, 0.408, and 0.598, for Molecular Function, Biological Process, and Cellular Component, respectively, which are significantly higher than those achieved by other state-of-the-art function annotations methods. Detailed data analysis shows that the major advantage of the MetaGO lies in the new functional homolog detections from partner's homology-based network mapping and structure-based local and global structure alignments, the confidence scores of which can be optimally combined through logistic regression. These data demonstrate the power of using a hybrid model incorporating protein structure and interaction networks to deduce new functional insights beyond traditional sequence homology-based referrals, especially for proteins that lack homologous function templates. The MetaGO pipeline is available at Copyright © 2018. Published by Elsevier Ltd.

  6. Mod two homology and cohomology

    CERN Document Server

    Hausmann, Jean-Claude


    Cohomology and homology modulo 2 helps the reader grasp more readily the basics of a major tool in algebraic topology. Compared to a more general approach to (co)homology this refreshing approach has many pedagogical advantages: It leads more quickly to the essentials of the subject, An absence of signs and orientation considerations simplifies the theory, Computations and advanced applications can be presented at an earlier stage, Simple geometrical interpretations of (co)chains. Mod 2 (co)homology was developed in the first quarter of the twentieth century as an alternative to integral homology, before both became particular cases of (co)homology with arbitrary coefficients. The first chapters of this book may serve as a basis for a graduate-level introductory course to (co)homology. Simplicial and singular mod 2 (co)homology are introduced, with their products and Steenrod squares, as well as equivariant cohomology. Classical applications include Brouwer's fixed point theorem, Poincaré duality, Borsuk-Ula...

  7. Compositional Homology and Creative Thinking

    Directory of Open Access Journals (Sweden)

    Salvatore Tedesco


    Full Text Available The concept of homology is the most solid theoretical basis elaborated by the morphological thinking during its history. The enucleation of some general criteria for the interpretation of homology is today a fundamental tool for life sciences, and for restoring their own opening to the question of qualitative innovation that arose so powerfully in the original Darwinian project. The aim of this paper is to verify the possible uses of the concept of compositional homology in order to provide of an adequate understanding of the dynamics of creative thinking.

  8. The OGCleaner: filtering false-positive homology clusters. (United States)

    Fujimoto, M Stanley; Suvorov, Anton; Jensen, Nicholas O; Clement, Mark J; Snell, Quinn; Bybee, Seth M


    Detecting homologous sequences in organisms is an essential step in protein structure and function prediction, gene annotation and phylogenetic tree construction. Heuristic methods are often employed for quality control of putative homology clusters. These heuristics, however, usually only apply to pairwise sequence comparison and do not examine clusters as a whole. We present the Orthology Group Cleaner (the OGCleaner), a tool designed for filtering putative orthology groups as homology or non-homology clusters by considering all sequences in a cluster. The OGCleaner relies on high-quality orthologous groups identified in OrthoDB to train machine learning algorithms that are able to distinguish between true-positive and false-positive homology groups. This package aims to improve the quality of phylogenetic tree construction especially in instances of lower-quality transcriptome assemblies. CONTACT: sfujimoto@gmail.comSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail:

  9. Productive Homologous and Non-homologous Recombination of Hepatitis C Virus in Cell Culture (United States)

    Li, Yi-Ping; Mikkelsen, Lotte S.; Gottwein, Judith M.; Bukh, Jens


    Genetic recombination is an important mechanism for increasing diversity of RNA viruses, and constitutes a viral escape mechanism to host immune responses and to treatment with antiviral compounds. Although rare, epidemiologically important hepatitis C virus (HCV) recombinants have been reported. In addition, recombination is an important regulatory mechanism of cytopathogenicity for the related pestiviruses. Here we describe recombination of HCV RNA in cell culture leading to production of infectious virus. Initially, hepatoma cells were co-transfected with a replicating JFH1ΔE1E2 genome (genotype 2a) lacking functional envelope genes and strain J6 (2a), which has functional envelope genes but does not replicate in culture. After an initial decrease in the number of HCV positive cells, infection spread after 13–36 days. Sequencing of recovered viruses revealed non-homologous recombinants with J6 sequence from the 5′ end to the NS2–NS3 region followed by JFH1 sequence from Core to the 3′ end. These recombinants carried duplicated sequence of up to 2400 nucleotides. HCV replication was not required for recombination, as recombinants were observed in most experiments even when two replication incompetent genomes were co-transfected. Reverse genetic studies verified the viability of representative recombinants. After serial passage, subsequent recombination events reducing or eliminating the duplicated region were observed for some but not all recombinants. Furthermore, we found that inter-genotypic recombination could occur, but at a lower frequency than intra-genotypic recombination. Productive recombination of attenuated HCV genomes depended on expression of all HCV proteins and tolerated duplicated sequence. In general, no strong site specificity was observed. Non-homologous recombination was observed in most cases, while few homologous events were identified. A better understanding of HCV recombination could help identification of natural recombinants

  10. Deep sequencing and flow cytometric characterization of expanded effector memory CD8+CD57+ T cells frequently reveals T-cell receptor Vβ oligoclonality and CDR3 homology in acquired aplastic anemia. (United States)

    Giudice, Valentina; Feng, Xingmin; Lin, Zenghua; Hu, Wei; Zhang, Fanmao; Qiao, Wangmin; Ibanez, Maria Del Pilar Fernandez; Rios, Olga; Young, Neal S


    Oligoclonal expansion of CD8 + CD28 - lymphocytes has been considered indirect evidence for a pathogenic immune response in acquired aplastic anemia. A subset of CD8 + CD28 - cells with CD57 expression, termed effector memory cells, is expanded in several immune-mediated diseases and may have a role in immune surveillance. We hypothesized that effector memory CD8 + CD28 - CD57 + cells may drive aberrant oligoclonal expansion in aplastic anemia. We found CD8 + CD57 + cells frequently expanded in the blood of aplastic anemia patients, with oligoclonal characteristics by flow cytometric Vβ usage analysis: skewing in 1-5 Vβ families and frequencies of immunodominant clones ranging from 1.98% to 66.5%. Oligoclonal characteristics were also observed in total CD8 + cells from aplastic anemia patients with CD8 + CD57 + cell expansion by T-cell receptor deep sequencing, as well as the presence of 1-3 immunodominant clones. Oligoclonality was confirmed by T-cell receptor repertoire deep sequencing of enriched CD8 + CD57 + cells, which also showed decreased diversity compared to total CD4 + and CD8 + cell pools. From analysis of complementarity-determining region 3 sequences in the CD8 + cell pool, a total of 29 sequences were shared between patients and controls, but these sequences were highly expressed in aplastic anemia subjects and also present in their immunodominant clones. In summary, expansion of effector memory CD8 + T cells is frequent in aplastic anemia and mirrors Vβ oligoclonal expansion. Flow cytometric Vβ usage analysis combined with deep sequencing technologies allows high resolution characterization of the T-cell receptor repertoire, and might represent a useful tool in the diagnosis and periodic evaluation of aplastic anemia patients. (Registered at identifiers: 00001620, 01623167, 00001397, 00071045, 00081523, 00961064 ). Copyright © 2018 Ferrata Storti Foundation.

  11. Complete Genome Sequences of Four Isolates of Plutella xylostella Granulovirus


    Spence, Robert J.; Noune, Christopher; Hauxwell, Caroline


    Granuloviruses are widespread pathogens of Plutella xylostella L. (diamondback moth) and potential biopesticides for control of this global insect pest. We report the complete genomes of four Plutella xylostella granulovirus isolates from China, Malaysia, and Taiwan exhibiting pairs of noncoding, homologous repeat regions with significant sequence variation but equivalent length.

  12. Complete Genome Sequences of Four Isolates of Plutella xylostella Granulovirus. (United States)

    Spence, Robert J; Noune, Christopher; Hauxwell, Caroline


    Granuloviruses are widespread pathogens of Plutella xylostella L. (diamondback moth) and potential biopesticides for control of this global insect pest. We report the complete genomes of four Plutella xylostella granulovirus isolates from China, Malaysia, and Taiwan exhibiting pairs of noncoding, homologous repeat regions with significant sequence variation but equivalent length. Copyright © 2016 Spence et al.

  13. Analysis of the role of homology arms in gene-targeting vectors in human cells.

    Directory of Open Access Journals (Sweden)

    Ayako Ishii

    Full Text Available Random integration of targeting vectors into the genome is the primary obstacle in human somatic cell gene targeting. Non-homologous end-joining (NHEJ, a major pathway for repairing DNA double-strand breaks, is thought to be responsible for most random integration events; however, absence of DNA ligase IV (LIG4, the critical NHEJ ligase, does not significantly reduce random integration frequency of targeting vector in human cells, indicating robust integration events occurring via a LIG4-independent mechanism. To gain insights into the mechanism and robustness of LIG4-independent random integration, we employed various types of targeting vectors to examine their integration frequencies in LIG4-proficient and deficient human cell lines. We find that the integration frequency of targeting vector correlates well with the length of homology arms and with the amount of repetitive DNA sequences, especially SINEs, present in the arms. This correlation was prominent in LIG4-deficient cells, but was also seen in LIG4-proficient cells, thus providing evidence that LIG4-independent random integration occurs frequently even when NHEJ is functionally normal. Our results collectively suggest that random integration frequency of conventional targeting vectors is substantially influenced by homology arms, which typically harbor repetitive DNA sequences that serve to facilitate LIG4-independent random integration in human cells, regardless of the presence or absence of functional NHEJ.

  14. A discriminative method for family-based protein remote homology detection that combines inductive logic programming and propositional models. (United States)

    Bernardes, Juliana S; Carbone, Alessandra; Zaverucha, Gerson


    Remote homology detection is a hard computational problem. Most approaches have trained computational models by using either full protein sequences or multiple sequence alignments (MSA), including all positions. However, when we deal with proteins in the "twilight zone" we can observe that only some segments of sequences (motifs) are conserved. We introduce a novel logical representation that allows us to represent physico-chemical properties of sequences, conserved amino acid positions and conserved physico-chemical positions in the MSA. From this, Inductive Logic Programming (ILP) finds the most frequent patterns (motifs) and uses them to train propositional models, such as decision trees and support vector machines (SVM). We use the SCOP database to perform our experiments by evaluating protein recognition within the same superfamily. Our results show that our methodology when using SVM performs significantly better than some of the state of the art methods, and comparable to other. However, our method provides a comprehensible set of logical rules that can help to understand what determines a protein function. The strategy of selecting only the most frequent patterns is effective for the remote homology detection. This is possible through a suitable first-order logical representation of homologous properties, and through a set of frequent patterns, found by an ILP system, that summarizes essential features of protein functions.

  15. Anisakis simplex complex: ecological significance of recombinant genotypes in an allopatric area of the Adriatic Sea inferred by genome-derived simple sequence repeats. (United States)

    Mladineo, Ivona; Trumbić, Željka; Radonić, Ivana; Vrbatović, Anamarija; Hrabar, Jerko; Bušelić, Ivana


    The genus Anisakis includes nine species which, due to close morphological resemblance even in the adult stage, have previously caused many issues in their correct identification. Recently observed interspecific hybridisation in sympatric areas of two closely related species, Anisakis simplex sensu stricto (s.s.) and Anisakis pegreffii, has raised concerns whether a F1 hybrid generation is capable of overriding the breeding barrier, potentially giving rise to more resistant/pathogenic strains infecting humans. To assess the ecological significance of anisakid genotypes in the Adriatic Sea, an allopatric area for the two above-mentioned species, we analysed data from PCR-RFLP genotyping of the ITS region and the sequence of the cytochrome oxidase 2 (cox2) mtDNA locus to discern the parental genotype and maternal haplotype of the individuals. Furthermore, using in silico genome-wide screening of the A. simplex database for polymorphic simple sequence repeats or microsatellites in non-coding regions, we randomly selected potentially informative loci that were tested and optimised for multiplex PCR. The first panel of microsatellites developed for Anisakis was shown to be highly polymorphic, sensitive and amplified in both A. simplex s.s. and A. pegreffii. It was used to inspect genetic differentiation of individuals showing mito-nuclear mosaicism which is characteristic for both species. The observed low level of intergroup heterozygosity suggests that existing mosaicism is likely a retention of an ancestral polymorphism rather than a recent recombination event. This is also supported by allopatry of pure A. simplex s.s. and A. pegreffii in the geographical area under study. Copyright © 2017 Australian Society for Parasitology. Published by Elsevier Ltd. All rights reserved.

  16. Persistent homology of complex networks

    International Nuclear Information System (INIS)

    Horak, Danijela; Maletić, Slobodan; Rajković, Milan


    Long-lived topological features are distinguished from short-lived ones (considered as topological noise) in simplicial complexes constructed from complex networks. A new topological invariant, persistent homology, is determined and presented as a parameterized version of a Betti number. Complex networks with distinct degree distributions exhibit distinct persistent topological features. Persistent topological attributes, shown to be related to the robust quality of networks, also reflect the deficiency in certain connectivity properties of networks. Random networks, networks with exponential connectivity distribution and scale-free networks were considered for homological persistency analysis

  17. Re-analysis of RNA-Sequencing Data on Apple Stem Grooving Virus infected Apple reveals more significant differentially expressed genes

    Directory of Open Access Journals (Sweden)

    Bipin Balan


    Full Text Available RNA sequencing (RNA-Seq technology has enabled the researchers to investigate the host global gene expression changes in plant-virus interactions which helped to understand the molecular basis of virus diseases. The re-analysis of RNA-Seq studies using most updated genome version and the available best analysis pipeline will produce most accurate results. In this study, we re-analysed the Apple stem grooving virus (ASGV infected apple shoots in comparison with that of virus-free in vitro shoots [1] using the most updated Malus x domestica genome downloaded from Phytozome database. The re-analysis was done by using HISAT2 software and Cufflinks program was used to mine the differentially expressed genes. We found that ~20% more reads was mapped to the latest genome using the updated pipeline, which proved the significance of such re-analysis. The comparison of the updated results with that of previous was done. In addition, we performed protein-protein interaction (PPI to investigate the proteins affected by ASGV infection.

  18. Productive homologous and non-homologous recombination of hepatitis C virus in cell culture

    DEFF Research Database (Denmark)

    Scheel, Troels K H; Galli, Andrea; Li, Yi-Ping


    . In addition, recombination is an important regulatory mechanism of cytopathogenicity for the related pestiviruses. Here we describe recombination of HCV RNA in cell culture leading to production of infectious virus. Initially, hepatoma cells were co-transfected with a replicating JFH1ΔE1E2 genome (genotype 2a......) lacking functional envelope genes and strain J6 (2a), which has functional envelope genes but does not replicate in culture. After an initial decrease in the number of HCV positive cells, infection spread after 13-36 days. Sequencing of recovered viruses revealed non-homologous recombinants with J6...

  19. Homological stability of diffeomorphism groups

    DEFF Research Database (Denmark)

    Berglund, Alexander; Madsen, Ib Henning


    In this paper we prove a stability theorem for block diffeomorphisms of 2d -dimensional manifolds that are connected sums of S d ×S d . Combining this with a recent theorem of S. Galatius and O. Randal-Williams and Morlet’s lemma of disjunction, we determine the homology of the classifying space ...

  20. Significant Association between Sulfate-Reducing Bacteria and Uranium-Reducing Microbial Communities as Revealed by a Combined Massively Parallel Sequencing-Indicator Species Approach▿ † (United States)

    Cardenas, Erick; Wu, Wei-Min; Leigh, Mary Beth; Carley, Jack; Carroll, Sue; Gentry, Terry; Luo, Jian; Watson, David; Gu, Baohua; Ginder-Vogel, Matthew; Kitanidis, Peter K.; Jardine, Philip M.; Zhou, Jizhong; Criddle, Craig S.; Marsh, Terence L.; Tiedje, James M.


    Massively parallel sequencing has provided a more affordable and high-throughput method to study microbial communities, although it has mostly been used in an exploratory fashion. We combined pyrosequencing with a strict indicator species statistical analysis to test if bacteria specifically responded to ethanol injection that successfully promoted dissimilatory uranium(VI) reduction in the subsurface of a uranium contamination plume at the Oak Ridge Field Research Center in Tennessee. Remediation was achieved with a hydraulic flow control consisting of an inner loop, where ethanol was injected, and an outer loop for flow-field protection. This strategy reduced uranium concentrations in groundwater to levels below 0.126 μM and created geochemical gradients in electron donors from the inner-loop injection well toward the outer loop and downgradient flow path. Our analysis with 15 sediment samples from the entire test area found significant indicator species that showed a high degree of adaptation to the three different hydrochemical-created conditions. Castellaniella and Rhodanobacter characterized areas with low pH, heavy metals, and low bioactivity, while sulfate-, Fe(III)-, and U(VI)-reducing bacteria (Desulfovibrio, Anaeromyxobacter, and Desulfosporosinus) were indicators of areas where U(VI) reduction occurred. The abundance of these bacteria, as well as the Fe(III) and U(VI) reducer Geobacter, correlated with the hydraulic connectivity to the substrate injection site, suggesting that the selected populations were a direct response to electron donor addition by the groundwater flow path. A false-discovery-rate approach was implemented to discard false-positive results by chance, given the large amount of data compared. PMID:20729318

  1. Significant association between sulfate-reducing bacteria and uranium-reducing microbial communities as revealed by a combined massively parallel sequencing-indicator species approach. (United States)

    Cardenas, Erick; Wu, Wei-Min; Leigh, Mary Beth; Carley, Jack; Carroll, Sue; Gentry, Terry; Luo, Jian; Watson, David; Gu, Baohua; Ginder-Vogel, Matthew; Kitanidis, Peter K; Jardine, Philip M; Zhou, Jizhong; Criddle, Craig S; Marsh, Terence L; Tiedje, James M


    Massively parallel sequencing has provided a more affordable and high-throughput method to study microbial communities, although it has mostly been used in an exploratory fashion. We combined pyrosequencing with a strict indicator species statistical analysis to test if bacteria specifically responded to ethanol injection that successfully promoted dissimilatory uranium(VI) reduction in the subsurface of a uranium contamination plume at the Oak Ridge Field Research Center in Tennessee. Remediation was achieved with a hydraulic flow control consisting of an inner loop, where ethanol was injected, and an outer loop for flow-field protection. This strategy reduced uranium concentrations in groundwater to levels below 0.126 μM and created geochemical gradients in electron donors from the inner-loop injection well toward the outer loop and downgradient flow path. Our analysis with 15 sediment samples from the entire test area found significant indicator species that showed a high degree of adaptation to the three different hydrochemical-created conditions. Castellaniella and Rhodanobacter characterized areas with low pH, heavy metals, and low bioactivity, while sulfate-, Fe(III)-, and U(VI)-reducing bacteria (Desulfovibrio, Anaeromyxobacter, and Desulfosporosinus) were indicators of areas where U(VI) reduction occurred. The abundance of these bacteria, as well as the Fe(III) and U(VI) reducer Geobacter, correlated with the hydraulic connectivity to the substrate injection site, suggesting that the selected populations were a direct response to electron donor addition by the groundwater flow path. A false-discovery-rate approach was implemented to discard false-positive results by chance, given the large amount of data compared.

  2. Homology groups for particles on one-connected graphs (United States)

    MaciÄ Żek, Tomasz; Sawicki, Adam


    We present a mathematical framework for describing the topology of configuration spaces for particles on one-connected graphs. In particular, we compute the homology groups over integers for different classes of one-connected graphs. Our approach is based on some fundamental combinatorial properties of the configuration spaces, Mayer-Vietoris sequences for different parts of configuration spaces, and some limited use of discrete Morse theory. As one of the results, we derive the closed-form formulae for ranks of the homology groups for indistinguishable particles on tree graphs. We also give a detailed discussion of the second homology group of the configuration space of both distinguishable and indistinguishable particles. Our motivation is the search for new kinds of quantum statistics.

  3. Acetylcholine Receptor: Complex of Homologous Subunits (United States)

    Raftery, Michael A.; Hunkapiller, Michael W.; Strader, Catherine D.; Hood, Leroy E.


    The acetylcholine receptor from the electric ray Torpedo californica is composed of five subunits; two are identical and the other three are structurally related to them. Microsequence analysis of the four polypeptides demonstrates amino acid homology among the subunits. Further sequence analysis of both membrane-bound and Triton-solubilized, chromatographically purified receptor gave the stoichiometry of the four subunits (40,000:50,000:60,000:65,000 daltons) as 2:1:1:1, indicating that this protein is a pentameric complex with a molecular weight of 255,000 daltons. Genealogical analysis suggests that divergence from a common ancestral gene occurred early in the evolution of the receptor. This shared ancestry argues that each of the four subunits plays a functional role in the receptor's physiological action.

  4. Improving model construction of profile HMMs for remote homology detection through structural alignment

    Directory of Open Access Journals (Sweden)

    Zaverucha Gerson


    Full Text Available Abstract Background Remote homology detection is a challenging problem in Bioinformatics. Arguably, profile Hidden Markov Models (pHMMs are one of the most successful approaches in addressing this important problem. pHMM packages present a relatively small computational cost, and perform particularly well at recognizing remote homologies. This raises the question of whether structural alignments could impact the performance of pHMMs trained from proteins in the Twilight Zone, as structural alignments are often more accurate than sequence alignments at identifying motifs and functional residues. Next, we assess the impact of using structural alignments in pHMM performance. Results We used the SCOP database to perform our experiments. Structural alignments were obtained using the 3DCOFFEE and MAMMOTH-mult tools; sequence alignments were obtained using CLUSTALW, TCOFFEE, MAFFT and PROBCONS. We performed leave-one-family-out cross-validation over super-families. Performance was evaluated through ROC curves and paired two tailed t-test. Conclusion We observed that pHMMs derived from structural alignments performed significantly better than pHMMs derived from sequence alignment in low-identity regions, mainly below 20%. We believe this is because structural alignment tools are better at focusing on the important patterns that are more often conserved through evolution, resulting in higher quality pHMMs. On the other hand, sensitivity of these tools is still quite low for these low-identity regions. Our results suggest a number of possible directions for improvements in this area.

  5. Improving model construction of profile HMMs for remote homology detection through structural alignment. (United States)

    Bernardes, Juliana S; Dávila, Alberto M R; Costa, Vítor S; Zaverucha, Gerson


    Remote homology detection is a challenging problem in Bioinformatics. Arguably, profile Hidden Markov Models (pHMMs) are one of the most successful approaches in addressing this important problem. pHMM packages present a relatively small computational cost, and perform particularly well at recognizing remote homologies. This raises the question of whether structural alignments could impact the performance of pHMMs trained from proteins in the Twilight Zone, as structural alignments are often more accurate than sequence alignments at identifying motifs and functional residues. Next, we assess the impact of using structural alignments in pHMM performance. We used the SCOP database to perform our experiments. Structural alignments were obtained using the 3DCOFFEE and MAMMOTH-mult tools; sequence alignments were obtained using CLUSTALW, TCOFFEE, MAFFT and PROBCONS. We performed leave-one-family-out cross-validation over super-families. Performance was evaluated through ROC curves and paired two tailed t-test. We observed that pHMMs derived from structural alignments performed significantly better than pHMMs derived from sequence alignment in low-identity regions, mainly below 20%. We believe this is because structural alignment tools are better at focusing on the important patterns that are more often conserved through evolution, resulting in higher quality pHMMs. On the other hand, sensitivity of these tools is still quite low for these low-identity regions. Our results suggest a number of possible directions for improvements in this area.

  6. Using relational databases for improved sequence similarity searching and large-scale genomic analyses. (United States)

    Mackey, Aaron J; Pearson, William R


    Relational databases are designed to integrate diverse types of information and manage large sets of search results, greatly simplifying genome-scale analyses. Relational databases are essential for management and analysis of large-scale sequence analyses, and can also be used to improve the statistical significance of similarity searches by focusing on subsets of sequence libraries most likely to contain homologs. This unit describes using relational databases to improve the efficiency of sequence similarity searching and to demonstrate various large-scale genomic analyses of homology-related data. This unit describes the installation and use of a simple protein sequence database, seqdb_demo, which is used as a basis for the other protocols. These include basic use of the database to generate a novel sequence library subset, how to extend and use seqdb_demo for the storage of sequence similarity search results and making use of various kinds of stored search results to address aspects of comparative genomic analysis.

  7. Homologs of the Acinetobacter baumannii AceI transporter represent a new family of bacterial multidrug efflux systems. (United States)

    Hassan, Karl A; Liu, Qi; Henderson, Peter J F; Paulsen, Ian T


    Multidrug efflux systems are a major cause of resistance to antimicrobials in bacteria, including those pathogenic to humans, animals, and plants. These proteins are ubiquitous in these pathogens, and five families of bacterial multidrug efflux systems have been identified to date. By using transcriptomic and biochemical analyses, we recently identified the novel AceI (Acinetobacter chlorhexidine efflux) protein from Acinetobacter baumannii that conferred resistance to the biocide chlorhexidine, via an active efflux mechanism. Proteins homologous to AceI are encoded in the genomes of many other bacterial species and are particularly prominent within proteobacterial lineages. In this study, we expressed 23 homologs of AceI and examined their resistance and/or transport profiles. MIC analyses demonstrated that, like AceI, many of the homologs conferred resistance to chlorhexidine. Many of the AceI homologs conferred resistance to additional biocides, including benzalkonium, dequalinium, proflavine, and acriflavine. We conducted fluorimetric transport assays using the AceI homolog from Vibrio parahaemolyticus and confirmed that resistance to both proflavine and acriflavine was mediated by an active efflux mechanism. These results show that this group of AceI homologs represent a new family of bacterial multidrug efflux pumps, which we have designated the proteobacterial antimicrobial compound efflux (PACE) family of transport proteins. Bacterial multidrug efflux pumps are an important class of resistance determinants that can be found in every bacterial genome sequenced to date. These transport proteins have important protective functions for the bacterial cell but are a significant problem in the clinical setting, since a single efflux system can mediate resistance to many structurally and mechanistically diverse antibiotics and biocides. In this study, we demonstrate that proteins related to the Acinetobacter baumannii AceI transporter are a new class of multidrug

  8. Sequence stratigraphic and sedimentologic significance of biogenic structures from a late Paleozoic marginal- to open-marine reservoir, Morrow Sandstone, subsurface of southwest Kansas, USA (United States)

    Buatois, L.A.; Mangano, M.G.; Alissa, A.; Carr, T.R.


    high diversity of biogenic structures representing the activity of a benthic fauna developed under normal salinity conditions. Trace fossil and facies analyses allow environmental subdivision of the shoreface-offshore successions and suggest deposition in a weakly storm-affected nearshore area. An onshore-offshore replacement of the Skolithos ichnofacies by the Cruziana ichnofacies is clearly displayed. The lower Morrow fluvio-estuarine valley was incised during a drop of sea level coincident with the Mississippian-Pennsylvanian transition, but was mostly filled during a subsequent transgression. The transgressive nature of the estuarine infill is further indicated by the upward replacement of depauperate brackish-water trace fossil assemblages by the open-marine Cruziana ichnofacies. Additional stratal surfaces of allostratigraphic significance identified within the estuary include the bayline surface, the tidal ravinement surface, the wave ravinement surface, and a basinwide flooding surface recording inundation of the valley interfluves. A younger sequence boundary within the lower Morrow is also recorded in the Gentzler field at the base of a forced regression shoreface, demarcated by the firmground Glossifungites ichnofacies, indicating a rapid basinward facies migration during a sea-level drop. Trace fossil models derived from the analysis of Mesozoic and Cenozoic reservoirs are generally applicable to the study of these late Paleozoic reservoirs. Pennsylvanian brackish-water facies differ ichnologically from their post-Paleozoic counterparts, however, in that they have: (1) lower trace fossil diversity, (2) lower degree of bioturbation, (3) scarcity of crustacean burrows, (4) absence of firmground suites, and (5) absence of ichnotaxa displaying specific architectures designed to protect the tracemaker from salinity fluctuations. Morrow open-marine ichnofaunas closely resemble their post-Paleozoic equivalents. ?? 2002 Elsevier Science B.V. All rights reserved.

  9. Homological algebra in -abelian categories

    Indian Academy of Sciences (India)

    Deren Luo


    Aug 16, 2017 ... Homological algebra in n-abelian categories. 627. We recall the Comparison lemma, together with its dual, plays a central role in the sequel. Lemma 2.1 [13, Comparison lemma 2.1]. Let C be an additive category and X ∈ Ch. ≥0(C) a complex such that for all k ≥ 0the morphism dk+1. X is a weak cokernel ...

  10. Evolution of pH buffers and water homeostasis in eukaryotes: homology between humans and Acanthamoeba proteins. (United States)

    Baig, Abdul M; Zohaib, R; Tariq, S; Ahmad, H R


    This study intended to trace the evolution of acid-base buffers and water homeostasis in eukaryotes. Acanthamoeba castellanii  was selected as a model unicellular eukaryote for this purpose. Homologies of proteins involved in pH and water regulatory mechanisms at cellular levels were compared between humans and A. castellanii. Amino acid sequence homology, structural homology, 3D modeling and docking prediction were done to show the extent of similarities between carbonic anhydrase 1 (CA1), aquaporin (AQP), band-3 protein and H + pump. Experimental assays were done with acetazolamide (AZM), brinzolamide and mannitol to observe their effects on the trophozoites of  A. castellanii.  The human CA1, AQP, band-3 protein and H + -transport proteins revealed similar proteins in Acanthamoeba. Docking showed the binding of AZM on amoebal AQP-like proteins.  Acanthamoeba showed transient shape changes and encystation at differential doses of brinzolamide, mannitol and AZM.  Conclusion: Water and pH regulating adapter proteins in Acanthamoeba and humans show significant homology, these mechanisms evolved early in the primitive unicellular eukaryotes and have remained conserved in multicellular eukaryotes.

  11. Remarkable phylogenetic resolution of the most complex clade of Cyprinidae (Teleostei: Cypriniformes): a proof of concept of homology assessment and partitioning sequence data integrated with mixed model Bayesian analyses. (United States)

    Tao, Wenjing; Mayden, Richard L; He, Shunping


    Despite many efforts to resolve evolutionary relationships among major clades of Cyprinidae, some nodes have been especially problematic and remain unresolved. In this study, we employ four nuclear gene fragments (3.3kb) to infer interrelationships of the Cyprinidae. A reconstruction of the phylogenetic relationships within the family using maximum parsimony, maximum likelihood, and Bayesian analyses is presented. Among the taxa within the monophyletic Cyprinidae, Rasborinae is the basal-most lineage; Cyprinine is sister to Leuciscine. The monophyly for the subfamilies Gobioninae, Leuciscinae and Acheilognathinae were resolved with high nodal support. Although our results do not completely resolve relationships within Cyprinidae, this study presents novel and significant findings having major implications for a highly diverse and enigmatic clade of East-Asian cyprinids. Within this monophyletic group five closely-related subgroups are identified. Tinca tinca, one of the most phylogenetically enigmatic genera in the family, is strongly supported as having evolutionary affinities with this East-Asian clade; an established yet remarkable association because of the natural variation in phenotypes and generalized ecological niches occupied by these taxa. Our results clearly argue that the choice of partitioning strategies has significant impacts on the phylogenetic reconstructions, especially when multiple genes are being considered. The most highly partitioned model (partitioned by codon positions within genes) extracts the strongest phylogenetic signals and performs better than any other partitioning schemes supported by the strongest 2Δln Bayes factor. Future studies should include higher levels of taxon sampling and partitioned, model-based analyses. Copyright © 2012 Elsevier Inc. All rights reserved.

  12. Significant Association between Sulfate-Reducing Bacteria and Uranium-Reducing Microbial Communities as Revealed by a Combined Massively Parallel Sequencing-Indicator Species Approach▿ †


    Cardenas, Erick; Wu, Wei-Min; Leigh, Mary Beth; Carley, Jack; Carroll, Sue; Gentry, Terry; Luo, Jian; Watson, David; Gu, Baohua; Ginder-Vogel, Matthew; Kitanidis, Peter K.; Jardine, Philip M.; Zhou, Jizhong; Criddle, Craig S.; Marsh, Terence L.


    Massively parallel sequencing has provided a more affordable and high-throughput method to study microbial communities, although it has mostly been used in an exploratory fashion. We combined pyrosequencing with a strict indicator species statistical analysis to test if bacteria specifically responded to ethanol injection that successfully promoted dissimilatory uranium(VI) reduction in the subsurface of a uranium contamination plume at the Oak Ridge Field Research Center in Tennessee. Remedi...

  13. The complete chloroplast genome sequence of Mahonia bealei (Berberidaceae) reveals a significant expansion of the inverted repeat and phylogenetic relationship with other angiosperms. (United States)

    Ma, Ji; Yang, Bingxian; Zhu, Wei; Sun, Lianli; Tian, Jingkui; Wang, Xumin


    Mahonia bealei (Berberidaceae) is a frequently-used traditional Chinese medicinal plant with efficient anti-inflammatory ability. This plant is one of the sources of berberine, a new cholesterol-lowering drug with anti-diabetic activity. We have sequenced the complete nucleotide sequence of the chloroplast (cp) genome of M. bealei. The complete cp genome of M. bealei is 164,792 bp in length, and has a typical structure with large (LSC 73,052 bp) and small (SSC 18,591 bp) single-copy regions separated by a pair of inverted repeats (IRs 36,501 bp) of large size. The Mahonia cp genome contains 111 unique genes and 39 genes are duplicated in the IR regions. The gene order and content of M. bealei are almost unarranged which is consistent with the hypothesis that large IRs stabilize cp genome and reduce gene loss-and-gain probabilities during evolutionary process. A large IR expansion of over 12 kb has occurred in M. bealei, 15 genes (rps19, rpl22, rps3, rpl16, rpl14, rps8, infA, rpl36, rps11, petD, petB, psbH, psbN, psbT and psbB) have expanded to have an additional copy in the IRs. The IR expansion rearrangement occurred via a double-strand DNA break and subsequence repair, which is different from the ordinary gene conversion mechanism. Repeat analysis identified 39 direct/inverted repeats 30 bp or longer with a sequence identity ≥ 90%. Analysis also revealed 75 simple sequence repeat (SSR) loci and almost all are composed of A or T, contributing to a distinct bias in base composition. Comparison of protein-coding sequences with ESTs reveals 9 putative RNA edits and 5 of them resulted in non-synonymous modifications in rpoC1, rps2, rps19 and ycf1. Phylogenetic analysis using maximum parsimony (MP) and maximum likelihood (ML) was performed on a dataset composed of 65 protein-coding genes from 25 taxa, which yields an identical tree topology as previous plastid-based trees, and provides strong support for the sister relationship between Ranunculaceae and Berberidaceae

  14. Rational Homological Stability for Automorphisms of Manifolds

    DEFF Research Database (Denmark)

    Grey, Matthias

    In this thesis we prove rational homological stability for the classifying spaces of the homotopy automorphisms and block di↵eomorphisms of iterated connected sums of products of spheres of a certain connectivity.The results in particular apply to the manifolds       Npg,q  = (#g(Sp x Sq)) - int...... with coefficients in the homology of the universal covering, which is studied using rational homology theory. The result for the block di↵eomorphisms is deduced from the homological stability for the homotopy automorphisms upon using Surgery theory. Themain theorems of this thesis extend the homological stability...

  15. Kuranishi homology and Kuranishi cohomology


    Joyce, Dominic


    A Kuranishi space is a topological space with a Kuranishi structure, defined by Fukaya and Ono. Kuranishi structures occur naturally on moduli spaces of J-holomorphic curves in symplectic geometry. Let Y be an orbifold and R a commutative ring or Q-algebra. We define two kinds of Kuranishi homology KH_*(Y;R). The chain complex KC_*(Y;R) defining KH_*(Y;R) is spanned over R by [X,f,G], for X a compact oriented Kuranishi space with corners, f : X --> Y smooth, and G "gauge-fixing data" which ma...

  16. Complete sequence of two tick-borne flaviviruses isolated from Siberia and the UK: analysis and significance of the 5' and 3'-UTRs. (United States)

    Gritsun, T S; Venugopal, K; Zanotto, P M; Mikhailov, M V; Sall, A A; Holmes, E C; Polkinghorne, I; Frolova, T V; Pogodina, V V; Lashkevich, V A; Gould, E A


    The complete nucleotide sequence of two tick-transmitted flaviviruses, Vasilchenko (Vs) from Siberia and louping ill (LI) from the UK, have been determined. The genomes were respectively, 10928 and 10871 nucleotides (nt) in length. The coding strategy and functional protein sequence motifs of tick-borne flaviviruses are presented in both Vs and LI viruses. The phylogenies based on maximum likelihood, maximum parsimony and distance analysis of the polyproteins, identified Vs virus as a member of the tick-borne encephalitis virus subgroup within the tick-borne serocomplex, genus Flavivirus, family Flaviviridae. Comparative alignment of the 3'-untranslated regions revealed deletions of different lengths essentially at the same position downstream of the stop codon for all tick-borne viruses. Two direct 27 nucleotide repeats at the 3'-end were found only for Vs and LI virus. Immediately following the deletions a region of 332-334 nt with relatively conserved primary structure (67-94% identity) was observed at the 3'-non-coding end of the virus genome. Pairwise comparisons of the nucleotide sequence data revealed similar levels of variation between the coding region, and the 5' and 3'-termini of the genome, implying an equivalent strong selective control for translated and untranslated regions. Indeed the predicted folding of the 5' and 3'-untranslated regions revealed patterns of stem and loop structures conserved for all tick-borne flaviviruses suggesting a purifying selection for preservation of essential RNA secondary structures which could be involved in translational control and replication. The possible implications of these findings are discussed.

  17. Stratigraphy and paleogeographic significance of a Late Pennsylvanian to Early Permian channeled slope sequence in the Darwin Basin, southern Darwin Hills, east-central California (United States)

    Stevens, Calvin H.; Stone, Paul; Magginetti, Robert T.; Ritter, Scott M.


    The complex stratigraphy of late Paleozoic rocks in the southern Darwin Hills consists of regionally extensive Mississippian and Early to Middle Pennsylvanian rocks overlain by latest Pennsylvanian to Early Permian rocks, herein called the Darwin Hills sequence. Deposition of this latter sequence marked the beginning of the Darwin Basin. In Mississippian time, a carbonate platform prograded westward over slightly older slope deposits. In the Late Mississippian this platform was exposed to erosion and siliciclastic sediments were deposited. In Early to Middle Pennsylvanian time the area subsided, forming a west-facing ramp that was subjected to deformation and erosion in Middle or early Late Pennsylvanian time. Later this area was tilted westward and deep-water sediments were deposited on this slope. In latest Pennsylvanian to earliest Permian time, a major channel was cut through the older Pennsylvanian rocks and into the Upper Mississippian strata. This channel was gradually filled with increasingly finer grained, deep-water sediment as the area evolved into a basin floor by Early Permian (Sakmarian) time. Expansion of the Darwin Basin in Artinskian time led to a second phase of deposition represented by strata of the regionally extensive Darwin Canyon Formation. The geology in this small area thus documents tectonic events occurring during the early development of the Darwin Basin.

  18. Spectrum of somatic mutations detected by targeted next-generation sequencing and their prognostic significance in adult patients with acute lymphoblastic leukemia

    Directory of Open Access Journals (Sweden)

    Juan Feng


    Full Text Available Abstract Target-specific next-generation sequencing technology was used to analyze 112 genes in adult patients with acute lymphoblastic leukemia (ALL. This sequencing mainly focused on the specific mutational hotspots. Among the 121 patients, 93 patients were B-ALL (76.9%, and 28 patients (23.1% were T-ALL. Of the 121 patients, 110 (90.9% harbored at least one mutation. The five most frequently mutated genes in T-ALL are NOTCH1, JAK3, FBXW7, FAT1, and NRAS. In B-ALL, FAT1, SF1, CRLF2, TET2, and PTPN1 have higher incidence of mutations. Gene mutations are different between Ph+ALL and Ph−ALL patients. B-ALL patients with PTPN11 mutation and T-ALL patients with NOTCH1 and/or FBXW7 mutations showed better survival. But B-ALL with JAK1/JAK2 mutations showed worse survival. The results suggest that gene mutations exist in adult ALL patients universally, they are related with prognosis.

  19. Multi-Locus Next-Generation Sequence Typing of DNA Extracted From Pooled Colonies Detects Multiple Unrelated Candida albicans Strains in a Significant Proportion of Patient Samples

    Directory of Open Access Journals (Sweden)

    Ningxin Zhang


    Full Text Available The yeast Candida albicans is an important opportunistic human pathogen. For C. albicans strain typing or drug susceptibility testing, a single colony recovered from a patient sample is normally used. This is insufficient when multiple strains are present at the site sampled. How often this is the case is unclear. Previous studies, confined to oral, vaginal and vulvar samples, have yielded conflicting results and have assessed too small a number of colonies per sample to reliably detect the presence of multiple strains. We developed a next-generation sequencing (NGS modification of the highly discriminatory C. albicans MLST (multilocus sequence typing method, 100+1 NGS-MLST, for detection and typing of multiple strains in clinical samples. In 100+1 NGS-MLST, DNA is extracted from a pool of colonies from a patient sample and also from one of the colonies. MLST amplicons from both DNA preparations are analyzed by high-throughput sequencing. Using base call frequencies, our bespoke DALMATIONS software determines the MLST type of the single colony. If base call frequency differences between pool and single colony indicate the presence of an additional strain, the differences are used to computationally infer the second MLST type without the need for MLST of additional individual colonies. In mixes of previously typed pairs of strains, 100+1 NGS-MLST reliably detected a second strain. Inferred MLST types of second strains were always more similar to their real MLST types than to those of any of 59 other isolates (22 of 31 inferred types were identical to the real type. Using 100+1 NGS-MLST we found that 7/60 human samples, including three superficial candidiasis samples, contained two unrelated strains. In addition, at least one sample contained two highly similar variants of the same strain. The probability of samples containing unrelated strains appears to differ considerably between body sites. Our findings indicate the need for wider surveys to

  20. Complete plastid genome sequencing of Trochodendraceae reveals a significant expansion of the inverted repeat and suggests a Paleogene divergence between the two extant species.

    Directory of Open Access Journals (Sweden)

    Yan-xia Sun

    Full Text Available The early-diverging eudicot order Trochodendrales contains only two monospecific genera, Tetracentron and Trochodendron. Although an extensive fossil record indicates that the clade is perhaps 100 million years old and was widespread throughout the Northern Hemisphere during the Paleogene and Neogene, the two extant genera are both narrowly distributed in eastern Asia. Recent phylogenetic analyses strongly support a clade of Trochodendrales, Buxales, and Gunneridae (core eudicots, but complete plastome analyses do not resolve the relationships among these groups with strong support. However, plastid phylogenomic analyses have not included data for Tetracentron. To better resolve basal eudicot relationships and to clarify when the two extant genera of Trochodendrales diverged, we sequenced the complete plastid genome of Tetracentron sinense using Illumina technology. The Tetracentron and Trochodendron plastomes possess the typical gene content and arrangement that characterize most angiosperm plastid genomes, but both genomes have the same unusual ∼4 kb expansion of the inverted repeat region to include five genes (rpl22, rps3, rpl16, rpl14, and rps8 that are normally found in the large single-copy region. Maximum likelihood analyses of an 83-gene, 88 taxon angiosperm data set yield an identical tree topology as previous plastid-based trees, and moderately support the sister relationship between Buxaceae and Gunneridae. Molecular dating analyses suggest that Tetracentron and Trochodendron diverged between 44-30 million years ago, which is congruent with the fossil record of Trochodendrales and with previous estimates of the divergence time of these two taxa. We also characterize 154 simple sequence repeat loci from the Tetracentron sinense and Trochodendron aralioides plastomes that will be useful in future studies of population genetic structure for these relict species, both of which are of conservation concern.

  1. Genes homologous to glycopeptide resistance vanA are widespread in soil microbial communities

    DEFF Research Database (Denmark)

    Guardabassi, L.; Agersø, Yvonne


    -Ala : D-Ala ligase genes unrelated to vanA. In order to enhance detection of vanA-homologous genes, a third PCR step was added using primers targeting vanA in soil Paenibacillus. Sequencing of 25 clones obtained by this method allowed recovery of 23 novel sequences having 86-100% identity with van...

  2. HFE gene mutations in patients with primary iron overload: is there a significant improvement in molecular diagnosis yield with HFE sequencing? (United States)

    Santos, Paulo C J L; Pereira, Alexandre C; Cançado, Rodolfo D; Schettert, Isolmar T; Sobreira, Tiago J P; Oliveira, Paulo S L; Hirata, Rosario D C; Hirata, Mario H; Figueiredo, Maria Stella; Chiattone, Carlos S; Krieger, Jose E; Guerra-Shinohara, Elvira M


    Rare HFE variants have been shown to be associated with hereditary hemochromatosis (HH), an iron overload disease. The low frequency of the HFE p.C282Y mutation in HH-affected Brazilian patients may suggest that other HFE-related mutations may also be implicated in the pathogenesis of HH in this population. The main aim was to screen for new HFE mutations in Brazilian individuals with primary iron overload and to investigate their relationship with HH. Fifty Brazilian patients with primary iron overload (transferrin saturation>50% in females and 60% in males) were selected. Subsequent bidirectional sequencing for each HFE exon was performed. The effect of HFE mutations on protein structure were analyzed by molecular dynamics simulation and free binding energy calculations. p.C282Y in homozygosis or in heterozygosis with p.H63D were the most frequent genotypic combinations associated with HH in our sample population (present in 17 individuals, 34%). Thirty-six (72.0%) out of the 50 individuals presented at least one HFE mutation. The most frequent genotype associated with HH was the homozygous p.C282Y mutation (n=11, 22.0%). One novel mutation (p.V256I) was indentified in heterozygosis with the p.H63D mutation. In silico modeling analysis of protein behavior indicated that the p.V256I mutation does not reduce the binding affinity between HFE and β2-microglobulin (β2M) in the same way the p.C282Y mutation does compared with the native HFE protein. In conclusion, screening of HFE through direct sequencing, as compared to p.C282Y/p.H63D genotyping, was not able to increase the molecular diagnosis yield of HH. The novel p.V256I mutation could not be implicated in the molecular basis of the HH phenotype, although its role cannot be completely excluded in HH-phenotype development. Our molecular modeling analysis can help in the analysis of novel, previously undescribed, HFE mutations. Copyright © 2010 Elsevier Inc. All rights reserved.

  3. Persistent homology and string vacua

    Energy Technology Data Exchange (ETDEWEB)

    Cirafici, Michele [Center for Mathematical Analysis, Geometry and Dynamical Systems,Instituto Superior Técnico, Universidade de Lisboa,Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Institut des Hautes Études Scientifiques,Le Bois-Marie, 35 route de Chartres, F-91440 Bures-sur-Yvette (France)


    We use methods from topological data analysis to study the topological features of certain distributions of string vacua. Topological data analysis is a multi-scale approach used to analyze the topological features of a dataset by identifying which homological characteristics persist over a long range of scales. We apply these techniques in several contexts. We analyze N=2 vacua by focusing on certain distributions of Calabi-Yau varieties and Landau-Ginzburg models. We then turn to flux compactifications and discuss how we can use topological data analysis to extract physical information. Finally we apply these techniques to certain phenomenologically realistic heterotic models. We discuss the possibility of characterizing string vacua using the topological properties of their distributions.

  4. Equivariant ordinary homology and cohomology

    CERN Document Server

    Costenoble, Steven R


    Filling a gap in the literature, this book takes the reader to the frontiers of equivariant topology, the study of objects with specified symmetries. The discussion is motivated by reference to a list of instructive “toy” examples and calculations in what is a relatively unexplored field. The authors also provide a reading path for the first-time reader less interested in working through sophisticated machinery but still desiring a rigorous understanding of the main concepts. The subject’s classical counterparts, ordinary homology and cohomology, dating back to the work of Henri Poincaré in topology, are calculational and theoretical tools which are important in many parts of mathematics and theoretical physics, particularly in the study of manifolds. Similarly powerful tools have been lacking, however, in the context of equivariant topology. Aimed at advanced graduate students and researchers in algebraic topology and related fields, the book assumes knowledge of basic algebraic topology and group act...


    Directory of Open Access Journals (Sweden)

    E. P. Kharchenko


    Full Text Available With computer analysis occurrence of small homologous and complementary fragments (21 nucleotides in length has been studied in genomes of 14 human viruses causing most dangerous infections. The sample includes viruses with (+ and (– single stranded RNA and DNA-containing hepatitis A virus. Analysis of occurrence of homologous sequences has shown the existence two extreme situations. On the one hand, the same virus contains homologous sequences to almost all other viruses (for example, Ebola virus, severe acute respiratory syndrome-related coronavirus, and mumps virus, and numerous homologous sequences to the same other virus (especially in severe acute respiratory syndrome-related coronavirus to Dengue virus and in Ebola virus to poliovirus. On the other hand, there are rare occurrence and not numerous homologous sequences in genomes of other viruses (rubella virus, hepatitis A virus, and hepatitis B virus. Similar situation exists for occurrence of complementary sequences. Rubella virus, the genome of which has the high content of guanine and cytosine, has no complementary sequences to almost all other viruses. Most viruses have moderate level of occurrence for homologous and complementary sequences. Autocomplementary sequences are numerous in most viruses and one may suggest that the genome of single stranded RNA viruses has branched secondary structure. In addition to possible role in recombination among strains autocomplementary sequences could be regulators of translation rate of virus proteins and determine its optimal proportion in virion assembly with genome and mRNA folding. Occurrence of small homologous and complementary sequences in RNA- and DNA-containing viruses may be the result of multiple recombinations in the past and the present and determine their adaptation and variability. Recombination may take place in coinfection of human and/or common hosts. Inclusion of homologous and complementary sequences into genome could not

  6. Homology in Electromagnetic Boundary Value Problems

    Directory of Open Access Journals (Sweden)

    Pellikka Matti


    Full Text Available We discuss how homology computation can be exploited in computational electromagnetism. We represent various cellular mesh reduction techniques, which enable the computation of generators of homology spaces in an acceptable time. Furthermore, we show how the generators can be used for setting up and analysis of an electromagnetic boundary value problem. The aim is to provide a rationale for homology computation in electromagnetic modeling software.

  7. Epitopes of human testis-specific lactate dehydrogenase deduced from a cDNA sequence

    International Nuclear Information System (INIS)

    Millan, J.L.; Driscoll, C.E.; LeVan, K.M.; Goldberg, E.


    The sequence and structure of human testis-specific L-lactate dehydrogenase [LDHC 4 , LDHX; (L)-lactate:NAD + oxidoreductase, EC] has been derived from analysis of a complementary DNA (cDNA) clone comprising the complete protein coding region of the enzyme. From the deduced amino acid sequence, human LDHC 4 is as different from rodent LDHC 4 (73% homology) as it is from human LDHA 4 (76% homology) and porcine LDHB 4 (68% homology). Subunit homologies are consistent with the conclusion that the LDHC gene arose by at least two independent duplication events. Furthermore, the lower degree of homology between mouse and human LDHC 4 and the appearance of this isozyme late in evolution suggests a higher rate of mutation in the mammalian LDHC genes than in the LDHA and -B genes. Comparison of exposed amino acid residues of discrete anti-genic determinants of mouse and human LDHC 4 reveals significant differences. Knowledge of the human LDHC 4 sequence will help design human-specific peptides useful in the development of a contraceptive vaccine

  8. Isolamento e caracterização parcial de sequências homólogas a genes ribossomais (rDNA em Blastocladiella emersonii - DOI: 10.4025/actascibiolsci.v25i2.2037 Isolation and partial characterization of homologous sequences of ribosomal genes (rDNA in Blastocladiella emersonii

    Directory of Open Access Journals (Sweden)

    Luiz Carlos Correa


    Full Text Available A definição e a caracterização de regiões de origens de replicação nos eucariotos superiores são ainda controversas. A iniciação da replicação é sítio-específica em alguns sistemas e, em outros, parece estar contida em regiões extensas. Regiões rDNA são modelos atrativos para o estudo de origens de replicação pela sua organização in tandem, reduzindo a área de estudo para o espaço restrito que codifica uma unidade de transcrição. Neste trabalho nós isolamos e caracterizamos parcialmente um clone que contém uma sequência ribossomal do fungo aquático Blastocladiella emersonii, Be97M20. Southern blots mostraram diversos sítios para enzimas de restrição Eco RI, HindIII e SalI. Northern blot de RNA total hibridado contra uma sonda feita com Be97M20 confirmou a sua homologia com o gene ribossomal 18S. A caracterização detalhada, incluindo o mapeamento de restrição completo, subclonagem, sequenciamento e análise em géis bidimensionais proverão informações adicionais importantes sobre a estrutura e dinâmica desta regiãoThe definition and the characterization of replication origins regions in higher eukaryotes are still controversial. The initiation of the replication is site-specific in some systems but seems to occur in large regions in others. Because of its in tandem organization, reducing the area to the restricted space that codifies an unit of transcription, rDNA regions are attractive models to study replication origins. In this work we isolated and started to characterize a clone that contains a ribosomal sequence from the aquatic fungus B. emersonii, Be97M20. Southern blots showed several sites for the restrition enzymes Eco RI, HindIII and SalI. A northern blot of total RNA, hybridized against a probe made from Be97M20, confirmed its homology with the ribosomal 18S gene. The detailed characterization, including complete restriction map, subcloning, sequence and analysis on bidimensional gels will

  9. Chromhome: a rich internet application for accessing comparative chromosome homology maps. (United States)

    Nagarajan, Sridevi; Rens, Willem; Stalker, James; Cox, Tony; Ferguson-Smith, Malcolm A


    Comparative genomics has become a significant research area in recent years, following the availability of a number of sequenced genomes. The comparison of genomes is of great importance in the analysis of functionally important genome regions. It can also be used to understand the phylogenetic relationships of species and the mechanisms leading to rearrangement of karyotypes during evolution. Many species have been studied at the cytogenetic level by cross species chromosome painting. With the large amount of such information, it has become vital to computerize the data and make them accessible worldwide. Chromhome is a comprehensive web application that is designed to provide cytogenetic comparisons among species and to fulfil this need. The Chromhome application architecture is multi-tiered with an interactive client layer, business logic and database layers. Enterprise java platform with open source framework OpenLaszlo is used to implement the Rich Internet Chromhome Application. Cross species comparative mapping raw data are collected and the processed information is stored into MySQL Chromhome database. Chromhome Release 1.0 contains 109 homology maps from 51 species. The data cover species from 14 orders and 30 families. The homology map displays all the chromosomes of the compared species as one image, making comparisons among species easier. Inferred data also provides maps of homologous regions that could serve as a guideline for researchers involved in phylogenetic or evolution based studies. Chromhome provides a useful resource for comparative genomics, holding graphical homology maps of a wide range of species. It brings together cytogenetic data of many genomes under one roof. Inferred painting can often determine the chromosomal homologous regions between two species, if each has been compared with a common third species. Inferred painting greatly reduces the need to map entire genomes and helps focus only on relevant

  10. Chromhome: A rich internet application for accessing comparative chromosome homology maps

    Directory of Open Access Journals (Sweden)

    Cox Tony


    Full Text Available Abstract Background Comparative genomics has become a significant research area in recent years, following the availability of a number of sequenced genomes. The comparison of genomes is of great importance in the analysis of functionally important genome regions. It can also be used to understand the phylogenetic relationships of species and the mechanisms leading to rearrangement of karyotypes during evolution. Many species have been studied at the cytogenetic level by cross species chromosome painting. With the large amount of such information, it has become vital to computerize the data and make them accessible worldwide. Chromhome is a comprehensive web application that is designed to provide cytogenetic comparisons among species and to fulfil this need. Results The Chromhome application architecture is multi-tiered with an interactive client layer, business logic and database layers. Enterprise java platform with open source framework OpenLaszlo is used to implement the Rich Internet Chromhome Application. Cross species comparative mapping raw data are collected and the processed information is stored into MySQL Chromhome database. Chromhome Release 1.0 contains 109 homology maps from 51 species. The data cover species from 14 orders and 30 families. The homology map displays all the chromosomes of the compared species as one image, making comparisons among species easier. Inferred data also provides maps of homologous regions that could serve as a guideline for researchers involved in phylogenetic or evolution based studies. Conclusion Chromhome provides a useful resource for comparative genomics, holding graphical homology maps of a wide range of species. It brings together cytogenetic data of many genomes under one roof. Inferred painting can often determine the chromosomal homologous regions between two species, if each has been compared with a common third species. Inferred painting greatly reduces the need to

  11. Evaluating the efficacy of a structure-derived amino acid substitution matrix in detecting protein homologs by BLAST and PSI-BLAST

    Directory of Open Access Journals (Sweden)

    Nalin CW Goonesekere


    Full Text Available Nalin CW GoonesekereDepartment of Chemistry and Biochemistry, University of Northern iowa, Cedar Falls, IA, USAAbstract: The large numbers of protein sequences generated by whole genome sequencing projects require rapid and accurate methods of annotation. The detection of homology through computational sequence analysis is a powerful tool in determining the complex evolutionary and functional relationships that exist between proteins. Homology search algorithms employ amino acid substitution matrices to detect similarity between proteins sequences. The substitution matrices in common use today are constructed using sequences aligned without reference to protein structure. Here we present amino acid substitution matrices constructed from the alignment of a large number of protein domain structures from the structural classification of proteins (SCOP database. We show that when incorporated into the homology search algorithms BLAST and PSI-blaST, the structure-based substitution matrices enhance the efficacy of detecting remote homologs. Keywords: computational biology, protein homology, amino acid substitution matrix, protein structure

  12. Homotopic Chain Maps Have Equal s-Homology and d-Homology

    Directory of Open Access Journals (Sweden)

    M. Z. Kazemi-Baneh


    Full Text Available The homotopy of chain maps on preabelian categories is investigated and the equality of standard homologies and d-homologies of homotopic chain maps is established. As a special case, if X and Y are the same homotopy type, then their nth d-homology R-modules are isomorphic, and if X is a contractible space, then its nth d-homology R-modules for n≠0 are trivial.

  13. Therapeutic Potential of a Scorpion Venom-Derived Antimicrobial Peptide and Its Homologs Against Antibiotic-Resistant Gram-Positive Bacteria

    Directory of Open Access Journals (Sweden)

    Gaomin Liu


    Full Text Available The alarming rise in the prevalence of antibiotic resistance among pathogenic bacteria poses a unique challenge for the development of effective therapeutic agents. Antimicrobial peptides (AMPs have attracted a great deal of attention as a possible solution to the increasing problem of antibiotic-resistant bacteria. Marcin-18 was identified from the scorpion Mesobuthus martensii at both DNA and protein levels. The genomic sequence revealed that the marcin-18 coding gene contains a phase-I intron with a GT-AG splice junction located in the DNA region encoding the N-terminal part of signal peptide. The peptide marcin-18 was also isolated from scorpion venom. A protein sequence homology search revealed that marcin-18 shares extremely high sequence identity to the AMPs meucin-18 and megicin-18. In vitro, chemically synthetic marcin-18 and its homologs (meucin-18 and megicin-18 showed highly potent inhibitory activity against Gram-positive bacteria, including some clinical antibiotic-resistant strains. Importantly, in a mouse acute peritonitis model, these peptides significantly decreased the bacterial load in ascites and rescued nearly all mice heavily infected with clinical methicillin-resistant Staphylococcus aureus from lethal bacteremia. Peptides exerted antimicrobial activity via a bactericidal mechanism and killed bacteria through membrane disruption. Taken together, marcin-18 and its homologs have potential for development as therapeutic agents for treating antibiotic-resistant, Gram-positive bacterial infections.

  14. Lectures on homology with internal symmetries

    International Nuclear Information System (INIS)

    Solovyov, Yu.


    Homology with internal symmetries is a natural generalization of cyclic homology introduced, independently, by Connes and Tsygan, which has turned out to be a very useful tool in a number of problems of algebra, geometry topology, analysis and mathematical physics. It suffices to say cycling homology and cohomology are successfully applied in the index theory of elliptic operators on foliations, in the description of the homotopy type of pseudoisotopy spaces, in the theory of characteristic classes in algebraic K-theory. They are also applied in noncommutative differential geometry and in the cohomology of Lie algebras, the branches of mathematics which brought them to life in the first place. Essentially, we consider dihedral homology, which was successfully applied for the description of the homology type of groups of homeomorphisms and diffeomorphisms of simply connected manifolds. (author). 27 refs

  15. Molecular cloning, expression, and sequence analysis of GPRC6A, a novel family C G-protein-coupled receptor

    DEFF Research Database (Denmark)

    Wellendorph, Petrine; Bräuner-Osborne, Hans


    with a significant homology to the human calcium-sensing receptor (CaR, 34% aa sequence identity), the taste receptor 1 (T1R1, 28%), and the metabotropic glutamate receptor 1 (mGluR1, 24%), places GPRC6A in family C of the GPCRs. Interestingly, GPRC6A bears the highest resemblance with an odorant goldfish 5...

  16. The colocalization transition of homologous chromosomes at meiosis (United States)

    Nicodemi, Mario; Panning, Barbara; Prisco, Antonella


    Meiosis is the specialized cell division required in sexual reproduction. During its early stages, in the mother cell nucleus, homologous chromosomes recognize each other and colocalize in a crucial step that remains one of the most mysterious of meiosis. Starting from recent discoveries on the system molecular components and interactions, we discuss a statistical mechanics model of chromosome early pairing. Binding molecules mediate long-distance interaction of special DNA recognition sequences and, if their concentration exceeds a critical threshold, they induce a spontaneous colocalization transition of chromosomes, otherwise independently diffusing.

  17. The PLAC1-homology region of the ZP domain is sufficient for protein polymerisation

    Directory of Open Access Journals (Sweden)

    Litscher Eveline S


    Full Text Available Abstract Background Hundreds of extracellular proteins polymerise into filaments and matrices by using zona pellucida (ZP domains. ZP domain proteins perform highly diverse functions, ranging from structural to receptorial, and mutations in their genes are responsible for a number of severe human diseases. Recently, PLAC1, Oosp1-3, Papillote and CG16798 proteins were identified that share sequence homology with the N-terminal half of the ZP domain (ZP-N, but not with its C-terminal half (ZP-C. The functional significance of this partial conservation is unknown. Results By exploiting a highly engineered bacterial strain, we expressed in soluble form the PLAC1-homology region of mammalian sperm receptor ZP3 as a fusion to maltose binding protein. Mass spectrometry showed that the 4 conserved Cys residues within the ZP-N moiety of the fusion protein adopt the same disulfide bond connectivity as in full-length native ZP3, indicating that it is correctly folded, and electron microscopy and biochemical analyses revealed that it assembles into filaments. Conclusion These findings provide a function for PLAC1-like proteins and, by showing that ZP-N is a biologically active folding unit, prompt a re-evaluation of the architecture of the ZP domain and its polymers. Furthermore, they suggest that ZP-C might play a regulatory role in the assembly of ZP domain protein complexes.

  18. Membrane and Protein Interactions of the Pleckstrin Homology Domain Superfamily

    Directory of Open Access Journals (Sweden)

    Marc Lenoir


    Full Text Available The human genome encodes about 285 proteins that contain at least one annotated pleckstrin homology (PH domain. As the first phosphoinositide binding module domain to be discovered, the PH domain recruits diverse protein architectures to cellular membranes. PH domains constitute one of the largest protein superfamilies, and have diverged to regulate many different signaling proteins and modules such as Dbl homology (DH and Tec homology (TH domains. The ligands of approximately 70 PH domains have been validated by binding assays and complexed structures, allowing meaningful extrapolation across the entire superfamily. Here the Membrane Optimal Docking Area (MODA program is used at a genome-wide level to identify all membrane docking PH structures and map their lipid-binding determinants. In addition to the linear sequence motifs which are employed for phosphoinositide recognition, the three dimensional structural features that allow peripheral membrane domains to approach and insert into the bilayer are pinpointed and can be predicted ab initio. The analysis shows that conserved structural surfaces distinguish which PH domains associate with membrane from those that do not. Moreover, the results indicate that lipid-binding PH domains can be classified into different functional subgroups based on the type of membrane insertion elements they project towards the bilayer.

  19. Membrane and Protein Interactions of the Pleckstrin Homology Domain Superfamily. (United States)

    Lenoir, Marc; Kufareva, Irina; Abagyan, Ruben; Overduin, Michael


    The human genome encodes about 285 proteins that contain at least one annotated pleckstrin homology (PH) domain. As the first phosphoinositide binding module domain to be discovered, the PH domain recruits diverse protein architectures to cellular membranes. PH domains constitute one of the largest protein superfamilies, and have diverged to regulate many different signaling proteins and modules such as Dbl homology (DH) and Tec homology (TH) domains. The ligands of approximately 70 PH domains have been validated by binding assays and complexed structures, allowing meaningful extrapolation across the entire superfamily. Here the Membrane Optimal Docking Area (MODA) program is used at a genome-wide level to identify all membrane docking PH structures and map their lipid-binding determinants. In addition to the linear sequence motifs which are employed for phosphoinositide recognition, the three dimensional structural features that allow peripheral membrane domains to approach and insert into the bilayer are pinpointed and can be predicted ab initio. The analysis shows that conserved structural surfaces distinguish which PH domains associate with membrane from those that do not. Moreover, the results indicate that lipid-binding PH domains can be classified into different functional subgroups based on the type of membrane insertion elements they project towards the bilayer.

  20. Protein sequence comparison and protein evolution

    Energy Technology Data Exchange (ETDEWEB)

    Pearson, W.R. [Univ. of Virginia, Charlottesville, VA (United States). Dept. of Biochemistry


    This tutorial was one of eight tutorials selected to be presented at the Third International Conference on Intelligent Systems for Molecular Biology which was held in the United Kingdom from July 16 to 19, 1995. This tutorial examines how the information conserved during the evolution of a protein molecule can be used to infer reliably homology, and thus a shared proteinfold and possibly a shared active site or function. The authors start by reviewing a geological/evolutionary time scale. Next they look at the evolution of several protein families. During the tutorial, these families will be used to demonstrate that homologous protein ancestry can be inferred with confidence. They also examine different modes of protein evolution and consider some hypotheses that have been presented to explain the very earliest events in protein evolution. The next part of the tutorial will examine the technical aspects of protein sequence comparison. Both optimal and heuristic algorithms and their associated parameters that are used to characterize protein sequence similarities are discussed. Perhaps more importantly, they survey the statistics of local similarity scores, and how these statistics can both be used to improve the selectivity of a search and to evaluate the significance of a match. They them examine distantly related members of three protein families, the serine proteases, the glutathione transferases, and the G-protein-coupled receptors (GCRs). Finally, the discuss how sequence similarity can be used to examine internal repeated or mosaic structures in proteins.

  1. Double Strand Break Repair, one mechanism can hide another: Alternative non-homologous end joining

    International Nuclear Information System (INIS)

    Rass, E.; Grabarz, A.; Bertrand, P.; Lopez, B.S.


    DNA double strand breaks are major cytotoxic lesions encountered by the cells. They can be induced by ionizing radiation or endogenous stress and can lead to genetic instability. Two mechanisms compete for the repair of DNA double strand breaks: homologous recombination and non-homologous end joining (NHEJ). Homologous recombination requires DNA sequences homology and is initiated by single strand resection. Recently, advances have been made concerning the major steps and proteins involved in resection. NHEJ, in contrast, does not require sequence homology. The existence of a DNA double strand break repair mechanism, independent of KU and ligase IV, the key proteins of the canonical non homologous end joining pathway, has been revealed lately and named alternative non homologous end joining. The hallmarks of this highly mutagenic pathway are deletions at repair junctions and frequent use of distal micro-homologies. This mechanism is also initiated by a single strand resection of the break. The aim of this review is firstly to present recent data on single strand resection, and secondly the alternative NHEJ pathway, including a discussion on the fidelity of NHEJ. Based on current knowledge, canonical NHEJ does not appear as an intrinsically mutagenic mechanism, but in contrast, as a conservative one. The structure of broken DNA ends actually dictates the quality repair of the alternative NHEJ and seems the actual responsible for the mutagenesis attributed beforehand to the canonical NHEJ. The existence of this novel DNA double strand breaks repair mechanism needs to be taken into account in the development of radiosensitizing strategies in order to optimise the efficiency of radiotherapy. (authors)

  2. Primary structure and functional characterization of a Drosophila dopamine receptor with high homology to human D1/5 receptors. (United States)

    Gotzes, F; Balfanz, S; Baumann, A


    Members of the superfamily of G-protein coupled receptors share significant similarities in sequence and transmembrane architecture. We have isolated a Drosophila homologue of the mammalian dopamine receptor family using a low stringency hybridization approach. The deduced amino acid sequence is approximately 70% homologous to the human D1/D5 receptors. When expressed in HEK 293 cells, the Drosophila receptor stimulates cAMP production in response to dopamine application. This effect was mimicked by SKF 38393, a specific D1 receptor agonist, but inhibited by dopaminergic antagonists such as butaclamol and flupentixol. In situ hybridization revealed that the Drosophila dopamine receptor is highly expressed in the somata of the optic lobes. This suggests that the receptor might be involved in the processing of visual information and/or visual learning in invertebrates.

  3. p53 regulates the repair of DNA double-strand breaks by both homologous and non-homologous recombination

    International Nuclear Information System (INIS)

    Willers, H.; Powell, S.N.; Dahm-Daphi, J.


    Full text: p53 is known to suppress spontaneous homologous recombination (HR), while its role in non-homologous recombination (NHR) remains to be clarified. Here, we sought to determine the influence of p53 on the repair of chromosomal double-strand breaks (DSBs) by HR or NHR using specially designed recombination substrates that integrate into the genome. Isogenic mouse fibroblast pairs with or without expression of exogenous p53 protein were utilized. A reporter plasmid carrying a mutated XGPRT gene was chromosomally integrated and DSBs were generated within the plasmid by the I-SceI endonuclease. Subsequent homology-mediated repair from an episomal donor resulted in XGPRT reconstitution and cellular resistance to a selection antibiotic. Analogously, the repair of chromosomal I-SceI breaks by NHR using another novel reporter plasmid restored XGPRT translation. For p53-null cells, the mean frequency of I-SceI break repair via HR was 5.5 x 10 -4 . The p53-Val135 mutant, which previously has been shown to suppress spontaneous HR by 14-fold employing the same cell system and reporter gene, only caused a 2- to 3-fold suppression of break-induced HR. In contrast, a dramatic effect of p53 on repair via NHR was found. Preliminary sequence analysis indicated that there was at least a 1000-fold reduction of illegitimate repair events resulting in loss of sequence at the break sites. The observed effects were mediated by p53 mutants defective in regulation of the cell-cycle and apoptosis. The main findings were: (1) p53 virtually blocked illegitimate rejoining of chromosomal ends. (2) The suppression of homologous DSB repair was less pronounced than the inhibition of spontaneous HR. We hypothesize that p53 allows to a certain extent error-free homology-dependent repair to proceed, while blocking error-prone NHR. The data support and extent a previous model, in which p53 maintains genomic stability by regulating recombination independently of its transactivation function

  4. Evaluating the efficacy of a structure-derived amino acid substitution matrix in detecting protein homologs by BLAST and PSI-BLAST


    Goonesekere, Nalin CW


    Nalin CW GoonesekereDepartment of Chemistry and Biochemistry, University of Northern iowa, Cedar Falls, IA, USAAbstract: The large numbers of protein sequences generated by whole genome sequencing projects require rapid and accurate methods of annotation. The detection of homology through computational sequence analysis is a powerful tool in determining the complex evolutionary and functional relationships that exist between proteins. Homology search algorithms employ amino acid substitution ...

  5. Preserved irradiated homologous cartilage for orbital reconstruction

    International Nuclear Information System (INIS)

    Linberg, J.V.; Anderson, R.L.; Edwards, J.J.; Panje, W.R.; Bardach, J.


    Human costal cartilage is an excellent implant material for orbital and periorbital reconstruction because of its light weight, strength, homogeneous consistency and the ease with which it can be carved. Its use has been limited by the necessity of a separate surgical procedure to obtain the material. Preserved irradiated homologous cartilage has been shown to have almost all the autogenous cartilage and is convenient to use. Preserved irradiated homologous cartilage transplants do not elicit rejection reactions, resist infection and rarely undergo absorption

  6. FBH1 helicase disrupts RAD51 filaments in vitro and modulates homologous recombination in mammalian cells

    DEFF Research Database (Denmark)

    Simandlova, Jitka; Zagelbaum, Jennifer; Payne, Miranda J


    Efficient repair of DNA double strand breaks and interstrand cross-links requires the homologous recombination (HR) pathway, a potentially error-free process that utilizes a homologous sequence as a repair template. A key player in HR is RAD51, the eukaryotic ortholog of bacterial RecA protein. RAD......51 can polymerize on DNA to form a nucleoprotein filament that facilitates both the search for the homologous DNA sequences and the subsequent DNA strand invasion required to initiate HR. Because of its pivotal role in HR, RAD51 is subject to numerous positive and negative regulatory influences...... filaments on DNA through its ssDNA translocase function. Consistent with this, a mutant mouse embryonic stem cell line with a deletion in the FBH1 helicase domain fails to limit RAD51 chromatin association and shows hyper-recombination. Our data are consistent with FBH1 restraining RAD51 DNA binding under...

  7. Sequencing BPS spectra

    Energy Technology Data Exchange (ETDEWEB)

    Gukov, Sergei [Walter Burke Institute for Theoretical Physics, California Institute of Technology,1200 E California Blvd, Pasadena, CA 91125 (United States); Max-Planck-Institut für Mathematik,Vivatsgasse 7, D-53111 Bonn (Germany); Nawata, Satoshi [Walter Burke Institute for Theoretical Physics, California Institute of Technology,1200 E California Blvd, Pasadena, CA 91125 (United States); Centre for Quantum Geometry of Moduli Spaces, University of Aarhus,Nordre Ringgade 1, DK-8000 (Denmark); Saberi, Ingmar [Walter Burke Institute for Theoretical Physics, California Institute of Technology,1200 E California Blvd, Pasadena, CA 91125 (United States); Stošić, Marko [CAMGSD, Departamento de Matemática, Instituto Superior Técnico,Av. Rovisco Pais, 1049-001 Lisbon (Portugal); Mathematical Institute SANU,Knez Mihajlova 36, 11000 Belgrade (Serbia); Sułkowski, Piotr [Walter Burke Institute for Theoretical Physics, California Institute of Technology,1200 E California Blvd, Pasadena, CA 91125 (United States); Faculty of Physics, University of Warsaw,ul. Pasteura 5, 02-093 Warsaw (Poland)


    This paper provides both a detailed study of color-dependence of link homologies, as realized in physics as certain spaces of BPS states, and a broad study of the behavior of BPS states in general. We consider how the spectrum of BPS states varies as continuous parameters of a theory are perturbed. This question can be posed in a wide variety of physical contexts, and we answer it by proposing that the relationship between unperturbed and perturbed BPS spectra is described by a spectral sequence. These general considerations unify previous applications of spectral sequence techniques to physics, and explain from a physical standpoint the appearance of many spectral sequences relating various link homology theories to one another. We also study structural properties of colored HOMFLY homology for links and evaluate Poincaré polynomials in numerous examples. Among these structural properties is a novel “sliding” property, which can be explained by using (refined) modular S-matrix. This leads to the identification of modular transformations in Chern-Simons theory and 3d N=2 theory via the 3d/3d correspondence. Lastly, we introduce the notion of associated varieties as classical limits of recursion relations of colored superpolynomials of links, and study their properties.

  8. Sequencing BPS spectra

    International Nuclear Information System (INIS)

    Gukov, Sergei; Nawata, Satoshi; Saberi, Ingmar; Stošić, Marko; Sułkowski, Piotr


    This paper provides both a detailed study of color-dependence of link homologies, as realized in physics as certain spaces of BPS states, and a broad study of the behavior of BPS states in general. We consider how the spectrum of BPS states varies as continuous parameters of a theory are perturbed. This question can be posed in a wide variety of physical contexts, and we answer it by proposing that the relationship between unperturbed and perturbed BPS spectra is described by a spectral sequence. These general considerations unify previous applications of spectral sequence techniques to physics, and explain from a physical standpoint the appearance of many spectral sequences relating various link homology theories to one another. We also study structural properties of colored HOMFLY homology for links and evaluate Poincaré polynomials in numerous examples. Among these structural properties is a novel “sliding” property, which can be explained by using (refined) modular S-matrix. This leads to the identification of modular transformations in Chern-Simons theory and 3d N=2 theory via the 3d/3d correspondence. Lastly, we introduce the notion of associated varieties as classical limits of recursion relations of colored superpolynomials of links, and study their properties.

  9. SPOT-ligand 2: improving structure-based virtual screening by binding-homology search on an expanded structural template library. (United States)

    Litfin, Thomas; Zhou, Yaoqi; Yang, Yuedong


    The high cost of drug discovery motivates the development of accurate virtual screening tools. Binding-homology, which takes advantage of known protein-ligand binding pairs, has emerged as a powerful discrimination technique. In order to exploit all available binding data, modelled structures of ligand-binding sequences may be used to create an expanded structural binding template library. SPOT-Ligand 2 has demonstrated significantly improved screening performance over its previous version by expanding the template library 15 times over the previous one. It also performed better than or similar to other binding-homology approaches on the DUD and DUD-E benchmarks. The server is available online at . or Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail:

  10. Ribonucleotide Reductases from Bifidobacteria Contain Multiple Conserved Indels Distinguishing Them from All Other Organisms: In Silico Analysis of the Possible Role of a 43 aa Bifidobacteria-Specific Insert in the Class III RNR Homolog

    Directory of Open Access Journals (Sweden)

    Seema Alnajar


    Full Text Available Bifidobacteria comprises an important group/order of bacteria whose members have widespread usage in the food and health industry due to their health-promoting activity in the human gastrointestinal tract. However, little is known about the underlying molecular properties that are responsible for the probiotic effects of these bacteria. The enzyme ribonucleotide reductase (RNR plays a key role in all organisms by reducing nucleoside di- or tri- phosphates into corresponding deoxyribose derivatives required for DNA synthesis, and RNR homologs belonging to classes I and III are present in either most or all Bifidobacteriales. Comparative analyses of these RNR homologs have identified several novel sequence features in the forms of conserved signature indels (CSIs that are exclusively found in bifidobacterial RNRs. Specifically, in the large subunit of the aerobic class Ib RNR, three CSIs have been identified that are uniquely found in the Bifidobacteriales homologs. Similarly, the large subunit of the anaerobic class III RNR contains five CSIs that are also distinctive characteristics of bifidobacteria. Phylogenetic analyses indicate that these CSIs were introduced in a common ancestor of the Bifidobacteriales and retained by all descendants, likely due to their conferring advantageous functional roles. The identified CSIs in the bifidobacterial RNR homologs provide useful tools for further exploration of the novel functional aspects of these important enzymes that are exclusive to these bacteria. We also report here the results of homology modeling studies, which indicate that most of the bifidobacteria-specific CSIs are located within the surface loops of the RNRs, and of these, a large 43 amino acid insert in the class III RNR homolog forms an extension of the allosteric regulatory site known to be essential for protein function. Preliminary docking studies suggest that this large CSI may be playing a role in enhancing the stability of the RNR

  11. Coding sequence of human rho cDNAs clone 6 and clone 9

    Energy Technology Data Exchange (ETDEWEB)

    Chardin, P; Madaule, P; Tavitian, A


    The authors have isolated human cDNAs including the complete coding sequence for two rho proteins corresponding to the incomplete isolates previously described as clone 6 and clone 9. The deduced a.a. sequences, when compared to the a.a. sequence deduced from clone 12 cDNA, show that there are in human at least three highly homologous rho genes. They suggest that clone 12 be named rhoA, clone 6 : rhoB and clone 9 : rhoC. RhoA, B and C proteins display approx. 30% a.a. identity with ras proteins,. mainly clustered in four highly homologous internal regions corresponding to the GTP binding site; however at least one significant difference is found; the 3 rho proteins have an Alanine in position corresponding to ras Glycine 13, suggesting that rho and ras proteins might have slightly different biochemical properties.

  12. A recurrent translocation is mediated by homologous recombination between HERV-H elements

    Directory of Open Access Journals (Sweden)

    Hermetz Karen E


    Full Text Available Abstract Background Chromosome rearrangements are caused by many mutational mechanisms; of these, recurrent rearrangements can be particularly informative for teasing apart DNA sequence-specific factors. Some recurrent translocations are mediated by homologous recombination between large blocks of segmental duplications on different chromosomes. Here we describe a recurrent unbalanced translocation casued by recombination between shorter homologous regions on chromosomes 4 and 18 in two unrelated children with intellectual disability. Results Array CGH resolved the breakpoints of the 6.97-Megabase (Mb loss of 18q and the 7.30-Mb gain of 4q. Sequencing across the translocation breakpoints revealed that both translocations occurred between 92%-identical human endogenous retrovirus (HERV elements in the same orientation on chromosomes 4 and 18. In addition, we find sequence variation in the chromosome 4 HERV that makes one allele more like the chromosome 18 HERV. Conclusions Homologous recombination between HERVs on the same chromosome is known to cause chromosome deletions, but this is the first report of interchromosomal HERV-HERV recombination leading to a translocation. It is possible that normal sequence variation in substrates of non-allelic homologous recombination (NAHR affects the alignment of recombining segments and influences the propensity to chromosome rearrangement.

  13. Induction and repair of DNA double strand breaks: The increasing spectrum of non-homologous end joining pathways

    International Nuclear Information System (INIS)

    Mladenov, Emil; Iliakis, George


    A defining characteristic of damage induced in the DNA by ionizing radiation (IR) is its clustered character that leads to the formation of complex lesions challenging the cellular repair mechanisms. The most widely investigated such complex lesion is the DNA double strand break (DSB). DSBs undermine chromatin stability and challenge the repair machinery because an intact template strand is lacking to assist restoration of integrity and sequence in the DNA molecule. Therefore, cells have evolved a sophisticated machinery to detect DSBs and coordinate a response on the basis of inputs from various sources. A central function of cellular responses to DSBs is the coordination of DSB repair. Two conceptually different mechanisms can in principle remove DSBs from the genome of cells of higher eukaryotes. Homologous recombination repair (HRR) uses as template a homologous DNA molecule and is therefore error-free; it functions preferentially in the S and G2 phases. Non-homologous end joining (NHEJ), on the other hand, simply restores DNA integrity by joining the two ends, is error prone as sequence is only fortuitously preserved and active throughout the cell cycle. The basis of DSB repair pathway choice remains unknown, but cells of higher eukaryotes appear programmed to utilize preferentially NHEJ. Recent work suggests that when the canonical DNA-PK dependent pathway of NHEJ (D-NHEJ), becomes compromised an alternative NHEJ pathway and not HRR substitutes in a quasi-backup function (B-NHEJ). Here, we outline aspects of DSB induction by IR and review the mechanisms of their processing in cells of higher eukaryotes. We place particular emphasis on backup pathways of NHEJ and summarize their increasing significance in various cellular processes, as well as their potential contribution to carcinogenesis.

  14. Evaluating the efficacy of a structure-derived amino acid substitution matrix in detecting protein homologs by BLAST and PSI-BLAST. (United States)

    Goonesekere, Nalin Cw


    The large numbers of protein sequences generated by whole genome sequencing projects require rapid and accurate methods of annotation. The detection of homology through computational sequence analysis is a powerful tool in determining the complex evolutionary and functional relationships that exist between proteins. Homology search algorithms employ amino acid substitution matrices to detect similarity between proteins sequences. The substitution matrices in common use today are constructed using sequences aligned without reference to protein structure. Here we present amino acid substitution matrices constructed from the alignment of a large number of protein domain structures from the structural classification of proteins (SCOP) database. We show that when incorporated into the homology search algorithms BLAST and PSI-blast, the structure-based substitution matrices enhance the efficacy of detecting remote homologs.

  15. Using SQL Databases for Sequence Similarity Searching and Analysis. (United States)

    Pearson, William R; Mackey, Aaron J


    Relational databases can integrate diverse types of information and manage large sets of similarity search results, greatly simplifying genome-scale analyses. By focusing on taxonomic subsets of sequences, relational databases can reduce the size and redundancy of sequence libraries and improve the statistical significance of homologs. In addition, by loading similarity search results into a relational database, it becomes possible to explore and summarize the relationships between all of the proteins in an organism and those in other biological kingdoms. This unit describes how to use relational databases to improve the efficiency of sequence similarity searching and demonstrates various large-scale genomic analyses of homology-related data. It also describes the installation and use of a simple protein sequence database, seqdb_demo, which is used as a basis for the other protocols. The unit also introduces search_demo, a database that stores sequence similarity search results. The search_demo database is then used to explore the evolutionary relationships between E. coli proteins and proteins in other organisms in a large-scale comparative genomic analysis. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

  16. Protein Function Prediction Based on Sequence and Structure Information

    KAUST Repository

    Smaili, Fatima Z.


    The number of available protein sequences in public databases is increasing exponentially. However, a significant fraction of these sequences lack functional annotation which is essential to our understanding of how biological systems and processes operate. In this master thesis project, we worked on inferring protein functions based on the primary protein sequence. In the approach we follow, 3D models are first constructed using I-TASSER. Functions are then deduced by structurally matching these predicted models, using global and local similarities, through three independent enzyme commission (EC) and gene ontology (GO) function libraries. The method was tested on 250 “hard” proteins, which lack homologous templates in both structure and function libraries. The results show that this method outperforms the conventional prediction methods based on sequence similarity or threading. Additionally, our method could be improved even further by incorporating protein-protein interaction information. Overall, the method we use provides an efficient approach for automated functional annotation of non-homologous proteins, starting from their sequence.

  17. A Comprehensive Strategy for Accurate Mutation Detection of the Highly Homologous PMS2. (United States)

    Li, Jianli; Dai, Hongzheng; Feng, Yanming; Tang, Jia; Chen, Stella; Tian, Xia; Gorman, Elizabeth; Schmitt, Eric S; Hansen, Terah A A; Wang, Jing; Plon, Sharon E; Zhang, Victor Wei; Wong, Lee-Jun C


    Germline mutations in the DNA mismatch repair gene PMS2 underlie the cancer susceptibility syndrome, Lynch syndrome. However, accurate molecular testing of PMS2 is complicated by a large number of highly homologous sequences. To establish a comprehensive approach for mutation detection of PMS2, we have designed a strategy combining targeted capture next-generation sequencing (NGS), multiplex ligation-dependent probe amplification, and long-range PCR followed by NGS to simultaneously detect point mutations and copy number changes of PMS2. Exonic deletions (E2 to E9, E5 to E9, E8, E10, E14, and E1 to E15), duplications (E11 to E12), and a nonsense mutation, p.S22*, were identified. Traditional multiplex ligation-dependent probe amplification and Sanger sequencing approaches cannot differentiate the origin of the exonic deletions in the 3' region when PMS2 and PMS2CL share identical sequences as a result of gene conversion. Our approach allows unambiguous identification of mutations in the active gene with a straightforward long-range-PCR/NGS method. Breakpoint analysis of multiple samples revealed that recurrent exon 14 deletions are mediated by homologous Alu sequences. Our comprehensive approach provides a reliable tool for accurate molecular analysis of genes containing multiple copies of highly homologous sequences and should improve PMS2 molecular analysis for patients with Lynch syndrome. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  18. Somatic association of telocentric chromosomes carrying homologous centromeres in common wheat. (United States)

    Mello-Sampayo, T


    Measurements of distances between telocentric chromosomes, either homologous or representing the opposite arms of a metacentric chromosome (complementary telocentrics), were made at metaphase in root tip cells of common wheat carrying two homologous pairs of complementary telocentrics of chromosome 1 B or 6 B (double ditelosomic 1 B or 6 B). The aim was to elucidate the relative locations of the telocentric chromosomes within the cell. The data obtained strongly suggest that all four telocentrics of chromosome 1 B or 6 B are spacially and simultaneously co-associated. In plants carrying two complementary (6 B (S) and 6 B (L)) and a non-related (5 B (L)) telocentric, only the complementary chromosomes were found to be somatically associated. It is thought, therefore, that the somatic association of chromosomes may involve more than two chromosomes in the same association and, since complementary telocentrics are as much associated as homologous, that the homology between centromeres (probably the only homologous region that exists between complementary telocentrics) is a very important condition for somatic association of chromosomes. The spacial arrangement of chromosomes was studied at anaphase and prophase and the polar orientation of chromosomes at prophase was found to resemble anaphase orientation. This was taken as good evidence for the maintenance of the chromosome arrangement - the Rabl orientation - and of the peripheral location of the centromere and its association with the nuclear membrane. Within this general arrangement homologous telocentric chromosomes were frequently seen to have their centromeres associated or directed towards each other. The role of the centromere in somatic association as a spindle fibre attachment and chromosome binder is discussed. It is suggested that for non-homologous chromosomes to become associated in root tips, the only requirement needed should be the homology of centromeres such as exists between complementary

  19. Generation and analysis of expressed sequence tags from Botrytis cinerea

    Directory of Open Access Journals (Sweden)



    Full Text Available Botrytis cinerea is a filamentous plant pathogen of a wide range of plant species, and its infection may cause enormous damage both during plant growth and in the post-harvest phase. We have constructed a cDNA library from an isolate of B. cinerea and have sequenced 11,482 expressed sequence tags that were assembled into 1,003 contigs sequences and 3,032 singletons. Approximately 81% of the unigenes showed significant similarity to genes coding for proteins with known functions: more than 50% of the sequences code for genes involved in cellular metabolism, 12% for transport of metabolites, and approximately 10% for cellular organization. Other functional categories include responses to biotic and abiotic stimuli, cell communication, cell homeostasis, and cell development. We carried out pair-wise comparisons with fungal databases to determine the B. cinerea unisequence set with relevant similarity to genes in other fungal pathogenic counterparts. Among the 4,035 non-redundant B. cinerea unigenes, 1,338 (23% have significant homology with Fusarium verticillioides unigenes. Similar values were obtained for Saccharomyces cerevisiae and Aspergillus nidulans (22% and 24%, respectively. The lower percentages of homology were with Magnaporthe grisae and Neurospora crassa (13% and 19%, respectively. Several genes involved in putative and known fungal virulence and general pathogenicity were identified. The results provide important information for future research on this fungal pathogen

  20. Homological methods, representation theory, and cluster algebras

    CERN Document Server

    Trepode, Sonia


    This text presents six mini-courses, all devoted to interactions between representation theory of algebras, homological algebra, and the new ever-expanding theory of cluster algebras. The interplay between the topics discussed in this text will continue to grow and this collection of courses stands as a partial testimony to this new development. The courses are useful for any mathematician who would like to learn more about this rapidly developing field; the primary aim is to engage graduate students and young researchers. Prerequisites include knowledge of some noncommutative algebra or homological algebra. Homological algebra has always been considered as one of the main tools in the study of finite-dimensional algebras. The strong relationship with cluster algebras is more recent and has quickly established itself as one of the important highlights of today’s mathematical landscape. This connection has been fruitful to both areas—representation theory provides a categorification of cluster algebras, wh...

  1. Whole genome analysis of CRISPR Cas9 sgRNA off-target homologies via an efficient computational algorithm. (United States)

    Zhou, Hong; Zhou, Michael; Li, Daisy; Manthey, Joseph; Lioutikova, Ekaterina; Wang, Hong; Zeng, Xiao


    The beauty and power of the genome editing mechanism, CRISPR Cas9 endonuclease system, lies in the fact that it is RNA-programmable such that Cas9 can be guided to any genomic loci complementary to a 20-nt RNA, single guide RNA (sgRNA), to cleave double stranded DNA, allowing the introduction of wanted mutations. Unfortunately, it has been reported repeatedly that the sgRNA can also guide Cas9 to off-target sites where the DNA sequence is homologous to sgRNA. Using human genome and Streptococcus pyogenes Cas9 (SpCas9) as an example, this article mathematically analyzed the probabilities of off-target homologies of sgRNAs and discovered that for large genome size such as human genome, potential off-target homologies are inevitable for sgRNA selection. A highly efficient computationl algorithm was developed for whole genome sgRNA design and off-target homology searches. By means of a dynamically constructed sequence-indexed database and a simplified sequence alignment method, this algorithm achieves very high efficiency while guaranteeing the identification of all existing potential off-target homologies. Via this algorithm, 1,876,775 sgRNAs were designed for the 19,153 human mRNA genes and only two sgRNAs were found to be free of off-target homology. By means of the novel and efficient sgRNA homology search algorithm introduced in this article, genome wide sgRNA design and off-target analysis were conducted and the results confirmed the mathematical analysis that for a sgRNA sequence, it is almost impossible to escape potential off-target homologies. Future innovations on the CRISPR Cas9 gene editing technology need to focus on how to eliminate the Cas9 off-target activity.

  2. A homology theory for smale spaces

    CERN Document Server

    Putnam, Ian F


    The author develops a homology theory for Smale spaces, which include the basics sets for an Axiom A diffeomorphism. It is based on two ingredients. The first is an improved version of Bowen's result that every such system is the image of a shift of finite type under a finite-to-one factor map. The second is Krieger's dimension group invariant for shifts of finite type. He proves a Lefschetz formula which relates the number of periodic points of the system for a given period to trace data from the action of the dynamics on the homology groups. The existence of such a theory was proposed by Bowen in the 1970s.

  3. The Porcelain Crab Transcriptome and PCAD, the Porcelain Crab Microarray and Sequence Database

    Energy Technology Data Exchange (ETDEWEB)

    Tagmount, Abderrahmane; Wang, Mei; Lindquist, Erika; Tanaka, Yoshihiro; Teranishi, Kristen S.; Sunagawa, Shinichi; Wong, Mike; Stillman, Jonathon H.


    Background: With the emergence of a completed genome sequence of the freshwater crustacean Daphnia pulex, construction of genomic-scale sequence databases for additional crustacean sequences are important for comparative genomics and annotation. Porcelain crabs, genus Petrolisthes, have been powerful crustacean models for environmental and evolutionary physiology with respect to thermal adaptation and understanding responses of marine organisms to climate change. Here, we present a large-scale EST sequencing and cDNA microarray database project for the porcelain crab Petrolisthes cinctipes. Methodology/Principal Findings: A set of ~;;30K unique sequences (UniSeqs) representing ~;;19K clusters were generated from ~;;98K high quality ESTs from a set of tissue specific non-normalized and mixed-tissue normalized cDNA libraries from the porcelain crab Petrolisthes cinctipes. Homology for each UniSeq was assessed using BLAST, InterProScan, GO and KEGG database searches. Approximately 66percent of the UniSeqs had homology in at least one of the databases. All EST and UniSeq sequences along with annotation results and coordinated cDNA microarray datasets have been made publicly accessible at the Porcelain Crab Array Database (PCAD), a feature-enriched version of the Stanford and Longhorn Array Databases.Conclusions/Significance: The EST project presented here represents the third largest sequencing effort for any crustacean, and the largest effort for any crab species. Our assembly and clustering results suggest that our porcelain crab EST data set is equally diverse to the much larger EST set generated in the Daphnia pulex genome sequencing project, and thus will be an important resource to the Daphnia research community. Our homology results support the pancrustacea hypothesis and suggest that Malacostraca may be ancestral to Branchiopoda and Hexapoda. Our results also suggest that our cDNA microarrays cover as much of the transcriptome as can reasonably be captured in

  4. Protein secondary structure prediction for a single-sequence using hidden semi-Markov models

    Directory of Open Access Journals (Sweden)

    Borodovsky Mark


    Full Text Available Abstract Background The accuracy of protein secondary structure prediction has been improving steadily towards the 88% estimated theoretical limit. There are two types of prediction algorithms: Single-sequence prediction algorithms imply that information about other (homologous proteins is not available, while algorithms of the second type imply that information about homologous proteins is available, and use it intensively. The single-sequence algorithms could make an important contribution to studies of proteins with no detected homologs, however the accuracy of protein secondary structure prediction from a single-sequence is not as high as when the additional evolutionary information is present. Results In this paper, we further refine and extend the hidden semi-Markov model (HSMM initially considered in the BSPSS algorithm. We introduce an improved residue dependency model by considering the patterns of statistically significant amino acid correlation at structural segment borders. We also derive models that specialize on different sections of the dependency structure and incorporate them into HSMM. In addition, we implement an iterative training method to refine estimates of HSMM parameters. The three-state-per-residue accuracy and other accuracy measures of the new method, IPSSP, are shown to be comparable or better than ones for BSPSS as well as for PSIPRED, tested under the single-sequence condition. Conclusions We have shown that new dependency models and training methods bring further improvements to single-sequence protein secondary structure prediction. The results are obtained under cross-validation conditions using a dataset with no pair of sequences having significant sequence similarity. As new sequences are added to the database it is possible to augment the dependency structure and obtain even higher accuracy. Current and future advances should contribute to the improvement of function prediction for orphan proteins inscrutable

  5. Fast subcellular localization by cascaded fusion of signal-based and homology-based methods

    Directory of Open Access Journals (Sweden)

    Wang Wei


    Full Text Available Abstract Background The functions of proteins are closely related to their subcellular locations. In the post-genomics era, the amount of gene and protein data grows exponentially, which necessitates the prediction of subcellular localization by computational means. Results This paper proposes mitigating the computation burden of alignment-based approaches to subcellular localization prediction by a cascaded fusion of cleavage site prediction and profile alignment. Specifically, the informative segments of protein sequences are identified by a cleavage site predictor using the information in their N-terminal shorting signals. Then, the sequences are truncated at the cleavage site positions, and the shortened sequences are passed to PSI-BLAST for computing their profiles. Subcellular localization are subsequently predicted by a profile-to-profile alignment support-vector-machine (SVM classifier. To further reduce the training and recognition time of the classifier, the SVM classifier is replaced by a new kernel method based on the perturbational discriminant analysis (PDA. Conclusions Experimental results on a new dataset based on Swiss-Prot Release 57.5 show that the method can make use of the best property of signal- and homology-based approaches and can attain an accuracy comparable to that achieved by using full-length sequences. Analysis of profile-alignment score matrices suggest that both profile creation time and profile alignment time can be reduced without significant reduction in subcellular localization accuracy. It was found that PDA enjoys a short training time as compared to the conventional SVM. We advocate that the method will be important for biologists to conduct large-scale protein annotation or for bioinformaticians to perform preliminary investigations on new algorithms that involve pairwise alignments.

  6. The genome BLASTatlas - a GeneWiz extension for visualization of whole-genome homology

    DEFF Research Database (Denmark)

    Hallin, Peter Fischer; Binnewies, Tim Terence; Ussery, David


    ://, where programming examples are available in Perl. By providing an interoperable method to carry out whole genome visualization of homology, this service offers bioinformaticians as well as biologists an easy-to-adopt workflow that can be directly called from the programming language of the user, hence......The development of fast and inexpensive methods for sequencing bacterial genomes has led to a wealth of data, often with many genomes being sequenced of the same species or closely related organisms. Thus, there is a need for visualization methods that will allow easy comparison of many sequenced...... genomes to a defined reference strain. The BLASTatlas is one such tool that is useful for mapping and visualizing whole genome homology of genes and proteins within a reference strain compared to other strains or species of one or more prokaryotic organisms. We provide examples of BLASTatlases, including...


    Directory of Open Access Journals (Sweden)

    Aditya Dev


    Full Text Available The Shikimate pathway is an attractive target for herbicides and antimicrobial agents because it is essential in microbes and plants but absent in animals. The 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase (DAHPS is the first enzyme of this pathway, which is involved in the condensation of phosphoenolpyruvate (PEP and D-erythrose 4-phosphate (E4P to produce 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP. DAHPS enzymes have been divided into two types, class I and class II, based on their primary amino acid sequence and three dimensional structures. The plant DAHPS belongs to class II and is regulated differently than DAHPS from microorganisms. To understand the structural basis of such differences in DAHPS from plants and its catalytic mechanism, we have used sequence analysis, homology modeling and docking approach to generate the three dimensional models of DAHP synthase from Brachypodium distachyon (Bd-DAHPS complexed with substrate PEP for the first time. The three dimensional models of Bd-DAHPS provides a detailed knowledge of the active site and the important secondary structural regions that play significant roles in the regulatory mechanism and further may be helpful for design of specific inhibitors towards herbicide development.

  8. A family of cell-adhering peptides homologous to fibrinogen C-termini

    International Nuclear Information System (INIS)

    Levy-Beladev, Liron; Levdansky, Lilia; Gaberman, Elena; Friedler, Assaf; Gorodetsky, Raphael


    Research highlights: → Cell-adhesive sequences homologous to fibrinogen C-termini exist in other proteins. → The extended homologous cell-adhesive C-termini peptides family is termed Haptides. → In membrane-like environment random coiled Haptides adopt a helical conformation. → Replacing positively charged residues with alanine reduces Haptides activity. -- Abstract: A family of cell-adhesive peptides homologous to sequences on different chains of fibrinogen was investigated. These homologous peptides, termed Haptides, include the peptides Cβ, preCγ, and CαE, corresponding to sequences on the C-termini of fibrinogen chains β, γ, and αE, respectively. Haptides do not affect cell survival and rate of proliferation of the normal cell types tested. The use of new sensitive assays of cell adhesion clearly demonstrated the ability of Haptides, bound to inert matrices, to mediate attachment of different matrix-dependent cell types including normal fibroblasts, endothelial, and smooth muscle cells. Here we present new active Haptides bearing homologous sequences derived from the C-termini of other proteins, such as angiopoietin 1 and 2, tenascins C and X, and microfibril-associated glycoprotein-4. The cell adhesion properties of all the Haptides were found to be associated mainly with their 11 N-terminal residues. Mutated preCγ peptides revealed that positively charged residues account for their attachment effect. These results suggest a mechanism of direct electrostatic interaction of Haptides with the cell membrane. The extended Haptides family may be applied in modulating adhesion of cells to scaffolds for tissue regeneration and for enhancement of nanoparticulate transfection into cells.

  9. Homology and cohomology of Rees semigroup algebras

    DEFF Research Database (Denmark)

    Grønbæk, Niels; Gourdeau, Frédéric; White, Michael C.


    Let S by a Rees semigroup, and let 1¹(S) be its convolution semigroup algebra. Using Morita equivalence we show that bounded Hochschild homology and cohomology of l¹(S) is isomorphic to those of the underlying discrete group algebra....

  10. Threading homology through algebra selected patterns

    CERN Document Server

    Boffi, Giandomenico


    Aimed at graduate students and researchers in mathematics, this book takes homological themes, such as Koszul complexes and their generalizations, and shows how these can be used to clarify certain problems in selected parts of algebra, as well as their success in solving a number of them.

  11. Cell biology of homologous recombination in yeast

    DEFF Research Database (Denmark)

    Eckert-Boulet, Nadine Valerie; Rothstein, Rodney; Lisby, Michael


    Homologous recombination is an important pathway for error-free repair of DNA lesions, such as single- and double-strand breaks, and for rescue of collapsed replication forks. Here, we describe protocols for live cell imaging of single-lesion recombination events in the yeast Saccharomyces...

  12. Polar representation of centrifugal pump homologous curves

    International Nuclear Information System (INIS)

    Veloso, Marcelo Antonio; Mattos, Joao Roberto Loureiro de


    Essential for any mathematical model designed to simulate flow transient events caused by pump operations is the pump performance data. The performance of a centrifugal pump is characterized by four basic parameters: the rotational speed, the volumetric flow rate, the dynamic head, and the hydraulic torque. Any one of these quantities can be expressed as a function of any two others. The curves showing the relationships between these four variables are called the pump characteristic curves, also referred to as four-quadrant curves. The characteristic curves are empirically developed by the pump manufacturer and uniquely describe head and torque as functions of volumetric flow rate and rotation speed. Because of comprising a large amount of points, the four-quadrant configuration is not suitable for computational purposes. However, it can be converted to a simpler form by the development of the homologous curves, in which dynamic head and hydraulic torque ratios are expressed as functions of volumetric flow and rotation speed ratios. The numerical use of the complete set of homologous curves requires specification of sixteen partial curves, being eight for the dynamic head and eight for the hydraulic torque. As a consequence, the handling of homologous curves is still somewhat complicated. In solving flow transient problems that require the pump characteristic data for all the operation zones, the polar form appears as the simplest way to represent the homologous curves. In the polar method, the complete characteristics of a pump can be described by only two closed curves, one for the dynamic head and other for the hydraulic torque, both in function of a single angular coordinate defined adequately in terms of the quotient between volumetric flow ratio and rotation speed ratio. The usefulness and advantages of this alternative method are demonstrated through a practical example in which the homologous curves for a pump of the type used in the main coolant loops of a

  13. Parametric representation of centrifugal pump homologous curves

    International Nuclear Information System (INIS)

    Veloso, Marcelo A.; Mattos, Joao R.L. de


    Essential for any mathematical model designed to simulate flow transient events caused by pump operations is the pump performance data. The performance of a centrifugal pump is characterized by four basic quantities: the rotational speed, the volumetric flow rate, the dynamic head, and the hydraulic torque. The curves showing the relationships between these four variables are called the pump characteristic curves. The characteristic curves are empirically developed by the pump manufacturer and uniquely describe head and torque as functions of volumetric flow rate and rotation speed. Because of comprising a large amount of points, this configuration is not suitable for computational purposes. However, it can be converted to a simpler form by the development of the homologous curves, in which dynamic head and hydraulic torque ratios are expressed as functions of volumetric flow and rotation speed ratios. The numerical use of the complete set of homologous curves requires specification of sixteen partial curves, being eight for the dynamic head and eight for the hydraulic torque. As a consequence, the handling of homologous curves is still somewhat complicated. In solving flow transient problems that require the pump characteristic data for all the operation zones, the parametric form appears as the simplest way to deal with the homologous curves. In this approach, the complete characteristics of a pump can be described by only two closed curves, one for the dynamic head and other for the hydraulic torque, both in function of a single angular coordinate defined adequately in terms of the quotient between volumetric flow ratio and rotation speed ratio. The usefulness and advantages of this alternative method are demonstrated through a practical example in which the homologous curves for a pump of the type used in the main coolant loops of a pressurized water reactor (PWR) are transformed to the parametric form. (author)

  14. Homology of yeast photoreactivating gene fragment with human genomic digests

    International Nuclear Information System (INIS)

    Meechan, P.J.; Milam, K.M.; Cleaver, J.E.


    Enzymatic photoreactivation of UV-induced DNA lesions has been demonstrated for a variety of prokaryotic and eukaryotic organisms. Its presence in placental mammals, however, has not been clearly established. The authors attempted to resolve this question by assaying for the presence (or absence) of sequences in human DNA complimentary to a fragment of the photoreactivating gene from S. cerevisiae that has recently been cloned. In another study, DNA from human, chick E. coli and yeast cells was digested with either HindIII of BglII, electrophoresed on a 0.5% agarose gel, transferred (Southern blot) to a nylon membrane and probed for homology against a Sau3A restriction fragment from S. cerevisiae that compliments phr/sup -/ cells. Hybridization to human DNA digests was observed only under relatively non-stringent conditions indicating the gene is not conserved in placental mammals. These results are correlated with current literature data concerning photoreactivating enzymes

  15. Non-homologous isofunctional enzymes: a systematic analysis of alternative solutions in enzyme evolution. (United States)

    Omelchenko, Marina V; Galperin, Michael Y; Wolf, Yuri I; Koonin, Eugene V


    Evolutionarily unrelated proteins that catalyze the same biochemical reactions are often referred to as analogous - as opposed to homologous - enzymes. The existence of numerous alternative, non-homologous enzyme isoforms presents an interesting evolutionary problem; it also complicates genome-based reconstruction of the metabolic pathways in a variety of organisms. In 1998, a systematic search for analogous enzymes resulted in the identification of 105 Enzyme Commission (EC) numbers that included two or more proteins without detectable sequence similarity to each other, including 34 EC nodes where proteins were known (or predicted) to have distinct structural folds, indicating independent evolutionary origins. In the past 12 years, many putative non-homologous isofunctional enzymes were identified in newly sequenced genomes. In addition, efforts in structural genomics resulted in a vastly improved structural coverage of proteomes, providing for definitive assessment of (non)homologous relationships between proteins. We report the results of a comprehensive search for non-homologous isofunctional enzymes (NISE) that yielded 185 EC nodes with two or more experimentally characterized - or predicted - structurally unrelated proteins. Of these NISE sets, only 74 were from the original 1998 list. Structural assignments of the NISE show over-representation of proteins with the TIM barrel fold and the nucleotide-binding Rossmann fold. From the functional perspective, the set of NISE is enriched in hydrolases, particularly carbohydrate hydrolases, and in enzymes involved in defense against oxidative stress. These results indicate that at least some of the non-homologous isofunctional enzymes were recruited relatively recently from enzyme families that are active against related substrates and are sufficiently flexible to accommodate changes in substrate specificity.

  16. High frequency of phylogenetically diverse reductive dehalogenase-homologous genes in deep subseafloor sedimentary metagenomes

    Directory of Open Access Journals (Sweden)

    Mikihiko eKawai


    Full Text Available Marine subsurface sediments on the Pacific margin harbor diverse microbial communities even at depths of several hundreds meters below the seafloor (mbsf or more. Previous PCR-based molecular analysis showed the presence of diverse reductive dehalogenase gene (rdhA homologs in marine subsurface sediment, suggesting that anaerobic respiration of organohalides is one of the possible energy-yielding pathways in the organic-rich sedimentary habitat. However, primer-independent molecular characterization of rdhA has remained to be demonstrated. Here, we studied the diversity and frequency of rdhA homologs by metagenomic analysis of five different depth horizons (0.8, 5.1, 18.6, 48.5 and 107.0 mbsf at Site C9001 off the Shimokita Peninsula of Japan. From all metagenomic pools, remarkably diverse rdhA-homologous sequences, some of which are affiliated with novel clusters, were observed with high frequency. As a comparison, we also examined frequency of dissimilatory sulfite reductase genes (dsrAB, key functional genes for microbial sulfate reduction. The dsrAB were also widely observed in the metagenomic pools whereas the frequency of dsrAB genes was generally smaller than that of rdhA-homologous genes. The phylogenetic composition of rdhA-homologous genes was similar among the five depth horizons. Our metagenomic data revealed that subseafloor rdhA homologs are more diverse than previously identified from PCR-based molecular studies. Spatial distribution of similar rdhA homologs across wide depositional ages indicates that the heterotrophic metabolic processes mediated by the genes can be ecologically important, functioning in the organic-rich subseafloor sedimentary biosphere.

  17. Integration of vectors by homologous recombination in the plant pathogen Glomerella cingulata. (United States)

    Rikkerink, E H; Solon, S L; Crowhurst, R N; Templeton, M D


    An homologous transformation system has been developed for the plant pathogenic fungus Glomerella cingulata (Colletotrichum gloeosporioides). A transformation vector containing the G. cingulata gpdA promoter fused to the hygromycin phosphotransferase gene was constructed. Southern analyses indicated that this vector integrated at single sites in most transformants. A novel method of PCR amplification across the recombination junction point indicated that the integration event occurred by homologous recombination in more than 95% of the transformants. Deletion studies demonstrated that 505 bp (the minimum length of homologous promoter DNA analysed which was still capable of promoter function) was sufficient to target integration events. Homologous integration of the vector resulted in duplication of the gdpA promoter region. When transformants were grown without selective pressure, a high incidence of vector excision by recombination between the duplicated regions was evident. The significance of these recombination characteristics is discussed with reference to the feasibility of performing gene disruption experiments.

  18. Assembly and dynamics of the bacteriophage T4 homologous recombination machinery

    Directory of Open Access Journals (Sweden)

    Morrical Scott W


    Full Text Available Abstract Homologous recombination (HR, a process involving the physical exchange of strands between homologous or nearly homologous DNA molecules, is critical for maintaining the genetic diversity and genome stability of species. Bacteriophage T4 is one of the classic systems for studies of homologous recombination. T4 uses HR for high-frequency genetic exchanges, for homology-directed DNA repair (HDR processes including DNA double-strand break repair, and for the initiation of DNA replication (RDR. T4 recombination proteins are expressed at high levels during T4 infection in E. coli, and share strong sequence, structural, and/or functional conservation with their counterparts in cellular organisms. Biochemical studies of T4 recombination have provided key insights on DNA strand exchange mechanisms, on the structure and function of recombination proteins, and on the coordination of recombination and DNA synthesis activities during RDR and HDR. Recent years have seen the development of detailed biochemical models for the assembly and dynamics of presynaptic filaments in the T4 recombination system, for the atomic structure of T4 UvsX recombinase, and for the roles of DNA helicases in T4 recombination. The goal of this chapter is to review these recent advances and their implications for HR and HDR mechanisms in all organisms.

  19. Statistical distributions of optimal global alignment scores of random protein sequences

    Directory of Open Access Journals (Sweden)

    Tang Jiaowei


    Full Text Available Abstract Background The inference of homology from statistically significant sequence similarity is a central issue in sequence alignments. So far the statistical distribution function underlying the optimal global alignments has not been completely determined. Results In this study, random and real but unrelated sequences prepared in six different ways were selected as reference datasets to obtain their respective statistical distributions of global alignment scores. All alignments were carried out with the Needleman-Wunsch algorithm and optimal scores were fitted to the Gumbel, normal and gamma distributions respectively. The three-parameter gamma distribution performs the best as the theoretical distribution function of global alignment scores, as it agrees perfectly well with the distribution of alignment scores. The normal distribution also agrees well with the score distribution frequencies when the shape parameter of the gamma distribution is sufficiently large, for this is the scenario when the normal distribution can be viewed as an approximation of the gamma distribution. Conclusion We have shown that the optimal global alignment scores of random protein sequences fit the three-parameter gamma distribution function. This would be useful for the inference of homology between sequences whose relationship is unknown, through the evaluation of gamma distribution significance between sequences.

  20. Molecular Cloning And Sequencing Of Disintegrin Like Domain ...

    African Journals Online (AJOL)

    Disintegrin-like domain was cloned and sequenced from Cerastes cerastes venom gland tissue. Nested RT-PCR was performed using initial primers designed based on the homology of disintegrins from Trimeresurus flavoviridis, Glodius halys , Agkistrodon halys and Trimeresurus macrosquamatus. The homology was ...

  1. Gene expression of a green fluorescent protein homolog as a host-specific biomarker of heat stress within a reef-building coral. (United States)

    Smith-Keune, C; Dove, S


    Recent incidences of mass coral bleaching indicate that major reef building corals are increasingly suffering thermal stress associated with climate-related temperature increases. The development of pulse amplitude modulated (PAM) fluorometry has enabled rapid detection of the onset of thermal stress within coral algal symbionts, but sensitive biomarkers of thermal stress specific to the host coral have been slower to emerge. Differential display reverse transcription polymerase chain reaction (DDRT-PCR) was used to produce fingerprints of gene expression for the reef-building coral Acropora millepora exposed to 33 degrees C. Changes in the expression of 23 out of 399 putative genes occurred within 144 h. Down-regulation of one host-specific gene (AmA1a) occurred within just 6 h. Full-length sequencing revealed the product of this gene to be an all-protein chromatophore (green fluorescent protein [GFP]-homolog). RT-PCR revealed consistent down-regulation of this GFP-homolog for three replicate colonies within 6 h at both 32 degrees C and 33 degrees C but not at lower temperatures. Down-regulation of this host gene preceded significant decreases in the photosynthetic activity of photosystem II (dark-adapted F (v)/F (m)) of algal symbionts as measured by PAM fluorometry. Gene expression of host-specific genes such as GFP-homologs may therefore prove to be highly sensitive indicators for the onset of thermal stress within host coral cells.

  2. Homologation Reaction of Ketones with Diazo Compounds. (United States)

    Candeias, Nuno R; Paterna, Roberta; Gois, Pedro M P


    This review covers the addition of diazo compounds to ketones to afford homologated ketones, either in the presence or in the absence of promoters or catalysts. Reactions with diazoalkanes, aryldiazomethanes, trimethylsilyldiazomethane, α-diazo esters, and disubstituted diazo compounds are covered, commenting on the complex regiochemistry of the reaction and the nature of the catalysts and promoters. The recent reports on the enantioselective version of ketone homologation reactions are gathered in one section, followed by reports on the use of cyclic ketones ring expansion in total synthesis. Although the first reports of this reaction appeared in the literature almost one century ago, the recent achievements, in particular, for the asymmetric version, forecast the development of new breakthroughs in the synthetically valuable field of diazo chemistry.

  3. Homological mirror symmetry and tropical geometry

    CERN Document Server

    Catanese, Fabrizio; Kontsevich, Maxim; Pantev, Tony; Soibelman, Yan; Zharkov, Ilia


    The relationship between Tropical Geometry and Mirror Symmetry goes back to the work of Kontsevich and Y. Soibelman (2000), who applied methods of non-archimedean geometry (in particular, tropical curves) to Homological Mirror Symmetry. In combination with the subsequent work of Mikhalkin on the “tropical” approach to Gromov-Witten theory, and the work of Gross and Siebert, Tropical Geometry has now become a powerful tool. Homological Mirror Symmetry is the area of mathematics concentrated around several categorical equivalences connecting symplectic and holomorphic (or algebraic) geometry. The central ideas first appeared in the work of Maxim Kontsevich (1993). Roughly speaking, the subject can be approached in two ways: either one uses Lagrangian torus fibrations of Calabi-Yau manifolds (the so-called Strominger-Yau-Zaslow picture, further developed by Kontsevich and Soibelman) or one uses Lefschetz fibrations of symplectic manifolds (suggested by Kontsevich and further developed by Seidel). Tropical Ge...

  4. Homological stability for unordered configuration spaces

    DEFF Research Database (Denmark)

    Randal-Williams, Oscar


    This paper consists of two related parts. In the first part we give a self-contained proof of homological stability for the spaces C_n(M;X) of configurations of n unordered points in a connected open manifold M with labels in a path-connected space X, with the best possible integral stability range...... of the spaces C_n(M) can be considered stable when M is a closed manifold. In this case there are no stabilisation maps, but one may still ask if the dimensions of the homology groups over some field stabilise with n. We prove that this is true when M is odd-dimensional, or when the field is F_2 or Q...

  5. Searching remote homology with spectral clustering with symmetry in neighborhood cluster kernels.

    Directory of Open Access Journals (Sweden)

    Ujjwal Maulik

    Full Text Available Remote homology detection among proteins utilizing only the unlabelled sequences is a central problem in comparative genomics. The existing cluster kernel methods based on neighborhoods and profiles and the Markov clustering algorithms are currently the most popular methods for protein family recognition. The deviation from random walks with inflation or dependency on hard threshold in similarity measure in those methods requires an enhancement for homology detection among multi-domain proteins. We propose to combine spectral clustering with neighborhood kernels in Markov similarity for enhancing sensitivity in detecting homology independent of "recent" paralogs. The spectral clustering approach with new combined local alignment kernels more effectively exploits the unsupervised protein sequences globally reducing inter-cluster walks. When combined with the corrections based on modified symmetry based proximity norm deemphasizing outliers, the technique proposed in this article outperforms other state-of-the-art cluster kernels among all twelve implemented kernels. The comparison with the state-of-the-art string and mismatch kernels also show the superior performance scores provided by the proposed kernels. Similar performance improvement also is found over an existing large dataset. Therefore the proposed spectral clustering framework over combined local alignment kernels with modified symmetry based correction achieves superior performance for unsupervised remote homolog detection even in multi-domain and promiscuous domain proteins from Genolevures database families with better biological relevance. Source code available upon

  6. Universal sequence map (USM of arbitrary discrete sequences

    Directory of Open Access Journals (Sweden)

    Almeida Jonas S


    Full Text Available Abstract Background For over a decade the idea of representing biological sequences in a continuous coordinate space has maintained its appeal but not been fully realized. The basic idea is that any sequence of symbols may define trajectories in the continuous space conserving all its statistical properties. Ideally, such a representation would allow scale independent sequence analysis – without the context of fixed memory length. A simple example would consist on being able to infer the homology between two sequences solely by comparing the coordinates of any two homologous units. Results We have successfully identified such an iterative function for bijective mappingψ of discrete sequences into objects of continuous state space that enable scale-independent sequence analysis. The technique, named Universal Sequence Mapping (USM, is applicable to sequences with an arbitrary length and arbitrary number of unique units and generates a representation where map distance estimates sequence similarity. The novel USM procedure is based on earlier work by these and other authors on the properties of Chaos Game Representation (CGR. The latter enables the representation of 4 unit type sequences (like DNA as an order free Markov Chain transition table. The properties of USM are illustrated with test data and can be verified for other data by using the accompanying web-based tool: Conclusions USM is shown to enable a statistical mechanics approach to sequence analysis. The scale independent representation frees sequence analysis from the need to assume a memory length in the investigation of syntactic rules.

  7. Identification of rat genes by TWINSCAN gene prediction, RT-PCR, and direct sequencing

    DEFF Research Database (Denmark)

    Wu, Jia Qian; Shteynberg, David; Arumugam, Manimozhiyan


    an alternative approach: reverse transcription-polymerase chain reaction (RT-PCR) and direct sequencing based on dual-genome de novo predictions from TWINSCAN. We tested 444 TWINSCAN-predicted rat genes that showed significant homology to known human genes implicated in disease but that were partially...... in the single-intron experiment. Spliced sequences were amplified in 46 cases (34%). We conclude that this procedure for elucidating gene structures with native cDNA sequences is cost-effective and will become even more so as it is further optimized.......The publication of a draft sequence of a third mammalian genome--that of the rat--suggests a need to rethink genome annotation. New mammalian sequences will not receive the kind of labor-intensive annotation efforts that are currently being devoted to human. In this paper, we demonstrate...

  8. Regulation of homologous recombination in eukaryotes


    Heyer, Wolf-Dietrich; Ehmsen, Kirk T.; Liu, Jie


    Homologous recombination is required for accurate chromosome segregation during the first meiotic division and constitutes a key repair and tolerance pathway for complex DNA damage including DNA double-stranded breaks, interstrand crosslinks, and DNA gaps. In addition, recombination and replication are inextricably linked, as recombination recovers stalled and broken replication forks enabling the evolution of larger genomes/replicons. Defects in recombination lead to genomic instability and ...

  9. Khovanov homology of graph-links

    Energy Technology Data Exchange (ETDEWEB)

    Nikonov, Igor M [M. V. Lomonosov Moscow State University, Faculty of Mechanics and Mathematics, Moscow (Russian Federation)


    Graph-links arise as the intersection graphs of turning chord diagrams of links. Speaking informally, graph-links provide a combinatorial description of links up to mutations. Many link invariants can be reformulated in the language of graph-links. Khovanov homology, a well-known and useful knot invariant, is defined for graph-links in this paper (in the case of the ground field of characteristic two). Bibliography: 14 titles.

  10. Quandle and Biquandle Homology Calculation in R

    Directory of Open Access Journals (Sweden)

    Roger Fenn


    Full Text Available In knot theory several knot invariants have been found over the last decades. This paper concerns itself with invariants of several of those invariants, namely the Homology of racks, quandles, biracks and biquandles. The software described in this paper calculates the rack, quandle and degenerate homology groups of racks and biracks. It works for any rack/quandle with finite elements where there are homology coefficients in 'Z'k. The up and down actions can be given either as a function of the elements of 'Z'k or provided as a matrix. When calculating a rack, the down action should coincide with the identity map. We have provided actions for both the general dihedral quandle and the group quandle over 'S'3. We also provide a second function to test if a set with a given action (or with both actions gives rise to a quandle or biquandle. The program is provided as an R package and can be found at   AMS subject classification: 57M27; 57M25

  11. Several aspects of some techniques avoiding homologous blood transfusions

    NARCIS (Netherlands)

    E.C.S.M. van Woerkens (Liesbeth)


    textabstractThe use of homologous blood products during anesthesia and surgery is not without risks. Complications due to homologous blood transfusions include transfusion reactions, isosensitization, transmission of infections (including HIV, hepatitis, CMV) and immunosuppression (resuiting in

  12. Secondary Analysis of the NCI-60 Whole Exome Sequencing Data Indicates Significant Presence of Propionibacterium acnes Genomic Material in Leukemia (RPMI-8226 and Central Nervous System (SF-295, SF-539, and SNB-19 Cell Lines.

    Directory of Open Access Journals (Sweden)

    Mark Rojas

    Full Text Available The NCI-60 human tumor cell line panel has been used in a broad range of cancer research over the last two decades. A landmark 2013 whole exome sequencing study of this panel added an exceptional new resource for cancer biologists. The complementary analysis of the sequencing data produced by this study suggests the presence of Propionibacterium acnes genomic sequences in almost half of the datasets, with the highest abundance in the leukemia (RPMI-8226 and central nervous system (SF-295, SF-539, and SNB-19 cell lines. While the origin of these contaminating bacterial sequences remains to be determined, observed results suggest that computational control for the presence of microbial genomic material is a necessary step in the analysis of the high throughput sequencing (HTS data.

  13. Computing Homology Group Generators of Images Using Irregular Graph Pyramids


    Peltier , Samuel; Ion , Adrian; Haxhimusa , Yll; Kropatsch , Walter; Damiand , Guillaume


    International audience; We introduce a method for computing homology groups and their generators of a 2D image, using a hierarchical structure i.e. irregular graph pyramid. Starting from an image, a hierarchy of the image is built, by two operations that preserve homology of each region. Instead of computing homology generators in the base where the number of entities (cells) is large, we first reduce the number of cells by a graph pyramid. Then homology generators are computed efficiently on...

  14. Statistical alignment: computational properties, homology testing and goodness-of-fit

    DEFF Research Database (Denmark)

    Hein, J; Wiuf, Carsten; Møller, Martin


    The model of insertions and deletions in biological sequences, first formulated by Thorne, Kishino, and Felsenstein in 1991 (the TKF91 model), provides a basis for performing alignment within a statistical framework. Here we investigate this model.Firstly, we show how to accelerate the statistical...... alignment algorithms several orders of magnitude. The main innovations are to confine likelihood calculations to a band close to the similarity based alignment, to get good initial guesses of the evolutionary parameters and to apply an efficient numerical optimisation algorithm for finding the maximum...... analysis.Secondly, we propose a new homology test based on this model, where homology means that an ancestor to a sequence pair can be found finitely far back in time. This test has statistical advantages relative to the traditional shuffle test for proteins.Finally, we describe a goodness-of-fit test...

  15. An RNA secondary structure bias for non-homologous reverse transcriptase-mediated deletions in vivo

    DEFF Research Database (Denmark)

    Duch, Mogens; Carrasco, Maria L; Jespersen, Thomas


    Murine leukemia viruses harboring an internal ribosome entry site (IRES)-directed translational cassette are able to replicate, but undergo loss of heterologous sequences upon continued passage. While complete loss of heterologous sequences is favored when these are flanked by a direct repeat......, deletion mutants with junction sites within the heterologous cassette may also be retrieved, in particular from vectors without flanking repeats. Such deletion mutants were here used to investigate determinants of reverse transcriptase-mediated non-homologous recombination. Based upon previous structural...... result from template switching during first-strand cDNA synthesis and that the choice of acceptor sites for non-homologous recombination are guided by non-paired regions. Our results may have implications for recombination events taking place within structured regions of retroviral RNA genomes...

  16. Human papilloma viruses and cervical tumours: mapping of integration sites and analysis of adjacent cellular sequences

    International Nuclear Information System (INIS)

    Klimov, Eugene; Vinokourova, Svetlana; Moisjak, Elena; Rakhmanaliev, Elian; Kobseva, Vera; Laimins, Laimonis; Kisseljov, Fjodor; Sulimova, Galina


    In cervical tumours the integration of human papilloma viruses (HPV) transcripts often results in the generation of transcripts that consist of hybrids of viral and cellular sequences. Mapping data using a variety of techniques has demonstrated that HPV integration occurred without obvious specificity into human genome. However, these techniques could not demonstrate whether integration resulted in the generation of transcripts encoding viral or viral-cellular sequences. The aim of this work was to map the integration sites of HPV DNA and to analyse the adjacent cellular sequences. Amplification of the INTs was done by the APOT technique. The APOT products were sequenced according to standard protocols. The analysis of the sequences was performed using BLASTN program and public databases. To localise the INTs PCR-based screening of GeneBridge4-RH-panel was used. Twelve cellular sequences adjacent to integrated HPV16 (INT markers) expressed in squamous cell cervical carcinomas were isolated. For 11 INT markers homologous human genomic sequences were readily identified and 9 of these showed significant homologies to known genes/ESTs. Using the known locations of homologous cDNAs and the RH-mapping techniques, mapping studies showed that the INTs are distributed among different human chromosomes for each tumour sample and are located in regions with the high levels of expression. Integration of HPV genomes occurs into the different human chromosomes but into regions that contain highly transcribed genes. One interpretation of these studies is that integration of HPV occurs into decondensed regions, which are more accessible for integration of foreign DNA

  17. Isolation, sequence identification and tissue expression profile of a ...

    African Journals Online (AJOL)

    The complete expressed sequence tag (CDS) sequence of Banna mini-pig inbred line (BMI) ribokinase gene (RBKS) was amplified using the reverse transcription-polymerase chain reaction (RT-PCR) based on the conserved sequence information of the cattle or other mammals and known highly homologous swine ESTs.

  18. Comparative anatomy of the human APRT gene and enzyme: nucleotide sequence divergence and conservation of a nonrandom CpG dinucleotide arrangement

    International Nuclear Information System (INIS)

    Broderick, T.P.; Schaff, D.A.; Bertino, A.M.; Dush, M.K.; Tischfield, J.A.; Stambrook, P.J.


    The functional human adenine phosphoribosyltransferase (APRT) gene is <2.6 kilobases in length and contains five exons. The amino acid sequences of APRTs have been highly conserved throughout evolution. The human enzyme is 82%, 90%, and 40% identical to the mouse, hamster, and Escherichia coli enzymes, respectively. The promoter region of the human APRT gene, like that of several other housekeeping genes, lacks TATA and CCAAT boxes but contains five GC boxes that are potential binding sites for the Sp1 transcription factor. The distal three, however, are dispensable for gene expression. Comparison between human and mouse APRT gene nucleotide sequences reveals a high degree of homology within protein coding regions but an absence of significant homology in 5' flanking, 3' untranslated, and intron sequences, except for similarly positioned GC boxes in the promoter region and a 26-base-pair region in intron 3. This 26-base-pair sequence is 92% identical with a similarly positioned sequence in the mouse gene and is also found in intron 3 of the hamster gene, suggesting that its retention may be a consequence of stringent selection. The positions of all introns have been precisely retained in the human and both rodent genes. Retention of an elevated CpG dinucleotide content, despite loss of sequence homology, suggests that there may be selection for CpG dinucleotides in these regions and that their maintenance may be important for APRT gene function

  19. Phylogenetic incongruence in E. coli O104: understanding the evolutionary relationships of emerging pathogens in the face of homologous recombination.

    Directory of Open Access Journals (Sweden)

    Weilong Hao

    Full Text Available Escherichia coli O104:H4 was identified as an emerging pathogen during the spring and summer of 2011 and was responsible for a widespread outbreak that resulted in the deaths of 50 people and sickened over 4075. Traditional phenotypic and genotypic assays, such as serotyping, pulsed field gel electrophoresis (PFGE, and multilocus sequence typing (MLST, permit identification and classification of bacterial pathogens, but cannot accurately resolve relationships among genotypically similar but pathotypically different isolates. To understand the evolutionary origins of E. coli O104:H4, we sequenced two strains isolated in Ontario, Canada. One was epidemiologically linked to the 2011 outbreak, and the second, unrelated isolate, was obtained in 2010. MLST analysis indicated that both isolates are of the same sequence type (ST678, but whole-genome sequencing revealed differences in chromosomal and plasmid content. Through comprehensive phylogenetic analysis of five O104:H4 ST678 genomes, we identified 167 genes in three gene clusters that have undergone homologous recombination with distantly related E. coli strains. These recombination events have resulted in unexpectedly high sequence diversity within the same sequence type. Failure to recognize or adjust for homologous recombination can result in phylogenetic incongruence. Understanding the extent of homologous recombination among different strains of the same sequence type may explain the pathotypic differences between the ON2010 and ON2011 strains and help shed new light on the emergence of this new pathogen.

  20. Internal and External Reconnection Series Homologous Solar Flares (United States)

    Sterling, Alphonse C.; Moore, Ronald L.


    Using data from the extreme ultraviolet imaging telescope (EIT) on SOHO and the soft X-ray telescope (SXT) on Yohkoh, we examine a series of morphologically homologous solar flares occurring in National Oceanic and Atmospheric Administration (NOAA) active region 8210 over May 1-2, 1998. An emerging flux region (EFR) impacted against a sunspot to the west and next to a coronal hole to the east is the source of the repeated flaring. An SXT sigmoid parallels the EFR's neutral line at the site of the initial flaring in soft X rays. In EIT each flaring episode begins with the formation of a crinkle pattern external to the EFR. These EIT crinkles move out from, and then in toward, the EFR with velocities approx. 20 km/ s. A shrinking and expansion of the width of the coronal hole coincides with the crinkle activity, and generation and evolution of a postflare loop system begins near the time of crinkle formation. Using a schematic based on magnetograms of the region, we suggest that these observations are consistent with the standard reconnection-based model for solar eruptions but are modified by the presence of the additional magnetic fields of the sunspot and coronal hole. In the schematic, internal reconnection begins inside of the EFR-associated fields, unleashing a flare, postflare loops, and a coronal mass ejection (CME). External reconnection, first occurring between the escaping CME and the coronal hole field and second occurring between fields formed as a result of the first external reconnection, results in the EIT crinkles and changes in the coronal hole boundary. By the end of the second external reconnection, the initial setup is reinstated; thus the sequence can repeat, resulting in morphologically homologous eruptions. Our inferred magnetic topology is similar to that suggested in the "breakout model" of eruptions although we cannot determine if our eruptions are released primarily by the breakout mechanism (external reconnection) or, alternatively

  1. Function of Rad51 paralogs in eukaryotic homologous recombinational repair

    International Nuclear Information System (INIS)

    Liu, N.; Skowronek, K.


    Full text: Homologous recombinational repair (HRR) is an important mechanism for maintaining genetic integrity and cancer prevention by accurately repair of DNA double strand breaks induced by environmental insults or occurred in DNA replication. A critical step in HRR is the polymerization of Rad51 on single stranded DNA to form nuclear protein filaments, the later conduct DNA strand paring and exchange between homologous strands. A number of proteins, including replication protein A (RPA), Rad52 and Rad51 paralogs, are suggested to modulate or facilitate the process of Rad51 filament formation. Five Rad51 paralogs, namely XRCC2, XRCC3, Rad51B, Rad51C and Rad51D have been identified in eucaryotic cells. These proteins show distant protein sequence identity to Rad51, to yeast Rad51 paralogs (Rad55 and Rad57) and to each other. Hamster or chicken mutants of Rad51 paralogs exhibit hypersensitivity to a variety of DNA damaging agents, especially cross-linking agents, and are defective in assembly of Rad51 onto HRR site after DNA damage. Recent data from our and other labs showed that Rad51 paralogs constitute two distinct complexes in cell extracts, one contains XRCC2, Rad51B, Rad51C and Rad51D, and the other contains Rad51C and XRCC3. Rad51C is involved in both complexes. Our results also showed that XRCC3-Rad51C complex interacts with Rad51 in vivo. Furthermore, overexpression of Rad52 can partially suppress the hypersensitivity of XRCC2 mutant irs1 to ionizing radiation and corrected the defects in Rad51 focus formation. These results suggest that XRCC2 and other Rad51 paralogs play a mediator function to Rad51 in the early stage of HRR

  2. DNA damage, homology-directed repair, and DNA methylation.

    Directory of Open Access Journals (Sweden)

    Concetta Cuozzo


    Full Text Available To explore the link between DNA damage and gene silencing, we induced a DNA double-strand break in the genome of Hela or mouse embryonic stem (ES cells using I-SceI restriction endonuclease. The I-SceI site lies within one copy of two inactivated tandem repeated green fluorescent protein (GFP genes (DR-GFP. A total of 2%-4% of the cells generated a functional GFP by homology-directed repair (HR and gene conversion. However, approximately 50% of these recombinants expressed GFP poorly. Silencing was rapid and associated with HR and DNA methylation of the recombinant gene, since it was prevented in Hela cells by 5-aza-2'-deoxycytidine. ES cells deficient in DNA methyl transferase 1 yielded as many recombinants as wild-type cells, but most of these recombinants expressed GFP robustly. Half of the HR DNA molecules were de novo methylated, principally downstream to the double-strand break, and half were undermethylated relative to the uncut DNA. Methylation of the repaired gene was independent of the methylation status of the converting template. The methylation pattern of recombinant molecules derived from pools of cells carrying DR-GFP at different loci, or from an individual clone carrying DR-GFP at a single locus, was comparable. ClustalW analysis of the sequenced GFP molecules in Hela and ES cells distinguished recombinant and nonrecombinant DNA solely on the basis of their methylation profile and indicated that HR superimposed novel methylation profiles on top of the old patterns. Chromatin immunoprecipitation and RNA analysis revealed that DNA methyl transferase 1 was bound specifically to HR GFP DNA and that methylation of the repaired segment contributed to the silencing of GFP expression. Taken together, our data support a mechanistic link between HR and DNA methylation and suggest that DNA methylation in eukaryotes marks homologous recombined segments.

  3. A PHF8 homolog in C. elegans promotes DNA repair via homologous recombination.

    Directory of Open Access Journals (Sweden)

    Changrim Lee

    Full Text Available PHF8 is a JmjC domain-containing histone demethylase, defects in which are associated with X-linked mental retardation. In this study, we examined the roles of two PHF8 homologs, JMJD-1.1 and JMJD-1.2, in the model organism C. elegans in response to DNA damage. A deletion mutation in either of the genes led to hypersensitivity to interstrand DNA crosslinks (ICLs, while only mutation of jmjd-1.1 resulted in hypersensitivity to double-strand DNA breaks (DSBs. In response to ICLs, JMJD-1.1 did not affect the focus formation of FCD-2, a homolog of FANCD2, a key protein in the Fanconi anemia pathway. However, the dynamic behavior of RPA-1 and RAD-51 was affected by the mutation: the accumulations of both proteins at ICLs appeared normal, but their subsequent disappearance was retarded, suggesting that later steps of homologous recombination were defective. Similar changes in the dynamic behavior of RPA-1 and RAD-51 were seen in response to DSBs, supporting a role of JMJD-1.1 in homologous recombination. Such a role was also supported by our finding that the hypersensitivity of jmjd-1.1 worms to ICLs was rescued by knockdown of lig-4, a homolog of Ligase 4 active in nonhomologous end-joining. The hypersensitivity of jmjd-1.1 worms to ICLs was increased by rad-54 knockdown, suggesting that JMJD-1.1 acts in parallel with RAD-54 in modulating chromatin structure. Indeed, the level of histone H3 Lys9 tri-methylation, a marker of heterochromatin, was higher in jmjd-1.1 cells than in wild-type cells. We conclude that the histone demethylase JMJD-1.1 influences homologous recombination either by relaxing heterochromatin structure or by indirectly regulating the expression of multiple genes affecting DNA repair.

  4. Frequent gene conversion events between the X and Y homologous chromosomal regions in primates

    Directory of Open Access Journals (Sweden)

    Hirai Hirohisa


    Full Text Available Abstract Background Mammalian sex-chromosomes originated from a pair of autosomes. A step-wise cessation of recombination is necessary for the proper maintenance of sex-determination and, consequently, generates a four strata structure on the X chromosome. Each stratum shows a specific per-site nucleotide sequence difference (p-distance between the X and Y chromosomes, depending on the time of recombination arrest. Stratum 4 covers the distal half of the human X chromosome short arm and the p-distance of the stratum is ~10%, on average. However, a 100-kb region, which includes KALX and VCX, in the middle of stratum 4 shows a significantly lower p-distance (1-5%, suggesting frequent sequence exchanges or gene conversions between the X and Y chromosomes in humans. To examine the evolutionary mechanism for this low p-distance region, sequences of a corresponding region including KALX/Y from seven species of non-human primates were analyzed. Results Phylogenetic analysis of this low p-distance region in humans and non-human primate species revealed that gene conversion like events have taken place at least ten times after the divergence of New World monkeys and Catarrhini (i.e., Old World monkeys and hominoids. A KALY-converted KALX allele in white-handed gibbons also suggests a possible recent gene conversion between the X and Y chromosomes. In these primate sequences, the proximal boundary of this low p-distance region is located in a LINE element shared between the X and Y chromosomes, suggesting the involvement of this element in frequent gene conversions. Together with a palindrome on the Y chromosome, a segmental palindrome structure on the X chromosome at the distal boundary near VCX, in humans and chimpanzees, may mediate frequent sequence exchanges between X and Y chromosomes. Conclusion Gene conversion events between the X and Y homologous regions have been suggested, mainly in humans. Here, we found frequent gene conversions in the

  5. Homologous genetic recombination in the yellow head complex of nidoviruses infecting Penaeus monodon shrimp. (United States)

    Wijegoonawardane, Priyanjalie K M; Sittidilokratna, Nusra; Petchampai, Natthida; Cowley, Jeff A; Gudkovs, Nicholas; Walker, Peter J


    Yellow head virus (YHV) is a highly virulent pathogen of Penaeus monodon shrimp. It is one of six known genotypes in the yellow head complex of nidoviruses which also includes mildly pathogenic gill-associated virus (GAV, genotype 2) and four other genotypes (genotypes 3-6) that have been detected only in healthy shrimp. In this study, comparative phylogenetic analyses conducted on replicase- (ORF1b) and glycoprotein- (ORF3) gene amplicons identified 10 putative natural recombinants amongst 28 viruses representing all six genotypes from across the Indo-Pacific region. The approximately 4.6 kb genomic region spanning the two amplicons was sequenced for three putative recombinant viruses from Vietnam (genotype 3/5), the Philippines (genotype 5/2) and Indonesia (genotype 3/2). SimPlot analysis using these and representative parental virus sequences confirmed that each was a recombinant genotype and identified a recombination hotspot in a region just upstream of the ORF1b C-terminus. Maximum-likelihood breakpoint analysis predicted identical crossover positions in the Vietnamese and Indonesian recombinants, and a crossover position 12 nt upstream in the Philippine recombinant. Homologous genetic recombination in the same genome region was also demonstrated in recombinants generated experimentally in shrimp co-infected with YHV and GAV. The high frequency with which natural recombinants were identified indicates that genetic exchange amongst genotypes is occurring commonly in Asia and playing a significant role in expanding the genetic diversity in the yellow head complex. This is the first evidence of genetic recombination in viruses infecting crustaceans and has significant implications for the pathogenesis of infection and diagnosis of these newly emerging invertebrate pathogens.

  6. Hochschild Homology and Cohomology of Klein Surfaces

    Directory of Open Access Journals (Sweden)

    Frédéric Butin


    Full Text Available Within the framework of deformation quantization, a first step towards the study of star-products is the calculation of Hochschild cohomology. The aim of this article is precisely to determine the Hochschild homology and cohomology in two cases of algebraic varieties. On the one hand, we consider singular curves of the plane; here we recover, in a different way, a result proved by Fronsdal and make it more precise. On the other hand, we are interested in Klein surfaces. The use of a complex suggested by Kontsevich and the help of Groebner bases allow us to solve the problem.

  7. Homology in vertebrates bone mineral structure

    International Nuclear Information System (INIS)

    Batdehmbehrehl, G.; Chultehm, D.; Sangaa, D.


    Using the neutron diffraction method a domination of low crystal syngonic (sp. gr. P63/m) phase Ca 5 [PO 4 ] 3 (OH, F, Cl) in bull and sheep bones as well as in the fossil dinosaur bone has been established and crystal phases in all the bones have identical structure (homology). The result becomes to be an important contribution to fundamental science such as biological evolution and to be useful in medical practice and solution of radiobiological problems connected with vertebrates and man. (author)

  8. Homological Perturbation Theory for Nonperturbative Integrals (United States)

    Johnson-Freyd, Theo


    We use the homological perturbation lemma to produce explicit formulas computing the class in the twisted de Rham complex represented by an arbitrary polynomial. This is a non-asymptotic version of the method of Feynman diagrams. In particular, we explain that phenomena usually thought of as particular to asymptotic integrals in fact also occur exactly: integrals of the type appearing in quantum field theory can be reduced in a totally algebraic fashion to integrals over an Euler-Lagrange locus, provided this locus is understood in the scheme-theoretic sense, so that imaginary critical points and multiplicities of degenerate critical points contribute.

  9. PEST sequences in the malaria parasite Plasmodium falciparum: a genomic study

    Directory of Open Access Journals (Sweden)

    Bell Angus


    Full Text Available Abstract Background Inhibitors of the protease calpain are known to have selectively toxic effects on Plasmodium falciparum. The enzyme has a natural inhibitor calpastatin and in eukaryotes is responsible for turnover of proteins containing short sequences enriched in certain amino acids (PEST sequences. The genome of P. falciparum was searched for this protease, its natural inhibitor and putative substrates. Methods The publicly available P. falciparum genome was found to have too many errors to permit reliable analysis. An earlier annotation of chromosome 2 was instead examined. PEST scores were determined for all annotated proteins. The published genome was searched for calpain and calpastatin homologs. Results Typical PEST sequences were found in 13% of the proteins on chromosome 2, including a surprising number of cell-surface proteins. The annotated calpain gene has a non-biological "intron" that appears to have been created to avoid an unrecognized frameshift. Only the catalytic domain has significant similarity with the vertebrate calpains. No calpastatin homologs were found in the published annotation. Conclusion A calpain gene is present in the genome and many putative substrates of this enzyme have been found. Calpastatin homologs may be found once the re-annotation is completed. Given the selective toxicity of calpain inhibitors, this enzyme may be worth exploring further as a potential drug target.

  10. Annotating Protein Functional Residues by Coupling High-Throughput Fitness Profile and Homologous-Structure Analysis. (United States)

    Du, Yushen; Wu, Nicholas C; Jiang, Lin; Zhang, Tianhao; Gong, Danyang; Shu, Sara; Wu, Ting-Ting; Sun, Ren


    Identification and annotation of functional residues are fundamental questions in protein sequence analysis. Sequence and structure conservation provides valuable information to tackle these questions. It is, however, limited by the incomplete sampling of sequence space in natural evolution. Moreover, proteins often have multiple functions, with overlapping sequences that present challenges to accurate annotation of the exact functions of individual residues by conservation-based methods. Using the influenza A virus PB1 protein as an example, we developed a method to systematically identify and annotate functional residues. We used saturation mutagenesis and high-throughput sequencing to measure the replication capacity of single nucleotide mutations across the entire PB1 protein. After predicting protein stability upon mutations, we identified functional PB1 residues that are essential for viral replication. To further annotate the functional residues important to the canonical or noncanonical functions of viral RNA-dependent RNA polymerase (vRdRp), we performed a homologous-structure analysis with 16 different vRdRp structures. We achieved high sensitivity in annotating the known canonical polymerase functional residues. Moreover, we identified a cluster of noncanonical functional residues located in the loop region of the PB1 β-ribbon. We further demonstrated that these residues were important for PB1 protein nuclear import through the interaction with Ran-binding protein 5. In summary, we developed a systematic and sensitive method to identify and annotate functional residues that are not restrained by sequence conservation. Importantly, this method is generally applicable to other proteins about which homologous-structure information is available. To fully comprehend the diverse functions of a protein, it is essential to understand the functionality of individual residues. Current methods are highly dependent on evolutionary sequence conservation, which is

  11. Cloning of human and mouse genes homologous to RAD52, a yeast gene involved in DNA repair and recombination.

    NARCIS (Netherlands)

    D.F.R. Muris; O.Y. Bezzubova (Olga); J-M. Buerstedde; K. Vreeken; A.S. Balajee; C.J. Osgood; C. Troelstra (Christine); J.H.J. Hoeijmakers (Jan); K. Ostermann; H. Schmidt (Henning); A.T. Natarajan; J.C.J. Eeken; P.H.M. Lohmann (Paul); A. Pastink (Albert)


    textabstractThe RAD52 gene of Saccharomyces cerevisiae is required for recombinational repair of double-strand breaks. Using degenerate oligonucleotides based on conserved amino acid sequences of RAD52 and rad22, its counterpart from Schizosaccharomyces pombe, RAD52 homologs from man and mouse were

  12. Structural analysis of zwitterionic liquids vs. homologous ionic liquids (United States)

    Wu, Boning; Kuroda, Kosuke; Takahashi, Kenji; Castner, Edward W.


    Zwitterionic liquids (Zw-ILs) have been developed that are homologous to monovalent ionic liquids (ILs) and show great promise for controlled dissolution of cellulosic biomass. Using both high energy X-ray scattering and atomistic molecular simulations, this article compares the bulk liquid structural properties for novel Zw-ILs with their homologous ILs. It is shown that the significant localization of the charges on Zw-ILs leads to charge ordering similar to that observed for conventional ionic liquids with monovalent anions and cations. A low-intensity first sharp diffraction peak in the liquid structure factor S(q) is observed for both the Zw-IL and the IL. This is unexpected since both the Zw-IL and IL have a 2-(2-methoxyethoxy)ethyl (diether) functional group on the cationic imidazolium ring and ether functional groups are known to suppress this peak. Detailed analyses show that this intermediate range order in the liquid structure arises for slightly different reasons in the Zw-IL vs. the IL. For the Zw-IL, the ether tails in the liquid are shown to aggregate into nanoscale domains.

  13. Evolutionary distance from human homologs reflects allergenicity of animal food proteins. (United States)

    Jenkins, John A; Breiteneder, Heimo; Mills, E N Clare


    In silico analysis of allergens can identify putative relationships among protein sequence, structure, and allergenic properties. Such systematic analysis reveals that most plant food allergens belong to a restricted number of protein superfamilies, with pollen allergens behaving similarly. We have investigated the structural relationships of animal food allergens and their evolutionary relatedness to human homologs to define how closely a protein must resemble a human counterpart to lose its allergenic potential. Profile-based sequence homology methods were used to classify animal food allergens into Pfam families, and in silico analyses of their evolutionary and structural relationships were performed. Animal food allergens could be classified into 3 main families--tropomyosins, EF-hand proteins, and caseins--along with 14 minor families each composed of 1 to 3 allergens. The evolutionary relationships of each of these allergen superfamilies showed that in general, proteins with a sequence identity to a human homolog above approximately 62% were rarely allergenic. Single substitutions in otherwise highly conserved regions containing IgE epitopes in EF-hand parvalbumins may modulate allergenicity. These data support the premise that certain protein structures are more allergenic than others. Contrasting with plant food allergens, animal allergens, such as the highly conserved tropomyosins, challenge the capability of the human immune system to discriminate between foreign and self-proteins. Such immune responses run close to becoming autoimmune responses. Exploiting the closeness between animal allergens and their human homologs in the development of recombinant allergens for immunotherapy will need to consider the potential for developing unanticipated autoimmune responses.

  14. Identification and Partial Characterization of Potential FtsL and FtsQ Homologs of Chlamydia

    Directory of Open Access Journals (Sweden)

    Scot P Ouellette


    Full Text Available Chlamydia is amongst the rare bacteria that lack the critical cell division protein FtsZ. By annotation, Chlamydia also lacks several other essential cell division proteins including the FtsLBQ complex that links the early (e.g. FtsZ and late (e.g. FtsI/Pbp3 components of the division machinery. Here, we report chlamydial FtsL and FtsQ homologs. Ct271 aligned well with E. coli FtsL and shared sequence homology with it, including a predicted leucine-zipper like motif. Based on in silico modeling, we show that Ct764 has structural homology to FtsQ in spite of little sequence similarity. Importantly, ct271/ftsL and ct764/ftsQ are present within all sequenced chlamydial genomes and are expressed during the replicative phase of the chlamydial developmental cycle, two key characteristics for a chlamydial cell division gene. GFP-Ct764 localized to the division septum of dividing transformed chlamydiae, and, importantly, over-expression inhibited chlamydial development. Using a bacterial two-hybrid approach, we show that Ct764 interacted with other components of the chlamydial division apparatus. However, Ct764 was not capable of complementing an E. coli FtsQ depletion strain in spite of its ability to interact with many of the same division proteins as E. coli FtsQ, suggesting that chlamydial FtsQ may function differently. We previously proposed that Chlamydia uses MreB and other rod-shape determining proteins as an alternative system for organizing the division site and its apparatus. Chlamydial FtsL and FtsQ homologs expand the number of identified chlamydial cell division proteins and suggest that Chlamydia has likely kept the late components of the division machinery while substituting the Mre system for the early components.

  15. Direct Single-Molecule Observation of Mode and Geometry of RecA-Mediated Homology Search. (United States)

    Lee, Andrew J; Endo, Masayuki; Hobbs, Jamie K; Wälti, Christoph


    Genomic integrity, when compromised by accrued DNA lesions, is maintained through efficient repair via homologous recombination. For this process the ubiquitous recombinase A (RecA), and its homologues such as the human Rad51, are of central importance, able to align and exchange homologous sequences within single-stranded and double-stranded DNA in order to swap out defective regions. Here, we directly observe the widely debated mechanism of RecA homology searching at a single-molecule level using high-speed atomic force microscopy (HS-AFM) in combination with tailored DNA origami frames to present the reaction targets in a way suitable for AFM-imaging. We show that RecA nucleoprotein filaments move along DNA substrates via short-distance facilitated diffusions, or slides, interspersed with longer-distance random moves, or hops. Importantly, from the specific interaction geometry, we find that the double-stranded substrate DNA resides in the secondary DNA binding-site within the RecA nucleoprotein filament helical groove during the homology search. This work demonstrates that tailored DNA origami, in conjunction with HS-AFM, can be employed to reveal directly conformational and geometrical information on dynamic protein-DNA interactions which was previously inaccessible at an individual single-molecule level.

  16. [Preparation of monoclonal antibody against 4-amylphenol and homology modeling of its Fv fragment]. (United States)

    Cheng, Lei; Wu, Haizhen; Fei, Jing; Zhang, Lujia; Ye, Jiang; Zhang, Huizhan


    Objective To prepare and characterize a monoclonal antibody (mAb) against 4-amylphenol (4-AP), clone its cDNA sequence and make homology modeling for its Fv fragment. Methods A high-affinity anti-4-AP mAb was generated from a hybridoma cell line F10 using electrofusion between splenocytes from APA-BSA-immunized mouse and Sp2/0 myeloma cells. Then we extracted the mRNA of F10 cells and cloned the cDNA of mAb. The homology modeling and molecular docking of its Fv fragment was conducted with biological software. Results Under the optimum conditions, the ic-ELISA equation was y=A 2 +(A 1 -A 2 )/(1+(x/x 0 ) p ) (A 1 =1.28; A 2 =-0.066; x 0 =12560.75; p=0.74) with a correlation coefficient (R 2 ) of 0.997. The lowest detectable limit was 0.65 μg/mL. The heavy and light chains of mAb respectively belonged to IgG1 and Kappa. The homology modeling and molecular docking studies revealed that the binding of 4-Ap and mAb was attributed to the hydrogen bond and hydrophobic interactions. Conclusion The study successfully established a stable 4-AP mAb-secreting hybridoma cell line. The study on spatial structure of Fv fragment using homology modeling provided a reference for the development and design of single chain variable fragments.

  17. A 1,681-locus consensus genetic map of cultivated cucumber including 67 NB-LRR resistance gene homolog and ten gene loci. (United States)

    Yang, Luming; Li, Dawei; Li, Yuhong; Gu, Xingfang; Huang, Sanwen; Garcia-Mas, Jordi; Weng, Yiqun


    Cucumber is an important vegetable crop that is susceptible to many pathogens, but no disease resistance (R) genes have been cloned. The availability of whole genome sequences provides an excellent opportunity for systematic identification and characterization of the nucleotide binding and leucine-rich repeat (NB-LRR) type R gene homolog (RGH) sequences in the genome. Cucumber has a very narrow genetic base making it difficult to construct high-density genetic maps. Development of a consensus map by synthesizing information from multiple segregating populations is a method of choice to increase marker density. As such, the objectives of the present study were to identify and characterize NB-LRR type RGHs, and to develop a high-density, integrated cucumber genetic-physical map anchored with RGH loci. From the Gy14 draft genome, 70 NB-containing RGHs were identified and characterized. Most RGHs were in clusters with uneven distribution across seven chromosomes. In silico analysis indicated that all 70 RGHs had EST support for gene expression. Phylogenetic analysis classified 58 RGHs into two clades: CNL and TNL. Comparative analysis revealed high-degree sequence homology and synteny in chromosomal locations of these RGH members between the cucumber and melon genomes. Fifty-four molecular markers were developed to delimit 67 of the 70 RGHs, which were integrated into a genetic map through linkage analysis. A 1,681-locus cucumber consensus map including 10 gene loci and spanning 730.0 cM in seven linkage groups was developed by integrating three component maps with a bin-mapping strategy. Physically, 308 scaffolds with 193.2 Mbp total DNA sequences were anchored onto this consensus map that covered 52.6% of the 367 Mbp cucumber genome. Cucumber contains relatively few NB-LRR RGHs that are clustered and unevenly distributed in the genome. All RGHs seem to be transcribed and shared significant sequence homology and synteny with the melon genome suggesting conservation of

  18. Molecular characterization of DnaJ 5 homologs in silkworm Bombyx mori and its expression during egg diapause. (United States)

    Sirigineedi, Sasibhushan; Vijayagowri, Esvaran; Murthy, Geetha N; Rao, Guruprasada; Ponnuvel, Kangayam M


    A comparison of the cDNA sequences (1 056 bp) of Bombyx mori DnaJ 5 homolog with B. mori genome revealed that unlike in other Hsps, it has an intron of 234 bp. The DnaJ 5 homolog contains 351 amino acids, of which 70 contain the conserved DnaJ domain at the N-terminal end. This homolog of B. mori has all desirable functional domains similar to other insects, and the 13 different DnaJ homologs identified in B. mori genome were distributed on different chromosomes. The expressed sequence tag database analysis of Hsp40 gene expression revealed higher expression in wing disc followed by diapause-induced eggs. Microarray analysis revealed higher expression of DnaJ 5 homolog at 18th h after oviposition in diapause-induced eggs. Further validation of DnaJ 5 expression through qPCR in diapause-induced and nondiapause eggs at different time intervals revealed higher expression in diapause eggs at 18 and 24 h after oviposition, which coincided with the expression of Hsp70 as the Hsp 40 is its co-chaperone. This study thus provides an outline of the genome organization of Hsp40 gene, and its role in egg diapause induction in B. mori. © 2013 Institute of Zoology, Chinese Academy of Sciences.

  19. BLAST and FASTA similarity searching for multiple sequence alignment. (United States)

    Pearson, William R


    BLAST, FASTA, and other similarity searching programs seek to identify homologous proteins and DNA sequences based on excess sequence similarity. If two sequences share much more similarity than expected by chance, the simplest explanation for the excess similarity is common ancestry-homology. The most effective similarity searches compare protein sequences, rather than DNA sequences, for sequences that encode proteins, and use expectation values, rather than percent identity, to infer homology. The BLAST and FASTA packages of sequence comparison programs provide programs for comparing protein and DNA sequences to protein databases (the most sensitive searches). Protein and translated-DNA comparisons to protein databases routinely allow evolutionary look back times from 1 to 2 billion years; DNA:DNA searches are 5-10-fold less sensitive. BLAST and FASTA can be run on popular web sites, but can also be downloaded and installed on local computers. With local installation, target databases can be customized for the sequence data being characterized. With today's very large protein databases, search sensitivity can also be improved by searching smaller comprehensive databases, for example, a complete protein set from an evolutionarily neighboring model organism. By default, BLAST and FASTA use scoring strategies target for distant evolutionary relationships; for comparisons involving short domains or queries, or searches that seek relatively close homologs (e.g. mouse-human), shallower scoring matrices will be more effective. Both BLAST and FASTA provide very accurate statistical estimates, which can be used to reliably identify protein sequences that diverged more than 2 billion years ago.

  20. Bioinformatic approach in the identification of arabidopsis gene homologous in amaranthus

    Directory of Open Access Journals (Sweden)

    Jana Žiarovská


    Full Text Available Bioinfomatics offers an efficient tool for molecular genetics applications and sequence homology search algorithms became an inevitable part for many different research strategies. Appropriate managing of known data that are stored in public available databases can be used in many ways in the research. Here, we report the identification of RmlC-like cupins superfamily protein DNA sequence than is known in Arabidopsis genome for the Amaranthus - plant specie where this sequence was still not sequenced. A BLAST based approach was used to identify the homologous sequences in the nucleotide database and to find suitable parts of the Arabidopsis sequence were primers can be designed. In total, 64 hits were found in nucleotide database for Arabidopsis RmlC-like cupins sequence. A query cover ranged from 10% up to the 100% among RmlC-like cupins nucleotides and its homologues that are actually stored in public nucleotide databases. The most conserved region was identified for matches that posses nucleotides in the range of 1506 up to the 1925 bp of RmlC-like cupins DNA sequence stored in the database. The in silico approach was subsequently used in PCR analysis where the specifity of designed primers was approved. A unique, 250 bp long fragment was obtained for Amaranthus cruentus and a hybride Amaranthus hypochondriacus x hybridus in our analysis. Bioinformatic based analysis of unknown parts of the plant genomes as showed in this study is a very good additional tool in PCR based analysis of plant variability. This approach is suitable in the case for plants, where concrete genomic data are still missing for the appropriate genes, as was demonstrated for Amaranthus. 

  1. Regulation of Homologous Recombination by SUMOylation

    DEFF Research Database (Denmark)

    Pinela da Silva, Sonia Cristina

    factors such as the homologous recombination (HR) machinery. HR constitutes the main DSB repair pathway in Saccharomyces cerevisiae and despite being largely considered an error-free process and essential for genome stability, uncontrolled recombination can lead to loss of heterozygosity, translocations......, deletions, and genome rearrangements that can lead to cell death or cancer in humans. The post-translational modification by SUMO (small ubiquitinlike modifier) has proven to be an important regulator of HR and genome integrity, but the molecular mechanisms responsible for these roles are still unclear....... In this study I present new insights for the role of SUMOylation in regulating HR by dissecting the role of SUMO in the interaction between the central HR-mediator protein Rad52 and its paralogue Rad59 and the outcome of recombination. This data provides evidence for the importance of SUMO in promoting protein...

  2. Homological mirror symmetry. New developments and perspectives

    International Nuclear Information System (INIS)

    Kapustin, Anton; Kreuzer, Maximilian; Schlesinger, Karl-Georg


    Homological Mirror Symmetry, the study of dualities of certain quantum field theories in a mathematically rigorous form, has developed into a flourishing subject on its own over the past years. The present volume bridges a gap in the literature by providing a set of lectures and reviews that both introduce and representatively review the state-of-the art in the field from different perspectives. With contributions by K. Fukaya, M. Herbst, K. Hori, M. Huang, A. Kapustin, L. Katzarkov, A. Klemm, M. Kontsevich, D. Page, S. Quackenbush, E. Sharpe, P. Seidel, I. Smith and Y. Soibelman, this volume will be a reference on the topic for everyone starting to work or actively working on mathematical aspects of quantum field theory. (orig.)


    Energy Technology Data Exchange (ETDEWEB)

    Yu, Xinting; Zhang, Jun; Li, Ting; Zhang, Yuzong; Yang, Shuhong, E-mail:, E-mail:, E-mail:, E-mail:, E-mail: [Key Laboratory of Solar Activity, National Astronomical Observatories, Chinese Academy of Sciences, Beijing 100012 (China)


    Through observations with the Solar Dynamics Observatory Atmospheric Imaging Assembly (AIA) and Helioseismic and Magnetic Imager, we tracked one rotating network magnetic field (RNF) near the solar equator. It lasted for more than 100 hr, from 2013 February 23 to 28. During its evolution, three cyclones were found to be rooted in this structure. Each cyclone event lasted for about 8 to 10 hr. While near the polar region, another RNF was investigated. It lasted for a shorter time (∼70 hr), from 2013 July 7 to 9. There were two cyclones rooted in the RNF and each lasted for 8 and 11 hr, respectively. For the two given examples, the cyclones have a similar dynamic evolution, and thus we put forward a new term: homologous cyclones. The detected brightening in AIA 171 Å maps indicates the release of energy, which is potentially available to heat the corona.

  4. Modeling Non-homologous End Joining (United States)

    Li, Yongfeng


    Non-homologous end joining (NHEJ) is the dominant DNA double strand break (DSB) repair pathway and involves several NHEJ proteins such as Ku, DNA-PKcs, XRCC4, Ligase IV and so on. Once DSBs are generated, Ku is first recruited to the DNA end, followed by other NHEJ proteins for DNA end processing and ligation. Because of the direct ligation of break ends without the need for a homologous template, NHEJ turns out to be an error-prone but efficient repair pathway. Some mechanisms have been proposed of how the efficiency of NHEJ repair is affected. The type of DNA damage is an important factor of NHEJ repair. For instance, the length of DNA fragment may determine the recruitment efficiency of NHEJ protein such as Ku [1], or the complexity of the DNA breaks [2] is accounted for the choice of NHEJ proteins and subpathway of NHEJ repair. On the other hand, the chromatin structure also plays a role of the accessibility of NHEJ protein to the DNA damage site. In this talk, some mathematical models of NHEJ, that consist of series of biochemical reactions complying with the laws of chemical reaction (e.g. mass action, etc.), will be introduced. By mathematical and numerical analysis and parameter estimation, the models are able to capture the qualitative biological features and show good agreement with experimental data. As conclusions, from the viewpoint of modeling, how the NHEJ proteins are recruited will be first discussed for connection between the classical sequential model [4] and recently proposed two-phase model [5]. Then how the NHEJ repair pathway is affected, by the length of DNA fragment [6], the complexity of DNA damage [7] and the chromatin structure [8], will be addressed

  5. More on homological supersymmetric quantum mechanics (United States)

    Behtash, Alireza


    In this work, we first solve complex Morse flow equations for the simplest case of a bosonic harmonic oscillator to discuss localization in the context of Picard-Lefschetz theory. We briefly touch on the exact non-BPS solutions of the bosonized supersymmetric quantum mechanics on algebraic geometric grounds and report that their complex phases can be accessed through the cohomology of WKB 1-form of the underlying singular spectral curve subject to necessary cohomological corrections for nonzero genus. Motivated by Picard-Lefschetz theory, we write down a general formula for the index of N =4 quantum mechanics with background R -symmetry gauge fields. We conjecture that certain symmetries of the refined Witten index and singularities of the moduli space may be used to determine the correct intersection coefficients. A few examples, where this conjecture holds, are shown in both linear and closed quivers with rank-one quiver gauge groups. The R -anomaly removal along the "Morsified" relative homology cycles also called "Lefschetz thimbles" is shown to lead to the appearance of Stokes lines. We show that the Fayet-Iliopoulos parameters appear in the intersection coefficients for the relative homology of the quiver quantum mechanics resulting from dimensional reduction of 2 d N =(2 ,2 ) gauge theory on a circle and explicitly calculate integrals along the Lefschetz thimbles in N =4 C Pk -1 model. The Stokes jumping of coefficients and its relation to wall crossing phenomena is briefly discussed. We also find that the notion of "on-the-wall" index is related to the invariant Lefschetz thimbles under Stokes phenomena. An implication of the Lefschetz thimbles in constructing knots from quiver quantum mechanics is indicated.

  6. K-homology and K-cohomology constructions of relations

    International Nuclear Information System (INIS)

    Abd El-Sattar, A. Dabbour; Bayoumy, F.M.


    One of the important homology (cohomology) theories, based on systems of covering of the space, is the homology (cohomology) theory of relations. In the present work, by using the idea of K-homology and K-cohomology groups different varieties of the Dowker's theory are introduced and studied. These constructions are defined on the category of pairs of topological spaces and over a pair of coefficient groups. (author). 14 refs

  7. A local homology theory for linearly compact modules

    International Nuclear Information System (INIS)

    Nguyen Tu Cuong; Tran Tuan Nam


    We introduce a local homology theory for linearly modules which is in some sense dual to the local cohomology theory of A. Grothendieck. Some basic properties of local homology modules are shown such as: the vanishing and non-vanishing, the noetherianness of local homology modules. By using duality, we extend some well-known results in theory of local cohomology of A. Grothendieck. (author)

  8. On (co)homology of Frobenius Poisson algebras


    Zhu, Can; Van Oystaeyen, Fred; ZHANG, Yinhuo


    In this paper, we study Poisson (co)homology of a Frobenius Poisson algebra. More precisely, we show that there exists a duality between Poisson homology and Poisson cohomology of Frobenius Poisson algebras, similar to that between Hochschild homology and Hochschild cohomology of Frobenius algebras. Then we use the non-degenerate bilinear form on a unimodular Frobenius Poisson algebra to construct a Batalin-Vilkovisky structure on the Poisson cohomology ring making it into a Batalin-Vilkovisk...

  9. A geometric model for Hochschild homology of Soergel bimodules

    DEFF Research Database (Denmark)

    Webster, Ben; Williamson, Geordie


    An important step in the calculation of the triply graded link homology of Khovanov and Rozansky is the determination of the Hochschild homology of Soergel bimodules for SL(n). We present a geometric model for this Hochschild homology for any simple group G, as B–equivariant intersection cohomology...... on generators whose degree is explicitly determined by the geometry of the orbit closure, and to describe its Hilbert series, proving a conjecture of Jacob Rasmussen....

  10. Heteromorphic Sex Chromosomes: Navigating Meiosis without a Homologous Partner


    Checchi, Paula M.; Engebrecht, JoAnne


    Accurate chromosome segregation during meiosis relies on homology between the maternal and paternal chromosomes. Yet by definition, sex chromosomes of the heterogametic sex lack a homologous partner. Recent studies in a number of systems have shed light on the unique meiotic behavior of heteromorphic sex chromosomes, and highlight both the commonalities and differences in divergent species. During meiotic prophase, the homology-dependent processes of pairing, synapsis, and recombination have ...

  11. Colored Kauffman homology and super-A-polynomials

    International Nuclear Information System (INIS)

    Nawata, Satoshi; Ramadevi, P.; Zodinmawia


    We study the structural properties of colored Kauffman homologies of knots. Quadruple-gradings play an essential role in revealing the differential structure of colored Kauffman homology. Using the differential structure, the Kauffman homologies carrying the symmetric tensor products of the vector representation for the trefoil and the figure-eight are determined. In addition, making use of relations from representation theory, we also obtain the HOMFLY homologies colored by rectangular Young tableaux with two rows for these knots. Furthermore, the notion of super-A-polynomials is extended in order to encompass two-parameter deformations of PSL(2,ℂ) character varieties

  12. Homology among tet determinants in conjugative elements of streptococci

    Energy Technology Data Exchange (ETDEWEB)

    Smith, M.D.; Hazum, S.; Guild, W.R.


    A mutation to tetracycline sensitivity in a resistant strain of Streptococcus pneumoniae was shown by several criteria to be due to a point mutation in the conjugative o(cat-tet) element found in the chromosomes of strains derived from BM6001, a clinical strain resistant to tetracycline and chloramphenicol. Strains carrying the mutation were transformed back to tetracycline resistance with the high efficiency of a point marker by donor deoxyribonucleic acids from its ancestral strain and from nine other clinical isolates of pneumococcus and by deoxyribonucleic acids from Group D Streptococcus faecalis and Group B Streptococcus agalactiae strains that also carry conjugative tet elements in their chromosomes. It was not transformed to resistance by tet plasmid deoxyribonucleic acids from either gram-negative or gram-positive species, except for one that carried transposon TN916, the conjugative tet element present in the chromosomes of some S. faecalis strains. The results showed that the tet determinants in conjugative elements of several streptococcal species share a high degree of deoxyribonucleic acid sequence homology and suggested that they differ from other tet genes.

  13. MollDE: a homology modeling framework you can click with. (United States)

    Canutescu, Adrian A; Dunbrack, Roland L


    Molecular Integrated Development Environment (MolIDE) is an integrated application designed to provide homology modeling tools and protocols under a uniform, user-friendly graphical interface. Its main purpose is to combine the most frequent modeling steps in a semi-automatic, interactive way, guiding the user from the target protein sequence to the final three-dimensional protein structure. The typical basic homology modeling process is composed of building sequence profiles of the target sequence family, secondary structure prediction, sequence alignment with PDB structures, assisted alignment editing, side-chain prediction and loop building. All of these steps are available through a graphical user interface. MolIDE's user-friendly and streamlined interactive modeling protocol allows the user to focus on the important modeling questions, hiding from the user the raw data generation and conversion steps. MolIDE was designed from the ground up as an open-source, cross-platform, extensible framework. This allows developers to integrate additional third-party programs to MolIDE.

  14. Bioaugmentation with endophytic bacterium E6S homologous to Achromobacter piechaudii enhances metal rhizoaccumulation in host Sedum plumbizincicola

    Directory of Open Access Journals (Sweden)

    Ying eMa


    Full Text Available Application of hyperaccumulator–endophyte symbiotic systems is a potential approach to improve phytoremediation efficiency, since some beneficial endophytic bacteria are able to detoxify heavy metals, alter metal solubility in soil and facilitate plant growth. The objective of this study was to isolate multi-metal resistant and plant beneficial endophytic bacteria and to evaluate their role in enhancing plant growth and metal accumulation/translocation. The metal resistant endophytic bacterial strain E6S was isolated from stems of the Zn/Cd hyperaccumulator plant Sedum plumbizincicola growing in metalliferous mine soils using Dworkin and Foster salts minimal agar medium with 1-aminocyclopropane-1-carboxylate (ACC as the sole nitrogen source, and identified as homologous to Achromobacter piechaudii based on morphological and biochemical characteristics, partial 16S rDNA sequence and phylogenetic analysis. Strain E6S showed high level of resistance to various metals (Cd, Zn and Pb. Besides utilizing ACC, strain E6S exhibited plant beneficial traits, such as solubilization of phosphate and production of indole-3-acetic acid. Inoculation with E6S significantly increased the bioavailability of Cd, Zn and Pb in soil. In addition, bacterial cells bound considerable amounts of metal ions in the following order: Zn ˃ Cd ˃ Pb. Inoculation of E6S significantly stimulated plant biomass, uptake and bioaccumulation of Cd, Zn and Pb. However, E6S greatly reduced the root to shoot translocation of Cd and Zn, indicating that bacterial inoculation assisted the host plant to uptake and store heavy metals in its root system. Inoculation with the endophytic bacterium E6S homologous to A. piechaudii can improve phytostabilization of metalliferous soils due to its effective ability to enhance in situ metal rhizoaccumulation in plants.

  15. Ecological genomics in Xanthomonas: the nature of genetic adaptation with homologous recombination and host shifts

    KAUST Repository

    Huang, Chao-Li


    Background: Comparative genomics provides insights into the diversification of bacterial species. Bacterial speciation usually takes place with lasting homologous recombination, which not only acts as a cohering force between diverging lineages but brings advantageous alleles favored by natural selection, and results in ecologically distinct species, e.g., frequent host shift in Xanthomonas pathogenic to various plants. Results: Using whole-genome sequences, we examined the genetic divergence in Xanthomonas campestris that infected Brassicaceae, and X. citri, pathogenic to a wider host range. Genetic differentiation between two incipient races of X. citri pv. mangiferaeindicae was attributable to a DNA fragment introduced by phages. In contrast to most portions of the genome that had nearly equivalent levels of genetic divergence between subspecies as a result of the accumulation of point mutations, 10% of the core genome involving with homologous recombination contributed to the diversification in Xanthomonas, as revealed by the correlation between homologous recombination and genomic divergence. Interestingly, 179 genes were under positive selection; 98 (54.7%) of these genes were involved in homologous recombination, indicating that foreign genetic fragments may have caused the adaptive diversification, especially in lineages with nutritional transitions. Homologous recombination may have provided genetic materials for the natural selection, and host shifts likely triggered ecological adaptation in Xanthomonas. To a certain extent, we observed positive selection nevertheless contributed to ecological divergence beyond host shifting. Conclusion: Altogether, mediated with lasting gene flow, species formation in Xanthomonas was likely governed by natural selection that played a key role in helping the deviating populations to explore novel niches (hosts) or respond to environmental cues, subsequently triggering species diversification. © Huang et al.

  16. Ecological genomics in Xanthomonas: the nature of genetic adaptation with homologous recombination and host shifts

    KAUST Repository

    Huang, Chao-Li; Pu, Pei-Hua; Huang, Hao-Jen; Sung, Huang-Mo; Liaw, Hung-Jiun; Chen, Yi-Min; Chen, Chien-Ming; Huang, Ming-Ban; Osada, Naoki; Gojobori, Takashi; Pai, Tun-Wen; Chen, Yu-Tin; Hwang, Chi-Chuan; Chiang, Tzen-Yuh


    Background: Comparative genomics provides insights into the diversification of bacterial species. Bacterial speciation usually takes place with lasting homologous recombination, which not only acts as a cohering force between diverging lineages but brings advantageous alleles favored by natural selection, and results in ecologically distinct species, e.g., frequent host shift in Xanthomonas pathogenic to various plants. Results: Using whole-genome sequences, we examined the genetic divergence in Xanthomonas campestris that infected Brassicaceae, and X. citri, pathogenic to a wider host range. Genetic differentiation between two incipient races of X. citri pv. mangiferaeindicae was attributable to a DNA fragment introduced by phages. In contrast to most portions of the genome that had nearly equivalent levels of genetic divergence between subspecies as a result of the accumulation of point mutations, 10% of the core genome involving with homologous recombination contributed to the diversification in Xanthomonas, as revealed by the correlation between homologous recombination and genomic divergence. Interestingly, 179 genes were under positive selection; 98 (54.7%) of these genes were involved in homologous recombination, indicating that foreign genetic fragments may have caused the adaptive diversification, especially in lineages with nutritional transitions. Homologous recombination may have provided genetic materials for the natural selection, and host shifts likely triggered ecological adaptation in Xanthomonas. To a certain extent, we observed positive selection nevertheless contributed to ecological divergence beyond host shifting. Conclusion: Altogether, mediated with lasting gene flow, species formation in Xanthomonas was likely governed by natural selection that played a key role in helping the deviating populations to explore novel niches (hosts) or respond to environmental cues, subsequently triggering species diversification. © Huang et al.

  17. Gene Discovery through Genomic Sequencing of Brucella abortus


    Sánchez, Daniel O.; Zandomeni, Ruben O.; Cravero, Silvio; Verdún, Ramiro E.; Pierrou, Ester; Faccio, Paula; Diaz, Gabriela; Lanzavecchia, Silvia; Agüero, Fernán; Frasch, Alberto C. C.; Andersson, Siv G. E.; Rossetti, Osvaldo L.; Grau, Oscar; Ugalde, Rodolfo A.


    Brucella abortus is the etiological agent of brucellosis, a disease that affects bovines and human. We generated DNA random sequences from the genome of B. abortus strain 2308 in order to characterize molecular targets that might be useful for developing immunological or chemotherapeutic strategies against this pathogen. The partial sequencing of 1,899 clones allowed the identification of 1,199 genomic sequence surveys (GSSs) with high homology (BLAST expect value < 10−5) to sequences deposit...

  18. Vitamin E homologs and ¿-oryzanol levels in rice (Oryza sativa L.) during seed development (United States)

    Vitamin E homologs (tocopherols and tocotrienols) and gamma-oryzanol have gained significant attention due to their proposed health benefits and ability to increase vegetable oil stability. Changes in the levels of these phytochemicals were examined during seed development. Rapid accumulation of toc...

  19. Liver receptor homolog-1 is a critical determinant of methyl-pool metabolism (United States)

    Balance of labile methyl groups (choline, methionine, betaine, and folate) is important for normal liver function. Quantitatively, a significant use of labile methyl groups is in the production of phosphatidylcholines (PCs), which are ligands for the nuclear liver receptor homolog-1 (LRH-1). We stud...

  20. Cytokine-like factor-1, a novel soluble protein, shares homology with members of the cytokine type I receptor family. (United States)

    Elson, G C; Graber, P; Losberger, C; Herren, S; Gretener, D; Menoud, L N; Wells, T N; Kosco-Vilbois, M H; Gauchat, J F


    In this report we describe the identification, cloning, and expression pattern of human cytokine-like factor 1 (hCLF-1) and the identification and cloning of its murine homologue. They were identified from expressed sequence tags using amino acid sequences from conserved regions of the cytokine type I receptor family. Human CLF-1 and murine CLF-1 shared 96% amino acid identity and significant homology with many cytokine type I receptors. CLF-1 is a secreted protein, suggesting that it is either a soluble subunit within a cytokine receptor complex, like the soluble form of the IL-6R alpha-chain, or a subunit of a multimeric cytokine, e.g., IL-12 p40. The highest levels of hCLF-1 mRNA were observed in lymph node, spleen, thymus, appendix, placenta, stomach, bone marrow, and fetal lung, with constitutive expression of CLF-1 mRNA detected in a human kidney fibroblastic cell line. In fibroblast primary cell cultures, CLF-1 mRNA was up-regulated by TNF-alpha, IL-6, and IFN-gamma. Western blot analysis of recombinant forms of hCLF-1 showed that the protein has the tendency to form covalently linked di- and tetramers. These results suggest that CLF-1 is a novel soluble cytokine receptor subunit or part of a novel cytokine complex, possibly playing a regulatory role in the immune system and during fetal development.

  1. The lytic origin of herpesvirus papio is highly homologous to Epstein-Barr virus ori-Lyt: evolutionary conservation of transcriptional activation and replication signals. (United States)

    Ryon, J J; Fixman, E D; Houchens, C; Zong, J; Lieberman, P M; Chang, Y N; Hayward, G S; Hayward, S D


    Herpesvirus papio (HVP) is a B-lymphotropic baboon virus with an estimated 40% homology to Epstein-Barr virus (EBV). We have cloned and sequenced ori-Lyt of herpesvirus papio and found a striking degree of nucleotide homology (89%) with ori-Lyt of EBV. Transcriptional elements form an integral part of EBV ori-Lyt. The promoter and enhancer domains of EBV ori-Lyt are conserved in herpesvirus papio. The EBV ori-Lyt promoter contains four binding sites for the EBV lytic cycle transactivator Zta, and the enhancer includes one Zta and two Rta response elements. All five of the Zta response elements and one of the Rta motifs are conserved in HVP ori-Lyt, and the HVP DS-L leftward promoter and the enhancer were activated in transient transfection assays by the EBV Zta and Rta transactivators. The EBV ori-Lyt enhancer contains a palindromic sequence, GGTCAGCTGACC, centered on a PvuII restriction site. This sequence, with a single base change, is also present in the HVP ori-Lyt enhancer. DNase I footprinting demonstrated that the PvuII sequence was bound by a protein present in a Raji nuclear extract. Mobility shift and competition assays using oligonucleotide probes identified this sequence as a binding site for the cellular transcription factor MLTF. Mutagenesis of the binding site indicated that MLTF contributes significantly to the constitutive activity of the ori-Lyt enhancer. The high degree of conservation of cis-acting signal sequences in HVP ori-Lyt was further emphasized by the finding that an HVP ori-Lyt-containing plasmid was replicated in Vero cells by a set of cotransfected EBV replication genes. The central domain of EBV ori-Lyt contains two related AT-rich palindromes, one of which is partially duplicated in the HVP sequence. The AT-rich palindromes are functionally important cis-acting motifs. Deletion of these palindromes severely diminished replication of an ori-Lyt target plasmid. Images PMID:8389916

  2. GPCR-SSFE: A comprehensive database of G-protein-coupled receptor template predictions and homology models

    Directory of Open Access Journals (Sweden)

    Kreuchwig Annika


    Full Text Available Abstract Background G protein-coupled receptors (GPCRs transduce a wide variety of extracellular signals to within the cell and therefore have a key role in regulating cell activity and physiological function. GPCR malfunction is responsible for a wide range of diseases including cancer, diabetes and hyperthyroidism and a large proportion of drugs on the market target these receptors. The three dimensional structure of GPCRs is important for elucidating the molecular mechanisms underlying these diseases and for performing structure-based drug design. Although structural data are restricted to only a handful of GPCRs, homology models can be used as a proxy for those receptors not having crystal structures. However, many researchers working on GPCRs are not experienced homology modellers and are therefore unable to benefit from the information that can be gleaned from such three-dimensional models. Here, we present a comprehensive database called the GPCR-SSFE, which provides initial homology models of the transmembrane helices for a large variety of family A GPCRs. Description Extending on our previous theoretical work, we have developed an automated pipeline for GPCR homology modelling and applied it to a large set of family A GPCR sequences. Our pipeline is a fragment-based approach that exploits available family A crystal structures. The GPCR-SSFE database stores the template predictions, sequence alignments, identified sequence and structure motifs and homology models for 5025 family A GPCRs. Users are able to browse the GPCR dataset according to their pharmacological classification or search for results using a UniProt entry name. It is also possible for a user to submit a GPCR sequence that is not contained in the database for analysis and homology model building. The models can be viewed using a Jmol applet and are also available for download along with the alignments. Conclusions The data provided by GPCR-SSFE are useful for investigating

  3. GPCR-SSFE: a comprehensive database of G-protein-coupled receptor template predictions and homology models. (United States)

    Worth, Catherine L; Kreuchwig, Annika; Kleinau, Gunnar; Krause, Gerd


    G protein-coupled receptors (GPCRs) transduce a wide variety of extracellular signals to within the cell and therefore have a key role in regulating cell activity and physiological function. GPCR malfunction is responsible for a wide range of diseases including cancer, diabetes and hyperthyroidism and a large proportion of drugs on the market target these receptors. The three dimensional structure of GPCRs is important for elucidating the molecular mechanisms underlying these diseases and for performing structure-based drug design. Although structural data are restricted to only a handful of GPCRs, homology models can be used as a proxy for those receptors not having crystal structures. However, many researchers working on GPCRs are not experienced homology modellers and are therefore unable to benefit from the information that can be gleaned from such three-dimensional models. Here, we present a comprehensive database called the GPCR-SSFE, which provides initial homology models of the transmembrane helices for a large variety of family A GPCRs. Extending on our previous theoretical work, we have developed an automated pipeline for GPCR homology modelling and applied it to a large set of family A GPCR sequences. Our pipeline is a fragment-based approach that exploits available family A crystal structures. The GPCR-SSFE database stores the template predictions, sequence alignments, identified sequence and structure motifs and homology models for 5025 family A GPCRs. Users are able to browse the GPCR dataset according to their pharmacological classification or search for results using a UniProt entry name. It is also possible for a user to submit a GPCR sequence that is not contained in the database for analysis and homology model building. The models can be viewed using a Jmol applet and are also available for download along with the alignments. The data provided by GPCR-SSFE are useful for investigating general and detailed sequence-structure-function relationships

  4. Salmon louse (Lepeophtheirus salmonis transcriptomes during post molting maturation and egg production, revealed using EST-sequencing and microarray analysis

    Directory of Open Access Journals (Sweden)

    Jonassen Inge


    Full Text Available Abstract Background Lepeophtheirus salmonis is an ectoparasitic copepod feeding on skin, mucus and blood from salmonid hosts. Initial analysis of EST sequences from pre adult and adult stages of L. salmonis revealed a large proportion of novel transcripts. In order to link unknown transcripts to biological functions we have combined EST sequencing and microarray analysis to characterize female salmon louse transcriptomes during post molting maturation and egg production. Results EST sequence analysis shows that 43% of the ESTs have no significant hits in GenBank. Sequenced ESTs assembled into 556 contigs and 1614 singletons and whenever homologous genes were identified no clear correlation with homologous genes from any specific animal group was evident. Sequence comparison of 27 L. salmonis proteins with homologous proteins in humans, zebrafish, insects and crustaceans revealed an almost identical sequence identity with all species. Microarray analysis of maturing female adult salmon lice revealed two major transcription patterns; up-regulation during the final molting followed by down regulation and female specific up regulation during post molting growth and egg production. For a third minor group of ESTs transcription decreased during molting from pre-adult II to immature adults. Genes regulated during molting typically gave hits with cuticula proteins whilst transcripts up regulated during post molting growth were female specific, including two vitellogenins. Conclusion The copepod L.salmonis contains high a level of novel genes. Among analyzed L.salmonis proteins, sequence identities with homologous proteins in crustaceans are no higher than to homologous proteins in humans. Three distinct processes, molting, post molting growth and egg production correlate with transcriptional regulation of three groups of transcripts; two including genes related to growth, one including genes related to egg production. The function of the regulated

  5. No allelic variation in genes with high gliadin homology in patients with celiac disease and type 1 diabetes

    DEFF Research Database (Denmark)

    Nielsen, Christian; Hansen, Dorte; Husby, Steffen


    recognize gluten-derived peptides in which specific glutamine residues are deamidated to glutamic acid by tissue transglutaminase. Recently, intestinally expressed human genes with high homology to DQ2-gliadin celiac T-cell epitopes have been identified. Single or double point mutations which would increase...... the celiac T-cell epitope homology, and mutation in these genes, leading to the expression of glutamic acid at particular positions, could hypothetically be involved in the initiation of CD in HLA-DQ2-positive children. Six gene regions with high celiac T-cell epitope homology were investigated for single......-nucleotide polymorphisms using direct sequencing of DNA from 20 CD patients, 27 type 1 diabetes mellitus (T1DM) patients with associated CD, 24 patients with T1DM without CD and 110 healthy controls, all of Caucasian origin. No variants in any of these genes in any of the investigated groups were found. We conclude...

  6. Identification and nucleotide sequence of the thymidine kinase gene of Shope fibroma virus

    International Nuclear Information System (INIS)

    Upton, C.; McFadden, G.


    The thymidine kinase (TK) gene of Shope fibroma virus (SFV), a tumorigenic leporipoxvirus, was localized within the viral genome with degenerate oligonucleotide probes. These probes were constructed to two regions of high sequence conservation between the vaccinia virus TK gene and those of several known eucaryotic cellular TK genes, including human, mouse, hamster, and chicken TK genes. The oligonucleotide probes initially localized the SFV TK gene 50 kilobases (kb) from the right terminus of the 160-kb SFV genome within the 9.5-kb BamHI-HindIII fragment E. Fine-mapping analysis indicated that the TK Gene was within a 1.2-kb AvaI-HaeIII fragment, and DNA sequencing of this region revealed an open reading frame capable of encoding a polypeptide of 187 amino acids possessing considerable homology to the TK genes of the vaccinia, variola, and monkeypox orthopoxviruses and also to a variety of cellular TK genes. Homology matrix analysis and homology scores suggest that the SFV TK gene has diverged significantly from its counterpart members in the orthopoxvirus genus. Nevertheless, the presence of conserved upstream open reading frames on the 5' side of all of the poxvirus TK genes indicates a similarity of functional organization between the orthopoxviruses and leporipoxviruses. These data suggest a common ancestral origin for at least some of the unique internal regions of the leporipoxviruses and orthopoxviruses as exemplified by SFV and vaccinia virus, respectively

  7. The Causes of Quasi-homologous CMEs

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Lijuan; Wang, Yuming; Liu, Rui; Zhou, Zhenjun; Liu, Jiajia; Liu, Kai; Shen, Chenglong; Zhang, Quanhao [CAS Key Laboratory of Geospace Environment, Department of Geophysics and Planetary Sciences, University of Science and Technology of China, Hefei, Anhui, 230026 (China); Temmer, M.; Thalmann, J. K.; Veronig, A. M., E-mail:, E-mail: [Institute of Physics/IGAM, University of Graz, Universitätsplatz 5/II, A-8010 Graz (Austria)


    In this paper, we identified the magnetic source locations of 142 quasi-homologous (QH) coronal mass ejections (CMEs), of which 121 are from solar cycle (SC) 23 and 21 from SC 24. Among those CMEs, 63% originated from the same source location as their predecessor (defined as S-type), while 37% originated from a different location within the same active region as their predecessor (defined as D-type). Their distinctly different waiting time distributions, peaking around 7.5 and 1.5 hr for S- and D-type CMEs, suggest that they might involve different physical mechanisms with different characteristic timescales. Through detailed analysis based on nonlinear force-free coronal magnetic field modeling of two exemplary cases, we propose that the S-type QH CMES might involve a recurring energy release process from the same source location (by magnetic free energy replenishment), whereas the D-type QH CMEs can happen when a flux tube system is disturbed by a nearby CME.

  8. Torus actions, combinatorial topology, and homological algebra

    International Nuclear Information System (INIS)

    Bukhshtaber, V M; Panov, T E


    This paper is a survey of new results and open problems connected with fundamental combinatorial concepts, including polytopes, simplicial complexes, cubical complexes, and arrangements of subspaces. Attention is concentrated on simplicial and cubical subdivisions of manifolds, and especially on spheres. Important constructions are described that enable one to study these combinatorial objects by using commutative and homological algebra. The proposed approach to combinatorial problems is based on the theory of moment-angle complexes recently developed by the authors. The crucial construction assigns to each simplicial complex K with m vertices a T m -space Z K with special bigraded cellular decomposition. In the framework of this theory, well-known non-singular toric varieties arise as orbit spaces of maximally free actions of subtori on moment-angle complexes corresponding to simplicial spheres. It is shown that diverse invariants of simplicial complexes and related combinatorial-geometric objects can be expressed in terms of bigraded cohomology rings of the corresponding moment-angle complexes. Finally, it is shown that the new relationships between combinatorics, geometry, and topology lead to solutions of some well-known topological problems

  9. Long-term use and follow-up of autologous and homologous cartilage graft in rhinoplasty

    Directory of Open Access Journals (Sweden)

    Ghasemali Khorasani


    Full Text Available Background: Cartilage grafting is used in rhinoplasty and reconstructive surgeries. Autologous rib and nasal septum cartilage (auto graft is the preferred source of graft material in rhinoplasty, however, homologous cartilage (allograft has been extensively used to correct the nasal framework in nasal deformities. Autologous cartilage graft usage is restricted with complication of operation and limiting availability of tissue for extensive deformities. Alternatively, preserved costal cartilage allograft represents a readily available and easily contoured material. The current study was a formal systematic review of complications associated with autologous versus homologous cartilage grafting in rhinoplasty patients. Methods: In this cohort retrospective study, a total of 124 patients undergone primary or revision rhinoplasty using homologous or autologus grafts with postoperative follow-up ranging from 6 to 60 months were studied. The types of grafts and complications related to the grafts were evaluated. This included evaluation for warping, infection, resorption, mobility and fracture. Results: The total complications related to the cartilage grafts were 7 cases, which included 1 warped in auto graft group, three cases of graft displacement (two in allograft group and one in auto graft group and three fractures in allograft group. No infection and resorption was recorded. Complication rate (confidence interval 0.95 in autologous and homologous group were 1.25(0.4-3.88 and 2.08(0.78-5.55 in 1000 months follow up. There was no statistically significant difference between autologous and homologous group complications. Onset of complication in autologous and homologous group were 51.23(49.27-53.19 and 58.7(54.51-62.91 month respectively (P=0.81. Conclusion: The allograft cartilage has the advantage of avoiding donor-site scar. Moreover, it provides the same benefits as autologous costal cartilage with comparable complication rate. Therefore, it

  10. Statistical Inference for Porous Materials using Persistent Homology.

    Energy Technology Data Exchange (ETDEWEB)

    Moon, Chul [Univ. of Georgia, Athens, GA (United States); Heath, Jason E. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Mitchell, Scott A. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)


    We propose a porous materials analysis pipeline using persistent homology. We rst compute persistent homology of binarized 3D images of sampled material subvolumes. For each image we compute sets of homology intervals, which are represented as summary graphics called persistence diagrams. We convert persistence diagrams into image vectors in order to analyze the similarity of the homology of the material images using the mature tools for image analysis. Each image is treated as a vector and we compute its principal components to extract features. We t a statistical model using the loadings of principal components to estimate material porosity, permeability, anisotropy, and tortuosity. We also propose an adaptive version of the structural similarity index (SSIM), a similarity metric for images, as a measure to determine the statistical representative elementary volumes (sREV) for persistence homology. Thus we provide a capability for making a statistical inference of the uid ow and transport properties of porous materials based on their geometry and connectivity.

  11. Gene mining a marama bean expressed sequence tags (ESTs ...

    African Journals Online (AJOL)

    The authors reported the identification of genes associated with embryonic development and microsatellite sequences. The future direction will entail characterization of these genes using gene over-expression and mutant assays. Key words: Namibia, simple sequence repeats (SSR), data mining, homology searches, ...

  12. Genome-wide sequence variations among Mycobacterium avium subspecies paratuberculosis.

    Directory of Open Access Journals (Sweden)

    Chung-Yi eHsu


    Full Text Available Mycobacterium avium subspecies paratuberculosis (M. ap, the causative agent of Johne’s disease (JD, infects many farmed ruminants, wildlife animals and humans. To better understand the molecular pathogenesis of these infections, we analyzed the whole genome sequences of several M. ap and M. avium subspecies avium (M. avium strains isolated from various hosts and environments. Using Next-generation sequencing technology, all 6 M. ap isolates showed a high percentage of homology (98% to the reference genome sequence of M. ap K-10 isolated from cattle. However, 2 M. avium isolates (DT 78 and Env 77 showed significant sequence diversity from the reference strain M. avium 104. The genomes of M. avium isolates DT 78 and Env 77 exhibited only 87% and 40% homology, respectively, to the M. avium 104 reference genome. Within the M. ap isolates, genomic rearrangements (insertions/deletions, Indels were not detected, and only unique single nucleotide polymorphisms (SNPs were observed among the 6 M. ap strains. While most of the SNPs (~100 in M. ap genomes were non-synonymous, a total of ~ 6000 SNPs were detected among M. avium genomes, most of them were synonymous suggesting a differential selective pressure between M. ap and M. avium isolates. In addition, SNPs-based phylo-genomic analysis showed that isolates from goat and Oryx are closely related to the cattle (K-10 strain while the human isolate (M. ap 4B is closely related to the environmental strains, indicating environmental source to human infections. Overall, SNPs were the most common variations among M. ap isolates while SNPs in addition to Indels were prevalent among M. avium isolates. Genomic variations will be useful in designing host-specific markers for the analysis of mycobacterial evolution and for developing novel diagnostics directed against Johne’s disease in animals.

  13. Annotating Protein Functional Residues by Coupling High-Throughput Fitness Profile and Homologous-Structure Analysis

    Directory of Open Access Journals (Sweden)

    Yushen Du


    Full Text Available Identification and annotation of functional residues are fundamental questions in protein sequence analysis. Sequence and structure conservation provides valuable information to tackle these questions. It is, however, limited by the incomplete sampling of sequence space in natural evolution. Moreover, proteins often have multiple functions, with overlapping sequences that present challenges to accurate annotation of the exact functions of individual residues by conservation-based methods. Using the influenza A virus PB1 protein as an example, we developed a method to systematically identify and annotate functional residues. We used saturation mutagenesis and high-throughput sequencing to measure the replication capacity of single nucleotide mutations across the entire PB1 protein. After predicting protein stability upon mutations, we identified functional PB1 residues that are essential for viral replication. To further annotate the functional residues important to the canonical or noncanonical functions of viral RNA-dependent RNA polymerase (vRdRp, we performed a homologous-structure analysis with 16 different vRdRp structures. We achieved high sensitivity in annotating the known canonical polymerase functional residues. Moreover, we identified a cluster of noncanonical functional residues located in the loop region of the PB1 β-ribbon. We further demonstrated that these residues were important for PB1 protein nuclear import through the interaction with Ran-binding protein 5. In summary, we developed a systematic and sensitive method to identify and annotate functional residues that are not restrained by sequence conservation. Importantly, this method is generally applicable to other proteins about which homologous-structure information is available.

  14. Use of genotypic identification by sodA sequencing in a prospective study to examine the distribution of coagulase-negative Staphylococcus species among strains recovered during septic orthopedic surgery and evaluate their significance. (United States)

    Sivadon, V; Rottman, M; Chaverot, S; Quincampoix, J-C; Avettand, V; de Mazancourt, P; Bernard, L; Trieu-Cuot, P; Féron, J-M; Lortat-Jacob, A; Piriou, P; Judet, T; Gaillard, J-L


    A total of 212 coagulase-negative Staphylococcus strains recovered prospectively during 119 surgeries for proven or suspected bone and joint infection (BJI) were identified by sodA sequencing. These strains were identified as 151 Staphylococcus epidermidis isolates, 15 S. warneri isolates, 14 S. capitis isolates, 9 S. hominis isolates, 6 S. lugdunensis isolates, 5 S. haemolyticus isolates, 4 S. caprae isolates, 4 S. pasteuri isolates, 3 S. simulans isolates, and 1 S. cohnii isolate. Only S. epidermidis, S. lugdunensis, S. capitis, and S. caprae were found to be infecting organisms and were involved, respectively, in 35 (81.4%), 3 (7.0%), 3 (7.0%), and 2 (4.6%) cases of BJI.

  15. Homologous series of induced early mutants in indican rice. Pt.1. The production of homologous series of early mutants

    International Nuclear Information System (INIS)

    Chen Xiulan; Yang Hefeng; He Zhentian; Han Yuepeng; Liu Xueyu


    The percentage of homologous series of early mutants induced from the same Indican rice variety were almost the same (1.37%∼1.64%) in 1983∼1993, but the ones from the different eco-typical varieties were different. The early variety was 0.73%, the mid variety was 1.51%, and the late variety was 1.97%. The percentage of homologous series of early mutants from the varieties with the same pedigree and relationship were similar, but the one from the cog nation were lower than those from distant varieties. There are basic laws and characters in the homologous series of early mutants: 1. The inhibited phenotype is the basic of the homologous series of early mutants; 2. The production of the homologous series of early mutants is closely related with the growing period of the parent; 3. The parallel mutation of the stem and leaves are simultaneously happened with the variation of early or late maturing; 4. The occurrence of the homologous series of early mutants is in a state of imbalance. According to the law of parallel variability, the production of homologous series of early mutants can be predicted as long as the parents' classification of plant, pedigree and ecological type are identified. Therefore, the early breeding can be guided by the law of homologous series of early mutants

  16. Sequence requirement of the ade6-4095 meiotic recombination hotspot in Schizosaccharomyces pombe. (United States)

    Foulis, Steven J; Fowler, Kyle R; Steiner, Walter W


    Homologous recombination occurs at a greatly elevated frequency in meiosis compared to mitosis and is initiated by programmed double-strand DNA breaks (DSBs). DSBs do not occur at uniform frequency throughout the genome in most organisms, but occur preferentially at a limited number of sites referred to as hotspots. The location of hotspots have been determined at nucleotide-level resolution in both the budding and fission yeasts, and while several patterns have emerged regarding preferred locations for DSB hotspots, it remains unclear why particular sites experience DSBs at much higher frequency than other sites with seemingly similar properties. Short sequence motifs, which are often sites for binding of transcription factors, are known to be responsible for a number of hotspots. In this study we identified the minimum sequence required for activity of one of such motif identified in a screen of random sequences capable of producing recombination hotspots. The experimentally determined sequence, GGTCTRGACC, closely matches the previously inferred sequence. Full hotspot activity requires an effective sequence length of 9.5 bp, whereas moderate activity requires an effective sequence length of approximately 8.2 bp and shows significant association with DSB hotspots. In combination with our previous work, this result is consistent with a large number of different sequence motifs capable of producing recombination hotspots, and supports a model in which hotspots can be rapidly regenerated by mutation as they are lost through recombination.

  17. The primary structures of two yeast enolase genes. Homology between the 5' noncoding flanking regions of yeast enolase and glyceraldehyde-3-phosphate dehydrogenase genes. (United States)

    Holland, M J; Holland, J P; Thill, G P; Jackson, K A


    Segments of yeast genomic DNA containing two enolase structural genes have been isolated by subculture cloning procedures using a cDNA hybridization probe synthesized from purified yeast enolase mRNA. Based on restriction endonuclease and transcriptional maps of these two segments of yeast DNA, each hybrid plasmid contains a region of extensive nucleotide sequence homology which forms hybrids with the cDNA probe. The DNA sequences which flank this homologous region in the two hybrid plasmids are nonhomologous indicating that these sequences are nontandemly repeated in the yeast genome. The complete nucleotide sequence of the coding as well as the flanking noncoding regions of these genes has been determined. The amino acid sequence predicted from one reading frame of both structural genes is extremely similar to that determined for yeast enolase (Chin, C. C. Q., Brewer, J. M., Eckard, E., and Wold, F. (1981) J. Biol. Chem. 256, 1370-1376), confirming that these isolated structural genes encode yeast enolase. The nucleotide sequences of the coding regions of the genes are approximately 95% homologous, and neither gene contains an intervening sequence. Codon utilization in the enolase genes follows the same biased pattern previously described for two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes (Holland, J. P., and Holland, M. J. (1980) J. Biol. Chem. 255, 2596-2605). DNA blotting analysis confirmed that the isolated segments of yeast DNA are colinear with yeast genomic DNA and that there are two nontandemly repeated enolase genes per haploid yeast genome. The noncoding portions of the two enolase genes adjacent to the initiation and termination codons are approximately 70% homologous and contain sequences thought to be involved in the synthesis and processing messenger RNA. Finally there are regions of extensive homology between the two enolase structural genes and two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes within the 5

  18. Competitive repair by naturally dispersed repetitive DNA during non-allelic homologous recombination

    Energy Technology Data Exchange (ETDEWEB)

    Hoang, Margaret L.; Tan, Frederick J.; Lai, David C.; Celniker, Sue E.; Hoskins, Roger A.; Dunham, Maitreya J.; Zheng, Yixian; Koshland, Douglas


    Genome rearrangements often result from non-allelic homologous recombination (NAHR) between repetitive DNA elements dispersed throughout the genome. Here we systematically analyze NAHR between Ty retrotransposons using a genome-wide approach that exploits unique features of Saccharomyces cerevisiae purebred and Saccharomyces cerevisiae/Saccharomyces bayanus hybrid diploids. We find that DNA double-strand breaks (DSBs) induce NAHR-dependent rearrangements using Ty elements located 12 to 48 kilobases distal to the break site. This break-distal recombination (BDR) occurs frequently, even when allelic recombination can repair the break using the homolog. Robust BDR-dependent NAHR demonstrates that sequences very distal to DSBs can effectively compete with proximal sequences for repair of the break. In addition, our analysis of NAHR partner choice between Ty repeats shows that intrachromosomal Ty partners are preferred despite the abundance of potential interchromosomal Ty partners that share higher sequence identity. This competitive advantage of intrachromosomal Tys results from the relative efficiencies of different NAHR repair pathways. Finally, NAHR generates deleterious rearrangements more frequently when DSBs occur outside rather than within a Ty repeat. These findings yield insights into mechanisms of repeat-mediated genome rearrangements associated with evolution and cancer.

  19. Competitive repair by naturally dispersed repetitive DNA during non-allelic homologous recombination.

    Directory of Open Access Journals (Sweden)

    Margaret L Hoang


    Full Text Available Genome rearrangements often result from non-allelic homologous recombination (NAHR between repetitive DNA elements dispersed throughout the genome. Here we systematically analyze NAHR between Ty retrotransposons using a genome-wide approach that exploits unique features of Saccharomyces cerevisiae purebred and Saccharomyces cerevisiae/Saccharomyces bayanus hybrid diploids. We find that DNA double-strand breaks (DSBs induce NAHR-dependent rearrangements using Ty elements located 12 to 48 kilobases distal to the break site. This break-distal recombination (BDR occurs frequently, even when allelic recombination can repair the break using the homolog. Robust BDR-dependent NAHR demonstrates that sequences very distal to DSBs can effectively compete with proximal sequences for repair of the break. In addition, our analysis of NAHR partner choice between Ty repeats shows that intrachromosomal Ty partners are preferred despite the abundance of potential interchromosomal Ty partners that share higher sequence identity. This competitive advantage of intrachromosomal Tys results from the relative efficiencies of different NAHR repair pathways. Finally, NAHR generates deleterious rearrangements more frequently when DSBs occur outside rather than within a Ty repeat. These findings yield insights into mechanisms of repeat-mediated genome rearrangements associated with evolution and cancer.

  20. Allergenic characterization of a novel allergen, homologous to chymotrypsin, from german cockroach. (United States)

    Jeong, Kyoung Yong; Son, Mina; Lee, Jae Hyun; Hong, Chein Soo; Park, Jung Won


    Cockroach feces are known to be rich in IgE-reactive components. Various protease allergens were identified by proteomic analysis of German cockroach fecal extract in a previous study. In this study, we characterized a novel allergen, a chymotrypsin-like serine protease. A cDNA sequence homologous to chymotrypsin was obtained by analysis of German cockroach expressed sequence tag (EST) clones. The recombinant chymotrypsins from the German cockroach and house dust mite (Der f 6) were expressed in Escherichia coli using the pEXP5NT/TOPO vector system, and their allergenicity was investigated by ELISA. The deduced amino acid sequence of German cockroach chymotrypsin showed 32.7 to 43.1% identity with mite group 3 (trypsin) and group 6 (chymotrypsin) allergens. Sera from 8 of 28 German cockroach allergy subjects (28.6%) showed IgE binding to the recombinant protein. IgE binding to the recombinant cockroach chymotrypsin was inhibited by house dust mite chymotrypsin Der f 6, while it minimally inhibited the German cockroach whole body extract. A novel allergen homologous to chymotrypsin was identified from the German cockroach and was cross-reactive with Der f 6.

  1. Efficient Detection of Copy Number Mutations in PMS2 Exons with a Close Homolog. (United States)

    Herman, Daniel S; Smith, Christina; Liu, Chang; Vaughn, Cecily P; Palaniappan, Selvi; Pritchard, Colin C; Shirts, Brian H


    Detection of 3' PMS2 copy-number mutations that cause Lynch syndrome is difficult because of highly homologous pseudogenes. To improve the accuracy and efficiency of clinical screening for these mutations, we developed a new method to analyze standard capture-based, next-generation sequencing data to identify deletions and duplications in PMS2 exons 9 to 15. The approach captures sequences using PMS2 targets, maps sequences randomly among regions with equal mapping quality, counts reads aligned to homologous exons and introns, and flags read count ratios outside of empirically derived reference ranges. The method was trained on 1352 samples, including 8 known positives, and tested on 719 samples, including 17 known positives. Clinical implementation of the first version of this method detected new mutations in the training (N = 7) and test (N = 2) sets that had not been identified by our initial clinical testing pipeline. The described final method showed complete sensitivity in both sample sets and false-positive rates of 5% (training) and 7% (test), dramatically decreasing the number of cases needing additional mutation evaluation. This approach leveraged the differences between gene and pseudogene to distinguish between PMS2 and PMS2CL copy-number mutations. These methods enable efficient and sensitive Lynch syndrome screening for 3' PMS2 copy-number mutations and may be applied similarly to other genomic regions with highly homologous pseudogenes. Copyright © 2018 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  2. Homology modelling and docking analysis of L-lactate dehydrogenase from Streptococcus thermopilus

    Directory of Open Access Journals (Sweden)

    Vukić Vladimir R.


    Full Text Available The aim of this research was to create a three-dimensional model of L-lactate dehydrogenase from the main yoghurt starter culture - Streptococcus thermopilus, to analyse its structural features and investigate substrate binding in the active site. NCBI BlastP was used against the Protein Data Bank database in order to identify the template for construction of homology models. Multiple sequence alignment was performed using the program MUSCULE within the UGENE 1.11.3 program. Homology models were constructed using the program Modeller v. 9.17. The obtained 3D model was verified by Ramachandran plots. Molecular docking simulations were performed using the program Surflex-Dock. The highest sequence similarity was observed with L-lactate dehydrogenase from Lactobacillus casei subsp. casei, with 69% identity. Therefore, its structure (PDB ID: 2ZQY:A was selected as a modelling template for homology modelling. Active residues are by sequence similarity predicted: S. thermophilus - HIS181 and S. aureus - HIS179. Binding energy of pyruvate to L-lactate dehydrogenase of S. thermopilus was - 7.874 kcal/mol. Pyruvate in L-lactate dehydrogenase of S. thermopilus makes H bonds with catalytic HIS181 (1.9 Å, as well as with THR235 (3.6 Å. Although our results indicate similar position of substrates between L-lactate dehydrogenase of S. thermopilus and S. aureus, differences in substrate distances and binding energy values could influence the reaction rate. Based on these results, the L-lactate dehydrogenase model proposed here could be used as a guide for further research, such as transition states of the reaction through molecular dynamics. [Projekat Ministarstva nauke Republike Srbije, br. III 46009

  3. Transcriptional transitions in Nicotiana benthamiana leaves upon induction of oil synthesis by WRINKLED1 homologs from diverse species and tissues. (United States)

    Grimberg, Åsa; Carlsson, Anders S; Marttila, Salla; Bhalerao, Rishikesh; Hofvander, Per


    Carbon accumulation and remobilization are essential mechanisms in plants to ensure energy transfer between plant tissues with different functions or metabolic needs and to support new generations. Knowledge about the regulation of carbon allocation into oil (triacylglycerol) in plant storage tissue can be of great economic and environmental importance for developing new high-yielding oil crops. Here, the effect on global gene expression as well as on physiological changes in leaves transiently expressing five homologs of the transcription factor WRINKLED1 (WRI1) originating from diverse species and tissues; Arabidopsis thaliana and potato (Solanum tuberosum) seed embryo, poplar (Populus trichocarpa) stem cambium, oat (Avena sativa) grain endosperm, and nutsedge (Cyperus esculentus) tuber parenchyma, were studied by agroinfiltration in Nicotiana benthamiana. All WRI1 homologs induced oil accumulation when expressed in leaf tissue. Transcriptome sequencing revealed that all homologs induced the same general patterns with a drastic shift in gene expression profiles of leaves from that of a typical source tissue to a source-limited sink-like tissue: Transcripts encoding enzymes for plastid uptake and metabolism of phosphoenolpyruvate, fatty acid and oil biosynthesis were up-regulated, as were also transcripts encoding starch degradation. Transcripts encoding enzymes in photosynthesis and starch synthesis were instead down-regulated. Moreover, transcripts representing fatty acid degradation were up-regulated indicating that fatty acids might be degraded to feed the increased need to channel carbons into fatty acid synthesis creating a futile cycle. RT-qPCR analysis of leaves expressing Arabidopsis WRI1 showed the temporal trends of transcripts selected as 'markers' for key metabolic pathways one to five days after agroinfiltration. Chlorophyll fluorescence measurements of leaves expressing Arabidopsis WRI1 showed a significant decrease in photosynthesis, even though

  4. Description of durancin TW-49M, a novel enterocin B-homologous bacteriocin in carrot-isolated Enterococcus durans QU 49. (United States)

    Hu, C-B; Zendo, T; Nakayama, J; Sonomoto, K


    To characterize the novel bacteriocin produced by Enterococcus durans. Enterococcus durans QU 49 was isolated from carrot and expressed bactericidal activity over 20-43 degrees C. Bacteriocins were purified to homogeneity using the three-step purification method, one of which, termed durancin TW-49M, was an enterocin B-homologous peptide with most identical residues occurring in the N-terminus. Durancin TW-49M was more tolerant in acidic than in alkali. DNA sequencing analysis revealed durancin TW-49M was translated as a prepeptide of the double-glycine type. Durancin TW-49M and enterocin B expressed similar antimicrobial spectra, in which no significant variation due to the diversity in their C-termini was observed. Durancin TW-49M, a novel nonpediocin-like class II bacteriocin, was characterized to the amino acid and genetic levels. The diverse C-terminal parts of durancin TW-49M and enterocin B were hardly to be suggested as the place determining the target cell specificity. This is the first and comprehensive study of a novel bacteriocin produced by Ent. durans. The high homology at the N-terminal halves between durancin TW-49M and enterocin B makes them suitable to study the structure-function relationship of bacteriocins and their immunity proteins.

  5. TurboFold: Iterative probabilistic estimation of secondary structures for multiple RNA sequences

    Directory of Open Access Journals (Sweden)

    Sharma Gaurav


    significance threshold are shown to be more accurate for TurboFold than for alternative methods that estimate base pairing probabilities. TurboFold-MEA, which uses base pairing probabilities from TurboFold in a maximum expected accuracy algorithm for secondary structure prediction, has accuracy comparable to the best performing secondary structure prediction methods. The computational and memory requirements for TurboFold are modest and, in terms of sequence length and number of sequences, scale much more favorably than joint alignment and folding algorithms. Conclusions TurboFold is an iterative probabilistic method for predicting secondary structures for multiple RNA sequences that efficiently and accurately combines the information from the comparative analysis between sequences with the thermodynamic folding model. Unlike most other multi-sequence structure prediction methods, TurboFold does not enforce strict commonality of structures and is therefore useful for predicting structures for homologous sequences that have diverged significantly. TurboFold can be downloaded as part of the RNAstructure package at

  6. Quantification and Sequencing of Crossover Recombinant Molecules from Arabidopsis Pollen DNA. (United States)

    Choi, Kyuha; Yelina, Nataliya E; Serra, Heïdi; Henderson, Ian R


    During meiosis, homologous chromosomes undergo recombination, which can result in formation of reciprocal crossover molecules. Crossover frequency is highly variable across the genome, typically occurring in narrow hotspots, which has a significant effect on patterns of genetic diversity. Here we describe methods to measure crossover frequency in plants at the hotspot scale (bp-kb), using allele-specific PCR amplification from genomic DNA extracted from the pollen of F 1 heterozygous plants. We describe (1) titration methods that allow amplification, quantification and sequencing of single crossover molecules, (2) quantitative PCR methods to more rapidly measure crossover frequency, and (3) application of high-throughput sequencing for study of crossover distributions within hotspots. We provide detailed descriptions of key steps including pollen DNA extraction, prior identification of hotspot locations, allele-specific oligonucleotide design, and sequence analysis approaches. Together, these methods allow the rate and recombination topology of plant hotspots to be robustly measured and compared between varied genetic backgrounds and environmental conditions.

  7. Protein remote homology detection based on bidirectional long short-term memory. (United States)

    Li, Shumin; Chen, Junjie; Liu, Bin


    Protein remote homology detection plays a vital role in studies of protein structures and functions. Almost all of the traditional machine leaning methods require fixed length features to represent the protein sequences. However, it is never an easy task to extract the discriminative features with limited knowledge of proteins. On the other hand, deep learning technique has demonstrated its advantage in automatically learning representations. It is worthwhile to explore the applications of deep learning techniques to the protein remote homology detection. In this study, we employ the Bidirectional Long Short-Term Memory (BLSTM) to learn effective features from pseudo proteins, also propose a predictor called ProDec-BLSTM: it includes input layer, bidirectional LSTM, time distributed dense layer and output layer. This neural network can automatically extract the discriminative features by using bidirectional LSTM and the time distributed dense layer. Experimental results on a widely-used benchmark dataset show that ProDec-BLSTM outperforms other related methods in terms of both the mean ROC and mean ROC50 scores. This promising result shows that ProDec-BLSTM is a useful tool for protein remote homology detection. Furthermore, the hidden patterns learnt by ProDec-BLSTM can be interpreted and visualized, and therefore, additional useful information can be obtained.

  8. Accurate protein structure modeling using sparse NMR data and homologous structure information. (United States)

    Thompson, James M; Sgourakis, Nikolaos G; Liu, Gaohua; Rossi, Paolo; Tang, Yuefeng; Mills, Jeffrey L; Szyperski, Thomas; Montelione, Gaetano T; Baker, David


    While information from homologous structures plays a central role in X-ray structure determination by molecular replacement, such information is rarely used in NMR structure determination because it can be incorrect, both locally and globally, when evolutionary relationships are inferred incorrectly or there has been considerable evolutionary structural divergence. Here we describe a method that allows robust modeling of protein structures of up to 225 residues by combining (1)H(N), (13)C, and (15)N backbone and (13)Cβ chemical shift data, distance restraints derived from homologous structures, and a physically realistic all-atom energy function. Accurate models are distinguished from inaccurate models generated using incorrect sequence alignments by requiring that (i) the all-atom energies of models generated using the restraints are lower than models generated in unrestrained calculations and (ii) the low-energy structures converge to within 2.0 Å backbone rmsd over 75% of the protein. Benchmark calculations on known structures and blind targets show that the method can accurately model protein structures, even with very remote homology information, to a backbone rmsd of 1.2-1.9 Å relative to the conventional determined NMR ensembles and of 0.9-1.6 Å relative to X-ray structures for well-defined regions of the protein structures. This approach facilitates the accurate modeling of protein structures using backbone chemical shift data without need for side-chain resonance assignments and extensive analysis of NOESY cross-peak assignments.

  9. Conservation and co-option in developmental programmes: the importance of homology relationships

    Directory of Open Access Journals (Sweden)

    Becker May-Britt


    Full Text Available Abstract One of the surprising insights gained from research in evolutionary developmental biology (evo-devo is that increasing diversity in body plans and morphology in organisms across animal phyla are not reflected in similarly dramatic changes at the level of gene composition of their genomes. For instance, simplicity at the tissue level of organization often contrasts with a high degree of genetic complexity. Also intriguing is the observation that the coding regions of several genes of invertebrates show high sequence similarity to those in humans. This lack of change (conservation indicates that evolutionary novelties may arise more frequently through combinatorial processes, such as changes in gene regulation and the recruitment of novel genes into existing regulatory gene networks (co-option, and less often through adaptive evolutionary processes in the coding portions of a gene. As a consequence, it is of great interest to examine whether the widespread conservation of the genetic machinery implies the same developmental function in a last common ancestor, or whether homologous genes acquired new developmental roles in structures of independent phylogenetic origin. To distinguish between these two possibilities one must refer to current concepts of phylogeny reconstruction and carefully investigate homology relationships. Particularly problematic in terms of homology decisions is the use of gene expression patterns of a given structure. In the future, research on more organisms other than the typical model systems will be required since these can provide insights that are not easily obtained from comparisons among only a few distantly related model species.

  10. Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality. (United States)

    Lu, Sha; Yin, Xiaoyan; Spollen, William; Zhang, Ning; Xu, Dong; Schoelz, James; Bilyeu, Kristin; Zhang, Zhanyuan J


    In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

  11. Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality.

    Directory of Open Access Journals (Sweden)

    Sha Lu

    Full Text Available In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

  12. The K-homology of nets of C∗-algebras (United States)

    Ruzzi, Giuseppe; Vasselli, Ezio


    Let X be a space, intended as a possibly curved space-time, and A a precosheaf of C∗-algebras on X. Motivated by algebraic quantum field theory, we study the Kasparov and Θ-summable K-homology of A interpreting them in terms of the holonomy equivariant K-homology of the associated C∗-dynamical system. This yields a characteristic class for K-homology cycles of A with values in the odd cohomology of X, that we interpret as a generalized statistical dimension.

  13. New Insight Into the Diversity of SemiSWEET Sugar Transporters and the Homologs in Prokaryotes

    Directory of Open Access Journals (Sweden)

    Baolei Jia


    Full Text Available Sugars will eventually be exported transporters (SWEETs and SemiSWEETs represent a family of sugar transporters in eukaryotes and prokaryotes, respectively. SWEETs contain seven transmembrane helices (TMHs, while SemiSWEETs contain three. The functions of SemiSWEETs are less studied. In this perspective article, we analyzed the diversity and conservation of SemiSWEETs and further proposed the possible functions. 1,922 SemiSWEET homologs were retrieved from the UniProt database, which is not proportional to the sequenced prokaryotic genomes. However, these proteins are very diverse in sequences and can be classified into 19 clusters when >50% sequence identity is required. Moreover, a gene context analysis indicated that several SemiSWEETs are located in the operons that are related to diverse carbohydrate metabolism. Several proteins with seven TMHs can be found in bacteria, and sequence alignment suggested that these proteins in bacteria may be formed by the duplication and fusion. Multiple sequence alignments showed that the amino acids for sugar translocation are still conserved and coevolved, although the sequences show diversity. Among them, the functions of a few amino acids are still not clear. These findings highlight the challenges that exist in SemiSWEETs and provide future researchers the foundation to explore these uncharted areas.

  14. Sequence assembly

    DEFF Research Database (Denmark)

    Scheibye-Alsing, Karsten; Hoffmann, S.; Frankel, Annett Maria


    Despite the rapidly increasing number of sequenced and re-sequenced genomes, many issues regarding the computational assembly of large-scale sequencing data have remain unresolved. Computational assembly is crucial in large genome projects as well for the evolving high-throughput technologies and...... in genomic DNA, highly expressed genes and alternative transcripts in EST sequences. We summarize existing comparisons of different assemblers and provide a detailed descriptions and directions for download of assembly programs at:

  15. Genome Sequencing

    DEFF Research Database (Denmark)

    Sato, Shusei; Andersen, Stig Uggerhøj


    The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based on transcr......The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based...

  16. Resistance of hypoxic cells to ionizing radiation is influenced by homologous recombination status

    International Nuclear Information System (INIS)

    Sprong, Debbie; Janssen, Hilde L.; Vens, Conchita; Begg, Adrian C.


    Purpose: To determine the role of DNA repair in hypoxic radioresistance. Methods and Materials: Chinese hamster cell lines with mutations in homologous recombination (XRCC2, XRCC3, BRAC2, RAD51C) or nonhomologous end-joining (DNA-PKcs) genes were irradiated under normoxic (20% oxygen) and hypoxic (<0.1% oxygen) conditions, and the oxygen enhancement ratio (OER) was calculated. In addition, Fanconi anemia fibroblasts (complementation groups C and G) were compared with fibroblasts from nonsyndrome patients. RAD51 foci were studied using immunofluorescence. Results: All hamster cell lines deficient in homologous recombination showed a decrease in OER (1.5-2.0 vs. 2.6-3.0 for wild-types). In contrast, the OER for the DNA-PKcs-deficient line was comparable to wild-type controls. The two Fanconi anemia cell strains also showed a significant reduction in OER. The OER for RAD51 foci formation at late times after irradiation was considerably lower than that for survival in wild-type cells. Conclusion: Homologous recombination plays an important role in determining hypoxic cell radiosensitivity. Lower OERs have also been reported in cells deficient in XPF and ERCC1, which, similar to homologous recombination genes, are known to play a role in cross-link repair. Because Fanconi anemia cells are also sensitive to cross-linking agents, this strengthens the notion that the capacity to repair cross-links determines hypoxic radiosensitivity

  17. Activities of wildtype and mutant p53 in suppression of homologous recombination as measured by a retroviral vector system

    International Nuclear Information System (INIS)

    Lu Xiongbin; Lozano, Guillermina; Donehower, Lawrence A.


    DNA repair of double strand breaks, interstrand DNA cross-links, and other types of DNA damage utilizes the processes of homologous recombination and non-homologous end joining to repair the damage. Aberrant homologous recombination is likely to be responsible for a significant fraction of chromosomal deletions, duplications, and translocations that are observed in cancer cells. To facilitate measurement of homologous recombination frequencies in normal cells, mutant cells, and cancer cells, we have developed a high titer retroviral vector containing tandem repeats of mutant versions of a GFP-Zeocin resistance fusion gene and an intact neomycin resistance marker. Recombination between the tandem repeats regenerates a functional GFP-Zeo R marker that can be easily scored. This retroviral vector was used to assess homologous recombination frequencies in human cancer cells and rodent fibroblasts with differing dosages of wild type or mutant p53. Absence of wild type p53 stimulated spontaneous and ionizing radiation-induced homologous recombination, confirming previous studies. Moreover, p53 +/- mouse fibroblasts show elevated levels of homologous recombination compared to their p53 +/+ counterparts following retroviral vector infection, indicating that p53 is haploinsufficient for suppression of homologous recombination. Transfection of vector-containing p53 null Saos-2 cells with various human cancer-associated p53 mutants revealed that these altered p53 proteins retain some recombination suppression function despite being totally inactive for transcriptional transactivation. The retroviral vector utilized in these studies may be useful in performing recombination assays on a wide array of cell types, including those not readily transfected by normal vectors

  18. Characterization and sequence analysis of the F2 promoter from corynephage BFK20

    International Nuclear Information System (INIS)

    Koptides, M.; Ugorcakova, J.; Baloghova, E.; Bukovska, G.; Timko, J.


    F2 promoter from corynephage BFK20 was isolated and characterized. It was functional in Escherichia coli and Corynebacterium glutamicum. Cloning of the F2 promoter into the pJUP05 promoter probe vector caused an increase of the neomycin phosphotransferase II specific activity. According to the Northern blot hybridization the nptII gene was expressed from the cloned F2 promoter. The apparent transcription start point in E. coli and C. glutamicum was determined. The-35 region of F2 promoter showed high similarity to that of E. coli promoter consensus sequence, but its - 10 region was G+C rich and had no significant homology to that. (author)

  19. In vitro site selection of a consensus binding site for the Drosophila melanogaster Tbx20 homolog midline.

    Directory of Open Access Journals (Sweden)

    Nima Najand

    Full Text Available We employed in vitro site selection to identify a consensus binding sequence for the Drosophila melanogaster Tbx20 T-box transcription factor homolog Midline. We purified a bacterially expressed T-box DNA binding domain of Midline, and used it in four rounds of precipitation and polymerase-chain-reaction based amplification. We cloned and sequenced 54 random oligonucleotides selected by Midline. Electromobility shift-assays confirmed that 27 of these could bind the Midline T-box. Sequence alignment of these 27 clones suggests that Midline binds as a monomer to a consensus sequence that contains an AGGTGT core. Thus, the Midline consensus binding site we define in this study is similar to that defined for vertebrate Tbx20, but differs from a previously reported Midline binding sequence derived through site selection.

  20. Two human cDNA molecules coding for the Duchenne muscular dystrophy (DMD) locus are highly homologous

    Energy Technology Data Exchange (ETDEWEB)

    Rosenthal, A.; Speer, A.; Billwitz, H. (Zentralinstitut fuer Molekularbiologie, Berlin-Buch (Germany Democratic Republic)); Cross, G.S.; Forrest, S.M.; Davies, K.E. (Univ. of Oxford (England))


    Recently the complete sequence of the human fetal cDNA coding for the Duchenne muscular dystrophy (DMD) locus was reported and a 3,685 amino acid long, rod-shaped cytoskeletal protein (dystrophin) was predicted as the protein product. Independently, the authors have isolated and sequenced different DMD cDNA molecules from human adult and fetal muscle. The complete 12.5 kb long sequence of all their cDNA clones has now been determined and they report here the nucleotide (nt) and amino acid (aa) differences between the sequences of both groups. The cDNA sequence comprises the whole coding region but lacks the first 110 nt from the 5{prime}-untranslated region and the last 1,417 nt of the 3{prime}-untranslated region. They have found 11 nt differences (approximately 99.9% homology) from which 7 occurred at the aa level.

  1. Activation of the polyomavirus enhancer by a murine activator protein 1 (AP1) homolog and two contiguous proteins.


    Martin, M E; Piette, J; Yaniv, M; Tang, W J; Folk, W R


    The polyomavirus enhancer is composed of multiple DNA sequence elements serving as binding sites for proteins present in mouse nuclear extracts that activate transcription and DNA replication. We have identified three such proteins and their binding sites and correlate them with enhancer function. Mutation of nucleotide (nt) 5140 in the enhancer alters the binding site (TGACTAA, nt 5139-5145) for polyomavirus enhancer A binding protein 1 (PEA1), a murine homolog of the human transcription fac...

  2. Homology of normal chains and cohomology of charges

    CERN Document Server

    Pauw, Th De; Pfeffer, W F


    The authors consider a category of pairs of compact metric spaces and Lipschitz maps where the pairs satisfy a linearly isoperimetric condition related to the solvability of the Plateau problem with partially free boundary. It includes properly all pairs of compact Lipschitz neighborhood retracts of a large class of Banach spaces. On this category the authors define homology and cohomology functors with real coefficients which satisfy the Eilenberg-Steenrod axioms, but reflect the metric properties of the underlying spaces. As an example they show that the zero-dimensional homology of a space in our category is trivial if and only if the space is path connected by arcs of finite length. The homology and cohomology of a pair are, respectively, locally convex and Banach spaces that are in duality. Ignoring the topological structures, the homology and cohomology extend to all pairs of compact metric spaces. For locally acyclic spaces, the authors establish a natural isomorphism between their cohomology and the �...

  3. Generalized local homology and cohomology for linearly compact modules

    International Nuclear Information System (INIS)

    Tran Tuan Nam


    We study generalized local homology for linearly compact modules. By duality, we get some properties of generalized local cohomology modules and extend well-known properties of local cohomology of A. Grothendieck. (author)

  4. On the homology and the cohomology of certain polycyclic groups

    International Nuclear Information System (INIS)

    Majumdar, S.


    The homology and the cohomology of infinite non-abelian split extensions of cyclic groups by cyclic groups have been computed through construction of nice free resolutions for these groups. (author). 16 refs

  5. Inhibitory Effect of Berberine on Zeste Homolog 2 (Ezh2 ...

    African Journals Online (AJOL)

    homolog 2 (Ezh2) expressions in KYSE450 human esophageal cancer cells. Methods: ... of the AXL receptor kinase. The results of ... effects of estrogen receptor antagonists on ..... protein EZH2 is involved in progression of prostate cancer.

  6. Matrix factorizations and homological mirror symmetry on the torus

    International Nuclear Information System (INIS)

    Knapp, Johanna; Omer, Harun


    We consider matrix factorizations and homological mirror symmetry on the torus T 2 using a Landau-Ginzburg description. We identify the basic matrix factorizations of the Landau-Ginzburg superpotential and compute the full spectrum taking into account the explicit dependence on bulk and boundary moduli. We verify homological mirror symmetry by comparing three-point functions in the A-model and the B-model

  7. Zeroth Poisson Homology, Foliated Cohomology and Perfect Poisson Manifolds (United States)

    Martínez-Torres, David; Miranda, Eva


    We prove that, for compact regular Poisson manifolds, the zeroth homology group is isomorphic to the top foliated cohomology group, and we give some applications. In particular, we show that, for regular unimodular Poisson manifolds, top Poisson and foliated cohomology groups are isomorphic. Inspired by the symplectic setting, we define what a perfect Poisson manifold is. We use these Poisson homology computations to provide families of perfect Poisson manifolds.

  8. Genome sequence determination and metagenomic characterization of a Dehalococcoides mixed culture grown on cis-1,2-dichloroethene. (United States)

    Yohda, Masafumi; Yagi, Osami; Takechi, Ayane; Kitajima, Mizuki; Matsuda, Hisashi; Miyamura, Naoaki; Aizawa, Tomoko; Nakajima, Mutsuyasu; Sunairi, Michio; Daiba, Akito; Miyajima, Takashi; Teruya, Morimi; Teruya, Kuniko; Shiroma, Akino; Shimoji, Makiko; Tamotsu, Hinako; Juan, Ayaka; Nakano, Kazuma; Aoyama, Misako; Terabayashi, Yasunobu; Satou, Kazuhito; Hirano, Takashi


    A Dehalococcoides-containing bacterial consortium that performed dechlorination of 0.20 mM cis-1,2-dichloroethene to ethene in 14 days was obtained from the sediment mud of the lotus field. To obtain detailed information of the consortium, the metagenome was analyzed using the short-read next-generation sequencer SOLiD 3. Matching the obtained sequence tags with the reference genome sequences indicated that the Dehalococcoides sp. in the consortium was highly homologous to Dehalococcoides mccartyi CBDB1 and BAV1. Sequence comparison with the reference sequence constructed from 16S rRNA gene sequences in a public database showed the presence of Sedimentibacter, Sulfurospirillum, Clostridium, Desulfovibrio, Parabacteroides, Alistipes, Eubacterium, Peptostreptococcus and Proteocatella in addition to Dehalococcoides sp. After further enrichment, the members of the consortium were narrowed down to almost three species. Finally, the full-length circular genome sequence of the Dehalococcoides sp. in the consortium, D. mccartyi IBARAKI, was determined by analyzing the metagenome with the single-molecule DNA sequencer PacBio RS. The accuracy of the sequence was confirmed by matching it to the tag sequences obtained by SOLiD 3. The genome is 1,451,062 nt and the number of CDS is 1566, which includes 3 rRNA genes and 47 tRNA genes. There exist twenty-eight RDase genes that are accompanied by the genes for anchor proteins. The genome exhibits significant sequence identity with other Dehalococcoides spp. throughout the genome, but there exists significant difference in the distribution RDase genes. The combination of a short-read next-generation DNA sequencer and a long-read single-molecule DNA sequencer gives detailed information of a bacterial consortium. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  9. Prokaryotic caspase homologs: phylogenetic patterns and functional characteristics reveal considerable diversity.

    Directory of Open Access Journals (Sweden)

    Johannes Asplund-Samuelsson

    Full Text Available Caspases accomplish initiation and execution of apoptosis, a programmed cell death process specific to metazoans. The existence of prokaryotic caspase homologs, termed metacaspases, has been known for slightly more than a decade. Despite their potential connection to the evolution of programmed cell death in eukaryotes, the phylogenetic distribution and functions of these prokaryotic metacaspase sequences are largely uncharted, while a few experiments imply involvement in programmed cell death. Aiming at providing a more detailed picture of prokaryotic caspase homologs, we applied a computational approach based on Hidden Markov Model search profiles to identify and functionally characterize putative metacaspases in bacterial and archaeal genomes. Out of the total of 1463 analyzed genomes, merely 267 (18% were identified to contain putative metacaspases, but their taxonomic distribution included most prokaryotic phyla and a few archaea (Euryarchaeota. Metacaspases were particularly abundant in Alphaproteobacteria, Deltaproteobacteria and Cyanobacteria, which harbor many morphologically and developmentally complex organisms, and a distinct correlation was found between abundance and phenotypic complexity in Cyanobacteria. Notably, Bacillus subtilis and Escherichia coli, known to undergo genetically regulated autolysis, lacked metacaspases. Pfam domain architecture analysis combined with operon identification revealed rich and varied configurations among the metacaspase sequences. These imply roles in programmed cell death, but also e.g. in signaling, various enzymatic activities and protein modification. Together our data show a wide and scattered distribution of caspase homologs in prokaryotes with structurally and functionally diverse sub-groups, and with a potentially intriguing evolutionary role. These features will help delineate future characterizations of death pathways in prokaryotes.

  10. Homologous Recombination and Xylella fastidiosa Host-Pathogen Associations in South America. (United States)

    Coletta-Filho, Helvécio D; Francisco, Carolina S; Lopes, João R S; Muller, Christiane; Almeida, Rodrigo P P


    Homologous recombination affects the evolution of bacteria such as Xylella fastidiosa, a naturally competent plant pathogen that requires insect vectors for dispersal. This bacterial species is taxonomically divided into subspecies, with phylogenetic clusters within subspecies that are host specific. One subspecies, pauca, is primarily limited to South America, with the exception of recently reported strains in Europe and Costa Rica. Despite the economic importance of X. fastidiosa subsp. pauca in South America, little is known about its genetic diversity. Multilocus sequence typing (MLST) has previously identified six sequence types (ST) among plant samples collected in Brazil (both subsp. pauca and multiplex). Here, we report on a survey of X. fastidiosa genetic diversity (MLST based) performed in six regions in Brazil and two in Argentina, by sampling five different plant species. In addition to the six previously reported ST, seven new subsp. pauca and two new subsp. multiplex ST were identified. The presence of subsp. multiplex in South America is considered to be the consequence of a single introduction from its native range in North America more than 80 years ago. Different phylogenetic approaches clustered the South American ST into four groups, with strains infecting citrus (subsp. pauca); coffee and olive (subsp. pauca); coffee, hibiscus, and plum (subsp. pauca); and plum (subsp. multiplex). In areas where these different genetic clusters occurred sympatrically, we found evidence of homologous recombination in the form of bidirectional allelic exchange between subspp. pauca and multiplex. In fact, the only strain of subsp. pauca isolated from a plum host had an allele that originated from subsp. multiplex. These signatures of bidirectional homologous recombination between endemic and introduced ST indicate that gene flow occurs in short evolutionary time frames in X. fastidiosa, despite the ecological isolation (i.e., host plant species) of genotypes.

  11. Functional Coverage of the Human Genome by Existing Structures, Structural Genomics Targets, and Homology Models.

    Directory of Open Access Journals (Sweden)


    Full Text Available The bias in protein structure and function space resulting from experimental limitations and targeting of particular functional classes of proteins by structural biologists has long been recognized, but never continuously quantified. Using the Enzyme Commission and the Gene Ontology classifications as a reference frame, and integrating structure data from the Protein Data Bank (PDB, target sequences from the structural genomics projects, structure homology derived from the SUPERFAMILY database, and genome annotations from Ensembl and NCBI, we provide a quantified view, both at the domain and whole-protein levels, of the current and projected coverage of protein structure and function space relative to the human genome. Protein structures currently provide at least one domain that covers 37% of the functional classes identified in the genome; whole structure coverage exists for 25% of the genome. If all the structural genomics targets were solved (twice the current number of structures in the PDB, it is estimated that structures of one domain would cover 69% of the functional classes identified and complete structure coverage would be 44%. Homology models from existing experimental structures extend the 37% coverage to 56% of the genome as single domains and 25% to 31% for complete structures. Coverage from homology models is not evenly distributed by protein family, reflecting differing degrees of sequence and structure divergence within families. While these data provide coverage, conversely, they also systematically highlight functional classes of proteins for which structures should be determined. Current key functional families without structure representation are highlighted here; updated information on the "most wanted list" that should be solved is available on a weekly basis from

  12. Multiple evolutionary events involved in maintaining homologs of Resistance to Powdery Mildew 8 in Brassica napus

    Directory of Open Access Journals (Sweden)

    Qin Li


    Full Text Available The Resistance to Powdery Mildew 8 (RPW8 locus confers broad-spectrum resistance to powdery mildew in Arabidopsis thaliana. There are four Homologous to RPW8s (BrHRs in Brassica rapa and three in B. oleracea (BoHRs. B. napus (Bn is derived from diploidization of a hybrid between B. rapa and B. oleracea, thus should have seven homologs of RPW8 (BnHRs. It is unclear whether these genes are still maintained or lost in B. napus after diploidization and how they might have been evolved. Here we reported the identification and sequence polymorphisms of BnHRs from a set of B. napus accessions. Our data indicated that while the BoHR copy from B. oleracea is highly conserved, the BrHR copy from B. rapa is relatively variable in the B. napus genome owing to multiple evolutionary events, such as gene loss, point mutation, insertion, deletion and intragenic recombination. Given the overall high sequence homology of BnHR genes, it is not surprising that both intragenic recombination between two orthologs and two paralogs were detected in B. napus, which may explain the loss of BoHR genes in some B. napus accessions. When ectopically expressed in Arabidopsis, a C-terminally truncated version of BnHRa and BnHRb, as well as the full length BnHRd fused with YFP at their C-termini could trigger cell death in the absence of pathogens and enhanced resistance to powdery mildew disease. Moreover, subcellular localization analysis showed that both BnHRa-YFP and BnHRb-YFP were mainly localized to the extra-haustorial membrane (EHM encasing the haustorium of powdery mildew. Taken together, our data suggest that the duplicated BnHR genes might have been subjected to differential selection and at least some may play a role in defense and could serve as resistance resource in engineering disease-resistant plants.

  13. Multiple Evolutionary Events Involved in Maintaining Homologs of Resistance to Powdery Mildew 8 in Brassica napus. (United States)

    Li, Qin; Li, Jing; Sun, Jin-Long; Ma, Xian-Feng; Wang, Ting-Ting; Berkey, Robert; Yang, Hui; Niu, Ying-Ze; Fan, Jing; Li, Yan; Xiao, Shunyuan; Wang, Wen-Ming


    The Resistance to Powdery Mildew 8 (RPW8) locus confers broad-spectrum resistance to powdery mildew in Arabidopsis thaliana. There are four Homologous to RPW8s (BrHRs) in Brassica rapa and three in Brassica oleracea (BoHRs). Brassica napus (Bn) is derived from diploidization of a hybrid between B. rapa and B. oleracea, thus should have seven homologs of RPW8 (BnHRs). It is unclear whether these genes are still maintained or lost in B. napus after diploidization and how they might have been evolved. Here, we reported the identification and sequence polymorphisms of BnHRs from a set of B. napus accessions. Our data indicated that while the BoHR copy from B. oleracea is highly conserved, the BrHR copy from B. rapa is relatively variable in the B. napus genome owing to multiple evolutionary events, such as gene loss, point mutation, insertion, deletion, and intragenic recombination. Given the overall high sequence homology of BnHR genes, it is not surprising that both intragenic recombination between two orthologs and two paralogs were detected in B. napus, which may explain the loss of BoHR genes in some B. napus accessions. When ectopically expressed in Arabidopsis, a C-terminally truncated version of BnHRa and BnHRb, as well as the full length BnHRd fused with YFP at their C-termini could trigger cell death in the absence of pathogens and enhanced resistance to powdery mildew disease. Moreover, subcellular localization analysis showed that both BnHRa-YFP and BnHRb-YFP were mainly localized to the extra-haustorial membrane encasing the haustorium of powdery mildew. Taken together, our data suggest that the duplicated BnHR genes might have been subjected to differential selection and at least some may play a role in defense and could serve as resistance resource in engineering disease-resistant plants.

  14. A decline in transcript abundance for Heterodera glycines homologs of Caenorhabditis elegans uncoordinated genes accompanies its sedentary parasitic phase

    Directory of Open Access Journals (Sweden)

    Overall Christopher C


    Full Text Available Abstract Background Heterodera glycines (soybean cyst nematode [SCN], the major pathogen of Glycine max (soybean, undergoes muscle degradation (sarcopenia as it becomes sedentary inside the root. Many genes encoding muscular and neuromuscular components belong to the uncoordinated (unc family of genes originally identified in Caenorhabditis elegans. Previously, we reported a substantial decrease in transcript abundance for Hg-unc-87, the H. glycines homolog of unc-87 (calponin during the adult sedentary phase of SCN. These observations implied that changes in the expression of specific muscle genes occurred during sarcopenia. Results We developed a bioinformatics database that compares expressed sequence tag (est and genomic data of C. elegans and H. glycines (CeHg database. We identify H. glycines homologs of C. elegans unc genes whose protein products are involved in muscle composition and regulation. RT-PCR reveals the transcript abundance of H. glycines unc homologs at mobile and sedentary stages of its lifecycle. A prominent reduction in transcript abundance occurs in samples from sedentary nematodes for homologs of actin, unc-60B (cofilin, unc-89, unc-15 (paromyosin, unc-27 (troponin I, unc-54 (myosin, and the potassium channel unc-110 (twk-18. Less reduction is observed for the focal adhesion complex gene Hg-unc-97. Conclusion The CeHg bioinformatics database is shown to be useful in identifying homologs of genes whose protein products perform roles in specific aspects of H. glycines muscle biology. Our bioinformatics comparison of C. elegans and H. glycines genomic data and our Hg-unc-87 expression experiments demonstrate that the transcript abundance of specific H. glycines homologs of muscle gene decreases as the nematode becomes sedentary inside the root during its parasitic feeding stages.

  15. Homologous gene targeting of a carotenoids biosynthetic gene in Rhodosporidium toruloides by Agrobacterium-mediated transformation. (United States)

    Sun, Wenyi; Yang, Xiaobing; Wang, Xueying; Lin, Xinping; Wang, Yanan; Zhang, Sufang; Luan, Yushi; Zhao, Zongbao K


    To target a carotenoid biosynthetic gene in the oleaginous yeast Rhodosporidium toruloides by using the Agrobacterium-mediated transformation (AMT) method. The RHTO_04602 locus of R. toruloides NP11, previously assigned to code the carotenoid biosynthetic gene CRTI, was amplified from genomic DNA and cloned into the binary plasmid pZPK-mcs, resulting in pZPK-CRT. A HYG-expression cassette was inserted into the CRTI sequence of pZPK-CRT by utilizing the restriction-free clone strategy. The resulted plasmid was used to transform R. toruloides cells according to the AMT method, leading to a few white transformants. Sequencing analysis of those transformants confirmed homologous recombination and insertional inactivation of CRTI. When the white variants were transformed with a CRTI-expression cassette, cells became red and produced carotenoids as did the wild-type strain NP11. Successful homologous targeting of the CrtI locus confirmed the function of RHTO_04602 in carotenoids biosynthesis in R. toruloides. It provided valuable information for metabolic engineering of this non-model yeast species.

  16. Transformation of Aspergillus parasiticus with a homologous gene (pyrG) involved in pyrimidine biosynthesis

    International Nuclear Information System (INIS)

    Skory, C.D.; Horng, J.S.; Pestka, J.J.; Linz, J.E.


    The lack of efficient transformation methods for aflatoxigenic Aspergillus parasiticus has been a major constraint for the study of aflatoxin biosynthesis at the genetic level. A transformation system with efficiencies of 30 to 50 stable transformants per μg of DNA was developed for A. parasiticus by using homologous pyrG gene. The pyrG gene from A. parasiticus was isolated by in situ plaque hybridization of a lambda genomic DNA library. Uridine auxotrophs of A. parasiticus ATCC 36537, a mutant blocked in aflatoxin biosynthesis, were isolated by selection on 5-fluoroorotic acid following nitrosoguanidine mutagenesis. Isolates with mutations in the pyrG gene resulting in elimination of orotidine monophosphate (OMP) decarboxylase activity were detected by assaying cell extracts for their ability to convert [ 14 C]OMP to [ 14 C]UMP. Transformation of A. parasiticus pyrG protoplasts with the homologous pyrG gene restored the fungal cells to prototrophy. Enzymatic analysis of cell extracts of transformant clones demonstrated that these extracts had the ability to convert [ 14 C]OMP to [ 14 C]UMP. Southern analysis of DNA purified from transformant clones indicated that both pUC19 vector sequences and pyrG sequences were integrated into the genome. The development of this pyrG transformation system should allow cloning of the aflatoxin-biosynthetic genes, which will be useful in studying the regulation of aflatoxin biosynthesis and may ultimately provide a means for controlling aflatoxin production in the field

  17. Isolation and characterization of a FLOWERING LOCUS T homolog from pineapple (Ananas comosus (L.) Merr). (United States)

    Lv, LingLing; Duan, Jun; Xie, JiangHui; Wei, ChangBin; Liu, YuGe; Liu, ShengHui; Sun, GuangMing


    FLOWERING LOCUS T (FT)-like genes are crucial regulators of flowering in angiosperms. A homolog of FT, designated as AcFT (GenBank ID: HQ343233), was isolated from pineapple cultivar Comte de Paris by reverse transcriptase polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). The cDNA sequence of AcFT is 915 bp in length and contains an ORF of 534 bp, which encodes a protein of 177 aa. Molecular weight was 19.9 kDa and isoelectric point was 6.96. The deduced protein sequence of AcFT was 84% and 82% identical to homologs encoded by CgFT in Cymbidium goeringii and OgFT in Oncidium Gower Ramsey respectively. Quantitative real-time PCR (qRT-PCR) analyses showed that the expression of AcFT was high in flesh and none in leaves. qRT-PCR analyses in different stages indicated that the expression of AcFT reached the highest level on 40 d after flower inducing, when the multiple fruit and floral organs were forming. The 35S::AcFT transgenic Arabidopsis plants flowered earlier and had more inflorescences or branches than wild type plants. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. Feature Selection and the Class Imbalance Problem in Predicting Protein Function from Sequence

    NARCIS (Netherlands)

    Al-Shahib, A.; Breitling, R.; Gilbert, D.


    Abstract: When the standard approach to predict protein function by sequence homology fails, other alternative methods can be used that require only the amino acid sequence for predicting function. One such approach uses machine learning to predict protein function directly from amino acid sequence

  19. Insights into hydrocarbon formation by nitrogenase cofactor homologs. (United States)

    Lee, Chi Chung; Hu, Yilin; Ribbe, Markus W


    The L-cluster is an all-iron homolog of nitrogenase cofactors. Driven by europium(II) diethylenetriaminepentaacetate [Eu(II)-DTPA], the isolated L-cluster is capable of ATP-independent reduction of CO and CN(-) to C1 to C4 and C1 to C6 hydrocarbons, respectively. Compared to its cofactor homologs, the L-cluster generates considerably more CH4 from the reduction of CO and CN(-), which could be explained by the presence of a "free" Fe atom that is "unmasked" by homocitrate as an additional site for methanation. Moreover, the elevated CH4 formation is accompanied by a decrease in the amount of longer hydrocarbons and/or the lengths of the hydrocarbon products, illustrating a competition between CH4 formation/release and C-C coupling/chain extension. These observations suggest the possibility of designing simpler synthetic clusters for hydrocarbon formation while establishing the L-cluster as a platform for mechanistic investigations of CO and CN(-) reduction without complications originating from the heterometal and homocitrate components. Nitrogenase is a metalloenzyme that is highly complex in structure and uniquely versatile in function. It catalyzes two reactions that parallel two important industrial processes: the reduction of nitrogen to ammonia, which parallels the Haber-Bosch process in ammonia production, and the reduction of carbon monoxide to hydrocarbons, which parallels the Fischer-Tropsch process in fuel production. Thus, the significance of nitrogenase can be appreciated from the perspective of the useful products it generates: (i) ammonia, the "fixed" nitrogen that is essential for the existence of the entire human population; and (ii) hydrocarbons, the "recycled" carbon fuel that could be used to directly address the worldwide energy shortage. This article provides initial insights into the catalytic characteristics of various nitrogenase cofactors in hydrocarbon formation. The reported assay system provides a useful tool for mechanistic

  20. Homologous Basal Ganglia Network Models in Physiological and Parkinsonian Conditions

    Directory of Open Access Journals (Sweden)

    Jyotika Bahuguna


    Full Text Available The classical model of basal ganglia has been refined in recent years with discoveries of subpopulations within a nucleus and previously unknown projections. One such discovery is the presence of subpopulations of arkypallidal and prototypical neurons in external globus pallidus, which was previously considered to be a primarily homogeneous nucleus. Developing a computational model of these multiple interconnected nuclei is challenging, because the strengths of the connections are largely unknown. We therefore use a genetic algorithm to search for the unknown connectivity parameters in a firing rate model. We apply a binary cost function derived from empirical firing rate and phase relationship data for the physiological and Parkinsonian conditions. Our approach generates ensembles of over 1,000 configurations, or homologies, for each condition, with broad distributions for many of the parameter values and overlap between the two conditions. However, the resulting effective weights of connections from or to prototypical and arkypallidal neurons are consistent with the experimental data. We investigate the significance of the weight variability by manipulating the parameters individually and cumulatively, and conclude that the correlation observed between the parameters is necessary for generating the dynamics of the two conditions. We then investigate the response of the networks to a transient cortical stimulus, and demonstrate that networks classified as physiological effectively suppress activity in the internal globus pallidus, and are not susceptible to oscillations, whereas parkinsonian networks show the opposite tendency. Thus, we conclude that the rates and phase relationships observed in the globus pallidus are predictive of experimentally observed higher level dynamical features of the physiological and parkinsonian basal ganglia, and that the multiplicity of solutions generated by our method may well be indicative of a natural

  1. Efficient use of unlabeled data for protein sequence classification: a comparative study. (United States)

    Kuksa, Pavel; Huang, Pai-Hsi; Pavlovic, Vladimir


    Recent studies in computational primary protein sequence analysis have leveraged the power of unlabeled data. For example, predictive models based on string kernels trained on sequences known to belong to particular folds or superfamilies, the so-called labeled data set, can attain significantly improved accuracy if this data is supplemented with protein sequences that lack any class tags-the unlabeled data. In this study, we present a principled and biologically motivated computational framework that more effectively exploits the unlabeled data by only using the sequence regions that are more likely to be biologically relevant for better prediction accuracy. As overly-represented sequences in large uncurated databases may bias the estimation of computational models that rely on unlabeled data, we also propose a method to remove this bias and improve performance of the resulting classifiers. Combined with state-of-the-art string kernels, our proposed computational framework achieves very accurate semi-supervised protein remote fold and homology detection on three large unlabeled databases. It outperforms current state-of-the-art methods and exhibits significant reduction in running time. The unlabeled sequences used under the semi-supervised setting resemble the unpolished gemstones; when used as-is, they may carry unnecessary features and hence compromise the classification accuracy but once cut and polished, they improve the accuracy of the classifiers considerably.


    Directory of Open Access Journals (Sweden)



    Full Text Available Myostatin, also called growth differentiation factor-8 (GDF-8, is a member of the mammalian growth transforming family (TGF-beta superfamily, which is expressed specifically in developing an adult skeletal muscle. Muscular hypertrophy allele (mh allele in the double muscle breeds involved mutation within the myostatin gene. Genomic DNA was isolated from the camel hair using NucleoSpin Tissue kit. Two animals of each of the six breeds namely, Marecha, Dhatti, Larri, Kohi, Sakrai and Cambelpuri were used for sequencing. For PCR amplification of the gene, a primer pair was designed from homolog regions of already published sequences of farm animals from GenBank. Results showed that camel myostatin possessed more than 90% homology with that of cattle, sheep and pig. Camel formed separate cluster from the pig in spite of having high homology (98% and showed 94% homology with cattle and sheep as reported in literature. Sequence analysis of the PCR amplified part of exon 1 (256 bp of the camel myostatin was identical among six camel breeds.

  3. Analysis of plasmid genes by phylogenetic profiling and visualization of homology relationships using Blast2Network

    Directory of Open Access Journals (Sweden)

    Bazzicalupo Marco


    Full Text Available Abstract Background Phylogenetic methods are well-established bioinformatic tools for sequence analysis, allowing to describe the non-independencies of sequences because of their common ancestor. However, the evolutionary profiles of bacterial genes are often complicated by hidden paralogy and extensive and/or (multiple horizontal gene transfer (HGT events which make bifurcating trees often inappropriate. In this context, plasmid sequences are paradigms of network-like relationships characterizing the evolution of prokaryotes. Actually, they can be transferred among different organisms allowing the dissemination of novel functions, thus playing a pivotal role in prokaryotic evolution. However, the study of their evolutionary dynamics is complicated by the absence of universally shared genes, a prerequisite for phylogenetic analyses. Results To overcome such limitations we developed a bioinformatic package, named Blast2Network (B2N, allowing the automatic phylogenetic profiling and the visualization of homology relationships in a large number of plasmid sequences. The software was applied to the study of 47 completely sequenced plasmids coming from Escherichia, Salmonella and Shigella spps. Conclusion The tools implemented by B2N allow to describe and visualize in a new way some of the evolutionary features of plasmid molecules of Enterobacteriaceae; in particular it helped to shed some light on the complex history of Escherichia, Salmonella and Shigella plasmids and to focus on possible roles of unannotated proteins. The proposed methodology is general enough to be used for comparative genomic analyses of bacteria.

  4. Homologous radioimmunoassay for human epidermal growth factor (urogastrone)

    International Nuclear Information System (INIS)

    Dailey, G.E.; Kraus, J.W.; Orth, D.N.


    Epidermal growth factor (EGF), a polypeptide hormone originally discovered in the mouse submaxillary gland, stimulates growth in a variety of tissues in several species. This hormone has recently been identified in human urine. A homologous RIA for human EGF (RIA-hEGF) has been developed. In general, levels were similar to those recently reported using a heterologous RIA system. Twenty-four-hour urinary excretion of RIA-hEGF by normal adult males and females was 63.0 +- 3.0 and 52.0 +- 3.5 (mean +- SE) μg/total vol, or 29.7 +- 1.1 and 39.8 +- 1.7 μg/g creatinine, respectively. Excretion by females taking oral contraceptives was significantly greater (60.1 +- 2.7 μg/g creatinine; P 0.05). Several of those with very low values had histories of alcohol abuse. Excretion by patients with Cushing's syndrome was normal. Patients with psoriasis or recovering from major burns excreted both abnormally high and abnormally low levels of RIA-hEGF, with no obvious correlation to their clinical condition. There was no apparent diurnal or postprandial variation in urinary RIA-hEGF excretion by normal subjects. An excellent linear correlation was observed between RIA-hEGF and creatinine concentrations in each urine sample for each subject, suggesting that RIA-hEGF concentration in a random urine sample provides a valid index of 24-h RIA-hEGF excretion

  5. Beauty is in the eye of the beholder: proteins can recognize binding sites of homologous proteins in more than one way.

    Directory of Open Access Journals (Sweden)

    Juliette Martin


    Full Text Available Understanding the mechanisms of protein-protein interaction is a fundamental problem with many practical applications. The fact that different proteins can bind similar partners suggests that convergently evolved binding interfaces are reused in different complexes. A set of protein complexes composed of non-homologous domains interacting with homologous partners at equivalent binding sites was collected in 2006, offering an opportunity to investigate this point. We considered 433 pairs of protein-protein complexes from the ABAC database (AB and AC binary protein complexes sharing a homologous partner A and analyzed the extent of physico-chemical similarity at the atomic and residue level at the protein-protein interface. Homologous partners of the complexes were superimposed using Multiprot, and similar atoms at the interface were quantified using a five class grouping scheme and a distance cut-off. We found that the number of interfacial atoms with similar properties is systematically lower in the non-homologous proteins than in the homologous ones. We assessed the significance of the similarity by bootstrapping the atomic properties at the interfaces. We found that the similarity of binding sites is very significant between homologous proteins, as expected, but generally insignificant between the non-homologous proteins that bind to homologous partners. Furthermore, evolutionarily conserved residues are not colocalized within the binding sites of non-homologous proteins. We could only identify a limited number of cases of structural mimicry at the interface, suggesting that this property is less generic than previously thought. Our results support the hypothesis that different proteins can interact with similar partners using alternate strategies, but do not support convergent evolution.

  6. Sequence and transcription analysis of the human cytomegalovirus DNA polymerase gene

    International Nuclear Information System (INIS)

    Kouzarides, T.; Bankier, A.T.; Satchwell, S.C.; Weston, K.; Tomlinson, P.; Barrell, B.G.


    DNA sequence analysis has revealed that the gene coding for the human cytomegalovirus (HCMV) DNA polymerase is present within the long unique region of the virus genome. Identification is based on extensive amino acid homology between the predicted HCMV open reading frame HFLF2 and the DNA polymerase of herpes simplex virus type 1. The authors present here a 5280 base-pair DNA sequence containing the HCMV pol gene, along with the analysis of transcripts encoded within this region. Since HCMV pol also shows homology to the predicted Epstein-Barr virus pol, they were able to analyze the extent of homology between the DNA polymerases of three distantly related herpes viruses, HCMV, Epstein-Barr virus, and herpes simplex virus. The comparison shows that these DNA polymerases exhibit considerable amino acid homology and highlights a number of highly conserved regions; two such regions show homology to sequences within the adenovirus type 2 DNA polymerase. The HCMV pol gene is flanked by open reading frames with homology to those of other herpes viruses; upstream, there is a reading frame homologous to the glycoprotein B gene of herpes simplex virus type I and Epstein-Barr virus, and downstream there is a reading frame homologous to BFLF2 of Epstein-Barr virus

  7. Molecular cloning, nucleotide sequence, and expression of the gene encoding human eosinophil differentiation factor (interleukin 5)

    International Nuclear Information System (INIS)

    Campbell, H.D.; Tucker, W.Q.J.; Hort, Y.; Martinson, M.E.; Mayo, G.; Clutterbuck, E.J.; Sanderson, C.J.; Young, I.G.


    The human eosinophil differentiation factor (EDF) gene was cloned from a genomic library in λ phage EMBL3A by using a murine EDF cDNA clone as a probe. The DNA sequence of a 3.2-kilobase BamHI fragment spanning the gene was determined. The gene contains three introns. The predicted amino acid sequence of 134 amino acids is identical with that recently reported for human interleukin 5 but shows no significant homology with other known hemopoietic growth regulators. The amino acid sequence shows strong homology (∼ 70% identity) with that of murine EDF. Recombinant human EDF, expressed from the human EDF gene after transfection into monkey COS cells, stimulated the production of eosinophils and eosinophil colonies from normal human bone marrow but had no effect on the production of neutrophils or mononuclear cells (monocytes and lymphoid cells). The apparent specificity of human EDF for the eosinophil lineage in myeloid hemopoiesis contrasts with the properties of human interleukin 3 and granulocyte/macrophage and granulocyte colony-stimulating factors but is directly analogous to the biological properties of murine EDF. Human EDF therefore represents a distinct hemopoietic growth factor that could play a central role in the regulation of eosinophilia

  8. Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity. (United States)

    Mulligan, M E; Hawley, D K; Entriken, R; McClure, W R


    We describe a simple algorithm for computing a homology score for Escherichia coli promoters based on DNA sequence alone. The homology score was related to 31 values, measured in vitro, of RNA polymerase selectivity, which we define as the product KBk2, the apparent second order rate constant for open complex formation. We found that promoter strength could be predicted to within a factor of +/-4.1 in KBk2 over a range of 10(4) in the same parameter. The quantitative evaluation was linked to an automated (Apple II) procedure for searching and evaluating possible promoters in DNA sequence files.

  9. Specific distribution of the Saccharomyces cerevisiae linker histone homolog HHO1p in the chromatin


    Freidkin, Ilya; Katcoff, Don J.


    In virtually all eukaryotic organisms, linker DNA between nucleosomes is associated with a histone termed linker histone or histone H1. In Saccharomyces cerevisiae, HHO1 encodes a putative linker histone with very significant homology to histone H1. The encoded protein is expressed in the nucleus, but has not been shown to affect global chromatin structure, nor has its deletion shown any detectable phenotype. In vitro chromatin assembly experiments with recombinant HHO1p have shown that it is...

  10. Yeast Fex1p Is a Constitutively Expressed Fluoride Channel with Functional Asymmetry of Its Two Homologous Domains* (United States)

    Smith, Kathryn D.; Gordon, Patricia B.; Rivetta, Alberto; Allen, Kenneth E.; Berbasova, Tetyana; Slayman, Clifford; Strobel, Scott A.


    Fluoride is a ubiquitous environmental toxin with which all biological species must cope. A recently discovered family of fluoride export (FEX) proteins protects organisms from fluoride toxicity by removing it from the cell. We show here that FEX proteins in Saccharomyces cerevisiae function as ion channels that are selective for fluoride over chloride and that these proteins are constitutively expressed at the yeast plasma membrane. Continuous expression is in contrast to many other toxin exporters in yeast, and this, along with the fact that two nearly duplicate proteins are encoded in the yeast genome, suggests that the threat posed by fluoride ions is frequent and detrimental. Structurally, eukaryotic FEX proteins consist of two homologous four-transmembrane helix domains folded into an antiparallel dimer, where the orientation of the two domains is fixed by a single transmembrane linker helix. Using phylogenetic sequence conservation as a guide, we have identified several functionally important residues. There is substantial functional asymmetry in the effect of mutation at corresponding sites in the two domains. Specifically, mutations to residues in the C-terminal domain proved significantly more detrimental to function than did similar mutations in the N-terminal domain. Our data suggest particular residues that may be important to anion specificity, most notably the necessity of a positive charge near the end of TMH1 in the C-terminal domain. It is possible that a cationic charge at this location may create an electrostatic well for fluoride ions entering the channel from the cytoplasm. PMID:26055717

  11. A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities


    Maréchal Eric; Ortet Philippe; Roy Sylvaine; Bastien Olivier


    Abstract Background Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic recon...

  12. How to Choose the Suitable Template for Homology Modelling of GPCRs: 5-HT7 Receptor as a Test Case. (United States)

    Shahaf, Nir; Pappalardo, Matteo; Basile, Livia; Guccione, Salvatore; Rayan, Anwar


    G protein-coupled receptors (GPCRs) are a super-family of membrane proteins that attract great pharmaceutical interest due to their involvement in almost every physiological activity, including extracellular stimuli, neurotransmission, and hormone regulation. Currently, structural information on many GPCRs is mainly obtained by the techniques of computer modelling in general and by homology modelling in particular. Based on a quantitative analysis of eighteen antagonist-bound, resolved structures of rhodopsin family "A" receptors - also used as templates to build 153 homology models - it was concluded that a higher sequence identity between two receptors does not guarantee a lower RMSD between their structures, especially when their pair-wise sequence identity (within trans-membrane domain and/or in binding pocket) lies between 25 % and 40 %. This study suggests that we should consider all template receptors having a sequence identity ≤50 % with the query receptor. In fact, most of the GPCRs, compared to the currently available resolved structures of GPCRs, fall within this range and lack a correlation between structure and sequence. When testing suitability for structure-based drug design, it was found that choosing as a template the most similar resolved protein, based on sequence resemblance only, led to unsound results in many cases. Molecular docking analyses were carried out, and enrichment factors as well as attrition rates were utilized as criteria for assessing suitability for structure-based drug design. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. The concept of homology as a basis for evaluating developmental mechanisms: exploring selective attention across the life-span. (United States)

    Lickliter, Robert; Bahrick, Lorraine E


    Research with human infants as well as non-human animal embryos and infants has consistently demonstrated the benefits of intersensory redundancy for perceptual learning and memory for redundantly specified information during early development. Studies of infant affect discrimination, face discrimination, numerical discrimination, sequence detection, abstract rule learning, and word comprehension and segmentation have all shown that intersensory redundancy promotes earlier detection of these properties when compared to unimodal exposure to the same properties. Here we explore the idea that such intersensory facilitation is evident across the life-span and that this continuity is an example of a developmental behavioral homology. We present evidence that intersensory facilitation is most apparent during early phases of learning for a variety of tasks, regardless of developmental level, including domains that are novel or tasks that require discrimination of fine detail or speeded responses. Under these conditions, infants, children, and adults all show intersensory facilitation, suggesting a developmental homology. We discuss the challenge and propose strategies for establishing appropriate guidelines for identifying developmental behavioral homologies. We conclude that evaluating the extent to which continuities observed across development are homologous can contribute to a better understanding of the processes of development. Copyright © 2012 Wiley Periodicals, Inc.

  14. Stringent homology-based prediction of H. sapiens-M. tuberculosis H37Rv protein-protein interactions. (United States)

    Zhou, Hufeng; Gao, Shangzhi; Nguyen, Nam Ninh; Fan, Mengyuan; Jin, Jingjing; Liu, Bing; Zhao, Liang; Xiong, Geng; Tan, Min; Li, Shijun; Wong, Limsoon


    H. sapiens-M. tuberculosis H37Rv protein-protein interaction (PPI) data are essential for understanding the infection mechanism of the formidable pathogen M. tuberculosis H37Rv. Computational prediction is an important strategy to fill the gap in experimental H. sapiens-M. tuberculosis H37Rv PPI data. Homology-based prediction is frequently used in predicting both intra-species and inter-species PPIs. However, some limitations are not properly resolved in several published works that predict eukaryote-prokaryote inter-species PPIs using intra-species template PPIs. We develop a stringent homology-based prediction approach by taking into account (i) differences between eukaryotic and prokaryotic proteins and (ii) differences between inter-species and intra-species PPI interfaces. We compare our stringent homology-based approach to a conventional homology-based approach for predicting host-pathogen PPIs, based on cellular compartment distribution analysis, disease gene list enrichment analysis, pathway enrichment analysis and functional category enrichment analysis. These analyses support the validity of our prediction result, and clearly show that our approach has better performance in predicting H. sapiens-M. tuberculosis H37Rv PPIs. Using our stringent homology-based approach, we have predicted a set of highly plausible H. sapiens-M. tuberculosis H37Rv PPIs which might be useful for many of related studies. Based on our analysis of the H. sapiens-M. tuberculosis H37Rv PPI network predicted by our stringent homology-based approach, we have discovered several interesting properties which are reported here for the first time. We find that both host proteins and pathogen proteins involved in the host-pathogen PPIs tend to be hubs in their own intra-species PPI network. Also, both host and pathogen proteins involved in host-pathogen PPIs tend to have longer primary sequence, tend to have more domains, tend to be more hydrophilic, etc. And the protein domains from both

  15. Multiscale analysis of nonlinear systems using computational homology

    Energy Technology Data Exchange (ETDEWEB)

    Konstantin Mischaikow; Michael Schatz; William Kalies; Thomas Wanner


    This is a collaborative project between the principal investigators. However, as is to be expected, different PIs have greater focus on different aspects of the project. This report lists these major directions of research which were pursued during the funding period: (1) Computational Homology in Fluids - For the computational homology effort in thermal convection, the focus of the work during the first two years of the funding period included: (1) A clear demonstration that homology can sensitively detect the presence or absence of an important flow symmetry, (2) An investigation of homology as a probe for flow dynamics, and (3) The construction of a new convection apparatus for probing the effects of large-aspect-ratio. (2) Computational Homology in Cardiac Dynamics - We have initiated an effort to test the use of homology in characterizing data from both laboratory experiments and numerical simulations of arrhythmia in the heart. Recently, the use of high speed, high sensitivity digital imaging in conjunction with voltage sensitive fluorescent dyes has enabled researchers to visualize electrical activity on the surface of cardiac tissue, both in vitro and in vivo. (3) Magnetohydrodynamics - A new research direction is to use computational homology to analyze results of large scale simulations of 2D turbulence in the presence of magnetic fields. Such simulations are relevant to the dynamics of black hole accretion disks. The complex flow patterns from simulations exhibit strong qualitative changes as a function of magnetic field strength. Efforts to characterize the pattern changes using Fourier methods and wavelet analysis have been unsuccessful. (4) Granular Flow - two experts in the area of granular media are studying 2D model experiments of earthquake dynamics where the stress fields can be measured; these stress fields from complex patterns of 'force chains' that may be amenable to analysis using computational homology. (5) Microstructure

  16. Multiscale analysis of nonlinear systems using computational homology

    Energy Technology Data Exchange (ETDEWEB)

    Konstantin Mischaikow, Rutgers University/Georgia Institute of Technology, Michael Schatz, Georgia Institute of Technology, William Kalies, Florida Atlantic University, Thomas Wanner,George Mason University


    This is a collaborative project between the principal investigators. However, as is to be expected, different PIs have greater focus on different aspects of the project. This report lists these major directions of research which were pursued during the funding period: (1) Computational Homology in Fluids - For the computational homology effort in thermal convection, the focus of the work during the first two years of the funding period included: (1) A clear demonstration that homology can sensitively detect the presence or absence of an important flow symmetry, (2) An investigation of homology as a probe for flow dynamics, and (3) The construction of a new convection apparatus for probing the effects of large-aspect-ratio. (2) Computational Homology in Cardiac Dynamics - We have initiated an effort to test the use of homology in characterizing data from both laboratory experiments and numerical simulations of arrhythmia in the heart. Recently, the use of high speed, high sensitivity digital imaging in conjunction with voltage sensitive fluorescent dyes has enabled researchers to visualize electrical activity on the surface of cardiac tissue, both in vitro and in vivo. (3) Magnetohydrodynamics - A new research direction is to use computational homology to analyze results of large scale simulations of 2D turbulence in the presence of magnetic fields. Such simulations are relevant to the dynamics of black hole accretion disks. The complex flow patterns from simulations exhibit strong qualitative changes as a function of magnetic field strength. Efforts to characterize the pattern changes using Fourier methods and wavelet analysis have been unsuccessful. (4) Granular Flow - two experts in the area of granular media are studying 2D model experiments of earthquake dynamics where the stress fields can be measured; these stress fields from complex patterns of 'force chains' that may be amenable to analysis using computational homology. (5) Microstructure

  17. Zebrafish (Danio rerio) androgen receptor: sequence homology and up-regulation by the fungicide vinclozolin. (United States)

    Smolinsky, Amanda N; Doughman, Jennifer M; Kratzke, Liên-Thành C; Lassiter, Christopher S


    Steroid hormones regulate gene expression in organisms by binding to receptor proteins. These hormones include the androgens, which signal through androgen receptors (ARs). Endocrine disrupters (EDCs) are chemicals in the environment that adversely affect organisms by binding to nuclear receptors, including ARs. Vinclozolin, a fungicide used on fruit and vegetable crops, is a known anti-androgen, a type of EDC that blocks signals from testosterone and its derivatives. In order to better understand the effects of EDCs, further research on androgen receptors and other hormone signaling pathways is necessary. In this study, we demonstrate the evolutionary conservation between the genomic structure of the human and zebrafish ar genes and find that ar mRNA expression increases in zebrafish embryos exposed to vinclozolin, which may be evolutionarily conserved as well. At 48 and 72 h post-fertilization, vinclozolin-treated embryos express ar mRNA 8-fold higher than the control level. These findings suggest that zebrafish embryos attempt to compensate for the presence of an anti-androgen by increasing the number of androgen receptors available.

  18. Draft genome sequence of Cicer reticulatum L., the wild progenitor of chickpea provides a resource for agronomic trait improvement. (United States)

    Gupta, Sonal; Nawaz, Kashif; Parween, Sabiha; Roy, Riti; Sahu, Kamlesh; Kumar Pole, Anil; Khandal, Hitaishi; Srivastava, Rishi; Kumar Parida, Swarup; Chattopadhyay, Debasis


    Cicer reticulatum L. is the wild progenitor of the fourth most important legume crop chickpea (C. arietinum L.). We assembled short-read sequences into 416 Mb draft genome of C. reticulatum and anchored 78% (327 Mb) of this assembly to eight linkage groups. Genome annotation predicted 25,680 protein-coding genes covering more than 90% of predicted gene space. The genome assembly shared a substantial synteny and conservation of gene orders with the genome of the model legume Medicago truncatula. Resistance gene homologs of wild and domesticated chickpeas showed high sequence homology and conserved synteny. Comparison of gene sequences and nucleotide diversity using 66 wild and domesticated chickpea accessions suggested that the desi type chickpea was genetically closer to the wild species than the kabuli type. Comparative analyses predicted gene flow between the wild and the cultivated species during domestication. Molecular diversity and population genetic structure determination using 15,096 genome-wide single nucleotide polymorphisms revealed an admixed domestication pattern among cultivated (desi and kabuli) and wild chickpea accessions belonging to three population groups reflecting significant influence of parentage or geographical origin for their cultivar-specific population classification. The assembly and the polymorphic sequence resources presented here would facilitate the study of chickpea domestication and targeted use of wild Cicer germplasms for agronomic trait improvement in chickpea. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.


    Directory of Open Access Journals (Sweden)

    I. N. Zhilinskaya


    Full Text Available Objectives: To identify homologous segments of human hemostatic and viral proteins and to assess the role of human hemostatic proteins in viral replication. Materials and Methods: The following viruses were chosen for comparison: influenza B (B/Astrakhan/2/2017, coronaviruses (Hcov229E and SARS-Co, type 1 adenovirus (adenoid 71, measles (ICHINOSE-BA and rubella (Therien. The primary structures of viral proteins and 41 human hemostatic proteins were obtained from open–access www.ncbi.nlm.nih. gov and databases, respectively. Sequence homology was determined by comparing 12-amino-acid segments. Those sequences identical in ≥ 8 positions were considered homologous. Results: The analysis shows that viral proteins contain segments which mimic a number of human hemostatic proteins. Most of these segments, except those of adenovirus proteins, are homologous with coagulation factors. The increase in viral virulence, as in case of SARS-Co, correlates with an increased number of segments homologous with hemostatic proteins. Conclusion: Hemostasis plays an important role in viral replication and pathogenesis. The conclusion is consistent with the literature data about the relationship of hemostasis and inflammatory response to viral infections.

  20. RPA homologs and ssDNA processing during meiotic recombination. (United States)

    Ribeiro, Jonathan; Abby, Emilie; Livera, Gabriel; Martini, Emmanuelle


    Meiotic homologous recombination is a specialized process that involves homologous chromosome pairing and strand exchange to guarantee proper chromosome segregation and genetic diversity. The formation and repair of DNA double-strand breaks (DSBs) during meiotic recombination differs from those during mitotic recombination in that the homologous chromosome rather than the sister chromatid is the preferred repair template. The processing of single-stranded DNA (ssDNA) formed on intermediate recombination structures is central to driving the specific outcomes of DSB repair during meiosis. Replication protein A (RPA) is the main ssDNA-binding protein complex involved in DNA metabolism. However, the existence of RPA orthologs in plants and the recent discovery of meiosis specific with OB domains (MEIOB), a widely conserved meiosis-specific RPA1 paralog, strongly suggest that multiple RPA complexes evolved and specialized to subdivide their roles during DNA metabolism. Here we review ssDNA formation and maturation during mitotic and meiotic recombination underlying the meiotic specific features. We describe and discuss the existence and properties of MEIOB and multiple RPA subunits in plants and highlight how they can provide meiosis-specific fates to ssDNA processing during homologous recombination. Understanding the functions of these RPA homologs and how they interact with the canonical RPA subunits is of major interest in the fields of meiosis and DNA repair.

  1. Primary homologies of the circumorbital bones of snakes. (United States)

    Palci, Alessandro; Caldwell, Michael W


    Some snakes have two circumorbital ossifications that in the current literature are usually referred to as the postorbital and supraorbital. We review the arguments that have been proposed to justify this interpretation and provide counter-arguments that reject those conjectures of primary homology based on the observation of 32 species of lizards and 81 species of snakes (both extant and fossil). We present similarity arguments, both topological and structural, for reinterpretation of the primary homologies of the dorsal and posterior orbital ossifications of snakes. Applying the test of similarity, we conclude that the posterior orbital ossification of snakes is topologically consistent as the homolog of the lacertilian jugal, and that the dorsal orbital ossification present in some snakes (e.g., pythons, Loxocemus, and Calabaria) is the homolog of the lacertilian postfrontal. We therefore propose that the terms postorbital and supraorbital should be abandoned as reference language for the circumorbital bones of snakes, and be replaced with the terms jugal and postfrontal, respectively. The primary homology claim for the snake "postorbital" fails the test of similarity, while the term "supraorbital" is an unnecessary and inaccurate application of the concept of a neomorphic ossification, for an element that passes the test of similarity as a postfrontal. This reinterpretation of the circumorbital bones of snakes is bound to have important repercussions for future phylogenetic analyses and consequently for our understanding of the origin and evolution of snakes. Copyright © 2013 Wiley Periodicals, Inc.

  2. Overexpression of PvPin1, a Bamboo Homolog of PIN1-Type Parvulin 1, Delays Flowering Time in Transgenic Arabidopsis and Rice

    Directory of Open Access Journals (Sweden)

    Zhigang Zheng


    Full Text Available Because of the long and unpredictable flowering period in bamboo, the molecular mechanism of bamboo flowering is unclear. Recent study showed that Arabidopsis PIN1-type parvulin 1 (Pin1At is an important floral activator and regulates floral transition by facilitating the cis/trans isomerization of the phosphorylated Ser/Thr residues preceding proline motifs in suppressor of overexpression of CO 1 (SOC1 and agamous-like 24 (AGL24. Whether bamboo has a Pin1 homolog and whether it works in bamboo flowering are still unknown. In this study, we cloned PvPin1, a homolog of Pin1At, from Phyllostachys violascens (Bambusoideae. Bioinformatics analysis showed that PvPin1 is closely related to Pin1-like proteins in monocots. PvPin1 was widely expressed in all tested bamboo tissues, with the highest expression in young leaf and lowest in floral bud. Moreover, PvPin1 expression was high in leaves before bamboo flowering then declined during flower development. Overexpression of PvPin1 significantly delayed flowering time by downregulating SOC1 and AGL24 expression in Arabidopsis under greenhouse conditions and conferred a significantly late flowering phenotype by upregulating OsMADS56 in rice under field conditions. PvPin1 showed subcellular localization in both the nucleus and cytolemma. The 1500-bp sequence of the PvPin1 promoter was cloned, and cis-acting element prediction showed that ABRE and TGACG-motif elements, which responded to abscisic acid (ABA and methyl jasmonate (MeJA, respectively, were characteristic of P. violascens in comparison with Arabidopsis. On promoter activity analysis, exogenous ABA and MeJA could significantly inhibit PvPin1 expression. These findings suggested that PvPin1 may be a repressor in flowering, and its delay of flowering time could be regulated by ABA and MeJA in bamboo.

  3. Overexpression of PvPin1, a Bamboo Homolog of PIN1-Type Parvulin 1, Delays Flowering Time in Transgenic Arabidopsis and Rice. (United States)

    Zheng, Zhigang; Yang, Xiaoming; Fu, Yaping; Zhu, Longfei; Wei, Hantian; Lin, Xinchun


    Because of the long and unpredictable flowering period in bamboo, the molecular mechanism of bamboo flowering is unclear. Recent study showed that Arabidopsis PIN1-type parvulin 1 (Pin1At) is an important floral activator and regulates floral transition by facilitating the cis/trans isomerization of the phosphorylated Ser/Thr residues preceding proline motifs in suppressor of overexpression of CO 1 (SOC1) and agamous-like 24 (AGL24). Whether bamboo has a Pin1 homolog and whether it works in bamboo flowering are still unknown. In this study, we cloned PvPin1 , a homolog of Pin1At , from Phyllostachys violascens (Bambusoideae). Bioinformatics analysis showed that PvPin1 is closely related to Pin1-like proteins in monocots. PvPin1 was widely expressed in all tested bamboo tissues, with the highest expression in young leaf and lowest in floral bud. Moreover, PvPin1 expression was high in leaves before bamboo flowering then declined during flower development. Overexpression of PvPin1 significantly delayed flowering time by downregulating SOC1 and AGL24 expression in Arabidopsis under greenhouse conditions and conferred a significantly late flowering phenotype by upregulating OsMADS56 in rice under field conditions. PvPin1 showed subcellular localization in both the nucleus and cytolemma. The 1500-bp sequence of the PvPin1 promoter was cloned, and cis -acting element prediction showed that ABRE and TGACG-motif elements, which responded to abscisic acid (ABA) and methyl jasmonate (MeJA), respectively, were characteristic of P. violascens in comparison with Arabidopsis . On promoter activity analysis, exogenous ABA and MeJA could significantly inhibit PvPin1 expression. These findings suggested that PvPin1 may be a repressor in flowering, and its delay of flowering time could be regulated by ABA and MeJA in bamboo.

  4. Highly immunogenic prime–boost DNA vaccination protects chickens against challenge with homologous and heterologous H5N1 virus

    Directory of Open Access Journals (Sweden)

    Anna Stachyra


    Full Text Available Highly pathogenic avian influenza viruses (HPAIVs cause huge economic losses in the poultry industry because of high mortality rate in infected flocks and trade restrictions. Protective antibodies, directed mainly against hemagglutinin (HA, are the primary means of protection against influenza outbreaks. A recombinant DNA vaccine based on the sequence of H5 HA from the H5N1/A/swan/Poland/305-135V08/2006 strain of HPAIV was prepared. Sequence manipulation included deletion of the proteolytic cleavage site to improve protein stability, codon usage optimization to improve translation and stability of RNA in host cells, and cloning into a commercially available vector to enable expression in animal cells. Naked plasmid DNA was complexed with a liposomal carrier and the immunization followed the prime–boost strategy. The immunogenic potential of the DNA vaccine was first proved in broilers in near-to-field conditions resembling a commercial farm. Next, the protective activity of the vaccine was confirmed in SPF layer-type chickens. Experimental infections (challenge experiments indicated that 100% of vaccinated chickens were protected against H5N1 of the same clade and that 70% of them were protected against H5N1 influenza virus of a different clade. Moreover, the DNA vaccine significantly limited (or even eliminated transmission of the virus to contact control chickens. Two intramuscular doses of DNA vaccine encoding H5 HA induced a strong protective response in immunized chicken. The effective protection lasted for a minimum 8 weeks after the second dose of the vaccine and was not limited to the homologous H5N1 virus. In addition, the vaccine reduced shedding of the virus.

  5. Two amino acid residues confer different binding affinities of Abelson family kinase SRC homology 2 domains for phosphorylated cortactin. (United States)

    Gifford, Stacey M; Liu, Weizhi; Mader, Christopher C; Halo, Tiffany L; Machida, Kazuya; Boggon, Titus J; Koleske, Anthony J


    The closely related Abl family kinases, Arg and Abl, play important non-redundant roles in the regulation of cell morphogenesis and motility. Despite similar N-terminal sequences, Arg and Abl interact with different substrates and binding partners with varying affinities. This selectivity may be due to slight differences in amino acid sequence leading to differential interactions with target proteins. We report that the Arg Src homology (SH) 2 domain binds two specific phosphotyrosines on cortactin, a known Abl/Arg substrate, with over 10-fold higher affinity than the Abl SH2 domain. We show that this significant affinity difference is due to the substitution of arginine 161 and serine 187 in Abl to leucine 207 and threonine 233 in Arg, respectively. We constructed Abl SH2 domains with R161L and S187T mutations alone and in combination and find that these substitutions are sufficient to convert the low affinity Abl SH2 domain to a higher affinity "Arg-like" SH2 domain in binding to a phospho-cortactin peptide. We crystallized the Arg SH2 domain for structural comparison to existing crystal structures of the Abl SH2 domain. We show that these two residues are important determinants of Arg and Abl SH2 domain binding specificity. Finally, we expressed Arg containing an "Abl-like" low affinity mutant Arg SH2 domain (L207R/T233S) and find that this mutant, although properly localized to the cell periphery, does not support wild type levels of cell edge protrusion. Together, these observations indicate that these two amino acid positions confer different binding affinities and cellular functions on the distinct Abl family kinases. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Hepatic receptors for homologous growth hormone in the eel

    International Nuclear Information System (INIS)

    Hirano, T.


    The specific binding of 125I-labeled eel growth hormone (eGH) to liver membranes of the eel was examined. The specific binding to the 10,000g pellet was greater than that to the 600g pellet. The specific binding was linear up to about 100 mg fresh tissue, and was saturable with increasing amounts of membrane. The specific binding was pH-, temperature-, and time-dependent, with the optimum pH at 7.4, and greater specific binding was obtained at 15 and 25 degrees than at 35 degrees. Scatchard analysis of liver binding gave an association constant of 1.1 x 10(9) M-1 and a capacity of 105 fmol/mg protein. The receptor preparation was highly specific for GHs. Natural and recombinant eel GHs as well as recombinant salmon GH competed equally with 125I-eGH for the receptor sites of the 10,000g liver membrane. Ovine GH was more potent in displacing the labeled eGH than the homologous eel hormone. Tilapia GH and ovine prolactin (PRL) were needed in greater amounts (40 times) than eGH to displace the labeled eGH. Salmon and tilapia PRLs were still less potent (500 times) than eGH. There was no displacement with eel PRL. No significant change in the specific binding was seen 1 week after hypophysectomy, whereas injection of eGH into the hypophysectomized eel caused a significant reduction after 24 hr. The binding to the membrane fractions from gills, kidney, muscle, intestine, and brain was low and exclusively nonspecific, indicating the presence of specific GH receptors predominantly in the liver

  7. Foundations of Sequence-to-Sequence Modeling for Time Series


    Kuznetsov, Vitaly; Mariet, Zelda


    The availability of large amounts of time series data, paired with the performance of deep-learning algorithms on a broad class of problems, has recently led to significant interest in the use of sequence-to-sequence models for time series forecasting. We provide the first theoretical analysis of this time series forecasting framework. We include a comparison of sequence-to-sequence modeling to classical time series models, and as such our theory can serve as a quantitative guide for practiti...

  8. Increased Eps15 homology domain 1 and RAB11FIP3 expression regulate breast cancer progression via promoting epithelial growth factor receptor recycling. (United States)

    Tong, Dandan; Liang, Ya-Nan; Stepanova, A A; Liu, Yu; Li, Xiaobo; Wang, Letian; Zhang, Fengmin; Vasilyeva, N V


    Recent research indicates that the C-terminal Eps15 homology domain 1 is associated with epithelial growth factor receptor-mediated endocytosis recycling in non-small-cell lung cancer. The aim of this study was to determine the clinical significance of Eps15 homology domain 1 gene expression in relation to phosphorylation of epithelial growth factor receptor expression in patients with breast cancer. Primary breast cancer samples from 306 patients were analyzed for Eps15 homology domain 1, RAB11FIP3, and phosphorylation of epithelial growth factor receptor expression via immunohistochemistry. The clinical significance was assessed via a multivariate Cox regression analysis, Kaplan-Meier curves, and the log-rank test. Eps15 homology domain 1 and phosphorylation of epithelial growth factor receptor were upregulated in 60.46% (185/306) and 53.92% (165/306) of tumor tissues, respectively, as assessed by immunohistochemistry. The statistical correlation analysis indicated that Eps15 homology domain 1 overexpression was positively correlated with the increases in phosphorylation of epithelial growth factor receptor ( r = 0.242, p breast cancer for the overall survival in the total, chemotherapy, and human epidermal growth factor receptor 2 (-) groups. However, the use of combined expression of Eps15 homology domain 1 and phosphorylation of epithelial growth factor receptor markers is more effective for the disease-free survival in the overall population, chemotherapy, and human epidermal growth factor receptor 2 (-) groups. Moreover, the combined markers are also significant prognostic markers of breast cancer in the human epidermal growth factor receptor 2 (+), estrogen receptor (+), and estrogen receptor (-) groups. Eps15 homology domain 1 has a tumor suppressor function, and the combined marker of Eps15 homology domain 1/phosphorylation of epithelial growth factor receptor expression was identified as a better prognostic marker in breast cancer diagnosis

  9. The cohesion protein SOLO associates with SMC1 and is required for synapsis, recombination, homolog bias and cohesion and pairing of centromeres in Drosophila Meiosis. (United States)

    Yan, Rihui; McKee, Bruce D


    Cohesion between sister chromatids is mediated by cohesin and is essential for proper meiotic segregation of both sister chromatids and homologs. solo encodes a Drosophila meiosis-specific cohesion protein with no apparent sequence homology to cohesins that is required in male meiosis for centromere cohesion, proper orientation of sister centromeres and centromere enrichment of the cohesin subunit SMC1. In this study, we show that solo is involved in multiple aspects of meiosis in female Drosophila. Null mutations in solo caused the following phenotypes: 1) high frequencies of homolog and sister chromatid nondisjunction (NDJ) and sharply reduced frequencies of homolog exchange; 2) reduced transmission of a ring-X chromosome, an indicator of elevated frequencies of sister chromatid exchange (SCE); 3) premature loss of centromere pairing and cohesion during prophase I, as indicated by elevated foci counts of the centromere protein CID; 4) instability of the lateral elements (LE)s and central regions of synaptonemal complexes (SCs), as indicated by fragmented and spotty staining of the chromosome core/LE component SMC1 and the transverse filament protein C(3)G, respectively, at all stages of pachytene. SOLO and SMC1 are both enriched on centromeres throughout prophase I, co-align along the lateral elements of SCs and reciprocally co-immunoprecipitate from ovarian protein extracts. Our studies demonstrate that SOLO is closely associated with meiotic cohesin and required both for enrichment of cohesin on centromeres and stable assembly of cohesin into chromosome cores. These events underlie and are required for stable cohesion of centromeres, synapsis of homologous chromosomes, and a recombination mechanism that suppresses SCE to preferentially generate homolog crossovers (homolog bias). We propose that SOLO is a subunit of a specialized meiotic cohesin complex that mediates both centromeric and axial arm cohesion and promotes homolog bias as a component of chromosome

  10. Mapping sequences by parts

    Directory of Open Access Journals (Sweden)

    Guziolowski Carito


    Full Text Available Abstract Background: We present the N-map method, a pairwise and asymmetrical approach which allows us to compare sequences by taking into account evolutionary events that produce shuffled, reversed or repeated elements. Basically, the optimal N-map of a sequence s over a sequence t is the best way of partitioning the first sequence into N parts and placing them, possibly complementary reversed, over the second sequence in order to maximize the sum of their gapless alignment scores. Results: We introduce an algorithm computing an optimal N-map with time complexity O (|s| × |t| × N using O (|s| × |t| × N memory space. Among all the numbers of parts taken in a reasonable range, we select the value N for which the optimal N-map has the most significant score. To evaluate this significance, we study the empirical distributions of the scores of optimal N-maps and show that they can be approximated by normal distributions with a reasonable accuracy. We test the functionality of the approach over random sequences on which we apply artificial evolutionary events. Practical Application: The method is illustrated with four case studies of pairs of sequences involving non-standard evolutionary events.

  11. Application of the homology method for quantification of low-attenuation lung region in patients with and without COPD

    Directory of Open Access Journals (Sweden)

    Nishio M


    Full Text Available Mizuho Nishio,1 Kazuaki Nakane,2 Yutaka Tanaka3 1Clinical PET Center, Institute of Biomedical Research and Innovation, Hyogo, Japan; 2Department of Molecular Pathology, Osaka University Graduate School of Medicine and Health Science, Osaka, Japan; 3Department of Radiology, Chibune General Hospital, Osaka, Japan Background: Homology is a mathematical concept that can be used to quantify degree of contact. Recently, image processing with the homology method has been proposed. In this study, we used the homology method and computed tomography images to quantify emphysema.Methods: This study included 112 patients who had undergone computed tomography and pulmonary function test. Low-attenuation lung regions were evaluated by the homology method, and homology-based emphysema quantification (b0, b1, nb0, nb1, and R was performed. For comparison, the percentage of low-attenuation lung area (LAA% was also obtained. Relationships between emphysema quantification and pulmonary function test results were evaluated by Pearson’s correlation coefficients. In addition to the correlation, the patients were divided into the following three groups based on guidelines of the Global initiative for chronic Obstructive Lung Disease: Group A, nonsmokers; Group B, smokers without COPD, mild COPD, and moderate COPD; Group C, severe COPD and very severe COPD. The homology-based emphysema quantification and LAA% were compared among these groups.Results: For forced expiratory volume in 1 second/forced vital capacity, the correlation coefficients were as follows: LAA%, -0.603; b0, -0.460; b1, -0.500; nb0, -0.449; nb1, -0.524; and R, -0.574. For forced expiratory volume in 1 second, the coefficients were as follows: LAA%, -0.461; b0, -0.173; b1, -0.314; nb0, -0.191; nb1, -0.329; and R, -0.409. Between Groups A and B, difference in nb0 was significant (P-value = 0.00858, and those in the other types of quantification were not significant.Conclusion: Feasibility of the

  12. Modeling compositional dynamics based on GC and purine contents of protein-coding sequences

    KAUST Repository

    Zhang, Zhang; Yu, Jun


    Background: Understanding the compositional dynamics of genomes and their coding sequences is of great significance in gaining clues into molecular evolution and a large number of publically-available genome sequences have allowed us to quantitatively predict deviations of empirical data from their theoretical counterparts. However, the quantification of theoretical compositional variations for a wide diversity of genomes remains a major challenge.Results: To model the compositional dynamics of protein-coding sequences, we propose two simple models that take into account both mutation and selection effects, which act differently at the three codon positions, and use both GC and purine contents as compositional parameters. The two models concern the theoretical composition of nucleotides, codons, and amino acids, with no prerequisite of homologous sequences or their alignments. We evaluated the two models by quantifying theoretical compositions of a large collection of protein-coding sequences (including 46 of Archaea, 686 of Bacteria, and 826 of Eukarya), yielding consistent theoretical compositions across all the collected sequences.Conclusions: We show that the compositions of nucleotides, codons, and amino acids are largely determined by both GC and purine contents and suggest that deviations of the observed from the expected compositions may reflect compositional signatures that arise from a complex interplay between mutation and selection via DNA replication and repair mechanisms.Reviewers: This article was reviewed by Zhaolei Zhang (nominated by Mark Gerstein), Guruprasad Ananda (nominated by Kateryna Makova), and Daniel Haft. 2010 Zhang and Yu; licensee BioMed Central Ltd.

  13. Modeling compositional dynamics based on GC and purine contents of protein-coding sequences

    KAUST Repository

    Zhang, Zhang


    Background: Understanding the compositional dynamics of genomes and their coding sequences is of great significance in gaining clues into molecular evolution and a large number of publically-available genome sequences have allowed us to quantitatively predict deviations of empirical data from their theoretical counterparts. However, the quantification of theoretical compositional variations for a wide diversity of genomes remains a major challenge.Results: To model the compositional dynamics of protein-coding sequences, we propose two simple models that take into account both mutation and selection effects, which act differently at the three codon positions, and use both GC and purine contents as compositional parameters. The two models concern the theoretical composition of nucleotides, codons, and amino acids, with no prerequisite of homologous sequences or their alignments. We evaluated the two models by quantifying theoretical compositions of a large collection of protein-coding sequences (including 46 of Archaea, 686 of Bacteria, and 826 of Eukarya), yielding consistent theoretical compositions across all the collected sequences.Conclusions: We show that the compositions of nucleotides, codons, and amino acids are largely determined by both GC and purine contents and suggest that deviations of the observed from the expected compositions may reflect compositional signatures that arise from a complex interplay between mutation and selection via DNA replication and repair mechanisms.Reviewers: This article was reviewed by Zhaolei Zhang (nominated by Mark Gerstein), Guruprasad Ananda (nominated by Kateryna Makova), and Daniel Haft. 2010 Zhang and Yu; licensee BioMed Central Ltd.

  14. [Analysis of DNA-DNA homologies in obligate methylotrophic bacteria]. (United States)

    Doronina, N V; Govorukhina, N I; Lysenko, A M; Trotsenko, Iu A


    The genotypic affinity of 19 bacterial strains obligately dependent on methanol or methylamine as carbon and energy sources was studied by techniques of molecular DNA hybridization. The high homology level (35-88%) between motile strain Methylophilus methanolovorus V-1447D and nonmotile strain Methylobacillus sp. VSB-792 as well as other motile strains (Pseudomonas methanolica ATCC 21704, Methylomonas methanolica NRRL 5458, Pseudomonas sp. W6, strain A3) indicates that all of them belong to one genus. Rather high level of homology (62-63%) was found between Methylobacillus glycogenes ATCC 29475 and Pseudomonas insueta ATCC 21276 and strain G-10. The motile strain Methylophilus methylotrophus NCIB 10515 has a low homology (below 20%) to other of the studied obligate methylobacteria. Therefore, at least two genetically different genera of obligate methylobacteria can be distinguished, namely Methylophilus and Methylobacillus, the latter being represented by both motile and nonmotile forms.

  15. Induction of intrachromosomal homologous recombination in whole plants

    International Nuclear Information System (INIS)

    Puchta, H.; Swoboda, P.; Hohn, B.


    The influence of different factors on frequencies of intrachromosomal homologous recombination in whole Arabidopsis thaliana and tobacco plants was analyzed using a disrupted β-glucuronidase marker gene. Recombination frequencies were enhanced several fold by DNA damaging agents like UV-light or MMS (methyl methanesulfonate). Applying 3-methoxybenzamide (3-MB), an inhibitor of poly(ADP)ribose polymerase (PARP), an enzyme that is postulated to be involved in DNA repair, enhanced homologous recombination frequencies strongly. These findings indicate that homologous recombination is involved in DNA repair and can (at least partially) compensate for other DNA repair pathways. Indications that recombination in plants can be induced by environmental stress factors that are not likely to be involved in DNA metabolism were also found; Arabidopsis plants growing in a medium containing 0.1 M NaCl exhibited elevated recombination frequencies. The possible general effects of ‘environmental’ challenges on genome flexibility are discussed. (author)

  16. Khovanov homology for virtual knots with arbitrary coefficients

    International Nuclear Information System (INIS)

    Manturov, Vassily O


    The Khovanov homology theory over an arbitrary coefficient ring is extended to the case of virtual knots. We introduce a complex which is well-defined in the virtual case and is homotopy equivalent to the original Khovanov complex in the classical case. Unlike Khovanov's original construction, our definition of the complex does not use any additional prescription of signs to the edges of a cube. Moreover, our method enables us to construct a Khovanov homology theory for 'twisted virtual knots' in the sense of Bourgoin and Viro (including knots in three-dimensional projective space). We generalize a number of results of Khovanov homology theory (the Wehrli complex, minimality problems, Frobenius extensions) to virtual knots with non-orientable atoms

  17. Homology blocks of Plasmodium falciparum var genes and clinically distinct forms of severe malaria in a local population. (United States)

    Rorick, Mary M; Rask, Thomas S; Baskerville, Edward B; Day, Karen P; Pascual, Mercedes


    The primary target of the human immune response to the malaria parasite Plasmodium falciparum, P. falciparum erythrocyte membrane protein 1 (PfEMP1), is encoded by the members of the hyper-diverse var gene family. The parasite exhibits antigenic variation via mutually exclusive expression (switching) of the ~60 var genes within its genome. It is thought that different variants exhibit different host endothelial binding preferences that in turn result in different manifestations of disease. Var sequences comprise ancient sequence fragments, termed homology blocks (HBs), that recombine at exceedingly high rates. We use HBs to define distinct var types within a local population. We then reanalyze a dataset that contains clinical and var expression data to investigate whether the HBs allow for a description of sequence diversity corresponding to biological function, such that it improves our ability to predict disease phenotype from parasite genetics. We find that even a generic set of HBs, which are defined for a small number of non-local parasites: capture the majority of local sequence diversity; improve our ability to predict disease severity from parasite genetics; and reveal a previously hypothesized yet previously unobserved parasite genetic basis for two forms of severe disease. We find that the expression rates of some HBs correlate more strongly with severe disease phenotypes than the expression rates of classic var DBLα tag types, and principal components of HB expression rate profiles further improve genotype-phenotype models. More specifically, within the large Kenyan dataset that is the focus of this study, we observe that HB expression differs significantly for severe versus mild disease, and for rosetting versus impaired consciousness associated severe disease. The analysis of a second much smaller dataset from Mali suggests that these HB-phenotype associations are consistent across geographically distant populations, since we find evidence suggesting

  18. 'Cold shock' increases the frequency of homology directed repair gene editing in induced pluripotent stem cells. (United States)

    Guo, Q; Mintier, G; Ma-Edmonds, M; Storton, D; Wang, X; Xiao, X; Kienzle, B; Zhao, D; Feder, John N


    Using CRISPR/Cas9 delivered as a RNA modality in conjunction with a lipid specifically formulated for large RNA molecules, we demonstrate that homology directed repair (HDR) rates between 20-40% can be achieved in induced pluripotent stem cells (iPSC). Furthermore, low HDR rates (between 1-20%) can be enhanced two- to ten-fold in both iPSCs and HEK293 cells by 'cold shocking' cells at 32 °C for 24-48 hours following transfection. This method can also increases the proportion of loci that have undergone complete sequence conversion across the donor sequence, or 'perfect HDR', as opposed to partial sequence conversion where nucleotides more distal to the CRISPR cut site are less efficiently incorporated ('partial HDR'). We demonstrate that the structure of the single-stranded DNA oligo donor can influence the fidelity of HDR, with oligos symmetric with respect to the CRISPR cleavage site and complementary to the target strand being more efficient at directing 'perfect HDR' compared to asymmetric non-target strand complementary oligos. Our protocol represents an efficient method for making CRISPR-mediated, specific DNA sequence changes within the genome that will facilitate the rapid generation of genetic models of human disease in iPSCs as well as other genome engineered cell lines.

  19. The Significance of Recursion Using the TI-84 Sequence Editor (United States)

    Domenick, Anthony


    Patterns are a ubiquitous phenomenon. They exist in nature's plant species emerging as a complete order from truncated matter. Patterns are also present in the fine arts where the aesthetic properties of form exist and conjugate through paintings and sculptures. Mathematical patterns, the focus of this position paper, dominate financial scenarios,…

  20. Induction of human immunodeficiency virus (HIV-1 envelope specific cell-mediated immunity by a non-homologous synthetic peptide.

    Directory of Open Access Journals (Sweden)

    Ammar Achour


    Full Text Available Cell mediated immunity, including efficient CTL response, is required to prevent HIV-1 from cell-to-cell transmission. In previous investigations, we have shown that B1 peptide derived by Fourier transformation of HIV-1 primary structures and sharing no sequence homology with the parent proteins was able to generate antiserum which recognizes envelope and Tat proteins. Here we have investigated cellular immune response towards a novel non-homologous peptide, referred to as cA1 peptide.The 20 amino acid sequence of cA1 peptide was predicted using the notion of peptide hydropathic properties; the peptide is encoded by the complementary anti-sense DNA strand to the sense strand of previously described non-homologous A1 peptide. In this report we demonstrate that the cA1 peptide can be a target for major histocompatibility complex (MHC class I-restricted cytotoxic T lymphocytes in HIV-1-infected or envelope-immunized individuals. The cA1 peptide is recognized in association with different MHC class I allotypes and could prime in vitro CTLs, derived from gp160-immunized individuals capable to recognize virus variants.For the first time a theoretically designed immunogen involved in broad-based cell-immune memory activation is described. Our findings may thus contribute to the advance in vaccine research by describing a novel strategy to develop a synthetic AIDS vaccine.

  1. Khovanov-Rozansky Graph Homology and Composition Product

    DEFF Research Database (Denmark)

    Wagner, Emmanuel


    In analogy with a recursive formula for the HOMFLY-PT polynomial of links given by Jaeger, we give a recursive formula for the graph polynomial introduced by Kauffman and Vogel. We show how this formula extends to the Khovanov–Rozansky graph homology.......In analogy with a recursive formula for the HOMFLY-PT polynomial of links given by Jaeger, we give a recursive formula for the graph polynomial introduced by Kauffman and Vogel. We show how this formula extends to the Khovanov–Rozansky graph homology....

  2. Macdonald operators and homological invariants of the colored Hopf link

    International Nuclear Information System (INIS)

    Awata, Hidetoshi; Kanno, Hiroaki


    Using a power sum (boson) realization for the Macdonald operators, we investigate the Gukov, Iqbal, Kozcaz and Vafa (GIKV) proposal for the homological invariants of the colored Hopf link, which include Khovanov-Rozansky homology as a special case. We prove the polynomiality of the invariants obtained by GIKV's proposal for arbitrary representations. We derive a closed formula of the invariants of the colored Hopf link for antisymmetric representations. We argue that a little amendment of GIKV's proposal is required to make all the coefficients of the polynomial non-negative integers. (paper)

  3. Nrf2 facilitates repair of radiation induced DNA damage through homologous recombination repair pathway in a ROS independent manner in cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Jayakumar, Sundarraj; Pal, Debojyoti; Sandur, Santosh K., E-mail:


    Highlights: • Nrf2 inhibition in A549 cells led to attenuated DNA repair and radiosensitization. • Influence of Nrf2 on DNA repair is not linked to its antioxidant function. • Nrf2 influences DNA repair through homologous recombination (HR) repair pathway. • Many genes involved in HR pathway show ARE sequences in their upstream region. - Abstract: Nrf2 is a redox sensitive transcription factor that is involved in the co-ordinated transcription of genes involved in redox homeostasis. But the role of Nrf2 in DNA repair is not investigated in detail. We have employed A549 and MCF7 cells to study the role of Nrf2 on DNA repair by inhibiting Nrf2 using all-trans retinoic acid (ATRA) or by knock down approach prior to radiation exposure (4 Gy). DNA damage and repair analysis was studied by γH2AX foci formation and comet assay. Results suggested that the inhibition of Nrf2 in A549 or MCF7 cells led to significant slowdown in DNA repair as compared to respective radiation controls. The persistence of residual DNA damage even in the presence of free radical scavenger N-acetyl cysteine, suggested that the influence of Nrf2 on DNA repair was not linked to its antioxidant functions. Further, its influence on non-homologous end joining repair pathway was studied by inhibiting both Nrf2 and DNA-PK together. This led to synergistic reduction of survival fraction, indicating that Nrf2 may not be influencing the NHEJ pathway. To investigate the role of homologous recombination repair (HR) pathway, RAD51 foci formation was monitored. There was a significant reduction in the foci formation in cells treated with ATRA or shRNA against Nrf2 as compared to their respective radiation controls. Further, Nrf2 inhibition led to significant reduction in mRNA levels of RAD51. BLAST analysis was also performed on upstream regions of DNA repair genes to identify antioxidant response element and found that many repair genes that are involved in HR pathway may be regulated by Nrf2

  4. Homologous Recombination between Genetically Divergent Campylobacter fetus Lineages Supports Host-Associated Speciation (United States)

    Duim, Birgitta; van der Graaf-van Bloois, Linda; Wagenaar, Jaap A; Zomer, Aldert L


    Abstract Homologous recombination is a major driver of bacterial speciation. Genetic divergence and host association are important factors influencing homologous recombination. Here, we study these factors for Campylobacter fetus, which shows a distinct intraspecific host dichotomy. Campylobacter fetus subspecies fetus (Cff) and venerealis are associated with mammals, whereas C. fetus subsp. testudinum (Cft) is associated with reptiles. Recombination between these genetically divergent C. fetus lineages is extremely rare. Previously it was impossible to show whether this barrier to recombination was determined by the differential host preferences, by the genetic divergence between both lineages or by other factors influencing recombination, such as restriction-modification, CRISPR/Cas, and transformation systems. Fortuitously, a distinct C. fetus lineage (ST69) was found, which was highly related to mammal-associated C. fetus, yet isolated from a chelonian. The whole genome sequences of two C. fetus ST69 isolates were compared with those of mammal- and reptile-associated C. fetus strains for phylogenetic and recombination analysis. In total, 5.1–5.5% of the core genome of both ST69 isolates showed signs of recombination. Of the predicted recombination regions, 80.4% were most closely related to Cft, 14.3% to Cff, and 5.6% to C. iguaniorum. Recombination from C. fetus ST69 to Cft was also detected, but to a lesser extent and only in chelonian-associated Cft strains. This study shows that despite substantial genetic divergence no absolute barrier to homologous recombination exists between two distinct C. fetus lineages when occurring in the same host type, which provides valuable insights in bacterial speciation and evolution. PMID:29608720

  5. Original Mycobacterial Sin, a consequence of highly homologous antigens? (United States)

    Jenkins, A O; Michel, A; Rutten, V


    The role of antigens shared between Mycobacteria in in-vivo cross-reactive immune responses in host animals, have been reported to be responsible for reduced BCG vaccination efficacy as well reduced specificity of routine immunological diagnostic tests. This presents with significant disease control challenges in humans and animals. The present review highlights the results of previous studies on the effect of pre-sensitization to environmental mycobacteria on either pathogenic mycobacteria and/or M. bovis BCG, in experimental animals. It also takes an in-depth view into assessing the genetic similarities and relationships between atypical mycobacteria and Mycobacterium tuberculosis complex (MTBC) and how they might explain the immunological imprint of environmental mycobacteria in directing the hosts' immune response upon subsequent exposure to other classes of mycobacteria. The outcome of this review suggests that genetic closeness between particular atypical mycobacteria and MTBC usually indicate a higher level of homology for certain shared protective antigens. This ultimately results in a higher level of cross reactive immune responses as compared with other atypical mycobacteria that are further away genetically. This would explain the different effects of environmental mycobacteria on MTBC that have been reported in the different studies. In other words the direction of the host immune system in response to exposure to MTBC would depend on the type of environmental mycobacteria that was encountered in the initial exposure. We also explain these mycobacterial interactions in the context of the phenomenon of "Original Mycobacterial Sin". The effects of these inevitable mycobacterial interactions on field diagnosis and control by vaccination and how to circumvent them are discussed. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  6. A computational approach to discovering the functions of bacterial phytochromes by analysis of homolog distributions

    Directory of Open Access Journals (Sweden)

    Lamparter Tilman


    Full Text Available Abstract Background Phytochromes are photoreceptors, discovered in plants, that control a wide variety of developmental processes. They have also been found in bacteria and fungi, but for many species their biological role remains obscure. This work concentrates on the phytochrome system of Agrobacterium tumefaciens, a non-photosynthetic soil bacterium with two phytochromes. To identify proteins that might share common functions with phytochromes, a co-distribution analysis was performed on the basis of protein sequences from 138 bacteria. Results A database of protein sequences from 138 bacteria was generated. Each sequence was BLASTed against the entire database. The homolog distribution of each query protein was then compared with the homolog distribution of every other protein (target protein of the same species, and the target proteins were sorted according to their probability of co-distribution under random conditions. As query proteins, phytochromes from Agrobacterium tumefaciens, Pseudomonas aeruginosa, Deinococcus radiodurans and Synechocystis PCC 6803 were chosen along with several phytochrome-related proteins from A. tumefaciens. The Synechocystis photosynthesis protein D1 was selected as a control. In the D1 analyses, the ratio between photosynthesis-related proteins and those not related to photosynthesis among the top 150 in the co-distribution tables was > 3:1, showing that the method is appropriate for finding partner proteins with common functions. The co-distribution of phytochromes with other histidine kinases was remarkably high, although most co-distributed histidine kinases were not direct BLAST homologs of the query protein. This finding implies that phytochromes and other histidine kinases share common functions as parts of signalling networks. All phytochromes tested, with one exception, also revealed a remarkably high co-distribution with glutamate synthase and methionine synthase. This result implies a general role of

  7. Silencing the lettuce homologs of small rubber particle protein does not influence natural rubber biosynthesis in lettuce (Lactuca sativa). (United States)

    Chakrabarty, Romit; Qu, Yang; Ro, Dae-Kyun


    Natural rubber, cis-1,4-polyisoprene, is an important raw material in chemical industries, but its biosynthetic mechanism remains elusive. Natural rubber is known to be synthesized in rubber particles suspended in laticifer cells in the Brazilian rubber tree (Hevea brasiliensis). In the rubber tree, rubber elongation factor (REF) and its homolog, small rubber particle protein (SRPP), were found to be the most abundant proteins in rubber particles, and they have been implicated in natural rubber biosynthesis. As lettuce (Lactuca sativa) can synthesize natural rubber, we utilized this annual, transformable plant to examine in planta roles of the lettuce REF/SRPP homologs by RNA interference. Among eight lettuce REF/SRPP homologs identified, transcripts of two genes (LsSRPP4 and LsSRPP8) accounted for more than 90% of total transcripts of REF/SRPP homologs in lettuce latex. LsSRPP4 displays a typical primary protein sequence as other REF/SRPP, while LsSRPP8 is twice as long as LsSRPP4. These two major LsSRPP transcripts were individually and simultaneously silenced by RNA interference, and relative abundance, polymer molecular weight, and polydispersity of natural rubber were analyzed from the LsSRPP4- and LsSRPP8-silenced transgenic lettuce. Despite previous data suggesting the implications of REF/SRPP in natural rubber biosynthesis, qualitative and quantitative alterations of natural rubber could not be observed in transgenic lettuce lines. It is concluded that lettuce REF/SRPP homologs are not critically important proteins in natural rubber biosynthesis in lettuce. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. Identification of a transformer homolog in the acorn worm, Saccoglossus kowalevskii, and analysis of its activity in insect cells. (United States)

    Suzuki, Masataka G; Tochigi, Mayuko; Sakaguchi, Honami; Aoki, Fugaku; Miyamoto, Norio


    The transformer (tra) gene is an intermediate component of the sex determination hierarchy in many insect species. The homolog of tra is also found in two branchiopod crustacean species but is not known outside arthropods. We have isolated a tra homolog in the acorn worm, Saccoglossus kowalevskii, which is a hemichordate belonging to the deuterostome superphylum. The full-length complementary DNA (cDNA) of the S. kowalevskii tra homolog (Sktra) has a 3786-bp open reading frame that encodes a 1261-amino acid sequence including a TRA-CAM domain and an arginine/serine (RS)-rich domain, both of which are characteristic of TRA orthologs. Reverse transcription PCR (RT-PCR) analyses demonstrated that Sktra showed no differences in expression patterns between testes and ovaries, but its expression level was approximately 7.5-fold higher in the testes than in the ovaries. TRA, together with the protein product of the transformer-2 (tra-2) gene, assembles on doublesex (dsx) pre-messenger RNA (mRNA) via the cis-regulatory element, enhancing female-specific splicing of dsx in Drosophila. To understand functional conservation of the SkTRA protein as a dsx-splicing activator, we investigated whether SkTRA is capable of inducing female-specific splicing of the Drosophila dsx. Ectopic expression of Sktra cDNA in insect cultured cells did not induce the female-specific splicing of dsx. On the other hand, forced expression of Sktra-2 (a tra-2 homolog of S. kowalevskii) was able to induce the female-specific dsx splicing. These results demonstrate that the function as a dsx-splicing activator is not conserved in SkTRA even though SkTRA-2 is capable of functionally replacing the Drosophila TRA-2. We have also found a tra homolog in an echinoderm genome. This study provides the first evidence that that tra is conserved not only in arthropods but also in basal species of deuterostoms.

  9. Genome sequence of Ensifer adhaerens OV14 provides insights into its ability as a novel vector for the genetic transformation of plant genomes. (United States)

    Rudder, Steven; Doohan, Fiona; Creevey, Christopher J; Wendt, Toni; Mullins, Ewen


    Recently it has been shown that Ensifer adhaerens can be used as a plant transformation technology, transferring genes into several plant genomes when equipped with a Ti plasmid. For this study, we have sequenced the genome of Ensifer adhaerens OV14 (OV14) and compared it with those of Agrobacterium tumefaciens C58 (C58) and Sinorhizobium meliloti 1021 (1021); the latter of which has also demonstrated a capacity to genetically transform crop genomes, albeit at significantly reduced frequencies. The 7.7 Mb OV14 genome comprises two chromosomes and two plasmids. All protein coding regions in the OV14 genome were functionally grouped based on an eggNOG database. No genes homologous to the A. tumefaciens Ti plasmid vir genes appeared to be present in the OV14 genome. Unexpectedly, OV14 and 1021 were found to possess homologs to chromosomal based genes cited as essential to A. tumefaciens T-DNA transfer. Of significance, genes that are non-essential but exert a positive influence on virulence and the ability to genetically transform host genomes were identified in OV14 but were absent from the 1021 genome. This study reveals the presence of homologs to chromosomally based Agrobacterium genes that support T-DNA transfer within the genome of OV14 and other alphaproteobacteria. The sequencing and analysis of the OV14 genome increases our understanding of T-DNA transfer by non-Agrobacterium species and creates a platform for the continued improvement of Ensifer-mediated transformation (EMT).

  10. Rotation in moderate-mass pre-main-sequence radiative track G stars

    International Nuclear Information System (INIS)

    Mcnamara, B.


    Recent studies suggest that the observed high-mass radiative track velocity histograms for pre-main-sequence stars differ significantly. In the Vogel and Kuhi (1981) study, these stars were found to possess a rather broad distribution of rotational velocities with a moderate peak at low velocities. In contrast, Smith et al. (1983), found a very sharply peaked distribution located at low values of v sin i. The difference in these velocity distributions is shown to be due to inadequate allowance for field stars in the Smith, et al., work. Once these stars are removed, the high-mass velocity distributions of the two regions are remarkably similar. This result suggests that a unique velocity distribution might be used in modeling very young stars. Assuming that the Orion Ic proto-F stars continue to contract in a homologous fashion, their average current rotational velocity is in agreement with that expected for zero-age main sequence F stars. 27 refs

  11. The rate of nonallelic homologous recombination in males is highly variable, correlated between monozygotic twins and independent of age.

    Directory of Open Access Journals (Sweden)

    Jacqueline A L MacArthur


    Full Text Available Nonallelic homologous recombination (NAHR between highly similar duplicated sequences generates chromosomal deletions, duplications and inversions, which can cause diverse genetic disorders. Little is known about interindividual variation in NAHR rates and the factors that influence this. We estimated the rate of deletion at the CMT1A-REP NAHR hotspot in sperm DNA from 34 male donors, including 16 monozygotic (MZ co-twins (8 twin pairs aged 24 to 67 years old. The average NAHR rate was 3.5 × 10(-5 with a seven-fold variation across individuals. Despite good statistical power to detect even a subtle correlation, we observed no relationship between age of unrelated individuals and the rate of NAHR in their sperm, likely reflecting the meiotic-specific origin of these events. We then estimated the heritability of deletion rate by calculating the intraclass correlation (ICC within MZ co-twins, revealing a significant correlation between MZ co-twins (ICC = 0.784, p = 0.0039, with MZ co-twins being significantly more correlated than unrelated pairs. We showed that this heritability cannot be explained by variation in PRDM9, a known regulator of NAHR, or variation within the NAHR hotspot itself. We also did not detect any correlation between Body Mass Index (BMI, smoking status or alcohol intake and rate of NAHR. Our results suggest that other, as yet unidentified, genetic or environmental factors play a significant role in the regulation of NAHR and are responsible for the extensive variation in the population for the probability of fathering a child with a genomic disorder resulting from a pathogenic deletion.

  12. Crotacetin, a novel snake venom C-type lectin, is homolog of convulxin

    Directory of Open Access Journals (Sweden)

    G. Rádis-Baptista


    Full Text Available Snake venom (sv C-type lectins encompass a group of hemorrhagic toxins, which are able to interfere with hemostasis. They share significant similarity in their primary structures with C-type lectins of other animals, and also present a conserved carbohydrate recognition domain (CRD. A very well studied sv C-type lectin is the heterodimeric toxin, convulxin (CVX, from the venoms of South American rattlesnakes, Crotalus durissus terrificus and C. d. cascavella. It consists of two subunits, alfa (CVXalpha , 13.9 kDa and beta (CVXbeta , 12.6 kDa, joined by inter and intra-chain disulfide bounds, and is arranged in a tetrameric alpha4beta4 conformation. Convulxin is able to activate platelet and induce their aggregation by acting via p62/GPVI collagen receptor. Several cDNA precursors, homolog of CVX subunits, were cloned by PCR homology screening. As determined by computational analysis, one of them, named crotacetin beta subunit, was predicted as a polypeptide with a tridimensional conformation very similar to other subunits of convulxin-like snake toxins. Crotacetin was purified from C. durissus venoms by gel permeation and reverse phase high performance liquid chromatography. The heterodimeric crotacetin is expressed in the venoms of several C. durissus subspecies, but it is prevalent in the venom of C. durissus cascavella. As inferred from homology modeling, crotacetin induces platelet aggregation but noticeably exhibits antimicrobial activity against Gram-positive and Gram-negative bacteria.

  13. Computational integration of homolog and pathway gene module expression reveals general stemness signatures.

    Directory of Open Access Journals (Sweden)

    Martina Koeva

    Full Text Available The stemness hypothesis states that all stem cells use common mechanisms to regulate self-renewal and multi-lineage potential. However, gene expression meta-analyses at the single gene level have failed to identify a significant number of genes selectively expressed by a broad range of stem cell types. We hypothesized that stemness may be regulated by modules of homologs. While the expression of any single gene within a module may vary from one stem cell type to the next, it is possible that the expression of the module as a whole is required so that the expression of different, yet functionally-synonymous, homologs is needed in different stem cells. Thus, we developed a computational method to test for stem cell-specific gene expression patterns from a comprehensive collection of 49 murine datasets covering 12 different stem cell types. We identified 40 individual genes and 224 stemness modules with reproducible and specific up-regulation across multiple stem cell types. The stemness modules included families regulating chromatin remodeling, DNA repair, and Wnt signaling. Strikingly, the majority of modules represent evolutionarily related homologs. Moreover, a score based on the discovered modules could accurately distinguish stem cell-like populations from other cell types in both normal and cancer tissues. This scoring system revealed that both mouse and human metastatic populations exhibit higher stemness indices than non-metastatic populations, providing further evidence for a stem cell-driven component underlying the transformation to metastatic disease.

  14. An Ambystoma mexicanum EST sequencing project: analysis of 17,352 expressed sequence tags from embryonic and regenerating blastema cDNA libraries (United States)

    Habermann, Bianca; Bebin, Anne-Gaelle; Herklotz, Stephan; Volkmer, Michael; Eckelt, Kay; Pehlke, Kerstin; Epperlein, Hans Henning; Schackert, Hans Konrad; Wiebe, Glenis; Tanaka, Elly M


    Background The ambystomatid salamander, Ambystoma mexicanum (axolotl), is an important model organism in evolutionary and regeneration research but relatively little sequence information has so far been available. This is a major limitation for molecular studies on caudate development, regeneration and evolution. To address this lack of sequence information we have generated an expressed sequence tag (EST) database for A. mexicanum. Results Two cDNA libraries, one made from stage 18-22 embryos and the other from day-6 regenerating tail blastemas, generated 17,352 sequences. From the sequenced ESTs, 6,377 contigs were assembled that probably represent 25% of the expressed genes in this organism. Sequence comparison revealed significant homology to entries in the NCBI non-redundant database. Further examination of this gene set revealed the presence of genes involved in important cell and developmental processes, including cell proliferation, cell differentiation and cell-cell communication. On the basis of these data, we have performed phylogenetic analysis of key cell-cycle regulators. Interestingly, while cell-cycle proteins such as the cyclin B family display expected evolutionary relationships, the cyclin-dependent kinase inhibitor 1 gene family shows an unusual evolutionary behavior among the amphibians. Conclusions Our analysis reveals the importance of a comprehensive sequence set from a representative of the Caudata and illustrates that the EST sequence database is a rich source of molecular, developmental and regeneration studies. To aid in data mining, the ESTs have been organized into an easily searchable database that is freely available online. PMID:15345051

  15. Topological Hochschild homology and the Bass trace conjecture

    DEFF Research Database (Denmark)

    Berrick, A. J.; Hesselholt, Lars


    We use the methods of topological Hochschild homology to shed new light on groups satisfying the Bass trace conjecture. Factorization of the Hattori–Stallings rank map through the Bökstedt–Hsiang–Madsen cyclotomic trace map leads to Linnell's restriction on such groups. As a new consequence...

  16. The homological content of the Jones representations at $q = -1$

    DEFF Research Database (Denmark)

    Egsgaard, Jens Kristian; Fuglede Jørgensen, Søren

    We generalize a discovery of Kasahara and show that the Jones representations of braid groups, when evaluated at $q = -1$, are related to the action on homology of a branched double cover of the underlying punctured disk. As an application, we prove for a large family of pseudo-Anosov mapping...

  17. Topological quantum information, virtual Jones polynomials and Khovanov homology

    International Nuclear Information System (INIS)

    Kauffman, Louis H


    In this paper, we give a quantum statistical interpretation of the bracket polynomial state sum 〈K〉, the Jones polynomial V K (t) and virtual knot theory versions of the Jones polynomial, including the arrow polynomial. We use these quantum mechanical interpretations to give new quantum algorithms for these Jones polynomials. In those cases where the Khovanov homology is defined, the Hilbert space C(K) of our model is isomorphic with the chain complex for Khovanov homology with coefficients in the complex numbers. There is a natural unitary transformation U:C(K) → C(K) such that 〈K〉 = Trace(U), where 〈K〉 denotes the evaluation of the state sum model for the corresponding polynomial. We show that for the Khovanov boundary operator ∂:C(K) → C(K), we have the relationship ∂U + U∂ = 0. Consequently, the operator U acts on the Khovanov homology, and we obtain a direct relationship between the Khovanov homology and this quantum algorithm for the Jones polynomial. (paper)

  18. Homology of the open moduli space of curves

    DEFF Research Database (Denmark)

    Madsen, Ib Henning


    This is a survey on the proof of a generalized version of the Mumford conjecture obtained in joint work with M. Weiss stating that a certain map between some classifying spaces which a priori have different natures induces an isomorphism at the level of integral homology. We also discuss our proo...

  19. On the Cogosvili functor generated by a homology

    International Nuclear Information System (INIS)

    Abd El-Satter, A. Dabbour; Mahmoud, S.


    In the present work we discuss the Cogosvili functor generated by a homology, and study the construction of the corresponding groups and their induced homomorphisms. Moreover, we investigate the properties of this functor and prove that the set of such functors are isomorphic to the Bauer homotopy theory. (author). 19 refs

  20. Multiresolution persistent homology for excessively large biomolecular datasets

    Energy Technology Data Exchange (ETDEWEB)

    Xia, Kelin; Zhao, Zhixiong [Department of Mathematics, Michigan State University, East Lansing, Michigan 48824 (United States); Wei, Guo-Wei, E-mail: [Department of Mathematics, Michigan State University, East Lansing, Michigan 48824 (United States); Department of Electrical and Computer Engineering, Michigan State University, East Lansing, Michigan 48824 (United States); Department of Biochemistry and Molecular Biology, Michigan State University, East Lansing, Michigan 48824 (United States)


    Although persistent homology has emerged as a promising tool for the topological simplification of complex data, it is computationally intractable for large datasets. We introduce multiresolution persistent homology to handle excessively large datasets. We match the resolution with the scale of interest so as to represent large scale datasets with appropriate resolution. We utilize flexibility-rigidity index to access the topological connectivity of the data set and define a rigidity density for the filtration analysis. By appropriately tuning the resolution of the rigidity density, we are able to focus the topological lens on the scale of interest. The proposed multiresolution topological analysis is validated by a hexagonal fractal image which has three distinct scales. We further demonstrate the proposed method for extracting topological fingerprints from DNA molecules. In particular, the topological persistence of a virus capsid with 273 780 atoms is successfully analyzed which would otherwise be inaccessible to the normal point cloud method and unreliable by using coarse-grained multiscale persistent homology. The proposed method has also been successfully applied to the protein domain classification, which is the first time that persistent homology is used for practical protein domain analysis, to our knowledge. The proposed multiresolution topological method has potential applications in arbitrary data sets, such as social networks, biological networks, and graphs.

  1. Human Fanconi anemia monoubiquitination pathway promotes homologous DNA repair. (United States)

    Nakanishi, Koji; Yang, Yun-Gui; Pierce, Andrew J; Taniguchi, Toshiyasu; Digweed, Martin; D'Andrea, Alan D; Wang, Zhao-Qi; Jasin, Maria


    Fanconi anemia (FA) is a recessive disorder characterized by congenital abnormalities, progressive bone-marrow failure, and cancer susceptibility. Cells from FA patients are hypersensitive to agents that produce DNA crosslinks and, after treatment with these agents, have pronounced chromosome breakage and other cytogenetic abnormalities. Eight FANC genes have been cloned, and the encoded proteins interact in a common cellular pathway. DNA-damaging agents activate the monoubiquitination of FANCD2, resulting in its targeting to nuclear foci that also contain BRCA1 and BRCA2/FANCD1, proteins involved in homology-directed DNA repair. Given the interaction of the FANC proteins with BRCA1 and BRCA2, we tested whether cells from FA patients (groups A, G, and D2) and mouse Fanca-/- cells with a targeted mutation are impaired for this repair pathway. We find that both the upstream (FANCA and FANCG) and downstream (FANCD2) FA pathway components promote homology-directed repair of chromosomal double-strand breaks (DSBs). The FANCD2 monoubiquitination site is critical for normal levels of repair, whereas the ATM phosphorylation site is not. The defect in these cells, however, is mild, differentiating them from BRCA1 and BRCA2 mutant cells. Surprisingly, we provide evidence that these proteins, like BRCA1 but unlike BRCA2, promote a second DSB repair pathway involving homology, i.e., single-strand annealing. These results suggest an early role for the FANC proteins in homologous DSB repair pathway choice.

  2. A macrophage inflammatory protein homolog encoded by guinea pig cytomegalovirus signals via CC chemokine receptor 1

    International Nuclear Information System (INIS)

    Penfold, Mark; Miao Zhenhua; Wang Yu; Haggerty, Shannon; Schleiss, Mark R.


    Cytomegaloviruses encode homologs of cellular immune effector proteins, including chemokines (CKs) and CK receptor-like G protein-coupled receptors (GPCRs). Sequence of the guinea pig cytomegalovirus (GPCMV) genome identified an open reading frame (ORF) which predicted a 101 amino acid (aa) protein with homology to the macrophage inflammatory protein (MIP) subfamily of CC (β) CKs, designated GPCMV-MIP. To assess functionality of this CK, recombinant GPCMV-MIP was expressed in HEK293 cells and assayed for its ability to bind to and functionally interact with a variety of GPCRs. Specific signaling was observed with the hCCR1 receptor, which could be blocked with hMIP -1α in competition experiments. Migration assays revealed that GPCMV-MIP was able to induce chemotaxis in hCCR1-L1.2 cells. Antisera raised against a GST-MIP fusion protein immunoprecipitated species of ∼12 and 10 kDa from GPCMV-inoculated tissue culture lysates, and convalescent antiserum from GPCMV-infected animals was immunoreactive with GST-MIP by ELISA assay. These results represent the first substantive in vitro characterization of a functional CC CK encoded by a cytomegalovirus

  3. Mutagenic Organized Recombination Process by Homologous IN vivo Grouping (MORPHING) for directed enzyme evolution. (United States)

    Gonzalez-Perez, David; Molina-Espeja, Patricia; Garcia-Ruiz, Eva; Alcalde, Miguel


    Approaches that depend on directed evolution require reliable methods to generate DNA diversity so that mutant libraries can focus on specific target regions. We took advantage of the high frequency of homologous DNA recombination in Saccharomyces cerevisiae to develop a strategy for domain mutagenesis aimed at introducing and in vivo recombining random mutations in defined segments of DNA. Mutagenic Organized Recombination Process by Homologous IN vivo Grouping (MORPHING) is a one-pot random mutagenic method for short protein regions that harnesses the in vivo recombination apparatus of yeast. Using this approach, libraries can be prepared with different mutational loads in DNA segments of less than 30 amino acids so that they can be assembled into the remaining unaltered DNA regions in vivo with high fidelity. As a proof of concept, we present two eukaryotic-ligninolytic enzyme case studies: i) the enhancement of the oxidative stability of a H2O2-sensitive versatile peroxidase by independent evolution of three distinct protein segments (Leu28-Gly57, Leu149-Ala174 and Ile199-Leu268); and ii) the heterologous functional expression of an unspecific peroxygenase by exclusive evolution of its native 43-residue signal sequence.

  4. Integrative taxonomy of ciliates: Assessment of molecular phylogenetic content and morphological homology testing. (United States)

    Vďačný, Peter


    The very diverse and comparatively complex morphology of ciliates has given rise to numerous taxonomic concepts. However, the information content of the utilized molecular markers has seldom been explored prior to phylogenetic analyses and taxonomic decisions. Likewise, robust testing of morphological homology statements and the apomorphic nature of diagnostic characters of ciliate taxa is rarely carried out. Four phylogenetic techniques that may help address these issues are reviewed. (1) Split spectrum analysis serves to determine the exact number and quality of nucleotide positions supporting individual nodes in phylogenetic trees and to discern long-branch artifacts that cause spurious phylogenies. (2) Network analysis can depict all possible evolutionary trajectories inferable from the dataset and locate and measure the conflict between them. (3) A priori likelihood mapping tests the suitability of data for reconstruction of a well resolved tree, visualizes the tree-likeness of quartets, and assesses the support of an internal branch of a given tree topology. (4) Reconstruction of ancestral morphologies can be applied for analyzing homology and apomorphy statements without circular reasoning. Since these phylogenetic tools are rarely used, their principles and interpretation are introduced and exemplified using various groups of ciliates. Finally, environmental sequencing data are discussed in this light. Copyright © 2017 The Author. Published by Elsevier GmbH.. All rights reserved.

  5. Isolation of Specific Clones from Nonarrayed BAC Libraries through Homologous Recombination

    Directory of Open Access Journals (Sweden)

    Mikhail Nefedov


    Full Text Available We have developed a new approach to screen bacterial artificial chromosome (BAC libraries by recombination selection. To test this method, we constructed an orangutan BAC library using an E. coli strain (DY380 with temperature inducible homologous recombination (HR capability. We amplified one library segment, induced HR at 42∘C to make it recombination proficient, and prepared electrocompetent cells for transformation with a kanamycin cassette to target sequences in the orangutan genome through terminal recombineering homologies. Kanamycin-resistant colonies were tested for the presence of BACs containing the targeted genes by the use of a PCR-assay to confirm the presence of the kanamycin insertion. The results indicate that this is an effective approach for screening clones. The advantage of recombination screening is that it avoids the high costs associated with the preparation, screening, and archival storage of arrayed BAC libraries. In addition, the screening can be conceivably combined with genetic engineering to create knockout and reporter constructs for functional studies.

  6. Antibodies against homologous microbial caseinolytic proteases P characterise primary biliary cirrhosis. (United States)

    Bogdanos, Dimitrios-Petrou; Baum, Harold; Sharma, Umesh C; Grasso, Alessandro; Ma, Yun; Burroughs, Andrew K; Vergani, Diego


    Antibodies to caseinolytic protease P(177-194) (ClpP(177-194)) of the proteolytic subunit of the Clp complex of Escherichia coli (E. coli) are uniquely present in primary biliary cirrhosis (PBC). Molecular mimicry between the regulatory subunit ClpX and the principal T-cell epitope of pyruvate dehydrogenase complex (PDC-E2) in PBC, has been proposed to account for this. Since ClpP is highly conserved among bacteria we investigated whether the micro-organisms triggering these antibodies may be other than E. coli. E. coli ClpP(177-194) is homologous with ClpP peptides of Yersinia enterocolitica (YEREN) and Haemophilus influenzae (HAEIN). Enzyme linked immunosorbent assay (ELISA) reactivity to these peptides was tested in 45 patients with PBC, 44 pathological and 32 healthy controls. Reactivity to at least one of the ClpP peptides was observed in 21 (47%) PBC patients, 5.8% pathological and 3.1% healthy controls (PECOLI ClpP(177-194), alone or in association with YEREN and/or HAEIN peptides, compared to three (14.2%) reactive with YEREN, two (9.5%) with YEREN/HAEIN and one (4.7%) with HAEIN peptide. Simultaneous reactivity to homologous sequences was due to cross-reactivity as confirmed by competition ELISAs. The PBC-specificity of anti-microbial ClpP reactivity is confirmed: the questions as to primary trigger(s) and relevance to PBC pathogenesis remain open.

  7. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

  8. The sequence of the Helicoverpa armigera single nucleocapsid nucleopolyhedrovirus genome

    NARCIS (Netherlands)

    Chen, X.; IJkel, W.F.J.; Tarchini, R.; Sun, X.; Sandbrink, H.; Wang, H.; Peters, S.; Zuidema, D.; Klein Lankhorst, R.; Vlak, J.M.; Hu, Z.


    The nucleotide sequence of the Helicoverpa armigera single-nucleocapsid nucleopolyhedrovirus (HaSNPV) DNA genome was determined and analysed. The circular genome encompasses 131 403 bp, has a G C content of 39.1 molnd contains five homologous regions with a unique pattern of repeats.

  9. The Coding and Effector Transfer of Movement Sequences (United States)

    Kovacs, Attila J.; Muhlbauer, Thomas; Shea, Charles H.


    Three experiments utilizing a 14-element arm movement sequence were designed to determine if reinstating the visual-spatial coordinates, which require movements to the same spatial locations utilized during acquisition, results in better effector transfer than reinstating the motor coordinates, which require the same pattern of homologous muscle…

  10. Sequence of human protamine 2 cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Domenjoud, L; Fronia, C; Uhde, F; Engel, W [Universitaet Goettingen (West Germany)


    The authors report the cloning and sequencing of a cDNA clone for human protamine 2 (hp2), isolated from a human testis cDNA library cloned in the vector {lambda}-gt11. A 66mer oligonucleotide, that corresponds to an amino acid sequence which is highly conserved between hp2 and mouse protamine 2 (mp2) served as hybridization probe. The homology between the amino acid sequence deduced from our cDNA and the published amino acid sequence for hp2 is 100%.

  11. Photovoltaic Effect of 2D Homologous Perovskites

    International Nuclear Information System (INIS)

    Jung, Mi-Hee


    Highlights: • The mixed perovskite was prepared by exposure of MAI gas on the BAPbI_4 film. • The increased dimensional perovskite shows a smaller band gap than 2D perovskite. • The mixed perovskite system shows the vertical crystal orientation. • The mixed perovskite cell exhibits the higher Jsc and FF than 2D perovskite cell. - Abstract: The controlled growth of mixed dimensional perovskite structures, (C_6H_5CH_2NH_2)(CH_3NH_3)_n_-_1Pb_nI_3_n_+_1, through the introduction of CH_3NH_3I molecule vapor into the two-dimensional perovskite C_6H_5CH_2NH_3PbI_4 structure and its application in photovoltaic devices is reported. The dimensionality of (C_6H_5CH_2NH_2)(CH_3NH_3)_n_-_1Pb_nI_3_n_+_1 is controlled using the exposure time to the CH_3NH_3I vapor on the C_6H_5CH_2NH_3PbI_4 perovskite film. As the stacking of the lead iodide lattice increases, the crystallographic planes of the inorganic perovskite compound exhibit vertical growth in order to facilitate efficient charge transport. Furthermore, the devices have a smaller band gap, which offers broader absorption and the potential to increase the photocurrent density in the solar cell. As a result, the photovoltaic device based on the (C_6H_5CH_2NH_2)(CH_3NH_3)_n_-_1Pb_nI_3_n_+_1 perovskite exhibits a power conversion efficiency of 5.43% with a short circuit current density of 14.49 mA cm"−"2, an open circuit voltage of 0.85 V, and a fill factor of 44.30 for the best power conversion efficiency under AM 1.5G solar irradiation (100 mW cm"−"2), which is significantly higher than the 0.34% of the pure two-dimensional BAPbI_4 perovskite-based solar cell.

  12. Partial nucleotide sequence analysis of 18S ribosomal RNA gene of the four genotypes of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanya, A.; Majiwa, P.A.O.; Kinyanjui, P.W.


    Specific oligonucleotide primers based on conserved nucleotide sequences of 18s ribisomal RNA (18s rRNA) gene of Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum have been designed and used in the ploymerase chain reaction (PCR) to amplify genomic DNA from four different clones each representing a different genotypic group of T. congolence. PCR products of approximately 1Kb were generated using as template DNA from each of the trypanosomes. The PCR products cross-hybridized with genomic DNA from T.brucei, T. simiae and the four genotypes of T.congolense implying significant sequence homology of 18S rRNA gene among trypanosomes. The nucleotide sequence of a segment of the PCR products were determined by direct sequencing to provide partial nucleotide sequence of the 18s rRNA gene in each T.congolense genotypic group. The sequences obtained together with those that have been published for T.brucei reveals that although most regions show inter and intra species nucleotide identity, there are several sites where deletions, insertions and base changes have occured in nucleotide sequence of of T.brucei and the four genotypes of T.congolense.(author)

  13. Repeated extragenic sequences in prokaryotic genomes: a proposal for the origin and dynamics of the RUP element in Streptococcus pneumoniae. (United States)

    Oggioni, M R; Claverys, J P


    A survey of all Streptococcus pneumoniae GenBank/EMBL DNA sequence entries and of the public domain sequence (representing more than 90% of the genome) of an S. pneumoniae type 4 strain allowed identification of 108 copies of a 107-bp-long highly repeated intergenic element called RUP (for repeat unit of pneumococcus). Several features of the element, revealed in this study, led to the proposal that RUP is an insertion sequence (IS)-derivative that could still be mobile. Among these features are: (1) a highly significant homology between the terminal inverted repeats (IRs) of RUPs and of IS630-Spn1, a new putative IS of S. pneumoniae; and (2) insertion at a TA dinucleotide, a characteristic target of several members of the IS630 family. Trans-mobilization of RUP is therefore proposed to be mediated by the transposase of IS630-Spn1. To account for the observation that RUPs are distributed among four subtypes which exhibit different degrees of sequence homogeneity, a scenario is invoked based on successive stages of RUP mobility and non-mobility, depending on whether an active transposase is present or absent. In the latter situation, an active transposase could be reintroduced into the species through natural transformation. Examination of sequences flanking RUP revealed a preferential association with ISs. It also provided evidence that RUPs promote sequence rearrangements, thereby contributing to genome flexibility. The possibility that RUP preferentially targets transforming DNA of foreign origin and subsequently favours disruption/rearrangement of exogenous sequences is discussed.

  14. Compilation and analysis of Escherichia coli promoter DNA sequences.


    Hawley, D K; McClure, W R


    The DNA sequence of 168 promoter regions (-50 to +10) for Escherichia coli RNA polymerase were compiled. The complete listing was divided into two groups depending upon whether or not the promoter had been defined by genetic (promoter mutations) or biochemical (5' end determination) criteria. A consensus promoter sequence based on homologies among 112 well-defined promoters was determined that was in substantial agreement with previous compilations. In addition, we have tabulated 98 promoter ...

  15. Phosphosite mapping of P-type plasma membrane H+-ATPase in homologous and heterologous environments

    DEFF Research Database (Denmark)

    Rudashevskaya, Elena; Ye, Juanying; Jensen, Ole Nørregaard


    Phosphorylation is an important posttranslational modification of proteins in living cells and primarily serves regulatory purposes. Several methods were employed for isolating phosphopeptides from proteolytically digested plasma membranes of Arabidopsis thaliana. After a mass spectrometric...... of the phosphosites identified in AHA2 were identical in the plant and fungal systems even though none of the target sequences in AHA2 show homology to proteins of the fungal host. These findings suggest an unexpected accessibility of the terminal regulatory domain of plasma membrane H(+)-ATPase to protein kinase...... analysis of the resulting peptides we could identify 10 different phosphorylation sites in plasma membrane H(+)-ATPases AHA1, AHA2, AHA3, and AHA4/11, five of which have not been reported before, bringing the total number of phosphosites up to 11, which is substantially higher than reported so far for any...

  16. Homologous recombination occurs in Entamoeba and is enhanced during growth stress and stage conversion.

    Directory of Open Access Journals (Sweden)

    Nishant Singh

    Full Text Available Homologous recombination (HR has not been demonstrated in the parasitic protists Entamoeba histolytica or Entamoeba invadens, as no convenient method is available to measure it. However, HR must exist to ensure genome integrity, and possible genetic exchange, especially during stage conversion from trophozoite to cyst. Here we show the up regulation of mitotic and meiotic HR genes in Entamoeba during serum starvation, and encystation. To directly demonstrate HR we use a simple PCR-based method involving inverted repeats, which gives a reliable read out, as the recombination junctions can be determined by sequencing the amplicons. Using this read out, we demonstrate enhanced HR under growth stress in E. histolytica, and during encystation in E. invadens. We also demonstrate recombination between chromosomal inverted repeats. This is the first experimental demonstration of HR in Entamoeba and will help future investigations into this process, and to explore the possibility of meiosis in Entamoeba.

  17. Zea mI, the maize homolog of the allergen-encoding Lol pI gene of rye grass. (United States)

    Broadwater, A H; Rubinstein, A L; Chay, C H; Klapper, D G; Bedinger, P A


    Sequence analysis of a pollen-specific cDNA from maize has identified a homolog (Zea mI) of the gene (Lol pI) encoding the major allergen of rye-grass pollen. The protein encoded by the partial cDNA sequence is 59.3% identical and 72.7% similar to the comparable region of the reported amino acid sequence of Lol pIA. Southern analysis indicates that this cDNA represents a member of a small multigene family in maize. Northern analysis shows expression only in pollen, not in vegetative or female floral tissues. The timing of expression is developmentally regulated, occurring at a low level prior to the first pollen mitosis and at a high level after this postmeiotic division. Western analysis detects a protein in maize pollen lysates using polyclonal antiserum and monoclonal antibodies directed against purified Lolium perenne allergen.

  18. Divergent homologs of the predicted small RNA BpCand697 in Burkholderia spp. (United States)

    Damiri, Nadzirah; Mohd-Padil, Hirzahida; Firdaus-Raih, Mohd


    The small RNA (sRNA) gene candidate, BpCand697 was previously reported to be unique to Burkholderia spp. and is encoded at 3' non-coding region of a putative AraC family transcription regulator gene. This study demonstrates the conservation of BpCand697 sequence across 32 Burkholderia spp. including B. pseudomallei, B. mallei, B. thailandensis and Burkholderia sp. by integrating both sequence homology and secondary structural analyses of BpCand697 within the dataset. The divergent sequence of BpCand697 was also used as a discriminatory power in clustering the dataset according to the potential virulence of Burkholderia spp., showing that B. thailandensis was clearly secluded from the virulent cluster of B. pseudomallei and B. mallei. Finally, the differential co-transcript expression of BpCand697 and its flanking gene, bpsl2391 was detected in Burkholderia pseudomallei D286 after grown under two different culture conditions using nutrient-rich and minimal media. It is hypothesized that the differential expression of BpCand697-bpsl2391 co-transcript between the two standard prepared media might correlate with nutrient availability in the culture media, suggesting that the physical co-localization of BpCand697 in B. pseudomallei D286 might be directly or indirectly involved with the transcript regulation of bpsl2391 under the selected in vitro culture conditions.

  19. Expressed sequence tag analysis of functional genes associated with adventitious rooting in Liriodendron hybrids. (United States)

    Zhong, Y D; Sun, X Y; Liu, E Y; Li, Y Q; Gao, Z; Yu, F X


    Liriodendron hybrids (Liriodendron chinense x L. tulipifera) are important landscaping and afforestation hardwood trees. To date, little genomic research on adventitious rooting has been reported in these hybrids, as well as in the genus Liriodendron. In the present study, we used adventitious roots to construct the first cDNA library for Liriodendron hybrids. A total of 5176 expressed sequence tags (ESTs) were generated and clustered into 2921 unigenes. Among these unigenes, 2547 had significant homology to the non-redundant protein database representing a wide variety of putative functions. Homologs of these genes regulated many aspects of adventitious rooting, including those for auxin signal transduction and root hair development. Results of quantitative real-time polymerase chain reaction showed that AUX1, IRE, and FB1 were highly expressed in adventitious roots and the expression of AUX1, ARF1, NAC1, RHD1, and IRE increased during the development of adventitious roots. Additionally, 181 simple sequence repeats were identified from 166 ESTs and more than 91.16% of these were dinucleotide and trinucleotide repeats. To the best of our knowledge, the present study reports the identification of the genes associated with adventitious rooting in the genus Liriodendron for the first time and provides a valuable resource for future genomic studies. Expression analysis of selected genes could allow us to identify regulatory genes that may be essential for adventitious rooting.

  20. Structural analysis of human complement protein H: homology with C4b binding protein, beta 2-glycoprotein I, and the Ba fragment of B2

    DEFF Research Database (Denmark)

    Kristensen, Torsten; Wetsel, R A; Tack, B F


    We report here a partial primary structure for human complement protein H. Tryptic peptides comprising 27% of the H molecule were isolated by conventional techniques and were sequenced (333 amino acid residues). Several mixed-sequence oligonucleotide probes were constructed, based on the peptide...... sequence data, and were used to screen a human liver cDNA library. The largest recombinant plasmid (pH1050), which hybridized with two probes, was further characterized. The cDNA insert of this plasmid contained coding sequence (672 bp) for 224 amino acids of H. The 3' end of this clone had...... a polyadenylated tail preceded by a polyadenylation recognition site (ATTAAA) and a 3'-untranslated region (229 bp). Four regions of internal homology, each about 60 amino acids in length, were observed in the derived protein sequence from this cDNA clone, and a further seven from the tryptic peptide sequences...

  1. Gene repair of an Usher syndrome causing mutation by zinc-finger nuclease mediated homologous recombination. (United States)

    Overlack, Nora; Goldmann, Tobias; Wolfrum, Uwe; Nagel-Wolfrum, Kerstin


    Human Usher syndrome (USH) is the most frequent cause of inherited deaf-blindness. It is clinically and genetically heterogeneous, assigned to three clinical types of which the most severe type is USH1. No effective treatment for the ophthalmic component of USH exists. Gene augmentation is an attractive strategy for hereditary retinal diseases. However, several USH genes, like USH1C, are expressed in various isoforms, hampering gene augmentation. As an alternative treatment strategy, we applied the zinc-finger nuclease (ZFN) technology for targeted gene repair of an USH1C, causing mutation by homologous recombination. We designed ZFNs customized for the p.R31X nonsense mutation in Ush1c. We evaluated ZFNs for DNA cleavage capability and analyzed ZFNs biocompatibilities by XTT assays. We demonstrated ZFNs mediated gene repair on genomic level by digestion assays and DNA sequencing, and on protein level by indirect immunofluorescence and Western blot analyses. The specifically designed ZFNs did not show cytotoxic effects in a p.R31X cell line. We demonstrated that ZFN induced cleavage of their target sequence. We showed that simultaneous application of ZFN and rescue DNA induced gene repair of the disease-causing mutation on the genomic level, resulting in recovery of protein expression. In our present study, we analyzed for the first time ZFN-activated gene repair of an USH gene. The data highlight the ability of ZFNs to induce targeted homologous recombination and mediate gene repair in USH. We provide further evidence that the ZFN technology holds great potential to recover disease-causing mutations in inherited retinal disorders.

  2. Homology Modeling and Analysis of Structure Predictions of the Bovine Rhinitis B Virus RNA Dependent RNA Polymerase (RdRp

    Directory of Open Access Journals (Sweden)

    Devendra K. Rai


    Full Text Available Bovine Rhinitis B Virus (BRBV is a picornavirus responsible for mild respiratory infection of cattle. It is probably the least characterized among the aphthoviruses. BRBV is the closest relative known to Foot and Mouth Disease virus (FMDV with a ~43% identical polyprotein sequence and as much as 67% identical sequence for the RNA dependent RNA polymerase (RdRp, which is also known as 3D polymerase (3Dpol. In the present study we carried out phylogenetic analysis, structure based sequence alignment and prediction of three-dimensional structure of BRBV 3Dpol using a combination of different computational tools. Model structures of BRBV 3Dpol were verified for their stereochemical quality and accuracy. The BRBV 3Dpol structure predicted by SWISS-MODEL exhibited highest scores in terms of stereochemical quality and accuracy, which were in the range of 2Å resolution crystal structures. The active site, nucleic acid binding site and overall structure were observed to be in agreement with the crystal structure of unliganded as well as template/primer (T/P, nucleotide tri-phosphate (NTP and pyrophosphate (PPi bound FMDV 3Dpol (PDB, 1U09 and 2E9Z. The closest proximity of BRBV and FMDV 3Dpol as compared to human rhinovirus type 16 (HRV-16 and rabbit hemorrhagic disease virus (RHDV 3Dpols is also substantiated by phylogeny analysis and root-mean square deviation (RMSD between C-α traces of the polymerase structures. The absence of positively charged α-helix at C terminal, significant differences in non-covalent interactions especially salt bridges and CH-pi interactions around T/P channel of BRBV 3Dpol compared to FMDV 3Dpol, indicate that despite a very high homology to FMDV 3Dpol, BRBV 3Dpol may adopt a different mechanism for handling its substrates and adapting to physiological requirements. Our findings will be valuable in the

  3. Complementary DNA and derived amino acid sequence of the α subunit of human complement protein C8: evidence for the existence of a separate α subunit messenger RNA

    International Nuclear Information System (INIS)

    Rao, A.G.; Howard, O.M.Z.; Ng, S.C.; Whitehead, A.S.; Colten, H.R.; Sodetz, J.M.


    The entire amino acid sequence of the α subunit (M/sub r/ 64,000) of the eight component of complement (C8) was determined by characterizing cDNA clones isolated from a human liver cDNA library. Two clones with overlapping inserts of net length 2.44 kilobases (kb) were isolated and found to contain the entire α coding region [1659 base pairs (bp)]. The 5' end consists of an untranslated region and a leader sequence of 30 amino acids. This sequence contains an apparent initiation Met, signal peptide, and propeptide which ends with an arginine-rich sequence that is characteristic of proteolytic processing sites found in the pro form of protein precursors. The 3' untranslated region contains two polyadenylation signals and a poly(A)sequence. RNA blot analysis of total cellular RNA from the human hepatoma cell line HepG2 revealed a message size of ∼2.5 kb. Features of the 5' and 3' sequences and the message size suggest that a separate mRNA codes for α and argues against the occurrence of a single-chain precursor form of the disulfide-linked α-λ subunit found in mature C8. Analysis of the derived amino acid sequence revealed several membrane surface seeking domains and a possible transmembrane domain. Analysis of the carbohydrate composition indicates 1 or 2 asparagine-linked but no O-linked oligosaccharide chains, a result consistent with predictions from the amino acid sequence. Most significantly, it exhibits a striking overall homology to human C9, with values of 24% on the basis of identity and 46% when conserved substitutions are allowed. As described in an accompanying report this homology also extends to the β subunit of C8

  4. VITAL NMR: using chemical shift derived secondary structure information for a limited set of amino acids to assess homology model accuracy

    Energy Technology Data Exchange (ETDEWEB)

    Brothers, Michael C.; Nesbitt, Anna E.; Hallock, Michael J. [University of Illinois at Urbana-Champaign, Department of Chemistry (United States); Rupasinghe, Sanjeewa G. [University of Illinois at Urbana-Champaign, Department of Cell and Developmental Biology (United States); Tang Ming [University of Illinois at Urbana-Champaign, Department of Chemistry (United States); Harris, Jason; Baudry, Jerome [University of Tennessee, Department of Biochemistry, Cellular and Molecular Biology (United States); Schuler, Mary A. [University of Illinois at Urbana-Champaign, Department of Cell and Developmental Biology (United States); Rienstra, Chad M., E-mail: [University of Illinois at Urbana-Champaign, Department of Chemistry (United States)


    Homology modeling is a powerful tool for predicting protein structures, whose success depends on obtaining a reasonable alignment between a given structural template and the protein sequence being analyzed. In order to leverage greater predictive power for proteins with few structural templates, we have developed a method to rank homology models based upon their compliance to secondary structure derived from experimental solid-state NMR (SSNMR) data. Such data is obtainable in a rapid manner by simple SSNMR experiments (e.g., {sup 13}C-{sup 13}C 2D correlation spectra). To test our homology model scoring procedure for various amino acid labeling schemes, we generated a library of 7,474 homology models for 22 protein targets culled from the TALOS+/SPARTA+ training set of protein structures. Using subsets of amino acids that are plausibly assigned by SSNMR, we discovered that pairs of the residues Val, Ile, Thr, Ala and Leu (VITAL) emulate an ideal dataset where all residues are site specifically assigned. Scoring the models with a predicted VITAL site-specific dataset and calculating secondary structure with the Chemical Shift Index resulted in a Pearson correlation coefficient (-0.75) commensurate to the control (-0.77), where secondary structure was scored site specifically for all amino acids (ALL 20) using STRIDE. This method promises to accelerate structure procurement by SSNMR for proteins with unknown folds through guiding the selection of remotely homologous protein templates and assessing model quality.

  5. VITAL NMR: Using Chemical Shift Derived Secondary Structure Information for a Limited Set of Amino Acids to Assess Homology Model Accuracy

    Energy Technology Data Exchange (ETDEWEB)

    Brothers, Michael C [University of Illinois, Urbana-Champaign; Nesbitt, Anna E [University of Illinois, Urbana-Champaign; Hallock, Michael J [University of Illinois, Urbana-Champaign; Rupasinghe, Sanjeewa [University of Illinois, Urbana-Champaign; Tang, Ming [University of Illinois, Urbana-Champaign; Harris, Jason B [ORNL; Baudry, Jerome Y [ORNL; Schuler, Mary A [University of Illinois, Urbana-Champaign; Rienstra, Chad M [University of Illinois, Urbana-Champaign


    Homology modeling is a powerful tool for predicting protein structures, whose success depends on obtaining a reasonable alignment between a given structural template and the protein sequence being analyzed. In order to leverage greater predictive power for proteins with few structural templates, we have developed a method to rank homology models based upon their compliance to secondary structure derived from experimental solid-state NMR (SSNMR) data. Such data is obtainable in a rapid manner by simple SSNMR experiments (e.g., (13)C-(13)C 2D correlation spectra). To test our homology model scoring procedure for various amino acid labeling schemes, we generated a library of 7,474 homology models for 22 protein targets culled from the TALOS+/SPARTA+ training set of protein structures. Using subsets of amino acids that are plausibly assigned by SSNMR, we discovered that pairs of the residues Val, Ile, Thr, Ala and Leu (VITAL) emulate an ideal dataset where all residues are site specifically assigned. Scoring the models with a predicted VITAL site-specific dataset and calculating secondary structure with the Chemical Shift Index resulted in a Pearson correlation coefficient (-0.75) commensurate to the control (-0.77), where secondary structure was scored site specifically for all amino acids (ALL 20) using STRIDE. This method promises to accelerate structure procurement by SSNMR for proteins with unknown folds through guiding the selection of remotely homologous protein templates and assessing model quality.

  6. Murine mammary tumor virus pol-related sequences in human DNA: characterization and sequence comparison with the complete murine mammary tumor virus pol gene

    International Nuclear Information System (INIS)

    Deen, K.C.; Sweet, R.W.


    Sequences in the human genome with homology to the murine mammary tumor virus (MMTV) pol gene were isolated from a human phage library. Ten clones with extensive pol homology were shown to define five separate loci. These loci share common sequences immediately adjacent to the pol-like segments and, in addition, contain a related repeat element which bounds this region. This organization is suggestive of a proviral structure. The authors estimate that the human genome contains 30 to 40 copies of these pol-related sequences. The pol region of one of the cloned segments (HM16) and the complete MMTV pol gene were sequenced and compared. The nucleotide homology between these pol sequences is 52% and is concentrated in the terminal regions. The MMTV pol gene contains a single long open reading frame encoding 899 amino acids and is demarcated from the partially overlapping putative gag gene by termination codons and a shift in translational reading frame. The pol sequence of HM16 is multiply terminated but does contain open reading frames which encode 370, 105, and 112 amino acids residues in separate reading frames. The authors deduced a composite pol protein sequence for HM16 by aligning it to the MMTV pol gene and then compared these sequences with other retroviral pol protein sequences. Conserved sequences occur in both the amino and carboxyl regions which lie within the polymerase and endonuclease domains of pol, respectively

  7. DSAP: deep-sequencing small RNA analysis pipeline. (United States)

    Huang, Po-Jung; Liu, Yi-Chung; Lee, Chi-Ching; Lin, Wei-Chen; Gan, Richie Ruei-Chi; Lyu, Ping-Chiang; Tang, Petrus


    DSAP is an automated multiple-task web service designed to provide a total solution to analyzing deep-sequencing small RNA datasets generated by next-generation sequencing technology. DSAP uses a tab-delimited file as an input format, which holds the unique sequence reads (tags) and their corresponding number of copies generated by the Solexa sequencing platform. The input data will go through four analysis steps in DSAP: (i) cleanup: removal of adaptors and poly-A/T/C/G/N nucleotides; (ii) clustering: grouping of cleaned sequence tags into unique sequence clusters; (iii) non-coding RNA (ncRNA) matching: sequence homology mapping against a transcribed sequence library from the ncRNA database Rfam (; and (iv) known miRNA matching: detection of known miRNAs in miRBase ( based on sequence homology. The expression levels corresponding to matched ncRNAs and miRNAs are summarized in multi-color clickable bar charts linked to external databases. DSAP is also capable of displaying miRNA expression levels from different jobs using a log(2)-scaled color matrix. Furthermore, a cross-species comparative function is also provided to show the distribution of identified miRNAs in different species as deposited in miRBase. DSAP is available at

  8. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus. (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H


    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  9. Intersection spaces, spatial homology truncation, and string theory

    CERN Document Server

    Banagl, Markus


    Intersection cohomology assigns groups which satisfy a generalized form of Poincaré duality over the rationals to a stratified singular space. The present monograph introduces a method that assigns to certain classes of stratified spaces cell complexes, called intersection spaces, whose ordinary rational homology satisfies generalized Poincaré duality. The cornerstone of the method is a process of spatial homology truncation, whose functoriality properties are analyzed in detail. The material on truncation is autonomous and may be of independent interest to homotopy theorists. The cohomology of intersection spaces is not isomorphic to intersection cohomology and possesses algebraic features such as perversity-internal cup-products and cohomology operations that are not generally available for intersection cohomology. A mirror-symmetric interpretation, as well as applications to string theory concerning massless D-branes arising in type IIB theory during a Calabi-Yau conifold transition, are discussed.

  10. A homology sound-based algorithm for speech signal interference (United States)

    Jiang, Yi-jiao; Chen, Hou-jin; Li, Ju-peng; Zhang, Zhan-song


    Aiming at secure analog speech communication, a homology sound-based algorithm for speech signal interference is proposed in this paper. We first split speech signal into phonetic fragments by a short-term energy method and establish an interference noise cache library with the phonetic fragments. Then we implement the homology sound interference by mixing the randomly selected interferential fragments and the original speech in real time. The computer simulation results indicated that the interference produced by this algorithm has advantages of real time, randomness, and high correlation with the original signal, comparing with the traditional noise interference methods such as white noise interference. After further studies, the proposed algorithm may be readily used in secure speech communication.

  11. The endless tale of non-homologous end-joining. (United States)

    Weterings, Eric; Chen, David J


    DNA double-strand breaks (DSBs) are introduced in cells by ionizing radiation and reactive oxygen species. In addition, they are commonly generated during V(D)J recombination, an essential aspect of the developing immune system. Failure to effectively repair these DSBs can result in chromosome breakage, cell death, onset of cancer, and defects in the immune system of higher vertebrates. Fortunately, all mammalian cells possess two enzymatic pathways that mediate the repair of DSBs: homologous recombination and non-homologous end-joining (NHEJ). The NHEJ process utilizes enzymes that capture both ends of the broken DNA molecule, bring them together in a synaptic DNA-protein complex, and finally repair the DNA break. In this review, all the known enzymes that play a role in the NHEJ process are discussed and a working model for the co-operation of these enzymes during DSB repair is presented.

  12. Homology and isomorphism: Bourdieu in conversation with New Institutionalism. (United States)

    Wang, Yingyao


    Bourdieusian Field Theory (BFT) provided decisive inspiration for the early conceptual formulation of New Institutionalism (NI). This paper attempts to reinvigorate the stalled intellectual dialogue between NI and BFT by comparing NI's concept of isomorphism with BFT's notion of homology. I argue that Bourdieu's understanding of domination-oriented social action, transposable habitus, and a non-linear causality, embodied in his neglected concept of homology, provides an alternative theorization of field-level convergence to New Institutionalism's central idea of institutional isomorphism. To showcase how BFT can be useful for organizational research, I postulate a habitus-informed and field-conditioned theory of transference to enrich NI's spin-off thesis of 'diffusion'. I propose that while NI can benefit from BFT's potential of bringing social structure back into organizational research, BFT can enrich its social analysis by borrowing from NI's elaboration of the symbolic system of organizations. © London School of Economics and Political Science 2016.

  13. RTEL1 maintains genomic stability by suppressing homologous recombination. (United States)

    Barber, Louise J; Youds, Jillian L; Ward, Jordan D; McIlwraith, Michael J; O'Neil, Nigel J; Petalcorin, Mark I R; Martin, Julie S; Collis, Spencer J; Cantor, Sharon B; Auclair, Melissa; Tissenbaum, Heidi; West, Stephen C; Rose, Ann M; Boulton, Simon J


    Homologous recombination (HR) is an important conserved process for DNA repair and ensures maintenance of genome integrity. Inappropriate HR causes gross chromosomal rearrangements and tumorigenesis in mammals. In yeast, the Srs2 helicase eliminates inappropriate recombination events, but the functional equivalent of Srs2 in higher eukaryotes has been elusive. Here, we identify C. elegans RTEL-1 as a functional analog of Srs2 and describe its vertebrate counterpart, RTEL1, which is required for genome stability and tumor avoidance. We find that rtel-1 mutant worms and RTEL1-depleted human cells share characteristic phenotypes with yeast srs2 mutants: lethality upon deletion of the sgs1/BLM homolog, hyperrecombination, and DNA damage sensitivity. In vitro, purified human RTEL1 antagonizes HR by promoting the disassembly of D loop recombination intermediates in a reaction dependent upon ATP hydrolysis. We propose that loss of HR control after deregulation of RTEL1 may be a critical event that drives genome instability and cancer.

  14. Identification of a Flavivirus Sequence in a Marine Arthropod.

    Directory of Open Access Journals (Sweden)

    Michael J Conway

    Full Text Available Phylogenetic analysis has yet to uncover the early origins of flaviviruses. In this study, I mined a database of expressed sequence tags in order to discover novel flavivirus sequences. Flavivirus sequences were identified in a pool of mRNA extracted from the sea spider Endeis spinosa (Pycnogonida, Pantopoda. Reconstruction of the translated sequences and BLAST analysis matched the sequence to the flavivirus NS5 gene. Additional sequences corresponding to envelope and the NS5 MTase domain were also identified. Phylogenetic analysis of homologous NS5 sequences revealed that Endeis spinosa NS5 (ESNS5 is likely related to classical insect-specific flaviviruses. It is unclear if ESNS5 represents genetic material from an active viral infection or an integrated viral genome. These data raise the possibility that classical insect-specific flaviviruses and perhaps medically relevant flaviviruses, evolved from progenitors that infected marine arthropods.

  15. The primary structure of rat liver ribosomal protein L37. Homology with yeast and bacterial ribosomal proteins. (United States)

    Lin, A; McNally, J; Wool, I G


    The covalent structure of the rat liver 60 S ribosomal subunit protein L37 was determined. Twenty-four tryptic peptides were purified and the sequence of each was established; they accounted for all 111 residues of L37. The sequence of the first 30 residues of L37, obtained previously by automated Edman degradation of the intact protein, provided the alignment of the first 9 tryptic peptides. Three peptides (CN1, CN2, and CN3) were produced by cleavage of protein L37 with cyanogen bromide. The sequence of CN1 (65 residues) was established from the sequence of secondary peptides resulting from cleavage with trypsin and chymotrypsin. The sequence of CN1 in turn served to order tryptic peptides 1 through 14. The sequence of CN2 (15 residues) was determined entirely by a micromanual procedure and allowed the alignment of tryptic peptides 14 through 18. The sequence of the NH2-terminal 28 amino acids of CN3 (31 residues) was determined; in addition the complete sequences of the secondary tryptic and chymotryptic peptides were done. The sequence of CN3 provided the order of tryptic peptides 18 through 24. Thus the sequence of the three cyanogen bromide peptides also accounted for the 111 residues of protein L37. The carboxyl-terminal amino acids were identified after carboxypeptidase A treatment. There is a disulfide bridge between half-cystinyl residues at positions 40 and 69. Rat liver ribosomal protein L37 is homologous with yeast YP55 and with Escherichia coli L34. Moreover, there is a segment of 17 residues in rat L37 that occurs, albeit with modifications, in yeast YP55 and in E. coli S4, L20, and L34.

  16. Classification of G-protein coupled receptors based on a rich generation of convolutional neural network, N-gram transformation and multiple sequence alignments. (United States)

    Li, Man; Ling, Cheng; Xu, Qi; Gao, Jingyang


    Sequence classification is crucial in predicting the function of newly discovered sequences. In recent years, the prediction of the incremental large-scale and diversity of sequences has heavily relied on the involvement of machine-learning algorithms. To improve prediction accuracy, these algorithms must confront the key challenge of extracting valuable features. In this work, we propose a feature-enhanced protein classification approach, considering the rich generation of multiple sequence alignment algorithms, N-gram probabilistic language model and the deep learning technique. The essence behind the proposed method is that if each group of sequences can be represented by one feature sequence, composed of homologous sites, there should be less loss when the sequence is rebuilt, when a more relevant sequence is added to the group. On the basis of this consideration, the prediction becomes whether a query sequence belonging to a group of sequences can be transferred to calculate the probability that the new feature sequence evolves from the original one. The proposed work focuses on the hierarchical classification of G-protein Coupled Receptors (GPCRs), which begins by extracting the feature sequences from the multiple sequence alignment results of the GPCRs sub-subfamilies. The N-gram model is then applied to construct the input vectors. Finally, these vectors are imported into a convolutional neural network to make a prediction. The experimental results elucidate that the proposed method provides significant performance improvements. The classification error rate of the proposed method is reduced by at least 4.67% (family level I) and 5.75% (family Level II), in comparison with the current state-of-the-art methods. The implementation program of the proposed work is freely available at: .

  17. Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity.


    Mulligan, M E; Hawley, D K; Entriken, R; McClure, W R


    We describe a simple algorithm for computing a homology score for Escherichia coli promoters based on DNA sequence alone. The homology score was related to 31 values, measured in vitro, of RNA polymerase selectivity, which we define as the product KBk2, the apparent second order rate constant for open complex formation. We found that promoter strength could be predicted to within a factor of +/-4.1 in KBk2 over a range of 10(4) in the same parameter. The quantitative evaluation was linked to ...

  18. Homologous Recombination in Protozoan Parasites and Recombinase Inhibitors

    Directory of Open Access Journals (Sweden)

    Andrew A. Kelso


    Full Text Available Homologous recombination (HR is a DNA double-strand break (DSB repair pathway that utilizes a homologous template to fully repair the damaged DNA. HR is critical to maintain genome stability and to ensure genetic diversity during meiosis. A specialized class of enzymes known as recombinases facilitate the exchange of genetic information between sister chromatids or homologous chromosomes with the help of numerous protein accessory factors. The majority of the HR machinery is highly conserved among eukaryotes. In many protozoan parasites, HR is an essential DSB repair pathway that allows these organisms to adapt to environmental conditions and evade host immune systems through genetic recombination. Therefore, small molecule inhibitors, capable of disrupting HR in protozoan parasites, represent potential therapeutic options. A number of small molecule inhibitors were identified that disrupt the activities of the human recombinase RAD51. Recent studies have examined the effect of two of these molecules on the Entamoeba recombinases. Here, we discuss the current understandings of HR in the protozoan parasites Trypanosoma, Leishmania, Plasmodium, and Entamoeba, and we review the small molecule inhibitors known to disrupt human RAD51 activity.

  19. Phenylbutyrate inhibits homologous recombination induced by camptothecin and methyl methanesulfonate. (United States)

    Kaiser, Gitte S; Germann, Susanne M; Westergaard, Tine; Lisby, Michael


    Homologous recombination is accompanied by extensive changes to chromatin organization at the site of DNA damage. Some of these changes are mediated through acetylation/deacetylation of histones. Here, we show that recombinational repair of DNA damage induced by the anti-cancer drug camptothecin (CPT) and the alkylating agent methyl methanesulfonate (MMS) is blocked by sodium phenylbutyrate (PBA) in the budding yeast Saccharomyces cerevisiae. In particular, PBA suppresses CPT- and MMS-induced genetic recombination as well as DNA double-strand break repair during mating-type interconversion. Treatment with PBA is accompanied by a dramatic reduction in histone H4 lysine 8 acetylation. Live cell imaging of homologous recombination proteins indicates that repair of CPT-induced DNA damage is redirected to a non-recombinogenic pathway in the presence of PBA without loss in cell viability. In contrast, the suppression of MMS-induced recombination by PBA is accompanied by a dramatic loss in cell viability. Taken together, our results demonstrate that PBA inhibits DNA damage-induced homologous recombination likely by mediating changes in chromatin acetylation. Moreover, the combination of PBA with genotoxic agents can lead to different cell fates depending on the type of DNA damage inflicted. 2011 Elsevier B.V. All rights reserved.

  20. In vivo blunt-end cloning through CRISPR/Cas9-facilitated non-homologous end-joining (United States)

    Geisinger, Jonathan M.; Turan, Sören; Hernandez, Sophia; Spector, Laura P.; Calos, Michele P.


    The CRISPR/Cas9 system facilitates precise DNA modifications by generating RNA-guided blunt-ended double-strand breaks. We demonstrate that guide RNA pairs generate deletions that are repaired with a high level of precision by non-homologous end-joining in mammalian cells. We present a method called knock-in blunt ligation for exploiting these breaks to insert exogenous PCR-generated sequences in a homology-independent manner without loss of additional nucleotides. This method is useful for making precise additions to the genome such as insertions of marker gene cassettes or functional elements, without the need for homology arms. We successfully utilized this method in human and mouse cells to insert fluorescent protein cassettes into various loci, with efficiencies up to 36% in HEK293 cells without selection. We also created versions of Cas9 fused to the FKBP12-L106P destabilization domain in an effort to improve Cas9 performance. Our in vivo blunt-end cloning method and destabilization-domain-fused Cas9 variant increase the repertoire of precision genome engineering approaches. PMID:26762978

  1. Calcium-Enhanced Twitching Motility in Xylella fastidiosa Is Linked to a Single PilY1 Homolog. (United States)

    Cruz, Luisa F; Parker, Jennifer K; Cobine, Paul A; De La Fuente, Leonardo


    The plant-pathogenic bacterium Xylella fastidiosa is restricted to the xylem vessel environment, where mineral nutrients are transported through the plant host; therefore, changes in the concentrations of these elements likely impact the growth and virulence of this bacterium. Twitching motility, dependent on type IV pili (TFP), is required for movement against the transpiration stream that results in basipetal colonization. We previously demonstrated that calcium (Ca) increases the motility of X. fastidiosa, although the mechanism was unknown. PilY1 is a TFP structural protein recently shown to bind Ca and to regulate twitching and adhesion in bacterial pathogens of humans. Sequence analysis identified three pilY1 homologs in X. fastidiosa (PD0023, PD0502, and PD1611), one of which (PD1611) contains a Ca-binding motif. Separate deletions of PD0023 and PD1611 resulted in mutants that still showed twitching motility and were not impaired in attachment or biofilm formation. However, the response of increased twitching at higher Ca concentrations was lost in the pilY1-1611 mutant. Ca does not modulate the expression of any of the X. fastidiosa PilY1 homologs, although it increases the expression of the retraction ATPase pilT during active movement. The evidence presented here suggests functional differences between the PilY1 homologs, which may provide X. fastidiosa with an adaptive advantage in environments with high Ca concentrations, such as xylem sap. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  2. Homology-integrated CRISPR-Cas (HI-CRISPR) system for one-step multigene disruption in Saccharomyces cerevisiae. (United States)

    Bao, Zehua; Xiao, Han; Liang, Jing; Zhang, Lu; Xiong, Xiong; Sun, Ning; Si, Tong; Zhao, Huimin


    One-step multiple gene disruption in the model organism Saccharomyces cerevisiae is a highly useful tool for both basic and applied research, but it remains a challenge. Here, we report a rapid, efficient, and potentially scalable strategy based on the type II Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR associated proteins (Cas) system to generate multiple gene disruptions simultaneously in S. cerevisiae. A 100 bp dsDNA mutagenizing homologous recombination donor is inserted between two direct repeats for each target gene in a CRISPR array consisting of multiple donor and guide sequence pairs. An ultrahigh copy number plasmid carrying iCas9, a variant of wild-type Cas9, trans-encoded RNA (tracrRNA), and a homology-integrated crRNA cassette is designed to greatly increase the gene disruption efficiency. As proof of concept, three genes, CAN1, ADE2, and LYP1, were simultaneously disrupted in 4 days with an efficiency ranging from 27 to 87%. Another three genes involved in an artificial hydrocortisone biosynthetic pathway, ATF2, GCY1, and YPR1, were simultaneously disrupted in 6 days with 100% efficiency. This homology-integrated CRISPR (HI-CRISPR) strategy represents a powerful tool for creating yeast strains with multiple gene knockouts.

  3. Candidate gene association mapping of Sclerotinia stalk rot resistance in sunflower (Helianthus annuus L.) uncovers the importance of COI1 homologs. (United States)

    Talukder, Zahirul I; Hulke, Brent S; Qi, Lili; Scheffler, Brian E; Pegadaraju, Venkatramana; McPhee, Kevin; Gulya, Thomas J


    Functional markers for Sclerotinia basal stalk rot resistance in sunflower were obtained using gene-level information from the model species Arabidopsis thaliana. Sclerotinia stalk rot, caused by Sclerotinia sclerotiorum, is one of the most destructive diseases of sunflower (Helianthus annuus L.) worldwide. Markers for genes controlling resistance to S. sclerotiorum will enable efficient marker-assisted selection (MAS). We sequenced eight candidate genes homologous to Arabidopsis thaliana defense genes known to be associated with Sclerotinia disease resistance in a sunflower association mapping population evaluated for Sclerotinia stalk rot resistance. The total candidate gene sequence regions covered a concatenated length of 3,791 bp per individual. A total of 187 polymorphic sites were detected for all candidate gene sequences, 149 of which were single nucleotide polymorphisms (SNPs) and 38 were insertions/deletions. Eight SNPs in the coding regions led to changes in amino acid codons. Linkage disequilibrium decay throughout the candidate gene regions declined on average to an r (2) = 0.2 for genetic intervals of 120 bp, but extended up to 350 bp with r (2) = 0.1. A general linear model with modification to account for population structure was found the best fitting model for this population and was used for association mapping. Both HaCOI1-1 and HaCOI1-2 were found to be strongly associated with Sclerotinia stalk rot resistance and explained 7.4 % of phenotypic variation in this population. These SNP markers associated with Sclerotinia stalk rot resistance can potentially be applied to the selection of favorable genotypes, which will significantly improve the efficiency of MAS during the development of stalk rot resistant cultivars.

  4. Genetic Variation of the SusC/SusD Homologs from a Polysaccharide Utilization Locus Underlies Divergent Fructan Specificities and Functional Adaptation in Bacteroides thetaiotaomicron Strains. (United States)

    Joglekar, Payal; Sonnenburg, Erica D; Higginbottom, Steven K; Earle, Kristen A; Morland, Carl; Shapiro-Ward, Sarah; Bolam, David N; Sonnenburg, Justin L


    Genomic differences between gut-resident bacterial strains likely underlie significant interindividual variation in microbiome function. Traditional methods of determining community composition, such as 16S rRNA gene amplicon sequencing, fail to capture this functional diversity. Metagenomic approaches are a significant step forward in identifying strain-level sequence variants; however, given the current paucity of biochemical information, they too are limited to mainly low-resolution and incomplete functional predictions. Using genomic, biochemical, and molecular approaches, we identified differences in the fructan utilization profiles of two closely related Bacteroides thetaiotaomicron strains. B. thetaiotaomicron 8736 ( Bt-8736 ) contains a fructan polysaccharide utilization locus (PUL) with a divergent susC / susD homolog gene pair that enables it to utilize inulin, differentiating this strain from other characterized Bt strains. Transfer of the distinct pair of susC / susD genes from Bt-8736 into the noninulin using type strain B. thetaiotaomicron VPI-5482 resulted in inulin use by the recipient strain, Bt ( 8736-2 ). The presence of the divergent susC / susD gene pair alone enabled the hybrid Bt ( 8736-2 ) strain to outcompete the wild-type strain in vivo in mice fed an inulin diet. Further, we discovered that the susC / susD homolog gene pair facilitated import of inulin into the periplasm without surface predigestion by an endo-acting enzyme, possibly due to the short average chain length of inulin compared to many other polysaccharides. Our data builds upon recent reports of dietary polysaccharide utilization mechanisms found in members of the Bacteroides genus and demonstrates how the acquisition of two genes can alter the functionality and success of a strain within the gut. IMPORTANCE Dietary polysaccharides play a dominant role in shaping the composition and functionality of our gut microbiota. Dietary interventions using these m icrobiota- a

  5. Construction of a novel kind of expression plasmid by homologous recombination in Saccharomyces cerevisiae

    Institute of Scientific and Technical Information of China (English)

    CHEN; Xiangling


    [1]Brunelli, J. P., Pall, M. L., A series of yeast vectors for expression of cDNAs and other DNA sequences, Yeast, 1993, 9: 1299―1308.[2]Sikorski, R. S., Hieter, P., A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae, Genetics, 1989, 122: 19―27.[3]Bonneaud, N., Ozier-Kalogerogoulos, O., Li, G. et al., A family of low and high copy replicative, integrative and single-stranded S. cerevisiae /E. coli shuttle vector, Yeast, 1991, 7: 609―615.[4]Huo, K. K., Yu, L. L., Chen, X. J., Li, Y. Y., A stable vector for high-level expression and secretion of human interferon alpha A in yeast, Science in China, Ser. B, 1993, 36(5): 557―567.[5]Zhou, Z. X., Yuan, H. Y., He, W. et al., Expression of the modified HBsAg gene SA-28 directed by a constitutive promoter, Journal of Fudan university (Natural Science), 2000, 39(3): 264―268.[6]Paques, F., Haber, J. E., Multiple pathways of recombination induces by double-strand breaks in Saccharomyces cerevisiae, Microbiology and Molecular Biology Reviews, 1999, 63(2): 349―404.[7]Martin, K., Damage-induced recombination in the yeast Saccharomyces cerevisiae, Mutation Research, 2000, 451: 91―105.[8]Alira, S., Tomoko, O., Homologous recombination and the roles of double-strand breaks, TIBS, 1995, 20: 387―391.[9]Patrick, S., Kelly, M. T., Stephen, V. K., Recombination factor of Saccharomyces cerevisiae, Mutation Research, 2000, 451: 257―275.[10]Manivasakam, P., Weber, S. C., McElver, J., Schiestl, R. H., Micro-homology mediated PCR targeting in Saccharomyces cerevisiae, Nucleic Acids Res., 1995, 23(14): 2799―2800.[11]Baudin, A., Lacroute, F., Cullin, C., A simple and efficient method for direct gene deletion in Saccharomyces cerevisiae, Nucleic Acids Res., 1993, 21(14): 3329―3330.[12]Hua, S. B., Qiu, M., Chan, E., Zhu, L., Luo, Y., Minimum length of sequence homology required for in vivo cloning by homolo-gous recombination in yeast, Plasmid, 1997, 38

  6. SAAS: Short Amino Acid Sequence - A Promising Protein Secondary Structure Prediction Method of Single Sequence

    Directory of Open Access Journals (Sweden)

    Zhou Yuan Wu


    Full Text Available In statistical methods of predicting protein secondary structure, many researchers focus on single amino acid frequencies in α-helices, β-sheets, and so on, or the impact near amino acids on an amino acid forming a secondary structure. But the paper considers a short sequence of amino acids (3, 4, 5 or 6 amino acids as integer, and statistics short sequence's probability forming secondary structure. Also, many researchers select low homologous sequences as statistical database. But this paper select whole PDB database. In this paper we propose a strategy to predict protein secondary structure using simple statistical method. Numerical computation shows that, short amino acids sequence as integer to statistics, which can easy see trend of short sequence forming secondary structure, and it will work well to select large statistical database (whole PDB database without considering homologous, and Q3 accuracy is ca. 74% using this paper proposed simple statistical method, but accuracy of others statistical methods is less than 70%.


    Chawjiraphan, Wireeya; Sonthayanon, Piengchan; Chanket, Phanita; Benjathummarak, Surachet; Kerdsin, Anusak; Kalambhaheti, Thareerat


    Although brucellosis outbreaks in Thailand are rare, they cause abortions and infertility in animals, resulting in significant economic loss. Because Brucella spp display > 90% DNA homology, multilocus sequence typing (MLST) was employed to categorize local Brucella isolates into sequence types (STs) and to determine their genetic relatedness. Brucella samples were isolated from vaginal secretion of cows and goats, and from blood cultures of infected individuals. Brucella species were determined by multiplex PCR of eight loci, in addition to MLST based on partial DNA sequences of nine house-keeping genes. MLST analysis of 36 isolates revealed 78 distinct novel allele types and 34 novel STs, while two isolates possessed the known ST8. Sequence alignments identified polymorphic sites in each allele, ranging from 2-6%, while overall genetic diversity was 3.6%. MLST analysis of the 36 Brucella isolates classified them into three species, namely, B. melitensis, B. abortus and B. suis, in agreement with multiplex PCR results. Genetic relatedness among ST members of B. melitensis and B. abortus determined by eBURST program revealed ST2 as founder of B. abortus isolates and ST8 the founder of B. melitensis isolates. ST 36, 41 and 50 of Thai Brucella isolates were identified as single locus variants of clonal cluster (CC) 8, while the majority of STs were diverse. The genetic diversity and relatedness identified using MLST revealed hitherto unexpected diversity among Thai Brucella isolates. Genetic classification of isolates could reveal the route of brucellosis transmission among humans and farm animals and also reveal their relationship with other isolates in the region and other parts of the world.

  8. Structure-based design of an osteoclast-selective, nonpeptide Src homology 2 inhibitor with in vivo antiresorptive activity (United States)

    Shakespeare, William; Yang, Michael; Bohacek, Regine; Cerasoli, Franklin; Stebbins, Karin; Sundaramoorthi, Raji; Azimioara, Mihai; Vu, Chi; Pradeepan, Selvi; Metcalf, Chester; Haraldson, Chad; Merry, Taylor; Dalgarno, David; Narula, Surinder; Hatada, Marcos; Lu, Xiaode; van Schravendijk, Marie Rose; Adams, Susan; Violette, Shelia; Smith, Jeremy; Guan, Wei; Bartlett, Catherine; Herson, Jay; Iuliucci, John; Weigele, Manfred; Sawyer, Tomi


    Targeted disruption of the pp60src (Src) gene has implicated this tyrosine kinase in osteoclast-mediated bone resorption and as a therapeutic target for the treatment of osteoporosis and other bone-related diseases. Herein we describe the discovery of a nonpeptide inhibitor (AP22408) of Src that demonstrates in vivo antiresorptive activity. Based on a cocrystal structure of the noncatalytic Src homology 2 (SH2) domain of Src complexed with citrate [in the phosphotyrosine (pTyr) binding pocket], we designed 3′,4′-diphosphonophenylalanine (Dpp) as a pTyr mimic. In addition to its design to bind Src SH2, the Dpp moiety exhibits bone-targeting properties that confer osteoclast selectivity, hence minimizing possible undesired effects on other cells that have Src-dependent activities. The chemical structure AP22408 also illustrates a bicyclic template to replace the post-pTyr sequence of cognate Src SH2 phosphopeptides such as Ac-pTyr-Glu-Glu-Ile (1). An x-ray structure of AP22408 complexed with Lck (S164C) SH2 confirmed molecular interactions of both the Dpp and bicyclic template of AP22408 as predicted from molecular modeling. Relative to the cognate phosphopeptide, AP22408 exhibits significantly increased Src SH2 binding affinity (IC50 = 0.30 μM for AP22408 and 5.5 μM for 1). Furthermore, AP22408 inhibits rabbit osteoclast-mediated resorption of dentine in a cellular assay, exhibits bone-targeting properties based on a hydroxyapatite adsorption assay, and demonstrates in vivo antiresorptive activity in a parathyroid hormone-induced rat model. PMID:10944210

  9. Down regulation of APETALA3 homolog resulted in defect of floral structure critical to explosive pollen release in Cornus canadensis

    Institute of Scientific and Technical Information of China (English)

    Xiang Liu; Lu Li; Qiu-Yun (Jenny) Xiang


    In mature buds of the dwarf dogwood lineage (DW) of Cornus,petals and filaments form an "x"-like box containing mechanical energy from the filaments to allow explosive pollen dispersal.As a start to understand the molecular mechanisms responsible for the origin of this unique structure in Cornus,we cloned and characterized the sequences of APETALA3 (AP3) homologs from Cornus canadensis of the DW lineage and five other Cornus species,given the function of AP3 on petal and stamen development in Arabidopsis,and tested the function of CorcanAP3 using a stable Agrobacterium-mediated transformation system.The cloned CorAP3s (AP3-like genes in Cornus) were confirmed to belong to the euAP3 lineage.qRT-PCR analysis indicated strong increase of CorcanAP3 expression in floral buds of wildtype C.canadensis.A hairpin construct of CorcanAP3 was successfully introduced into wild type plants of C.canadensis,resulting in significant reduction of CorcanAP3 expression and abnormal floral development.The abnormal floral buds lost the "x" form and opened immaturely due to delay or retard of petal and stamen elongation and the push of style elongation.The results suggested CorcanAP3 may function to regulate the coordinated rate of development of petals and stamens in C.canadensis,necessary for the x-structure formation,although the exact molecular mechanism remains unclear.Comparison among six Comus species indicated a greater ratio of stamen to petal and style growth in C.canadensis,suggesting an evolutionary change of CorAP3 expression pattern in the DW lineage,leading to the greater growth of filaments to form the "x"-box.

  10. Mmu-miR-615-3p regulates lipoapoptosis by inhibiting C/EBP homologous protein.

    Directory of Open Access Journals (Sweden)

    Yasuhiro Miyamoto

    Full Text Available Lipoapoptosis occurring due to an excess of saturated free fatty acids such as palmitate is a key pathogenic event in the initiation of nonalcoholic fatty liver disease. Palmitate loading of cells activates the endoplasmic reticulum stress response, including induction of the proapoptotic transcription factor C/EBP homologous protein (CHOP. Furthermore, the loss of microRNAs is implicated in regulating apoptosis under conditions of endoplasmic reticulum (ER stress. The aim of this study was to identify specific microRNAs regulating CHOP expression during palmitate-induced ER stress. Five microRNAs were repressed under palmitate-induced endoplasmic reticulum stress conditions in hepatocyte cell lines (miR-92b-3p, miR-328-3p, miR-484, miR-574-5p, and miR-615-3p. We identified miR-615-3p as a candidate microRNA which was repressed by palmitate treatment and regulated CHOP protein expression, by RNA sequencing and in silico analyses, respectively. There is a single miR-615-3p binding site in the 3'untranslated region (UTR of the Chop transcript. We characterized this as a functional binding site using a reporter gene-based assay. Augmentation of miR-615-3p levels, using a precursor molecule, repressed CHOP expression; and under these conditions palmitate- or tunicamycin-induced cell death were significantly reduced. Our results suggest that palmitate-induced apoptosis requires maximal expression of CHOP which is achieved via the downregulation of its repressive microRNA, miR-615-3p. We speculate that enhancement of miR-615-3p levels may be of therapeutic benefit by inhibiting palmitate-induced hepatocyte lipoapoptosis.

  11. Homologous SV40 RNA trans-splicing: Special case or prime example of viral RNA trans-splicing?

    Directory of Open Access Journals (Sweden)

    Sushmita Poddar


    Full Text Available To date the Simian Virus 40 (SV40 is the only proven example of a virus that recruits the mechanism of RNA trans-splicing to diversify its sequences and gene products. Thereby, two identical viral transcripts are efficiently joined by homologous trans-splicing triggering the formation of a highly transforming 100 kDa super T antigen. Sequences of other viruses including HIV-1 and the human adenovirus type 5 were reported to be involved in heterologous trans-splicing towards cellular or viral sequences but the meaning of these events remains unclear. We computationally and experimentally investigated molecular features associated with viral RNA trans-splicing and identified a common pattern: Viral RNA trans-splicing occurs between strong cryptic or regular viral splice sites and strong regular or cryptic splice sites of the trans-splice partner sequences. The majority of these splice sites are supported by exonic splice enhancers. Splice sites that could compete with the trans-splicing sites for cis-splice reactions are weaker or inexistent. Finally, all but one of the trans-splice reactions seem to be facilitated by one or more complementary binding domains of 11 to 16 nucleotides in length which, however occur with a statistical probability close to one for the given length of the involved sequences. The chimeric RNAs generated via heterologous viral RNA trans-splicing either did not lead to fusion proteins or led to proteins of unknown function. Our data suggest that distinct viral RNAs are highly susceptible to trans-splicing and that heterologous viral trans-splicing, unlike homologous SV40 trans-splicing, represents a chance event.

  12. [Effect of endonuclease G depletion on plasmid DNA uptake and levels of homologous recombination in hela cells]. (United States)

    Misic, V; El-Mogy, M; Geng, S; Haj-Ahmad, Y


    Endonuclease G (EndoG) is a mitochondrial apoptosis regulator that also has roles outside of programmed cell death. It has been implicated as a defence DNase involved in the degradation of exogenous DNA after transfection of mammalian cells and in homologous recombination of viral and endogenous DNA. In this study, we looked at the effect of EndoG depletion on plasmid DNA uptake and the levels of homologous recombination in HeLa cells. We show that the proposed defence role of EndoG against uptake of non-viral DNA vectors does not extend to the cervical carcinoma HeLa cells, as targeting of EndoG expression by RNA interference failed to increase intracellular plasmid DNA levels. However, reducing EndoG levels in HeLa cells resulted in a statistically significant reduction of homologous recombination between two plasmid DNA substrates. These findings suggest that non-viral DNA vectors are also substrates for EndoG in its role in homologous recombination.

  13. Tomato Cf resistance proteins mediate recognition of cognate homologous effectors from fungi pathogenic on dicots and monocots. (United States)

    Stergiopoulos, Ioannis; van den Burg, Harrold A; Okmen, Bilal; Beenen, Henriek G; van Liere, Sabine; Kema, Gert H J; de Wit, Pierre J G M


    Most fungal effectors characterized so far are species-specific and facilitate virulence on a particular host plant. During infection of its host tomato, Cladosporium fulvum secretes effectors that function as virulence factors in the absence of cognate Cf resistance proteins and induce effector-triggered immunity in their presence. Here we show that homologs of the C. fulvum Avr4 and Ecp2 effectors are present in other pathogenic fungi of the Dothideomycete class, including Mycosphaerella fijiensis, the causal agent of black Sigatoka disease of banana. We demonstrate that the Avr4 homolog of M. fijiensis is a functional ortholog of C. fulvum Avr4 that protects fungal cell walls against hydrolysis by plant chitinases through binding to chitin and, despite the low overall sequence homology, triggers a Cf-4-mediated hypersensitive response (HR) in tomato. Furthermore, three homologs of C. fulvum Ecp2 are found in M. fijiensis, one of which induces different levels of necrosis or HR in tomato lines that lack or contain a putative cognate Cf-Ecp2 protein, respectively. In contrast to Avr4, which acts as a defensive virulence factor, M. fijiensis Ecp2 likely promotes virulence by interacting with a putative host target causing host cell necrosis, whereas Cf-Ecp2 could possibly guard the virulence target of Ecp2 and trigger a Cf-Ecp2-mediated HR. Overall our data suggest that Avr4 and Ecp2 represent core effectors that are collectively recognized by single cognate Cf-proteins. Transfer of these Cf genes to plant species that are attacked by fungi containing these cognate core effectors provides unique ways for breeding disease-resistant crops.

  14. Anti-HmuY antibodies specifically recognize Porphyromonas gingivalis HmuY protein but not homologous proteins in other periodontopathogens.

    Directory of Open Access Journals (Sweden)

    Michał Śmiga

    Full Text Available Given the emerging evidence of an association between periodontal infections and systemic conditions, the search for specific methods to detect the presence of P. gingivalis, a principal etiologic agent in chronic periodontitis, is of high importance. The aim of this study was to characterize antibodies raised against purified P. gingivalis HmuY protein and selected epitopes of the HmuY molecule. Since other periodontopathogens produce homologs of HmuY, we also aimed to characterize responses of antibodies raised against the HmuY protein or its epitopes to the closest homologous proteins from Prevotella intermedia and Tannerella forsythia. Rabbits were immunized with purified HmuY protein or three synthetic, KLH-conjugated peptides, derived from the P. gingivalis HmuY protein. The reactivity of anti-HmuY antibodies with purified proteins or bacteria was determined using Western blotting and ELISA assay. First, we found homologs of P. gingivalis HmuY in P. intermedia (PinO and PinA proteins and T. forsythia (Tfo protein and identified corrected nucleotide and amino acid sequences of Tfo. All proteins were overexpressed in E. coli and purified using ion-exchange chromatography, hydrophobic chromatography and gel filtration. We demonstrated that antibodies raised against P. gingivalis HmuY are highly specific to purified HmuY protein and HmuY attached to P. gingivalis cells. No reactivity between P. intermedia and T. forsythia or between purified HmuY homologs from these bacteria and anti-HmuY antibodies was detected. The results obtained in this study demonstrate that P. gingivalis HmuY protein may serve as an antigen for specific determination of serum antibodies raised against this bacterium.

  15. Homology modeling and docking analyses of M. leprae Mur ligases reveals the common binding residues for structure based drug designing to eradicate leprosy. (United States)

    Shanmugam, Anusuya; Natarajan, Jeyakumar


    Multi drug resistance capacity for Mycobacterium leprae (MDR-Mle) demands the profound need for developing new anti-leprosy drugs. Since most of the drugs target a single enzyme, mutation in the active site renders the antibiotic ineffective. However, structural and mechanistic information on essential bacterial enzymes in a pathway could lead to the development of antibiotics that targets multiple enzymes. Peptidoglycan is an important component of the cell wall of M. leprae. The biosynthesis of bacterial peptidoglycan represents important targets for the development of new antibacterial drugs. Biosynthesis of peptidoglycan is a multi-step process that involves four key Mur ligase enzymes: MurC (EC:, MurD (EC:, MurE (EC: and MurF (EC: Hence in our work, we modeled the three-dimensional structure of the above Mur ligases using homology modeling method and analyzed its common binding features. The residues playing an important role in the catalytic activity of each of the Mur enzymes were predicted by docking these Mur ligases with their substrates and ATP. The conserved sequence motifs significant for ATP binding were predicted as the probable residues for structure based drug designing. Overall, the study was successful in listing significant and common binding residues of Mur enzymes in peptidoglycan pathway for multi targeted therapy.

  16. Study on homologous series of induced early mutants in Indica rice Ⅱ. the relationship between the homologous series of early mutants induced and the ecotype in Indica rice

    International Nuclear Information System (INIS)

    Chen Xiulan; Yang Hefeng; He Zhentian; Han Yuepeng; Liu Xueyu


    The induced mutation in light sensitivity of the Indica rice leads to induction of the homologous series of early mutants along with the variation of ecological character and the ecoclimate. The induction of mutants was closely related to the ecotype of Indica rice, the homologous series of early mutants in different level were derived from the different ecotype of the Indica rice, otherwise, the similar homologous series of early mutants were derived from the same ecotypic variety. The induction of the early ecotypic variety derived from the homologous series of early mutants provides the basis and possibility for accelerating the development of the new cultivars. (authors)

  17. Down-regulation of the strawberry Bet v 1-homologous allergen in concert with the flavonoid biosynthesis pathway in colorless strawberry mutant

    DEFF Research Database (Denmark)

    Hjernø, Karin; Alm, Rikard; Canbäck, Björn


    Proteomic screening of strawberry (Fragaria ananassa) yielded a 58% success rate in protein identification in spite of the fact that no genomic sequence is available for this species. This was achieved by a combination of MALDI-MS/MS de novo sequencing of double-derivatized peptides and indel......-tolerant searching against local protein databases built on both EST and full-length nucleotide sequences. The amino acid sequence of a strawberry allergen, homologous to the well-known major birch pollen allergen Bet v 1, was partially determined. This strawberry allergen, named Fra a 1 according...... to the nomenclature for allergen proteins, showed sequence identity of 54 and 77%, respectively, with corresponding allergens from birch and apple. Differential expression, as evaluated by 2-D DIGE, occurred in 10% of protein spots when red strawberries were compared to a colorless (white) strawberry mutant. White...

  18. Genomic DNA sequence and cytosine methylation changes of adult rice leaves after seeds space flight (United States)

    Shi, Jinming

    In this study, cytosine methylation on CCGG site and genomic DNA sequence changes of adult leaves of rice after seeds space flight were detected by methylation-sensitive amplification polymorphism (MSAP) and Amplified fragment length polymorphism (AFLP) technique respectively. Rice seeds were planted in the trial field after 4 days space flight on the shenzhou-6 Spaceship of China. Adult leaves of space-treated rice including 8 plants chosen randomly and 2 plants with phenotypic mutation were used for AFLP and MSAP analysis. Polymorphism of both DNA sequence and cytosine methylation were detected. For MSAP analysis, the average polymorphic frequency of the on-ground controls, space-treated plants and mutants are 1.3%, 3.1% and 11% respectively. For AFLP analysis, the average polymorphic frequencies are 1.4%, 2.9%and 8%respectively. Total 27 and 22 polymorphic fragments were cloned sequenced from MSAP and AFLP analysis respectively. Nine of the 27 fragments from MSAP analysis show homology to coding sequence. For the 22 polymorphic fragments from AFLP analysis, no one shows homology to mRNA sequence and eight fragments show homology to repeat region or retrotransposon sequence. These results suggest that although both genomic DNA sequence and cytosine methylation status can be effected by space flight, the genomic region homology to the fragments from genome DNA and cytosine methylation analysis were different.

  19. AcmD, a homolog of the major autolysin AcmA of Lactococcus lactis, binds to the cell wall and contributes to cell separation and autolysis

    NARCIS (Netherlands)

    Visweswaran, Ganesh Ram R; Steen, Anton; Leenhouts, Kees; Szeliga, Monika; Ruban, Beata; Hesseling-Meinders, Anne; Dijkstra, Bauke W; Kuipers, Oscar P; Kok, Jan; Buist, Girbe


    Lactococcus lactis expresses the homologous glucosaminidases AcmB, AcmC, AcmA and AcmD. The latter two have three C-terminal LysM repeats for peptidoglycan binding. AcmD has much shorter intervening sequences separating the LysM repeats and a lower iso-electric point (4.3) than AcmA (10.3). Under

  20. Development and Testing of New Gene-Homologous EST-SSRs for Eucalyptus gomphocephala (Myrtaceae

    Directory of Open Access Journals (Sweden)

    Donna Bradbury


    Full Text Available Premise of the study: New microsatellite (simple sequence repeat [SSR] primers were developed from Eucalyptus expressed sequence tags (ESTs and optimized for genetic studies of the southwestern Australian tree E. gomphocephala, which is severely impacted by tree health decline and habitat fragmentation. Methods and Results: A total of 133 gene-homologous EST-SSR primer pairs were designed for Eucalyptus, and 44 were screened in E. gomphocephala. Of these, 17 produced reliable amplification products and 11 were polymorphic. Between two and 13 alleles were observed per locus, and observed heterozygosities ranged from 0.172 to 0.867. All 17 EST-SSRs that amplified E. gomphocephala cross-amplified to at least one of E. marginata, E. camaldulensis, and E. victrix. Conclusions: This set of EST-SSR primer pairs will be valuable tools for future population genetic studies of E. gomphocephala and other eucalypts, particularly for studying gene-linked variation and informing seed-sourcing strategies for ecological restoration.

  1. Homology models guide discovery of diverse enzyme specificities among dipeptide epimerases in the enolase superfamily (United States)

    Lukk, Tiit; Sakai, Ayano; Kalyanaraman, Chakrapani; Brown, Shoshana D.; Imker, Heidi J.; Song, Ling; Fedorov, Alexander A.; Fedorov, Elena V.; Toro, Rafael; Hillerich, Brandan; Seidel, Ronald; Patskovsky, Yury; Vetting, Matthew W.; Nair, Satish K.; Babbitt, Patricia C.; Almo, Steven C.; Gerlt, John A.; Jacobson, Matthew P.


    The rapid advance in genome sequencing presents substantial challenges for protein functional assignment, with half or more of new protein sequences inferred from these genomes having uncertain assignments. The assignment of enzyme function in functionally diverse superfamilies represents a particular challenge, which we address through a combination of computational predictions, enzymology, and structural biology. Here we describe the results of a focused investigation of a group of enzymes in the enolase superfamily that are involved in epimerizing dipeptides. The first members of this group to be functionally characterized were Ala-Glu epimerases in Eschericiha coli and Bacillus subtilis, based on the operon context and enzymological studies; these enzymes are presumed to be involved in peptidoglycan recycling. We have subsequently studied more than 65 related enzymes by computational methods, including homology modeling and metabolite docking, which suggested that many would have divergent specificities;, i.e., they are likely to have different (unknown) biological roles. In addition to the Ala-Phe epimerase specificity reported previously, we describe the prediction and experimental verification of: (i) a new group of presumed Ala-Glu epimerases; (ii) several enzymes with specificity for hydrophobic dipeptides, including one from Cytophaga hutchinsonii that epimerizes D-Ala-D-Ala; and (iii) a small group of enzymes that epimerize cationic dipeptides. Crystal structures for certain of these enzymes further elucidate the structural basis of the specificities. The results highlight the potential of computational methods to guide experimental characterization of enzymes in an automated, large-scale fashion. PMID:22392983

  2. Structural insights into the anti-HIV activity of the Oscillatoria agardhii agglutinin homolog lectin family. (United States)

    Koharudin, Leonardus M I; Kollipara, Sireesha; Aiken, Christopher; Gronenborn, Angela M


    Oscillatoria agardhii agglutinin homolog (OAAH) proteins belong to a recently discovered lectin family. All members contain a sequence repeat of ~66 amino acids, with the number of repeats varying among different family members. Apart from data for the founding member OAA, neither three-dimensional structures, information about carbohydrate binding specificities, nor antiviral activity data have been available up to now for any other members of the OAAH family. To elucidate the structural basis for the antiviral mechanism of OAAHs, we determined the crystal structures of Pseudomonas fluorescens and Myxococcus xanthus lectins. Both proteins exhibit the same fold, resembling the founding family member, OAA, with minor differences in loop conformations. Carbohydrate binding studies by NMR and x-ray structures of glycan-lectin complexes reveal that the number of sugar binding sites corresponds to the number of sequence repeats in each protein. As for OAA, tight and specific binding to α3,α6-mannopentaose was observed. All the OAAH proteins described here exhibit potent anti-HIV activity at comparable levels. Altogether, our results provide structural details of the protein-carbohydrate interaction for this novel lectin family and insights into the molecular basis of their HIV inactivation properties.

  3. Gene Unprediction with Spurio: A tool to identify spurious protein sequences. (United States)

    Höps, Wolfram; Jeffryes, Matt; Bateman, Alex


    We now have access to the sequences of tens of millions of proteins. These protein sequences are essential for modern molecular biology and computational biology. The vast majority of protein sequences are derived from gene prediction tools and have no experimental supporting evidence for their translation.  Despite the increasing accuracy of gene prediction tools there likely exists a large number of spurious protein predictions in the sequence databases.  We have developed the Spurio tool to help identify spurious protein predictions in prokaryotes.  Spurio searches the query protein sequence against a prokaryotic nucleotide database using tblastn and identifies homologous sequences. The tblastn matches are used to score the query sequence's likelihood of being a spurious protein prediction using a Gaussian process model. The most informative feature is the appearance of stop codons within the presumed translation of homologous DNA sequences. Benchmarking shows that the Spurio tool is able to distinguish spurious from true proteins. However, transposon proteins are prone to be predicted as spurious because of the frequency of degraded homologs found in the DNA sequence databases. Our initial experiments suggest that less than 1% of the proteins in the UniProtKB sequence database are likely to be spurious and that Spurio is able to identify over 60 times more spurious proteins than the AntiFam resource. The Spurio software and source code is available under an MIT license at the following URL:

  4. Immunization of Mastomys coucha with Brugia malayi recombinant trehalose-6-phosphate phosphatase results in significant protection against homologous challenge infection.

    Directory of Open Access Journals (Sweden)

    Susheela Kushwaha

    Full Text Available Development of a vaccine to prevent or reduce parasite development in lymphatic filariasis would be a complementary approach to existing chemotherapeutic tools. Trehalose-6-phosphate phosphatase of Brugia malayi (Bm-TPP represents an attractive vaccine target due to its absence in mammals, prevalence in the major life stages of the parasite and immunoreactivity with human bancroftian antibodies, especially from endemic normal subjects. We have recently reported on the cloning, expression, purification and biochemical characterization of this vital enzyme of B. malayi. In the present study, immunoprophylactic evaluation of Bm-TPP was carried out against B. malayi larval challenge in a susceptible host Mastomys coucha and the protective ability of the recombinant protein was evaluated by observing the adverse effects on microfilarial density and adult worm establishment. Immunization caused 78.4% decrease in microfilaremia and 71.04% reduction in the adult worm establishment along with sterilization of 70.06% of the recovered live females. The recombinant protein elicited a mixed Th1/Th2 type of protective immune response as evidenced by the generation of both pro- and anti-inflammatory cytokines IL-2, IFN-γ, TNF-α, IL-4 and an increased production of antibody isotypes IgG1, IgG2a, IgG2b and IgA. Thus immunization with Bm-TPP conferred considerable protection against B. malayi establishment by engendering a long-lasting effective immune response and therefore emerges as a potential vaccine candidate against lymphatic filariasis (LF.

  5. Sequence Classification: 889733 [

    Lifescience Database Archive (English)

    Full Text Available teracts with electron transport chain components and may influence respiration; human homolog involved in Friedrich's ataxia; Yfh1p || ...

  6. DockoMatic 2.0: high throughput inverse virtual screening and homology modeling. (United States)

    Bullock, Casey; Cornia, Nic; Jacob, Reed; Remm, Andrew; Peavey, Thomas; Weekes, Ken; Mallory, Chris; Oxford, Julia T; McDougal, Owen M; Andersen, Timothy L


    DockoMatic is a free and open source application that unifies a suite of software programs within a user-friendly graphical user interface (GUI) to facilitate molecular docking experiments. Here we describe the release of DockoMatic 2.0; significant software advances include the ability to (1) conduct high throughput inverse virtual screening (IVS); (2) construct 3D homology models; and (3) customize the user interface. Users can now efficiently setup, start, and manage IVS experiments through the DockoMatic GUI by specifying receptor(s), ligand(s), grid parameter file(s), and docking engine (either AutoDock or AutoDock Vina). DockoMatic automatically generates the needed experiment input files and output directories and allows the user to manage and monitor job progress. Upon job completion, a summary of results is generated by Dockomatic to facilitate interpretation by the user. DockoMatic functionality has also been expanded to facilitate the construction of 3D protein homology models using the Timely Integrated Modeler (TIM) wizard. The wizard TIM provides an interface that accesses the basic local alignment search tool (BLAST) and MODELER programs and guides the user through the necessary steps to easily and efficiently create 3D homology models for biomacromolecular structures. The DockoMatic GUI can be customized by the user, and the software design makes it relatively easy to integrate additional docking engines, scoring functions, or third party programs. DockoMatic is a free comprehensive molecular docking software program for all levels of scientists in both research and education.

  7. On the origin of grasshopper oviposition behavior: structural homology in pregenital and genital motor systems. (United States)

    Thompson, Karen J; Jones, Alaine D; Miller, Sandra A


    In female grasshoppers, oviposition is a highly specialized behavior involving a rhythm-generating neural circuit, the oviposition central pattern generator, unusual abdominal appendages, and dedicated muscles. This study of Schistocerca americana (Drury) grasshoppers was undertaken to determine whether the simpler pregenital abdominal segments, which do not contain ovipositor appendages, share common features with the genital segment, suggesting a roadmap for the genesis of oviposition behavior. Our study revealed that although 5 of the standard pregenital body wall muscles were missing in the female genital segment, homologous lateral nerves were, indeed, present and served 4 ovipositor muscles. Retrograde labeling of the corresponding pregenital nerve branches in male and female grasshoppers revealed motor neurons, dorsal unpaired median neurons, and common inhibitor neurons which appear to be structural homologues of those filled from ovipositor muscles. Some pregenital motor neurons displayed pronounced contralateral neurites; in contrast, some ovipositor motor neurons were exclusively ipsilateral. Strong evidence of structural homology was also obtained for pregenital and ovipositor skeletal muscles supplied by the identified neurons and of the pregenital and ovipositor skeletons. For example, transient embryonic segmental appendages were maintained in the female genital segments, giving rise to ovipositor valves, but were lost in pregenital abdominal segments. Significant proportional differences in sternal apodemes and plates were observed, which partially obscure the similarities between the pregenital and genital skeletons. Other changes in reorganization included genital muscles that displayed adult hypertrophy, 1 genital muscle that appeared to represent 2 fused pregenital muscles, and the insertion points of 2 ovipositor muscles that appeared to have been relocated. Together, the comparisons support the idea that the oviposition behavior of genital

  8. Functional and structural analysis of the DNA sequence conferring glucocorticoid inducibility to the mouse mammary tumor virus gene

    International Nuclear Information System (INIS)

    Skroch, P.


    In the first part of my thesis I show that the DNA element conferring glucocorticoid inducibility to the Mouse Mammary Tumor Virus (HRE) has enhancer properties. It activates a heterologous promoter - that of the β-globin gene, independently of distance, position and orientation. These properties however have to be regarded in relation to the remaining regulatory elements of the activated gene as the recombinants between HRE and the TK gene have demonstrated. In the second part of my thesis I investigated the biological significance of certain sequence motifs of the HRE, which are remarkable by their interaction with transacting factors or sequence homologies with other regulatory DNA elements. I could confirm the generally postulated modular structure of enhancers for the HRE and bring the relevance of the single subdomains for the function of the element into relationship. (orig.) [de

  9. In Silico Characterization of Pectate Lyase Protein Sequences from Different Source Organisms

    Directory of Open Access Journals (Sweden)

    Amit Kumar Dubey


    Full Text Available A total of 121 protein sequences of pectate lyases were subjected to homology search, multiple sequence alignment, phylogenetic tree construction, and motif analysis. The phylogenetic tree constructed revealed different clusters based on different source organisms representing bacterial, fungal, plant, and nematode pectate lyases. The multiple accessions of bacterial, fungal, nematode, and plant pectate lyase protein sequences were placed closely revealing a sequence level similarity. The multiple sequence alignment of these pectate lyase protein sequences from different source organisms showed conserved regions at different stretches with maximum homology from amino acid residues 439–467, 715–816, and 829–910 which could be used for designing degenerate primers or probes specific for pectate lyases. The motif analysis revealed a conserved Pec_Lyase_C domain uniformly observed in all pectate lyases irrespective of variable sources suggesting its possible role in structural and enzymatic functions.

  10. Conservation of the glycoprotein B homologs of the Kaposi’s sarcoma-associated herpesvirus (KSHV/HHV8) and Old World primate rhadinoviruses of chimpanzees and macaques (United States)

    Bruce, A. Gregory; Horst, Jeremy A.; Rose, Timothy M.


    The envelope-associated glycoprotein B (gB) is highly conserved within the Herpesviridae and plays a critical role in viral entry. We analyzed the evolutionary conservation of sequence and structural motifs within the Kaposi’s sarcoma-associated herpesvirus (KSHV) gB and homologs of Old World primate rhadinoviruses belonging to the distinct RV1 and RV2 rhadinovirus lineages. In addition to gB homologs of rhadinoviruses infecting the pig-tailed and rhesus macaques, we cloned and sequenced gB homologs of RV1 and RV2 rhadinoviruses infecting chimpanzees. A structural model of the KSHV gB was determined, and functional motifs and sequence variants were mapped to the model structure. Conserved domains and motifs were identified, including an “RGD” motif that plays a critical role in KSHV binding and entry through the cellular integrin αVβ3. The RGD motif was only detected in RV1 rhadinoviruses suggesting an important difference in cell tropism between the two rhadinovirus lineages. PMID:27070755

  11. FASH: A web application for nucleotides sequence search

    Directory of Open Access Journals (Sweden)

    Chew Paul


    Full Text Available Abstract FASH (Fourier Alignment Sequence Heuristics is a web application, based on the Fast Fourier Transform, for finding remote homologs within a long nucleic acid sequence. Given a query sequence and a long text-sequence (e.g, the human genome, FASH detects subsequences within the text that are remotely-similar to the query. FASH offers an alternative approach to Blast/Fasta for querying long RNA/DNA sequences. FASH differs from these other approaches in that it does not depend on the existence of contiguous seed-sequences in its initial detection phase. The FASH web server is user friendly and very easy to operate. Availability FASH can be accessed at (secured website

  12. Protein thermostability prediction within homologous families using temperature-dependent statistical potentials.

    Directory of Open Access Journals (Sweden)

    Fabrizio Pucci

    Full Text Available The ability to rationally modify targeted physical and biological features of a protein of interest holds promise in numerous academic and industrial applications and paves the way towards de novo protein design. In particular, bioprocesses that utilize the remarkable properties of enzymes would often benefit from mutants that remain active at temperatures that are either higher or lower than the physiological temperature, while maintaining the biological activity. Many in silico methods have been developed in recent years for predicting the thermodynamic stability of mutant proteins, but very few have focused on thermostability. To bridge this gap, we developed an algorithm for predicting the best descriptor of thermostability, namely the melting temperature Tm, from the protein's sequence and structure. Our method is applicable when the Tm of proteins homologous to the target protein are known. It is based on the design of several temperature-dependent statistical potentials, derived from datasets consisting of either mesostable or thermostable proteins. Linear combinations of these potentials have been shown to yield an estimation of the protein folding free energies at low and high temperatures, and the difference of these energies, a prediction of the melting temperature. This particular construction, that distinguishes between the interactions that contribute more than others to the stability at high temperatures and those that are more stabilizing at low T, gives better performances compared to the standard approach based on T-independent potentials which predict the thermal resistance from the thermodynamic stability. Our method has been tested on 45 proteins of known Tm that belong to 11 homologous families. The standard deviation between experimental and predicted Tm's is equal to 13.6°C in cross validation, and decreases to 8.3°C if the 6 worst predicted proteins are excluded. Possible extensions of our approach are discussed.

  13. Functional and evolutionary characterization of Ohr proteins in eukaryotes reveals many active homologs among pathogenic fungi

    Directory of Open Access Journals (Sweden)

    D.A. Meireles


    Full Text Available Ohr and OsmC proteins comprise two subfamilies within a large group of proteins that display Cys-based, thiol dependent peroxidase activity. These proteins were previously thought to be restricted to prokaryotes, but we show here, using iterated sequence searches, that Ohr/OsmC homologs are also present in 217 species of eukaryotes with a massive presence in Fungi (186 species. Many of these eukaryotic Ohr proteins possess an N-terminal extension that is predicted to target them to mitochondria. We obtained recombinant proteins for four eukaryotic members of the Ohr/OsmC family and three of them displayed lipoyl peroxidase activity. Further functional and biochemical characterization of the Ohr homologs from the ascomycete fungus Mycosphaerella fijiensis Mf_1 (MfOhr, the causative agent of Black Sigatoka disease in banana plants, was pursued. Similarly to what has been observed for the bacterial proteins, we found that: (i the peroxidase activity of MfOhr was supported by DTT or dihydrolipoamide (dithiols, but not by β-mercaptoethanol or GSH (monothiols, even in large excess; (ii MfOhr displayed preference for organic hydroperoxides (CuOOH and tBOOH over hydrogen peroxide; (iii MfOhr presented extraordinary reactivity towards linoleic acid hydroperoxides (k=3.18 (±2.13×108 M−1 s−1. Both Cys87 and Cys154 were essential to the peroxidase activity, since single mutants for each Cys residue presented no activity and no formation of intramolecular disulfide bond upon treatment with hydroperoxides. The pKa value of the Cysp residue was determined as 5.7±0.1 by a monobromobimane alkylation method. Therefore, eukaryotic Ohr peroxidases share several biochemical features with prokaryotic orthologues and are preferentially located in mitochondria. Keywords: Ohr/OsmC, Thiol-dependent peroxidases, Phylogeny

  14. Unveiling novel RecO distant orthologues involved in homologous recombination.

    Directory of Open Access Journals (Sweden)

    Stéphanie Marsin


    Full Text Available The generation of a RecA filament on single-stranded DNA is a critical step in homologous recombination. Two main pathways leading to the formation of the nucleofilament have been identified in bacteria, based on the protein complexes mediating RecA loading: RecBCD (AddAB and RecFOR. Many bacterial species seem to lack some of the components involved in these complexes. The current annotation of the Helicobacter pylori genome suggests that this highly diverse bacterial pathogen has a reduced set of recombination mediator proteins. While it is now clear that homologous recombination plays a critical role in generating H. pylori diversity by allowing genomic DNA rearrangements and integration through transformation of exogenous DNA into the chromosome, no complete mediator complex is deduced from the sequence of its genome. Here we show by bioinformatics analysis the presence of a RecO remote orthologue that allowed the identification of a new set of RecO proteins present in all bacterial species where a RecR but not RecO was previously identified. HpRecO shares less than 15% identity with previously characterized homologues. Genetic dissection of recombination pathways shows that this novel RecO and the remote RecB homologue present in H. pylori are functional in repair and in RecA-dependent intrachromosomal recombination, defining two initiation pathways with little overlap. We found, however, that neither RecOR nor RecB contributes to transformation, suggesting the presence of a third, specialized, RecA-dependent pathway responsible for the integration of transforming DNA into the chromosome of this naturally competent bacteria. These results provide insight into the mechanisms that this successful pathogen uses to generate genetic diversity and adapt to changing environments and new hosts.

  15. Functional and evolutionary characterization of Ohr proteins in eukaryotes reveals many active homologs among pathogenic fungi. (United States)

    Meireles, D A; Domingos, R M; Gaiarsa, J W; Ragnoni, E G; Bannitz-Fernandes, R; da Silva Neto, J F; de Souza, R F; Netto, L E S


    Ohr and OsmC proteins comprise two subfamilies within a large group of proteins that display Cys-based, thiol dependent peroxidase activity. These proteins were previously thought to be restricted to prokaryotes, but we show here, using iterated sequence searches, that Ohr/OsmC homologs are also present in 217 species of eukaryotes with a massive presence in Fungi (186 species). Many of these eukaryotic Ohr proteins possess an N-terminal extension that is predicted to target them to mitochondria. We obtained recombinant proteins for four eukaryotic members of the Ohr/OsmC family and three of them displayed lipoyl peroxidase activity. Further functional and biochemical characterization of the Ohr homologs from the ascomycete fungus Mycosphaerella fijiensis Mf_1 (MfOhr), the causative agent of Black Sigatoka disease in banana plants, was pursued. Similarly to what has been observed for the bacterial proteins, we found that: (i) the peroxidase activity of MfOhr was supported by DTT or dihydrolipoamide (dithiols), but not by β-mercaptoethanol or GSH (monothiols), even in large excess; (ii) MfOhr displayed preference for organic hydroperoxides (CuOOH and tBOOH) over hydrogen peroxide; (iii) MfOhr presented extraordinary reactivity towards linoleic acid hydroperoxides (k=3.18 (±2.13)×10 8 M -1 s -1 ). Both Cys 87 and Cys 154 were essential to the peroxidase activity, since single mutants for each Cys residue presented no activity and no formation of intramolecular disulfide bond upon treatment with hydroperoxides. The pK a value of the Cys p residue was determined as 5.7±0.1 by a monobromobimane alkylation method. Therefore, eukaryotic Ohr peroxidases share several biochemical features with prokaryotic orthologues and are preferentially located in mitochondria. Copyright © 2017. Published by Elsevier B.V.

  16. Internal and External reconnection in a Series of Homologous Solar Flares (United States)

    Sterling, Alphonse C.; Moore, Ronald L.; Rose, M. Franklin (Technical Monitor)


    Using data from the Extreme Ultraviolet Telescope (EIT) on SOHO and the Soft X-ray Telescope (SXT) on Yohkoh, we examine a series of morphologically homologous solar flares occurring in NOAA AR 8210 over May 1-2, 1998. An emerging flux region (EFR) impacted against a sunspot to the west and next to a coronal hole to the east is the source of the repeated flaring. An SXT sigmoid parallels the EFR's neutral line at the site of the initial flaring in soft X-rays. In EIT, each flaring episode begins with the formation of a crinkle pattern external to the EFR. These EIT crinkles move out from, and then in toward, the EFR with velocities approximately 20 km/s. A shrinking and expansion of the width of the coronal hole coincides with the crinkle activity, and generation and evolution of a postflare loop system begins near the. time of crinkle formation. Using a schematic based on magnetograms of the region, we suggest that these observations are consistent with the standard reconnection-based model for solar eruptions, but modified by the presence of the additional magnetic fields of the sunspot and coronal hole. In the schematic, internal reconnection begins inside of the EFR-associated fields, unleashing a flare, postflare loops, and a CME. External reconnection, first occurring between the escaping CME and the coronal hole field, and second occurring between fields formed as a result of the first external reconnection, results in the EIT crinkles and changes in the coronal hole boundary. By the end of the second external reconnection, the initial setup is reinstated; thus the sequence can repeat, resulting in morphologically homologous eruptions. Our inferred magnetic topology is similar to that suggested in the "breakout model" of eruptions [Antiochos, 1998], although we cannot determine if our eruptions are released primarily by the breakout mechanism (external reconnection) or, alternatively, are released primarily by the internal r