A simple and robust vector-based shRNA expression system used for RNA interference.
Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi
2013-01-01
RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.
A simple and robust vector-based shRNA expression system used for RNA interference.
Directory of Open Access Journals (Sweden)
Xue-jun Wang
Full Text Available BACKGROUND: RNA interference (RNAi mediated by small interfering RNAs (siRNAs or short hairpin RNAs (shRNAs has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. RESULTS: In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. CONCLUSION: This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.
Creating Transgenic shRNA Mice by Recombinase-Mediated Cassette Exchange
Premsrirut, Prem K.; Dow, Lukas E.; Park, Youngkyu; Hannon, Gregory J.; Lowe, Scott W.
2014-01-01
RNA interference (RNAi) enables sequence-specific, experimentally induced silencing of virtually any gene by tapping into innate regulatory mechanisms that are conserved among most eukaryotes. The principles that enable transgenic RNAi in cell lines can also be used to create transgenic animals, which express short-hairpin RNAs (shRNAs) in a regulated or tissue-specific fashion. However, RNAi in transgenic animals is somewhat more challenging than RNAi in cultured cells. The activities of promoters that are commonly used for shRNA expression in cell culture can vary enormously in different tissues, and founder lines also typically vary in transgene expression due to the effects of their single integration sites. There are many ways to produce mice carrying shRNA transgenes and the method described here uses recombinase-mediated cassette exchange (RMCE). RMCE permits insertion of the shRNA transgene into a well-characterized locus that gives reproducible and predictable expression in each founder and enhances the probability of potent expression in many cell types. This procedure is more involved and complex than simple pronuclear injection, but if even a few shRNA mice are envisioned, for example, to probe the functions of several genes, the effort of setting up the processes outlined below are well worthwhile. Note that when creating a transgenic mouse, one should take care to use the most potent shRNA possible. As a rule of thumb, the sequence chosen should provide >90% knockdown when introduced into cultured cells at single copy (e.g., on retroviral infection at a multiplicity of ≤0.3). PMID:24003198
Deep Sequencing Insights in Therapeutic shRNA Processing and siRNA Target Cleavage Precision.
Denise, Hubert; Moschos, Sterghios A; Sidders, Benjamin; Burden, Frances; Perkins, Hannah; Carter, Nikki; Stroud, Tim; Kennedy, Michael; Fancy, Sally-Ann; Lapthorn, Cris; Lavender, Helen; Kinloch, Ross; Suhy, David; Corbau, Romu
2014-02-04
TT-034 (PF-05095808) is a recombinant adeno-associated virus serotype 8 (AAV8) agent expressing three short hairpin RNA (shRNA) pro-drugs that target the hepatitis C virus (HCV) RNA genome. The cytosolic enzyme Dicer cleaves each shRNA into multiple, potentially active small interfering RNA (siRNA) drugs. Using next-generation sequencing (NGS) to identify and characterize active shRNAs maturation products, we observed that each TT-034-encoded shRNA could be processed into as many as 95 separate siRNA strands. Few of these appeared active as determined by Sanger 5' RNA Ligase-Mediated Rapid Amplification of cDNA Ends (5-RACE) and through synthetic shRNA and siRNA analogue studies. Moreover, NGS scrutiny applied on 5-RACE products (RACE-seq) suggested that synthetic siRNAs could direct cleavage in not one, but up to five separate positions on targeted RNA, in a sequence-dependent manner. These data support an on-target mechanism of action for TT-034 without cytotoxicity and question the accepted precision of substrate processing by the key RNA interference (RNAi) enzymes Dicer and siRNA-induced silencing complex (siRISC).Molecular Therapy-Nucleic Acids (2014) 3, e145; doi:10.1038/mtna.2013.73; published online 4 February 2014.
Therapeutic effects of lentivirus-mediated shRNA targeting of cyclin D1 in human gastric cancer
International Nuclear Information System (INIS)
Seo, Jin-Hee; Jeong, Eui-Suk; Choi, Yang-Kyu
2014-01-01
Gastric cancer is the second most common cause of cancer-related death in males and the fourth in females. Traditional treatment has poor prognosis because of recurrence and systemic side effects. Therefore, the development of new therapeutic strategies is an important issue. Lentivirus-mediated shRNA stably inhibits target genes and can efficiently transduce most cells. Since overexpressed cyclin D1 is closely related to human gastric cancer progression, inhibition of cyclin D1 using specific targeting could be an effective treatment method of human gastric cancer. The therapeutic effect of lentivirus-mediated shRNA targeting of cyclin D1 (ShCCND1) was analyzed both in vitro and in vivo experiments. In vitro, NCI-N87 cells with downregulation of cyclin D1 by ShCCND1 showed significant inhibition of cell proliferation, cell motility, and clonogenicity. Downregulation of cyclin D1 in NCI-N87 cells also resulted in significantly increased G1 arrest and apoptosis. In vivo, stable NCI-N87 cells expressing ShCCND1 were engrafted into nude mice. Then, the cancer-growth inhibition effect of lentivirus was confirmed. To assess lentivirus including ShCCND1 as a therapeutic agent, intratumoral injection was conducted. Tumor growth of the lentivirus-treated group was significantly inhibited compared to growth of the control group. These results are in accordance with the in vitro data and lend support to the mitotic figure count and apoptosis analysis of the tumor mass. The lentivirus-mediated ShCCND1 was constructed, which effectively inhibited growth of NCI-N87-derived cancer both in vitro and in vivo. The efficiency of shRNA knockdown and variation in the degree of inhibition is mediated by different shRNA sequences and cancer cell lines. These experimental results suggest the possibility of developing new gastric cancer therapies using lentivirus-mediated shRNA
Short Hairpin RNA (shRNA): Design, Delivery, and Assessment of Gene Knockdown
Moore, Chris B.; Guthrie, Elizabeth H.; Huang, Max Tze-Han; Taxman, Debra J.
2013-01-01
Shortly after the cellular mechanism of RNA interference (RNAi) was first described, scientists began using this powerful technique to study gene function. This included designing better methods for the successful delivery of small interfering RNAs (siRNAs) and short hairpin RNAs (shRNAs) into mammalian cells. While the simplest method for RNAi is the cytosolic delivery of siRNA oligonucleotides, this technique is limited to cells capable of transfection and is primarily utilized during transient in vitro studies. The introduction of shRNA into mammalian cells through infection with viral vectors allows for stable integration of shRNA and long-term knockdown of the targeted gene; however, several challenges exist with the implementation of this technology. Here we describe some well-tested protocols which should increase the chances of successful design, delivery, and assessment of gene knockdown by shRNA. We provide suggestions for designing shRNA targets and controls, a protocol for sequencing through the secondary structure of the shRNA hairpin structure, and protocols for packaging and delivery of shRNA lentiviral particles. Using real-time PCR and functional assays we demonstrate the successful knockdown of ASC, an inflammatory adaptor molecule. These studies demonstrate the practicality of including two shRNAs with different efficacies of knockdown to provide an additional level of control and to verify dose dependency of functional effects. Along with the methods described here, as new techniques and algorithms are designed in the future, shRNA is likely to include further promising application and continue to be a critical component of gene discovery. PMID:20387148
Li, Lixuan; Li, Jia
2015-05-01
To study the effects of lentivirus-mediated short hairpin RNA (shRNA) silencing of lysosome-associated membrane protein type 2A (LAMP2A) expression on the proliferation of multiple myeloma cells. The constructed shRNA lentiviral vector was applied to infect human multiple myeloma cell line MM.1S, and stable expression cell line was obtained by puromycin screening. Western blotting was used to verify the inhibitory effect on LAMP2A protein expression. MTT assay was conducted to detect the effect of knocked-down LAMP2A on MM.1S cell proliferation, and the anti-tumor potency of suberoylanilide hydroxamic acid (SAHA) against the obtained MM.1S LAMP2A(shRNA) stable cell line. Lactate assay was performed to observe the impact of low LAMP2A expression on cell glycolysis. The stable cell line with low LAMP2A expression were obtained with the constructed human LAMP2A-shRNA lentiviral vector. Down-regulation of LAMP2A expression significantly inhibited MM.1S cell proliferation and enhanced the anti-tumor activity of SAHA. Interestingly, decreased LAMP2A expression also inhibited MM.1S cell lactic acid secretion. Down-regulation of LAMP2A expression could inhibit cell proliferation in multiple myeloma cells.
AAV-based shRNA silencing of NF-κB ameliorates muscle pathologies in mdx mice.
Yang, Q; Tang, Y; Imbrogno, K; Lu, A; Proto, J D; Chen, A; Guo, F; Fu, F H; Huard, J; Wang, B
2012-12-01
Chronic inflammation, promoted by an upregulated NF-kappa B (NF-κB) pathway, has a key role in Duchenne muscular dystrophy (DMD) patients' pathogenesis. Blocking the NF-κB pathway has been shown to be a viable approach to diminish chronic inflammation and necrosis in the dystrophin-defective mdx mouse, a murine DMD model. In this study, we used the recombinant adeno-associated virus serotype 9 (AAV9) carrying an short hairpin RNA (shRNA) specifically targeting the messenger RNA of NF-κB/p65 (p65-shRNA), the major subunit of NF-κB associated with chronic inflammation in mdx mice. We examined whether i.m. AAV9-mediated delivery of p65-shRNA could decrease NF-κB activation, allowing for amelioration of muscle pathologies in 1- and 4-month-old mdx mice. At 1 month after treatment, NF-κB/p65 levels were significantly decreased by AAV gene transfer of p65-shRNA in the two ages of treatment groups, with necrosis significantly decreased compared with controls. Quantitative analysis revealed that central nucleation (CN) of the myofibers of p65-shRNA-treated 1-month-old mdx muscles was reduced from 67 to 34%, but the level of CN was not significantly decreased in treated 4-month-old mdx mice. Moreover, delivery of the p65-shRNA enhanced the capacity of myofiber regeneration in old mdx mice treated at 4 months of age when the dystrophic myofibers were most exhausted; however, such p65 silencing diminished the myofiber regeneration in young mdx mice treated at 1 month of age. Taken together, these findings demonstrate that the AAV-mediated delivery of p65-shRNA has the capacity to ameliorate muscle pathologies in mdx mice by selectively reducing NF-κB/p65 activity.
DEFF Research Database (Denmark)
Stenderup, Karin; Jakobsen, Maria; Rosada, Cecilia
2008-01-01
TNF-α is a well known target in psoriasis treatment and biological treatments targeting TNF-a are already clinically used against psoriasis and psoriasis arthritis. Attention is however given to a novel therapeutic tool: RNA interference that controls gene silencing. This study investigates...... the efficiency of targeting TNF-a with specific short hairpin RNA (shRNA) and explores its potential in treating psoriasis. ShRNAs targeting human TNF-α mRNA were generated. Their efficiency in down-regulating TNF-a protein expression was evaluated using a Renilla luciferase screening-assay and a transient co...... TNF-a shRNA was used to transduce HEK293 cells and verify vector-derived TNF-a knockdown in vitro. In vivo, psoriasis skin was exposed to lentiviral TNF-a shRNAs by a single intra-dermal injection. Psoriasis skin for the in vivo study was obtained from psoriatic plaque skin biopsies that were...
International Nuclear Information System (INIS)
Pang, Shi-Feng; Li, Xiao-Kun; Zhang, Qiang; Yang, Fang; Xu, Peilin
2009-01-01
Recently our laboratory reported evidence showing that hNUDC acts as an additional cytokine for thrombopoietin receptor (Mpl). Previously known as the human homolog of a fungal nuclear migration protein, hNUDC plays a critical role in megakaryocyte differentiation and maturation. Here we sought to further clarify the hNUDC-Mpl ligand-receptor relationship by utilizing interference RNA (RNAi) to knockdown Mpl expression in a megakaryocyte cell line. We created U6 promoter driven constructs to express short hairpin RNAs (shRNA) with affinity for different sites on Mpl mRNA. By including Mpl-EGFP fusion protein in these constructs, we were able to effectively screen the shRNA that was most efficient in inhibiting Mpl mRNA expression. This shRNA was subsequently transferred into a lentivirus vector and transduced into Dami cells, a cell line which constitutively expresses endogenous Mpl. This lentiviral vector was also designed to simultaneously express EGFP to monitor transfection efficiency. Our results show that lentivirus can be used to effectively deliver shRNAs into Dami cells and cause specific inhibition of Mpl protein expression after transduction. Furthermore, we show the functional effects of shRNA-mediated Mpl silencing by demonstrating reduced hNUDC stimulated megakaryocyte proliferation and differentiation. Thus, the use of a RNAi knockdown strategy has allowed us to pinpoint the connection of hNUDC with Mpl in the regulation of megakaryocyte maturation.
Zhu, Xin-Hua; Liao, Bing; Xu, Yi; Liu, Ke; Huang, Yun; Huang, Quan-Long; Liu, Yue-Hui
2017-02-01
RNA interference has been considered as an effective gene silencing method in basic and preclinical investigations. The aims of the present study were to construct a lentiviral vector expressing a short hairpin RNA (shRNA) targeting the murine CC chemokine receptor 3 (mCCR3), and to investigate its effects on the proliferation and apoptosis of mouse eosinophils. A recombinant lentiviral vector expressing four fragments of mouse CCR3 shRNA (pLVX‑mCCR3‑1+2+3+4‑shRNA) was constructed using subcloning techniques. This novel lentivirus was then packaged into 293T cells by co‑transduction with plasmids, including Baculo p35, pCMV R8.2 and VSV. The interference effects of the vector were verified using polymerase chain reaction (PCR) and western blot analyses. The effects of the interference on the proliferation and apoptosis of mouse eosinophils were investigated using 3‑(4,5‑dimethylthiazol‑2‑yl)‑5‑(3‑carboxymethoxyphenyl)‑2‑(4‑sulfophenyl)‑2H‑tetrazolium and terminal deoxynucleotidyl transferase dUTP nick end labeling methods, respectively. The results of the PCR and western blot analyses confirmed that the novel recombinant vector, pLVX‑mCCR3‑1+2+3+4‑shRNA, had high efficiency in inhibiting the mRNA and protein expression levels of mCCR3 in mouse eosinophils. The downregulation of mCCR3 significantly inhibited proliferation of the eosinophils. Furthermore, the present study found that the downregulation of mCCR3 significantly promoted apoptosis of the eosinophils. Therefore, the downregulation of mCCR3 led to the inhibition of proliferation and induction of apoptosis in mouse eosinophils. The predominant characteristics of allergic rhinitis are eosinophil infiltration and release of inflammatory mediators, which appear in a variety of clinical manifestations. The results of the present study indicate that mCCR3 silencing may serve as a putative approach for the treatment of allergic rhinitis.
Directory of Open Access Journals (Sweden)
Shirley Lam
Full Text Available BACKGROUND: Chikungunya virus (CHIKV is a re-emerging alphavirus that causes chikungunya fever and persistent arthralgia in humans. Currently, there is no effective vaccine or antiviral against CHIKV infection. Therefore, this study evaluates whether RNA interference which targets at viral genomic level may be a novel antiviral strategy to inhibit the medically important CHIKV infection. METHODS: Plasmid-based small hairpin RNA (shRNA was investigated for its efficacy in inhibiting CHIKV replication. Three shRNAs designed against CHIKV Capsid, E1 and nsP1 genes were transfected to establish stable shRNA-expressing cell clones. Following infection of stable shRNA cells clones with CHIKV at M.O.I. 1, viral plaque assay, Western blotting and transmission electron microscopy were performed. The in vivo efficacy of shRNA against CHIKV replication was also evaluated in a suckling murine model of CHIKV infection. RESULTS: Cell clones expressing shRNAs against CHIKV E1 and nsP1 genes displayed significant inhibition of infectious CHIKV production, while shRNA Capsid demonstrated a modest inhibitory effect as compared to scrambled shRNA cell clones and non-transfected cell controls. Western blot analysis of CHIKV E2 protein expression and transmission electron microscopy of shRNA E1 and nsP1 cell clones collectively demonstrated similar inhibitory trends against CHIKV replication. shRNA E1 showed non cell-type specific anti-CHIKV effects and broad-spectrum silencing against different geographical strains of CHIKV. Furthermore, shRNA E1 clones did not exert any inhibition against Dengue virus and Sindbis virus replication, thus indicating the high specificity of shRNA against CHIKV replication. Moreover, no shRNA-resistant CHIKV mutant was generated after 50 passages of CHIKV in the stable cell clones. More importantly, strong and sustained anti-CHIKV protection was conferred in suckling mice pre-treated with shRNA E1. CONCLUSION: Taken together, these
International Nuclear Information System (INIS)
Hu Xiaoqu; Su Fengxi; Qin Li; Jia Weijuan; Gong Chang; Yu Fengyan; Guo Jujiang; Song Erwei
2006-01-01
Overexpression of human epidermal growth factor receptor-2 (Her2, ErbB-2) contributes to the progression and metastasis of breast cancer, implying that Her2 gene is a suitable target of RNA interference (RNAi) for breast cancer therapy. Here, we employed plasmid-mediated expression of 2 different Her2-shRNAs (pU6-Her2shRNAs) efficiently silenced the target gene expression on Her2 expressing SKBR-3 breast cancer cells in both mRNA and protein levels. Consequently, pU6-Her2shRNA increased apoptosis and reduced proliferation of SKBR-3 cells assayed by TUNEL and MTT, respectively. In vivo, intra-tumor injection of pU6-Her2shRNA inhibited the growth of SKBR-3 tumors inoculated subcutaneously in nude mice. Furthermore, pU6-Her2shRNA synergized the tumor suppression effect of epirubicin to SKBR-3 cells in vitro and implanted subcutaneously in nude mice. Therefore, we concluded that stable silencing of Her2 gene expression with plasmid expressing shRNA may hold great promise as a novel therapy for Her2 expressing breast cancers alone or in combination with anthracycline chemotherapy
Directory of Open Access Journals (Sweden)
Yuan-xing Gu
2014-01-01
Full Text Available RNA interference (RNAi has been proved to be a powerful tool for foot-and-mouth disease virus FMDV inhibition in vitro and in vivo. We established five stable baby hamster kidney 21 cell lines (BHK-21 containing five short hairpin RNAs (shRNAs expression plasmids (p3D1shRNA, p3D2shRNA, p3D3shRNA, p3D4shRNA, and p3D5shRNA targeting 3D gene of FMDV. Immunofluorescent assay, virus titration, and real-time quantitative reverse transcription polymerase chain reaction (Q-RT-PCR were conducted to detect the effect of shRNAs on FMDV replication. After challenged with FMDV of O/CHA/99, two cell lines (p3D1shRNA and p3D4shRNA showed a significant reduction in the synthesis of viral protein and RNA, accompanied by a sharp decrease in viral yield, and the inhibition could last for at least thirty passages. We developed an efficient procedure for the establishment and evaluation of stable cell lines for anti-FMDV research based on RNAi technology, which can be a candidate method for anti-FMDV research.
Inhibition of osteoclastogenesis by RNA interference targeting RANK
Directory of Open Access Journals (Sweden)
Ma Ruofan
2012-08-01
Full Text Available Abstract Background Osteoclasts and osteoblasts regulate bone resorption and formation to allow bone remodeling and homeostasis. The balance between bone resorption and formation is disturbed by abnormal recruitment of osteoclasts. Osteoclast differentiation is dependent on the receptor activator of nuclear factor NF-kappa B (RANK ligand (RANKL as well as the macrophage colony-stimulating factor (M-CSF. The RANKL/RANK system and RANK signaling induce osteoclast formation mediated by various cytokines. The RANK/RANKL pathway has been primarily implicated in metabolic, degenerative and neoplastic bone disorders or osteolysis. The central role of RANK/RANKL interaction in osteoclastogenesis makes RANK an attractive target for potential therapies in treatment of osteolysis. The purpose of this study was to assess the effect of inhibition of RANK expression in mouse bone marrow macrophages on osteoclast differentiation and bone resorption. Methods Three pairs of short hairpin RNAs (shRNA targeting RANK were designed and synthesized. The optimal shRNA was selected among three pairs of shRNAs by RANK expression analyzed by Western blot and Real-time PCR. We investigated suppression of osteoclastogenesis of mouse bone marrow macrophages (BMMs using the optimal shRNA by targeting RANK. Results Among the three shRANKs examined, shRANK-3 significantly suppressed [88.3%] the RANK expression (p Conclusions These findings suggest that retrovirus-mediated shRNA targeting RANK inhibits osteoclast differentiation and osteolysis. It may appear an attractive target for preventing osteolysis in humans with a potential clinical application.
Zhang, Qun; Shu, Fu-Li; Jiang, Yu-Feng; Huang, Xin-En
2015-01-01
In this study, influence caused by expression plasmids of connective tissue growth factor (CTGF) and tissue inhibitor of metalloproteinase-1 (TIMP-1) short hairpin RNA (shRNA) on mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII in hepatic tissue with hepatic fibrosis, a precancerous condition, in rats is analyzed. To screen and construct shRNA expression plasimid which effectively interferes RNA targets of CTGF and TIMP-1 in rats. 50 cleaning Wistar male rats are allocated randomly at 5 different groups after precancerous fibrosis models and then injection of shRNA expression plasimids. Plasmid psiRNA-GFP-Com (CTGF and TIMP-1 included), psiRNA-GFP-CTGF, psiRNA-GFP-TIMP-1 and psiRNA- DUO-GFPzeo of blank plasmid are injected at group A, B, C and D, respectively, and as model control group that none plasimid is injected at group E. In 2 weeks after last injection, to hepatic tissue at different groups, protein expression of CTGF, TIMP-1, procol-α1and PC III is tested by immunohistochemical method and,mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII is measured by real-time PCR. One-way ANOVA is used to comparison between-groups. Compared with model group, there is no obvious difference of mRNA expression among CTGF,TIMP-1,procol-α1,PC III and of protein expression among CTGF, TIMP-1, procol-α1, PC III in hepatic tissue at group injected with blank plasmid. Expression quantity of mRNA of CTGF, TIMP-1, procol-α1 and PCIII at group A, B and C decreases, protein expression of CTGF, TIMP-1, procol-α1, PC III in hepatic tissue is lower, where the inhibition of combination RNA interference group (group A) on procol-α1 mRNA transcription and procol-α1 protein expression is superior to that of single interference group (group B and C) (P<0.01 or P<0.05). RNA interference on CTGF and/or TIMP-1 is obviously a inhibiting factor for mRNA and protein expression of CTGF, TIMP-1, procol-α1 and PCIII. Combination RNA interference on genes of CTGF and TIMP-1 is superior
Haga, K; Lemp, N A; Logg, C R; Nagashima, J; Faure-Kumar, E; Gomez, G G; Kruse, C A; Mendez, R; Stripecke, R; Kasahara, N; Kasahara, N A; Cicciarelli, J C
2006-12-01
Transplantation of many tissues requires histocompatibility matching of human leukocyte antigens (HLA) to prevent graft rejection, to reduce the level of immunosuppression needed to maintain graft survival, and to minimize the risk of graft-versus-host disease, particularly in the case of bone marrow transplantation. However, recent advances in fields of gene delivery and genetic regulation technologies have opened the possibility of engineering grafts that display reduced levels of HLA expression. Suppression of HLA expression could help to overcome the limitations imposed by extensive HLA polymorphisms that restrict the availability of suitable donors, necessitate the maintenance of large donor registries, and complicate the logistics of procuring and delivering matched tissues and organs to the recipient. Accordingly, we investigated whether knockdown of HLA by RNA interference (RNAi), a ubiquitous regulatory system that can efficiently and selectively inhibit the expression of specific gene products, would enable allogeneic cells to evade immune recognition. For efficient and stable delivery of short hairpin-type RNAi constructs (shRNA), we employed lentivirus-based gene transfer vectors, which provide a delivery system that can achieve integration into genomic DNA, thereby permanently modifying transduced graft cells. Our results show that lentivirus-mediated delivery of shRNA targeting pan-Class I and allele-specific HLA can achieve efficient and dose-dependent reduction in surface expression of HLA in human cells, associated with enhanced resistance to alloreactive T lymphocyte-mediated cytotoxicity, while avoiding MHC-non-restricted killing. We hypothesize that RNAi-induced silencing of HLA expression has the potential to create histocompatibility-enhanced, and, eventually, perhaps "universally" compatible cellular grafts.
Jain, Sudhir Kumar; Jain, Hemlata; Kumar, Dharmendra; Bedekar, Megha Kadam; Pandey, Akhilesh Kumar; Sarkhel, Bikash Chandra
2015-09-01
Skeletal muscle is the major component of lean tissue that is used for consumption, and myostatin is a negative regulator of skeletal muscle growth. Downregulation of this gene therefore offers a strategy for developing superior animals with enhanced muscle growth. Knockdown of myostatin was achieved by RNA interference technology. The anti-myostatin shRNA were designed and stably transfected in caprine fibroblast cells. The reduced expression of target gene was achieved and measured in clonal fibroblast cells by real-time PCR. Two single-cell clones induced significant decrease of myostatin gene expression by 73.96 and 72.66 %, respectively (P < 0.05). To ensure the appropriate growth of transfected cell, seven media were tested. The best suited media was used for transfected fibroblast cell proliferation. The findings suggest that shRNA provides a novel potential tool for gene knockdown and these stably transfected cells can be used as the donor cells for animal cloning.
Efficient nanoparticle mediated sustained RNA interference in human primary endothelial cells
Energy Technology Data Exchange (ETDEWEB)
Mukerjee, Anindita; Shankardas, Jwalitha; Ranjan, Amalendu P; Vishwanatha, Jamboor K, E-mail: Jamboor.vishwanatha@unthsc.edu [Department of Molecular Biology and Immunology and Institute for Cancer Research, Graduate School of Biomedical Sciences, University of North Texas Health Science Center, Fort Worth, TX 76107 (United States)
2011-11-04
Endothelium forms an important target for drug and/or gene therapy since endothelial cells play critical roles in angiogenesis and vascular functions and are associated with various pathophysiological conditions. RNA mediated gene silencing presents a new therapeutic approach to overcome many such diseases, but the major challenge of such an approach is to ensure minimal toxicity and effective transfection efficiency of short hairpin RNA (shRNA) to primary endothelial cells. In the present study, we formulated shAnnexin A2 loaded poly(D,L-lactide-co-glycolide) (PLGA) nanoparticles which produced intracellular small interfering RNA (siRNA) against Annexin A2 and brought about the downregulation of Annexin A2. The per cent encapsulation of the plasmid within the nanoparticle was found to be 57.65%. We compared our nanoparticle based transfections with Lipofectamine mediated transfection, and our studies show that nanoparticle based transfection efficiency is very high ({approx}97%) and is more sustained compared to conventional Lipofectamine mediated transfections in primary retinal microvascular endothelial cells and human cancer cell lines. Our findings also show that the shAnnexin A2 loaded PLGA nanoparticles had minimal toxicity with almost 95% of cells being viable 24 h post-transfection while Lipofectamine based transfections resulted in only 30% viable cells. Therefore, PLGA nanoparticle based transfection may be used for efficient siRNA transfection to human primary endothelial and cancer cells. This may serve as a potential adjuvant treatment option for diseases such as diabetic retinopathy, retinopathy of prematurity and age related macular degeneration besides various cancers.
Efficient nanoparticle mediated sustained RNA interference in human primary endothelial cells
Mukerjee, Anindita; Shankardas, Jwalitha; Ranjan, Amalendu P.; Vishwanatha, Jamboor K.
2011-11-01
Endothelium forms an important target for drug and/or gene therapy since endothelial cells play critical roles in angiogenesis and vascular functions and are associated with various pathophysiological conditions. RNA mediated gene silencing presents a new therapeutic approach to overcome many such diseases, but the major challenge of such an approach is to ensure minimal toxicity and effective transfection efficiency of short hairpin RNA (shRNA) to primary endothelial cells. In the present study, we formulated shAnnexin A2 loaded poly(D,L-lactide-co-glycolide) (PLGA) nanoparticles which produced intracellular small interfering RNA (siRNA) against Annexin A2 and brought about the downregulation of Annexin A2. The per cent encapsulation of the plasmid within the nanoparticle was found to be 57.65%. We compared our nanoparticle based transfections with Lipofectamine mediated transfection, and our studies show that nanoparticle based transfection efficiency is very high (~97%) and is more sustained compared to conventional Lipofectamine mediated transfections in primary retinal microvascular endothelial cells and human cancer cell lines. Our findings also show that the shAnnexin A2 loaded PLGA nanoparticles had minimal toxicity with almost 95% of cells being viable 24 h post-transfection while Lipofectamine based transfections resulted in only 30% viable cells. Therefore, PLGA nanoparticle based transfection may be used for efficient siRNA transfection to human primary endothelial and cancer cells. This may serve as a potential adjuvant treatment option for diseases such as diabetic retinopathy, retinopathy of prematurity and age related macular degeneration besides various cancers.
Efficient nanoparticle mediated sustained RNA interference in human primary endothelial cells
International Nuclear Information System (INIS)
Mukerjee, Anindita; Shankardas, Jwalitha; Ranjan, Amalendu P; Vishwanatha, Jamboor K
2011-01-01
Endothelium forms an important target for drug and/or gene therapy since endothelial cells play critical roles in angiogenesis and vascular functions and are associated with various pathophysiological conditions. RNA mediated gene silencing presents a new therapeutic approach to overcome many such diseases, but the major challenge of such an approach is to ensure minimal toxicity and effective transfection efficiency of short hairpin RNA (shRNA) to primary endothelial cells. In the present study, we formulated shAnnexin A2 loaded poly(D,L-lactide-co-glycolide) (PLGA) nanoparticles which produced intracellular small interfering RNA (siRNA) against Annexin A2 and brought about the downregulation of Annexin A2. The per cent encapsulation of the plasmid within the nanoparticle was found to be 57.65%. We compared our nanoparticle based transfections with Lipofectamine mediated transfection, and our studies show that nanoparticle based transfection efficiency is very high (∼97%) and is more sustained compared to conventional Lipofectamine mediated transfections in primary retinal microvascular endothelial cells and human cancer cell lines. Our findings also show that the shAnnexin A2 loaded PLGA nanoparticles had minimal toxicity with almost 95% of cells being viable 24 h post-transfection while Lipofectamine based transfections resulted in only 30% viable cells. Therefore, PLGA nanoparticle based transfection may be used for efficient siRNA transfection to human primary endothelial and cancer cells. This may serve as a potential adjuvant treatment option for diseases such as diabetic retinopathy, retinopathy of prematurity and age related macular degeneration besides various cancers.
International Nuclear Information System (INIS)
Zuo, Keqiang; Li, Dan; Pulli, Benjamin; Yu, Fei; Cai, Haidong; Yuan, Xueyu; Zhang, Xiaoping; Lv, Zhongwei
2012-01-01
Highlights: ► Hsp90 is over-expressed in human breast cancer. ► The shRNA-mediated gene silencing of Hsp90 resulted in inhibition of cell growth. ► Akt and NF-kB were down-regulation after transfection due to Hsp90 silencing. ► The tumor growth ratio was decline due to Hsp90 silencing. ► The PCNA expression was down-regulation due to Hsp90 silencing. -- Abstract: Hsp90 interacts with proteins that mediate signaling pathways involved in the regulation of essential processes such as proliferation, cell cycle control, angiogenesis and apoptosis. Hsp90 inhibition is therefore an attractive strategy for blocking abnormal pathways that are crucial for cancer cell growth. In the present study, the role of Hsp90 in human breast cancer MCF-7 cells was examined by stably silencing Hsp90 gene expression with an Hsp90-silencing vector (Hsp90-shRNA). RT-PCR and Western blot analyses showed that Hsp90-shRNA specifically and markedly down-regulated Hsp90 mRNA and protein expression. NF-kB and Akt protein levels were down-regulated in Hsp90-shRNA transfected cells, indicating that Hsp90 knockout caused a reduction of survival factors and induced apoptosis. Treatment with Hsp90-shRNA significantly increased apoptotic cell death and caused cell cycle arrest in the G1/S phase in MCF-7 cells, as shown by flow cytometry. Silencing of Hsp90 also reduced cell viability, as determined by MTT assay. In vivo experiments showed that MCF-7 cells stably transfected with Hsp90-shRNA grew slowly in nude mice as compared with control groups. In summary, the Hsp90-shRNA specifically silenced the Hsp90 gene, and inhibited MCF-7 cell growth in vitro and in vivo. Possible molecular mechanisms underlying the effects of Hsp90-shRNA include the degradation of Hsp90 breast cancer-related client proteins, the inhibition of survival signals and the upregulation of apoptotic pathways. shRNA-mediated interference may have potential therapeutic utility in human breast cancer.
siRNA-mediated RNA interference in precision-cut tissue slices prepared from mouse lung and kidney
Ruigrok, Mitchel J. R.; Maggan, Nalinie; Willaert, Delphine; Frijlink, Henderik W.; Melgert, Barbro N.; Olinga, Peter; Hinrichs, Wouter L. J.
Small interfering RNA (siRNA)-mediated RNAi interference (RNAi) is a powerful post-transcriptional gene silencing mechanism which can be used to study the function of genes in vitro (cell cultures) and in vivo (animal models). However, there is a translational gap between these models. Hence, there
International Nuclear Information System (INIS)
Anesti, Anna-Maria; Simpson, Guy R; Price, Toby; Pandha, Hardev S; Coffin, Robert S
2010-01-01
Delivery of small interfering RNA (siRNA) to tumours remains a major obstacle for the development of RNA interference (RNAi)-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV) OncoVEX GM-CSF , we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA) or artificial microRNA (miRNA) against the reporter genes green fluorescent protein (eGFP) and β-galactosidase (lacZ). These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen in human clinical trials
Construction of lentiviral shRNA expression vector targeting ...
African Journals Online (AJOL)
ajl yemi
2011-10-26
Oct 26, 2011 ... was then selected, while the titer of lentiviral packing PLD2-shRNA was 3.47 × 104 TU/ml and the virus was successfully ... MATERIALS AND METHODS .... such as: transfecting cells not only in mitotic active phase but also in ...
Subramanya, Sandesh; Kim, Sang-Soo; Manjunath, N; Shankar, Premlata
2010-02-01
Despite the clinical benefits of highly active antiretroviral therapy (HAART), the prospect of life-long antiretroviral treatment poses significant problems, which has spurred interest in developing new drugs and strategies to treat HIV infection and eliminate persistent viral reservoirs. RNAi has emerged as a therapeutic possibility for HIV. We discuss progress in overcoming hurdles to translating transient and stable RNAi enabling technologies to clinical application for HIV; covering the past 2 - 3 years. HIV inhibition can be achieved by transfection of chemically or enzymatically synthesized siRNAs or by DNA-based vector systems expressing short hairpin RNAs (shRNAs) that are processed intracellularly into siRNA. We compare these approaches, focusing on technical and safety issues that will guide the choice of strategy for clinical use. Introduction of synthetic siRNA into cells or its stable endogenous production using vector-driven shRNA have been shown to suppress HIV replication in vitro and, in some instances, in vivo. Each method has advantages and limitations in terms of ease of delivery, duration of silencing, emergence of escape mutants and potential toxicity. Both appear to have potential as future therapeutics for HIV, once the technical and safety issues of each approach are overcome.
Short hairpin RNA interference therapy for ischemic heart disease
Huang, Mei; Chan, Denise; Jia, Fangjun; Xie, Xiaoyan; Li, Zongjin; Hoyt, Grant; Robbins, Robert C.; Chen, Xiaoyuan; Giaccia, Amato; Wu, Joseph C.
2013-01-01
Background During hypoxia, upregulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Here we hypothesize that short hairpin RNA (shRNA) interference therapy targeting PHD2 can be used for treatment of myocardial ischemia and this process can be followed noninvasively by molecular imaging. Methods and Results PHD2 was cloned from mouse embryonic stem (ES) cells by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted into the pSuper vector driven by the H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct was used to transfect mouse C2C12 myoblast cell line for in vitro confirmation. Compared to the control short hairpin scramble (shScramble) as control, inhibition of PHD2 increased levels of HIF-1α protein and several downstream angiogenic genes by >30% (P<0.01). Afterwards, shRNA targeting PHD2 (shPHD2) plasmid was injected intramyocardially following ligation of left anterior descending (LAD) artery in mice. Animals were randomized into shPHD2 group (n=20) versus shScramble sequence as control (n=20). Bioluminescence imaging detected transgene expression for 4–5 weeks. Echocardiographic study showed the shPHD2 group had improved fractional shortening compared with the shScramble group at week 4 (33.7%±1.9% vs. 28.4%±2.8%; P<0.05). Postmortem analysis showed increased presence of small capillaries and venules in the infarcted zones by CD31 staining. Finally, Western blot anlaysis of explanted hearts also confirm that animals treated with shPHD2 had significantly higher levels of HIF-1α protein. Conclusions This is the first study to image the biological role of shRNA therapy for improving cardiac function. Inhibition of PHD2 by shRNA led to
Neuron-specific RNA interference using lentiviral vectors
DEFF Research Database (Denmark)
Nielsen, Troels Tolstrup; Marion, Ingrid van; Hasholt, Lis
2009-01-01
BACKGROUND: Viral vectors have been used in several different settings for the delivery of small hairpin (sh) RNAs. However, most vectors have utilized ubiquitously-expressing polymerase (pol) III promoters to drive expression of the hairpin as a result of the strict requirement for precise...... transcriptional initiation and termination. Recently, pol II promoters have been used to construct vectors for RNA interference (RNAi). By embedding the shRNA into a micro RNA-context (miRNA) the endogenous miRNA processing machinery is exploited to achieve the mature synthetic miRNA (smiRNA), thereby expanding...... the possible promoter choices and eventually allowing cell type specific down-regulation of target genes. METHODS: In the present study, we constructed lentiviral vectors expressing smiRNAs under the control of pol II promoters to knockdown gene expression in cell culture and in the brain. RESULTS: We...
Directory of Open Access Journals (Sweden)
Verhaagen Joost
2010-02-01
Full Text Available Abstract Background After a spinal cord lesion, axon regeneration is inhibited by the presence of a diversity of inhibitory molecules in the lesion environment. At and around the lesion site myelin-associated inhibitors, chondroitin sulfate proteoglycans (CSPGs and several axon guidance molecules, including all members of the secreted (class 3 Semaphorins, are expressed. Interfering with multiple inhibitory signals could potentially enhance the previously reported beneficial effects of blocking single molecules. RNA interference (RNAi is a tool that can be used to simultaneously silence expression of multiple genes. In this study we aimed to employ adeno-associated virus (AAV mediated expression of short hairpin RNAs (shRNAs to target all Semaphorin class 3 signaling by knocking down its receptors, Neuropilin 1 (Npn-1 and Neuropilin 2 (Npn-2. Results We have successfully generated shRNAs that knock down Npn-1 and Npn-2 in a neuronal cell line. We detected substantial knockdown of Npn-2 mRNA when AAV5 viral vector particles expressing Npn-2 specific shRNAs were injected in dorsal root ganglia (DRG of the rat. Unexpectedly however, AAV1-mediated expression of Npn-2 shRNAs and a control shRNA in the red nucleus resulted in an adverse tissue response and neuronal degeneration. The observed toxicity was dose dependent and was not seen with control GFP expressing AAV vectors, implicating the shRNAs as the causative toxic agents. Conclusions RNAi is a powerful tool to knock down Semaphorin receptor expression in neuronal cells in vitro and in vivo. However, when shRNAs are expressed at high levels in CNS neurons, they trigger an adverse tissue response leading to neuronal degradation.
Construction of lentiviral shRNA expression vector targeting ...
African Journals Online (AJOL)
DNA oligo was cloned into lentiviral expression vector, and then polymerase chain reaction (PCR) and sequencing analyses were conducted to verify the constructs. The verified vectors were co-transfected into 293FT cells that could produce lentiviral. shRNA lentiviruses from the selected constructs were propagated and ...
International Nuclear Information System (INIS)
Rumi, Mohammad; Ishihara, Shunji; Aziz, Monowar; Kazumori, Hideaki; Ishimura, Norihisa; Yuki, Takafumi; Kadota, Chikara; Kadowaki, Yasunori; Kinoshita, Yoshikazu
2006-01-01
RNA polymerase III promoters of human ribonuclease P RNA component H1, human U6, and mouse U6 small nuclear RNA genes are commonly used in short hairpin RNA (shRNA) expression vectors due their precise initiation and termination sites. During transient transfection of shRNA vectors, we observed that H1 or U6 promoters also express longer transcripts enough to express several reporter genes including firefly luciferase, green fluorescent protein EGFP, and red fluorescent protein JRed. Expression of such longer transcripts was augmented by upstream RNA polymerase II enhancers and completely inhibited by downstream polyA signal sequences. Moreover, the transcription of firefly luciferase from human H1 promoter was sensitive to RNA polymerase II inhibitor α-amanitin. Our findings suggest that commonly used polymerase III promoters in shRNA vectors are also prone to RNA polymerase II mediated transcription, which may have negative impacts on their targeted use
Javan, Bita; Atyabi, Fatemeh; Shahbazi, Majid
2018-04-12
This investigation was conducted to construct a hypoxia/colorectal dual-specific bidirectional short hairpin RNA (shRNA) expression vector and to transfect it into the colon cancer cell line HT-29 with PEI/chitosan-TBA nanoparticles for the simultaneous knock down of β-catenin and Bcl-2 under hypoxia. To construct a pRNA-bipHRE-CEA vector, the carcinoma embryonic antigen (CEA) promoter designed in two directions and the vascular endothelial growth factor (VEGF) enhancer were inserted between two promoters for hypoxic cancer specific gene expression. To confirm the therapeutic effect of the dual-specific vector, β-catenin and Bcl-2 shRNAs were inserted downstream of each promoter. The physicochemical properties, the cytotoxicity, and the transfection efficiency of these PEI/chitosan-TBA nanoparticles were investigated. In addition, the antitumor effects of the designed vector on the expression of β-catenin and Bcl-2, cell cycle distribution, and apoptosis were investigated in vitro. The silencing effect of the hypoxia-response shRNA expression vector was relatively low (18%-25%) under normoxia, whereas it was significantly increased to approximately 50%-60% in the HT-29 cell line. Moreover, the cancer cells showed significant G0/G1 arrest and increased apoptosis due to gene silencing under hypoxia. Furthermore, MTS assay, fluorescence microscopy images, and flow cytometry analyses confirmed that the PEI/chitosan-TBA blend system provided effective transfection with low cytotoxicity. This novel hypoxia-responsive shRNA expression vector may be useful for RNA interference (RNAi)-based cancer gene therapy in hypoxic colorectal tumors. Moreover, the PEI/chitosan-TBA copolymer might be a promising gene carrier for use in gene transfer in vivo. Copyright © 2017. Published by Elsevier Inc.
Directory of Open Access Journals (Sweden)
John S Cho
2009-09-01
Full Text Available The events required to initiate host defenses against invading pathogens involve complex signaling cascades comprised of numerous adaptor molecules, kinases, and transcriptional elements, ultimately leading to the production of proinflammatory cytokines, such as tumor necrosis factor alpha (TNF-alpha. How these signaling cascades are regulated, and the proteins and regulatory elements participating are still poorly understood.We report here the development a completely random short-hairpin RNA (shRNA library coupled with a novel forward genetic screening strategy to identify inhibitors of Toll-like receptor (TLR dependent proinflammatory responses. We developed a murine macrophage reporter cell line stably transfected with a construct expressing diphtheria toxin-A (DT-A under the control of the TNF-alpha-promoter. Stimulation of the reporter cell line with the TLR ligand lipopolysaccharide (LPS resulted in DT-A induced cell death, which could be prevented by the addition of an shRNA targeting the TLR adaptor molecule MyD88. Utilizing this cell line, we screened a completely random lentiviral short hairpin RNA (shRNA library for sequences that inhibited TLR-mediated TNF-alpha production. Recovery of shRNA sequences from surviving cells led to the identification of unique shRNA sequences that significantly inhibited TLR4-dependent TNF-alpha gene expression. Furthermore, these shRNA sequences specifically blocked TLR2 but not TLR3-dependent TNF-alpha production.Thus, we describe the generation of novel tools to facilitate large-scale forward genetic screens in mammalian cells and the identification of potent shRNA inhibitors of TLR2 and TLR4- dependent proinflammatory responses.
An infinitely expandable cloning strategy plus repeat-proof PCR for working with multiple shRNA.
Directory of Open Access Journals (Sweden)
Glen John McIntyre
Full Text Available Vector construction with restriction enzymes (REs typically involves the ligation of a digested donor fragment (insert to a reciprocally digested recipient fragment (vector backbone. Creating a suitable cloning plan becomes increasingly difficult for complex strategies requiring repeated insertions such as constructing multiple short hairpin RNA (shRNA expression vectors for RNA interference (RNAi studies. The problem lies in the reduced availability of suitable RE recognition sites with an increasing number of cloning events and or vector size. This report details a technically simple, directional cloning solution using REs with compatible cohesive ends that are repeatedly destroyed and simultaneously re-introduced with each round of cloning. Donor fragments can be made by PCR or sub-cloned from pre-existing vectors and inserted ad infinitum in any combination. The design incorporates several cloning cores in order to be compatible with as many donor sequences as possible. We show that joining sub-combinations made in parallel is more time-efficient than sequential construction (of one cassette at a time for any combination of 4 or more insertions. Screening for the successful construction of combinations using Taq polymerase based PCR became increasingly difficult with increasing number of repeated sequence elements. A Pfu polymerase based PCR was developed and successfully used to amplify combinations of up to eleven consecutive hairpin expression cassettes. The identified PCR conditions can be beneficial to others working with multiple shRNA or other repeated sequences, and the infinitely expandable cloning strategy serves as a general solution applicable to many cloning scenarios.
DEFF Research Database (Denmark)
Peng, Wenfang; Feng, Mingxia; Feng, Xu
2015-01-01
CRISPR-Cas systems provide a small RNA-based mechanism to defend against invasive genetic elements in archaea and bacteria. To investigate the in vivo mechanism of RNA interference by two type III-B systems (Cmr-α and Cmr-β) in Sulfolobus islandicus, a genetic assay was developed using plasmids...... carrying an artificial mini-CRISPR (AC) locus with a single spacer. After pAC plasmids were introduced into different strains, Northern analyses confirmed that mature crRNAs were produced from the plasmid-borne CRISPR loci, which then guided gene silencing to target gene expression. Spacer mutagenesis....... islandicus Cmr-α mediated transcription-dependent DNA interference, the Cmr-α constitutes the first CRISPR system exhibiting dual targeting of RNA and DNA....
Three new shRNA expression vectors targeting the CYP3A4 coding sequence to inhibit its expression
Directory of Open Access Journals (Sweden)
Siyun Xu
2014-10-01
Full Text Available RNA interference (RNAi is useful for selective gene silencing. Cytochrome P450 3A4 (CYP3A4, which metabolizes approximately 50% of drugs in clinical use, plays an important role in drug metabolism. In this study, we aimed to develop a short hairpin RNA (shRNA to modulate CYP3A4 expression. Three new shRNAs (S1, S2 and S3 were designed to target the coding sequence (CDS of CYP3A4, cloned into a shRNA expression vector, and tested in different cells. The mixture of three shRNAs produced optimal reduction (55% in CYP3A4 CDS-luciferase activity in both CHL and HEK293 cells. Endogenous CYP3A4 expression in HepG2 cells was decreased about 50% at both mRNA and protein level after transfection of the mixture of three shRNAs. In contrast, CYP3A5 gene expression was not altered by the shRNAs, supporting the selectivity of CYP3A4 shRNAs. In addition, HepG2 cells transfected with CYP3A4 shRNAs were less sensitive to Ginkgolic acids, whose toxic metabolites are produced by CYP3A4. These results demonstrate that vector-based shRNAs could modulate CYP3A4 expression in cells through their actions on CYP3A4 CDS, and CYP3A4 shRNAs may be utilized to define the role of CYP3A4 in drug metabolism and toxicity.
[Construction of lentiviral mediated CyPA siRNA and its functions in non-small cell lung cancer].
FENG, Yan-ming; WU, Yi-ming; TU, Xin-ming; XU, Zheng-shun; WU, Wei-dong
2010-02-01
To construct a lentiviral-vector-mediated CyPA small interference RNA (siRNA) and study its function in non-small cell lung cancer. First, four target sequences were selected according to CyPA mRNA sequence, the complementary DNA contained both sense and antisense oligonucleotides were designed, synthesized and cloned into the pGCL-GFP vector, which contained U6 promoter and green fluorescent protein (GFP). The resulting lentiviral vector containing CyPA shRNA was named Lv-shCyPA, and it was confirmed by PCR and sequencing. Next, it was cotransfected by Lipofectamine 2000 along with pHelper1.0 and pHelper 2.0 into 293T cells to package lentivirus particles. At the same time, the packed virus infected non-small cell lung cancer cell (A549), the level of CyPA protein at 5 d after infection was detected by Western Blot to screen the target of CyPA. A549 were infected with Lv-shCyPA and grown as xenografts in severe combined immunodeficient mice. Cell cycle and apoptosis were measured by FCM. It was confirmed by PCR and DNA sequencing that lentiviral-vector-mediated CyPA siRNA (Lv-shCyPA) producing CyPA shRNA was constructed successfully. The titer of concentrated virus were 1 x 10(7) TU/ml. Flow cytometric analysis demonstrated G2-M phase (11.40% +/- 0.68%) was decreased relatively in A549/LvshCyPA compared with control groups (14.52% +/- 1.19%) (Ppathways may lead to new targeted therapies for non-small cell lung cancer.
Yu, Feng; Li, Hua; Bu, Xuefeng; Zhang, Yongjun
2012-01-01
To investigate the effects of integrin-β1 gene expression inhibited by shRNA on invasion of pancreatic carcinoma PANC-1 cells in vitro. The eukaryotic expression plasmid of short hairpin RNA (shRNA) targeting integrin-β1 gene (integrin-β1-shRNA) was constructed and transfected into PANC-1 cells. The expressions of integrin-β1 mRNA and protein were detected by real-time quantitative polymerase chain reaction (PCR) and western blot assay, respectively. The invasive ability of PANC-1 cells was observed with a transwell cell culture chamber and the expressions of MMP-2 and MMP-9 were assayed. Compared to the untransfected group, recombinant expression plasmid integrin-β1-shRNA resulted in reduction of integrin-β1 mRNA and protein by 78.58%±7.24% and 92.88%±3.18%, respectively and the average number of invading PANC-1 cells were decreased from 52±5 to 21±4 (pPANC-1 cells in vitro significantly.
Knock down of the myostatin gene by RNA interference increased body weight in chicken.
Bhattacharya, T K; Shukla, R; Chatterjee, R N; Dushyanth, K
2017-01-10
Myostatin is a negative regulator of muscular growth in poultry and other animals. Of several approaches, knocking down the negative regulator is an important aspect to augment muscular growth in chicken. Knock down of myostatin gene has been performed by shRNA acting against the expression of gene in animals. Two methods of knock down of gene in chicken such as embryo manipulation and sperm mediated method have been performed. The hatching percentage in embryo manipulation and sperm mediated method of knock down was 58.0 and 41.5%, respectively. The shRNA in knock down chicken enhanced body weight at 6 weeks by 26.9%. The dressing percentage and serum biochemical parameters such as SGPT and alkaline phosphatase differed significantly (Pknock down and control birds. It is concluded that knocking down the myostatin gene successfully augmented growth in chicken. Copyright © 2016 Elsevier B.V. All rights reserved.
Chen, Jie; Pan, Yuqin; He, Bangshun; Ying, Houqun; Wang, Feng; Sun, Huiling; Deng, Qiwen; Liu, Xian; Lin, Kang; Peng, Hongxin; Cho, William C; Wang, Shukui
2015-10-01
The association between CD147 and cancer stem cells (CSCs) provides a new angle for cancer treatments. The aim of this study was to investigate the biological roles of CD147 in colorectal CSCs. The Oct4-green fluorescent protein (GFP) vector was used to isolate CSCs and pYr-mir30-shRNA was used to generate short hairpin RNA (shRNA) specifically for CD147. After RNA interference (RNAi), CD147 was evaluated by reverse transcription‑quantitative PCR and western blot analysis, and its biological functions were assessed by MTT and invasion assays. The results showed that the differentiation of isolated CSC-like HT-29 cells was blocked and these cells were highly positive for CD44 and CD147. RNAi-mediated CD147 silencing reduced the expression of CD147 at both mRNA and protein levels. Moreover, the activities of proliferation and invasion were decreased obviously in CSCs. Knockdown of CD147 increased the chemosensitivity of CSC-like cells to gemcitabine, cisplatin, docetaxel at 0.1, 1 and 10 µM respectively, however, there was no significant difference among the three groups to paclitaxel at 10 µM. In conclusion, these results suggest that CD147 plays an important role in colorectal CSCs and might be regarded as a novel CSC-specific targeted strategy against colorectal cancer.
Directory of Open Access Journals (Sweden)
Tae Kwann Park
2017-09-01
Full Text Available Choroidal neovascularization (CNV is the defining characteristic feature of the wet subtype of age-related macular degeneration (AMD and may result in irreversible blindness. Based on anti-vascular endothelial growth factor (anti-VEGF, the current therapeutic approaches to CNV are fraught with difficulties, and mammalian target of rapamycin (mTOR has recently been proposed as a possible therapeutic target, although few studies have been conducted. Here, we show that a recombinant adeno-associated virus-delivered mTOR-inhibiting short hairpin RNA (rAAV-mTOR shRNA, which blocks the activity of both mTOR complex 1 and 2, represents a promising therapeutic approach for the treatment of CNV. Eight-week-old male C57/B6 mice were treated with the short hairpin RNA (shRNA after generating CNV lesions in the eyes via laser photocoagulation. The recombinant adeno-associated virus (rAAV delivery vehicle was able to effectively transduce cells in the inner retina, and significantly fewer inflammatory cells and less extensive CNV were observed in the animals treated with rAAV-mTOR shRNA when compared with control- and rAAV-scrambled shRNA-treated groups. Presumably related to the reduction of CNV, increased autophagy was detected in CNV lesions treated with rAAV-mTOR shRNA, whereas significantly fewer apoptotic cells detected in the outer nuclear layer around the CNV indicate that mTOR inhibition may also have neuroprotective effects. Taken together, these results demonstrate the therapeutic potential of mTOR inhibition, resulting from rAAV-mTOR shRNA activity, in the treatment of AMD-related CNV. Keywords: retinal neovascularization, choroidal neovascularization, adeno-associated virus, mTOR, RNA interference, mTOR shRNA, autophagy
Buluwela, Laki; Kamalati, Tahereh; Photiou, Andy; Heathcote, Dean A.; Jones, Michael D.; Ali, Simak
2010-01-01
RNA mediated gene interference (RNAi) is now a key tool in eukaryotic cell and molecular biology research. This article describes a five session laboratory practical, spread over a seven day period, to introduce and illustrate the technique. During the exercise, students working in small groups purify PCR products that encode "in vitro"…
RNA interference-mediated intrinsic antiviral immunity in invertebrates.
Nayak, Arabinda; Tassetto, Michel; Kunitomi, Mark; Andino, Raul
2013-01-01
In invertebrates such as insects and nematodes, RNA interference (RNAi) provides RNA-based protection against viruses. This form of immunity restricts viral replication and dissemination from infected cells and viruses, in turn, have evolved evasion mechanisms or RNAi suppressors to counteract host defenses. Recent advances indicate that, in addition to RNAi, other related small RNA pathways contribute to antiviral functions in invertebrates. This has led to a deeper understanding of fundamental aspects of small RNA-based antiviral immunity in invertebrates and its contribution to viral spread and pathogenesis.
Directory of Open Access Journals (Sweden)
Yu Jin
2008-07-01
Full Text Available Abstract Background The objective was to understand the influence of Survivin plasmid with short hairpin RNA (shRNA on the cell cycle, invasion, and the silencing effect of Survivin gene in the SW480 cell of colorectal carcinoma. Methods A eukaryotic expression vector, PGCH1/Survivin shRNA, a segment sequence of Survivin as target, was created and transfected into colorectal carcinoma cell line SW480 by the non-lipid method. The influence on the Survivin protein was analyzed by Western blotting, while the cell cycle, cell apoptosis were analyzed by flow cytometry, and invasion of the cell was analyzed by Transwell's chamber method. Results After the transfection of PGCH1/Survivin shRNA, the expression of Survivin protein in SW480 cells was dramatically decreased by 60.68%, in which the cells were stopped at G2/M phase, even though no apoptosis was detected. The number of transmembranous cells of the experimental group, negative control group, and blank control group were 14.46 ± 2.11, 25.12 ± 8.37, and 25.86 ± 7.45, respectively (P 0.05. Conclusion Survivin shRNA could significantly reduce the expression of Survivin protein and invasion of SW480 cells. Changes in cell cycle were observed, but no apoptosis was induced.
Directory of Open Access Journals (Sweden)
Jialin Song
2016-08-01
Full Text Available Small interfering RNA (siRNA is an effective and specific method for silencing genes. However, an efficient and nontoxic carrier is needed to deliver the siRNA into the target cells. Tumor necrosis factor α (TNF-α plays a central role in the occurrence and progression of rheumatoid arthritis. In this study, we pre-synthetized a degradable cationic polymer (PDAPEI from 2,6-pyridinedicarboxaldehyde and low molecular weight polyethyleneimine (PEI, Mw=1.8 kDa as a gene vector for the delivery of TNF-α shRNA. The PDAPEI/pDNA complex showed a suitable particle size and stable zeta potential for transfection. In vitro study of the PDAPEI/pDNA complex revealed a lower cytotoxicity and higher transfection efficiency when transfecting TNF-α shRNA to macrophages by significantly down-regulating the expression of TNF-α. Moreover, the complex was extremely efficient in decreasing the severity of arthritis in mice with collagen-induced arthritis (CIA. PDAPEI delivered TNF-α shRNA has great potential in the treatment of rheumatoid arthritis.
RNA interference mediated pten knock-down inhibit the formation of polycystic ovary.
Ouyang, Jie-Xiu; Luo, Tao; Sun, Hui-Yun; Huang, Jian; Tang, Dan-Feng; Wu, Lei; Zheng, Yue-Hui; Zheng, Li-Ping
2013-08-01
Pten (phosphatase and tensin homolog deleted on chromosome 10), a kind of tumor suppressor gene, plays important roles in female reproductive system. But its expression and roles in the formation of polycystic ovaries are yet to be known. In this study, we constructed a rat model of PCOS using norethindrone and HCG injections and found the expressions of pten mRNA and PTEN protein increased significantly in the polycystic ovary tissue by immunohistochemistry, RT-PCR, and western blot. Furthermore, the results showed that in vivo ovaries could be effectively transfected by lentiviral vectors through the ovarian microinjection method and indicated that pten shRNA may inhibit the formation of polycystic ovaries by pten down-regulation. Our study provides new information regarding the role of PTEN in female reproductive disorders, such as polycystic ovary syndrome.
Directory of Open Access Journals (Sweden)
Hai-Bo Xing
2018-01-01
Full Text Available Pancreatic adenocarcinoma has an exceedingly poor prognosis, accounting for five-year survival of less than 5%. Presently, improving the efficacy of pancreatic adenocarcinoma treatment has been the focus of medical researchers worldwide. Recently, it has been suggested that deregulation of interleukin- (IL- 6 is caused by a key gene involved in the beginning and development of pancreatic adenocarcinoma. Herein, we investigated whether suppression of IL-6 could augment gemcitabine sensitivity in the PANC-1 cells. We found considerably higher expression of IL-6 in pancreatic adenocarcinoma tissues than that in the adjacent nontumorous tissues. Suppression of IL-6 by shRNA resulted in apoptosis as well as inhibition of cell proliferation and tumorigenicity. In addition, suppression of IL-6 remarkably promoted antitumor effect of gemcitabine, indicating that the combination of shRNA targeting IL-6 with gemcitabine may provide a potential clinical approach for pancreatic cancer therapy.
Whitten, Miranda; Dyson, Paul
2017-03-01
Insight into animal biology and development provided by classical genetic analysis of the model organism Drosophila melanogaster was an incentive to develop advanced genetic tools for this insect. But genetic systems for the over one million other known insect species are largely undeveloped. With increasing information about insect genomes resulting from next generation sequencing, RNA interference is now the method of choice for reverse genetics, although it is constrained by the means of delivery of interfering RNA. A recent advance to ensure sustained delivery with minimal experimental intervention or trauma to the insect is to exploit commensal bacteria for symbiont-mediated RNA interference. This technology not only offers an efficient means for RNA interference in insects in laboratory conditions, but also has potential for use in the control of human disease vectors, agricultural pests and pathogens of beneficial insects. © 2017 WILEY Periodicals, Inc.
Yang, Jing; Wang, Rong; Li, Hongjiang; Lv, Qing; Meng, Wentong; Yang, Xiaoqin
2016-07-08
Overexpression of extracellular matrix metalloproteinase inducer (EMMPRIN) or cluster of differentiation 147 (CD147), a glycoprotein enriched on the plasma membrane of tumor cells, promotes proliferation, invasion, metastasis, and survival of malignant tumor cells. In this study, we sought to examine the expression of EMMPRIN in breast tumors, and to identify the potential roles of EMMPRIN on breast cancer cells. EMMPRIN expression in breast cancer tissues was assessed by immunohistochemistry. We used a lentivirus vector-based RNA interference (RNAi) approach expressing short hairpin RNA (shRNA) to knockdown EMMPRIN gene in breast cancer cell lines MDA-MB-231 and MCF-7. In vitro, Cell proliferative, invasive potential were determined by Cell Counting Kit (CCK-8), cell cycle analysis and matrigel invasion assay, respectively. In vivo, tumorigenicity was monitored by inoculating tumor cells into breast fat pad of female nude mice. EMMPRIN was over-expressed in breast tumors and breast cancer cell lines. Down-regulation of EMMPRIN by lentivirus vector-based RNAi led to decreased cell proliferative, decreased matrigel invasion in vitro, and attenuated tumor formation in vivo. High expression of EMMPRIN plays a crucial role in breast cancer cell proliferation, matrigel invasion and tumor formation.
Wang, Wen-Xia; Sun, Shan-Zhen; Song, Ying
2008-06-01
To construct a short hairpin RNA(shRNA) interference expression plasmid vector of survivin gene, transfect tongue squamous cell carcinoma line Tca8113 which expressed survivin gene in a high level, and choose the cells whose survivin gene were suppressed significantly. Two pairs of oligonucleotide sequences specific for survivin gene were designed and synthesized, and cloned into pSilencer-2.1U6-neo plasmid. The recombinant plasmids (named PS1 and PS2) were amplified in Ecoli. DH5alpha was identified by restriction digestion, PCR and sequencing. The vectors were transfected into Tca8113 cells with lipofectamine 2000. After selection with G418, the stable cell clones were attained. Survivn expression was assayed with real-time quantitative PCR and Western blotting. SAS8.0 software package was used for Student t test. Two vectors were constructed successfully and stable cell clones with PS1 or PS2 plasmid were obtained. As compared with those of control, survivin expression of transfected cell with PS1 or PS2 in mRNA level was significantly suppressed (P<0.05). In protein level, only those of transfected cell with PS2 was significantly suppressed (P<0.01). The shRNA interference expression plasmid vectors of survivin gene are successfully constructed, and Tca8113 cells which express survivin gene in a stable lower level are attained, which enable us to carry out further research on gene therapy of oral squamous cell carcinoma. Supported by National Natural Science Foundation of China (Grant No.30572056).
Directory of Open Access Journals (Sweden)
Shin-ichiro Kojima
2014-02-01
Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.
Directory of Open Access Journals (Sweden)
Shin-ichiro Kojima
2014-05-01
Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.
Shih, Yao-Ming; Sun, Cheng-Pu; Chou, Hui-Hsien; Wu, Tzu-Hui; Chen, Chun-Chi; Wu, Ping-Yi; Enya Chen, Yu-Chen; Bissig, Karl-Dimiter; Tao, Mi-Hua
2015-01-01
Selection of escape mutants with mutations within the target sequence could abolish the antiviral RNA interference activity. Here, we investigated the impact of a pre-existing shRNA-resistant HBV variant on the efficacy of shRNA therapy. We previously identified a highly potent shRNA, S1, which, when delivered by an adeno-associated viral vector, effectively inhibits HBV replication in HBV transgenic mice. We applied the “PICKY” software to systemically screen the HBV genome, then used hydrodynamic transfection and HBV transgenic mice to identify additional six highly potent shRNAs. Human liver chimeric mice were infected with a mixture of wild-type and T472C HBV, a S1-resistant HBV variant, and then treated with a single or combined shRNAs. The presence of T472C mutant compromised the therapeutic efficacy of S1 and resulted in replacement of serum wild-type HBV by T472C HBV. In contrast, combinatorial therapy using S1 and P28, one of six potent shRNAs, markedly reduced titers for both wild-type and T472C HBV. Interestingly, treatment with P28 alone led to the emergence of escape mutants with mutations in the P28 target region. Our results demonstrate that combinatorial RNAi therapy can minimize the escape of resistant viral mutants in chronic HBV patients. PMID:26482836
RDE-2 interacts with MUT-7 to mediate RNA interference in Caenorhabditis elegans.
Tops, Bastiaan B J; Tabara, Hiroaki; Sijen, Titia; Simmer, Femke; Mello, Craig C; Plasterk, Ronald H A; Ketting, René F
2005-01-01
In Caenorhabditis elegans, the activity of transposable elements is repressed in the germline. One of the mechanisms involved in this repression is RNA interference (RNAi), a process in which dsRNA targets cleavage of mRNAs in a sequence-specific manner. The first gene found to be involved in RNAi and transposon silencing in C.elegans is mut-7, a gene encoding a putative exoribonuclease. Here, we show that the MUT-7 protein resides in complexes of approximately 250 kDa in the nucleus and in the cytosol. In addition, we find that upon triggering of RNAi the cytosolic MUT-7 complex increases in size. This increase is independent of the presence of target RNA, but does depend on the presence of RDE-1 and RDE-4, two proteins involved in small interfering RNA (siRNA) production. Finally, using a yeast two-hybrid screen, we identified RDE-2/MUT-8 as one of the other components of this complex. This protein is encoded by the rde-2/mut-8 locus, previously implicated in RNAi and transposon silencing. Using genetic complementation analysis, we show that the interaction between these two proteins is required for efficient RNAi in vivo. Together these data support a role for the MUT-7/RDE-2 complex downstream of siRNA formation, but upstream of siRNA mediated target RNA recognition, possibly indicating a role in the siRNA amplification step.
Fujioka, Takashi; Matsunaga, Naoya; Okazaki, Hiroyuki; Koyanagi, Satoru; Ohdo, Shigehiro
2010-01-01
Hypoxia-induced gene expression frequently occurs in malignant solid tumors because they often have hypoxic areas in which circulation is compromised due to structurally disorganized blood vessels. Hypoxia-response elements (HREs) are responsible for activating gene transcription in response to hypoxia. In this study, we constructed a hypoxia-response plasmid vector producing short hairpin RNA (shRNA) against B-cell leukemia/lymphoma-2 (bcl-2), an anti-apoptotic factor. The hypoxia-response promoter was made by inserting tandem repeats of HREs upstream of cytomegalovirus (CMV) promoter (HRE-CMV). HRE-CMV shbcl-2 vector consisted of bcl-2 shRNA under the control of HRE-CMV promoter. In hypoxic mouse rectum carcinoma cells (colon-26), the production of bcl-2 shRNA driven by HRE-CMV promoter was approximately 2-fold greater than that driven by CMV promoter. A single intratumoral (i.t.) injection of 40 microg HRE-CMV shbcl-2 to colon-26 tumor-bearing mice caused apoptotic cell death, and repetitive treatment with HRE-CMV shbcl-2 (40 microg/mouse, i.t.) also significantly suppressed the growth of colon-26 tumor cells implanted in mice. Apoptotic and anti-tumor effects were not observed in tumor-bearing mice treated with CMV shbcl-2. These results reveal the ability of HRE-CMV shbcl-2 vector to suppress the expression of bcl-2 in hypoxic tumor cells and suggest the usefulness of our constructed hypoxia-response plasmid vector to treat malignant tumors. [Supplementary Figures: available only at http://dx.doi.org/10.1254/jphs.10054FP].
Cohen, Ami; Whitfield, Timothy W; Kreifeldt, Max; Koebel, Pascale; Kieffer, Brigitte L; Contet, Candice; George, Olivier; Koob, George F
2014-01-01
Dynorphins, endogenous opioid peptides that arise from the precursor protein prodynorphin (Pdyn), are hypothesized to be involved in the regulation of mood states and the neuroplasticity associated with addiction. The current study tested the hypothesis that dynorphin in the nucleus accumbens (NAcc) mediates such effects. More specifically, we examined whether knockdown of Pdyn within the NAcc in rats would alter the expression of depressive-like and anxiety-like behavior, as well as cocaine locomotor sensitization. Wistar rats were injected with adeno-associated viral (AAV) vectors encoding either a Pdyn-specific short hairpin RNA (AAV-shPdyn) or a scrambled shRNA (AAV-shScr) as control. Four weeks later, rats were tested for anxiety-like behavior in the elevated plus maze test and depressive-like behavior in the forced swim test (FST). Finally, rats received one daily injection of saline or cocaine (20 mg/kg, i.p.), followed by assessment of locomotion for 4 consecutive days. Following 3 days of abstinence, the rats completed 2 additional daily cocaine/saline locomotor trials. Pdyn knockdown in the NAcc led to a significant reduction in depressive-like behavior in the FST, but had no effect on anxiety-like behavior in the elevated plus maze. Pdyn knockdown did not alter baseline locomotor behavior, the locomotor response to acute cocaine, or the initial sensitization of the locomotor response to cocaine over the first 4 cocaine treatment days. However, following 3 days abstinence the locomotor response to the cocaine challenge returned to their original levels in the AAV-shPdyn rats while remaining heightened in the AAV-shScr rats. These results suggest that dynorphin in a very specific area of the nucleus accumbens contributes to depressive-like states and may be involved in neuroadaptations in the NAcc that contribute to the development of cocaine addiction as a persistent and lasting condition.
Directory of Open Access Journals (Sweden)
Ami Cohen
Full Text Available Dynorphins, endogenous opioid peptides that arise from the precursor protein prodynorphin (Pdyn, are hypothesized to be involved in the regulation of mood states and the neuroplasticity associated with addiction. The current study tested the hypothesis that dynorphin in the nucleus accumbens (NAcc mediates such effects. More specifically, we examined whether knockdown of Pdyn within the NAcc in rats would alter the expression of depressive-like and anxiety-like behavior, as well as cocaine locomotor sensitization. Wistar rats were injected with adeno-associated viral (AAV vectors encoding either a Pdyn-specific short hairpin RNA (AAV-shPdyn or a scrambled shRNA (AAV-shScr as control. Four weeks later, rats were tested for anxiety-like behavior in the elevated plus maze test and depressive-like behavior in the forced swim test (FST. Finally, rats received one daily injection of saline or cocaine (20 mg/kg, i.p., followed by assessment of locomotion for 4 consecutive days. Following 3 days of abstinence, the rats completed 2 additional daily cocaine/saline locomotor trials. Pdyn knockdown in the NAcc led to a significant reduction in depressive-like behavior in the FST, but had no effect on anxiety-like behavior in the elevated plus maze. Pdyn knockdown did not alter baseline locomotor behavior, the locomotor response to acute cocaine, or the initial sensitization of the locomotor response to cocaine over the first 4 cocaine treatment days. However, following 3 days abstinence the locomotor response to the cocaine challenge returned to their original levels in the AAV-shPdyn rats while remaining heightened in the AAV-shScr rats. These results suggest that dynorphin in a very specific area of the nucleus accumbens contributes to depressive-like states and may be involved in neuroadaptations in the NAcc that contribute to the development of cocaine addiction as a persistent and lasting condition.
Directory of Open Access Journals (Sweden)
Li eJiang
2014-04-01
Full Text Available RNA interference (RNAi knockdown is an efficacious therapeutic strategy for silencing genes causative for dominant retinal dystrophies. To test this, we used self-complementary (sc AAV2/8 vector to develop an RNAi-based therapy in two dominant retinal degeneration mouse models. The allele-specific model expresses transgenic bovine GCAP1(Y99C establishing a rapid RP-like phenotype, whereas the nonallele-specific model expresses mouse GCAP1(L151F producing a slowly progressing cone/rod dystrophy (CORD. The late onset GCAP1(L151F-CORD mimics the dystrophy observed in human GCAP1-CORD patients. Subretinal injection of scAAV2/8 carrying shRNA expression cassettes specific for bovine or mouse GCAP1 showed strong expression at one week post-injection. In both allele-specific (GCAP1(Y99C-RP and nonallele-specific (GCAP1(L151F-CORD models of dominant retinal dystrophy, RNAi-mediated gene silencing enhanced photoreceptor survival, delayed onset of degeneration and improved visual function. Such results provide a proof of concept toward effective RNAi-based gene therapy mediated by scAAV2/8 for dominant retinal disease based on GCAP1 mutation. Further, nonallele-specific RNAi knockdown of GCAP1 may prove generally applicable toward the rescue of any human GCAP1-based dominant cone-rod dystrophy.
A fast, simple method for screening radiation susceptibility genes by RNA interference
International Nuclear Information System (INIS)
Tsuji, Atsushi B.; Sudo, Hitomi; Sugyo, Aya; Otsuki, Marika; Miyagishi, Makoto; Taira, Kazunari; Imai, Takashi; Harada, Yoshi-nobu
2005-01-01
Radiotherapy can cause unacceptable levels of damage to normal tissues in some cancer patients. To understand the molecular mechanisms underlying radiation-induced physiological responses, and to be able to predict the radiation susceptibility of normal tissues in individual patients, it is important to identify a comprehensive set of genes responsible for radiation susceptibility. We have developed a simple and rapid 96-well screening protocol using cell proliferation assays and RNA interference to identify genes associated with radiation susceptibility. We evaluated the performance of alamarBlue-, BrdU-, and sulforhodamine B-based cell proliferation assays using the 96-well format. Each proliferation assay detected the known radiation susceptibility gene, PRKDC. In a trial screen using 28 shRNA vectors, another known gene, CDKN1A, and one new radiation susceptibility gene, ATP5G3, were identified. Our results indicate that this method may be useful for large-scale screens designed to identify novel radiation susceptibility genes
Shortcomings of short hairpin RNA-based transgenic RNA interference in mouse oocytes
Czech Academy of Sciences Publication Activity Database
Sarnová, Lenka; Malík, Radek; Sedláček, Radislav; Svoboda, Petr
2010-01-01
Roč. 9, č. 8 (2010), s. 1-10 ISSN 1477-5751 R&D Projects: GA MŠk ME09039 Grant - others:EMBO SDIG(DE) project 1483 Institutional research plan: CEZ:AV0Z50520514 Keywords : transgenic RNAi * shRNA * oocyte Subject RIV: EB - Genetics ; Molecular Biology http://www.jnrbm.com/content/9/1/8
Understanding the core of RNA interference: The dynamic aspects of Argonaute-mediated processes
Zhu, Lizhe
2016-10-05
At the core of RNA interference, the Argonaute proteins (Ago) load and utilize small guide nucleic acids to silence mRNAs or cleave foreign nucleic acids in a sequence specific manner. In recent years, based on extensive structural studies of Ago and its interaction with the nucleic acids, considerable progress has been made to reveal the dynamic aspects of various Ago-mediated processes. Here we review these novel insights into the guide-strand loading, duplex unwinding, and effects of seed mismatch, with a focus on two representative Agos, the human Ago 2 (hAgo2) and the bacterial Thermus thermophilus Ago (TtAgo). In particular, comprehensive molecular simulation studies revealed that although sharing similar overall structures, the two Agos have vastly different conformational landscapes and guide-strand loading mechanisms because of the distinct rigidity of their L1-PAZ hinge. Given the central role of the PAZ motions in regulating the exposure of the nucleic acid binding channel, these findings exemplify the importance of protein motions in distinguishing the overlapping, yet distinct, mechanisms of Ago-mediated processes in different organisms.
Shortcomings of short hairpin RNA-based transgenic RNA interference in mouse oocytes
Czech Academy of Sciences Publication Activity Database
Sarnová, Lenka; Malík, Radek; Sedláček, Radislav; Svoboda, Petr
2010-01-01
Roč. 9, č. 8 (2010), s. 1-10 ISSN 1477-5751 R&D Project s: GA MŠk ME09039 Grant - others:EMBO SDIG(DE) project 1483 Institutional research plan: CEZ:AV0Z50520514 Keywords : transgenic RNAi * shRNA * oocyte Subject RIV: EB - Genetics ; Molecular Biology http://www.jnrbm.com/content/9/1/8
Directory of Open Access Journals (Sweden)
Yao Hailan
2012-08-01
Full Text Available Abstract Background Coxsackievirus B3 is an important infectious agent of viral myocarditis, pancreatitis and aseptic meningitis, but there are no specific antiviral therapeutic reagents in clinical use. RNA interference-based technology has been developed to prevent the viral infection. Methods To evaluate the impact of RNA interference on viral replication, cytopathogenicity and animal survival, short hairpin RNAs targeting the viral 2B region (shRNA-2B expressed by a recombinant vector (pGCL-2B or a recombinant lentivirus (Lenti-2B were tansfected in HeLa cells or transduced in mice infected with CVB3. Results ShRNA-2B exhibited a significant effect on inhibition of viral production in HeLa cells. Furthermore, shRNA-2B improved mouse survival rate, reduced the viral tissues titers and attenuated tissue damage compared with those of the shRNA-NC treated control group. Lenti-2B displayed more effective role in inhibition of viral replication than pGCL-2B in vivo. Conclusions Coxsackievirus B3 2B is an effective target of gene silencing against coxsackievirus B3 infection, suggesting that shRNA-2B is a potential agent for further development into a treatment for enterviral diseases.
Directory of Open Access Journals (Sweden)
Chang Myint OO
2009-10-01
Full Text Available Abstract Background Hepatitis C virus (HCV is one of the main causes of liver-related morbidity and mortality. Although combined interferon-α-ribavirin therapy is effective for about 50% of the patients with HCV, better therapies are needed and preventative vaccines have yet to be developed. Short-hairpin RNAs (shRNAs inhibit gene expression by RNA interference. The application of transient shRNA expression is limited, however, due to the inability of the shRNA to replicate in mammalian cells and its inefficient transduction. The duration of transgene (shRNA expression in mammalian cells can be significantly extended using baculovirus-based shRNA-expressing vectors that contain the latent viral protein Epstein-Barr nuclear antigen 1 (EBNA1 and the origin of latent viral DNA replication (OriP sequences. These recombinant vectors contain compatible promoters and are highly effective for infecting primary hepatocyte and hepatoma cell lines, making them very useful tools for studies of hepatitis B and hepatitis C viruses. Here, we report the use of these baculovirus-based vector-derived shRNAs to inhibit core-protein expression in full-length hepatitis C virus (HCV replicon cells. Results We constructed a long-term transgene shRNA expression vector that contains the EBV EBNA1 and OriP sequences. We also designed baculovirus vector-mediated shRNAs against the highly conserved core-protein region of HCV. HCV core protein expression was inhibited by the EBNA1/OriP baculovirus vector for at least 14 days, which was considerably longer than the 3 days of inhibition produced by the wild-type baculovirus vector. Conclusion These findings indicate that we successfully constructed a long-term transgene (shRNA expression vector (Ac-EP-shRNA452 using the EBNA1/OriP system, which was propagated in Escherichia coli and converted into mammalian cells. The potential anti-HCV activity of the long-term transgene (shRNA expression vector was evaluated with the view
International Nuclear Information System (INIS)
Doi, Nobutaka; Ogawa, Ryohei; Cui, Zheng-Guo; Morii, Akihiro; Watanabe, Akihiko; Kanayama, Shinji; Yoneda, Yuko; Kondo, Takashi
2015-01-01
The cancer cells residing in the hypoxic layer are resistant to radiation and these are ones responsible for cancer recurrence after radiation therapy. One of the reasons why hypoxic cancer cells acquire radioresistance may be attributable to changes in the gene expression profile by the activation of hypoxia inducible factors (HIFs). However, the details underlying this process remain unknown. In this study, we investigated the effects of knockdown of HIF subunit genes to elucidate how HIF subunit genes may be involved in the radioresistance acquired by HeLa cells following exposure to a hypoxia mimic. Interestingly, HIF-1α and HIF-2α seemed mutually complementary for each other when either of them was suppressed. We thus suppressed the expression of both genes simultaneously. To do this, we developed a short hairpin RNA (shRNA) targeting a high homology region between HIF-1α and HIF-2α. It was shown that the expression of the shRNA effectively suppressed the acquisition of radioresistance following the hypoxia mimic. Moreover, it was confirmed that suppression of both subunits resulted in the downregulation of stem cell markers and the suppression of spheroid formation during the hypoxia mimicking-conditions. This shRNA-mediated knockdown method targeting a common region shared by a family of genes may offer a new candidate cancer treatment. - Highlights: • Incubation with CoCl 2 confers radioresistance to HeLa cells. • Both HIF-1α and HIF-2α are involved in the acquisition of radioresistance. • An shRNA to a homology region of HIF-1α and HIF-2α suppressed the radioresistance. • The shRNA decreased cells with stem cell markers and a stem cell phenotype
Energy Technology Data Exchange (ETDEWEB)
Doi, Nobutaka [Department of Radiological Sciences, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama 930-0194 (Japan); New Products Research & Development, Gene Engineering Division, NIPPON GENE Co., Ltd. (Japan); Ogawa, Ryohei, E-mail: ogawa@med.u-toyama.ac.jp [Department of Radiological Sciences, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama 930-0194 (Japan); Cui, Zheng-Guo [Department of Public Health, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama (Japan); Morii, Akihiro; Watanabe, Akihiko [Department of Urology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama (Japan); Kanayama, Shinji; Yoneda, Yuko [New Products Research & Development, Gene Engineering Division, NIPPON GENE Co., Ltd. (Japan); Kondo, Takashi [Department of Radiological Sciences, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama 930-0194 (Japan)
2015-05-01
The cancer cells residing in the hypoxic layer are resistant to radiation and these are ones responsible for cancer recurrence after radiation therapy. One of the reasons why hypoxic cancer cells acquire radioresistance may be attributable to changes in the gene expression profile by the activation of hypoxia inducible factors (HIFs). However, the details underlying this process remain unknown. In this study, we investigated the effects of knockdown of HIF subunit genes to elucidate how HIF subunit genes may be involved in the radioresistance acquired by HeLa cells following exposure to a hypoxia mimic. Interestingly, HIF-1α and HIF-2α seemed mutually complementary for each other when either of them was suppressed. We thus suppressed the expression of both genes simultaneously. To do this, we developed a short hairpin RNA (shRNA) targeting a high homology region between HIF-1α and HIF-2α. It was shown that the expression of the shRNA effectively suppressed the acquisition of radioresistance following the hypoxia mimic. Moreover, it was confirmed that suppression of both subunits resulted in the downregulation of stem cell markers and the suppression of spheroid formation during the hypoxia mimicking-conditions. This shRNA-mediated knockdown method targeting a common region shared by a family of genes may offer a new candidate cancer treatment. - Highlights: • Incubation with CoCl{sub 2} confers radioresistance to HeLa cells. • Both HIF-1α and HIF-2α are involved in the acquisition of radioresistance. • An shRNA to a homology region of HIF-1α and HIF-2α suppressed the radioresistance. • The shRNA decreased cells with stem cell markers and a stem cell phenotype.
CasA mediates Cas3-catalyzed target degradation during CRISPR RNA-guided interference.
Hochstrasser, Megan L; Taylor, David W; Bhat, Prashant; Guegler, Chantal K; Sternberg, Samuel H; Nogales, Eva; Doudna, Jennifer A
2014-05-06
In bacteria, the clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) DNA-targeting complex Cascade (CRISPR-associated complex for antiviral defense) uses CRISPR RNA (crRNA) guides to bind complementary DNA targets at sites adjacent to a trinucleotide signature sequence called the protospacer adjacent motif (PAM). The Cascade complex then recruits Cas3, a nuclease-helicase that catalyzes unwinding and cleavage of foreign double-stranded DNA (dsDNA) bearing a sequence matching that of the crRNA. Cascade comprises the CasA-E proteins and one crRNA, forming a structure that binds and unwinds dsDNA to form an R loop in which the target strand of the DNA base pairs with the 32-nt RNA guide sequence. Single-particle electron microscopy reconstructions of dsDNA-bound Cascade with and without Cas3 reveal that Cascade positions the PAM-proximal end of the DNA duplex at the CasA subunit and near the site of Cas3 association. The finding that the DNA target and Cas3 colocalize with CasA implicates this subunit in a key target-validation step during DNA interference. We show biochemically that base pairing of the PAM region is unnecessary for target binding but critical for Cas3-mediated degradation. In addition, the L1 loop of CasA, previously implicated in PAM recognition, is essential for Cas3 activation following target binding by Cascade. Together, these data show that the CasA subunit of Cascade functions as an essential partner of Cas3 by recognizing DNA target sites and positioning Cas3 adjacent to the PAM to ensure cleavage.
Energy Technology Data Exchange (ETDEWEB)
Merritt, William M.; Lin, Yvonne G.; Han, Liz Y.; Kamat, Aparna A.; Spannuth, Whitney A.; Schmandt, Rosemarie; Urbauer, Diana; Pennacchio, Len A.; Cheng, Jan-Fang; Zeidan, Alexandra; Wang, Hua; Mueller, Peter; Lenburg, Marc E.; Gray, Joe W.; Mok, Samuel; Birrer, Michael J.; Lopez-Berestein, Gabriel; Coleman, Robert L.; Bar-Eli, Menashe; Sood, Anil K.
2008-05-06
The clinical and functional significance of RNA interference (RNAi) machinery, Dicer and Drosha, in ovarian cancer is not known and was examined. Dicer and Drosha expression was measured in ovarian cancer cell lines (n=8) and invasive epithelial ovarian cancer specimens (n=111) and correlated with clinical outcome. Validation was performed with previously published cohorts of ovarian, breast, and lung cancer patients. Anti-Galectin-3 siRNA and shRNA transfections were used for in vitro functional studies. Dicer and Drosha mRNA and protein levels were decreased in 37% to 63% of ovarian cancer cell lines and in 60% and 51% of human ovarian cancer specimens, respectively. Low Dicer was significantly associated with advanced tumor stage (p=0.007), and low Drosha with suboptimal surgical cytoreduction (p=0.02). Tumors with both high Dicer and Drosha were associated with increased median patient survival (>11 years vs. 2.66 years for other groups; p<0.001). In multivariate analysis, high Dicer (HR=0.48; p=0.02), high-grade histology (HR=2.46; p=0.03), and poor chemoresponse (HR=3.95; p<0.001) were identified as independent predictors of disease-specific survival. Findings of poor clinical outcome with low Dicer expression were validated in separate cohorts of cancer patients. Galectin-3 silencing with siRNA transfection was superior to shRNA in cell lines with low Dicer (78-95% vs. 4-8% compared to non-targeting sequences), and similar in cell lines with high Dicer. Our findings demonstrate the clinical and functional impact of RNAi machinery alterations in ovarian carcinoma and support the use of siRNA constructs that do not require endogenous Dicer and Drosha for therapeutic applications.
Chen, ChengShi; Liu, Rong; Wang, JianHua; Yan, ZhiPing; Qian, Sheng; Zhang, Wei
2015-04-01
The obstruction of hepatic arterial blood flow results in tumor tissue hypoxia and elevated expression of hypoxia-inducible factor-1alpha (HIF-1α). Our study evaluated whether lentivirus-mediated short interference RNA against HIF-1α inhibits proliferation, invasion, and migration of hepatocellular carcinoma (HCC) cells under hypoxia. RNA interference knockdown of HIF-1α was achieved by HIF-1α-directed lentiviral shRNA, in a rat HCC cell line cultured under hypoxia condition for varying length of times. The expression levels of HIF-1α and vascular endothelial growth factor were examined using reverse transcription polymerase chain reaction and western blot analyses. Cell proliferation, migration, and invasion were measured by cell viability, transwell migration, and invasion assays, respectively. Inhibition of HIF-1α expression by shRNA suppressed vascular endothelial growth factor mRNA and protein levels under both normoxia and hypoxia. It also suppressed cell migration and invasion, which were enhanced under hypoxic conditions. RNAi knockdown of HIF-1α further suppressed hypoxia-mediated inhibition of the cell proliferation. These data suggest that shRNA of HIF-1α could antagonize the hypoxia-mediated increase in hepatic cancer cell migration and invasion, and synergize with hypoxia to inhibit the cell proliferation in HCC cells.
Yang, Hong; Deng, Liwei; Li, Tingting; Shen, Xue; Yan, Jie; Zuo, Liangming; Wu, Chunhui; Liu, Yiyao
2015-12-01
Multidrug resistance (MDR) is a major impediment to the success of cancer chemotherapy. One of the effective approaches to overcome MDR is to use nanoparticle-mediated the gene silence of chemotherapeutic export proteins by RNA interference to increase drug accumulation in drug resistant cancer cells. In this work, a new co-delivery system, DOX-PLGA/PEI/P-gp shRNA nanobubbles (NBs) around 327 nm, to overcome doxorubicin (DOX) resistance in MCF-7 human breast cancer was designed and developed. Positively charged polyethylenimine (PEI) were modified onto the surface of DOX-PLGA NBs through DCC/NHS crosslinking, and could efficiently condense P-gp shRNA into DOX-PLGA/PEI NBs at vector/shRNA weight ratios of 70:1 and above. An in vitro release profile demonstrated an efficient DOX release (more than 80%) from DOX-PLGA/PEI NBs at pH 4.4, suggesting a pH-responsive drug release for the multifunctionalized NBs. Cellular experimental results further showed that DOX-PLGA/PEI/P-gp shRNA NBs could facilitate cellular uptake of DOX into cells and increase the cell proliferation suppression effect of DOX against MCF-7/ADR cells (a DOX-resistant and P-glycoprotein (P-gp) over-expression cancer cell line). The IC50 of DOX-PLGA NBs against MCF-7/ADR cells was 2-fold lower than that of free DOX. The increased cellular uptake and nuclear accumulation of DOX delivered by DOX-PLGA/PEI/P-gp shRNA NBs in MCF-7/ADR cells was confirmed by fluorescence microscopy and fluorescence spectrophotometry, and might be owning to the down-regulation of P-gp and reduced the efflux of DOX. The cellular uptake mechanism of DOX-PLGA/PEI/P-gp shRNA NBs indicated that the macropinocytosis was one of the pathways for the uptake of NBs by MCF-7/ADR cells, which was also an energy-dependent process. Furthermore, the in vitro cellular ultrasound imaging suggested that the employment of the DOX-PLGA/PEI/P-gp shRNA NBs could efficiently enhance ultrasound imaging of cancer cells. These results demonstrated
Directory of Open Access Journals (Sweden)
Wang Haibo
2010-09-01
Full Text Available Abstract Background RhoA and RhoC have been proved to be over-expressed in many solid cancers, including colorectal cancer. The reduction of RhoA and RhoC expression by RNA interference (RNAi resulted growth inhibition of cancer cells. The present study was to evaluate the effect of silencing of RhoA and RhoC expression by RNAi on growth of human colorectal carcinoma (CRC in tumor-bearing nude mice in vivo. Methods To establish HCT116 cell transplantable model, the nude mice were subcutaneously inoculated with 1.0 × 107 HCT116 cells and kept growing till the tumor xenografts reached 5-7 mm in diameter. Then the mice were randomly assigned to three groups(seven mice in each group: (1 normal saline(NS group, (2replication-defective recombinant adenovirus carrying the negative control shRNA (Ad-HK group and (3replication-defective recombinant adenovirus carrying the 4-tandem linked RhoA and RhoC shRNAs (Ad-RhoA-RhoC group. Ad-HK (4 × 108 pfu, 30 ul/mouse, Ad-RhoA-RhoC (4 × 108 pfu, 30 ul/mouse or PBS (30 ul/mouse was injected intratumorally four times once every other day. The weight and volumes of tumor xenografts were recorded. The levels of RhoA and RhoC mRNA transcripts and proteins in tumor xenografts were detected by reverse quantitative transcription polymerase chain reaction (QRT-PCR and immunohistochemical staining respectively. The terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL assay was used to detect the death of cells. Results The xenografts in mice could be seen at 5th day from the implantation of HCT116 cells and all had reached 5-7 mm in size at 9th day. After injection intratumorally, the growth speed of tumor xenografts in Ad-RhoA-RhoC group was significantly delayed compared with those in NS and Ad-HK group(P RhoA and RhoC reduced more in Ad-RhoA-RhoC group than those in NS and Ad-HK group. The relative RhoA and RhoC mRNA transcripts were decreased to 48% and 43% respectively (P RhoA and Rho
Directory of Open Access Journals (Sweden)
Pham PV
2012-05-01
Full Text Available Phuc Van Pham1, Ngoc Bich Vu1, Thuy Thanh Duong1, Tam Thanh Nguyen1, Nhung Hai Truong1, Nhan Lu Chinh Phan1, Tue Gia Vuong1, Viet Quoc Pham1, Hoang Minh Nguyen1, Kha The Nguyen1, Nhung Thi Nguyen1, Khue Gia Nguyen1, Lam Tan Khat1, Dong Van Le2, Kiet Dinh Truong1, Ngoc Kim Phan11Laboratory of Stem Cell Research and Application, University of Science, Vietnam National University, HCM City, 2Military Medical University, Ha Noi, VietnamBackground: Breast cancer stem cells with a CD44+CD24- phenotype are the origin of breast tumors. Strong CD44 expression in this population indicates its important role in maintaining the stem cell phenotype. Previous studies show that CD44 down-regulation causes CD44+CD24- breast cancer stem cells to differentiate into non-stem cells that are sensitive to antitumor drugs and lose many characteristics of the original cells. In this study, we determined tumor suppression in non-obese severe combined immunodeficiency mice using CD44 shRNA therapy combined with doxorubicin treatment.Methods: Tumor-bearing non-obese severe combined immunodeficiency mice were established by injection of CD44+CD24- cells. To track CD44+CD24- cells, green fluorescence protein was stably transduced using a lentiviral vector prior to injection into mice. The amount of CD44 shRNA lentiviral vector used for transduction was based on CD44 down-regulation by in vitro CD44 shRNA transduction. Mice were treated with direct injection of CD44 shRNA lentiviral vector into tumors followed by doxorubicin administration after 48 hours. The effect was evaluated by changes in the size and weight of tumors compared with that of the control.Results: The combination of CD44 down-regulation and doxorubicin strongly suppressed tumor growth with significant differences in tumor sizes and weights compared with that of CD44 down-regulation or doxorubicin treatment alone. In the combination of CD44 down-regulation and doxorubicin group, the tumor weight was
Energy Technology Data Exchange (ETDEWEB)
Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)
2014-11-14
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
The rde-1 gene, RNA interference, and transposon silencing in C. elegans.
Tabara, H; Sarkissian, M; Kelly, W G; Fleenor, J; Grishok, A; Timmons, L; Fire, A; Mello, C C
1999-10-15
Double-stranded (ds) RNA can induce sequence-specific inhibition of gene function in several organisms. However, both the mechanism and the physiological role of the interference process remain mysterious. In order to study the interference process, we have selected C. elegans mutants resistant to dsRNA-mediated interference (RNAi). Two loci, rde-1 and rde-4, are defined by mutants strongly resistant to RNAi but with no obvious defects in growth or development. We show that rde-1 is a member of the piwi/sting/argonaute/zwille/eIF2C gene family conserved from plants to vertebrates. Interestingly, several, but not all, RNAi-deficient strains exhibit mobilization of the endogenous transposons. We discuss implications for the mechanism of RNAi and the possibility that one natural function of RNAi is transposon silencing.
Towards Antiviral shRNAs Based on the AgoshRNA Design.
Directory of Open Access Journals (Sweden)
Ying Poi Liu
Full Text Available RNA interference (RNAi can be induced by intracellular expression of a short hairpin RNA (shRNA. Processing of the shRNA requires the RNaseIII-like Dicer enzyme to remove the loop and to release the biologically active small interfering RNA (siRNA. Dicer is also involved in microRNA (miRNA processing to liberate the mature miRNA duplex, but recent studies indicate that miR-451 is not processed by Dicer. Instead, this miRNA is processed by the Argonaute 2 (Ago2 protein, which also executes the subsequent cleavage of a complementary mRNA target. Interestingly, shRNAs that structurally resemble miR-451 can also be processed by Ago2 instead of Dicer. The key determinant of these "AgoshRNA" molecules is a relatively short basepaired stem, which avoids Dicer recognition and consequently allows alternative processing by Ago2. AgoshRNA processing yields a single active RNA strand, whereas standard shRNAs produce a duplex with guide and passenger strands and the latter may cause adverse off-target effects. In this study, we converted previously tested active anti-HIV-1 shRNA molecules into AgoshRNA. We tested several designs that could potentially improve AgoshRNA activity, including extension of the complementarity between the guide strand and the mRNA target and reduction of the thermodynamic stability of the hairpins. We demonstrate that active AgoshRNAs can be generated. However, the RNAi activity is reduced compared to the matching shRNAs. Despite reduced RNAi activity, comparison of an active AgoshRNA and the matching shRNA in a sensitive cell toxicity assay revealed that the AgoshRNA is much less toxic.
Directory of Open Access Journals (Sweden)
Bojie Hu
2014-01-01
Full Text Available Therapeutic modalities targeting vascular endothelial growth factor (VEGF have been used to treat neovascularization and macular edema. However, anti-VEGF treatment alone may cause up-regulation of connective tissue growth factor (CTGF in the retina, increasing the risk of fibrosis and tractional retinal detachment. Therefore, in this study, we employ a novel dual-target intervention that involves intravitreal injection of the VEGF inhibitor ranibizumab and a transfection reagent-treated non-viral vector carrying anti-CTGF short hairpin RNA (shRNA driven by human RNA polymerase III promoter U6. The effects of the dual-target intervention on the expression of VEGF and CTGF and on microvessel ultrastructure were examined in retina of streptozocin-induced diabetic rats. CTGF was significantly up-regulated at week 8 after diabetic induction, whereas VEGF was not up-regulated until week 10. The high expression of both genes was maintained at week 12. Transmission electron microscopy also revealed progressive exacerbation of microvessel ultrastructure during the same period. In addition, ranibizumab significantly lowered VEGF but elevated CTGF mRNA, whereas CTGF shRNA significantly reduced the mRNA levels of both CTGF and VEGF in diabetic retinas. Importantly, dual-target intervention normalized the transcript levels of both target genes and ameliorated retinal microvessel ultrastructural damage better than either single-target intervention. These results suggest the advantages of dual-target over single-target interventions in diabetic retina and reveal a novel therapeutic modality for diabetic retinopathy.
Energy Technology Data Exchange (ETDEWEB)
Liang, Wenqing, E-mail: liangwenqing_1234@126.com [Department of Orthopaedics, Shaoxing People' s Hospital, 568 Zhongxing North Road, Shaoxing 312000 (China); Yang, Chengwei [Department of Spinal Surgery, Lanzhou General Hospital, Lanzhou Military Area Command, 333 Nanbinhe Road, Lanzhou 730050 (China); Qian, Yu [Department of Orthopaedics, Shaoxing People' s Hospital, 568 Zhongxing North Road, Shaoxing 312000 (China); Fu, Qiang, E-mail: chyygklwq@hotmail.com [Department of Orthopaedics, Changhai Hospital, Second Military Medical University, 168 Changhai Road, Shanghai 200433 (China)
2012-06-15
Highlights: Black-Right-Pointing-Pointer {beta}-Catenin expression were markedly down-regulated by CTNNB1 shRNA. Black-Right-Pointing-Pointer CTNNB1 shRNA could inhibit the proliferation of RPMI8226 cells. Black-Right-Pointing-Pointer Significantly profound apoptotic cell death in CTNNB1 shRNA cells. Black-Right-Pointing-Pointer In vivo, CTNNB1 silence led to a growth inhibition of myeloma growth. Black-Right-Pointing-Pointer c-myc and {beta}-catenin in the expression cells of cleaved caspase-3 were increased. -- Abstract: Multiple myeloma (MM) is thrombogenic as a consequence of multiple hemostatic effects. Overexpression of {beta}-catenin has been observed in several types of malignant tumors, including MM. However, the relationship between {beta}-catenin expression and MM remains unclear. In the present study, RNA interference was used to inhibit {beta}-catenin expression in RPMI8226 cells. RT-PCR and Western blotting analyses showed that {beta}-catenin mRNA and protein expression were markedly down-regulated by CTNNB1 shRNA. Western blotting showed that the protein levels of cyclin D1 and glutamine synthetase were downregulated and supported the transcriptional regulatory function of {beta}-catenin. The MTT assay showed that CTNNB1 shRNA could have significant inhibitory effects on the proliferation of RPMI8226 cells. The TOPflash reporter assay demonstrated significant downregulation after CTNNB1 shRNA transfection in RPMI8226 cells. Flow cytometric analyses also showed significantly profound apoptosis in CTNNB1 shRNA cells. We found CTNNB1 silence led to growth inhibition of MM growth in vivo. Immunohistochemical analyses showed that c-myc and {beta}-catenin were reduced in CTNNB1 shRNA tumor tissues, but that expression of cleaved caspase-3 was increased. These results show that {beta}-catenin could be a new therapeutic agent that targets the biology of MM cells.
Directory of Open Access Journals (Sweden)
Liu X
2016-04-01
Full Text Available Xiaoxia Liu, Guiling Sun, Xiuju Sun Department of Nephrology, Affiliated Hospital of Weifang Medical University, Weifang, People’s Republic of China Abstract: This study aimed to investigate the effects of silencing the speckle-type POZ protein (SPOP gene on renal cell cancer (RCC cells and to explore its possible mechanism. The A498 and ACHN RCC cells were transfected with small interference RNA (siRNA-SPOP by lipofection methods. The silencing efficiency was monitored by quantitative real-time polymerase chain reaction and Western blot. The effects of SPOP silencing on cell apoptosis, cell viability, colony formation ability, cell migration ability, and chemosensitivity to Sorafenib were assessed by flow cytometry, an MTT assay, a colony formation assay, a trans-well migration assay, and a CCK-8 assay, respectively. Its effects on the expression of several cytokines were determined by a protein microarray. Relevant signaling pathways were also analyzed. Compared with the control group, the cell apoptosis rate was significantly higher; the cell viability, the colony formation, and migration ability were significantly decreased in the siRNA-SPOP group. The protein microarray screening showed that the expression of vascular endothelial growth factor receptor, matrix metallopeptidase-9, vascular cell adhesion molecule-1, and stromal cell-derived factor-1 in the siRNA group was significantly decreased and that the expression of granulocyte–macrophage colony-stimulating factor and E-cadherin was significantly increased (P<0.05. The relevant signaling pathways were the integrin-mediated cell surface interactions pathway and extracellular matrix organization signal pathway. SPOP gene silencing induced cell apoptosis, decreased cell viability, colony formation, and migration ability, and elevated the drug sensitivity in the RCC cells. A possible mechanism is that silencing SPOP induces the differential expression of E-cadherin, vascular endothelial
Nam, Woo Suk; Park, Kwon Moo; Park, Jeen-Woo
2012-08-01
A metabolic abnormality in lipid biosynthesis is frequently associated with obesity and hyperlipidemia. Nicotinamide adenine dinucleotide phosphate-oxidase (NADPH) is an essential reducing equivalent for numerous enzymes required in fat and cholesterol biosynthesis. Cytosolic NADP(+)-dependent isocitrate dehydrogenase (IDPc) has been proposed as a key enzyme for supplying cytosolic NADPH. We report here that knockdown of IDPc expression by Ribonucleic acid (RNA) interference (RNAi) inhibited adipocyte differentiation and lipogenesis in 3T3-L1 preadipocytes and mice. Attenuated IDPc expression by IDPc small interfering RNA (siRNA) resulted in a reduction of differentiation and triglyceride level and adipogenic protein expression as well as suppression of glucose uptake in cultured adipocytes. In addition, the attenuation of Nox activity and Reactive oxygen species (ROS) generation accompanied with knockdown of IDPc was associated with inhibition of adipogenesis and lipogenesis. The loss of body weight and the reduction of triglyceride level were also observed in diet-induced obese mice transduced with IDPc short-hairpin (shRNA). Taken together, the inhibiting effect of RNAi targeting IDPc on adipogenesis and lipid biosynthesis is considered to be of therapeutic value in the treatment and prevention of obesity and obesity-associated metabolic syndrome. © 2012 Elsevier B.V. All rights reserved.
The Role of RNA Interference (RNAi in Arbovirus-Vector Interactions
Directory of Open Access Journals (Sweden)
Carol D. Blair
2015-02-01
Full Text Available RNA interference (RNAi was shown over 18 years ago to be a mechanism by which arbovirus replication and transmission could be controlled in arthropod vectors. During the intervening period, research on RNAi has defined many of the components and mechanisms of this antiviral pathway in arthropods, yet a number of unexplored questions remain. RNAi refers to RNA-mediated regulation of gene expression. Originally, the term described silencing of endogenous genes by introduction of exogenous double-stranded (dsRNA with the same sequence as the gene to be silenced. Further research has shown that RNAi comprises three gene regulation pathways that are mediated by small RNAs: the small interfering (siRNA, micro (miRNA, and Piwi-interacting (piRNA pathways. The exogenous (exo-siRNA pathway is now recognized as a major antiviral innate immune response of arthropods. More recent studies suggest that the piRNA and miRNA pathways might also have important roles in arbovirus-vector interactions. This review will focus on current knowledge of the role of the exo-siRNA pathway as an arthropod vector antiviral response and on emerging research into vector piRNA and miRNA pathway modulation of arbovirus-vector interactions. Although it is assumed that arboviruses must evade the vector’s antiviral RNAi response in order to maintain their natural transmission cycles, the strategies by which this is accomplished are not well defined. RNAi is also an important tool for arthropod gene knock-down in functional genomics studies and in development of arbovirus-resistant mosquito populations. Possible arbovirus strategies for evasion of RNAi and applications of RNAi in functional genomics analysis and arbovirus transmission control will also be reviewed.
Heme oxygenase-1 mediates BAY 11-7085 induced ferroptosis.
Chang, Ling-Chu; Chiang, Shih-Kai; Chen, Shuen-Ei; Yu, Yung-Luen; Chou, Ruey-Hwang; Chang, Wei-Chao
2018-03-01
Ferroptosis is a form of oxidative cell death and has become a chemotherapeutic target for cancer treatment. BAY 11-7085 (BAY), which is a well-known IκBα inhibitor, suppressed viability in cancer cells via induction of ferroptotic death in an NF-κB-independent manner. Reactive oxygen species scavenging, relief of lipid peroxidation, replenishment of glutathione and thiol-containing agents, as well as iron chelation, rescued BAY-induced cell death. BAY upregulated a variety of Nrf2 target genes related to redox regulation, particularly heme oxygenase-1 (HO-1). Studies with specific inhibitors and shRNA interventions suggested that the hierarchy of induction is Nrf2-SLC7A11-HO-1. SLC7A11 inhibition by erastin, sulfasalazine, or shRNA interference sensitizes BAY-induced cell death. Overexperession of SLC7A11 attenuated BAY-inhibited cell viability. The ferroptotic process induced by hHO-1 overexpression further indicated that HO-1 is a key mediator of BAY-induced ferroptosis that operates through cellular redox regulation and iron accumulation. BAY causes compartmentalization of HO-1 into the nucleus and mitochondrion, and followed mitochondrial dysfunctions, leading to lysosome targeting for mitophagy. In this study, we first discovered that BAY induced ferroptosis via Nrf2-SLC7A11-HO-1 pathway and HO-1 is a key mediator by responding to the cellular redox status. Copyright © 2017 Elsevier B.V. All rights reserved.
Yoon, June-Sun; Gurusamy, Dhandapani; Palli, Subba Reddy
2017-11-01
RNA interference (RNAi) efficiency varies among insects studied. The barriers for successful RNAi include the presence of double-stranded ribonucleases (dsRNase) in the lumen and hemolymph that could potentially digest double-stranded RNA (dsRNA) and the variability in the transport of dsRNA into and within the cells. We recently showed that the dsRNAs are transported into lepidopteran cells, but they are not processed into small interference RNAs (siRNAs) because they are trapped in acidic bodies. In the current study, we focused on the identification of acidic bodies in which dsRNAs accumulate in Sf9 cells. Time-lapse imaging studies showed that dsRNAs enter Sf9 cells and accumulate in acidic bodies within 20 min after their addition to the medium. CypHer-5E-labeled dsRNA also accumulated in the midgut and fat body dissected from Spodoptera frugiperda larvae with similar patterns observed in Sf9 cells. Pharmacological inhibitor assays showed that the dsRNAs use clathrin mediated endocytosis pathway for transport into the cells. We investigated the potential dsRNA accumulation sites employing LysoTracker and double labeling experiments using the constructs to express a fusion of green fluorescence protein with early or late endosomal marker proteins and CypHer-5E-labeled dsRNA. Interestingly, CypHer-5E-labeled dsRNA accumulated predominantly in early and late endosomes. These data suggest that entrapment of internalized dsRNA in endosomes is one of the major factors contributing to inefficient RNAi response in lepidopteran insects. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Xianqi Zhao
2015-06-01
Full Text Available Breast cancer has a high incidence and mortality rate worldwide. Several viral vectors including lentiviral, adenoviral and adeno-associated viral vectors have been used in gene therapy for various forms of human cancer, and have shown promising effects in controlling tumor development. Claudin1 (CLDN1 is a member of the tetraspan transmembrane protein family that plays a major role in tight junctions and is associated with tumor metastasis. However, the role of CLDN1 in breast cancer is largely unexplored. In this study, we tested the therapeutic potential of silencing CLDN1 expression in two breast cancer (MDA-MB-231 and MCF7 cell lines using lentiviral vector mediated RNA interference. We found that a CLDN1 short hairpin (shRNA construct efficiently silenced CLDN1 expression in both breast cancer cell lines, and CLDN1 knockdown resulted in reduced cell proliferation, survival, migration and invasion. Furthermore, silencing CLDN1 inhibited epithelial to mesenchymal transition (EMT by upregulating the epithelial cell marker, E-cadherin, and downregulating mesenchymal markers, smooth muscle cell alpha-actin (SMA and Snai2. Our data demonstrated that lentiviral vector mediated CLDN1 RNA interference has great potential in breast cancer gene therapy by inhibiting EMT and controlling tumor cell growth.
Immune modulation through RNA interference-mediated silencing of CD40 in dendritic cells.
Karimi, Mohammad Hossein; Ebadi, Padideh; Pourfathollah, Ali Akbar; Soheili, Zahra Soheila; Samiee, Shahram; Ataee, Zahra; Tabei, Seyyed Ziyaoddin; Moazzeni, Seyed Mohammad
2009-01-01
RNA interference (RNAi) is an exciting mechanism for knocking down any target gene in transcriptional level. It is now clear that small interfering RNA (siRNA), a 19-21nt long dsRNA, can trigger a degradation process (RNAi) that specifically silences the expression of a cognate mRNA. Our findings in this study showed that down regulation of CD40 gene expression in dendritic cells (DCs) by RNAi culminated to immune modulation. Effective delivery of siRNA into DCs would be a reasonable method for the blocking of CD40 gene expression at the cell surface without any effect on other genes and cell cytotoxicity. The effects of siRNA against CD40 mRNA on the function and phenotype of DCs were investigated. The DCs were separated from the mice spleen and then cultured in vitro. By the means of Lipofectamine2000, siRNA was delivered to the cells and the efficacy of transfection was estimated by flow cytometry. By Annexine V and Propidium Iodide staining, we could evaluate the transfected cells viability. Also, the mRNA expression and protein synthesis were assessed by real-time PCR and flow cytometry, respectively. Knocking down the CD40 gene in the DCs caused an increase in IL-4 production, decrease in IL-12 production and allostimulation activity. All together, these effects would stimulate Th2 cytokines production from allogenic T-cells in vitro.
Induction of RNA interference in dendritic cells.
Li, Mu; Qian, Hua; Ichim, Thomas E; Ge, Wei-Wen; Popov, Igor A; Rycerz, Katarzyna; Neu, John; White, David; Zhong, Robert; Min, Wei-Ping
2004-01-01
Dendritic cells (DC) reside at the center of the immunological universe, possessing the ability both to stimulate and inhibit various types of responses. Tolerogenic/regulatory DC with therapeutic properties can be generated through various means of manipulations in vitro and in vivo. Here we describe several attractive strategies for manipulation of DC using the novel technique of RNA interference (RNAi). Additionally, we overview some of our data regarding yet undescribed characteristics of RNAi in DC such as specific transfection strategies, persistence of gene silencing, and multi-gene silencing. The advantages of using RNAi for DC genetic manipulation gives rise to the promise of generating tailor-made DC that can be used effectively to treat a variety of immunologically mediated diseases.
Liu, Xiaoxia; Sun, Guiling; Sun, Xiuju
2016-01-01
This study aimed to investigate the effects of silencing the speckle-type POZ protein (SPOP) gene on renal cell cancer (RCC) cells and to explore its possible mechanism. The A498 and ACHN RCC cells were transfected with small interference RNA (siRNA)-SPOP by lipofection methods. The silencing efficiency was monitored by quantitative real-time polymerase chain reaction and Western blot. The effects of SPOP silencing on cell apoptosis, cell viability, colony formation ability, cell migration ability, and chemosensitivity to Sorafenib were assessed by flow cytometry, an MTT assay, a colony formation assay, a trans-well migration assay, and a CCK-8 assay, respectively. Its effects on the expression of several cytokines were determined by a protein microarray. Relevant signaling pathways were also analyzed. Compared with the control group, the cell apoptosis rate was significantly higher; the cell viability, the colony formation, and migration ability were significantly decreased in the siRNA-SPOP group. The protein microarray screening showed that the expression of vascular endothelial growth factor receptor, matrix metallopeptidase-9, vascular cell adhesion molecule-1, and stromal cell-derived factor-1 in the siRNA group was significantly decreased and that the expression of granulocyte-macrophage colony-stimulating factor and E-cadherin was significantly increased (Pmatrix organization signal pathway. SPOP gene silencing induced cell apoptosis, decreased cell viability, colony formation, and migration ability, and elevated the drug sensitivity in the RCC cells. A possible mechanism is that silencing SPOP induces the differential expression of E-cadherin, vascular endothelial growth factor receptor, matrix metallopeptidase-9, and vascular cell adhesion molecule, which are related to the integrin-mediated cell surface interactions and extracellular matrix organization signaling pathway.
Apolipoprotein B knockdown by AAV-delivered shRNA lowers plasma cholesterol in mice
Koornneef, Annemart; Maczuga, Piotr; van Logtenstein, Richard; Borel, Florie; Blits, Bas; Ritsema, Tita; van Deventer, Sander; Petry, Harald; Konstantinova, Pavlina
2011-01-01
Serum low-density lipoprotein cholesterol (LDL-C) levels are proportionate to the risk of atherosclerotic cardiovascular disease. In order to reduce serum total cholesterol and LDL-C levels in mice, RNA interference (RNAi) was used to inhibit expression of the structural protein of LDL-C,
Patel, Utsav A; Patel, Amrutlal K; Joshi, Chaitanya G
2015-01-01
Myostatin (MSTN) is a secreted growth factor that negatively regulates skeletal muscle mass, and therefore, strategies to block myostatin-signaling pathway have been extensively pursued to increase the muscle mass in livestock. Here, we report a lentiviral vector-based delivery of shRNA to disrupt myostatin expression into goat fetal fibroblasts (GFFs) that were commonly used as karyoplast donors in somatic-cell nuclear transfer (SCNT) studies. Sh-RNA positive cells were screened by puromycin selection. Using real-time polymerase chain reaction (PCR), we demonstrated efficient knockdown of endogenous myostatin mRNA with 64% down-regulation in sh2 shRNA-treated GFF cells compared to GFF cells treated by control lentivirus without shRNA. Moreover, we have also demonstrated both the induction of interferon response and the expression of genes regulating myogenesis in GFF cells. The results indicate that myostatin-targeting siRNA produced endogenously could efficiently down-regulate myostatin expression. Therefore, targeted knockdown of the MSTN gene using lentivirus-mediated shRNA transgenics would facilitate customized cell engineering, allowing potential use in the establishment of stable cell lines to produce genetically engineered animals. © 2014 American Institute of Chemical Engineers.
Targeting CCl4 -induced liver fibrosis by RNA interference-mediated inhibition of cyclin E1 in mice.
Bangen, Jörg-Martin; Hammerich, Linda; Sonntag, Roland; Baues, Maike; Haas, Ute; Lambertz, Daniela; Longerich, Thomas; Lammers, Twan; Tacke, Frank; Trautwein, Christian; Liedtke, Christian
2017-10-01
Initiation and progression of liver fibrosis requires proliferation and activation of resting hepatic stellate cells (HSCs). Cyclin E1 (CcnE1) is the regulatory subunit of the cyclin-dependent kinase 2 (Cdk2) and controls cell cycle re-entry. We have recently shown that genetic inactivation of CcnE1 prevents activation, proliferation, and survival of HSCs and protects from liver fibrogenesis. The aim of the present study was to translate these findings into preclinical applications using an RNA interference (RNAi)-based approach. CcnE1-siRNA (small interfering RNA) efficiently inhibited CcnE1 gene expression in murine and human HSC cell lines and in primary HSCs, resulting in diminished proliferation and increased cell death. In C57BL/6 wild-type (WT) mice, delivery of stabilized siRNA using a liposome-based carrier targeted approximately 95% of HSCs, 70% of hepatocytes, and 40% of CD45 + cells after single injection. Acute CCl 4 -mediated liver injury in WT mice induced endogenous CcnE1 expression and proliferation of surviving hepatocytes and nonparenchymal cells, including CD45 + leukocytes. Pretreatment with CcnE1-siRNA reverted CcnE1 induction to baseline levels of healthy mice, which was associated with reduced liver injury, diminished proliferation of hepatocytes and leukocytes, and attenuated overall inflammatory response. For induction of liver fibrosis, WT mice were challenged with CCl 4 for 4-6 weeks. Co-treatment with CcnE1-siRNA once a week was sufficient to continuously block CcnE1 expression and cell-cycle activity of hepatocytes and nonparenchymal cells, resulting in significantly ameliorated liver fibrosis and inflammation. Importantly, CcnE1-siRNA also prevented progression of liver fibrosis if applied after onset of chronic liver injury. Therapeutic targeting of CcnE1 in vivo using RNAi is feasible and has high antifibrotic activity. (Hepatology 2017;66:1242-1257). © 2017 by the American Association for the Study of Liver Diseases.
Intervention of radiation‐induced skin fibrosis by RNA interference
DEFF Research Database (Denmark)
Nawroth, Isabel
‐α (TNFα) production by macrophages might promote RIF. RNA interference (RNAi) is an evolutionary conserved gene‐silencing mechanism capable of degrading mRNA containing a homologous sequence to an exogenously introduced double stranded small interfering RNA (siRNA). These siRNAs can induce RNAi...... and inhibit the expression of target proteins. Therefore, siRNAs are considered as promising therapeutics for treatment of various diseases including genetic and viral diseases, and cancer. In this study, the therapeutic potential of RNA interference was investigated as an intervention strategy for radiation......‐induced skin fibrosis. Chitosan‐based nanoparticles (or polyplexes) formed by self‐assembly with siRNA were applied to overcome extracellular and intracellular barriers and deliver siRNA site‐specific. In this work we show that intraperitoneal administration of chitosan/DsiRNA nanoparticles targeting TNFα...
RNA virus interference via CRISPR/Cas13a system in plants
Aman, Rashid
2017-11-04
CRISPR/Cas systems confer immunity against invading nucleic acids and phages in bacteria and archaea. CRISPR/Cas13a (known previously as C2c2) is a class 2 type VI-A ribonuclease capable of targeting and cleaving single stranded RNA (ssRNA) molecules of the phage genome. Here, we employ CRISPR/Cas13a to engineer interference with an RNA virus, Turnip Mosaic Virus (TuMV), in plants. CRISPR/Cas13a produced interference against green fluorescent protein (GFP) expressing TuMV in transient assays and stable overexpression lines of Nicotiana benthamiana. crRNAs targeting the HC-Pro and GFP sequences exhibited better interference than those targeting other regions such as coat protein (CP) sequence. Cas13a can also process pre-crRNAs into functional crRNAs. Our data indicate that CRISPR/Cas13a can be used for engineering interference against RNA viruses, providing a potential novel mechanism for RNA-guided immunity against RNA viruses, and for other RNA manipulations in plants.
Using RNA Interference to Study Protein Function
Curtis, Carol D.; Nardulli, Ann M.
2009-01-01
RNA interference can be extremely useful in determining the function of an endogenously-expressed protein in its normal cellular environment. In this chapter, we describe a method that uses small interfering RNA (siRNA) to knock down mRNA and protein expression in cultured cells so that the effect of a putative regulatory protein on gene expression can be delineated. Methods of assessing the effectiveness of the siRNA procedure using real time quantitative PCR and Western analysis are also in...
Directory of Open Access Journals (Sweden)
Yang Xing
2009-07-01
Full Text Available Abstract Background 17alpha-hydroxylase/17, 20-lyase encoded by CYP17 is the key enzyme in androgen biosynthesis pathway. Previous studies demonstrated the accentuation of the enzyme in patients with polycystic ovary syndrome (PCOS was the most important mechanism of androgen excess. We chose CYP17 as the therapeutic target, trying to suppress the activity of 17alpha-hydroxylase/17, 20-lyase and inhibit androgen biosynthesis by silencing the expression of CYP17 in the rat ovary. Methods Three CYP17-targeting and one negative control oligonucleotides were designed and used in the present study. The silence efficiency of lentivirus shRNA was assessed by qRT-PCR, Western blotting and hormone assay. After subcapsular injection of lentivirus shRNA in rat ovary, the delivery efficiency was evaluated by GFP fluorescence and qPCR. Total RNA was extracted from rat ovary for CYP17 mRNA determination and rat serum was collected for hormone measurement. Results In total, three CYP17-targeting lentivirus shRNAs were synthesized. The results showed that all of them had a silencing effect on CYP17 mRNA and protein. Moreover, androstenedione secreted by rat theca interstitial cells (TIC in the RNAi group declined significantly compared with that in the control group. Two weeks after rat ovarian subcapsular injection of chosen CYP17 shRNA, the GFP fluorescence of frozen ovarian sections could be seen clearly under fluorescence microscope. It also showed that the GFP DNA level increased significantly, and its relative expression level was 7.42 times higher than that in the control group. Simultaneously, shRNA treatment significantly decreased CYP17 mRNA and protein levels at 61% and 54%, respectively. Hormone assay showed that all the levels of androstenedione, 17-hydroxyprogesterone and testosterone declined to a certain degree, but progesterone levels declined significantly. Conclusion The present study proves for the first time that ovarian androgen
RNA virus interference via CRISPR/Cas13a system in plants
Aman, Rashid
2018-01-04
CRISPR/Cas systems confer immunity against invading nucleic acids and phages in bacteria and archaea. CRISPR/Cas13a (known previously as C2c2) is a class 2 type VI-A ribonuclease capable of targeting and cleaving single-stranded RNA (ssRNA) molecules of the phage genome. Here, we employ CRISPR/Cas13a to engineer interference with an RNA virus, Turnip Mosaic Virus (TuMV), in plants.CRISPR/Cas13a produces interference against green fluorescent protein (GFP)-expressing TuMV in transient assays and stable overexpression lines of Nicotiana benthamiana. CRISPR RNA (crRNAs) targeting the HC-Pro and GFP sequences exhibit better interference than those targeting other regions such as coat protein (CP) sequence. Cas13a can also process pre-crRNAs into functional crRNAs.Our data indicate that CRISPR/Cas13a can be used for engineering interference against RNA viruses, providing a potential novel mechanism for RNA-guided immunity against RNA viruses and for other RNA manipulations in plants.
Lysosomal putative RNA transporter SIDT2 mediates direct uptake of RNA by lysosomes.
Aizawa, Shu; Fujiwara, Yuuki; Contu, Viorica Raluca; Hase, Katsunori; Takahashi, Masayuki; Kikuchi, Hisae; Kabuta, Chihana; Wada, Keiji; Kabuta, Tomohiro
2016-01-01
Lysosomes are thought to be the major intracellular compartment for the degradation of macromolecules. We recently identified a novel type of autophagy, RNautophagy, where RNA is directly taken up by lysosomes in an ATP-dependent manner and degraded. However, the mechanism of RNA translocation across the lysosomal membrane and the physiological role of RNautophagy remain unclear. In the present study, we performed gain- and loss-of-function studies with isolated lysosomes, and found that SIDT2 (SID1 transmembrane family, member 2), an ortholog of the Caenorhabditis elegans putative RNA transporter SID-1 (systemic RNA interference deficient-1), mediates RNA translocation during RNautophagy. We also observed that SIDT2 is a transmembrane protein, which predominantly localizes to lysosomes. Strikingly, knockdown of Sidt2 inhibited up to ˜50% of total RNA degradation at the cellular level, independently of macroautophagy. Moreover, we showed that this impairment is mainly due to inhibition of lysosomal RNA degradation, strongly suggesting that RNautophagy plays a significant role in constitutive cellular RNA degradation. Our results provide a novel insight into the mechanisms of RNA metabolism, intracellular RNA transport, and atypical types of autophagy.
Maczuga, Piotr
2013-01-01
Familial hypercholesterolemia (FH) is a genetic disorder characterized by high levels of low density lipoprotein cholesterol (LDL-C) and increasing the risk of cardio vascular diseases. FH and many other liver diseases can possibly be treated with RNA interference (RNAi). RNAi is a natural process
Small Molecule Modifiers of the microRNA and RNA Interference Pathway
Deiters, Alexander
2009-01-01
Recently, the RNA interference (RNAi) pathway has become the target of small molecule inhibitors and activators. RNAi has been well established as a research tool in the sequence-specific silencing of genes in eukaryotic cells and organisms by using exogenous, small, double-stranded RNA molecules of approximately 20 nucleotides. Moreover, a recently discovered post-transcriptional gene regulatory mechanism employs microRNAs (miRNAs), a class of endogenously expressed small RNA molecules, whic...
Directory of Open Access Journals (Sweden)
Che-Ming Liu
Full Text Available Cancer cells respond to stress by activating a variety of survival signaling pathways. A disintegrin and metalloproteinase (ADAM 9 is upregulated during cancer progression and hormone therapy, functioning in part through an increase in reactive oxygen species. Here, we present in vitro and in vivo evidence that therapeutic targeting of ADAM9 gene expression by lentivirus-delivered small hairpin RNA (shRNA significantly inhibited proliferation of human prostate cancer cell lines and blocked tumor growth in a murine model of prostate cancer bone metastasis. Cell cycle studies confirmed an increase in the G1-phase and decrease in the S-phase population of cancer cells under starvation stress conditions, which correlated with elevated intracellular superoxide levels. Microarray data showed significantly decreased levels of regenerating islet-derived family member 4 (REG4 expression in prostate cancer cells with knockdown of ADAM9 gene expression. This REG4 downregulation also resulted in induction of expression of p21(Cip1/WAF1, which negatively regulates cyclin D1 and blocks the G1/S transition. Our data reveal a novel molecular mechanism of ADAM9 in the regulation of prostate cancer cell proliferation, and suggests a combined modality of ADAM9 shRNA gene therapy and cytotoxic agents for hormone refractory and bone metastatic prostate cancer.
International Nuclear Information System (INIS)
Loublier, Sandrine; Bayot, Aurelien; Rak, Malgorzata; El-Khoury, Riyad; Benit, Paule; Rustin, Pierre
2011-01-01
Highlights: → NDUFB6 is required for activity of mitochondrial complex I in human cell lines. → Lentivirus based RNA interference results in frequent off target insertions. → Flp-In recombinase mediated miRNA insertion allows gene-specific extinction. -- Abstract: Molecular bases of inherited deficiencies of mitochondrial respiratory chain complex I are still unknown in a high proportion of patients. Among 45 subunits making up this large complex, more than half has unknown function(s). Understanding the function of these subunits would contribute to our knowledge on mitochondrial physiology but might also reveal that some of these subunits are not required for the catalytic activity of the complex. A direct consequence of this finding would be the reduction of the number of candidate genes to be sequenced in patients with decreased complex I activity. In this study, we tested two different methods to stably extinct complex I subunits in cultured cells. We first found that lentivirus-mediated shRNA expression frequently resulted in the unpredicted extinction of additional gene(s) beside targeted ones. This can be ascribed to uncontrolled genetic material insertions in the genome of the host cell. This approach thus appeared inappropriate to study unknown functions of a gene. Next, we found it possible to specifically extinct a CI subunit gene by direct insertion of a miR targeting CI subunits in a Flp site (HEK293 Flp-In cells). By using this strategy we unambiguously demonstrated that the NDUFB6 subunit is required for complex I activity, and defined conditions suitable to undertake a systematic and stable extinction of the different supernumerary subunits in human cells.
Energy Technology Data Exchange (ETDEWEB)
Loublier, Sandrine; Bayot, Aurelien; Rak, Malgorzata; El-Khoury, Riyad; Benit, Paule [Inserm U676, Hopital Robert Debre, F-75019 Paris (France); Universite Paris 7, Faculte de medecine Denis Diderot, IFR02 Paris (France); Rustin, Pierre, E-mail: pierre.rustin@inserm.fr [Inserm U676, Hopital Robert Debre, F-75019 Paris (France); Universite Paris 7, Faculte de medecine Denis Diderot, IFR02 Paris (France)
2011-10-22
Highlights: {yields} NDUFB6 is required for activity of mitochondrial complex I in human cell lines. {yields} Lentivirus based RNA interference results in frequent off target insertions. {yields} Flp-In recombinase mediated miRNA insertion allows gene-specific extinction. -- Abstract: Molecular bases of inherited deficiencies of mitochondrial respiratory chain complex I are still unknown in a high proportion of patients. Among 45 subunits making up this large complex, more than half has unknown function(s). Understanding the function of these subunits would contribute to our knowledge on mitochondrial physiology but might also reveal that some of these subunits are not required for the catalytic activity of the complex. A direct consequence of this finding would be the reduction of the number of candidate genes to be sequenced in patients with decreased complex I activity. In this study, we tested two different methods to stably extinct complex I subunits in cultured cells. We first found that lentivirus-mediated shRNA expression frequently resulted in the unpredicted extinction of additional gene(s) beside targeted ones. This can be ascribed to uncontrolled genetic material insertions in the genome of the host cell. This approach thus appeared inappropriate to study unknown functions of a gene. Next, we found it possible to specifically extinct a CI subunit gene by direct insertion of a miR targeting CI subunits in a Flp site (HEK293 Flp-In cells). By using this strategy we unambiguously demonstrated that the NDUFB6 subunit is required for complex I activity, and defined conditions suitable to undertake a systematic and stable extinction of the different supernumerary subunits in human cells.
Varas-Godoy, Manuel; Lladser, Alvaro; Farfan, Nicole; Villota, Claudio; Villegas, Jaime; Tapia, Julio C; Burzio, Luis O; Burzio, Veronica A; Valenzuela, Pablo D T
2018-01-01
The family of non-coding mitochondrial RNAs (ncmtRNA) is differentially expressed according to proliferative status. Normal proliferating cells express sense (SncmtRNA) and antisense ncmtRNAs (ASncmtRNAs), whereas tumor cells express SncmtRNA and downregulate ASncmtRNAs. Knockdown of ASncmtRNAs with oligonucleotides induces apoptotic cell death of tumor cells, leaving normal cells unaffected, suggesting a potential application for developing a novel cancer therapy. In this study, we knocked down the ASncmtRNAs in melanoma cell lines with a lentiviral-encoded shRNA approach. Transduction with lentiviral constructs targeted to the ASncmtRNAs induced apoptosis in murine B16F10 and human A375 melanoma cells in vitro and significantly retarded B16F10 primary tumor growth in vivo. Moreover, the treatment drastically reduced the number of lung metastatic foci in a tail vein injection assay, compared to controls. These results provide additional proof of concept to the knockdown of ncmtRNAs for cancer therapy and validate lentiviral-shRNA vectors for gene therapy. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
Chen, Jie; Shi, Dehuan; Liu, Xiaoyan; Fang, Shuang; Zhang, Jie; Zhao, Yueran
2012-01-01
Secreted protein acidic and rich in cysteine (SPARC), a calcium-binding matricellular glycoprotein, is implicated in the progressions of some cancers. However, no information has been available to date regarding the function of SPARC in cervical cancer cell growth and metastasis. In this study, we isolated and established high invasive subclones and low invasive subclones from human cervical cancer cell lines HeLa and SiHa by the limited dilution method. Real-time q-RT-PCR, Western Blot and ICC were performed to investigate SPARC mRNA and protein expressions in high invasive subclones and low invasive subclones. Then lentivirus vector with SPARC shRNA was constructed and infected the highly invasive subclones. Real-time q-RT-PCR, Western Blot and ICC were also performed to investigate the changes of SPARC expression after viral infection. In functional assays, effects of SPARC knockdown on the biological behaviors of cervical cancer cells were investigated. The mechanisms of SPARC in cervical cancer proliferation, apoptosis and invasion were also researched. SPARC was over-expressed in the highly invasive subclones compared with the low invasive subclones. Knockdown of SPARC significantly suppressed cervical cancer cell proliferation, and induced cell cycle arrest at the G1/G0 phase through the p53/p21 pathway, also caused cell apoptosis accompanied by the decreased ratio of Bcl-2/Bax, and inhibited cell invasion and metastasis accompanied by down-regulated MMP2 and MMP9 expressions and up-regulated E-cadherin expression. SPARC is related to the invasive phenotype of cervical cancer cells. Knockdown of SPARC significantly suppresses cervical cancer cell proliferation, induces cell apoptosis and inhibits cell invasion and metastasis. SPARC as a promoter improves cervical cancer cell growth and metastasis
Directory of Open Access Journals (Sweden)
Chen Jie
2012-10-01
Full Text Available Abstract Background Secreted protein acidic and rich in cysteine (SPARC, a calcium-binding matricellular glycoprotein, is implicated in the progressions of some cancers. However, no information has been available to date regarding the function of SPARC in cervical cancer cell growth and metastasis. Methods In this study, we isolated and established high invasive subclones and low invasive subclones from human cervical cancer cell lines HeLa and SiHa by the limited dilution method. Real-time q-RT-PCR, Western Blot and ICC were performed to investigate SPARC mRNA and protein expressions in high invasive subclones and low invasive subclones. Then lentivirus vector with SPARC shRNA was constructed and infected the highly invasive subclones. Real-time q-RT-PCR, Western Blot and ICC were also performed to investigate the changes of SPARC expression after viral infection. In functional assays, effects of SPARC knockdown on the biological behaviors of cervical cancer cells were investigated. The mechanisms of SPARC in cervical cancer proliferation, apoptosis and invasion were also researched. Results SPARC was over-expressed in the highly invasive subclones compared with the low invasive subclones. Knockdown of SPARC significantly suppressed cervical cancer cell proliferation, and induced cell cycle arrest at the G1/G0 phase through the p53/p21 pathway, also caused cell apoptosis accompanied by the decreased ratio of Bcl-2/Bax, and inhibited cell invasion and metastasis accompanied by down-regulated MMP2 and MMP9 expressions and up-regulated E-cadherin expression. Conclusion SPARC is related to the invasive phenotype of cervical cancer cells. Knockdown of SPARC significantly suppresses cervical cancer cell proliferation, induces cell apoptosis and inhibits cell invasion and metastasis. SPARC as a promoter improves cervical cancer cell growth and metastasis.
Radiation enhancement effect of RNA interference for HIF-1α on the transplant tumor
International Nuclear Information System (INIS)
Ren Ruimei; Sun Xindong; Zhao Hanxi; Yan Qingxia; Huang Guangwu
2008-01-01
Objective: To determine and explore the radiation enhancement of RNA interference for HIF-1α on the transplant tumor using polycationic polyethylenimine (PEI), as a new kind of gene vector. Methods: SPCA-1 nude mouse model was used. 160 nude mice bearing SPCA-1 were randomly divided into 4 treated groups and 1 control groups, each group had 32 mice. The expression of HIF-1α was studied by immunohistochemical method after RNA interference for HIF-1α. The differences of the volume, weight, survival time of the transplant tumor were studied among the simple radiation group, the simple RNA interference for HIF- 1α group and the combination of radiation and RNA interference for HIF-1α. Results: The expression of HIF-1α was decreased after RNA interference for HIF-1α. RNA interference for HIF-1α combined with radiation decreased the volume, weight of the transplant tumor, and prolonged its survival time period significantly than other methods. Conclusions: RNA interference targeting HIF-1α might enhance the radiosensitivity of the transplant tumor using PEI as a new kind of gene vector in vitro. (authors)
Directory of Open Access Journals (Sweden)
Anil Babu Korrapati
Full Text Available BACKGROUND: Dengue is a mosquito-borne viral disease caused by four closely related serotypes of Dengue viruses (DENVs. This disease whose symptoms range from mild fever to potentially fatal haemorrhagic fever and hypovolemic shock, threatens nearly half the global population. There is neither a preventive vaccine nor an effective antiviral therapy against dengue disease. The difference between severe and mild disease appears to be dependent on the viral load. Early diagnosis may enable timely therapeutic intervention to blunt disease severity by reducing the viral load. Harnessing the therapeutic potential of RNA interference (RNAi to attenuate DENV replication may offer one approach to dengue therapy. METHODOLOGY/PRINCIPAL FINDINGS: We screened the non-translated regions (NTRs of the RNA genomes of representative members of the four DENV serotypes for putative siRNA targets mapping to known transcription/translation regulatory elements. We identified a target site in the 5' NTR that maps to the 5' upstream AUG region, a highly conserved cis-acting element essential for viral replication. We used a replication-defective human adenovirus type 5 (AdV5 vector to deliver a short-hairpin RNA (shRNA targeting this site into cells. We show that this shRNA matures to the cognate siRNA and is able to inhibit effectively antigen secretion, viral RNA replication and infectious virus production by all four DENV serotypes. CONCLUSION/SIGNIFICANCE: The data demonstrate the feasibility of using AdV5-mediated delivery of shRNAs targeting conserved sites in the viral genome to achieve inhibition of all four DENV serotypes. This paves the way towards exploration of RNAi as a possible therapeutic strategy to curtail DENV infection.
Prokaryotic Argonautes - variations on the RNA interference theme
van der Oost, John; Swarts, Daan C.; Jore, Matthijs M.
2014-01-01
The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes. PMID:28357239
RNA virus interference via CRISPR/Cas13a system in plants
Aman, Rashid; Ali, Zahir; Butt, Haroon; Mahas, Ahmed; Aljedaani, Fatimah R.; Khan, Muhammad Zuhaib; Ding, Shouwei; Mahfouz, Magdy M.
2018-01-01
-crRNAs into functional crRNAs.Our data indicate that CRISPR/Cas13a can be used for engineering interference against RNA viruses, providing a potential novel mechanism for RNA-guided immunity against RNA viruses and for other RNA manipulations in plants.
Takagi, Kyoko; Nishizawa, Keito; Hirose, Aya; Kita, Akiko; Ishimoto, Masao
2011-10-01
Soybean seeds contain substantial amount of diverse triterpenoid saponins that influence the seed quality, although little is known about the physiologic functions of saponins in plants. We now describe the modification of saponin biosynthesis by RNA interference (RNAi)-mediated gene silencing targeted to β-amyrin synthase, a key enzyme in the synthesis of a common aglycon of soybean saponins. We identified two putative β-amyrin synthase genes in soybean that manifested distinct expression patterns with regard to developmental stage and tissue specificity. Given that one of these genes, GmBAS1, was expressed at a much higher level than the other (GmBAS2) in various tissues including the developing seeds, we constructed two RNAi vectors that encode self-complementary hairpin RNAs corresponding to the distinct regions of GmBAS1 under the control of a seed-specific promoter derived from the soybean gene for the α' subunit of the seed storage protein β-conglycinin. These vectors were introduced independently into soybean. Six independent transgenic lines exhibited a stable reduction in seed saponin content, with the extent of saponin deficiency correlating with the β-amyrin synthase mRNA depletion. Although some transgenic lines produced seeds almost devoid of saponins, no abnormality in their growth was apparent and the antioxidant activity of their seeds was similar to that of control seeds. These results suggest that saponins are not required for seed development and survival, and that soybean seeds may therefore be amenable to the modification of triterpenoid saponin content and composition through molecular biologic approaches.
Directory of Open Access Journals (Sweden)
Yuan-Fei Peng
Full Text Available RNA interference (RNAi has recently emerged as a potential treatment modality for hepatocellular carcinoma (HCC therapy, but the lack of cellular targets and sustained efficacy limits its application. The purpose of this study is to develop an HCC tissue-specific RNAi system and investigate its possibility for HCC treatment.Two different HCC-specific RNAi systems in which therapeutic miRNA or shRNA against target gene (Beclin 1 was directly or indirectly driven by alpha-fetoprotein promoter (AFP-miRNA and AFP-Cre/LoxP-shRNA were constructed. Human HCC cell lines (HepG2, Hep3B and HCCLM3 and non-HCC cell lines (L-02, Hela and SW1116 were infected with the systems. The effectiveness and tissue-specificity of the systems were examined by Q-PCR and western blot analysis. The efficacy of the systems was further tested in mouse model of HCC by intravenous or intratumoral administration. The feasibility of the system for HCC treatment was evaluated by applying the system as adjuvant therapy to enhance sorafenib treatment. An AFP-Cre/LoxP-shRNA system targeting Atg5 gene (AFP-Cre/LoxP-shRNA-Atg5 was constructed and its efficacy in sensitizing HCC cells (MHCC97L/PLC to sorafenib treatment was examined by apoptosis assay in vitro and tumorigenesis assay in vivo.The AFP-miRNA system could silence target gene (Beclin 1 but required a high titer which was lethal to target cells. The AFP-Cre/LoxP-shRNA system could efficiently knockdown target gene while maintain high HCC specificity. Intratumoral injection of the AFP-Cre/LoxP-shRNA system could efficiently silence target gene (Beclin 1 in vivo while intravenous administration could not. The AFP-Cre/LoxP-shRNA system target Atg5 gene could significantly sensitize MHCC97L/PLC cells to sorafenib-induced apoptosis in vitro and tumor growth suppression in vivo.An efficient HCC tissue-specific RNAi system (AFP-Cre/LoxP-shRNA was successfully established. The system provides a usable tool for HCC-specific RNAi
JNK1 protects against glucolipotoxicity-mediated beta-cell apoptosis
DEFF Research Database (Denmark)
Prause, Michala; Christensen, Dan Ploug; Billestrup, Nils
2014-01-01
Pancreatic β-cell dysfunction is central to type 2 diabetes pathogenesis. Prolonged elevated levels of circulating free-fatty acids and hyperglycemia, also termed glucolipotoxicity, mediate β-cell dysfunction and apoptosis associated with increased c-Jun N-terminal Kinase (JNK) activity. Endoplas......Pancreatic β-cell dysfunction is central to type 2 diabetes pathogenesis. Prolonged elevated levels of circulating free-fatty acids and hyperglycemia, also termed glucolipotoxicity, mediate β-cell dysfunction and apoptosis associated with increased c-Jun N-terminal Kinase (JNK) activity....... Endoplasmic reticulum (ER) and oxidative stress are elicited by palmitate and high glucose concentrations further potentiating JNK activity. Our aim was to determine the role of the JNK subtypes JNK1, JNK2 and JNK3 in palmitate and high glucose-induced β-cell apoptosis. We established insulin-producing INS1...... INS1 cells showed increased apoptosis and cleaved caspase 9 and 3 compared to non-sense shRNA expressing control INS1 cells when exposed to palmitate and high glucose associated with increased CHOP expression, ROS formation and Puma mRNA expression. JNK2 shRNA expressing INS1 cells did not affect...
Influence of silencing the MC4R gene by lentivirusmediated RNA ...
African Journals Online (AJOL)
Melanocortin receptor 4 (MC4R) is a key element in the mechanisms used to regulate both aspects of keeping the balance between energy uptake and energy expenditure. MC4R was knocked down by lentivirus-mediated shRNA expressing plasmids, which were controlled by the U6 promoter in bovine fibroblast cells, and ...
RNA interference in designing transgenic crops.
Ali, Nusrat; Datta, Swapan K; Datta, Karabi
2010-01-01
RNA interference (RNAi) is a sequence specific gene silencing mechanism, triggered by the introduction of dsRNA leading to mRNA degradation. It helps in switching on and off the targeted gene, which might have significant impact in developmental biology. Discovery of RNAi represents one of the most promising and rapidly advancing frontiers in plant functional genomics and in crop improvement by plant metabolic engineering and also plays an important role in reduction of allergenicity by silencing specific plant allergens. In plants the RNAi technology has been employed successfully in improvement of several plant species- by increasing their nutritional value, overall quality and by conferring resistance against pathogens and diseases. The review gives an insight to the perspective use of the technology in designing crops with innovation, to bring improvement to crop productivity and quality.
Inhibition of virus replication by RNA interference
Haasnoot, P. C. Joost; Cupac, Daniel; Berkhout, Ben
2003-01-01
RNA interference (RNAi) is a sequence-specific gene-silencing mechanism in eukaryotes, which is believed to function as a defence against viruses and transposons. Since its discovery, RNAi has been developed into a widely used technique for generating genetic knock-outs and for studying gene
Directory of Open Access Journals (Sweden)
Peng Cheng
2015-05-01
Full Text Available Glioblastoma is a highly lethal cancer for which novel therapeutics are urgently needed. Two distinct subtypes of glioblastoma stem-like cells (GSCs were recently identified: mesenchymal (MES and proneural (PN. To identify mechanisms to target the more aggressive MES GSCs, we combined transcriptomic expression analysis and kinome-wide short hairpin RNA screening of MES and PN GSCs. In comparison to PN GSCs, we found significant upregulation and phosphorylation of the receptor tyrosine kinase AXL in MES GSCs. Knockdown of AXL significantly decreased MES GSC self-renewal capacity in vitro and inhibited the growth of glioblastoma patient-derived xenografts. Moreover, inhibition of AXL with shRNA or pharmacologic inhibitors also increased cell death significantly more in MES GSCs. Clinically, AXL expression was elevated in the MES GBM subtype and significantly correlated with poor prognosis in multiple cancers. In conclusion, we identified AXL as a potential molecular target for novel approaches to treat glioblastoma and other solid cancers.
Takahashi, Yuki; Vikman, Elin; Nishikawa, Makiya; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu
2010-09-01
The in vivo half-life of interferons (IFNs) is very short, and its extension would produce a better therapeutic outcome in IFN-based therapy. Delivery of IFN genes is one solution for providing a sustained supply. IFNs have a variety of functions, including the suppression of transgene expression, through interaction with IFN receptors (IFNRs). This suppression could prevent IFNs from being expressed from vectors delivered. Silencing the expression of IFNAR and IFNGR, the receptors for type I and II IFNs, respectively, in cells expressing IFNs may prolong transgene expression of IFNs. Mouse melanoma B16-BL6 cells or mouse liver were selected as a site expressing IFNs (not a target for IFN gene therapy) and IFN-expressing plasmid DNA was delivered with or without small interfering RNA (siRNA) targeting IFNRs. Transfection of B16-BL6 cells with siRNA targeting IFNAR1 subunit (IFNAR1) resulted in the reduced expression of IFNAR on the cell surface. This silencing significantly increased the IFN-beta production in cells that were transfected with IFN-beta-expressing plasmid DNA. Similar results were obtained with the combination of IFN-gamma and IFNGR. Co-injection of IFN-beta-expressing plasmid DNA with siRNA targeting IFNAR1 into mice resulted in sustained plasma concentration of IFN-beta. These results provide experimental evidence that the RNAi-mediated silencing of IFNRs in cells expressing IFN, such as hepatocytes, is an effective approach for improving transgene expression of IFNs when their therapeutic target comprises cells other than those expressing IFNs.
RNA interference: its use as antiviral therapy
Haasnoot, J.; Berkhout, B.
2006-01-01
RNA interference (RNAi) is a sequence-specific gene-silencing mechanism that has been proposed to function as a defence mechanism of eukaryotic cells against viruses and transposons. RNAi was first observed in plants in the form of a mysterious immune response to viral pathogens. But RNAi is more
DEFF Research Database (Denmark)
Nielsen, Troels Tolstrup; Mizielinska, Sarah; Hasholt, Lis
2012-01-01
role in the pathogenesis of the disease. METHODS: In the present study, we used lentiviral vectors to efficiently knockdown CHMP2B by delivering microRNA embedded small hairpin RNAs. RESULTS: We show that CHMP2B can be efficiently knocked down in patient fibroblasts using an RNA interference approach......BACKGROUND: Frontotemporal dementia is the second most common form of young-onset dementia after Alzheimer's disease, and several genetic forms of frontotemporal dementia are known. A rare genetic variant is caused by a point mutation in the CHMP2B gene. CHMP2B is a component of the ESCRT......-III complex, which is involved in endosomal trafficking of proteins targeted for degradation in lysosomes. Mutations in CHMP2B result in abnormal endosomal structures in patient fibroblasts and patient brains, probably through a gain-of-function mechanism, suggesting that the endosomal pathway plays a central...
MicroRNA-Mediated Myostatin Silencing in Caprine Fetal Fibroblasts
Zhong, Bushuai; Zhang, Yanli; Yan, Yibo; Wang, Ziyu; Ying, Shijia; Huang, Mingrui; Wang, Feng
2014-01-01
Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi) mediated by microRNAs (miRNAs) is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF) was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN) response genes, such as interferon beta (IFN-β) and 2′-5′-oligoadenylate synthetase 2 (OAS2), were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats. PMID:25244645
MicroRNA-mediated myostatin silencing in caprine fetal fibroblasts.
Directory of Open Access Journals (Sweden)
Bushuai Zhong
Full Text Available Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi mediated by microRNAs (miRNAs is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN response genes, such as interferon beta (IFN-β and 2'-5'-oligoadenylate synthetase 2 (OAS2, were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats.
Jiang, Lei; Lai, Yiu-Kay; Zhang, Jinfang; Wang, Hua; Lin, Marie CM; He, Ming-liang; Kung, Hsiang-fu
2011-01-01
S100P was recently found to be overexpressed in a variety of cancers and is considered a potential target for cancer therapy, but the functional role or mechanism of action of S100P in colon cancer is not fully understood. In the present study, we knocked down the gene expression of S100P in colon cancer cells using lentivirus-mediated RNA interference. This step resulted in significant inhibition of cancer cell growth, migration and invasion in vitro and tumor growth and liver metastasis in vivo. Moreover, S100P downstream target proteins were identified by proteomic analysis in colon cancer DLD-1 cells with deletion of S100P. Knockdown of S100P led to downregulation of thioredoxin 1 and β-tubulin and upregulation of Rho guanosine diphosphate (GDP) dissociation inhibitor α (RhoGDIA), all potential therapeutic targets in cancer. Taken together, these findings suggest that S100P plays an important role in colon tumorigenesis and metastasis, and the comprehensive and comparative analyses of proteins associated with S100P could contribute to understanding the downstream signal cascade of S100P, leading to tumorigenesis and metastasis. PMID:21327297
Recent Findings Concerning PAMAM Dendrimer Conjugates with Cyclodextrins as Carriers of DNA and RNA
Directory of Open Access Journals (Sweden)
Keiichi Motoyama
2009-08-01
Full Text Available We have evaluated the potential use of various polyamidoamine (PAMAM dendrimer [dendrimer, generation (G 2-4] conjugates with cyclodextrins (CyDs as novel DNA and RNA carriers. Among the various dendrimer conjugates with CyDs, the dendrimer (G3 conjugate with α-CyD having an average degree of substitution (DS of 2.4 [α-CDE (G3, DS2] displayed remarkable properties as DNA, shRNA and siRNA delivery carriers through the sensor function of α-CDEs toward nucleic acid drugs, cell surface and endosomal membranes. In an attempt to develop cell-specific gene transfer carriers, we prepared sugar-appended α-CDEs. Of the various sugar-appended α-CDEs prepared, galactose- or mannose-appended α-CDEs provided superior gene transfer activity to α-CDE in various cells, but not cell-specific gene delivery ability. However, lactose-appended α-CDE [Lac-α-CDE (G2] was found to possess asialoglycoprotein receptor (AgpR-mediated hepatocyte-selective gene transfer activity, both in vitro and in vivo. Most recently, we prepared folate-poly(ethylene glycol-appended α-CDE [Fol-PαC (G3] and revealed that Fol-PαC (G3 imparted folate receptor (FR-mediated cancer cell-selective gene transfer activity. Consequently, α-CDEs bearing integrated, multifunctional molecules may possess the potential to be novel carriers for DNA, shRNA and siRNA.
Lam, Frankie; Abbas, Abdullahi Y; Shao, Hao; Teo, Theodosia; Adams, Julian; Li, Peng; Bradshaw, Tracey D; Fischer, Peter M; Walsby, Elisabeth; Pepper, Chris; Chen, Yi; Ding, Jian; Wang, Shudong
2014-09-15
Dysregulation of cellular transcription and translation is a fundamental hallmark of cancer. As CDK9 and Mnks play pivotal roles in the regulation of RNA transcription and protein synthesis, respectively, they are important targets for drug development. We herein report the cellular mechanism of a novel CDK9 inhibitor CDKI-73 in an ovarian cancer cell line (A2780). We also used shRNA-mediated CDK9 knockdown to investigate the importance of CDK9 in the maintenance of A2780 cells. This study revealed that CDKI-73 rapidly inhibited cellular CDK9 kinase activity and down-regulated the RNAPII phosphorylation. This subsequently caused a decrease in the eIF4E phosphorylation by blocking Mnk1 kinase activity. Consistently, CDK9 shRNA was also found to down-regulate the Mnk1 expression. Both CDKI-73 and CDK9 shRNA decreased anti-apoptotic proteins Mcl-1 and Bcl-2 and induced apoptosis. The study confirmed that CDK9 is required for cell survival and that ovarian cancer may be susceptible to CDK9 inhibition strategy. The data also implied a role of CDK9 in eIF4E-mediated translational control, suggesting that CDK9 may have important implication in the Mnk-eIF4E axis, the key determinants of PI3K/Akt/mTOR- and Ras/Raf/MAPK-mediated tumorigenic activity. As such, CDK9 inhibitor drug candidate CDKI-73 should have a major impact on these pathways in human cancers.
RNA interference and Register Machines (extended abstract
Directory of Open Access Journals (Sweden)
Masahiro Hamano
2012-11-01
Full Text Available RNA interference (RNAi is a mechanism whereby small RNAs (siRNAs directly control gene expression without assistance from proteins. This mechanism consists of interactions between RNAs and small RNAs both of which may be single or double stranded. The target of the mechanism is mRNA to be degraded or aberrated, while the initiator is double stranded RNA (dsRNA to be cleaved into siRNAs. Observing the digital nature of RNAi, we represent RNAi as a Minsky register machine such that (i The two registers hold single and double stranded RNAs respectively, and (ii Machine's instructions are interpreted by interactions of enzyme (Dicer, siRNA (with RISC com- plex and polymerization (RdRp to the appropriate registers. Interpreting RNAi as a computational structure, we can investigate the computational meaning of RNAi, especially its complexity. Initially, the machine is configured as a Chemical Ground Form (CGF, which generates incorrect jumps. To remedy this problem, the system is remodeled as recursive RNAi, in which siRNA targets not only mRNA but also the machine instructional analogues of Dicer and RISC. Finally, probabilistic termination is investigated in the recursive RNAi system.
Role of RNA interference (RNAi) in the moss Physcomitrella patens
Arif, Muhammad Asif; Frank, Wolfgang; Khraiwesh, Basel
2013-01-01
RNA interference (RNAi) is a mechanism that regulates genes by either transcriptional (TGS) or posttranscriptional gene silencing (PTGS), required for genome maintenance and proper development of an organism. Small non-coding RNAs are the key players in RNAi and have been intensively studied in eukaryotes. In plants, several classes of small RNAs with specific sizes and dedicated functions have evolved. The major classes of small RNAs include microRNAs (miRNAs) and small interfering RNAs (siRNAs), which differ in their biogenesis. miRNAs are synthesized from a short hairpin structure while siRNAs are derived from long double-stranded RNAs (dsRNA). Both miRNA and siRNAs control the expression of cognate target RNAs by binding to reverse complementary sequences mediating cleavage or translational inhibition of the target RNA. They also act on the DNA and cause epigenetic changes such as DNA methylation and histone modifications. In the last years, the analysis of plant RNAi pathways was extended to the bryophyte Physcomitrella patens, a non-flowering, non-vascular ancient land plant that diverged from the lineage of seed plants approximately 450 million years ago. Based on a number of characteristic features and its phylogenetic key position in land plant evolution P. patens emerged as a plant model species to address basic as well as applied topics in plant biology. Here we summarize the current knowledge on the role of RNAi in P. patens that shows functional overlap with RNAi pathways from seed plants, and also unique features specific to this species. 2013 by the authors; licensee MDPI, Basel, Switzerland.
Role of RNA interference (RNAi) in the moss Physcomitrella patens
Arif, Muhammad Asif
2013-01-14
RNA interference (RNAi) is a mechanism that regulates genes by either transcriptional (TGS) or posttranscriptional gene silencing (PTGS), required for genome maintenance and proper development of an organism. Small non-coding RNAs are the key players in RNAi and have been intensively studied in eukaryotes. In plants, several classes of small RNAs with specific sizes and dedicated functions have evolved. The major classes of small RNAs include microRNAs (miRNAs) and small interfering RNAs (siRNAs), which differ in their biogenesis. miRNAs are synthesized from a short hairpin structure while siRNAs are derived from long double-stranded RNAs (dsRNA). Both miRNA and siRNAs control the expression of cognate target RNAs by binding to reverse complementary sequences mediating cleavage or translational inhibition of the target RNA. They also act on the DNA and cause epigenetic changes such as DNA methylation and histone modifications. In the last years, the analysis of plant RNAi pathways was extended to the bryophyte Physcomitrella patens, a non-flowering, non-vascular ancient land plant that diverged from the lineage of seed plants approximately 450 million years ago. Based on a number of characteristic features and its phylogenetic key position in land plant evolution P. patens emerged as a plant model species to address basic as well as applied topics in plant biology. Here we summarize the current knowledge on the role of RNAi in P. patens that shows functional overlap with RNAi pathways from seed plants, and also unique features specific to this species. 2013 by the authors; licensee MDPI, Basel, Switzerland.
Deep Sequence Analysis of AgoshRNA Processing Reveals 3' A Addition and Trimming.
Harwig, Alex; Herrera-Carrillo, Elena; Jongejan, Aldo; van Kampen, Antonius Hubertus; Berkhout, Ben
2015-07-14
The RNA interference (RNAi) pathway, in which microprocessor and Dicer collaborate to process microRNAs (miRNA), was recently expanded by the description of alternative processing routes. In one of these noncanonical pathways, Dicer action is replaced by the Argonaute2 (Ago2) slicer function. It was recently shown that the stem-length of precursor-miRNA or short hairpin RNA (shRNA) molecules is a major determinant for Dicer versus Ago2 processing. Here we present the results of a deep sequence study on the processing of shRNAs with different stem length and a top G·U wobble base pair (bp). This analysis revealed some unexpected properties of these so-called AgoshRNA molecules that are processed by Ago2 instead of Dicer. First, we confirmed the gradual shift from Dicer to Ago2 processing upon shortening of the hairpin length. Second, hairpins with a stem larger than 19 base pair are inefficiently cleaved by Ago2 and we noticed a shift in the cleavage site. Third, the introduction of a top G·U bp in a regular shRNA can promote Ago2-cleavage, which coincides with a loss of Ago2-loading of the Dicer-cleaved 3' strand. Fourth, the Ago2-processed AgoshRNAs acquire a short 3' tail of 1-3 A-nucleotides (nt) and we present evidence that this product is subsequently trimmed by the poly(A)-specific ribonuclease (PARN).
Domain motions of Argonaute, the catalytic engine of RNA interference
Directory of Open Access Journals (Sweden)
Wall Michael E
2007-11-01
Full Text Available Abstract Background The Argonaute protein is the core component of the RNA-induced silencing complex, playing the central role of cleaving the mRNA target. Visual inspection of static crystal structures already has enabled researchers to suggest conformational changes of Argonaute that might occur during RNA interference. We have taken the next step by performing an all-atom normal mode analysis of the Pyrococcus furiosus and Aquifex aeolicus Argonaute crystal structures, allowing us to quantitatively assess the feasibility of these conformational changes. To perform the analysis, we begin with the energy-minimized X-ray structures. Normal modes are then calculated using an all-atom molecular mechanics force field. Results The analysis reveals low-frequency vibrations that facilitate the accommodation of RNA duplexes – an essential step in target recognition. The Pyrococcus furiosus and Aquifex aeolicus Argonaute proteins both exhibit low-frequency torsion and hinge motions; however, differences in the overall architecture of the proteins cause the detailed dynamics to be significantly different. Conclusion Overall, low-frequency vibrations of Argonaute are consistent with mechanisms within the current reaction cycle model for RNA interference.
Directory of Open Access Journals (Sweden)
Yong Wang
Full Text Available Cytochomosome P450 enzymes (CYP are heme-containing monooxygenases responsible for oxidative metabolism of many exogenous and endogenous compounds including drugs. The species difference of CYP limits the extent to which data obtained from animals can be translated to humans in pharmacodynamics or pharmacokinetics studies. Transgenic expression of human CYP in animals lacking or with largely reduced endogenous CYP counterparts is recognized as an ideal strategy to correct CYP species difference. CYP3A is the most abundant CYP subfamily both in human and mammals. In this study, we designed a microRNA-based shRNA (miR-shRNA simultaneously targeting four members of mouse CYP3A subfamily (CYP3A11, CYP3A16, CYP3A41 and CYP3A44, and transgenic mice expressing the designed miR-shRNA were generated by lentiviral transgenesis. Results showed that the CYP3A expression level in transgenic mice was markedly reduced compared to that in wild type or unrelated miR-shRNA transgenic mice, and was inversely correlated to the miR-shRNA expression level. The CYP3A expression levels in transgenic offspring of different generations were also remarkably lower compared to those of controls, and moreover the inhibition rate of CYP3A expression remained comparable over generations. The ratio of the targeted CYP3A transcriptional levels was comparable between knockdown and control mice of the same gender as detected by RT-PCR DGGE analysis. These data suggested that transgenic miR-shRNA suppressed CYP3A expression in a dose-dependent and inheritable manner, and transcriptional levels of the targeted CYP3As were suppressed to a similar extent. The observed knockdown efficacy was further confirmed by enzymatic activity analysis, and data showed that CYP3A activities in transgenic mice were markedly reduced compared to those in wild-type or unrelated miR-shRNA transgenic controls (1.11±0.71 vs 5.85±1.74, 5.9±2.4; P<0.01. This work laid down a foundation to further knock
RNA interference targeting raptor inhibits proliferation of gastric cancer cells
International Nuclear Information System (INIS)
Wu, William Ka Kei; Lee, Chung Wa; Cho, Chi Hin; Chan, Francis Ka Leung; Yu, Jun; Sung, Joseph Jao Yiu
2011-01-01
Mammalian target of rapamycin complex 1 (mTORC1) is dysregulated in gastric cancer. The biologic function of mTORC1 in gastric carcinogenesis is unclear. Here, we demonstrate that disruption of mTORC1 function by RNA interference-mediated downregulation of raptor substantially inhibited gastric cancer cell proliferation through induction of G 0 /G 1 -phase cell cycle arrest. The anti-proliferative effect was accompanied by concomitant downregulation of activator protein-1 and upregulation of Smad2/3 transcriptional activities. In addition, the expression of cyclin D 3 and p21 Waf1 , which stabilizes cyclin D/cdk4 complex for G 1 -S transition, was reduced by raptor knockdown. In conclusion, disruption of mTORC1 inhibits gastric cancer cell proliferation through multiple pathways. This discovery may have an implication in the application of mTORC1-directed therapy for the treatment of gastric cancer.
Deep Sequence Analysis of AgoshRNA Processing Reveals 3’ A Addition and Trimming
Directory of Open Access Journals (Sweden)
Alex Harwig
2015-01-01
Full Text Available The RNA interference (RNAi pathway, in which microprocessor and Dicer collaborate to process microRNAs (miRNA, was recently expanded by the description of alternative processing routes. In one of these noncanonical pathways, Dicer action is replaced by the Argonaute2 (Ago2 slicer function. It was recently shown that the stem-length of precursor-miRNA or short hairpin RNA (shRNA molecules is a major determinant for Dicer versus Ago2 processing. Here we present the results of a deep sequence study on the processing of shRNAs with different stem length and a top G·U wobble base pair (bp. This analysis revealed some unexpected properties of these so-called AgoshRNA molecules that are processed by Ago2 instead of Dicer. First, we confirmed the gradual shift from Dicer to Ago2 processing upon shortening of the hairpin length. Second, hairpins with a stem larger than 19 base pair are inefficiently cleaved by Ago2 and we noticed a shift in the cleavage site. Third, the introduction of a top G·U bp in a regular shRNA can promote Ago2-cleavage, which coincides with a loss of Ago2-loading of the Dicer-cleaved 3’ strand. Fourth, the Ago2-processed AgoshRNAs acquire a short 3’ tail of 1–3 A-nucleotides (nt and we present evidence that this product is subsequently trimmed by the poly(A-specific ribonuclease (PARN.
Yuan, Meng-Ke; Tao, Yong; Yu, Wen-Zhen; Kai, Wang; Jiang, Yan-Rong
2010-08-25
To explore the in vivo anti-angiogenesis effects resulting from lentivirus-mediated RNAi of vascular endothelial growth factor (VEGF) in monkeys with iris neovascularization (INV). Five specific recombinant lentiviral vectors for RNA interference, targeting Macaca mulatta VEGFA, were designed and the one with best knock down efficacy (LV-GFP-VEGFi1) in H1299 cells and RF/6A cells was selected by real-time PCR for in vivo use. A laser-induced retinal vein occlusion model was established in one eye of seven cynomolgus monkeys. In monkeys number 1, 3, and 5 (Group 1), the virus (1x10(8) particles) was intravitreally injected into the preretinal space of the animal's eye immediately after laser coagulation; and in monkeys number 2, 4, and 6 (Group 2), the virus (1x10(8) particles) was injected at 10 days after laser coagulation. In monkey number 7, a blank control injection was performed. In monkeys number 1 and 2, virus without RNAi sequence was used; in monkeys number 3 and 4, virus with nonspecific RNAi sequence was used; and in monkeys 5 and 6, LV-GFP-VEGFi1 was used. In monkey number 5, at 23 days after laser treatment, no obvious INV was observed, while fluorescein angiography of the iris revealed high fluorescence at the margin of pupil and point posterior synechiae. At 50 days after laser treatment, only a slight ectropion uvea was found. However, in the other eyes, obvious INV or hyphema was observed. The densities of new iridic vessels all significantly varied: between monkey number 5 and number 3 (36.01+/-4.49/mm(2) versus 48.68+/-9.30/mm(2), p=0.025), between monkey number 3 and monkey number 7 (48.68+/-9.30/mm(2) versus 74.38+/-9.23/mm(2), p=0.002), and between monkey number 5 and number 7 (36.01+/-4.49/mm(2) versus 74.38+/-9.23/mm(2), p<0.001). Lentivirus-mediated RNAi of VEGF may be a new strategy to treat iris neovascularization, while further studies are needed to investigate the long-term effect.
Hacker, David L; Bertschinger, Martin; Baldi, Lucia; Wurm, Florian M
2004-10-27
Human embryonic kidney 293 (HEK293) cells, a widely used host for large-scale transient expression of recombinant proteins, are transformed with the adenovirus E1A and E1B genes. Because the E1A proteins function as transcriptional activators or repressors, they may have a positive or negative effect on transient transgene expression in this cell line. Suspension cultures of HEK293 EBNA (HEK293E) cells were co-transfected with a reporter plasmid expressing the GFP gene and a plasmid expressing a short hairpin RNA (shRNA) targeting the E1A mRNAs for degradation by RNA interference (RNAi). The presence of the shRNA in HEK293E cells reduced the steady state level of E1A mRNA up to 75% and increased transient GFP expression from either the elongation factor-1alpha (EF-1alpha) promoter or the human cytomegalovirus (HCMV) immediate early promoter up to twofold. E1A mRNA depletion also resulted in a twofold increase in transient expression of a recombinant IgG in both small- and large-scale suspension cultures when the IgG light and heavy chain genes were controlled by the EF-1alpha promoter. Finally, transient IgG expression was enhanced 2.5-fold when the anti-E1A shRNA was expressed from the same vector as the IgG light chain gene. These results demonstrated that E1A has a negative effect on transient gene expression in HEK293E cells, and they established that RNAi can be used to enhance recombinant protein expression in mammalian cells.
Short-term cytotoxic effects and long-term instability of RNAi delivered using lentiviral vectors
Directory of Open Access Journals (Sweden)
Kruithof Egbert KO
2004-08-01
Full Text Available Abstract Background RNA interference (RNAi can potently reduce target gene expression in mammalian cells and is in wide use for loss-of-function studies. Several recent reports have demonstrated that short double-stranded RNAs (dsRNAs, used to mediate RNAi, can also induce an interferon-based response resulting in changes in the expression of many interferon-responsive genes. Off-target gene silencing has also been described, bringing into question the validity of certain RNAi-based approaches for studying gene function. We have targeted the plasminogen activator inhibitor-2 (PAI-2 or SERPINB2 mRNA using lentiviral vectors for delivery of U6 promoter-driven PAI-2-targeted short hairpin RNA (shRNA expression. PAI-2 is reported to have anti-apoptotic activity, thus reduction of endogenous expression may be expected to make cells more sensitive to programmed cell death. Results As expected, we encountered a cytotoxic phenotype when targeting the PAI-2 mRNA with vector-derived shRNA. However, this predicted phenotype was a potent non-specific effect of shRNA expression, as functional overexpression of the target protein failed to rescue the phenotype. By decreasing the shRNA length or modifying its sequence we maintained PAI-2 silencing and reduced, but did not eliminate, cytotoxicity. ShRNA of 21 complementary nucleotides (21 mers or more increased expression of the oligoadenylate synthase-1 (OAS1 interferon-responsive gene. 19 mer shRNA had no effect on OAS1 expression but long-term selective pressure on cell growth was observed. By lowering lentiviral vector titre we were able to reduce both expression of shRNA and induction of OAS1, without a major impact on the efficacy of gene silencing. Conclusions Our data demonstrate a rapid cytotoxic effect of shRNAs expressed in human tumor cell lines. There appears to be a cut-off of 21 complementary nucleotides below which there is no interferon response while target gene silencing is maintained
Miller, Peter G.; Al-Shahrour, Fatima; Hartwell, Kimberly A.; Chu, Lisa P.; Järås, Marcus; Puram, Rishi V.; Puissant, Alexandre; Callahan, Kevin P.; Ashton, John; McConkey, Marie E.; Poveromo, Luke P.; Cowley, Glenn S.; Kharas, Michael G.; Labelle, Myriam; Shterental, Sebastian; Fujisaki, Joji; Silberstein, Lev; Alexe, Gabriela; Al-Hajj, Muhammad A.; Shelton, Christopher A.; Armstrong, Scott A.; Root, David E.; Scadden, David T.; Hynes, Richard O.; Mukherjee, Siddhartha; Stegmaier, Kimberly; Jordan, Craig T.; Ebert, Benjamin L.
2013-01-01
SUMMARY We used an in vivo short hairpin RNA (shRNA) screening approach to identify genes that are essential for MLL-AF9 acute myeloid leukemia (AML). We found that Integrin Beta 3 (Itgb3) is essential for murine leukemia cells in vivo, and for human leukemia cells in xenotransplantation studies. In leukemia cells, Itgb3 knockdown impaired homing, downregulated LSC transcriptional programs, and induced differentiation via the intracellular kinase, Syk. In contrast, loss of Itgb3 in normal HSPCs did not affect engraftment, reconstitution, or differentiation. Finally, we confirmed that Itgb3 is dispensable for normal hematopoiesis and required for leukemogenesis using an Itgb3 knockout mouse model. Our results establish the significance of the Itgb3 signaling pathway as a potential therapeutic target in AML. PMID:23770013
A large-scale RNA interference screen identifies genes that regulate autophagy at different stages.
Guo, Sujuan; Pridham, Kevin J; Virbasius, Ching-Man; He, Bin; Zhang, Liqing; Varmark, Hanne; Green, Michael R; Sheng, Zhi
2018-02-12
Dysregulated autophagy is central to the pathogenesis and therapeutic development of cancer. However, how autophagy is regulated in cancer is not well understood and genes that modulate cancer autophagy are not fully defined. To gain more insights into autophagy regulation in cancer, we performed a large-scale RNA interference screen in K562 human chronic myeloid leukemia cells using monodansylcadaverine staining, an autophagy-detecting approach equivalent to immunoblotting of the autophagy marker LC3B or fluorescence microscopy of GFP-LC3B. By coupling monodansylcadaverine staining with fluorescence-activated cell sorting, we successfully isolated autophagic K562 cells where we identified 336 short hairpin RNAs. After candidate validation using Cyto-ID fluorescence spectrophotometry, LC3B immunoblotting, and quantitative RT-PCR, 82 genes were identified as autophagy-regulating genes. 20 genes have been reported previously and the remaining 62 candidates are novel autophagy mediators. Bioinformatic analyses revealed that most candidate genes were involved in molecular pathways regulating autophagy, rather than directly participating in the autophagy process. Further autophagy flux assays revealed that 57 autophagy-regulating genes suppressed autophagy initiation, whereas 21 candidates promoted autophagy maturation. Our RNA interference screen identifies identified genes that regulate autophagy at different stages, which helps decode autophagy regulation in cancer and offers novel avenues to develop autophagy-related therapies for cancer.
RNA interference prevents lipopolysaccharide-induced preprotachykinin gene expression
International Nuclear Information System (INIS)
Lai, Y.-L.; Yu, S.C.; Chen, M.-J.
2003-01-01
We showed previously that lipopolysaccharide (LPS) induces noncholinergic airway hyperreactivity to capsaicin via an upregulation of tachykinin synthesis. This study was designed to test whether double-stranded preprotachykinin (ds PPT) RNA, RNA interference (RNAi), prevents the LPS-induced alterations. First, cultured primary nodose ganglial cells of newborn Brown-Norway rats were divided into four groups: control; LPS; LPS+RNAi; and LPS+RNAi+liposome. Second, young Brown-Norway rats for the in vivo study were divided into three groups (control; LPS; and LPS+RNAi), and ds PPT RNA was microinjected bilaterally into the nodose ganglia in the LPS+RNAi group. Then, ganglial cells were collected from the culture whereas the nodose ganglia and lungs were sampled from the animals, and PPT mRNA and substance P (SP) levels were analyzed. Also, airway reactivity to capsaicin was performed in vivo. LPS induced significant increases in PPT mRNA and SP levels in vitro and in vivo and an increase in airway reactivity to capsaicin in vivo. However, ds PPT RNA, but not scrambled RNA, prevented all LPS-induced alterations. The effect of ds PPT RNA was not enhanced by liposome in vitro. Therefore, we demonstrated that the local application of RNAi prevents effectively the activation of the noncholinergic system modulating the lungs/airways
Specific RNA Interference in Caenorhabditis elegans by Ingested dsRNA Expressed in Bacillus subtilis
Lezzerini, M.; van de Ven, K.; Veerman, M.; Brul, S.; Budovskaya, Y.V.
2015-01-01
In nematodes, genome-wide RNAi-screening has been widely used as a rapid and efficient method to identify genes involved in the aging processes. By far the easiest way of inducing RNA interference (RNAi) in Caenorhabditis elegans is by feeding Escherichia coli that expresses specific double stranded
Scott, Tristan; Paweska, Janusz T; Arbuthnot, Patrick; Weinberg, Marc S
2012-01-01
Rift Valley fever virus (RVFV), a member of the Bunyaviridae family, may cause severe hepatitis, encephalitis and haemorrhagic fever in humans. There are currently no available licensed vaccines or therapies to treat the viral infection in humans. RNA interference (RNAi)-based viral gene silencing offers a promising approach to inhibiting replication of this highly pathogenic virus. The small (S) segment of the RVFV tripartite genome carries the genetic determinates for pathogenicity during infection. This segment encodes the non-structural S (NSs) and essential nucleocapsid (N) genes. To advance RNAi-based inhibition of RVFV replication, we designed several Pol III short hairpin RNA (shRNA) expression cassettes against the NSs and N genes, including a multimerized plasmid vector that included four shRNA expression cassettes. Effective target silencing was demonstrated using full- and partial-length target reporter assays, and confirmed by western blot analysis of exogenous N and NSs expression. Small RNA northern blots showed detectable RNAi guide strand formation from single and multimerized shRNA constructs. Using a cell culture model of RVFV replication, shRNAs targeting the N gene decreased intracellular nucleocapsid protein concentration and viral replication. The shRNAs directed against the NSs gene reduced NSs protein concentrations and alleviated NSs-mediated cytotoxicity, which may be caused by host transcription suppression. These data are the first demonstration that RNAi activators have a potential therapeutic benefit for countering RVFV infection.
Directory of Open Access Journals (Sweden)
Li T
2015-07-01
Full Text Available Tingting Li,1 Xue Shen,1 Yin Chen,1 Chengchen Zhang,1 Jie Yan,1 Hong Yang,1 Chunhui Wu,1,2 Hongjun Zeng,1,2 Yiyao Liu1,21Department of Biophysics, School of Life Science and Technology, 2Center for Information in Biomedicine, University of Electronic Science and Technology of China, Chengdu, Sichuan, People’s Republic of ChinaAbstract: Engineering a safe and high-efficiency delivery system for efficient RNA interference is critical for successful gene therapy. In this study, we designed a novel nanocarrier system of polyethyleneimine (PEI-modified Fe3O4@SiO2, which allows high efficient loading of VEGF small hairpin (shRNA to form Fe3O4@SiO2/PEI/VEGF shRNA nanocomposites for VEGF gene silencing as well as magnetic resonance (MR imaging. The size, morphology, particle stability, magnetic properties, and gene-binding capacity and protection were determined. Low cytotoxicity and hemolyticity against human red blood cells showed the excellent biocompatibility of the multifunctional nanocomposites, and also no significant coagulation was observed. The nanocomposites maintain their superparamagnetic property at room temperature and no appreciable change in magnetism, even after PEI modification. The qualitative and quantitative analysis of cellular internalization into MCF-7 human breast cancer cells by Prussian blue staining and inductively coupled plasma atomic emission spectroscopy analysis, respectively, demonstrated that the Fe3O4@SiO2/PEI/VEGF shRNA nanocomposites could be easily internalized by MCF-7 cells, and they exhibited significant inhibition of VEGF gene expression. Furthermore, the MR cellular images showed that the superparamagnetic iron oxide core of our Fe3O4@SiO2/PEI/VEGF shRNA nanocomposites could also act as a T2-weighted contrast agent for cancer MR imaging. Our data highlight multifunctional Fe3O4@SiO2/PEI/VEGF shRNA nanocomposites as a potential platform for simultaneous gene delivery and MR cell imaging, which are promising
Li, Rui; Pan, Yuqin; He, Bangshun; Xu, Yeqiong; Gao, Tianyi; Song, Guoqi; Sun, Huiling; Deng, Qiwen; Wang, Shukui
2013-12-01
We investigated the effect of CD147 silencing on HT29 cell proliferation and invasion. We constructed a novel short hairpin RNA (shRNA) expression vector pYr-mir30-shRNA. The plasmid was transferred to HT29 cells. The expression of CD147, MCT1 (lactate transporters monocarboxylate transporter 1) and MCT4 (lactate transporters monocarboxylate transporter 4) were monitored by quantitative PCR and western blotting, respectively. The MMP-2 (matrix metalloproteinase-2) and MMP-9 (matrix metalloproteinase-9) activities were determined by gelatin zymography assay, while the intracellular lactate concentration was determined by the lactic acid assay kit. WST-8 assay was used to determine the HT29 cell proliferation and the chemosensitivity. Invasion assay was used to determine the invasion of HT29 cells. In addition, we established a colorectal cancer model, and detected CD147 expression in vivo. The results showed that the expression of CD147 and MCT1 was significantly reduced at both mRNA and protein levels, and also the activity of MMP-2 and MMP-9 was reduced. The proliferation and invasion were decreased, but chemosensitivity to cisplatin was increased. In vivo, the CD147 expression was also significantly decreased, and reduced the tumor growth after CD147 gene silencing. The results demonstrated that silencing of CD147 expression inhibited the proliferation and invasion, suggesting CD147 silencing might be an adjuvant gene therapy strategy to chemotherapy.
Immunoregulation by interference RNA (iRNA – mechanisms, role, perspective
Directory of Open Access Journals (Sweden)
Emilia Sikora
2011-08-01
Full Text Available The functioning of an organism depends on the precise control mechanisms, constantly adjusted to the actual state. Therefore, there is a need for efficient communication between both adjacent and distant cells, which may be executed by proteins such as hormones, neurotransmitters and cytokines. Recently another means of regulation has emerged – short regulatory RNAs (srRNAs. Although discovered only a couple of years ago, the mechanism of RNA interference has already become a topic of thousands of publications, defining its roles in both physiological and pathological processes, such as cancerogenesis and autoimmunization.RNAs regulating cell function may be coded in its genome (both exons and introns or be introduced from the external environment. In mammals microRNAs (miRNAs cooperate with proteins from the Ago/PIWI family to form effector ribonucleoprotein complexes, and owing to their complementarity to the target mRNA, control genes’ expression at the posttranscriptional level, either through the suppression of mRNA translation or through mRNA degradation.SrRNAs are crucial regulators throughout the development of immune cells, starting from hematopoietic stem cells, up to the effector cells of the adaptive immune response. Moreover, some of the regulatory cells perform their function by releasing miRNAs, which are then transported to the target cells, possibly enclosed in the exosomes.
Directory of Open Access Journals (Sweden)
Hongmei Wang
Full Text Available BACKGROUND: Although it is known that RNA interference (RNAi targeting viral genes protects experimental animals, such as mice, from the challenge of Foot-and-mouth disease virus (FMDV, it has not been previously investigated whether shRNAs targeting FMDV in transgenic dairy cattle or primary transgenic bovine epithelium cells will confer resistance against FMDV challenge. PRINCIPAL FINDING: Here we constructed three recombinant lentiviral vectors containing shRNA against VP2 (RNAi-VP2, VP3 (RNAi-VP3, or VP4 (RNAi-VP4 of FMDV, and found that all of them strongly suppressed the transient expression of a FLAG-tagged viral gene fusion protein in 293T cells. In BHK-21 cells, RNAi-VP4 was found to be more potent in inhibition of viral replication than the others with over 98% inhibition of viral replication. Therefore, recombinant lentiviral vector RNAi-VP4 was transfected into bovine fetal fibroblast cells to generate transgenic nuclear donor cells. With subsequent somatic cell cloning, we generated forty transgenic blastocysts, and then transferred them to 20 synchronized recipient cows. Three transgenic bovine fetuses were obtained after pregnant period of 4 months, and integration into chromosome in cloned fetuses was confirmed by Southern hybridization. The primary tongue epithelium cells of transgenic fetuses were isolated and inoculated with 100 TCID(50 of FMDV, and it was observed that shRNA significantly suppressed viral RNA synthesis and inhibited over 91% of viral replication after inoculation of FMDV for 48 h. CONCLUSION: RNAi-VP4 targeting viral VP4 gene appears to prevent primary epithelium cells of transgenic bovine fetus from FMDV infection, and it could be a candidate shRNA used for cultivation of transgenic cattle against FMDV.
Production of high-amylose maize lines using RNA interference in ...
African Journals Online (AJOL)
amylose maize lines with a low T-DNA copy number, demonstrating that RNAi is an efficient method for the production of high-amylose maize lines. Key words: Maize, high-amylose, RNA interference, starch branching enzyme gene sbe2a.
Retention and loss of RNA interference pathways in trypanosomatid protozoans.
Directory of Open Access Journals (Sweden)
Lon-Fye Lye
2010-10-01
Full Text Available RNA interference (RNAi pathways are widespread in metaozoans but the genes required show variable occurrence or activity in eukaryotic microbes, including many pathogens. While some Leishmania lack RNAi activity and Argonaute or Dicer genes, we show that Leishmania braziliensis and other species within the Leishmania subgenus Viannia elaborate active RNAi machinery. Strong attenuation of expression from a variety of reporter and endogenous genes was seen. As expected, RNAi knockdowns of the sole Argonaute gene implicated this protein in RNAi. The potential for functional genetics was established by testing RNAi knockdown lines lacking the paraflagellar rod, a key component of the parasite flagellum. This sets the stage for the systematic manipulation of gene expression through RNAi in these predominantly diploid asexual organisms, and may also allow selective RNAi-based chemotherapy. Functional evolutionary surveys of RNAi genes established that RNAi activity was lost after the separation of the Leishmania subgenus Viannia from the remaining Leishmania species, a divergence associated with profound changes in the parasite infectious cycle and virulence. The genus Leishmania therefore offers an accessible system for testing hypothesis about forces that may select for the loss of RNAi during evolution, such as invasion by viruses, changes in genome plasticity mediated by transposable elements and gene amplification (including those mediating drug resistance, and/or alterations in parasite virulence.
Energy Technology Data Exchange (ETDEWEB)
Li, Min; Li, Hui; Liu, Xiaoqiang; Xu, Ding; Wang, Fang, E-mail: milwang_122@msn.com
2016-07-15
The role of microRNA (miRNA) in proliferative vitreoretinopathy (PVR) progression has not been studied extensively, especially in retinal pigment epithelial–mesenchymal transition (EMT) which is the main reason for formation of PVR. In this study, we first investigated the miRNA expression profile in transforming growth factor beta 1 (TGF-β1) mediated EMT of ARPE-19 cells. Among the five changed miRNAs, miR-29b showed the most significant downregulation. Enhanced expression of miR-29b could reverse TGF-β1 induced EMT through targeting Akt2. Akt2 downregulation could inhibit TGF-β1-induced EMT. Furthermore, inhibition of miR-29b in ARPE-19 cells directly triggered EMT process, which characterized by the phenotypic transition and the upregulation of α-smooth muscle actin (α-SMA) and downregulation of E-cadherin and zona occludin-1 (ZO-1) with increased cell migration. Akt2-shRNA also inhibited miR-29 inhibitor-induced EMT process. These data indicate that miR-29b plays an important role in TGF-β1-mediated EMT in ARPE-19 cells by targeting Akt2. - Highlights: • MiR-29b expression is decreased in TGF-β1-induced EMT of ARPE-19 cells. • MiR-29b inhibits TGF-β1-induced EMT in ARPE-19 cells. • MiR-29b inhibitor induces EMT in ARPE-19 cells. • Akt2 is the target for miR-29b. • Downregulation of Akt2 prevents TGF-β1-induced EMT of ARPE-19 cells.
A genome-wide shRNA screen identifies GAS1 as a novel melanoma metastasis suppressor gene.
Gobeil, Stephane; Zhu, Xiaochun; Doillon, Charles J; Green, Michael R
2008-11-01
Metastasis suppressor genes inhibit one or more steps required for metastasis without affecting primary tumor formation. Due to the complexity of the metastatic process, the development of experimental approaches for identifying genes involved in metastasis prevention has been challenging. Here we describe a genome-wide RNAi screening strategy to identify candidate metastasis suppressor genes. Following expression in weakly metastatic B16-F0 mouse melanoma cells, shRNAs were selected based upon enhanced satellite colony formation in a three-dimensional cell culture system and confirmed in a mouse experimental metastasis assay. Using this approach we discovered 22 genes whose knockdown increased metastasis without affecting primary tumor growth. We focused on one of these genes, Gas1 (Growth arrest-specific 1), because we found that it was substantially down-regulated in highly metastatic B16-F10 melanoma cells, which contributed to the high metastatic potential of this mouse cell line. We further demonstrated that Gas1 has all the expected properties of a melanoma tumor suppressor including: suppression of metastasis in a spontaneous metastasis assay, promotion of apoptosis following dissemination of cells to secondary sites, and frequent down-regulation in human melanoma metastasis-derived cell lines and metastatic tumor samples. Thus, we developed a genome-wide shRNA screening strategy that enables the discovery of new metastasis suppressor genes.
Li, Yuan; Zhuo, Baobiao; Yin, Yiyu; Han, Tao; Li, Shixian; Li, Zhengwei; Wang, Jian
2017-09-09
Chemotherapy is one of the few effective choices for patients with neuroblastoma. However, the development of muti-drug resistance (MDR) to chemotherapy is a major obstacle to the effective treatment of advanced or recurrent neuroblastoma. The muti-drug resistance-associated protein (MRP), which encodes a transmembrane glycoprotein, is a key regulator of MDR. The expression of MRP is a close correlation with MYCN oncogene in neuroblastoma. We have recently shown ZD55-shMYCN (oncolytic virus armed with shRNA against MYCN) can down-regulate MYCN to inhibit tumor cells proliferation and induce apoptosis in neuroblastoma. Here we further report ZD55-shMYCN re-sensitized doxorubicin-resistant cells to doxorubicin (as shown by reduced proliferation, increased apoptosis, and inhibited cell migration), and reduced the in vivo growth rate of neuroblastoma xenografts by down-regulation of MRP expression. Sequential therapy with doxorubicin did not affect the replication of ZD55-shMYCN in doxorubicin-resistant neuroblastoma cells, but decreased the expression of Bcl-2, Bcl-X L , MMP-1. Thus, this synergistic effect of ZD55-shMYCN in combination with doxorubicin provides a novel therapy strategy for doxorubicin-resistant neuroblastoma, and is a promising approach for further clinical development. Copyright © 2017 Elsevier Inc. All rights reserved.
Steric restrictions of RISC in RNA interference identified with size-expanded RNA nucleobases.
Hernández, Armando R; Peterson, Larryn W; Kool, Eric T
2012-08-17
Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC), the key protein complex of RNA interference (RNAi), is of great importance to the development of siRNAs with improved biological and potentially therapeutic function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to -5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3'-end increased activity over that of wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation.
Petrick, Jay S; Brower-Toland, Brent; Jackson, Aimee L; Kier, Larry D
2013-07-01
Gene expression can be modulated in plants to produce desired traits through agricultural biotechnology. Currently, biotechnology-derived crops are compared to their conventional counterparts, with safety assessments conducted on the genetic modification and the intended and unintended differences. This review proposes that this comparative safety assessment paradigm is appropriate for plants modified to express mediators of RNA-mediated gene regulation, including RNA interference (RNAi), a gene suppression mechanism that naturally occurs in plants and animals. The molecular mediators of RNAi, including long double-stranded RNAs (dsRNA), small interfering RNAs (siRNA), and microRNAs (miRNA), occur naturally in foods; therefore, there is an extensive history of safe consumption. Systemic exposure following consumption of plants containing dsRNAs that mediate RNAi is limited in higher organisms by extensive degradation of ingested nucleic acids and by biological barriers to uptake and efficacy of exogenous nucleic acids. A number of mammalian RNAi studies support the concept that a large margin of safety will exist for any small fraction of RNAs that might be absorbed following consumption of foods from biotechnology-derived plants that employ RNA-mediated gene regulation. Food and feed derived from these crops utilizing RNA-based mechanisms is therefore expected to be as safe as food and feed derived through conventional plant breeding. Copyright © 2013 Elsevier Inc. All rights reserved.
Vondrusková, Eva; van den Burg, Janny; Zíková, Alena; Ernst, Nancy Lewis; Stuart, Kenneth; Benne, Rob; Lukes, Julius
2005-01-01
Mitochondrial RNA-binding proteins MRP1 and MRP2 occur in a heteromeric complex that appears to play a role in U-insertion/deletion editing in trypanosomes. Reduction in the levels of MRP1 (gBP21) and/or MRP2 (gBP25) mRNA by RNA interference in procyclic Trypanosoma brucei resulted in severe growth
RNA Interference in Insect Vectors for Plant Viruses
Kanakala, Surapathrudu; Ghanim, Murad
2016-01-01
Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests...
Cao, Yongmei; Jiang, Zhen; Zeng, Zhen; Liu, Yujing; Gu, Yuchun; Ji, Yingying; Zhao, Yupeng; Li, Yingchuan
2016-01-01
Pulmonary arterial hypertension (PAH) is a life-threatening disorder that ultimately causes heart failure. While the underlying causes of this condition are not well understood, previous studies suggest that the anti-apoptotic nature of pulmonary microvascular endothelial cells (PMVECs) in hypoxic environments contributes to PAH pathogenesis. In this study, we focus on the contribution of Bcl-2 and hypoxia response element (HRE) to apoptosis-resistant endothelial cells and investigate the mechanism. PMVECs obtained from either normal rats or apoptosis-resistant PMVECs obtained from PAH rats were transduced with recombinant lentiviral vectors carrying either Bcl-2-shRNA or HRE combined Bcl-2-shRNA, and then cultured these cells for 24 h under hypoxic (5% O2) or normoxic (21% O2) conditions. In normal PMVECs, Bcl-2-shRNA or HRE combined with Bcl-2-shRNA transduction successfully decreased Bcl-2 expression, while increasing apoptosis as well as caspase-3 and P53 expression in a normoxic environment. In a hypoxic environment, the effects of Bcl-2-shRNA treatment on cell apoptosis, and on Bcl-2, caspase-3, P53 expression were significantly suppressed. Conversely, HRE activation combined with Bcl-2-shRNA transduction markedly enhanced cell apoptosis and upregulated caspase-3 and P53 expression, while decreasing Bcl-2 expression. Furthermore, in apoptosis-resistant PMVECs, HRE-mediated Bcl-2 silencing effectively enhanced cell apoptosis and caspase-3 activity. The apoptosis rate was significantly depressed when Lv-HRE-Bcl-2-shRNA was combined with Lv-P53-shRNA or Lv-caspase3-shRNA transduction in a hypoxic environment. These results suggest that HRE-mediated Bcl-2 inhibition can effectively attenuate hypoxia-induced apoptosis resistance in PMVECs by downregulating Bcl-2 expression and upregulating caspase-3 and P53 expression. This study therefore reveals critical insight into potential therapeutic targets for treating PAH.
Hu, Hui; Lu, Hong; He, Zhanping; Han, Xiangjun; Chen, Jing; Tu, Rong
2012-07-25
To investigate the effects of mRNA interference on aquaporin-4 expression in swollen tissue of rats with ischemic cerebral edema, and diagnose the significance of diffusion-weighted MRI, we injected 5 μL shRNA- aquaporin-4 (control group) or siRNA- aquaporin-4 solution (1:800) (RNA interference group) into the rat right basal ganglia immediately before occlusion of the middle cerebral artery. At 0.25 hours after occlusion of the middle cerebral artery, diffusion-weighted MRI displayed a high signal; within 2 hours, the relative apparent diffusion coefficient decreased markedly, aquaporin-4 expression increased rapidly, and intracellular edema was obviously aggravated; at 4 and 6 hours, the relative apparent diffusion coefficient slowly returned to control levels, aquaporin-4 expression slightly increased, and angioedema was observed. In the RNA interference group, during 0.25-6 hours after injection of siRNA- aquaporin-4 solution, the relative apparent diffusion coefficient slightly fluctuated and aquaporin-4 expression was upregulated; during 0.5-4 hours, the relative apparent diffusion coefficient was significantly higher, while aquaporin-4 expression was significantly lower when compared with the control group, and intracellular edema was markedly reduced; at 0.25 and 6 hours, the relative apparent diffusion coefficient and aquaporin-4 expression were similar when compared with the control group; obvious angioedema remained at 6 hours. Pearson's correlation test results showed that aquaporin-4 expression was negatively correlated with the apparent diffusion coefficient (r = -0.806, P coefficient. Aquaporin-4 gene interference can effectively inhibit the upregulation of aquaporin-4 expression during the stage of intracellular edema with time-effectiveness. Moreover, diffusion-weighted MRI can accurately detect intracellular edema.
Energy Technology Data Exchange (ETDEWEB)
Iida, Tetsushi, E-mail: tiida@nig.ac.jp [Division of Cytogenetics, National Institute of Genetics, Mishima, 1111 Yata, Mishima 411-8540 (Japan); The Graduate University for Advanced Studies, Sokendai, Mishima, 1111 Yata, Mishima 411-8540 (Japan); Precursory Research for Embryonic Science and Technology (PRESTO), Japan Science and Technology Agency (JST), 4-1-8, Honcho, Kawaguchi-shi, Saitama 332-0012 (Japan); Iida, Naoko [Division of Mutagenesis, National Institute of Genetics, Mishima, 1111 Yata, Mishima 411-8540 (Japan); Tsutsui, Yasuhiro [Department of Life Science, Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology, Nagatsuda-cho, Midori-ku, Yokohama 226-8501 (Japan); Yamao, Fumiaki [Division of Mutagenesis, National Institute of Genetics, Mishima, 1111 Yata, Mishima 411-8540 (Japan); The Graduate University for Advanced Studies, Sokendai, Mishima, 1111 Yata, Mishima 411-8540 (Japan); Kobayashi, Takehiko [Division of Cytogenetics, National Institute of Genetics, Mishima, 1111 Yata, Mishima 411-8540 (Japan); The Graduate University for Advanced Studies, Sokendai, Mishima, 1111 Yata, Mishima 411-8540 (Japan)
2012-10-12
Highlights: Black-Right-Pointing-Pointer RNAi is linked to the cell cycle checkpoint in fission yeast. Black-Right-Pointing-Pointer Ptr1 co-purifies with Ago1. Black-Right-Pointing-Pointer The ptr1-1 mutation impairs the checkpoint but does not affect gene silencing. Black-Right-Pointing-Pointer ago1{sup +} and ptr1{sup +} regulate the cell cycle checkpoint via the same pathway. Black-Right-Pointing-Pointer Mutations in ago1{sup +} and ptr1{sup +} lead to the nuclear accumulation of poly(A){sup +} RNAs. -- Abstract: Ago1, an effector protein of RNA interference (RNAi), regulates heterochromatin silencing and cell cycle arrest in fission yeast. However, the mechanism by which Ago1 controls cell cycle checkpoint following hydroxyurea (HU) treatment has not been elucidated. In this study, we show that Ago1 and other RNAi factors control cell cycle checkpoint following HU treatment via a mechanism independent of silencing. While silencing requires dcr1{sup +}, the overexpression of ago1{sup +} alleviated the cell cycle defect in dcr1{Delta}. Ago1 interacted with the mRNA export factor, Ptr1. The ptr1-1 mutation impaired cell cycle checkpoint but gene silencing was unaffected. Genetic analysis revealed that the regulation of cell cycle checkpoint by ago1{sup +} is dependent on ptr1{sup +}. Nuclear accumulation of poly(A){sup +} RNAs was detected in mutants of ago1{sup +} and ptr1{sup +}, suggesting there is a functional link between the cell cycle checkpoint and RNAi-mediated RNA quality control.
Directory of Open Access Journals (Sweden)
Jinlong Guo
2015-01-01
Full Text Available As one of the critical diseases of sugarcane, sugarcane mosaic disease can lead to serious decline in stalk yield and sucrose content. It is mainly caused by Potyvirus sugarcane mosaic virus (SCMV and/or Sorghum mosaic virus (SrMV, with additional differences in viral strains. RNA interference (RNAi is a novel strategy for producing viral resistant plants. In this study, based on multiple sequence alignment conducted on genomic sequences of different strains and isolates of SrMV, the conserved region of coat protein (CP genes was selected as the target gene and the interference sequence with size of 423 bp in length was obtained through PCR amplification. The RNAi vector pGII00-HACP with an expression cassette containing both hairpin interference sequence and cp4-epsps herbicide-tolerant gene was transferred to sugarcane cultivar ROC22 via Agrobacterium-mediated transformation. After herbicide screening, PCR molecular identification, and artificial inoculation challenge, anti-SrMV positive transgenic lines were successfully obtained. SrMV resistance rate of the transgenic lines with the interference sequence was 87.5% based on SrMV challenge by artificial inoculation. The genetically modified SrMV-resistant lines of cultivar ROC22 provide resistant germplasm for breeding lines and can also serve as resistant lines having the same genetic background for study of resistance mechanisms.
Alakonya, Amos; Kumar, Ravi; Koenig, Daniel; Kimura, Seisuke; Townsley, Brad; Runo, Steven; Garces, Helena M; Kang, Julie; Yanez, Andrea; David-Schwartz, Rakefet; Machuka, Jesse; Sinha, Neelima
2012-07-01
Infection of crop species by parasitic plants is a major agricultural hindrance resulting in substantial crop losses worldwide. Parasitic plants establish vascular connections with the host plant via structures termed haustoria, which allow acquisition of water and nutrients, often to the detriment of the infected host. Despite the agricultural impact of parasitic plants, the molecular and developmental processes by which host/parasitic interactions are established are not well understood. Here, we examine the development and subsequent establishment of haustorial connections by the parasite dodder (Cuscuta pentagona) on tobacco (Nicotiana tabacum) plants. Formation of haustoria in dodder is accompanied by upregulation of dodder KNOTTED-like homeobox transcription factors, including SHOOT MERISTEMLESS-like (STM). We demonstrate interspecific silencing of a STM gene in dodder driven by a vascular-specific promoter in transgenic host plants and find that this silencing disrupts dodder growth. The reduced efficacy of dodder infection on STM RNA interference transgenics results from defects in haustorial connection, development, and establishment. Identification of transgene-specific small RNAs in the parasite, coupled with reduced parasite fecundity and increased growth of the infected host, demonstrates the efficacy of interspecific small RNA-mediated silencing of parasite genes. This technology has the potential to be an effective method of biological control of plant parasite infection.
HIV-1 nef suppression by virally encoded microRNA
Directory of Open Access Journals (Sweden)
Brisibe Ebiamadon
2004-12-01
Full Text Available Abstract Background MicroRNAs (miRNAs are 21~25-nucleotides (nt long and interact with mRNAs to trigger either translational repression or RNA cleavage through RNA interference (RNAi, depending on the degree of complementarity with the target mRNAs. Our recent study has shown that HIV-1 nef dsRNA from AIDS patients who are long-term non-progressors (LTNPs inhibited the transcription of HIV-1. Results Here, we show the possibility that nef-derived miRNAs are produced in HIV-1 persistently infected cells. Furthermore, nef short hairpin RNA (shRNA that corresponded to a predicted nef miRNA (~25 nt, miR-N367 can block HIV-1 Nef expression in vitro and the suppression by shRNA/miR-N367 would be related with low viremia in an LTNP (15-2-2. In the 15-2-2 model mice, the weight loss, which may be rendered by nef was also inhibited by shRNA/miR-N367 corresponding to suppression of nef expression in vivo. Conclusions These data suggest that nef/U3 miRNAs produced in HIV-1-infected cells may suppress both Nef function and HIV-1 virulence through the RNAi pathway.
Chen, Liping; Pan, Yuqin; Gu, Ling; Nie, Zhenlin; He, Bangshun; Song, Guoqi; Li, Rui; Xu, Yeqiong; Gao, Tianyi; Wang, Shukui
2013-08-01
This study aimed to investigate the role of CD147 in the progression of gastric cancer and the signalling pathway involved in CD147-mediated gastric cancer cell line SGC7901 proliferation and invasion. Short hairpin RNA (shRNA) expression vectors targeting CD147 were constructed to silence CD147, and the expression of CD147 was monitored by quantitative realtime reverse transcriptase polymerase chain reaction and Western blot and further confirmed by immunohistochemistry in vivo. Cell proliferation was determined by Cell Counting Kit-8 assay, the activities of matrix metalloproteinase (MMP)-2 and MMP-9 were determined by gelatin zymography, and the invasion of SGC7901 was determined by invasion assay. The phosphorylation and non-phosphorylation of the mitogen-activated protein kinases, extracellular signal-regulated kinase1/2 (ERK1/2), P38 and c-Jun NH2-terminal kinase were examined by Western blot. Additionally, the ERK1/2 inhibitor U0126 were used to confirm the signalling pathway involved in CD147-mediated SGC7901 progression. The BALB/c nude mice were used to study tumour progression in vivo. The results revealed that CD147 silencing inhibited the proliferation and invasion of SGC7901 cells, and down-regulated the activities of MMP-2 and MMP-9 and the phosphorylation of the ERK1/2 in SGC7901 cells. ERK1/2 inhibitor U0126 decreased the proliferation, and invasion of SGC7901 cells, and down-regulated the MMP-2 and MMP-9 activities. In a nude mouse model of subcutaneous xenografts, the tumour volume was significantly smaller in the SGC7901/shRNA group compared to the SGC7901 and SGC7901/snc-RNA group. Immunohistochemistry analysis showed that CD147 and p-ERK1/2 protein expressions were down-regulated in the SGC7901/shRNA2 group compared to the SGC7901 and SGC7901/snc-RNA group. These results suggest that ERK1/2 pathway involves in CD147-mediated gastric cancer growth and invasion. These findings further highlight the importance of CD147 in cancer progression
Directory of Open Access Journals (Sweden)
Sylvie Rato
2010-02-01
Full Text Available HIV-1 is a complex retrovirus that uses host machinery to promote its replication. Understanding cellular proteins involved in the multistep process of HIV-1 infection may result in the discovery of more adapted and effective therapeutic targets. Kinases and phosphatases are a druggable class of proteins critically involved in regulation of signal pathways of eukaryotic cells. Here, we focused on the discovery of kinases and phosphatases that are essential for HIV-1 replication but dispensable for cell viability. We performed an iterative screen in Jurkat T-cells with a short-hairpin-RNA (shRNA library highly enriched for human kinases and phosphatases. We identified 14 new proteins essential for HIV-1 replication that do not affect cell viability. These proteins are described to be involved in MAPK, JNK and ERK pathways, vesicular traffic and DNA repair. Moreover, we show that the proteins under study are important in an early step of HIV-1 infection before viral integration, whereas some of them affect viral transcription/translation. This study brings new insights for the complex interplay of HIV-1/host cell and opens new possibilities for antiviral strategies.
Bioreducible poly(amido amine)s for siRNA delivery
van der Aa, L.J.
2011-01-01
Successes in RNA interference based therapies are still limited due to the lack of efficient delivery of the mediator, small interfering RNA (siRNA), to the targeted site. The key to success can be the delivery of the siRNA molecules by polymer-based carrier systems, since they can be chemically
RNA interference: ready to silence cancer?
Mocellin, Simone; Costa, Rodolfo; Nitti, Donato
2006-01-01
RNA interference (RNAi) is considered the most promising functional genomics tool recently developed. As in other medical fields, this biotechnology might revolutionize the approach to dissecting the biology of cancer, ultimately speeding up the discovery pace of novel targets suitable for molecularly tailored antitumor therapies. In addition, preclinical results suggest that RNAi itself might be used as a therapeutic weapon. With the aim of illustrating not only the potentials but also the current limitations of RNAi as a tool in the fight against cancer, here we summarize the physiology of RNAi, discuss the main technical issues of RNAi-based gene silencing, and review some of the most interesting preclinical results obtained so far with its implementation in the field of oncology.
Theoretical studies on sRNA-mediated regulation in bacteria
Chang, Xiao-Xue; Xu, Liu-Fang; Shi, Hua-Lin
2015-12-01
Small RNA(sRNA)-mediated post-transcriptional regulation differs from protein-mediated regulation. Through base-pairing, sRNA can regulate the target mRNA in a catalytic or stoichiometric manner. Some theoretical models were built for comparison of the protein-mediated and sRNA-mediated modes in the steady-state behaviors and noise properties. Many experiments demonstrated that a single sRNA can regulate several mRNAs, which causes crosstalk between the targets. Here, we focus on some models in which two target mRNAs are silenced by the same sRNA to discuss their crosstalk features. Additionally, the sequence-function relationship of sRNA and its role in the kinetic process of base-pairing have been highlighted in model building. Project supported by the National Basic Research Program of China (Grant No. 2013CB834100), the National Natural Science Foundation of China (Grant Nos. 11121403 and 11274320), the Open Project Program of State Key Laboratory of Theoretical Physics, Institute of Theoretical Physics, Chinese Academy of Sciences, China (Grant No. Y4KF171CJ1), the National Natural Science Foundation for Young Scholar of China (Grant No. 11304115), and the China Postdoctoral Science Foundation (Grant No. 2013M541282).
(AAV)-mediated expression of small interfering RNA
African Journals Online (AJOL)
Effective inhibition of specific gene by adenoassociated virus (AAV)-mediated expression of small interfering RNA. ... To perform functional tests on siRNA, which was expressed by the viral vector, recombinant AAVs, coding for siRNA against exogenous gene, EGFP, and endogenous gene, p53, were established and ...
PsOr1, a potential target for RNA interference-based pest management.
Zhao, Y Y; Liu, F; Yang, G; You, M S
2011-02-01
Insect pests cause billions of dollars in agricultural losses, and attempts to kill them have resulted in growing threats from insecticide resistance, dietary pesticide pollution and environmental destruction. New approaches to control refractory insect pests are therefore needed. The host-plant preferences of insect pests rely on olfaction and are mediated via a seven transmembrane-domain odorant receptor (Or) family. The present study reports the cloning and characterization of PsOr1, the first candidate member of the Or gene family from Phyllotreta striolata, a devastating beetle pest that causes damage worldwide. PsOr1 is remarkably well conserved with respect to other insect orthologues, including DmOr83b from Drosophila melanogaster. These insect orthologues form an essential non-conventional Or sub-family and may play an important and generalized role in insect olfaction. We designed double-stranded (ds) RNA directly against the PsOr1 gene and exploited RNA interference (RNAi) to control P. striolata. The chemotactic behavioural measurements showed that adult beetles were unable to sense the attractant or repellent odour stimulus after microinjection of dsRNA against PsOr1. Reverse Transcription (RT)-PCR analysis showed specific down-regulation of mRNA transcript levels for this gene. Furthermore, host-plant preference experiments confirmed that silencing PsOr1 by RNAi treatment impaired the host-plant preferences of P. striolata for cruciferous vegetables. These results demonstrate that this insect control approach of using RNAi to target PsOr1 and its orthologues might be effective in blocking host-plant-seeking behaviours in diverse insect pests. The results also support the theory that this unique receptor type plays an essential general role in insect olfaction. © 2010 Fujian Agriculture and Forestry University. Insect Molecular Biology © 2010 The Royal Entomological Society.
IBTK Differently Modulates Gene Expression and RNA Splicing in HeLa and K562 Cells
Directory of Open Access Journals (Sweden)
Giuseppe Fiume
2016-11-01
Full Text Available The IBTK gene encodes the major protein isoform IBTKα that was recently characterized as substrate receptor of Cul3-dependent E3 ligase, regulating ubiquitination coupled to proteasomal degradation of Pdcd4, an inhibitor of translation. Due to the presence of Ankyrin-BTB-RCC1 domains that mediate several protein-protein interactions, IBTKα could exert expanded regulatory roles, including interaction with transcription regulators. To verify the effects of IBTKα on gene expression, we analyzed HeLa and K562 cell transcriptomes by RNA-Sequencing before and after IBTK knock-down by shRNA transduction. In HeLa cells, 1285 (2.03% of 63,128 mapped transcripts were differentially expressed in IBTK-shRNA-transduced cells, as compared to cells treated with control-shRNA, with 587 upregulated (45.7% and 698 downregulated (54.3% RNAs. In K562 cells, 1959 (3.1% of 63128 mapped RNAs were differentially expressed in IBTK-shRNA-transduced cells, including 1053 upregulated (53.7% and 906 downregulated (46.3%. Only 137 transcripts (0.22% were commonly deregulated by IBTK silencing in both HeLa and K562 cells, indicating that most IBTKα effects on gene expression are cell type-specific. Based on gene ontology classification, the genes responsive to IBTK are involved in different biological processes, including in particular chromatin and nucleosomal organization, gene expression regulation, and cellular traffic and migration. In addition, IBTK RNA interference affected RNA maturation in both cell lines, as shown by the evidence of alternative 3′- and 5′-splicing, mutually exclusive exons, retained introns, and skipped exons. Altogether, these results indicate that IBTK differently modulates gene expression and RNA splicing in HeLa and K562 cells, demonstrating a novel biological role of this protein.
IBTK Differently Modulates Gene Expression and RNA Splicing in HeLa and K562 Cells.
Fiume, Giuseppe; Scialdone, Annarita; Rizzo, Francesca; De Filippo, Maria Rosaria; Laudanna, Carmelo; Albano, Francesco; Golino, Gaetanina; Vecchio, Eleonora; Pontoriero, Marilena; Mimmi, Selena; Ceglia, Simona; Pisano, Antonio; Iaccino, Enrico; Palmieri, Camillo; Paduano, Sergio; Viglietto, Giuseppe; Weisz, Alessandro; Scala, Giuseppe; Quinto, Ileana
2016-11-07
The IBTK gene encodes the major protein isoform IBTKα that was recently characterized as substrate receptor of Cul3-dependent E3 ligase, regulating ubiquitination coupled to proteasomal degradation of Pdcd4, an inhibitor of translation. Due to the presence of Ankyrin-BTB-RCC1 domains that mediate several protein-protein interactions, IBTKα could exert expanded regulatory roles, including interaction with transcription regulators. To verify the effects of IBTKα on gene expression, we analyzed HeLa and K562 cell transcriptomes by RNA-Sequencing before and after IBTK knock-down by shRNA transduction. In HeLa cells, 1285 (2.03%) of 63,128 mapped transcripts were differentially expressed in IBTK -shRNA-transduced cells, as compared to cells treated with control-shRNA, with 587 upregulated (45.7%) and 698 downregulated (54.3%) RNAs. In K562 cells, 1959 (3.1%) of 63128 mapped RNAs were differentially expressed in IBTK -shRNA-transduced cells, including 1053 upregulated (53.7%) and 906 downregulated (46.3%). Only 137 transcripts (0.22%) were commonly deregulated by IBTK silencing in both HeLa and K562 cells, indicating that most IBTKα effects on gene expression are cell type-specific. Based on gene ontology classification, the genes responsive to IBTK are involved in different biological processes, including in particular chromatin and nucleosomal organization, gene expression regulation, and cellular traffic and migration. In addition, IBTK RNA interference affected RNA maturation in both cell lines, as shown by the evidence of alternative 3'- and 5'-splicing, mutually exclusive exons, retained introns, and skipped exons. Altogether, these results indicate that IBTK differently modulates gene expression and RNA splicing in HeLa and K562 cells, demonstrating a novel biological role of this protein.
RNA interference targets arbovirus replication in Culicoides cells.
Schnettler, Esther; Ratinier, Maxime; Watson, Mick; Shaw, Andrew E; McFarlane, Melanie; Varela, Mariana; Elliott, Richard M; Palmarini, Massimo; Kohl, Alain
2013-03-01
Arboviruses are transmitted to vertebrate hosts by biting arthropod vectors such as mosquitoes, ticks, and midges. These viruses replicate in both arthropods and vertebrates and are thus exposed to different antiviral responses in these organisms. RNA interference (RNAi) is a sequence-specific RNA degradation mechanism that has been shown to play a major role in the antiviral response against arboviruses in mosquitoes. Culicoides midges are important vectors of arboviruses, known to transmit pathogens of humans and livestock such as bluetongue virus (BTV) (Reoviridae), Oropouche virus (Bunyaviridae), and likely the recently discovered Schmallenberg virus (Bunyaviridae). In this study, we investigated whether Culicoides cells possess an antiviral RNAi response and whether this is effective against arboviruses, including those with double-stranded RNA (dsRNA) genomes, such as BTV. Using reporter gene-based assays, we established the presence of a functional RNAi response in Culicoides sonorensis-derived KC cells which is effective in inhibiting BTV infection. Sequencing of small RNAs from KC and Aedes aegypti-derived Aag2 cells infected with BTV or the unrelated Schmallenberg virus resulted in the production of virus-derived small interfering RNAs (viRNAs) of 21 nucleotides, similar to the viRNAs produced during arbovirus infections of mosquitoes. In addition, viRNA profiles strongly suggest that the BTV dsRNA genome is accessible to a Dicer-type nuclease. Thus, we show for the first time that midge cells target arbovirus replication by mounting an antiviral RNAi response mainly resembling that of other insect vectors of arboviruses.
Characterization of the TRBP domain required for Dicer interaction and function in RNA interference
Directory of Open Access Journals (Sweden)
El Far Mohamed
2009-05-01
Full Text Available Abstract Background Dicer, Ago2 and TRBP are the minimum components of the human RNA-induced silencing complex (RISC. While Dicer and Ago2 are RNases, TRBP is the double-stranded RNA binding protein (dsRBP that loads small interfering RNA into the RISC. TRBP binds directly to Dicer through its C-terminal domain. Results We show that the TRBP binding site in Dicer is a 165 amino acid (aa region located between the ATPase and the helicase domains. The binding site in TRBP is a 69 aa domain, called C4, located at the C-terminal end of TRBP. The TRBP1 and TRBP2 isoforms, but not TRBPs lacking the C4 site (TRBPsΔC4, co-immunoprecipitated with Dicer. The C4 domain is therefore necessary to bind Dicer, irrespective of the presence of RNA. Immunofluorescence shows that while full-length TRBPs colocalize with Dicer, TRBPsΔC4 do not. tarbp2-/- cells, which do not express TRBP, do not support RNA interference (RNAi mediated by short hairpin or micro RNAs against EGFP. Both TRBPs, but not TRBPsΔC4, were able to rescue RNAi function. In human cells with low RNAi activity, addition of TRBP1 or 2, but not TRBPsΔC4, rescued RNAi function. Conclusion The mapping of the interaction sites between TRBP and Dicer show unique domains that are required for their binding. Since TRBPsΔC4 do not interact or colocalize with Dicer, we suggest that TRBP and Dicer, both dsRBPs, do not interact through bound dsRNA. TRBPs, but not TRBPsΔC4, rescue RNAi activity in RNAi-compromised cells, indicating that the binding of Dicer to TRBP is critical for RNAi function.
Soares, Emilie; Schwartz, Annie; Nollmann, Marcello; Margeat, Emmanuel; Boudvillain, Marc
2014-08-01
Rho is a ring-shaped, ATP-dependent RNA helicase/translocase that dissociates transcriptional complexes in bacteria. How RNA recognition is coupled to ATP hydrolysis and translocation in Rho is unclear. Here, we develop and use a new combinatorial approach, called time-resolved Nucleotide Analog Interference Probing (trNAIP), to unmask RNA molecular determinants of catalytic Rho function. We identify a regulatory step in the translocation cycle involving recruitment of the 2'-hydroxyl group of the incoming 3'-RNA nucleotide by a Rho subunit. We propose that this step arises from the intrinsic weakness of one of the subunit interfaces caused by asymmetric, split-ring arrangement of primary RNA tethers around the Rho hexamer. Translocation is at highest stake every seventh nucleotide when the weak interface engages the incoming 3'-RNA nucleotide or breaks, depending on RNA threading constraints in the Rho pore. This substrate-governed, 'test to run' iterative mechanism offers a new perspective on how a ring-translocase may function or be regulated. It also illustrates the interest and versatility of the new trNAIP methodology to unveil the molecular mechanisms of complex RNA-based systems. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Cernilogar, Filippo M.
2013-06-13
Background:Beyond their role in post-transcriptional gene silencing, Dicer and Argonaute, two components of the RNA interference (RNAi) machinery, were shown to be involved in epigenetic regulation of centromeric heterochromatin and transcriptional gene silencing. In particular, RNAi mechanisms appear to play a role in repeat induced silencing and some aspects of Polycomb-mediated gene silencing. However, the functional interplay of RNAi mechanisms and Polycomb group (PcG) pathways at endogenous loci remains to be elucidated.Principal Findings:Here we show that the endogenous Dicer-2/Argonaute-2 RNAi pathway is dispensable for the PcG mediated silencing of the homeotic Bithorax Complex (BX-C). Although Dicer-2 depletion triggers mild transcriptional activation at Polycomb Response Elements (PREs), this does not induce transcriptional changes at PcG-repressed genes. Moreover, Dicer-2 is not needed to maintain global levels of methylation of lysine 27 of histone H3 and does not affect PRE-mediated higher order chromatin structures within the BX-C. Finally bioinformatic analysis, comparing published data sets of PcG targets with Argonaute-2-bound small RNAs reveals no enrichment of these small RNAs at promoter regions associated with PcG proteins.Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.
Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.
Parrish, S; Fire, A
2001-10-01
RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed.
siRNA-mediated Erc gene silencing suppresses tumor growth in Tsc2 mutant renal carcinoma model.
Imamura, Osamu; Okada, Hiroaki; Takashima, Yuuki; Zhang, Danqing; Kobayashi, Toshiyuki; Hino, Okio
2008-09-18
Silencing of gene expression by small interfering RNAs (siRNAs) is rapidly becoming a powerful tool for genetic analysis and represents a potential strategy for therapeutic product development. However, there are no reports of systemic delivery of siRNAs for stable treatment except short hairpin RNAs (shRNAs). On the other hand, there are many reports of systemic delivery of siRNAs for transient treatment using liposome carriers and others. With regard to shRNAs, a report showed fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways. Therefore, we decided to use original siRNA microspheres instead of shRNA for stable treatment of disease. In this study, we designed rat-specific siRNA sequences for Erc/mesothelin, which is a tumor-specific gene expressed in the Eker (Tsc2 mutant) rat model of hereditary renal cancer and confirmed the efficacy of gene silencing in vitro. Then, by using siRNA microspheres, we found that the suppression of Erc/mesothelin caused growth inhibition of Tsc2 mutant renal carcinoma cells in tumor implantation experiments in mice.
Göertz, G P; Fros, J J; Miesen, P; Vogels, C B F; van der Bent, M L; Geertsema, C; Koenraadt, C J M; van Rij, R P; van Oers, M M; Pijlman, G P
2016-11-15
Flaviviruses, such as Zika virus, yellow fever virus, dengue virus, and West Nile virus (WNV), are a serious concern for human health. Flaviviruses produce an abundant noncoding subgenomic flavivirus RNA (sfRNA) in infected cells. sfRNA results from stalling of the host 5'-3' exoribonuclease XRN1/Pacman on conserved RNA structures in the 3' untranslated region (UTR) of the viral genomic RNA. sfRNA production is conserved in insect-specific, mosquito-borne, and tick-borne flaviviruses and flaviviruses with no known vector, suggesting a pivotal role for sfRNA in the flavivirus life cycle. Here, we investigated the function of sfRNA during WNV infection of Culex pipiens mosquitoes and evaluated its role in determining vector competence. An sfRNA1-deficient WNV was generated that displayed growth kinetics similar to those of wild-type WNV in both RNA interference (RNAi)-competent and -compromised mosquito cell lines. Small-RNA deep sequencing of WNV-infected mosquitoes indicated an active small interfering RNA (siRNA)-based antiviral response for both the wild-type and sfRNA1-deficient viruses. Additionally, we provide the first evidence that sfRNA is an RNAi substrate in vivo Two reproducible small-RNA hot spots within the 3' UTR/sfRNA of the wild-type virus mapped to RNA stem-loops SL-III and 3' SL, which stick out of the three-dimensional (3D) sfRNA structure model. Importantly, we demonstrate that sfRNA-deficient WNV displays significantly decreased infection and transmission rates in vivo when administered via the blood meal. Finally, we show that transmission and infection rates are not affected by sfRNA after intrathoracic injection, thereby identifying sfRNA as a key driver to overcome the mosquito midgut infection barrier. This is the first report to describe a key biological function of sfRNA for flavivirus infection of the arthropod vector, providing an explanation for the strict conservation of sfRNA production. Understanding the flavivirus transmission
Thermal Stability of siRNA Modulates Aptamer- conjugated siRNA Inhibition
Directory of Open Access Journals (Sweden)
Alexey Berezhnoy
2012-01-01
Full Text Available Oligonucleotide aptamer-mediated in vivo cell targeting of small interfering RNAs (siRNAs is emerging as a useful approach to enhance the efficacy and reduce the adverse effects resulting from siRNA-mediated genetic interference. A current main impediment in aptamer-mediated siRNA targeting is that the activity of the siRNA is often compromised when conjugated to an aptamer, often requiring labor intensive and time consuming design and testing of multiple configurations to identify a conjugate in which the siRNA activity has not been significantly reduced. Here, we show that the thermal stability of the siRNA is an important parameter of siRNA activity in its conjugated form, and that siRNAs with lower melting temperature (Tm are not or are minimally affected when conjugated to the 3′ end of 2′F-pyrimidine-modified aptamers. In addition, the configuration of the aptamer-siRNA conjugate retains activity comparable with the free siRNA duplex when the passenger strand is co-transcribed with the aptamer and 3′ overhangs on the passenger strand are removed. The approach described in this paper significantly reduces the time and effort necessary to screening siRNA sequences that retain biological activity upon aptamer conjugation, facilitating the process of identifying candidate aptamer-siRNA conjugates suitable for in vivo testing.
RNA Interference in Moths: Mechanisms, Applications, and Progress
Directory of Open Access Journals (Sweden)
Jin Xu
2016-10-01
Full Text Available The vast majority of lepidopterans, about 90%, are moths. Some moths, particularly their caterpillars, are major agricultural and forestry pests in many parts of the world. However, some other members of moths, such as the silkworm Bombyx mori, are famous for their economic value. Fire et al. in 1998 initially found that exogenous double-stranded RNA (dsRNA can silence the homolog endogenous mRNA in organisms, which is called RNA interference (RNAi. Soon after, the RNAi technique proved to be very promising not only in gene function determination but also in pest control. However, later studies demonstrate that performing RNAi in moths is not as straightforward as shown in other insect taxa. Nevertheless, since 2007, especially after 2010, an increasing number of reports have been published that describe successful RNAi experiments in different moth species either on gene function analysis or on pest management exploration. So far, more than 100 peer-reviewed papers have reported successful RNAi experiments in moths, covering 10 families and 25 species. By using classic and novel dsRNA delivery methods, these studies effectively silence the expression of various target genes and determine their function in larval development, reproduction, immunology, resistance against chemicals, and other biological processes. In addition, a number of laboratory and field trials have demonstrated that RNAi is also a potential strategy for moth pest management. In this review, therefore, we summarize and discuss the mechanisms and applications of the RNAi technique in moths by focusing on recent progresses.
Dicer-independent processing of short hairpin RNAs
Liu, Ying Poi; Schopman, Nick C. T.; Berkhout, Ben
2013-01-01
Short hairpin RNAs (shRNAs) are widely used to induce RNA interference (RNAi). We tested a variety of shRNAs that differed in stem length and terminal loop size and revealed strikingly different RNAi activities and shRNA-processing patterns. Interestingly, we identified a specific shRNA design that
RNA Interference in Insect Vectors for Plant Viruses
Directory of Open Access Journals (Sweden)
Surapathrudu Kanakala
2016-12-01
Full Text Available Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists.
Eukaryotic interference with homoserine lactone mediated procaryotic signalling
DEFF Research Database (Denmark)
Givskov, Michael Christian; de Nys, Rocky; Gram, Lone
1996-01-01
Acylated homoserine lactones (AHLs) plays a widespread role in intercellular communication among bacteria. The Australian macroalga Delisea pulchra produces secondary metabolites which have structural similarities to AHL molecules. We report here that these metabolites inhibited AHL-controlled pr......-controlled processes in prokaryotes. Our results suggest that the interaction between higher organisms and their surface-associated bacteria may be mediated by interference with bacterial regulatory systems....
Cardiac Gene Expression Knockdown Using Small Inhibitory RNA-Loaded Microbubbles and Ultrasound.
Directory of Open Access Journals (Sweden)
Jonathan A Kopechek
Full Text Available RNA interference has potential therapeutic value for cardiac disease, but targeted delivery of interfering RNA is a challenge. Custom designed microbubbles, in conjunction with ultrasound, can deliver small inhibitory RNA to target tissues in vivo. The efficacy of cardiac RNA interference using a microbubble-ultrasound theranostic platform has not been demonstrated in vivo. Therefore, our objective was to test the hypothesis that custom designed microbubbles and ultrasound can mediate effective delivery of small inhibitory RNA to the heart. Microbubble and ultrasound mediated cardiac RNA interference was tested in transgenic mice displaying cardiac-restricted luciferase expression. Luciferase expression was assayed in select tissues of untreated mice (n = 14. Mice received intravenous infusion of cationic microbubbles bearing small inhibitory RNA directed against luciferase (n = 9 or control RNA (n = 8 during intermittent cardiac-directed ultrasound at mechanical index of 1.6. Simultaneous echocardiography in a separate group of mice (n = 3 confirmed microbubble destruction and replenishment during treatment. Three days post treatment, cardiac luciferase messenger RNA and protein levels were significantly lower in ultrasound-treated mice receiving microbubbles loaded with small inhibitory RNA directed against luciferase compared to mice receiving microbubbles bearing control RNA (23±7% and 33±7% of control mice, p<0.01 and p = 0.03, respectively. Passive cavitation detection focused on the heart confirmed that insonification resulted in inertial cavitation. In conclusion, small inhibitory RNA-loaded microbubbles and ultrasound directed at the heart significantly reduced the expression of a reporter gene. Ultrasound-targeted destruction of RNA-loaded microbubbles may be an effective image-guided strategy for therapeutic RNA interference in cardiac disease.
Li, Longhu; Haider, Husnain Kh.; Wang, Linlin; Lu, Gang
2012-01-01
We previously showed that treatment with tadalafil, a long-acting phosphodiesterase-5a (PDE5a) inhibitor, effectively prevented adverse left ventricular (LV) remodeling of the infarcted heart. We hypothesized that short-hairpin RNA (shRNA) therapy targeting PDE5a would simulate the effects of pharmacological intervention for treatment of postinfarction LV remodeling and dysfunction. Experimental model of myocardial infarction was developed in female mice by permanent ligation of left coronary artery. Immediately after that, an adenoviral vector encoding for shRNA sequence targeting PDE5a (Ad-shPDE5a) was injected intramyocardially, which specifically inhibited PDE5a in the heart. Four weeks later, Ad-shPDE5a treated mice showed significant mitigation of the left ventricle (LV) dilatation and dysfunction as indicated by smaller LV cavity and more preserved ejection fraction and fractional shortening. Infarction size and fibrosis were significantly reduced in Ad-shPDE5a-treated mice. Additionally, more salvaged cardiomyocytes, significantly reduced collagen contents, and higher blood vessel density were observed in Ad-shPDE5a-treated mice. The cytoprotective effects of Ad-shPDE5a were demonstrated in vitro in Ad-shPDE5a transfected cardiomyocytes cultured under oxygen glucose deprivation. Among downstream mediators of PDE5a signaling, cyclic GMP (cGMP) and cGMP-dependent protein kinase G (PKG) were activated with concomitant reduction in caspase-3 activity. However, no significant change in PKA and cAMP activities were observed in Ad-shPDE5a-treated hearts. Inhibition with shRNA improved cardiac remodeling and dysfunction by reducing infarction size and cardiac fibrosis and increased cGMP and PKG activity. These findings suggest that PDE5 inhibition with Ad-shPDE5a is a novel approach for treatment of myocardial infarction. PMID:22447941
SETD1A modulates cell cycle progression through a miRNA network that regulates p53 target genes
Tajima, Ken; Yae, Toshifumi; Javaid, Sarah; Tam, Oliver; Comaills, Valentine; Morris, Robert; Wittner, Ben S.; Liu, Mingzhu; Engstrom, Amanda; Takahashi, Fumiyuki; Black, Joshua C.; Ramaswamy, Sridhar; Shioda, Toshihiro; Hammell, Molly; Haber, Daniel A.
2015-01-01
Expression of the p53-inducible antiproliferative gene BTG2 is suppressed in many cancers in the absence of inactivating gene mutations, suggesting alternative mechanisms of silencing. Using a shRNA screen targeting 43 histone lysine methyltransferases (KMTs), we show that SETD1A suppresses BTG2 expression through its induction of several BTG2-targeting miRNAs. This indirect but highly specific mechanism, by which a chromatin regulator that mediates transcriptional activating marks can lead t...
Short-hairpin RNA-mediated stable silencing of Grb2 impairs cell growth and DNA synthesis
International Nuclear Information System (INIS)
Di Fulvio, Mauricio; Henkels, Karen M.; Gomez-Cambronero, Julian
2007-01-01
Grb2 is an SH2-SH3 protein adaptor responsible for linking growth factor receptors with intracellular signaling cascades. To study the role of Grb2 in cell growth, we have generated a new COS7 cell line (COS7 shGrb2 ), based on RNAi technology, as null mutations in mammalian Grb2 genes are lethal in early development. This novel cell line continuously expresses a short hairpin RNA that targets endogenous Grb2. Stable COS7 shGrb2 cells had the shGrb2 integrated into the genomic DNA and carried on SiL construct (made refractory to the shRNA-mediated interference), but not with an SH2-deficient mutant (R86K). Thus, a viable knock-down and rescue protocol has demonstrated that Grb2 is crucial for cell proliferation
Dysregulation of RNA Mediated Gene Expression in Motor Neuron Diseases.
Gonçalves, Inês do Carmo G; Rehorst, Wiebke A; Kye, Min Jeong
2016-01-01
Recent findings indicate an important role for RNA-mediated gene expression in motor neuron diseases, including ALS (amyotrophic lateral sclerosis) and SMA (spinal muscular atrophy). ALS, also known as Lou Gehrig's disease, is an adult-onset progressive neurodegenerative disorder, whereby SMA or "children's Lou Gehrig's disease" is considered a pediatric neurodevelopmental disorder. Despite the difference in genetic causes, both ALS and SMA share common phenotypes; dysfunction/loss of motor neurons that eventually leads to muscle weakness and atrophy. With advanced techniques in molecular genetics and cell biology, current data suggest that these two distinct motor neuron diseases share more than phenotypes; ALS and SMA have similar cellular pathological mechanisms including mitochondrial dysfunction, oxidative stress and dysregulation in RNA-mediated gene expression. Here, we will discuss the current findings on these two diseases with specific focus on RNA-mediated gene regulation including miRNA expression, pre-mRNA processing and RNA binding proteins.
RNA interference for performance enhancement and detection in doping control.
Kohler, Maxie; Schänzer, Wilhelm; Thevis, Mario
2011-10-01
RNA interference represents a comparably new route of regulating and manipulating specific gene expression. Promising results were obtained in experimental therapies aim at the treatment of different kinds of diseases including cancer, diabetes mellitus or Dychenne muscular dystrophy. While studies on down-regulation efficiency are often performed by analyzing the regulated protein, the direct detection of small, interfering RNA molecules and antisense oligonucleotides is of great interest for the investigation of the metabolism and degradation and also for the detection of a putative misuse of these molecules in sports. Myostatin down-regulation was shown to result in increased performance and muscle growth and the regulation of several other proteins could be relevant for performance enhancement. This mini-review summarizes current approaches for the mass spectrometric analysis of siRNA and antisense oligonucleotides from biological matrices and the available data on biodistribution, metabolism, and half-life of relevant substances are discussed. Copyright © 2011 John Wiley & Sons, Ltd.
Evaluation of locked nucleic acid-modified small interfering RNA in vitro and in vivo
Mook, Olaf R.; Baas, Frank; de Wissel, Marit B.; Fluiter, Kees
2007-01-01
RNA interference has become widely used as an experimental tool to study gene function. In addition, small interfering RNA (siRNA) may have great potential for the treatment of diseases. Recently, it was shown that siRNA can be used to mediate gene silencing in mouse models. Locally administered
Modelling Toehold-Mediated RNA Strand Displacement
Šulc, Petr; Ouldridge, Thomas E.; Romano, Flavio; Doye, Jonathan P.K.; Louis, Ard A.
2015-01-01
We study the thermodynamics and kinetics of an RNA toehold-mediated strand displacement reaction with a recently developed coarse-grained model of RNA. Strand displacement, during which a single strand displaces a different strand previously bound to a complementary substrate strand, is an essential mechanism in active nucleic acid nanotechnology and has also been hypothesized to occur in vivo. We study the rate of displacement reactions as a function of the length of the toehold and temperat...
Lifescience Database Archive (English)
Full Text Available 18703349 Negative regulation of cytoplasmic RNA-mediated antiviral signaling. Komur...Show Negative regulation of cytoplasmic RNA-mediated antiviral signaling. PubmedID 18703349 Title Negative r...egulation of cytoplasmic RNA-mediated antiviral signaling. Authors Komuro A, Bamm
Role of RNA interference in plant improvement.
Jagtap, Umesh Balkrishna; Gurav, Ranjit Gajanan; Bapat, Vishwas Anant
2011-06-01
Research to alter crops for their better performance involving modern technology is underway in numerous plants, and achievements in transgenic plants are impacting crop improvements in unparalleled ways. Striking progress has been made using genetic engineering technology over the past two decades in manipulating genes from diverse and exotic sources, and inserting them into crop plants for inducing desirable characteristics. RNA interference (RNAi) has recently been identified as a natural mechanism for regulation of gene expression in all higher organisms from plants to humans and promises greater accuracy and precision to plant improvement. The expression of any gene can be down-regulated in a highly explicit manner exclusive of affecting the expression of any other gene by using RNAi technologies. Additional research in this field has been focused on a number of other areas including microRNAs, hairpin RNA, and promoter methylation. Manipulating new RNAi pathways, which generate small RNA molecules to amend gene expression in crops, can produce new quality traits and having better potentiality of protection against abiotic and biotic stresses. Nutritional improvement, change in morphology, or enhanced secondary metabolite synthesis are some of the other advantages of RNAi technology. In addition to its roles in regulating gene expression, RNAi is also used as a natural defense mechanism against molecular parasites such as jumping genes and viral genetic elements that affect genome stability. Even though much advancement has been made on the field of RNAi over the preceding few years, the full prospective of RNAi for crop improvement remains to be fully realized. The intricacy of RNAi pathway, the molecular machineries, and how it relates to plant development are still to be explained.
Role of RNA interference in plant improvement
Jagtap, Umesh Balkrishna; Gurav, Ranjit Gajanan; Bapat, Vishwas Anant
2011-06-01
Research to alter crops for their better performance involving modern technology is underway in numerous plants, and achievements in transgenic plants are impacting crop improvements in unparalleled ways. Striking progress has been made using genetic engineering technology over the past two decades in manipulating genes from diverse and exotic sources, and inserting them into crop plants for inducing desirable characteristics. RNA interference (RNAi) has recently been identified as a natural mechanism for regulation of gene expression in all higher organisms from plants to humans and promises greater accuracy and precision to plant improvement. The expression of any gene can be down-regulated in a highly explicit manner exclusive of affecting the expression of any other gene by using RNAi technologies. Additional research in this field has been focused on a number of other areas including microRNAs, hairpin RNA, and promoter methylation. Manipulating new RNAi pathways, which generate small RNA molecules to amend gene expression in crops, can produce new quality traits and having better potentiality of protection against abiotic and biotic stresses. Nutritional improvement, change in morphology, or enhanced secondary metabolite synthesis are some of the other advantages of RNAi technology. In addition to its roles in regulating gene expression, RNAi is also used as a natural defense mechanism against molecular parasites such as jumping genes and viral genetic elements that affect genome stability. Even though much advancement has been made on the field of RNAi over the preceding few years, the full prospective of RNAi for crop improvement remains to be fully realized. The intricacy of RNAi pathway, the molecular machineries, and how it relates to plant development are still to be explained.
Identification of chemosensory receptor genes in Manduca sexta and knockdown by RNA interference
Directory of Open Access Journals (Sweden)
Howlett Natalie
2012-05-01
Full Text Available Abstract Background Insects detect environmental chemicals via a large and rapidly evolving family of chemosensory receptor proteins. Although our understanding of the molecular genetic basis for Drosophila chemoreception has increased enormously in the last decade, similar understanding in other insects remains limited. The tobacco hornworm, Manduca sexta, has long been an important model for insect chemosensation, particularly from ecological, behavioral, and physiological standpoints. It is also a major agricultural pest on solanaceous crops. However, little sequence information and lack of genetic tools has prevented molecular genetic analysis in this species. The ability to connect molecular genetic mechanisms, including potential lineage-specific changes in chemosensory genes, to ecologically relevant behaviors and specializations in M. sexta would be greatly beneficial. Results Here, we sequenced transcriptomes from adult and larval chemosensory tissues and identified chemosensory genes based on sequence homology. We also used dsRNA feeding as a method to induce RNA interference in larval chemosensory tissues. Conclusions We report identification of new chemosensory receptor genes including 17 novel odorant receptors and one novel gustatory receptor. Further, we demonstrate that systemic RNA interference can be used in larval olfactory neurons to reduce expression of chemosensory receptor transcripts. Together, our results further the development of M. sexta as a model for functional analysis of insect chemosensation.
DEFF Research Database (Denmark)
Yang, Chuanxu; Shan, Gao; Song, Ping
2018-01-01
RNA interference (RNAi) mediated gene regulation in stem cells offers great potential in regenerative medicine. In this study, we developed a theranostic platform for efficient delivery of small RNAs (siRNA/miRNA) to human mesenchymal stem cells (hMSCs) to promote differentiation, and meanwhile...... OFF/ON activatable fluorescence upon cellular internalization, resulting in efficient NIR labeling and the capability to dynamically monitor stem cells in mice. In addition, iSPN/siRNA achieved simultaneous long-term cell tracking and in vivo gene silencing after implantation in mice. These results...
Directory of Open Access Journals (Sweden)
Shuo Liu
Full Text Available Osteoarthritis is a joint-destructive disease that has no effective cure. Human mesenchymal stem cells (hMSCs could offer therapeutic benefit in the treatment of arthritic diseases by suppressing inflammation and permitting tissue regeneration, but first these cells must overcome the catabolic environment of the diseased joint. Likewise, gene therapy also offers therapeutic promise given its ability to directly modulate key catabolic factors that mediate joint deterioration, although it too has limitations. In the current study, we explore an approach that combines hMSCs and gene therapy. Specifically, we test the use of hMSC as a vehicle to deliver ADAMTS5 (an aggrecanase with a key role in osteoarthritis-targeting siRNAs to SW982 synovial fibroblast-like cells via connexin43 containing gap junctions. Accordingly, we transduced hMSCs with ADAMTS5-targeting shRNA or non-targeted shRNA, and co-cultured them with synovial fibroblasts to allow delivery of siRNAs from hMSC to synovial fibroblasts. We found that co-culture of hMSCs-shRNA-ADAMTS5 and synovial fibroblasts reduced ADAMTS5 expression relative to co-culture of hMSCs-shRNA-control and synovial fibroblasts. Furthermore, ADAMTS5 was specifically reduced in the synovial fibroblasts populations as determined by fluorescence-activated cell sorting, suggesting transfer of the siRNA between cells. To test if Cx43-containing gap junctions are involved in the transfer of siRNA, we co-cultured hMSCs-shRNA-ADAMTS5 cells with synovial fibroblasts in which connexin43 was knocked down. Under these conditions, ADAMTS5 levels were not inhibited by co-culture, indicating that connexin43 mediates the delivery of siRNA from hMSCs to synovial fibroblasts. In total, our findings demonstrate that hMSCs can function as donor cells to host and deliver siRNAs to synovial fibroblasts via connexin43 gap junction in vitro. These data may have implications in the combination of hMSCs and gene therapy to treat diseases
Liu, Shuo; Niger, Corinne; Koh, Eugene Y; Stains, Joseph P
2015-01-01
Osteoarthritis is a joint-destructive disease that has no effective cure. Human mesenchymal stem cells (hMSCs) could offer therapeutic benefit in the treatment of arthritic diseases by suppressing inflammation and permitting tissue regeneration, but first these cells must overcome the catabolic environment of the diseased joint. Likewise, gene therapy also offers therapeutic promise given its ability to directly modulate key catabolic factors that mediate joint deterioration, although it too has limitations. In the current study, we explore an approach that combines hMSCs and gene therapy. Specifically, we test the use of hMSC as a vehicle to deliver ADAMTS5 (an aggrecanase with a key role in osteoarthritis)-targeting siRNAs to SW982 synovial fibroblast-like cells via connexin43 containing gap junctions. Accordingly, we transduced hMSCs with ADAMTS5-targeting shRNA or non-targeted shRNA, and co-cultured them with synovial fibroblasts to allow delivery of siRNAs from hMSC to synovial fibroblasts. We found that co-culture of hMSCs-shRNA-ADAMTS5 and synovial fibroblasts reduced ADAMTS5 expression relative to co-culture of hMSCs-shRNA-control and synovial fibroblasts. Furthermore, ADAMTS5 was specifically reduced in the synovial fibroblasts populations as determined by fluorescence-activated cell sorting, suggesting transfer of the siRNA between cells. To test if Cx43-containing gap junctions are involved in the transfer of siRNA, we co-cultured hMSCs-shRNA-ADAMTS5 cells with synovial fibroblasts in which connexin43 was knocked down. Under these conditions, ADAMTS5 levels were not inhibited by co-culture, indicating that connexin43 mediates the delivery of siRNA from hMSCs to synovial fibroblasts. In total, our findings demonstrate that hMSCs can function as donor cells to host and deliver siRNAs to synovial fibroblasts via connexin43 gap junction in vitro. These data may have implications in the combination of hMSCs and gene therapy to treat diseases like
RNA-mediated epigenetic heredity requires the cytosine methyltransferase Dnmt2.
Directory of Open Access Journals (Sweden)
Jafar Kiani
2013-05-01
Full Text Available RNA-mediated transmission of phenotypes is an important way to explain non-Mendelian heredity. We have previously shown that small non-coding RNAs can induce hereditary epigenetic variations in mice and act as the transgenerational signalling molecules. Two prominent examples for these paramutations include the epigenetic modulation of the Kit gene, resulting in altered fur coloration, and the modulation of the Sox9 gene, resulting in an overgrowth phenotype. We now report that expression of the Dnmt2 RNA methyltransferase is required for the establishment and hereditary maintenance of both paramutations. Our data show that the Kit paramutant phenotype was not transmitted to the progeny of Dnmt2(-/- mice and that the Sox9 paramutation was also not established in Dnmt2(-/- embryos. Similarly, RNA from Dnmt2-negative Kit heterozygotes did not induce the paramutant phenotype when microinjected into Dnmt2-deficient fertilized eggs and microinjection of the miR-124 microRNA failed to induce the characteristic giant phenotype. In agreement with an RNA-mediated mechanism of inheritance, no change was observed in the DNA methylation profiles of the Kit locus between the wild-type and paramutant mice. RNA bisulfite sequencing confirmed Dnmt2-dependent tRNA methylation in mouse sperm and also indicated Dnmt2-dependent cytosine methylation in Kit RNA in paramutant embryos. Together, these findings uncover a novel function of Dnmt2 in RNA-mediated epigenetic heredity.
Reprogramming the Dynamin 2 mRNA by Spliceosome-mediated RNA Trans-splicing
Directory of Open Access Journals (Sweden)
Delphine Trochet
2016-01-01
Full Text Available Dynamin 2 (DNM2 is a large GTPase, ubiquitously expressed, involved in membrane trafficking and regulation of actin and microtubule cytoskeletons. DNM2 mutations cause autosomal dominant centronuclear myopathy which is a rare congenital myopathy characterized by skeletal muscle weakness and histopathological features including nuclear centralization in absence of regeneration. No curative treatment is currently available for the DNM2-related autosomal dominant centronuclear myopathy. In order to develop therapeutic strategy, we evaluated here the potential of Spliceosome-Mediated RNA Trans-splicing technology to reprogram the Dnm2-mRNA in vitro and in vivo in mice. We show that classical 3′-trans-splicing strategy cannot be considered as accurate therapeutic strategy regarding toxicity of the pre-trans-splicing molecules leading to low rate of trans-splicing in vivo. Thus, we tested alternative strategies devoted to prevent this toxicity and enhance frequency of trans-splicing events. We succeeded to overcome the toxicity through a 5′-trans-splicing strategy which also allows detection of trans-splicing events at mRNA and protein levels in vitro and in vivo. These results suggest that the Spliceosome-Mediated RNA Trans-splicing strategy may be used to reprogram mutated Dnm2-mRNA but highlight the potential toxicity linked to the molecular tools which have to be carefully investigated during preclinical development.
Directory of Open Access Journals (Sweden)
Feixiang Wu
2012-01-01
Full Text Available Objective. The present study was to investigate the feasibility of adenovirus-mediated small interference RNA (siRNA targeting Toll-like receptor 4 (TLR4 gene in ameliorating lipopolysaccharide- (LPS- induced acute lung injury (ALI. Methods. In vitro, alveolar macrophages (AMs were treated with Ad-siTLR4 and Ad-EFGP, respectively, for 12 h, 24 h, and 48 h, and then with LPS (100 ng/mL for 2 h, and the function and expression of TLR4 were evaluated. In vivo, rats received intratracheal injection of 300 μL of normal saline (control group, 300 μL of Ad-EGFP (Ad-EGFP group, or 300 μL of Ad-siTLR4 (Ad-siTLR4 group and then were intravenously treated with LPS (50 mg/kg to induce ALI. Results. Ad-siTLR4 treatment significantly reduced TLR4 expression and production of proinflammatory cytokines following LPS treatment both in vitro and in vivo. Significant alleviation of tissue edema, microvascular protein leakage, and neutrophil infiltration was observed in the AdsiTLR4-treated animals. Conclusion. TLR4 plays a critical role in LPS-induced ALI, and transfection of Ad-siTLR4 can effectively downregulate TLR4 expression in vitro and in vivo, accompanied by alleviation of LPS-induced lung injury. These findings suggest that TLR4 may serve as a potential target in the treatment of ALI and RNA interfering targeting TLR4 expression represents a therapeutic strategy.
Effective mRNA Inhibition in PANC-1 Cells in Vitro Mediated via an mPEG-SeSe-PEI Delivery System.
Zhang, Yuefeng; Yang, Bin; Liu, Yajie; Qin, Wenjie; Li, Chao; Wang, Lantian; Zheng, Wen; Wu, Yulian
2016-05-01
RNA interference (RNAi)-mediated gene therapy is a promising approach to cure various diseases. However, developing an effective, safe, specific RNAi delivery system remains a major challenge. In this study, a novel redox-responsive polyetherimide (PEI)-based nanovector, mPEG-SeSe-PEI, was developed and its efficacy evaluated. We prepared three mPEG-SeSe-PEI vector candidates for small interfering glyceraldehyde-3-phosphate dehydrogenase (siGADPH) and determined their physiochemical properties and transfection efficiency using flow cytometry and PEG11.6-SeSe-PEI polymer. We investigated the silencing efficacy of GADPH mRNA expression in PANC-1 cells and observed that PEG11.6-SeSe-PEI/siGADPH (N/P ratio=10) polyplexes possessed the appropriate size and zeta-potential and exhibited excellent in vitro gene silencing effects with the least cytotoxicity in PANC-1 cells. In conclusion, we present PEG11.6-SeSe-PEI as a potential therapeutic gene delivery system for small interfering RNA (siRNA).
RNA interference: learning gene knock-down from cell physiology
Directory of Open Access Journals (Sweden)
Provenzano Maurizio
2004-11-01
Full Text Available Summary Over the past decade RNA interference (RNAi has emerged as a natural mechanism for silencing gene expression. This ancient cellular antiviral response can be exploited to allow specific inhibition of the function of any chosen target gene. RNAi is proving to be an invaluable research tool, allowing much more rapid characterization of the function of known genes. More importantly, RNAi technology considerably bolsters functional genomics to aid in the identification of novel genes involved in disease processes. This review briefly describes the molecular principles underlying the biology of RNAi phenomenon and discuss the main technical issues regarding optimization of RNAi experimental design.
RNA interference: learning gene knock-down from cell physiology
Mocellin, Simone; Provenzano, Maurizio
2004-01-01
Over the past decade RNA interference (RNAi) has emerged as a natural mechanism for silencing gene expression. This ancient cellular antiviral response can be exploited to allow specific inhibition of the function of any chosen target gene. RNAi is proving to be an invaluable research tool, allowing much more rapid characterization of the function of known genes. More importantly, RNAi technology considerably bolsters functional genomics to aid in the identification of novel genes involved in disease processes. This review briefly describes the molecular principles underlying the biology of RNAi phenomenon and discuss the main technical issues regarding optimization of RNAi experimental design. PMID:15555080
Thermodynamic control of small RNA-mediated gene silencing
Directory of Open Access Journals (Sweden)
Kumiko eUi-Tei
2012-06-01
Full Text Available Small interfering RNAs (siRNAs and microRNAs (miRNAs are crucial regulators of posttranscriptional gene silencing, which is referred to as RNA interference (RNAi or RNA silencing. In RNAi, siRNA loaded onto the RNA-induced silencing complex (RISC downregulates target gene expression by cleaving mRNA whose sequence is perfectly complementary to the siRNA guide strand. We previously showed that highly functional siRNAs possessed the following characteristics: A or U residues at nucleotide position 1 measured from the 5’ terminal, four to seven A/Us in positions 1–7, and G or C residues at position 19. This finding indicated that an RNA strand with a thermodynamically unstable 5’ terminal is easily retained in the RISC and functions as a guide strand. In addition, it is clear that unintended genes with complementarities only in the seed region (positions 2–8 are also downregulated by off-target effects. siRNA efficiency is mainly determined by the Watson-Crick base-pairing stability formed between the siRNA seed region and target mRNA. siRNAs with a low seed-target duplex melting temperature (Tm have little or no seed-dependent off-target activity. Thus, important parts of the RNA silencing machinery may be regulated by nucleotide base-pairing thermodynamic stability. A mechanistic understanding of thermodynamic control may enable an efficient target gene-specific RNAi for functional genomics and safe therapeutic applications.
Directory of Open Access Journals (Sweden)
Dzeneta Vizlin-Hodzic
Full Text Available BACKGROUND: Scaffold attachment factor A (SAF-A participates in the regulation of gene expression by organizing chromatin into transcriptionally active domains and by interacting directly with RNA polymerase II. METHODOLOGY: Here we use co-localization, co-immunoprecipitation (co-IP and in situ proximity ligation assay (PLA to identify Brahma Related Gene 1 (BRG1, the ATP-driven motor of the human SWI-SNF chromatin remodeling complex, as another SAF-A interaction partner in mouse embryonic stem (mES cells. We also employ RNA interference to investigate functional aspects of the SAF-A/BRG1 interaction. PRINCIPAL FINDINGS: We find that endogenous SAF-A protein interacts with endogenous BRG1 protein in mES cells, and that the interaction does not solely depend on the presence of mRNA. Moreover the interaction remains intact when cells are induced to differentiate. Functional analyses reveal that dual depletion of SAF-A and BRG1 abolishes global transcription by RNA polymerase II, while the nucleolar RNA polymerase I transcription machinery remains unaffected. CONCLUSIONS: We demonstrate that SAF-A interacts with BRG1 and that both components are required for RNA Polymerase II Mediated Transcription.
Kim, Il-Doo; Lim, Chae-Moon; Kim, Jung-Bin; Nam, Hye Yeong; Nam, Kihoon; Kim, Seung-Woo; Park, Jong-Sang; Lee, Ja-Kyeong
2010-03-19
Although RNA interference (RNAi)-mediated gene silencing provides a powerful strategy for modulating specific gene functions, difficulties associated with siRNA delivery have impeded the development of efficient therapeutic applications. In particular, the efficacy of siRNA delivery into neurons has been limited by extremely low transfection efficiencies. e-PAM-R is a biodegradable arginine ester of PAMAM dendrimer, which is readily degradable under physiological conditions (pH 7.4, 37 degrees C). In the present study, we investigated the efficiency of siRNA delivery by e-PAM-R in primary cortical cultures and in rat brain. e-PAM-R/siRNA complexes showed high transfection efficiencies and low cytotoxicities in primary cortical cultures. Localization of fluorescence-tagged siRNA revealed that siRNA was delivered not only into the nucleus and cytoplasm, but also along the processes of the neuron. e-PAM-R/siRNA complex-mediated target gene reduction was observed in over 40% of cells and it was persistent for over 48 h. The potential use of e-PAM-R was demonstrated by gene knockdown after transfecting High mobility group box-1 (HMGB1, a novel cytokine-like molecule) siRNA into H(2)O(2)- or NMDA-treated primary cortical cultures. In these cells, HMGB1 siRNA delivery successfully reduced both basal and H(2)O(2)- or NMDA-induced HMGB1 levels, and as a result of that, neuronal cell death was significantly suppressed in both cases. Furthermore, we showed that e-PAM-R successfully delivered HMGB1 siRNA into the rat brain, wherein HMGB1 expression was depleted in over 40% of neurons and astrocytes of the normal brain. Moreover, e-PAM-R-mediated HMGB1 siRNA delivery notably reduced infarct volume in the postischemic rat brain, which is generated by occluding the middle cerebral artery for 60 min. These results indicate that e-PAM-R, a novel biodegradable nonviral gene carrier, offers an efficient means of transfecting siRNA into primary neuronal cells and in the brain and of
Evaluation of carrier-mediated siRNA delivery
DEFF Research Database (Denmark)
Colombo, Stefano; Nielsen, Hanne Mørck; Foged, Camilla
2013-01-01
RNA delivery. An in vitro cell culture model system expressing enhanced green fluorescent protein (EGFP) was used to develop the assay, which was based on the intracellular quantification of a full-length double-stranded Dicer substrate siRNA by stem-loop RT qPCR. The result is a well-documented protocol......RNA delivered by use of carriers remains an analytical challenge. The purpose of the present study was to optimize and validate an analytical protocol based on stem-loop reverse transcription quantitative polymerase chain reaction (RT qPCR) to quantitatively monitor the carrier-mediated intracellular si...
International Nuclear Information System (INIS)
Ding, L.; Wu, J.P.; Xu, G.; Zhu, B.; Zeng, Q.M.; Li, D.F.; Lu, W.
2014-01-01
Current studies find that degenerated cartilage endplates (CEP) of vertebrae, with fewer diffusion areas, decrease nutrient supply and accelerate intervertebral disc degeneration. Many more apoptotic cells have been identified in degenerated than in normal endplates, and may be responsible for the degenerated grade. Previous findings suggest that inhibition of apoptosis is one possible approach to improve disc regeneration. It is postulated that inhibition of CEP cell apoptosis may be responsible for the regeneration of endplates. Caspase-3, involved in the execution phase of apoptosis, is a candidate for regulating the apoptotic process. In the present study, CEP cells were incubated in 1% fetal bovine serum. Activated caspases were detected to identify the apoptotic pathway, and apoptosis was quantified by flow cytometry. Lentiviral caspase-3 short hairpin RNA (shRNA) was employed to study its protective effects against serum deprivation. Silencing of caspase-3 expression was quantified by reverse transcription-polymerase chain reaction and Western blots, and inhibition of apoptosis was quantified by flow cytometry. Serum deprivation increased apoptosis of rat CEP cells through activation of a caspase cascade. Lentiviral caspase-3 shRNA was successfully transduced into CEP cells, and specifically silenced endogenous caspase-3 expression. Surviving cells were protected by the downregulation of caspase-3 expression and activation. Thus, lentiviral caspase-3 shRNA-mediated RNAi successfully silenced endogenous caspase-3 expression, preventing inappropriate or premature apoptosis
Energy Technology Data Exchange (ETDEWEB)
Ding, L.; Wu, J.P. [Fudan University, Jinshan Hospital, Department of Orthopaedics, Shanghai, China, Department of Orthopaedics, Jinshan Hospital, Fudan University, Shanghai (China); Xu, G. [Fudan University, Jinshan Hospital, Center Laboratory, Shanghai, China, Center Laboratory, Jinshan Hospital, Fudan University, Shanghai (China); Zhu, B.; Zeng, Q.M.; Li, D.F.; Lu, W. [Fudan University, Jinshan Hospital, Department of Orthopaedics, Shanghai, China, Department of Orthopaedics, Jinshan Hospital, Fudan University, Shanghai (China)
2014-05-09
Current studies find that degenerated cartilage endplates (CEP) of vertebrae, with fewer diffusion areas, decrease nutrient supply and accelerate intervertebral disc degeneration. Many more apoptotic cells have been identified in degenerated than in normal endplates, and may be responsible for the degenerated grade. Previous findings suggest that inhibition of apoptosis is one possible approach to improve disc regeneration. It is postulated that inhibition of CEP cell apoptosis may be responsible for the regeneration of endplates. Caspase-3, involved in the execution phase of apoptosis, is a candidate for regulating the apoptotic process. In the present study, CEP cells were incubated in 1% fetal bovine serum. Activated caspases were detected to identify the apoptotic pathway, and apoptosis was quantified by flow cytometry. Lentiviral caspase-3 short hairpin RNA (shRNA) was employed to study its protective effects against serum deprivation. Silencing of caspase-3 expression was quantified by reverse transcription-polymerase chain reaction and Western blots, and inhibition of apoptosis was quantified by flow cytometry. Serum deprivation increased apoptosis of rat CEP cells through activation of a caspase cascade. Lentiviral caspase-3 shRNA was successfully transduced into CEP cells, and specifically silenced endogenous caspase-3 expression. Surviving cells were protected by the downregulation of caspase-3 expression and activation. Thus, lentiviral caspase-3 shRNA-mediated RNAi successfully silenced endogenous caspase-3 expression, preventing inappropriate or premature apoptosis.
Directory of Open Access Journals (Sweden)
L. Ding
2014-06-01
Full Text Available Current studies find that degenerated cartilage endplates (CEP of vertebrae, with fewer diffusion areas, decrease nutrient supply and accelerate intervertebral disc degeneration. Many more apoptotic cells have been identified in degenerated than in normal endplates, and may be responsible for the degenerated grade. Previous findings suggest that inhibition of apoptosis is one possible approach to improve disc regeneration. It is postulated that inhibition of CEP cell apoptosis may be responsible for the regeneration of endplates. Caspase-3, involved in the execution phase of apoptosis, is a candidate for regulating the apoptotic process. In the present study, CEP cells were incubated in 1% fetal bovine serum. Activated caspases were detected to identify the apoptotic pathway, and apoptosis was quantified by flow cytometry. Lentiviral caspase-3 short hairpin RNA (shRNA was employed to study its protective effects against serum deprivation. Silencing of caspase-3 expression was quantified by reverse transcription-polymerase chain reaction and Western blots, and inhibition of apoptosis was quantified by flow cytometry. Serum deprivation increased apoptosis of rat CEP cells through activation of a caspase cascade. Lentiviral caspase-3 shRNA was successfully transduced into CEP cells, and specifically silenced endogenous caspase-3 expression. Surviving cells were protected by the downregulation of caspase-3 expression and activation. Thus, lentiviral caspase-3 shRNA-mediated RNAi successfully silenced endogenous caspase-3 expression, preventing inappropriate or premature apoptosis.
RNA interference: Applications and advances in insect toxicology and insect pest management.
Kim, Young Ho; Soumaila Issa, Moustapha; Cooper, Anastasia M W; Zhu, Kun Yan
2015-05-01
Since its discovery, RNA interference (RNAi) has revolutionized functional genomic studies due to its sequence-specific nature of post-transcriptional gene silencing. In this paper, we provide a comprehensive review of the recent literature and summarize the current knowledge and advances in the applications of RNAi technologies in the field of insect toxicology and insect pest management. Many recent studies have focused on identification and validation of the genes encoding insecticide target proteins, such as acetylcholinesterases, ion channels, Bacillus thuringiensis receptors, and other receptors in the nervous system. RNAi technologies have also been widely applied to reveal the role of genes encoding cytochrome P450 monooxygenases, carboxylesterases, and glutathione S-transferases in insecticide detoxification and resistance. More recently, studies have focused on understanding the mechanism of insecticide-mediated up-regulation of detoxification genes in insects. As RNAi has already shown great potentials for insect pest management, many recent studies have also focused on host-induced gene silencing, in which several RNAi-based transgenic plants have been developed and tested as proof of concept for insect pest management. These studies indicate that RNAi is a valuable tool to address various fundamental questions in insect toxicology and may soon become an effective strategy for insect pest management. Copyright © 2015 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Francis M. F. Nunes
2013-01-01
Full Text Available RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP-derived double-stranded RNA (dsRNA-GFP is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control.
Nunes, Francis M F; Aleixo, Aline C; Barchuk, Angel R; Bomtorin, Ana D; Grozinger, Christina M; Simões, Zilá L P
2013-01-04
RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control.
Global effects of the CSR-1 RNA interference pathway on the transcriptional landscape.
Cecere, Germano; Hoersch, Sebastian; O'Keeffe, Sean; Sachidanandam, Ravi; Grishok, Alla
2014-04-01
Argonaute proteins and their small RNA cofactors short interfering RNAs are known to inhibit gene expression at the transcriptional and post-transcriptional levels. In Caenorhabditis elegans, the Argonaute CSR-1 binds thousands of endogenous siRNAs (endo-siRNAs) that are antisense to germline transcripts. However, its role in gene expression regulation remains controversial. Here we used genome-wide profiling of nascent RNA transcripts and found that the CSR-1 RNA interference pathway promoted sense-oriented RNA polymerase II transcription. Moreover, a loss of CSR-1 function resulted in global increase in antisense transcription and ectopic transcription of silent chromatin domains, which led to reduced chromatin incorporation of centromere-specific histone H3. On the basis of these findings, we propose that the CSR-1 pathway helps maintain the directionality of active transcription, thereby propagating the distinction between transcriptionally active and silent genomic regions.
[Construction and identification of eukaryotic plasmid pGC-silencer-U6/Neo/GFP/ABCG2].
Yu, Yanping; Zhang, Song; Kong, Weijia
2010-09-01
To construct three short hairpin RNA (shRNA) interference expression plasmid vectors of human ABCG2 gene, to assay the expression of ABCG2 in a human nasopharyngeal carcinoma (NPC) cell line, CEN-2 cell line, and to detect the RNAi effect of shRNA. Targeting ABCG2 gene sequence, three plasmid expression vectors coding for shRNA and a control vector containing random DNA fragment were constructed. The recombinant plasmids were amplified in Ecoli. DH5 and then identified by restriction digestion, PCR and sequencing. The recombinant plasmids were transfected into CEN-2 cells. ABCG2 expression was assayed by real-time quantitative PCR and Western blot. The construction of pGC-silencer-U6/Neo/GFP/ABCG2 was succeed. The shRNA plasmids significantly down-regulated the ABCG2 expression in CEN-2 cells, at both mRNA level and protein level. Recombinant plasmid 1 had the strongest effect compared with plasmids 2 and 3 (P < 0.05), with an inhibition ratio of 75% at the mRNA level and 68% at the protein level. pGC-silencer-U6/Neo/GFP/ABCG2 has been successfully constructed and it can down-regulate ABCG2 expression after transfected into CEN-2 cells, which could help further studies of ABCG2 functions CEN-2 cell line and contribute to the NPC gene therapy.
Adams, Felix F; Heckl, Dirk; Hoffmann, Thomas; Talbot, Steven R; Kloos, Arnold; Thol, Felicitas; Heuser, Michael; Zuber, Johannes; Schambach, Axel; Schwarzer, Adrian
2017-09-01
RNA interference (RNAi) and CRISPR-Cas9-based screening systems have emerged as powerful and complementary tools to unravel genetic dependencies through systematic gain- and loss-of-function studies. In recent years, a series of technical advances helped to enhance the performance of virally delivered RNAi. For instance, the incorporation of short hairpin RNAs (shRNAs) into endogenous microRNA contexts (shRNAmiRs) allows the use of Tet-regulated promoters for synchronous onset of gene knockdown and precise interrogation of gene dosage effects. However, remaining challenges include lack of efficient cloning strategies, inconsistent knockdown potencies and leaky expression. Here, we present a simple, one-step cloning approach for rapid and efficient cloning of miR-30 shRNAmiR libraries. We combined a human miR-30 backbone retaining native flanking sequences with an optimized all-in-one lentiviral vector system for conditional RNAi to generate a versatile toolbox characterized by higher doxycycline sensitivity, reduced leakiness and enhanced titer. Furthermore, refinement of existing shRNA design rules resulted in substantially improved prediction of powerful shRNAs. Our approach was validated by accurate quantification of the knockdown potency of over 250 single shRNAmiRs. To facilitate access and use by the scientific community, an online tool was developed for the automated design of refined shRNA-coding oligonucleotides ready for cloning into our system. Copyright © 2017 Elsevier Ltd. All rights reserved.
Hu, Weining; Zhang, Yang; Wang, Li; Lau, Chi Wai; Xu, Jian; Luo, Jiang-Yun; Gou, Lingshan; Yao, Xiaoqiang; Chen, Zhen-Yu; Ma, Ronald Ching Wan; Tian, Xiao Yu; Huang, Yu
2016-03-01
Bone morphogenic protein 4 (BMP4) is an important mediator of endothelial dysfunction in cardio-metabolic diseases, whereas platelet-derived growth factors (PDGFs) are major angiogenic and proinflammatory mediator, although the functional link between these 2 factors is unknown. The present study investigated whether PDGF mediates BMP4-induced endothelial dysfunction in diabetes mellitus. We generated Ad-Bmp4 to overexpress Bmp4 and Ad-Pdgfa-shRNA to knockdown Pdgfa in mice through tail intravenous injection. SMAD4-shRNA lentivirus, SMAD1-shRNA, and SMAD5 shRNA adenovirus were used for knockdown in human and mouse endothelial cells. We found that PDGF-AA impaired endothelium-dependent vasodilation in aortas and mesenteric resistance arteries. BMP4 upregulated PDGF-AA in human and mouse endothelial cells, which was abolished by BMP4 antagonist noggin or knockdown of SMAD1/5 or SMAD4. BMP4-impared relaxation in mouse aorta was also ameliorated by PDGF-AA neutralizing antibody. Tail injection of Ad-Pdgfa-shRNA ameliorates endothelial dysfunction induced by Bmp4 overexpression (Ad-Bmp4) in vivo. Serum PDGF-AA was elevated in both diabetic patients and diabetic db/db mice compared with nondiabetic controls. Pdgfa-shRNA or Bmp4-shRNA adenovirus reduced serum PDGF-AA concentration in db/db mice. PDGF-AA neutralizing antibody or tail injection with Pdgfa-shRNA adenovirus improved endothelial function in aortas and mesenteric resistance arteries from db/db mice. The effect of PDGF-AA on endothelial function in mouse aorta was also inhibited by Ad-Pdgfra-shRNA to inhibit PDGFRα. The present study provides novel evidences to show that PDGF-AA impairs endothelium-dependent vasodilation and PDGF-AA mediates BMP4-induced adverse effect on endothelial cell function through SMAD1/5- and SMAD4-dependent mechanisms. Inhibition of PGDF-AA ameliorates vascular dysfunction in diabetic mice. © 2016 American Heart Association, Inc.
Human GW182 Paralogs Are the Central Organizers for RNA-Mediated Control of Transcription.
Hicks, Jessica A; Li, Liande; Matsui, Masayuki; Chu, Yongjun; Volkov, Oleg; Johnson, Krystal C; Corey, David R
2017-08-15
In the cytoplasm, small RNAs can control mammalian translation by regulating the stability of mRNA. In the nucleus, small RNAs can also control transcription and splicing. The mechanisms for RNA-mediated nuclear regulation are not understood and remain controversial, hindering the effective application of nuclear RNAi and investigation of its natural regulatory roles. Here, we reveal that the human GW182 paralogs TNRC6A/B/C are central organizing factors critical to RNA-mediated transcriptional activation. Mass spectrometry of purified nuclear lysates followed by experimental validation demonstrates that TNRC6A interacts with proteins involved in protein degradation, RNAi, the CCR4-NOT complex, the mediator complex, and histone-modifying complexes. Functional analysis implicates TNRC6A, NAT10, MED14, and WDR5 in RNA-mediated transcriptional activation. These findings describe protein complexes capable of bridging RNA-mediated sequence-specific recognition of noncoding RNA transcripts with the regulation of gene transcription. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Branched RNA: A New Architecture for RNA Interference
Directory of Open Access Journals (Sweden)
Anna Aviñó
2011-01-01
Full Text Available Branched RNAs with two and four strands were synthesized. These structures were used to obtain branched siRNA. The branched siRNA duplexes had similar inhibitory capacity as those of unmodified siRNA duplexes, as deduced from gene silencing experiments of the TNF-α protein. Branched RNAs are considered novel structures for siRNA technology, and they provide an innovative tool for specific gene inhibition. As the method described here is compatible with most RNA modifications described to date, these compounds may be further functionalized to obtain more potent siRNA derivatives and can be attached to suitable delivery systems.
Janardhanan, Rajiv; Yang, Binxia; Kilari, Sreenivasulu; Leof, Edward B; Mukhopadhyay, Debabrata; Misra, Sanjay
2016-04-01
To determine if a second dose of a lentivirus mediated small hairpin RNA that inhibits Vegf-A gene expression (LV-shRNA-Vegf-A) can improve lumen vessel area (LVA) of the outflow vein of an arteriovenous fistula (AVF) and decrease venous neointimal hyperplasia. Chronic kidney disease was created in C57BL/6 mice; 28 days later, an AVF was created by connecting the right carotid artery to the ipsilateral jugular vein. Immediately after AVF creation, 5 × 10(6) plaque-forming units of LV-shRNA-Vegf-A or control shRNA was administered to the adventitia of the outflow vein, and a second dose of the same treatment was administered 14 days later. Animals were sacrificed at 21 days, 28 days, and 42 days after AVF creation for reverse transcription polymerase chain reaction and histomorphometric analyses. By day 21, there was a 125% increase in the average LVA (day 21, P = .11), with a decrease in cell proliferation (day 21, P = .0079; day 28, P = .28; day 42, P = .5), decrease in α-smooth muscle cell actin staining (day 21, P < .0001; day 28, P < .05; day 42, P = .59), and decrease in hypoxic stress (day 21, P < .001; day 28, P = .28; day 42, P = .46) in LV versus control shRNA vessels. A second dose of LV-shRNA-Vegf-A administration results in a moderate improvement in LVA at day 21. Copyright © 2016 SIR. Published by Elsevier Inc. All rights reserved.
Human CAR T cells with cell-intrinsic PD-1 checkpoint blockade resist tumor-mediated inhibition
Cherkassky, Leonid; Morello, Aurore; Villena-Vargas, Jonathan; Feng, Yang; Dimitrov, Dimiter S.; Jones, David R.; Sadelain, Michel; Adusumilli, Prasad S.
2016-01-01
Following immune attack, solid tumors upregulate coinhibitory ligands that bind to inhibitory receptors on T cells. This adaptive resistance compromises the efficacy of chimeric antigen receptor (CAR) T cell therapies, which redirect T cells to solid tumors. Here, we investigated whether programmed death-1–mediated (PD-1–mediated) T cell exhaustion affects mesothelin-targeted CAR T cells and explored cell-intrinsic strategies to overcome inhibition of CAR T cells. Using an orthotopic mouse model of pleural mesothelioma, we determined that relatively high doses of both CD28- and 4-1BB–based second-generation CAR T cells achieved tumor eradication. CAR-mediated CD28 and 4-1BB costimulation resulted in similar levels of T cell persistence in animals treated with low T cell doses; however, PD-1 upregulation within the tumor microenvironment inhibited T cell function. At lower doses, 4-1BB CAR T cells retained their cytotoxic and cytokine secretion functions longer than CD28 CAR T cells. The prolonged function of 4-1BB CAR T cells correlated with improved survival. PD-1/PD-1 ligand [PD-L1] pathway interference, through PD-1 antibody checkpoint blockade, cell-intrinsic PD-1 shRNA blockade, or a PD-1 dominant negative receptor, restored the effector function of CD28 CAR T cells. These findings provide mechanistic insights into human CAR T cell exhaustion in solid tumors and suggest that PD-1/PD-L1 blockade may be an effective strategy for improving the potency of CAR T cell therapies. PMID:27454297
Devers, Emanuel A.; Branscheid, Anja; May, Patrick; Krajinski, Franziska
2011-01-01
The majority of plants are able to form the arbuscular mycorrhizal (AM) symbiosis in association with AM fungi. During symbiosis development, plant cells undergo a complex reprogramming resulting in profound morphological and physiological changes. MicroRNAs (miRNAs) are important components of the regulatory network of plant cells. To unravel the impact of miRNAs and miRNA-mediated mRNA cleavage on root cell reprogramming during AM symbiosis, we carried out high-throughput (Illumina) sequencing of small RNAs and degradome tags of Medicago truncatula roots. This led to the annotation of 243 novel miRNAs. An increased accumulation of several novel and conserved miRNAs in mycorrhizal roots suggest a role of these miRNAs during AM symbiosis. The degradome analysis led to the identification of 185 root transcripts as mature miRNA and also miRNA*-mediated mRNA cleavage targets. Several of the identified miRNA targets are known to be involved in root symbioses. In summary, the increased accumulation of specific miRNAs and the miRNA-mediated cleavage of symbiosis-relevant genes indicate that miRNAs are an important part of the regulatory network leading to symbiosis development. PMID:21571671
Le Foll, Christelle; Dunn-Meynell, Ambrose A; Levin, Barry E
2015-02-01
Hypothalamic fatty acid (FA) sensing neurons alter their activity utilizing the FA translocator/receptor, FAT/CD36. Depletion of ventromedial hypothalamus (VMH) CD36 with adeno-associated viral vector expressing CD36 shRNA (AAV CD36 shRNA) leads to redistribution of adipose stores and insulin resistance in outbred rats. This study assessed the requirement of VMH CD36-mediated FA sensing for the regulation of energy and glucose homeostasis in postnatal day 5 (P5) and P21 selectively bred diet-induced obese (DIO) and diet-resistant (DR) rats using VMH AAV CD36 shRNA injections. P5 CD36 depletion altered VMH neuronal FA sensing predominantly in DIO rats. After 10 wk on a 45% fat diet, DIO rats injected with VMH AAV CD36 shRNA at P21 ate more and gained more weight than DIO AAV controls, while DR AAV CD36 shRNA-injected rats gained less weight than DR AAV controls. VMH CD36 depletion increased inguinal fat pad weights and leptin levels in DIO and DR rats. Although DR AAV CD36 shRNA-injected rats became as obese as DIO AAV controls, only DIO control and CD36 depleted rats became insulin-resistant on a 45% fat diet. VMH CD36 depletion stunted linear growth in DIO and DR rats. DIO rats injected with AAV CD36 shRNA at P5 had increased fat mass, mostly due to a 45% increase in subcutaneous fat. They were also insulin-resistant with an associated 71% increase of liver triglycerides. These results demonstrate that VMH CD36-mediated FA sensing is a critical factor in the regulation of energy and glucose homeostasis and fat deposition in DIO and DR rats.
Seyhan, Attila A
2016-01-01
Knockdown of single or multiple gene targets by RNA interference (RNAi) is necessary to overcome escape mutants or isoform redundancy. It is also necessary to use multiple RNAi reagents to knockdown multiple targets. It is also desirable to express a transgene or positive regulatory elements and inhibit a target gene in a coordinated fashion. This study reports a flexible multiplexed RNAi and transgene platform using endogenous intronic primary microRNAs (pri-miRNAs) as a scaffold located in the green fluorescent protein (GFP) as a model for any functional transgene. The multiplexed intronic miRNA - GFP transgene platform was designed to co-express multiple small RNAs within the polycistronic cluster from a Pol II promoter at more moderate levels to reduce potential vector toxicity. The native intronic miRNAs are co-transcribed with a precursor GFP mRNA as a single transcript and presumably cleaved out of the precursor-(pre) mRNA by the RNA splicing machinery, spliceosome. The spliced intron with miRNA hairpins will be further processed into mature miRNAs or small interfering RNAs (siRNAs) capable of triggering RNAi effects, while the ligated exons become a mature messenger RNA for the translation of the functional GFP protein. Data show that this approach led to robust RNAi-mediated silencing of multiple Renilla Luciferase (R-Luc)-tagged target genes and coordinated expression of functional GFP from a single transcript in transiently transfected HeLa cells. The results demonstrated that this design facilitates the coordinated expression of all mature miRNAs either as individual miRNAs or as multiple miRNAs and the associated protein. The data suggest that, it is possible to simultaneously deliver multiple negative (miRNA or shRNA) and positive (transgene) regulatory elements. Because many cellular processes require simultaneous repression and activation of downstream pathways, this approach offers a platform technology to achieve that dual manipulation efficiently
The Mediator Complex: At the Nexus of RNA Polymerase II Transcription.
Jeronimo, Célia; Robert, François
2017-10-01
Mediator is an essential, large, multisubunit, transcriptional co-activator highly conserved across eukaryotes. Mediator interacts with gene-specific transcription factors at enhancers as well as with the RNA polymerase II (RNAPII) transcription machinery bound at promoters. It also interacts with several other factors involved in various aspects of transcription, chromatin regulation, and mRNA processing. Hence, Mediator is at the nexus of RNAPII transcription, regulating its many steps and connecting transcription with co-transcriptional events. To achieve this flexible role, Mediator, which is divided into several functional modules, reorganizes its conformation and composition while making transient contacts with other components. Here, we review the mechanisms of action of Mediator and propose a unifying model for its function. Copyright © 2017 Elsevier Ltd. All rights reserved.
Does Work-Home Interference mediate the relationship between workload and well-being?
Geurts, S.A.E.; Kompier, M.A.J.; Roxburgh, S.; Houtman, I.L.D.
2003-01-01
Drawing on the Effort-Recovery (E-R) model, the current study investigated to what extent Work-Home Interference (WHI) mediated the relationship between workload and two indicators of well-being, that is, (a) affective well-being (i.e., work-related negative affect and depressive mood) and (b)
Directory of Open Access Journals (Sweden)
Baodong Wu
2009-03-01
Full Text Available Plus-strand RNA viruses contain RNA elements within their genomes that mediate a variety of fundamental viral processes. The traditional view of these elements is that of local RNA structures. This perspective, however, is changing due to increasing discoveries of functional viral RNA elements that are formed by long-range RNA-RNA interactions, often spanning thousands of nucleotides. The plus-strand RNA genomes of tombusviruses exemplify this concept by possessing different long-range RNA-RNA interactions that regulate both viral translation and transcription. Here we report that a third fundamental tombusvirus process, viral genome replication, requires a long-range RNA-based interaction spanning approximately 3000 nts. In vivo and in vitro analyses suggest that the discontinuous RNA platform formed by the interaction facilitates efficient assembly of the viral RNA replicase. This finding has allowed us to build an integrated model for the role of global RNA structure in regulating the reproduction of a eukaryotic RNA virus, and the insights gained have extended our understanding of the multifunctional nature of viral RNA genomes.
Directory of Open Access Journals (Sweden)
Chu Justin
2010-02-01
Full Text Available Abstract Background Dengue virus (DENV is the causative agent of Dengue fever and the life-threatening Dengue Haemorrhagic fever or Dengue shock syndrome. In the absence of anti-viral agents or vaccine, there is an urgent need to develop an effective anti-viral strategy against this medically important viral pathogen. The initial interplay between DENV and the host cells may represent one of the potential anti-viral targeting sites. Currently the involvements of human membrane trafficking host genes or factors that mediate the infectious cellular entry of dengue virus are not well defined. Results In this study, we have used a targeted small interfering RNA (siRNA library to identify and profile key cellular genes involved in processes of endocytosis, cytoskeletal dynamics and endosome trafficking that are important and essential for DENV infection. The infectious entry of DENV into Huh7 cells was shown to be potently inhibited by siRNAs targeting genes associated with clathrin-mediated endocytosis. The important role of clathrin-mediated endocytosis was confirmed by the expression of well-characterized dominant-negative mutants of genes in this pathway and by using the clathrin endocytosis inhibitor chlorpromazine. Furthermore, DENV infection was shown to be sensitive to the disruption of human genes in regulating the early to late endosomal trafficking as well as the endosomal acidic pH. The importance and involvement of both actin and microtubule dynamics in mediating the infectious entry of DENV was also revealed in this study. Conclusions Together, the findings from this study have provided a detail profiling of the human membrane trafficking cellular genes and the mechanistic insight into the interplay of these host genes with DENV to initiate an infection, hence broadening our understanding on the entry pathway of this medically important viral pathogen. These data may also provide a new potential avenue for development of anti
RNA interference: concept to reality in crop improvement.
Saurabh, Satyajit; Vidyarthi, Ambarish S; Prasad, Dinesh
2014-03-01
The phenomenon of RNA interference (RNAi) is involved in sequence-specific gene regulation driven by the introduction of dsRNA resulting in inhibition of translation or transcriptional repression. Since the discovery of RNAi and its regulatory potentials, it has become evident that RNAi has immense potential in opening a new vista for crop improvement. RNAi technology is precise, efficient, stable and better than antisense technology. It has been employed successfully to alter the gene expression in plants for better quality traits. The impact of RNAi to improve the crop plants has proved to be a novel approach in combating the biotic and abiotic stresses and the nutritional improvement in terms of bio-fortification and bio-elimination. It has been employed successfully to bring about modifications of several desired traits in different plants. These modifications include nutritional improvements, reduced content of food allergens and toxic compounds, enhanced defence against biotic and abiotic stresses, alteration in morphology, crafting male sterility, enhanced secondary metabolite synthesis and seedless plant varieties. However, crop plants developed by RNAi strategy may create biosafety risks. So, there is a need for risk assessment of GM crops in order to make RNAi a better tool to develop crops with biosafety measures. This article is an attempt to review the RNAi, its biochemistry, and the achievements attributed to the application of RNAi in crop improvement.
Selection Demands and Working Memory Mediate Interference during Naming
Directory of Open Access Journals (Sweden)
Julie W Hughes
2015-05-01
Analyzing RTs, we replicated previous SI effects in BCN in healthy subjects and patients (reported effects’ p’s < .05. Subjects responded more slowly to items in semantically related vs. unrelated groups, and this interference increased across cycles (evidence of increasing selection demands; Figures 1a/c. Indicative of WM, healthy subjects were faster to name items as the number of unrelated items to be named (i.e., remembered decreased. However, this was attenuated by selection demand, as there was no decrease in RTs across repeated related items (Figure 1b. Converging evidence from patients demonstrated more impaired selection capacity produced increasingly slower RTs across item positions within the related condition (high selection demand (Figure 1d. Larger WM capacity (rhyme probe but not category probe, p = .54 produced increasingly faster RTs across items positions in the unrelated condition (low selection demand (Figure 1e. Together, these findings suggest that both selection demand and phonological WM processes mediate interference during naming.
DEFF Research Database (Denmark)
Mousaei, Marzieh; Deng, Ling; She, Qunxin
2016-01-01
The stringency of crRNA-protospacer DNA base pair matching required for effective CRISPR-Cas interference is relatively low in crenarchaeal Sulfolobus species in contrast to that required in some bacteria. To understand its biological significance we studied crRNA-protospacer interactions...... in Sulfolobus islandicus REY15A which carries multiple, and functionally diverse, interference complexes. A range of mismatches were introduced into a vector-borne protospacer that was identical to spacer 1 of CRISPR locus 2, with a cognate CCN PAM sequence. Two important crRNA annealing regions were identified...
RNA Interference - Towards RNA becoming a Medicine -42 ...
Indian Academy of Sciences (India)
research. A brief history of the development ofRNAi is shown in. Box 2. Mechanism of ... new RNA strand using target RNA as the template and thereby converting it ... thought to excise precursor stRNA from their -70 nt stem loop precursor to ...
Takahashi, Yuki; Kaneda, Haruka; Takasuka, Nana; Hattori, Kayoko; Nishikawa, Makiya; Watanabe, Yoshihiko; Takakura, Yoshinobu
2008-08-01
The suppressor of cytokine signaling (SOCS) proteins, negative regulators of interferon (IFN)-induced signaling pathways, is involved in IFN resistance of tumor cells. To improve the growth inhibitory effect of IFN-beta and IFN-gamma on a murine melanoma cell line, B16-BL6, and a murine colon carcinoma cell line, Colon26 cells, SOCS-1 and SOCS-3 gene expression in tumor cells was downregulated by transfection of plasmid DNA expressing short hairpin RNA targeting one of these genes (pshSOCS-1 and pshSOCS-3, respectively). Transfection of pshSOCS-1 significantly increased the antiproliferative effect of IFN-gamma on B16-BL6 cells. However, any other combinations of plasmids and IFN had little effect on the growth of B16-BL6 cells. In addition, transfection of pshSOCS-1 and pshSOCS-3 produced little improvement in the effect of IFN on Colon26 cells. To understand the mechanism underlining these findings, the level of SOCS gene expression was measured by real time polymerase chain reaction. Addition of IFN-gamma greatly increased the SOCS-1 mRNA expression in B16-BL6 cells. Taking into account the synergistic effect of pshSOCS-1 and IFN-gamma on the growth of B16-BL6 cells, these findings suggest that IFN-gamma-induced high SOCS-1 gene expression in B16-BL6 cells significantly interferes with the antiproliferative effect of IFN-gamma. These results indicate that silencing SOCS gene expression can be an effective strategy to enhance the antitumor effect of IFN under conditions in which the SOCS gene expression is upregulated by IFN.
miRNA-mediated functional changes through co-regulating function related genes.
Directory of Open Access Journals (Sweden)
Jie He
Full Text Available BACKGROUND: MicroRNAs play important roles in various biological processes involving fairly complex mechanism. Analysis of genome-wide miRNA microarray demonstrate that a single miRNA can regulate hundreds of genes, but the regulative extent on most individual genes is surprisingly mild so that it is difficult to understand how a miRNA provokes detectable functional changes with such mild regulation. RESULTS: To explore the internal mechanism of miRNA-mediated regulation, we re-analyzed the data collected from genome-wide miRNA microarray with bioinformatics assay, and found that the transfection of miR-181b and miR-34a in Hela and HCT-116 tumor cells regulated large numbers of genes, among which, the genes related to cell growth and cell death demonstrated high Enrichment scores, suggesting that these miRNAs may be important in cell growth and cell death. MiR-181b induced changes in protein expression of most genes that were seemingly related to enhancing cell growth and decreasing cell death, while miR-34a mediated contrary changes of gene expression. Cell growth assays further confirmed this finding. In further study on miR-20b-mediated osteogenesis in hMSCs, miR-20b was found to enhance osteogenesis by activating BMPs/Runx2 signaling pathway in several stages by co-repressing of PPARγ, Bambi and Crim1. CONCLUSIONS: With its multi-target characteristics, miR-181b, miR-34a and miR-20b provoked detectable functional changes by co-regulating functionally-related gene groups or several genes in the same signaling pathway, and thus mild regulation from individual miRNA targeting genes could have contributed to an additive effect. This might also be one of the modes of miRNA-mediated gene regulation.
Li, Yang; Zhu, Danxi; Hou, Lidan; Hu, Bin; Xu, Min; Meng, Xiangjun
2018-01-01
Tribbles homolog 3 (TRB3), a type of pseudokinase that contains a consensus serine/threonine kinase catalytic core structure, is upregulated in hepatocellular carcinoma. However, the effect of TRB3 expression in hepatocellular carcinoma and the molecular mechanisms underlying TRB3-mediated effects on tumorigenesis in hepatocellular carcinoma have not been fully elucidated. The present study focused on the effect of TRB3 expression in MHCC97H hepatocellular carcinoma cells and investigated the underlying molecular mechanisms in MHCC97H cells. In the present study, it was revealed that TRB3 was significantly overexpressed in the MHCC97H hepatocellular carcinoma cell compared with L-02 normal hepatic cells. Under endoplasmic reticulum (ER) stress induced by thapsigargin and tunicamycin, the levels of TRB3, CCAAT/enhancer binding protein homologous protein (CHOP), protein kinase B (AKT) and phosphorylated (p)AKT expression were upregulated. Furthermore, when the expression of TRB3 was silenced by short hairpin (sh)RNA, the survival of MHCC97H hepatocellular carcinoma cells was increased. Notably, following transduction with lentiviral containing TRB3-shRNA, cell survival also increased after treatment with chemotherapy drug cisplatin. The present study demonstrated that knockdown of CHOP by shRNA was able to reduce TRB3 expression, and the knockdown of TRB3 markedly increased the level of pAKT. TRB3 was overexpressed in MHCC97H hepatocellular carcinoma cells, particularly under endoplasmic reticulum stress. Knockdown of TRB3 was able to increase cell survival. Therefore, TRB3 expression may induce apoptosis and reverse resistance to chemotherapy in MHCC97H hepatic carcinoma cells. The present study suggests that TRB3 is a key molecule that mediates the crosstalk between ER stress and AKT signal pathways. Furthermore, the present study may provide further insight into the cancer biology of hepatocellular carcinoma and the development of anticancer drugs targeting the ER
International Nuclear Information System (INIS)
Beck, Markus; Strand, Michael R.
2003-01-01
The family Polydnaviridae consists of ds-DNA viruses that are symbiotically associated with certain parasitoid wasps. PDVs are transmitted vertically but also are injected by wasps into hosts where they cause several physiological alterations including immunosuppression. The PDV genes responsible for mediating immunosuppression and other host alterations remain poorly characterized in large measure because viral mutants cannot be produced to study gene function. Here we report the use of RNA interference (RNAi) to specifically silence the glc1.8 and egf1.0 genes from Microplitis demolitor bracovirus (MdBV) in High Five cells derived from the lepidopteran Trichoplusia ni. Dose-response studies indicated that MdBV infects High Five cells and blocks the ability of these cells to adhere to culture plates. This response was very similar to what occurs in two classes of hemocytes, granular cells, and plasmatocytes, after infection by MdBV. Screening of monoclonal antibody (mAb) markers that distinguish different classes of lepidopteran hemocytes indicated that High Five cells cross-react with three mAbs that recognize granular cells from T. ni. Double-stranded RNA (dsRNA) complementary to glc1.8 specifically silenced glc1.8 expression and rescued the adhesive phenotype of High Five cells. Reciprocally, dsRNA complementary to egf1.0 silenced egf1.0 expression but had no effect on adhesion. The simplicity and potency of RNAi could be extremely useful for analysis of other PDV genes
Schnettler, Esther; Hemmes, Hans; Huismann, Rik; Goldbach, Rob; Prins, Marcel; Kormelink, Richard
2010-11-01
The tospovirus NSs protein was previously shown to suppress the antiviral RNA silencing mechanism in plants. Here the biochemical analysis of NSs proteins from different tospoviruses, using purified NSs or NSs containing cell extracts, is described. The results showed that all tospoviral NSs proteins analyzed exhibited affinity to small double-stranded RNA molecules, i.e., small interfering RNAs (siRNAs) and micro-RNA (miRNA)/miRNA* duplexes. Interestingly, the NSs proteins from tomato spotted wilt virus (TSWV), impatiens necrotic spot virus (INSV), and groundnut ringspot virus (GRSV) also showed affinity to long double-stranded RNA (dsRNA), whereas tomato yellow ring virus (TYRV) NSs did not. The TSWV NSs protein was shown to be capable of inhibiting Dicer-mediated cleavage of long dsRNA in vitro. In addition, it suppressed the accumulation of green fluorescent protein (GFP)-specific siRNAs during coinfiltration with an inverted-repeat-GFP RNA construct in Nicotiana benthamiana. In vivo interference of TSWV NSs in the miRNA pathway was shown by suppression of an enhanced GFP (eGFP) miRNA sensor construct. The ability to stabilize miRNA/miRNA* by different tospovirus NSs proteins in vivo was demonstrated by increased accumulation and detection of both miRNA171c and miRNA171c* in tospovirus-infected N. benthamiana. All together, these data suggest that tospoviruses interfere in the RNA silencing pathway by sequestering siRNA and miRNA/miRNA* molecules before they are uploaded into their respective RNA-induced silencing complexes. The observed affinity to long dsRNA for only a subset of the tospoviruses studied is discussed in light of evolutional divergence and their ancestral relation to the animal-infecting members of the Bunyaviridae.
Wannenes, Francesca; Ciafré, Silvia Anna; Niola, Francesco; Frajese, Gaetano; Farace, Maria Giulia
2005-12-01
RNA interference technology is emerging as a very potent tool to obtain a cellular knockdown of a desired gene. In this work we used vector-based RNA interference to inhibit vascular endothelial growth factor (VEGF) expression in prostate cancer in vitro and in vivo. We demonstrated that transduction with a plasmid carrying a small interfering RNA targeting all isoforms of VEGF, dramatically impairs the expression of this growth factor in the human prostate cancer cell line PC3. As a consequence, PC3 cells loose their ability to induce one of the fundamental steps of angiogenesis, namely the formation of a tube-like network in vitro. Most importantly, our "therapeutic" vector is able to impair tumor growth rate and vascularization in vivo. We show that a single injection of naked plasmid in developing neoplastic mass significantly decreases microvessel density in an androgen-refractory prostate xenograft and is able to sustain a long-term slowing down of tumor growth. In conclusion, our results confirm the basic role of VEGF in the angiogenic development of prostate carcinoma, and suggest that the use of our vector-based RNA interference approach to inhibit angiogenesis could be an effective tool in view of future gene therapy applications for prostate cancer.
Hasiów-Jaroszewska, Beata; Minicka, Julia; Zarzyńska-Nowak, Aleksandra; Budzyńska, Daria; Elena, Santiago F
2018-05-02
Tomato black ring virus (TBRV) is the only member of the Nepovirus genus that is known to form defective RNA particles (D RNAs) during replication. Here, de novo generation of D RNAs was observed during prolonged passages of TBRV isolates originated from Solanum lycopersicum and Lactuca sativa in Chenopodium quinoa plants. D RNAs of about 500 nt derived by a single deletion in the RNA1 molecule and contained a portion of the 5' untranslated region and viral replicase, and almost the entire 3' non-coding region. Short regions of sequence complementarity were found at the 5' and 3' junction borders, which can facilitate formation of the D RNAs. Moreover, in this study we analyzed the effects of D RNAs on TBRV replication and symptoms development of infected plants. C. quinoa, S. lycopersicum, Nicotiana tabacum, and L. sativa were infected with the original TBRV isolates (TBRV-D RNA) and those containing additional D RNA particles (TBRV + D RNA). The viral accumulation in particular hosts was measured up to 28 days post inoculation by RT-qPCR. Statistical analyses revealed that D RNAs interfere with TBRV replication and thus should be referred to as defective interfering particles. The magnitude of the interference effect depends on the interplay between TBRV isolate and host species. Copyright © 2018 Elsevier B.V. All rights reserved.
A CRISPR CASe for High-Throughput Silencing
Directory of Open Access Journals (Sweden)
Jacob eHeintze
2013-10-01
Full Text Available Manipulation of gene expression on a genome-wide level is one of the most important systematic tools in the post-genome era. Such manipulations have largely been enabled by expression cloning approaches using sequence-verified cDNA libraries, large-scale RNA interference libraries (shRNA or siRNA and zinc finger nuclease technologies. More recently, the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats and CRISPR-associated (Cas9-mediated gene editing technology has been described that holds great promise for future use of this technology in genomic manipulation. It was suggested that the CRISPR system has the potential to be used in high-throughput, large-scale loss of function screening. Here we discuss some of the challenges in engineering of CRISPR/Cas genomic libraries and some of the aspects that need to be addressed in order to use this technology on a high-throughput scale.
Chen, Xiaoyin; Cuadros, Margarete Diaz; Chalfie, Martin
2015-01-09
Caenorhabditis elegans senses gentle touch along the body via six touch receptor neurons. Although genetic screens and microarray analyses have identified several genes needed for touch sensitivity, these methods miss pleiotropic genes that are essential for the viability, movement, or fertility of the animals. We used neuronally enhanced feeding RNA interference to screen genes that cause lethality or paralysis when mutated, and we identified 61 such genes affecting touch sensitivity, including five positive controls. We confirmed 18 genes by using available alleles, and further studied one of them, tag-170, now renamed txdc-9. txdc-9 preferentially affects anterior touch response but is needed for tubulin acetylation and microtubule formation in both the anterior and posterior touch receptor neurons. Our results indicate that neuronally enhanced feeding RNA interference screens complement traditional mutageneses by identifying additional nonviable genes needed for specific neuronal functions. Copyright © 2015 Chen et al.
Du, Zhou; Sun, Tong; Hacisuleyman, Ezgi; Fei, Teng; Wang, Xiaodong; Brown, Myles; Rinn, John L; Lee, Mary Gwo-Shu; Chen, Yiwen; Kantoff, Philip W; Liu, X Shirley
2016-03-15
Mounting evidence suggests that long noncoding RNAs (lncRNAs) can function as microRNA sponges and compete for microRNA binding to protein-coding transcripts. However, the prevalence, functional significance and targets of lncRNA-mediated sponge regulation of cancer are mostly unknown. Here we identify a lncRNA-mediated sponge regulatory network that affects the expression of many protein-coding prostate cancer driver genes, by integrating analysis of sequence features and gene expression profiles of both lncRNAs and protein-coding genes in tumours. We confirm the tumour-suppressive function of two lncRNAs (TUG1 and CTB-89H12.4) and their regulation of PTEN expression in prostate cancer. Surprisingly, one of the two lncRNAs, TUG1, was previously known for its function in polycomb repressive complex 2 (PRC2)-mediated transcriptional regulation, suggesting its sub-cellular localization-dependent function. Our findings not only suggest an important role of lncRNA-mediated sponge regulation in cancer, but also underscore the critical influence of cytoplasmic localization on the efficacy of a sponge lncRNA.
C to U RNA editing mediated by APOBEC1 requires RNA-binding protein RBM47.
Fossat, Nicolas; Tourle, Karin; Radziewic, Tania; Barratt, Kristen; Liebhold, Doreen; Studdert, Joshua B; Power, Melinda; Jones, Vanessa; Loebel, David A F; Tam, Patrick P L
2014-08-01
Cytidine (C) to Uridine (U) RNA editing is a post-transcriptional modification that is accomplished by the deaminase APOBEC1 and its partnership with the RNA-binding protein A1CF. We identify and characterise here a novel RNA-binding protein, RBM47, that interacts with APOBEC1 and A1CF and is expressed in tissues where C to U RNA editing occurs. RBM47 can substitute for A1CF and is necessary and sufficient for APOBEC1-mediated editing in vitro. Editing is further impaired in Rbm47-deficient mutant mice. These findings suggest that RBM47 and APOBEC1 constitute the basic machinery for C to U RNA editing. © 2014 The Authors.
A ribonuclease coordinates siRNA amplification and mRNA cleavage during RNAi.
Tsai, Hsin-Yue; Chen, Chun-Chieh G; Conte, Darryl; Moresco, James J; Chaves, Daniel A; Mitani, Shohei; Yates, John R; Tsai, Ming-Daw; Mello, Craig C
2015-01-29
Effective silencing by RNA-interference (RNAi) depends on mechanisms that amplify and propagate the silencing signal. In some organisms, small-interfering RNAs (siRNAs) are amplified from target mRNAs by RNA-dependent RNA polymerase (RdRP). Both RdRP recruitment and mRNA silencing require Argonaute proteins, which are generally thought to degrade RNAi targets by directly cleaving them. However, in C. elegans, the enzymatic activity of the primary Argonaute, RDE-1, is not required for silencing activity. We show that RDE-1 can instead recruit an endoribonuclease, RDE-8, to target RNA. RDE-8 can cleave RNA in vitro and is needed for the production of 3' uridylated fragments of target mRNA in vivo. We also find that RDE-8 promotes RdRP activity, thereby ensuring amplification of siRNAs. Together, our findings suggest a model in which RDE-8 cleaves target mRNAs to mediate silencing, while generating 3' uridylated mRNA fragments to serve as templates for the RdRP-directed amplification of the silencing signal. Copyright © 2015 Elsevier Inc. All rights reserved.
Guo, Yijing; Wang, Pin; Sun, Haixia; Cai, Rongrong; Xia, Wenqing; Wang, Shaohua
2013-12-23
This study aims to investigate the roles of the Notch-Hes1 pathway in the advanced glycation end product (AGE)-mediated differentiation of neural stem cells (NSCs). We prepared pLentiLox3.7 lentiviral vectors that express short hairpin RNA (shRNA) against Notch1 and transfected it into NSCs. Cell differentiation was analyzed under confocal laser-scanning microscopy. The percentage of neurons and astrocytes was quantified by normalizing the total number of TUJ1+ (Neuron-specific class III β-tubulin) and GFAP+ (Glial fibrillary acidic protein) cells to the total number of Hoechst 33342-labeled cell nuclei. The protein and gene expression of Notch-Hes1 pathway components was examined via western blot analysis and real-time PCR. After 1 week of incubation, we found that AGE-bovine serum albumin (BSA) (400 μg/mL) induced the astrocytic differentiation of cultured neurospheres and inhibited neuronal formation. The expression of Notch-Hes1 pathway components was upregulated in the cells in the AGE-BSA culture medium. Immunoblot analysis indicated that shRNA silencing of Notch1 expression in NSCs significantly increases neurogenesis and suppresses astrocytic differentiation in NSCs incubated with AGE-BSA. AGEs promote the astrocytic differentiation of cultured neurospheres by inhibiting neurogenesis through the Notch-Hes1 pathway, providing a potential therapeutic target for hyperglycemia-related cognitive deficits.
BET Bromodomain Inhibition Releases the Mediator Complex from Select cis-Regulatory Elements.
Bhagwat, Anand S; Roe, Jae-Seok; Mok, Beverly Y L; Hohmann, Anja F; Shi, Junwei; Vakoc, Christopher R
2016-04-19
The bromodomain and extraterminal (BET) protein BRD4 can physically interact with the Mediator complex, but the relevance of this association to the therapeutic effects of BET inhibitors in cancer is unclear. Here, we show that BET inhibition causes a rapid release of Mediator from a subset of cis-regulatory elements in the genome of acute myeloid leukemia (AML) cells. These sites of Mediator eviction were highly correlated with transcriptional suppression of neighboring genes, which are enriched for targets of the transcription factor MYB and for functions related to leukemogenesis. A shRNA screen of Mediator in AML cells identified the MED12, MED13, MED23, and MED24 subunits as performing a similar regulatory function to BRD4 in this context, including a shared role in sustaining a block in myeloid maturation. These findings suggest that the interaction between BRD4 and Mediator has functional importance for gene-specific transcriptional activation and for AML maintenance. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
A Significant Increase of RNAi Efficiency in Human Cells by the CMV Enhancer with a tRNAlys Promoter
Directory of Open Access Journals (Sweden)
Ma Weiwei
2009-01-01
Full Text Available RNA interference (RNAi is the process of mRNA degradation induced by double-stranded RNA in a sequence-specific manner. Different types of promoters, such as U6, H1, tRNA, and CMV, have been used to control the inhibitory effect of RNAi expression vectors. In the present study, we constructed two shRNA expression vectors, respectively, controlled by tRNAlys and CMV enhancer-tRNAlys promoters. Compared to the vectors with tRNAlys or U6 promoter, the vector with a CMV enhancer-tRNAlys promoter silenced pokemon more efficiently on both the mRNA and the protein levels. Meanwhile, the silencing of pokemon inhibited the proliferation of MCF7 cells, but the induction of apoptosis of MCF7 cells was not observed. We conclude that the CMV enhancer-tRNAlys promoter may be a powerful tool in driving intracellular expression of shRNA which can efficiently silence targeted gene.
A Significant Increase of RNAi Efficiency in Human Cells by the CMV Enhancer with a tRNAlys Promoter
Weiwei, Ma; Zhenhua, Xie; Feng, Liu; Hang, Ning; Yuyang, Jiang
2009-01-01
RNA interference (RNAi) is the process of mRNA degradation induced by double-stranded RNA in a sequence-specific manner. Different types of promoters, such as U6, H1, tRNA, and CMV, have been used to control the inhibitory effect of RNAi expression vectors. In the present study, we constructed two shRNA expression vectors, respectively, controlled by tRNAlys and CMV enhancer-tRNAlys promoters. Compared to the vectors with tRNAlys or U6 promoter, the vector with a CMV enhancer-tRNAlys promoter silenced pokemon more efficiently on both the mRNA and the protein levels. Meanwhile, the silencing of pokemon inhibited the proliferation of MCF7 cells, but the induction of apoptosis of MCF7 cells was not observed. We conclude that the CMV enhancer-tRNAlys promoter may be a powerful tool in driving intracellular expression of shRNA which can efficiently silence targeted gene. PMID:19859553
Wang, Zhaohui; Jay, Christopher M; Evans, Courtney; Kumar, Padmasini; Phalon, Connor; Rao, Donald D; Senzer, Neil; Nemunaitis, John
2017-02-01
Stathmin-1 (STMN1) is a microtubule-destabilizing protein which is overexpressed in cancer. Its overexpression is associated with poor prognosis and also serves as a predictive marker to taxane therapy. We have developed a proprietary bi-functional shRNA (bi-shRNA) platform to execute RNA interference (RNAi)-mediated gene silencing and a liposome-carrier complex to systemically deliver the pbi-shRNA plasmids. In vitro and in vivo testing demonstrated efficacy and specificity of pbi-shRNA plasmid in targeting STMN1 (Phadke, A. P., Jay, C. M., Wang, Z., Chen, S., Liu, S., Haddock, C., Kumar, P., Pappen, B. O., Rao, D. D., Templeton, N. S., et al. (2011). In vivo safety and antitumor efficacy of bifunctional small hairpin RNAs specific for the human Stathmin 1 oncoprotein. DNA Cell Biol. 30, 715-726.). Biodistribution and toxicology studies in bio-relevant Sprague Dawley rats with pbi-shRNA STMN1 lipoplex revealed that the plasmid DNA was delivered to a broad distribution of organs after a single subcutaneous injection. Specifically, plasmid was detected within the first week using QPCR (threshold 50 copies plasmid/1 µg genomic DNA) at the injection site, lung, spleen, blood, skin, ovary (limited), lymph nodes, and liver. It was not detected in the heart, testis or bone marrow. No plasmid was detected from any organ 30 days after injection. Treatment was well tolerated. Minimal inflammation/erythema was observed at the injection site. Circulating cytokine response was also examined by ELISA. The IL-6 levels were induced within 6 h then declined to the vehicle control level 72 h after the injection. TNFα induction was transiently observed 4 days after the DNA lipoplex treatment. In summary, the pbi-shRNA STMN1 lipoplex was well tolerated and displayed broad distribution after a single subcutaneous injection. The pre-clinical data has been filed to FDA and the pbi-shRNA STMN1 lipoplex is being investigated in a phase I clinical study. © The Author 2016. Published
Adenovirus Vector-Derived VA-RNA-Mediated Innate Immune Responses
Directory of Open Access Journals (Sweden)
Hiroyuki Mizuguchi
2011-07-01
Full Text Available The major limitation of the clinical use of replication-incompetent adenovirus (Ad vectors is the interference by innate immune responses, including induction of inflammatory cytokines and interferons (IFN, following in vivo application of Ad vectors. Ad vector-induced production of inflammatory cytokines and IFNs also results in severe organ damage and efficient induction of acquired immune responses against Ad proteins and transgene products. Ad vector-induced innate immune responses are triggered by the recognition of Ad components by pattern recognition receptors (PRRs. In order to reduce the side effects by Ad vector-induced innate immune responses and to develop safer Ad vectors, it is crucial to clarify which PRRs and which Ad components are involved in Ad vector-induced innate immune responses. Our group previously demonstrated that myeloid differentiating factor 88 (MyD88 and toll-like receptor 9 (TLR9 play crucial roles in the Ad vector-induced inflammatory cytokine production in mouse bone marrow-derived dendritic cells. Furthermore, our group recently found that virus associated-RNAs (VA-RNAs, which are about 160 nucleotide-long non-coding small RNAs encoded in the Ad genome, are involved in IFN production through the IFN-β promoter stimulator-1 (IPS-1-mediated signaling pathway following Ad vector transduction. The aim of this review is to highlight the Ad vector-induced innate immune responses following transduction, especially VA-RNA-mediated innate immune responses. Our findings on the mechanism of Ad vector-induced innate immune responses should make an important contribution to the development of safer Ad vectors, such as an Ad vector lacking expression of VA-RNAs.
Interference of transcription across H-NS binding sites and repression by H-NS.
Rangarajan, Aathmaja Anandhi; Schnetz, Karin
2018-05-01
Nucleoid-associated protein H-NS represses transcription by forming extended DNA-H-NS complexes. Repression by H-NS operates mostly at the level of transcription initiation. Less is known about how DNA-H-NS complexes interfere with transcription elongation. In vitro H-NS has been shown to enhance RNA polymerase pausing and to promote Rho-dependent termination, while in vivo inhibition of Rho resulted in a decrease of the genome occupancy by H-NS. Here we show that transcription directed across H-NS binding regions relieves H-NS (and H-NS/StpA) mediated repression of promoters in these regions. Further, we observed a correlation of transcription across the H-NS-bound region and de-repression. The data suggest that the transcribing RNA polymerase is able to remodel the H-NS complex and/or dislodge H-NS from the DNA and thus relieve repression. Such an interference of transcription and H-NS mediated repression may imply that poorly transcribed AT-rich loci are prone to be repressed by H-NS, while efficiently transcribed loci escape repression. © 2018 John Wiley & Sons Ltd.
Modelling toehold-mediated RNA strand displacement.
Šulc, Petr; Ouldridge, Thomas E; Romano, Flavio; Doye, Jonathan P K; Louis, Ard A
2015-03-10
We study the thermodynamics and kinetics of an RNA toehold-mediated strand displacement reaction with a recently developed coarse-grained model of RNA. Strand displacement, during which a single strand displaces a different strand previously bound to a complementary substrate strand, is an essential mechanism in active nucleic acid nanotechnology and has also been hypothesized to occur in vivo. We study the rate of displacement reactions as a function of the length of the toehold and temperature and make two experimentally testable predictions: that the displacement is faster if the toehold is placed at the 5' end of the substrate; and that the displacement slows down with increasing temperature for longer toeholds. Copyright © 2015 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Wang, Xiaofeng; Liu, Xinyang; Huang, Mingzhu; Gan, Lu; Cheng, Yufan; Li, Jin
2016-01-01
Bmi-1 is aberrantly activated in various cancers and plays a vital role in maintaining the self-renewal of stem cells. Our previous research revealed that Bmi-1 was overexpressed in gastric cancer (GC) and it's overexpression was an independent negative prognostic factor, suggesting it can be a therapeutic target. The main purpose of this investigation was to explore the antitumor activity of Bmi-1 interference driven by its own promoter (Ad-Bmi-1i) for GC. In this study, we used adenoviral vector to deliver Bmi-1 shRNA driven by its own promoter to treat GC. Our results revealed that Ad-Bmi-1i could selectively silence Bmi-1 in GC cells which overexpress Bmi-1 and suppress the malignant phenotypes and stem-like properties of GC cells in vitro and in vivo. Moreover, direct injection of Ad-Bmi-1i into xenografts suppressed tumor growth and destroyed cancer cells in vivo. Ad-Bmi-1i inhibited the proliferation of GC cells mainly via inducing senescence in vitro, but it suppressed tumor through inducing senescence and apoptosis, and inhibiting angiogenesis in vivo. Bmi-1 knockdown by Ad-Bmi-1i downregulated VEGF via inhibiting AKT activity. These results suggest that Ad-Bmi-1i not only inhibits tumor growth and stem cell-like phenotype by inducing cellular senescence directly, but also has an indirect anti-tumor activity by anti-angiogenesis effects via regulating PTEN/AKT/VEGF pathway. Transfer of gene interference guided by its own promoter by an adeno-associated virus (AAV) vector might be a potent antitumor approach for cancer therapy. PMID:27009837
Killiny, Nabil; Kishk, Abdelaziz
2017-06-01
RNA interference (RNAi) is a powerful means to study functional genomics in insects. The delivery of dsRNA is a challenging step in the development of RNAi assay. Here, we describe a new delivery method to increase the effectiveness of RNAi in the Asian citrus psyllid Diaphorina citri. Bromophenol blue droplets were topically applied to fifth instar nymphs and adults on the ventral side of the thorax between the three pairs of legs. In addition to video recordings that showed sucking of the bromophenol blue by the stylets, dissected guts turned blue indicating that the uptake was through feeding. Thus, we called the method topical feeding. We targeted the abnormal wing disc gene (awd), also called nucleoside diphosphate kinase (NDPK), as a reporter gene to prove the uptake of dsRNA via this method of delivery. Our results showed that dsRNA-awd caused reduction of awd expression and nymph mortality. Survival and lifespan of adults emerged from treated nymphs and treated adults were affected. Silencing awd caused wing malformation in the adults emerged from treated nymphs. Topical feeding as a delivery of dsRNA is highly efficient for both nymphs and adults. The described method could be used to increase the efficiency of RNAi in D. citri and other sap piercing-sucking hemipterans. © 2017 Wiley Periodicals, Inc.
Asha, Srinivasan; Sreekumar, Sweda; Soniya, E V
2016-01-01
Analysis of high-throughput small RNA deep sequencing data, in combination with black pepper transcriptome sequences revealed microRNA-mediated gene regulation in black pepper ( Piper nigrum L.). Black pepper is an important spice crop and its berries are used worldwide as a natural food additive that contributes unique flavour to foods. In the present study to characterize microRNAs from black pepper, we generated a small RNA library from black pepper leaf and sequenced it by Illumina high-throughput sequencing technology. MicroRNAs belonging to a total of 303 conserved miRNA families were identified from the sRNAome data. Subsequent analysis from recently sequenced black pepper transcriptome confirmed precursor sequences of 50 conserved miRNAs and four potential novel miRNA candidates. Stem-loop qRT-PCR experiments demonstrated differential expression of eight conserved miRNAs in black pepper. Computational analysis of targets of the miRNAs showed 223 potential black pepper unigene targets that encode diverse transcription factors and enzymes involved in plant development, disease resistance, metabolic and signalling pathways. RLM-RACE experiments further mapped miRNA-mediated cleavage at five of the mRNA targets. In addition, miRNA isoforms corresponding to 18 miRNA families were also identified from black pepper. This study presents the first large-scale identification of microRNAs from black pepper and provides the foundation for the future studies of miRNA-mediated gene regulation of stress responses and diverse metabolic processes in black pepper.
RNA Interference: A Novel Source of Resistance to Combat Plant Parasitic Nematodes
Directory of Open Access Journals (Sweden)
Sagar Banerjee
2017-05-01
Full Text Available Plant parasitic nematodes cause severe damage and yield loss in major crops all over the world. Available control strategies include use of insecticides/nematicides but these have proved detrimental to the environment, while other strategies like crop rotation and resistant cultivars have serious limitations. This scenario provides an opportunity for the utilization of technological advances like RNA interference (RNAi to engineer resistance against these devastating parasites. First demonstrated in the model free living nematode, Caenorhabtidis elegans; the phenomenon of RNAi has been successfully used to suppress essential genes of plant parasitic nematodes involved in parasitism, nematode development and mRNA metabolism. Synthetic neurotransmitants mixed with dsRNA solutions are used for in vitro RNAi in plant parasitic nematodes with significant success. However, host delivered in planta RNAi has proved to be a pioneering phenomenon to deliver dsRNAs to feeding nematodes and silence the target genes to achieve resistance. Highly enriched genomic databases are exploited to limit off target effects and ensure sequence specific silencing. Technological advances like gene stacking and use of nematode inducible and tissue specific promoters can further enhance the utility of RNAi based transgenics against plant parasitic nematodes.
Pompey, Justine M; Foda, Bardees; Singh, Upinder
2015-01-01
Dicer enzymes process double-stranded RNA (dsRNA) into small RNAs that target gene silencing through the RNA interference (RNAi) pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway.
Directory of Open Access Journals (Sweden)
Justine M Pompey
Full Text Available Dicer enzymes process double-stranded RNA (dsRNA into small RNAs that target gene silencing through the RNA interference (RNAi pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway.
DEFF Research Database (Denmark)
Radzisheuskaya, Aliaksandra; Shlyueva, Daria; Müller, Iris
2016-01-01
CRISPR interference (CRISPRi) represents a newly developed tool for targeted gene repression. It has great application potential for studying gene function and mapping gene regulatory elements. However, the optimal parameters for efficient single guide RNA (sgRNA) design for CRISPRi are not fully...
An essential role of Nrf2 in American ginseng-mediated anti-oxidative actions in cardiomyocytes.
Li, Jinqing; Ichikawa, Tomonaga; Jin, Yu; Hofseth, Lorne J; Nagarkatti, Prakash; Nagarkatti, Mitzi; Windust, Anthony; Cui, Taixing
2010-07-20
Ginseng has been used as a folk medicine for thousands of years in Asia, and has become a popular herbal medicine world-wide. Recent studies have revealed that ginseng, including American ginseng, exerts antioxidant effects in the cardiovascular system; however, the underlying mechanisms are not fully understood. Thus, we investigated role of Nrf2, a master transcription factor of endogenous anti-oxidative defense systems, in the regulation of American ginseng-mediated anti-oxidative actions in cardiomyocytes. A standardized crude extract of American ginseng was supplied by the National Research Council of Canada, Institute for National Measurement Standards. H9C2 cells, a rat cardiomyocyte cell line, were exposed to angiotensin II (Ang II) or tumor necrosis factor alpha (TNFalpha) to induce oxidative stress that was examined by measuring formation of reactive oxygen and nitrogen species. Oxidative stress-induced cell death was induced by exogenous addition of hydrogen peroxide (H(2)O(2)). Proteins were measured by Western blot and mRNA expression was determined by quantitative real time PCR. Nrf2-driven transcriptional activity was assessed by antioxidant response element (ARE)-luciferase reporter assay. Direct Nrf2 binding to its target gene promoters was determined by chromatin immunoprecipitation assay. Adenoviral over-expression of Nrf2 shRNA was utilized to knock down Nrf2 in H9C2 cells. Immunochemical staining was applied for Nrf2 expression in the heart. American ginseng induced dramatic increases in Nrf2 protein expression, Nrf2 nuclear translocation, Nrf2 transcriptional activity, direct Nrf2 binding to its target gene promoters, and expression of a group of anti-oxidative genes driven by Nrf2 in H9C2 cells. In addition, American ginseng inhibited Ang II- or TNFalpha-induced free radical formation and H(2)O(2)-induced cell death in H9C2 cells over-expressed with control shRNA but not in the cells over-expressed with Nrf2 shRNA. Finally, oral
Directory of Open Access Journals (Sweden)
Manev Hari
2003-08-01
Full Text Available Abstract Background RNA interference (RNAi is a process triggered by a double-stranded RNA that leads to targeted down-regulation/silencing of gene expression and can be used for functional genomics; i.e. loss-of-function studies. Here we report on the use of RNAi in the identification of a developmentally important novel Drosophila (fruit fly gene (corresponding to a putative gene CG5652/GM06434, that we named beltless based on an embryonic loss-of-function phenotype. Results Beltless mRNA is expressed in all developmental stages except in 0–6 h embryos. In situ RT-PCR localized beltless mRNA in the ventral cord and brain of late stage embryos and in the nervous system, ovaries, and the accessory glands of adult flies. RNAi was induced by injection of short (22 bp beltless double-stranded RNAs into embryos or into adult flies. Embryonic RNAi altered cuticular phenotypes ranging from partially-formed to missing denticle belts (thus beltless of the abdominal segments A2–A4. Embryonic beltless RNAi was lethal. Adult RNAi resulted in the shrinkage of the ovaries by half and reduced the number of eggs laid. We also examined Df(1RK4 flies in which deletion removes 16 genes, including beltless. In some embryos, we observed cuticular abnormalities similar to our findings with beltless RNAi. After differentiating Df(1RK4 embryos into those with visible denticle belts and those missing denticle belts, we assayed the presence of beltless mRNA; no beltless mRNA was detectable in embryos with missing denticle belts. Conclusions We have identified a developmentally important novel Drosophila gene, beltless, which has been characterized in loss-of-function studies using RNA interference. The putative beltless protein shares homologies with the C. elegans nose resistant to fluoxetine (NRF NRF-6 gene, as well as with several uncharacterized C. elegans and Drosophila melanogaster genes, some with prominent acyltransferase domains. Future studies should
Son, Heehwa G; Seo, Mihwa; Ham, Seokjin; Hwang, Wooseon; Lee, Dongyeop; An, Seon Woo A; Artan, Murat; Seo, Keunhee; Kaletsky, Rachel; Arey, Rachel N; Ryu, Youngjae; Ha, Chang Man; Kim, Yoon Ki; Murphy, Coleen T; Roh, Tae-Young; Nam, Hong Gil; Lee, Seung-Jae V
2017-03-09
Long-lived organisms often feature more stringent protein and DNA quality control. However, whether RNA quality control mechanisms, such as nonsense-mediated mRNA decay (NMD), which degrades both abnormal as well as some normal transcripts, have a role in organismal aging remains unexplored. Here we show that NMD mediates longevity in C. elegans strains with mutations in daf-2/insulin/insulin-like growth factor 1 receptor. We find that daf-2 mutants display enhanced NMD activity and reduced levels of potentially aberrant transcripts. NMD components, including smg-2/UPF1, are required to achieve the longevity of several long-lived mutants, including daf-2 mutant worms. NMD in the nervous system of the animals is particularly important for RNA quality control to promote longevity. Furthermore, we find that downregulation of yars-2/tyrosyl-tRNA synthetase, an NMD target transcript, by daf-2 mutations contributes to longevity. We propose that NMD-mediated RNA surveillance is a crucial quality control process that contributes to longevity conferred by daf-2 mutations.
Multi-resistance strategy for viral diseases and short hairpin RNA verification method in pigs
Directory of Open Access Journals (Sweden)
Jong-nam Oh
2018-04-01
Full Text Available Objective Foot and mouth disease (FMD and porcine reproductive and respiratory syndrome (PRRS are major diseases that interrupt porcine production. Because they are viral diseases, vaccinations are of only limited effectiveness in preventing outbreaks. To establish an alternative multi-resistant strategy against FMD virus (FMDV and PRRS virus (PRRSV, the present study introduced two genetic modification techniques to porcine cells. Methods First, cluster of differentiation 163 (CD163, the PRRSV viral receptor, was edited with the clustered regularly interspaced short palindromic repeats-CRISPR-associated protein 9 technique. The CD163 gene sequences of edited cells and control cells differed. Second, short hairpin RNA (shRNAs were integrated into the cells. The shRNAs, targeting the 3D gene of FMDV and the open reading frame 7 (ORF7 gene of PRRSV, were transferred into fibroblasts. We also developed an in vitro shRNA verification method with a target gene expression vector. Results shRNA activity was confirmed in vitro with vectors that expressed the 3D and ORF7 genes in the cells. Cells containing shRNAs showed lower transcript levels than cells with only the expression vectors. The shRNAs were integrated into CD163-edited cells to combine the two techniques, and the viral genes were suppressed in these cells. Conclusion We established a multi-resistant strategy against viral diseases and an in vitro shRNA verification method.
Directory of Open Access Journals (Sweden)
Gene-Errol E Ringpis
Full Text Available Down-regulation of the HIV-1 coreceptor CCR5 holds significant potential for long-term protection against HIV-1 in patients. Using the humanized bone marrow/liver/thymus (hu-BLT mouse model which allows investigation of human hematopoietic stem/progenitor cell (HSPC transplant and immune system reconstitution as well as HIV-1 infection, we previously demonstrated stable inhibition of CCR5 expression in systemic lymphoid tissues via transplantation of HSPCs genetically modified by lentiviral vector transduction to express short hairpin RNA (shRNA. However, CCR5 down-regulation will not be effective against existing CXCR4-tropic HIV-1 and emergence of resistant viral strains. As such, combination approaches targeting additional steps in the virus lifecycle are required. We screened a panel of previously published shRNAs targeting highly conserved regions and identified a potent shRNA targeting the R-region of the HIV-1 long terminal repeat (LTR. Here, we report that human CD4(+ T-cells derived from transplanted HSPC engineered to co-express shRNAs targeting CCR5 and HIV-1 LTR are resistant to CCR5- and CXCR4- tropic HIV-1-mediated depletion in vivo. Transduction with the combination vector suppressed CXCR4- and CCR5- tropic viral replication in cell lines and peripheral blood mononuclear cells in vitro. No obvious cytotoxicity or interferon response was observed. Transplantation of combination vector-transduced HSPC into hu-BLT mice resulted in efficient engraftment and subsequent stable gene marking and CCR5 down-regulation in human CD4(+ T-cells within peripheral blood and systemic lymphoid tissues, including gut-associated lymphoid tissue, a major site of robust viral replication, for over twelve weeks. CXCR4- and CCR5- tropic HIV-1 infection was effectively inhibited in hu-BLT mouse spleen-derived human CD4(+ T-cells ex vivo. Furthermore, levels of gene-marked CD4(+ T-cells in peripheral blood increased despite systemic infection with either
International Nuclear Information System (INIS)
Carbonell, Alberto; Martinez de Alba, Angel-Emilio; Flores, Ricardo; Gago, Selma
2008-01-01
Infection by viroids, non-protein-coding circular RNAs, occurs with the accumulation of 21-24 nt viroid-derived small RNAs (vd-sRNAs) with characteristic properties of small interfering RNAs (siRNAs) associated to RNA silencing. The vd-sRNAs most likely derive from dicer-like (DCL) enzymes acting on viroid-specific dsRNA, the key elicitor of RNA silencing, or on the highly structured genomic RNA. Previously, viral dsRNAs delivered mechanically or agroinoculated have been shown to interfere with virus infection in a sequence-specific manner. Here, we report similar results with members of the two families of nuclear- and chloroplast-replicating viroids. Moreover, homologous vd-sRNAs co-delivered mechanically also interfered with one of the viroids examined. The interference was sequence-specific, temperature-dependent and, in some cases, also dependent on the dose of the co-inoculated dsRNA or vd-sRNAs. The sequence-specific nature of these effects suggests the involvement of the RNA induced silencing complex (RISC), which provides sequence specificity to RNA silencing machinery. Therefore, viroid titer in natural infections might be regulated by the concerted action of DCL and RISC. Viroids could have evolved their secondary structure as a compromise between resistance to DCL and RISC, which act preferentially against RNAs with compact and relaxed secondary structures, respectively. In addition, compartmentation, association with proteins or active replication might also help viroids to elude their host RNA silencing machinery
Takata, Nozomu; Sakakura, Eriko; Sakuma, Tetsushi; Yamamoto, Takashi
2017-01-01
Approaches to investigate gene functions in experimental biology are becoming more diverse and reliable. Furthermore, several kinds of tissues and organs that possess their original identities can be generated in petri dishes from stem cells including embryonic, adult and induced pluripotent stem cells. Researchers now have several choices of experimental methods and their combinations to analyze gene functions in various biological systems. Here, as an example we describe one of the better protocols, which combines three-dimensional embryonic stem cell culture with small regulatory RNA-mediated technologies, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9), and inducible RNA interference (RNAi). This protocol allows investigation of genes of interest to better understand gene functions in target tissues (or organs) during in vitro development.
Nuclear Factor 90, a cellular dsRNA binding protein inhibits the HIV Rev-export function
Directory of Open Access Journals (Sweden)
St-Laurent Georges
2006-11-01
Full Text Available Abstract Background The HIV Rev protein is known to facilitate export of incompletely spliced and unspliced viral transcripts to the cytoplasm, a necessary step in virus life cycle. The Rev-mediated nucleo-cytoplasmic transport of nascent viral transcripts, dependents on interaction of Rev with the RRE RNA structural element present in the target RNAs. The C-terminal variant of dsRNA-binding nuclear protein 90 (NF90ctv has been shown to markedly attenuate viral replication in stably transduced HIV-1 target cell line. Here we examined a mechanism of interference of viral life cycle involving Rev-NF90ctv interaction. Results Since Rev:RRE complex formations depend on protein:RNA and protein:protein interactions, we investigated whether the expression of NF90ctv might interfere with Rev-mediated export of RRE-containing transcripts. When HeLa cells expressed both NF90ctv and Rev protein, we observed that NF90ctv inhibited the Rev-mediated RNA transport. In particular, three regions of NF90ctv protein are involved in blocking Rev function. Moreover, interaction of NF90ctv with the RRE RNA resulted in the expression of a reporter protein coding sequences linked to the RRE structure. Moreover, Rev influenced the subcellular localization of NF90ctv, and this process is leptomycin B sensitive. Conclusion The dsRNA binding protein, NF90ctv competes with HIV Rev function at two levels, by competitive protein:protein interaction involving Rev binding to specific domains of NF90ctv, as well as by its binding to the RRE-RNA structure. Our results are consistent with a model of Rev-mediated HIV-1 RNA export that envisions Rev-multimerization, a process interrupted by NF90ctv.
Directory of Open Access Journals (Sweden)
Graziella Cimino-Reale
2017-07-01
Full Text Available Abstract Background Understanding the molecular/cellular underpinnings of diffuse malignant peritoneal mesothelioma (DMPM, a fatal malignancy with limited therapeutic options, is of utmost importance for the fruitful management of the disease. In this context, we previously found that telomerase activity (TA, which accounts for the limitless proliferative potential of cancer cells, is prognostic for disease relapse and cancer-related death in DMPM patients. Consequently, the identification of factors involved in telomerase activation/regulation may pave the way towards the development of novel therapeutic interventions for the disease. Here, the capability of miR-380-5p, a microRNA negligibly expressed in telomerase-positive DMPM clinical specimens, to interfere with telomerase-mediated telomere maintenance and, hence, with cancer cell growth was assessed on preclinical models of DMPM. Methods DMPM cells were transfected with a miR-380-5p synthetic precursor, and the effects of miRNA replacement were evaluated in terms of growing capability, induction of apoptosis and interference with TA. Reiterated weekly transfections were also performed in order to analyse the phenotype arising upon prolonged miR-380-5p reconstitution in DMPM cells. Results The ectopic expression of miR-380-5p elicited a remarkable inhibition of TA and resulted in DMPM cell growth impairment and apoptosis induction. In particular, we demonstrated for the first time that these effects were the result of a molecular circuitry converging on telomerase associated protein 1 (TEP1, where the miRNA was able to target the gene both directly in unconventional targeting modality and indirectly via p53 accumulation consequent to miRNA-mediated downregulation of testis-specific protein, Y-encoded-like 5 gene. Moreover, miR-380-5p did not cause telomere attrition and cell growth arrest in long-term DMPM transfectants, which in turn showed slightly elongated telomeres and molecular
Lysosomal membrane protein SIDT2 mediates the direct uptake of DNA by lysosomes.
Aizawa, Shu; Contu, Viorica Raluca; Fujiwara, Yuuki; Hase, Katsunori; Kikuchi, Hisae; Kabuta, Chihana; Wada, Keiji; Kabuta, Tomohiro
2017-01-02
Lysosomes degrade macromolecules such as proteins and nucleic acids. We previously identified 2 novel types of autophagy, RNautophagy and DNautophagy, where lysosomes directly take up RNA and DNA, in an ATP-dependent manner, for degradation. We have also reported that SIDT2 (SID1 transmembrane family, member 2), an ortholog of the Caenorhabditis elegans putative RNA transporter SID-1 (systemic RNA interference defective-1), mediates RNA translocation during RNautophagy. In this addendum, we report that SIDT2 also mediates DNA translocation in the process of DNautophagy. These findings help elucidate the mechanisms underlying the direct uptake of nucleic acids by lysosomes and the physiological functions of DNautophagy.
RNA Interference Technology to Control Pest Sea Lampreys - A Proof-of-Concept
Heath, George; Childs, Darcy; Docker, Margaret F.; McCauley, David W.; Whyard, Steven
2014-01-01
The parasitic sea lamprey (Petromyzon marinus) has caused extensive losses to commercial fish stocks of the upper Great Lakes of North America. Methods of controlling the sea lamprey include trapping, barriers to prevent migration, and use of a chemical lampricide (3-trifluoromethyl-4-nitrophenol) to kill the filter-feeding larvae. Concerns about the non-specificity of these methods have prompted continued development of species-specific methods to control lampreys outside their native range. In this study, we considered the utility of RNA interference to develop a sea lamprey-specific lampricide. Injection of six different short interfering, double-stranded RNAs (siRNAs) into lamprey embryos first confirmed that the siRNAs could reduce the targeted transcript levels by more than 50%. Two size classes of lamprey larvae were then fed the siRNAs complexed with liposomes, and three of the siRNAs (targeting elongation factor 1α, calmodulin, and α-actinin) reduced transcript levels 2.5, 3.6, and 5.0–fold, respectively, within the lamprey midsections. This is not only the first demonstration of RNAi in lampreys, but it is also the first example of delivery of siRNAs to a non-mammalian vertebrate through feeding formulations. One of the siRNA treatments also caused increased mortality of the larvae following a single feeding of siRNAs, which suggests that prolonged or multiple feedings of siRNAs could be used to kill filter-feeding larvae within streams, following development of a slow-release formulation. The genes targeted in this study are highly conserved across many species, and only serve as a proof-of-concept demonstration that siRNAs can be used in lampreys. Given that RNA interference is a sequence-specific phenomenon, it should be possible to design siRNAs that selectively target gene sequences that are unique to sea lampreys, and thus develop a technology to control these pests without adversely affecting non-target species. PMID:24505485
RNA interference technology to control pest sea lampreys--a proof-of-concept.
Directory of Open Access Journals (Sweden)
George Heath
Full Text Available The parasitic sea lamprey (Petromyzon marinus has caused extensive losses to commercial fish stocks of the upper Great Lakes of North America. Methods of controlling the sea lamprey include trapping, barriers to prevent migration, and use of a chemical lampricide (3-trifluoromethyl-4-nitrophenol to kill the filter-feeding larvae. Concerns about the non-specificity of these methods have prompted continued development of species-specific methods to control lampreys outside their native range. In this study, we considered the utility of RNA interference to develop a sea lamprey-specific lampricide. Injection of six different short interfering, double-stranded RNAs (siRNAs into lamprey embryos first confirmed that the siRNAs could reduce the targeted transcript levels by more than 50%. Two size classes of lamprey larvae were then fed the siRNAs complexed with liposomes, and three of the siRNAs (targeting elongation factor 1α, calmodulin, and α-actinin reduced transcript levels 2.5, 3.6, and 5.0-fold, respectively, within the lamprey midsections. This is not only the first demonstration of RNAi in lampreys, but it is also the first example of delivery of siRNAs to a non-mammalian vertebrate through feeding formulations. One of the siRNA treatments also caused increased mortality of the larvae following a single feeding of siRNAs, which suggests that prolonged or multiple feedings of siRNAs could be used to kill filter-feeding larvae within streams, following development of a slow-release formulation. The genes targeted in this study are highly conserved across many species, and only serve as a proof-of-concept demonstration that siRNAs can be used in lampreys. Given that RNA interference is a sequence-specific phenomenon, it should be possible to design siRNAs that selectively target gene sequences that are unique to sea lampreys, and thus develop a technology to control these pests without adversely affecting non-target species.
RNA interference technology to control pest sea lampreys--a proof-of-concept.
Heath, George; Childs, Darcy; Docker, Margaret F; McCauley, David W; Whyard, Steven
2014-01-01
The parasitic sea lamprey (Petromyzon marinus) has caused extensive losses to commercial fish stocks of the upper Great Lakes of North America. Methods of controlling the sea lamprey include trapping, barriers to prevent migration, and use of a chemical lampricide (3-trifluoromethyl-4-nitrophenol) to kill the filter-feeding larvae. Concerns about the non-specificity of these methods have prompted continued development of species-specific methods to control lampreys outside their native range. In this study, we considered the utility of RNA interference to develop a sea lamprey-specific lampricide. Injection of six different short interfering, double-stranded RNAs (siRNAs) into lamprey embryos first confirmed that the siRNAs could reduce the targeted transcript levels by more than 50%. Two size classes of lamprey larvae were then fed the siRNAs complexed with liposomes, and three of the siRNAs (targeting elongation factor 1α, calmodulin, and α-actinin) reduced transcript levels 2.5, 3.6, and 5.0-fold, respectively, within the lamprey midsections. This is not only the first demonstration of RNAi in lampreys, but it is also the first example of delivery of siRNAs to a non-mammalian vertebrate through feeding formulations. One of the siRNA treatments also caused increased mortality of the larvae following a single feeding of siRNAs, which suggests that prolonged or multiple feedings of siRNAs could be used to kill filter-feeding larvae within streams, following development of a slow-release formulation. The genes targeted in this study are highly conserved across many species, and only serve as a proof-of-concept demonstration that siRNAs can be used in lampreys. Given that RNA interference is a sequence-specific phenomenon, it should be possible to design siRNAs that selectively target gene sequences that are unique to sea lampreys, and thus develop a technology to control these pests without adversely affecting non-target species.
MicroRNA-mediated down-regulation of NKG2D ligands contributes to glioma immune escape.
Codo, Paula; Weller, Michael; Meister, Gunter; Szabo, Emese; Steinle, Alexander; Wolter, Marietta; Reifenberger, Guido; Roth, Patrick
2014-09-15
Malignant gliomas are intrinsic brain tumors with a dismal prognosis. They are well-adapted to hypoxic conditions and poorly immunogenic. NKG2D is one of the major activating receptors of natural killer (NK) cells and binds to several ligands (NKG2DL). Here we evaluated the impact of miRNA on the expression of NKG2DL in glioma cells including stem-like glioma cells. Three of the candidate miRNA predicted to target NKG2DL were expressed in various glioma cell lines as well as in glioblastomas in vivo: miR-20a, miR-93 and miR-106b. LNA inhibitor-mediated miRNA silencing up-regulated cell surface NKG2DL expression, which translated into increased susceptibility to NK cell-mediated lysis. This effect was reversed by neutralizing NKG2D antibodies, confirming that enhanced lysis upon miRNA silencing was mediated through the NKG2D system. Hypoxia, a hallmark of glioblastomas in vivo, down-regulated the expression of NKG2DL on glioma cells, associated with reduced susceptibility to NK cell-mediated lysis. This process, however, was not mediated through any of the examined miRNA. Accordingly, both hypoxia and the expression of miRNA targeting NKG2DL may contribute to the immune evasion of glioma cells at the level of the NKG2D recognition pathway. Targeting miRNA may therefore represent a novel approach to increase the immunogenicity of glioblastoma.
A comprehensive platform for highly multiplexed mammalian functional genetic screens
Directory of Open Access Journals (Sweden)
Cheung-Ong Kahlin
2011-05-01
Full Text Available Abstract Background Genome-wide screening in human and mouse cells using RNA interference and open reading frame over-expression libraries is rapidly becoming a viable experimental approach for many research labs. There are a variety of gene expression modulation libraries commercially available, however, detailed and validated protocols as well as the reagents necessary for deconvolving genome-scale gene screens using these libraries are lacking. As a solution, we designed a comprehensive platform for highly multiplexed functional genetic screens in human, mouse and yeast cells using popular, commercially available gene modulation libraries. The Gene Modulation Array Platform (GMAP is a single microarray-based detection solution for deconvolution of loss and gain-of-function pooled screens. Results Experiments with specially constructed lentiviral-based plasmid pools containing ~78,000 shRNAs demonstrated that the GMAP is capable of deconvolving genome-wide shRNA "dropout" screens. Further experiments with a larger, ~90,000 shRNA pool demonstrate that equivalent results are obtained from plasmid pools and from genomic DNA derived from lentivirus infected cells. Parallel testing of large shRNA pools using GMAP and next-generation sequencing methods revealed that the two methods provide valid and complementary approaches to deconvolution of genome-wide shRNA screens. Additional experiments demonstrated that GMAP is equivalent to similar microarray-based products when used for deconvolution of open reading frame over-expression screens. Conclusion Herein, we demonstrate four major applications for the GMAP resource, including deconvolution of pooled RNAi screens in cells with at least 90,000 distinct shRNAs. We also provide detailed methodologies for pooled shRNA screen readout using GMAP and compare next-generation sequencing to GMAP (i.e. microarray based deconvolution methods.
Directory of Open Access Journals (Sweden)
Kynan T Lawlor
Full Text Available Expanded DNA repeat sequences are known to cause over 20 diseases, including Huntington's disease, several types of spinocerebellar ataxia and myotonic dystrophy type 1 and 2. A shared genetic basis, and overlapping clinical features for some of these diseases, indicate that common pathways may contribute to pathology. Multiple mechanisms, mediated by both expanded homopolymeric proteins and expanded repeat RNA, have been identified by the use of model systems, that may account for shared pathology. The use of such animal models enables identification of distinct pathways and their 'molecular hallmarks' that can be used to determine the contribution of each pathway in human pathology. Here we characterise a tergite disruption phenotype in adult flies, caused by ubiquitous expression of either untranslated CUG or CAG expanded repeat RNA. Using the tergite phenotype as a quantitative trait we define a new genetic system in which to examine 'hairpin' repeat RNA-mediated cellular perturbation. Further experiments use this system to examine whether pathways involving Muscleblind sequestration or Dicer processing, which have been shown to mediate repeat RNA-mediated pathology in other model systems, contribute to cellular perturbation in this model.
Sun, Tao; Sutton, Jonathan T.; Power, Chanikarn; Zhang, Yongzhi; Miller, Eric L.; McDannold, Nathan J.
2017-10-01
Sub-megahertz transmission is not usually adopted in pre-clinical small animal experiments for focused ultrasound (FUS) brain therapy due to the large focal size. However, low frequency FUS is vital for preclinical evaluations due to the frequency-dependence of cavitation behavior. To maximize clinical relevance, a dual-aperture FUS system was designed for low-frequency (274.3 kHz) cavitation-mediated FUS therapy. Combining two spherically curved transducers provides significantly improved focusing in the axial direction while yielding an interference pattern with strong side lobes, leading to inhomogeneously distributed cavitation activities. By operating the two transducers at slightly offset frequencies to modulate this interference pattern over the period of sonication, the acoustic energy was redistributed and resulted in a spatially homogenous treatment profile. Simulation and pressure field measurements in water were performed to assess the beam profiles. In addition, the system performance was demonstrated in vivo in rats via drug delivery through microbubble-mediated blood-brain barrier disruption. This design resulted in a homogenous treatment profile that was fully contained within the rat brain at a clinically relevant acoustic frequency.
Baranasic, Damir; Oppermann, Timo; Cheaib, Miriam; Cullum, John; Schmidt, Helmut
2014-01-01
ABSTRACT Antigenic or phenotypic variation is a widespread phenomenon of expression of variable surface protein coats on eukaryotic microbes. To clarify the mechanism behind mutually exclusive gene expression, we characterized the genetic properties of the surface antigen multigene family in the ciliate Paramecium tetraurelia and the epigenetic factors controlling expression and silencing. Genome analysis indicated that the multigene family consists of intrachromosomal and subtelomeric genes; both classes apparently derive from different gene duplication events: whole-genome and intrachromosomal duplication. Expression analysis provides evidence for telomere position effects, because only subtelomeric genes follow mutually exclusive transcription. Microarray analysis of cultures deficient in Rdr3, an RNA-dependent RNA polymerase, in comparison to serotype-pure wild-type cultures, shows cotranscription of a subset of subtelomeric genes, indicating that the telomere position effect is due to a selective occurrence of Rdr3-mediated silencing in subtelomeric regions. We present a model of surface antigen evolution by intrachromosomal gene duplication involving the maintenance of positive selection of structurally relevant regions. Further analysis of chromosome heterogeneity shows that alternative telomere addition regions clearly affect transcription of closely related genes. Consequently, chromosome fragmentation appears to be of crucial importance for surface antigen expression and evolution. Our data suggest that RNAi-mediated control of this genetic network by trans-acting RNAs allows rapid epigenetic adaptation by phenotypic variation in combination with long-term genetic adaptation by Darwinian evolution of antigen genes. PMID:25389173
Novel guanidinylated bioresponsive poly(amidoamines designed for short hairpin RNA delivery
Directory of Open Access Journals (Sweden)
Yu J
2016-12-01
Full Text Available Jiankun Yu,1 Jinmin Zhang,1 Haonan Xing,1 Yanping Sun,1 Zhen Yang,1 Tianzhi Yang,2 Cuifang Cai,1 Xiaoyun Zhao,3 Li Yang,1 Pingtian Ding1 1School of Pharmacy, Shenyang Pharmaceutical University, Shenyang, China; 2Department of Basic Pharmaceutical Sciences, School of Pharmacy, Husson University, Bangor, ME, USA; 3Department of Microbiology and Cell Biology, School of Life Science and Biopharmaceutics, Shenyang Pharmaceutical University, Shenyang, China Abstract: Two different disulfide (SS-containing poly(amidoamine (PAA polymers were constructed using guanidino (Gua-containing monomers (ie, arginine [Arg] and agmatine [Agm] and N,N'-cystamine bisacrylamide (CBA by Michael-addition polymerization. In order to characterize these two Gua-SS-PAA polymers and investigate their potentials as short hairpin RNA (shRNA-delivery carriers, pSilencer 4.1-CMV FANCF shRNA was chosen as a model plasmid DNA to form complexes with these two polymers. The Gua-SS-PAAs and plasmid DNA complexes were determined with particle sizes less than 90 nm and positive ζ-potentials under 20 mV at nucleic acid:polymer weight ratios lower than 1:24. Bioresponsive release of plasmid DNA was observed from both newly constructed complexes. Significantly lower cytotoxicity was observed for both polymer complexes compared with polyethylenimine and Lipofectamine 2000, two widely used transfection reagents as reference carriers. Arg-CBA showed higher transfection efficiency and gene-silencing efficiency in MCF7 cells than Agm-CBA and the reference carriers. In addition, the cellular uptake of Arg-CBA in MCF7 cells was found to be higher and faster than Agm-CBA and the reference carriers. Similarly, plasmid DNA transport into the nucleus mediated by Arg-CBA was more than that by Agm-CBA and the reference carriers. The study suggested that guanidine and carboxyl introduced into Gua-SS-PAAs polymers resulted in a better nuclear localization effect, which played a key role in the
Raimondeau, Etienne; Bufton, Joshua C; Schaffitzel, Christiane
2018-06-19
Faulty mRNAs with a premature stop codon (PTC) are recognized and degraded by nonsense-mediated mRNA decay (NMD). Recognition of a nonsense mRNA depends on translation and on the presence of NMD-enhancing or the absence of NMD-inhibiting factors in the 3'-untranslated region. Our review summarizes our current understanding of the molecular function of the conserved NMD factors UPF3B and UPF1, and of the anti-NMD factor Poly(A)-binding protein, and their interactions with ribosomes translating PTC-containing mRNAs. Our recent discovery that UPF3B interferes with human translation termination and enhances ribosome dissociation in vitro , whereas UPF1 is inactive in these assays, suggests a re-interpretation of previous experiments and modification of prevalent NMD models. Moreover, we discuss recent work suggesting new functions of the key NMD factor UPF1 in ribosome recycling, inhibition of translation re-initiation and nascent chain ubiquitylation. These new findings suggest that the interplay of UPF proteins with the translation machinery is more intricate than previously appreciated, and that this interplay quality-controls the efficiency of termination, ribosome recycling and translation re-initiation. © 2018 The Author(s).
Alakonya, Amos; Kumar, Ravi; Koenig, Daniel; Kimura, Seisuke; Townsley, Brad; Runo, Steven; Garces, Helena M.; Kang, Julie; Yanez, Andrea; David-Schwartz, Rakefet; Machuka, Jesse; Sinha, Neelima
2012-01-01
Infection of crop species by parasitic plants is a major agricultural hindrance resulting in substantial crop losses worldwide. Parasitic plants establish vascular connections with the host plant via structures termed haustoria, which allow acquisition of water and nutrients, often to the detriment of the infected host. Despite the agricultural impact of parasitic plants, the molecular and developmental processes by which host/parasitic interactions are established are not well understood. Here, we examine the development and subsequent establishment of haustorial connections by the parasite dodder (Cuscuta pentagona) on tobacco (Nicotiana tabacum) plants. Formation of haustoria in dodder is accompanied by upregulation of dodder KNOTTED-like homeobox transcription factors, including SHOOT MERISTEMLESS-like (STM). We demonstrate interspecific silencing of a STM gene in dodder driven by a vascular-specific promoter in transgenic host plants and find that this silencing disrupts dodder growth. The reduced efficacy of dodder infection on STM RNA interference transgenics results from defects in haustorial connection, development, and establishment. Identification of transgene-specific small RNAs in the parasite, coupled with reduced parasite fecundity and increased growth of the infected host, demonstrates the efficacy of interspecific small RNA–mediated silencing of parasite genes. This technology has the potential to be an effective method of biological control of plant parasite infection. PMID:22822208
van Haaften, Gijs; Vastenhouw, Nadine L; Nollen, Ellen A A; Plasterk, Ronald H A; Tijsterman, Marcel
2004-01-01
Here, we describe a systematic search for synthetic gene interactions in a multicellular organism, the nematode Caenorhabditis elegans. We established a high-throughput method to determine synthetic gene interactions by genome-wide RNA interference and identified genes that are required to protect
Adkar-Purushothama, Charith Raj; Bru, Pierrick; Perreault, Jean-Pierre
2017-12-01
5' RNA ligase-mediated rapid amplification of cDNA ends (5' RLM-RACE) is a widely-accepted method for the validation of direct cleavage of a target gene by a microRNA (miRNA) and viroid-derived small RNA (vd-sRNA). However, this method cannot be used if cleavage takes place in the 3' extremity of the target RNA, as this gives insufficient sequence length to design nested PCR primers for 5' RLM RACE. To overcome this hurdle, we have developed 3' RNA ligase-mediated rapid amplification of cDNA ends (3' RLM RACE). In this method, an oligonucleotide adapter having 5' adenylated and 3' blocked is ligated to the 3' end of the cleaved RNA followed by PCR amplification using gene specific primers. In other words, in 3' RLM RACE, 3' end is mapped using 5' fragment instead of small 3' fragment. The method developed here was verified by examining the bioinformatics predicted and parallel analysis of RNA ends (PARE) proved cleavage sites of chloride channel protein CLC-b-like mRNA in Potato spindle tuber viroid infected tomato plants. The 3' RLM RACE developed in this study has the potential to validate the miRNA and vd-sRNA mediated cleavage of mRNAs at its 3' untranslated region (3' UTR). Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Natália Regine de França
2010-12-01
Full Text Available A interferência por RNA (RNAi é um mecanismo de silenciamento gênico pós-transcricional conservado durante a evolução. Esse mecanismo, recentemente descrito, é mediado por pequenos RNAs de fita dupla (dsRNAs capazes de reconhecer especificamente uma sequência de mRNA-alvo e mediar sua clivagem ou repressão traducional. O emprego da RNAi como uma ferramenta de terapia gênica tem sido muito estudado, especialmente em infecções virais, câncer, desordens genéticas herdadas, doenças cardiovasculares e mesmo em doenças reumáticas. Aliados aos dados do genoma humano, os conhecimentos do silenciamento gênico mediado por RNAi podem permitir a determinação funcional de praticamente qualquer gene expresso em uma célula e sua implicação para o funcionamento e homeostase celular. Vários estudos terapêuticos in vitro e in vivo em modelos de doenças autoimunes vêm sendo realizados com resultados encorajadores. As vias de quebra de tolerância e inflamação são alvos potenciais para terapia com RNAi em doenças inflamatórias e autoimunes. Nesta revisão vamos recordar os princípios básicos da RNAi e discutir os aspectos que levaram ao desenvolvimento de propostas terapêuticas baseadas em RNAi, começando pelos estudos in vitro de desenvolvimento de ferramentas e identificação de alvos, chegando até os estudos pré-clínicos de disponibilização da droga in vivo, e testes em células humanas e modelos animais de doenças autoimunes. Por fim, vamos revisar os últimos avanços da experiência clínica da terapia com RNAiRNA interference (RNAi is a post-transcriptional gene silencing mechanism preserved during evolution. This mechanism, recently described, is mediated by small double-stranded RNAs (dsRNAs that can specifically recognize a target mRNA sequence and mediate its cleavage or translational repression. The use of RNAi as a tool for gene therapy has been extensively studied, especially in viral infections, cancer
Emerging strategies for RNA interference (RNAi) applications in insects.
Nandety, Raja Sekhar; Kuo, Yen-Wen; Nouri, Shahideh; Falk, Bryce W
2015-01-01
RNA interference (RNAi) in insects is a gene regulatory process that also plays a vital role in the maintenance and in the regulation of host defenses against invading viruses. Small RNAs determine the specificity of the RNAi through precise recognition of their targets. These small RNAs in insects comprise small interfering RNAs (siRNAs), micro RNAs (miRNAs) and Piwi interacting RNAs (piRNAs) of various lengths. In this review, we have explored different forms of the RNAi inducers that are presently in use, and their applications for an effective and efficient fundamental and practical RNAi research with insects. Further, we reviewed trends in next generation sequencing (NGS) technologies and their importance for insect RNAi, including the identification of novel insect targets as well as insect viruses. Here we also describe a rapidly emerging trend of using plant viruses to deliver the RNAi inducer molecules into insects for an efficient RNAi response.
Aedes aegypti uses RNA interference in defense against Sindbis virus infection.
Campbell, Corey L; Keene, Kimberly M; Brackney, Douglas E; Olson, Ken E; Blair, Carol D; Wilusz, Jeffrey; Foy, Brian D
2008-03-17
RNA interference (RNAi) is an important anti-viral defense mechanism. The Aedes aegypti genome encodes RNAi component orthologs, however, most populations of this mosquito are readily infected by, and subsequently transmit flaviviruses and alphaviruses. The goal of this study was to use Ae. aegypti as a model system to determine how the mosquito's anti-viral RNAi pathway interacts with recombinant Sindbis virus (SINV; family Togaviridae, genus Alphavirus). SINV (TR339-eGFP) (+) strand RNA, infectious virus titers and infection rates transiently increased in mosquitoes following dsRNA injection to cognate Ago2, Dcr2, or TSN mRNAs. Detection of SINV RNA-derived small RNAs at 2 and 7 days post-infection in non-silenced mosquitoes provided important confirmation of RNAi pathway activity. Two different recombinant SINV viruses (MRE16-eGFP and TR339-eGFP) with significant differences in infection kinetics were used to delineate vector/virus interactions in the midgut. We show virus-dependent effects on RNAi component transcript and protein levels during infection. Monitoring midgut Ago2, Dcr2, and TSN transcript levels during infection revealed that only TSN transcripts were significantly increased in midguts over blood-fed controls. Ago2 protein levels were depleted immediately following a non-infectious bloodmeal and varied during SINV infection in a virus-dependent manner. We show that silencing RNAi components in Ae. aegypti results in transient increases in SINV replication. Furthermore, Ae. aegypti RNAi is active during SINV infection as indicated by production of virus-specific siRNAs. Lastly, the RNAi response varies in a virus-dependent manner. These data define important features of RNAi anti-viral defense in Ae. aegypti.
Neurogenesis-mediated forgetting minimizes proactive interference.
Epp, Jonathan R; Silva Mera, Rudy; Köhler, Stefan; Josselyn, Sheena A; Frankland, Paul W
2016-02-26
Established memories may interfere with the encoding of new memories, particularly when existing and new memories overlap in content. By manipulating levels of hippocampal neurogenesis, here we show that neurogenesis regulates this form of proactive interference. Increasing hippocampal neurogenesis weakens existing memories and, in doing so, facilitates the encoding of new, conflicting (but not non-conflicting) information in mice. Conversely, decreasing neurogenesis stabilizes existing memories, and impedes the encoding of new, conflicting information. These results suggest that reduced proactive interference is an adaptive benefit of neurogenesis-induced forgetting.
sRNA-Mediated Regulation of P-Fimbriae Phase Variation in Uropathogenic Escherichia coli
DEFF Research Database (Denmark)
Khandige, Surabhi; Kronborg, Tina; Uhlin, Bernt Eric
2015-01-01
Uropathogenic Escherichia coli (UPEC) are capable of occupying physiologically distinct intracellular and extracellular niches within the urinary tract. This feat requires the timely regulation of gene expression and small RNAs (sRNAs) are known to mediate such rapid adjustments in response to ch...... to changing environmental cues. This study aimed to uncover sRNA-mediated gene regulation in the UPEC strain UTI89, during infection of bladder epithelial cells. Hfq is an RNA chaperone known to facilitate and stabilize sRNA and target mRNA interactions with bacterial cells. The co...... to the discovery of a novel virulence-associated trans-acting sRNA-PapR. Deletion of papR was found to enhance adhesion of UTI89 to both bladder and kidney cell lines in a manner independent of type-1 fimbriae. We demonstrate PapR mediated posttranscriptional repression of the P-fimbriae phase regulator gene pap...
Directory of Open Access Journals (Sweden)
Gabriel Rinaldi
2008-07-01
Full Text Available The growing availability of sequence information from diverse parasites through genomic and transcriptomic projects offer new opportunities for the identification of key mediators in the parasite-host interaction. Functional genomics approaches and methods for the manipulation of genes are essential tools for deciphering the roles of genes and to identify new intervention targets in parasites. Exciting advances in functional genomics for parasitic helminths are starting to occur, with transgene expression and RNA interference (RNAi reported in several species of nematodes, but the area is still in its infancy in flatworms, with reports in just three species. While advancing in model organisms, there is a need to rapidly extend these technologies to other parasites responsible for several chronic diseases of humans and cattle. In order to extend these approaches to less well studied parasitic worms, we developed a test method for the presence of a viable RNAi pathway by silencing the exogenous reporter gene, firefly luciferase (fLUC. We established the method in the human blood fluke Schistosoma mansoni and then confirmed its utility in the liver fluke Fasciola hepatica. We transformed newly excysted juveniles of F. hepatica by electroporation with mRNA of fLUC and three hours later were able to detect luciferase enzyme activity, concentrated mainly in the digestive ceca. Subsequently, we tested the presence of an active RNAi pathway in F. hepatica by knocking down the exogenous luciferase activity by introduction into the transformed parasites of double-stranded RNA (dsRNA specific for fLUC. In addition, we tested the RNAi pathway targeting an endogenous F. hepatica gene encoding leucine aminopeptidase (FhLAP, and observed a significant reduction in specific mRNA levels. In summary, these studies demonstrated the utility of RNAi targeting reporter fLUC as a reporter gene assay to establish the presence of an intact RNAi pathway in helminth
miRNA and mRNA Expression Profiles Reveal Insight into Chitosan-Mediated Regulation of Plant Growth.
Zhang, Xiaoqian; Li, Kecheng; Xing, Ronge; Liu, Song; Chen, Xiaolin; Yang, Haoyue; Li, Pengcheng
2018-04-18
Chitosan has been numerously studied as a plant growth regulator and stress tolerance inducer. To investigate the roles of chitosan as bioregulator on plant and unravel its possible metabolic responses mechanisms, we simultaneously investigated mRNAs and microRNAs (miRNAs) expression profiles of wheat seedlings in response to chitosan heptamer. We found 400 chitosan-responsive differentially expressed genes, including 268 up-regulated and 132 down-regulated mRNAs, many of which were related to photosynthesis, primary carbon and nitrogen metabolism, defense responses, and transcription factors. Moreover, miRNAs also participate in chitosan-mediated regulation on plant growth. We identified 87 known and 21 novel miRNAs, among which 56 miRNAs were induced or repressed by chitosan heptamer, such as miRNA156, miRNA159a, miRNA164, miRNA171a, miRNA319, and miRNA1127. The integrative analysis of miRNA and mRNA expression profiles in this case provides fundamental information for further investigation of regulation mechanisms of chitosan on plant growth and will facilitate its application in agriculture.
Wajih, Nadeem; Owen, John; Wallin, Reidar
2008-01-01
Recombinant members of the vitamin K-dependent protein family (factors IX and VII and protein C) have become important pharmaceuticals in treatment of bleeding disorders and sepsis. However, because the in vivo gamma-carboxylation system in stable cell lines used for transfection has a limited capacity of post translational gamma-carboxylation, the recovery of fully gamma-carboxylated and functional proteins is low. In this work we have engineered recombinant factor VII producing HEK 293 cells to stably overexpress VKORC1, the reduced vitamin K gamma-carboxylase cofactor and in addition stably silenced the gamma-carboxylase inhibitory protein calumenin. Stable cell lines transfected with only a factor VII cDNA had a 9% production of functional recombinant factor VII. On the other hand, these recombinant factor VII producing cells when engineered to overexpress VKORC1 and having calumenin stably suppressed more than 80% by shRNA expression, produced 68% functional factor VII. The technology presented should be applicable to all vertebrae members of the vitamin K-dependent protein family and should lower the production cost of the clinically used factors VII, IX and protein C.
RNA interference: a promising technique for the improvement of traditional crops.
Katoch, Rajan; Thakur, Neelam
2013-03-01
RNA interference (RNAi) is a homology-dependent gene-silencing technology that involves double-stranded RNA directed against a target gene. This technique has emerged as powerful tool in understanding the functions of a number of genes in recent years. For the improvement in the nutritional status of the plants and reduction in the level of antinutrients, the conventional breeding methods were not completely successful in achieving the tissue-specific regulation of some genes. RNAi has shown successful results in a number of plant species for nutritional improvement, change in morphology and alteration in metabolite synthesis. This technology has been applied mostly in genetic engineering of important crop plants, and till date there are no reports of its application for the improvement of traditional/underutilized crops. In this study, we discuss current knowledge of RNAi function and concept and strategies for the improvement of traditional crops. Practical application. Although RNAi has been extensively used for the improvement of popular crops, no attention has been given for the use of this technology for the improvement of underutilized crops. This study describes the importance of use of this technology for the improvement of underutilized crops.
Directory of Open Access Journals (Sweden)
Jalil Nejati
2017-05-01
Full Text Available Background and Objectives: RNA interference is a process, in which a molecule of double-stranded RNA prevents the expression of a particular gene and leads to its silencing. Application of this technology in the control of disease-carrying insects is rising in agriculture and medical sciences. Also, its application in control of insect-borne diseases could be considered as a new, important, and effective approach. In this article, it was attempted to study the mechanisms of RNA interference, routs of its delivery to insects, as well as its application in genetic control of disease vector insects. Methods: In this study, 71 indexed articles in databases, such as Pubmed, SID, Scopus, Science direct, and Google scholar, were used. Results: dsRNA could be delivered to insect body through three routes of oral, injection, and Impregnation. The mechanism of dsRNA entrance into the cells has considerable effect on the success and applicability of this technique. Identification of host-parasite relationship in the insect body is one of the important applications of RNAi in medical entomology. Conclusion: Although, there is a considerable number of researches on RNAi in the agricultural pests field, studies on insect vectors of human diseases have been mostly in-vivo. However, application of RNAi is suggested as a new, safe and applicable approach, alone or along with other methods. Certainly, further researches in this field can pave the way for enforcement measures in the control of disease vectors, especially Zika, dengue fever, and malaria in the not so distant future.
Hatoum-Aslan, Asma; Maniv, Inbal; Marraffini, Luciano A
2011-12-27
Precise RNA processing is fundamental to all small RNA-mediated interference pathways. In prokaryotes, clustered, regularly interspaced, short palindromic repeats (CRISPR) loci encode small CRISPR RNAs (crRNAs) that protect against invasive genetic elements by antisense targeting. CRISPR loci are transcribed as a long precursor that is cleaved within repeat sequences by CRISPR-associated (Cas) proteins. In many organisms, this primary processing generates crRNA intermediates that are subject to additional nucleolytic trimming to render mature crRNAs of specific lengths. The molecular mechanisms underlying this maturation event remain poorly understood. Here, we defined the genetic requirements for crRNA primary processing and maturation in Staphylococcus epidermidis. We show that changes in the position of the primary processing site result in extended or diminished maturation to generate mature crRNAs of constant length. These results indicate that crRNA maturation occurs by a ruler mechanism anchored at the primary processing site. We also show that maturation is mediated by specific cas genes distinct from those genes involved in primary processing, showing that this event is directed by CRISPR/Cas loci.
International Nuclear Information System (INIS)
Bueren, André O von; Shalaby, Tarek; Oehler-Jänne, Christoph; Arnold, Lucia; Stearns, Duncan; Eberhart, Charles G; Arcaro, Alexandre; Pruschy, Martin; Grotzer, Michael A
2009-01-01
With current treatment strategies, nearly half of all medulloblastoma (MB) patients die from progressive tumors. Accordingly, the identification of novel therapeutic strategies remains a major goal. Deregulation of c-MYC is evident in numerous human cancers. In MB, over-expression of c-MYC has been shown to cause anaplasia and correlate with unfavorable prognosis. To study the role of c-MYC in MB biology, we down-regulated c-MYC expression by using small interfering RNA (siRNA) and investigated changes in cellular proliferation, cell cycle analysis, apoptosis, telomere maintenance, and response to ionizing radiation (IR) and chemotherapeutics in a representative panel of human MB cell lines expressing different levels of c-MYC (DAOY wild-type, DAOY transfected with the empty vector, DAOY transfected with c-MYC, D341, and D425). siRNA-mediated c-MYC down-regulation resulted in an inhibition of cellular proliferation and clonogenic growth, inhibition of G1-S phase cell cycle progression, and a decrease in human telomerase reverse transcriptase (hTERT) expression and telomerase activity. On the other hand, down-regulation of c-MYC reduced apoptosis and decreased the sensitivity of human MB cells to IR, cisplatin, and etoposide. This effect was more pronounced in DAOY cells expressing high levels of c-MYC when compared with DAOY wild-type or DAOY cells transfected with the empty vector. In human MB cells, in addition to its roles in growth and proliferation, c-MYC is also a potent inducer of apoptosis. Therefore, targeting c-MYC might be of therapeutic benefit when used sequentially with chemo- and radiotherapy rather than concomitantly
Directory of Open Access Journals (Sweden)
Arcaro Alexandre
2009-01-01
Full Text Available Abstract Background With current treatment strategies, nearly half of all medulloblastoma (MB patients die from progressive tumors. Accordingly, the identification of novel therapeutic strategies remains a major goal. Deregulation of c-MYC is evident in numerous human cancers. In MB, over-expression of c-MYC has been shown to cause anaplasia and correlate with unfavorable prognosis. Methods To study the role of c-MYC in MB biology, we down-regulated c-MYC expression by using small interfering RNA (siRNA and investigated changes in cellular proliferation, cell cycle analysis, apoptosis, telomere maintenance, and response to ionizing radiation (IR and chemotherapeutics in a representative panel of human MB cell lines expressing different levels of c-MYC (DAOY wild-type, DAOY transfected with the empty vector, DAOY transfected with c-MYC, D341, and D425. Results siRNA-mediated c-MYC down-regulation resulted in an inhibition of cellular proliferation and clonogenic growth, inhibition of G1-S phase cell cycle progression, and a decrease in human telomerase reverse transcriptase (hTERT expression and telomerase activity. On the other hand, down-regulation of c-MYC reduced apoptosis and decreased the sensitivity of human MB cells to IR, cisplatin, and etoposide. This effect was more pronounced in DAOY cells expressing high levels of c-MYC when compared with DAOY wild-type or DAOY cells transfected with the empty vector. Conclusion In human MB cells, in addition to its roles in growth and proliferation, c-MYC is also a potent inducer of apoptosis. Therefore, targeting c-MYC might be of therapeutic benefit when used sequentially with chemo- and radiotherapy rather than concomitantly.
King, Madeleine V.; Kurian, Nisha; Qin, Si; Papadopoulou, Nektaria; Westerink, Ben H. C.; Cremers, Thomas I.; Epping-Jordan, Mark P.; Le Poul, Emmanuel; Ray, David E.; Fone, Kevin C. F.; Kendall, David A.; Marsden, Charles A.; Sharp, Tyson V.
Glutamate is the principle excitatory neurotransmitter in the mammalian brain, and dysregulation of glutamatergic neurotransmission is implicated in the pathophysiology of several psychiatric and neurological diseases. This study utilized novel lentiviral short hairpin RNA (shRNA) vectors to target
Yang, X-C; Wang, X; Luo, L; Dong, D-H; Yu, Q-C; Wang, X-S; Zhao, K
2013-06-01
S100A4 is a well established marker and mediator of metastatic disease, but the exact mechanisms responsible for the metastasis promoting effects are less well defined. We tested a hypothesis that the S100A4 gene plays a role in the proliferation and invasiveness of human renal cancer cells (RCC) and may be associated with its metastatic spread. The small interference RNA vector pcDNA3.1-S100A4 siRNA was transfected in to the human renal cancer cell lines ACHN, Ketr-3, OS-RC-2, CaKi-2 and HTB-47, then treated with ABT-737 or BB94. Cell apoptosis and cell viability was detected by flow cytometry and MTT assay. Matrigel was used for cell motility and invasion assay. MMP-2, bcl-2 and S100A4 was detected by RT-PCR and western blot assay. NF-kB subunit p65 activity was detected by confocal microscopy assay. We then determine the effect S100A4 sliencing on tumor growth, lung metastasis development in vivo. Immunohistochemistry was used to detected the expression of S100A4, bcl-2, MMP-2, p65 and CD31. S100A4 silencing in ACHN cells by RNA interference significantly inhibited NF-kB and NF-kB-mediated MMP-2 and bcl-2 activation and cellular migration, proliferation, and promoted apoptosis. Furthermore, re-expression of S100A4 in S100A4-siRNA-transfected ACHN cells by transient S100A4 cDNA transfection restored the NF-kB and NF-kB-mediated MMP-2 and bcl-2 activation and their high migratory and cellular proliferative ability. An inhibitor ABT-737 (the Bcl-2 antagonist targets Bcl-2) against Bcl-2 suppressed cellular proliferation and promoted apoptosis induced by S100A4 re-expression in S100A4-siRNA-transfected ACHN cells. A inhibitor BB94 against MMPs to neutralize MMP-2 protein suppressed cellular invasion and migration induced by S100A4 re-expression in S100A4-siRNA-transfected ACHN cells. In the prevention model, S100A4 silencing inhibited primary tumor growth by (tumor weight) (76 ± 8%) and (tumor volum) (78 ± 4%) respectively and promoted apoptosis and the formation
RNA interference-based resistance against a legume mastrevirus
Directory of Open Access Journals (Sweden)
Mansoor Shahid
2011-11-01
Full Text Available Abstract Background RNA interference (RNAi is a homology-dependant gene silencing mechanism and has been widely used to engineer resistance in plants against RNA viruses. However, its usefulness in delivering resistance against plant DNA viruses belonging to family Geminiviridae is still being debated. Although the RNAi approach has been shown, using a transient assay, to be useful in countering monocotyledonous plant-infecting geminiviruses of the genus Mastrevirus, it has yet to be investigated as a means of delivering resistance to dicot-infecting mastreviruses. Chickpea chlorotic dwarf Pakistan virus (CpCDPKV is a legume-infecting mastrevirus that affects chickpea and other leguminous crops in Pakistan. Results Here a hairpin (hpRNAi construct containing sequences encompassing part of replication-associated protein gene, intergenic region and part of the movement protein gene of CpCDPKV under the control of the Cauliflower mosaic virus 35S promoter has been produced and stably transformed into Nicotiana benthamiana. Plants harboring the hairpin construct were challenged with CpCDPKV. All non-transgenic N. benthamiana plants developed symptoms of CpCDPKV infection within two weeks post-inoculation. In contrast, none of the inoculated transgenic plants showed symptoms of infection and no viral DNA could be detected by Southern hybridization. A real-time quantitative PCR analysis identified very low-level accumulation of viral DNA in the inoculated transgenic plants. Conclusions The results presented show that the RNAi-based resistance strategy is useful in protecting plants from a dicot-infecting mastrevirus. The very low levels of virus detected in plant tissue of transgenic plants distal to the inoculation site suggest that virus movement and/or viral replication was impaired leading to plants that showed no discernible signs of virus infection.
RNA Interference and its therapeutic applications
Directory of Open Access Journals (Sweden)
Srinivasa Rao T
2011-10-01
Full Text Available RNAi is a potent method, requiring only a few molecules of dsRNA per cell to silence the expression. Long molecules of double stranded RNA (dsRNA trigger the process. The dsRNA comes from virus and transposon activity in natural RNAi process, while it can be injected in the cells in experimental processes. The strand of the dsRNA that is identical in sequence to a region in target mRNA molecule is called the sense strand, and the other strand which is complimentary is termed the antisense strand. An enzyme complex called DICER thought to be similar to RNAase III then recognizes dsRNA, and cuts it into roughly 22- nucleotide long fragments. These fragments termed siRNAs for small interfering RNAs remain in double stranded duplexes with very short 3' overhangs. However, only one of the two strands, known as the guide strand or antisense strand binds the argonaute protein of RNA-induced silencing complex (RISC and target the complementary mRNA resulting gene silencing. The other anti-guide strand or passenger strand is degraded as a RISC substrate during the process of RISC activation. This form of RNAi is termed as post transcriptional gene silencing (PTGS; other forms are also thought to operate at the genomic or transcriptional level in some organisms. In mammals dsRNA longer than 30 base pairs induces a nonspecific antiviral response. This so-called interferon response results in a nonspecific arrest in translation and induction of apoptosis. This cascade induces a global non-specific suppression of translation, which in turn triggers apoptosis. Interestingly, dsRNAs less than 30 nt in length do not activate the antiviral response and specifically switched off genes in human cells without initiating the acute phase response. Thus these siRNAs are suitable for gene target validation and therapeutic applications in many species, including humans. [Vet. World 2011; 4(5.000: 225-229
Specific Silencing of L392V PSEN1 Mutant Allele by RNA Interference
Directory of Open Access Journals (Sweden)
Malgorzata Sierant
2011-01-01
Full Text Available RNA interference (RNAi technology provides a powerful molecular tool to reduce an expression of selected genes in eukaryotic cells. Short interfering RNAs (siRNAs are the effector molecules that trigger RNAi. Here, we describe siRNAs that discriminate between the wild type and mutant (1174 C→G alleles of human Presenilin1 gene (PSEN1. This mutation, resulting in L392V PSEN1 variant, contributes to early onset familial Alzheimer's disease. Using the dual fluorescence assay, flow cytometry and fluorescent microscopy we identified positions 8th–11th, within the central part of the antisense strand, as the most sensitive to mismatches. 2-Thiouridine chemical modification introduced at the 3′-end of the antisense strand improved the allele discrimination, but wobble base pairing adjacent to the mutation site abolished the siRNA activity. Our data indicate that siRNAs can be designed to discriminate between the wild type and mutant alleles of genes that differ by just a single nucleotide.
Zhang, Feng-Lin; Shen, Guo-Min; Liu, Xiao-Ling; Wang, Fang; Zhao, Ying-Ze; Zhang, Jun-Wu
2012-08-01
Hypoxia-inducible factor promotes erythropoiesis through coordinated cell type-specific hypoxia responses. GATA1 is essential to normal erythropoiesis and plays a crucial role in erythroid differentiation. In this study, we show that hypoxia-induced GATA1 expression is mediated by HIF1 in erythroid cells. Under hypoxic conditions, significantly increased GATA1 mRNA and protein levels were detected in K562 cells and erythroid induction cultures of CD34(+) haematopoietic stem/progenitor cells. Enforced HIF1α expression increased GATA1 expression, while HIF1α knockdown by RNA interference decreased GATA1 expression. In silico analysis revealed one potential hypoxia response element (HRE). The results from reporter gene and mutation analysis suggested that this element is necessary for hypoxic response. Chromatin immunoprecipitation (ChIP)-PCR showed that the putative HRE was recognized and bound by HIF1 in vivo. These results demonstrate that the up-regulation of GATA1 during hypoxia is directly mediated by HIF1.The mRNA expression of some erythroid differentiation markers was increased under hypoxic conditions, but decreased with RNA interference of HIF1α or GATA1. Flow cytometry analysis also indicated that hypoxia, desferrioxamine or CoCl(2) induced expression of erythroid surface markers CD71 and CD235a, while expression repression of HIF1α or GATA1 by RNA interference led to a decreased expression of CD235a. These results suggested that HIF1-mediated GATA1 up-regulation promotes erythropoiesis in order to satisfy the needs of an organism under hypoxic conditions. © 2011 The Authors Journal of Cellular and Molecular Medicine © 2011 Foundation for Cellular and Molecular Medicine/Blackwell Publishing Ltd.
Involvement of activation of PKR in HBx-siRNA-mediated innate immune effects on HBV inhibition.
Directory of Open Access Journals (Sweden)
Qiuju Han
Full Text Available RNA interference (RNAi of virus-specific genes offers the possibility of developing a new anti-hepatitis B virus (anti-HBV therapy. Recent studies have revealed that siRNAs can induce an innate immune response in vitro and in vivo. Here, HBVx (HBx mRNA expression and HBV replication were significantly inhibited, followed by the enhancement of expression of type I interferons (IFNs, IFN-stimulated genes (ISG15 and ISG56 and proinflammatory cytokines after HepG2.2.15 cells were transfected with chemically synthesized HBx-siRNAs. Transfection with HBx-siRNAs also significantly increased expression of dsRNA-dependent protein kinase R (PKR in HepG2.2.15 cells, followed by activation of downstream signaling events such as eukaryotic initiation factor 2α (eIF2-α. In PKR-over-expressing HepG2.2.15 cells, HBx-siRNAs exerted more potent inhibitory effects on HBV replication and greater production of type I IFNs. By contrast, the inhibitory effect of HBx-siRNAs on HBV replication was attenuated when PKR was inhibited or silenced, demonstrating that HBx-siRNAs greatly promoted PKR activation, leading to the higher production of type I IFN. Therefore, we concluded that PKR is involved in the innate immune effects mediated by HBx-siRNAs and further contributes to HBV inhibition. The bifunctional siRNAs with both gene silencing and innate immune activation properties may represent a new potential strategy for treatment of HBV.
Biogenesis pathways of RNA guides in archaeal and bacterial CRISPR-Cas adaptive immunity
Charpentier, Emmanuelle; Richter, Hagen; Oost, van der John; White, Malcolm F.
2015-01-01
CRISPR-Cas is an RNA-mediated adaptive immune system that defends bacteria and archaea against mobile genetic elements. Short mature CRISPR RNAs (crRNAs) are key elements in the interference step of the immune pathway. A CRISPR array composed of a series of repeats interspaced by spacer sequences
Regression of mouse-derived renal cancer by adoptive transfer of ...
African Journals Online (AJOL)
USER
2010-08-16
Mizuguchi et al., 2005) and negative control shRNA targeting none specific gene ..... factor-beta type II receptor suppresses ocular inflammation and fibrosis. ... in bone marrow cells through a retroviral-mediated gene therapy in mice.
Liu, G Y; Gao, Z H; Li, L; Song, T T; Sheng, X G
2016-06-25
To investigate the expression of Jagged1 in human epithelial ovarian carcinoma tissues and the effect of Jagged1 on growth of xenograft in nude mice. (1) Forty-eight cases of ovarian cancer and 30 cases of patients with benign epithelial ovarian tumor in the Henan Province Xinxiang Central Hospital during Feb. 2011 to Mar. 2014 were enrolled in this study. The mRNA expression of Jagged1, Notch1 and the downstream target genes Hes1, Hey1 were analyzed by using realtime PCR method. (2) The ovarian cancer xenograft models in nude mice were constructed by injecting SKOV3 cells in axillary subcutaneouswere. The nude mice were randomly divided into Jagged1 interference group, blank plasmid group and control group. Each group had 10 mice. They were transfected with pcDNA3.1(+)-siRNA-Jagged1, blank plasmid pDC3.1 and phosphate buffer, respectively. The tumor volumes and tumor masses were measured 14 days after transfection and the inhibition rate was calculated. The relative mRNA expression of Jagged1, Notch1, Hes1 and Hey1 in xenograft tissues after transfection in each group was detected by using realtime PCR technique and the relative protein expression of Jagged1, Notch1, Hes1 and Hey1 in xenograft tissues was detected by utilizing western blot method. (1) The relative mRNA expression of Jagged1, Notch1, Hes1 and Hey1 in ovarian cancer tissues were higher than benign ovarian tumor tissues, the differences were statistically significant (Ptissues of nude micein Jagged1 interference group were lower than that in the other two groups, the differences were statistically significant (Ptissues of nude mice among the three groups (P>0.05). Jagged1 is highly expressed in epithelial ovarian carcinoma. Jagged1 gene interference in xenograft tumor can inhibit ovarian cancer cell growth and improve tumor suppressor rate, which probably play roles by inhibiting Notch1 signaling pathway.
Citrus paradisi Macf. cv. Duncan was transformed with constructs coding for the wild-type and mutant RNA-dependent RNA polymerase (RdRp) of Citrus tristeza virus (CTV) for exploring replicase-mediated pathogen-derived resistance (RM-PDR). The RdRp gene was amplified from CTV genome and used to gener...
RNA Interference in the Age of CRISPR: Will CRISPR Interfere with RNAi?
Directory of Open Access Journals (Sweden)
Unnikrishnan Unniyampurath
2016-02-01
Full Text Available The recent emergence of multiple technologies for modifying gene structure has revolutionized mammalian biomedical research and enhanced the promises of gene therapy. Over the past decade, RNA interference (RNAi based technologies widely dominated various research applications involving experimental modulation of gene expression at the post-transcriptional level. Recently, a new gene editing technology, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR and the CRISPR-associated protein 9 (Cas9 (CRISPR/Cas9 system, has received unprecedented acceptance in the scientific community for a variety of genetic applications. Unlike RNAi, the CRISPR/Cas9 system is bestowed with the ability to introduce heritable precision insertions and deletions in the eukaryotic genome. The combination of popularity and superior capabilities of CRISPR/Cas9 system raises the possibility that this technology may occupy the roles currently served by RNAi and may even make RNAi obsolete. We performed a comparative analysis of the technical aspects and applications of the CRISPR/Cas9 system and RNAi in mammalian systems, with the purpose of charting out a predictive picture on whether the CRISPR/Cas9 system will eclipse the existence and future of RNAi. The conclusion drawn from this analysis is that RNAi will still occupy specific domains of biomedical research and clinical applications, under the current state of development of these technologies. However, further improvements in CRISPR/Cas9 based technology may ultimately enable it to dominate RNAi in the long term.
Architecture of the RNA polymerase II-Mediator core initiation complex.
Plaschka, C; Larivière, L; Wenzeck, L; Seizl, M; Hemann, M; Tegunov, D; Petrotchenko, E V; Borchers, C H; Baumeister, W; Herzog, F; Villa, E; Cramer, P
2015-02-19
The conserved co-activator complex Mediator enables regulated transcription initiation by RNA polymerase (Pol) II. Here we reconstitute an active 15-subunit core Mediator (cMed) comprising all essential Mediator subunits from Saccharomyces cerevisiae. The cryo-electron microscopic structure of cMed bound to a core initiation complex was determined at 9.7 Å resolution. cMed binds Pol II around the Rpb4-Rpb7 stalk near the carboxy-terminal domain (CTD). The Mediator head module binds the Pol II dock and the TFIIB ribbon and stabilizes the initiation complex. The Mediator middle module extends to the Pol II foot with a 'plank' that may influence polymerase conformation. The Mediator subunit Med14 forms a 'beam' between the head and middle modules and connects to the tail module that is predicted to bind transcription activators located on upstream DNA. The Mediator 'arm' and 'hook' domains contribute to a 'cradle' that may position the CTD and TFIIH kinase to stimulate Pol II phosphorylation.
Understanding the core of RNA interference: The dynamic aspects of Argonaute-mediated processes
Zhu, Lizhe; Jiang, Hanlun; Sheong, Fu Kit; Cui, Xuefeng; Wang, Yanli; Gao, Xin; Huang, Xuhui
2016-01-01
and its interaction with the nucleic acids, considerable progress has been made to reveal the dynamic aspects of various Ago-mediated processes. Here we review these novel insights into the guide-strand loading, duplex unwinding, and effects of seed
Over the past decade RNA interference (RNAi) technology has emerged as a successful tool not only for functional genomics, but in planta expression of short interfering RNAs (siRNAs) could offer potential for insect pest management. Insects feeding exclusively on plant sap depend on osmotic pressure...
Directory of Open Access Journals (Sweden)
Tohru Takemasa
2012-06-01
Full Text Available To investigate the feasibility of developing a method for detection of gene doping in power-athletes, we devised an experimental model system. Myostatin is a potent negative regulator of skeletal muscle development and growth, and myostatin-knockout mice exhibit a double-muscle phenotype. To achieve knockdown, we constructed plasmids expressing short hairpin interfering RNAs (shRNAs against myostatin. These shRNAs were transfected into C2C12 cultured cells or injected into the tibialis anterior (TA muscle of adult mice. By performing in vitro and in vivo experiments, we found that some shRNAs effectively reduced the expression of myostatin, and that the TA muscle showed hypertrophy of up to 27.9%. Then, using real-time PCR, we tried to detect the shRNA plasmid in the serum or muscles of mice into which it had been injected. Although we were unable to detect the plasmid in serum samples, it was detectable in the treated muscle at least four weeks after induction. We were also able to detect the plasmid in muscle in the vicinity of the TA. This gene doping model system will be useful for further studies aimed at doping control
Gold nanoparticle mediated laser transfection for efficient siRNA mediated gene knock down.
Directory of Open Access Journals (Sweden)
Dag Heinemann
Full Text Available Laser based transfection methods have proven to be an efficient and gentle alternative to established molecule delivery methods like lipofection or electroporation. Among the laser based methods, gold nanoparticle mediated laser transfection bears the major advantage of high throughput and easy usability. This approach uses plasmon resonances on gold nanoparticles unspecifically attached to the cell membrane to evoke transient and spatially defined cell membrane permeabilization. In this study, we explore the parameter regime for gold nanoparticle mediated laser transfection for the delivery of molecules into cell lines and prove its suitability for siRNA mediated gene knock down. The developed setup allows easy usage and safe laser operation in a normal lab environment. We applied a 532 nm Nd:YAG microchip laser emitting 850 ps pulses at a repetition rate of 20.25 kHz. Scanning velocities of the laser spot over the sample of up to 200 mm/s were tested without a decline in perforation efficiency. This velocity leads to a process speed of ∼8 s per well of a 96 well plate. The optimal particle density was determined to be ∼6 particles per cell using environmental scanning electron microscopy. Applying the optimized parameters transfection efficiencies of 88% were achieved in canine pleomorphic adenoma ZMTH3 cells using a fluorescent labeled siRNA while maintaining a high cell viability of >90%. Gene knock down of d2-EGFP was demonstrated and validated by fluorescence repression and western blot analysis. On basis of our findings and established mathematical models we suppose a mixed transfection mechanism consisting of thermal and multiphoton near field effects. Our findings emphasize that gold nanoparticle mediated laser transfection provides an excellent tool for molecular delivery for both, high throughput purposes and the transfection of sensitive cells types.
Gold nanoparticle mediated laser transfection for efficient siRNA mediated gene knock down.
Heinemann, Dag; Schomaker, Markus; Kalies, Stefan; Schieck, Maximilian; Carlson, Regina; Murua Escobar, Hugo; Ripken, Tammo; Meyer, Heiko; Heisterkamp, Alexander
2013-01-01
Laser based transfection methods have proven to be an efficient and gentle alternative to established molecule delivery methods like lipofection or electroporation. Among the laser based methods, gold nanoparticle mediated laser transfection bears the major advantage of high throughput and easy usability. This approach uses plasmon resonances on gold nanoparticles unspecifically attached to the cell membrane to evoke transient and spatially defined cell membrane permeabilization. In this study, we explore the parameter regime for gold nanoparticle mediated laser transfection for the delivery of molecules into cell lines and prove its suitability for siRNA mediated gene knock down. The developed setup allows easy usage and safe laser operation in a normal lab environment. We applied a 532 nm Nd:YAG microchip laser emitting 850 ps pulses at a repetition rate of 20.25 kHz. Scanning velocities of the laser spot over the sample of up to 200 mm/s were tested without a decline in perforation efficiency. This velocity leads to a process speed of ∼8 s per well of a 96 well plate. The optimal particle density was determined to be ∼6 particles per cell using environmental scanning electron microscopy. Applying the optimized parameters transfection efficiencies of 88% were achieved in canine pleomorphic adenoma ZMTH3 cells using a fluorescent labeled siRNA while maintaining a high cell viability of >90%. Gene knock down of d2-EGFP was demonstrated and validated by fluorescence repression and western blot analysis. On basis of our findings and established mathematical models we suppose a mixed transfection mechanism consisting of thermal and multiphoton near field effects. Our findings emphasize that gold nanoparticle mediated laser transfection provides an excellent tool for molecular delivery for both, high throughput purposes and the transfection of sensitive cells types.
Gold Nanoparticle Mediated Laser Transfection for Efficient siRNA Mediated Gene Knock Down
Heinemann, Dag; Schomaker, Markus; Kalies, Stefan; Schieck, Maximilian; Carlson, Regina; Escobar, Hugo Murua; Ripken, Tammo; Meyer, Heiko; Heisterkamp, Alexander
2013-01-01
Laser based transfection methods have proven to be an efficient and gentle alternative to established molecule delivery methods like lipofection or electroporation. Among the laser based methods, gold nanoparticle mediated laser transfection bears the major advantage of high throughput and easy usability. This approach uses plasmon resonances on gold nanoparticles unspecifically attached to the cell membrane to evoke transient and spatially defined cell membrane permeabilization. In this study, we explore the parameter regime for gold nanoparticle mediated laser transfection for the delivery of molecules into cell lines and prove its suitability for siRNA mediated gene knock down. The developed setup allows easy usage and safe laser operation in a normal lab environment. We applied a 532 nm Nd:YAG microchip laser emitting 850 ps pulses at a repetition rate of 20.25 kHz. Scanning velocities of the laser spot over the sample of up to 200 mm/s were tested without a decline in perforation efficiency. This velocity leads to a process speed of ∼8 s per well of a 96 well plate. The optimal particle density was determined to be ∼6 particles per cell using environmental scanning electron microscopy. Applying the optimized parameters transfection efficiencies of 88% were achieved in canine pleomorphic adenoma ZMTH3 cells using a fluorescent labeled siRNA while maintaining a high cell viability of >90%. Gene knock down of d2-EGFP was demonstrated and validated by fluorescence repression and western blot analysis. On basis of our findings and established mathematical models we suppose a mixed transfection mechanism consisting of thermal and multiphoton near field effects. Our findings emphasize that gold nanoparticle mediated laser transfection provides an excellent tool for molecular delivery for both, high throughput purposes and the transfection of sensitive cells types. PMID:23536802
Kishk, Abdelaziz; Anber, Helmy A I; AbdEl-Raof, Tsamoh K; El-Sherbeni, AbdEl-Hakeem D; Hamed, Sobhy; Gowda, Siddarame; Killiny, Nabil
2017-03-01
Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Liviidae), is an important pest of citrus. In addition, D. citri is the vector of Huanglongbing, a destructive disease in citrus, also known as citrus greening disease caused by Candidatus Liberibacter asiaticus. Huanglongbing causes huge losses for citrus industries. Insecticide application for D. citri is the major strategy to prevent disease spread. The heavy use of insecticides causes development of insecticide resistance. We used RNA interference (RNAi) to silence genes implicated in pesticide resistance in order to increase the susceptibility. The activity of dsRNA to reduce the expression of carboxyesterases including esterases FE4 (EstFE4) and acetylcholinesterases (AChe) in D. citri was investigated. The dsRNA was applied topically to the fourth and fifth instars of nymphs. We targeted several EstFE4 and AChe genes using dsRNA against a consensus sequence for each of them. Five concentrations (25, 50, 75, 100, 125 ng/μl) from both dsRNAs were used. The treatments with the dsRNA caused concentration dependent nymph mortality. The highest gene expression levels of both AChe and EstFE4 were found in the fourth and fifth nymphal instars. Gene expression analysis showed that AChe genes were downregulated in emerged adults from dsRNA-AChe-treated nymphs compared to controls. However, EstFE4 genes were not affected. In the same manner, treatment with dsRNA-EstFE4 reduced expression level of EstFE4 genes in emerged adults from treated nymphs, but did not affect the expression of AChe genes. In the era of environmentally friendly control strategies, RNAi is a new promising venue to reduce pesticide applications. © 2017 Wiley Periodicals, Inc.
Growing evidence indicates deregulation of the epigenetic machinery comprising the microRNA (miRNA) network as a critical factor in the progression of various diseases including cancer. Concurrently, dietary phytochemicals are being intensively studied for their miRNA-mediated health beneficial prop...
CRISPR/Cas9-mediated noncoding RNA editing in human cancers.
Yang, Jie; Meng, Xiaodan; Pan, Jinchang; Jiang, Nan; Zhou, Chengwei; Wu, Zhenhua; Gong, Zhaohui
2018-01-02
Cancer is characterized by multiple genetic and epigenetic alterations, including a higher prevalence of mutations of oncogenes and/or tumor suppressors. Mounting evidences have shown that noncoding RNAs (ncRNAs) are involved in the epigenetic regulation of cancer genes and their associated pathways. The clustered regularly interspaced short palindromic repeats (CRISPR)-associated nuclease 9 (CRISPR/Cas9) system, a revolutionary genome-editing technology, has shed light on ncRNA-based cancer therapy. Here, we briefly introduce the classifications and mechanisms of CRISPR/Cas9 system. Importantly, we mainly focused on the applications of CRISPR/Cas9 system as a molecular tool for ncRNA (microRNA, long noncoding RNA and circular RNA, etc.) editing in human cancers, and the novel techniques that are based on CRISPR/Cas9 system. Additionally, the off-target effects and the corresponding solutions as well as the challenges toward CRISPR/Cas9 were also evaluated and discussed. Long- and short-ncRNAs have been employed as targets in precision oncology, and CRISPR/Cas9-mediated ncRNA editing may provide an excellent way to cure cancer.
International Nuclear Information System (INIS)
Hu, Duanmin; Su, Cunjin; Jiang, Min; Shen, Yating; Shi, Aiming; Zhao, Fenglun; Chen, Ruidong; Shen, Zhu; Bao, Junjie; Tang, Wen
2016-01-01
There is still no suitable drug for pancreatic cancer treatment, which is one of the most aggressive human tumors. Maternally expressed gene 3 (MEG3), a LncRNA, has been suggested as a tumor suppressor in a range of human tumors. Studies found fenofibrate exerted anti-tumor roles in various human cancer cell lines. However, its role in pancreatic cancer remains unknown. The present study aimed to explore the impacts of fenofibrate on pancreatic cancer cell lines, and to investigate MEG3 role in its anti-tumor mechanisms. We used MTT assay to determine cells proliferation, genome-wide LncRNA microarray analysis to identify differently expressed LncRNAs, siRNA or pCDNA-MEG3 transfection to interfere or upregulate MEG3 expression, western blot to detect protein levels, real-time PCR to determine MEG3 level. Fenofibrate significantly inhibited proliferation of pancreatic cancer cells, increased MEG3 expression and p53 levels. Moreover, knockdown of MEG3 attenuated cytotoxicity induced by fenofibrate. Furthermore, overexpression of MEG3 induced cells death and increased p53 expression. Our results indicated fenofibrate inhibited pancreatic cancer cells proliferation via activation of p53 mediated by upregulation of MEG3. - Highlights: • We found that fenofibrate suppressed proliferation of pancreatic cancer cells. • We found fenofibrate increased LncRNA-MEG3 expression and p53 level in PANC-1 cells. • Inhibition of MEG3 expression attenuated anti-tumor effects of fenofibrate.
Energy Technology Data Exchange (ETDEWEB)
Hu, Duanmin [Department of Gastroenterology, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Su, Cunjin [Department of Pharmacy, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Jiang, Min [Department of Breast Surgery, The First Affiliated Hospital of Soochow University, Suzhou 215004 (China); Shen, Yating [Department of Gastroenterology, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Shi, Aiming; Zhao, Fenglun [Department of Pharmacy, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Chen, Ruidong [Department of Gastroenterology, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Shen, Zhu [Department of Pharmacy, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Bao, Junjie, E-mail: baojjsdfey@sina.com [Department of Pharmacy, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Tang, Wen, E-mail: sztangwen@163.com [Department of Gastroenterology, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China)
2016-03-04
There is still no suitable drug for pancreatic cancer treatment, which is one of the most aggressive human tumors. Maternally expressed gene 3 (MEG3), a LncRNA, has been suggested as a tumor suppressor in a range of human tumors. Studies found fenofibrate exerted anti-tumor roles in various human cancer cell lines. However, its role in pancreatic cancer remains unknown. The present study aimed to explore the impacts of fenofibrate on pancreatic cancer cell lines, and to investigate MEG3 role in its anti-tumor mechanisms. We used MTT assay to determine cells proliferation, genome-wide LncRNA microarray analysis to identify differently expressed LncRNAs, siRNA or pCDNA-MEG3 transfection to interfere or upregulate MEG3 expression, western blot to detect protein levels, real-time PCR to determine MEG3 level. Fenofibrate significantly inhibited proliferation of pancreatic cancer cells, increased MEG3 expression and p53 levels. Moreover, knockdown of MEG3 attenuated cytotoxicity induced by fenofibrate. Furthermore, overexpression of MEG3 induced cells death and increased p53 expression. Our results indicated fenofibrate inhibited pancreatic cancer cells proliferation via activation of p53 mediated by upregulation of MEG3. - Highlights: • We found that fenofibrate suppressed proliferation of pancreatic cancer cells. • We found fenofibrate increased LncRNA-MEG3 expression and p53 level in PANC-1 cells. • Inhibition of MEG3 expression attenuated anti-tumor effects of fenofibrate.
Roles of Prolyl Isomerases in RNA-Mediated Gene Expression
Directory of Open Access Journals (Sweden)
Roopa Thapar
2015-05-01
Full Text Available The peptidyl-prolyl cis-trans isomerases (PPIases that include immunophilins (cyclophilins and FKBPs and parvulins (Pin1, Par14, Par17 participate in cell signaling, transcription, pre-mRNA processing and mRNA decay. The human genome encodes 19 cyclophilins, 18 FKBPs and three parvulins. Immunophilins are receptors for the immunosuppressive drugs cyclosporin A, FK506, and rapamycin that are used in organ transplantation. Pin1 has also been targeted in the treatment of Alzheimer’s disease, asthma, and a number of cancers. While these PPIases are characterized as molecular chaperones, they also act in a nonchaperone manner to promote protein-protein interactions using surfaces outside their active sites. The immunosuppressive drugs act by a gain-of-function mechanism by promoting protein-protein interactions in vivo. Several immunophilins have been identified as components of the spliceosome and are essential for alternative splicing. Pin1 plays roles in transcription and RNA processing by catalyzing conformational changes in the RNA Pol II C-terminal domain. Pin1 also binds several RNA binding proteins such as AUF1, KSRP, HuR, and SLBP that regulate mRNA decay by remodeling mRNP complexes. The functions of ribonucleoprotein associated PPIases are largely unknown. This review highlights PPIases that play roles in RNA-mediated gene expression, providing insight into their structures, functions and mechanisms of action in mRNP remodeling in vivo.
Directory of Open Access Journals (Sweden)
Peek Andrew S
2007-06-01
Full Text Available Abstract Background RNA interference (RNAi is a naturally occurring phenomenon that results in the suppression of a target RNA sequence utilizing a variety of possible methods and pathways. To dissect the factors that result in effective siRNA sequences a regression kernel Support Vector Machine (SVM approach was used to quantitatively model RNA interference activities. Results Eight overall feature mapping methods were compared in their abilities to build SVM regression models that predict published siRNA activities. The primary factors in predictive SVM models are position specific nucleotide compositions. The secondary factors are position independent sequence motifs (N-grams and guide strand to passenger strand sequence thermodynamics. Finally, the factors that are least contributory but are still predictive of efficacy are measures of intramolecular guide strand secondary structure and target strand secondary structure. Of these, the site of the 5' most base of the guide strand is the most informative. Conclusion The capacity of specific feature mapping methods and their ability to build predictive models of RNAi activity suggests a relative biological importance of these features. Some feature mapping methods are more informative in building predictive models and overall t-test filtering provides a method to remove some noisy features or make comparisons among datasets. Together, these features can yield predictive SVM regression models with increased predictive accuracy between predicted and observed activities both within datasets by cross validation, and between independently collected RNAi activity datasets. Feature filtering to remove features should be approached carefully in that it is possible to reduce feature set size without substantially reducing predictive models, but the features retained in the candidate models become increasingly distinct. Software to perform feature prediction and SVM training and testing on nucleic acid
Silencing effect of shRNA expression vectors with stem length of 21 ...
African Journals Online (AJOL)
Then, the recombinant plasmids were transfected into mouse embryonic fibroblast with lipofection and injected into leg muscle of mouse. The mRNA expression level of the green fluorescent protein gene was checked by real-time quantitative polymerase chain reaction (RT-PCR). The silencing effect of the 29 bp shRNA ...
Wang, Yi; Li, Quan; Wei, Xianzhao; Xu, Jie; Chen, Qi; Song, Shuang; Lu, Zhe; Wang, Zimin
2015-09-01
Subacromial bursitis (SAB) is the major source of pain in rotator cuff disease. Although multiple investigations have provided support for the role of inflammatory cytokines in SAB, few have focussed on the use these cytokines in the treatment of SAB. The aim of the present study was to observe the therapeutic efficacy of lentivirus‑mediated RNA interference (RNAi) on carrageenan‑induced SAB by injecting lentivirus‑tumor necrosis factor (TNF)‑α‑RNAi expressing TNF‑α small interfering (si)RNA. Using screened siRNA segments, an siRNA was designed. A lentivirus vector expressing siRNA was established and packed as lentivirus particles. A lentivirus that expressed the negative sequence was used as a lentivirus‑negative control (NC). The carrageenan‑induced SAB model was established in 32 male Sprague‑Dawley rats. The modeled rats were randomly assigned to four groups: Lentivirus‑RNAi treatment group, lentivirus‑NC group, SAB group and phosphate‑buffered saline (PBS) blank control group. The lentivirus was injected (1x10(7) transducing units) into the subacromial bursa of the rats in the lentivirus‑RNAi group and lentivirus‑NC group, whereas 100 µl PBS was injected at the same site in the SAB group and the PBS blank control group. At 5 weeks following injection, the animals were sacrificed and venous blood was obtained. The effect of TNF‑α interference and the expression of inflammatory cytokines were determined by reverse transcription‑quantitative polymerase chain reaction, western blotting, hematoxylin and eosin staining, Van Gieson's staining and immunofluorescence. The expression of TNF‑α was decreased in the lentivirus‑TNF‑α‑RNAi group compared with that in the SAB group. Morphological observations revealed that the number of inflammatory cells were reduced and damage to tendon fibers was attenuated in this group, suggesting that the downregulation of the protein expression levels of TNF‑α‑associated nuclear
CRISPR/Cas9 mediates efficient conditional mutagenesis in Drosophila.
Xue, Zhaoyu; Wu, Menghua; Wen, Kejia; Ren, Menda; Long, Li; Zhang, Xuedi; Gao, Guanjun
2014-09-05
Existing transgenic RNA interference (RNAi) methods greatly facilitate functional genome studies via controlled silencing of targeted mRNA in Drosophila. Although the RNAi approach is extremely powerful, concerns still linger about its low efficiency. Here, we developed a CRISPR/Cas9-mediated conditional mutagenesis system by combining tissue-specific expression of Cas9 driven by the Gal4/upstream activating site system with various ubiquitously expressed guide RNA transgenes to effectively inactivate gene expression in a temporally and spatially controlled manner. Furthermore, by including multiple guide RNAs in a transgenic vector to target a single gene, we achieved a high degree of gene mutagenesis in specific tissues. The CRISPR/Cas9-mediated conditional mutagenesis system provides a simple and effective tool for gene function analysis, and complements the existing RNAi approach. Copyright © 2014 Xue et al.
UBXN1 Interferes with Rig-I-like Receptor-Mediated Antiviral Immune Response by Targeting MAVS
Directory of Open Access Journals (Sweden)
Penghua Wang
2013-04-01
Full Text Available RNA viruses are sensed by RIG-I-like receptors (RLRs, which signal through a mitochondria-associated adaptor molecule, MAVS, resulting in systemic antiviral immune responses. Although RLR signaling is essential for limiting RNA virus replication, it must be stringently controlled to prevent damage from inflammation. We demonstrate here that among all tested UBX-domain-containing protein family members, UBXN1 exhibits the strongest inhibitory effect on RNA-virus-induced type I interferon response. UBXN1 potently inhibits RLR- and MAVS-induced, but not TLR3-, TLR4-, or DNA-virus-induced innate immune responses. Depletion of UBXN1 enhances virus-induced innate immune responses, including those resulting from RNA viruses such as vesicular stomatitis, Sendai, West Nile, and dengue virus infection, repressing viral replication. Following viral infection, UBXN1 is induced, binds to MAVS, interferes with intracellular MAVS oligomerization, and disrupts the MAVS/TRAF3/TRAF6 signalosome. These findings underscore a critical role of UBXN1 in the modulation of a major antiviral signaling pathway.
Directory of Open Access Journals (Sweden)
Irma Sánchez-Vargas
2009-02-01
Full Text Available A number of studies have shown that both innate and adaptive immune defense mechanisms greatly influence the course of human dengue virus (DENV infections, but little is known about the innate immune response of the mosquito vector Aedes aegypti to arbovirus infection. We present evidence here that a major component of the mosquito innate immune response, RNA interference (RNAi, is an important modulator of mosquito infections. The RNAi response is triggered by double-stranded RNA (dsRNA, which occurs in the cytoplasm as a result of positive-sense RNA virus infection, leading to production of small interfering RNAs (siRNAs. These siRNAs are instrumental in degradation of viral mRNA with sequence homology to the dsRNA trigger and thereby inhibition of virus replication. We show that although dengue virus type 2 (DENV2 infection of Ae. aegypti cultured cells and oral infection of adult mosquitoes generated dsRNA and production of DENV2-specific siRNAs, virus replication and release of infectious virus persisted, suggesting viral circumvention of RNAi. We also show that DENV2 does not completely evade RNAi, since impairing the pathway by silencing expression of dcr2, r2d2, or ago2, genes encoding important sensor and effector proteins in the RNAi pathway, increased virus replication in the vector and decreased the extrinsic incubation period required for virus transmission. Our findings indicate a major role for RNAi as a determinant of DENV transmission by Ae. aegypti.
From early lessons to new frontiers: the worm as a treasure trove of small RNA biology.
Youngman, Elaine M; Claycomb, Julie M
2014-01-01
In the past 20 years, the tiny soil nematode Caenorhabditis elegans has provided critical insights into our understanding of the breadth of small RNA-mediated gene regulatory activities. The first microRNA was identified in C. elegans in 1993, and the understanding that dsRNA was the driving force behind RNA-mediated gene silencing came from experiments performed in C. elegans in 1998. Likewise, early genetic screens in C. elegans for factors involved in RNA interference pointed to conserved mechanisms for small RNA-mediated gene silencing pathways, placing the worm squarely among the founding fathers of a now extensive field of molecular biology. Today, the worm continues to be at the forefront of ground-breaking insight into small RNA-mediated biology. Recent studies have revealed with increasing mechanistic clarity that C. elegans possesses an extensive nuclear small RNA regulatory network that encompasses not only gene silencing but also gene activating roles. Further, a portrait is emerging whereby small RNA pathways play key roles in integrating responses to environmental stimuli and transmitting epigenetic information about such responses from one generation to the next. Here we discuss endogenous small RNA pathways in C. elegans and the insight worm biology has provided into the mechanisms employed by these pathways. We touch on the increasingly spectacular diversity of small RNA biogenesis and function, and discuss the relevance of lessons learned in the worm for human biology.
Li, Yining; Xu, Shuxiong; Wang, Xiangwei; Shi, Hua; Sun, Zhaolin; Yang, Zhao
2013-02-01
To explore the exact mechanism of Pokemon in prostate cancer. Pokemon is a member of the POK family of transcriptional repressors. Its main function is suppression of the p14ARF (alternate reading frame) tumor suppressor gene. Although Pokemon expression has been found to be increased in various types of lymphoma, the exact mechanism of the gene in prostate cancer is not clear. In the present study, prostate cancer cells were transfected with the specific short hairpin ribonucleic acid (RNA) expression vector targeting Pokemon. The expression of Pokemon messenger RNA and its protein was detected by semiquantitative reverse transcriptase-polymerase chain reaction and Western blotting, respectively. The cell growth and cell apoptosis were also examined using the methyl thiazolyl tetrazolium assay and flow cytometry. The results demonstrated that specific RNA interference (RNAi) could decrease the expression levels of Pokemon gene messenger RNA and protein in prostate cancer cells. In addition, that specific RNAi significantly inhibited the cell proliferation and increased the apoptotic rate. In vivo experiments showed that specific RNAi inhibited the tumorigenicity of prostate cancer cells and significantly suppressed tumor growth. Therefore, an RNAi-targeted Pokemon gene strategy could be a potential approach to prostate cancer therapy. Copyright © 2013 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Wang, Chunmao; Ding, Chao; Kong, Minjian [Department of Cardiothoracic Surgery, Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou 310009 (China); Dong, Aiqiang, E-mail: dr_dongaiqiang@sina.com [Department of Cardiothoracic Surgery, Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou 310009 (China); Qian, Jianfang; Jiang, Daming; Shen, Zhonghua [Department of Cardiothoracic Surgery, Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou 310009 (China)
2011-07-08
Highlights: {yields} We compared lipofection with magnetofection about difference of transfection efficiency on delivery a therapeutic gene in vitro and in vivo. {yields} We investigated the difference of shRNA induced by magnetofection and lipofection into A549 cell and subcutaneous tumor to knockdown IGF-1R overexpressed in A549 cell and A549 tumor. {yields} We investigated in vivo shRNA silenced IGF-1R overexpression 24, 48, and 72 h after shRNA intravenous injection into tumor-bearing mice by way of magnetofection and lipofection. {yields} Our results showed that magnetofection could achieve therapeutic gene targeted delivery into special site, which contributed to targeted gene therapy of lung cancers. -- Abstract: Liposomal magnetofection potentiates gene transfection by applying a magnetic field to concentrate magnetic lipoplexes onto target cells. Magnetic lipoplexes are self-assembling ternary complexes of cationic lipids with plasmid DNA associated with superparamagnetic iron oxide nanoparticles (SPIONs). Type1insulin-like growth factor receptor (IGF-1R), an important oncogene, is frequently overexpressed in lung cancer and mediates cancer cell proliferation and tumor growth. In this study, we evaluated the transfection efficiency (percentage of transfected cells) and therapeutic potential (potency of IGF-1R knockdown) of liposomal magnetofection of plasmids expressing GFP and shRNAs targeting IGF-1R (pGFPshIGF-1Rs) in A549 cells and in tumor-bearing mice as compared to lipofection using Lipofectamine 2000. Liposomal magnetofection provided a threefold improvement in transgene expression over lipofection and transfected up to 64.1% of A549 cells in vitro. In vitro, IGF-1R specific-shRNA transfected by lipofection inhibited IGF-1R protein by 56.1 {+-} 6% and by liposomal magnetofection by 85.1 {+-} 3%. In vivo delivery efficiency of the pGFPshIGF-1R plasmid into the tumor was significantly higher in the liposomal magnetofection group than in the
International Nuclear Information System (INIS)
Wang, Chunmao; Ding, Chao; Kong, Minjian; Dong, Aiqiang; Qian, Jianfang; Jiang, Daming; Shen, Zhonghua
2011-01-01
Highlights: → We compared lipofection with magnetofection about difference of transfection efficiency on delivery a therapeutic gene in vitro and in vivo. → We investigated the difference of shRNA induced by magnetofection and lipofection into A549 cell and subcutaneous tumor to knockdown IGF-1R overexpressed in A549 cell and A549 tumor. → We investigated in vivo shRNA silenced IGF-1R overexpression 24, 48, and 72 h after shRNA intravenous injection into tumor-bearing mice by way of magnetofection and lipofection. → Our results showed that magnetofection could achieve therapeutic gene targeted delivery into special site, which contributed to targeted gene therapy of lung cancers. -- Abstract: Liposomal magnetofection potentiates gene transfection by applying a magnetic field to concentrate magnetic lipoplexes onto target cells. Magnetic lipoplexes are self-assembling ternary complexes of cationic lipids with plasmid DNA associated with superparamagnetic iron oxide nanoparticles (SPIONs). Type1insulin-like growth factor receptor (IGF-1R), an important oncogene, is frequently overexpressed in lung cancer and mediates cancer cell proliferation and tumor growth. In this study, we evaluated the transfection efficiency (percentage of transfected cells) and therapeutic potential (potency of IGF-1R knockdown) of liposomal magnetofection of plasmids expressing GFP and shRNAs targeting IGF-1R (pGFPshIGF-1Rs) in A549 cells and in tumor-bearing mice as compared to lipofection using Lipofectamine 2000. Liposomal magnetofection provided a threefold improvement in transgene expression over lipofection and transfected up to 64.1% of A549 cells in vitro. In vitro, IGF-1R specific-shRNA transfected by lipofection inhibited IGF-1R protein by 56.1 ± 6% and by liposomal magnetofection by 85.1 ± 3%. In vivo delivery efficiency of the pGFPshIGF-1R plasmid into the tumor was significantly higher in the liposomal magnetofection group than in the lipofection group. In vivo IGF-1R
In Vivo Testing of MicroRNA-Mediated Gene Knockdown in Zebrafish
Directory of Open Access Journals (Sweden)
Ivone Un San Leong
2012-01-01
Full Text Available The zebrafish (Danio rerio has become an attractive model for human disease modeling as there are a large number of orthologous genes that encode similar proteins to those found in humans. The number of tools available to manipulate the zebrafish genome is limited and many currently used techniques are only effective during early development (such as morpholino-based antisense technology or it is phenotypically driven and does not offer targeted gene knockdown (such as chemical mutagenesis. The use of RNA interference has been met with controversy as off-target effects can make interpreting phenotypic outcomes difficult; however, this has been resolved by creating zebrafish lines that contain stably integrated miRNA constructs that target the desired gene of interest. In this study, we show that a commercially available miRNA vector system with a mouse-derived miRNA backbone is functional in zebrafish and is effective in causing eGFP knockdown in a transient in vivo eGFP sensor assay system. We chose to apply this system to the knockdown of transcripts that are implicated in the human cardiac disorder, Long QT syndrome.
Systemic RNAi-mediated Gene Silencing in Nonhuman Primate and Rodent Myeloid Cells
Directory of Open Access Journals (Sweden)
Tatiana I Novobrantseva
2012-01-01
Full Text Available Leukocytes are central regulators of inflammation and the target cells of therapies for key diseases, including autoimmune, cardiovascular, and malignant disorders. Efficient in vivo delivery of small interfering RNA (siRNA to immune cells could thus enable novel treatment strategies with broad applicability. In this report, we develop systemic delivery methods of siRNA encapsulated in lipid nanoparticles (LNP for durable and potent in vivo RNA interference (RNAi-mediated silencing in myeloid cells. This work provides the first demonstration of siRNA-mediated silencing in myeloid cell types of nonhuman primates (NHPs and establishes the feasibility of targeting multiple gene targets in rodent myeloid cells. The therapeutic potential of these formulations was demonstrated using siRNA targeting tumor necrosis factor-α (TNFα which induced substantial attenuation of disease progression comparable to a potent antibody treatment in a mouse model of rheumatoid arthritis (RA. In summary, we demonstrate a broadly applicable and therapeutically relevant platform for silencing disease genes in immune cells.
DEFF Research Database (Denmark)
Del Nobile, Eugenio; Kouvaris, Christoforos; Sannino, Francesco
2012-01-01
We study different patterns of interference in WIMP-nuclei elastic scattering that can accommodate the DAMA and CoGeNT experiments via an isospin violating ratio $f_n/f_p=-0.71$. We study interference between the following pairs of mediators: Z and Z', Z' and Higgs, and two Higgs fields. We show ...
RNA interference screen identifies Abl kinase and PDGFR signaling in Chlamydia trachomatis entry.
Directory of Open Access Journals (Sweden)
Cherilyn A Elwell
2008-03-01
Full Text Available The strain designated Chlamydia trachomatis serovar L2 that was used for experiments in this paper is Chlamydia muridarum, a species closely related to C. trachomatis (and formerly termed the Mouse Pneumonitis strain of C. trachomatis. This conclusion was verified by deep sequencing and by PCR using species-specific primers. All data presented in the results section that refer to C. trachomatis should be interpreted as referring to C. muridarum. Since C. muridarum TARP lacks the consensus tyrosine repeats present in C. trachomatis TARP, we cannot make any conclusions about the role of TARP phosphorylation and C. muridarum entry. However, the conclusion that C. trachomatis L2 TARP is a target of Abl kinase is still valid as these experiments were performed with C. trachomatis L2 TARP [corrected]. To elucidate the mechanisms involved in early events in Chlamydia trachomatis infection, we conducted a large scale unbiased RNA interference screen in Drosophila melanogaster S2 cells. This allowed identification of candidate host factors in a simple non-redundant, genetically tractable system. From a library of 7,216 double stranded RNAs (dsRNA, we identified approximately 226 host genes, including two tyrosine kinases, Abelson (Abl kinase and PDGF- and VEGF-receptor related (Pvr, a homolog of the Platelet-derived growth factor receptor (PDGFR. We further examined the role of these two kinases in C. trachomatis binding and internalization into mammalian cells. Both kinases are phosphorylated upon infection and recruited to the site of bacterial attachment, but their roles in the infectious process are distinct. We provide evidence that PDGFRbeta may function as a receptor, as inhibition of PDGFRbeta by RNA interference or by PDGFRbeta neutralizing antibodies significantly reduces bacterial binding, whereas depletion of Abl kinase has no effect on binding. Bacterial internalization can occur through activation of PDGFRbeta or through independent
C6/36 Aedes albopictus cells have a dysfunctional antiviral RNA interference response.
Directory of Open Access Journals (Sweden)
Doug E Brackney
2010-10-01
Full Text Available Mosquitoes rely on RNA interference (RNAi as their primary defense against viral infections. To this end, the combination of RNAi and invertebrate cell culture systems has become an invaluable tool in studying virus-vector interactions. Nevertheless, a recent study failed to detect an active RNAi response to West Nile virus (WNV infection in C6/36 (Aedes albopictus cells, a mosquito cell line frequently used to study arthropod-borne viruses (arboviruses. Therefore, we sought to determine if WNV actively evades the host's RNAi response or if C6/36 cells have a dysfunctional RNAi pathway. C6/36 and Drosophila melanogaster S2 cells were infected with WNV (Flaviviridae, Sindbis virus (SINV, Togaviridae and La Crosse virus (LACV, Bunyaviridae and total RNA recovered from cell lysates. Small RNA (sRNA libraries were constructed and subjected to high-throughput sequencing. In S2 cells, virus-derived small interfering RNAs (viRNAs from all three viruses were predominantly 21 nt in length, a hallmark of the RNAi pathway. However, in C6/36 cells, viRNAs were primarily 17 nt in length from WNV infected cells and 26-27 nt in length in SINV and LACV infected cells. Furthermore, the origin (positive or negative viral strand and distribution (position along viral genome of S2 cell generated viRNA populations was consistent with previously published studies, but the profile of sRNAs isolated from C6/36 cells was altered. In total, these results suggest that C6/36 cells lack a functional antiviral RNAi response. These findings are analogous to the type-I interferon deficiency described in Vero (African green monkey kidney cells and suggest that C6/36 cells may fail to accurately model mosquito-arbovirus interactions at the molecular level.
SLUG promotes prostate cancer cell migration and invasion via CXCR4/CXCL12 axis.
Uygur, Berna; Wu, Wen-Shu
2011-11-10
SLUG is a zinc-finger transcription factor of the Snail/Slug zinc-finger family that plays a role in migration and invasion of tumor cells. Mechanisms by which SLUG promotes migration and invasion in prostate cancers remain elusive. Expression level of CXCR4 and CXCL12 was examined by Western blot, RT-PCR, and qPCR analyses. Forced expression of SLUG was mediated by retroviruses, and SLUG and CXCL12 was downregulated by shRNAs-expressing lentiviruses. Migration and invasion of prostate cancer were measured by scratch-wound assay and invasion assay, respectively. We demonstrated that forced expression of SLUG elevated CXCR4 and CXCL12 expression in human prostate cancer cell lines PC3, DU145, 22RV1, and LNCaP; conversely, reduced expression of SLUG by shRNA downregulated CXCR4 and CXCL12 expression at RNA and protein levels in prostate cancer cells. Furthermore, ectopic expression of SLUG increased MMP9 expression and activity in PC3, 22RV1, and DU-145 cells, and SLUG knockdown by shRNA downregulated MMP9 expression. We showed that CXCL12 is required for SLUG-mediated MMP9 expression in prostate cancer cells. Moreover, we found that migration and invasion of prostate cancer cells was increased by ectopic expression of SLUG and decreased by SLUG knockdown. Notably, knockdown of CXCL12 by shRNA impaired SLUG-mediated migration and invasion in prostate cancer cells. Lastly, our data suggest that CXCL12 and SLUG regulate migration and invasion of prostate cancer cells independent of cell growth. We provide the first compelling evidence that upregulation of autocrine CXCL12 is a major mechanism underlying SLUG-mediated migration and invasion of prostate cancer cells. Our findings suggest that CXCL12 is a therapeutic target for prostate cancer metastasis.
Pulmonary Delivery of siRNA via Polymeric Vectors as Therapies of Asthma.
Xie, Yuran; Merkel, Olivia M
2015-10-01
Asthma is a chronic inflammatory disease. Despite the fact that current therapies, such as the combination of inhaled corticosteroids and β2-agonists, can control the symptoms of asthma in most patients, there is still an urgent need for an alternative anti-inflammatory therapy for patients who suffer from severe asthma but lack acceptable response to conventional therapies. Many molecular factors are involved in the inflammatory process in asthma, and thus blocking the function of these factors could efficiently alleviate airway inflammation. RNA interference (RNAi) is often thought to be the answer in the search for more efficient and biocompatible treatments. However, difficulties of efficient delivery of small interference RNA (siRNA), the key factor in RNAi, to target cells and tissues have limited its clinical application. In this review, we summarize cytokines and chemokines, transcription factors, tyrosine kinases, and costimulatory factors that have been reported as targets of siRNA-mediated treatment in experimental asthma. Additionally, we conclude several targeted delivery systems of siRNA to specific cells such as T cells, macrophages, and dendritic cells, which could potentially be applied in asthma therapy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
CYP3A5 mRNA degradation by nonsense-mediated mRNA decay.
Busi, Florent; Cresteil, Thierry
2005-09-01
The total CYP3A5 mRNA level is significantly greater in carriers of the CYP3A5*1 allele than in CYP3A5*3 homozygotes. Most of the CYP3A5*3 mRNA includes an intronic sequence (exon 3B) containing premature termination codons (PTCs) between exons 3 and 4. Two models were used to investigate the degradation of CYP3A5 mRNA: a CYP3A5 minigene consisting of CYP3A5 exons and introns 3 to 6 transfected into MCF7 cells, and the endogenous CYP3A5 gene expressed in HepG2 cells. The 3'-untranslated region g.31611C>T mutation has no effect on CYP3A5 mRNA decay. Splice variants containing exon 3B were more unstable than wild-type (wt) CYP3A5 mRNA. Cycloheximide prevents the recognition of PTCs by ribosomes: in transfected MCF7 and HepG2 cells, cycloheximide slowed down the degradation of exon 3B-containing splice variants, suggesting the participation of nonsense-mediated decay (NMD). When PTCs were removed from pseudoexon 3B or when UPF1 small interfering RNA was used to impair the NMD mechanism, the decay of the splice variant was reduced, confirming the involvement of NMD in the degradation of CYP3A5 splice variants. Induction could represent a source of variability for CYP3A5 expression and could modify the proportion of splice variants. The extent of CYP3A5 induction was investigated after exposure to barbiturates or steroids: CYP3A4 was markedly induced in a pediatric population compared with untreated neonates. However, no effect could be detected in either the total CYP3A5 RNA, the proportion of splice variant RNA, or the protein level. Therefore, in these carriers, induction is unlikely to switch on the phenotypic CYP3A5 expression in carriers of CYP3A5*3/*3.
McShane, Connar Jo; Quirk, Frances
2009-10-01
This study investigated whether work-home (WHI) or home-work interference (HWI) explained or affected the strength of the relationship between farmers' stresses and reported psychological distress. Distribution of questionnaire package; included Work-Home Conflict Scale, Farm Stress Survey, Depression Anxiety Stress Scale. Participants recruited via advertising in newsletters and newspapers, and distribution through businesses and meetings. The majority of farmers (N = 51, male = 45, female = 5) were recruited from the one district. Farmers were individuals who identified their occupation as a farm owner, farm manager, or farm hand. It was predicted farmers would report higher levels of WHI than HWI; time, a determinant of interference, would mediate the relationship between farmers' stresses and psychological distress; WHI and HWI would moderate farmers' stresses and their psychological distress; overall reported level of psychological distress would be in normal to mild range because of positive general economic conditions. Farmers reported significantly higher levels of WHI than HWI (M = 3.21, M = 2.76, P stresses and psychological distress, particularly anxiety. WHI, time and strain, determinants of WHI mediated personal finances and subcomponents of psychological distress (stress, anxiety, depression). Time-based HWI mediated personal finances and stress. No moderating effects were found for WHI (r = -0.02, P = 0.882) or HWI (r = 0.15, P = 0.306). Farmers of this specific sample presented a unique work-home interface. Limitations include the small sample size, recruitment methods, and culturally irrelevant measures as well as only assessing work-related stresses. Future research should aim to develop measures appropriate for farmers of Australia.
Nonsense-Mediated RNA Decay Influences Human Embryonic Stem Cell Fate
Directory of Open Access Journals (Sweden)
Chih-Hong Lou
2016-06-01
Full Text Available Nonsense-mediated RNA decay (NMD is a highly conserved pathway that selectively degrades specific subsets of RNA transcripts. Here, we provide evidence that NMD regulates early human developmental cell fate. We found that NMD factors tend to be expressed at higher levels in human pluripotent cells than in differentiated cells, raising the possibility that NMD must be downregulated to permit differentiation. Loss- and gain-of-function experiments in human embryonic stem cells (hESCs demonstrated that, indeed, NMD downregulation is essential for efficient generation of definitive endoderm. RNA-seq analysis identified NMD target transcripts induced when NMD is suppressed in hESCs, including many encoding signaling components. This led us to test the role of TGF-β and BMP signaling, which we found NMD acts through to influence definitive endoderm versus mesoderm fate. Our results suggest that selective RNA decay is critical for specifying the developmental fate of specific human embryonic cell lineages.
Energy Technology Data Exchange (ETDEWEB)
Wu, Lijuan [Shanghai Key Laboratory of Magnetic Resonance, East China Normal University, Shanghai 200062 (China); Suzhou Novovita Bio-products Co., Ltd., Suzhou 215300 (China); Wu, Changlin, E-mail: Ph.Dclwu1314@sina.cn [Shanghai Key Laboratory of Magnetic Resonance, East China Normal University, Shanghai 200062 (China); Suzhou Novovita Bio-products Co., Ltd., Suzhou 215300 (China); Liu, Guangwan [Suzhou Novovita Bio-products Co., Ltd., Suzhou 215300 (China); Liao, Nannan [Shanghai Key Laboratory of Magnetic Resonance, East China Normal University, Shanghai 200062 (China); Suzhou Novovita Bio-products Co., Ltd., Suzhou 215300 (China); Zhao, Fang; Yang, Xuxia; Qu, Hongyuan [Suzhou Novovita Bio-products Co., Ltd., Suzhou 215300 (China); Peng, Bo [Shanghai Key Laboratory of Magnetic Resonance, East China Normal University, Shanghai 200062 (China); Chen, Li [Shanghai Key Laboratory of Magnetic Resonance, East China Normal University, Shanghai 200062 (China); Suzhou Novovita Bio-products Co., Ltd., Suzhou 215300 (China); Yang, Guang [Shanghai Key Laboratory of Magnetic Resonance, East China Normal University, Shanghai 200062 (China)
2016-12-15
Highlights: • We prepared Chitosan/Hyaluronic acid-siRNA multilayer as carrier to effectively load and protect siRNAs. • The stability and integrity of the siRNA was verified in the siRNA-loaded films. • The siRNA-loaded films showed good cells adhesion and gene silencing effect in eGFP-HEK 293T cells. • This is a new type of surface-mediated non-viral multilayer films. - Abstract: siRNA delivery remains highly challenging because of its hydrophilic and anionic nature and its sensitivity to nuclease degradation. Effective siRNA loading and improved transfection efficiency into cells represents a key problem. In our study, we prepared Chitosan/Hyaluronic acid-siRNA multilayer films through layer-by-layer self-assembly, in which siRNAs can be effectively loaded and protected. The construction process was characterized by FTIR, {sup 13}C NMR (CP/MAS), UV–vis spectroscopy, and atomic force microscopy (AFM). We presented the controlled-release performance of the films during incubation in 1 M NaCl solution for several days through UV–vis spectroscopy and polyacrylamide gel electrophoresis (PAGE). Additionally, we verified the stability and integrity of the siRNA loaded on multilayer films. Finally, the biological efficacy of the siRNA delivery system was evaluated via cells adhesion and gene silencing analyses in eGFP-HEK 293T cells. This new type of surface-mediated non-viral multilayer films may have considerable potential in the localized and controlled-release delivery of siRNA in mucosal tissues, and tissue engineering application.
Regulation of gene expression in neuronal tissue by RNA interference and editing
DEFF Research Database (Denmark)
Venø, Morten Trillingsgaard
No tissue in the mammalian organism is more complex than the brain. This complexity is in part the result of precise timing and interplay of a large number mechanisms modulating gene expression post-transcriptionally. Fine-tuning mechanisms such as A-to-I editing of RNA transcripts and regulation...... mediated by microRNAs are crucial for the correct function of the mammalian brain. We are addressing A-to-I editing and regulation by microRNAs with spatio-temporal resolution in the embryonic porcine brain by Solexa sequencing of microRNAs and 454 sequencing of edited neuronal messenger RNAs, resulting...... in detailed data of both of these fine-tuning mechanisms in the embryonic development of the pig. Editing levels of transcripts examined are generally seen to increase through development, in agreement with editing of specific microRNA also examined in the Solexa sequencing study. Three studies examining...
Confirming the RNAi-mediated mechanism of action of siRNA-based cancer therapeutics in mice.
Judge, Adam D; Robbins, Marjorie; Tavakoli, Iran; Levi, Jasna; Hu, Lina; Fronda, Anna; Ambegia, Ellen; McClintock, Kevin; MacLachlan, Ian
2009-03-01
siRNAs that specifically silence the expression of cancer-related genes offer a therapeutic approach in oncology. However, it remains critical to determine the true mechanism of their therapeutic effects. Here, we describe the preclinical development of chemically modified siRNA targeting the essential cell-cycle proteins polo-like kinase 1 (PLK1) and kinesin spindle protein (KSP) in mice. siRNA formulated in stable nucleic acid lipid particles (SNALP) displayed potent antitumor efficacy in both hepatic and subcutaneous tumor models. This was correlated with target gene silencing following a single intravenous administration that was sufficient to cause extensive mitotic disruption and tumor cell apoptosis. Our siRNA formulations induced no measurable immune response, minimizing the potential for nonspecific effects. Additionally, RNAi-specific mRNA cleavage products were found in tumor cells, and their presence correlated with the duration of target mRNA silencing. Histological biomarkers confirmed that RNAi-mediated gene silencing effectively inhibited the target's biological activity. This report supports an RNAi-mediated mechanism of action for siRNA antitumor effects, suggesting a new methodology for targeting other key genes in cancer development with siRNA-based therapeutics.
RNA interference in plant parasitic nematodes
African Journals Online (AJOL)
STORAGESEVER
2008-08-04
Aug 4, 2008 ... grower preference or by government restrictions to limit the environmental ... risks associated with chemical control and (c) the pro- vision of ... certain model organisms. The first ... reproductive system (Lilley et al., 2005b), sperm (Urwin .... interference of dual oxidase in the plant nematode Meloidogyne.
Silva, Amanda Perse da; Lopes, Juliana Freitas; Paula, Vanessa Salete de
2014-01-01
The aim of this study was to evaluate the use of RNA interference to inhibit herpes simplex virus type-1 replication in vitro. For herpes simplex virus type-1 gene silencing, three different small interfering RNAs (siRNAs) targeting the herpes simplex virus type-1 UL39 gene (sequence si-UL 39-1, si-UL 39-2, and si-UL 39-3) were used, which encode the large subunit of ribonucleotide reductase, an essential enzyme for DNA synthesis. Herpes simplex virus type-1 was isolated from saliva samples and mucocutaneous lesions from infected patients. All mucocutaneous lesions' samples were positive for herpes simplex virus type-1 by real-time PCR and by virus isolation; all herpes simplex virus type-1 from saliva samples were positive by real-time PCR and 50% were positive by virus isolation. The levels of herpes simplex virus type-1 DNA remaining after siRNA treatment were assessed by real-time PCR, whose results demonstrated that the effect of siRNAs on gene expression depends on siRNA concentration. The three siRNA sequences used were able to inhibit viral replication, assessed by real-time PCR and plaque assays and among them, the sequence si-UL 39-1 was the most effective. This sequence inhibited 99% of herpes simplex virus type-1 replication. The results demonstrate that silencing herpes simplex virus type-1 UL39 expression by siRNAs effectively inhibits herpes simplex virus type-1 replication, suggesting that siRNA based antiviral strategy may be a potential therapeutic alternative. Copyright © 2014. Published by Elsevier Editora Ltda.
A Critical Analysis of the Role of SNARE Protein SEC22B in Antigen Cross-Presentation
Directory of Open Access Journals (Sweden)
S. Julia Wu
2017-06-01
Full Text Available Cross-presentation initiates immune responses against tumors and viral infections by presenting extracellular antigen on MHC I to activate CD8+ T cell-mediated cytotoxicity. In vitro studies in dendritic cells (DCs established SNARE protein SEC22B as a specific regulator of cross-presentation. However, the in vivo contribution of SEC22B to cross-presentation has not been tested. To address this, we generated DC-specific Sec22b knockout (CD11c-Cre Sec22bfl/fl mice. Contrary to the paradigm, SEC22B-deficient DCs efficiently cross-present both in vivo and in vitro. Although in vitro small hairpin RNA (shRNA-mediated Sec22b silencing in bone-marrow-derived dendritic cells (BMDCs reduced cross-presentation, treatment of SEC22B-deficient BMDCs with the same shRNA produced a similar defect, suggesting the Sec22b shRNA modulates cross-presentation through off-target effects. RNA sequencing of Sec22b shRNA-treated SEC22B-deficient BMDCs demonstrated several changes in the transcriptome. Our data demonstrate that contrary to the accepted model, SEC22B is not necessary for cross-presentation, cautioning against extrapolating phenotypes from knockdown studies alone.
Li, Zhiqian; You, Lang; Yan, Dong; James, Anthony A; Huang, Yongping; Tan, Anjiang
2018-02-01
Sex determination is a hierarchically-regulated process with high diversity in different organisms including insects. The W chromosome-derived Fem piRNA has been identified as the primary sex determination factor in the lepidopteran insect, Bombyx mori, revealing a distinctive piRNA-mediated sex determination pathway. However, the comprehensive mechanism of silkworm sex determination is still poorly understood. We show here that the silkworm PIWI protein BmSiwi, but not BmAgo3, is essential for silkworm sex determination. CRISPR/Cas9-mediated depletion of BmSiwi results in developmental arrest in oogenesis and partial female sexual reversal, while BmAgo3 depletion only affects oogenesis. We identify three histone methyltransferases (HMTs) that are significantly down-regulated in BmSiwi mutant moths. Disruption one of these, BmAsh2, causes dysregulation of piRNAs and transposable elements (TEs), supporting a role for it in the piRNA signaling pathway. More importantly, we find that BmAsh2 mutagenesis results in oogenesis arrest and partial female-to-male sexual reversal as well as dysregulation of the sex determination genes, Bmdsx and BmMasc. Mutagenesis of other two HMTs, BmSETD2 and BmEggless, does not affect piRNA-mediated sex determination. Histological analysis and immunoprecipitation results support a functional interaction between the BmAsh2 and BmSiwi proteins. Our data provide the first evidence that the HMT, BmAsh2, plays key roles in silkworm piRNA-mediated sex determination.
Directory of Open Access Journals (Sweden)
Zhiqian Li
2018-02-01
Full Text Available Sex determination is a hierarchically-regulated process with high diversity in different organisms including insects. The W chromosome-derived Fem piRNA has been identified as the primary sex determination factor in the lepidopteran insect, Bombyx mori, revealing a distinctive piRNA-mediated sex determination pathway. However, the comprehensive mechanism of silkworm sex determination is still poorly understood. We show here that the silkworm PIWI protein BmSiwi, but not BmAgo3, is essential for silkworm sex determination. CRISPR/Cas9-mediated depletion of BmSiwi results in developmental arrest in oogenesis and partial female sexual reversal, while BmAgo3 depletion only affects oogenesis. We identify three histone methyltransferases (HMTs that are significantly down-regulated in BmSiwi mutant moths. Disruption one of these, BmAsh2, causes dysregulation of piRNAs and transposable elements (TEs, supporting a role for it in the piRNA signaling pathway. More importantly, we find that BmAsh2 mutagenesis results in oogenesis arrest and partial female-to-male sexual reversal as well as dysregulation of the sex determination genes, Bmdsx and BmMasc. Mutagenesis of other two HMTs, BmSETD2 and BmEggless, does not affect piRNA-mediated sex determination. Histological analysis and immunoprecipitation results support a functional interaction between the BmAsh2 and BmSiwi proteins. Our data provide the first evidence that the HMT, BmAsh2, plays key roles in silkworm piRNA-mediated sex determination.
Directory of Open Access Journals (Sweden)
Isabelle Plante
2006-01-01
Full Text Available MicroRNA (miRNA-guided messenger RNA (mRNA translational repression is believed to be mediated by effector miRNA-containing ribonucleoprotein (miRNP complexes harboring fragile X mental retardation protein (FMRP. Recent studies documented the nucleic acid chaperone properties of FMRP and characterized its role and importance in RNA silencing in mammalian cells. We propose a model in which FMRP could facilitate miRNA assembly on target mRNAs in a process involving recognition of G quartet structures. Functioning within a duplex miRNP, FMRP may also mediate mRNA targeting through a strand exchange mechanism, in which the miRNA* of the duplex is swapped for the mRNA. Furthermore, FMRP may contribute to the relief of miRNA-guided mRNA repression through a reverse strand exchange reaction, possibly initiated by a specific cellular signal, that would liberate the mRNA for translation. Suboptimal utilization of miRNAs may thus account for some of themolecular defects in patients with the fragile X syndrome.
AGO/RISC-mediated antiviral RNA silencing in a plant in vitro system.
Schuck, Jana; Gursinsky, Torsten; Pantaleo, Vitantonio; Burgyán, Jozsef; Behrens, Sven-Erik
2013-05-01
AGO/RISC-mediated antiviral RNA silencing, an important component of the plant's immune response against RNA virus infections, was recapitulated in vitro. Cytoplasmic extracts of tobacco protoplasts were applied that supported Tombusvirus RNA replication, as well as the formation of RNA-induced silencing complexes (RISC) that could be functionally reconstituted with various plant ARGONAUTE (AGO) proteins. For example, when RISC containing AGO1, 2, 3 or 5 were programmed with exogenous siRNAs that specifically targeted the viral RNA, endonucleolytic cleavages occurred and viral replication was inhibited. Antiviral RNA silencing was disabled by the viral silencing suppressor p19 when this was present early during RISC formation. Notably, with replicating viral RNA, only (+)RNA molecules were accessible to RISC, whereas (-)RNA replication intermediates were not. The vulnerability of viral RNAs to RISC activity also depended on the RNA structure of the target sequence. This was most evident when we characterized viral siRNAs (vsiRNAs) that were particularly effective in silencing with AGO1- or AGO2/RISC. These vsiRNAs targeted similar sites, suggesting that accessible parts of the viral (+)RNA may be collectively attacked by different AGO/RISC. The in vitro system was, hence, established as a valuable tool to define and characterize individual molecular determinants of antiviral RNA silencing.
The brain cytoplasmic RNA BC1 regulates dopamine D2 receptor-mediated transmission in the striatum.
Centonze, Diego; Rossi, Silvia; Napoli, Ilaria; Mercaldo, Valentina; Lacoux, Caroline; Ferrari, Francesca; Ciotti, Maria Teresa; De Chiara, Valentina; Prosperetti, Chiara; Maccarrone, Mauro; Fezza, Filomena; Calabresi, Paolo; Bernardi, Giorgio; Bagni, Claudia
2007-08-15
Dopamine D(2) receptor (D(2)DR)-mediated transmission in the striatum is remarkably flexible, and changes in its efficacy have been heavily implicated in a variety of physiological and pathological conditions. Although receptor-associated proteins are clearly involved in specific forms of synaptic plasticity, the molecular mechanisms regulating the sensitivity of D(2) receptors in this brain area are essentially obscure. We have studied the physiological responses of the D(2)DR stimulations in mice lacking the brain cytoplasmic RNA BC1, a small noncoding dendritically localized RNA that is supposed to play a role in mRNA translation. We show that the efficiency of D(2)-mediated transmission regulating striatal GABA synapses is under the control of BC1 RNA, through a negative influence on D(2) receptor protein level affecting the functional pool of receptors. Ablation of the BC1 gene did not result in widespread dysregulation of synaptic transmission, because the sensitivity of cannabinoid CB(1) receptors was intact in the striatum of BC1 knock-out (KO) mice despite D(2) and CB(1) receptors mediated similar electrophysiological actions. Interestingly, the fragile X mental retardation protein FMRP, one of the multiple BC1 partners, is not involved in the BC1 effects on the D(2)-mediated transmission. Because D(2)DR mRNA is apparently equally translated in the BC1-KO and wild-type mice, whereas the protein level is higher in BC1-KO mice, we suggest that BC1 RNA controls D(2)DR indirectly, probably regulating translation of molecules involved in D(2)DR turnover and/or stability.
RNAi Screening in Spodoptera frugiperda.
Ghosh, Subhanita; Singh, Gatikrushna; Sachdev, Bindiya; Kumar, Ajit; Malhotra, Pawan; Mukherjee, Sunil K; Bhatnagar, Raj K
2016-01-01
RNA interference is a potent and precise reverse genetic approach to carryout large-scale functional genomic studies in a given organism. During the past decade, RNAi has also emerged as an important investigative tool to understand the process of viral pathogenesis. Our laboratory has successfully generated transgenic reporter and RNAi sensor line of Spodoptera frugiperda (Sf21) cells and developed a reversal of silencing assay via siRNA or shRNA guided screening to investigate RNAi factors or viral pathogenic factors with extraordinary fidelity. Here we describe empirical approaches and conceptual understanding to execute successful RNAi screening in Spodoptera frugiperda 21-cell line.
Directory of Open Access Journals (Sweden)
Klingelhoeffer Christoph
2012-05-01
Full Text Available Abstract Background Ascorbic acid demonstrates a cytotoxic effect by generating hydrogen peroxide, a reactive oxygen species (ROS involved in oxidative cell stress. A panel of eleven human cancer cell lines, glioblastoma and carcinoma, were exposed to serial dilutions of ascorbic acid (5-100 mmol/L. The purpose of this study was to analyse the impact of catalase, an important hydrogen peroxide-detoxifying enzyme, on the resistance of cancer cells to ascorbic acid mediated oxidative stress. Methods Effective concentration (EC50 values, which indicate the concentration of ascorbic acid that reduced the number of viable cells by 50%, were detected with the crystal violet assay. The level of intracellular catalase protein and enzyme activity was determined. Expression of catalase was silenced by catalase-specific short hairpin RNA (sh-RNA in BT-20 breast carcinoma cells. Oxidative cell stress induced apoptosis was measured by a caspase luminescent assay. Results The tested human cancer cell lines demonstrated obvious differences in their resistance to ascorbic acid mediated oxidative cell stress. Forty-five percent of the cell lines had an EC50 > 20 mmol/L and fifty-five percent had an EC50 50 of 2.6–5.5 mmol/L, glioblastoma cells were the most susceptible cancer cell lines analysed in this study. A correlation between catalase activity and the susceptibility to ascorbic acid was observed. To study the possible protective role of catalase on the resistance of cancer cells to oxidative cell stress, the expression of catalase in the breast carcinoma cell line BT-20, which cells were highly resistant to the exposure to ascorbic acid (EC50: 94,9 mmol/L, was silenced with specific sh-RNA. The effect was that catalase-silenced BT-20 cells (BT-20 KD-CAT became more susceptible to high concentrations of ascorbic acid (50 and 100 mmol/L. Conclusions Fifty-five percent of the human cancer cell lines tested were unable to protect themselves
Koralewska, Natalia; Hoffmann, Weronika; Pokornowska, Maria; Milewski, Marek; Lipinska, Andrea; Bienkowska-Szewczyk, Krystyna; Figlerowicz, Marek; Kurzynska-Kokorniak, Anna
2016-01-01
Ribonuclease Dicer plays a pivotal role in RNA interference pathways by processing long double-stranded RNAs and single-stranded hairpin RNA precursors into small interfering RNAs (siRNAs) and microRNAs (miRNAs), respectively. While details of Dicer regulation by a variety of proteins are being elucidated, less is known about non-protein factors, e.g. RNA molecules, that may influence this enzyme's activity. Therefore, we decided to investigate the question of whether the RNA molecules can function not only as Dicer substrates but also as its regulators. Our previous in vitro studies indicated that the activity of human Dicer can be influenced by short RNA molecules that either bind to Dicer or interact with its substrates, or both. Those studies were carried out with commercial Dicer preparations. Nevertheless, such preparations are usually not homogeneous enough to carry out more detailed RNA-binding studies. Therefore, we have established our own system for the production of human Dicer in insect cells. In this manuscript, we characterize the RNA-binding and RNA-cleavage properties of the obtained preparation. We demonstrate that Dicer can efficiently bind single-stranded RNAs that are longer than ~20-nucleotides. Consequently, we revisit possible scenarios of Dicer regulation by single-stranded RNA species ranging from ~10- to ~60-nucleotides, in the context of their binding to this enzyme. Finally, we show that siRNA/miRNA-sized RNAs may affect miRNA production either by binding to Dicer or by participating in regulatory feedback-loops. Altogether, our studies suggest a broad regulatory role of short RNAs in Dicer functioning.
Barker, Gregory A; Diamond, Scott L
2008-09-01
Some barriers to DNA lipofection are well characterized; however, there is as yet no method of finding unknown pathways that impact the process. A druggable genome small-interfering RNA (siRNA) screen against 5,520 genes was tested for its effect on lipofection of human aortic endothelial cells (HAECs). We found 130 gene targets which, when silenced by pooled siRNAs (three siRNAs per gene), resulted in enhanced luminescence after lipofection (86 gene targets showed reduced expression). In confirmation tests with single siRNAs, 18 of the 130 hits showed enhanced lipofection with two or more individual siRNAs in the absence of cytotoxicity. Of these confirmed gene targets, we identified five leading candidates, two of which are isoforms of the regulatory subunit of protein phosphatase 2A (PP2A). The best candidate siRNA targeted the PPP2R2C gene and produced a 65% increase in luminescence from lipofection, with a quantitative PCR-validated knockdown of approximately 76%. Flow cytometric analysis confirmed that the silencing of the PPP2R2C gene resulted in an improvement of 10% in transfection efficiency, thereby demonstrating an increase in the number of transfected cells. These results show that an RNA interference (RNAi) high-throughput screen (HTS) can be applied to nonviral gene transfer. We have also demonstrated that siRNAs can be co-delivered with lipofected DNA to increase the transfection efficiency in vitro.
Sindhu, Annu; Arora, Pooja; Chaudhury, Ashok
2012-07-01
A novel laboratory revolution for disease therapy, the RNA interference (RNAi) technology, has adopted a new era of molecular research as the next generation "Gene-targeted prophylaxis." In this review, we have focused on the chief technological challenges associated with the efforts to develop RNAi-based therapeutics that may guide the biomedical researchers. Many non-curable maladies, like neurodegenerative diseases and cancers have effectively been cured using this technology. Rapid advances are still in progress for the development of RNAi-based technologies that will be having a major impact on medical research. We have highlighted the recent discoveries associated with the phenomenon of RNAi, expression of silencing molecules in mammals along with the vector systems used for disease therapeutics.
2016-09-07
sequences of the target mRNA, and a double stranded stem at the 5′ end that forms a stem -loop to function as a forceps to stabilize the secondary...E-mjournal homepage: www.elsevier.com/locate/bbrepDetection of siRNA-mediated target mRNA cleavage activities in human cells by a novel stem -loop...challenges for the accurate and efficient detection and verification of cleavage sites on target mRNAs. Here we used a sensitive stem -loop array reverse
Shin, Shanghun; Kim, Karam; Lee, Myung Joo; Lee, Jeongju; Choi, Sungjin; Kim, Kyung-Suk; Ko, Jung-Min; Han, Hyunjoo; Kim, Su Young; Youn, Hae Jeong; Ahn, Kyu Joong; An, In-Sook; An, Sungkwan; Cha, Hwa Jun
2016-06-01
Dihydrotestosterone (DHT) induces androgenic alopecia by shortening the hair follicle growth phase, resulting in hair loss. We previously demonstrated how changes in the microRNA (miRNA) expression profile influenced DHT-mediated cell death, cell cycle arrest, cell viability, the generation of reactive oxygen species (ROS), and senescence. Protective effects against DHT have not, however, been elucidated at the genome level. We showed that epigallocatechin gallate (EGCG), a major component of green tea, protects DHT-induced cell death by regulating the cellular miRNA expression profile. We used a miRNA microarray to identify miRNA expression levels in human dermal papilla cells (DPCs). We investigated whether the miRNA expression influenced the protective effects of EGCG against DHT-induced cell death, growth arrest, intracellular ROS levels, and senescence. EGCG protected against the effects of DHT by altering the miRNA expression profile in human DPCs. In addition, EGCG attenuated DHT-mediated cell death and growth arrest and decreased intracellular ROS levels and senescence. A bioinformatics analysis elucidated the relationship between the altered miRNA expression and EGCG-mediated protective effects against DHT. Overall, our results suggest that EGCG ameliorates the negative effects of DHT by altering the miRNA expression profile in human DPCs.
Production of cloned pigs with targeted attenuation of gene expression.
Directory of Open Access Journals (Sweden)
Vilceu Bordignon
Full Text Available The objective of this study was to demonstrate that RNA interference (RNAi and somatic cell nuclear transfer (SCNT technologies can be used to attenuate the expression of specific genes in tissues of swine, a large animal species. Apolipoprotein E (apoE, a secreted glycoprotein known for its major role in lipid and lipoprotein metabolism and transport, was selected as the target gene for this study. Three synthetic small interfering RNAs (siRNA targeting the porcine apoE mRNA were tested in porcine granulosa cells in primary culture and reduced apoE mRNA abundance ranging from 45-82% compared to control cells. The most effective sequence was selected for cloning into a short hairpin RNA (shRNA expression vector under the control of RNA polymerase III (U6 promoter. Stably transfected fetal porcine fibroblast cells were generated and used to produce embryos with in vitro matured porcine oocytes, which were then transferred into the uterus of surrogate gilts. Seven live and one stillborn piglet were born from three gilts that became pregnant. Integration of the shRNA expression vector into the genome of clone piglets was confirmed by PCR and expression of the GFP transgene linked to the expression vector. Analysis showed that apoE protein levels in the liver and plasma of the clone pigs bearing the shRNA expression vector targeting the apoE mRNA was significantly reduced compared to control pigs cloned from non-transfected fibroblasts of the same cell line. These results demonstrate the feasibility of applying RNAi and SCNT technologies for introducing stable genetic modifications in somatic cells for eventual attenuation of gene expression in vivo in large animal species.
RNAi reduces expression and intracellular retention of mutant cartilage oligomeric matrix protein.
Directory of Open Access Journals (Sweden)
Karen L Posey
2010-04-01
Full Text Available Mutations in cartilage oligomeric matrix protein (COMP, a large extracellular glycoprotein expressed in musculoskeletal tissues, cause two skeletal dysplasias, pseudoachondroplasia and multiple epiphyseal dysplasia. These mutations lead to massive intracellular retention of COMP, chondrocyte death and loss of growth plate chondrocytes that are necessary for linear growth. In contrast, COMP null mice have only minor growth plate abnormalities, normal growth and longevity. This suggests that reducing mutant and wild-type COMP expression in chondrocytes may prevent the toxic cellular phenotype causing the skeletal dysplasias. We tested this hypothesis using RNA interference to reduce steady state levels of COMP mRNA. A panel of shRNAs directed against COMP was tested. One shRNA (3B reduced endogenous and recombinant COMP mRNA dramatically, regardless of expression levels. The activity of the shRNA against COMP mRNA was maintained for up to 10 weeks. We also demonstrate that this treatment reduced ER stress. Moreover, we show that reducing steady state levels of COMP mRNA alleviates intracellular retention of other extracellular matrix proteins associated with the pseudoachondroplasia cellular pathology. These findings are a proof of principle and the foundation for the development of a therapeutic intervention based on reduction of COMP expression.
Structure of a Complete Mediator-RNA Polymerase II Pre-Initiation Complex.
Robinson, Philip J; Trnka, Michael J; Bushnell, David A; Davis, Ralph E; Mattei, Pierre-Jean; Burlingame, Alma L; Kornberg, Roger D
2016-09-08
A complete, 52-protein, 2.5 million dalton, Mediator-RNA polymerase II pre-initiation complex (Med-PIC) was assembled and analyzed by cryo-electron microscopy and by chemical cross-linking and mass spectrometry. The resulting complete Med-PIC structure reveals two components of functional significance, absent from previous structures, a protein kinase complex and the Mediator-activator interaction region. It thereby shows how the kinase and its target, the C-terminal domain of the polymerase, control Med-PIC interaction and transcription. Copyright © 2016 Elsevier Inc. All rights reserved.
Sudo, Ryo; Sato, Fumiaki; Azechi, Takuya; Wachi, Hiroshi
2015-12-01
Vascular calcification increases the risk of cardiovascular mortality. We previously reported that expression of elastin decreases with progression of inorganic phosphorus (Pi)-induced vascular smooth muscle cell (VSMC) calcification. However, the regulatory mechanisms of elastin mRNA expression during vascular calcification remain unclear. MicroRNA-29 family members (miR-29a, b and c) are reported to mediate elastin mRNA expression. Therefore, we aimed to determine the effect of miR-29 on elastin expression and Pi-induced vascular calcification. Calcification of human VSMCs was induced by Pi and evaluated measuring calcium deposition. Pi stimulation promoted Ca deposition and suppressed elastin expression in VSMCs. Knockdown of elastin expression by shRNA also promoted Pi-induced VSMC calcification. Elastin pre-mRNA measurements indicated that Pi stimulation suppressed elastin expression without changing transcriptional activity. Conversely, Pi stimulation increased miR-29a and miR-29b expression. Inhibition of miR-29 recovered elastin expression and suppressed calcification in Pi-treated VSMCs. Furthermore, over-expression of miR-29b promoted Pi-induced VSMC calcification. RT-qPCR analysis showed knockdown of elastin expression in VSMCs induced expression of osteoblast-related genes, similar to Pi stimulation, and recovery of elastin expression by miR-29 inhibition reduced their expression. Our study shows that miR-29-mediated suppression of elastin expression in VSMCs plays a pivotal role in osteoblastic differentiation leading to vascular calcification. © 2015 The Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd.
RNA SURVEILLANCE– AN EMERGING ROLE FOR RNA REGULATORY NETWORKS IN AGING
Montano, Monty; Long, Kimberly
2010-01-01
In this review, we describe recent advances in the field of RNA regulatory biology and relate these advances to aging science. We introduce a new term, RNA surveillance, an RNA regulatory process that is conserved in metazoans, and describe how RNA surveillance represents molecular cross-talk between two emerging RNA regulatory systems – RNA interference and RNA editing. We discuss how RNA surveillance mechanisms influence mRNA and microRNA expression and activity during lifespan. Additionall...
Vishnu, Prakash; Colon-Otero, Gerardo; Kennedy, Gregory T; Marlow, Laura A; Kennedy, William P; Wu, Kevin J; Santoso, Joseph T; Copland, John A
2012-03-01
The aim was to evaluate antitumor activity of the combination of ixabepilone and sunitinib in pre-clinical models of chemotherapy naïve and refractory epithelial ovarian tumors, and to investigate the mechanism of synergy of such drug combination. HOVTAX2 cell line was derived from a metastatic serous papillary epithelial ovarian tumor (EOC) and a paclitaxel-resistant derivative was established. Dose response curves for ixabepilone and sunitinib were generated and synergy was determined using combination indexes. The molecular mechanism of antitumor synergy was examined using shRNA silencing. The combination of ixabepilone and sunitinib demonstrated robust antitumor synergy in naïve and paclitaxel-resistant HOVTAX2 cell lines due to increased apoptosis. The GTPase, RhoB, was synergistically upregulated in cells treated with ixabepilone and sunitinib. Using shRNA, RhoB was demonstrated to mediate antitumor synergy. These results were validated in two other EOC cell lines. Ixabepilone plus sunitinib demonstrated antitumor synergy via RhoB in naïve and paclitaxel-resistant cells resulting in apoptosis. This study demonstrates a novel mechanism of action leading to antitumor synergy and provides 'proof-of-principle' for combining molecular targeted agents with cytotoxic chemotherapy to improve antitumor efficacy. RhoB could be envisioned as an early biomarker of response to therapy in a planned Phase II clinical trial to assess the efficacy of ixabepilone combined with a receptor tyrosine kinase inhibitor such as sunitinib. To the best of our knowledge, this is the first demonstration of antitumor synergy between these two classes of drugs in EOC and the pivotal role of RhoB in this synergy. Copyright © 2011 Elsevier Inc. All rights reserved.
Exosomes: Nanoparticulate tools for RNA interference and drug delivery.
Shahabipour, Fahimeh; Barati, Nastaran; Johnston, Thomas P; Derosa, Giuseppe; Maffioli, Pamela; Sahebkar, Amirhossein
2017-07-01
Exosomes are naturally occurring extracellular vesicles released by most mammalian cells in all body fluids. Exosomes are known as key mediators in cell-cell communication and facilitate the transfer of genetic and biochemical information between distant cells. Structurally, exosomes are composed of lipids, proteins, and also several types of RNAs which enable these vesicles to serve as important disease biomarkers. Moreover, exosomes have emerged as novel drug and gene delivery tools owing to their multiple advantages over conventional delivery systems. Recently, increasing attention has been focused on exosomes for the delivery of drugs, including therapeutic recombinant proteins, to various target tissues. Exosomes are also promising vehicles for the delivery of microRNAs and small interfering RNAs, which is usually hampered by rapid degradation of these RNAs, as well as inefficient tissue specificity of currently available delivery strategies. This review highlights the most recent accomplishments and trends in the use of exosomes for the delivery of drugs and therapeutic RNA molecules. © 2017 Wiley Periodicals, Inc.
High-Throughput Silencing Using the CRISPR-Cas9 System: A Review of the Benefits and Challenges.
Wade, Mark
2015-09-01
The clustered regularly interspaced short palindromic repeats (CRISPR)/Cas system has been seized upon with a fervor enjoyed previously by small interfering RNA (siRNA) and short hairpin RNA (shRNA) technologies and has enormous potential for high-throughput functional genomics studies. The decision to use this approach must be balanced with respect to adoption of existing platforms versus awaiting the development of more "mature" next-generation systems. Here, experience from siRNA and shRNA screening plays an important role, as issues such as targeting efficiency, pooling strategies, and off-target effects with those technologies are already framing debates in the CRISPR field. CRISPR/Cas can be exploited not only to knockout genes but also to up- or down-regulate gene transcription-in some cases in a multiplex fashion. This provides a powerful tool for studying the interaction among multiple signaling cascades in the same genetic background. Furthermore, the documented success of CRISPR/Cas-mediated gene correction (or the corollary, introduction of disease-specific mutations) provides proof of concept for the rapid generation of isogenic cell lines for high-throughput screening. In this review, the advantages and limitations of CRISPR/Cas are discussed and current and future applications are highlighted. It is envisaged that complementarities between CRISPR, siRNA, and shRNA will ensure that all three technologies remain critical to the success of future functional genomics projects. © 2015 Society for Laboratory Automation and Screening.
HIV-1 RNAs are Not Part of the Argonaute 2 Associated RNA Interference Pathway in Macrophages.
Directory of Open Access Journals (Sweden)
Valentina Vongrad
Full Text Available MiRNAs and other small noncoding RNAs (sncRNAs are key players in post-transcriptional gene regulation. HIV-1 derived small noncoding RNAs (sncRNAs have been described in HIV-1 infected cells, but their biological functions still remain to be elucidated. Here, we approached the question whether viral sncRNAs may play a role in the RNA interference (RNAi pathway or whether viral mRNAs are targeted by cellular miRNAs in human monocyte derived macrophages (MDM.The incorporation of viral sncRNAs and/or their target RNAs into RNA-induced silencing complex was investigated using photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP as well as high-throughput sequencing of RNA isolated by cross-linking immunoprecipitation (HITS-CLIP, which capture Argonaute2-bound miRNAs and their target RNAs. HIV-1 infected monocyte-derived macrophages (MDM were chosen as target cells, as they have previously been shown to express HIV-1 sncRNAs. In addition, we applied small RNA deep sequencing to study differential cellular miRNA expression in HIV-1 infected versus non-infected MDMs.PAR-CLIP and HITS-CLIP data demonstrated the absence of HIV-1 RNAs in Ago2-RISC, although the presence of a multitude of HIV-1 sncRNAs in HIV-1 infected MDMs was confirmed by small RNA sequencing. Small RNA sequencing revealed that 1.4% of all sncRNAs were of HIV-1 origin. However, neither HIV-1 derived sncRNAs nor putative HIV-1 target sequences incorporated into Ago2-RISC were identified suggesting that HIV-1 sncRNAs are not involved in the canonical RNAi pathway nor is HIV-1 targeted by this pathway in HIV-1 infected macrophages.
Cellular Response to Ionizing Radiation: A MicroRNA Story
Halimi, Mohammad; Asghari, S. Mohsen; Sariri, Reyhaneh; Moslemi, Dariush; Parsian, Hadi
2012-01-01
MicroRNAs (miRNAs) represent a class of small non-coding RNA molecules that regulate gene expression at the post-transcriptional level. They play a crucial role in diverse cellular pathways. Ionizing radiation (IR) is one of the most important treatment protocols for patients that suffer from cancer and affects directly or indirectly cellular integration. Recently it has been discovered that microRNA-mediated gene regulation interferes with radio-related pathways in ionizing radiation. Here, we review the recent discoveries about miRNAs in cellular response to IR. Thoroughly understanding the mechanism of miRNAs in radiation response, it will be possible to design new strategies for improving radiotherapy efficiency and ultimately cancer treatment. PMID:24551775
Cui, Li; Xu, Shuaimei; Ma, Dandan; Gao, Jie; Liu, Ying; Yue, Jing; Wu, Buling
2014-02-01
It has been reported that integrin-α5 (ITGA5) activity is related to cell proliferation, differentiation, migration, and organ development. However, the involvement of ITGA5 in the biological functions of human dental pulp stem cells (hDPSCs) has not been explored. The aim of this study was to investigate the role of ITGA5 in the proliferation and odontogenic differentiation of hDPSCs. We knocked down ITGA5 in hDPSCs using lentivirus-mediated ITGA5 short hairpin RNA (shRNA). Changes in the proliferation in hDPSCs infected with lentiviruses expressing ITGA5-specific shRNA or negative control shRNA were examined using the 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay and 5-ethynyl-2'-deoxyuridine labeling. Both ITGA5 knockdown cells and shMock cells were cultured in mineralization medium for 3 weeks, and the differentiation of cells was detected with alizarin red S staining. The expression of odontogenic differentiation-related molecular markers was assessed using real-time polymerase chain reaction and Western blot assays. The knockdown of ITGA5 decreased the proliferation capacity of hDPSCs. ITGA5 shRNA promoted odontogenic differentiation of hDPSCs with the enhanced formation of mineralized nodules. It also up-regulated the messenger RNA expression of multiple markers of odontogenesis and the expression of dentin sialophosphoprotein protein. These findings suggest that ITGA5 plays an important role in maintaining hDPSCs in a proliferative state. The inhibition of ITGA5 signaling promotes the odontogenic differentiation of hDPSCs. Copyright © 2014 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.
HPV16 E6 regulates annexin 1 (ANXA1) protein expression in cervical carcinoma cell lines
International Nuclear Information System (INIS)
Calmon, Marilia Freitas; Sichero, Laura; Boccardo, Enrique; Villa, Luisa Lina; Rahal, Paula
2016-01-01
Annexin 1 (ANXA1) is a substrate for E6AP mediated ubiquitylation. It has been hypothesized that HPV 16 E6 protein redirects E6AP away from ANXA1, increasing its stability and possibly contributing to viral pathogenesis. We analyzed ANXA1 expression in HPV-positive and negative cervical carcinoma-derived cells, in cells expressing HPV-16 oncogenes and in cells transduced with shRNA targeting E6AP. We observed that ANXA1 protein expression increased in HPV-16-positive tumor cells, in keratinocytes expressing HPV-16 E6wt (wild-type) or E6/E7 and C33 cells expressing HPV-16 E6wt. ANXA1 protein expression decreased in cells transfected with E6 Dicer-substrate RNAs (DsiRNA) and C33 cells cotransduced with HPV-16 E6wt and E6AP shRNA. Moreover, colony number and proliferation rate decreased in HPV16-positive cells transduced with ANXA1 shRNA. We observed that in cells infected with HPV16, the E6 binds to E6AP to degrade p53 and upregulate ANXA1. We suggest that ANXA1 may play a role in HPV-mediated carcinogenesis. - Highlights: • ANXA1 upregulation requires the presence of E6 and E6AP and is dependent on E6 integrity. • E6 binds to E6AP to degrade p53 and upregulate ANXA1 in cells infected with HPV16. • ANXA1 plays a role in cell proliferation in HPV-positive cervical cells.
HPV16 E6 regulates annexin 1 (ANXA1) protein expression in cervical carcinoma cell lines
Energy Technology Data Exchange (ETDEWEB)
Calmon, Marilia Freitas [Department of Biology, Institute of Bioscience, Language and Exact Science, São Paulo State University, São Jose do Rio Preto (Brazil); Sichero, Laura [Molecular Biology Laboratory, Centre for Translational Research in Oncology, Instituto do Câncer do Estado de São Paulo (ICESP), São Paulo (Brazil); Boccardo, Enrique [Department of Microbiology, Institute of Biomedical Sciences, University of São Paulo., São Paulo (Brazil); Villa, Luisa Lina [Department of Radiology and Oncology, Faculdade de Medicina, Universidade de São Paulo, São Paulo (Brazil); Rahal, Paula, E-mail: rahalp@yahoo.com.br [Department of Biology, Institute of Bioscience, Language and Exact Science, São Paulo State University, São Jose do Rio Preto (Brazil)
2016-09-15
Annexin 1 (ANXA1) is a substrate for E6AP mediated ubiquitylation. It has been hypothesized that HPV 16 E6 protein redirects E6AP away from ANXA1, increasing its stability and possibly contributing to viral pathogenesis. We analyzed ANXA1 expression in HPV-positive and negative cervical carcinoma-derived cells, in cells expressing HPV-16 oncogenes and in cells transduced with shRNA targeting E6AP. We observed that ANXA1 protein expression increased in HPV-16-positive tumor cells, in keratinocytes expressing HPV-16 E6wt (wild-type) or E6/E7 and C33 cells expressing HPV-16 E6wt. ANXA1 protein expression decreased in cells transfected with E6 Dicer-substrate RNAs (DsiRNA) and C33 cells cotransduced with HPV-16 E6wt and E6AP shRNA. Moreover, colony number and proliferation rate decreased in HPV16-positive cells transduced with ANXA1 shRNA. We observed that in cells infected with HPV16, the E6 binds to E6AP to degrade p53 and upregulate ANXA1. We suggest that ANXA1 may play a role in HPV-mediated carcinogenesis. - Highlights: • ANXA1 upregulation requires the presence of E6 and E6AP and is dependent on E6 integrity. • E6 binds to E6AP to degrade p53 and upregulate ANXA1 in cells infected with HPV16. • ANXA1 plays a role in cell proliferation in HPV-positive cervical cells.
Genome-wide association of mediator and RNA polymerase II in wild-type and mediator mutant yeast.
Paul, Emily; Zhu, Z Iris; Landsman, David; Morse, Randall H
2015-01-01
Mediator is a large, multisubunit complex that is required for essentially all mRNA transcription in eukaryotes. In spite of the importance of Mediator, the range of its targets and how it is recruited to these is not well understood. Previous work showed that in Saccharomyces cerevisiae, Mediator contributes to transcriptional activation by two distinct mechanisms, one depending on the tail module triad and favoring SAGA-regulated genes, and the second occurring independently of the tail module and favoring TFIID-regulated genes. Here, we use chromatin immunoprecipitation sequencing (ChIP-seq) to show that dependence on tail module subunits for Mediator recruitment and polymerase II (Pol II) association occurs preferentially at SAGA-regulated over TFIID-regulated genes on a genome-wide scale. We also show that recruitment of tail module subunits to active gene promoters continues genome-wide when Mediator integrity is compromised in med17 temperature-sensitive (ts) yeast, demonstrating the modular nature of the Mediator complex in vivo. In addition, our data indicate that promoters exhibiting strong and stable occupancy by Mediator have a wide range of activity and are enriched for targets of the Tup1-Cyc8 repressor complex. We also identify a number of strong Mediator occupancy peaks that overlap dubious open reading frames (ORFs) and are likely to include previously unrecognized upstream activator sequences. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Starkey, Jason L.; Chiari, Estelle F.; Isom, Harriet C.
2009-01-01
Hepatitis B virus (HBV) covalently closed circular DNA (CCC DNA) is the source of HBV transcripts and persistence in chronically infected patients. The novel aspect of this study was to determine the effect of RNA interference (RNAi) on HBV CCC DNA when administered prior to establishment of HBV replication or during chronic HBV infection. HBV replication was initiated in HepG2 cells by transduction with HBV baculovirus. Subculture of HBV expressing HepG2 cells at 10 days post-transduction ge...
Exosome-mediated microRNA transfer plays a role in radiation-induced bystander effect.
Xu, Shuai; Wang, Jufang; Ding, Nan; Hu, Wentao; Zhang, Xurui; Wang, Bing; Hua, Junrui; Wei, Wenjun; Zhu, Qiyun
2015-01-01
Bystander effects can be induced through cellular communication between irradiated cells and non-irradiated cells. The signals that mediate this cellular communication, such as cytokines, reactive oxygen species, nitric oxide and even microRNAs, can be transferred between cells via gap junctions or extracellular medium. We have previously reported that miR-21, a well described DDR (DNA damage response) microRNA, is involved in radiation-induced bystander effects through a medium-mediated way. However, the mechanisms of the microRNA transfer have not been elucidated in details. In the present study, it was found that exosomes isolated from irradiated conditioned medium could induce bystander effects. Furthermore, we demonstrated plenty of evidences that miR-21, which is up-regulated as a result of mimic transfection or irradiation, can be transferred from donor or irradiated cells into extracellular medium and subsequently get access to the recipient or bystander cells through exosomes to induce bystander effects. Inhibiting the miR-21 expression in advance can offset the bystander effects to some extent. From all of these results, it can be concluded that the exosome-mediated microRNA transfer plays an important role in the radiation-induced bystander effects. These findings provide new insights into the functions of microRNAs and the cellular communication between the directly irradiated cells and the non-irradiated cells.
Kai, Yoshiro; Tomoda, Koichi; Yoneyama, Hiroyuki; Yoshikawa, Masanori; Kimura, Hiroshi
2015-12-09
Chondroitin sulfate proteoglycans are an important mediators in inflammation and leukocyte trafficking. However, their roles in pulmonary emphysema have not been explored. In a murine model of elastase-induced pulmonary emphysema, we found increased carbohydrate sulfotransferase 3 (CHST3), a specific enzyme that synthesizes chondroitin 6-sulfate proteoglycan (C6SPG). To elucidate the role of C6SPG, we investigated the effect of small interfering RNA (siRNA) targeting CHST3 that inhibits C6SPG-synthesis on the pathogenesis of pulmonary emphysema. Mice were intraperitoneally injected with CHST3 siRNA or negative control siRNA on day0 and 7 after intratracheal instillation of elastase. Histology, respiratory function, glycosaminoglycans (GAGs) content, bronchoalveolar lavage (BAL), elastin staining and gene expressions of tumor necrosis factor (TNF)-α and matrix metalloproteinase (MMP)-9 mRNA were evaluated on day7 and/or day21. CHST3 mRNA increased at day 7 and decreased thereafter in lung. CHST3 siRNA successfully inhibited the expression of CHST3 mRNA throughout the study and this was associated with significant reduction of GAGs and C6SPG. Airway destruction and respiratory function were improved by the treatment with CHST3 siRNA. CHST3 siRNA reduced the number of macrophages both in BAL and lung parenchyma and also suppressed the increased expressions of TNF-α and MMP-9 mRNA. Futhermore, CHST3 siRNA improved the reduction of the elastin in the alveolar walls. CHST3 siRNA diminishes accumulation of excessive macrophages and the mediators, leading to accelerate the functional recovery from airway damage by repair of the elastin network associated with pulmonary emphysema.
[Construction and selection of effective mouse Smad6 recombinant lenti-virus interference vectors].
Yu, Jing; Qi, Mengchun; Deng, Jiupeng; Liu, Gang; Chen, Huaiqing
2010-10-01
This experiment was designed to construct mouse Smad6 recombinant RNA interference vectors and determine their interference effects on bone marrow mesenchymal stem cells (BMSCs). Three recombinant Smad6 RNA interference vectors were constructed by molecular clone techniques with a lenti-virus vector expressing green fluorescent protein (GFP), and the correctness of recombinant vectors was verified by DNA sequencing. Mouse BMSCs were used for transfection experiments and BMP-2 was in use for osteogenic induction of MSCs. The transfection efficiency of recombinant vectors was examined by Laser confocal scanning microscope and the interference effect of recombinant vectors on Smad6 gene expression was determined by real-time RT-PCR and Western blot, respectively. Three Smad6 recombinant RNA interference vectors were successfully constructed and their correctness was proved by DNA sequencing. After transfection, GFPs were effectively expressed in MSCs and all of three recombinant vectors gained high transfection efficiency (> 95%). Both real-time PCR and Western blot examination indicated that among three recombinant vectors, No. 2 Svector had the best interference effect and the interference effect was nearly 91% at protein level. In conclusion, Mouse recombinant Smad6 RNA interference (RNAi) vector was successfully constructed and it provided an effective tool for further studies on BMP signal pathways.
MicroRNA-Mediated Gene Silencing in Plant Defense and Viral Counter-Defense
Directory of Open Access Journals (Sweden)
Sheng-Rui Liu
2017-09-01
Full Text Available MicroRNAs (miRNAs are non-coding RNAs of approximately 20–24 nucleotides in length that serve as central regulators of eukaryotic gene expression by targeting mRNAs for cleavage or translational repression. In plants, miRNAs are associated with numerous regulatory pathways in growth and development processes, and defensive responses in plant–pathogen interactions. Recently, significant progress has been made in understanding miRNA-mediated gene silencing and how viruses counter this defense mechanism. Here, we summarize the current knowledge and recent advances in understanding the roles of miRNAs involved in the plant defense against viruses and viral counter-defense. We also document the application of miRNAs in plant antiviral defense. This review discusses the current understanding of the mechanisms of miRNA-mediated gene silencing and provides insights on the never-ending arms race between plants and viruses.
[Knockdown of STAT3 inhibits proliferation and migration of HepG2 hepatoma cells induced by IFN1].
Li, Xiaofang; Wang, Yuqi; Yan, Ben; Fang, Peipei; Ma, Chao; Xu, Ning; Fu, Xiaoyan; Liang, Shujuan
2018-02-01
Objective To prepare lentiviruses expressing shRNA sequences targeting human signal transducer and activator of transcription 3 (STAT3) and detect the effect of STAT3 knockdown on type I interferon (IFN1)-induced proliferation and migration in HepG2 cells. Methods Four STAT3-targeting shRNA sequences (shRNA1-shRNA4) and one control sequence (Ctrl shRNA) were selected and cloned respectively into pLKO.1-sp6-pgk-GFP to construct shRNA-expressing vectors. Along with backbone psPAX2 and pMD2.G vectors, they were separately transfected into HEK293T cells to prepare lentiviruses. HepG2 cells were infected with the lentiviruses. Cytoplastic STAT3 level was detected by Western blotting to screen effective shRNA sequence(s) targeting STAT3. Proliferation and migration of HepG2 cells were analyzed by CCK-8 assay and Transwell TM migration and scratching assay, respectively. To detect the effect of IFN1 on cell proliferation and migration of HepG2 cells, the cells were treated with 2000 U/mL IFNα2b for indicated time and the activation of IFN-triggered STAT1 signal transduction was assayed by Western blotting. Results Two most effective STAT3-targeting shRNA sequences shRNA1 and shRNA2 were selected, and the expression of both STAT3 shRNA significantly decreased proliferation and migration of HepG2 cells. When treated with IFNα2b, 2000 U/mL of IFN1 showed more competent in attenuating growth and migration of HepG2 cells. Our data further proved that knockdown of STAT3 increased the phosphorylation of STAT1, and IFNα2b further enhanced the activation of STAT1 signaling in HepG2 cells. Conclusion Knockdown of STAT3 inhibits cell migration and growth, and rescues IFN response through up-regulating STAT1 signal transduction in HepG2 hepatoma cells.
Autocrine IL-6 mediates pituitary tumor senescence
Fuertes, Mariana; Ajler, Pablo; Carrizo, Guillermo; Cervio, Andrés; Sevlever, Gustavo; Stalla, Günter K.; Arzt, Eduardo
2017-01-01
Cellular senescence is a stable proliferative arrest state. Pituitary adenomas are frequent and mostly benign, but the mechanism for this remains unknown. IL-6 is involved in pituitary tumor progression and is produced by the tumoral cells. In a cell autonomous fashion, IL-6 participates in oncogene-induced senescence in transduced human melanocytes. Here we prove that autocrine IL-6 participates in pituitary tumor senescence. Endogenous IL-6 inhibition in somatotroph MtT/S shRNA stable clones results in decreased SA-β-gal activity and p16INK4a but increased pRb, proliferation and invasion. Nude mice injected with IL-6 silenced clones develop tumors contrary to MtT/S wild type that do not, demonstrating that clones that escape senescence are capable of becoming tumorigenic. When endogenous IL-6 is silenced, cell cultures derived from positive SA-β-gal human tumor samples decrease the expression of the senescence marker. Our results establish that IL-6 contributes to maintain senescence by its autocrine action, providing a natural model of IL-6 mediated benign adenoma senescence. PMID:27902467
Potential microRNA-mediated oncogenic intercellular communication revealed by pan-cancer analysis
Li, Yue; Zhang, Zhaolei
2014-11-01
Carcinogenesis consists of oncogenesis and metastasis, and intriguingly microRNAs (miRNAs) are involved in both processes. Although aberrant miRNA activities are prevalent in diverse tumor types, the exact mechanisms for how they regulate cancerous processes are not always clear. To this end, we performed a large-scale pan-cancer analysis via a novel probabilistic approach to infer recurrent miRNA-target interactions implicated in 12 cancer types using data from The Cancer Genome Atlas. We discovered ~20,000 recurrent miRNA regulations, which are enriched for cancer-related miRNAs/genes. Notably, miRNA 200 family (miR-200/141/429) is among the most prominent miRNA regulators, which is known to be involved in metastasis. Importantly, the recurrent miRNA regulatory network is not only enriched for cancer pathways but also for extracellular matrix (ECM) organization and ECM-receptor interactions. The results suggest an intriguing cancer mechanism involving miRNA-mediated cell-to-cell communication, which possibly involves delivery of tumorigenic miRNA messengers to adjacent cells via exosomes. Finally, survival analysis revealed 414 recurrent-prognostic associations, where both gene and miRNA involved in each interaction conferred significant prognostic power in one or more cancer types. Together, our comprehensive pan-cancer analysis provided not only biological insights into metastasis but also brought to bear the clinical relevance of the proposed recurrent miRNA-gene associations.
Li, Chaoxing; Dinu, Valentin
2018-03-22
MicroRNAs (miRNAs) are small, non-coding RNAs involved in the regulation of gene expression at a post-transcriptional level. Recent studies have shown miRNAs as key regulators of a variety of biological processes, such as proliferation, differentiation, apoptosis, metabolism, etc. Aberrantly expressed miRNAs influence individual gene expression level, but rewired miRNA-mRNA connections can influence the activity of biological pathways. Here, we define rewired miRNA-mRNA connections as the differential (rewiring) effects on the activity of biological pathways between hepatocellular carcinoma (HCC) and normal phenotypes. Our work presented here uses a PageRank-based approach to measure the degree of miRNA-mediated dysregulation of biological pathways between HCC and normal samples based on rewired miRNA-mRNA connections. In our study, we regard the degree of miRNA-mediated dysregulation of biological pathways as disease risk of biological pathways. Therefore, we propose a new method, miR2Pathway, to measure and rank the degree of miRNA-mediated dysregulation of biological pathways by measuring the total differential influence of miRNAs on the activity of pathways between HCC and normal states. miR2Pathway proposed here systematically shows the first evidence for a mechanism of biological pathways being dysregulated by rewired miRNA-mRNA connections, and provides new insight into exploring mechanisms behind HCC. Thus, miR2Pathway is a novel method to identify and rank miRNA-dysregulated pathways in HCC. Copyright © 2018. Published by Elsevier Inc.
Directory of Open Access Journals (Sweden)
Md Shamim Hossain
Full Text Available The special glycerophospholipids plasmalogens (Pls are enriched in the brain and reported to prevent neuronal cell death by enhancing phosphorylation of Akt and ERK signaling in neuronal cells. Though the activation of Akt and ERK was found to be necessary for the neuronal cells survival, it was not known how Pls enhanced cellular signaling. To answer this question, we searched for neuronal specific orphan GPCR (G-protein coupled receptor proteins, since these proteins were believed to play a role in cellular signal transduction through the lipid rafts, where both Pls and some GPCRs were found to be enriched. In the present study, pan GPCR inhibitor significantly reduced Pls-induced ERK signaling in neuronal cells, suggesting that Pls could activate GPCRs to induce signaling. We then checked mRNA expression of 19 orphan GPCRs and 10 of them were found to be highly expressed in neuronal cells. The knockdown of these 10 neuronal specific GPCRs by short hairpin (sh-RNA lentiviral particles revealed that the Pls-mediated phosphorylation of ERK was inhibited in GPR1, GPR19, GPR21, GPR27 and GPR61 knockdown cells. We further found that the overexpression of these GPCRs enhanced Pls-mediated phosphorylation of ERK and Akt in cells. Most interestingly, the GPCRs-mediated cellular signaling was reduced significantly when the endogenous Pls were reduced. Our cumulative data, for the first time, suggest a possible mechanism for Pls-induced cellular signaling in the nervous system.
EGF receptor targeted lipo-oligocation polyplexes for antitumoral siRNA and miRNA delivery
Müller, Katharina; Klein, Philipp M.; Heissig, Philipp; Roidl, Andreas; Wagner, Ernst
2016-11-01
Antitumoral siRNA and miRNA delivery was demonstrated by epidermal growth factor receptor (EGFR) targeted oligoaminoamide polyplexes. For this purpose, the T-shaped lipo-oligomer 454 was used to complex RNA into a core polyplex, which was subsequently functionalized with the targeting peptide ligand GE11 via a polyethylene glycol (PEG) linker. To this end, free cysteines on the surface of 454 polyplex were coupled with a maleimide-PEG-GE11 reagent (Mal-GE11). Resulting particles with sizes of 120-150 nm showed receptor-mediated uptake into EGFR-positive T24 bladder cancer cells, MDA-MB 231 breast cancer cells and Huh7 liver cancer cells. Furthermore, these formulations led to ligand-dependent gene silencing. RNA interference (RNAi) triggered antitumoral effects were observed for two different therapeutic RNAs, a miRNA-200c mimic or EG5 siRNA. Using polyplexes modified with a ratio of 0.8 molar equivalents of Mal-GE11, treatment of T24 or MDA-MB 231 cancer cells with miR-200c led to the expected decreased proliferation and migration, changes in cell cycle and enhanced sensitivity towards doxorubicin. Delivery of EG5 siRNA into Huh7 cells resulted in antitumoral activity with G2/M arrest, triggered by loss of mitotic spindle separation and formation of mono-astral spindles. These findings demonstrate the potential of GE11 ligand-containing RNAi polyplexes for cancer treatment.
Early endonuclease-mediated evasion of RNA sensing ensures efficient coronavirus replication.
Directory of Open Access Journals (Sweden)
Eveline Kindler
2017-02-01
Full Text Available Coronaviruses are of veterinary and medical importance and include highly pathogenic zoonotic viruses, such as SARS-CoV and MERS-CoV. They are known to efficiently evade early innate immune responses, manifesting in almost negligible expression of type-I interferons (IFN-I. This evasion strategy suggests an evolutionary conserved viral function that has evolved to prevent RNA-based sensing of infection in vertebrate hosts. Here we show that the coronavirus endonuclease (EndoU activity is key to prevent early induction of double-stranded RNA (dsRNA host cell responses. Replication of EndoU-deficient coronaviruses is greatly attenuated in vivo and severely restricted in primary cells even during the early phase of the infection. In macrophages we found immediate induction of IFN-I expression and RNase L-mediated breakdown of ribosomal RNA. Accordingly, EndoU-deficient viruses can retain replication only in cells that are deficient in IFN-I expression or sensing, and in cells lacking both RNase L and PKR. Collectively our results demonstrate that the coronavirus EndoU efficiently prevents simultaneous activation of host cell dsRNA sensors, such as Mda5, OAS and PKR. The localization of the EndoU activity at the site of viral RNA synthesis-within the replicase complex-suggests that coronaviruses have evolved a viral RNA decay pathway to evade early innate and intrinsic antiviral host cell responses.
Cyclic-AMP mediated regulation of ABCB mRNA expression in mussel haemocytes.
Directory of Open Access Journals (Sweden)
Silvia Franzellitti
Full Text Available BACKGROUND: The multixenobiotic resistance system (MXR allows aquatic organisms to cope with their habitat despite high pollution levels by over-expressing membrane and intracellular transporters, including the P-glycoprotein (Pgp. In mammals transcription of the ABCB1 gene encoding Pgp is under cAMP/PKA-mediated regulation; whether this is true in mollusks is not fully clarified. METHODOLOGY/PRINCIPAL FINDINGS: cAMP/PKA regulation and ABCB mRNA expression were assessed in haemocytes from Mediterranean mussels (Mytilus galloprovincialis exposed in vivo for 1 week to 0.3 ng/L fluoxetine (FX alone or in combination with 0.3 ng/L propranolol (PROP. FX significantly decreased cAMP levels and PKA activity, and induced ABCB mRNA down-regulation. FX effects were abolished in the presence of PROP. In vitro experiments using haemocytes treated with physiological agonists (noradrenaline and serotonin and pharmacological modulators (PROP, forskolin, dbcAMP, and H89 of the cAMP/PKA system were performed to obtain clear evidence about the involvement of the signaling pathway in the transcriptional regulation of ABCB. Serotonin (5-HT decreased cAMP levels, PKA activity and ABCB mRNA expression but increased the mRNA levels for a putative 5-HT1 receptor. Interestingly, 5-HT1 was also over-expressed after in vivo exposures to FX. 5-HT effects were counteracted by PROP. Forskolin and dbcAMP increased PKA activity as well as ABCB mRNA expression; the latter effect was abolished in the presence of the PKA inhibitor H89. CONCLUSIONS: This study provides the first direct evidence for the cAMP/PKA-mediated regulation of ABCB transcription in mussels.
Katoch, Rajan; Thakur, Neelam
2013-03-01
This review highlights the advances in the knowledge of RNA interference (RNAi) and discusses recent progress on the functionality of different components RNAi machinery operating in the organisms. The silencing of genes by RNA interference has become the technology of choice for investigation of gene functions in different organisms. The refinement in the knowledge of the endogenous RNAi pathways in plants along with the development of new strategies and applications for the improvement of nutritional value of important agricultural crops through suppression of genes in different plants have opened new vistas for nutritional security. The improvement in the nutritional status of the plants and reduction in the level of toxins or antinutrients was desired for long, but the available technology was not completely successful in achieving the tissue specific regulation of some genes. In the recent years, a number of economically important crop plants have been tested successfully for improving plant nutritional value through metabolic engineering using RNAi. The implications of this technology for crop improvement programs, including nutritional enrichment, reduction of antinutrients, disease, and insect control have been successfully tested in variety of crops with commercial considerations. The enhancement of the nutraceutical traits for the desired health benefits in common crop plants through manipulation of gene expression has been elaborated in this article. The tremendous potential with RNAi technology is expected to revolutionize the modern agriculture for meeting the growing challenges is discussed.
Cotton Leaf Curl virus Disease (CLCuD) has caused enormous losses in cotton (Gossypium hirsutum) production in Pakistan. RNA interference (RNAi) is an emerging technique that could knock out CLCuD by targeting different regions of the pathogen genome that are important for replication, transcription...
Hif1a inactivation rescues photoreceptor degeneration induced by a chronic hypoxia-like stress.
Barben, Maya; Ail, Divya; Storti, Federica; Klee, Katrin; Schori, Christian; Samardzija, Marijana; Michalakis, Stylianos; Biel, Martin; Meneau, Isabelle; Blaser, Frank; Barthelmes, Daniel; Grimm, Christian
2018-04-17
Reduced choroidal blood flow and tissue changes in the ageing human eye impair oxygen delivery to photoreceptors and the retinal pigment epithelium. As a consequence, mild but chronic hypoxia may develop and disturb cell metabolism, function and ultimately survival, potentially contributing to retinal pathologies such as age-related macular degeneration (AMD). Here, we show that several hypoxia-inducible genes were expressed at higher levels in the aged human retina suggesting increased activity of hypoxia-inducible transcription factors (HIFs) during the physiological ageing process. To model chronically elevated HIF activity and investigate ensuing consequences for photoreceptors, we generated mice lacking von Hippel Lindau (VHL) protein in rods. This activated HIF transcription factors and led to a slowly progressing retinal degeneration in the ageing mouse retina. Importantly, this process depended mainly on HIF1 with only a minor contribution of HIF2. A gene therapy approach using AAV-mediated RNA interference through an anti-Hif1a shRNA significantly mitigated the degeneration suggesting a potential intervention strategy that may be applicable to human patients.
Kinetics of lipid-nanoparticle-mediated intracellular mRNA delivery and function
Zhdanov, Vladimir P.
2017-10-01
mRNA delivery into cells forms the basis for one of the new and promising ways to treat various diseases. Among suitable carriers, lipid nanoparticles (LNPs) with a size of about 100 nm are now often employed. Despite high current interest in this area, the understanding of the basic details of LNP-mediated mRNA delivery and function is limited. To clarify the kinetics of mRNA release from LNPs, the author uses three generic models implying (i) exponential, (ii) diffusion-controlled, and (iii) detachment-controlled kinetic regimes, respectively. Despite the distinct differences in these kinetics, the associated transient kinetics of mRNA translation to the corresponding protein and its degradation are shown to be not too sensitive to the details of the mRNA delivery by LNPs (or other nanocarriers). In addition, the author illustrates how this protein may temporarily influence the expression of one gene or a few equivalent genes. The analysis includes positive or negative regulation of the gene transcription via the attachment of the protein without or with positive or negative feedback in the gene expression. Stable, bistable, and oscillatory schemes have been scrutinized in this context.
Directory of Open Access Journals (Sweden)
Zach N Adelman
Full Text Available The impact of global climate change on the transmission dynamics of infectious diseases is the subject of extensive debate. The transmission of mosquito-borne viral diseases is particularly complex, with climatic variables directly affecting many parameters associated with the prevalence of disease vectors. While evidence shows that warmer temperatures often decrease the extrinsic incubation period of an arthropod-borne virus (arbovirus, exposure to cooler temperatures often predisposes disease vector mosquitoes to higher infection rates. RNA interference (RNAi pathways are essential to antiviral immunity in the mosquito; however, few experiments have explored the effects of temperature on the RNAi machinery.We utilized transgenic "sensor" strains of Aedes aegypti to examine the role of temperature on RNA silencing. These "sensor" strains express EGFP only when RNAi is inhibited; for example, after knockdown of the effector proteins Dicer-2 (DCR-2 or Argonaute-2 (AGO-2. We observed an increase in EGFP expression in transgenic sensor mosquitoes reared at 18°C as compared with 28°C. Changes in expression were dependent on the presence of an inverted repeat with homology to a portion of the EGFP sequence, as transgenic strains lacking this sequence, the double stranded RNA (dsRNA trigger for RNAi, showed no change in EGFP expression when reared at 18°C. Sequencing small RNAs in sensor mosquitoes reared at low temperature revealed normal processing of dsRNA substrates, suggesting the observed deficiency in RNAi occurs downstream of DCR-2. Rearing at cooler temperatures also predisposed mosquitoes to higher levels of infection with both chikungunya and yellow fever viruses.This data suggest that microclimates, such as those present in mosquito breeding sites, as well as more general climactic variables may influence the dynamics of mosquito-borne viral diseases by affecting the antiviral immunity of disease vectors.
Zhang, Qian; Cao, De-Li; Zhang, Zhi-Jun; Jiang, Bao-Chun; Gao, Yong-Jing
2016-07-11
Trigeminal nerve damage-induced neuropathic pain is a severely debilitating chronic orofacial pain syndrome. Spinal chemokine CXCL13 and its receptor CXCR5 were recently demonstrated to play a pivotal role in the pathogenesis of spinal nerve ligation-induced neuropathic pain. Whether and how CXCL13/CXCR5 in the trigeminal ganglion (TG) mediates orofacial pain are unknown. The partial infraorbital nerve ligation (pIONL) was used to induce trigeminal neuropathic pain in mice. The expression of ATF3, CXCL13, CXCR5, and phosphorylated extracellular signal-regulated kinase (pERK) in the TG was detected by immunofluorescence staining and western blot. The effect of shRNA targeting on CXCL13 or CXCR5 on pain hypersensitivity was checked by behavioral testing. pIONL induced persistent mechanical allodynia and increased the expression of ATF3, CXCL13, and CXCR5 in the TG. Inhibition of CXCL13 or CXCR5 by shRNA lentivirus attenuated pIONL-induced mechanical allodynia. Additionally, pIONL-induced neuropathic pain and the activation of ERK in the TG were reduced in Cxcr5 (-/-) mice. Furthermore, MEK inhibitor (PD98059) attenuated mechanical allodynia and reduced TNF-α and IL-1β upregulation induced by pIONL. TNF-α inhibitor (Etanercept) and IL-1β inhibitor (Diacerein) attenuated pIONL-induced orofacial pain. Finally, intra-TG injection of CXCL13 induced mechanical allodynia, increased the activation of ERK and the production of TNF-α and IL-1β in the TG of WT mice, but not in Cxcr5 (-/-) mice. Pretreatment with PD98059, Etanercept, or Diacerein partially blocked CXCL13-induced mechanical allodynia, and PD98059 also reduced CXCL13-induced TNF-α and IL-1β upregulation. CXCL13 and CXCR5 contribute to orofacial pain via ERK-mediated proinflammatory cytokines production. Targeting CXCL13/CXCR5/ERK/TNF-α and IL-1β pathway in the trigeminal ganglion may offer effective treatment for orofacial neuropathic pain.
Cyclophilin B is a functional regulator of hepatitis C virus RNA polymerase.
Watashi, Koichi; Ishii, Naoto; Hijikata, Makoto; Inoue, Daisuke; Murata, Takayuki; Miyanari, Yusuke; Shimotohno, Kunitada
2005-07-01
Viruses depend on host-derived factors for their efficient genome replication. Here, we demonstrate that a cellular peptidyl-prolyl cis-trans isomerase (PPIase), cyclophilin B (CyPB), is critical for the efficient replication of the hepatitis C virus (HCV) genome. CyPB interacted with the HCV RNA polymerase NS5B to directly stimulate its RNA binding activity. Both the RNA interference (RNAi)-mediated reduction of endogenous CyPB expression and the induced loss of NS5B binding to CyPB decreased the levels of HCV replication. Thus, CyPB functions as a stimulatory regulator of NS5B in HCV replication machinery. This regulation mechanism for viral replication identifies CyPB as a target for antiviral therapeutic strategies.
Chimeric peptide-mediated siRNA transduction to inhibit HIV-1 infection.
Bivalkar-Mehla, Shalmali; Mehla, Rajeev; Chauhan, Ashok
2017-04-01
Persistent human immunodeficiency virus 1 (HIV-1) infection provokes immune activation and depletes CD4 + lymphocytes, leading to acquired immunodeficiency syndrome. Uninterrupted administration of combination antiretroviral therapy (cART) in HIV-infected patients suppresses viral replication to below the detectable level and partially restores the immune system. However, cART-unresponsive residual HIV-1 infection and elusive transcriptionally silent but reactivatable viral reservoirs maintain a permanent viral DNA blue print. The virus rebounds within a few weeks after interruption of suppressive therapy. Adjunct gene therapy to control viral replication by ribonucleic acid interference (RNAi) is a post-transcriptional gene silencing strategy that could suppress residual HIV-1 burden and overcome viral resistance. Small interfering ribonucleic acids (siRNAs) are efficient transcriptional inhibitors, but need delivery systems to reach inside target cells. We investigated the potential of chimeric peptide (FP-PTD) to deliver specific siRNAs to HIV-1-susceptible and permissive cells. Chimeric FP-PTD peptide was designed with an RNA binding domain (PTD) to bind siRNA and a cell fusion peptide domain (FP) to enter cells. FP-PTD-siRNA complex entered and inhibited HIV-1 replication in susceptible cells, and could be a candidate for in vivo testing.
Li, Ming; Radvanyi, Laszlo; Yin, Bingnan; Li, Jia; Chivukula, Raghavender; Lin, Kevin; Lu, Yue; Shen, JianJun; Chang, David Z.; Li, Donghui; Johanning, Gary L.; Wang-Johanning, Feng
2017-01-01
Purpose We investigated the role of the human endogenous retrovirus type K (HERV-K) envelope (env) gene in pancreatic cancer (PC). Experimental Design shRNA was employed to knockdown (KD) the expression of HERV-K in PC cells. Results HERV-K env expression was detected in seven PC cell lines and in 80% of PC patient biopsies, but not in two normal pancreatic cell lines or uninvolved normal tissues. A new HERV-K splice variant was discovered in several PC cell lines. RT activity and virus-like particles were observed in culture media supernatant obtained from Panc-1 and Panc-2 cells. HERV-K viral RNA levels and anti-HERV-K antibody titers were significantly higher in PC patient sera (N=106) than in normal donor sera (N=40). Importantly, the in vitro and in vivo growth rates of three PC cell lines were significantly reduced after HERV-K KD by shRNA targeting HERV-K env, and there was reduced metastasis to lung after treatment. RNA-seq results revealed changes in gene expression after HERV-K env KD, including RAS and TP53. Furthermore, downregulation of HERV-K Env protein expression by shRNA also resulted in decreased expression of RAS, p-ERK, p-RSK, and p-AKT in several PC cells or tumors. Conclusion These results demonstrate that HERV-K influences signal transduction via the RAS-ERK-RSK pathway in PC. Our data highlight the potentially important role of HERV-K in tumorigenesis and progression of PC, and indicate that HERV-K viral proteins may be attractive biomarkers and/or tumor-associated antigens, as well as potentially useful targets for detection, diagnosis and immunotherapy of PC. PMID:28679769
Yu, Jisuk; Lee, Kyung-Mi; Cho, Won Kyong; Park, Ju Yeon; Kim, Kook-Hyung
2018-05-01
The mechanisms of RNA interference (RNAi) as a defense response against viruses remain unclear in many plant-pathogenic fungi. In this study, we used reverse genetics and virus-derived small RNA profiling to investigate the contributions of RNAi components to the antiviral response against Fusarium graminearum viruses 1 to 3 (FgV1, -2, and -3). Real-time reverse transcription-quantitative PCR (qRT-PCR) indicated that infection of Fusarium graminearum by FgV1, -2, or -3 differentially induces the gene expression of RNAi components in F. graminearum Transcripts of the DICER-2 and AGO-1 genes of F. graminearum ( FgDICER-2 and FgAGO-1 ) accumulated at lower levels following FgV1 infection than following FgV2 or FgV3 infection. We constructed gene disruption and overexpression mutants for each of the Argonaute and dicer genes and for two RNA-dependent RNA polymerase (RdRP) genes and generated virus-infected strains of each mutant. Interestingly, mycelial growth was significantly faster for the FgV1-infected FgAGO-1 overexpression mutant than for the FgV1-infected wild type, while neither FgV2 nor FgV3 infection altered the colony morphology of the gene deletion and overexpression mutants. FgV1 RNA accumulation was significantly decreased in the FgAGO-1 overexpression mutant. Furthermore, the levels of induction of FgAGO-1 , FgDICER-2 , and some of the FgRdRP genes caused by FgV2 and FgV3 infection were similar to those caused by hairpin RNA-induced gene silencing. Using small RNA sequencing analysis, we documented different patterns of virus-derived small interfering RNA (vsiRNA) production in strains infected with FgV1, -2, and -3. Our results suggest that the Argonaute protein encoded by FgAGO-1 is required for RNAi in F. graminearum , that FgAGO-1 induction differs in response to FgV1, -2, and -3, and that FgAGO-1 might contribute to the accumulation of vsiRNAs in FgV1-infected F. graminearum IMPORTANCE To increase our understanding of how RNAi components in Fusarium
RNA interference-based therapeutics: new strategies to fight infectious disease.
López-Fraga, M; Wright, N; Jiménez, A
2008-12-01
For many years, there has been an ongoing search for new compounds that can selectively alter gene expression as a new way to treat human disease by addressing targets that are otherwise "undruggable" with traditional pharmaceutical approaches involving small molecules or proteins. RNA interference (RNAi) strategies have raised a lot of attention and several compounds are currently being tested in clinical trials. Viruses are the obvious target for RNAi-therapy, as most are difficult to treat with conventional drugs, they become rapidly resistant to drug treatment and their genes differ substantially from human genes, minimizing side effects. Antisense strategy offers very high target specificity, i.e., any viral sequence could potentially be targeted using the complementary oligonucleotide sequence. Consequently, new antisense-based therapeutics have the potential to lead a revolution in the anti-infective drug development field. Additionally, the relatively short turnaround for efficacy testing of potential RNAi molecules and that any pathogen is theoretically amenable to rapid targeting, make them invaluable tools for treating a wide range of diseases. This review will focus on some of the current efforts to treat infectious disease with RNAi-based therapies and some of the obstacles that have appeared on the road to successful clinical intervention.
microRNA-mediated resistance to hypoglycemia in the HepG2 human hepatoma cell line
International Nuclear Information System (INIS)
Ueki, Satomi; Murakami, Yuko; Yamada, Shoji; Kimura, Masaki; Saito, Yoshimasa; Saito, Hidetsugu
2016-01-01
It is generally accepted that the energy resources of cancer cells rely on anaerobic metabolism or the glycolytic system, even if they have sufficient oxygen. This is known as the Warburg effect. The cells skillfully survive under hypoglycemic conditions when their circumstances change, which probably at least partly involves microRNA (miRNA)-mediated regulation. To determine how cancer cells exploit miRNA-mediated epigenetic mechanisms to survive in hypoglycemic conditions, we used DNA microarray analysis to comprehensively and simultaneously compare the expression of miRNAs and mRNAs in the HepG2 human hepatoma cell line and in cultured normal human hepatocytes. The hypoglycemic condition decreased the expression of miRNA-17-5p and -20a-5p in hepatoma cells and consequently upregulated the expression of their target gene p21. These regulations were also confirmed by using antisense inhibitors of these miRNAs. In addition to this change, the hypoglycemic condition led to upregulated expression of heat shock proteins and increased resistance to caspase-3-induced apoptosis. However, we could not identify miRNA-mediated regulations, despite using comprehensive detection. Several interesting genes were also found to be upregulated in the hypoglycemic condition by the microarray analysis, probably because of responding to this cellular stress. These results suggest that cancer cells skillfully survive in hypoglycemic conditions, which frequently occur in malignancies, and that some of the gene regulation of this process is manipulated by miRNAs. The online version of this article (doi:10.1186/s12885-016-2762-7) contains supplementary material, which is available to authorized users
Qi, Yanmei; Mair, Norbert; Kummer, Kai K.; Leitner, Michael G.; Camprubí-Robles, María; Langeslag, Michiel; Kress, Michaela
2018-01-01
Sphingosine-1-phosphate (S1P) is a bioactive sphingolipid involved in numerous physiological and pathophysiological processes. We have previously reported a S1P-induced nocifensive response in mice by excitation of sensory neurons via activation of an excitatory chloride current. The underlying molecular mechanism for the S1P-induced chloride conductance remains elusive. In the present study, we identified two CLCN voltage-gated chloride channels, CLCN3 and CLCN5, which mediated a S1P-induced excitatory Cl− current in sensory neurons by combining RNA-seq, adenovirus-based gene silencing and whole-cell electrophysiological voltage-clamp recordings. Downregulation of CLCN3 and CLCN5 channels by adenovirus-mediated delivery of shRNA dramatically reduced S1P-induced Cl− current and membrane depolarization in sensory neurons. The mechanism of S1P-induced activation of the chloride current involved Rho GTPase but not Rho-associated protein kinase. Although S1P-induced potentiation of TRPV1-mediated ionic currents also involved Rho-dependent process, the lack of correlation of the S1P-activated Cl− current and the potentiation of TRPV1 by S1P suggests that CLCN3 and CLCN5 are necessary components for S1P-induced excitatory Cl− currents but not for the amplification of TRPV1-mediated currents in sensory neurons. This study provides a novel mechanistic insight into the importance of bioactive sphingolipids in nociception. PMID:29479306
Directory of Open Access Journals (Sweden)
Yanmei Qi
2018-02-01
Full Text Available Sphingosine-1-phosphate (S1P is a bioactive sphingolipid involved in numerous physiological and pathophysiological processes. We have previously reported a S1P-induced nocifensive response in mice by excitation of sensory neurons via activation of an excitatory chloride current. The underlying molecular mechanism for the S1P-induced chloride conductance remains elusive. In the present study, we identified two CLCN voltage-gated chloride channels, CLCN3 and CLCN5, which mediated a S1P-induced excitatory Cl− current in sensory neurons by combining RNA-seq, adenovirus-based gene silencing and whole-cell electrophysiological voltage-clamp recordings. Downregulation of CLCN3 and CLCN5 channels by adenovirus-mediated delivery of shRNA dramatically reduced S1P-induced Cl− current and membrane depolarization in sensory neurons. The mechanism of S1P-induced activation of the chloride current involved Rho GTPase but not Rho-associated protein kinase. Although S1P-induced potentiation of TRPV1-mediated ionic currents also involved Rho-dependent process, the lack of correlation of the S1P-activated Cl− current and the potentiation of TRPV1 by S1P suggests that CLCN3 and CLCN5 are necessary components for S1P-induced excitatory Cl− currents but not for the amplification of TRPV1-mediated currents in sensory neurons. This study provides a novel mechanistic insight into the importance of bioactive sphingolipids in nociception.
The role of incoherent microRNA-mediated feedforward loops in noise buffering.
Directory of Open Access Journals (Sweden)
Matteo Osella
2011-03-01
Full Text Available MicroRNAs are endogenous non-coding RNAs which negatively regulate the expression of protein-coding genes in plants and animals. They are known to play an important role in several biological processes and, together with transcription factors, form a complex and highly interconnected regulatory network. Looking at the structure of this network, it is possible to recognize a few overrepresented motifs which are expected to perform important elementary regulatory functions. Among them, a special role is played by the microRNA-mediated feedforward loop in which a master transcription factor regulates a microRNA and, together with it, a set of target genes. In this paper we show analytically and through simulations that the incoherent version of this motif can couple the fine-tuning of a target protein level with an efficient noise control, thus conferring precision and stability to the overall gene expression program, especially in the presence of fluctuations in upstream regulators. Among the other results, a nontrivial prediction of our model is that the optimal attenuation of fluctuations coincides with a modest repression of the target expression. This feature is coherent with the expected fine-tuning function and in agreement with experimental observations of the actual impact of a wide class of microRNAs on the protein output of their targets. Finally, we describe the impact on noise-buffering efficiency of the cross-talk between microRNA targets that can naturally arise if the microRNA-mediated circuit is not considered as isolated, but embedded in a larger network of regulations.
Neuropilin-2 mediated β-catenin signaling and survival in human gastro-intestinal cancer cell lines.
Directory of Open Access Journals (Sweden)
Shaija Samuel
Full Text Available NRP-2 is a high-affinity kinase-deficient receptor for ligands belonging to the class 3 semaphorin and vascular endothelial growth factor families. NRP-2 has been detected on the surface of several types of human cancer cells, but its expression and function in gastrointestinal (GI cancer cells remains to be determined. We sought to determine the function of NRP-2 in mediating downstream signals regulating the growth and survival of human gastrointestinal cancer cells. In human gastric cancer specimens, NRP-2 expression was detected in tumor tissues but not in adjacent normal mucosa. In CNDT 2.5 cells, shRNA mediated knockdown NRP-2 expression led to decreased migration and invasion in vitro (p<0.01. Focused gene-array analysis demonstrated that loss of NRP-2 reduced the expression of a critical metastasis mediator gene, S100A4. Steady-state levels and function of β-catenin, a known regulator of S100A4, were also decreased in the shNRP-2 clones. Furthermore, knockdown of NRP-2 sensitized CNDT 2.5 cells in vitro to 5FU toxicity. This effect was associated with activation of caspases 3 and 7, cleavage of PARP, and downregulation of Bcl-2. In vivo growth of CNDT 2.5 cells in the livers of nude mice was significantly decreased in the shNRP-2 group (p<0.05. Intraperitoneal administration of NRP-2 siRNA-DOPC decreased the tumor burden in mice (p = 0.01. Collectively, our results demonstrate that tumor cell-derived NRP-2 mediates critical survival signaling in gastrointestinal cancer cells.
Wuriyanghan, Hada; Falk, Bryce W.
2013-01-01
The potato/tomato psyllid, Bactericera cockerelli (B. cockerelli), is an important plant pest and the vector of the phloem-limited bacterium Candidatus Liberibacter psyllaurous (solanacearum), which is associated with the zebra chip disease of potatoes. Previously, we reported induction of RNA interference effects in B. cockerelli via in vitro-prepared dsRNA/siRNAs after intrathoracic injection, and after feeding of artificial diets containing these effector RNAs. In order to deliver RNAi effectors via plant hosts and to rapidly identify effective target sequences in plant-feeding B. cockerelli, here we developed a plant virus vector-based in planta system for evaluating candidate sequences. We show that recombinant Tobacco mosaic virus (TMV) containing B. cockerelli sequences can efficiently infect and generate small interfering RNAs in tomato (Solanum lycopersicum), tomatillo (Physalis philadelphica) and tobacco (Nicotiana tabacum) plants, and more importantly delivery of interfering sequences via TMV induces RNAi effects, as measured by actin and V-ATPase mRNA reductions, in B. cockerelli feeding on these plants. RNAi effects were primarily detected in the B. cockerelli guts. In contrast to our results with TMV, recombinant Potato virus X (PVX) and Tobacco rattle virus (TRV) did not give robust infections in all plants and did not induce detectable RNAi effects in B. cockerelli. The greatest RNA interference effects were observed when B. cockerelli nymphs were allowed to feed on leaf discs collected from inoculated or lower expanded leaves from corresponding TMV-infected plants. Tomatillo plants infected with recombinant TMV containing B. cockerelli actin or V-ATPase sequences also showed phenotypic effects resulting in decreased B. cockerelli progeny production as compared to plants infected by recombinant TMV containing GFP. These results showed that RNAi effects can be achieved in plants against the phloem feeder, B. cockerelli, and the TMV-plant system will
SiRNA Crosslinked Nanoparticles for the Treatment of Inflammation-induced Liver Injury.
Tang, Yaqin; Zeng, Ziying; He, Xiao; Wang, Tingting; Ning, Xinghai; Feng, Xuli
2017-02-01
RNA interference mediated by small interfering RNA (siRNA) provides a powerful tool for gene regulation, and has a broad potential as a promising therapeutic strategy. However, therapeutics based on siRNA have had limited clinical success due to their undesirable pharmacokinetic properties. This study presents pH-sensitive nanoparticles-based siRNA delivery systems (PNSDS), which are positive-charge-free nanocarriers, composed of siRNA chemically crosslinked with multi-armed poly(ethylene glycol) carriers via acid-labile acetal linkers. The unique siRNA crosslinked structure of PNSDS allows it to have minimal cytotoxicity, high siRNA loading efficiency, and a stimulus-responsive property that enables the selective intracellular release of siRNA in response to pH conditions. This study demonstrates that PNSDS can deliver tumor necrosis factor alpha (TNF-α) siRNA into macrophages and induce the efficient down regulation of the targeted gene in complete cell culture media. Moreover, PNSDS with mannose targeting moieties can selectively accumulate in mice liver, induce specific inhibition of macrophage TNF-α expression in vivo, and consequently protect mice from inflammation-induced liver damages. Therefore, this novel siRNA delivering platform would greatly improve the therapeutic potential of RNAi based therapies.
Directory of Open Access Journals (Sweden)
Lim Chee Liew
Full Text Available Epigenetics has been recognised to play vital roles in many plant developmental processes, including floral initiation through the epigenetic regulation of gene expression. The histone modifying proteins that mediate these modifications involve the SET domain-containing histone methyltransferases, JmjC domain-containing demethylase, acetylases and deacetylases. In addition, RNA interference (RNAi-associated genes are also involved in epigenetic regulation via RNA-directed DNA methylation and post-transcriptional gene silencing. Soybean, a major crop legume, requires a short day to induce flowering. How histone modifications regulate the plant response to external cues that initiate flowering is still largely unknown. Here, we used RNA-seq to address the dynamics of transcripts that are potentially involved in the epigenetic programming and RNAi mediated gene silencing during the floral initiation of soybean. Soybean is a paleopolyploid that has been subjected to at least two rounds of whole genome duplication events. We report that the expanded genomic repertoire of histone modifiers and RNA silencing genes in soybean includes 14 histone acetyltransferases, 24 histone deacetylases, 47 histone methyltransferases, 15 protein arginine methyltransferases, 24 JmjC domain-containing demethylases and 47 RNAi-associated genes. To investigate the role of these histone modifiers and RNA silencing genes during floral initiation, we compared the transcriptional dynamics of the leaf and shoot apical meristem at different time points after a short-day treatment. Our data reveal that the extensive activation of genes that are usually involved in the epigenetic programming and RNAi gene silencing in the soybean shoot apical meristem are reprogrammed for floral development following an exposure to inductive conditions.
Directory of Open Access Journals (Sweden)
Zongli eHu
2015-01-01
Full Text Available Fusarium oxysporum is a devastating pathogen causing extensive yield losses in a variety of crops and development of sustainable, environmentally friendly methods to improve crop resistance is crucial. We have used Host-Derived RNA interference (HD-RNAi technology to partially silence three different genes (FOW2, FRP1 and OPR in the hemi-biotrophic fungus Fusarium oxysporum f. sp. conglutinans. Expression of double stranded RNA molecules targeting fungal pathogen genes was achieved in a number of transgenic Arabidopsis lines. F. oxysporum infecting the transgenic lines displayed substantially reduced mRNA levels on all three targeted genes, with an average of 75%, 83% and 72% reduction for FOW2, FRP1 and OPR respectively. The silencing of pathogen genes had a clear positive effect on the ability of the transgenic lines to fight infection. All transgenic lines displayed enhanced resistance to F. oxysporum with delayed disease symptom development, especially FRP1 and OPR lines. Survival rates after fungal infection were higher in the transgenic lines compared to control wild type plants which consistently showed survival rates of 10%, with FOW2 lines showing 25% survival; FRP1 lines 30-50% survival and FOW2 between 45-70% survival. The down-regulation effect was specific for the targeted genes without unintended effects in related genes. In addition to producing resistant crops, HD-RNAi can provide a useful tool to rapidly screen candidate fungal pathogenicity genes without the need to produce fungal knockout mutants.
Hu, Zongli; Parekh, Urvi; Maruta, Natsumi; Trusov, Yuri; Botella, Jimmy
2015-01-01
Fusarium oxysporum is a devastating pathogen causing extensive yield losses in a variety of crops and development of sustainable, environmentally friendly methods to improve crop resistance is crucial. We have used Host-Derived RNA interference (HD-RNAi) technology to partially silence three different genes (FOW2, FRP1 and OPR) in the hemi-biotrophic fungus Fusarium oxysporum f. sp. conglutinans. Expression of double stranded RNA molecules targeting fungal pathogen genes was achieved in a number of transgenic Arabidopsis lines. F. oxysporum infecting the transgenic lines displayed substantially reduced mRNA levels on all three targeted genes, with an average of 75%, 83% and 72% reduction for FOW2, FRP1 and OPR respectively. The silencing of pathogen genes had a clear positive effect on the ability of the transgenic lines to fight infection. All transgenic lines displayed enhanced resistance to F. oxysporum with delayed disease symptom development, especially FRP1 and OPR lines. Survival rates after fungal infection were higher in the transgenic lines compared to control wild type plants which consistently showed survival rates of 10%, with FOW2 lines showing 25% survival; FRP1 lines 30-50% survival and FOW2 between 45-70% survival. The down-regulation effect was specific for the targeted genes without unintended effects in related genes. In addition to producing resistant crops, HD-RNAi can provide a useful tool to rapidly screen candidate fungal pathogenicity genes without the need to produce fungal knockout mutants.
Directory of Open Access Journals (Sweden)
Louise Ford
Full Text Available Cathepsin-like enzymes have been identified as potential targets for drug or vaccine development in many parasites, as their functions appear to be essential in a variety of important biological processes within the host, such as molting, cuticle remodeling, embryogenesis, feeding and immune evasion. Functional analysis of Caenorhabditis elegans cathepsin L (Ce-cpl-1 and cathepsin Z (Ce-cpz-1 has established that both genes are required for early embryogenesis, with Ce-cpl-1 having a role in regulating in part the processing of yolk proteins. Ce-cpz-1 also has an important role during molting.RNA interference assays have allowed us to verify whether the functions of the orthologous filarial genes in Brugia malayi adult female worms are similar. Treatment of B. malayi adult female worms with Bm-cpl-1, Bm-cpl-5, which belong to group Ia of the filarial cpl gene family, or Bm-cpz-1 dsRNA resulted in decreased numbers of secreted microfilariae in vitro. In addition, analysis of the intrauterine progeny of the Bm-cpl-5 or Bm-cpl Pro dsRNA- and siRNA-treated worms revealed a clear disruption in the process of embryogenesis resulting in structural abnormalities in embryos and a varied differential development of embryonic stages.Our studies suggest that these filarial cathepsin-like cysteine proteases are likely to be functional orthologs of the C. elegans genes. This functional conservation may thus allow for a more thorough investigation of their distinct functions and their development as potential drug targets.
Directory of Open Access Journals (Sweden)
Tiago Campos Pereira
2007-01-01
Full Text Available The RNA interference (RNAi technique is a recent technology that uses double-stranded RNA molecules to promote potent and specific gene silencing. The application of this technique to molecular biology has increased considerably, from gene function identification to disease treatment. However, not all small interfering RNAs (siRNAs are equally efficient, making target selection an essential procedure. Here we present Strand Analysis (SA, a free online software tool able to identify and classify the best RNAi targets based on Gibbs free energy (deltaG. Furthermore, particular features of the software, such as the free energy landscape and deltaG gradient, may be used to shed light on RNA-induced silencing complex (RISC activity and RNAi mechanisms, which makes the SA software a distinct and innovative tool.
SiRNA-mediated IGF-1R inhibition sensitizes human colon cancer SW480 cells to radiation
International Nuclear Information System (INIS)
Yavari, Kamal; Taghikhani, Mohammad; Mesbah-Namin, Seyed A.; Maragheh, Mohammad Ghannadi; Babaei, Mohammad Hosein; Arfaee, Ali Jabbary; Madani, Hossein; Mirzaei, Hamid Reza
2010-01-01
Purpose. Insulin like growth factor receptor 1 (IGF-1R) is well-documented to play a key role in radiation response and tumor radiosensitivity, thus offering an attractive clinic drug target to enhance tumor sensitivity to anti-cancer radiotherapy. Material and methods. Human colon carcinoma SW480 cells were transfected with the specific small interference RNA (siRNA) expression vector (pkD-shRNA-IGF-1R-V2) designed to target IGF-1R mRNA. The expression of IGF-1R mRNA and its protein among the transfected and untransfected cells were detected by semi-quantitative RT-PCR and ELISA assay. The changes in cell radiosensitivity were examined by MTT assay. Results. Transfection of mammalian expression vector pkD containing IGF-1R siRNA was shown to reduce IGF-1R mRNA levels by up to 95%. ELISA assay detected a similar inhibition of IGF-1R protein levels in cells transfected with IGF-1R siRNA. SW480 cells transfected with the expression vector for siRNA significantly rendered cells more sensitive to radiation and the highest radiation enhancement ratio was 2.02 ± 0.08. Conclusion. These data provide the first evidence that specific siRNA fragment (pkD-shRNA-IGF-1R-V2) targeting human IGF-1R mRNA is able to enhance colon cancer radiosensitivity. Also results indicated that, combining IGF-1R siRNA and radiation significantly enhances antitumor efficacy compared with either modality alone
Characterization of RNA interference in rat PC12 cells
DEFF Research Database (Denmark)
Thonberg, Håkan; Schéele, Camilla C; Dahlgren, Cecilia
2004-01-01
strand of the siRNA guides a multi-protein complex, RNA-induced silencing complex (RISC), to cleave target mRNA. Although the exact function and composition of RISC is still unclear, it has been shown to include several proteins of the Argonaute protein family. Here we report of a robust system...... of the rat Golgi-ER protein 95 kDa (GERp95), an Argonaute family protein, by siRNA methodology. After GERp95-ablation, sequential knockdown of NPY by siRNA was shown to be impaired. Thus, we report that the GERp95 protein is functionally required for RNAi targeting NPY in rat PC12 cells....
Yang, X; Liu, H; Lin, Z H; Qian, J; Xu, X R
2016-08-01
To investigate the inhibitory effects of RNA interference targeting GFI-1 on growth and proliferation of atypical chronic myelogenous leukemia (aCML) NT1 cells. NT1 cells were transfected with PBS and liposome complex (vehicle group), scrambled siRNA and liposome complex (negative control, NC group), and GFI-1 siRNA and liposome complex (GFI-1 siRNA group), respectively. Real-time quantitative RT-PCR (qRT-PCR) and Western blot were performed to examine the expression levels of GFI-1 mRNA and protein, respectively. The proliferation abilities of NT1 cells of the three groups were evaluated by MTT assay. The cell cycle in cells of the three groups was analyzed by flow cytometry. Moreover, nude mouse xenograft model was used to detect the tumor formation ability in the three group cells. Quantitative real-time PCR data showed that the expression level of GFI-1 mRNA in GFI-1 siRNA group was significantly lower than those of NC group and vehicle group [(0.367±0.017) vs. (0.918±0.006) and (1.010±0.005), respectively, (PNT1 cells in the GFI-1 siRNA group (0.667±0.059) was significantly lower than those of the NC group (1.096±0.049) and vehicle group (1.193±0.064, P=0.023). Flow cytometry data showed that sub-G1 and G0/G1 phase proportions of the GFI-1 siRNA group were significantly higher than those of the NC and vehicle groups [sub-G1: (8.2±2.5)% vs. (1.9±1.3)% and (2.0±3.6)%, respectively, (PNT1 cells, which may provide a new therapeutic target for atypical chronic myelogenous leukemia.
Use of bacterially expressed dsRNA to downregulate Entamoeba histolytica gene expression.
Directory of Open Access Journals (Sweden)
Carlos F Solis
Full Text Available BACKGROUND: Modern RNA interference (RNAi methodologies using small interfering RNA (siRNA oligonucleotide duplexes or episomally synthesized hairpin RNA are valuable tools for the analysis of gene function in the protozoan parasite Entamoeba histolytica. However, these approaches still require time-consuming procedures including transfection and drug selection, or costly synthetic molecules. PRINCIPAL FINDINGS: Here we report an efficient and handy alternative for E. histolytica gene down-regulation mediated by bacterial double-stranded RNA (dsRNA targeting parasite genes. The Escherichia coli strain HT115 which is unable to degrade dsRNA, was genetically engineered to produce high quantities of long dsRNA segments targeting the genes that encode E. histolytica beta-tubulin and virulence factor KERP1. Trophozoites cultured in vitro were directly fed with dsRNA-expressing bacteria or soaked with purified dsRNA. Both dsRNA delivery methods resulted in significant reduction of protein expression. In vitro host cell-parasite assays showed that efficient downregulation of kerp1 gene expression mediated by bacterial dsRNA resulted in significant reduction of parasite adhesion and lytic capabilities, thus supporting a major role for KERP1 in the pathogenic process. Furthermore, treatment of trophozoites cultured in microtiter plates, with a repertoire of eighty-five distinct bacterial dsRNA segments targeting E. histolytica genes with unknown function, led to the identification of three genes potentially involved in the growth of the parasite. CONCLUSIONS: Our results showed that the use of bacterial dsRNA is a powerful method for the study of gene function in E. histolytica. This dsRNA delivery method is also technically suitable for the study of a large number of genes, thus opening interesting perspectives for the identification of novel drug and vaccine targets.
The MicroRNA390/TAS3 Pathway Mediates Symbiotic Nodulation and Lateral Root Growth1[OPEN
Bustos-Sanmamed, Pilar; Mysore, Kirankumar S.
2017-01-01
Legume roots form two types of postembryonic organs, lateral roots and symbiotic nodules. Nodule formation is the result of the interaction of legumes with rhizobia and requires the mitotic activation and differentiation of root cells as well as an independent, but coordinated, program that allows infection by rhizobia. MicroRNA390 (miR390) is an evolutionarily conserved microRNA that targets the Trans-Acting Short Interference RNA3 (TAS3) transcript. Cleavage of TAS3 by ARGONAUTE7 results in the production of trans-acting small interference RNAs, which target mRNAs encoding AUXIN RESPONSE FACTOR2 (ARF2), ARF3, and ARF4. Here, we show that activation of the miR390/TAS3 regulatory module by overexpression of miR390 in Medicago truncatula promotes lateral root growth but prevents nodule organogenesis, rhizobial infection, and the induction of two key nodulation genes, Nodulation Signaling Pathway1 (NSP1) and NSP2. Accordingly, inactivation of the miR390/TAS3 module, either by expression of a miR390 target mimicry construct or mutations in ARGONAUTE7, enhances nodulation and rhizobial infection, alters the spatial distribution of the nodules, and increases the percentage of nodules with multiple meristems. Our results revealed a key role of the miR390/TAS3 pathway in legumes as a modulator of lateral root organs, playing opposite roles in lateral root and nodule development. PMID:28663332
International Nuclear Information System (INIS)
Xue Yan; Bi Feng; Zhang Xueyong; Pan Yanglin; Liu Na; Zheng Yi; Fan Daiming
2004-01-01
Hypoxia-induced angiogenesis plays an important role in the malignancy of solid tumors. A number of recent studies including our own have suggested that Rho family small GTPases are involved in this process, and Rac1, a prominent member of the Rho family, may be critical in regulating hypoxia-induced gene activation of several angiogenesis factors and tumor suppressors. To further define Rac1 function in angiogenesis and to explore novel approaches to modulate angiogenesis, we employed the small interference RNA technique to knock down gene expression of Rac1 in gastric cancer cell line AGS that expresses a high level of Rac1. Both the mRNA and protein levels of Rac1 in the AGS cells were decreased dramatically after transfection with a Rac1-specific siRNA vector. When the conditioned medium derived from the Rac1 downregulated AGS cells was applied to the human endothelial cells, it could significantly inhibit the cell proliferation. Further study proved that, VEGF and HIF-1α, two angiogenesis promoting factors, were found to be downregulated whereas p53 and VHL, which are tumor suppressors and angiogenesis inhibitors, were upregulated in the Rac1 siRNA transfected cells. Our results suggest that Rac1 may be involved in angiogenesis by controlling the expression of angiogenesis-related factors and provide a possible strategy for the treatment of tumor angiogenesis by targeting the Rac1 GTPase
The nuclear import of RNA helicase A is mediated by importin-α3
International Nuclear Information System (INIS)
Aratani, Satoko; Oishi, Takayuki; Fujita, Hidetoshi; Nakazawa, Minako; Fujii, Ryouji; Imamoto, Naoko; Yoneda, Yoshihiro; Fukamizu, Akiyoshi; Nakajima, Toshihiro
2006-01-01
RNA helicase A (RHA), an ATPase/helicase, regulates the gene expression at various steps including transcriptional activation and RNA processing. RHA is known to shuttle between the nucleus and cytoplasm. We identified the nuclear localization signal (NLS) of RHA and analyzed the nuclear import mechanisms. The NLS of RHA (RHA-NLS) consisting of 19 amino acid residues is highly conserved through species and does not have the consensus classical NLS. In vitro nuclear import assays revealed that the nuclear import of RHA was Ran-dependent and mediated with the classical importin-α/β-dependent pathway. The binding assay indicated that the basic residues in RHA-NLS were used for interaction with importin-α. Furthermore, the nuclear import of RHA-NLS was supported by importin-α1 and preferentially importin-α3. Our results indicate that the nuclear import of RHA is mediated by the importin-α3/importin-β-dependent pathway and suggest that the specificity for importin may regulate the functions of cargo proteins
Directory of Open Access Journals (Sweden)
Qun Wang
2015-01-01
Full Text Available Matrix metalloproteinases (MMPs are widely implicated in inflammation and tissue remodeling associated with various neurodegenerative diseases and play an important role in nociception and allodynia. Extracellular Matrix Metalloproteinase Inducer (EMMPRIN plays a key regulatory role for MMP activities. However, the role of EMMPRIN in the development of neuropathic pain is not clear. Western blotting, real-time quantitative RT-PCR (qRT-PCR, and immunofluorescence were performed to determine the changes of messenger RNA and protein of EMMPRIN/OX47 and their cellular localization in the rat dorsal root ganglion (DRG after nerve injury. Paw withdrawal threshold test was examined to evaluate the pain behavior in spinal nerve ligation (SNL model. The lentivirus containing OX47 shRNA was injected into the DRG one day before SNL. The expression level of both mRNA and protein of OX47 was markedly upregulated in ipsilateral DRG after SNL. OX47 was mainly expressed in the extracellular matrix of DRG. Administration of shRNA targeted against OX47 in vivo remarkably attenuated mechanical allodynia induced by SNL. In conclusion, peripheral nerve injury induced upregulation of OX47 in the extracellular matrix of DRG. RNA interference against OX47 significantly suppressed the expression of OX47 mRNA and the development of mechanical allodynia. The altered expression of OX47 may contribute to the development of neuropathic pain after nerve injury.
Directory of Open Access Journals (Sweden)
Jaclyn C Scott
2010-10-01
Full Text Available The exogenous RNA interference (RNAi pathway is an important antiviral defense against arboviruses in mosquitoes, and virus-specific small interfering (siRNAs are key components of this pathway. Understanding the biogenesis of siRNAs in mosquitoes could have important ramifications in using RNAi to control arbovirus transmission. Using deep sequencing technology, we characterized dengue virus type 2 (DENV2-specific small RNAs produced during infection of Aedes aegypti mosquitoes and A. aegypti Aag2 cell cultures and compared them to those produced in the C6/36 Aedes albopictus cell line. We show that the size and mixed polarity of virus-specific small RNAs from DENV-infected A. aegypti cells indicate that they are products of Dicer-2 (Dcr2 cleavage of long dsRNA, whereas C6/36 cells generate DENV2-specific small RNAs that are longer and predominantly positive polarity, suggesting that they originate from a different small RNA pathway. Examination of virus-specific small RNAs after infection of the two mosquito cell lines with the insect-only flavivirus cell fusing agent virus (CFAV corroborated these findings. An in vitro assay also showed that Aag2 A. aegypti cells are capable of siRNA production, while C6/36 A. albopictus cells exhibit inefficient Dcr2 cleavage of long dsRNA. Defective expression or function of Dcr2, the key initiator of the RNAi pathway, might explain the comparatively robust growth of arthropod-borne viruses in the C6/36 cell line, which has been used frequently as a surrogate for studying molecular interactions between arboviruses and cells of their mosquito hosts.
Hu, Z; Lin, Q; Chen, H; Li, Z; Yin, F; Feng, X
2014-12-01
Insect cytochrome P450 monooxygenases (P450s) play an important role in catalysis of many reactions leading to insecticides resistance. Our previous studies on transcriptome analysis of chlorantraniliprole-resistant development in the diamondback moth, Plutella xylostella revealed that up-regulation of cytochrome P450s are one of the main factors leading to the development of chlorantraniliprole resistance. Here, we report for the first time a novel cytochrome P450 gene CYP321E1, which belongs to the cytochrome P450 gene family CYP321. Real-time quantitative PCR (RT-qPCR) analyses indicated that CYP321E1 was expressed at all developmental stages of P. xylostella but was highest in the fourth-instar larvae; furthermore, the relatively high expression was observed in the midgut of the fourth-instar larvae, followed by fat bodies and epidermis. The expression of CYP321E1 in P. xylostella was differentially affected by three representative insecticides, including alphamethrin, abamectin and chlorantraniliprole. Among them, the exposure to chlorantraniliprole resulted in the largest transcript level of this cytochrome P450 gene. The findings suggested potential involvement of CYP321E1 in chlorantraniliprole resistance of P. xylostella. To assess the functional link of CYP321E1 to chlorantraniliprole resistance, RNA interference (RNAi)-mediated gene silencing by double stranded RNA (dsRNA) injecting was used. Results revealed that injection delivery of dsRNA can greatly reduce gene expression after 24 h. As a consequence of RNAi, a significant increment in mortality of larvae injected CYP321E1 dsRNA was observed after 24 h of exposure to chlorantraniliprole. These results strongly support our notion that this novel cytochrome P450 gene plays an important role in chlorantraniliprole detoxification in the diamondback moth and is partly responsible for its resistance.
Intragenomic matching reveals a huge potential for miRNA-mediated regulation in plants
DEFF Research Database (Denmark)
Lindow, Morten; Jacobsen, Anders; Nygaard, Sanne
2007-01-01
indicates that only a few of the candidates are conserved between the species. We conclude that there is a large potential for miRNA-mediated regulatory interactions encoded in the genomes of the investigated plants. We hypothesize that some of these interactions may be realized under special environmental...
Inhibition of STAT-3 results in radiosensitization of human squamous cell carcinoma
International Nuclear Information System (INIS)
Bonner, James A.; Trummell, Hoa Q.; Willey, Christopher D.; Plants, Brian A.; Raisch, Kevin P.
2009-01-01
Background: Signal transducer and activator of transcription-3 (STAT-3) is a downstream component of the Epidermal Growth Factor Receptor (EGFr) signaling process that may facilitate the resistance of tumor cells to conventional cancer treatments. Studies were performed to determine if inhibition of this downstream protein produces radiosensitization. Methods/Results: A431 cells (human squamous cell carcinoma cells with EGFr overexpression) were found to be sensitized to radiation after treatment with STAT-3 small interfering RNA (siRNA). Therefore, a short hairpin RNA (shRNA) against STAT-3 was designed and cloned into a pBABE vector system modified for shRNA expression. Following transfection, clone 2.1 was selected for further study as it showed a dramatic reduction of STAT-3 protein (and mRNA) when compared to A431 parental cells or a negative control shRNA cell line (transfected with STAT-3 shRNA with 2 base pairs mutated). A431 2.1 showed doubling times of 25-31 h as compared to 18-24 h for the parental cell line. The A431 shRNA knockdown STAT-3 cells A431 were more sensitive to radiation than A431 parental or negative STAT-3 control cells. Conclusion: A431 cells stably transfected with shRNA against STAT-3 resulted in enhanced radiosensitivity. Further work will be necessary to determine whether the inhibition of STAT-3 phosphorylation is a necessary step for the radiosensitization that is induced by the inhibition of EGFr.
Chen, Wei; Zhao, Minjie; Zhao, Shuzhi; Lu, Qianyi; Ni, Lisha; Zou, Chen; Lu, Li; Xu, Xun; Guan, Huaijin; Zheng, Zhi; Qiu, Qinghua
2017-02-01
Chronic low-grade inflammation occurs in diabetic retinopathy (DR), but the underlying mechanism(s) remains (remain) unclear. NLRP3 inflammasome activation is involved in several other inflammatory diseases. Thus, we investigated the role of the NLRP3 inflammasome signaling pathway in the pathogenesis of DR. Diabetes was induced in rats by streptozotocin treatment for 8 weeks. They were treated with NLRP3 shRNA or minocycline during the last 4 weeks. High glucose-exposed human retinal microvascular endothelial cells (HRMECs) were co-incubated with antioxidants or subjected to TXNIP or NLRP3 shRNA interference. In high glucose-exposed HRMECs and retinas of diabetic rats, mRNA and protein expression of NLRP3, ASC, and proinflammatory cytokines were induced significantly by hyperglycemia. Upregulated interleukin (IL)-1β maturation, IL-18 secretion, and caspase-1 cleavage were also observed with increased cell apoptosis and retinal vascular permeability, compared with the control group. NLRP3 silencing blocked these effects in the rat model and HRMECs, confirming that inflammasome activation contributed to inflammation in DR. TXNIP expression was increased by reactive oxygen species (ROS) overproduction in animal and cell models, whereas antioxidant addition or TXNIP silencing blocked IL-1β and IL-18 secretion in high glucose-exposed HRMECs, indicating that the ROS-TXNIP pathway mediates NLRP3 inflammasome activation. Minocycline significantly downregulated ROS generation and reduced TXNIP expression, subsequently inhibited NLRP3 activation, and further decreased inflammatory factors, which were associated with a decrease in retinal vascular permeability and cell apoptosis. Together, our data suggest that the TXNIP/NLRP3 pathway is a potential therapeutic target for the treatment of DR, and the use of minocycline specifically for such therapy may be a new avenue of investigation in inflammatory disease.
Directory of Open Access Journals (Sweden)
Lin Tong
2011-09-01
Full Text Available Abstract Background shRNA targeting the integrin αv subunit, which is the foot-and-mouth disease virus (FMDV receptor, plays a key role in virus attachment to susceptible cells. We constructed a RNAi lentiviral vector, iαv pLenti6/BLOCK -iT™, which expressed siRNA targeting the FMDV receptor, the porcine integrin αv subunit, on PK-15 cells. We also produced a lentiviral stock, established an iαv-PK-15 cell line, evaluated the gene silencing efficiency of mRNA using real-time qRT-PCR, integrand αv expression by indirect immunofluorescence assay (IIF and cell enzyme linked immunosorbent assays (cell ELISA, and investigated the in vivo inhibitory effect of shRNA on FMDV replication in PK-15 cells. Results Our results indicated successful establishment of the iαv U6 RNAi entry vector and the iαv pLenti6/BLOCK -iT expression vector. The functional titer of obtained virus was 1.0 × 106 TU/mL. To compare with the control and mock group, the iαv-PK-15 group αv mRNA expression rate in group was reduced by 89.5%, whilst IIF and cell ELISA clearly indicated suppression in the experimental group. Thus, iαv-PK-15 cells could reduce virus growth by more than three-fold and there was a > 99% reduction in virus titer when cells were challenged with 102 TCID50 of FMDV. Conclusions Iαv-PK-15 cells were demonstrated as a cell model for anti-FMDV potency testing, and this study suggests that shRNA could be a viable therapeutic approach for controlling the severity of FMD infection and spread.
Anosova, Irina; Melnik, Svitlana; Tripsianes, Konstantinos; Kateb, Fatiha; Grummt, Ingrid; Sattler, Michael
2015-05-26
The chromatin remodeling complex NoRC, comprising the subunits SNF2h and TIP5/BAZ2A, mediates heterochromatin formation at major clusters of repetitive elements, including rRNA genes, centromeres and telomeres. Association with chromatin requires the interaction of the TAM (TIP5/ARBP/MBD) domain of TIP5 with noncoding RNA, which targets NoRC to specific genomic loci. Here, we show that the NMR structure of the TAM domain of TIP5 resembles the fold of the MBD domain, found in methyl-CpG binding proteins. However, the TAM domain exhibits an extended MBD fold with unique C-terminal extensions that constitute a novel surface for RNA binding. Mutation of critical amino acids within this surface abolishes RNA binding in vitro and in vivo. Our results explain the distinct binding specificities of TAM and MBD domains to RNA and methylated DNA, respectively, and reveal structural features for the interaction of NoRC with non-coding RNA. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
mediated RNA interference in bovine fibroblast cells
African Journals Online (AJOL)
Jane
2011-08-03
Aug 3, 2011 ... there are lots of problems related to the method of delivery, especially .... Detection of MC4R silencing of Lvsh-MC4R in FBCs. The Auris .... Schwartz MW, Seeley RJ, Woods SC, Weigle DS, Campfield LA, Burn. P, Baskin DG ...
Hsc70/Hsp90 chaperone machinery mediates ATP-dependent RISC loading of small RNA duplexes.
Iwasaki, Shintaro; Kobayashi, Maki; Yoda, Mayuko; Sakaguchi, Yuriko; Katsuma, Susumu; Suzuki, Tsutomu; Tomari, Yukihide
2010-07-30
Small silencing RNAs--small interfering RNAs (siRNAs) or microRNAs (miRNAs)--direct posttranscriptional gene silencing of their mRNA targets as guides for the RNA-induced silencing complex (RISC). Both siRNAs and miRNAs are born double stranded. Surprisingly, loading these small RNA duplexes into Argonaute proteins, the core components of RISC, requires ATP, whereas separating the two small RNA strands within Argonaute does not. Here we show that the Hsc70/Hsp90 chaperone machinery is required to load small RNA duplexes into Argonaute proteins, but not for subsequent strand separation or target cleavage. We envision that the chaperone machinery uses ATP and mediates a conformational opening of Ago proteins so that they can receive bulky small RNA duplexes. Our data suggest that the chaperone machinery may serve as the driving force for the RISC assembly pathway. Copyright 2010 Elsevier Inc. All rights reserved.
Xu, Lu-Lu; Guo, Shu-Liang; Ma, Su-Ren; Luo, Yong-Ai
2012-01-01
Mammalian mediator (MED) is a multi-protein coactivator that has been identified by several research groups. The involvement of the MED complex subunit 19 (MED 19) in the metastasis of lung adenocarcinoma cell line (H1299), which expresses the MED 19 subunit, was here investigated. When MED 19 expression was decreased by RNA interference H1299 cells demonstrated reduced clone formation, arrest in the S phase of the cell cycle, and lowered metastatic capacity. Thus, MED 19 appears to play important roles in the biological behavior of non-small cell lung carcinoma cells. These findings may be important for the development of novel lung carcinoma treatments.
Sidorenko, Lyudmila; Dorweiler, Jane E; Cigan, A Mark; Arteaga-Vazquez, Mario; Vyas, Meenal; Kermicle, Jerry; Jurcin, Diane; Brzeski, Jan; Cai, Yu; Chandler, Vicki L
2009-11-01
Paramutation involves homologous sequence communication that leads to meiotically heritable transcriptional silencing. We demonstrate that mop2 (mediator of paramutation2), which alters paramutation at multiple loci, encodes a gene similar to Arabidopsis NRPD2/E2, the second-largest subunit of plant-specific RNA polymerases IV and V. In Arabidopsis, Pol-IV and Pol-V play major roles in RNA-mediated silencing and a single second-largest subunit is shared between Pol-IV and Pol-V. Maize encodes three second-largest subunit genes: all three genes potentially encode full length proteins with highly conserved polymerase domains, and each are expressed in multiple overlapping tissues. The isolation of a recessive paramutation mutation in mop2 from a forward genetic screen suggests limited or no functional redundancy of these three genes. Potential alternative Pol-IV/Pol-V-like complexes could provide maize with a greater diversification of RNA-mediated transcriptional silencing machinery relative to Arabidopsis. Mop2-1 disrupts paramutation at multiple loci when heterozygous, whereas previously silenced alleles are only up-regulated when Mop2-1 is homozygous. The dramatic reduction in b1 tandem repeat siRNAs, but no disruption of silencing in Mop2-1 heterozygotes, suggests the major role for tandem repeat siRNAs is not to maintain silencing. Instead, we hypothesize the tandem repeat siRNAs mediate the establishment of the heritable silent state-a process fully disrupted in Mop2-1 heterozygotes. The dominant Mop2-1 mutation, which has a single nucleotide change in a domain highly conserved among all polymerases (E. coli to eukaryotes), disrupts both siRNA biogenesis (Pol-IV-like) and potentially processes downstream (Pol-V-like). These results suggest either the wild-type protein is a subunit in both complexes or the dominant mutant protein disrupts both complexes. Dominant mutations in the same domain in E. coli RNA polymerase suggest a model for Mop2-1 dominance
Chen, Anyi; Gui, Guo-Feng; Zhuo, Ying; Chai, Ya-Qin; Xiang, Yun; Yuan, Ruo
2015-06-16
A target induced cycling strand displacement amplification (SDA) mediated by phi29 DNA polymerase (phi29) was first investigated and applied in a signal-off electrochemiluminescence (ECL) biosensor for microRNA (miRNA) detection. Herein, the target miRNA triggered the phi29-mediated SDA which could produce amounts of single-stranded DNA (assistant probe) with accurate and comprehensive nucleotide sequence. Then, the assistant probe hybridized with the capture probe and the ferrocene-labeled probe (Fc-probe) to form a ternary "Y" structure for ECL signal quenching by ferrocene. Therefore, the ECL intensity would decrease with increasing concentration of the target miRNA, and the sensitivity of biosensor would be promoted on account of the efficient signal amplification of the target induced cycling reaction. Besides, a self-enhanced Ru(II) ECL system was designed to obtain a stable and strong initial signal to further improve the sensitivity. The ECL assay for miRNA-21 detection is developed with excellent sensitivity of a concentration variation from 10 aM to 1.0 pM and limit of detection down to 3.3 aM.
CRISPR/Cas13 as a Tool for RNA Interference
Ali, Zahir
2018-03-28
Almost all biological processes involve RNA, making it crucial to develop tools for manipulation of the transcriptome. The bacterial CRISPR/Cas13 system was recently rewired to facilitate RNA manipulation in eukaryotes, including plants. We discuss here the opportunities and limitations of using CRISPR/Cas13 in plants for various types of RNA manipulation.
Systematic comparison of the response properties of protein and RNA mediated gene regulatory motifs.
Iyengar, Bharat Ravi; Pillai, Beena; Venkatesh, K V; Gadgil, Chetan J
2017-05-30
We present a framework enabling the dissection of the effects of motif structure (feedback or feedforward), the nature of the controller (RNA or protein), and the regulation mode (transcriptional, post-transcriptional or translational) on the response to a step change in the input. We have used a common model framework for gene expression where both motif structures have an activating input and repressing regulator, with the same set of parameters, to enable a comparison of the responses. We studied the global sensitivity of the system properties, such as steady-state gain, overshoot, peak time, and peak duration, to parameters. We find that, in all motifs, overshoot correlated negatively whereas peak duration varied concavely with peak time. Differences in the other system properties were found to be mainly dependent on the nature of the controller rather than the motif structure. Protein mediated motifs showed a higher degree of adaptation i.e. a tendency to return to baseline levels; in particular, feedforward motifs exhibited perfect adaptation. RNA mediated motifs had a mild regulatory effect; they also exhibited a lower peaking tendency and mean overshoot. Protein mediated feedforward motifs showed higher overshoot and lower peak time compared to the corresponding feedback motifs.
Simple method for assembly of CRISPR synergistic activation mediator gRNA expression array.
Vad-Nielsen, Johan; Nielsen, Anders Lade; Luo, Yonglun
2018-05-20
When studying complex interconnected regulatory networks, effective methods for simultaneously manipulating multiple genes expression are paramount. Previously, we have developed a simple method for generation of an all-in-one CRISPR gRNA expression array. We here present a Golden Gate Assembly-based system of synergistic activation mediator (SAM) compatible CRISPR/dCas9 gRNA expression array for the simultaneous activation of multiple genes. Using this system, we demonstrated the simultaneous activation of the transcription factors, TWIST, SNAIL, SLUG, and ZEB1 a human breast cancer cell line. Copyright © 2018 Elsevier B.V. All rights reserved.
Chereji, Razvan V; Bharatula, Vasudha; Elfving, Nils; Blomberg, Jeanette; Larsson, Miriam; Morozov, Alexandre V; Broach, James R; Björklund, Stefan
2017-09-06
Mediator is a multi-unit molecular complex that plays a key role in transferring signals from transcriptional regulators to RNA polymerase II in eukaryotes. We have combined biochemical purification of the Saccharomyces cerevisiae Mediator from chromatin with chromatin immunoprecipitation in order to reveal Mediator occupancy on DNA genome-wide, and to identify proteins interacting specifically with Mediator on the chromatin template. Tandem mass spectrometry of proteins in immunoprecipitates of mediator complexes revealed specific interactions between Mediator and the RSC, Arp2/Arp3, CPF, CF 1A and Lsm complexes in chromatin. These factors are primarily involved in chromatin remodeling, actin assembly, mRNA 3'-end processing, gene looping and mRNA decay, but they have also been shown to enter the nucleus and participate in Pol II transcription. Moreover, we have found that Mediator, in addition to binding Pol II promoters, occupies chromosomal interacting domain (CID) boundaries and that Mediator in chromatin associates with proteins that have been shown to interact with CID boundaries, such as Sth1, Ssu72 and histone H4. This suggests that Mediator plays a significant role in higher-order genome organization. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Guo, Xunyang; Zhang, Rui; Wang, Jeffrey; Lu, Rui
2013-10-01
Small interfering RNAs (siRNAs) processed from double-stranded RNA (dsRNA) of virus origins mediate potent antiviral defense through a process referred to as RNA interference (RNAi) or RNA silencing in diverse organisms. In the simple invertebrate Caenorhabditis elegans, the RNAi process is initiated by a single Dicer, which partners with the dsRNA binding protein RDE-4 to process dsRNA into viral siRNAs (viRNAs). Notably, in C. elegans this RNA-directed viral immunity (RDVI) also requires a number of worm-specific genes for its full antiviral potential. One such gene is rsd-2 (RNAi spreading defective 2), which was implicated in RDVI in our previous studies. In the current study, we first established an antiviral role by showing that rsd-2 null mutants permitted higher levels of viral RNA accumulation, and that this enhanced viral susceptibility was reversed by ectopic expression of RSD-2. We then examined the relationship of rsd-2 with other known components of RNAi pathways and established that rsd-2 functions in a novel pathway that is independent of rde-4 but likely requires the RNA-dependent RNA polymerase RRF-1, suggesting a critical role for RSD-2 in secondary viRNA biogenesis, likely through coordinated action with RRF-1. Together, these results suggest that RDVI in the single-Dicer organism C. elegans depends on the collective actions of both RDE-4-dependent and RDE-4-independent mechanisms to produce RNAi-inducing viRNAs. Our study reveals, for the first time, a novel siRNA-producing mechanism in C. elegans that bypasses the need for a dsRNA-binding protein.
Bhagwat, Basdeo; Chi, Ming; Han, Dianwei; Tang, Haifeng; Tang, Guiliang; Xiang, Yu
2016-01-01
Artificial microRNA (amiRNA) technology utilizes microRNA (miRNA) biogenesis pathway to produce artificially selected small RNAs using miRNA gene backbone. It provides a feasible strategy for inducing loss of gene function, and has been applied in functional genomics study, improvement of crop quality and plant virus disease resistance. A big challenge in amiRNA applications is the unpredictability of silencing efficacy of the designed amiRNAs and not all constructed amiRNA candidates would be expressed effectively in plant cells. We and others found that high efficiency and specificity in RNA silencing can be achieved by designing amiRNAs with perfect or almost perfect sequence complementarity to their targets. In addition, we recently demonstrated that Agrobacterium-mediated transient expression system can be used to validate amiRNA constructs, which provides a simple, rapid and effective method to select highly expressible amiRNA candidates for stable genetic transformation. Here, we describe the methods for design of amiRNA candidates with perfect or almost perfect base-pairing to the target gene or gene groups, incorporation of amiRNA candidates in miR168a gene backbone by one step inverse PCR amplification, construction of plant amiRNA expression vectors, and assay of transient expression of amiRNAs in Nicotiana benthamiana through agro-infiltration, small RNA extraction, and amiRNA Northern blot.
International Nuclear Information System (INIS)
Patel, Devang N.; Bailey, Steven R.; Gresham, John K.; Schuchman, David B.; Shelhamer, James H.; Goldstein, Barry J.; Foxwell, Brian M.; Stemerman, Michael B.; Maranchie, Jodi K.; Valente, Anthony J.; Mummidi, Srinivas; Chandrasekar, Bysani
2006-01-01
CXCL16 is a transmembrane non-ELR CXC chemokine that signals via CXCR6 to induce aortic smooth muscle cell (ASMC) proliferation. While bacterial lipopolysaccharide (LPS) has been shown to stimulate CXCL16 expression in SMC, its effects on CXCR6 are not known. Here, we demonstrate that LPS upregulates CXCR6 mRNA, protein, and surface expression in human ASMC. Inhibition of TLR4 with neutralizing antibodies or specific siRNA interference blocked LPS-mediated CXCR6 expression. LPS stimulated both AP-1 (c-Fos, c-Jun) and NF-κB (p50 and p65) activation, but only inhibition of AP-1 attenuated LPS-induced CXCR6 expression. Using dominant negative expression vectors and siRNA interference, we demonstrate that LPS induces AP-1 activation via MyD88, TRAF6, ERK1/2, and JNK signaling pathways. Furthermore, the flavoprotein inhibitor diphenyleniodonium chloride significantly attenuated LPS-mediated AP-1-dependent CXCR6 expression, as did inhibition of NOX4 NADPH oxidase by siRNA. Finally, CXCR6 knockdown inhibited CXCL16-induced ASMC proliferation. These results demonstrate that LPS-TLR4-NOX4-AP-1 signaling can induce CXCR6 expression in ASMC, and suggest that the CXCL16-CXCR6 axis may be an important proinflammatory pathway in the pathogenesis of atherosclerosis
MicroRNA-mediated networks underlie immune response regulation in papillary thyroid carcinoma
Huang, Chen-Tsung; Oyang, Yen-Jen; Huang, Hsuan-Cheng; Juan, Hsueh-Fen
2014-09-01
Papillary thyroid carcinoma (PTC) is a common endocrine malignancy with low death rate but increased incidence and recurrence in recent years. MicroRNAs (miRNAs) are small non-coding RNAs with diverse regulatory capacities in eukaryotes and have been frequently implied in human cancer. Despite current progress, however, a panoramic overview concerning miRNA regulatory networks in PTC is still lacking. Here, we analyzed the expression datasets of PTC from The Cancer Genome Atlas (TCGA) Data Portal and demonstrate for the first time that immune responses are significantly enriched and under specific regulation in the direct miRNA-target network among distinctive PTC variants to different extents. Additionally, considering the unconventional properties of miRNAs, we explore the protein-coding competing endogenous RNA (ceRNA) and the modulatory networks in PTC and unexpectedly disclose concerted regulation of immune responses from these networks. Interestingly, miRNAs from these conventional and unconventional networks share general similarities and differences but tend to be disparate as regulatory activities increase, coordinately tuning the immune responses that in part account for PTC tumor biology. Together, our systematic results uncover the intensive regulation of immune responses underlain by miRNA-mediated networks in PTC, opening up new avenues in the management of thyroid cancer.
Khalil, Mohamed I; Foda, Bardees M; Suresh, Susmitha; Singh, Upinder
2016-03-01
Entamoeba histolytica has a robust endogenous RNA interference (RNAi) pathway. There are abundant 27 nucleotide (nt) anti-sense small RNAs (AS sRNAs) that target genes for silencing and the genome encodes many genes involved in the RNAi pathway such as Argonaute proteins. Importantly, an E. histolytica gene with numerous AS sRNAs can function as a "trigger" to induce silencing of a gene that is fused to the trigger. Thus, the amebic RNAi pathway regulates gene expression relevant to amebic biology and has additionally been harnessed as a tool for genetic manipulation. In this study we have further improved the trigger-induced gene silencing method. We demonstrate that rather than using the full-length gene, a short portion of the coding region fused to a trigger is sufficient to induce silencing; the first 537 bp of the E. histolytica rhomboid gene (EhROM1) fused in-frame to the trigger was sufficient to silence EhROM1. We also demonstrated that the trigger method could silence two amebic genes concomitantly; fusion of the coding regions of EhROM1 and transcription factor, EhMyb, in-frame to a trigger gene resulted in both genes being silenced. Alternatively, two genes can be silenced sequentially: EhROM1-silenced parasites with no drug selection plasmid were transfected with trigger-EhMyb, resulting in parasites with both EhROM1 and EhMyb silenced. With all approaches tested, the trigger-mediated silencing was substantive and silencing was maintained despite loss of the G418 selectable marker. All gene silencing was associated with generation of AS sRNAs to the silenced gene. We tested the reversibility of the trigger system using inhibitors of histone modifications but found that the silencing was highly stable. This work represents a technical advance in the trigger gene silencing method in E. histolytica. Approaches that readily silence multiple genes add significantly to the genetic toolkit available to the ameba research community. Copyright © 2016
Yu, Yang; Wei, Shun-Guang; Weiss, Robert M; Felder, Robert B
2017-10-01
In systolic heart failure (HF), circulating proinflammatory cytokines upregulate inflammation and renin-angiotensin system (RAS) activity in cardiovascular regions of the brain, contributing to sympathetic excitation and cardiac dysfunction. Important among these is the subfornical organ (SFO), a forebrain circumventricular organ that lacks an effective blood-brain barrier and senses circulating humors. We hypothesized that the tumor necrosis factor-α (TNF-α) receptor 1 (TNFR1) in the SFO contributes to sympathetic excitation and cardiac dysfunction in HF rats. Rats received SFO microinjections of a TNFR1 shRNA or a scrambled shRNA lentiviral vector carrying green fluorescent protein, or vehicle. One week later, some rats were euthanized to confirm the accuracy of the SFO microinjections and the transfection potential of the lentiviral vector. Other rats underwent coronary artery ligation (CL) to induce HF or a sham operation. Four weeks after CL, vehicle- and scrambled shRNA-treated HF rats had significant increases in TNFR1 mRNA and protein, NF-κB activity, and mRNA for inflammatory mediators, RAS components and c-Fos protein in the SFO and downstream in the hypothalamic paraventricular nucleus, along with increased plasma norepinephrine levels and impaired cardiac function, compared with vehicle-treated sham-operated rats. In HF rats treated with TNFR1 shRNA, TNFR1 was reduced in the SFO but not paraventricular nucleus, and the central and peripheral manifestations of HF were ameliorated. In sham-operated rats treated with TNFR1 shRNA, TNFR1 expression was also reduced in the SFO but there were no other effects. These results suggest a key role for TNFR1 in the SFO in the pathophysiology of systolic HF. NEW & NOTEWORTHY Activation of TNF-α receptor 1 in the subfornical organ (SFO) contributes to sympathetic excitation in heart failure rats by increasing inflammation and renin-angiotensin system activity in the SFO and downstream in the hypothalamic
HIV-1 pre-mRNA commitment to Rev mediated export through PSF and Matrin 3
International Nuclear Information System (INIS)
Kula, Anna; Gharu, Lavina; Marcello, Alessandro
2013-01-01
Human immunodeficiency virus gene expression and replication are regulated at several levels. Incompletely spliced viral RNAs and full-length genomic RNA contain the RRE element and are bound by the viral trans-acting protein Rev to be transported out of the nucleus. Previously we found that the nuclear matrix protein MATR3 was a cofactor of Rev-mediated RNA export. Here we show that the pleiotropic protein PSF binds viral RNA and is associated with MATR3. PSF is involved in the maintenance of a pool of RNA available for Rev activity. However, while Rev and PSF bind the viral pre-mRNA at the site of viral transcription, MATR3 interacts at a subsequent step. We propose that PSF and MATR3 define a novel pathway for RRE-containing HIV-1 RNAs that is hijacked by the viral Rev protein.
Energy Technology Data Exchange (ETDEWEB)
Maquat, Lynne
2002-12-01
The goal of this meeting was to provide an interactive forum for scientists working on prokaryotic and eukaryotic mRNA decay. A special seminar presented by a leader in the field of mRNA decay in S. cerevisiae focused on what is known and what needs to be determined, not only for yeast but for other organisms. The large attendance (110 participants) reflects the awareness that mRNA decay is a key player in gene regulation in a way that is affected by the many steps that precede mRNA formation. Sessions were held on the following topics: mRNA transport and mRNP; multicomponent eukaryotic nucleases; nonsense-mediated mRNA decay and nonsense-associated altered splicing; Cis-acting sequences/Trans-acting factors of mRNA decay; translational accuracy; multicomponent bacterial nucleases; interplay between mRNA polyadenylation, translation and decay in prokaryotes and prokaryotic organelles; and RNA interference and other RNA mediators of gene expression. In addition to the talks and two poster sessions, there were three round tables: (1) Does translation occur in the nucleus? (2) Differences and similarities in the mechanisms of mRNA decay in different eukaryotes, and (3) RNA surveillance in bacteria?
Lu, Ying; Wang, Weiming; Mao, Huiming; Hu, Hai; Wu, Yanling; Chen, Bing-Guan; Liu, Zhongmin
2011-01-01
Immune thrombocytopenia depends upon Fc receptor-mediated phagocytosis that involves signaling through the SH2 tyrosine kinase, Syk. We designed small interfering (siRNA) sequences complementary to Syk coding regions to decrease the expression of Syk in the human macrophage cell line, THP-1. To evaluate the functional effect of siRNA on phagocytosis, we developed a new in vitro assay for antibody-mediated platelet ingestion by THP-1 cells. Incubation of THP-1 cells at 37°C with fluorescence-labeled platelets and anti-platelet antibody promoted ingestion of platelets that could be quantitated by flow cytometry. Transfection of THP-1 cells with Syk-specific siRNA resulted in a reduction in the amount of FcγRII-associated Syk protein. Coincident with decreased Syk expression, we observed inhibition of antibody-mediated platelet ingestion. These results confirm a key role for Syk in antibody-mediated phagocytosis and suggest Syk-specific siRNA as a possible therapeutic candidate for immune thrombocytopenia. Copyright © 2011 Elsevier Inc. All rights reserved.
Gildea, John J; Xu, Peng; Carlson, Julia M; Gaglione, Robert T; Bigler Wang, Dora; Kemp, Brandon A; Reyes, Camellia M; McGrath, Helen E; Carey, Robert M; Jose, Pedro A; Felder, Robin A
2015-12-01
The electrogenic sodium bicarbonate cotransporter (NBCe2) is encoded by SLC4A5, variants of which have been associated with salt sensitivity of blood pressure, which affects 25% of the adult population. NBCe2 is thought to mediate sodium bicarbonate cotransport primarily in the renal collecting duct, but NBCe2 mRNA is also found in the rodent renal proximal tubule (RPT). The protein expression or function of NBCe2 has not been demonstrated in the human RPT. We validated an NBCe2 antibody by shRNA and Western blot analysis, as well as overexpression of an epitope-tagged NBCe2 construct in both RPT cells (RPTCs) and human embryonic kidney 293 (HEK293) cells. Using this validated NBCe2 antibody, we found NBCe2 protein expression in the RPT of fresh and frozen human kidney slices, RPTCs isolated from human urine, and isolated RPTC apical membrane. Under basal conditions, NBCe2 was primarily found in the Golgi, while NBCe1 was primarily found at the basolateral membrane. Following an acute short-term increase in intracellular sodium, NBCe2 expression was increased at the apical membrane in cultured slices of human kidney and polarized, immortalized RPTCs. Sodium bicarbonate transport was increased by monensin and overexpression of NBCe2, decreased by NBCe2 shRNA, but not by NBCe1 shRNA, and blocked by 2,2'-(1,2-ethenediyl)bis[5-isothiocyanato-benzenesulfonic acid]. NBCe2 could be important in apical sodium and bicarbonate cotransport under high-salt conditions; the implication of the ex vivo studies to the in vivo situation when salt intake is increased remains unclear. Therefore, future studies will examine the role of NBCe2 in mediating increased renal sodium transport in humans whose blood pressures are elevated by an increase in sodium intake. Copyright © 2015 the American Physiological Society.
A novel interference mechanism by a type IIIB CRISPR-Cmr module in Sulfolobus
DEFF Research Database (Denmark)
Deng, Ling; Garrett, Roger Antony; Shah, Shiraz Ali
2013-01-01
Recent studies on CRISPR-based adaptive immune systems have revealed extensive structural and functional diversity of the interference complexes which often coexist intracellularly. The archaeon Sulfolobus islandicus REY15A encodes three interference modules, one of type IA and two of type IIIB...... targeting. A rationale is provided for the intracellular coexistence of the different interference systems in S.¿islandicus REY15A which cooperate functionally by sharing a single Cas6 protein for crRNA processing and utilize crRNA products from identical CRISPR spacers....
Specific Inhibition of SRC Kinase Impairs Malignant Glioma Growth In Vitro and In Vivo
Directory of Open Access Journals (Sweden)
Hanna Stedt
2012-01-01
Full Text Available Malignant glioma is a severe cancer with a poor prognosis. Local occurrence and rare metastases of malignant glioma make it a suitable target for gene therapy. Several studies have demonstrated the importance of Src kinase in different cancers. However, these studies have focused mainly on Src-deficient mice or pharmacological inhibitors of Src. In this study we have used Src small hairpin RNAs (shRNAs in a lentiviral backbone to mimic a long-term stable treatment and determined the role of Src in tumor tissues. Efficacy of Src shRNAs was confirmed in vitro demonstrating up to 90% target gene inhibition. In a mouse malignant glioma model, Src shRNA tumors were almost 50-fold smaller in comparison to control tumors and had significantly reduced vascularity. In a syngenic rat intracranial glioma model, Src shRNA-transduced tumors were smaller and these rats had a survival benefit over the control rats. In vivo treatment was enhanced by chemotherapy and histone deacetylase inhibition. Our results emphasise the importance of Src in tumorigenesis and demonstrate that it can be efficiently inhibited in vitro and in vivo in two independent malignant glioma models. In conclusion, Src is a potential target for RNA interference-mediated treatment of malignant glioma.
GUItars: a GUI tool for analysis of high-throughput RNA interference screening data.
Directory of Open Access Journals (Sweden)
Asli N Goktug
Full Text Available High-throughput RNA interference (RNAi screening has become a widely used approach to elucidating gene functions. However, analysis and annotation of large data sets generated from these screens has been a challenge for researchers without a programming background. Over the years, numerous data analysis methods were produced for plate quality control and hit selection and implemented by a few open-access software packages. Recently, strictly standardized mean difference (SSMD has become a widely used method for RNAi screening analysis mainly due to its better control of false negative and false positive rates and its ability to quantify RNAi effects with a statistical basis. We have developed GUItars to enable researchers without a programming background to use SSMD as both a plate quality and a hit selection metric to analyze large data sets.The software is accompanied by an intuitive graphical user interface for easy and rapid analysis workflow. SSMD analysis methods have been provided to the users along with traditionally-used z-score, normalized percent activity, and t-test methods for hit selection. GUItars is capable of analyzing large-scale data sets from screens with or without replicates. The software is designed to automatically generate and save numerous graphical outputs known to be among the most informative high-throughput data visualization tools capturing plate-wise and screen-wise performances. Graphical outputs are also written in HTML format for easy access, and a comprehensive summary of screening results is written into tab-delimited output files.With GUItars, we demonstrated robust SSMD-based analysis workflow on a 3840-gene small interfering RNA (siRNA library and identified 200 siRNAs that increased and 150 siRNAs that decreased the assay activities with moderate to stronger effects. GUItars enables rapid analysis and illustration of data from large- or small-scale RNAi screens using SSMD and other traditional analysis
Binding of NUFIP2 to Roquin promotes recognition and regulation of ICOS mRNA.
Rehage, Nina; Davydova, Elena; Conrad, Christine; Behrens, Gesine; Maiser, Andreas; Stehklein, Jenny E; Brenner, Sven; Klein, Juliane; Jeridi, Aicha; Hoffmann, Anne; Lee, Eunhae; Dianzani, Umberto; Willemsen, Rob; Feederle, Regina; Reiche, Kristin; Hackermüller, Jörg; Leonhardt, Heinrich; Sharma, Sonia; Niessing, Dierk; Heissmeyer, Vigo
2018-01-19
The ubiquitously expressed RNA-binding proteins Roquin-1 and Roquin-2 are essential for appropriate immune cell function and postnatal survival of mice. Roquin proteins repress target mRNAs by recognizing secondary structures in their 3'-UTRs and by inducing mRNA decay. However, it is unknown if other cellular proteins contribute to target control. To identify cofactors of Roquin, we used RNA interference to screen ~1500 genes involved in RNA-binding or mRNA degradation, and identified NUFIP2 as a cofactor of Roquin-induced mRNA decay. NUFIP2 binds directly and with high affinity to Roquin, which stabilizes NUFIP2 in cells. Post-transcriptional repression of human ICOS by endogenous Roquin proteins requires two neighboring non-canonical stem-loops in the ICOS 3'-UTR. This unconventional cis-element as well as another tandem loop known to confer Roquin-mediated regulation of the Ox40 3'-UTR, are bound cooperatively by Roquin and NUFIP2. NUFIP2 therefore emerges as a cofactor that contributes to mRNA target recognition by Roquin.
Directory of Open Access Journals (Sweden)
Itzel López-Rosas
Full Text Available In higher eukaryotes, mRNA degradation and RNA-based gene silencing occur in cytoplasmic foci referred to as processing bodies (P-bodies. In protozoan parasites, the presence of P-bodies and their putative role in mRNA decay have yet to be comprehensively addressed. Identification of P-bodies might provide information on how mRNA degradation machineries evolved in lower eukaryotes. Here, we used immunofluorescence and confocal microscopy assays to investigate the cellular localization of mRNA degradation proteins in the human intestinal parasite Entamoeba histolytica and found evidence of the existence of P-bodies. Two mRNA decay factors, namely the EhXRN2 exoribonuclease and the EhDCP2 decapping enzyme, were localized in cytoplasmic foci in a pattern resembling P-body organization. Given that amoebic foci appear to be smaller and less rounded than those described in higher eukaryotes, we have named them "P-body-like structures". These foci contain additional mRNA degradation factors, including the EhCAF1 deadenylase and the EhAGO2-2 protein involved in RNA interference. Biochemical analysis revealed that EhCAF1 co-immunoprecipitated with EhXRN2 but not with EhDCP2 or EhAGO2-2, thus linking deadenylation to 5'-to-3' mRNA decay. The number of EhCAF1-containing foci significantly decreased after inhibition of transcription and translation with actinomycin D and cycloheximide, respectively. Furthermore, results of RNA-FISH assays showed that (i EhCAF1 colocalized with poly(A(+ RNA and (ii during silencing of the Ehpc4 gene by RNA interference, EhAGO2-2 colocalized with small interfering RNAs in cytoplasmic foci. Our observation of decapping, deadenylation and RNA interference proteins within P-body-like foci suggests that these structures have been conserved after originating in the early evolution of eukaryotic lineages. To the best of our knowledge, this is the first study to report on the localization of mRNA decay proteins within P
RNA interference in Lepidoptera
DEFF Research Database (Denmark)
Terenius, Ole; Papanicolaou, Alexie; Garbutt, Jennie S.
2011-01-01
in RNAi experiments in Lepidoptera are discussed. The review also points to a need to further investigate the mechanism of RNAi in lepidopteran insects and its possible connection to the innate immune response. Our general understanding of RNAi in Lepidoptera will be further aided in the future as our...... experiments have not been collected in such a way that they are possible to analyze. In this review, we have collected detailed data from more than 150 experiments including all to date published and many unpublished experiments. Despite a large variation in the data, trends that are found are that RNAi...... is particularly successful in the family Saturniidae and in genes involved in immunity. On the contrary, gene expression in epidermal tissues seems to be most difficult to silence. In addition, gene silencing by feeding dsRNA requires high concentrations for success. Possible causes for the variability of success...
Ramesh Kumar, D; Saravana Kumar, P; Gandhi, M Rajiv; Al-Dhabi, Naif Abdullah; Paulraj, M Gabriel; Ignacimuthu, S
2016-05-01
RNA interference (RNAi) has been used as a gene silencing strategy by the introduction of long double stranded RNA (dsRNA) for the control of pest insects. The aim of the present study was to examine whether the expression of vg gene which is responsible for wing development, can be repressed by chitosan/dsRNA based nanoparticles in Aedes aegypti. The vestigial gene (vg) was amplified from adult mosquito and cloned in pLitmus28i vector. Genetically engineered recombinant plasmid was transformed into RNase III deficient strain for synthesis of bacterially expressed dsRNA. Nanoparticles were prepared via electrostatic interaction between cationic polymer chitosan and anionic nucleic acids (dsRNA). The formation of chitosan/dsRNAnanoparticles and their size were confirmed by Atomic force microscopy (AFM). Chitosan/dsRNA mediated knockdown of Enhanced Green Fluorescence Protein (EGFP) was demonstrated in Sf21 cells. Further, we tested whether such an approach could be used to target vg gene in Ae. aegypti. The results showed that chitosan/dsRNA caused significant mortality, delayed growth development and caused adult wing-malformation. A qRT-PCR analysis confirmed that the chitosan/dsRNA mediated transcriptional level was downregulated. Our findings suggest that vg gene intervention strategies through RNAi can emerge as viable option for pest control. Copyright © 2016 Elsevier B.V. All rights reserved.
RNA-Binding Proteins Revisited – The Emerging Arabidopsis mRNA Interactome
Köster, Tino
2017-04-13
RNA–protein interaction is an important checkpoint to tune gene expression at the RNA level. Global identification of proteins binding in vivo to mRNA has been possible through interactome capture – where proteins are fixed to target RNAs by UV crosslinking and purified through affinity capture of polyadenylated RNA. In Arabidopsis over 500 RNA-binding proteins (RBPs) enriched in UV-crosslinked samples have been identified. As in mammals and yeast, the mRNA interactomes came with a few surprises. For example, a plethora of the proteins caught on RNA had not previously been linked to RNA-mediated processes, for example proteins of intermediary metabolism. Thus, the studies provide unprecedented insights into the composition of the mRNA interactome, highlighting the complexity of RNA-mediated processes.
RNA-Binding Proteins Revisited – The Emerging Arabidopsis mRNA Interactome
Kö ster, Tino; Marondedze, Claudius; Meyer, Katja; Staiger, Dorothee
2017-01-01
RNA–protein interaction is an important checkpoint to tune gene expression at the RNA level. Global identification of proteins binding in vivo to mRNA has been possible through interactome capture – where proteins are fixed to target RNAs by UV crosslinking and purified through affinity capture of polyadenylated RNA. In Arabidopsis over 500 RNA-binding proteins (RBPs) enriched in UV-crosslinked samples have been identified. As in mammals and yeast, the mRNA interactomes came with a few surprises. For example, a plethora of the proteins caught on RNA had not previously been linked to RNA-mediated processes, for example proteins of intermediary metabolism. Thus, the studies provide unprecedented insights into the composition of the mRNA interactome, highlighting the complexity of RNA-mediated processes.
Branscheid, Anja; Marchais, Antonin; Schott, Gregory; Lange, Heike; Gagliardi, Dominique; Andersen, Stig Uggerhøj; Voinnet, Olivier; Brodersen, Peter
2015-12-15
Small regulatory RNAs are fundamental in eukaryotic and prokaryotic gene regulation. In plants, an important element of post-transcriptional control is effected by 20-24 nt microRNAs (miRNAs) and short interfering RNAs (siRNAs) bound to the ARGONAUTE1 (AGO1) protein in an RNA induced silencing complex (RISC). AGO1 may cleave target mRNAs with small RNA complementarity, but the fate of the resulting cleavage fragments remains incompletely understood. Here, we show that SKI2, SKI3 and SKI8, subunits of a cytoplasmic cofactor of the RNA exosome, are required for degradation of RISC 5', but not 3'-cleavage fragments in Arabidopsis. In the absence of SKI2 activity, many miRNA targets produce siRNAs via the RNA-dependent RNA polymerase 6 (RDR6) pathway. These siRNAs are low-abundant, and map close to the cleavage site. In most cases, siRNAs were produced 5' to the cleavage site, but several examples of 3'-spreading were also identified. These observations suggest that siRNAs do not simply derive from RDR6 action on stable 5'-cleavage fragments and hence that SKI2 has a direct role in limiting secondary siRNA production in addition to its function in mediating degradation of 5'-cleavage fragments. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Hurtado, Cecilia; Ander, Bradley P; Maddaford, Thane G; Lukas, Anton; Hryshko, Larry V; Pierce, Grant N
2005-04-01
The cardiac Na(+)-Ca(2+) exchanger (NCX1) is the main mechanism for Ca(2+) efflux in the heart and is thought to serve an essential role in cardiac excitation-contraction (E-C) coupling. The demonstration that an NCX1 gene knock-out is embryonic lethal provides further support for this essential role. However, a recent report employing the Cre/loxP technique for cardiac specific knock-out of NCX1 has revealed that cardiac function is remarkably preserved in these mice, which survived to adulthood. This controversy highlights the necessity for further investigation of NCX1 function in the heart. In this study, we report on a novel approach for depletion of NCX1 in postnatal rat myocytes that utilizes RNA interference (RNAi), administered with high efficiency via adenoviral transfection. Depletion of NCX1 was confirmed by immunocytochemical detection, Western blots and radioisotopic assays of Na(+)-Ca(2+) exchange activity. Exchanger expression was inhibited by up to approximately 94%. Surprisingly, spontaneous beating of these cardiomyocytes was still maintained, although at a lower frequency. Electrical stimulation could elicit a normal beating rhythm, although NCX depleted cells exhibited a depressed Ca(2+) transient amplitude, a depressed rate of Ca(2+) rise and decline, elevated diastolic [Ca(2+)], and shorter action potentials. We also observed a compensatory increase in sarcolemmal Ca(2+) pump expression. Our data support an important, though non-essential, role for the NCX1 in E-C coupling in these neonatal heart cells. Furthermore, this approach provides a valuable means for assessing the role of NCX1 and could be utilized to examine other cardiac proteins in physiological and pathological studies.
LncRNA H19 and Target Gene-mediated Cleft Palate Induced by TCDD.
Gao, Li Yun; Zhang, Feng Quan; Zhao, Wei Hui; Han, Guang Liang; Wang, Xiao; Li, Qiang; Gao, Shan Shan; Wu, Wei Dong
2017-09-01
This study investigated the role of long non-coding RNAs (lncRNAs) in the development of the palatal tissues. Cleft palates in mice were induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Expression levels of long non-coding RNA H19 (lncRNA H19) and insulin-like growth factor 2 (IGF2) gene were measured by quantitative real-time polymerase chain reaction (qRT-PCR). The rate of occurrence of cleft palate was found to be 100% by TCDD exposure, and TCDD could cause short upper limb, cerebral fissure, webbed neck, and short neck. The expression levels of lncRNA H19 and IGF2 gene specifically showed embryo age-related differences on E13, E14, and E15 in the palatal tissues. The expression levels of lncRNA H19 and IGF2 gene showed an inverse relationship on E13, E14, and E15. These findings demonstrated that lncRNA H19 and IGF2 can mediate the development of mouse cleft palate. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.
Sonnleitner, Elisabeth; Wulf, Alexander; Campagne, Sébastien; Pei, Xue-Yuan; Wolfinger, Michael T; Forlani, Giada; Prindl, Konstantin; Abdou, Laetitia; Resch, Armin; Allain, Frederic H-T; Luisi, Ben F; Urlaub, Henning; Bläsi, Udo
2018-02-16
In Pseudomonas aeruginosa the RNA chaperone Hfq and the catabolite repression control protein (Crc) act as post-transcriptional regulators during carbon catabolite repression (CCR). In this regard Crc is required for full-fledged Hfq-mediated translational repression of catabolic genes. RNAseq based transcriptome analyses revealed a significant overlap between the Crc and Hfq regulons, which in conjunction with genetic data supported a concerted action of both proteins. Biochemical and biophysical approaches further suggest that Crc and Hfq form an assembly in the presence of RNAs containing A-rich motifs, and that Crc interacts with both, Hfq and RNA. Through these interactions, Crc enhances the stability of Hfq/Crc/RNA complexes, which can explain its facilitating role in Hfq-mediated translational repression. Hence, these studies revealed for the first time insights into how an interacting protein can modulate Hfq function. Moreover, Crc is shown to interfere with binding of a regulatory RNA to Hfq, which bears implications for riboregulation. These results are discussed in terms of a working model, wherein Crc prioritizes the function of Hfq toward utilization of favored carbon sources.
How the RNA isolation method can affect microRNA microarray results
DEFF Research Database (Denmark)
Podolska, Agnieszka; Kaczkowski, Bogumil; Litman, Thomas
2011-01-01
RNA microarray analysis on porcine brain tissue. One method is a phenol-guanidine isothiocyanate-based procedure that permits isolation of total RNA. The second method, miRVana™ microRNA isolation, is column based and recovers the small RNA fraction alone. We found that microarray analyses give different results...... that depend on the RNA fraction used, in particular because some microRNAs appear very sensitive to the RNA isolation method. We conclude that precautions need to be taken when comparing microarray studies based on RNA isolated with different methods.......The quality of RNA is crucial in gene expression experiments. RNA degradation interferes in the measurement of gene expression, and in this context, microRNA quantification can lead to an incorrect estimation. In the present study, two different RNA isolation methods were used to perform micro...
Park, Yeonkyung; Lee, Chang Yeol; Kang, Shinyoung; Kim, Hansol; Park, Ki Soo; Park, Hyun Gyu
2018-02-01
In this work, we developed a novel, label-free, and enzyme-free strategy for the colorimetric detection of microRNA (miRNA), which relies on a target-catalyzed toehold-mediated strand displacement (TMSD) reaction. The system employs a detection probe that specifically binds to the target miRNA and sequentially releases a catalyst strand (CS) intended to trigger the subsequent TMSD reaction. Thus, the presence of target miRNA releases the CS that mediates the formation of an active G-quadruplex DNAzyme which is initially caged and inactivated by a blocker strand. In addition, a fuel strand that is supplemented for the recycling of the CS promotes another TMSD reaction, consequently generating a large number of active G-quadruplex DNAzymes. As a result, a distinct colorimetric signal is produced by the ABTS oxidation promoted by the peroxidase mimicking activity of the released G-quadruplex DNAzymes. Based on this novel strategy, we successfully detected miR-141, a promising biomarker for human prostate cancer, with high selectivity. The diagnostic capability of this system was also demonstrated by reliably determining target miR-141 in human serum, showing its great potential towards real clinical applications. Importantly, the proposed approach is composed of separate target recognition and signal transduction modules. Thus, it could be extended to analyze different target miRNAs by simply redesigning the detection probe while keeping the same signal transduction module as a universal signal amplification unit, which was successfully demonstrated by analyzing another target miRNA, let-7d.
DEFF Research Database (Denmark)
de Groot, Anne Marit; Thanki, Kaushik; Gangloff, Monique
2018-01-01
, we showed that encapsulation of siRNA in lipid-polymer hybrid nanoparticles (LPNs), based on poly(DL-lactic-co-glycolic acid) (PLGA) and cationic lipid-like materials (lipidoids), remarkably enhances intracellular delivery of siRNA as compared to siRNA delivery with LPNs modified...... acid lipid particles, which was the reference formulation for siRNA delivery, proved to activate TLR4. However, by combining lipidoids with PLGA into LPNs, TLR4 activation was abrogated. Thus, lipidoid-mediated TLR4 activation during siRNA delivery may be modulated via optimization of the formulation......Therapeutics based on small interfering RNA (siRNA) have promising potential as antiviral and anti-inflammatory agents. To deliver siRNA across cell membranes to reach the RNA interference pathway in the cytosol of target cells, non-viral nanoparticulate delivery approaches are explored. Recently...
Lu, Sha; Yin, Xiaoyan; Spollen, William; Zhang, Ning; Xu, Dong; Schoelz, James; Bilyeu, Kristin; Zhang, Zhanyuan J
2015-01-01
In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.
MicroRNA-Mediated Downregulation of the Potassium Channel Kv4.2 Contributes to Seizure Onset
Directory of Open Access Journals (Sweden)
Christina Gross
2016-09-01
Full Text Available Seizures are bursts of excessive synchronized neuronal activity, suggesting that mechanisms controlling brain excitability are compromised. The voltage-gated potassium channel Kv4.2, a major mediator of hyperpolarizing A-type currents in the brain, is a crucial regulator of neuronal excitability. Kv4.2 expression levels are reduced following seizures and in epilepsy, but the underlying mechanisms remain unclear. Here, we report that Kv4.2 mRNA is recruited to the RNA-induced silencing complex shortly after status epilepticus in mice and after kainic acid treatment of hippocampal neurons, coincident with reduction of Kv4.2 protein. We show that the microRNA miR-324-5p inhibits Kv4.2 protein expression and that antagonizing miR-324-5p is neuroprotective and seizure suppressive. MiR-324-5p inhibition also blocks kainic-acid-induced reduction of Kv4.2 protein in vitro and in vivo and delays kainic-acid-induced seizure onset in wild-type but not in Kcnd2 knockout mice. These results reveal an important role for miR-324-5p-mediated silencing of Kv4.2 in seizure onset.
The cyclin-dependent kinase 8 module sterically blocks Mediator interactions with RNA polymerase II
DEFF Research Database (Denmark)
Elmlund, Hans; Baraznenok, Vera; Lindahl, Martin
2006-01-01
CDK8 (cyclin-dependent kinase 8), along with CycC, Med12, and Med13, form a repressive module (the Cdk8 module) that prevents RNA polymerase II (pol II) interactions with Mediator. Here, we report that the ability of the Cdk8 module to prevent pol II interactions is independent of the Cdk8......-dependent kinase activity. We use electron microscopy and single-particle reconstruction to demonstrate that the Cdk8 module forms a distinct structural entity that binds to the head and middle region of Mediator, thereby sterically blocking interactions with pol II....
International Nuclear Information System (INIS)
Smialowska, Agata; Djupedal, Ingela; Wang, Jingwen; Kylsten, Per; Swoboda, Peter; Ekwall, Karl
2014-01-01
Highlights: • Protein coding genes accumulate anti-sense sRNAs in fission yeast S. pombe. • RNAi represses protein-coding genes in S. pombe. • RNAi-mediated gene repression is post-transcriptional. - Abstract: RNA interference (RNAi) is a gene silencing mechanism conserved from fungi to mammals. Small interfering RNAs are products and mediators of the RNAi pathway and act as specificity factors in recruiting effector complexes. The Schizosaccharomyces pombe genome encodes one of each of the core RNAi proteins, Dicer, Argonaute and RNA-dependent RNA polymerase (dcr1, ago1, rdp1). Even though the function of RNAi in heterochromatin assembly in S. pombe is established, its role in controlling gene expression is elusive. Here, we report the identification of small RNAs mapped anti-sense to protein coding genes in fission yeast. We demonstrate that these genes are up-regulated at the protein level in RNAi mutants, while their mRNA levels are not significantly changed. We show that the repression by RNAi is not a result of heterochromatin formation. Thus, we conclude that RNAi is involved in post-transcriptional gene silencing in S. pombe
Niu, Yuchun; Ma, Feng; Huang, Weimei; Fang, Shun; Li, Man; Wei, Ting; Guo, Linlang
2017-01-09
Taurine upregulated gene1 (TUG1) as a 7.1-kb lncRNA, has been shown to play an oncogenic role in various cancers. However, the biological functions of lncRNA TUG1 in small cell lung cancer (SCLC) remain unknown. The aim of this study is to explore the roles of TUG1 in cell growth and chemoresistance of SCLC and its possible molecular mechanism. The expression of TUG1 in thirty-three cases of SCLC tissues and SCLC cell line were examined by quantitative RT-PCR (qRT-PCR). The functional roles of TUG1 in SCLC were demonstrated by CCK8 assay, colony formation assay, wound healing assay and transwell assay, flow cytometry analysis and in vivo study through siRNA or shRNA mediated knockdown. Western blot assays were used to evaluate gene and protein expression in cell lines. Chromatin immunoprecipitation (ChIP) and RNA binding protein immunoprecipitation (RIP) were performed to confirm the molecular mechanism of TUG1 involved in cell growth and chemoresistance of small cell lung cancer. We found that TUG1 was overexpressed in SCLC tissues, and its expression was correlated with the clinical stage and the shorter survival time of SCLC patients. Moreover, downregulation of TUG1 expression could impair cell proliferation and increased cell sensitivity to anticancer drugs both in vitro and in vivo. We also discovered that TUG1 knockdown significantly promoted cell apoptosis and cell cycle arrest, and inhibited cell migration and invasion in vitro . We further demonstrated that TUG1 can regulate the expression of LIMK2b (a splice variant of LIM-kinase 2) via binding with enhancer of zeste homolog 2 (EZH2), and then promoted cell growth and chemoresistance of SCLC. Together, these results suggested that TUG1 mediates cell growth and chemoresistance of SCLC by regulating LIMK2b via EZH2.
Energy Technology Data Exchange (ETDEWEB)
Nam, Ki Hyun; Haitjema, Charles; Liu, Xueqi; Ding, Fran; Wang, Hongwei; DeLisa, Matthew P.; Ke, Ailong (Yale); (Cornell); (Tsinghua)
2012-10-10
Clustered regularly interspaced short palindromic repeats (CRISPRs), together with an operon of CRISPR-associated (Cas) proteins, form an RNA-based prokaryotic immune system against exogenous genetic elements. Cas5 family proteins are found in several type I CRISPR-Cas systems. Here, we report the molecular function of subtype I-C/Dvulg Cas5d from Bacillus halodurans. We show that Cas5d cleaves pre-crRNA into unit length by recognizing both the hairpin structure and the 3 single stranded sequence in the CRISPR repeat region. Cas5d structure reveals a ferredoxin domain-based architecture and a catalytic triad formed by Y46, K116, and H117 residues. We further show that after pre-crRNA processing, Cas5d assembles with crRNA, Csd1, and Csd2 proteins to form a multi-sub-unit interference complex similar to Escherichia coli Cascade (CRISPR-associated complex for antiviral defense) in architecture. Our results suggest that formation of a crRNA-presenting Cascade-like complex is likely a common theme among type I CRISPR subtypes.
CRISPR/Cas13 as a Tool for RNA Interference
Ali, Zahir; Mahas, Ahmed; Mahfouz, Magdy M.
2018-01-01
Almost all biological processes involve RNA, making it crucial to develop tools for manipulation of the transcriptome. The bacterial CRISPR/Cas13 system was recently rewired to facilitate RNA manipulation in eukaryotes, including plants. We discuss
International Nuclear Information System (INIS)
Wan Hong; South, Andrew P.; Hart, Ian R.
2007-01-01
The intercellular adhesive junction desmosomes are essential for the maintenance of tissue structure and integrity in skin. Desmoplakin (Dp) is a major obligate plaque protein which plays a fundamental role in anchoring intermediate filaments to desmosomal cadherins. Evidence from hereditary human disease caused by mutations in the gene encoding Dp, e.g. Dp haploinsufficiency, suggests that alterations in Dp expression result not only in the disruption of tissue structure and integrity but also could evoke changes in keratinocyte proliferation. We have used transient RNA interference (RNAi) to downregulate Dp specifically in HaCaT keratinocytes. We showed that this Dp downregulation also caused reduced expression of several other desmosomal proteins. Increased cell proliferation and enhanced G 1 -to-S-phase entry in the cell cycle, as monitored by colonial cellular density and BrdU incorporation, were seen in Dp RNAi-treated cells. These proliferative changes were associated with elevated phospho-ERK1/2 and phospho-Akt levels. Furthermore, this increase in phospho-ERK/1/2 and phospho-Akt levels was sustained in Dp RNAi-treated cells at confluence whereas in control cells there was a significant reduction in phosphorylation of ERK1/2. This study indicates that Dp may participate in the regulation of keratinocyte cell proliferation by, in part at least, regulating cell cycle progression
International Nuclear Information System (INIS)
Zhang Jing; Yamada, Osamu; Sakamoto, Takashi; Yoshida, Hiroshi; Iwai, Takahiro; Matsushita, Yoshihisa; Shimamura, Hideo; Araki, Hiromasa; Shimotohno, Kunitada
2004-01-01
Small interfering RNA (siRNA) is currently being evaluated not only as a powerful tool for functional genomics, but also as a potentially promising therapeutic agent for cancer and infectious diseases. Inhibitory effect of siRNA on viral replication has been demonstrated in multiple pathogenic viruses. However, because of the high sequence specificity of siRNA-mediated RNA degradation, antiviral efficacy of siRNA directed to viral genome will be largely limited by emergence of escape variants resistant to siRNA due to high mutation rates of virus, especially RNA viruses such as poliovirus and hepatitis C virus (HCV). To investigate the therapeutic feasibility of siRNAs specific for the putative cellular cofactors for HCV, we constructed adenovirus vectors expressing siRNAs against La, polypyrimidine tract-binding protein (PTB), subunit gamma of human eukaryotic initiation factors 2B (eIF2Bγ), and human VAMP-associated protein of 33 kDa (hVAP-33). Adenoviral-mediated expression of siRNAs markedly diminished expression of the endogenous genes, and silencing of La, PTB, and hVAP-33 by siRNAs substantially blocked HCV replication in Huh-7 cells. Thus, our studies demonstrate the feasibility and potential of adenoviral-delivered siRNAs specific for cellular cofactors in combating HCV infection, which can be used either alone or in combination with siRNA against viral genome to prevent the escape of mutant variants and provide additive or synergistic anti-HCV effects
Duan, Li-Jun; Ding, Min; Hou, Li-Jun; Cui, Yuan-Tao; Li, Chun-Jun; Yu, De-Min
2017-03-11
Long noncoding RNA taurine-upregulated gene 1 (lncRNA TUG1) has been reported to play a key role in the progression of diabetic nephropathy (DN). However, the role of lncRNA TUG1 in the regulation of diabetic nephropathy remains largely unknown. The aim of the present study is to identify the regulation of lncRNA TUG1 on extracellular matrix accumulation via mediating microRNA-377 targeting of PPARγ, and investigate the underlying mechanisms in progression of DN. Microarray was performed to screen differentially expressed miRNAs in db/db DN mice. Afterwards, computational prediction programs (TargetScan, miRanda, PicTar and miRGen) was applied to predict the target gene of miRNAs. The complementary binding of miRNA and lncRNA was assessed by luciferase assays. Protein and mRNA expression were detected by western blot and real time quantitate PCR. MiRNA-377 was screened by miRNA microarray and differentially up-regulated in db/db DN mice. PPARγ was predicted to be the target of miR-377 and the prediction was verified by luciferase assays. Expression of miR-377 was up-regulated in mesangial cell treated with high glucose (25 mM), and overexpression of miR-377 inhibited PPARγ expression and promoted PAI-1 and TGF-β1 expression. The expression of TUG1 antagonized the effect of miR-377 on the downregulation of its target PPARγ and inhibited extracellular matrix accumulation, including PAI-1, TGF-β1, fibronectin (FN) and collagen IV (Col IV), induced by high glucose. LncRNA TUG1 acts as an endogenous sponge of miR-377 and downregulates miR-377 expression levels, and thereby relieving the inhibition of its target gene PPARγ and alleviates extracellular matrix accumulation of mesangial cells, which provides a novel insight of diabetic nephropathy pathogenesis. Copyright © 2017 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Siegel, Gabriele; Obernosterer, Gregor; Fiore, Roberto
2009-01-01
of acyl protein thioesterase 1 (APT1), an enzyme regulating the palmitoylation status of proteins that are known to function at the synapse, including the alpha(13) subunits of G proteins (Galpha(13)). RNA-interference-mediated knockdown of APT1 and the expression of membrane-localized Galpha(13) both...... suppress spine enlargement caused by inhibition of miR-138, suggesting that APT1-regulated depalmitoylation of Galpha(13) might be an important downstream event of miR-138 function. Our results uncover a previously unknown miRNA-dependent mechanism in neurons and demonstrate a previously unrecognized...
DEFF Research Database (Denmark)
Weischenfeldt, Joachim Lütken; Waage, Johannes Eichler; Tian, Geng
2012-01-01
ABSTRACT: BACKGROUND: Nonsense-mediated mRNA decay (NMD) affects the outcome of alternative splicing by degrading mRNA isoforms with premature termination codons. Splicing regulators constitute important NMD targets; however, the extent to which loss of NMD causes extensive deregulation...... of alternative splicing has not previously been assayed in a global, unbiased manner. Here, we combine mouse genetics and RNA-seq to provide the first in vivo analysis of the global impact of NMD on splicing patterns in two primary mouse tissues ablated for the NMD factor UPF2. RESULTS: We developed...... importance, the latter events are associated with high intronic conservation. CONCLUSIONS: Our data demonstrate that NMD regulates alternative splicing outcomes through an intricate web of splicing regulators and that its loss leads to the deregulation of a panoply of splicing events, providing novel...
Viral RNAi suppressor reversibly binds siRNA to outcompete Dicer and RISC via multiple turnover.
Rawlings, Renata A; Krishnan, Vishalakshi; Walter, Nils G
2011-04-29
RNA interference is a conserved gene regulatory mechanism employed by most eukaryotes as a key component of their innate immune response to viruses and retrotransposons. During viral infection, the RNase-III-type endonuclease Dicer cleaves viral double-stranded RNA into small interfering RNAs (siRNAs) 21-24 nucleotides in length and helps load them into the RNA-induced silencing complex (RISC) to guide the cleavage of complementary viral RNA. As a countermeasure, many viruses have evolved viral RNA silencing suppressors (RSS) that tightly, and presumably quantitatively, bind siRNAs to thwart RNA-interference-mediated degradation. Viral RSS proteins also act across kingdoms as potential immunosuppressors in gene therapeutic applications. Here we report fluorescence quenching and electrophoretic mobility shift assays that probe siRNA binding by the dimeric RSS p19 from Carnation Italian Ringspot Virus, as well as by human Dicer and RISC assembly complexes. We find that the siRNA:p19 interaction is readily reversible, characterized by rapid binding [(1.69 ± 0.07) × 10(8) M(-)(1) s(-1)] and marked dissociation (k(off)=0.062 ± 0.002 s(-1)). We also observe that p19 efficiently competes with recombinant Dicer and inhibits the formation of RISC-related assembly complexes found in human cell extract. Computational modeling based on these results provides evidence for the transient formation of a ternary complex between siRNA, human Dicer, and p19. An expanded model of RNA silencing indicates that multiple turnover by reversible binding of siRNAs potentiates the efficiency of the suppressor protein. Our predictive model is expected to be applicable to the dosing of p19 as a silencing suppressor in viral gene therapy. Copyright © 2011 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Qin Wang
2014-01-01
Full Text Available Colon cancer is one of the most common tumors of the digestive tract. Resistance to ionizing radiation (IR decreased therapeutic efficiency in these patients’ radiotherapy. XRCC2 is the key protein of DNA homologous recombination repair, and its high expression is associated with enhanced resistance to DNA damage induced by IR. Here, we investigated the effect of XRCC2 silencing on colon tumor cells’ growth and sensitivity to X-radiation in vitro and in vivo. Colon tumor cells (T84 cell line were cultivated in vitro and tumors originated from the cell line were propagated as xenografts in nude mice. The suppression of XRCC2 expression was achieved by using vector-based short hairpin RNA (shRNA in T84 cells. We found that the knockdown of XRCC2 expression effectively decreased T84 cellular proliferation and colony formation, and led to cell apoptosis and cell cycle arrested in G2/M phase induced by X-radiation in vitro. In addition, tumor xenograft studies suggested that XRCC2 silencing inhibited tumorigenicity after radiation treatment in vivo. Our data suggest that the suppression of XRCC2 expression rendered colon tumor cells more sensitive to radiation therapy in vitro and in vivo, implying XRCC2 as a promising therapeutic target for the treatment of radioresistant human colon cancer.
RNA- and protein-mediated control of Listeria monocytogenes virulence gene expression
Lebreton, Alice; Cossart, Pascale
2017-01-01
ABSTRACT The model opportunistic pathogen Listeria monocytogenes has been the object of extensive research, aiming at understanding its ability to colonize diverse environmental niches and animal hosts. Bacterial transcriptomes in various conditions reflect this efficient adaptability. We review here our current knowledge of the mechanisms allowing L. monocytogenes to respond to environmental changes and trigger pathogenicity, with a special focus on RNA-mediated control of gene expression. We highlight how these studies have brought novel concepts in prokaryotic gene regulation, such as the ‘excludon’ where the 5′-UTR of a messenger also acts as an antisense regulator of an operon transcribed in opposite orientation, or the notion that riboswitches can regulate non-coding RNAs to integrate complex metabolic stimuli into regulatory networks. Overall, the Listeria model exemplifies that fine RNA tuners act together with master regulatory proteins to orchestrate appropriate transcriptional programmes. PMID:27217337
Directory of Open Access Journals (Sweden)
Stephanie J DeWitte-Orr
2010-03-01
Full Text Available Extracellular RNA is becoming increasingly recognized as a signaling molecule. Virally derived double stranded (dsRNA released into the extracellular space during virus induced cell lysis acts as a powerful inducer of classical type I interferon (IFN responses; however, the receptor that mediates this response has not been identified. Class A scavenger receptors (SR-As are likely candidates due to their cell surface expression and ability to bind nucleic acids. In this study, we investigated a possible role for SR-As in mediating type I IFN responses induced by extracellular dsRNA in fibroblasts, a predominant producer of IFNbeta. Fibroblasts were found to express functional SR-As, even SR-A species thought to be macrophage specific. SR-A specific competitive ligands significantly blocked extracellular dsRNA binding, entry and subsequent interferon stimulated gene (ISG induction. Candidate SR-As were systematically investigated using RNAi and the most dramatic inhibition in responses was observed when all candidate SR-As were knocked down in unison. Partial inhibition of dsRNA induced antiviral responses was observed in vivo in SR-AI/II(-/- mice compared with WT controls. The role of SR-As in mediating extracellular dsRNA entry and subsequent induced antiviral responses was observed in both murine and human fibroblasts. SR-As appear to function as 'carriers', facilitating dsRNA entry and delivery to the established dsRNA sensing receptors, specifically TLR3, RIGI and MDA-5. Identifying SR-As as gatekeepers of the cell, mediating innate antiviral responses, represents a novel function for this receptor family and provides insight into how cells recognize danger signals associated with lytic virus infections. Furthermore, the implications of a cell surface receptor capable of recognizing extracellular RNA may exceed beyond viral immunity to mediating other important innate immune functions.
[Impact of siRNA-mediated down-regulation of CD147 on human breast cancer cells].
Li, Zhenqian; Li, Daoming; Li, Jiangwei; Huang, Pei; Qin, Hui
2015-10-01
To investigate the influence of siRNA-mediated down-regulation of CD147 on growth, proliferation and movement of human breast cancer cell line MDA-MB-231. The protein expression of CD147, MMP-2 and TIMP-2 of the MDA-MB-231 cells were analyzed by ABC. Lentiviral expression vector of CD147 gene was constructed and transfected into MDA-MB-231 cells. RT-PCR and Western blot were used to detect the mRNA and protein level changes of CD147 genes to identify the optimal time point, followed by detection of changes of mRNA and protein expression of MMP-2 and TIMP-2 genes. CCK-8 reagent method and cell scratch test were used to detect the proliferation and migration change of MDA-MB-231 cells. The nude mouse model of breast cancer by hypodermic injection with MDA-MB-231 cells was established to document the effect of CD147 siRNA on the tumor transplants. After transfection of lentiviral expression vector of CD147 gene, protein of CD147, MMP-2 and TIMP-2 were weakly or negative expressed, significantly weaker than those of control group (P CD147 and MMP-2 were 96.03% ± 0.84% and 96.03% ± 0.84%, respectively. Both CD147 mRNA and MMP-2 mRNA expression were down-regulated (P 0.05). No less than 2 days after transfection, cell growth of MDA-MB-231 cell line was found significantly inhibited (P CD147 led to reduction of volume and mass of nude mouses. The growth of the carcinoma transplant was inhibited upon siRNA-mediated down-regulation of CD147 (P CD147 may alter the MMP-2/TIMP-2 balance in MDA-MB-231 cells. CD147 gene silencing inhibits the proliferation and migration of MDA-MB-231 cells and the growth of carcinoma transplants in nude mice.
Branscheid, Anja; Marchais, Antonin; Schott, Gregory; Lange, Heike; Gagliardi, Dominique; Andersen, Stig Uggerhøj; Voinnet, Olivier; Brodersen, Peter
2015-01-01
Small regulatory RNAs are fundamental in eukaryotic and prokaryotic gene regulation. In plants, an important element of post-transcriptional control is effected by 20–24 nt microRNAs (miRNAs) and short interfering RNAs (siRNAs) bound to the ARGONAUTE1 (AGO1) protein in an RNA induced silencing complex (RISC). AGO1 may cleave target mRNAs with small RNA complementarity, but the fate of the resulting cleavage fragments remains incompletely understood. Here, we show that SKI2, SKI3 and SKI8, subunits of a cytoplasmic cofactor of the RNA exosome, are required for degradation of RISC 5′, but not 3′-cleavage fragments in Arabidopsis. In the absence of SKI2 activity, many miRNA targets produce siRNAs via the RNA-dependent RNA polymerase 6 (RDR6) pathway. These siRNAs are low-abundant, and map close to the cleavage site. In most cases, siRNAs were produced 5′ to the cleavage site, but several examples of 3′-spreading were also identified. These observations suggest that siRNAs do not simply derive from RDR6 action on stable 5′-cleavage fragments and hence that SKI2 has a direct role in limiting secondary siRNA production in addition to its function in mediating degradation of 5′-cleavage fragments. PMID:26464441
Grishok, Alla; Hoersch, Sebastian; Sharp, Phillip A
2008-12-23
In Caenorhabditis elegans, a vast number of endogenous short RNAs corresponding to thousands of genes have been discovered recently. This finding suggests that these short interfering RNAs (siRNAs) may contribute to regulation of many developmental and other signaling pathways in addition to silencing viruses and transposons. Here, we present a microarray analysis of gene expression in RNA interference (RNAi)-related mutants rde-4, zfp-1, and alg-1 and the retinoblastoma (Rb) mutant lin-35. We found that a component of Dicer complex RDE-4 and a chromatin-related zinc finger protein ZFP-1, not implicated in endogenous RNAi, regulate overlapping sets of genes. Notably, genes a) up-regulated in the rde-4 and zfp-1 mutants and b) up-regulated in the lin-35(Rb) mutant, but not the down-regulated genes are highly represented in the set of genes with corresponding endogenous siRNAs (endo-siRNAs). Our study suggests that endogenous siRNAs cooperate with chromatin factors, either C. elegans ortholog of acute lymphoblastic leukemia-1 (ALL-1)-fused gene from chromosome 10 (AF10), ZFP-1, or tumor suppressor Rb, to regulate overlapping sets of genes and predicts a large role for RNAi-based chromatin silencing in control of gene expression in C. elegans.
Nemoto, Takashi; Maruyama, Jun-ichi; Kitamoto, Katsuhiko
2009-11-01
Aspergillus oryzae RIB40 has three alpha-amylase genes (amyA, amyB, and amyC), and secretes alpha-amylase abundantly. However, large amounts of endogenous secretory proteins such as alpha-amylase can compete with heterologous protein in the secretory pathway and decrease its production yields. In this study, we examined the effects of suppression of alpha-amylase on heterologous protein production in A. oryzae, using the bovine chymosin (CHY) as a reporter heterologous protein. The three alpha-amylase genes in A. oryzae have nearly identical DNA sequences from those promoters to the coding regions. Hence we performed silencing of alpha-amylase genes by RNA interference (RNAi) in the A. oryzae CHY producing strain. The silenced strains exhibited a reduction in alpha-amylase activity and an increase in CHY production in the culture medium. This result suggests that suppression of alpha-amylase is effective in heterologous protein production in A. oryzae.
Directory of Open Access Journals (Sweden)
Andrew S French
2015-07-01
Full Text Available Our current understanding of insect phototransduction is based on a small number of species, but insects occupy many different visual environments. We created the retinal transcriptome of a nocturnal insect, the cockroach, Periplaneta americana to identify proteins involved in the earliest stages of compound eye phototransduction, and test the hypothesis that different visual environments are reflected in different molecular contributions to function. We assembled five novel mRNAs: two green opsins, one UV opsin, and one each TRP and TRPL ion channel homologs. One green opsin mRNA (pGO1 was 100-1000 times more abundant than the other opsins (pGO2 and pUVO, while pTRPL mRNA was 10 times more abundant than pTRP, estimated by transcriptome analysis or quantitative PCR (qPCR. Electroretinograms were used to record photoreceptor responses. Gene-specific in vivo RNA interference (RNAi was achieved by injecting long (596-708 bp double-stranded RNA into head hemolymph, and verified by qPCR. RNAi of the most abundant green opsin reduced both green opsins by more than 97% without affecting UV opsin, and gave a maximal reduction of 75% in ERG amplitude seven days after injection that persisted for at least 19 days. RNAi of pTRP and pTRPL genes each specifically reduced the corresponding mRNA by 90%. Electroretinogram reduction by pTRPL RNAi was slower than for opsin, reaching 75% attenuation by 21 days, without recovery at 29 days. pTRP RNAi attenuated ERG much less; only 30% after 21 days. Combined pTRP plus pTRPL RNAi gave only weak evidence of any cooperative interactions. We conclude that silencing retinal genes by in vivo RNAi using long dsRNA is effective, that visible light transduction in Periplaneta is dominated by pGO1, and that pTRPL plays a major role in cockroach phototransduction.
Directory of Open Access Journals (Sweden)
Sha Lu
Full Text Available In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.
microRNA-independent recruitment of Argonaute 1 to nanos mRNA through the Smaug RNA-binding protein
Pinder, Benjamin D; Smibert, Craig A
2012-01-01
Argonaute 1 directly interacts with the RNA binding protein Smaug in Drosophila, is thereby recruited to the Smaug target nanos mRNA and is required for Smaug-mediated translational repression of the nanos mRNA.
A conserved Mediator–CDK8 kinase module association regulates Mediator–RNA polymerase II interaction
Tsai, Kuang-Lei; Sato, Shigeo; Tomomori-Sato, Chieri; Conaway, Ronald C.; Conaway, Joan W.; Asturias, Francisco J.
2013-01-01
The CDK8 kinase module (CKM) is a conserved, dissociable Mediator subcomplex whose component subunits were genetically linked to the RNA polymerase II (RNAPII) carboxy-terminal domain (CTD) and individually recognized as transcriptional repressors before Mediator was identified as a preeminent complex in eukaryotic transcription regulation. We used macromolecular electron microscopy and biochemistry to investigate the subunit organization, structure, and Mediator interaction of the Saccharomyces cerevisiae CKM. We found that interaction of the CKM with Mediator’s Middle module interferes with CTD-dependent RNAPII binding to a previously unknown Middle module CTD-binding site targeted early on in a multi-step holoenzyme formation process. Taken together, our results reveal the basis for CKM repression, clarify the origin of the connection between CKM subunits and the CTD, and suggest that a combination of competitive interactions and conformational changes that facilitate holoenzyme formation underlie the Mediator mechanism. PMID:23563140
Müller, Rachel; Terrill, Alexandra L; Jensen, Mark P; Molton, Ivan R; Ravesloot, Craig; Ipsen, Catherine
2015-12-01
The aim of this study was to examine how the construct of happiness is related to pain intensity, pain interference, and distress in individuals with physical disabilities. This study involves cross-sectional analyses of 471 individuals with a variety of health conditions reporting at least mild pain. The first hypothesis that happiness mediates the relationship between pain intensity and two outcomes, pain interference and distress, was not supported. The second hypothesis was supported by a good fitting model (χ2(10) = 12.83, P = 0.23, root-mean-square error of approximation = 0.025) and indicated that pain intensity significantly mediated the effect of happiness on pain interference (indirect effect: β = -0.13, P Happiness showed a significant direct effect on pain intensity (β = -0.20, P happiness components meaning, pleasure, and engagement fitted well (χ2(4) = 9.65, P = 0.05, root-mean-square error of approximation = 0.055). Pain intensity acted as a significant mediator but only mediated the effect of meaning on pain interference (indirect effect: β = -0.07, P = 0.05) and on distress (indirect effect via pain interference: β = -0.04, P = 0.05). Only meaning (β = -0.10, P = 0.05), but neither pleasure nor engagement, had a significant direct effect on pain intensity. Participants who reported greater happiness reported lower pain interference and distress through happiness' effects on pain intensity. Experiencing meaning and purpose in life seems to be most closely (and negatively) associated with pain intensity, pain interference, and distress. Findings from this study can lay the groundwork for intervention studies to better understand how to more effectively decrease pain intensity, pain interference, and distress.
Takemasa, Tohru; Yakushiji, Naohisa; Kikuchi, Dale Manjiro; Deocaris, Custer; Widodo; Machida, Masanao; Kiyosawa, Hidenori
2012-01-01
To investigate the feasibility of developing a method for detection of gene doping in power-athletes, we devised an experimental model system. Myostatin is a potent negative regulator of skeletal muscle development and growth, and myostatin-knockout mice exhibit a double-muscle phenotype. To achieve knockdown, we constructed plasmids expressing short hairpin interfering RNAs (shRNAs) against myostatin. These shRNAs were transfected into C2C12 cultured cells or injected into the tibialis anterior (TA) muscle of adult mice. By performing in vitro and in vivo experiments, we found that some shRNAs effectively reduced the expression of myostatin, and that the TA muscle showed hypertrophy of up to 27.9%. Then, using real-time PCR, we tried to detect the shRNA plasmid in the serum or muscles of mice into which it had been injected. Although we were unable to detect the plasmid in serum samples, it was detectable in the treated muscle at least four weeks after induction. We were also able to detect the plasmid in muscle in the vicinity of the TA. This gene doping model system will be useful for further studies aimed at doping control. Key pointsUsing a myostatin knockdown plasmid, we have succeeded in creating a model system for gene doping using mice that resulted in muscle hypertrophy greater than that reported previously.We confirmed that there was a limit of gene doping detection using real-time PCR, either from serum or muscle smple.This model experimental system can be utilized for examining indirect methods of gene doping detection such as immune responses to gene transfer or a profiling approach using DNA microarray.
Palacios-Ceña, María; Fernández-Muñoz, Juan J; Castaldo, Matteo; Wang, Kelun; Guerrero-Peral, Ángel; Arendt-Nielsen, Lars; Fernández-de-Las-Peñas, César
2017-12-01
A better understanding of potential relationship between mood disorders, sleep quality, pain, and headache frequency may assist clinicians in determining optimal therapeutic programs. The aim of the current study was to analyze the effects of sleep quality, anxiety, depression on potential relationships between headache intensity, burden of headache, and headache frequency in chronic tension type headache (CTTH). One hundred and ninety-three individuals with CTTH participated. Headache features were collected with a 4-weeks headache diary. The Hospital Anxiety and Depression Scale was used for assessing anxiety and depression. Headache Disability Inventory evaluated the burden of headache. Pain interference was determined with the bodily pain domain (SF-36 questionnaire). Sleep quality was assessed with Pittsburgh Sleep Quality Index. Path analyses with maximum likelihood estimations were conducted to determine the direct and indirect effects of depression, anxiety, and sleep quality on the frequency of headaches. Two paths were observed: the first with depression and the second with sleep quality as mediators. Direct effects were noted from sleep quality, emotional burden of disease and pain interference on depression, and from depression to headache frequency. The first path showed indirect effects of depression from emotional burden and from sleep quality to headache frequency (first model R 2 = 0.12). Direct effects from the second path were from depression and pain interference on sleep quality and from sleep quality on headache frequency. Sleep quality indirectly mediated the effects of depression, emotional burden and pain interference on headache frequency (second model R 2 = 0.18). Depression and sleep quality, but not anxiety, mediated the relationship between headache frequency and the emotional burden of disease and pain interference in CTTH.
Directory of Open Access Journals (Sweden)
Hoorig Nassanian
2007-08-01
Full Text Available RNA interference (RNAi, mediated by small interfering RNA (siRNA, is an effective method used to silence gene expression at the post-transcriptional level. Upon introduction into target cells, siRNAs incorporate into the RNA-induced silencing complex (RISC. The antisense strand of the siRNA duplex then "guides" the RISC to the homologous mRNA, leading to target degradation and gene silencing. In recent years, various vector-based siRNA expression systems have been developed which utilize opposing polymerase III promoters to independently drive expression of the sense and antisense strands of the siRNA duplex from the same template.We show here the use of a ligase chain reaction (LCR to develop a new vector system called pInv-H1 in which a DNA sequence encoding a specific siRNA is placed between two inverted minimal human H1 promoters (approximately 100 bp each. Expression of functional siRNAs from this construct has led to efficient silencing of both reporter and endogenous genes. Furthermore, the inverted H1 promoter-siRNA expression cassette was used to generate a retrovirus vector capable of transducing and silencing expression of the targeted protein by>80% in target cells.The unique design of this construct allows for the efficient exchange of siRNA sequences by the directional cloning of short oligonucleotides via asymmetric restriction sites. This provides a convenient way to test the functionality of different siRNA sequences. Delivery of the siRNA cassette by retroviral transduction suggests that a single copy of the siRNA expression cassette efficiently knocks down gene expression at the protein level. We note that this vector system can potentially be used to generate a random siRNA library. The flexibility of the ligase chain reaction suggests that additional control elements can easily be introduced into this siRNA expression cassette.
Heat shock protein 90β: A novel mediator of vitamin D action
International Nuclear Information System (INIS)
Angelo, Giana; Lamon-Fava, Stefania; Sonna, Larry A.; Lindauer, Meghan L.; Wood, Richard J.
2008-01-01
We investigated the role of Heat shock protein 90 (Hsp90) in vitamin D action in Caco-2 cells using geldanamycin (GA) to block Hsp90 function and RNA interference to reduce Hsp90β expression. When cells were exposed to GA, vitamin D-mediated gene expression and transcriptional activity were inhibited by 69% and 54%, respectively. Gel shift analysis indicated that GA reduced vitamin D-mediated DNA binding activity of the vitamin D receptor (VDR). We tested the specific role of Hsp90β by knocking down its expression with stably expressed short hairpin RNA. Vitamin D-induced gene expression and transcriptional activity were reduced by 90% and 80%, respectively, in Hsp90β-deficient cells. Nuclear protein for VDR and RXRα, its heterodimer partner, were not reduced in Hsp90β-deficient cells. These findings indicate that Hsp90β is needed for optimal vitamin D responsiveness in the enterocyte and demonstrate a specific role for Hsp90β in VDR signaling
International Nuclear Information System (INIS)
Sun, Zhen; Xiang, Wenqing; Guo, Yajuan; Chen, Zhi; Liu, Wei; Lu, Daru
2011-01-01
Highlights: → LNA-modified oligonucleotides can pass through the plasma membrane of cultured cells even without using transfection machinery. → LNA-modified oligonucleotides passed efficiently across the cell membrane, and lipid-coating facilitated translocation from the cytoplasm to the nucleus. → LNA-oligonucleotide designed to target nuclear HBV DNA efficiently suppresses HBV replication and transcription in cultured hepatic cells. -- Abstract: Silencing target genes with small regulatory RNAs is widely used to investigate gene function and therapeutic drug development. Recently, triplex-based approaches have provided another attractive means to achieve targeted gene regulation and gene manipulation at the molecular and cellular levels. Nuclear entry of oligonucleotides and enhancement of their affinity to the DNA targets are key points of such approaches. In this study, we developed lipid-based transport of a locked-nucleic-acid (LNA)-modified oligonucleotide for hepatitis B virus (HBV) DNA interference in human hepatocytes expressing HBV genomic DNA. In these cells, the LNA-modified oligonucleotides passed efficiently across the cell membrane, and lipid-coating facilitated translocation from the cytoplasm to the nucleus. The oligonucleotide specifically targeting HBV DNA clearly interfered with HBV DNA transcription as shown by a block in pregenomic RNA (pgRNA) production. The HBV DNA-targeted oligonucleotide suppressed HBV DNA replication and HBV protein production more efficiently than small interfering RNAs directed to the pgRNA. These results demonstrate that fusion with lipid can carry LNA-modified oligonucleotides to the nucleus where they regulate gene expression. Interfering with HBV DNA transcription by LNA-modified oligonucleotides has strong potential as a new strategy for HBV inhibition.
Energy Technology Data Exchange (ETDEWEB)
Sun, Zhen [The State Key Laboratory of Genetic Engineering and The MOE Key Laboratory of Contemporary Anthropology, School of Life Science, Fudan University, Shanghai 200433 (China); Department of Biochemistry and Molecular Biology, Program in Molecular Cell Biology, Zhejiang University School of Medicine, Hangzhou, Zhejiang 310058 (China); Xiang, Wenqing; Guo, Yajuan [Department of Biochemistry and Molecular Biology, Program in Molecular Cell Biology, Zhejiang University School of Medicine, Hangzhou, Zhejiang 310058 (China); Chen, Zhi [The State Key Laboratory for Infectious Disease, Institute of Infectious Disease, First Affiliated Hospital, Zhejiang University School of Medicine, Hangzhou, Zhejiang 310003 (China); Liu, Wei, E-mail: liuwei666@zju.edu.cn [Department of Biochemistry and Molecular Biology, Program in Molecular Cell Biology, Zhejiang University School of Medicine, Hangzhou, Zhejiang 310058 (China); Lu, Daru, E-mail: drlu@fudan.edu.cn [The State Key Laboratory of Genetic Engineering and The MOE Key Laboratory of Contemporary Anthropology, School of Life Science, Fudan University, Shanghai 200433 (China)
2011-06-10
Highlights: {yields} LNA-modified oligonucleotides can pass through the plasma membrane of cultured cells even without using transfection machinery. {yields} LNA-modified oligonucleotides passed efficiently across the cell membrane, and lipid-coating facilitated translocation from the cytoplasm to the nucleus. {yields} LNA-oligonucleotide designed to target nuclear HBV DNA efficiently suppresses HBV replication and transcription in cultured hepatic cells. -- Abstract: Silencing target genes with small regulatory RNAs is widely used to investigate gene function and therapeutic drug development. Recently, triplex-based approaches have provided another attractive means to achieve targeted gene regulation and gene manipulation at the molecular and cellular levels. Nuclear entry of oligonucleotides and enhancement of their affinity to the DNA targets are key points of such approaches. In this study, we developed lipid-based transport of a locked-nucleic-acid (LNA)-modified oligonucleotide for hepatitis B virus (HBV) DNA interference in human hepatocytes expressing HBV genomic DNA. In these cells, the LNA-modified oligonucleotides passed efficiently across the cell membrane, and lipid-coating facilitated translocation from the cytoplasm to the nucleus. The oligonucleotide specifically targeting HBV DNA clearly interfered with HBV DNA transcription as shown by a block in pregenomic RNA (pgRNA) production. The HBV DNA-targeted oligonucleotide suppressed HBV DNA replication and HBV protein production more efficiently than small interfering RNAs directed to the pgRNA. These results demonstrate that fusion with lipid can carry LNA-modified oligonucleotides to the nucleus where they regulate gene expression. Interfering with HBV DNA transcription by LNA-modified oligonucleotides has strong potential as a new strategy for HBV inhibition.
CRISPR/Cas9-mediated viral interference in plants
Ali, Zahir; Abulfaraj, Aala A.; Idris, Ali; Ali, Shawkat; Tashkandi, Manal; Mahfouz, Magdy M.
2015-01-01
These data establish the efficacy of the CRISPR/Cas9 system for viral interference in plants, thereby extending the utility of this technology and opening the possibility of producing plants resistant to multiple viral infections.
Lin28 Mediates Cancer Chemotherapy Resistance via Regulation of miRNA Signaling.
Xu, Chaoyang; Xie, Shuduo; Song, Chunjiao; Huang, Liming; Jiang, Zhinong
2014-06-01
Chemotherapy resistance is one of the major obstacles limiting the success of cancer drug treatment. Among the mechanisms of resistance to chemotherapy treatment, there are those closely related to P-Glycoprotein, multidrug resistance-related protein, glutathione S-transferase pi and topoisomerase-II. Lin28 is a highly conserved RNA-binding protein, it consists of a cold shock domain and retroviral-type (CCHC) zinc finger motifs. In previous preclinical and clinical studies, positive Lin28 expression in cancer cells was correlated with decreased sensitivity to chemotherapy. And Lin28 could mediate cancer chemotherapy resistance via regulation of miR107 and Let-7 MiRNA. This article reviews current knowledge on predictive value of Lin28 in response to chemotherapy. Better understanding of its role may facilitate patient's selection of therapeutic regimen and lead to optimal clinical outcome.
Emerging RNA-based drugs: siRNAs, microRNAs and derivates.
Pereira, Tiago Campos; Lopes-Cendes, Iscia
2012-09-01
An emerging new category of therapeutic agents based on ribonucleic acid has emerged and shown very promising in vitro, animal and pre-clinical results, known as small interfering RNAs (siRNAs), microRNAs mimics (miRNA mimics) and their derivates. siRNAs are small RNA molecules that promote potent and specific silencing of mutant, exogenous or aberrant genes through a mechanism known as RNA interference. These agents have called special attention to medicine since they have been used to experimentally treat a series of neurological conditions with distinct etiologies such as prion, viral, bacterial, fungal, genetic disorders and others. siRNAs have also been tested in other scenarios such as: control of anxiety, alcohol consumption, drug-receptor blockage and inhibition of pain signaling. Although in a much earlier stage, miRNAs mimics, anti-miRs and small activating RNAs (saRNAs) also promise novel therapeutic approaches to control gene expression. In this review we intend to introduce clinicians and medical researchers to the most recent advances in the world of siRNA- and miRNA-mediated gene control, its history, applications in cells, animals and humans, delivery methods (an yet unsolved hurdle), current status and possible applications in future clinical practice.
Li, Weiqiang; Yoshida, Akiko; Takahashi, Megumu; Maekawa, Masahiko; Kojima, Mikiko; Sakakibara, Hitoshi; Kyozuka, Junko
2015-01-01
The DWARF14 (D14) gene of rice functions within the signaling pathway of strigolactones, a group of plant hormones that inhibits shoot branching. We isolated a recessive mutant named super apical dormant (sad1-1) from a suppressor screen of d14-1. The growth of tillers (vegetative shoot branches) is suppressed in both the d14-1 sad1-1 double mutant and the sad1-1 single mutant. In addition, the sad1-1 mutant shows pleiotropic defects throughout development. SAD1 encodes an ortholog of RPA34.5, a subunit of RNA polymerase I (Pol I). Consequently, the level of ribosomal RNA (rRNA) is severely reduced in the sad1-1 mutant. These results indicate that proper ribosome function is a prerequisite for normal development in plants. The Arabidopsis ortholog of SAD1 was previously isolated as a Mediator-interacting protein. Here we show that SAD1 interacts physically with the Mediator complex through direct binding with OsMED4, a component of the middle module of the Mediator complex in rice. It is known that Mediator interacts with Pol II, which transcribes mRNAs and functions as a central regulator of transcription. This study indicates a novel aspect of Mediator function in Pol I-controlled rRNA transcription. TFIIF2 and RPC53 are the counterparts of RPA34.5 in Pol II and Pol III, respectively. We demonstrate that the rice orthologs of these proteins also interact with OsMED4. Our results suggest that interaction with MED4 in the Mediator complex is a common feature of the three types of RNA polymerases. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.
[Effect of DOT1L gene silence on proliferation of acute monocytic leukemia cell line THP-1].
Zhang, Yu-Juan; Li, Hua-Wen; Chang, Guo-Qiang; Zhang, Hong-Ju; Wang, Jian; Lin, Ya-Ni; Zhou, Jia-Xi; Li, Qing-Hua; Pang, Tian-Xiang
2013-08-01
This study was aimed to investigate the influence of short hairpin RNA (shRNA) on proliferation of human leukemia cell line THP-1. The shRNA targeting the site 732-752 of DOT1L mRNA was designed and chemically synthesized, then a single-vector lentiviral, tet-inducible shRNA-DOT1L system (Plko-Tet-On) was generated. Thereafter, the THP-1 cells with lentivirus were infected to create stable cell line with regulatable shRNA expression. The expression of DOT1L in the THP-1 cell line was assayed by RT-PCR. Effect of shRNA-DOT1L on the proliferation of THP-1 cells was detected with MTT method,and the change of colony forming potential of THP-1 cells was analyzed by colony forming unit test. Cell cycle distribution was tested by flow cytometry. The results indicated that the expression of DOT1L was statistically lower than that in the control groups. The proliferation and colony forming capacity of THP-1 cells were significantly inhibited. The percentage of cells at G0/G1 phase increased in THP-1/shRNA cells treated with Dox while the percentage of cells at S phase significantly decreased as compared with that in the control group. It is concluded that the shRNA targeting DOT1L can effectively inhibit the proliferation of acute monocytic leukemia cell line THP-1.
Kwok, Hoi-Hin
2017-05-18
MicroRNAs (miRNAs) are a family of non-coding RNAs that play crucial roles in regulating various normal cellular responses. Recent studies revealed that the canonical miRNA biogenesis pathway is subject to sophisticated regulation. Hormonal control of miRNA biogenesis by androgen and estrogen has been demonstrated, but the direct effects of the glucocorticoid receptor (GR) on miRNA biogenesis are unknown. This study revealed the role of GR in miRNA maturation. We showed that two GR agonists, dexamethasone and ginsenoside-Rg1 rapidly suppressed the expression of mature miR-15b, miR-23a, and miR-214 in human endothelial cells. RNA pulldown coupled with proteomic analysis identified GTPase-activating protein (SH3 domain) binding protein 1 (G3BP1) as one of the RNA-binding proteins mediating GR-regulated miRNA maturation. Activated GR induced phosphorylation of v-AKT Murine Thymoma Viral Oncogene Homologue (AKT) kinase, which in turn phosphorylated and promoted nuclear translocation of G3BP1. The nuclear G3BP1 bound to the G3BP1 consensus sequence located on primary miR-15b~16-2 and miR-23a~27a~24-2 to inhibit their maturation. The findings from this study have advanced our understanding of the non-genomic effects of GR in the vascular system.
Functional characterization of endogenous siRNA target genes in Caenorhabditis elegans
Directory of Open Access Journals (Sweden)
Heikkinen Liisa
2008-06-01
Full Text Available Abstract Background Small interfering RNA (siRNA molecules mediate sequence specific silencing in RNA interference (RNAi, a gene regulatory phenomenon observed in almost all organisms. Large scale sequencing of small RNA libraries obtained from C. elegans has revealed that a broad spectrum of siRNAs is endogenously transcribed from genomic sequences. The biological role and molecular diversity of C. elegans endogenous siRNA (endo-siRNA molecules, nonetheless, remain poorly understood. In order to gain insight into their biological function, we annotated two large libraries of endo-siRNA sequences, identified their cognate targets, and performed gene ontology analysis to identify enriched functional categories. Results Systematic trends in categorization of target genes according to the specific length of siRNA sequences were observed: 18- to 22-mer siRNAs were associated with genes required for embryonic development; 23-mers were associated uniquely with post-embryonic development; 24–26-mers were associated with phosphorus metabolism or protein modification. Moreover, we observe that some argonaute related genes associate with siRNAs with multiple reads. Sequence frequency graphs suggest that different lengths of siRNAs share similarities in overall sequence structure: the 5' end begins with G, while the body predominates with U and C. Conclusion These results suggest that the lengths of endogenous siRNA molecules are consequential to their biological functions since the gene ontology categories for their cognate mRNA targets vary depending upon their lengths.
Hossain, Mohammad Motarab; Ray, Swapan Kumar
2014-10-01
Ewing's sarcoma is a pediatric tumor that mainly occurs in soft tissues and bones. Malignant characteristics of Ewing's sarcoma are correlated with expression of EWS oncogene. We achieved knockdown of EWS expression using a plasmid vector encoding EWS short hairpin RNA (shRNA) to increase anti-tumor mechanisms of taxifolin (TFL), a new flavonoid, in human Ewing's sarcoma cells in culture and animal models. Immunofluorescence microscopy and flow cytometric analysis showed high expression of EWS in human Ewing's sarcoma SK-N-MC and RD-ES cell lines. EWS shRNA plus TFL inhibited 80% cell viability and caused the highest decreases in EWS expression at mRNA and protein levels in both cell lines. Knockdown of EWS expression induced morphological features of differentiation. EWS shRNA plus TFL caused more alterations in molecular markers of differentiation than either agent alone. EWS shRNA plus TFL caused the highest decreases in cell migration with inhibition of survival, angiogenic and invasive factors. Knockdown of EWS expression was associated with removal of DNA methylation from p53 promoter, promoting expression of p53, Puma, and Noxa. EWS shRNA plus TFL induced the highest amounts of apoptosis with activation of extrinsic and intrinsic pathways in both cell lines in culture. EWS shRNA plus TFL also inhibited growth of Ewing's sarcoma tumors in animal models due to inhibition of differentiation inhibitors and angiogenic and invasive factors and also induction of activation of caspase-3 for apoptosis. Collectively, knockdown of EWS expression increased various anti-tumor mechanisms of TFL in human Ewing's sarcoma in cell culture and animal models.
RNA-Mediated Regulation of HMGA1 Function
Directory of Open Access Journals (Sweden)
Arndt G. Benecke
2015-05-01
Full Text Available The high mobility group protein A1 (HMGA1 is a master regulator of chromatin structure mediating its major gene regulatory activity by direct interactions with A/T-rich DNA sequences located in the promoter and enhancer regions of a large variety of genes. HMGA1 DNA-binding through three AT-hook motifs results in an open chromatin structure and subsequently leads to changes in gene expression. Apart from its significant expression during development, HMGA1 is over-expressed in virtually every cancer, where HMGA1 expression levels correlate with tumor malignancy. The exogenous overexpression of HMGA1 can lead to malignant cell transformation, assigning the protein a key role during cancerogenesis. Recent studies have unveiled highly specific competitive interactions of HMGA1 with cellular and viral RNAs also through an AT-hook domain of the protein, significantly impacting the HMGA1-dependent gene expression. In this review, we discuss the structure and function of HMGA1-RNA complexes during transcription and epigenomic regulation and their implications in HMGA1-related diseases.
Xie, Ying; Qiao, Hongzhi; Su, Zhigui; Chen, Minglei; Ping, Qineng; Sun, Minjie
2014-09-01
Lack of safe and effective delivery vehicle is the main obstacle for siRNA mediated cancer therapy. In this study, we synthesized a pH-sensitive polymer of PEG grafted carboxymethyl chitosan (PEG-CMCS) and developed anionic-charged hybrid nanoparticles of PEG-CMCS and calcium phosphate (CaP) for siRNA delivery through a single-step self-assembly method in aqueous condition. The formed nanoparticles with charge of around -8.25 mv and average diameter of 102.1 nm exhibited efficient siRNA encapsulation and enhanced colloidal and serum stability. The test in vitro indicated that the nanoparticles entered into HepG2 cells by endocytosis, and achieved endosomal escape of siRNA effectively due to the pH-responsive disassembly of nanoparticles and dissolution of CaP in the endosome. Reporter gene silencing assay showed that luciferase siRNA delivered by the anionic nanoparticles could achieve gene silencing efficacy comparable to that of conventional Lipofectamine 2000. Additionally, dramatic hTERT knockdown mediated by the anionic nanoparticles transfection induced significant apoptosis of HepG2 cells in vitro. After intravenous injection in tumor-bearing BALB/c nude mice, the nanoparticles specifically accumulated into tumor regions by EPR effect, leading to efficient and specific gene silencing sequentially. Most importantly, the nanoparticles carrying hTERT siRNA inhibited tumor growth significantly via silencing hTERT expression and inducing cells apoptosis in HepG2 tumor xenograft. Moreover, comprehensive safety studies of the nanoparticles confirmed their superior safety both in vitro and in vivo. We concluded that the PEG-CMCS/CaP hybrid anionic nanoparticles possessed potential as a safe and effective siRNA delivery system for anticancer therapy. Copyright © 2014 Elsevier Ltd. All rights reserved.
Nuclear pore complex protein mediated nuclear localization of dicer protein in human cells.
Directory of Open Access Journals (Sweden)
Yoshinari Ando
Full Text Available Human DICER1 protein cleaves double-stranded RNA into small sizes, a crucial step in production of single-stranded RNAs which are mediating factors of cytoplasmic RNA interference. Here, we clearly demonstrate that human DICER1 protein localizes not only to the cytoplasm but also to the nucleoplasm. We also find that human DICER1 protein associates with the NUP153 protein, one component of the nuclear pore complex. This association is detected predominantly in the cytoplasm but is also clearly distinguishable at the nuclear periphery. Additional characterization of the NUP153-DICER1 association suggests NUP153 plays a crucial role in the nuclear localization of the DICER1 protein.
TRPV4 activation mediates flow-induced nitric oxide production in the rat thick ascending limb
Garvin, Jeffrey L.
2014-01-01
Nitric oxide (NO) regulates renal function. Luminal flow stimulates NO production in the thick ascending limb (TAL). Transient receptor potential vanilloid 4 (TRPV4) is a mechano-sensitive channel activated by luminal flow in different types of cells. We hypothesized that TRPV4 mediates flow-induced NO production in the rat TAL. We measured NO production in isolated, perfused rat TALs using the fluorescent dye DAF FM. Increasing luminal flow from 0 to 20 nl/min stimulated NO from 8 ± 3 to 45 ± 12 arbitrary units (AU)/min (n = 5; P < 0.05). The TRPV4 antagonists, ruthenium red (15 μmol/l) and RN 1734 (10 μmol/l), blocked flow-induced NO production. Also, luminal flow did not increase NO production in the absence of extracellular calcium. We also studied the effect of luminal flow on NO production in TALs transduced with a TRPV4shRNA. In nontransduced TALs luminal flow increased NO production by 47 ± 17 AU/min (P < 0.05; n = 5). Similar to nontransduced TALs, luminal flow increased NO production by 39 ± 11 AU/min (P < 0.03; n = 5) in TALs transduced with a control negative sequence-shRNA while in TRPV4shRNA-transduced TALs, luminal flow did not increase NO production (Δ10 ± 15 AU/min; n = 5). We then tested the effect of two different TRPV4 agonists on NO production in the absence of luminal flow. 4α-Phorbol 12,13-didecanoate (1 μmol/l) enhanced NO production by 60 ± 11 AU/min (P < 0.002; n = 7) and GSK1016790A (10 ηmol/l) increased NO production by 52 ± 15 AU/min (P < 0.03; n = 5). GSK1016790A (10 ηmol/l) did not stimulate NO production in TRPV4shRNA-transduced TALs. We conclude that activation of TRPV4 channels mediates flow-induced NO production in the rat TAL. PMID:24966090
Role for the MED21-MED7 Hinge in Assembly of the Mediator-RNA Polymerase II Holoenzyme*
Sato, Shigeo; Tomomori-Sato, Chieri; Tsai, Kuang-Lei; Yu, Xiaodi; Sardiu, Mihaela; Saraf, Anita; Washburn, Michael P.; Florens, Laurence; Asturias, Francisco J.; Conaway, Ronald C.
2016-01-01
Mediator plays an integral role in activation of RNA polymerase II (Pol II) transcription. A key step in activation is binding of Mediator to Pol II to form the Mediator-Pol II holoenzyme. Here, we exploit a combination of biochemistry and macromolecular EM to investigate holoenzyme assembly. We identify a subset of human Mediator head module subunits that bind Pol II independent of other subunits and thus probably contribute to a major Pol II binding site. In addition, we show that binding of human Mediator to Pol II depends on the integrity of a conserved “hinge” in the middle module MED21-MED7 heterodimer. Point mutations in the hinge region leave core Mediator intact but lead to increased disorder of the middle module and markedly reduced affinity for Pol II. These findings highlight the importance of Mediator conformation for holoenzyme assembly. PMID:27821593
Ghosal, Abhisek; Sekar, Thillai V.
2014-01-01
Biotin is essential for the normal function of pancreatic beta cells. These cells obtain biotin from their surroundings via transport across their cell membrane. Little is known about the uptake mechanism involved, how it is regulated, and how it is affected by internal and external factors. We addressed these issues using the mouse-derived pancreatic beta-TC-6 cells and freshly isolated mouse and human primary pancreatic beta cells as models. The results showed biotin uptake by pancreatic beta-TC-6 cells occurs via a Na+-dependent, carrier-mediated process, that is sensitive to desthiobiotin, as well as to pantothenic acid and lipoate; the process is also saturable as a function of concentration (apparent Km = 22.24 ± 5.5 μM). These cells express the sodium-dependent multivitamin transporter (SMVT), whose knockdown (with doxycycline-inducible shRNA) led to a sever inhibition in biotin uptake. Similarly, uptake of biotin by mouse and human primary pancreatic islets is Na+-dependent and carrier-mediated, and both cell types express SMVT. Biotin uptake by pancreatic beta-TC-6 cells is also adaptively regulated (via transcriptional mechanism) by extracellular substrate level. Chronic treatment of pancreatic beta-TC-6 cells with bacterial lipopolysaccharides (LPS) leads to inhibition in biotin uptake. This inhibition is mediated via a Toll-Like receptor 4-mediated process and involves a decrease in membrane expression of SMVT. These findings show, for the first time, that pancreatic beta cells/islets take up biotin via a specific and regulated carrier-mediated process, and that the process is sensitive to the effect of LPS. PMID:24904078
Liu, Yuan; Chen, Zhijun; Cheng, Haixia; Chen, Juan; Qian, Jing
2017-01-03
Retinopathy of prematurity (ROP) is characterized by late-phase pathologic retinal vasoproliferation. Gremlin is a novel vascular endothelial growth factors (VEGF) receptor 2 (VEGFR2) agonist and promotes angiogenic response. We demonstrated that gremlin expression was significantly increased in retinas of ROP model mice, which was correlated with VEGF upregulation. In retinal pigmentation epithelial (RPE) cells, gremlin activated VEGFR2-Akt-mTORC2 (mammalian target of rapamycin complex 2) signaling, and promoted cell proliferation, migration and VEGF production. VEGFR inhibition (by SU5416) or shRNA knockdown almost abolished gremlin-mediated pleiotropic functions in RPE cells. Further, pharmacological inhibition of Akt-mTOR, or shRNA knockdown of key mTORC2 component (Rictor or Sin1) also attenuated gremlin-exerted activities in RPE cells. We conclude that gremlin promotes RPE cell proliferation, migration and VEGF production possibly via activating VEGFR2-Akt-mTORC2 signaling. Gremlin could be a novel therapeutic target of ROP or other retinal vasoproliferation diseases.