A genome-wide shRNA screen identifies GAS1 as a novel melanoma metastasis suppressor gene.
Gobeil, Stephane; Zhu, Xiaochun; Doillon, Charles J; Green, Michael R
2008-11-01
Metastasis suppressor genes inhibit one or more steps required for metastasis without affecting primary tumor formation. Due to the complexity of the metastatic process, the development of experimental approaches for identifying genes involved in metastasis prevention has been challenging. Here we describe a genome-wide RNAi screening strategy to identify candidate metastasis suppressor genes. Following expression in weakly metastatic B16-F0 mouse melanoma cells, shRNAs were selected based upon enhanced satellite colony formation in a three-dimensional cell culture system and confirmed in a mouse experimental metastasis assay. Using this approach we discovered 22 genes whose knockdown increased metastasis without affecting primary tumor growth. We focused on one of these genes, Gas1 (Growth arrest-specific 1), because we found that it was substantially down-regulated in highly metastatic B16-F10 melanoma cells, which contributed to the high metastatic potential of this mouse cell line. We further demonstrated that Gas1 has all the expected properties of a melanoma tumor suppressor including: suppression of metastasis in a spontaneous metastasis assay, promotion of apoptosis following dissemination of cells to secondary sites, and frequent down-regulation in human melanoma metastasis-derived cell lines and metastatic tumor samples. Thus, we developed a genome-wide shRNA screening strategy that enables the discovery of new metastasis suppressor genes.
A simple and robust vector-based shRNA expression system used for RNA interference.
Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi
2013-01-01
RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.
A simple and robust vector-based shRNA expression system used for RNA interference.
Directory of Open Access Journals (Sweden)
Xue-jun Wang
Full Text Available BACKGROUND: RNA interference (RNAi mediated by small interfering RNAs (siRNAs or short hairpin RNAs (shRNAs has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. RESULTS: In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. CONCLUSION: This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.
A comprehensive platform for highly multiplexed mammalian functional genetic screens
Directory of Open Access Journals (Sweden)
Cheung-Ong Kahlin
2011-05-01
Full Text Available Abstract Background Genome-wide screening in human and mouse cells using RNA interference and open reading frame over-expression libraries is rapidly becoming a viable experimental approach for many research labs. There are a variety of gene expression modulation libraries commercially available, however, detailed and validated protocols as well as the reagents necessary for deconvolving genome-scale gene screens using these libraries are lacking. As a solution, we designed a comprehensive platform for highly multiplexed functional genetic screens in human, mouse and yeast cells using popular, commercially available gene modulation libraries. The Gene Modulation Array Platform (GMAP is a single microarray-based detection solution for deconvolution of loss and gain-of-function pooled screens. Results Experiments with specially constructed lentiviral-based plasmid pools containing ~78,000 shRNAs demonstrated that the GMAP is capable of deconvolving genome-wide shRNA "dropout" screens. Further experiments with a larger, ~90,000 shRNA pool demonstrate that equivalent results are obtained from plasmid pools and from genomic DNA derived from lentivirus infected cells. Parallel testing of large shRNA pools using GMAP and next-generation sequencing methods revealed that the two methods provide valid and complementary approaches to deconvolution of genome-wide shRNA screens. Additional experiments demonstrated that GMAP is equivalent to similar microarray-based products when used for deconvolution of open reading frame over-expression screens. Conclusion Herein, we demonstrate four major applications for the GMAP resource, including deconvolution of pooled RNAi screens in cells with at least 90,000 distinct shRNAs. We also provide detailed methodologies for pooled shRNA screen readout using GMAP and compare next-generation sequencing to GMAP (i.e. microarray based deconvolution methods.
Directory of Open Access Journals (Sweden)
Peng Cheng
2015-05-01
Full Text Available Glioblastoma is a highly lethal cancer for which novel therapeutics are urgently needed. Two distinct subtypes of glioblastoma stem-like cells (GSCs were recently identified: mesenchymal (MES and proneural (PN. To identify mechanisms to target the more aggressive MES GSCs, we combined transcriptomic expression analysis and kinome-wide short hairpin RNA screening of MES and PN GSCs. In comparison to PN GSCs, we found significant upregulation and phosphorylation of the receptor tyrosine kinase AXL in MES GSCs. Knockdown of AXL significantly decreased MES GSC self-renewal capacity in vitro and inhibited the growth of glioblastoma patient-derived xenografts. Moreover, inhibition of AXL with shRNA or pharmacologic inhibitors also increased cell death significantly more in MES GSCs. Clinically, AXL expression was elevated in the MES GBM subtype and significantly correlated with poor prognosis in multiple cancers. In conclusion, we identified AXL as a potential molecular target for novel approaches to treat glioblastoma and other solid cancers.
Short Hairpin RNA (shRNA): Design, Delivery, and Assessment of Gene Knockdown
Moore, Chris B.; Guthrie, Elizabeth H.; Huang, Max Tze-Han; Taxman, Debra J.
2013-01-01
Shortly after the cellular mechanism of RNA interference (RNAi) was first described, scientists began using this powerful technique to study gene function. This included designing better methods for the successful delivery of small interfering RNAs (siRNAs) and short hairpin RNAs (shRNAs) into mammalian cells. While the simplest method for RNAi is the cytosolic delivery of siRNA oligonucleotides, this technique is limited to cells capable of transfection and is primarily utilized during transient in vitro studies. The introduction of shRNA into mammalian cells through infection with viral vectors allows for stable integration of shRNA and long-term knockdown of the targeted gene; however, several challenges exist with the implementation of this technology. Here we describe some well-tested protocols which should increase the chances of successful design, delivery, and assessment of gene knockdown by shRNA. We provide suggestions for designing shRNA targets and controls, a protocol for sequencing through the secondary structure of the shRNA hairpin structure, and protocols for packaging and delivery of shRNA lentiviral particles. Using real-time PCR and functional assays we demonstrate the successful knockdown of ASC, an inflammatory adaptor molecule. These studies demonstrate the practicality of including two shRNAs with different efficacies of knockdown to provide an additional level of control and to verify dose dependency of functional effects. Along with the methods described here, as new techniques and algorithms are designed in the future, shRNA is likely to include further promising application and continue to be a critical component of gene discovery. PMID:20387148
Creating Transgenic shRNA Mice by Recombinase-Mediated Cassette Exchange
Premsrirut, Prem K.; Dow, Lukas E.; Park, Youngkyu; Hannon, Gregory J.; Lowe, Scott W.
2014-01-01
RNA interference (RNAi) enables sequence-specific, experimentally induced silencing of virtually any gene by tapping into innate regulatory mechanisms that are conserved among most eukaryotes. The principles that enable transgenic RNAi in cell lines can also be used to create transgenic animals, which express short-hairpin RNAs (shRNAs) in a regulated or tissue-specific fashion. However, RNAi in transgenic animals is somewhat more challenging than RNAi in cultured cells. The activities of promoters that are commonly used for shRNA expression in cell culture can vary enormously in different tissues, and founder lines also typically vary in transgene expression due to the effects of their single integration sites. There are many ways to produce mice carrying shRNA transgenes and the method described here uses recombinase-mediated cassette exchange (RMCE). RMCE permits insertion of the shRNA transgene into a well-characterized locus that gives reproducible and predictable expression in each founder and enhances the probability of potent expression in many cell types. This procedure is more involved and complex than simple pronuclear injection, but if even a few shRNA mice are envisioned, for example, to probe the functions of several genes, the effort of setting up the processes outlined below are well worthwhile. Note that when creating a transgenic mouse, one should take care to use the most potent shRNA possible. As a rule of thumb, the sequence chosen should provide >90% knockdown when introduced into cultured cells at single copy (e.g., on retroviral infection at a multiplicity of ≤0.3). PMID:24003198
DEFF Research Database (Denmark)
Stenderup, Karin; Jakobsen, Maria; Rosada, Cecilia
2008-01-01
TNF-α is a well known target in psoriasis treatment and biological treatments targeting TNF-a are already clinically used against psoriasis and psoriasis arthritis. Attention is however given to a novel therapeutic tool: RNA interference that controls gene silencing. This study investigates...... the efficiency of targeting TNF-a with specific short hairpin RNA (shRNA) and explores its potential in treating psoriasis. ShRNAs targeting human TNF-α mRNA were generated. Their efficiency in down-regulating TNF-a protein expression was evaluated using a Renilla luciferase screening-assay and a transient co...... TNF-a shRNA was used to transduce HEK293 cells and verify vector-derived TNF-a knockdown in vitro. In vivo, psoriasis skin was exposed to lentiviral TNF-a shRNAs by a single intra-dermal injection. Psoriasis skin for the in vivo study was obtained from psoriatic plaque skin biopsies that were...
Advances in cervical screening technology.
Stoler, M H
2000-03-01
The Pap smear unquestionably is a successful screening test for cervical cancer. However, recent advances in technology have raised questions regarding whether the conventional Pap smear is still the standard of care. This article relates issues of screening and cost-effectiveness to the state of the art in thin layer preparations, cytology automation, human papillomavirus screening, human papillomavirus vaccines, and other cervical screening adjuncts. Perhaps nowhere in medicine is clinical decision making being more strongly influenced by market and other external forces than in cervical cytopathology.
Directory of Open Access Journals (Sweden)
John S Cho
2009-09-01
Full Text Available The events required to initiate host defenses against invading pathogens involve complex signaling cascades comprised of numerous adaptor molecules, kinases, and transcriptional elements, ultimately leading to the production of proinflammatory cytokines, such as tumor necrosis factor alpha (TNF-alpha. How these signaling cascades are regulated, and the proteins and regulatory elements participating are still poorly understood.We report here the development a completely random short-hairpin RNA (shRNA library coupled with a novel forward genetic screening strategy to identify inhibitors of Toll-like receptor (TLR dependent proinflammatory responses. We developed a murine macrophage reporter cell line stably transfected with a construct expressing diphtheria toxin-A (DT-A under the control of the TNF-alpha-promoter. Stimulation of the reporter cell line with the TLR ligand lipopolysaccharide (LPS resulted in DT-A induced cell death, which could be prevented by the addition of an shRNA targeting the TLR adaptor molecule MyD88. Utilizing this cell line, we screened a completely random lentiviral short hairpin RNA (shRNA library for sequences that inhibited TLR-mediated TNF-alpha production. Recovery of shRNA sequences from surviving cells led to the identification of unique shRNA sequences that significantly inhibited TLR4-dependent TNF-alpha gene expression. Furthermore, these shRNA sequences specifically blocked TLR2 but not TLR3-dependent TNF-alpha production.Thus, we describe the generation of novel tools to facilitate large-scale forward genetic screens in mammalian cells and the identification of potent shRNA inhibitors of TLR2 and TLR4- dependent proinflammatory responses.
Construction of lentiviral shRNA expression vector targeting ...
African Journals Online (AJOL)
ajl yemi
2011-10-26
Oct 26, 2011 ... was then selected, while the titer of lentiviral packing PLD2-shRNA was 3.47 × 104 TU/ml and the virus was successfully ... MATERIALS AND METHODS .... such as: transfecting cells not only in mitotic active phase but also in ...
Construction of lentiviral shRNA expression vector targeting ...
African Journals Online (AJOL)
DNA oligo was cloned into lentiviral expression vector, and then polymerase chain reaction (PCR) and sequencing analyses were conducted to verify the constructs. The verified vectors were co-transfected into 293FT cells that could produce lentiviral. shRNA lentiviruses from the selected constructs were propagated and ...
Li, Lixuan; Li, Jia
2015-05-01
To study the effects of lentivirus-mediated short hairpin RNA (shRNA) silencing of lysosome-associated membrane protein type 2A (LAMP2A) expression on the proliferation of multiple myeloma cells. The constructed shRNA lentiviral vector was applied to infect human multiple myeloma cell line MM.1S, and stable expression cell line was obtained by puromycin screening. Western blotting was used to verify the inhibitory effect on LAMP2A protein expression. MTT assay was conducted to detect the effect of knocked-down LAMP2A on MM.1S cell proliferation, and the anti-tumor potency of suberoylanilide hydroxamic acid (SAHA) against the obtained MM.1S LAMP2A(shRNA) stable cell line. Lactate assay was performed to observe the impact of low LAMP2A expression on cell glycolysis. The stable cell line with low LAMP2A expression were obtained with the constructed human LAMP2A-shRNA lentiviral vector. Down-regulation of LAMP2A expression significantly inhibited MM.1S cell proliferation and enhanced the anti-tumor activity of SAHA. Interestingly, decreased LAMP2A expression also inhibited MM.1S cell lactic acid secretion. Down-regulation of LAMP2A expression could inhibit cell proliferation in multiple myeloma cells.
AAV-based shRNA silencing of NF-κB ameliorates muscle pathologies in mdx mice.
Yang, Q; Tang, Y; Imbrogno, K; Lu, A; Proto, J D; Chen, A; Guo, F; Fu, F H; Huard, J; Wang, B
2012-12-01
Chronic inflammation, promoted by an upregulated NF-kappa B (NF-κB) pathway, has a key role in Duchenne muscular dystrophy (DMD) patients' pathogenesis. Blocking the NF-κB pathway has been shown to be a viable approach to diminish chronic inflammation and necrosis in the dystrophin-defective mdx mouse, a murine DMD model. In this study, we used the recombinant adeno-associated virus serotype 9 (AAV9) carrying an short hairpin RNA (shRNA) specifically targeting the messenger RNA of NF-κB/p65 (p65-shRNA), the major subunit of NF-κB associated with chronic inflammation in mdx mice. We examined whether i.m. AAV9-mediated delivery of p65-shRNA could decrease NF-κB activation, allowing for amelioration of muscle pathologies in 1- and 4-month-old mdx mice. At 1 month after treatment, NF-κB/p65 levels were significantly decreased by AAV gene transfer of p65-shRNA in the two ages of treatment groups, with necrosis significantly decreased compared with controls. Quantitative analysis revealed that central nucleation (CN) of the myofibers of p65-shRNA-treated 1-month-old mdx muscles was reduced from 67 to 34%, but the level of CN was not significantly decreased in treated 4-month-old mdx mice. Moreover, delivery of the p65-shRNA enhanced the capacity of myofiber regeneration in old mdx mice treated at 4 months of age when the dystrophic myofibers were most exhausted; however, such p65 silencing diminished the myofiber regeneration in young mdx mice treated at 1 month of age. Taken together, these findings demonstrate that the AAV-mediated delivery of p65-shRNA has the capacity to ameliorate muscle pathologies in mdx mice by selectively reducing NF-κB/p65 activity.
Directory of Open Access Journals (Sweden)
Sylvie Rato
2010-02-01
Full Text Available HIV-1 is a complex retrovirus that uses host machinery to promote its replication. Understanding cellular proteins involved in the multistep process of HIV-1 infection may result in the discovery of more adapted and effective therapeutic targets. Kinases and phosphatases are a druggable class of proteins critically involved in regulation of signal pathways of eukaryotic cells. Here, we focused on the discovery of kinases and phosphatases that are essential for HIV-1 replication but dispensable for cell viability. We performed an iterative screen in Jurkat T-cells with a short-hairpin-RNA (shRNA library highly enriched for human kinases and phosphatases. We identified 14 new proteins essential for HIV-1 replication that do not affect cell viability. These proteins are described to be involved in MAPK, JNK and ERK pathways, vesicular traffic and DNA repair. Moreover, we show that the proteins under study are important in an early step of HIV-1 infection before viral integration, whereas some of them affect viral transcription/translation. This study brings new insights for the complex interplay of HIV-1/host cell and opens new possibilities for antiviral strategies.
Deep Sequencing Insights in Therapeutic shRNA Processing and siRNA Target Cleavage Precision.
Denise, Hubert; Moschos, Sterghios A; Sidders, Benjamin; Burden, Frances; Perkins, Hannah; Carter, Nikki; Stroud, Tim; Kennedy, Michael; Fancy, Sally-Ann; Lapthorn, Cris; Lavender, Helen; Kinloch, Ross; Suhy, David; Corbau, Romu
2014-02-04
TT-034 (PF-05095808) is a recombinant adeno-associated virus serotype 8 (AAV8) agent expressing three short hairpin RNA (shRNA) pro-drugs that target the hepatitis C virus (HCV) RNA genome. The cytosolic enzyme Dicer cleaves each shRNA into multiple, potentially active small interfering RNA (siRNA) drugs. Using next-generation sequencing (NGS) to identify and characterize active shRNAs maturation products, we observed that each TT-034-encoded shRNA could be processed into as many as 95 separate siRNA strands. Few of these appeared active as determined by Sanger 5' RNA Ligase-Mediated Rapid Amplification of cDNA Ends (5-RACE) and through synthetic shRNA and siRNA analogue studies. Moreover, NGS scrutiny applied on 5-RACE products (RACE-seq) suggested that synthetic siRNAs could direct cleavage in not one, but up to five separate positions on targeted RNA, in a sequence-dependent manner. These data support an on-target mechanism of action for TT-034 without cytotoxicity and question the accepted precision of substrate processing by the key RNA interference (RNAi) enzymes Dicer and siRNA-induced silencing complex (siRISC).Molecular Therapy-Nucleic Acids (2014) 3, e145; doi:10.1038/mtna.2013.73; published online 4 February 2014.
Directory of Open Access Journals (Sweden)
Shirley Lam
Full Text Available BACKGROUND: Chikungunya virus (CHIKV is a re-emerging alphavirus that causes chikungunya fever and persistent arthralgia in humans. Currently, there is no effective vaccine or antiviral against CHIKV infection. Therefore, this study evaluates whether RNA interference which targets at viral genomic level may be a novel antiviral strategy to inhibit the medically important CHIKV infection. METHODS: Plasmid-based small hairpin RNA (shRNA was investigated for its efficacy in inhibiting CHIKV replication. Three shRNAs designed against CHIKV Capsid, E1 and nsP1 genes were transfected to establish stable shRNA-expressing cell clones. Following infection of stable shRNA cells clones with CHIKV at M.O.I. 1, viral plaque assay, Western blotting and transmission electron microscopy were performed. The in vivo efficacy of shRNA against CHIKV replication was also evaluated in a suckling murine model of CHIKV infection. RESULTS: Cell clones expressing shRNAs against CHIKV E1 and nsP1 genes displayed significant inhibition of infectious CHIKV production, while shRNA Capsid demonstrated a modest inhibitory effect as compared to scrambled shRNA cell clones and non-transfected cell controls. Western blot analysis of CHIKV E2 protein expression and transmission electron microscopy of shRNA E1 and nsP1 cell clones collectively demonstrated similar inhibitory trends against CHIKV replication. shRNA E1 showed non cell-type specific anti-CHIKV effects and broad-spectrum silencing against different geographical strains of CHIKV. Furthermore, shRNA E1 clones did not exert any inhibition against Dengue virus and Sindbis virus replication, thus indicating the high specificity of shRNA against CHIKV replication. Moreover, no shRNA-resistant CHIKV mutant was generated after 50 passages of CHIKV in the stable cell clones. More importantly, strong and sustained anti-CHIKV protection was conferred in suckling mice pre-treated with shRNA E1. CONCLUSION: Taken together, these
An infinitely expandable cloning strategy plus repeat-proof PCR for working with multiple shRNA.
Directory of Open Access Journals (Sweden)
Glen John McIntyre
Full Text Available Vector construction with restriction enzymes (REs typically involves the ligation of a digested donor fragment (insert to a reciprocally digested recipient fragment (vector backbone. Creating a suitable cloning plan becomes increasingly difficult for complex strategies requiring repeated insertions such as constructing multiple short hairpin RNA (shRNA expression vectors for RNA interference (RNAi studies. The problem lies in the reduced availability of suitable RE recognition sites with an increasing number of cloning events and or vector size. This report details a technically simple, directional cloning solution using REs with compatible cohesive ends that are repeatedly destroyed and simultaneously re-introduced with each round of cloning. Donor fragments can be made by PCR or sub-cloned from pre-existing vectors and inserted ad infinitum in any combination. The design incorporates several cloning cores in order to be compatible with as many donor sequences as possible. We show that joining sub-combinations made in parallel is more time-efficient than sequential construction (of one cassette at a time for any combination of 4 or more insertions. Screening for the successful construction of combinations using Taq polymerase based PCR became increasingly difficult with increasing number of repeated sequence elements. A Pfu polymerase based PCR was developed and successfully used to amplify combinations of up to eleven consecutive hairpin expression cassettes. The identified PCR conditions can be beneficial to others working with multiple shRNA or other repeated sequences, and the infinitely expandable cloning strategy serves as a general solution applicable to many cloning scenarios.
Advanced breast cancer and its prevention by screening
de Koning, H. J.; van Ineveld, B. M.; de Haes, J. C.; van Oortmarssen, G. J.; Klijn, J. G.; van der Maas, P. J.
1992-01-01
In discussions on breast cancer screening, much attention has been focussed on the possible morbidity generated by screening. Favourable effects like the prevention of advanced disease seem underestimated, probably because quantification is that difficult. To analyse the amount of care and treatment
van Nierop, Pim; Vormer, Tinke L.; Foijer, Floris; Verheij, Joanne; Lodder, Johannes C.; Andersen, Jesper B.; Mansvelder, Huibert D.; te Riele, Hein
2018-01-01
To identify coding and non-coding suppressor genes of anchorage-independent proliferation by efficient loss-of-function screening, we have developed a method for enzymatic production of low complexity shRNA libraries from subtracted transcriptomes. We produced and screened two LEGO (Low-complexity by Enrichment for Genes shut Off) shRNA libraries that were enriched for shRNA vectors targeting coding and non-coding polyadenylated transcripts that were reduced in transformed Mouse Embryonic Fibroblasts (MEFs). The LEGO shRNA libraries included ~25 shRNA vectors per transcript which limited off-target artifacts. Our method identified 79 coding and non-coding suppressor transcripts. We found that taurine-responsive GABAA receptor subunits, including GABRA5 and GABRB3, were induced during the arrest of non-transformed anchor-deprived MEFs and prevented anchorless proliferation. We show that taurine activates chloride currents through GABAA receptors on MEFs, causing seclusion of cell volume in large membrane protrusions. Volume seclusion from cells by taurine correlated with reduced proliferation and, conversely, suppression of this pathway allowed anchorage-independent proliferation. In human cholangiocarcinomas, we found that several proteins involved in taurine signaling via GABAA receptors were repressed. Low GABRA5 expression typified hyperproliferative tumors, and loss of taurine signaling correlated with reduced patient survival, suggesting this tumor suppressive mechanism operates in vivo. PMID:29787571
Therapeutic effects of lentivirus-mediated shRNA targeting of cyclin D1 in human gastric cancer
International Nuclear Information System (INIS)
Seo, Jin-Hee; Jeong, Eui-Suk; Choi, Yang-Kyu
2014-01-01
Gastric cancer is the second most common cause of cancer-related death in males and the fourth in females. Traditional treatment has poor prognosis because of recurrence and systemic side effects. Therefore, the development of new therapeutic strategies is an important issue. Lentivirus-mediated shRNA stably inhibits target genes and can efficiently transduce most cells. Since overexpressed cyclin D1 is closely related to human gastric cancer progression, inhibition of cyclin D1 using specific targeting could be an effective treatment method of human gastric cancer. The therapeutic effect of lentivirus-mediated shRNA targeting of cyclin D1 (ShCCND1) was analyzed both in vitro and in vivo experiments. In vitro, NCI-N87 cells with downregulation of cyclin D1 by ShCCND1 showed significant inhibition of cell proliferation, cell motility, and clonogenicity. Downregulation of cyclin D1 in NCI-N87 cells also resulted in significantly increased G1 arrest and apoptosis. In vivo, stable NCI-N87 cells expressing ShCCND1 were engrafted into nude mice. Then, the cancer-growth inhibition effect of lentivirus was confirmed. To assess lentivirus including ShCCND1 as a therapeutic agent, intratumoral injection was conducted. Tumor growth of the lentivirus-treated group was significantly inhibited compared to growth of the control group. These results are in accordance with the in vitro data and lend support to the mitotic figure count and apoptosis analysis of the tumor mass. The lentivirus-mediated ShCCND1 was constructed, which effectively inhibited growth of NCI-N87-derived cancer both in vitro and in vivo. The efficiency of shRNA knockdown and variation in the degree of inhibition is mediated by different shRNA sequences and cancer cell lines. These experimental results suggest the possibility of developing new gastric cancer therapies using lentivirus-mediated shRNA
RNAi Screening in Spodoptera frugiperda.
Ghosh, Subhanita; Singh, Gatikrushna; Sachdev, Bindiya; Kumar, Ajit; Malhotra, Pawan; Mukherjee, Sunil K; Bhatnagar, Raj K
2016-01-01
RNA interference is a potent and precise reverse genetic approach to carryout large-scale functional genomic studies in a given organism. During the past decade, RNAi has also emerged as an important investigative tool to understand the process of viral pathogenesis. Our laboratory has successfully generated transgenic reporter and RNAi sensor line of Spodoptera frugiperda (Sf21) cells and developed a reversal of silencing assay via siRNA or shRNA guided screening to investigate RNAi factors or viral pathogenic factors with extraordinary fidelity. Here we describe empirical approaches and conceptual understanding to execute successful RNAi screening in Spodoptera frugiperda 21-cell line.
Yu, Feng; Li, Hua; Bu, Xuefeng; Zhang, Yongjun
2012-01-01
To investigate the effects of integrin-β1 gene expression inhibited by shRNA on invasion of pancreatic carcinoma PANC-1 cells in vitro. The eukaryotic expression plasmid of short hairpin RNA (shRNA) targeting integrin-β1 gene (integrin-β1-shRNA) was constructed and transfected into PANC-1 cells. The expressions of integrin-β1 mRNA and protein were detected by real-time quantitative polymerase chain reaction (PCR) and western blot assay, respectively. The invasive ability of PANC-1 cells was observed with a transwell cell culture chamber and the expressions of MMP-2 and MMP-9 were assayed. Compared to the untransfected group, recombinant expression plasmid integrin-β1-shRNA resulted in reduction of integrin-β1 mRNA and protein by 78.58%±7.24% and 92.88%±3.18%, respectively and the average number of invading PANC-1 cells were decreased from 52±5 to 21±4 (pPANC-1 cells in vitro significantly.
Advances in Predictive Toxicology for Discovery Safety through High Content Screening.
Persson, Mikael; Hornberg, Jorrit J
2016-12-19
High content screening enables parallel acquisition of multiple molecular and cellular readouts. In particular the predictive toxicology field has progressed from the advances in high content screening, as more refined end points that report on cellular health can be studied in combination, at the single cell level, and in relatively high throughput. Here, we discuss how high content screening has become an essential tool for Discovery Safety, the discipline that integrates safety and toxicology in the drug discovery process to identify and mitigate safety concerns with the aim to design drug candidates with a superior safety profile. In addition to customized mechanistic assays to evaluate target safety, routine screening assays can be applied to identify risk factors for frequently occurring organ toxicities. We discuss the current state of high content screening assays for hepatotoxicity, cardiotoxicity, neurotoxicity, nephrotoxicity, and genotoxicity, including recent developments and current advances.
Directory of Open Access Journals (Sweden)
Yu Jin
2008-07-01
Full Text Available Abstract Background The objective was to understand the influence of Survivin plasmid with short hairpin RNA (shRNA on the cell cycle, invasion, and the silencing effect of Survivin gene in the SW480 cell of colorectal carcinoma. Methods A eukaryotic expression vector, PGCH1/Survivin shRNA, a segment sequence of Survivin as target, was created and transfected into colorectal carcinoma cell line SW480 by the non-lipid method. The influence on the Survivin protein was analyzed by Western blotting, while the cell cycle, cell apoptosis were analyzed by flow cytometry, and invasion of the cell was analyzed by Transwell's chamber method. Results After the transfection of PGCH1/Survivin shRNA, the expression of Survivin protein in SW480 cells was dramatically decreased by 60.68%, in which the cells were stopped at G2/M phase, even though no apoptosis was detected. The number of transmembranous cells of the experimental group, negative control group, and blank control group were 14.46 ± 2.11, 25.12 ± 8.37, and 25.86 ± 7.45, respectively (P 0.05. Conclusion Survivin shRNA could significantly reduce the expression of Survivin protein and invasion of SW480 cells. Changes in cell cycle were observed, but no apoptosis was induced.
Fragment screening by SPR and advanced application to GPCRs.
Shepherd, Claire A; Hopkins, Andrew L; Navratilova, Iva
2014-01-01
Surface plasmon resonance (SPR) is one of the primary biophysical methods for the screening of low molecular weight 'fragment' libraries, due to its low protein consumption and 'label-free' methodology. SPR biosensor interaction analysis is employed to both screen and confirm the binding of compounds in fragment screening experiments, as it provides accurate information on the affinity and kinetics of molecular interactions. The most advanced application of the use of SPR for fragment screening is against membrane protein drug targets, such G-protein coupled receptors (GPCRs). Biophysical GPCR assays using SPR have been validated with pharmacological measurements approximate to cell-based methods, yet provide the advantage of biophysical methods in their ability to measure the weak affinities of low molecular weight fragments. A number of SPR fragment screens against GPCRs have now been disclosed in the literature. SPR fragment screening is proving versatile to screen both thermostabilised GPCRs and solubilised wild type receptors. In this chapter, we discuss the state-of-the-art in GPCR fragment screening by SPR and the technical considerations in performing such experiments. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.
Predictors of advanced colorectal neoplasia for colorectal cancer screening.
Wong, Martin C S; Lam, Thomas Y T; Tsoi, Kelvin K F; Chan, Victor C W; Hirai, Hoyee W; Ching, Jessica Y L; Sung, Joseph J Y
2014-05-01
The Asia-Pacific Colorectal Screening (APCS) score based on age, gender, family history, and smoking is useful to predict advanced colorectal neoplasia (ACN) in asymptomatic Asian subjects. To evaluate the factors in addition to those of APCS associated with ACN colonoscopic findings. Data from 5,220 asymptomatic subjects aged between 50 and 70 years who underwent screening colonoscopy in a community center between 2008 and 2012 were analyzed. One binary logistic regression analysis was conducted in 2013 with the presence of ACN or cancer as the outcome, controlling for APCS score, alcohol consumption, BMI, hypertension, and other chronic diseases as independent variables. The average participant age was 57.7 years (SD=4.9) and 47.5% were men. Advanced neoplasms or cancers were identified at colonoscopy in 5.6% of all screening participants. From multivariate regression analysis, APCS score≥4 (adjusted OR [AOR]=1.74, 95% CI=1.34, 2.25, pstatistic of APCS score alone was 0.560 (95% CI=0.524, 0.595, p=0.001) and that of APCS score plus BMI, hypertension, and alcohol consumption was 0.613 (95% CI=0.578, 0.648, p<0.001). Alcohol consumption, hypertension, and BMI are independent predictors of ACN, which could be incorporated into the APCS for prioritizing Asian asymptomatic subjects for colorectal cancer screening. Copyright © 2014. Published by Elsevier Inc.
Directory of Open Access Journals (Sweden)
Hai-Bo Xing
2018-01-01
Full Text Available Pancreatic adenocarcinoma has an exceedingly poor prognosis, accounting for five-year survival of less than 5%. Presently, improving the efficacy of pancreatic adenocarcinoma treatment has been the focus of medical researchers worldwide. Recently, it has been suggested that deregulation of interleukin- (IL- 6 is caused by a key gene involved in the beginning and development of pancreatic adenocarcinoma. Herein, we investigated whether suppression of IL-6 could augment gemcitabine sensitivity in the PANC-1 cells. We found considerably higher expression of IL-6 in pancreatic adenocarcinoma tissues than that in the adjacent nontumorous tissues. Suppression of IL-6 by shRNA resulted in apoptosis as well as inhibition of cell proliferation and tumorigenicity. In addition, suppression of IL-6 remarkably promoted antitumor effect of gemcitabine, indicating that the combination of shRNA targeting IL-6 with gemcitabine may provide a potential clinical approach for pancreatic cancer therapy.
Haga, K; Lemp, N A; Logg, C R; Nagashima, J; Faure-Kumar, E; Gomez, G G; Kruse, C A; Mendez, R; Stripecke, R; Kasahara, N; Kasahara, N A; Cicciarelli, J C
2006-12-01
Transplantation of many tissues requires histocompatibility matching of human leukocyte antigens (HLA) to prevent graft rejection, to reduce the level of immunosuppression needed to maintain graft survival, and to minimize the risk of graft-versus-host disease, particularly in the case of bone marrow transplantation. However, recent advances in fields of gene delivery and genetic regulation technologies have opened the possibility of engineering grafts that display reduced levels of HLA expression. Suppression of HLA expression could help to overcome the limitations imposed by extensive HLA polymorphisms that restrict the availability of suitable donors, necessitate the maintenance of large donor registries, and complicate the logistics of procuring and delivering matched tissues and organs to the recipient. Accordingly, we investigated whether knockdown of HLA by RNA interference (RNAi), a ubiquitous regulatory system that can efficiently and selectively inhibit the expression of specific gene products, would enable allogeneic cells to evade immune recognition. For efficient and stable delivery of short hairpin-type RNAi constructs (shRNA), we employed lentivirus-based gene transfer vectors, which provide a delivery system that can achieve integration into genomic DNA, thereby permanently modifying transduced graft cells. Our results show that lentivirus-mediated delivery of shRNA targeting pan-Class I and allele-specific HLA can achieve efficient and dose-dependent reduction in surface expression of HLA in human cells, associated with enhanced resistance to alloreactive T lymphocyte-mediated cytotoxicity, while avoiding MHC-non-restricted killing. We hypothesize that RNAi-induced silencing of HLA expression has the potential to create histocompatibility-enhanced, and, eventually, perhaps "universally" compatible cellular grafts.
Directory of Open Access Journals (Sweden)
Jialin Song
2016-08-01
Full Text Available Small interfering RNA (siRNA is an effective and specific method for silencing genes. However, an efficient and nontoxic carrier is needed to deliver the siRNA into the target cells. Tumor necrosis factor α (TNF-α plays a central role in the occurrence and progression of rheumatoid arthritis. In this study, we pre-synthetized a degradable cationic polymer (PDAPEI from 2,6-pyridinedicarboxaldehyde and low molecular weight polyethyleneimine (PEI, Mw=1.8 kDa as a gene vector for the delivery of TNF-α shRNA. The PDAPEI/pDNA complex showed a suitable particle size and stable zeta potential for transfection. In vitro study of the PDAPEI/pDNA complex revealed a lower cytotoxicity and higher transfection efficiency when transfecting TNF-α shRNA to macrophages by significantly down-regulating the expression of TNF-α. Moreover, the complex was extremely efficient in decreasing the severity of arthritis in mice with collagen-induced arthritis (CIA. PDAPEI delivered TNF-α shRNA has great potential in the treatment of rheumatoid arthritis.
Jain, Sudhir Kumar; Jain, Hemlata; Kumar, Dharmendra; Bedekar, Megha Kadam; Pandey, Akhilesh Kumar; Sarkhel, Bikash Chandra
2015-09-01
Skeletal muscle is the major component of lean tissue that is used for consumption, and myostatin is a negative regulator of skeletal muscle growth. Downregulation of this gene therefore offers a strategy for developing superior animals with enhanced muscle growth. Knockdown of myostatin was achieved by RNA interference technology. The anti-myostatin shRNA were designed and stably transfected in caprine fibroblast cells. The reduced expression of target gene was achieved and measured in clonal fibroblast cells by real-time PCR. Two single-cell clones induced significant decrease of myostatin gene expression by 73.96 and 72.66 %, respectively (P < 0.05). To ensure the appropriate growth of transfected cell, seven media were tested. The best suited media was used for transfected fibroblast cell proliferation. The findings suggest that shRNA provides a novel potential tool for gene knockdown and these stably transfected cells can be used as the donor cells for animal cloning.
77 FR 65395 - Air Cargo Advance Screening (ACAS) Pilot Program
2012-10-26
... DEPARTMENT OF HOMELAND SECURITY U.S. Customs and Border Protection Air Cargo Advance Screening (ACAS) Pilot Program Correction In notice document 2012-26031 appearing on pages 65006-65009 in the issue of October 24, 2012 make the following correction: On page 65007, in the first column, under the...
Birnbaum, Jeanette; Gadi, Vijayakrishna K; Markowitz, Elan; Etzioni, Ruth
2016-02-16
Mammography trials, which are the primary sources of evidence for screening benefit, were conducted decades ago. Whether advances in systemic therapies have rendered previously observed benefits of screening less significant is unknown. To compare the outcomes of breast cancer screening trials had they been conducted using contemporary systemic treatments with outcomes of trials conducted with previously used treatments. Computer simulation model of 3 virtual screening trials with similar reductions in advanced-stage cancer cases but reflecting treatment patterns in 1975 (prechemotherapy era), 1999, or 2015 (treatment according to receptor status). Meta-analyses of screening and treatment trials; study of dissemination of primary systemic treatments; SEER (Surveillance, Epidemiology, and End Results) registry. U.S. women aged 50 to 74 years. 10 and 25 years. Population. Mammography, chemotherapy, tamoxifen, aromatase inhibitors, and trastuzumab. Breast cancer mortality rate ratio (MRR) and absolute risk reduction (ARR) obtained by the difference in cumulative breast cancer mortality between control and screening groups. At 10 years, screening in a 1975 trial yielded an MRR of 90% and an ARR of 5 deaths per 10,000 women. A 2015 screening trial yielded a 10-year MRR of 90% and an ARR of 3 deaths per 10,000 women. Greater reductions in advanced-stage disease yielded a greater screening effect, but MRRs remained similar across trials. However, ARRs were consistently lower under contemporary treatments. When contemporary treatments were available only for early-stage cases, the MRR was 88%. Disease models simplify reality and cannot capture all breast cancer subtypes. Advances in systemic therapies for breast cancer have not substantively reduced the relative benefits of screening but have likely reduced the absolute benefits because of their positive effect on breast cancer survival. University of Washington and National Cancer Institute.
Oberaigner, W; Geiger-Gritsch, Sabine; Edlinger, M; Daniaux, M; Knapp, R; Hubalek, M; Siebert, U; Marth, C; Buchberger, W
2017-06-01
We analysed all female breast cancer (BC) cases in Tyrol/Austria regarding the shift in cancer characteristics, especially the shift in advanced BC, for the group exposed to screening as compared to the group unexposed to screening. The analysis was based on all BC cases diagnosed in women aged 40-69 years, resident in Tyrol, and diagnosed between 2009 and 2013. The data were linked to the Tyrolean mammography screening programme database to classify BC cases as "exposed to screening" or "unexposed to screening". Age-adjusted relative risks (RR) were estimated by relating the exposed to the unexposed group. In a total of about 145,000 women aged 40-69 years living in Tyrol during the study period, 1475 invasive BC cases were registered. We estimated an age-adjusted relative risk (RR) for tumour size ≥ 21 mm of 0.72 (95% confidence interval (CI) 0.60 to 0.86), for metastatic BC of 0.27 (95% CI 0.17 to 0.46) and for advanced BC of 0.83 (95% CI 0.71 to 0.96), each comparing those exposed to those unexposed to screening, respectively. In our population-based registry analysis we observed that participation in the mammography screening programme in Tyrol is associated with a 28% decrease in risk for BC cases with tumour size ≥ 21 mm and a 17% decrease in risk for advanced BC. We therefore expect the Tyrolean mammography programme to show a reduction in BC mortality. Copyright © 2017 Elsevier Ltd. All rights reserved.
Zhang, Qun; Shu, Fu-Li; Jiang, Yu-Feng; Huang, Xin-En
2015-01-01
In this study, influence caused by expression plasmids of connective tissue growth factor (CTGF) and tissue inhibitor of metalloproteinase-1 (TIMP-1) short hairpin RNA (shRNA) on mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII in hepatic tissue with hepatic fibrosis, a precancerous condition, in rats is analyzed. To screen and construct shRNA expression plasimid which effectively interferes RNA targets of CTGF and TIMP-1 in rats. 50 cleaning Wistar male rats are allocated randomly at 5 different groups after precancerous fibrosis models and then injection of shRNA expression plasimids. Plasmid psiRNA-GFP-Com (CTGF and TIMP-1 included), psiRNA-GFP-CTGF, psiRNA-GFP-TIMP-1 and psiRNA- DUO-GFPzeo of blank plasmid are injected at group A, B, C and D, respectively, and as model control group that none plasimid is injected at group E. In 2 weeks after last injection, to hepatic tissue at different groups, protein expression of CTGF, TIMP-1, procol-α1and PC III is tested by immunohistochemical method and,mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII is measured by real-time PCR. One-way ANOVA is used to comparison between-groups. Compared with model group, there is no obvious difference of mRNA expression among CTGF,TIMP-1,procol-α1,PC III and of protein expression among CTGF, TIMP-1, procol-α1, PC III in hepatic tissue at group injected with blank plasmid. Expression quantity of mRNA of CTGF, TIMP-1, procol-α1 and PCIII at group A, B and C decreases, protein expression of CTGF, TIMP-1, procol-α1, PC III in hepatic tissue is lower, where the inhibition of combination RNA interference group (group A) on procol-α1 mRNA transcription and procol-α1 protein expression is superior to that of single interference group (group B and C) (P<0.01 or P<0.05). RNA interference on CTGF and/or TIMP-1 is obviously a inhibiting factor for mRNA and protein expression of CTGF, TIMP-1, procol-α1 and PCIII. Combination RNA interference on genes of CTGF and TIMP-1 is superior
Fujioka, Takashi; Matsunaga, Naoya; Okazaki, Hiroyuki; Koyanagi, Satoru; Ohdo, Shigehiro
2010-01-01
Hypoxia-induced gene expression frequently occurs in malignant solid tumors because they often have hypoxic areas in which circulation is compromised due to structurally disorganized blood vessels. Hypoxia-response elements (HREs) are responsible for activating gene transcription in response to hypoxia. In this study, we constructed a hypoxia-response plasmid vector producing short hairpin RNA (shRNA) against B-cell leukemia/lymphoma-2 (bcl-2), an anti-apoptotic factor. The hypoxia-response promoter was made by inserting tandem repeats of HREs upstream of cytomegalovirus (CMV) promoter (HRE-CMV). HRE-CMV shbcl-2 vector consisted of bcl-2 shRNA under the control of HRE-CMV promoter. In hypoxic mouse rectum carcinoma cells (colon-26), the production of bcl-2 shRNA driven by HRE-CMV promoter was approximately 2-fold greater than that driven by CMV promoter. A single intratumoral (i.t.) injection of 40 microg HRE-CMV shbcl-2 to colon-26 tumor-bearing mice caused apoptotic cell death, and repetitive treatment with HRE-CMV shbcl-2 (40 microg/mouse, i.t.) also significantly suppressed the growth of colon-26 tumor cells implanted in mice. Apoptotic and anti-tumor effects were not observed in tumor-bearing mice treated with CMV shbcl-2. These results reveal the ability of HRE-CMV shbcl-2 vector to suppress the expression of bcl-2 in hypoxic tumor cells and suggest the usefulness of our constructed hypoxia-response plasmid vector to treat malignant tumors. [Supplementary Figures: available only at http://dx.doi.org/10.1254/jphs.10054FP].
International Nuclear Information System (INIS)
Song, Mi-Young; Jung, Young-Dae
2003-01-01
Quantum screening effects on the occurrence scattering time advance for elastic electron-ion collisions in strongly coupled semiclassical plasmas are investigated using the second-order eikonal analysis. The electron-ion interaction in strongly coupled semiclassical plasmas is obtained by the pseudopotential model taking into account the plasma screening and quantum effects. It is found that the quantum-mechanical effects significantly reduce the occurrence scattering time advance. It is also found that the occurrence scattering time advance increases with increasing Debye length. It is quite interesting to note that the domain of the maximum occurrence time advance is localized for the forward scattering case. The region of the scaled thermal de Broglie wave length (λ-bar) for the maximum occurrence time advance is found to be 0.4≤λ-bar≤1.4
Advances in genome-wide RNAi cellular screens: a case study using the Drosophila JAK/STAT pathway
2012-01-01
Background Genome-scale RNA-interference (RNAi) screens are becoming ever more common gene discovery tools. However, whilst every screen identifies interacting genes, less attention has been given to how factors such as library design and post-screening bioinformatics may be effecting the data generated. Results Here we present a new genome-wide RNAi screen of the Drosophila JAK/STAT signalling pathway undertaken in the Sheffield RNAi Screening Facility (SRSF). This screen was carried out using a second-generation, computationally optimised dsRNA library and analysed using current methods and bioinformatic tools. To examine advances in RNAi screening technology, we compare this screen to a biologically very similar screen undertaken in 2005 with a first-generation library. Both screens used the same cell line, reporters and experimental design, with the SRSF screen identifying 42 putative regulators of JAK/STAT signalling, 22 of which verified in a secondary screen and 16 verified with an independent probe design. Following reanalysis of the original screen data, comparisons of the two gene lists allows us to make estimates of false discovery rates in the SRSF data and to conduct an assessment of off-target effects (OTEs) associated with both libraries. We discuss the differences and similarities between the resulting data sets and examine the relative improvements in gene discovery protocols. Conclusions Our work represents one of the first direct comparisons between first- and second-generation libraries and shows that modern library designs together with methodological advances have had a significant influence on genome-scale RNAi screens. PMID:23006893
Costs of Finding an Advanced Adenoma in Colorectal Screening
Directory of Open Access Journals (Sweden)
Jerome B Simon
2004-01-01
Full Text Available The authors used computerized decision analysis to estimate the costs of finding and removing an advanced colonic adenoma in patients referred because of a positive fecal occult blood test. An advanced adenoma was defined as a villous adenoma, a tubular adenoma 10 mm or more in size, or a lesion that harboured highgrade dysplasia or cancer. Four strategies were compared: flexible sigmoidoscopy, flexible sigmoidoscopy plus air contrast barium enema, virtual colonoscopy (CT colography and colonoscopy. Colonoscopy with polypectomy was undertaken if any of the methods detected a polyp. Probabilities and test characteristics were determined from the literature, and costs were estimated from the provincial fee schedule (Ontario and local hospital sources. With an assumed 17% probability of an advanced adenoma being present, sigmoidoscopy was the most cost effective strategy at $1930 to find and clear an advanced lesion, but the procredure missed between one-third and almost one-half of the lesions, depending on the depth of insertion. At $2290, colonoscopy was slightly more expensive than sigmoidoscopy and more cost effective than either sigmoidoscopy plus barium enema ($2840 or virtual colonoscopy ($3681, neither of which detected as many advanced adenomas. The authors concluded that colonoscopy is the preferred investigative strategy and that improved access to colonoscopy is an important goal for occult blood screening programs.
Javan, Bita; Atyabi, Fatemeh; Shahbazi, Majid
2018-04-12
This investigation was conducted to construct a hypoxia/colorectal dual-specific bidirectional short hairpin RNA (shRNA) expression vector and to transfect it into the colon cancer cell line HT-29 with PEI/chitosan-TBA nanoparticles for the simultaneous knock down of β-catenin and Bcl-2 under hypoxia. To construct a pRNA-bipHRE-CEA vector, the carcinoma embryonic antigen (CEA) promoter designed in two directions and the vascular endothelial growth factor (VEGF) enhancer were inserted between two promoters for hypoxic cancer specific gene expression. To confirm the therapeutic effect of the dual-specific vector, β-catenin and Bcl-2 shRNAs were inserted downstream of each promoter. The physicochemical properties, the cytotoxicity, and the transfection efficiency of these PEI/chitosan-TBA nanoparticles were investigated. In addition, the antitumor effects of the designed vector on the expression of β-catenin and Bcl-2, cell cycle distribution, and apoptosis were investigated in vitro. The silencing effect of the hypoxia-response shRNA expression vector was relatively low (18%-25%) under normoxia, whereas it was significantly increased to approximately 50%-60% in the HT-29 cell line. Moreover, the cancer cells showed significant G0/G1 arrest and increased apoptosis due to gene silencing under hypoxia. Furthermore, MTS assay, fluorescence microscopy images, and flow cytometry analyses confirmed that the PEI/chitosan-TBA blend system provided effective transfection with low cytotoxicity. This novel hypoxia-responsive shRNA expression vector may be useful for RNA interference (RNAi)-based cancer gene therapy in hypoxic colorectal tumors. Moreover, the PEI/chitosan-TBA copolymer might be a promising gene carrier for use in gene transfer in vivo. Copyright © 2017. Published by Elsevier Inc.
shRNA screening identifies JMJD1C as being required for leukemia maintenance
DEFF Research Database (Denmark)
Sroczynska, Patrycja; Cruickshank, V Adam; Bukowski, John-Paul
2014-01-01
Epigenetic regulatory mechanisms are implicated in the pathogenesis of acute myeloid and lymphoid leukemia (AML and ALL). Recent progress suggests that proteins involved in epigenetic control are amenable to drug intervention, but little is known about the cancer-specific dependency on epigenetic...... candidate drug targets identified in these screens was Jmjd1c. Depletion of Jmjd1c impairs growth and colony formation of mouse MLL-AF9 cells in vitro, as well as establishment of leukemia after transplantation. Depletion of JMJD1C impairs expansion and colony formation of human leukemic cell lines......, with the strongest effect observed in the MLL-rearranged ALL cell line, SEM. In both mouse and human leukemic cells, the growth defect upon JMJD1C depletion appears to be primarily due to increased apoptosis, which implicates JMJD1C as a potential therapeutic target in leukemia....
Albrecht, Heinz; Gallitz, Julia; Hable, Robert; Vieth, Michael; Tontini, Gian Eugenio; Neurath, Markus Friedrich; Riemann, Jurgen Ferdinand; Neumann, Helmut
2016-01-01
Colonoscopy plays a fundamental role in early diagnosis and management of colorectal cancer and requires public and professional acceptance to ensure the ongoing success of screening programs. The aim of the study was to prospectively assess whether patient acceptance rates to undergo screening colonoscopy could be improved by the offer of advanced imaging techniques. Overall, 372 randomly selected patients were prospectively included. A standardized questionnaire was developed that inquired of the patients their knowledge regarding advanced imaging techniques. Second, several media campaigns and information events were organized reporting about advanced imaging techniques, followed by repeated evaluation. After one year the evaluation ended. At baseline, 64% of the patients declared that they had no knowledge about new endoscopic methods. After twelve months the overall grade of information increased significantly from 14% at baseline to 34%. The percentage of patients who decided to undergo colonoscopy because of the offer of new imaging methods also increased significantly from 12% at baseline to 42% after 12 months. Patients were highly interested in the offer of advanced imaging techniques. Knowledge about these techniques could relatively easy be provided using local media campaigns. The offer of advanced imaging techniques leads to higher acceptance rates for screening colonoscopies.
Li, Yuan; Zhuo, Baobiao; Yin, Yiyu; Han, Tao; Li, Shixian; Li, Zhengwei; Wang, Jian
2017-09-09
Chemotherapy is one of the few effective choices for patients with neuroblastoma. However, the development of muti-drug resistance (MDR) to chemotherapy is a major obstacle to the effective treatment of advanced or recurrent neuroblastoma. The muti-drug resistance-associated protein (MRP), which encodes a transmembrane glycoprotein, is a key regulator of MDR. The expression of MRP is a close correlation with MYCN oncogene in neuroblastoma. We have recently shown ZD55-shMYCN (oncolytic virus armed with shRNA against MYCN) can down-regulate MYCN to inhibit tumor cells proliferation and induce apoptosis in neuroblastoma. Here we further report ZD55-shMYCN re-sensitized doxorubicin-resistant cells to doxorubicin (as shown by reduced proliferation, increased apoptosis, and inhibited cell migration), and reduced the in vivo growth rate of neuroblastoma xenografts by down-regulation of MRP expression. Sequential therapy with doxorubicin did not affect the replication of ZD55-shMYCN in doxorubicin-resistant neuroblastoma cells, but decreased the expression of Bcl-2, Bcl-X L , MMP-1. Thus, this synergistic effect of ZD55-shMYCN in combination with doxorubicin provides a novel therapy strategy for doxorubicin-resistant neuroblastoma, and is a promising approach for further clinical development. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Pham PV
2012-05-01
Full Text Available Phuc Van Pham1, Ngoc Bich Vu1, Thuy Thanh Duong1, Tam Thanh Nguyen1, Nhung Hai Truong1, Nhan Lu Chinh Phan1, Tue Gia Vuong1, Viet Quoc Pham1, Hoang Minh Nguyen1, Kha The Nguyen1, Nhung Thi Nguyen1, Khue Gia Nguyen1, Lam Tan Khat1, Dong Van Le2, Kiet Dinh Truong1, Ngoc Kim Phan11Laboratory of Stem Cell Research and Application, University of Science, Vietnam National University, HCM City, 2Military Medical University, Ha Noi, VietnamBackground: Breast cancer stem cells with a CD44+CD24- phenotype are the origin of breast tumors. Strong CD44 expression in this population indicates its important role in maintaining the stem cell phenotype. Previous studies show that CD44 down-regulation causes CD44+CD24- breast cancer stem cells to differentiate into non-stem cells that are sensitive to antitumor drugs and lose many characteristics of the original cells. In this study, we determined tumor suppression in non-obese severe combined immunodeficiency mice using CD44 shRNA therapy combined with doxorubicin treatment.Methods: Tumor-bearing non-obese severe combined immunodeficiency mice were established by injection of CD44+CD24- cells. To track CD44+CD24- cells, green fluorescence protein was stably transduced using a lentiviral vector prior to injection into mice. The amount of CD44 shRNA lentiviral vector used for transduction was based on CD44 down-regulation by in vitro CD44 shRNA transduction. Mice were treated with direct injection of CD44 shRNA lentiviral vector into tumors followed by doxorubicin administration after 48 hours. The effect was evaluated by changes in the size and weight of tumors compared with that of the control.Results: The combination of CD44 down-regulation and doxorubicin strongly suppressed tumor growth with significant differences in tumor sizes and weights compared with that of CD44 down-regulation or doxorubicin treatment alone. In the combination of CD44 down-regulation and doxorubicin group, the tumor weight was
Allen, Marvin; Allen, John; Naseri, Take; Gardner, Rebecca; Tolley, Dennis; Allen, Lori
2017-10-01
Echocardiography has been proposed as a method to screen children for rheumatic heart disease. The World Heart Federation has established guidelines for echocardiographic screening. In this study, we describe a rapid echocardiogram screening protocol according to the World Heart Federation guidelines in Samoa, endemic for rheumatic heart disease. We performed echocardiogram screening in schoolchildren in Samoa between 2013 and 2015. A brief screening echocardiogram was performed on all students. Children with predefined criteria suspicious for rheumatic hear diseases were referred for a more comprehensive echocardiogram. Complete echocardiograms were classified according to the World Heart Federation guidelines and severity of valve disease. Echocardiographic screening was performed on 11,434 children, with a mean age of 10.2 years; 51% of them were females. A total of 558 (4.8%) children underwent comprehensive echocardiography, including 49 students who were randomly selected as controls. Definite rheumatic heart disease was observed in 115 students (10.0 per 1000): 92 students were classified as borderline (8.0 per 1000) and 23 with CHD. Advanced disease was identified in 50 students (4.4 per 1000): 15 with severe mitral regurgitation, five with severe aortic regurgitation, 11 with mitral stenoses, and 19 with mitral and aortic valve disease. We successfully applied a rapid echocardiographic screening protocol to a large number of students over a short time period - 28 days of screening over a 3-year time period - to identify a high prevalence of rheumatic heart disease. We also reported a significantly higher rate of advanced disease compared with previously published echocardiographic screening programmes.
A Risk Prediction Index for Advanced Colorectal Neoplasia at Screening Colonoscopy.
Schroy, Paul C; Wong, John B; O'Brien, Michael J; Chen, Clara A; Griffith, John L
2015-07-01
Eliciting patient preferences within the context of shared decision making has been advocated for colorectal cancer screening. Risk stratification for advanced colorectal neoplasia (ACN) might facilitate more effective shared decision making when selecting an appropriate screening option. Our objective was to develop and validate a clinical index for estimating the probability of ACN at screening colonoscopy. We conducted a cross-sectional analysis of 3,543 asymptomatic, mostly average-risk patients 50-79 years of age undergoing screening colonoscopy at two urban safety net hospitals. Predictors of ACN were identified using multiple logistic regression. Model performance was internally validated using bootstrapping methods. The final index consisted of five independent predictors of risk (age, smoking, alcohol intake, height, and a combined sex/race/ethnicity variable). Smoking was the strongest predictor (net reclassification improvement (NRI), 8.4%) and height the weakest (NRI, 1.5%). Using a simplified weighted scoring system based on 0.5 increments of the adjusted odds ratio, the risk of ACN ranged from 3.2% (95% confidence interval (CI), 2.6-3.9) for the low-risk group (score ≤2) to 8.6% (95% CI, 7.4-9.7) for the intermediate/high-risk group (score 3-11). The model had moderate to good overall discrimination (C-statistic, 0.69; 95% CI, 0.66-0.72) and good calibration (P=0.73-0.93). A simple 5-item risk index based on readily available clinical data accurately stratifies average-risk patients into low- and intermediate/high-risk categories for ACN at screening colonoscopy. Uptake into clinical practice could facilitate more effective shared decision-making for CRC screening, particularly in situations where patient and provider test preferences differ.
Zhang, Litao; Cvijic, Mary Ellen; Lippy, Jonathan; Myslik, James; Brenner, Stephen L; Binnie, Alastair; Houston, John G
2012-07-01
In this paper, we review the key solutions that enabled evolution of the lead optimization screening support process at Bristol-Myers Squibb (BMS) between 2004 and 2009. During this time, technology infrastructure investment and scientific expertise integration laid the foundations to build and tailor lead optimization screening support models across all therapeutic groups at BMS. Together, harnessing advanced screening technology platforms and expanding panel screening strategy led to a paradigm shift at BMS in supporting lead optimization screening capability. Parallel SAR and structure liability relationship (SLR) screening approaches were first and broadly introduced to empower more-rapid and -informed decisions about chemical synthesis strategy and to broaden options for identifying high-quality drug candidates during lead optimization. Copyright © 2012 Elsevier Ltd. All rights reserved.
A fast, simple method for screening radiation susceptibility genes by RNA interference
International Nuclear Information System (INIS)
Tsuji, Atsushi B.; Sudo, Hitomi; Sugyo, Aya; Otsuki, Marika; Miyagishi, Makoto; Taira, Kazunari; Imai, Takashi; Harada, Yoshi-nobu
2005-01-01
Radiotherapy can cause unacceptable levels of damage to normal tissues in some cancer patients. To understand the molecular mechanisms underlying radiation-induced physiological responses, and to be able to predict the radiation susceptibility of normal tissues in individual patients, it is important to identify a comprehensive set of genes responsible for radiation susceptibility. We have developed a simple and rapid 96-well screening protocol using cell proliferation assays and RNA interference to identify genes associated with radiation susceptibility. We evaluated the performance of alamarBlue-, BrdU-, and sulforhodamine B-based cell proliferation assays using the 96-well format. Each proliferation assay detected the known radiation susceptibility gene, PRKDC. In a trial screen using 28 shRNA vectors, another known gene, CDKN1A, and one new radiation susceptibility gene, ATP5G3, were identified. Our results indicate that this method may be useful for large-scale screens designed to identify novel radiation susceptibility genes
Energy Technology Data Exchange (ETDEWEB)
Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)
2014-11-14
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Sekiguchi, Masau; Kakugawa, Yasuo; Terauchi, Takashi; Matsumoto, Minori; Saito, Hiroshi; Muramatsu, Yukio; Saito, Yutaka; Matsuda, Takahisa
2016-12-01
The sensitivity of 2-[ 18 F]fluoro-2-deoxyglucose positron emission tomography (FDG-PET) for advanced colorectal neoplasms among healthy subjects is not yet fully understood. The present study aimed to clarify the sensitivity by analyzing large-scale data from an asymptomatic screening population. A total of 7505 asymptomatic screenees who underwent both FDG-PET and colonoscopy at our Cancer Screening Division between February 2004 and March 2013 were analyzed. FDG-PET and colonoscopy were performed on consecutive days, and each examination was interpreted in a blinded fashion. The results of the two examinations were compared for each of the divided six colonic segments, with those from colonoscopy being set as the reference. The relationships between the sensitivity of FDG-PET and clinicopathological features of advanced neoplasms were also evaluated. Two hundred ninety-one advanced neoplasms, including 24 invasive cancers, were detected in 262 individuals. Thirteen advanced neoplasms (advanced adenomas) were excluded from the analysis because of the coexistence of lesions in the same colonic segment. The sensitivity, specificity, and positive and negative predictive values of FDG-PET for advanced neoplasms were 16.9 % [95 % confidence interval (CI) 12.7-21.8 %], 99.3 % (95 % CI 99.2-99.4 %), 13.5 % (95 % CI 10.1-17.6 %), and 99.4 % (95 % CI 99.3-99.5 %), respectively. The sensitivity was lower for lesions with less advanced histological grade, of smaller size, and flat-type morphology, and for those located in the proximal part of the colon. FDG-PET is believed to be difficult to use as a primary screening tool in population-based colorectal cancer screening because of its low sensitivity for advanced neoplasms. Even when it is used in opportunistic cancer screening, the limit of its sensitivity should be considered.
Large screen mimic display design research for advanced main control room in nuclear power plant
International Nuclear Information System (INIS)
Zheng Mingguang; Yang Yanhua; Xu Jijun; Zhang Qinshun; Ning Zhonghe
2002-01-01
Firstly the evolution of mimic diagrams or displays used in the main control room of nuclear power plant was introduced. The active functions of mimic diagrams were analyzed on the release of operator psychological burden and pressure, the assistance of operator for the information searching, status understanding, manual actuation, correct decision making as well as the safe and reliable operation of the nuclear power plant. The importance and necessity to use the (large screen) mimic diagrams in advanced main control room of nuclear power plant, the design principle, design details and verification measures of large screen mimic display are also described
Screening of ten advanced chickpea lines for blight and wilt resistance
International Nuclear Information System (INIS)
Jamil, F.F.; Haq, I.; Sarwar, N.; Alam, S.S.; Khan, J.A.; Hanif, M.; Khan, I.A.; Sarwar, M.; Haq, M.A.
2002-01-01
Ten advanced chickpea lines developed at NIAB were screened for resistance to Ascochyta blight and Fusarium wilt diseases in different sets of experiments conducted under controlled environment. Inoculation of plants by spore suspension of virulent strains of Ascochyta rabiei revealed that one line (97313) was resistant tolerant, two lines (97305, 97392) were tolerant, six lines (97306, 97310, 97311, 97303, 97302, 97393) were tolerant/susceptible and one line (97301) was susceptible. Screening of the same lines against Fusarium wilt by water culture method showed that two lines (97301, 97313) were moderately resistant, four lines (97302, 97303, 97306, 97393) were tolerant and the remaining four lines were susceptible. Screening through phytotoxic culture filtrates revealed that two lines (97302, 97313) were less sensitive to culture filtrates of Ascochyta rabiei and Fusarium oxysporum than the resistant check (CM88). These lines were also analyzed spectrophotometrically for peroxidase enzyme activity. Maximum enzyme activity was detected after 48 hours of inoculation with A. rabiei in three lines (97305, 97311, 97313) and resistant check (CM88) while enzyme activity in the remaining lines reached its maximum after 72 hours of inoculation which was comparable to the susceptible check (Pb-1). These studies lead to the conclusion that one line (97313) exhibited resistance against both the diseases and can be used as a source of resistance for further improvement of chickpea germplasm. (author)
Wong, Martin C S; Ching, Jessica Y L; Ng, Simpson; Lam, Thomas Y T; Luk, Arthur K C; Wong, Sunny H; Ng, Siew C; Ng, Simon S M; Wu, Justin C Y; Chan, Francis K L; Sung, Joseph J Y
2016-02-03
We evaluated the performance of seven existing risk scoring systems in predicting advanced colorectal neoplasia in an asymptomatic Chinese cohort. We prospectively recruited 5,899 Chinese subjects aged 50-70 years in a colonoscopy screening programme(2008-2014). Scoring systems under evaluation included two scoring tools from the US; one each from Spain, Germany, and Poland; the Korean Colorectal Screening(KCS) scores; and the modified Asia Pacific Colorectal Screening(APCS) scores. The c-statistics, sensitivity, specificity, positive predictive values(PPVs), and negative predictive values(NPVs) of these systems were evaluated. The resources required were estimated based on the Number Needed to Screen(NNS) and the Number Needed to Refer for colonoscopy(NNR). Advanced neoplasia was detected in 364 (6.2%) subjects. The German system referred the least proportion of subjects (11.2%) for colonoscopy, whilst the KCS scoring system referred the highest (27.4%). The c-statistics of all systems ranged from 0.56-0.65, with sensitivities ranging from 0.04-0.44 and specificities from 0.74-0.99. The modified APCS scoring system had the highest c-statistics (0.65, 95% C.I. 0.58-0.72). The NNS (12-19) and NNR (5-10) were similar among the scoring systems. The existing scoring systems have variable capability to predict advanced neoplasia among asymptomatic Chinese subjects, and further external validation should be performed.
High-throughput screening of effective siRNAs using luciferase-linked chimeric mRNA.
Directory of Open Access Journals (Sweden)
Shen Pang
Full Text Available The use of siRNAs to knock down gene expression can potentially be an approach to treat various diseases. To avoid siRNA toxicity the less transcriptionally active H1 pol III promoter, rather than the U6 promoter, was proposed for siRNA expression. To identify highly efficacious siRNA sequences, extensive screening is required, since current computer programs may not render ideal results. Here, we used CCR5 gene silencing as a model to investigate a rapid and efficient screening approach. We constructed a chimeric luciferase-CCR5 gene for high-throughput screening of siRNA libraries. After screening approximately 900 shRNA clones, 12 siRNA sequences were identified. Sequence analysis demonstrated that most (11 of the 12 sequences of these siRNAs did not match those identified by available siRNA prediction algorithms. Significant inhibition of CCR5 in a T-lymphocyte cell line and primary T cells by these identified siRNAs was confirmed using the siRNA lentiviral vectors to infect these cells. The inhibition of CCR5 expression significantly protected cells from R5 HIV-1JRCSF infection. These results indicated that the high-throughput screening method allows efficient identification of siRNA sequences to inhibit the target genes at low levels of expression.
Three new shRNA expression vectors targeting the CYP3A4 coding sequence to inhibit its expression
Directory of Open Access Journals (Sweden)
Siyun Xu
2014-10-01
Full Text Available RNA interference (RNAi is useful for selective gene silencing. Cytochrome P450 3A4 (CYP3A4, which metabolizes approximately 50% of drugs in clinical use, plays an important role in drug metabolism. In this study, we aimed to develop a short hairpin RNA (shRNA to modulate CYP3A4 expression. Three new shRNAs (S1, S2 and S3 were designed to target the coding sequence (CDS of CYP3A4, cloned into a shRNA expression vector, and tested in different cells. The mixture of three shRNAs produced optimal reduction (55% in CYP3A4 CDS-luciferase activity in both CHL and HEK293 cells. Endogenous CYP3A4 expression in HepG2 cells was decreased about 50% at both mRNA and protein level after transfection of the mixture of three shRNAs. In contrast, CYP3A5 gene expression was not altered by the shRNAs, supporting the selectivity of CYP3A4 shRNAs. In addition, HepG2 cells transfected with CYP3A4 shRNAs were less sensitive to Ginkgolic acids, whose toxic metabolites are produced by CYP3A4. These results demonstrate that vector-based shRNAs could modulate CYP3A4 expression in cells through their actions on CYP3A4 CDS, and CYP3A4 shRNAs may be utilized to define the role of CYP3A4 in drug metabolism and toxicity.
iScreen: Image-Based High-Content RNAi Screening Analysis Tools.
Zhong, Rui; Dong, Xiaonan; Levine, Beth; Xie, Yang; Xiao, Guanghua
2015-09-01
High-throughput RNA interference (RNAi) screening has opened up a path to investigating functional genomics in a genome-wide pattern. However, such studies are often restricted to assays that have a single readout format. Recently, advanced image technologies have been coupled with high-throughput RNAi screening to develop high-content screening, in which one or more cell image(s), instead of a single readout, were generated from each well. This image-based high-content screening technology has led to genome-wide functional annotation in a wider spectrum of biological research studies, as well as in drug and target discovery, so that complex cellular phenotypes can be measured in a multiparametric format. Despite these advances, data analysis and visualization tools are still largely lacking for these types of experiments. Therefore, we developed iScreen (image-Based High-content RNAi Screening Analysis Tool), an R package for the statistical modeling and visualization of image-based high-content RNAi screening. Two case studies were used to demonstrate the capability and efficiency of the iScreen package. iScreen is available for download on CRAN (http://cran.cnr.berkeley.edu/web/packages/iScreen/index.html). The user manual is also available as a supplementary document. © 2014 Society for Laboratory Automation and Screening.
Directory of Open Access Journals (Sweden)
Bojie Hu
2014-01-01
Full Text Available Therapeutic modalities targeting vascular endothelial growth factor (VEGF have been used to treat neovascularization and macular edema. However, anti-VEGF treatment alone may cause up-regulation of connective tissue growth factor (CTGF in the retina, increasing the risk of fibrosis and tractional retinal detachment. Therefore, in this study, we employ a novel dual-target intervention that involves intravitreal injection of the VEGF inhibitor ranibizumab and a transfection reagent-treated non-viral vector carrying anti-CTGF short hairpin RNA (shRNA driven by human RNA polymerase III promoter U6. The effects of the dual-target intervention on the expression of VEGF and CTGF and on microvessel ultrastructure were examined in retina of streptozocin-induced diabetic rats. CTGF was significantly up-regulated at week 8 after diabetic induction, whereas VEGF was not up-regulated until week 10. The high expression of both genes was maintained at week 12. Transmission electron microscopy also revealed progressive exacerbation of microvessel ultrastructure during the same period. In addition, ranibizumab significantly lowered VEGF but elevated CTGF mRNA, whereas CTGF shRNA significantly reduced the mRNA levels of both CTGF and VEGF in diabetic retinas. Importantly, dual-target intervention normalized the transcript levels of both target genes and ameliorated retinal microvessel ultrastructural damage better than either single-target intervention. These results suggest the advantages of dual-target over single-target interventions in diabetic retina and reveal a novel therapeutic modality for diabetic retinopathy.
Zhu, Xin-Hua; Liao, Bing; Xu, Yi; Liu, Ke; Huang, Yun; Huang, Quan-Long; Liu, Yue-Hui
2017-02-01
RNA interference has been considered as an effective gene silencing method in basic and preclinical investigations. The aims of the present study were to construct a lentiviral vector expressing a short hairpin RNA (shRNA) targeting the murine CC chemokine receptor 3 (mCCR3), and to investigate its effects on the proliferation and apoptosis of mouse eosinophils. A recombinant lentiviral vector expressing four fragments of mouse CCR3 shRNA (pLVX‑mCCR3‑1+2+3+4‑shRNA) was constructed using subcloning techniques. This novel lentivirus was then packaged into 293T cells by co‑transduction with plasmids, including Baculo p35, pCMV R8.2 and VSV. The interference effects of the vector were verified using polymerase chain reaction (PCR) and western blot analyses. The effects of the interference on the proliferation and apoptosis of mouse eosinophils were investigated using 3‑(4,5‑dimethylthiazol‑2‑yl)‑5‑(3‑carboxymethoxyphenyl)‑2‑(4‑sulfophenyl)‑2H‑tetrazolium and terminal deoxynucleotidyl transferase dUTP nick end labeling methods, respectively. The results of the PCR and western blot analyses confirmed that the novel recombinant vector, pLVX‑mCCR3‑1+2+3+4‑shRNA, had high efficiency in inhibiting the mRNA and protein expression levels of mCCR3 in mouse eosinophils. The downregulation of mCCR3 significantly inhibited proliferation of the eosinophils. Furthermore, the present study found that the downregulation of mCCR3 significantly promoted apoptosis of the eosinophils. Therefore, the downregulation of mCCR3 led to the inhibition of proliferation and induction of apoptosis in mouse eosinophils. The predominant characteristics of allergic rhinitis are eosinophil infiltration and release of inflammatory mediators, which appear in a variety of clinical manifestations. The results of the present study indicate that mCCR3 silencing may serve as a putative approach for the treatment of allergic rhinitis.
Wen, Qiang; Goldenson, Benjamin; Silver, Serena J.; Schenone, Monica; Dancik, Vladimir; Huang, Zan; Wang, Ling-Zhi; Lewis, Timothy; An, W. Frank; Li, Xiaoyu; Bray, Mark-Anthony; Thiollier, Clarisse; Diebold, Lauren; Gilles, Laure; Vokes, Martha S.; Moore, Christopher B.; Bliss-Moreau, Meghan; VerPlank, Lynn; Tolliday, Nicola J.; Mishra, Rama; Vemula, Sasidhar; Shi, Jianjian; Wei, Lei; Kapur, Reuben; Lopez, Cécile K.; Gerby, Bastien; Ballerini, Paola; Pflumio, Francoise; Gilliland, D. Gary; Goldberg, Liat; Birger, Yehudit; Izraeli, Shai; Gamis, Alan S.; Smith, Franklin O.; Woods, William G.; Taub, Jeffrey; Scherer, Christina A.; Bradner, James; Goh, Boon-Cher; Mercher, Thomas; Carpenter, Anne E.; Gould, Robert J.; Clemons, Paul A.; Carr, Steven A.; Root, David E.; Schreiber, Stuart L.; Stern, Andrew M.; Crispino, John D.
2012-01-01
Summary The mechanism by which cells decide to skip mitosis to become polyploid is largely undefined. Here we used a high-content image-based screen to identify small-molecule probes that induce polyploidization of megakaryocytic leukemia cells and serve as perturbagens to help understand this process. We found that dimethylfasudil (diMF, H-1152P) selectively increased polyploidization, mature cell-surface marker expression, and apoptosis of malignant megakaryocytes. A broadly applicable, highly integrated target identification approach employing proteomic and shRNA screening revealed that a major target of diMF is Aurora A kinase (AURKA), which has not been studied extensively in megakaryocytes. Moreover, we discovered that MLN8237 (Alisertib), a selective inhibitor of AURKA, induced polyploidization and expression of mature megakaryocyte markers in AMKL blasts and displayed potent anti-AMKL activity in vivo. This research provides the rationale to support clinical trials of MLN8237 and other inducers of polyploidization in AMKL. Finally, we have identified five networks of kinases that regulate the switch to polyploidy. PMID:22863010
A Large-Scale RNAi Screen Identifies SGK1 as a Key Survival Kinase for GBM Stem Cells.
Kulkarni, Shreya; Goel-Bhattacharya, Surbhi; Sengupta, Sejuti; Cochran, Brent H
2018-01-01
Glioblastoma multiforme (GBM) is the most common type of primary malignant brain cancer and has a very poor prognosis. A subpopulation of cells known as GBM stem-like cells (GBM-SC) have the capacity to initiate and sustain tumor growth and possess molecular characteristics similar to the parental tumor. GBM-SCs are known to be enriched in hypoxic niches and may contribute to therapeutic resistance. Therefore, to identify genetic determinants important for the proliferation and survival of GBM stem cells, an unbiased pooled shRNA screen of 10,000 genes was conducted under normoxic as well as hypoxic conditions. A number of essential genes were identified that are required for GBM-SC growth, under either or both oxygen conditions, in two different GBM-SC lines. Interestingly, only about a third of the essential genes were common to both cell lines. The oxygen environment significantly impacts the cellular genetic dependencies as 30% of the genes required under hypoxia were not required under normoxic conditions. In addition to identifying essential genes already implicated in GBM such as CDK4, KIF11 , and RAN , the screen also identified new genes that have not been previously implicated in GBM stem cell biology. The importance of the serum and glucocorticoid-regulated kinase 1 (SGK1) for cellular survival was validated in multiple patient-derived GBM stem cell lines using shRNA, CRISPR, and pharmacologic inhibitors. However, SGK1 depletion and inhibition has little effect on traditional serum grown glioma lines and on differentiated GBM-SCs indicating its specific importance in GBM stem cell survival. Implications: This study identifies genes required for the growth and survival of GBM stem cells under both normoxic and hypoxic conditions and finds SGK1 as a novel potential drug target for GBM. Mol Cancer Res; 16(1); 103-14. ©2017 AACR . ©2017 American Association for Cancer Research.
Sekiguchi, Masau; Kakugawa, Yasuo; Matsumoto, Minori; Matsuda, Takahisa
2018-01-22
Risk stratification of screened populations could help improve colorectal cancer (CRC) screening. Use of the modified Asia-Pacific Colorectal Screening (APCS) score has been proposed in the Asia-Pacific region. This study was performed to build a new useful scoring model for CRC screening. Data were reviewed from 5218 asymptomatic Japanese individuals who underwent their first screening colonoscopy. Multivariate logistic regression was used to investigate risk factors for advanced colorectal neoplasia (ACN), and a new scoring model for the prediction of ACN was developed based on the results. The discriminatory capability of the new model and the modified APCS score were assessed and compared. Internal validation was also performed. ACN was detected in 225 participants. An 8-point scoring model for the prediction of ACN was developed using five independent risk factors for ACN (male sex, higher age, presence of two or more first-degree relatives with CRC, body mass index of > 22.5 kg/m 2 , and smoking history of > 18.5 pack-years). The prevalence of ACN was 1.6% (34/2172), 5.3% (127/2419), and 10.2% (64/627) in participants with scores of statistic of the scoring model was 0.70 (95% confidence interval, 0.67-0.73) in both the development and internal validation sets, and this value was higher than that of the modified APCS score [0.68 (95% confidence interval, 0.65-0.71), P = 0.03]. We built a new simple scoring model for prediction of ACN in a Japanese population that could stratify the screened population into low-, moderate-, and high-risk groups.
Ruff, Anna Joëlle
2012-01-01
Directed Evolution became a powerful tool for proteins engineers to generate tailor-made biocatalyst. Directed protein evolution consist of the following three consecutive main steps, which are performed in iterative cycles; Step 1 the gene diversity generation, Step 2 the screening for improved variants and Step 3 the isolation of gene encoding for improved proteins. In this thesis, methodological advancements in the two key steps of the directed evolution, the diversity generation (SeSaM me...
Choma, Kim; McKeever, Amy E
2015-02-01
The literature reports great variation in the knowledge levels and application of the recent changes of cervical cancer screening guidelines into clinical practice. Evidence-based screening guidelines for the prevention and early detection of cervical cancer offers healthcare providers the opportunity to improve practice patterns among female adolescents by decreasing psychological distress as well as reducing healthcare costs and morbidities associated with over-screening. The purpose of this pilot intervention study was to determine the effects of a Web-based continuing education unit (CEU) program on advanced practice nurses' (APNs) knowledge of current cervical cancer screening evidence-based recommendations and their application in practice. This paper presents a process improvement project as an example of a way to disseminate updated evidence-based practice guidelines among busy healthcare providers. This Web-based CEU program was developed, piloted, and evaluated specifically for APNs. The program addressed their knowledge level of cervical cancer and its relationship with high-risk human papillomavirus. It also addressed the new cervical cancer screening guidelines and the application of those guidelines into clinical practice. Results of the study indicated that knowledge gaps exist among APNs about cervical cancer screening in adolescents. However, when provided with a CEU educational intervention, APNs' knowledge levels increased and their self-reported clinical practice behaviors changed in accordance with the new cervical cancer screening guidelines. Providing convenient and readily accessible up-to-date electronic content that provides CEU enhances the adoption of clinical practice guidelines, thereby decreasing the potential of the morbidities associated with over-screening for cervical cancer in adolescents and young women. © 2014 Sigma Theta Tau International.
Vibrational spectroscopy in diagnosis and screening
Severcan, F
2012-01-01
In recent years there has been a tremendous growth in the use of vibrational spectroscopic methods for diagnosis and screening. These applications range from diagnosis of disease states in humans, such as cancer, to rapid identification and screening of microorganisms. The growth in such types of studies has been possible thanks to advances in instrumentation and associated computational and mathematical tools for data processing and analysis. This volume of Advances in Biomedical Spectroscopy contains chapters from leading experts who discuss the latest advances in the application of Fourier
Directory of Open Access Journals (Sweden)
Che-Ming Liu
Full Text Available Cancer cells respond to stress by activating a variety of survival signaling pathways. A disintegrin and metalloproteinase (ADAM 9 is upregulated during cancer progression and hormone therapy, functioning in part through an increase in reactive oxygen species. Here, we present in vitro and in vivo evidence that therapeutic targeting of ADAM9 gene expression by lentivirus-delivered small hairpin RNA (shRNA significantly inhibited proliferation of human prostate cancer cell lines and blocked tumor growth in a murine model of prostate cancer bone metastasis. Cell cycle studies confirmed an increase in the G1-phase and decrease in the S-phase population of cancer cells under starvation stress conditions, which correlated with elevated intracellular superoxide levels. Microarray data showed significantly decreased levels of regenerating islet-derived family member 4 (REG4 expression in prostate cancer cells with knockdown of ADAM9 gene expression. This REG4 downregulation also resulted in induction of expression of p21(Cip1/WAF1, which negatively regulates cyclin D1 and blocks the G1/S transition. Our data reveal a novel molecular mechanism of ADAM9 in the regulation of prostate cancer cell proliferation, and suggests a combined modality of ADAM9 shRNA gene therapy and cytotoxic agents for hormone refractory and bone metastatic prostate cancer.
Breast Cancer Screening in Denmark
DEFF Research Database (Denmark)
Jørgensen, Karsten Juhl; Gøtzsche, Peter C; Kalager, Mette
2017-01-01
Background: Effective breast cancer screening should detect early-stage cancer and prevent advanced disease. Objective: To assess the association between screening and the size of detected tumors and to estimate overdiagnosis (detection of tumors that would not become clinically relevant). Design......) and nonadvanced (≤20 mm) breast cancer tumors in screened and nonscreened women were measured. Two approaches were used to estimate the amount of overdiagnosis: comparing the incidence of advanced and nonadvanced tumors among women aged 50 to 84 years in screening and nonscreening areas; and comparing...... rate ratio, 1.49 [95% CI, 1.43 to 1.54]). The first estimation approach found that 271 invasive breast cancer tumors and 179 ductal carcinoma in situ (DCIS) lesions were overdiagnosed in 2010 (overdiagnosis rate of 24.4% [including DCIS] and 14.7% [excluding DCIS]). The second approach, which accounted...
Puliti, Donella; Bucchi, Lauro; Mancini, Silvia; Paci, Eugenio; Baracco, Susanna; Campari, Cinzia; Canuti, Debora; Cirilli, Claudia; Collina, Natalina; Conti, Giovanni Maria; Di Felice, Enza; Falcini, Fabio; Michiara, Maria; Negri, Rossella; Ravaioli, Alessandra; Sassoli De' Bianchi, Priscilla; Serafini, Monica; Zorzi, Manuel; Caldarella, Adele; Cataliotti, Luigi; Zappa, Marco
2017-04-01
The objective of this study was to evaluate if mammography screening attendance is associated with a reduction in late-stage breast cancer incidence. The cohort included over 400,000 Italian women who were first invited to participate in regional screening programmes during the 1990s and were followed for breast cancer incidence for 13 years. We obtained individual data on their exposure to screening and correlated this with total and stage-specific breast cancer incidence. Socio-economic status and pre-screening incidence data were used to assess the presence of self-selection bias. Overall, screening attendance was associated with a 10% excess risk of in situ and invasive breast cancer (IRR = 1.10; 95% confidence interval (CI): 1.06-1.14), which dropped to 5% for invasive cancers only (IRR = 1.05; 95% CI: 1.01-1.09). There were significant reductions among attenders for specific cancer stages; we observed a 39% reduction for T2 or larger (IRR = 0.61; 95% CI: 0.57-0.66), 19% for node positives (IRR = 0.81; 95% CI: 0.76-0.86) and 28% for stage II and higher (IRR = 0.72; 95% CI: 0.68-0.76). Our data suggest that the presence of self-selection bias is limited and, overall, invited women experienced a 17% reduction of advanced cancers compared with pre-screening rates. Comparing attenders' and non-attenders' stage-specific breast cancer incidence, we have estimated that screening attendance is associated with a reduction of nearly 30% for stages II+. Copyright © 2017 Elsevier Ltd. All rights reserved.
Miller, Peter G.; Al-Shahrour, Fatima; Hartwell, Kimberly A.; Chu, Lisa P.; Järås, Marcus; Puram, Rishi V.; Puissant, Alexandre; Callahan, Kevin P.; Ashton, John; McConkey, Marie E.; Poveromo, Luke P.; Cowley, Glenn S.; Kharas, Michael G.; Labelle, Myriam; Shterental, Sebastian; Fujisaki, Joji; Silberstein, Lev; Alexe, Gabriela; Al-Hajj, Muhammad A.; Shelton, Christopher A.; Armstrong, Scott A.; Root, David E.; Scadden, David T.; Hynes, Richard O.; Mukherjee, Siddhartha; Stegmaier, Kimberly; Jordan, Craig T.; Ebert, Benjamin L.
2013-01-01
SUMMARY We used an in vivo short hairpin RNA (shRNA) screening approach to identify genes that are essential for MLL-AF9 acute myeloid leukemia (AML). We found that Integrin Beta 3 (Itgb3) is essential for murine leukemia cells in vivo, and for human leukemia cells in xenotransplantation studies. In leukemia cells, Itgb3 knockdown impaired homing, downregulated LSC transcriptional programs, and induced differentiation via the intracellular kinase, Syk. In contrast, loss of Itgb3 in normal HSPCs did not affect engraftment, reconstitution, or differentiation. Finally, we confirmed that Itgb3 is dispensable for normal hematopoiesis and required for leukemogenesis using an Itgb3 knockout mouse model. Our results establish the significance of the Itgb3 signaling pathway as a potential therapeutic target in AML. PMID:23770013
Advances in High Throughput Screening of Biomass Recalcitrance (Poster)
Energy Technology Data Exchange (ETDEWEB)
Turner, G. B.; Decker, S. R.; Tucker, M. P.; Law, C.; Doeppke, C.; Sykes, R. W.; Davis, M. F.; Ziebell, A.
2012-06-01
This was a poster displayed at the Symposium. Advances on previous high throughput screening of biomass recalcitrance methods have resulted in improved conversion and replicate precision. Changes in plate reactor metallurgy, improved preparation of control biomass, species-specific pretreatment conditions, and enzymatic hydrolysis parameters have reduced overall coefficients of variation to an average of 6% for sample replicates. These method changes have improved plate-to-plate variation of control biomass recalcitrance and improved confidence in sugar release differences between samples. With smaller errors plant researchers can have a higher degree of assurance more low recalcitrance candidates can be identified. Significant changes in plate reactor, control biomass preparation, pretreatment conditions and enzyme have significantly reduced sample and control replicate variability. Reactor plate metallurgy significantly impacts sugar release aluminum leaching into reaction during pretreatment degrades sugars and inhibits enzyme activity. Removal of starch and extractives significantly decreases control biomass variability. New enzyme formulations give more consistent and higher conversion levels, however required re-optimization for switchgrass. Pretreatment time and temperature (severity) should be adjusted to specific biomass types i.e. woody vs. herbaceous. Desalting of enzyme preps to remove low molecular weight stabilizers and improved conversion levels likely due to water activity impacts on enzyme structure and substrate interactions not attempted here due to need to continually desalt and validate precise enzyme concentration and activity.
Nanofabrication strategies for advanced electrode materials
Directory of Open Access Journals (Sweden)
Chen Kunfeng
2017-09-01
Full Text Available The development of advanced electrode materials for high-performance energy storage devices becomes more and more important for growing demand of portable electronics and electrical vehicles. To speed up this process, rapid screening of exceptional materials among various morphologies, structures and sizes of materials is urgently needed. Benefitting from the advance of nanotechnology, tremendous efforts have been devoted to the development of various nanofabrication strategies for advanced electrode materials. This review focuses on the analysis of novel nanofabrication strategies and progress in the field of fast screening advanced electrode materials. The basic design principles for chemical reaction, crystallization, electrochemical reaction to control the composition and nanostructure of final electrodes are reviewed. Novel fast nanofabrication strategies, such as burning, electrochemical exfoliation, and their basic principles are also summarized. More importantly, colloid system served as one up-front design can skip over the materials synthesis, accelerating the screening rate of highperformance electrode. This work encourages us to create innovative design ideas for rapid screening high-active electrode materials for applications in energy-related fields and beyond.
Advances in CRC Prevention: Screening and Surveillance.
Dekker, Evelien; Rex, Douglas K
2018-05-01
Colorectal cancer (CRC) is among the most commonly diagnosed cancers and causes of death from cancer across the world. CRC can, however, be detected in asymptomatic patients at a curable stage, and several studies have shown lower mortality among patients who undergo screening compared with those who do not. Using colonoscopy in CRC screening also results in the detection of precancerous polyps that can be directly removed during the procedure, thereby reducing the incidence of cancer. In the past decade, convincing evidence has appeared that the effectiveness of colonoscopy as CRC prevention tool is associated with the quality of the procedure. This review aims to provide an up-to-date overview of recent efforts to improve colonoscopy effectiveness by enhancing detection and improving the completeness and safety of resection of colorectal lesions. Copyright © 2018 AGA Institute. Published by Elsevier Inc. All rights reserved.
Ha, Jung-Eun; Jung, Se-Hwan; Jin, Bo-Hyoung; Lee, Byoung-Jin; Bae, Kwang-Hak
2013-09-01
The National Oral Health Screening Program (NOHSP) is a general population-based program in Korea. The objective of this study was to assess the association between participation in the NOHSP and dental visit for periapical abscess (PA) and advanced periodontal disease (APD) among Korean adults. Data were obtained for subjects from the National Health Insurance database. The authors conducted a retrospective cohort study of 9358 randomly selected subjects who were between 40 and 64 years old in 2002. The outcomes of dental visit for PA or APD from the years 2003 to 2007 were compared between the screening and nonscreening groups. The nonscreening group had 19% higher risk of PA and 15% higher risk of APD. This study suggests that the NOHSP may decrease the risk of dental visit because of PA and APD by preventing the progress of lesion to the advanced stage among Korean adults.
Advances in CRC prevention: screening and surveillance
Dekker, Evelien; Rex, Douglas K.
2018-01-01
Colorectal cancer (CRC) is amongst the most commonly diagnosed cancers and causes of death from cancer across the world. CRC can, however, be detected in asymptomatic patients at a curable stage, and several studies have shown lower mortality among patients who undergo screening compared to those
Mammography screening: A major issue in medicine.
Autier, Philippe; Boniol, Mathieu
2018-02-01
Breast cancer mortality is declining in most high-income countries. The role of mammography screening in these declines is much debated. Screening impacts cancer mortality through decreasing the incidence of number of advanced cancers with poor prognosis, while therapies and patient management impact cancer mortality through decreasing the fatality of cancers. The effectiveness of cancer screening is the ability of a screening method to curb the incidence of advanced cancers in populations. Methods for evaluating cancer screening effectiveness are based on the monitoring of age-adjusted incidence rates of advanced cancers that should decrease after the introduction of screening. Likewise, cancer-specific mortality rates should decline more rapidly in areas with screening than in areas without or with lower levels of screening but where patient management is similar. These two criteria have provided evidence that screening for colorectal and cervical cancer contributes to decreasing the mortality associated with these two cancers. In contrast, screening for neuroblastoma in children was discontinued in the early 2000s because these two criteria were not met. In addition, overdiagnosis - i.e. the detection of non-progressing occult neuroblastoma that would not have been life-threatening during the subject's lifetime - is a major undesirable consequence of screening. Accumulating epidemiological data show that in populations where mammography screening has been widespread for a long time, there has been no or only a modest decline in the incidence of advanced cancers, including that of de novo metastatic (stage IV) cancers at diagnosis. Moreover, breast cancer mortality reductions are similar in areas with early introduction and high penetration of screening and in areas with late introduction and low penetration of screening. Overdiagnosis is commonplace, representing 20% or more of all breast cancers among women invited to screening and 30-50% of screen
Seuss, Hannes; Dankerl, Peter; Cavallaro, Alexander; Uder, Michael; Hammon, Matthias
2016-05-20
To evaluate screening and diagnostic accuracy for the detection of osteoblastic rib lesions using an advanced post-processing package enabling in-plane rib reading in CT-images. We retrospectively assessed the CT-data of 60 consecutive prostate cancer patients by applying dedicated software enabling in-plane rib reading. Reading the conventional multiplanar reconstructions was considered to be the reference standard. To simulate clinical practice, the reader was given 10 s to screen for sclerotic rib lesions in each patient applying both approaches. Afterwards, every rib was evaluated individually with both approaches without a time limit. Sensitivities, specificities, positive/negative predictive values and the time needed for detection were calculated depending on the lesion's size (largest diameter 10 mm). In 53 of 60 patients, all ribs were properly displayed in plane, in five patients ribs were partially displayed correctly, and in two patients none of the ribs were displayed correctly. During the 10-s screening approach all patients with sclerotic rib lesions were correctly identified reading the in-plane images (including the patients without a correct rib segmentation), whereas 14 of 23 patients were correctly identified reading conventional multiplanar images. Overall screening sensitivity, specificity, and positive/negative predictive values were 100/27.0/46.0/100 %, respectively, for in-plane reading and 60.9/100/100/80.4 %, respectively, for multiplanar reading. Overall diagnostic (no time limit) sensitivity, specificity, and positive/negative predictive values of in-plane reading were 97.8/92.8/74.6/99.5 %, respectively. False positive results predominantly occurred for lesions <5 mm in size. In-plane reading of the ribs allows reliable detection of osteoblastic lesions for screening purposes. The limited specificity results from false positives predominantly occurring for small lesions.
Screening for heart transplantation and left ventricular assist system
DEFF Research Database (Denmark)
Lund, Lars H; Trochu, Jean-Noel; Meyns, Bart
2018-01-01
BACKGROUND: Heart transplantation (HTx) and implantable left ventricular assist systems (LVAS) improve outcomes in advanced heart failure but may be underutilized. We hypothesized that screening can identify appropriate candidates. METHODS AND RESULTS: The ScrEEning for advanced Heart Failure...... treatment (SEE-HF) study was a multicentre prospective study screening patients with existing cardiac resynchronization therapy (CRT) and/or implantable cardioverter-defibrillator (ICD) for ejection fraction ≤40% and New York Heart Association (NYHA) class III-IV, and subsequently for guideline-based HTx...
Erben, Vanessa; Carr, Prudence R; Holleczek, Bernd; Stegmaier, Christa; Hoffmeister, Michael; Brenner, Hermann
2018-06-01
Specific components of the diet such as red and processed meat have been associated with the risk of developing colorectal cancer. However, evidence on the association of dietary patterns with colorectal neoplasms is sparse. The aim of this study was to analyze the association of dietary patterns with prevalence of advanced colorectal neoplasms among older adults in Germany. A cross-sectional study was conducted among participants of screening colonoscopy in Saarland, Germany, who were enrolled in the KolosSal study (Effektivität der Früherkennungs-Koloskopie: eine Saarland-weite Studie) from 2005 to 2013. Information on diet and lifestyle factors was obtained through questionnaires and colonoscopy results were extracted from physicians' reports. Associations of a priori defined dietary patterns (vegetarian or adapted versions of the Healthy Eating Index [HEI] and the Dietary Approaches to Stop Hypertension [DASH] index) with the risk of advanced colorectal neoplasms were assessed by multiple logistic regression analyses with comprehensive adjustment for potential confounders. A total of 14,309 participants were included (1561 with advanced colorectal neoplasms). Healthier eating behavior was associated with lower prevalence of advanced colorectal neoplasms in a dose-response manner. Adjusted odds ratios (95% confidence intervals) comparing the highest with the lowest categories of adapted HEI and DASH were 0.61 (0.50, 0.76) and 0.70 (0.55, 0.89), respectively. No significant associations were observed for a vegetarian eating pattern (adjusted OR 0.80 (0.55, 1.17)). Healthy dietary patterns, as described by a high HEI or DASH score, but not a vegetarian diet alone, are associated with reduced risk of advanced colorectal neoplasms. Copyright © 2018 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Shin-ichiro Kojima
2014-02-01
Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.
Directory of Open Access Journals (Sweden)
Shin-ichiro Kojima
2014-05-01
Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.
Cost analysis of colorectal cancer screening with CT colonography in Italy.
Mantellini, Paola; Lippi, Giuseppe; Sali, Lapo; Grazzini, Grazia; Delsanto, Silvia; Mallardi, Beatrice; Falchini, Massimo; Castiglione, Guido; Carozzi, Francesca Maria; Mascalchi, Mario; Milani, Stefano; Ventura, Leonardo; Zappa, Marco
2018-06-01
Unit costs of screening CT colonography (CTC) can be useful for cost-effectiveness analyses and for health care decision-making. We evaluated the unit costs of CTC as a primary screening test for colorectal cancer in the setting of a randomized trial in Italy. Data were collected within the randomized SAVE trial. Subjects were invited to screening CTC by mail and requested to have a pre-examination consultation. CTCs were performed with 64- and 128-slice CT scanners after reduced or full bowel preparation. Activity-based costing was used to determine unit costs per-process, per-participant to screening CTC, and per-subject with advanced neoplasia. Among 5242 subjects invited to undergo screening CTC, 1312 had pre-examination consultation and 1286 ultimately underwent CTC. Among 129 subjects with a positive CTC, 126 underwent assessment colonoscopy and 67 were ultimately diagnosed with advanced neoplasia (i.e., cancer or advanced adenoma). Cost per-participant of the entire screening CTC pathway was €196.80. Average cost per-participant for the screening invitation process was €17.04 and €9.45 for the pre-examination consultation process. Average cost per-participant of the CTC execution and reading process was €146.08 and of the diagnostic assessment colonoscopy process was €24.23. Average cost per-subject with advanced neoplasia was €3777.30. Cost of screening CTC was €196.80 per-participant. Our data suggest that the more relevant cost of screening CTC, amenable of intervention, is related to CTC execution and reading process.
Energy Technology Data Exchange (ETDEWEB)
Ouyang, Lizhi [Tennessee State Univ. Nashville, TN (United States)
2016-11-29
Advanced Ultra Supercritical Boiler (AUSC) requires materials that can operate in corrosive environment at temperature and pressure as high as 760°C (or 1400°F) and 5000psi, respectively, while at the same time maintain good ductility at low temperature. We develop automated simulation software tools to enable fast large scale screening studies of candidate designs. While direct evaluation of creep rupture strength and ductility are currently not feasible, properties such as energy, elastic constants, surface energy, interface energy, and stack fault energy can be used to assess their relative ductility and creeping strength. We implemented software to automate the complex calculations to minimize human inputs in the tedious screening studies which involve model structures generation, settings for first principles calculations, results analysis and reporting. The software developed in the project and library of computed mechanical properties of phases found in ferritic steels, many are complex solid solutions estimated for the first time, will certainly help the development of low cost ferritic steel for AUSC.
Breast Cancer Screening in Denmark: A Cohort Study of Tumor Size and Overdiagnosis.
Jørgensen, Karsten Juhl; Gøtzsche, Peter C; Kalager, Mette; Zahl, Per-Henrik
2017-03-07
Effective breast cancer screening should detect early-stage cancer and prevent advanced disease. To assess the association between screening and the size of detected tumors and to estimate overdiagnosis (detection of tumors that would not become clinically relevant). Cohort study. Denmark from 1980 to 2010. Women aged 35 to 84 years. Screening programs offering biennial mammography for women aged 50 to 69 years beginning in different regions at different times. Trends in the incidence of advanced (>20 mm) and nonadvanced (≤20 mm) breast cancer tumors in screened and nonscreened women were measured. Two approaches were used to estimate the amount of overdiagnosis: comparing the incidence of advanced and nonadvanced tumors among women aged 50 to 84 years in screening and nonscreening areas; and comparing the incidence for nonadvanced tumors among women aged 35 to 49, 50 to 69, and 70 to 84 years in screening and nonscreening areas. Screening was not associated with lower incidence of advanced tumors. The incidence of nonadvanced tumors increased in the screening versus prescreening periods (incidence rate ratio, 1.49 [95% CI, 1.43 to 1.54]). The first estimation approach found that 271 invasive breast cancer tumors and 179 ductal carcinoma in situ (DCIS) lesions were overdiagnosed in 2010 (overdiagnosis rate of 24.4% [including DCIS] and 14.7% [excluding DCIS]). The second approach, which accounted for regional differences in women younger than the screening age, found that 711 invasive tumors and 180 cases of DCIS were overdiagnosed in 2010 (overdiagnosis rate of 48.3% [including DCIS] and 38.6% [excluding DCIS]). Regional differences complicate interpretation. Breast cancer screening was not associated with a reduction in the incidence of advanced cancer. It is likely that 1 in every 3 invasive tumors and cases of DCIS diagnosed in women offered screening represent overdiagnosis (incidence increase of 48.3%). None.
Advances in preimplantation genetic diagnosis/screening.
Yan, LiYing; Wei, Yuan; Huang, Jin; Zhu, XiaoHui; Shi, XiaoDan; Xia, Xi; Yan, Jie; Lu, CuiLing; Lian, Ying; Li, Rong; Liu, Ping; Qiao, Jie
2014-07-01
Preimplantation genetic diagnosis (PGD) gives couples who have a high risk of transmitting genetic disorders to their baby the chance to have a healthy offspring through embryo genetic analysis and selection. Preimplantation genetic screening (PGS) is an effective method to select euploid embryos that may prevent repeated implantation failure or miscarriage. However, how and to whom PGS should be provided is a controversial topic. The first successful case of PGD of a human being was reported in 1990, and there have been tremendous improvements in this technology since then. Both embryo biopsy and genetic technologies have been improved dramatically, which increase the accuracy and expand the indications of PGD/PGS.
Directory of Open Access Journals (Sweden)
Nabendu Pore
2015-06-01
Full Text Available Reprogramming of energy metabolism is one of the emerging hallmarks of cancer. Up-regulation of energy metabolism pathways fuels cell growth and division, a key characteristic of neoplastic disease, and can lead to dependency on specific metabolic pathways. Thus, targeting energy metabolism pathways might offer the opportunity for novel therapeutics. Here, we describe the application of a novel in vivo screening approach for the identification of genes involved in cancer metabolism using a patient-derived pancreatic xenograft model. Lentiviruses expressing short hairpin RNAs (shRNAs targeting 12 different cell surface protein transporters were separately transduced into the primary pancreatic tumor cells. Transduced cells were pooled and implanted into mice. Tumors were harvested at different times, and the frequency of each shRNA was determined as a measure of which ones prevented tumor growth. Several targets including carbonic anhydrase IX (CAIX, monocarboxylate transporter 4, and anionic amino acid transporter light chain, xc- system (xCT were identified in these studies and shown to be required for tumor initiation and growth. Interestingly, CAIX was overexpressed in the tumor initiating cell population. CAIX expression alone correlated with a highly tumorigenic subpopulation of cells. Furthermore, CAIX expression was essential for tumor initiation because shRNA knockdown eliminated the ability of cells to grow in vivo. To the best of our knowledge, this is the first parallel in vivo assessment of multiple novel oncology target genes using a patient-derived pancreatic tumor model.
Yang, Jian-Hua; Zhang, Xiao-Chen; Huang, Zhan-Peng; Zhou, Hui; Huang, Mian-Bo; Zhang, Shu; Chen, Yue-Qin; Qu, Liang-Hu
2006-01-01
Small nucleolar RNAs (snoRNAs) represent an abundant group of non-coding RNAs in eukaryotes. They can be divided into guide and orphan snoRNAs according to the presence or absence of antisense sequence to rRNAs or snRNAs. Current snoRNA-searching programs, which are essentially based on sequence complementarity to rRNAs or snRNAs, exist only for the screening of guide snoRNAs. In this study, we have developed an advanced computational package, snoSeeker, which includes CDseeker and ACAseeker ...
Dräger, Désirée Louise; Protzel, Chris; Hakenberg, Oliver W
2017-10-01
We examined the effects of treatment on the psychological well-being of patients with localized or advanced penile cancer using screening questionnaires to determine the consecutive need for psychosocial care. Penile cancer is a rare, but highly aggressive, malignancy. The psychological stress of patients with penile cancer arises from the cancer diagnosis per se and the corresponding consequences of treatment. In addition, cancer-specific distress results (eg, fear of metastasis, progression, relapse, death). Studies of the psychosocial stress of penile cancer patients are rare. We undertook a prospective analysis of the data from patients with penile cancer who had undergone surgery or chemotherapy from August 2014 to October 2016 at our department. Patients were evaluated using standardized questionnaires for stress screening and the identification for the need for psychosocial care (National Comprehensive Cancer Network Distress Thermometer and Hornheider screening instrument) and by assessing the actual use of psychosocial support. The average stress level was 4.5. Of all the patients, 42.5% showed increased care needs at the time of the survey. Younger patients, patients undergoing chemotherapy, and patients with recurrence were significantly more integrated with the psychosocial care systems. Finally, 67% of all patients received inpatient psychosocial care. Owing to the potentially mutilating surgery, patients with penile cancer experience increased psychological stress and, consequently, have an increased need for psychosocial care. Therefore, the emotional stress of these patients should be recognized and support based on interdisciplinary collaboration offered. Copyright © 2017 Elsevier Inc. All rights reserved.
Design and screening of nanoprecipitates-strengthened advanced ferritic alloys
Energy Technology Data Exchange (ETDEWEB)
Tan, Lizhen [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Yang, Ying [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Chen, Tianyi [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Sridharan, K. [Univ. of Wisconsin, Madison, WI (United States); He, Li [Univ. of Wisconsin, Madison, WI (United States)
2016-12-30
Advanced nuclear reactors as well as the life extension of light water reactors require advanced alloys capable of satisfactory operation up to neutron damage levels approaching 200 displacements per atom (dpa). Extensive studies, including fundamental theories, have demonstrated the superior resistance to radiation-induced swelling in ferritic steels, primarily inherited from their body-centered cubic (bcc) structure. This study aims at developing nanoprecipitates strengthened advanced ferritic alloys for advanced nuclear reactor applications. To be more specific, this study aims at enhancing the amorphization ability of some precipitates, such as Laves phase and other types of intermetallic phases, through smart alloying strategy, and thereby promote the crystalline®amorphous transformation of these precipitates under irradiation.
[Knockdown of STAT3 inhibits proliferation and migration of HepG2 hepatoma cells induced by IFN1].
Li, Xiaofang; Wang, Yuqi; Yan, Ben; Fang, Peipei; Ma, Chao; Xu, Ning; Fu, Xiaoyan; Liang, Shujuan
2018-02-01
Objective To prepare lentiviruses expressing shRNA sequences targeting human signal transducer and activator of transcription 3 (STAT3) and detect the effect of STAT3 knockdown on type I interferon (IFN1)-induced proliferation and migration in HepG2 cells. Methods Four STAT3-targeting shRNA sequences (shRNA1-shRNA4) and one control sequence (Ctrl shRNA) were selected and cloned respectively into pLKO.1-sp6-pgk-GFP to construct shRNA-expressing vectors. Along with backbone psPAX2 and pMD2.G vectors, they were separately transfected into HEK293T cells to prepare lentiviruses. HepG2 cells were infected with the lentiviruses. Cytoplastic STAT3 level was detected by Western blotting to screen effective shRNA sequence(s) targeting STAT3. Proliferation and migration of HepG2 cells were analyzed by CCK-8 assay and Transwell TM migration and scratching assay, respectively. To detect the effect of IFN1 on cell proliferation and migration of HepG2 cells, the cells were treated with 2000 U/mL IFNα2b for indicated time and the activation of IFN-triggered STAT1 signal transduction was assayed by Western blotting. Results Two most effective STAT3-targeting shRNA sequences shRNA1 and shRNA2 were selected, and the expression of both STAT3 shRNA significantly decreased proliferation and migration of HepG2 cells. When treated with IFNα2b, 2000 U/mL of IFN1 showed more competent in attenuating growth and migration of HepG2 cells. Our data further proved that knockdown of STAT3 increased the phosphorylation of STAT1, and IFNα2b further enhanced the activation of STAT1 signaling in HepG2 cells. Conclusion Knockdown of STAT3 inhibits cell migration and growth, and rescues IFN response through up-regulating STAT1 signal transduction in HepG2 hepatoma cells.
Rare earth phosphors and phosphor screens
International Nuclear Information System (INIS)
Buchanan, R.A.; Maple, T.G.; Sklensky, A.F.
1981-01-01
Advances in the use of stabilized rare earth phosphors and of conversion screens using these materials are examined. In particular the new phosphors discussed in this invention consist of oxybromides of yttrium, lanthanum and gadolinium with a luminescent activator ion stabilized by an oxychloride or oxyfluoride surface layer and the conversion screens include trivalent cerium as the activator ion. (U.K.)
Is the tide turning against breast screening?
DEFF Research Database (Denmark)
Jørgensen, Karsten Juhl
2012-01-01
ABSTRACT: Herein I argue that mammographic screening has not delivered on its fundamental premise: to reduce the incidence of advanced breast cancer. Indeed, achieving this goal is required if screening is to reduce breast cancer mortality or mastectomy use. Rather, screening has caused substantial...... increases in the incidence of in situ and early invasive cancers. Moreover, evidence indicates that these screen-detected cancers are unlikely to be cases that were 'caught early', but instead represent women who would not have been diagnosed in the absence of screening and who, as a result, have received...... harmful, unnecessary treatment. If true, these observations raise the specter that screening creates breast cancer patients and that this practice carries little or no benefit....
Stem cells: a model for screening, discovery and development of drugs
Directory of Open Access Journals (Sweden)
Kitambi SS
2011-09-01
Full Text Available Satish Srinivas Kitambi1, Gayathri Chandrasekar21Department of Medical Biochemistry and Biophysics; 2Department of Biosciences, Karolinska Institutet, Stockholm, SwedenAbstract: The identification of normal and cancerous stem cells and the recent advances made in isolation and culture of stem cells have rapidly gained attention in the field of drug discovery and regenerative medicine. The prospect of performing screens aimed at proliferation, directed differentiation, and toxicity and efficacy studies using stem cells offers a reliable platform for the drug discovery process. Advances made in the generation of induced pluripotent stem cells from normal or diseased tissue serves as a platform to perform drug screens aimed at developing cell-based therapies against conditions like Parkinson's disease and diabetes. This review discusses the application of stem cells and cancer stem cells in drug screening and their role in complementing, reducing, and replacing animal testing. In addition to this, target identification and major advances in the field of personalized medicine using induced pluripotent cells are also discussed.Keywords: therapeutics, stem cells, cancer stem cells, screening models, drug development, high throughput screening
Guo, Yijing; Wang, Pin; Sun, Haixia; Cai, Rongrong; Xia, Wenqing; Wang, Shaohua
2013-12-23
This study aims to investigate the roles of the Notch-Hes1 pathway in the advanced glycation end product (AGE)-mediated differentiation of neural stem cells (NSCs). We prepared pLentiLox3.7 lentiviral vectors that express short hairpin RNA (shRNA) against Notch1 and transfected it into NSCs. Cell differentiation was analyzed under confocal laser-scanning microscopy. The percentage of neurons and astrocytes was quantified by normalizing the total number of TUJ1+ (Neuron-specific class III β-tubulin) and GFAP+ (Glial fibrillary acidic protein) cells to the total number of Hoechst 33342-labeled cell nuclei. The protein and gene expression of Notch-Hes1 pathway components was examined via western blot analysis and real-time PCR. After 1 week of incubation, we found that AGE-bovine serum albumin (BSA) (400 μg/mL) induced the astrocytic differentiation of cultured neurospheres and inhibited neuronal formation. The expression of Notch-Hes1 pathway components was upregulated in the cells in the AGE-BSA culture medium. Immunoblot analysis indicated that shRNA silencing of Notch1 expression in NSCs significantly increases neurogenesis and suppresses astrocytic differentiation in NSCs incubated with AGE-BSA. AGEs promote the astrocytic differentiation of cultured neurospheres by inhibiting neurogenesis through the Notch-Hes1 pathway, providing a potential therapeutic target for hyperglycemia-related cognitive deficits.
High content screening in microfluidic devices
Cheong, Raymond; Paliwal, Saurabh; Levchenko, Andre
2011-01-01
Importance of the field Miniaturization is key to advancing the state-of-the-art in high content screening (HCS), in order to enable dramatic cost savings through reduced usage of expensive biochemical reagents and to enable large-scale screening on primary cells. Microfluidic technology offers the potential to enable HCS to be performed with an unprecedented degree of miniaturization. Areas covered in this review This perspective highlights a real-world example from the authors’ work of HCS assays implemented in a highly miniaturized microfluidic format. Advantages of this technology are discussed, including cost savings, high throughput screening on primary cells, improved accuracy, the ability to study complex time-varying stimuli, and ease of automation, integration, and scaling. What the reader will gain The reader will understand the capabilities of a new microfluidics-based platform for HCS, and the advantages it provides over conventional plate-based HCS. Take home message Microfluidics technology will drive significant advancements and broader usage and applicability of HCS in drug discovery. PMID:21852997
Ruco, Arlinda; Stock, David; Hilsden, Robert J; McGregor, S Elizabeth; Paszat, Lawrence F; Saskin, Refik; Rabeneck, Linda
2015-11-19
A clinical risk index employing age, sex, family history of colorectal cancer (CRC), smoking history and body mass index (BMI) may be useful for prioritizing screening with colonoscopy. The aim of this study was to conduct an external evaluation of a previously published risk index for advanced neoplasia (AN) in a large, well-characterized cohort. Five thousand one hundred thirty-seven asymptomatic persons aged 50 to 74 (54.9 % women) with a mean age (SD) of 58.3 (6.2) years were recruited for the study from a teaching hospital and colorectal cancer screening centre between 2003 and 2011. All participants underwent a complete screening colonoscopy and removal of all polyps. AN was defined as cancer or a tubular adenoma, traditional serrated adenoma (TSA), or sessile serrated adenoma (SSA) with villous characteristics (≥25% villous component), and/or high-grade dysplasia and/or diameter ≥10 mm. Risk scores for each participant were summed to derive an overall score (0-8). The c-statistic was used to measure discriminating ability of the risk index. The prevalence of AN in the study cohort was 6.8 %. The likelihood of detecting AN increased from 3.6 to 13.1 % for those with a risk score of 1 to 6 respectively. The c-statistic for the multivariable logistic model in our cohort was 0.64 (95 % CI = 0.61-067) indicating modest overlap between risk scores. The risk index for AN using age, sex, family history, smoking history and BMI was found to be of limited discriminating ability upon external validation. The index requires further refinement to better predict AN in average risk persons of screening age.
Antunes, Bárbara; Murtagh, Fliss; Bausewein, Claudia; Harding, Richard; Higginson, Irene J
2015-02-01
Depression is common among patients with advanced disease but often difficult to detect. To assess the Palliative care Outcome Scale (POS) (10 items) against the Geriatric Depression Scale (GDS)-10 total score and the Hospital Anxiety and Depression Scale (HADS)-Depression subscale total score and determine if the POS has appropriate items to screen for depression among people with advanced disease. This was a secondary analysis performed on five studies. Four psychometric properties were assessed: data quality, scaling assumptions, acceptability, and internal consistency (reliability). Receiver operating characteristic (ROC) curves were used to determine the area under the curve. Sensitivity, specificity, positive and negative predictive values, false positive and negative rates, and positive and negative likelihood ratios were computed. The overall sample had 416 patients from Germany and England: 144 had cancer and 267 had nonmalignant conditions. Prevalence of depression across the sample was 17.5%. Floor and ceiling effects were rare. Cronbach's alpha coefficients for POS items 7 and 8 summed, GDS-10 and HADS-Depression items varied: 0.61 (heart failure) and 0.80 (cancer). Two items combined (Item 7-feeling depressed and Item 8-feeling good about yourself) consistently presented the highest area under the ROC curve, ranging from 0.76 (95% CI 0.60, 0.93) (Germany, lung cancer) to 0.97 (95% CI 0.91, 1.0) (heart failure), highest negative predictive value, and lowest false negative rate. For the overall sample, the cutoff 2/3 presented a negative predictive value of 89.4% (95% CI 84.7, 92.8) and false negative rate of 10.6 (95% CI 7.2, 15.3). POS items 7 and 8 summed are potentially useful to screen for depression in advanced disease populations. Copyright © 2015 American Academy of Hospice and Palliative Medicine. Published by Elsevier Inc. All rights reserved.
Nelson, Emily V; Pacheco, Jennifer R; Hume, Adam J; Cressey, Tessa N; Deflubé, Laure R; Ruedas, John B; Connor, John H; Ebihara, Hideki; Mühlberger, Elke
2017-10-01
Ebola virus (EBOV) causes a severe disease in humans with the potential for significant international public health consequences. Currently, treatments are limited to experimental vaccines and therapeutics. Therefore, research into prophylaxis and antiviral strategies to combat EBOV infections is of utmost importance. The requirement for high containment laboratories to study EBOV infection is a limiting factor for conducting EBOV research. To overcome this issue, minigenome systems have been used as valuable tools to study EBOV replication and transcription mechanisms and to screen for antiviral compounds at biosafety level 2. The most commonly used EBOV minigenome system relies on the ectopic expression of the T7 RNA polymerase (T7), which can be limiting for certain cell types. We have established an improved EBOV minigenome system that utilizes endogenous RNA polymerase II (pol II) as a driver for the synthesis of minigenome RNA. We show here that this system is as efficient as the T7-based minigenome system, but works in a wider range of cell types, including biologically relevant cell types such as bat cells. Importantly, we were also able to adapt this system to a reliable and cost-effective 96-well format antiviral screening assay with a Z-factor of 0.74, indicative of a robust assay. Using this format, we identified JG40, an inhibitor of Hsp70, as an inhibitor of EBOV replication, highlighting the potential for this system as a tool for antiviral drug screening. In summary, this updated EBOV minigenome system provides a convenient and effective means of advancing the field of EBOV research. Copyright © 2017 Elsevier B.V. All rights reserved.
High-Throughput Silencing Using the CRISPR-Cas9 System: A Review of the Benefits and Challenges.
Wade, Mark
2015-09-01
The clustered regularly interspaced short palindromic repeats (CRISPR)/Cas system has been seized upon with a fervor enjoyed previously by small interfering RNA (siRNA) and short hairpin RNA (shRNA) technologies and has enormous potential for high-throughput functional genomics studies. The decision to use this approach must be balanced with respect to adoption of existing platforms versus awaiting the development of more "mature" next-generation systems. Here, experience from siRNA and shRNA screening plays an important role, as issues such as targeting efficiency, pooling strategies, and off-target effects with those technologies are already framing debates in the CRISPR field. CRISPR/Cas can be exploited not only to knockout genes but also to up- or down-regulate gene transcription-in some cases in a multiplex fashion. This provides a powerful tool for studying the interaction among multiple signaling cascades in the same genetic background. Furthermore, the documented success of CRISPR/Cas-mediated gene correction (or the corollary, introduction of disease-specific mutations) provides proof of concept for the rapid generation of isogenic cell lines for high-throughput screening. In this review, the advantages and limitations of CRISPR/Cas are discussed and current and future applications are highlighted. It is envisaged that complementarities between CRISPR, siRNA, and shRNA will ensure that all three technologies remain critical to the success of future functional genomics projects. © 2015 Society for Laboratory Automation and Screening.
Stem cells: a model for screening, discovery and development of drugs.
Kitambi, Satish Srinivas; Chandrasekar, Gayathri
2011-01-01
The identification of normal and cancerous stem cells and the recent advances made in isolation and culture of stem cells have rapidly gained attention in the field of drug discovery and regenerative medicine. The prospect of performing screens aimed at proliferation, directed differentiation, and toxicity and efficacy studies using stem cells offers a reliable platform for the drug discovery process. Advances made in the generation of induced pluripotent stem cells from normal or diseased tissue serves as a platform to perform drug screens aimed at developing cell-based therapies against conditions like Parkinson's disease and diabetes. This review discusses the application of stem cells and cancer stem cells in drug screening and their role in complementing, reducing, and replacing animal testing. In addition to this, target identification and major advances in the field of personalized medicine using induced pluripotent cells are also discussed.
Genetic and epigenetic markers in colorectal cancer screening: recent advances.
Singh, Manish Pratap; Rai, Sandhya; Suyal, Shradha; Singh, Sunil Kumar; Singh, Nand Kumar; Agarwal, Akash; Srivastava, Sameer
2017-07-01
Colorectal cancer (CRC) is a heterogenous disease which develops from benign intraepithelial lesions known as adenomas to malignant carcinomas. Acquired alterations in Wnt signaling, TGFβ, MAPK pathway genes and clonal propagation of altered cells are responsible for this transformation. Detection of adenomas or early stage cancer in asymptomatic patients and better prognostic and predictive markers is important for improving the clinical management of CRC. Area covered: In this review, the authors have evaluated the potential of genetic and epigenetic alterations as markers for early detection, prognosis and therapeutic predictive potential in the context of CRC. We have discussed molecular heterogeneity present in CRC and its correlation to prognosis and response to therapy. Expert commentary: Molecular marker based CRC screening methods still fail to gain trust of clinicians. Invasive screening methods, molecular heterogeneity, chemoresistance and low quality test samples are some key challenges which need to be addressed in the present context. New sequencing technologies and integrated omics data analysis of individual or population cohort results in GWAS. MPE studies following a GWAS could be future line of research to establish accurate correlations between CRC and its risk factors. This strategy would identify most reliable biomarkers for CRC screening and management.
An updated Asia Pacific Consensus Recommendations on colorectal cancer screening.
Sung, J J Y; Ng, S C; Chan, F K L; Chiu, H M; Kim, H S; Matsuda, T; Ng, S S M; Lau, J Y W; Zheng, S; Adler, S; Reddy, N; Yeoh, K G; Tsoi, K K F; Ching, J Y L; Kuipers, E J; Rabeneck, L; Young, G P; Steele, R J; Lieberman, D; Goh, K L
2015-01-01
Since the publication of the first Asia Pacific Consensus on Colorectal Cancer (CRC) in 2008, there are substantial advancements in the science and experience of implementing CRC screening. The Asia Pacific Working Group aimed to provide an updated set of consensus recommendations. Members from 14 Asian regions gathered to seek consensus using other national and international guidelines, and recent relevant literature published from 2008 to 2013. A modified Delphi process was adopted to develop the statements. Age range for CRC screening is defined as 50-75 years. Advancing age, male, family history of CRC, smoking and obesity are confirmed risk factors for CRC and advanced neoplasia. A risk-stratified scoring system is recommended for selecting high-risk patients for colonoscopy. Quantitative faecal immunochemical test (FIT) instead of guaiac-based faecal occult blood test (gFOBT) is preferred for average-risk subjects. Ancillary methods in colonoscopy, with the exception of chromoendoscopy, have not proven to be superior to high-definition white light endoscopy in identifying adenoma. Quality of colonoscopy should be upheld and quality assurance programme should be in place to audit every aspects of CRC screening. Serrated adenoma is recognised as a risk for interval cancer. There is no consensus on the recruitment of trained endoscopy nurses for CRC screening. Based on recent data on CRC screening, an updated list of recommendations on CRC screening is prepared. These consensus statements will further enhance the implementation of CRC screening in the Asia Pacific region. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
Providing information about prenatal screening for Down syndrome
DEFF Research Database (Denmark)
Skjøth, Mette Maria; Draborg, Eva; Pedersen, Claus Duedal
2015-01-01
BACKGROUND: In recent decades there have been advances in the options for prenatal screening. Screening programmes for Down syndrome are well established in many countries. It is important that pregnant women are well informed about the benefits and risks of screening. A variety of interventions...... screening for Down syndrome. DESIGN: SYSTEMATIC REVIEW: METHODS: A systematic search was performed using the PUBMED and EMBASE databases. The search terms included MeSH terms and free text and were combined by Boolean terms (AND, OR) with no restriction on language or time. MAIN OUTCOME MEASURES: Main...... information about prenatal screening for Down syndrome can improve their ability to make an informed choice. This article is protected by copyright. All rights reserved....
Prostate cancer screening in Ghana - a clinical benefit? | Arthur ...
African Journals Online (AJOL)
In Ghana and most African countries, prostate cancer is the most common cancer in males after hepatocellular carcinoma. Whereas in the advanced countries, screening for prostate specific antigen (PSA) has led to early detection and management of the disease, screening has been very low in Ghana, thus leading to low ...
Patel, Utsav A; Patel, Amrutlal K; Joshi, Chaitanya G
2015-01-01
Myostatin (MSTN) is a secreted growth factor that negatively regulates skeletal muscle mass, and therefore, strategies to block myostatin-signaling pathway have been extensively pursued to increase the muscle mass in livestock. Here, we report a lentiviral vector-based delivery of shRNA to disrupt myostatin expression into goat fetal fibroblasts (GFFs) that were commonly used as karyoplast donors in somatic-cell nuclear transfer (SCNT) studies. Sh-RNA positive cells were screened by puromycin selection. Using real-time polymerase chain reaction (PCR), we demonstrated efficient knockdown of endogenous myostatin mRNA with 64% down-regulation in sh2 shRNA-treated GFF cells compared to GFF cells treated by control lentivirus without shRNA. Moreover, we have also demonstrated both the induction of interferon response and the expression of genes regulating myogenesis in GFF cells. The results indicate that myostatin-targeting siRNA produced endogenously could efficiently down-regulate myostatin expression. Therefore, targeted knockdown of the MSTN gene using lentivirus-mediated shRNA transgenics would facilitate customized cell engineering, allowing potential use in the establishment of stable cell lines to produce genetically engineered animals. © 2014 American Institute of Chemical Engineers.
Advanced Breast Cancer as Indicator of Quality Mammography
International Nuclear Information System (INIS)
Gaona, Enrique
2003-01-01
Breast cancer is the most frequently diagnosed cancer and is the second leading cause of cancer death among women in the Mexican Republic. Mammography is the more important screening tool for detecting early breast cancer. Screening mammography involves taking x-rays from two views from each breast, typically from above (cranial-caudal view, CC) and from an oblique or angled view (mediolateral-oblique, MLO). The purpose of this study was to carry out an exploratory survey of the issue of patients with advanced breast cancer who have had a screening mammography. A general result of the survey is that 22.5% of all patients (102) with advanced breast cancer that participated in the study had previous screening mammography. But we should consider that 10% of breast cancers are not detected by mammography. Only 70% of the family doctors prescribed a diagnostic mammography when the first symptoms were diagnosed
Wong, Martin C S; Ching, Jessica Y L; Chan, Victor C W; Sung, Joseph J Y
2015-09-04
Faecal immunochemical tests (FITs) and colonoscopy are two common screening tools for colorectal cancer(CRC). Most cost-effectiveness studies focused on survival as the outcome, and were based on modeling techniques instead of real world observational data. This study evaluated the cost-effectiveness of these two tests to detect colorectal neoplastic lesions based on data from a 5-year community screening service. The incremental cost-effectiveness ratio (ICER) was assessed based on the detection rates of neoplastic lesions, and costs including screening compliance, polypectomy, colonoscopy complications, and staging of CRC detected. A total of 5,863 patients received yearly FIT and 4,869 received colonoscopy. Compared with FIT, colonoscopy detected notably more adenomas (23.6% vs. 1.6%) and advanced lesions or cancer (4.2% vs. 1.2%). Using FIT as control, the ICER of screening colonoscopy in detecting adenoma, advanced adenoma, CRC and a composite endpoint of either advanced adenoma or stage I CRC was US$3,489, US$27,962, US$922,762 and US$23,981 respectively. The respective ICER was US$3,597, US$439,513, -US$2,765,876 and US$32,297 among lower-risk subjects; whilst the corresponding figure was US$3,153, US$14,852, US$184,162 and US$13,919 among higher-risk subjects. When compared to FIT, colonoscopy is considered cost-effective for screening adenoma, advanced neoplasia, and a composite endpoint of advanced neoplasia or stage I CRC.
Recent advances in quantitative high throughput and high content data analysis.
Moutsatsos, Ioannis K; Parker, Christian N
2016-01-01
High throughput screening has become a basic technique with which to explore biological systems. Advances in technology, including increased screening capacity, as well as methods that generate multiparametric readouts, are driving the need for improvements in the analysis of data sets derived from such screens. This article covers the recent advances in the analysis of high throughput screening data sets from arrayed samples, as well as the recent advances in the analysis of cell-by-cell data sets derived from image or flow cytometry application. Screening multiple genomic reagents targeting any given gene creates additional challenges and so methods that prioritize individual gene targets have been developed. The article reviews many of the open source data analysis methods that are now available and which are helping to define a consensus on the best practices to use when analyzing screening data. As data sets become larger, and more complex, the need for easily accessible data analysis tools will continue to grow. The presentation of such complex data sets, to facilitate quality control monitoring and interpretation of the results will require the development of novel visualizations. In addition, advanced statistical and machine learning algorithms that can help identify patterns, correlations and the best features in massive data sets will be required. The ease of use for these tools will be important, as they will need to be used iteratively by laboratory scientists to improve the outcomes of complex analyses.
Trends in quality of screening colonoscopy in Austria.
Waldmann, Elisabeth; Gessl, Irina; Sallinger, Daniela; Jeschek, Philip; Britto-Arias, Martha; Heinze, Georg; Fasching, Elisabeth; Weiss, Werner; Gschwantler, Michael; Trauner, Michael; Ferlitsch, Monika
2016-12-01
Background and study aim: Screening colonoscopy only effectively prevents colorectal cancer if performed with high quality. The aim of this study was to analyze the detection rates of premalignant colorectal lesions in screening colonoscopies performed within a nationwide quality control program for screening colonoscopy in Austria. Methods: Data from electronic records of the screening program from its implementation in 2007 until December 2014 were analyzed in order to calculate detection rates for adenomas, advanced adenomas, polyps, and proximal lesions, and rates of cecal intubation, sedation, complications, and adequate bowel preparation. Results were evaluated to identify trends and changes in quality parameters over the 8-year study period. Results: During the study period, 301 endoscopists provided data from 159 246 screening colonoscopies. Mean age of screened individuals was 61.1 years, and 49.1 % were women. Significant increases over time were found for age- and sex-adjusted adenoma detection rates (ADRs), which increased from a mean of 22.2 % (SD 10.7 %) in 2007/2008 to 24.2 % (SD 11.6 %) in 2013/2014. On average, each endoscopist increased their individual ADR by + 1.5 percentage points per 2-year period (95 % confidence interval [CI] 0.9 - 2.2 percentage points; P Austria between 2007 and 2014. Although, overall ADR increased significantly during the study period, there was a decrease in the rate of advanced adenoma detection. © Georg Thieme Verlag KG Stuttgart · New York.
Armstrong, Katrina; Kim, Jane J; Halm, Ethan A; Ballard, Rachel M; Schnall, Mitchell D
2016-05-01
Multiple advisory groups now recommend that high-risk smokers be screened for lung cancer by low-dose computed tomography. Given that the development of lung cancer screening programs will face many of the same issues that have challenged other cancer screening programs, the National Cancer Institute-funded Population-based Research Optimizing Screening through Personalized Regimens (PROSPR) consortium was used to identify lessons learned from the implementation of breast, cervical, and colorectal cancer screening that should inform the introduction of lung cancer screening. These lessons include the importance of developing systems for identifying and recruiting eligible individuals in primary care, ensuring that screening centers are qualified and performance is monitored, creating clear communication standards for reporting screening results to referring physicians and patients, ensuring follow-up is available for individuals with abnormal test results, avoiding overscreening, remembering primary prevention, and leveraging advances in cancer genetics and immunology. Overall, this experience emphasizes that effective cancer screening is a multistep activity that requires robust strategies to initiate, report, follow up, and track each step as well as a dynamic and ongoing oversight process to revise current screening practices as new evidence regarding screening is created, new screening technologies are developed, new biological markers are identified, and new approaches to health care delivery are disseminated. Cancer 2016;122:1338-1342. © 2016 American Cancer Society. © 2016 American Cancer Society.
Premarital HIV screening in Johor--(2002-2004).
Khebir, B V; Adam, M A; Daud, A R; Shahrom, C M D
2007-03-01
A descriptive study was conducted on premarital HIV screening programme in Johor over a three year period. HIV screenings were done at government clinics and confirmed by accredited laboratories. As a result, 123 new HIV cases were detected (0.17%) from 74,210 respondents. In 2004, 24 cases (64.9%) advanced to marriage (n = 37) after they underwent counselling and six of them married among themselves. Positivity rate from this programme (0.17%) is higher than antenatal screening (0.05%). Despite the implementation of the premarital HIV screening programme, marriage application in Johor rose 2.8% in 2004 compared with 2002. This programme had partly contributed to public awareness against HIV and provides another option in early detection of the disease.
Subramanya, Sandesh; Kim, Sang-Soo; Manjunath, N; Shankar, Premlata
2010-02-01
Despite the clinical benefits of highly active antiretroviral therapy (HAART), the prospect of life-long antiretroviral treatment poses significant problems, which has spurred interest in developing new drugs and strategies to treat HIV infection and eliminate persistent viral reservoirs. RNAi has emerged as a therapeutic possibility for HIV. We discuss progress in overcoming hurdles to translating transient and stable RNAi enabling technologies to clinical application for HIV; covering the past 2 - 3 years. HIV inhibition can be achieved by transfection of chemically or enzymatically synthesized siRNAs or by DNA-based vector systems expressing short hairpin RNAs (shRNAs) that are processed intracellularly into siRNA. We compare these approaches, focusing on technical and safety issues that will guide the choice of strategy for clinical use. Introduction of synthetic siRNA into cells or its stable endogenous production using vector-driven shRNA have been shown to suppress HIV replication in vitro and, in some instances, in vivo. Each method has advantages and limitations in terms of ease of delivery, duration of silencing, emergence of escape mutants and potential toxicity. Both appear to have potential as future therapeutics for HIV, once the technical and safety issues of each approach are overcome.
Observed and Predicted Risk of Breast Cancer Death in Randomized Trials on Breast Cancer Screening.
Autier, Philippe; Boniol, Mathieu; Smans, Michel; Sullivan, Richard; Boyle, Peter
2016-01-01
The role of breast screening in breast cancer mortality declines is debated. Screening impacts cancer mortality through decreasing the number of advanced cancers with poor diagnosis, while cancer treatment works through decreasing the case-fatality rate. Hence, reductions in cancer death rates thanks to screening should directly reflect reductions in advanced cancer rates. We verified whether in breast screening trials, the observed reductions in the risk of breast cancer death could be predicted from reductions of advanced breast cancer rates. The Greater New York Health Insurance Plan trial (HIP) is the only breast screening trial that reported stage-specific cancer fatality for the screening and for the control group separately. The Swedish Two-County trial (TCT)) reported size-specific fatalities for cancer patients in both screening and control groups. We computed predicted numbers of breast cancer deaths, from which we calculated predicted relative risks (RR) and (95% confidence intervals). The Age trial in England performed its own calculations of predicted relative risk. The observed and predicted RR of breast cancer death were 0.72 (0.56-0.94) and 0.98 (0.77-1.24) in the HIP trial, and 0.79 (0.78-1.01) and 0.90 (0.80-1.01) in the Age trial. In the TCT, the observed RR was 0.73 (0.62-0.87), while the predicted RR was 0.89 (0.75-1.05) if overdiagnosis was assumed to be negligible and 0.83 (0.70-0.97) if extra cancers were excluded. In breast screening trials, factors other than screening have contributed to reductions in the risk of breast cancer death most probably by reducing the fatality of advanced cancers in screening groups. These factors were the better management of breast cancer patients and the underreporting of breast cancer as the underlying cause of death. Breast screening trials should publish stage-specific fatalities observed in each group.
Optimizing Outcomes of Colorectal Cancer Screening
R.G.S. Meester (Reinier)
2017-01-01
markdownabstractColorectal cancer is a leading cause of cancer deaths. Screening for colorectal cancer is implemented in an increasing number of settings, but performance of programs is often suboptimal. In this thesis, advanced modeling, informed by empirical data, was used to identify areas for
Varas-Godoy, Manuel; Lladser, Alvaro; Farfan, Nicole; Villota, Claudio; Villegas, Jaime; Tapia, Julio C; Burzio, Luis O; Burzio, Veronica A; Valenzuela, Pablo D T
2018-01-01
The family of non-coding mitochondrial RNAs (ncmtRNA) is differentially expressed according to proliferative status. Normal proliferating cells express sense (SncmtRNA) and antisense ncmtRNAs (ASncmtRNAs), whereas tumor cells express SncmtRNA and downregulate ASncmtRNAs. Knockdown of ASncmtRNAs with oligonucleotides induces apoptotic cell death of tumor cells, leaving normal cells unaffected, suggesting a potential application for developing a novel cancer therapy. In this study, we knocked down the ASncmtRNAs in melanoma cell lines with a lentiviral-encoded shRNA approach. Transduction with lentiviral constructs targeted to the ASncmtRNAs induced apoptosis in murine B16F10 and human A375 melanoma cells in vitro and significantly retarded B16F10 primary tumor growth in vivo. Moreover, the treatment drastically reduced the number of lung metastatic foci in a tail vein injection assay, compared to controls. These results provide additional proof of concept to the knockdown of ncmtRNAs for cancer therapy and validate lentiviral-shRNA vectors for gene therapy. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Advanced Lung Cancer Screening: An Individualized Molecular Nanotechnology Approach
2016-03-01
proportion of smokers , former 146 smokers and never smokers was not different between cases and controls. 147 Detection of DNA Methylation 148 We...highest risk smokers for an expensive screening modality such as CT scanning. Hypothesis: DNA methylation testing is more specific in selecting those...with non -cancerous nodules, and have completed the writing of a manuscript containing these results. The abstract of that manuscript is as follows
Four Principles to Consider Before Advising Women on Screening Mammography
DEFF Research Database (Denmark)
Keen, John D; Juhl Jørgensen, Karsten
2015-01-01
This article reviews four important screening principles applicable to screening mammography in order to facilitate informed choice. The first principle is that screening may help, hurt, or have no effect. In order to reduce mortality and mastectomy rates, screening must reduce the rate of advanced...... of a screening intervention. Disease-specific mortality is biased due to difficulties in attribution of cause of death and to increased mortality due to overdiagnosis and the resulting overtreatment with radiotherapy and chemotherapy. To enhance participation, the benefit from screening is often presented...... in relative instead of absolute terms. Third, some screening statistics must be interpreted with caution. Increased survival time and the percentage of early-stage tumors at detection sound plausible, but are affected by lead-time and length biases. In addition, analyses that only include women who attend...
Berchi, Célia; Guittet, Lydia; Bouvier, Véronique; Launoy, Guy
2010-01-01
Most industrialized countries, including France, have undertaken to generalize colorectal cancer screening using guaiac fecal occult blood tests (G-FOBT). However, recent researches demonstrate that immunochemical fecal occult blood tests (I-FOBT) are more effective than G-FOBT. Moreover, new generation I-FOBT benefits from a quantitative reading technique allowing the positivity threshold to be chosen, hence offering the best balance between effectiveness and cost. We aimed at comparing the cost and the clinical performance of one round of screening using I-FOBT at different positivity thresholds to those obtained with G-FOBT to determine the optimal cut-off for I-FOBT. Data were derived from an experiment conducted from June 2004 to December 2005 in Calvados (France) where 20,322 inhabitants aged 50-74 years performed both I-FOBT and G-FOBT. Clinical performance was assessed by the number of advanced tumors screened, including large adenomas and cancers. Costs were assessed by the French Social Security Board and included only direct costs. Screening using I-FOBT resulted in better health outcomes and lower costs than screening using G-FOBT for thresholds comprised between 75 and 93 ng/ml. I-FOBT at 55 ng/ml also offers a satisfactory alternative to G-FOBT, because it is 1.8-fold more effective than G-FOBT, without increasing the number of unnecessary colonoscopies, and at an extra cost of 2,519 euros per advanced tumor screened. The use of an automated I-FOBT at 75 ng/ml would guarantee more efficient screening than currently used G-FOBT. Health authorities in industrialized countries should consider the replacement of G-FOBT by an automated I-FOBT test in the near future.
International Nuclear Information System (INIS)
Skaane, P.
2009-01-01
Full-field digital mammography (FFDM) has several potential benefits as compared with screen-film mammography (SFM) in mammography screening. Digital technology also opens for implementation of advanced applications, including computer-aided detection (CAD) and tomosynthesis. Phantom studies and experimental clinical studies have shown that FFDM is equal or slightly superior to SFM for detection and characterization of mammographic abnormalities. Despite obvious advantages, the conversion to digital mammography has been slower than anticipated, and not only due to higher costs. Until very recently, some countries did not even permit the use of digital mammography in breast cancer screening. The reason for this reluctant attitude was concern about lower spatial resolution and about using soft-copy reading. Furthermore, there was a lack of data supporting improved diagnostic accuracy using FFDM in a screening setting, since two pioneer trials both showed nonsignificantly lower cancer detection rate at FFDM. The 10 studies comparing FFDM and SFM in mammography screening published so far have shown divergent and rather conflicting results. Nevertheless, there is a rapid conversion to digital mammography in breast cancer screening in many western countries. The aim of this article is to give an updated review of these studies, discuss the conflicting findings, and draw some conclusions from the results
Advanced Energy Validated Photovoltaic Inverter Technology at NREL | Energy
Inverter Technology at NREL Advanced Energy Industries-NREL's first partner at the Energy Systems Integration Facility (ESIF)-validated its advanced photovoltaic (PV) inverter technology using the ESIF's computer screen in a laboratory, with power inverter hardware in the background Photo by Dennis Schroeder
Recent advances in preimplantation genetic diagnosis and screening.
Lu, Lina; Lv, Bo; Huang, Kevin; Xue, Zhigang; Zhu, Xianmin; Fan, Guoping
2016-09-01
Preimplantation genetic diagnosis/screening (PGD/PGS) aims to help couples lower the risks of transmitting genetic defects to their offspring, implantation failure, and/or miscarriage during in vitro fertilization (IVF) cycles. However, it is still being debated with regard to the practicality and diagnostic accuracy of PGD/PGS due to the concern of invasive biopsy and the potential mosaicism of embryos. Recently, several non-invasive and high-throughput assays have been developed to help overcome the challenges encountered in the conventional invasive biopsy and low-throughput analysis in PGD/PGS. In this mini-review, we will summarize the recent progresses of these new methods for PGD/PGS and discuss their potential applications in IVF clinics.
Gupta, Akshay K; Samadder, Jewel; Elliott, Eric; Sethi, Saurabh; Schoenfeld, Philip
2011-07-01
Per current guidelines, patients with a first-degree relative (FDR) with colorectal cancer (CRC) should get screened at least at age 40. Data about the prevalence of adenomas and advanced adenomas (AAs) in these patients are lacking. To examine the prevalence of adenomas and AAs in 40- to 49-year-old individuals undergoing screening colonoscopy for family history of CRC. Retrospective chart review. Asymptomatic patients 40 to 49 years of age undergoing their first screening colonoscopy at the University of Michigan during the period 1999 to 2009 because of an FDR with CRC. Prevalence of adenomas (any size), AAs, and risk factors associated with adenomas. Among 640 study patients, the prevalence of adenomas (any size) was 15.4% and 3.3% for AAs. Adenoma prevalence was lower if the FDR with CRC was younger than 60 years of age versus an FDR with CRC older than 60 years of age (12.4% vs 19%, P = .034). Male sex (odds ratio 2.6; 95% CI, 1.06-4.4) and advancing age (odds ratio 1.16; 95% CI, 1.03-1.31) were associated with adenomas. Limited data on risk factor exposure and insufficient sample size to assess risk factors for AAs. Among 40- to 49-year-old patients undergoing screening colonoscopy because of an FDR with CRC, the prevalence of adenomas and AAs is low. Further research should determine whether these individuals have a higher prevalence of adenomas compared with average-risk individuals. Copyright © 2011 American Society for Gastrointestinal Endoscopy. Published by Mosby, Inc. All rights reserved.
Do doctors understand the test characteristics of lung cancer screening?
Schmidt, Richard; Breyer, Marie; Breyer-Kohansal, Robab; Urban, Matthias; Funk, Georg-Christian
2018-04-01
Screening for lung cancer with a low-dose computed tomography (CT) scan is estimated to prevent 3 deaths per 1000 individuals at high risk; however, false positive results and radiation exposure are relevant harms and deserve careful consideration. Screening candidates can only make an autonomous decision if doctors correctly inform them of the pros and cons of the method; therefore, this study aimed to evaluate whether doctors understand the test characteristics of lung cancer screening. In a randomized trial 556 doctors (members of the Austrian Respiratory Society) were invited to answer questions regarding lung cancer screening based on online case vignettes. Half of the participants were randomized to the group 'solutions provided' and received the correct solutions in advance. The group 'solutions withheld' had to rely on prior knowledge or estimates. The primary endpoint was the between-group difference in the estimated number of deaths preventable by screening. Secondary endpoints were the between-group differences in the prevalence of lung cancer, prevalence of a positive screening results, sensitivity, specificity, positive predictive value, and false negative rate. Estimations were also compared with current data from the literature. The response rate was 29% in both groups. The reduction in the number of deaths due to screening was overestimated six-fold (95% confidence interval CI: 4-8) compared with the actual data, and there was no effect of group allocation. Providing the correct solutions to doctors had no systematic effect on their answers. Doctors poorly understand the test characteristics of lung cancer screening. Providing the correct solutions in advance did not improve the answers. Continuing education regarding lung cancer screening and the interpretation of test characteristics may be a simple remedy. Clinical trial registered with www.clinicaltrials.gov (NCT02542332).
Proteasome inhibitors block DNA repair and radiosensitize non-small cell lung cancer.
Directory of Open Access Journals (Sweden)
Kyle R Cron
Full Text Available Despite optimal radiation therapy (RT, chemotherapy and/or surgery, a majority of patients with locally advanced non-small cell lung cancer (NSCLC fail treatment. To identify novel gene targets for improved tumor control, we performed whole genome RNAi screens to identify knockdowns that most reproducibly increase NSCLC cytotoxicity. These screens identified several proteasome subunits among top hits, including the topmost hit PSMA1, a component of the core 20 S proteasome. Radiation and proteasome inhibition showed synergistic effects. Proteasome inhibition resulted in an 80-90% decrease in homologous recombination (HR, a 50% decrease in expression of NF-κB-inducible HR genes BRCA1 and FANCD2, and a reduction of BRCA1, FANCD2 and RAD51 ionizing radiation-induced foci. IκBα RNAi knockdown rescued NSCLC radioresistance. Irradiation of mice with NCI-H460 xenografts after inducible PSMA1 shRNA knockdown markedly increased murine survival compared to either treatment alone. Proteasome inhibition is a promising strategy for NSCLC radiosensitization via inhibition of NF-κB-mediated expression of Fanconi Anemia/HR DNA repair genes.
Evaluation of critical materials in five additional advance design photovoltaic cells
Energy Technology Data Exchange (ETDEWEB)
Smith, S.A.; Watts, R.L.; Martin, P.; Gurwell, W.E.
1981-02-01
The objective of this study is to identify potential material supply constraints due to the large-scale deployment of five advanced photovoltaic (PV) cell designs, and to suggest strategies to reduce the impacts of these production capacity limitations and potential future material shortages. The Critical Materials Assessment Program (CMAP) screens the designs and their supply chains and identifies potential shortages which might preclude large-scale use of the technologies. The results of the screening of five advanced PV cell designs are presented: (1) indium phosphide/cadmium sulfide, (2) zinc phosphide, (3) cadmium telluride/cadmium sulfide, (4) copper indium selenium, and (5) cadmium selenide photoelectrochemical. Each of these five cells is screened individually assuming that they first come online in 1991, and that 25 Gwe of peak capacity is online by the year 2000. A second computer screening assumes that each cell first comes online in 1991 and that each cell has a 5 GWe of peak capacity by the year 2000, so that the total online capacity for the five cells is 25 GWe. Based on a review of the preliminary baseline screening results, suggestions were made for varying such parameters as the layer thickness, cell production processes, etc. The resulting PV cell characterizations were then screened again by the CMAP computer code. The CMAP methodology used to identify critical materials is described; and detailed characterizations of the advanced photovoltaic cell designs under investigation, descriptions of additional cell production processes, and the results are presented. (WHK)
Interactive Screen Experiments with Single Photons
Bronner, Patrick; Strunz, Andreas; Silberhorn, Christine; Meyn, Jan-Peter
2009-01-01
Single photons are used for fundamental quantum physics experiments as well as for applications. Originally being a topic of advance courses, such experiments are increasingly a subject of undergraduate courses. We provide interactive screen experiments (ISE) for supporting the work in a real laboratory, and for students who do not have access to…
Pharmacological screening technologies for venom peptide discovery.
Prashanth, Jutty Rajan; Hasaballah, Nojod; Vetter, Irina
2017-12-01
Venomous animals occupy one of the most successful evolutionary niches and occur on nearly every continent. They deliver venoms via biting and stinging apparatuses with the aim to rapidly incapacitate prey and deter predators. This has led to the evolution of venom components that act at a number of biological targets - including ion channels, G-protein coupled receptors, transporters and enzymes - with exquisite selectivity and potency, making venom-derived components attractive pharmacological tool compounds and drug leads. In recent years, plate-based pharmacological screening approaches have been introduced to accelerate venom-derived drug discovery. A range of assays are amenable to this purpose, including high-throughput electrophysiology, fluorescence-based functional and binding assays. However, despite these technological advances, the traditional activity-guided fractionation approach is time-consuming and resource-intensive. The combination of screening techniques suitable for miniaturization with sequence-based discovery approaches - supported by advanced proteomics, mass spectrometry, chromatography as well as synthesis and expression techniques - promises to further improve venom peptide discovery. Here, we discuss practical aspects of establishing a pipeline for venom peptide drug discovery with a particular emphasis on pharmacology and pharmacological screening approaches. This article is part of the Special Issue entitled 'Venom-derived Peptides as Pharmacological Tools.' Copyright © 2017 Elsevier Ltd. All rights reserved.
Retinal Imaging Techniques for Diabetic Retinopathy Screening
Goh, James Kang Hao; Cheung, Carol Y.; Sim, Shaun Sebastian; Tan, Pok Chien; Tan, Gavin Siew Wei; Wong, Tien Yin
2016-01-01
Due to the increasing prevalence of diabetes mellitus, demand for diabetic retinopathy (DR) screening platforms is steeply increasing. Early detection and treatment of DR are key public health interventions that can greatly reduce the likelihood of vision loss. Current DR screening programs typically employ retinal fundus photography, which relies on skilled readers for manual DR assessment. However, this is labor-intensive and suffers from inconsistency across sites. Hence, there has been a recent proliferation of automated retinal image analysis software that may potentially alleviate this burden cost-effectively. Furthermore, current screening programs based on 2-dimensional fundus photography do not effectively screen for diabetic macular edema (DME). Optical coherence tomography is becoming increasingly recognized as the reference standard for DME assessment and can potentially provide a cost-effective solution for improving DME detection in large-scale DR screening programs. Current screening techniques are also unable to image the peripheral retina and require pharmacological pupil dilation; ultra-widefield imaging and confocal scanning laser ophthalmoscopy, which address these drawbacks, possess great potential. In this review, we summarize the current DR screening methods using various retinal imaging techniques, and also outline future possibilities. Advances in retinal imaging techniques can potentially transform the management of patients with diabetes, providing savings in health care costs and resources. PMID:26830491
Advanced teleoperation in nuclear applications
International Nuclear Information System (INIS)
Hamel, W.R.; Feldman, M.J.; Martin, H.L.
1984-01-01
A new generation of integrated remote maintenance systems is being developed to meet the needs of future nuclear fuel reprocessing at the Oak Ridge National Laboratory. Development activities cover all aspects of an advanced teleoperated maintenance system with particular emphasis on a new force-reflecting servomanipulator concept. The new manipulator, called the advanced servomanipulator, is microprocessor controlled and is designed to achieve force-reflection performance near that of mechanical master/slave manipulators. The advanced servomanipulator uses a gear-drive transmission which permits modularization for remote maintainability (by other advanced servomanipulators) and increases reliability. Human factors analysis has been used to develop an improved man/machine interface concept based upon colorgraphic displays and menu-driven tough screens. Initial test and evaluation of two advanced servomanipulator slave arms and several other development components have begun. 9 references, 5 figures
Tsai, Tsung-Ying; Chang, Kai-Wei; Chen, Calvin Yu-Chian
2011-06-01
The rapidly advancing researches on traditional Chinese medicine (TCM) have greatly intrigued pharmaceutical industries worldwide. To take initiative in the next generation of drug development, we constructed a cloud-computing system for TCM intelligent screening system (iScreen) based on TCM Database@Taiwan. iScreen is compacted web server for TCM docking and followed by customized de novo drug design. We further implemented a protein preparation tool that both extract protein of interest from a raw input file and estimate the size of ligand bind site. In addition, iScreen is designed in user-friendly graphic interface for users who have less experience with the command line systems. For customized docking, multiple docking services, including standard, in-water, pH environment, and flexible docking modes are implemented. Users can download first 200 TCM compounds of best docking results. For TCM de novo drug design, iScreen provides multiple molecular descriptors for a user's interest. iScreen is the world's first web server that employs world's largest TCM database for virtual screening and de novo drug design. We believe our web server can lead TCM research to a new era of drug development. The TCM docking and screening server is available at http://iScreen.cmu.edu.tw/.
Tsai, Tsung-Ying; Chang, Kai-Wei; Chen, Calvin Yu-Chian
2011-06-01
The rapidly advancing researches on traditional Chinese medicine (TCM) have greatly intrigued pharmaceutical industries worldwide. To take initiative in the next generation of drug development, we constructed a cloud-computing system for TCM intelligent screening system (iScreen) based on TCM Database@Taiwan. iScreen is compacted web server for TCM docking and followed by customized de novo drug design. We further implemented a protein preparation tool that both extract protein of interest from a raw input file and estimate the size of ligand bind site. In addition, iScreen is designed in user-friendly graphic interface for users who have less experience with the command line systems. For customized docking, multiple docking services, including standard, in-water, pH environment, and flexible docking modes are implemented. Users can download first 200 TCM compounds of best docking results. For TCM de novo drug design, iScreen provides multiple molecular descriptors for a user's interest. iScreen is the world's first web server that employs world's largest TCM database for virtual screening and de novo drug design. We believe our web server can lead TCM research to a new era of drug development. The TCM docking and screening server is available at http://iScreen.cmu.edu.tw/.
Artificial intelligence for breast cancer screening: Opportunity or hype?
Houssami, Nehmat; Lee, Christoph I; Buist, Diana S M; Tao, Dacheng
2017-12-01
Interpretation of mammography for breast cancer (BC) screening can confer a mortality benefit through early BC detection, can miss a cancer that is present or fast growing, or can result in false-positives. Efforts to improve screening outcomes have mostly focused on intensifying imaging practices (double instead of single-reading, more frequent screens, or supplemental imaging) that may add substantial resource expenditures and harms associated with population screening. Less attention has been given to making mammography screening practice 'smarter' or more efficient. Artificial intelligence (AI) is capable of advanced learning using large complex datasets and has the potential to perform tasks such as image interpretation. With both highly-specific capabilities, and also possible un-intended (and poorly understood) consequences, this viewpoint considers the promise and current reality of AI in BC detection. Copyright © 2017 Elsevier Ltd. All rights reserved.
Hospitalized women's willingness to pay for an inpatient screening mammogram.
Khaliq, Waseem; Harris, Ché Matthew; Landis, Regina; Bridges, John F P; Wright, Scott M
2014-01-01
Lower rates for breast cancer screening persist among low income and uninsured women. Although Medicare and many other insurance plans would pay for screening mammograms done during hospital stays, breast cancer screening has not been part of usual hospital care. This study explores the mean amount of money that hospitalized women were willing to contribute towards the cost of a screening mammogram. Of the 193 enrolled patients, 72% were willing to pay a mean of $83.41 (95% CI, $71.51-$95.31) in advance towards inpatient screening mammogram costs. The study's findings suggest that hospitalized women value the prospect of screening mammography during the hospitalization. It may be wise policy to offer mammograms to nonadherent hospitalized women, especially those who are at high risk for developing breast cancer. © 2014 Annals of Family Medicine, Inc.
Expanded newborn screening: social and ethical issues.
Dhondt, Jean-Louis
2010-10-01
Newborn screening and genetic testing have expanded rapidly in the last decade with the advent of multiplex (e.g., tandem mass spectrometry) and/or DNA technologies. However, screening panels include a large number of disorders, which may not meet all of the traditional screening criteria, established in late 1960s, and used for years to justify screening programs. After a period of expansion driven by technological advances, many reports have reconsidered the justification of expanded programs. Many factors have contributed to test-panel discrepancies between countries. The test-panel review methodology, the way health benefits are weighed against harms, and the socioeconomic-political environment all play a role. Expansion of screening also requires reconsideration of the infrastructure (ideally, in the context of national plans for rare diseases) to support testing, counselling, education, treatment, and follow-up. Consequently, economic aspects cannot be ignored and can be a limitation for expansion. New ethical questions have emerged: risks of discrimination or stigmatization, respect of the autonomy of persons to make decisions, parental anxiety resulting from a false positive test (especially when reporting to parents screening results for untreatable conditions identified as by-products of screening), etc. For disorders where there is not yet confirmation of benefit, it may be prudent to recommend pilot screening and to have a mechanism that can be used to adapt or even to stop a program.
Rester, Ulrich
2008-07-01
Drug discovery and development is an interdisciplinary, expensive and time-consuming process. Scientific advancements during the past two decades have altered the way pharmaceutical research produces novel bio-active molecules. Advances in computational techniques and hardware solutions have enabled in silico methods, and in particular virtual screening, to speed up modern lead identification and lead optimization. Recent successes have proven the power of combining virtual screening with complementary and synergistic biophysical methods, such as X-ray crystallography, NMR spectroscopy and isothermal titration calorimetry (ITC). This review addresses key issues, challenges and recent improvements of virtual screening methods and strategies. Examples highlighting the impact of an integrated virtual screening and biophysical characterization platform in the lead identification and optimization process are presented and discussed.
A multi-infrastructure gateway for virtual drug screening
Jaghoori, Mohammad Mahdi; van Altena, Allard J.; Bleijlevens, Boris; Ramezani, Sara; Font, Juan Luis; Olabarriaga, Silvia D.
2015-01-01
In computer-aided drug design, software tools are used to narrow down possible drug candidates, thereby reducing the amount of expensive in vitro research, by a process called virtual screening. This process includes large computations that require advanced computing infrastructure; however, using
Dynamic screening and electron dynamics in low-dimensional metal systems
International Nuclear Information System (INIS)
Silkin, V.M.; Quijada, M.; Vergniory, M.G.; Alducin, M.; Borisov, A.G.; Diez Muino, R.; Juaristi, J.I.; Sanchez-Portal, D.; Chulkov, E.V.; Echenique, P.M.
2007-01-01
Recent advances in the theoretical description of dynamic screening and electron dynamics in metallic media are reviewed. The time-dependent building-up of screening in different situations is addressed. Perturbative and non-perturbative theories are used to study electron dynamics in low-dimensional systems, such as metal clusters, image states, surface states and quantum wells. Modification of the electronic lifetimes due to confinement effects is analyzed as well
Directory of Open Access Journals (Sweden)
Margaret Finn
2018-04-01
Full Text Available Background: This study evaluated how the level of medical education affected confidence of counseling on skin health, performing skin examinations, and the likelihood of using those skills in future screenings. Material and Methods: An online survey was distributed to students at three midwest medical schools that assessed sun protection behaviors, and the student’s perception of education and comfort on the complete skin examination and counseling on skin health. Results: 51.6% (n=243 indicated they were in the last two years of medical school and were considered advanced students, compared to less advanced students in the first two years. Advanced students were significantly more comfortable in performing a complete skin examination and counseling patients on skin health when compared to less advanced students (p < 0.001. However, they were also statistically less likely to indicate they would provide skin screening on future patients when compared to less advanced students (p < 0.001. Only 29.5% (n = 139 and 60.7% (n = 286 of students indicated they had been educated on performing a complete skin examination and counseling on skin health, respectively. Conclusions: Although advanced students were more likely to report education and comfortability in skin cancer screening they were not as likely to indicate they would practice these skills in the future compared to less advanced students. Also, only a small number of students perceived themselves to be educated in these aspects.
American Indian Men's Perceptions of Breast Cancer Screening for American Indian Women.
Filippi, Melissa K; Pacheco, Joseph; James, Aimee S; Brown, Travis; Ndikum-Moffor, Florence; Choi, Won S; Greiner, K Allen; Daley, Christine M
2014-01-01
Screening, especially screening mammography, is vital for decreasing breast cancer incidence and mortality. Screening rates in American Indian women are low compared to other racial/ethnic groups. In addition, American Indian women are diagnosed at more advanced stages and have lower 5-year survival rate than others. To better address the screening rates of American Indian women, focus groups (N=8) were conducted with American Indian men (N=42) to explore their perceptions of breast cancer screening for American Indian women. Our intent was to understand men's support level toward screening. Using a community-based participatory approach, focus groups were audio-taped, transcribed verbatim, and analyzed using a text analysis approach developed by our team. Topics discussed included breast cancer and screening knowledge, barriers to screening, and suggestions to improve screening rates. These findings can guide strategies to improve knowledge and awareness, communication among families and health care providers, and screening rates in American Indian communities.
Benn, Peter A
2002-10-01
The acceptability of prenatal screening and diagnosis of Down syndrome is dependent, in part, on the gestational age at which the testing is offered. First trimester screening could be advantageous if it has sufficient efficacy and can be effectively delivered. Two first trimester maternal serum screening markers, pregnancy-associated plasma protein-A (PAPP-A) and free beta-human chorionic gonadotropin (beta-hCG), are useful for identifying women at increased risk for fetal Down syndrome. In addition, measurement of an enlarged thickness of the subcutaneous fluid-filled space at the back of the neck of the developing fetus (referred to as nuchal translucency or NT) has been demonstrated to be an indicator for these high-risk pregnancies. When these three parameters are combined, estimates for Down syndrome efficacy exceed those currently attainable in the second trimester. Women who are screen-positive in the first trimester can elect to receive cytogenetic testing of a chorionic villus biopsy. The first trimester tests could also, theoretically, be combined with the second trimester maternal serum screening tests (integrated screening) to obtain even higher levels of efficacy. There are, however, several practical limitations to first trimester and integrated screening. These include scheduling of testing within relatively narrow gestational age intervals, availability of appropriately trained ultrasonographers for NT measurement, risks associated with chorionic villus biopsy, and costs. There is also increasing evidence that an enlarged NT measurement is indicative of a high risk for spontaneous abortion and for fetal abnormalities that are not detectable by cytogenetic analysis. Women whose fetuses show enlarged NT, therefore, need first trimester counseling regarding their Down syndrome risks and the possibility of other adverse pregnancy outcomes. Follow-up ultrasound and fetal echocardiography in the second trimester are also indicated. First trimester
Zorzi, Manuel; Hassan, Cesare; Capodaglio, Giulia; Fedato, Chiara; Montaguti, Adriana; Turrin, Anna; Rosano, Alberto; Monetti, Daniele; Stocco, Carmen; Baracco, Susanna; Russo, Francesca; Repici, Alessandro; Rugge, Massimo
2017-11-03
The long-term performance of colorectal cancer (CRC) screening programmes based on a 2-year faecal immunochemical test (FIT) is still unclear. In a sample of 50 to 69-year-olds repeatedly screened with the FIT (OC-Hemodia latex agglutination test; cut-off: 20 µg haemoglobin/g faeces), we examined: (1) the FIT positivity rate, the CRC and advanced adenoma detection rate and the FIT's positive predictive value (PPV) for advanced neoplasia, at each round of screening and (2) the cumulative CRC and advanced adenoma detection rate after five rounds of FIT. Over 12 years (2002-2014), 123 347 individuals were administered the FIT up to six times, and 781 CRCs and 4713 advanced adenomas were diagnosed. The CRC and advanced adenoma detection rates declined substantially from the first to the third (rate ratio (RR) 0.25, 95% CI 0.20 to 0.32) and second (RR 0.51, 95% CI 0.47 to 0.56) rounds, respectively, and then remained stable. The PPV for advanced neoplasia dropped by 18% in the second round (RR 0.82, 95% CI 0.77 to 0.89), with no further reduction thereafter due to a concomitant decline in the FIT positivity rate (RR first to sixth rounds: 0.56, 95% CI 0.53 to 0.60).The cumulative CRC and advanced adenoma detection rates over five consecutive rounds were 8.5‰ (95% CI 7.8 to 9.2), and 58.9‰ (95% CI 56.9 to 61.0), respectively. Repeated FIT significantly reduces the burden of colorectal disease while facilitating an efficient use of colonoscopy resources. The cumulative detection rate after five rounds of FIT is similar to primary screening with colonoscopy, supporting the need to account for the cumulative sensitivity of repeated FITs when evaluating the test's efficacy. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
Introduction to sump screen downstream effect analysis of AP1000 nuclear power plant
International Nuclear Information System (INIS)
Zhang Qinghua; Liu Yu; Chai Guohan
2010-01-01
The design of AP1000 takes into account the potential impact of debris clogging on sump screen. In this article, the technical background of sump screen issue and the design characteristics of AP1000 to address the sump screen blockage issue are introduced. The article focuses on the 'downstream effect' analysis method, acceptance criteria and analysis result of AP1000 sump screen. Although the design of AP1000 is different with traditional PWR, the author expects to bring some reference to advance the downstream effect analysis in China through the introduction. (authors)
Advancing Public Health in Cancer - Annual Plan
Cancer is the leading cause of death from disease among Americans under 85. Learn how NCI advances public health by conducting research to improve the delivery of quality cancer prevention, screening, and treatment to all Americans.
Joslin, John; Gilligan, James; Anderson, Paul; Garcia, Catherine; Sharif, Orzala; Hampton, Janice; Cohen, Steven; King, Miranda; Zhou, Bin; Jiang, Shumei; Trussell, Christopher; Dunn, Robert; Fathman, John W; Snead, Jennifer L; Boitano, Anthony E; Nguyen, Tommy; Conner, Michael; Cooke, Mike; Harris, Jennifer; Ainscow, Ed; Zhou, Yingyao; Shaw, Chris; Sipes, Dan; Mainquist, James; Lesley, Scott
2018-05-01
The goal of high-throughput screening is to enable screening of compound libraries in an automated manner to identify quality starting points for optimization. This often involves screening a large diversity of compounds in an assay that preserves a connection to the disease pathology. Phenotypic screening is a powerful tool for drug identification, in that assays can be run without prior understanding of the target and with primary cells that closely mimic the therapeutic setting. Advanced automation and high-content imaging have enabled many complex assays, but these are still relatively slow and low throughput. To address this limitation, we have developed an automated workflow that is dedicated to processing complex phenotypic assays for flow cytometry. The system can achieve a throughput of 50,000 wells per day, resulting in a fully automated platform that enables robust phenotypic drug discovery. Over the past 5 years, this screening system has been used for a variety of drug discovery programs, across many disease areas, with many molecules advancing quickly into preclinical development and into the clinic. This report will highlight a diversity of approaches that automated flow cytometry has enabled for phenotypic drug discovery.
R. de Gelder (Rianne); G. Draisma (Gerrit); E.A.M. Heijnsdijk (Eveline); H.J. de Koning (Harry)
2011-01-01
textabstractIntroduction:Exposure to ionizing radiation at mammography screening may cause breast cancer. Because the radiation risk increases with lower exposure age, advancing the lower age limit may affect the balance between screening benefits and risks. The present study explores the
A note on the catch-up time method for estimating lead or sojourn time in prostate cancer screening
G. Draisma (Gerrit); J.M. van Rosmalen (Joost)
2013-01-01
textabstractModels of cancer screening assume that cancers are detectable by screening before being diagnosed clinically through symptoms. The duration of this preclinical phase is called sojourn time, and it determines how much diagnosis might be advanced in time by the screening test (lead time).
Hot Topic: Preimplantation aneuploidy screening
Directory of Open Access Journals (Sweden)
Kayhan Yakın
2009-03-01
Full Text Available Preimplantation Genetic Screening (PGS is a technique that has been introduced into clinical practice to screen and eliminate aneuploid embryos form transfer with the intention to improve implantation rates and decrease pregnancy wastage. Although practiced widely throughout the world the PGS unfortunately has been adopted without being subjected to rigorous scientific validation. Data from recent prospective randomized trials have shed doubt on the efficacy of the procedure when used in women with advanced age, one of the target populations for PGS. Other purported indications for the application of this complicated technique such as recurrent implantation failure and recurrent spontaneous abortion have not been subjected to randomized controlled trials. For the best interest of patients, we feel it is timely for a debate regarding the efficacy and safety of PGS.
Murillo, Raúl; Díaz, Sandra; Perry, Fernando; Poveda, César; Piñeros, Marion; Sánchez, Oswaldo; Buitrago, Lina; Gamboa, Oscar; Lozano, Teófilo; Yu, Hsiang; Wang, Ching-Yun; Duggan, Catherine; Thomas, David B; Anderson, Benjamin O
2016-02-01
The lack of breast cancer screening in low and middle-income countries results in later stage diagnosis and worsened outcomes for women. A cluster randomized trial was performed in Bogotá, Colombia between 2008 and 2012 to evaluate effects of opportunistic breast cancer screening. Thirteen clinics were randomized to an intervention arm and 13 to a control arm. Physicians in intervention clinics were instructed to perform clinical breast examination on all women aged 50-69 years attending clinics for non-breast health issues, and then refer them for mammographic screening. Physicians in control clinics were not explicitly instructed to perform breast screening or mammography referrals, but could do so if they thought it indicated ("usual care"). Women were followed for 2-years postrandomization. 7,436 women were enrolled and 7,419 (99.8%) screened in intervention clinics, versus 8,419 enrolled and 1,108 (13.1%) screened in control clinics. Incidence ratios (IR) of early, advanced and all breast cancers were 2.9 (95% CI 1.1-9.2), 1.0 (0.3-3.5) and 1.9 (0.9-4.1) in the first (screening) year of the trial, and the cumulative IR for all breast cancers converged to 1.4 (0.7-2.8) by the end of follow-up (Year 2). Eighteen (69.2%) of 26 women with early stage disease had breast conservation surgery (BCS) versus 6 (42.5%) of 14 women with late-stage disease (p = 0.02). Fifteen (68.2%) of 22 women with breast cancer in the intervention group had BCS versus nine (50.0%) of 18 women in the control group (p = 0.34). Well-designed opportunistic clinic-based breast cancer screening programs may be useful for early breast cancer detection in LMICs. © 2015 The Authors. Published by Wiley Periodicals, Inc. on behalf of UICC.
Breast Cancer Screening in an Era of Personalized Regimens
Onega, Tracy; Beaber, Elisabeth F.; Sprague, Brian L.; Barlow, William E.; Haas, Jennifer S.; Tosteson, Anna N.A.; Schnall, Mitchell D.; Armstrong, Katrina; Schapira, Marilyn M.; Geller, Berta; Weaver, Donald L.; Conant, Emily F.
2014-01-01
Breast cancer screening holds a prominent place in public health, health care delivery, policy, and women’s health care decisions. Several factors are driving shifts in how population-based breast cancer screening is approached, including advanced imaging technologies, health system performance measures, health care reform, concern for “overdiagnosis,” and improved understanding of risk. Maximizing benefits while minimizing the harms of screening requires moving from a “1-size-fits-all” guideline paradigm to more personalized strategies. A refined conceptual model for breast cancer screening is needed to align women’s risks and preferences with screening regimens. A conceptual model of personalized breast cancer screening is presented herein that emphasizes key domains and transitions throughout the screening process, as well as multilevel perspectives. The key domains of screening awareness, detection, diagnosis, and treatment and survivorship are conceptualized to function at the level of the patient, provider, facility, health care system, and population/policy arena. Personalized breast cancer screening can be assessed across these domains with both process and outcome measures. Identifying, evaluating, and monitoring process measures in screening is a focus of a National Cancer Institute initiative entitled PROSPR (Population-based Research Optimizing Screening through Personalized Regimens), which will provide generalizable evidence for a risk-based model of breast cancer screening, The model presented builds on prior breast cancer screening models and may serve to identify new measures to optimize benefits-to-harms tradeoffs in population-based screening, which is a timely goal in the era of health care reform. PMID:24830599
A focus group study of consumer attitudes toward genetic testing and newborn screening for deafness.
Burton, Sarah K; Withrow, Kara; Arnos, Kathleen S; Kalfoglou, Andrea L; Pandya, Arti
2006-12-01
Progress in identifying genes for deafness together with implementation of universal audiologic screening of newborns has provided the opportunity for more widespread use of molecular tests to detect genetic forms of hearing loss. Efforts to assess consumer attitudes toward these advances have lagged behind. Consumer focus groups were held to explore attitudes toward genetic advances and technologies for hearing loss, views about newborn hearing screening, and reactions to the idea of adding molecular screening for hearing loss at birth. Focus group discussions were recorded, transcribed and analyzed. Five focus groups with 44 participants including hearing parents of deaf children, deaf parents and young deaf adults were held. Focus group participants supported the use of genetic tests to identify the etiology of hearing loss but were concerned that genetic information might influence reproductive decisions. Molecular newborn screening was advocated by some; however, others expressed concern about its effectiveness. Documenting the attitudes of parents and other consumers toward genetic technologies establishes the framework for discussions on the appropriateness of molecular newborn screening for hearing loss and informs specialists about potential areas of public education necessary prior to the implementation of such screening.
[Screening of ovarian cancer : not for tomorrow].
Vuilleumier, Aurélie; Labidi-Galy, Intidhar
2017-05-17
As the worldwide incidence of cancer continuously rises, one of the measures to reduce mortality is early diagnosis while the disease is still curable. Colonoscopy screening and PAP-smears are worthwhile examples illustrating the impact of early diagnosis on mortality. Ovarian cancer is the first cause of mortality by gynecological cancers in Switzerland (incidence of 600 new cases / year), mostly diagnosed at advanced stages with a poor prognosis. Could surveillance measures improve survival ? Three large-scale randomized control trials failed to show mortality reduction from ovarian cancer with the methods currently available. A better comprehension of pathogenesis can allow the development of new strategies of screening.
Economic model of a birth cohort screening program for hepatitis C virus.
McGarry, Lisa J; Pawar, Vivek S; Panchmatia, Hemangi R; Rubin, Jaime L; Davis, Gary L; Younossi, Zobair M; Capretta, James C; O'Grady, Michael J; Weinstein, Milton C
2012-05-01
Recent research has identified high hepatitis C virus (HCV) prevalence among older U.S. residents who contracted HCV decades ago and may no longer be recognized as high risk. We assessed the cost-effectiveness of screening 100% of U.S. residents born 1946-1970 over 5 years (birth-cohort screening), compared with current risk-based screening, by projecting costs and outcomes of screening over the remaining lifetime of this birth cohort. A Markov model of the natural history of HCV was developed using data synthesized from surveillance data, published literature, expert opinion, and other secondary sources. We assumed eligible patients were treated with pegylated interferon plus ribavirin, with genotype 1 patients receiving a direct-acting antiviral in combination. The target population is U.S. residents born 1946-1970 with no previous HCV diagnosis. Among the estimated 102 million (1.6 million chronically HCV infected) eligible for screening, birth-cohort screening leads to 84,000 fewer cases of decompensated cirrhosis, 46,000 fewer cases of hepatocellular carcinoma, 10,000 fewer liver transplants, and 78,000 fewer HCV-related deaths. Birth-cohort screening leads to higher overall costs than risk-based screening ($80.4 billion versus $53.7 billion), but yields lower costs related to advanced liver disease ($31.2 billion versus $39.8 billion); birth-cohort screening produces an incremental cost-effectiveness ratio (ICER) of $37,700 per quality-adjusted life year gained versus risk-based screening. Sensitivity analyses showed that reducing the time horizon during which health and economic consequences are evaluated increases the ICER; similarly, decreasing the treatment rates and efficacy increases the ICER. Model results were relatively insensitive to other inputs. Birth-cohort screening for HCV is likely to provide important health benefits by reducing lifetime cases of advanced liver disease and HCV-related deaths and is cost-effective at conventional willingness
DEFF Research Database (Denmark)
Gøtzsche, Peter C
2011-01-01
The mammography screening trials have shown varying results. This could be because screening was better in some trials than in others at advancing the time of diagnosis. If so, more cancers would be identified in such trials relative to the control group, and fewer of the cancers would have reach...
The Stanford Automated Mounter: Enabling High-Throughput Protein Crystal Screening at SSRL
International Nuclear Information System (INIS)
Smith, C.A.; Cohen, A.E.
2009-01-01
The macromolecular crystallography experiment lends itself perfectly to high-throughput technologies. The initial steps including the expression, purification, and crystallization of protein crystals, along with some of the later steps involving data processing and structure determination have all been automated to the point where some of the last remaining bottlenecks in the process have been crystal mounting, crystal screening, and data collection. At the Stanford Synchrotron Radiation Laboratory, a National User Facility that provides extremely brilliant X-ray photon beams for use in materials science, environmental science, and structural biology research, the incorporation of advanced robotics has enabled crystals to be screened in a true high-throughput fashion, thus dramatically accelerating the final steps. Up to 288 frozen crystals can be mounted by the beamline robot (the Stanford Auto-Mounting System) and screened for diffraction quality in a matter of hours without intervention. The best quality crystals can then be remounted for the collection of complete X-ray diffraction data sets. Furthermore, the entire screening and data collection experiment can be controlled from the experimenter's home laboratory by means of advanced software tools that enable network-based control of the highly automated beamlines.
Smart material screening machines using smart materials and controls
Allaei, Daryoush; Corradi, Gary; Waigand, Al
2002-07-01
The objective of this product is to address the specific need for improvements in the efficiency and effectiveness in physical separation technologies in the screening areas. Currently, the mining industry uses approximately 33 billion kW-hr per year, costing 1.65 billion dollars at 0.05 cents per kW-hr, of electrical energy for physical separations. Even though screening and size separations are not the single most energy intensive process in the mining industry, they are often the major bottleneck in the whole process. Improvements to this area offer tremendous potential in both energy savings and production improvements. Additionally, the vibrating screens used in the mining processing plants are the most costly areas from maintenance and worker health and safety point of views. The goal of this product is to reduce energy use in the screening and total processing areas. This goal is accomplished by developing an innovative screening machine based on smart materials and smart actuators, namely smart screen that uses advanced sensory system to continuously monitor the screening process and make appropriate adjustments to improve production. The theory behind the development of Smart Screen technology is based on two key technologies, namely smart actuators and smart Energy Flow ControlT (EFCT) strategies, developed initially for military applications. Smart Screen technology controls the flow of vibration energy and confines it to the screen rather than shaking much of the mass that makes up the conventional vibratory screening machine. Consequently, Smart Screens eliminates and downsizes many of the structural components associated with conventional vibratory screening machines. As a result, the surface area of the screen increases for a given envelope. This increase in usable screening surface area extends the life of the screens, reduces required maintenance by reducing the frequency of screen change-outs and improves throughput or productivity.
Influence of screening on longitudinal-optical phonon scattering in quantum cascade lasers
International Nuclear Information System (INIS)
Ezhov, Ivan; Jirauschek, Christian
2016-01-01
We theoretically investigate the influence of screening on electron-longitudinal optical phonon scattering in quantum cascade lasers. By employing ensemble Monte Carlo simulations, an advanced screening model based on the random-phase approximation is compared to the more elementary Thomas-Fermi and Debye models. For mid-infrared structures, and to a lesser extent also for terahertz designs, the inclusion of screening is shown to affect the simulated current and optical output power. Furthermore, it is demonstrated that by using the electron temperature rather than the lattice temperature, the Debye model can be significantly improved
Education for screen use as holistic praxis
Directory of Open Access Journals (Sweden)
Lic. José Antonio Gabelas Barroso
2007-09-01
Full Text Available New generations maintain a very close daily relationship with screens (television, Internet, video consoles and mobile telephones. A lot of their leisure time centres on these means of communication with a double purpose: either for playing or communicating with others. These are the two dimensions (recreational and social that dominate the choice of these types of communication in order to entertain oneself and/or establish relationships with their groups of friends. The trend in the consumption of screens has distanced television from its previous monopoly and has meant that it has to share young people’s leisure time with other advanced technological supports. The health of children and adolescents involves educating them towards a healthy and responsible consumption of all screens, in a balanced way as regards dosis and planning, and with criteria as regards the content that could endanger them and the level of their cognitive development.
Wang, Chia-Hung; Naik, Nenavath Gopal; Liao, Lin-Li; Wei, Sung-Chan; Chao, Yu-Chan
2017-09-15
Although baculovirus has been used as a safe and convenient gene delivery vector in mammalian cells, baculovirus-mediated transgene expression is less effective in various mammalian cell lines. Identification of the negative regulators in host cells is necessary to improve baculovirus-based expression systems. Here, we performed high-throughput shRNA library screening, targeting 176 antiviral innate immune genes, and identified 43 host restriction factor genes in a human A549 lung carcinoma cell line. Among them, suppression of receptor interaction protein kinase 1 (RIP1, also known as RIPK1) significantly increased baculoviral transgene expression without resulting in significant cell death. Silencing of RIP1 did not affect viral entry or cell viability, but it did inhibit nuclear translocation of the IRF3 and NF-κB transcription factors. Also, activation of downstream signaling mediators (such as TBK1 and IRF7) was affected, and subsequent interferon and cytokine gene expression levels were abolished. Further, Necrostatin-1 (Nec-1)-an inhibitor of RIP1 kinase activity-dramatically increased baculoviral transgene expression in RIP1-silenced cells. Using baculovirus as a model system, this study presents an initial investigation of large numbers of human cell antiviral innate immune response factors against a "nonadaptive virus." In addition, our study has made baculovirus a more efficient gene transfer vector for some of the most frequently used mammalian cell systems.
Rukuni, Ruramayi; Knight, Marian; Murphy, Michael F; Roberts, David; Stanworth, Simon J
2015-10-20
Iron deficiency anaemia is a common problem in pregnancy despite national recommendations and guidelines for treatment. The aim of this study was to appraise the evidence against the UK National Screening Committee (UKNSC) criteria as to whether a national screening programme could reduce the prevalence of iron deficiency anaemia and/or iron deficiency in pregnancy and improve maternal and fetal outcomes. Search strategies were developed for the Cochrane library, Medline and Embase to identify evidence relevant to UK National Screening Committee (UKNSC) appraisal criteria which cover the natural history of iron deficiency and iron deficiency anaemia, the tests for screening, clinical management and evidence of cost effectiveness. Many studies evaluated haematological outcomes of anaemia, but few analysed clinical consequences. Haemoglobin and ferritin appeared the most suitable screening tests, although future options may follow recent advances in understanding iron homeostasis. The clinical consequences of iron deficiency without anaemia are unknown. Oral and intravenous iron are effective in improving haemoglobin and iron parameters. There have been no trials or economic evaluations of a national screening programme for iron deficiency anaemia in pregnancy. Iron deficiency in pregnancy remains an important problem although effective tests and treatment exist. A national screening programme could be of value for early detection and intervention. However, high quality studies are required to confirm whether this would reduce maternal and infant morbidity and be cost effective.
Staged anticonvulsant screening for chronic epilepsy
Berdichevsky, Yevgeny; Saponjian, Yero; Park, Kyung‐Il; Roach, Bonnie; Pouliot, Wendy; Lu, Kimberly; Swiercz, Waldemar; Dudek, F. Edward; Staley, Kevin J.
2016-01-01
Abstract Objective: Current anticonvulsant screening programs are based on seizures evoked in normal animals. One‐third of epileptic patients do not respond to the anticonvulsants discovered with these models. We evaluated a tiered program based on chronic epilepsy and spontaneous seizures, with compounds advancing from high‐throughput in vitro models to low‐throughput in vivo models. Methods: Epileptogenesis in organotypic hippocampal slice cultures was quantified by lactate production and l...
An experimental investigation of head loss through a triangular “V- shaped” screen
Directory of Open Access Journals (Sweden)
Mahmoud Zayed
2018-03-01
Full Text Available Common traditional screens (screens perpendicular and vertical to the flow direction face extensive problems with screen blockage, which can result in adverse hydraulic, environmental, and economic consequences. Experimentally, this paper presents an advanced trash screen concept to reduce traditional screen problems and improve the hydraulic performance of screens. The traditional screen is re-developed using a triangular V shape with circular bars in the flow direction. Triangular V-shaped screen models with different angles, blockage ratios, circular bar designs, and flow discharges were tested in a scaled physical model. The analyses provide promising results. The findings showed that the head loss coefficients were effectively reduced by using the triangular V-shaped screens with circular bars (α < 90° in comparison with the traditional trash screen (α = 90. Additionally, the results indicated that the head loss across the screen increased with increasing flow discharge and blockage ratio. The losses considerably increase by large percentages when the screen becomes blocked by 40%. Low head losses were recorded at low screen angles for the circular bars. A new head loss equation is recommended for triangular screens with circular bars.
The use of twin-screen-based WIMPS in spacecraft control
Klim, R. D.
1990-10-01
The ergonomic problems of designing a sophisticated Windows Icons Mouse Pop-up (WIMP) based twin screen workstation are outlined. These same problems will be encountered by future spacecraft controllers. The design of a modern, advanced workstation for use on a distributed multicontrol center in a multisatellite control system is outlined. The system uses access control mechanisms to ensure that only authorized personnel can undertake certain operations on the workstation. Rules governing the use of windowing features, screen attributes, icons, keyboard and mouse in spacecraft control are discussed.
Maximizing gain in high-throughput screening using conformal prediction.
Svensson, Fredrik; Afzal, Avid M; Norinder, Ulf; Bender, Andreas
2018-02-21
Iterative screening has emerged as a promising approach to increase the efficiency of screening campaigns compared to traditional high throughput approaches. By learning from a subset of the compound library, inferences on what compounds to screen next can be made by predictive models, resulting in more efficient screening. One way to evaluate screening is to consider the cost of screening compared to the gain associated with finding an active compound. In this work, we introduce a conformal predictor coupled with a gain-cost function with the aim to maximise gain in iterative screening. Using this setup we were able to show that by evaluating the predictions on the training data, very accurate predictions on what settings will produce the highest gain on the test data can be made. We evaluate the approach on 12 bioactivity datasets from PubChem training the models using 20% of the data. Depending on the settings of the gain-cost function, the settings generating the maximum gain were accurately identified in 8-10 out of the 12 datasets. Broadly, our approach can predict what strategy generates the highest gain based on the results of the cost-gain evaluation: to screen the compounds predicted to be active, to screen all the remaining data, or not to screen any additional compounds. When the algorithm indicates that the predicted active compounds should be screened, our approach also indicates what confidence level to apply in order to maximize gain. Hence, our approach facilitates decision-making and allocation of the resources where they deliver the most value by indicating in advance the likely outcome of a screening campaign.
Fecal Molecular Markers for Colorectal Cancer Screening
Directory of Open Access Journals (Sweden)
Rani Kanthan
2012-01-01
Full Text Available Despite multiple screening techniques, including colonoscopy, flexible sigmoidoscopy, radiological imaging, and fecal occult blood testing, colorectal cancer remains a leading cause of death. As these techniques improve, their sensitivity to detect malignant lesions is increasing; however, detection of precursor lesions remains problematic and has generated a lack of general acceptance for their widespread usage. Early detection by an accurate, noninvasive, cost-effective, simple-to-use screening technique is central to decreasing the incidence and mortality of this disease. Recent advances in the development of molecular markers in faecal specimens are encouraging for its use as a screening tool. Genetic mutations and epigenetic alterations that result from the carcinogenetic process can be detected by coprocytobiology in the colonocytes exfoliated from the lesion into the fecal matter. These markers have shown promising sensitivity and specificity in the detection of both malignant and premalignant lesions and are gaining popularity as a noninvasive technique that is representative of the entire colon. In this paper, we summarize the genetic and epigenetic fecal molecular markers that have been identified as potential targets in the screening of colorectal cancer.
Helfand, M; Mahon, S M; Eden, K B; Frame, P S; Orleans, C T
2001-04-01
Malignant melanoma is often lethal, and its incidence in the United States has increased rapidly over the past 2 decades. Nonmelanoma skin cancer is seldom lethal, but, if advanced, can cause severe disfigurement and morbidity. Early detection and treatment of melanoma might reduce mortality, while early detection and treatment of nonmelanoma skin cancer might prevent major disfigurement and to a lesser extent prevent mortality. Current recommendations from professional societies regarding screening for skin cancer vary. To examine published data on the effectiveness of routine screening for skin cancer by a primary care provider, as part of an assessment for the U.S. Preventive Services Task Force. We searched the MEDLINE database for papers published between 1994 and June 1999, using search terms for screening, physical examination, morbidity, and skin neoplasms. For information on accuracy of screening tests, we used the search terms sensitivity and specificity. We identified the most important studies from before 1994 from the Guide to Clinical Preventive Services, second edition, and from high-quality reviews. We used reference lists and expert recommendations to locate additional articles. Two reviewers independently reviewed a subset of 500 abstracts. Once consistency was established, the remainder were reviewed by one reviewer. We included studies if they contained data on yield of screening, screening tests, risk factors, risk assessment, effectiveness of early detection, or cost effectiveness. We abstracted the following descriptive information from full-text published studies of screening and recorded it in an electronic database: type of screening study, study design, setting, population, patient recruitment, screening test description, examiner, advertising targeted at high-risk groups or not targeted, reported risk factors of participants, and procedure for referrals. We also abstracted the yield of screening data including probabilities and numbers
Colorectal cancers detected through screening are associated with lower stages and improved survival
DEFF Research Database (Denmark)
Lindebjerg, Jan; Osler, Merete; Bisgaard, Claus Hedebo
2014-01-01
in the feasibility study cohort were reviewed with respect to the effect of screening participation on stages and survival. MATERIAL AND METHODS: All cases of CRC in a feasibility study cohort diagnosed from the beginning of the study until two years after the study ended were identified. Differences...... in the distribution of colon cancer stages and rectal cancer groups between the various screening categories were analysed through χ(2)-tests. Survival analysis with respect to screening groups was done by Kaplan-Meier and Cox-Mantel hazard ratios, and survival was corrected for lead time. RESULTS: Colon cancers...... detected through screening were diagnosed at significantly lower stages than among screening non-responders. There were relatively fewer locally advanced rectal cancers among patients diagnosed through positive FOBT than among non-responders. Survival among screening cancer patients was superior...
Why mammography screening has not lived up to expectations from the randomised trials
DEFF Research Database (Denmark)
Gøtzsche, Peter C; Jørgensen, Karsten Juhl; Zahl, Per-Henrik
2012-01-01
adjuvant therapy and breast cancer awareness, not screening. We also believe it is more important to reduce the incidence of cancer than to detect it 'early.' Avoiding getting screening mammograms reduces the risk of becoming a breast cancer patient by one-third.......We analysed the relation between tumour sizes and stages and the reported effects on breast cancer mortality with and without screening in trials and observational studies. The average tumour sizes in all the trials suggest only a 12% reduction in breast cancer mortality, which agrees with the 10......% reported in the most reliable trials. Recent studies of tumour sizes and tumour stages show that screening has not lowered the rate of advanced cancers. In agreement with this, recent observational studies of breast cancer mortality have failed to find an effect of screening. In contrast, screening leads...
Wang, Wen-Xia; Sun, Shan-Zhen; Song, Ying
2008-06-01
To construct a short hairpin RNA(shRNA) interference expression plasmid vector of survivin gene, transfect tongue squamous cell carcinoma line Tca8113 which expressed survivin gene in a high level, and choose the cells whose survivin gene were suppressed significantly. Two pairs of oligonucleotide sequences specific for survivin gene were designed and synthesized, and cloned into pSilencer-2.1U6-neo plasmid. The recombinant plasmids (named PS1 and PS2) were amplified in Ecoli. DH5alpha was identified by restriction digestion, PCR and sequencing. The vectors were transfected into Tca8113 cells with lipofectamine 2000. After selection with G418, the stable cell clones were attained. Survivn expression was assayed with real-time quantitative PCR and Western blotting. SAS8.0 software package was used for Student t test. Two vectors were constructed successfully and stable cell clones with PS1 or PS2 plasmid were obtained. As compared with those of control, survivin expression of transfected cell with PS1 or PS2 in mRNA level was significantly suppressed (P<0.05). In protein level, only those of transfected cell with PS2 was significantly suppressed (P<0.01). The shRNA interference expression plasmid vectors of survivin gene are successfully constructed, and Tca8113 cells which express survivin gene in a stable lower level are attained, which enable us to carry out further research on gene therapy of oral squamous cell carcinoma. Supported by National Natural Science Foundation of China (Grant No.30572056).
Horeweg, Nanda; Scholten, Ernst Th; de Jong, Pim A; van der Aalst, Carlijn M; Weenink, Carla; Lammers, Jan-Willem J; Nackaerts, Kristiaan; Vliegenthart, Rozemarijn; ten Haaf, Kevin; Yousaf-Khan, Uraujh A; Heuvelmans, Marjolein A; Thunnissen, Erik; Oudkerk, Matthijs; Mali, Willem; de Koning, Harry J
2014-11-01
median follow-up of 8·16 years (IQR 7·56-8·56). 187 (3%) of 7155 screened participants were diagnosed with 196 screen-detected lung cancers, and another 34 (advanced stages (29 [83%] of 35 interval cancers vs 44 [22%] of 196 screen-detected cancers diagnosed in stage III or IV; pNELSON trial yielded high specificity and sensitivity, with only a small number of interval cancers. The results of this study could be used to improve screening algorithms, and reduce the number of missed cancers. Zorgonderzoek Nederland Medische Wetenschappen and Koningin Wilhelmina Fonds. Copyright © 2014 Elsevier Ltd. All rights reserved.
Barriers for breast cancer screening among Asian women: a mini literature review.
Parsa, Parisa; Kandiah, Mirnalini; Abdul Rahman, H; Zulkefli, Na Mohd
2006-01-01
Breast cancer is the most commonly diagnosed cancer among Asian women. Breast cancer is detected in advanced stages and among younger age group women in Asia. The delay in presentation is attributed mainly to the social-cultural perception of the disease, poverty, and the strong influence of traditional medicine. Many of Asian women are not aware of the importance of regular screening. Cultural attitudes toward breast cancer screening tests, modesty, lack of encouragement by family members and physicians are the major inhibitors to women's participation in breast cancer screening. Health education using media and community health programs to create awareness of the advantages of earlier presentation and diagnosis of breast cancer in Asian women can motivate participation in breast cancer screening programs.
Immunochemical faecal occult blood test for colorectal cancer screening: a systematic review.
Syful Azlie, M F; Hassan, M R; Junainah, S; Rugayah, B
2015-02-01
A systematic review on the effectiveness and costeffectiveness of Immunochemical faecal occult IFOBT for CRC screening was carried out. A total of 450 relevant titles were identified, 41 abstracts were screened and 18 articles were included in the results. There was fair level of retrievable evidence to suggest that the sensitivity and specificity of IFOBT varies with the cut-off point of haemoglobin, whereas the diagnostic accuracy performance was influenced by high temperature and haemoglobin stability. A screening programme using IFOBT can be effective for prevention of advanced CRC and reduced mortality. There was also evidence to suggest that IFOBT is cost-effective in comparison with no screening, whereby a two-day faecal collection method was found to be costeffective as a means of screening for CRC. Based on the review, quantitative IFOBT method can be used in Malaysia as a screening test for CRC. The use of fully automated IFOBT assay would be highly desirable.
Diagnostic mode and tumor stage of breast cancers in the setting of opportunistic screening
International Nuclear Information System (INIS)
Graf, O.; Hopf, G.; Obermayer, M.; Fruehwald, F.; Scheurecker, A.; Kramer, J.
2006-01-01
Purpose: To analyze data at the time of diagnosis of breast cancer in three radiology practices in Austria in the setting of opportunistic screening. Materials and methods: In 529 women (ages 31 - 89, mean age 61.1) with breast cancer, the mode of diagnosis (detected clinically or by opportunistic screening), the local tumor stages, and intervals between screening examinations were assessed. Results: In 33.6% (178 of 529) of the cases, the breast cancer was detected clinically, and in 66.4% (351 of 529) of the cases, the cancer was detected by opportunistic screening. Cancers in prognostically favorable stages (in situ carcinomas, pT1 a, pT1 b, pT1c) were detected by opportunistic screening in 79.9% of the cases. The clinically detected cancers were in locally advanced stages (pT2, pT3) in 58.4% of the cases. In the majority of clinically detected cases (75%), the women had never had a mammogram before or had not had a recent one. In 13% of the cases detected by opportunistic screening, diagnosis was made during the first exam, in 40% of the cases, the period since the last mammogram was less than 24 months, and in 47% of the cases, this period was greater than 24 months. Conclusion: In our patients the majority of breast cancers were detected in early stages by opportunistic screening. The use of an organized system with exams at regular intervals may further reduce the number of advanced cancers. (orig.)
Smith, Alec S T; Macadangdang, Jesse; Leung, Winnie; Laflamme, Michael A; Kim, Deok-Ho
Improved methodologies for modeling cardiac disease phenotypes and accurately screening the efficacy and toxicity of potential therapeutic compounds are actively being sought to advance drug development and improve disease modeling capabilities. To that end, much recent effort has been devoted to the development of novel engineered biomimetic cardiac tissue platforms that accurately recapitulate the structure and function of the human myocardium. Within the field of cardiac engineering, induced pluripotent stem cells (iPSCs) are an exciting tool that offer the potential to advance the current state of the art, as they are derived from somatic cells, enabling the development of personalized medical strategies and patient specific disease models. Here we review different aspects of iPSC-based cardiac engineering technologies. We highlight methods for producing iPSC-derived cardiomyocytes (iPSC-CMs) and discuss their application to compound efficacy/toxicity screening and in vitro modeling of prevalent cardiac diseases. Special attention is paid to the application of micro- and nano-engineering techniques for the development of novel iPSC-CM based platforms and their potential to advance current preclinical screening modalities. Published by Elsevier Inc.
Generalizability of results from the National Lung Screening Trial
International Nuclear Information System (INIS)
Heuvers, Marlies E.; Wisnivesky, Juan; Stricker, Bruno H.; Aerts, Joachim G.
2012-01-01
Lung cancer is the major cause of cancer-related death worldwide, with a 5-year survival of only 16 %. Most lung cancer cases are diagnosed at an advanced incurable stage. As earlier stages have a better prognosis, the key to reducing mortality could be early diagnosis of the disease. At present, low-dose computed tomographic (CT) screening has shown promising data. Lung cancer death rates were reduced by 20 % when CT screening is compared to chest radiography in a high-risk group. There are many advantages of CT screening in lung cancer, however there are also some important issues that should be taken into account. Therefore, the applicability of the results to clinical practice is not clear yet. In this Commentary we discuss different aspects that play important roles in the balance between harms and benefits of screening, including overdiagnosis, availability of treatment options worldwide, ethical considerations, costs, and prolonged life expectancy. We conclude that clinicians should be cautious in generalizing findings to the total population of smokers and take into account that the use of lung cancer screening in clinical practice may have limitations.
Staged anticonvulsant screening for chronic epilepsy.
Berdichevsky, Yevgeny; Saponjian, Yero; Park, Kyung-Il; Roach, Bonnie; Pouliot, Wendy; Lu, Kimberly; Swiercz, Waldemar; Dudek, F Edward; Staley, Kevin J
2016-12-01
Current anticonvulsant screening programs are based on seizures evoked in normal animals. One-third of epileptic patients do not respond to the anticonvulsants discovered with these models. We evaluated a tiered program based on chronic epilepsy and spontaneous seizures, with compounds advancing from high-throughput in vitro models to low-throughput in vivo models. Epileptogenesis in organotypic hippocampal slice cultures was quantified by lactate production and lactate dehydrogenase release into culture media as rapid assays for seizure-like activity and cell death, respectively. Compounds that reduced these biochemical measures were retested with in vitro electrophysiological confirmation (i.e., second stage). The third stage involved crossover testing in the kainate model of chronic epilepsy, with blinded analysis of spontaneous seizures after continuous electrographic recordings. We screened 407 compound-concentration combinations. The cyclooxygenase inhibitor, celecoxib, had no effect on seizures evoked in normal brain tissue but demonstrated robust antiseizure activity in all tested models of chronic epilepsy. The use of organotypic hippocampal cultures, where epileptogenesis occurs on a compressed time scale, and where seizure-like activity and seizure-induced cell death can be easily quantified with biomarker assays, allowed us to circumvent the throughput limitations of in vivo chronic epilepsy models. Ability to rapidly screen compounds in a chronic model of epilepsy allowed us to find an anticonvulsant that would be missed by screening in acute models.
Adenoma detection in patients undergoing a comprehensive colonoscopy screening
International Nuclear Information System (INIS)
Raju, Gottumukkala S; Vadyala, Vikram; Slack, Rebecca; Krishna, Somashekar G; Ross, William A; Lynch, Patrick M; Bresalier, Robert S; Hawk, Ernest; Stroehlein, John R
2013-01-01
Measures shown to improve the adenoma detection during colonoscopy (excellent bowel preparation, cecal intubation, cap fitted colonoscope to examine behind folds, patient position change to optimize colon distention, trained endoscopy team focusing on detection of subtle flat lesions, and incorporation of optimum endoscopic examination with adequate withdrawal time) are applicable to clinical practice and, if incorporated are projected to facilitate comprehensive colonoscopy screening program for colon cancer prevention. To determine adenoma and serrated polyp detection rate under conditions designed to optimize quality parameters for comprehensive screening colonoscopy. Retrospective analysis of data obtained from a comprehensive colon cancer screening program designed to optimize quality parameters. Academic medical center. Three hundred and forty-three patients between the ages of 50 years and 75 years who underwent first screening colonoscopy between 2009 and 2011 among 535 consecutive patients undergoing colonoscopy. Comprehensive colonoscopy screening program was utilized to screen all patients. Cecal intubation was successful in 98.8% of patients. The Boston Bowel Preparation Scale for quality of colonoscopy was 8.97 (95% confidence interval [CI]; 8.94, 9.00). The rate of adenoma detection was 60% and serrated lesion (defined as serrated adenomas or hyperplastic polyps proximal to the splenic flexure) detection was 23%. The rate of precancerous lesion detection (adenomas and serrated lesions) was 66%. The mean number of adenomas per screening procedure was 1.4 (1.2, 1.6) and the mean number of precancerous lesions (adenomas or serrated lesions) per screening procedure was 1.6 (1.4, 1.8). Retrospective study and single endoscopist experience. A comprehensive colonoscopy screening program results in high-quality screening with high detection of adenomas, advanced adenomas, serrated adenomas, and multiple adenomas
Are screening processes effective instruments and what are the environmental benefits?
DEFF Research Database (Denmark)
Nielsen, Eskild Holm; Christensen, Per; Kørnøv, Lone
2003-01-01
Environmental Impact Assessment (EIA)is the process by which the effects that proposed projects are likely to have with respect to a number of environmental criteria is evaluated. Screening is an activity carried out in advance of an EIA to determine whether, in fact, it is necessary to undertake...... a full assessment.The paper discuss the extent of changes due to the screening process, and ask questions like what kind of environmental considerations do the changes reflect? And are they in line with EIA's holistic environmental approach?...
Blunt Cerebrovascular Injuries: Advances in Screening, Imaging, and Management Trends.
Nagpal, P; Policeni, B A; Bathla, G; Khandelwal, A; Derdeyn, C; Skeete, D
2017-10-12
Blunt cerebrovascular injury is a relatively uncommon but sometimes life-threatening injury, particularly in patients presenting with ischemic symptoms in that vascular territory. The decision to pursue vascular imaging (generally CT angiography) is based on clinical and imaging findings. Several grading scales or screening criteria have been developed to guide the decision to pursue vascular imaging, as well as to recommend different treatment options for various injuries. The data supporting many of these guidelines and options are limited however. The purpose of this article is to review and compare these scales and criteria and the data supporting clinical efficacy and to make recommendations for future research in this area. © 2017 by American Journal of Neuroradiology.
Zhan, F Benjamin; Lin, Yan
2014-01-01
Advanced-stage diagnosis is among the primary causes of mortality among cervical cancer patients. With the wide use of Pap smear screening, cervical cancer advanced-stage diagnosis rates have decreased. However, disparities of advanced-stage diagnosis persist among different population groups. A challenging task in cervical cancer disparity reduction is to identify where underserved population groups are. Based on cervical cancer incidence data between 1995 and 2008, this study investigated advanced-stage cervical cancer disparities in Texas from three social domains: Race/ethnicity, socioeconomic status (SES), and geographic location. Effects of individual and contextual factors, including age, tumor grade, race/ethnicity, as well as contextual SES, spatial access to health care, sociocultural factors, percentage of African Americans, and insurance expenditures, on these disparities were examined using multilevel logistic regressions. Significant variations by race/ethnicity and SES were found in cervical cancer advanced-stage diagnosis. We also found a decline in racial/ethnic disparities of advanced cervical cancer diagnosis rate from 1995 to 2008. However, the progress was slower among African Americans than Hispanics. Geographic disparities could be explained by age, race/ethnicity, SES, and the percentage of African Americans in a census tract. Our findings have important implications for developing effective cervical cancer screening and control programs. We identified the location of underserved populations who need the most assistance with cervical cancer screening. Cervical cancer intervention programs should target Hispanics and African Americans, as well as individuals from communities with lower SES in geographic areas where higher advanced-stage diagnosis rates were identified in this study. Copyright © 2014 Jacobs Institute of Women's Health. Published by Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Lam, J U H; Elfström, K M; Ejegod, D. M.
2018-01-01
precancer lesions. Here, we compare the cervical intraepithelial neoplasia grade 2 or worse (⩾CIN2) detection rate between non-attenders who participated in self-sampling and women attending routine screening. METHODS: A total of 23 632 women who were qualified as non-attenders in the Copenhagen Region were......BACKGROUND: Self-sampling for human papillomavirus (HPV) offered to women who do not participate in cervical cancer screening is an increasingly popular method to increase screening coverage. The rationale behind self-sampling is that unscreened women harbour a high proportion of undetected...... higher detection rates for ⩾CIN2 than routine cytology-based screening, and similar detection rates as HPV and cytology co-testing. This reinforces the importance of self-sampling for screening non-attenders in organised cervical cancer screening.British Journal of Cancer advance online publication, 14...
QSAR Methods to Screen Endocrine Disruptors
Directory of Open Access Journals (Sweden)
Nicola Porta
2016-08-01
Full Text Available The identification of endocrine disrupting chemicals (EDCs is one of the important goals of environmental chemical hazard screening. We report on in silico methods addressing toxicological studies about EDCs with a special focus on the application of QSAR models for screening purpose. Since Estrogen-like (ER activity has been extensively studied, the majority of the available models are based on ER-related endpoints. Some of these models are here reviewed and described. As example for their application, we screen an assembled dataset of candidate substitutes for some known EDCs belonging to the chemical classes of phthalates, bisphenols and parabens, selected considering their toxicological relevance and broad application, with the general aim of preliminary assessing their ED potential. The goal of the substitution processes is to advance inherently safer chemicals and products, consistent with the principles of green chemistry. Results suggest that the integration of a family of different models accounting for different endpoints can be a convenient way to describe ED as properly as possible and allow also both to increase the confidence of the predictions and to maximize the probability that most active compounds are correctly found.
ESR/ERS white paper on lung cancer screening
Energy Technology Data Exchange (ETDEWEB)
Kauczor, Hans-Ulrich; Stackelberg, Oyunbileg von [University Hospital Heidelberg, Dept of Diagnostic and Interventional Radiology, Heidelberg (Germany); Member of the German Lung Research Center, Translational Lung Research Center, Heidelberg (Germany); Bonomo, Lorenzo [A. Gemelli University Hospital, Institute of Radiology, Rome (Italy); Gaga, Mina [Athens Chest Hospital, 7th Resp. Med. Dept and Asthma Center, Athens (Greece); Nackaerts, Kristiaan [KU Leuven-University of Leuven, University Hospitals Leuven, Department of Respiratory Diseases/Respiratory Oncology Unit, Leuven (Belgium); Peled, Nir [Tel Aviv University, Davidoff Cancer Center, Rabin Medical Center, Tel Aviv (Israel); Prokop, Mathias [Radboud University Medical Center, Department of Radiology and Nuclear Medicine, Nijmegen (Netherlands); Remy-Jardin, Martine [Department of Thoracic Imaging, Hospital Calmette (EA 2694), CHRU et Universite de Lille, Lille (France); Sculier, Jean-Paul [Universite Libre de Bruxelles, Thoracic oncology, Institut Jules Bordet, Brussels (Belgium); Collaboration: on behalf of the European Society of Radiology (ESR) and the European Respiratory Society (ERS)
2015-09-15
Lung cancer is the most frequently fatal cancer, with poor survival once the disease is advanced. Annual low-dose computed tomography has shown a survival benefit in screening individuals at high risk for lung cancer. Based on the available evidence, the European Society of Radiology and the European Respiratory Society recommend lung cancer screening in comprehensive, quality-assured, longitudinal programmes within a clinical trial or in routine clinical practice at certified multidisciplinary medical centres. Minimum requirements include: standardised operating procedures for low-dose image acquisition, computer-assisted nodule evaluation, and positive screening results and their management; inclusion/exclusion criteria; expectation management; and smoking cessation programmes. Further refinements are recommended to increase quality, outcome and cost-effectiveness of lung cancer screening: inclusion of risk models, reduction of effective radiation dose, computer-assisted volumetric measurements and assessment of comorbidities (chronic obstructive pulmonary disease and vascular calcification). All these requirements should be adjusted to the regional infrastructure and healthcare system, in order to exactly define eligibility using a risk model, nodule management and a quality assurance plan. The establishment of a central registry, including a biobank and an image bank, and preferably on a European level, is strongly encouraged. (orig.)
ESR/ERS white paper on lung cancer screening
International Nuclear Information System (INIS)
Kauczor, Hans-Ulrich; Stackelberg, Oyunbileg von; Bonomo, Lorenzo; Gaga, Mina; Nackaerts, Kristiaan; Peled, Nir; Prokop, Mathias; Remy-Jardin, Martine; Sculier, Jean-Paul
2015-01-01
Lung cancer is the most frequently fatal cancer, with poor survival once the disease is advanced. Annual low-dose computed tomography has shown a survival benefit in screening individuals at high risk for lung cancer. Based on the available evidence, the European Society of Radiology and the European Respiratory Society recommend lung cancer screening in comprehensive, quality-assured, longitudinal programmes within a clinical trial or in routine clinical practice at certified multidisciplinary medical centres. Minimum requirements include: standardised operating procedures for low-dose image acquisition, computer-assisted nodule evaluation, and positive screening results and their management; inclusion/exclusion criteria; expectation management; and smoking cessation programmes. Further refinements are recommended to increase quality, outcome and cost-effectiveness of lung cancer screening: inclusion of risk models, reduction of effective radiation dose, computer-assisted volumetric measurements and assessment of comorbidities (chronic obstructive pulmonary disease and vascular calcification). All these requirements should be adjusted to the regional infrastructure and healthcare system, in order to exactly define eligibility using a risk model, nodule management and a quality assurance plan. The establishment of a central registry, including a biobank and an image bank, and preferably on a European level, is strongly encouraged. (orig.)
LENUS (Irish Health Repository)
Kelley, Leanne
2013-06-10
AIM: This study examined the relevance of using a two sample quantitative immunochemical faecal occult blood test (iFOBT or FIT) at a high cut off stringency by the first population-based colorectal cancer (CRC) pilot screening programme in Ireland. METHOD: Approximately ten thousand individuals between the ages of 50-74 years were invited to perform two consecutive FITs. These were analysed in tandem using the OC-Sensor and participants with at least one positive result with a haemoglobin cut off for positivity at 100 ng\\/ml were offered colonoscopy. RESULTS: A total of 5023 (52%) (2177 (43%) male; 2846 (57%) female) individuals with a median age of 64 years participated. At least one positive FIT test was detected from 514 (10%) individuals. From the 419 (82%) patients who proceeded to colonoscopy 17 (4%) had CRC and 132(33%) had an advanced adenoma. The detection rate for these screen relevant lesions was 3% (95% CIs = 2.5% - 3.5%) and the FIT positive + colonoscopy detection rate was 36% (95% CI = 31% - 40%). The numbers needed to colonoscope to find an advanced lesion was 2.8. The two test system detected four (23.5%) additional patients with CRC and 37 (28%) with an advanced adenoma compared with a single test. CONCLUSION: The CRC miss rate estimated for a single test (23.5%) was unacceptably high when the goal was to maximize the discovery of advanced lesions in the initial screening round. We conclude that the two test protocol at a high cut off threshold is suitable to optimize FIT screening in Ireland. This article is protected by copyright. All rights reserved.
[Generalized neonatal screening based on laboratory tests].
Ardaillou, Raymond; Le Gall, Jean-Yves
2006-11-01
Implementation of a generalized screening program for neonatal diseases must obey precise rules. The disease must be severe, recognizable at an early stage, amenable to an effective treatment, detectable with a non expensive and widely applicable test; it must also be a significant public health problem. Subjects with positive results must be offered immediate treatment or prevention. All screening programs must be regularly evaluated. In France, since 1978, a national screening program has been organized by a private association ("Association française pour le dépistage et la prévention des handicaps de l'enfant") and supervised by the "Caisse nationale d'assurance maladie" and "Direction Générale de la Sante". Five diseases are now included in the screening program: phenylketonuria, hypothyroidism, congenital adrenal hyperplasia, cystic fibrosis and sickle cell disease (the latter only in at-risk newborns). Toxoplasmosis is a particular problem because only the children of mothers who were not tested during the pregnancy or who seroconverted are screened. Neonatal screening for phenylketonuria and hypothyrodism is unanimously recommended. Screening for congenital adrenal hyperplasia is approved in most countries. Cases of sickle cell disease and cystic fibrosis are more complex because--not all children who carry the mutations develop severe forms;--there is no curative treatment;--parents may become anxious, even though the phenotype is sometimes mild or even asymptomatic. Supporters of screening stress the benefits of early diagnosis (which extends the life expectancy of these children, particularly in the case of sickle cell disease), the fact that it opens up the possibility of prenatal screening of future pregnancies, and the utility of informing heterozygous carriers identified by familial screening. Neonatal screening for other diseases is under discussion. Indeed, technical advances such as tandem mass spectrometry make it possible to detect about 50
Directory of Open Access Journals (Sweden)
Koekenbier Rik H
2010-10-01
Full Text Available Abstract Background Implementing Chlamydia trachomatis screening in the Netherlands has been a point of debate for several years. The National Health Council advised against implementing nationwide screening until additional data collected from a pilot project in 2003 suggested that screening by risk profiles could be effective. A continuous increase in infections recorded in the national surveillance database affirmed the need for a more active approach. Here, we describe the rationale, design, and implementation of a Chlamydia screening demonstration programme. Methods A systematic, selective, internet-based Chlamydia screening programme started in April 2008. Letters are sent annually to all 16 to 29-year-old residents of Amsterdam, Rotterdam, and selected municipalities of South Limburg. The letters invite sexually active persons to login to http://www.chlamydiatest.nl with a personal code and to request a test kit. In the lower prevalence area of South Limburg, test kits can only be requested if the internet-based risk assessment exceeds a predefined value. Results We sent invitations to 261,025 people in the first round. One-fifth of the invitees requested a test kit, of whom 80% sent in a sample for testing. The overall positivity rate was 4.2%. Conclusions This programme advances Chlamydia control activities in the Netherlands. Insight into the feasibility, effectiveness, cost-effectiveness, and impact of this large-scale screening programme will determine whether the programme will be implemented nationally.
de Glas, Nienke A; de Craen, Anton J M; Bastiaannet, Esther; Op 't Land, Ester G; Kiderlen, Mandy; van de Water, Willemien; Siesling, Sabine; Portielje, Johanneke E A; Schuttevaer, Herman M; de Bock, Geertruida Truuske H; van de Velde, Cornelis J H; Liefers, Gerrit-Jan
2014-09-14
To assess the incidence of early stage and advanced stage breast cancer before and after the implementation of mass screening in women aged 70-75 years in the Netherlands in 1998. Prospective nationwide population based study. National cancer registry, the Netherlands. Patients aged 70-75 years with a diagnosis of invasive or ductal carcinoma in situ breast cancer between 1995 and 2011 (n=25,414). Incidence rates were calculated using population data from Statistics Netherlands. Incidence rates of early stage (I, II, or ductal carcinoma in situ) and advanced stage (III and IV) breast cancer before and after implementation of screening. Hypotheses were formulated before data collection. The incidence of early stage tumours significantly increased after the extension for implementation of screening (248.7 cases per 100,000 women before screening up to 362.9 cases per 100,000 women after implementation of screening, incidence rate ratio 1.46, 95% confidence interval 1.40 to 1.52, Pbreast cancers decreased to a far lesser extent (58.6 cases per 100,000 women before screening to 51.8 cases per 100,000 women after implementation of screening, incidence rate ratio 0.88, 0.81 to 0.97, Pbreast cancer, while that of early stage tumours has strongly increased. © de Glas et al 2014.
Overdiagnosis in breast cancer screening: The impact of study design and calculations.
Lynge, Elsebeth; Beau, Anna-Belle; Christiansen, Peer; von Euler-Chelpin, My; Kroman, Niels; Njor, Sisse; Vejborg, Ilse
2017-07-01
Overdiagnosis in breast cancer screening is an important issue. A recent study from Denmark concluded that one in three breast cancers diagnosed in screening areas in women aged 50-69 years were overdiagnosed. The purpose of this short communication was to disentangle the study's methodology in order to evaluate the soundness of this conclusion. We found that both the use of absolute differences as opposed to ratios; the sole focus on non-advanced tumours and the crude allocation of tumours and person-years by screening history for women aged 70-84 years, all contributed to the very high estimate of overdiagnosis. Screening affects cohorts of screened women. Danish registers allow very accurate mapping of the fate of every woman. We should be past the phase where studies of overdiagnosis are based on the fixed age groups from routine statistics. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.
Newborn Screening for Primary Immunodeficiency Diseases: The Past, the Present and the Future
Directory of Open Access Journals (Sweden)
Jovanka King
2017-08-01
Full Text Available Primary immunodeficiency diseases (PID are a heterogeneous group of disorders caused by inborn errors of immunity, with affected children presenting with severe, recurrent or unusual infections. Over 300 distinct genetic molecular abnormalities resulting in PID have been identified, and this number continues to rise. Newborn screening for PID has been established in many countries, with the majority of centers using a PCR-based T cell receptor excision circle (TREC assay to screen for severe combined immunodeficiency (SCID and other forms of T cell lymphopenia. Multiplexed screening including quantitation of kappa-recombining exclusion circles (KREC has also been described, offering advantages over TREC screening alone. Screening technologies are also expanding to include protein-based assays to identify complement deficiencies and granulocyte disorders. Given the rapid advances in genomic medicine, a potential future direction is the application of next-generation sequencing (NGS technologies to screen infants for a panel of genetic mutations, which would enable identification of a wide range of diseases. However, several ethical and economic issues must be considered before moving towards this screening strategy.
Mining collections of compounds with Screening Assistant 2.
Guilloux, Vincent Le; Arrault, Alban; Colliandre, Lionel; Bourg, Stéphane; Vayer, Philippe; Morin-Allory, Luc
2012-08-31
High-throughput screening assays have become the starting point of many drug discovery programs for large pharmaceutical companies as well as academic organisations. Despite the increasing throughput of screening technologies, the almost infinite chemical space remains out of reach, calling for tools dedicated to the analysis and selection of the compound collections intended to be screened. We present Screening Assistant 2 (SA2), an open-source JAVA software dedicated to the storage and analysis of small to very large chemical libraries. SA2 stores unique molecules in a MySQL database, and encapsulates several chemoinformatics methods, among which: providers management, interactive visualisation, scaffold analysis, diverse subset creation, descriptors calculation, sub-structure / SMART search, similarity search and filtering. We illustrate the use of SA2 by analysing the composition of a database of 15 million compounds collected from 73 providers, in terms of scaffolds, frameworks, and undesired properties as defined by recently proposed HTS SMARTS filters. We also show how the software can be used to create diverse libraries based on existing ones. Screening Assistant 2 is a user-friendly, open-source software that can be used to manage collections of compounds and perform simple to advanced chemoinformatics analyses. Its modular design and growing documentation facilitate the addition of new functionalities, calling for contributions from the community. The software can be downloaded at http://sa2.sourceforge.net/.
Directory of Open Access Journals (Sweden)
Ping-Hsiu Wu
2013-06-01
Conclusion: In comparison with the outcomes of the HPS database, the screening efficacy of the PPS database is even for detecting colorectal carcinoma but is limited in detecting advanced adenoma. HPS may provide comprehensive validity indicators and will be helpful in adjusting current policies for improving screening performance.
2016-01-01
This Sixth volume in the series The Key Debates. Mutations and Appropriations in European Film Studies investigates the question of screens in the context both of the dematerialization due to digitalization and the multiplication of media screens. Scholars offer various infomations and theories of topics such as the archeology of screen, film and media theories, contemporary art, pragmatics of new ways of screening (from home video to street screening).
Cancer Screening Practice among Iranian Middle-aged Women
Directory of Open Access Journals (Sweden)
Behnaz Enjezab
2016-10-01
Full Text Available Background & aim: Breast, cervical, and colorectal cancers are the leading causes of mortality among women, the incidence rate of which has an upward trend with advancing age. Although cost-effective, easy, and available screening programs can help control these types of cancer in their early stages, it seems that cancer screening programs have not been implemented effectively. In this study, we investigated the rate of cancer screening practice in middle-aged women and explained the influential factors. Methods: This cross-sectional study with a sequential mixed method approach was conducted on 483 middle-age women selected through cluster random sampling in Yazd, Iran. Data were obtained by a research made questionnaire and analyzed with descriptive statistics and performing Pearson product-moment correlation, Student’s t-test, and One-way ANOVA tests, using SPSS version 16. In the second phase of the study, qualitative, semi-structured interviews were performed and data were analyzed through content analysis. Results: The majority of the subjects had never been screened for cancer through mammogram (87.7%, Pap test (64.2%, or fecal occult blood test (FOBT (89.8%. Educational level, employment status, perceived adequacy of income, perceived health status, and the number of children were significantly associated with breast and colon cancer screening practice. Qualitative data showed that lack of knowledge, the cost of screening exams, lack of financial independence, negligence of spouse, fear of cancer, embarrassment, and belief in destiny were the main reasons for non-adherence to cancer screening tests. In addition, knowledge and observing cancer in acquaintances and relatives were the main motivators of cancer screening. Conclusion: Middle-aged housewives, as well as women with low educational level and income were the most vulnerable groups, who did not adhere to cancer screening. Planning and management of cancer preventive programs and
Chuang, Shu-Lin; Su, William Wang-Yu; Chen, Sam Li-Sheng; Yen, Amy Ming-Fang; Wang, Cheng-Ping; Fann, Jean Ching-Yuan; Chiu, Sherry Yueh-Hsia; Lee, Yi-Chia; Chiu, Han-Mo; Chang, Dun-Cheng; Jou, Yann-Yuh; Wu, Chien-Yuan; Chen, Hsiu-Hsi; Chen, Mu-Kuan; Chiou, Shu-Ti
2017-05-01
To reduce oral cancer mortality, an organized, population-based screening program for the early detection of oral premalignancy and oral cancer was designed for high-risk individuals with habits of betel quid chewing, cigarette smoking, or both. The objective of this report was to evaluate the long-term effectiveness of this program in reducing the incidence of advanced disease and deaths from oral cancer. A nationwide, population-based screening program for oral cancer has been conducted in Taiwan since 2004. Residents aged ≥ 18 years with oral habits of cigarette smoking and/or betel quid chewing were invited. The standardized mortality ratio method was used to compare the observed numbers of advanced oral cancers and deaths from oral cancer among screening attendees with the expected numbers derived from mortality among nonattendees. An intention-to-treat analysis of the relative rate of reductions in advanced-stage oral cancers and oral cancer mortality also was conducted. The overall screening rate was 55.1%. The relative risk of death from oral cancer was 0.53 (95% confidence interval [CI], 0.51-0.56) as a result of screening compared with the expected risk of oral cancer deaths in the absence of screening. The corresponding relative risk was 0.74 (95% CI, 0.72-0.77) after adjusting for self-selection bias. The relative risk of advanced oral cancer for the screened group versus the nonscreened group was 0.62 (95% CI, 0.59-0.64), which increased to 0.79 (95% CI, 0.76-0.82) after adjustment for self-selection bias. An organized, population-based oral cancer screening program targeting more than 2 million Taiwanese cigarette smokers and/or betel quid chewers demonstrated the effectiveness of reducing stage III or IV oral cancers and oral cancer mortality. These evidence-based findings corroborate and support the screening strategy of oral visual inspection for the prevention of oral cancer among high-risk individuals in areas with a high incidence of oral
Advancing Social Workers' Responsiveness to Health Disparities: The Case of Breast Cancer Screening
Altpeter, Mary; Mitchell, James F.; Pennell, Joan
2005-01-01
This study provides the basis for customizing culturally responsive social work health promotion programs aimed at eliminating breast cancer screening and mortality disparities between white and African American women. Survey data collected from a random sample of 853 women in rural North Carolina were used to explore the impact of psychosocial…
Advances in phage display technology for drug discovery.
Omidfar, Kobra; Daneshpour, Maryam
2015-06-01
Over the past decade, several library-based methods have been developed to discover ligands with strong binding affinities for their targets. These methods mimic the natural evolution for screening and identifying ligand-target interactions with specific functional properties. Phage display technology is a well-established method that has been applied to many technological challenges including novel drug discovery. This review describes the recent advances in the use of phage display technology for discovering novel bioactive compounds. Furthermore, it discusses the application of this technology to produce proteins and peptides as well as minimize the use of antibodies, such as antigen-binding fragment, single-chain fragment variable or single-domain antibody fragments like VHHs. Advances in screening, manufacturing and humanization technologies demonstrate that phage display derived products can play a significant role in the diagnosis and treatment of disease. The effects of this technology are inevitable in the development pipeline for bringing therapeutics into the market, and this number is expected to rise significantly in the future as new advances continue to take place in display methods. Furthermore, a widespread application of this methodology is predicted in different medical technological areas, including biosensing, monitoring, molecular imaging, gene therapy, vaccine development and nanotechnology.
Breast cancer screening programmes: the development of a monitoring and evaluation system.
Day, N E; Williams, D R; Khaw, K T
1989-06-01
It is important that the introduction of breast screening is closely monitored. The anticipated effect on breast cancer mortality will take 10 years or more fully to emerge, and will only occur if a succession of more short-term end points are met. Data from the Swedish two-county randomised trial provide targets that should be achieved, following a logical progression of compliance with the initial invitation, prevalence and stage distribution at the prevalence screen, the rate of interval cancers after the initial screen, the pick-up rate and stage distribution at later screening tests, the rate of interval cancers after later tests, the absolute rate of advanced cancer and finally the breast cancer mortality rate. For evaluation purposes, historical data on stage at diagnosis is desirable; it is suggested that tumour size is probably the most relevant variable available in most cases.
Detection of Antibiotics and Evaluation of Antibacterial Activity with Screen-Printed Electrodes
Directory of Open Access Journals (Sweden)
Florentina-Daniela Munteanu
2018-03-01
Full Text Available This review provides a brief overview of the fabrication and properties of screen-printed electrodes and details the different opportunities to apply them for the detection of antibiotics, detection of bacteria and antibiotic susceptibility. Among the alternative approaches to costly chromatographic or ELISA methods for antibiotics detection and to lengthy culture methods for bacteria detection, electrochemical biosensors based on screen-printed electrodes present some distinctive advantages. Chemical and (biosensors for the detection of antibiotics and assays coupling detection with screen-printed electrodes with immunomagnetic separation are described. With regards to detection of bacteria, the emphasis is placed on applications targeting viable bacterial cells. While the electrochemical sensors and biosensors face many challenges before replacing standard analysis methods, the potential of screen-printed electrodes is increasingly exploited and more applications are anticipated to advance towards commercial analytical tools.
The utility of alpha-fetoprotein screening in Beckwith-Wiedemann syndrome.
Duffy, Kelly A; Deardorff, Matthew A; Kalish, Jennifer M
2017-03-01
Beckwith-Wiedemann syndrome (BWS) is one of the most common cancer predisposition disorders. As a result, BWS patients receive tumor screening as part of their clinical management. Until recently, this screening has been employed uniformly across all genetic and epigenetic causes of BWS, including the utilization of ultrasonography to detect abdominal tumors and alpha-fetoprotein (AFP) to detect hepatoblastoma. The advancements in our understanding of the genetics and epigenetics leading to BWS has evolved over time, and has led to the development of genotype/phenotype correlations. As tumor risk appears to correlate with genetic and epigenetic causes of BWS, several groups have proposed alterations to tumor screening protocols based on the etiology of BWS, with the elimination of AFP as a screening measure and the elimination of all screening measures in BWS patients with loss of methylation at the KCNQ1OT1:TSS-DMR 2 (IC2). There are many challenges to this suggestion, as IC2 patients may have additional factors that contribute to risk of hepatoblastoma including fetal growth patterns, relationship with assisted reproductive technologies, and the regulation of the IC2 locus. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Riyaz Bhikoo
2017-05-01
Full Text Available AIM: To describe the demographic features and visual outcomes of patients presenting to photo-screening services, and treated for sight threatening retinopathy (STR in a low resource setting, Fiji. METHODS: A retrospective review of all new patients who presented for diabetic photo-screening at the Diabetic Eye Clinic, Suva in 2010. Fundus images were graded using standardised guidelines. Patient demographics, retinopathy grading and visual acuity data were extracted from the database and analyzed. Patients that received laser therapy and still attending follow up in 2012 were examined for disease progression RESULTS: Totally 2236 patients were photo-screened, 87% (3870/4472 of images were gradable. STR was observed in 26% (988/3870 with advanced STR (proliferative retinopathy/severe maculopathy in 10% (385/3870. Of those with STR, 59% had BCVA ≥6/18, 31% with advanced STR were <6/60. Male gender [odds ratio (OR 1.59; 1.20-2.12], history of hypertension (OR 1.36; 1.03-1.80 and peripheral neuropathy (OR 1.41; 1.01-1.95 were predictive of advanced STR. In 2012, 32% (315/988 attended follow up with 69% exhibiting advanced STR compared with 53% of the same cohort in 2010. Laser photocoagulation was administered to 212 eyes (212/3870, 5% with retinopathy and maculopathy progression observed in 52% and 33% respectively. BCVA ≥6/18 was noted in 67% (143/212 of treated eyes. Improved glycaemic control (OR 46.52; 1.50-1441.90 amongst those with advanced STR was predictive of eyes that maintained good vision. CONCLUSION: In Fiji, a quarter of new patients presenting to photo-screening have STR with a third of those with advanced STR having already loss vision. Improved glycaemic control and timely treatment of patients with sight threatening complications is important in halting disease progression.
Clinical Implications of Technological Advances in Screening for Atrial Fibrillation.
Singh, Nikhil; Chun, Sung; Hadley, David; Froelicher, Victor
The incidence of atrial fibrillation (AF) continues to increase worldwide as people live longer. AF is the leading cause of stroke among patients older than 75 years and is responsible for at least 15% of all strokes. Industry has responded to this problem with a plethora of monitoring devices. These include single lead ECG adhesive sensors, implantable loop recorders, smartphone attachments and wearables. This review will concentrate on clinical studies using these technologies. There are wearables including watches and watch-like devices that will be mentioned but these have not been validated for clinical use. This review will begin with a background regarding screening for AF and at the end present findings from Cardiac Implantable devices that could influence use of the new mobile health technologies. Copyright © 2018 Elsevier Inc. All rights reserved.
Advanced teleoperation in nuclear applications: consolidated fuel reprocessing program
International Nuclear Information System (INIS)
Hamel, W.R.; Feldman, M.J.; Martin, H.L.
1984-01-01
A new generation of integrated remote maintenance systems is being developed to meet the needs of future nuclear fuel reprocessing at the Oak Ridge National Laboratory. Development activities cover all aspects of an advanced teleoperated maintenance system with particular emphasis on a new force-reflecting servomanipulator concept. The new manipulator, called the advanced servomanipulator, is microprocessor controlled and is designed to achieve force-reflection performance near that of mechanical master/slave manipulators. The advanced servomanipulator uses a gear-drive transmission which permits modularization for remote maintainability (by other advanced servomanipulators) and increases reliability. Human factors analysis has been used to develop an improved man/machine interface concept based upon colographic displays and menu-driven touch screens. Initial test and evaluation of two advanced servomanipulator slave arms and several other development components have begun. 9 references, 5 figures
Disposable Screen Printed Electrochemical Sensors: Tools for Environmental Monitoring
Directory of Open Access Journals (Sweden)
Akhtar Hayat
2014-06-01
Full Text Available Screen printing technology is a widely used technique for the fabrication of electrochemical sensors. This methodology is likely to underpin the progressive drive towards miniaturized, sensitive and portable devices, and has already established its route from “lab-to-market” for a plethora of sensors. The application of these sensors for analysis of environmental samples has been the major focus of research in this field. As a consequence, this work will focus on recent important advances in the design and fabrication of disposable screen printed sensors for the electrochemical detection of environmental contaminants. Special emphasis is given on sensor fabrication methodology, operating details and performance characteristics for environmental applications.
Subtypes of Ovarian Cancer and Ovarian Cancer Screening
Directory of Open Access Journals (Sweden)
Masafumi Koshiyama
2017-03-01
Full Text Available Ovarian cancer is the foremost cause of gynecological cancer death in the developed world, as it is usually diagnosed at an advanced stage. In this paper we discuss current issues, the efficacy and problems associated with ovarian cancer screening, and compare the characteristics of ovarian cancer subtypes. There are two types of ovarian cancer: Type I carcinomas, which are slow-growing, indolent neoplasms thought to arise from a precursor lesion, which are relatively common in Asia; and Type II carcinomas, which are clinically aggressive neoplasms that can develop de novo from serous tubal intraepithelial carcinomas (STIC and/or ovarian surface epithelium and are common in Europe and the USA. One of the most famous studies on the subject reported that annual screening using CA125/transvaginal sonography (TVS did not reduce the ovarian cancer mortality rate in the USA. In contrast, a recent study in the UK showed an overall average mortality reduction of 20% in the screening group. Another two studies further reported that the screening was associated with decreased stage at detection. Theoretically, annual screening using CA125/TVS could easily detect precursor lesions and could be more effective in Asia than in Europe and the USA. The detection of Type II ovarian carcinoma at an early stage remains an unresolved issue. The resolving power of CA125 or TVS screening alone is unlikely to be successful at resolving STICs. Biomarkers for the early detection of Type II carcinomas such as STICs need to be developed.
Subtypes of Ovarian Cancer and Ovarian Cancer Screening.
Koshiyama, Masafumi; Matsumura, Noriomi; Konishi, Ikuo
2017-03-02
Ovarian cancer is the foremost cause of gynecological cancer death in the developed world, as it is usually diagnosed at an advanced stage. In this paper we discuss current issues, the efficacy and problems associated with ovarian cancer screening, and compare the characteristics of ovarian cancer subtypes. There are two types of ovarian cancer: Type I carcinomas, which are slow-growing, indolent neoplasms thought to arise from a precursor lesion, which are relatively common in Asia; and Type II carcinomas, which are clinically aggressive neoplasms that can develop de novo from serous tubal intraepithelial carcinomas (STIC) and/or ovarian surface epithelium and are common in Europe and the USA. One of the most famous studies on the subject reported that annual screening using CA125/transvaginal sonography (TVS) did not reduce the ovarian cancer mortality rate in the USA. In contrast, a recent study in the UK showed an overall average mortality reduction of 20% in the screening group. Another two studies further reported that the screening was associated with decreased stage at detection. Theoretically, annual screening using CA125/TVS could easily detect precursor lesions and could be more effective in Asia than in Europe and the USA. The detection of Type II ovarian carcinoma at an early stage remains an unresolved issue. The resolving power of CA125 or TVS screening alone is unlikely to be successful at resolving STICs. Biomarkers for the early detection of Type II carcinomas such as STICs need to be developed.
Laboratory screening markers in gastroenterology--state of the art.
Kocna, Petr; Vanickova, Zdislava; Zima, Tomas
2013-06-01
Screening tests for gastrointestinal diseases acceptable for population with a high sensitivity and high specificity can now be offered by clinical laboratories. This paper summarizes major recent advances in this area of laboratory medicine. Relevant articles published within the last 5 years in the NLM (National Library of Medicine) PubMed - Medline database covering the three gastrointestinal diseases - colorectal cancer, coeliac disease, and atrophic gastritis were included for this overview. In Europe, colorectal cancer (CRCA) is the second most frequent malignant disease. Quantitative immunochemical analysis of the stool for haemoglobin provides the best screening test to date, with both sensitivity and specificity approaching 95%. Even though coeliac disease (CD) affects approximately 1% of the general population, it remains largely unrecognised. Recommended methods for screening currently involve the detection of IgA and IgG antibodies against tissue transglutaminase and deamidated gliadin peptide. Evaluations of screening are now discussed for other diseases of the gastrointestinal tract - such as chronic atrophic gastritis (CAG), and inflammatory bowel disease (IBD). Detection of infection by Helicobacter pylori and stomach-specific plasmatic biomarkers, especially pepsinogen I/II ratio, could help with the prevention of gastric carcinomas. The use of faecal calprotectin as a screening test could substantially reduce the number of invasive methods necessary for the diagnostic work-up of patients with IBD. Screening tests for CRCA and CD have been used worldwide for many years. Screening strategies for gastrointestinal diseases are suggested in the text, based on recent basic science, clinical papers as well as our own experience.
From screen to structure with a harvestable microfluidic device
International Nuclear Information System (INIS)
Stojanoff, Vivian; Jakoncic, Jean; Oren, Deena A.; Nagarajan, V.; Navarro Poulsen, Jens-Christian; Adams-Cioaba, Melanie A.; Bergfors, Terese; Sommer, Morten O. A.
2011-01-01
Microfluidic crystallization using the Crystal Former improves the identification of initial crystallization conditions relative to screening via vapour diffusion. Advances in automation have facilitated the widespread adoption of high-throughput vapour-diffusion methods for initial crystallization screening. However, for many proteins, screening thousands of crystallization conditions fails to yield crystals of sufficient quality for structural characterization. Here, the rates of crystal identification for thaumatin, catalase and myoglobin using microfluidic Crystal Former devices and sitting-drop vapour-diffusion plates are compared. It is shown that the Crystal Former results in a greater number of identified initial crystallization conditions compared with vapour diffusion. Furthermore, crystals of thaumatin and lysozyme obtained in the Crystal Former were used directly for structure determination both in situ and upon harvesting and cryocooling. On the basis of these results, a crystallization strategy is proposed that uses multiple methods with distinct kinetic trajectories through the protein phase diagram to increase the output of crystallization pipelines
Cost Effective Community Based Dementia Screening: A Markov Model Simulation
Directory of Open Access Journals (Sweden)
Erin Saito
2014-01-01
Full Text Available Background. Given the dementia epidemic and the increasing cost of healthcare, there is a need to assess the economic benefit of community based dementia screening programs. Materials and Methods. Markov model simulations were generated using data obtained from a community based dementia screening program over a one-year period. The models simulated yearly costs of caring for patients based on clinical transitions beginning in pre dementia and extending for 10 years. Results. A total of 93 individuals (74 female, 19 male were screened for dementia and 12 meeting clinical criteria for either mild cognitive impairment (n=7 or dementia (n=5 were identified. Assuming early therapeutic intervention beginning during the year of dementia detection, Markov model simulations demonstrated 9.8% reduction in cost of dementia care over a ten-year simulation period, primarily through increased duration in mild stages and reduced time in more costly moderate and severe stages. Discussion. Community based dementia screening can reduce healthcare costs associated with caring for demented individuals through earlier detection and treatment, resulting in proportionately reduced time in more costly advanced stages.
Cohen, Ami; Whitfield, Timothy W; Kreifeldt, Max; Koebel, Pascale; Kieffer, Brigitte L; Contet, Candice; George, Olivier; Koob, George F
2014-01-01
Dynorphins, endogenous opioid peptides that arise from the precursor protein prodynorphin (Pdyn), are hypothesized to be involved in the regulation of mood states and the neuroplasticity associated with addiction. The current study tested the hypothesis that dynorphin in the nucleus accumbens (NAcc) mediates such effects. More specifically, we examined whether knockdown of Pdyn within the NAcc in rats would alter the expression of depressive-like and anxiety-like behavior, as well as cocaine locomotor sensitization. Wistar rats were injected with adeno-associated viral (AAV) vectors encoding either a Pdyn-specific short hairpin RNA (AAV-shPdyn) or a scrambled shRNA (AAV-shScr) as control. Four weeks later, rats were tested for anxiety-like behavior in the elevated plus maze test and depressive-like behavior in the forced swim test (FST). Finally, rats received one daily injection of saline or cocaine (20 mg/kg, i.p.), followed by assessment of locomotion for 4 consecutive days. Following 3 days of abstinence, the rats completed 2 additional daily cocaine/saline locomotor trials. Pdyn knockdown in the NAcc led to a significant reduction in depressive-like behavior in the FST, but had no effect on anxiety-like behavior in the elevated plus maze. Pdyn knockdown did not alter baseline locomotor behavior, the locomotor response to acute cocaine, or the initial sensitization of the locomotor response to cocaine over the first 4 cocaine treatment days. However, following 3 days abstinence the locomotor response to the cocaine challenge returned to their original levels in the AAV-shPdyn rats while remaining heightened in the AAV-shScr rats. These results suggest that dynorphin in a very specific area of the nucleus accumbens contributes to depressive-like states and may be involved in neuroadaptations in the NAcc that contribute to the development of cocaine addiction as a persistent and lasting condition.
Directory of Open Access Journals (Sweden)
Ami Cohen
Full Text Available Dynorphins, endogenous opioid peptides that arise from the precursor protein prodynorphin (Pdyn, are hypothesized to be involved in the regulation of mood states and the neuroplasticity associated with addiction. The current study tested the hypothesis that dynorphin in the nucleus accumbens (NAcc mediates such effects. More specifically, we examined whether knockdown of Pdyn within the NAcc in rats would alter the expression of depressive-like and anxiety-like behavior, as well as cocaine locomotor sensitization. Wistar rats were injected with adeno-associated viral (AAV vectors encoding either a Pdyn-specific short hairpin RNA (AAV-shPdyn or a scrambled shRNA (AAV-shScr as control. Four weeks later, rats were tested for anxiety-like behavior in the elevated plus maze test and depressive-like behavior in the forced swim test (FST. Finally, rats received one daily injection of saline or cocaine (20 mg/kg, i.p., followed by assessment of locomotion for 4 consecutive days. Following 3 days of abstinence, the rats completed 2 additional daily cocaine/saline locomotor trials. Pdyn knockdown in the NAcc led to a significant reduction in depressive-like behavior in the FST, but had no effect on anxiety-like behavior in the elevated plus maze. Pdyn knockdown did not alter baseline locomotor behavior, the locomotor response to acute cocaine, or the initial sensitization of the locomotor response to cocaine over the first 4 cocaine treatment days. However, following 3 days abstinence the locomotor response to the cocaine challenge returned to their original levels in the AAV-shPdyn rats while remaining heightened in the AAV-shScr rats. These results suggest that dynorphin in a very specific area of the nucleus accumbens contributes to depressive-like states and may be involved in neuroadaptations in the NAcc that contribute to the development of cocaine addiction as a persistent and lasting condition.
... Depression Screening Substance Abuse Screening Alcohol Use Screening Depression Screening (PHQ-9) - Instructions The following questions are ... this tool, there is also text-only version . Depression Screening - Manual Instructions The following questions are a ...
Value of audits in breast cancer screening quality assurance programmes.
Geertse, Tanya D; Holland, Roland; Timmers, Janine M H; Paap, Ellen; Pijnappel, Ruud M; Broeders, Mireille J M; den Heeten, Gerard J
2015-11-01
Our aim was to retrospectively evaluate the results of all audits performed in the past and to assess their value in the quality assurance of the Dutch breast cancer screening programme. The audit team of the Dutch Reference Centre for Screening (LRCB) conducts triennial audits of all 17 reading units. During audits, screening outcomes like recall rates and detection rates are assessed and a radiological review is performed. This study investigates and compares the results of four audit series: 1996-2000, 2001-2005, 2003-2007 and 2010-2013. The analysis shows increased recall rates (from 0.66%, 1.07%, 1.22% to 1.58%), increased detection rates (from 3.3, 4.5, 4.8 to 5.4 per 1000) and increased sensitivity (from 64.5%, 68.7%, 70.5% to 71.6%), over the four audit series. The percentage of 'missed cancers' among interval cancers and advanced screen-detected cancers did not change (p = 0.4). Our audits not only provide an opportunity for assessing screening outcomes, but also provide moments of self-reflection with peers. For radiologists, an accurate understanding of their performance is essential to identify points of improvement. We therefore recommend a radiological review of screening examinations and immediate feedback as part of an audit. • Radiological review and immediate feedback are recommended as part of an audit. • For breast screening radiologists, audits provide moments of self-reflection with peers. • Radiological review of screening examinations provides insights in recall behaviour. • Accurate understanding of radiologists' performance is essential to identify points of improvement.
Mining collections of compounds with Screening Assistant 2
Directory of Open Access Journals (Sweden)
Guilloux Vincent
2012-08-01
Full Text Available Abstract Background High-throughput screening assays have become the starting point of many drug discovery programs for large pharmaceutical companies as well as academic organisations. Despite the increasing throughput of screening technologies, the almost infinite chemical space remains out of reach, calling for tools dedicated to the analysis and selection of the compound collections intended to be screened. Results We present Screening Assistant 2 (SA2, an open-source JAVA software dedicated to the storage and analysis of small to very large chemical libraries. SA2 stores unique molecules in a MySQL database, and encapsulates several chemoinformatics methods, among which: providers management, interactive visualisation, scaffold analysis, diverse subset creation, descriptors calculation, sub-structure / SMART search, similarity search and filtering. We illustrate the use of SA2 by analysing the composition of a database of 15 million compounds collected from 73 providers, in terms of scaffolds, frameworks, and undesired properties as defined by recently proposed HTS SMARTS filters. We also show how the software can be used to create diverse libraries based on existing ones. Conclusions Screening Assistant 2 is a user-friendly, open-source software that can be used to manage collections of compounds and perform simple to advanced chemoinformatics analyses. Its modular design and growing documentation facilitate the addition of new functionalities, calling for contributions from the community. The software can be downloaded at http://sa2.sourceforge.net/.
Mining collections of compounds with Screening Assistant 2
2012-01-01
Background High-throughput screening assays have become the starting point of many drug discovery programs for large pharmaceutical companies as well as academic organisations. Despite the increasing throughput of screening technologies, the almost infinite chemical space remains out of reach, calling for tools dedicated to the analysis and selection of the compound collections intended to be screened. Results We present Screening Assistant 2 (SA2), an open-source JAVA software dedicated to the storage and analysis of small to very large chemical libraries. SA2 stores unique molecules in a MySQL database, and encapsulates several chemoinformatics methods, among which: providers management, interactive visualisation, scaffold analysis, diverse subset creation, descriptors calculation, sub-structure / SMART search, similarity search and filtering. We illustrate the use of SA2 by analysing the composition of a database of 15 million compounds collected from 73 providers, in terms of scaffolds, frameworks, and undesired properties as defined by recently proposed HTS SMARTS filters. We also show how the software can be used to create diverse libraries based on existing ones. Conclusions Screening Assistant 2 is a user-friendly, open-source software that can be used to manage collections of compounds and perform simple to advanced chemoinformatics analyses. Its modular design and growing documentation facilitate the addition of new functionalities, calling for contributions from the community. The software can be downloaded at http://sa2.sourceforge.net/. PMID:23327565
Receptor-based screening assays for the detection of antibiotics residues - A review.
Ahmed, Saeed; Ning, Jianan; Cheng, Guyue; Ahmad, Ijaz; Li, Jun; Mingyue, Liu; Qu, Wei; Iqbal, Mujahid; Shabbir, M A B; Yuan, Zonghui
2017-05-01
Consumer and regulatory agencies have a high concern to antibiotic residues in food producing animals, so appropriate screening assays of fast, sensitive, low cost, and easy sample preparation for the identification of these residues are essential for the food-safety insurance. Great efforts in the development of a high-throughput antibiotic screening assay have been made in recent years. Concerning the screening of antibiotic residue, this review elaborate an overview on the availability, advancement and applicability of antibiotic receptor based screening assays for the safety assessment of antibiotics usage (i.e. radio receptor assay, enzyme labeling assays, colloidal gold receptor assay, enzyme colorimetry assay and biosensor assay). This manuscript also tries to shed a light on the selection, preparation and future perspective of receptor protein for antibiotic residue detection. These assays have been introduced for the screening of numerous food samples. Receptor based screening technology for antibiotic detection has high accuracy. It has been concluded that at the same time, it can detect a class of drugs for certain receptor, and realize the multi-residue detection. These assays offer fast, easy and precise detection of antibiotics. Copyright © 2017 Elsevier B.V. All rights reserved.
Sadigh, Gelareh; Carlos, Ruth C; Ward, Kevin C; Switchenko, Jeffrey M; Jiang, Renjian; Applegate, Kimberly E; Duszak, Richard
2017-07-01
To assess breast cancer screening utilization in Medicare beneficiaries with colorectal and lung cancer versus cancer-free controls. Female fee-for-service Medicare beneficiaries who were ≥67 years old and diagnosed with lung or colorectal cancer between 2000 and 2011 and who reported to a Surveillance, Epidemiology, and End Results (SEER) registry (case group) were followed for 2 years after their diagnoses, unless death, a diagnosis of breast cancer, or the end of 2013 came first. A similar number of cancer-free controls were individually matched to cases by age, race, registry region, and follow-up time. Screening utilization was defined as the percentage of women with ≥1 screening mammogram during follow-up. Overall, 104,164 cases (48% colorectal, 52% lung; 30% advanced cancer) and 104,164 controls were included. Among women with lung or colorectal cancer, 22% underwent ≥1 screening mammogram versus 26% of controls (odds ratio [OR] 0.80; 95% confidence interval [CI] 0.78-0.82). Stratified by cancer type, 28% of colorectal cancer cases versus 29% of controls (OR 0.98; 95% CI 0.95-1.01) and 17% of lung cancer cases versus 23% of controls (OR 0.63; 95% CI 0.60-0.65) received ≥1 mammogram. When stratified by stage, 8% with advanced cancer versus 18% of controls (OR 0.33; 95% CI 0.31-0.35) and 30% with early-stage cancer versus 30% of controls (OR 1; 95% CI 0.97-1.02) underwent ≥1 mammogram. Screening mammography utilization rates are similar between Medicare beneficiaries with early-stage cancer versus controls. Although the majority of patients with advanced-stage cancer appropriately do not pursue screening mammography, a small number (8%) continue with screening. Copyright © 2017 American College of Radiology. Published by Elsevier Inc. All rights reserved.
Rigorous Screening Technology for Identifying Suitable CO2 Storage Sites II
Energy Technology Data Exchange (ETDEWEB)
George J. Koperna Jr.; Vello A. Kuuskraa; David E. Riestenberg; Aiysha Sultana; Tyler Van Leeuwen
2009-06-01
This report serves as the final technical report and users manual for the 'Rigorous Screening Technology for Identifying Suitable CO2 Storage Sites II SBIR project. Advanced Resources International has developed a screening tool by which users can technically screen, assess the storage capacity and quantify the costs of CO2 storage in four types of CO2 storage reservoirs. These include CO2-enhanced oil recovery reservoirs, depleted oil and gas fields (non-enhanced oil recovery candidates), deep coal seems that are amenable to CO2-enhanced methane recovery, and saline reservoirs. The screening function assessed whether the reservoir could likely serve as a safe, long-term CO2 storage reservoir. The storage capacity assessment uses rigorous reservoir simulation models to determine the timing, ultimate storage capacity, and potential for enhanced hydrocarbon recovery. Finally, the economic assessment function determines both the field-level and pipeline (transportation) costs for CO2 sequestration in a given reservoir. The screening tool has been peer reviewed at an Electrical Power Research Institute (EPRI) technical meeting in March 2009. A number of useful observations and recommendations emerged from the Workshop on the costs of CO2 transport and storage that could be readily incorporated into a commercial version of the Screening Tool in a Phase III SBIR.
Population-based colorectal cancer screening by fecal immunochemical testing over multiple rounds
van der Vlugt, M.
2017-01-01
Colorectal cancer (CRC) is one of the major causes of death in the Netherlands, accounting for over 5100 deaths in 2015. Population screening aims to detect CRC or its precursors, advanced adenoma, in an early phase, thereby reducing CRC morbidity and mortality. A recent observational study
Ambe, Peter C; Jansen, Stefan; Zirngibl, Hubert
2017-08-23
The role of colonoscopy in the screening of colorectal cancer (CRC) has been unequivocally established. In Germany, screening colonoscopy with full insurance reimbursement is available for individuals aged 55 and above, and/or for persons with well-known risk factors for CRC. However, advanced CRC is not uncommon in individuals below 55 years. This study was designed to investigate the incidence of advanced CRC in patients < 55 years. A retrospective analysis of data from a prospectively maintained CRC database of a university hospital in Germany was performed. Using the recommended age for screening colonoscopy as cutoff, the study population was divided into two groups: < 55 years (study group) and ≥ 55 years (control group). Both groups were compared with regard to the extent of CRC using the UICC stages. Only surgically managed patients were included for analysis. Advanced CRC was defined as UICC stage III or IV. Complete follow-up data was available for 609 patients treated between 2009 and 2013. The study group included 83 patients, 42 females and 41 males with a median age of 48.0 ± 10 years, while the control group was made up of 526 patients, 230 females and 296 males with a median age of 75.5 ± 8.3 years. Both groups were comparable with regard to gender distribution, p = 0.24. Significantly more patients from the study group were diagnosed with advanced CRC in comparison to the control group, 56.6 vs. 43.9%, p = 0.03. There was no statistically significant difference amongst both groups with respect to cancer-related mortality, 10.8 vs. 12.5%, p = 0.66. Patients below the recommended age for screening colonoscopy might be at increased risk for advanced CRC. There is need to decrease the recommended age for screening colonoscopy to prevent CRC or enable an early diagnosis in patients below 55 years.
Cressman, Sonya; Lam, Stephen; Tammemagi, Martin C; Evans, William K; Leighl, Natasha B; Regier, Dean A; Bolbocean, Corneliu; Shepherd, Frances A; Tsao, Ming-Sound; Manos, Daria; Liu, Geoffrey; Atkar-Khattra, Sukhinder; Cromwell, Ian; Johnston, Michael R; Mayo, John R; McWilliams, Annette; Couture, Christian; English, John C; Goffin, John; Hwang, David M; Puksa, Serge; Roberts, Heidi; Tremblay, Alain; MacEachern, Paul; Burrowes, Paul; Bhatia, Rick; Finley, Richard J; Goss, Glenwood D; Nicholas, Garth; Seely, Jean M; Sekhon, Harmanjatinder S; Yee, John; Amjadi, Kayvan; Cutz, Jean-Claude; Ionescu, Diana N; Yasufuku, Kazuhiro; Martel, Simon; Soghrati, Kamyar; Sin, Don D; Tan, Wan C; Urbanski, Stefan; Xu, Zhaolin; Peacock, Stuart J
2014-10-01
It is estimated that millions of North Americans would qualify for lung cancer screening and that billions of dollars of national health expenditures would be required to support population-based computed tomography lung cancer screening programs. The decision to implement such programs should be informed by data on resource utilization and costs. Resource utilization data were collected prospectively from 2059 participants in the Pan-Canadian Early Detection of Lung Cancer Study using low-dose computed tomography (LDCT). Participants who had 2% or greater lung cancer risk over 3 years using a risk prediction tool were recruited from seven major cities across Canada. A cost analysis was conducted from the Canadian public payer's perspective for resources that were used for the screening and treatment of lung cancer in the initial years of the study. The average per-person cost for screening individuals with LDCT was $453 (95% confidence interval [CI], $400-$505) for the initial 18-months of screening following a baseline scan. The screening costs were highly dependent on the detected lung nodule size, presence of cancer, screening intervention, and the screening center. The mean per-person cost of treating lung cancer with curative surgery was $33,344 (95% CI, $31,553-$34,935) over 2 years. This was lower than the cost of treating advanced-stage lung cancer with chemotherapy, radiotherapy, or supportive care alone, ($47,792; 95% CI, $43,254-$52,200; p = 0.061). In the Pan-Canadian study, the average cost to screen individuals with a high risk for developing lung cancer using LDCT and the average initial cost of curative intent treatment were lower than the average per-person cost of treating advanced stage lung cancer which infrequently results in a cure.
Approaches to virtual screening and screening library selection.
Wildman, Scott A
2013-01-01
The ease of access to virtual screening (VS) software in recent years has resulted in a large increase in literature reports. Over 300 publications in the last year report the use of virtual screening techniques to identify new chemical matter or present the development of new virtual screening techniques. The increased use is accompanied by a corresponding increase in misuse and misinterpretation of virtual screening results. This review aims to identify many of the common difficulties associated with virtual screening and allow researchers to better assess the reliability of their virtual screening effort.
Applying operations research to optimize a novel population management system for cancer screening.
Zai, Adrian H; Kim, Seokjin; Kamis, Arnold; Hung, Ken; Ronquillo, Jeremiah G; Chueh, Henry C; Atlas, Steven J
2014-02-01
To optimize a new visit-independent, population-based cancer screening system (TopCare) by using operations research techniques to simulate changes in patient outreach staffing levels (delegates, navigators), modifications to user workflow within the information technology (IT) system, and changes in cancer screening recommendations. TopCare was modeled as a multiserver, multiphase queueing system. Simulation experiments implemented the queueing network model following a next-event time-advance mechanism, in which systematic adjustments were made to staffing levels, IT workflow settings, and cancer screening frequency in order to assess their impact on overdue screenings per patient. TopCare reduced the average number of overdue screenings per patient from 1.17 at inception to 0.86 during simulation to 0.23 at steady state. Increases in the workforce improved the effectiveness of TopCare. In particular, increasing the delegate or navigator staff level by one person improved screening completion rates by 1.3% or 12.2%, respectively. In contrast, changes in the amount of time a patient entry stays on delegate and navigator lists had little impact on overdue screenings. Finally, lengthening the screening interval increased efficiency within TopCare by decreasing overdue screenings at the patient level, resulting in a smaller number of overdue patients needing delegates for screening and a higher fraction of screenings completed by delegates. Simulating the impact of changes in staffing, system parameters, and clinical inputs on the effectiveness and efficiency of care can inform the allocation of limited resources in population management.
Defining the taxonomic domain of applicability for mammalian-based high-throughput screening assays
Cell-based high throughput screening (HTS) technologies are becoming mainstream in chemical safety evaluations. The US Environmental Protection Agency (EPA) Toxicity Forecaster (ToxCastTM) and the multi-agency Tox21 Programs have been at the forefront in advancing this science, m...
Wajih, Nadeem; Owen, John; Wallin, Reidar
2008-01-01
Recombinant members of the vitamin K-dependent protein family (factors IX and VII and protein C) have become important pharmaceuticals in treatment of bleeding disorders and sepsis. However, because the in vivo gamma-carboxylation system in stable cell lines used for transfection has a limited capacity of post translational gamma-carboxylation, the recovery of fully gamma-carboxylated and functional proteins is low. In this work we have engineered recombinant factor VII producing HEK 293 cells to stably overexpress VKORC1, the reduced vitamin K gamma-carboxylase cofactor and in addition stably silenced the gamma-carboxylase inhibitory protein calumenin. Stable cell lines transfected with only a factor VII cDNA had a 9% production of functional recombinant factor VII. On the other hand, these recombinant factor VII producing cells when engineered to overexpress VKORC1 and having calumenin stably suppressed more than 80% by shRNA expression, produced 68% functional factor VII. The technology presented should be applicable to all vertebrae members of the vitamin K-dependent protein family and should lower the production cost of the clinically used factors VII, IX and protein C.
The Relationship between Recruiting and Screening within the Employer Search Framework
DEFF Research Database (Denmark)
Cunningham, Elizabeth J.
1996-01-01
Most firms are observed to put forth more effort in finding workers than randomly choosing someone off the street. Therefore, employers play a major role in deciding which workers are employed and which are not. The paper considers how job and firm characteristics affect the recruiting and screen......Most firms are observed to put forth more effort in finding workers than randomly choosing someone off the street. Therefore, employers play a major role in deciding which workers are employed and which are not. The paper considers how job and firm characteristics affect the recruiting...... and screening process used by employers trying to hire new workers and whether the recruiting efforts have an effect on screening through the flow of applicants. The results imply that starting wages, training needed, local unemployment rate, having advance notice, and size of the firm significantly affect...
Schlegel, Todd T.; Delgado, Reynolds; Poulin, Greg; Starc, Vito; Arenare, Brian; Rahman, M. A.
2006-01-01
Resting conventional ECG is notoriously insensitive for detecting coronary artery disease (CAD) and only nominally useful in screening for cardiomyopathy (CM). Similarly, conventional exercise stress test ECG is both time- and labor-consuming and its accuracy in identifying CAD is suboptimal for use in population screening. We retrospectively investigated the accuracy of several advanced resting electrocardiographic (ECG) parameters, both alone and in combination, for detecting CAD and cardiomyopathy (CM).
Fish protection at steam-electric power plants: alternative screening devices
International Nuclear Information System (INIS)
Cannon, J.B.
1978-01-01
Since the enactment of the Federal Water Pollution Control Act Amendments of 1972, very few innovations have surfaced that advance the state of intake technology for fish protection at steam-electric power plants. After careful examination of basic hydrology, hydraulics, and ecology of the source water body is completed and after a suitable location for the intake is established, the design process reduces to the development of proper screening techniques and to the provision of a means of preventing resident and migratory species from entering the intake structure. As a result of this design process, three basic fish protection concepts have evolved: fish deterrence, fish collection and removal, and fish diversion. Intake screening devices that protect fish are discussed
Weiss, Jennifer M; Pandhi, Nancy; Kraft, Sally; Potvien, Aaron; Carayon, Pascale; Smith, Maureen A
2018-04-25
National colorectal cancer (CRC) screening rates have plateaued. To optimize interventions targeting those unscreened, a better understanding is needed of how this preventive service fits in with multiple preventive and chronic care needs managed by primary care providers (PCPs). This study examines whether PCP practices of other preventive and chronic care needs correlate with CRC screening. We performed a retrospective cohort study of 90 PCPs and 33,137 CRC screening-eligible patients. Five PCP quality metrics (breast cancer screening, cervical cancer screening, HgbA1c and LDL testing, and blood pressure control) were measured. A baseline correlation test was performed between these metrics and PCP CRC screening rates. Multivariable logistic regression with clustering at the clinic-level estimated odds ratios and 95% confidence intervals for these PCP quality metrics, patient and PCP characteristics, and their relationship to CRC screening. PCP CRC screening rates have a strong correlation with breast cancer screening rates (r = 0.7414, p < 0.001) and a weak correlation with the other quality metrics. In the final adjusted model, the only PCP quality metric that significantly predicted CRC screening was breast cancer screening (OR 1.25; 95% CI 1.11-1.42; p < 0.001). PCP CRC screening rates are highly concordant with breast cancer screening. CRC screening is weakly concordant with cervical cancer screening and chronic disease management metrics. Efforts targeting PCPs to increase CRC screening rates could be bundled with breast cancer screening improvement interventions to increase their impact and success.
Directory of Open Access Journals (Sweden)
Humza J Tahir
Full Text Available Technological advances have led to the development of powerful yet portable tablet computers whose touch-screen resolutions now permit the presentation of targets small enough to test the limits of normal visual acuity. Such devices have become ubiquitous in daily life and are moving into the clinical space. However, in order to produce clinically valid tests, it is important to identify the limits imposed by the screen characteristics, such as resolution, brightness uniformity, contrast linearity and the effect of viewing angle. Previously we have conducted such tests on the iPad 3. Here we extend our investigations to 2 other devices and outline a protocol for calibrating such screens, using standardised methods to measure the gamma function, warm up time, screen uniformity and the effects of viewing angle and screen reflections. We demonstrate that all three devices manifest typical gamma functions for voltage and luminance with warm up times of approximately 15 minutes. However, there were differences in homogeneity and reflectance among the displays. We suggest practical means to optimise quality of display for vision testing including screen calibration.
Tahir, Humza J; Murray, Ian J; Parry, Neil R A; Aslam, Tariq M
2014-01-01
Technological advances have led to the development of powerful yet portable tablet computers whose touch-screen resolutions now permit the presentation of targets small enough to test the limits of normal visual acuity. Such devices have become ubiquitous in daily life and are moving into the clinical space. However, in order to produce clinically valid tests, it is important to identify the limits imposed by the screen characteristics, such as resolution, brightness uniformity, contrast linearity and the effect of viewing angle. Previously we have conducted such tests on the iPad 3. Here we extend our investigations to 2 other devices and outline a protocol for calibrating such screens, using standardised methods to measure the gamma function, warm up time, screen uniformity and the effects of viewing angle and screen reflections. We demonstrate that all three devices manifest typical gamma functions for voltage and luminance with warm up times of approximately 15 minutes. However, there were differences in homogeneity and reflectance among the displays. We suggest practical means to optimise quality of display for vision testing including screen calibration.
More comprehensive discussion of CRC screening associated with higher screening.
Mosen, David M; Feldstein, Adrianne C; Perrin, Nancy A; Rosales, A Gabriella; Smith, David H; Liles, Elizabeth G; Schneider, Jennifer L; Meyers, Ronald E; Elston-Lafata, Jennifer
2013-04-01
Examine association of comprehensiveness of colorectal cancer (CRC) screening discussion by primary care physicians (PCPs) with completion of CRC screening. Observational study in Kaiser Permanente Northwest, a group-model health maintenance organization. A total of 883 participants overdue for CRC screening received an automated telephone call (ATC) between April and June 2009 encouraging CRC screening. Between January and March 2010, participants completed a survey on PCPs' discussion of CRC screening and patient beliefs regarding screening. receipt of CRC screening (assessed by electronic medical record [EMR], 9 months after ATC). Primary independent variable: comprehensiveness of CRC screening discussion by PCPs (7-item scale). Secondary independent variables: perceived benefits of screening (4-item scale assessing respondents' agreement with benefits of timely screening) and primary care utilization (EMR; 9 months after ATC). The independent association of variables with CRC screening was assessed with logistic regression. Average scores for comprehensiveness of CRC discussion and perceived benefits were 0.4 (range 0-1) and 4.0 (range 1-5), respectively. A total of 28.2% (n = 249) completed screening, 84% of whom had survey assessments after their screening date. Of screeners, 95.2% completed the fecal immunochemical test. More comprehensive discussion of CRC screening was associated with increased screening (odds ratio [OR] = 1.51, 95% confidence interval [CI] = 1.03-2.21). Higher perceived benefits (OR = 1.46, 95% CI = 1.13-1.90) and 1 or more PCP visits (OR = 5.82, 95% CI = 3.87-8.74) were also associated with increased screening. More comprehensive discussion of CRC screening was independently associated with increased CRC screening. Primary care utilization was even more strongly associated with CRC screening, irrespective of discussion of CRC screening.
[Screening for colorectal cancer in Italy, 2010 survey].
Zorzi, Manuel; Fedato, Chiara; Grazzini, Grazia; Sassoli de' Bianchi, Priscilla; Naldoni, Carlo; Pendenza, Melania; Sassatelli, Romano; Senore, Carlo; Visioli, Carmen Beatriz; Zappa, Marco
2012-01-01
We present the main results of the 2010 survey of the Italian screening programmes for colorectal cancer carried out by the National centre for screening monitoring (Osservatorio nazionale screening, ONS) on behalf of the Ministry of health. By the end of 2010, 105 programmes were active, 9 of which had been activated during the year, and 65% of Italians aged 50-69 years were residing in areas covered by organised screening programmes (theoretical extension). Twelve regions had their whole population covered. In the South of Italy and Islands, 5 new programmes were activated in 2010, with a theoretical extension of 29%. The majority of programmes employed the faecal occult blood test (FIT), while some adopted flexible sigmoidoscopy (FS) once in a lifetime and FIT for non-responders to FS. Overall, about 3,404,000 subjects were invited to undergo FIT, 47.2% of those to be invited within the year. The adjusted attendance rate was 48% and approximately 1,568,796 subjects were screened. Large differences in the attendance rate were observed among regions: 10% of programmes reported values lower than 24%. Positivity rate of FIT programmes was 5.5% at first screening (range: 1.6-11.3%) and 4.3% at repeat screening (range: 3.2-6.7%). The average attendance rate to total colonoscopy (TC) was 81.4% and in one region it was lower than 70%. Completion rate for total colonoscopy (TC) was 88.7%. Among the 740,281 subjects attending screening for the first time, the detection rate (DR) per 1,000 screened subjects was 2.4 for invasive cancer and 10.3 for advanced adenomas (AA - adenomas with a diameter ≥1 cm, with villous/tubulo-villous type or with high-grade dysplasia). As expected, the corresponding figures in the 843,204 subjects at repeat screening were lower (1.2‰ and 7.6‰ for invasive cancer and AA, respectively). The DR of cancer and adenomas increased with age and was higher among males. Many programmes reported some difficulties in guaranteeing TC in the
Energy Technology Data Exchange (ETDEWEB)
Lindemann, Sebastian [Max-Planck-Institut fuer Kernphysik, Heidelberg (Germany)
2015-07-01
Radon with its isotope {sup 222}Rn is one of the dominant sources of internal background in liquid xenon detectors searching for low energetic rare events like WIMP-nucleon scattering. In my talk I briefly review the problem posed by {sup 222}Rn and motivate the screening strategy followed by XENON1T. I introduce the radon emanation technique making use of ultra low background proportional counters and present selected results obtained during the design and construction phases of XENON1T. Finally, I sketch advances in radon emanation assay techniques and give a short outlook on upcoming measurements.
International Nuclear Information System (INIS)
Pang, Shi-Feng; Li, Xiao-Kun; Zhang, Qiang; Yang, Fang; Xu, Peilin
2009-01-01
Recently our laboratory reported evidence showing that hNUDC acts as an additional cytokine for thrombopoietin receptor (Mpl). Previously known as the human homolog of a fungal nuclear migration protein, hNUDC plays a critical role in megakaryocyte differentiation and maturation. Here we sought to further clarify the hNUDC-Mpl ligand-receptor relationship by utilizing interference RNA (RNAi) to knockdown Mpl expression in a megakaryocyte cell line. We created U6 promoter driven constructs to express short hairpin RNAs (shRNA) with affinity for different sites on Mpl mRNA. By including Mpl-EGFP fusion protein in these constructs, we were able to effectively screen the shRNA that was most efficient in inhibiting Mpl mRNA expression. This shRNA was subsequently transferred into a lentivirus vector and transduced into Dami cells, a cell line which constitutively expresses endogenous Mpl. This lentiviral vector was also designed to simultaneously express EGFP to monitor transfection efficiency. Our results show that lentivirus can be used to effectively deliver shRNAs into Dami cells and cause specific inhibition of Mpl protein expression after transduction. Furthermore, we show the functional effects of shRNA-mediated Mpl silencing by demonstrating reduced hNUDC stimulated megakaryocyte proliferation and differentiation. Thus, the use of a RNAi knockdown strategy has allowed us to pinpoint the connection of hNUDC with Mpl in the regulation of megakaryocyte maturation.
Applying operations research to optimize a novel population management system for cancer screening
Zai, Adrian H; Kim, Seokjin; Kamis, Arnold; Hung, Ken; Ronquillo, Jeremiah G; Chueh, Henry C; Atlas, Steven J
2014-01-01
Objective To optimize a new visit-independent, population-based cancer screening system (TopCare) by using operations research techniques to simulate changes in patient outreach staffing levels (delegates, navigators), modifications to user workflow within the information technology (IT) system, and changes in cancer screening recommendations. Materials and methods TopCare was modeled as a multiserver, multiphase queueing system. Simulation experiments implemented the queueing network model following a next-event time-advance mechanism, in which systematic adjustments were made to staffing levels, IT workflow settings, and cancer screening frequency in order to assess their impact on overdue screenings per patient. Results TopCare reduced the average number of overdue screenings per patient from 1.17 at inception to 0.86 during simulation to 0.23 at steady state. Increases in the workforce improved the effectiveness of TopCare. In particular, increasing the delegate or navigator staff level by one person improved screening completion rates by 1.3% or 12.2%, respectively. In contrast, changes in the amount of time a patient entry stays on delegate and navigator lists had little impact on overdue screenings. Finally, lengthening the screening interval increased efficiency within TopCare by decreasing overdue screenings at the patient level, resulting in a smaller number of overdue patients needing delegates for screening and a higher fraction of screenings completed by delegates. Conclusions Simulating the impact of changes in staffing, system parameters, and clinical inputs on the effectiveness and efficiency of care can inform the allocation of limited resources in population management. PMID:24043318
The efficacy of issuing a free coupon for breast cancer screening
International Nuclear Information System (INIS)
Ban, Kanako; Watanabe, Satoko; Ono, Yoshiki
2011-01-01
In 2009, the Japanese government introduced a new project in which a free coupon for breast cancer screening was issued. Our institution provided two mammography buses and visited 11 suburbs of Tokyo places a total of 233 times for screening with the free coupon. We classified the areas visited into two groups: those where we had sent the bus every year (usual areas), and other areas to which we had never sent the bus previously (new area). We also issued questionnaires to the coupon examinees. The number of mammography screenings conducted was 15,257 (a 71% increase). The recall rate was 6.3%, and the rate of responders for detailed examination was 60.3% in the new areas, being lower than in the other areas. The most serious problem in the new areas was that the rate of early cancer detection was 44.4%, being much lower than in the other areas. In response to the questionnaire items inquiring about womens' motivation for screening, 'individual notice' accounted for the majority of responses, followed by 'free screening'. In response to the question of how much women were prepared to pay for breast cancer screening, the majority of women stated that they would be willing to pay between 1,000 and 2,000 yen. In conclusion, the scheme for providing free coupons for breast cancer screening would appear to motivate women who have never undergone screening before. On the other hand, some problems have been exposed. In areas new to screening, a high proportion of advanced cancers were found, and there was a lower rate of response for more detailed examination. The answers received appear to indicate that women prefer to receive individual notice, rather than free screening. (author)
Schneider, Jennifer L; Goddard, Katrina A B; Davis, James; Wilfond, Benjamin; Kauffman, Tia L; Reiss, Jacob A; Gilmore, Marian; Himes, Patricia; Lynch, Frances L; Leo, Michael C; McMullen, Carmit
2016-02-01
As genome sequencing technology advances, research is needed to guide decision-making about what results can or should be offered to patients in different clinical settings. We conducted three focus groups with individuals who had prior preconception genetic testing experience to explore perceived advantages and disadvantages of genome sequencing for preconception carrier screening, compared to usual care. Using a discussion guide, a trained qualitative moderator facilitated the audio-recorded focus groups. Sixteen individuals participated. Thematic analysis of transcripts started with a grounded approach and subsequently focused on participants' perceptions of the value of genetic information. Analysis uncovered two orientations toward genomic preconception carrier screening: "certain" individuals desiring all possible screening information; and "hesitant" individuals who were more cautious about its value. Participants revealed valuable information about barriers to screening: fear/anxiety about results; concerns about the method of returning results; concerns about screening necessity; and concerns about partner participation. All participants recommended offering choice to patients to enhance the value of screening and reduce barriers. Overall, two groups of likely users of genome sequencing for preconception carrier screening demonstrated different perceptions of the advantages or disadvantages of screening, suggesting tailored approaches to education, consent, and counseling may be warranted with each group.
Chen, Guilin; Huang, Bill X; Guo, Mingquan
2018-05-21
Medicinal plants have played an important role in maintaining human health for thousands of years. However, the interactions between the active components in medicinal plants and some certain biological targets during a disease are still unclear in most cases. To conduct the high-throughput screening for small active molecules that can interact with biological targets, which is of great theoretical significance and practical value. The ultrafiltration mass spectrometry (UF-LC/MS) is a powerful bio-analytical method by combining affinity ultrafiltration and liquid chromatography-mass spectrometry (LC/MS), which could rapidly screen and identify small active molecules that bind to biological targets of interest at the same time. Compared with other analytical methods, affinity UF-LC/MS has the characteristics of fast, sensitive and high throughput, and is especially suitable for the complicated extracts of medicinal plants. In this review, the basic principle, characteristics and some most recent challenges in UF-LC/MS have been demonstrated. Meanwhile, the progress and applications of affinity UF-LC/MS in the discovery of the active components from natural medicinal plants and the interactions between small molecules and biological target proteins are also briefly summarised. In addition, the future directions for UF-LC/MS are also prospected. Affinity UF-LC/MS is a powerful tool in studies on the interactions between small active molecules and biological protein targets, especially in the high-throughput screening of active components from the natural medicinal plants. Copyright © 2018 John Wiley & Sons, Ltd.
Local-global classifier fusion for screening chest radiographs
Ding, Meng; Antani, Sameer; Jaeger, Stefan; Xue, Zhiyun; Candemir, Sema; Kohli, Marc; Thoma, George
2017-03-01
Tuberculosis (TB) is a severe comorbidity of HIV and chest x-ray (CXR) analysis is a necessary step in screening for the infective disease. Automatic analysis of digital CXR images for detecting pulmonary abnormalities is critical for population screening, especially in medical resource constrained developing regions. In this article, we describe steps that improve previously reported performance of NLM's CXR screening algorithms and help advance the state of the art in the field. We propose a local-global classifier fusion method where two complementary classification systems are combined. The local classifier focuses on subtle and partial presentation of the disease leveraging information in radiology reports that roughly indicates locations of the abnormalities. In addition, the global classifier models the dominant spatial structure in the gestalt image using GIST descriptor for the semantic differentiation. Finally, the two complementary classifiers are combined using linear fusion, where the weight of each decision is calculated by the confidence probabilities from the two classifiers. We evaluated our method on three datasets in terms of the area under the Receiver Operating Characteristic (ROC) curve, sensitivity, specificity and accuracy. The evaluation demonstrates the superiority of our proposed local-global fusion method over any single classifier.
Nelson, Heidi D; Fu, Rochelle; Cantor, Amy; Pappas, Miranda; Daeges, Monica; Humphrey, Linda
2016-02-16
In 2009, the U.S. Preventive Services Task Force recommended biennial mammography screening for women aged 50 to 74 years and selective screening for those aged 40 to 49 years. To review studies of the effectiveness of breast cancer screening in average-risk women. MEDLINE and Cochrane databases to 4 June 2015. English-language randomized, controlled trials and observational studies of screening with mammography, magnetic resonance imaging, and ultrasonography that reported breast cancer mortality, all-cause mortality, or advanced breast cancer outcomes. Investigators extracted and confirmed data and dual rated study quality; discrepancies were resolved through consensus. Fair-quality evidence from a meta-analysis of mammography trials indicated relative risks (RRs) for breast cancer mortality of 0.92 for women aged 39 to 49 years (95% CI, 0.75 to 1.02) (9 trials; 3 deaths prevented per 10,000 women over 10 years); 0.86 for those aged 50 to 59 years (CI, 0.68 to 0.97) (7 trials; 8 deaths prevented per 10,000 women over 10 years); 0.67 for those aged 60 to 69 years (CI, 0.54 to 0.83) (5 trials; 21 deaths prevented per 10,000 women over 10 years); and 0.80 for those aged 70 to 74 years (CI, 0.51 to 1.28) (3 trials; 13 deaths prevented per 10,000 women over 10 years). Risk reduction was 25% to 31% for women aged 50 to 69 years in observational studies of mammography screening. All-cause mortality was not reduced with screening. Advanced breast cancer was reduced for women aged 50 years or older (RR, 0.62 [CI, 0.46 to 0.83]) (3 trials) but not those aged 39 to 49 years (RR, 0.98 [CI, 0.74 to 1.37]) (4 trials); less evidence supported this outcome. Most trials used imaging technologies and treatments that are now outdated, and definitions of advanced breast cancer were heterogeneous. Studies of effectiveness based on risk factors, intervals, or other modalities were unavailable or methodologically limited. Breast cancer mortality is generally reduced with mammography
Impact of prenatal screening on the prevalence of Down syndrome in Slovenia.
Rudolf, Gorazd; Tul, Nataša; Verdenik, Ivan; Volk, Marija; Brezigar, Anamarija; Kokalj Vokač, Nadja; Jeršin, Nataša; Prosenc, Bernarda; Premru Sršen, Tanja; Peterlin, Borut
2017-01-01
To evaluate the impact of prenatal screening and genetic testing for trisomy 21 (T21) on the prevalence of T21 in Slovenia. Data about all prenatally and postnatally confirmed cases of T21 in Slovenia between 1981 and 2012 were collected retrospectively from all genetic laboratories in Slovenia. The expected number of babies with T21 according to maternal age was calculated. The primary outcomes measures were number of fetuses and newborn infants with T21 diagnosed prenatally and postnatally and the impact of advances in screening and genetic diagnostics on the prevalence of newborns with T21 in Slovenia. Despite a significantly increased mean maternal age from 25.4 years in year 1981 to 30.3 years in year 2012 the prevalence of newborn infants with T21 was 0.51 per 1000 births compared to 0.55 per 1000 births, respectively. The prevalence of prenatally diagnosed cases increased from 0.03 per 1000 births to 2.06 per 1000. The detection rate of T21 in year 2012 was 78,9%. The total number of prenatal invasive procedures (chorionic villous sampling and amniocenteses) carried out during that period was rising until 2002, since when it is stable at around 7%. The advancement and implementation of screening tests and prenatal diagnostic procedures in Slovenia caused an important improvement in the efficiency of the prenatal detection of T21.
Screening of 20 patients with X-linked mental retardation using chromosome X-specific array-MAPH.
Kousoulidou, L.; Parkel, S.; Zilina, O.; Palta, P.; Puusepp, H.; Remm, M.; Turner, G.; Boyle, J.; Bokhoven, J.H.L.M. van; Brouwer, A.; Esch, H. van; Froyen, G.; Ropers, H.H.; Chelly, J.; Moraine, C.; Gecz, J.; Kurg, A.; Patsalis, P.C.
2007-01-01
The rapid advancement of high-resolution DNA copy number assessment methods revealed the significant contribution of submicroscopic genetic imbalances to abnormal phenotypes, including mental retardation. In order to detect submicroscopic genetic imbalances, we have screened 20 families with
Smith, P A; Hewer, E M
2003-06-01
Following the decision to establish an Advanced Biomedical Scientist Practitioner grade for senior biomedical scientists in the NHS Cervical Screening Programme, a conjoint examination board has been appointed by the Royal College of Pathologists and Institute of Biomedical Science to oversee the Certificate in Advanced Practice in Cervical Cytology examination. The examination consists of a multiple-choice paper, short-answer written questions and practical microscopy sections covering screening of unmarked slides, and more complex discussion cases. In the first year there were 58 entries with 29 successful candidates, a pass rate of 50%. The standard of performance in the examination showed a wide range, and some candidates appear to have underestimated the degree of preparation, knowledge or level of microscopy skill required.
Advanced and tendencies in the development of display technologies
Kompanets, I. N.
2006-06-01
Advances and key display applications are discussed. Computer, compact mobile, TV and collective large screen displays are mentioned. Flat panel displays step on CRT devices to leave them behind in 2007. Materials, active matricies and applications of bright radiative field emission and organic LED displays are developing successively and pressing other technologies to be used in photo-cameras, cellular phones, auto-cars and avionics. Progress in flexible screens can substantially extend the display design and application soon. 3D display systems are under intensive development, and laser is an important unit in some vaiants of holographic and volumetric 3D displays. Value forecast of different display markets is presented.
Interval Cancers in a Population-Based Screening Program for Colorectal Cancer in Catalonia, Spain
Directory of Open Access Journals (Sweden)
M. Garcia
2015-01-01
Full Text Available Objective. To analyze interval cancers among participants in a screening program for colorectal cancer (CRC during four screening rounds. Methods. The study population consisted of participants of a fecal occult blood test-based screening program from February 2000 to September 2010, with a 30-month follow-up (n = 30,480. We used hospital administration data to identify CRC. An interval cancer was defined as an invasive cancer diagnosed within 30 months of a negative screening result and before the next recommended examination. Gender, age, stage, and site distribution of interval cancers were compared with those in the screen-detected group. Results. Within the study period, 97 tumors were screen-detected and 74 tumors were diagnosed after a negative screening. In addition, 17 CRC (18.3% were found after an inconclusive result and 2 cases were diagnosed within the surveillance interval (2.1%. There was an increase of interval cancers over the four rounds (from 32.4% to 46.0%. When compared with screen-detected cancers, interval cancers were found predominantly in the rectum (OR: 3.66; 95% CI: 1.51–8.88 and at more advanced stages (P=0.025. Conclusion. There are large numbers of cancer that are not detected through fecal occult blood test-based screening. The low sensitivity should be emphasized to ensure that individuals with symptoms are not falsely reassured.
Screening for colon cancer; Colonoscopy - screening; Sigmoidoscopy - screening; Virtual colonoscopy - screening; Fecal immunochemical test; Stool DNA test; sDNA test; Colorectal cancer - screening; Rectal ...
An experience of qualified preventive screening: shiraz smart screening software.
Islami Parkoohi, Parisa; Zare, Hashem; Abdollahifard, Gholamreza
2015-01-01
Computerized preventive screening software is a cost effective intervention tool to address non-communicable chronic diseases. Shiraz Smart Screening Software (SSSS) was developed as an innovative tool for qualified screening. It allows simultaneous smart screening of several high-burden chronic diseases and supports reminder notification functionality. The extent in which SSSS affects screening quality is also described. Following software development, preventive screening and annual health examinations of 261 school staff (Medical School of Shiraz, Iran) was carried out in a software-assisted manner. To evaluate the quality of the software-assisted screening, we used quasi-experimental study design and determined coverage, irregular attendance and inappropriateness proportions in relation with the manual and software-assisted screening as well as the corresponding number of requested tests. In manual screening method, 27% of employees were covered (with 94% irregular attendance) while by software-assisted screening, the coverage proportion was 79% (attendance status will clear after the specified time). The frequency of inappropriate screening test requests, before the software implementation, was 41.37% for fasting plasma glucose, 41.37% for lipid profile, 0.84% for occult blood, 0.19% for flexible sigmoidoscopy/colonoscopy, 35.29% for Pap smear, 19.20% for mammography and 11.2% for prostate specific antigen. All of the above were corrected by the software application. In total, 366 manual screening and 334 software-assisted screening tests were requested. SSSS is an innovative tool to improve the quality of preventive screening plans in terms of increased screening coverage, reduction in inappropriateness and the total number of requested tests.
Colorectal cancer screening of immigrants to Italy. Figures from the 2013 National Survey.
Turrin, Anna; Zorzi, Manuel; Giorgi Rossi, Paolo; Senore, Carlo; Campari, Cinzia; Fedato, Chiara; Naldoni, Carlo; Anghinoni, Emanuela; Carrozzi, Giuliano; Sassoli De' Bianchi, Priscilla; Zappa, Marco
2015-12-01
Colorectal cancer screening programmes in Italy invite 50-69-year-old residents for a faecal immunochemical test every two years, regardless of their citizenship. The 2013 National Survey on Italian colorectal cancer screening programmes compared immigrants born in low- or middle-income countries with subjects who were born in Italy, by collecting aggregated data on compliance, faecal immunochemical test results, compliance with colonoscopy, detected lesions and stage at diagnosis separately for Italians and immigrants. Overall, 85 screening programmes invited 3,292,451 subjects, of whom 192,629 had been born abroad (5.9%). Compliance with invitation was lower in immigrants (34.3% vs. 51.3% in Italians), with pimmigrants but in the oldest of Italians. Immigrants showed a borderline excess of standardised faecal immunochemical test positivity rate at first screening (5.4% vs. 5.1% in Italians, p=0.05) and a significant excess at repeat screenings (4.8% vs. 4.4%, p=0.002). The detection rates for carcinoma and advanced adenomas were lower in immigrants than in Italians at first screening (respectively 1.34‰ vs. 1.62‰ and 8.41‰ vs. 9.25‰) - although the differences were not statistically significant - but not at repeat screening (respectively 1.06‰ vs. 0.98‰ and 6.90‰ vs. 6.79‰). Migrants showed a lower compliance with screening than Italians. The prevalence of neoplasia was lower at first screening and similar to the Italians' at repeat screenings. Copyright © 2015 Elsevier Inc. All rights reserved.
Through an shRNA screen, we identified the protein arginine methyltransferase Prmt1 as a vulnerable intervention point in murine p53/Rb-null osteosarcomas, the human counterpart of which lacks effective therapeutic options. Depletion of Prmt1 in p53-deficient cells impaired tumor initiation and maintenance in vitro and in vivo Mechanistic studies reveal that translation-associated pathways were enriched for Prmt1 downstream targets, implicating Prmt1 in translation control.
SETD1A modulates cell cycle progression through a miRNA network that regulates p53 target genes
Tajima, Ken; Yae, Toshifumi; Javaid, Sarah; Tam, Oliver; Comaills, Valentine; Morris, Robert; Wittner, Ben S.; Liu, Mingzhu; Engstrom, Amanda; Takahashi, Fumiyuki; Black, Joshua C.; Ramaswamy, Sridhar; Shioda, Toshihiro; Hammell, Molly; Haber, Daniel A.
2015-01-01
Expression of the p53-inducible antiproliferative gene BTG2 is suppressed in many cancers in the absence of inactivating gene mutations, suggesting alternative mechanisms of silencing. Using a shRNA screen targeting 43 histone lysine methyltransferases (KMTs), we show that SETD1A suppresses BTG2 expression through its induction of several BTG2-targeting miRNAs. This indirect but highly specific mechanism, by which a chromatin regulator that mediates transcriptional activating marks can lead t...
Yang, Haixia; Xiao, Lei; Wang, Nanping
2017-04-01
Peroxisome proliferator-activated receptor α (PPARα) plays a key role in lipid metabolism and glucose homeostasis and a crucial role in the prevention and treatment of metabolic diseases. Natural dietary compounds, including nutrients and phytochemicals, are PPARα ligands or modulators. High-throughput screening assays have been developed to screen for PPARα ligands and modulators in our diet. In the present review, we discuss recent advances in our knowledge of PPARα, including its structure, function, and ligand and modulator screening assays, and summarize the different types of dietary PPARα ligands and modulators. © 2016 Ruijin Hospital, Shanghai Jiaotong University School of Medicine and John Wiley & Sons Australia, Ltd.
Energy Technology Data Exchange (ETDEWEB)
Roman, M., E-mail: Marta.Roman@kreftregisteret.no [Cancer Registry of Norway, Oslo (Norway); Department of Women and Children’s Health, Oslo University Hospital, Oslo (Norway); Skaane, P., E-mail: PERSK@ous-hf.no [Department of Radiology, Oslo University Hospital Ullevaal, University of Oslo, Oslo (Norway); Hofvind, S., E-mail: Solveig.Hofvind@kreftregisteret.no [Cancer Registry of Norway, Oslo (Norway); Oslo and Akershus University College of Applied Sciences, Faculty of Health Science, Oslo (Norway)
2014-09-15
Highlights: • We found variation in early performance measures across screening centres. • Radiologists’ performance may play a key role in the variability. • Potential to improve the effectiveness of breast cancer screening programs. • Continuous surveillance of screening centres and radiologists is essential. - Abstract: Background: Recall for assessment in mammographic screening entails an inevitable number of false-positive screening results. This study aimed to investigate the variation in the cumulative risk of a false positive screening result and the positive predictive value across the screening centres in the Norwegian Breast Cancer Screening Program. Methods: We studied 618,636 women aged 50–69 years who underwent 2,090,575 screening exams (1996–2010. Recall rate, positive predictive value, rate of screen-detected cancer, and the cumulative risk of a false positive screening result, without and with invasive procedures across the screening centres were calculated. Generalized linear models were used to estimate the probability of a false positive screening result and to compute the cumulative false-positive risk for up to ten biennial screening examinations. Results: The cumulative risk of a false-positive screening exam varied from 10.7% (95% CI: 9.4–12.0%) to 41.5% (95% CI: 34.1–48.9%) across screening centres, with a highest to lowest ratio of 3.9 (95% CI: 3.7–4.0). The highest to lowest ratio for the cumulative risk of undergoing an invasive procedure with a benign outcome was 4.3 (95% CI: 4.0–4.6). The positive predictive value of recall varied between 12.0% (95% CI: 11.0–12.9%) and 19.9% (95% CI: 18.3–21.5%), with a highest to lowest ratio of 1.7 (95% CI: 1.5–1.9). Conclusions: A substantial variation in the performance measures across the screening centres in the Norwegian Breast Cancer Screening Program was identified, despite of similar administration, procedures, and quality assurance requirements. Differences in the
International Nuclear Information System (INIS)
Roman, M.; Skaane, P.; Hofvind, S.
2014-01-01
Highlights: • We found variation in early performance measures across screening centres. • Radiologists’ performance may play a key role in the variability. • Potential to improve the effectiveness of breast cancer screening programs. • Continuous surveillance of screening centres and radiologists is essential. - Abstract: Background: Recall for assessment in mammographic screening entails an inevitable number of false-positive screening results. This study aimed to investigate the variation in the cumulative risk of a false positive screening result and the positive predictive value across the screening centres in the Norwegian Breast Cancer Screening Program. Methods: We studied 618,636 women aged 50–69 years who underwent 2,090,575 screening exams (1996–2010. Recall rate, positive predictive value, rate of screen-detected cancer, and the cumulative risk of a false positive screening result, without and with invasive procedures across the screening centres were calculated. Generalized linear models were used to estimate the probability of a false positive screening result and to compute the cumulative false-positive risk for up to ten biennial screening examinations. Results: The cumulative risk of a false-positive screening exam varied from 10.7% (95% CI: 9.4–12.0%) to 41.5% (95% CI: 34.1–48.9%) across screening centres, with a highest to lowest ratio of 3.9 (95% CI: 3.7–4.0). The highest to lowest ratio for the cumulative risk of undergoing an invasive procedure with a benign outcome was 4.3 (95% CI: 4.0–4.6). The positive predictive value of recall varied between 12.0% (95% CI: 11.0–12.9%) and 19.9% (95% CI: 18.3–21.5%), with a highest to lowest ratio of 1.7 (95% CI: 1.5–1.9). Conclusions: A substantial variation in the performance measures across the screening centres in the Norwegian Breast Cancer Screening Program was identified, despite of similar administration, procedures, and quality assurance requirements. Differences in the
... Depression Screening Substance Abuse Screening Alcohol Use Screening Alcohol Use Screening (AUDIT-C) - Instructions The following questions ... this tool, there is also text-only version . Alcohol Use Screening (AUDIT-C) - Manual Instructions The following ...
Yousaf-Khan, U.; Aalst, C. van der; Jong, P.A. de; Heuvelmans, M.; Scholten, E.T.; Lammers, J.-W.J.; Ooijen, P. van; Nackaerts, K.; Weenink, C.; Groen, H.; Vliegenthart, R.; Haaf, K. Ten; Oudkerk, M.; Koning, H. de
2016-01-01
In the USA annual lung cancer screening is recommended. However, the optimal screening strategy (eg, screening interval, screening rounds) is unknown. This study provides results of the fourth screening round after a 2.5-year interval in the Dutch-Belgian Lung Cancer Screening trial
Yousaf-Khan, Uraujh; van der Aalst, Carlijn; de Jong, Pim A; Heuvelmans, Marjolein; Scholten, Ernst; Lammers, Jan-Willem; van Ooijen, Peter; Nackaerts, Kristiaan; Weenink, Carla; Groen, Harry; Vliegenthart, Rozemarijn; Ten Haaf, Kevin; Oudkerk, Matthijs; de Koning, Harry
BACKGROUND: In the USA annual lung cancer screening is recommended. However, the optimal screening strategy (eg, screening interval, screening rounds) is unknown. This study provides results of the fourth screening round after a 2.5-year interval in the Dutch-Belgian Lung Cancer Screening trial
Yousaf-Khan, Uraujh; van der Aalst, Carlijn; de Jong, Pim A.; Heuvelmans, Marjolein; Scholten, Ernst; Lammers, Jan-Willem; van Ooijen, Peter; Nackaerts, Kristiaan; Weenink, Carla; Groen, Harry; Vliegenthart, Rozemarijn; Ten Haaf, Kevin; Oudkerk, Matthijs; de Koning, Harry
Background In the USA annual lung cancer screening is recommended. However, the optimal screening strategy (eg, screening interval, screening rounds) is unknown. This study provides results of the fourth screening round after a 2.5-year interval in the Dutch-Belgian Lung Cancer Screening trial
A Conceptual Framework of Human Reliability Analysis for Execution Human Error in NPP Advanced MCRs
Energy Technology Data Exchange (ETDEWEB)
Jang, In Seok; Kim, Ar Ryum; Seong, Poong Hyun [KAIST, Daejeon (Korea, Republic of); Jung, Won Dea [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)
2014-08-15
The operation environment of Main Control Rooms (MCRs) in Nuclear Power Plants (NPPs) has changed with the adoption of new human-system interfaces that are based on computer-based technologies. The MCRs that include these digital and computer technologies, such as large display panels, computerized procedures, and soft controls, are called Advanced MCRs. Among the many features of Advanced MCRs, soft controls are a particularly important feature because the operation action in NPP Advanced MCRs is performed by soft control. Using soft controls such as mouse control, and touch screens, operators can select a specific screen, then choose the controller, and finally manipulate the given devices. Due to the different interfaces between soft control and hardwired conventional type control, different human error probabilities and a new Human Reliability Analysis (HRA) framework should be considered in the HRA for advanced MCRs. In other words, new human error modes should be considered for interface management tasks such as navigation tasks, and icon (device) selection tasks in monitors and a new framework of HRA method taking these newly generated human error modes into account should be considered. In this paper, a conceptual framework for a HRA method for the evaluation of soft control execution human error in advanced MCRs is suggested by analyzing soft control tasks.
A Conceptual Framework of Human Reliability Analysis for Execution Human Error in NPP Advanced MCRs
International Nuclear Information System (INIS)
Jang, In Seok; Kim, Ar Ryum; Seong, Poong Hyun; Jung, Won Dea
2014-01-01
The operation environment of Main Control Rooms (MCRs) in Nuclear Power Plants (NPPs) has changed with the adoption of new human-system interfaces that are based on computer-based technologies. The MCRs that include these digital and computer technologies, such as large display panels, computerized procedures, and soft controls, are called Advanced MCRs. Among the many features of Advanced MCRs, soft controls are a particularly important feature because the operation action in NPP Advanced MCRs is performed by soft control. Using soft controls such as mouse control, and touch screens, operators can select a specific screen, then choose the controller, and finally manipulate the given devices. Due to the different interfaces between soft control and hardwired conventional type control, different human error probabilities and a new Human Reliability Analysis (HRA) framework should be considered in the HRA for advanced MCRs. In other words, new human error modes should be considered for interface management tasks such as navigation tasks, and icon (device) selection tasks in monitors and a new framework of HRA method taking these newly generated human error modes into account should be considered. In this paper, a conceptual framework for a HRA method for the evaluation of soft control execution human error in advanced MCRs is suggested by analyzing soft control tasks
Directory of Open Access Journals (Sweden)
Zilin Sun
Full Text Available The efficacy of using fasting plasma glucose (FPG alone as a preferred screening test for diabetes has been questioned. This study was aimed to evaluate whether the use of serum advanced glycation end products-peptides (sAGEP would help to improve the efficacy of FPG in diabetes screening among high-risk Chinese subjects with FPG <7.0 mmol/L. FPG, 2-h plasma glucose (2h-PG, serum glycated haemoglobin A1c (HbA1c, and sAGEP were measured in 857 Chinese subjects with risk factors for diabetes. The areas under receiver operating characteristic (ROC curves generated by logistic regression models were assessed and compared to find the best model for diabetes screening in subjects with FPG <7.0 mmol/L. The optimal critical line was determined by maximizing the sum of sensitivity and specificity. Among the enrolled subjects, 730 of them had FPG <7.0 mmol/L, and only 41.7% new diabetes cases were identified using the 1999 World Health Organization FPG criterion (FPG ≥7.0 mmol/L. The area under ROC curves generated by the model on FPG-sAGEP was the largest compared with that on FPG-HbA1c, sAGEP, HbA1c or FPG in subjects with FPG <7.0 mmol/L. By maximizing the sum of sensitivity and specificity, the optimal critical line was determined as 0.69×FPG + 0.14×sAGEP = 7.03, giving a critical sensitivity of 91.2% in detecting 2h-PG ≥11.1 mmol/L, which was significantly higher than that of FPG-HbA1c or HbA1c. The model on FPG-sAGEP improves the efficacy of using FPG alone in detecting diabetes among high-risk Chinese subjects with FPG <7.0 mmol/L, and is worth being promoted for future diabetes screening.
Recent advances in processing and applications of microwave ferrites
International Nuclear Information System (INIS)
Harris, Vincent G.; Geiler, Anton; Chen Yajie; Yoon, Soack Dae; Wu Mingzhong; Yang, Aria; Chen Zhaohui; He Peng; Parimi, Patanjali V.; Zuo Xu; Patton, Carl E.; Abe, Manasori; Acher, Olivier
2009-01-01
Next generation magnetic microwave devices will be planar, smaller, weigh less, and perform well beyond the present state-of-the-art. For this to become a reality advances in ferrite materials must first be realized. These advances include self-bias magnetization, tunability of the magnetic anisotropy, low microwave loss, and volumetric and weight reduction. To achieve these goals one must turn to novel materials processing methods. Here, we review recent advances in the processing of microwave ferrites. Attention is paid to the processing of ferrite films by pulsed laser deposition, liquid phase epitaxy, spin spray ferrite plating, screen printing, and compaction of quasi-single crystals. Conventional and novel applications of ferrite materials, including microwave non-reciprocal passive devices, microwave signal processing, negative index metamaterial-based electronics, and electromagnetic interference suppression are discussed.
Non-visit-based cancer screening using a novel population management system.
Atlas, Steven J; Zai, Adrian H; Ashburner, Jeffrey M; Chang, Yuchiao; Percac-Lima, Sanja; Levy, Douglas E; Chueh, Henry C; Grant, Richard W
2014-01-01
Advances in information technology (IT) now permit population-based preventive screening, but the best methods remain uncertain. We evaluated whether involving primary care providers (PCPs) in a visit-independent population management IT application led to more effective cancer screening. We conducted a cluster-randomized trial involving 18 primary care practice sites and 169 PCPs from June 15, 2011, to June 14, 2012. Participants included adults eligible for breast, cervical, and/or colorectal cancer screening. In practices randomized to the intervention group, PCPs reviewed real-time rosters of their patients overdue for screening and provided individualized contact (via a letter, practice delegate, or patient navigator) or deferred screening (temporarily or permanently). In practices randomized to the comparison group, overdue patients were automatically sent reminder letters and transferred to practice delegate lists for follow-up. Intervention patients without PCP action within 8 weeks defaulted to the automated control version. The primary outcome was adjusted average cancer screening completion rates over 1-year follow-up, accounting for clustering by physician or practice. Baseline cancer screening rates (80.8% vs 80.3%) were similar among patients in the intervention (n = 51,071) and comparison group (n = 52,799). Most intervention providers used the IT application (88 of 101, 87%) and users reviewed 7984 patients overdue for at least 1 cancer screening (73% sent reminder letter, 6% referred directly to a practice delegate or patient navigator, and 21% deferred screening). In addition, 6128 letters were automatically sent to patients in the intervention group (total of 12,002 letters vs 16,378 letters in comparison practices; P management IT application resulted in similar cancer screening rates compared with an automated reminder system, but fewer patients were sent reminder letters. This suggests that PCPs were able to identify and exclude from contact
Directory of Open Access Journals (Sweden)
Andreas Sundermann
2016-01-01
Full Text Available A high-throughput (HT screening platform developed at hte with the application focus on automotive catalysis is described. hte HT units are configured for performing steady-state testing, as well as dynamic tests with fast feed switches, such as lean/rich excursions for the evaluation of NOx storage capacity and efficiency of lean NOx traps (LNT, ammonia storage capacity for selective catalytic reduction (SCR, evaluation of oxygen storage capacity (OSC, as well as lambda sweep tests for screening of three-way catalysts (TWC. Even though catalysts are screened on a rather small scale (~100 mg powder, experience showed that dosing rather complex gas mixtures in concentrations close to that found in real exhaust for the given application is mandatory to generate relevant data. The objective of this work is to give additional insight into HT technology. In the industrial research laboratory, HT screening has matured to become a reliable approach for rapid screening of both reaction parameter spaces, as well as material properties relevant for exhaust gas catalyst development. Due to the speed of optimized screening involving 48 parallel reactors, automated handling of primary data is an imported requirement. Software for data reduction, like estimation of light-off temperature, needs to be robust and handle results for diverse sample libraries in an unattended fashion. In combination with the statistical design of experiment and multivariate data analysis, HT testing has become a valuable enhancement to automotive catalyst development.
Patients’ perceptions of oral cancer screening in dental practice: a cross-sectional study
2012-01-01
Background Oral cancer is increasing in incidence in the UK and indeed worldwide. Delay in diagnosis is common; up to half of patients are diagnosed with advanced lesions. Thus it is essential to develop methods to aid early detection. This study aimed to assess dental patients’ experiences and awareness of oral cancer and screening within general dental practice. Methods A cross-sectional questionnaire survey of 184 English-speaking adults, with no previous history of oral cancer was conducted. The questionnaire collected data on participant’s knowledge of oral cancer, experience of ‘screening’, attitudes and feelings towards having a screening, anticipated help-seeking behaviours, health-related behaviours (particularly risk factors) and sociodemographics. Results Twenty percent of respondents had never heard of oral cancer; 77% knew little or nothing about it and 72% did not know that their Dentist routinely screens for oral cancer. Overall, attitudes to screening were positive. Ninety two percent of respondents would like their Dentist to tell them if they were being screened for signs of oral cancer and 97% would like help from their Dentists to reduce their risk. Conclusion Patients seem generally unaware of oral cancer screening by their dentist but are happy to take part in screening, would like to be informed, and welcome the support of their Dentist to reduce their risk of developing oral cancer. PMID:23249393
Oosterling, Iris J.; Wensing, Michel; Swinkels, Sophie H.; van der Gaag, Rutger Jan; Visser, Janne C.; Woudenberg, Tim; Minderaa, Ruud; Steenhuis, Mark-Peter; Buitelaar, Jan K.
Background: Few field trials exist on the impact of implementing guidelines for the early detection of autism spectrum disorders (ASD). The aims of the present study were to develop and evaluate a clinically relevant integrated early detection programme based on the two-stage screening approach of
Current Status of Comprehensive Chromosome Screening for Elective Single-Embryo Transfer
Directory of Open Access Journals (Sweden)
Ming-Yih Wu
2014-01-01
Full Text Available Most in vitro fertilization (IVF experts and infertility patients agree that the most ideal assisted reproductive technology (ART outcome is to have a healthy, full-term singleton born. To this end, the most reliable policy is the single-embryo transfer (SET. However, unsatisfactory results in IVF may result from plenty of factors, in which aneuploidy associated with advanced maternal age is a major hurdle. Throughout the past few years, we have got a big leap in advancement of the genetic screening of embryos on aneuploidy, translocation, or mutations. This facilitates a higher success rate in IVF accompanied by the policy of elective SET (eSET. As the cost is lowering while the scale of genome characterization continues to be up over the recent years, the contemporary technologies on trophectoderm biopsy and freezing-thaw, comprehensive chromosome screening (CCS with eSET appear to be getting more and more popular for modern IVF centers. Furthermore, evidence has showen that, by these avant-garde techniques (trophectoderm biopsy, vitrification, and CCS, older infertile women with the help of eSET may have an opportunity to increase the success of their live birth rates approaching those reported in younger infertility patients.
International Nuclear Information System (INIS)
Moran, S.; Warren-Forward, H.
2016-01-01
Introduction: Globally, the role of the radiographer is changing; some countries have developed advanced roles with specific scopes of practice. Other countries, like Australia, are in the process of this change. The aim of this research is to assess the diagnostic outcomes reported by the radiographers and compare them to those reported by current screen readers. Method: Six experienced radiographers were invited to participate in a prospective study conducted between 2010 and 2011. They were required to read 2000 mammograms each. Their results were compared with those of the radiologists. Statistical analysis of the results included overall cancer detection rates, recall rates, levels of agreement, kappa, sensitivity, specificity, accuracy, positive predictive value and negative predictive value. Results: A total of 9348 women were included in the study. The percentage of cancers detected by the radiographers ranged from 53% to 100% of the cancers detected by the radiologists. Radiologist recall rate ranged between 3.4% and 5.5% and the radiographers' range was 2.9%–9.8%. Level of agreement of the radiographers with the radiologists ranged from 90 to 96%. Conclusion: The potential for accuracy in screen reading by Australian radiographers is supported by the results of this study. Implementation of formal training is likely to result in an increase in the diagnostic accuracy of radiographers. - Highlights: • Radiographers prospectively read 2000 screening mammograms each. • These results support potential for accuracy in screen reading by radiographers. • Will advanced practice be introduced within BreastScreen Australia?.
International Nuclear Information System (INIS)
Morrison, B. F.; Aiken, W.; Mayhew, R.; Gordon, Y.; Reid, M.
2016-01-01
Prostate cancer is highly prevalent in Jamaica and is the leading cause of cancer-related deaths. Our aim was to evaluate the patterns of screening in the largest organized screening clinic in Jamaica at the Jamaica Cancer Society. A retrospective analysis of all men presenting for screening at the Jamaica Cancer Society from 1995 to 2005 was done. All patients had digital rectal examinations (DRE) and prostate specific antigen (PSA) tests done. Results of prostate biopsies were noted. 1117 men of mean age 59.9 ± 8.2 years presented for screening. The median documented PSA was 1.6 ng/mL (maximum of 5170 ng/mL). Most patients presented for only 1 screen. There was a gradual reduction in the mean age of presentation for screening over the period. Prostate biopsies were requested on 11% of screening visits; however, only 59% of these were done. 5.6% of all persons screened were found to have cancer. Of the cancers diagnosed, Gleason 6 adenocarcinoma was the commonest grade and median PSA was 8.9 ng/mL (range 1.5-1059 ng/mL). Older men tend to screen for prostate cancer in Jamaica. However, compliance with regular maintenance visits and requests for confirmatory biopsies are poor. Screening needs intervention in the Jamaican population.
Systemic treatment of advanced, persistent or recurrent cervical cancer
International Nuclear Information System (INIS)
Reckova, M.
2015-01-01
The cervical cancer is the third most common malignancy in women in the world. Despite advances in screening and treatment there are a relatively large number of patients who are diagnosed with advanced stage of disease, or who have inoperable recurrence. In this group of patients, the main aim of a treatment is palliative intent. The main cytotoxic agent is cisplatin, but the responses are also observed with other chemotherapy agents. Improved therapeutic results are observed with combined platinum-based chemotherapy regimens as compared to cisplatin monotherapy. Overall, however, the treatment results in advanced, persistent and recurrent cervical cancer are unfavorable and disease is considered to be relatively chemo resistant. The new treatment approaches are searched and a significant therapeutic benefit, as far as progression-free and overall survival, has been recently demonstrated when adding bevacizumab to systemic chemotherapy. The current article is a review of systemic treatment in advanced, persistent and recurrent metastatic carcinoma of the cervix. (author)
Trends in adherence to recommended cancer screening: The US population and working cancer survivors
Directory of Open Access Journals (Sweden)
Tainya C. Clarke
2012-12-01
Full Text Available Introduction: Over the past decade the United States has seen a decrease in advanced cancer diagnoses. There has also been an increase in the number of cancer survivors returning to work. Cancer screening behaviors among survivors may play an important role in their return-to-work process. Adherence to a post-treatment cancer screening protocol increases early detection of secondary tumors and reduces potentially limiting side-effects. We compared screening trends among all cancer survivors, working survivors, and the general population over the last decade.Methods: Trends in adherence to recommended screening were analyzed by site-specific cancer. We used the Healthy People goals as a measure of desired adherence. We selected participants 18+ years from 1997 to 2010 National Health Interview Survey (NHIS for years where detailed cancer screening information was available. Using the recommendations of the American Cancer Society as a guide, we assessed adherence to cancer screening across the decade. There were 174,393 participants. Analyses included 7,528 working cancer survivors representing 3.8 million US workers, and 119,374 adults representing more than 100 million working Americans with no cancer history.Results: The US population met the Healthy People 2010 goal for colorectal screening, but declined in all other recommended cancer screening. Cancer survivors met and maintained the HP2010 goal for all, except cervical cancer screening. Survivors had higher screening rates than the general population. Among survivors, white-collar and service occupations had higher screening rates than blue-collar survivors.Conclusions: Cancer survivors report higher screening rates than the general population. Nevertheless, national screening rates are lower than desired, and disparities exist by cancer history and occupation. Understanding existing disparities, and the impact of cancer screening on survivors is crucial as the number of working survivors
Automated Groundwater Screening
International Nuclear Information System (INIS)
Taylor, Glenn A.; Collard, Leonard B.
2005-01-01
The Automated Intruder Analysis has been extended to include an Automated Ground Water Screening option. This option screens 825 radionuclides while rigorously applying the National Council on Radiation Protection (NCRP) methodology. An extension to that methodology is presented to give a more realistic screening factor for those radionuclides which have significant daughters. The extension has the promise of reducing the number of radionuclides which must be tracked by the customer. By combining the Automated Intruder Analysis with the Automated Groundwater Screening a consistent set of assumptions and databases is used. A method is proposed to eliminate trigger values by performing rigorous calculation of the screening factor thereby reducing the number of radionuclides sent to further analysis. Using the same problem definitions as in previous groundwater screenings, the automated groundwater screening found one additional nuclide, Ge-68, which failed the screening. It also found that 18 of the 57 radionuclides contained in NCRP Table 3.1 failed the screening. This report describes the automated groundwater screening computer application
Impact of prenatal screening on the prevalence of Down syndrome in Slovenia.
Directory of Open Access Journals (Sweden)
Gorazd Rudolf
Full Text Available To evaluate the impact of prenatal screening and genetic testing for trisomy 21 (T21 on the prevalence of T21 in Slovenia.Data about all prenatally and postnatally confirmed cases of T21 in Slovenia between 1981 and 2012 were collected retrospectively from all genetic laboratories in Slovenia. The expected number of babies with T21 according to maternal age was calculated.The primary outcomes measures were number of fetuses and newborn infants with T21 diagnosed prenatally and postnatally and the impact of advances in screening and genetic diagnostics on the prevalence of newborns with T21 in Slovenia.Despite a significantly increased mean maternal age from 25.4 years in year 1981 to 30.3 years in year 2012 the prevalence of newborn infants with T21 was 0.51 per 1000 births compared to 0.55 per 1000 births, respectively. The prevalence of prenatally diagnosed cases increased from 0.03 per 1000 births to 2.06 per 1000. The detection rate of T21 in year 2012 was 78,9%. The total number of prenatal invasive procedures (chorionic villous sampling and amniocenteses carried out during that period was rising until 2002, since when it is stable at around 7%.The advancement and implementation of screening tests and prenatal diagnostic procedures in Slovenia caused an important improvement in the efficiency of the prenatal detection of T21.
Screening colonoscopy for the detection of neoplastic lesions in asymptomatic HIV-infected subjects.
Bini, E J; Green, B; Poles, M A
2009-08-01
Although non-AIDS defining malignancies are rapidly increasing as HIV-infected subjects live longer, little is know about the results of screening for colonic neoplasms (adenomatous polyps and adenocarcinomas) in this population. We conducted a screening colonoscopy study to determine the prevalence of colonic neoplasms in 136 asymptomatic HIV-infected subjects >or=50 years of age and 272 asymptomatic uninfected control subjects matched for age, sex, and family history of colorectal cancer. Advanced neoplasms were defined as adenomas >or=10 mm or any adenoma, regardless of size, with villous histology, high-grade dysplasia, or adenocarcinoma. The prevalence of neoplastic lesions was significantly higher in HIV-infected subjects than in control subjects (62.5% vs 41.2%, pscreening colonoscopy should be offered to HIV-infected subjects, but the age of initiation and the optimal frequency of screening require further study.
Improving Electronic Sensor Reliability by Robust Outlier Screening
Directory of Open Access Journals (Sweden)
Federico Cuesta
2013-10-01
Full Text Available Electronic sensors are widely used in different application areas, and in some of them, such as automotive or medical equipment, they must perform with an extremely low defect rate. Increasing reliability is paramount. Outlier detection algorithms are a key component in screening latent defects and decreasing the number of customer quality incidents (CQIs. This paper focuses on new spatial algorithms (Good Die in a Bad Cluster with Statistical Bins (GDBC SB and Bad Bin in a Bad Cluster (BBBC and an advanced outlier screening method, called Robust Dynamic Part Averaging Testing (RDPAT, as well as two practical improvements, which significantly enhance existing algorithms. Those methods have been used in production in Freescale® Semiconductor probe factories around the world for several years. Moreover, a study was conducted with production data of 289,080 dice with 26 CQIs to determine and compare the efficiency and effectiveness of all these algorithms in identifying CQIs.
Kanne, Stephen M; Carpenter, Laura Arnstein; Warren, Zachary
2018-05-07
There are many available tools with varying levels of accuracy designed to screen for Autism Spectrum Disorder (ASD) in young children, both in the general population and specifically among those referred for developmental concerns. With burgeoning waitlists for comprehensive diagnostic ASD assessments, finding accurate methods and tools for advancing diagnostic triage becomes increasingly important. The current study compares the efficacy of four oft used paper and pencil measures, the Modified Checklist for Autism in Toddlers Revised with Follow-up, the Social Responsiveness Scale, Second Edition, and the Social Communication Questionnaire, and the Child Behavior Checklist to a novel mobile-health screening tool developed by Cognoa, Inc. (Cognoa) in a group of children 18-72 months of age. The Cognoa tool may have potential benefits as it integrates a series of parent-report questions with remote clinical ratings of brief video segments uploaded via parent's smartphones to calculate level of ASD risk. Participants were referred to one of three tertiary care diagnostic centers for ASD-related concerns (n = 230) and received a best estimate ASD diagnosis. Analysis and comparison of psychometric properties indicated potential advantages for Cognoa within this clinical sample across age ranges not often covered by another single measure/tool. Autism Res 2018. © 2018 International Society for Autism Research, Wiley Periodicals, Inc. With the wait times getting longer for comprehensive Autism Spectrum Disorder (ASD) diagnostic assessments, it is becoming increasingly important to find accurate tools to screen for ASD. The current study compares four screening measures that have been in use for some time to a novel mobile-health screening tool, called Cognoa. The Cognoa tool is novel because it integrates parent-report questions with clinical ratings of brief video segments uploaded via parent's smartphones to calculate ASD risk. Two hundred thirty children who
Directory of Open Access Journals (Sweden)
Tanya Milachich
2014-01-01
Full Text Available The current morphologically based selection of human embryos for transfer cannot detect chromosome aneuploidies. So far, only biopsy techniques have been able to screen for chromosomal aneuploidies in the in vitro fertilization (IVF embryos. Preimplantation genetic diagnosis (PGD or screening (PGS involves the biopsy of oocyte polar bodies or embryonic cells and has become a routine clinical procedure in many IVF clinics worldwide, including recent development of comprehensive chromosome screening of all 23 pairs of chromosomes by microarrays for aneuploidy screening. The routine preimplantation and prenatal genetic diagnosis (PND require testing in an aggressive manner. These procedures may be invasive to the growing embryo and fetus and potentially could compromise the clinical outcome. Therefore the aim of this review is to summarize not only the new knowledge on preimplantation and prenatal genetic diagnosis in humans, but also on the development of potential noninvasive embryo and fetal testing that might play an important role in the future.
2014-01-01
The current morphologically based selection of human embryos for transfer cannot detect chromosome aneuploidies. So far, only biopsy techniques have been able to screen for chromosomal aneuploidies in the in vitro fertilization (IVF) embryos. Preimplantation genetic diagnosis (PGD) or screening (PGS) involves the biopsy of oocyte polar bodies or embryonic cells and has become a routine clinical procedure in many IVF clinics worldwide, including recent development of comprehensive chromosome screening of all 23 pairs of chromosomes by microarrays for aneuploidy screening. The routine preimplantation and prenatal genetic diagnosis (PND) require testing in an aggressive manner. These procedures may be invasive to the growing embryo and fetus and potentially could compromise the clinical outcome. Therefore the aim of this review is to summarize not only the new knowledge on preimplantation and prenatal genetic diagnosis in humans, but also on the development of potential noninvasive embryo and fetal testing that might play an important role in the future. PMID:24783200
Advances in fragment-based drug discovery platforms.
Orita, Masaya; Warizaya, Masaichi; Amano, Yasushi; Ohno, Kazuki; Niimi, Tatsuya
2009-11-01
Fragment-based drug discovery (FBDD) has been established as a powerful alternative and complement to traditional high-throughput screening techniques for identifying drug leads. At present, this technique is widely used among academic groups as well as small biotech and large pharmaceutical companies. In recent years, > 10 new compounds developed with FBDD have entered clinical development, and more and more attention in the drug discovery field is being focused on this technique. Under the FBDD approach, a fragment library of relatively small compounds (molecular mass = 100 - 300 Da) is screened by various methods and the identified fragment hits which normally weakly bind to the target are used as starting points to generate more potent drug leads. Because FBDD is still a relatively new drug discovery technology, further developments and optimizations in screening platforms and fragment exploitation can be expected. This review summarizes recent advances in FBDD platforms and discusses the factors important for the successful application of this technique. Under the FBDD approach, both identifying the starting fragment hit to be developed and generating the drug lead from that starting fragment hit are important. Integration of various techniques, such as computational technology, X-ray crystallography, NMR, surface plasmon resonance, isothermal titration calorimetry, mass spectrometry and high-concentration screening, must be applied in a situation-appropriate manner.
Mammogram - breast cancer screening; Breast exam - breast cancer screening; MRI - breast cancer screening ... is performed to screen women to detect early breast cancer when it is more likely to be cured. ...
Genomic instability is a hallmark of human cancer, and results in widespread somatic copy number alterations. We used a genome-scale shRNA viability screen in human cancer cell lines to systematically identify genes that are essential in the context of particular copy-number alterations (copy-number associated gene dependencies). The most enriched class of copy-number associated gene dependencies was CYCLOPS (Copy-number alterations Yielding Cancer Liabilities Owing to Partial losS) genes, and spliceosome components were the most prevalent.
... C Cystic Fibrosis (CF) Gene Mutations Testing Cytomegalovirus (CMV) Tests D-dimer Dengue Fever Testing Des-gamma- ... Index of Screening Recommendations Not Listed? Not Listed? Newborn Screening Screening Tests for Infants Screening Tests for ...
Ethical considerations in image-based screening for coronary artery disease.
Wexler, Lewis
2002-04-01
Despite marked advances in the treatment and prevention of coronary artery disease (CAD) during the last decade, CAD and its complications continue to account for 20% of all deaths in the United States, more than other cause of death. Moreover, half of those who die suddenly of an acute myocardial infarction have no prior symptoms or overt manifestations of their underlying CAD. As our understanding of the pathophysiology of coronary atherosclerosis improves, diagnostic tests utilizing magnetic resonance (MR) imaging and gated computed tomography are being developed to screen for significant CAD in symptomatic individuals and in those who are preclinical or asymptomatic. Patients with known or suspected CAD might be candidates for MR studies of myocardial perfusion, myocardial contraction under stress, MR coronary arteriography, and plaque characterization. One rationale would be to uncover patients before they have a silent heart attack to institute preventative therapies. Although clinical studies have not definitively demonstrated the efficacy of these modalities, screening sites are proliferating and patients are demanding screening tests for CAD. Radiologists interpreting these tests should understand their underlying rationale, the data referenced to substantiate their use, and their responsibility to inform the patient of the results. This review describes current concepts of the pathophysiology of CAD, the rationale for the various screening tests for CAD that are in use or in development, and the potential value of the results of screening to individual patients. The ethical issues embodied in the performance of screening tests for CAD are placed in the context of the appropriate role of the radiologist as a physician interacting directly with a patient.
Usage of Capillary Electrophoresis for screening common Hemoglobinopathies
Directory of Open Access Journals (Sweden)
2016-06-01
Full Text Available Hemoglobinopathies are most common inherited disorders in the world approximately 7 percent of the worldwide population and 5-6 percent of population of Iran are carriers. For control of this inherited hemoglobin disorders need to accurate screening by more advanced and more accurate methods. This study explains features of current Iran hemoglobin disorders, nominates the accessible methods for screening them and introduces the capillary zone electrophoresis as a rapid & more accurate method. The required data were extracted of various articles and then for good explanation, current Iran hemoglobinopathies properties were showed in the tables and electropherograms of important hemoglobin disorders in Iran population were provided for help to interpretation results of blood tests by capillary zone electrophoresis method. Hemoglobin disorders are including thalassemias & hemoglobin variants Disruption in the production and malfunction of globin chains cause types of hemoglobin disorders. We cannot introduce one of clinical laboratory tests as critical and basic method for screening and distinguishing types of inherited hemoglobin disorders as alone. For distinguishing the types of them must be prepared enough information and data of the hemoglobin disorders and for more accurate analysis must be used simultaneously different methods as Gel electrophoresis, High performance liquid chromatography, Isoelectric focusing, Capillary zone electrophoresis or molecular tests. The capillary electrophoresis is an accurate and rapid method for screening types of the hemoglobin disorders. Other side this method cannot analyze all of them, so must be used biochemical, biophysical and molecular methods for confirmation the results. This review showed we can use the capillary electrophoresis and HPLC as two complementary methods for hemoglobinopathies screening. We can analyze by the methods more hemoglobin disorders and decrease more laboratory errors. Moreover
Guevara-Oquendo, Víctor H; Zhang, Huihua; Yu, Peiqiang
2018-04-13
To date, advanced synchrotron-based and globar-sourced techniques are almost unknown to food and feed scientists. There has been little application of these advanced techniques to study blend pellet products at a molecular level. This article aims to provide recent research on advanced synchrotron and globar vibrational molecular spectroscopy contributions to advances in blend pellet products research on molecular structure and molecular nutrition interaction. How processing induced molecular structure changes in relation to nutrient availability and utilization of the blend pellet products. The study reviews Utilization of co-product components for blend pellet product in North America; Utilization and benefits of inclusion of pulse screenings; Utilization of additives in blend pellet products; Application of pellet processing in blend pellet products; Conventional evaluation techniques and methods for blend pellet products. The study focus on recent applications of cutting-edge vibrational molecular spectroscopy for molecular structure and molecular structure association with nutrient utilization in blend pellet products. The information described in this article gives better insight on how advanced molecular (micro)spectroscopy contributions to advances in blend pellet products research on molecular structure and molecular nutrition interaction.
Users’ Expectation from the User Interface Screen of an Academic Digital Library
Directory of Open Access Journals (Sweden)
Akbar Majidi
2010-09-01
Full Text Available The present paper investigates the E-learner’s expectations concerning the features incorporated within the user interface screen of an academic digital library. A researcher-made questionnaire was used for the survey. The sample was taken from the E-learners using this technology in Iranian universities. 200 questionnaires were distributed. The data analysis showed a general consensus about the priority of comprehensibility of the terms used in the User Interface Screen (uis as well as the display features and clarity of the navigational functions as the usability criteria for UIS. ANOVA analysis indicated that, with the exception of navigation and guidance functions, there was no significance with respect to three categories of students. In other words, all students had similar expectations and their ICT skill is not a factor influencing the prioritization of these criteria. The results further indicated that except for the browsing page, there is no significant difference between novice, intermediate and advanced students with respect to search screen features.
Stem cells: a model for screening, discovery and development of drugs
Kitambi, Satish Srinivas; Chandrasekar, Gayathri
2011-01-01
Satish Srinivas Kitambi1, Gayathri Chandrasekar21Department of Medical Biochemistry and Biophysics; 2Department of Biosciences, Karolinska Institutet, Stockholm, SwedenAbstract: The identification of normal and cancerous stem cells and the recent advances made in isolation and culture of stem cells have rapidly gained attention in the field of drug discovery and regenerative medicine. The prospect of performing screens aimed at proliferation, directed differentiation, and toxicity and efficac...
Seneviratne, Sanjeewa; Campbell, Ian; Scott, Nina; Shirley, Rachel; Lawrenson, Ross
2015-01-31
Indigenous Māori women experience a 60% higher breast cancer mortality rate compared with European women in New Zealand. We explored the impact of differences in rates of screen detected breast cancer on inequities in cancer stage at diagnosis and survival between Māori and NZ European women. All primary breast cancers diagnosed in screening age women (as defined by the New Zealand National Breast Cancer Screening Programme) during 1999-2012 in the Waikato area (n = 1846) were identified from the Waikato Breast Cancer Register and the National Screening Database. Stage at diagnosis and survival were compared for screen detected (n = 1106) and non-screen detected (n = 740) breast cancer by ethnicity and socioeconomic status. Indigenous Māori women were significantly more likely to be diagnosed with more advanced cancer compared with NZ European women (OR = 1.51), and approximately a half of this difference was explained by lower rate of screen detected cancer for Māori women. For non-screen detected cancer, Māori had significantly lower 10-year breast cancer survival compared with NZ European (46.5% vs. 73.2%) as did most deprived compared with most affluent socioeconomic quintiles (64.8% vs. 81.1%). No significant survival differences were observed for screen detected cancer by ethnicity or socioeconomic deprivation. The lower rate of screen detected breast cancer appears to be a key contributor towards the higher rate of advanced cancer at diagnosis and lower breast cancer survival for Māori compared with NZ European women. Among women with screen-detected breast cancer, Māori women do just as well as NZ European women, demonstrating the success of breast screening for Māori women who are able to access screening. Increasing breast cancer screening rates has the potential to improve survival for Māori women and reduce breast cancer survival inequity between Māori and NZ European women.
Pediatric MDS: GATA screen the germline.
Stieglitz, Elliot; Loh, Mignon L
2016-03-17
In this issue of Blood, Wlodarski and colleagues demonstrate that as many as 72% of adolescents diagnosed with myelodysplastic syndrome (MDS) and monosomy 7 harbor germline mutations in GATA2. Although pediatric MDS is a very rare diagnosis, occurring in 0.8 to 4 cases per million, Wlodarski et al screened >600 cases of primary or secondary MDS in children and adolescents who were enrolled in the European Working Group on MDS consortium over a period of 15 years. The overall frequency of germline GATA2 mutations in children with primary MDS was 7%, and 15% in those presenting with advanced disease. Notably, mutations in GATA2 were absent in patients with therapy-related MDS or acquired aplastic anemia.
Teh, Yew-Ching; Tan, Gie-Hooi; Taib, Nur Aishah; Rahmat, Kartini; Westerhout, Caroline Judy; Fadzli, Farhana; See, Mee-Hoong; Jamaris, Suniza; Yip, Cheng-Har
2015-05-15
available, population-based screening of women 50 and above is effective. Opportunistic mammographic screening is feasible and effective in a middle income country with performance indicators within international standards. Waiting until women are symptomatic will lead to more advanced cancers.
COLPOSCOPY- A PRIMARY ALTERNATIVE SCREENING TOOL FOR CERVICAL PRE-CANCER
Srinivas Sangisapu; Prajakta Mehendale; Aruna Menon; Venkatesan Manu
2017-01-01
BACKGROUND Cancer cervix is the most common and preventable malignancy in females. 80% of cases in India are detected in advanced stages. Paucity of cytologists in India is one of the important reasons for failure of screening by Pap smear. Visual Inspection of cervix with Acetic acid (VIA) and Visual Inspection of cervix with application of Lugol’s Iodine (VILI) are two alternative strategies in low resource settings. Colposcopy involves the same principles of VIA and VILI under ...
[Population-based breast cancer screening: certainties, controversies, and future perspectives].
Apesteguía Ciriza, Luis; Pina Insausti, Luis Javier
2014-01-01
Population-based breast cancer screening programs based on mammography must maintain a high level of quality, so the results must be constantly monitored. Although most authors consider that these programs have decreased the mortality due to breast cancer by about 30%, others claim that the mortality has decreased by only about 12% due to errors in the randomization of patients, because the rate of advanced tumors has hardly decreased and because adjuvant treatment also improves survival. Other criticisms focus on overdiagnosis and overtreatment. We believe that despite the unquestionable value of mammographic screening, we should be open to certain changes such as the stratification of patients by their level of risk and the introduction of complementary techniques like tomosynthesis, ultrasonography, and magnetic resonance imaging in selected cases. Copyright © 2012 SERAM. Published by Elsevier Espana. All rights reserved.
Prenatal screening and genetics
DEFF Research Database (Denmark)
Alderson, P; Aro, A R; Dragonas, T
2001-01-01
Although the term 'genetic screening' has been used for decades, this paper discusses how, in its most precise meaning, genetic screening has not yet been widely introduced. 'Prenatal screening' is often confused with 'genetic screening'. As we show, these terms have different meanings, and we...... examine definitions of the relevant concepts in order to illustrate this point. The concepts are i) prenatal, ii) genetic screening, iii) screening, scanning and testing, iv) maternal and foetal tests, v) test techniques and vi) genetic conditions. So far, prenatal screening has little connection...... with precisely defined genetics. There are benefits but also disadvantages in overstating current links between them in the term genetic screening. Policy making and professional and public understandings about screening could be clarified if the distinct meanings of prenatal screening and genetic screening were...
Jiang, Xiaoou; Yu, Han; Teo, Cui Rong; Tan, Genim Siu Xian; Goh, Sok Chin; Patel, Parasvi; Chua, Yiqiang Kevin; Hameed, Nasirah Banu Sahul; Bertoletti, Antonio; Patzel, Volker
2016-09-01
Dumbbell-shaped DNA minimal vectors lacking nontherapeutic genes and bacterial sequences are considered a stable, safe alternative to viral, nonviral, and naked plasmid-based gene-transfer systems. We investigated novel molecular features of dumbbell vectors aiming to reduce vector size and to improve the expression of noncoding or coding RNA. We minimized small hairpin RNA (shRNA) or microRNA (miRNA) expressing dumbbell vectors in size down to 130 bp generating the smallest genetic expression vectors reported. This was achieved by using a minimal H1 promoter with integrated transcriptional terminator transcribing the RNA hairpin structure around the dumbbell loop. Such vectors were generated with high conversion yields using a novel protocol. Minimized shRNA-expressing dumbbells showed accelerated kinetics of delivery and transcription leading to enhanced gene silencing in human tissue culture cells. In primary human T cells, minimized miRNA-expressing dumbbells revealed higher stability and triggered stronger target gene suppression as compared with plasmids and miRNA mimics. Dumbbell-driven gene expression was enhanced up to 56- or 160-fold by implementation of an intron and the SV40 enhancer compared with control dumbbells or plasmids. Advanced dumbbell vectors may represent one option to close the gap between durable expression that is achievable with integrating viral vectors and short-term effects triggered by naked RNA.
3D mosquito screens to create window double screen traps for mosquito control.
Khattab, Ayman; Jylhä, Kaisa; Hakala, Tomi; Aalto, Mikko; Malima, Robert; Kisinza, William; Honkala, Markku; Nousiainen, Pertti; Meri, Seppo
2017-08-29
Mosquitoes are vectors for many diseases such as malaria. Insecticide-treated bed nets and indoor residual spraying of insecticides are the principal malaria vector control tools used to prevent malaria in the tropics. Other interventions aim at reducing man-vector contact. For example, house screening provides additive or synergistic effects to other implemented measures. We used commercial screen materials made of polyester, polyethylene or polypropylene to design novel mosquito screens that provide remarkable additional benefits to those commonly used in house screening. The novel design is based on a double screen setup made of a screen with 3D geometric structures parallel to a commercial mosquito screen creating a trap between the two screens. Owing to the design of the 3D screen, mosquitoes can penetrate the 3D screen from one side but cannot return through the other side, making it a unidirectional mosquito screen. Therefore, the mosquitoes are trapped inside the double screen system. The permissiveness of both sides of the 3D screens for mosquitoes to pass through was tested in a wind tunnel using the insectary strain of Anopheles stephensi. Among twenty-five tested 3D screen designs, three designs from the cone, prism, or cylinder design groups were the most efficient in acting as unidirectional mosquito screens. The three cone-, prism-, and cylinder-based screens allowed, on average, 92, 75 and 64% of Anopheles stephensi mosquitoes released into the wind tunnel to penetrate the permissive side and 0, 0 and 6% of mosquitoes to escape through the non-permissive side, respectively. A cone-based 3D screen fulfilled the study objective. It allowed capturing 92% of mosquitoes within the double screen setup inside the wind tunnel and blocked 100% from escaping. Thus, the cone-based screen effectively acted as a unidirectional mosquito screen. This 3D screen-based trap design could therefore be used in house screening as a means of avoiding infective bites and
Screening for Breast Cancer: U.S. Preventive Services Task Force Recommendation Statement.
Siu, Albert L
2016-02-16
Update of the 2009 U.S. Preventive Services Task Force (USPSTF) recommendation on screening for breast cancer. The USPSTF reviewed the evidence on the following: effectiveness of breast cancer screening in reducing breast cancer-specific and all-cause mortality, as well as the incidence of advanced breast cancer and treatment-related morbidity; harms of breast cancer screening; test performance characteristics of digital breast tomosynthesis as a primary screening strategy; and adjunctive screening in women with increased breast density. In addition, the USPSTF reviewed comparative decision models on optimal starting and stopping ages and intervals for screening mammography; how breast density, breast cancer risk, and comorbidity level affect the balance of benefit and harms of screening mammography; and the number of radiation-induced breast cancer cases and deaths associated with different screening mammography strategies over the course of a woman's lifetime. This recommendation applies to asymptomatic women aged 40 years or older who do not have preexisting breast cancer or a previously diagnosed high-risk breast lesion and who are not at high risk for breast cancer because of a known underlying genetic mutation (such as a BRCA1 or BRCA2 gene mutation or other familial breast cancer syndrome) or a history of chest radiation at a young age. The USPSTF recommends biennial screening mammography for women aged 50 to 74 years. (B recommendation) The decision to start screening mammography in women prior to age 50 years should be an individual one. Women who place a higher value on the potential benefit than the potential harms may choose to begin biennial screening between the ages of 40 and 49 years. (C recommendation) The USPSTF concludes that the current evidence is insufficient to assess the balance of benefits and harms of screening mammography in women aged 75 years or older. (I statement) The USPSTF concludes that the current evidence is insufficient to
The WISDOM Study: breaking the deadlock in the breast cancer screening debate.
Esserman, Laura J
2017-01-01
makers, technology companies and payers to help break the deadlock in this debate and advance towards a new, dynamic approach to breast cancer screening.
Australia's National Bowel Cancer Screening Program: does it work for Indigenous Australians?
Directory of Open Access Journals (Sweden)
Katzenellenbogen Judith M
2010-06-01
Full Text Available Abstract Background Despite a lower incidence of bowel cancer overall, Indigenous Australians are more likely to be diagnosed at an advanced stage when prognosis is poor. Bowel cancer screening is an effective means of reducing incidence and mortality from bowel cancer through early identification and prompt treatment. In 2006, Australia began rolling out a population-based National Bowel Cancer Screening Program (NBCSP using the Faecal Occult Blood Test. Initial evaluation of the program revealed substantial disparities in bowel cancer screening uptake with Indigenous Australians significantly less likely to participate in screening than the non-Indigenous population. This paper critically reviews characteristics of the program which may contribute to the discrepancy in screening uptake, and includes an analysis of organisational, structural, and socio-cultural barriers that play a part in the poorer participation of Indigenous and other disadvantaged and minority groups. Methods A search was undertaken of peer-reviewed journal articles, government reports, and other grey literature using electronic databases and citation snowballing. Articles were critically evaluated for relevance to themes that addressed the research questions. Results The NBCSP is not reaching many Indigenous Australians in the target group, with factors contributing to sub-optimal participation including how participants are selected, the way the screening kit is distributed, the nature of the test and comprehensiveness of its contents, cultural perceptions of cancer and prevailing low levels of knowledge and awareness of bowel cancer and the importance of screening. Conclusions Our findings suggest that the population-based approach to implementing bowel cancer screening to the Australian population unintentionally excludes vulnerable minorities, particularly Indigenous and other culturally and linguistically diverse groups. This potentially contributes to exacerbating
Klompenhouwer, E. G.; Duijm, L. E. M.; Voogd, A. C.; den Heeten, G. J.; Nederend, J.; Jansen, F. H.; Broeders, M. J. M.
2014-01-01
Substantial inter-observer variability in screening mammography interpretation has been reported at single reading. However, screening results of pairs of screening radiologists have not yet been published. We determined variations in screening performances among pairs of screening radiologists at
Zhang, Baofeng; D'Erasmo, Michael P; Murelli, Ryan P; Gallicchio, Emilio
2016-09-30
We report the results of a binding free energy-based virtual screening campaign of a library of 77 α-hydroxytropolone derivatives against the challenging RNase H active site of the reverse transcriptase (RT) enzyme of human immunodeficiency virus-1. Multiple protonation states, rotamer states, and binding modalities of each compound were individually evaluated. The work involved more than 300 individual absolute alchemical binding free energy parallel molecular dynamics calculations and over 1 million CPU hours on national computing clusters and a local campus computational grid. The thermodynamic and structural measures obtained in this work rationalize a series of characteristics of this system useful for guiding future synthetic and biochemical efforts. The free energy model identified key ligand-dependent entropic and conformational reorganization processes difficult to capture using standard docking and scoring approaches. Binding free energy-based optimization of the lead compounds emerging from the virtual screen has yielded four compounds with very favorable binding properties, which will be the subject of further experimental investigations. This work is one of the few reported applications of advanced-binding free energy models to large-scale virtual screening and optimization projects. It further demonstrates that, with suitable algorithms and automation, advanced-binding free energy models can have a useful role in early-stage drug-discovery programs.
Newborn screening by tandem mass spectrometry: ethical and social issues.
Avard, Denise; Vallance, Hilary; Greenberg, Cheryl; Potter, Beth
2007-01-01
Emerging technologies like Tandem Mass Spectrometry (TMS) enable multiple tests on a single blood sample and allow the expansion of Newborn Screening (NBS) to include various metabolic diseases. Introducing TMS for NBS raises important social and ethical questions: what are the criteria for adding disorders to screening panels? What evidence justifies expansion of screening? How can equity in NBS access and standards be ensured? How can policy standards be set, given the multiplicity of stakeholders? To address emerging issues, policy-makers, patient advocates, clinicians and researchers had a workshop during the 2005 Garrod Symposium. The participants received a summary of the discussion and understood the workshop's goal was to provide a basis for further discussion. This article contributes to this ongoing discussion. Several proposed recommendations assert the centrality of including social and ethical issues in the assessment of whether or not to introduce TMS. The article outlines five key recommendations for advancing the NBS agenda: national public health leadership; transparency; increased national consistency in NBS strategy, including minimum standards; collaboration between the federal and provincial/territorial governments and diverse stakeholders; and supporting research and/or programs based on effectiveness, which integrate ethical and social issues into assessment.
Virtual screening of inorganic materials synthesis parameters with deep learning
Kim, Edward; Huang, Kevin; Jegelka, Stefanie; Olivetti, Elsa
2017-12-01
Virtual materials screening approaches have proliferated in the past decade, driven by rapid advances in first-principles computational techniques, and machine-learning algorithms. By comparison, computationally driven materials synthesis screening is still in its infancy, and is mired by the challenges of data sparsity and data scarcity: Synthesis routes exist in a sparse, high-dimensional parameter space that is difficult to optimize over directly, and, for some materials of interest, only scarce volumes of literature-reported syntheses are available. In this article, we present a framework for suggesting quantitative synthesis parameters and potential driving factors for synthesis outcomes. We use a variational autoencoder to compress sparse synthesis representations into a lower dimensional space, which is found to improve the performance of machine-learning tasks. To realize this screening framework even in cases where there are few literature data, we devise a novel data augmentation methodology that incorporates literature synthesis data from related materials systems. We apply this variational autoencoder framework to generate potential SrTiO3 synthesis parameter sets, propose driving factors for brookite TiO2 formation, and identify correlations between alkali-ion intercalation and MnO2 polymorph selection.
Visual, tangible, and touch-screen: Comparison of platforms for displaying simple graphics.
Gershon, Pnina; Klatzky, Roberta L; Palani, Hari; Giudice, Nicholas A
2016-01-01
Four different platforms were compared in a task of exploring an angular stimulus and reporting its value. The angle was explored visually, tangibly as raised fine-grit sandpaper, or on a touch-screen with a frictional or vibratory signal. All platforms produced highly accurate angle judgments. Differences were found, however, in exploration time, with vision fastest as expected, followed by tangible, vibration, and friction. Relative to the tangible display, touch-screens evidenced greater noise in the perceived angular value, with a particular disadvantage for friction. The latter must be interpreted in the context of a first-generation display and a rapidly advancing technology. On the whole, the results point both to promise and barriers in the use of refreshable graphical displays for blind users.
Bulk viscous corrections to screening and damping in QCD at high temperatures
Energy Technology Data Exchange (ETDEWEB)
Du, Qianqian [Department of Physics, Guangxi Normal University,Guilin, 541004 (China); Dumitru, Adrian [Department of Natural Sciences, Baruch College, CUNY,17 Lexington Avenue, New York, NY 10010 (United States); The Graduate School and University Center, The City University of New York,365 Fifth Avenue, New York, NY 10016 (United States); Guo, Yun [Department of Physics, Guangxi Normal University,Guilin, 541004 (China); Strickland, Michael [Department of Physics, Kent State University,206B Smith Hall, Kent, OH 44240 (United States)
2017-01-27
Non-equilibrium corrections to the distribution functions of quarks and gluons in a hot and dense QCD medium modify the “hard thermal loops” (HTL). The HTLs determine the retarded, advanced, and symmetric (time-ordered) propagators for gluons with soft momenta as well as the Debye screening and Landau damping mass scales. We compute such corrections to a thermal as well as to a non-thermal fixed point. The screening and damping mass scales are sensitive to the bulk pressure and hence to (pseudo-) critical dynamical scaling of the bulk viscosity in the vicinity of a second-order critical point. This could be reflected in the properties of quarkonium bound states in the deconfined phase and in the dynamics of soft gluon fields.
Bulk viscous corrections to screening and damping in QCD at high temperatures
International Nuclear Information System (INIS)
Du, Qianqian; Dumitru, Adrian; Guo, Yun; Strickland, Michael
2017-01-01
Non-equilibrium corrections to the distribution functions of quarks and gluons in a hot and dense QCD medium modify the “hard thermal loops” (HTL). The HTLs determine the retarded, advanced, and symmetric (time-ordered) propagators for gluons with soft momenta as well as the Debye screening and Landau damping mass scales. We compute such corrections to a thermal as well as to a non-thermal fixed point. The screening and damping mass scales are sensitive to the bulk pressure and hence to (pseudo-) critical dynamical scaling of the bulk viscosity in the vicinity of a second-order critical point. This could be reflected in the properties of quarkonium bound states in the deconfined phase and in the dynamics of soft gluon fields.
Advanced colorectal neoplasia risk stratification by penalized logistic regression.
Lin, Yunzhi; Yu, Menggang; Wang, Sijian; Chappell, Richard; Imperiale, Thomas F
2016-08-01
Colorectal cancer is the second leading cause of death from cancer in the United States. To facilitate the efficiency of colorectal cancer screening, there is a need to stratify risk for colorectal cancer among the 90% of US residents who are considered "average risk." In this article, we investigate such risk stratification rules for advanced colorectal neoplasia (colorectal cancer and advanced, precancerous polyps). We use a recently completed large cohort study of subjects who underwent a first screening colonoscopy. Logistic regression models have been used in the literature to estimate the risk of advanced colorectal neoplasia based on quantifiable risk factors. However, logistic regression may be prone to overfitting and instability in variable selection. Since most of the risk factors in our study have several categories, it was tempting to collapse these categories into fewer risk groups. We propose a penalized logistic regression method that automatically and simultaneously selects variables, groups categories, and estimates their coefficients by penalizing the [Formula: see text]-norm of both the coefficients and their differences. Hence, it encourages sparsity in the categories, i.e. grouping of the categories, and sparsity in the variables, i.e. variable selection. We apply the penalized logistic regression method to our data. The important variables are selected, with close categories simultaneously grouped, by penalized regression models with and without the interactions terms. The models are validated with 10-fold cross-validation. The receiver operating characteristic curves of the penalized regression models dominate the receiver operating characteristic curve of naive logistic regressions, indicating a superior discriminative performance. © The Author(s) 2013.
Novel Stool-Based Protein Biomarkers for Improved Colorectal Cancer Screening: A Case-Control Study.
Bosch, Linda J W; de Wit, Meike; Pham, Thang V; Coupé, Veerle M H; Hiemstra, Annemieke C; Piersma, Sander R; Oudgenoeg, Gideon; Scheffer, George L; Mongera, Sandra; Sive Droste, Jochim Terhaar; Oort, Frank A; van Turenhout, Sietze T; Larbi, Ilhame Ben; Louwagie, Joost; van Criekinge, Wim; van der Hulst, Rene W M; Mulder, Chris J J; Carvalho, Beatriz; Fijneman, Remond J A; Jimenez, Connie R; Meijer, Gerrit A
2017-12-19
The fecal immunochemical test (FIT) for detecting hemoglobin is used widely for noninvasive colorectal cancer (CRC) screening, but its sensitivity leaves room for improvement. To identify novel protein biomarkers in stool that outperform or complement hemoglobin in detecting CRC and advanced adenomas. Case-control study. Colonoscopy-controlled referral population from several centers. 315 stool samples from one series of 12 patients with CRC and 10 persons without colorectal neoplasia (control samples) and a second series of 81 patients with CRC, 40 with advanced adenomas, and 43 with nonadvanced adenomas, as well as 129 persons without colorectal neoplasia (control samples); 72 FIT samples from a third independent series of 14 patients with CRC, 16 with advanced adenomas, and 18 with nonadvanced adenomas, as well as 24 persons without colorectal neoplasia (control samples). Stool samples were analyzed by mass spectrometry. Classification and regression tree (CART) analysis and logistic regression analyses were performed to identify protein combinations that differentiated CRC or advanced adenoma from control samples. Antibody-based assays for 4 selected proteins were done on FIT samples. In total, 834 human proteins were identified, 29 of which were statistically significantly enriched in CRC versus control stool samples in both series. Combinations of 4 proteins reached sensitivities of 80% and 45% for detecting CRC and advanced adenomas, respectively, at 95% specificity, which was higher than that of hemoglobin alone (P control samples (P control samples. Proof of concept that such proteins can be detected with antibody-based assays in small sample volumes indicates the potential of these biomarkers to be applied in population screening. Center for Translational Molecular Medicine, International Translational Cancer Research Dream Team, Stand Up to Cancer (American Association for Cancer Research and the Dutch Cancer Society), Dutch Digestive Foundation, and VU
A review of current sleep screening applications for smartphones
International Nuclear Information System (INIS)
Behar, Joachim; Roebuck, Aoife; Domingos, João S; Gederi, Elnaz; Clifford, Gari D
2013-01-01
Sleep disorders are a common problem and contribute to a wide range of healthcare issues. The societal and financial costs of sleep disorders are enormous. Sleep-related disorders are often diagnosed with an overnight sleep test called a polysomnogram, or sleep study involving the measurement of brain activity through the electroencephalogram. Other parameters monitored include oxygen saturation, respiratory effort, cardiac activity (through the electrocardiogram), as well as video recording, sound and movement activity. Monitoring can be costly and removes the patients from their normal sleeping environment, preventing repeated unbiased studies. The recent increase in adoption of smartphones, with high quality on-board sensors has led to the proliferation of many sleep screening applications running on the phone. However, with the exception of simple questionnaires, no existing sleep-related application available for smartphones is based on scientific evidence. This paper reviews the existing smartphone applications landscape used in the field of sleep disorders and proposes possible advances to improve screening approaches. (topical review)
A review of current sleep screening applications for smartphones.
Behar, Joachim; Roebuck, Aoife; Domingos, João S; Gederi, Elnaz; Clifford, Gari D
2013-07-01
Sleep disorders are a common problem and contribute to a wide range of healthcare issues. The societal and financial costs of sleep disorders are enormous. Sleep-related disorders are often diagnosed with an overnight sleep test called a polysomnogram, or sleep study involving the measurement of brain activity through the electroencephalogram. Other parameters monitored include oxygen saturation, respiratory effort, cardiac activity (through the electrocardiogram), as well as video recording, sound and movement activity. Monitoring can be costly and removes the patients from their normal sleeping environment, preventing repeated unbiased studies. The recent increase in adoption of smartphones, with high quality on-board sensors has led to the proliferation of many sleep screening applications running on the phone. However, with the exception of simple questionnaires, no existing sleep-related application available for smartphones is based on scientific evidence. This paper reviews the existing smartphone applications landscape used in the field of sleep disorders and proposes possible advances to improve screening approaches.
Auriemma, Catherine L; Chen, Lucy; Olorunnisola, Michael; Delman, Aaron; Nguyen, Christina A; Cooney, Elizabeth; Gabler, Nicole B; Halpern, Scott D
2017-09-01
The Centers for Medicare & Medicaid Services (CMS) recently instituted physician reimbursements for advance care planning (ACP) discussions with patients. To measure public support for similar programs. Cross-sectional online and in-person surveys. English-speaking adults recruited at public parks in Philadelphia, Pennsylvania, from July to August 2013 and online through survey sampling international Web-based recruitment platform in July 2015. Participants indicated support for 6 programs designed to increase advance directive (AD) completion or ACP discussion using 5-point Likert scales. Participants also indicated how much money (US$0-US$1000) was appropriate to incentivize such behaviors, compared to smoking cessation or colonoscopy screening. We recruited 883 participants: 503 online and 380 in-person. The status quo of no systematic approach to motivate AD completion was supported by 67.0% of participants (63.9%-70.1%). The most popular programs were paying patients to complete ADs (58.0%; 54.5%-61.2%) and requiring patients to complete ADs or declination forms for health insurance (54.1%; 50.8%-57.4%). Participants more commonly supported paying patients to complete ADs than paying physicians whose patients complete ADs (22.6%; 19.8%-25.4%) or paying physicians who document ACP discussions (19.1%; 16.5%-21.7%; both P < .001). Participants supported smaller payments for AD completion and ACP than for obtaining screening colonoscopies or stopping smoking. Americans view payments for AD completion or ACP more skeptically than for other health behaviors and prefer that such payments go to patients rather than physicians. The current CMS policy of reimbursing physicians for ACP conversations with patients was the least preferred of the programs evaluated.
Drug and bioactive molecule screening based on a bioelectrical impedance cell culture platform
Directory of Open Access Journals (Sweden)
Ramasamy S
2014-12-01
Full Text Available Sakthivel Ramasamy,1 Devasier Bennet,1 Sanghyo Kim1,2 1Department of Bionanotechnology, Gachon University, Gyeonggi-Do, Republic of Korea; 2Graduate Gachon Medical Research Institute, Gil Medical Center, Incheon, Republic of Korea Abstract: This review will present a brief discussion on the recent advancements of bioelectrical impedance cell-based biosensors, especially the electric cell-substrate impedance sensing (ECIS system for screening of various bioactive molecules. The different technical integrations of various chip types, working principles, measurement systems, and applications for drug targeting of molecules in cells are highlighted in this paper. Screening of bioactive molecules based on electric cell-substrate impedance sensing is a trial-and-error process toward the development of therapeutically active agents for drug discovery and therapeutics. In general, bioactive molecule screening can be used to identify active molecular targets for various diseases and toxicity at the cellular level with nanoscale resolution. In the innovation and screening of new drugs or bioactive molecules, the activeness, the efficacy of the compound, and safety in biological systems are the main concerns on which determination of drug candidates is based. Further, drug discovery and screening of compounds are often performed in cell-based test systems in order to reduce costs and save time. Moreover, this system can provide more relevant results in in vivo studies, as well as high-throughput drug screening for various diseases during the early stages of drug discovery. Recently, MEMS technologies and integration with image detection techniques have been employed successfully. These new technologies and their possible ongoing transformations are addressed. Select reports are outlined, and not all the work that has been performed in the field of drug screening and development is covered. Keywords: screening of bioactive agents, impedance-based cell
Zoorob, R; Anderson, R; Cefalu, C; Sidani, M
2001-03-15
Numerous medical organizations have developed cancer screening guidelines. Faced with the broad, and sometimes conflicting, range of recommendations for cancer screening, family physicians must determine the most reasonable and up-to-date method of screening. Major medical organizations have generally achieved consensus on screening guidelines for breast, cervical and colorectal cancer. For breast cancer screening in women ages 50 to 70, clinical breast examination and mammography are generally recommended every one or two years, depending on the medical organization. For cervical cancer screening, most organizations recommend a Papanicolaou test and pelvic examination at least every three years in patients between 20 and 65 years of age. Annual fecal occult blood testing along with flexible sigmoidoscopy at five-year to 10-year intervals is the standard recommendation for colorectal cancer screening in patients older than 50 years. Screening for prostate cancer remains a matter of debate. Some organizations recommend digital rectal examination and a serum prostate-specific antigen test for men older than 50 years, while others do not. In the absence of compelling evidence to indicate a high risk of endometrial cancer, lung cancer, oral cancer and ovarian cancer, almost no medical organizations have developed cancer screening guidelines for these types of cancer.
Directory of Open Access Journals (Sweden)
Yuan-xing Gu
2014-01-01
Full Text Available RNA interference (RNAi has been proved to be a powerful tool for foot-and-mouth disease virus FMDV inhibition in vitro and in vivo. We established five stable baby hamster kidney 21 cell lines (BHK-21 containing five short hairpin RNAs (shRNAs expression plasmids (p3D1shRNA, p3D2shRNA, p3D3shRNA, p3D4shRNA, and p3D5shRNA targeting 3D gene of FMDV. Immunofluorescent assay, virus titration, and real-time quantitative reverse transcription polymerase chain reaction (Q-RT-PCR were conducted to detect the effect of shRNAs on FMDV replication. After challenged with FMDV of O/CHA/99, two cell lines (p3D1shRNA and p3D4shRNA showed a significant reduction in the synthesis of viral protein and RNA, accompanied by a sharp decrease in viral yield, and the inhibition could last for at least thirty passages. We developed an efficient procedure for the establishment and evaluation of stable cell lines for anti-FMDV research based on RNAi technology, which can be a candidate method for anti-FMDV research.
2018-01-01
The California Community Environmental Health Screening Tool (CalEnviroScreen) advances research and policy pertaining to environmental health vulnerability. However, CalEnviroScreen departs from its historical foundations and comparable screening tools by no longer considering racial status as an indicator of environmental health vulnerability and predictor of cumulative pollution burden. This study used conceptual frameworks and analytical techniques from environmental health and inequality literature to address the limitations of CalEnviroScreen, especially its inattention to race-based environmental health vulnerabilities. It developed an adjusted measure of cumulative pollution burden from the CalEnviroScreen 2.0 data that facilitates multivariate analyses of the effect of neighborhood racial composition on cumulative pollution burden, net of other indicators of population vulnerability, traffic density, industrial zoning, and local and regional clustering of pollution burden. Principal component analyses produced three new measures of population vulnerability, including Latina/o cumulative disadvantage that represents the spatial concentration of Latinas/os, economic disadvantage, limited English-speaking ability, and health vulnerability. Spatial error regression analyses demonstrated that concentrations of Latinas/os, followed by Latina/o cumulative disadvantage, are the strongest demographic determinants of adjusted cumulative pollution burden. Findings have implications for research and policy pertaining to cumulative impacts and race-based environmental health vulnerabilities within and beyond California. PMID:29659481
Directory of Open Access Journals (Sweden)
Raoul S. Liévanos
2018-04-01
Full Text Available The California Community Environmental Health Screening Tool (CalEnviroScreen advances research and policy pertaining to environmental health vulnerability. However, CalEnviroScreen departs from its historical foundations and comparable screening tools by no longer considering racial status as an indicator of environmental health vulnerability and predictor of cumulative pollution burden. This study used conceptual frameworks and analytical techniques from environmental health and inequality literature to address the limitations of CalEnviroScreen, especially its inattention to race-based environmental health vulnerabilities. It developed an adjusted measure of cumulative pollution burden from the CalEnviroScreen 2.0 data that facilitates multivariate analyses of the effect of neighborhood racial composition on cumulative pollution burden, net of other indicators of population vulnerability, traffic density, industrial zoning, and local and regional clustering of pollution burden. Principal component analyses produced three new measures of population vulnerability, including Latina/o cumulative disadvantage that represents the spatial concentration of Latinas/os, economic disadvantage, limited English-speaking ability, and health vulnerability. Spatial error regression analyses demonstrated that concentrations of Latinas/os, followed by Latina/o cumulative disadvantage, are the strongest demographic determinants of adjusted cumulative pollution burden. Findings have implications for research and policy pertaining to cumulative impacts and race-based environmental health vulnerabilities within and beyond California.
Liévanos, Raoul S
2018-04-16
The California Community Environmental Health Screening Tool (CalEnviroScreen) advances research and policy pertaining to environmental health vulnerability. However, CalEnviroScreen departs from its historical foundations and comparable screening tools by no longer considering racial status as an indicator of environmental health vulnerability and predictor of cumulative pollution burden. This study used conceptual frameworks and analytical techniques from environmental health and inequality literature to address the limitations of CalEnviroScreen, especially its inattention to race-based environmental health vulnerabilities. It developed an adjusted measure of cumulative pollution burden from the CalEnviroScreen 2.0 data that facilitates multivariate analyses of the effect of neighborhood racial composition on cumulative pollution burden, net of other indicators of population vulnerability, traffic density, industrial zoning, and local and regional clustering of pollution burden. Principal component analyses produced three new measures of population vulnerability, including Latina/o cumulative disadvantage that represents the spatial concentration of Latinas/os, economic disadvantage, limited English-speaking ability, and health vulnerability. Spatial error regression analyses demonstrated that concentrations of Latinas/os, followed by Latina/o cumulative disadvantage, are the strongest demographic determinants of adjusted cumulative pollution burden. Findings have implications for research and policy pertaining to cumulative impacts and race-based environmental health vulnerabilities within and beyond California.
Scott, Tristan; Paweska, Janusz T; Arbuthnot, Patrick; Weinberg, Marc S
2012-01-01
Rift Valley fever virus (RVFV), a member of the Bunyaviridae family, may cause severe hepatitis, encephalitis and haemorrhagic fever in humans. There are currently no available licensed vaccines or therapies to treat the viral infection in humans. RNA interference (RNAi)-based viral gene silencing offers a promising approach to inhibiting replication of this highly pathogenic virus. The small (S) segment of the RVFV tripartite genome carries the genetic determinates for pathogenicity during infection. This segment encodes the non-structural S (NSs) and essential nucleocapsid (N) genes. To advance RNAi-based inhibition of RVFV replication, we designed several Pol III short hairpin RNA (shRNA) expression cassettes against the NSs and N genes, including a multimerized plasmid vector that included four shRNA expression cassettes. Effective target silencing was demonstrated using full- and partial-length target reporter assays, and confirmed by western blot analysis of exogenous N and NSs expression. Small RNA northern blots showed detectable RNAi guide strand formation from single and multimerized shRNA constructs. Using a cell culture model of RVFV replication, shRNAs targeting the N gene decreased intracellular nucleocapsid protein concentration and viral replication. The shRNAs directed against the NSs gene reduced NSs protein concentrations and alleviated NSs-mediated cytotoxicity, which may be caused by host transcription suppression. These data are the first demonstration that RNAi activators have a potential therapeutic benefit for countering RVFV infection.
Carr, Prudence R; Holleczek, Bernd; Stegmaier, Christa; Brenner, Hermann; Hoffmeister, Michael
2017-06-01
Background: Red and processed meats have been shown to be associated with colorectal adenomas in many, but not all, studies, and the association according to the type of colorectal adenoma or the location in the colorectum is unclear. Objectives: We investigated the association of meat intake in relation to colorectal polyps and further investigated the association according to histologic subtypes and subsites in a large population-based screening study in Germany. Design: In this cross-sectional study, 15,950 participants aged ≥55 y underwent a screening colonoscopy. We calculated prevalence ratios (PRs) and 95% CIs for associations between meat intake and the most-advanced findings from a colonoscopy with the use of log binomial regression. Results: Overall, 3340 participants (20.4%) had nonadvanced adenomas, 1643 participants (10.0%) had advanced adenomas, and 189 participants (1.2%) had colorectal cancer. We observed no statistically significant association between red or processed meat consumption and the prevalence of any adenomas or advanced adenomas [highest compared with lowest: red meat, PR: 1.07 (95% CI: 0.83, 1.37); processed meat, PR: 1.11 (95% CI: 0.91, 1.36)]. In site-specific analyses, although no dose-response relation was observed, processed meat was positively associated with the prevalence of advanced adenomas in the rectum only (multiple times per day compared with meat intake and the prevalence of any adenomas or advanced adenomas. However, processed meat may be positively associated with the prevalence of advanced adenomas in the rectum, but prospective cohort studies are needed to further clarify this association. There is no association between poultry consumption and the prevalence of colorectal polyps in this study. © 2017 American Society for Nutrition.
Presenting and discussing nuchal translucency screening for fetal abnormality in the UK.
Pilnick, Alison M; Fraser, Diane M; James, David K
2004-03-01
to investigate the relationship between information giving by midwives and decision-making by women offered nuchal translucency (NT) screening. To establish how risk figures are discussed in practice, with the intention of relating this to the existing, and often critical, literature on women's accounts of antenatal screening. a qualitative study following women through the process of being offered and deciding to undergo NT screening. Tape recording of consultations, analysed in their entirety, was combined with post-screening interviews. a large teaching hospital in the UK. fourteen pregnant women eligible for NT screening at the time of recruitment. (i) tape recordings of consultations between community midwives and pregnant women where nuchal translucency screening was offered; (ii) tape recordings of consultations between hospital midwives and pregnant women immediately post-screening; (iii) individual face-to-face interviews with pregnant women between two and six weeks after the screening, carried out by the first author. NT screening was in general well received, particularly by those women who had undergone serum screening with previous pregnancies. However, communicating the nature of a risk figure is an interactionally complex process. A large amount of interactional work is required by midwives both before and after screening to ensure that women comprehend this information. Despite the emphasis placed in these consultations on understanding the purpose of NT screening and the status of the results, women often framed their decision to undergo NT screening in terms of it being a formality, or of presuming that all was well. This sometimes created practical and personal difficulties in terms of decision-making. previous sociological and psychological research has tended to be critical of midwives in terms of ensuring informed choice in screening, but this research is often based on post hoc accounts. Examining actual consultations with these accounts
A high throughput screening assay for identifying glycation inhibitors on MALDI-TOF target.
Zhang, Qiuting; Tu, Zongcai; Wang, Hui; Fan, Liangliang; Huang, Xiaoqin; Xiao, Hui
2015-03-01
The Maillard reaction plays an important role in the food industry, however, the deleterious effects generated by the advanced glycation end-products (AGEs) have been well recognized. Many efforts have been made to seek new AGE inhibitors, in particular those natural ones without adverse effect. We have developed a rapid, mass spectrometry based, on-plate screening assay for novel AGE inhibitors. The glycation reaction, inhibition feedback as well as the subsequent MALDI mass spectrometric analysis occurred on one single MALDI plate. At 1:10 M ratio of peptide to sugar, as little as 4h incubation time allowed the screening test to be ready for analysis. DSP, inhibition and IC50 were calculated to evaluate selected inhibitors and resulting inhibition efficiencies were consistent with available references. We demonstrated that this method provide a potential high throughput screening assay to analyze and identify the anti-glycation agents. Copyright © 2014 Elsevier Ltd. All rights reserved.
Need for and relevance of prostate cancer screening in Nigeria.
Akinremi, To; Adeniyi, A; Olutunde, A; Oduniyi, A; Ogo, Cn
2014-01-01
Prostate cancer (PCa) has become the most prevalent cancer among males in Nigeria, and similar to other black populations, Nigerian men present with more advanced disease at an earlier age than in several other ethnic groups. In this unscreened, high-risk group, the reference range for early detection and diagnosis as well as risk factors need to be determined through large-scale screening. Over 4 years, 1124 previously unscreened men between 40 and 85 years of age were screened at free community health programmes for PCa, using the common parameters of prostate-specific antigen (PSA) plus digital rectal examination (DRE). We thereby assessed the practicality and importance of screening. Consent was obtained, demographic data obtained, PSA measured using qualitative laboratory kits, and DRE performed by surgeons. We found that the number of men attending and consenting to screening increases from year to year. Of 40-85-year-old men, 85.4% consented, of whom 33.3% (a third) and 60% were 51-60 years old and 51-65 years, respectively. While 11.5% of men had PSA >4 ng/ml, 31.45% showed abnormal DRE. Of the men who took the PSA test, 79.2% also consented to the DRE, of whom 5.8% had combined abnormal DRE and PSA >4 ng/ml. Our findings suggest that Nigerian men are a willing group for screening by both the PSA and DRE with the positive response to calls for health screening and interest in prostate health. The finding of PSA >4 ng/ml in 11.15% of this population reveals the need for greater awareness and measures to increase early detection. However, the value and validity of established PSA reference ranges and cutoff of 'normal' still need to be established. Screening is very important to better define the PCa prevalence and characteristics in our population; otherwise political and economic circumstances will ensure that men still present late with aggressive PCa.
High-throughput screening to enhance oncolytic virus immunotherapy
Directory of Open Access Journals (Sweden)
Allan KJ
2016-04-01
Full Text Available KJ Allan,1,2 David F Stojdl,1–3 SL Swift1 1Children’s Hospital of Eastern Ontario (CHEO Research Institute, 2Department of Biology, Microbiology and Immunology, 3Department of Pediatrics, University of Ottawa, Ottawa, ON, Canada Abstract: High-throughput screens can rapidly scan and capture large amounts of information across multiple biological parameters. Although many screens have been designed to uncover potential new therapeutic targets capable of crippling viruses that cause disease, there have been relatively few directed at improving the efficacy of viruses that are used to treat disease. Oncolytic viruses (OVs are biotherapeutic agents with an inherent specificity for treating malignant disease. Certain OV platforms – including those based on herpes simplex virus, reovirus, and vaccinia virus – have shown success against solid tumors in advanced clinical trials. Yet, many of these OVs have only undergone minimal engineering to solidify tumor specificity, with few extra modifications to manipulate additional factors. Several aspects of the interaction between an OV and a tumor-bearing host have clear value as targets to improve therapeutic outcomes. At the virus level, these include delivery to the tumor, infectivity, productivity, oncolysis, bystander killing, spread, and persistence. At the host level, these include engaging the immune system and manipulating the tumor microenvironment. Here, we review the chemical- and genome-based high-throughput screens that have been performed to manipulate such parameters during OV infection and analyze their impact on therapeutic efficacy. We further explore emerging themes that represent key areas of focus for future research. Keywords: oncolytic, virus, screen, high-throughput, cancer, chemical, genomic, immunotherapy
Cell line development for biomanufacturing processes: recent advances and an outlook.
Le, Huong; Vishwanathan, Nandita; Jacob, Nitya M; Gadgil, Mugdha; Hu, Wei-Shou
2015-08-01
At the core of a biomanufacturing process for recombinant proteins is the production cell line. It influences the productivity and product quality. Its characteristics also dictate process development, as the process is optimized to complement the producing cell to achieve the target productivity and quality. Advances in the past decade, from vector design to cell line screening, have greatly expanded our capability to attain producing cell lines with certain desired traits. Increasing availability of genomic and transcriptomic resources for industrially important cell lines coupled with advances in genome editing technology have opened new avenues for cell line development. These developments are poised to help biosimilar manufacturing, which requires targeting pre-defined product quality attributes, e.g., glycoform, to match the innovator's range. This review summarizes recent advances and discusses future possibilities in this area.
DEFF Research Database (Denmark)
Bjerrum, Andreas; Milter, Maya Christel; Andersen, Ole
2015-01-01
BACKGROUND: Limited data exist on adenoma surveillance as recommended in the European guidelines for quality assurance in colorectal cancer (CRC) screening and diagnosis after faecal occult blood test (FOBT) screening. OBJECTIVE: To assess the European guidelines for adenoma surveillance after CRC...... of CRC was higher in risk group C than A (RR 5.20, 95% confidence interval: 0.63-42.58), but not statistically significant. In risk group C, half of new advanced adenomas were detected within the first year and four of nine CRC were detected within 3 years. CONCLUSION: Risk stratification of adenoma...
Advanced-technology 30-cm-diameter mercury ion thruster
Beattie, J. R.; Kami, S.
1982-01-01
An advanced-technology mercury ion thruster designed for operation at high thrust and high thrust-to-power ratio is described. The laboratory-model thruster employs a highly efficient discharge-chamber design that uses high-field-strength samarium-cobalt magnets arranged in a ring-cusp configuration. Ion extraction is achieved using an advanced three-grid ion-optics assembly which utilizes flexible mounts for supporting the screen, accel, and decel electrodes. Performance results are presented for operation at beam currents in the range from 1 to 5 A. The baseline specific discharge power is shown to be about 125 eV/ion, and the acceptable range of net-to-total accelerating-voltage ratio is shown to be in the range of 0.2-0.8 for beam currents in the range of 1-5 A.
Screening for colorectal cancer.
He, Jin; Efron, Jonathan E
2011-01-01
March is national colorectal cancer awareness month. It is estimated that as many as 60% of colorectal cancer deaths could be prevented if all men and women aged 50 years or older were screened routinely. In 2000, Katie Couric's televised colonoscopy led to a 20% increase in screening colonoscopies across America, a stunning rise called the "Katie Couric Effect". This event demonstrated how celebrity endorsement affects health behavior. Currently, discussion is ongoing about the optimal strategy for CRC screening, particularly the costs of screening colonoscopy. The current CRC screening guidelines are summarized in Table 2. Debates over the optimum CRC screening test continue in the face of evidence that 22 million Americans aged 50 to 75 years are not screened for CRC by any modality and 25,000 of those lives may have been saved if they had been screened for CRC. It is clear that improving screening rates and reducing disparities in underscreened communities and population subgroups could further reduce colorectal cancer morbidity and mortality. National Institutes of Health consensus identified the following priority areas to enhance the use and quality of colorectal cancer screening: Eliminate financial barriers to colorectal cancer screening and appropriate follow-up of positive results of colorectal cancer screening. Develop systems to ensure the high quality of colorectal cancer screening programs. Conduct studies to determine the comparative effectiveness of the various colorectal cancer screening methods in usual practice settings. Encouraging population adherence to screening tests and allowing patients to select the tests they prefer may do more good (as long as they choose something) than whatever procedure is chosen by the medical profession as the preferred test.
... Genetics of Skin Cancer Skin Cancer Screening Research Skin Cancer Screening (PDQ®)–Patient Version What is screening? ... These are called diagnostic tests . General Information About Skin Cancer Key Points Skin cancer is a disease ...
Usage of capillary electrophoresis for common hemoglobinopathies screening
Directory of Open Access Journals (Sweden)
Alireza Ebrahimi
2016-06-01
Full Text Available Hemoglobinopathies are most common inherited disorders in the world; approximately 7 percent of the worldwide population and 5-6 percent of population of Iran are carriers. The hemoglobin disorders inherit as autosomal recessive and are very common in the Mediterranean area and much of the Asia and Africa. The control of this inherited disorders need to genetic counseling and accurate screening by more advanced and more accurate methods. This study explains features of current Iran hemoglobin disorders, nominates the accessible methods for screening them and introduces the capillary zone electrophoresis as a rapid and more accurate method. The required data were extracted of various articles and then for good explanation, current Iran hemoglobinopathies properties were showed in the tables and electropherograms of important hemoglobin disorders in Iran population were provided for help to interpretation results of blood tests by capillary zone electrophoresis method. Hemoglobin disorders are including thalassemias and hemoglobin variants; Disruption in the production and malfunction of globin chains cause types of hemoglobin disorders. We cannot introduce one of clinical laboratory tests as critical and basic method for screening and distinguishing types of inherited hemoglobin disorders as alone. For distinguishing the types of them must be prepared enough information and data of the hemoglobin disorders and for more accurate analysis must be used simultaneously different methods as gel electrophoresis, high performance liquid chromatography, isoelectric focusing, capillary zone electrophoresis or molecular tests. The capillary electrophoresis is an accurate and rapid method for screening types of the hemoglobin disorders. Other side this method cannot analyze all of them, so must be used biochemical, biophysical and molecular methods for confirmation the results. This review showed we can use the capillary electrophoresis and HPLC as two
Cancer screening is checking for cancer in people who don't have symptoms. Screening tests can help doctors find and treat several types of cancer early, but cancer screening can have harms as well as benefits.
Domestic violence screening in a military setting: provider screening and attitudes.
Lutgendorf, Monica; Busch, Jeanne; Magann, Everett F; Morrison, John C
2010-06-01
Domestic violence is an important healthcare problem, and it appears more prevalent in military patient populations although no one has demonstrated the cause behind this phenomenon. The purpose of this observational study was to assess data regarding domestic violence screening from practitioners at one military training center. This study used an anonymous questionnaire for physicians, nurses and nurse midwives, which surveyed current methods, attitudes toward screening, and barriers for such assessment. Fifty-seven surveys were distributed, and 26 were returned for a response rate of 45.6%. Only about a third (38.5%) of the practitioners screened all obstetric patients while the remainder screened selected patients for domestic violence. Even less (19%) screened gynecology patients routinely, whereas 69% reported they screened selected women with chronic or somatic complaints. A history of prior abuse in the respondents led practitioners to try to identify such patients within their practice. Lack of education or training was the most common barrier to universal screening followed by time constraints and frustration about not being able to address adequately the problem when noted. These results emphasized the importance of an educational program to increase domestic violence awareness and routine screening.
... Genetics of Colorectal Cancer Colorectal Cancer Screening Research Colorectal Cancer Screening (PDQ®)–Patient Version What is screening? Go ... These are called diagnostic tests . General Information About Colorectal Cancer Key Points Colorectal cancer is a disease in ...
Screening_mgmt: a Python module for managing screening data.
Helfenstein, Andreas; Tammela, Päivi
2015-02-01
High-throughput screening is an established technique in drug discovery and, as such, has also found its way into academia. High-throughput screening generates a considerable amount of data, which is why specific software is used for its analysis and management. The commercially available software packages are often beyond the financial limits of small-scale academic laboratories and, furthermore, lack the flexibility to fulfill certain user-specific requirements. We have developed a Python module, screening_mgmt, which is a lightweight tool for flexible data retrieval, analysis, and storage for different screening assays in one central database. The module reads custom-made analysis scripts and plotting instructions, and it offers a graphical user interface to import, modify, and display the data in a uniform manner. During the test phase, we used this module for the management of 10,000 data points of various origins. It has provided a practical, user-friendly tool for sharing and exchanging information between researchers. © 2014 Society for Laboratory Automation and Screening.
The Return of Lombroso? Ethical Aspects of (Visions of) Preventive Forensic Screening.
Munthe, Christian; Radovic, Susanna
2015-11-01
The vision of legendary criminologist Cesare Lombroso to use scientific theories of individual causes of crime as a basis for screening and prevention programmes targeting individuals at risk for future criminal behaviour has resurfaced, following advances in genetics, neuroscience and psychiatric epidemiology. This article analyses this idea and maps its ethical implications from a public health ethical standpoint. Twenty-seven variants of the new Lombrosian vision of forensic screening and prevention are distinguished, and some scientific and technical limitations are noted. Some lures, biases and structural factors, making the application of the Lombrosian idea likely in spite of weak evidence are pointed out and noted as a specific type of ethical aspect. Many classic and complex ethical challenges for health screening programmes are shown to apply to the identified variants and the choice between them, albeit with peculiar and often provoking variations. These variations are shown to actualize an underlying theoretical conundrum in need of further study, pertaining to the relationship between public health ethics and the ethics and values of criminal law policy.
Site Screening and Technical Guidance for Monitored Natural Attenuation at DOE Sites
Energy Technology Data Exchange (ETDEWEB)
Borns, D.J.; Brady, P.V.; Brady, W.D.; Krupka, K.M.; Spalding, B.P.; Waters, R.D.; Zhang, P.
1999-03-01
Site Screening and Technical Guidance for Monitored Natural Attenuation at DOE Sites briefly outlines the biological and geochemical origins of natural attenuation, the tendency for natural processes in soils to mitigate contaminant transport and availability, and the means for relying on monitored natural attenuation (MNA) for remediation of contaminated soils and groundwaters. This report contains a step-by-step guide for (1) screening contaminated soils and groundwaters on the basis of their potential for remediation by natural attenuation and (2) implementing MNA consistent with EPA OSWER Directive 9200.4-17. The screening and implementation procedures are set up as a web-based tool (http://www.sandia.gov/eesector/gs/gc/na/mnahome.html) to assist US Department of Energy (DOE) site environmental managers and their staff and contractors to adhere to EPA guidelines for implementing MNA. This document is intended to support the Decision Maker's Framework Guide and Monitoring Guide both to be issued from DOE EM-40. Further technical advances may cause some of the approach outlined in this document to change over time.
International Nuclear Information System (INIS)
Logan, W.W.; Janus, J.A.
1987-01-01
The development of screen-film mammography has resulted in the re-emergence of confidence, rather than fear, in mammography. When screen-film mammography is performed with state-of-the-art dedicated equipment utilizing vigorous breast compression and a ''soft'' x-ray beam for improved contrast, screen-film images are equivalent or superior to those of reduced-dose xeromammography and superior to those of nonscreen film mammography. Technological aids for conversion from xeromammographic or nonscreen film mammographic techniques to screen-film techniques have been described. Screen-film mammography should not be attempted until dedicated equipment has been obtained and the importance of vigorous compression has been understood
Five year colorectal cancer outcomes in a large negative CT colonography screening cohort
Energy Technology Data Exchange (ETDEWEB)
Kim, David H.; Pooler, B.D.; Pickhardt, Perry J. [University of Wisconsin School of Medicine and Public Health, Department of Radiology, Madison, WI (United States); Weiss, Jennifer M. [University of Wisconsin School of Medicine and Public Health, Section of Gastroenterology, Department of Internal Medicine, Madison, WI (United States)
2012-07-15
To assess the 5-year incidence of clinically presenting colorectal cancers following a negative CT colonography (CTC) screening examination, as few patient outcome data regarding a negative CTC screening result exist. Negative CTC screening patients (n = 1,050) in the University of Wisconsin Health system over a 14-month period were included. An electronic medical record (EMR) review was undertaken, encompassing provider, colonoscopy, imaging and histopathology reports. Incident colorectal cancers and other important GI tumours were recorded. Of the 1,050 cohort (mean [{+-}SD] age 56.9 {+-} 7.4 years), 39 (3.7%) patients were excluded owing to lack of follow-up within our system beyond the initial screening CTC. The remaining 1,011 patients were followed for an average of 4.73 {+-} 1.15 years. One incident colorectal adenocarcinoma represented a crude cancer incidence of 0.2 cancers per 1,000 patient years. EMR revealed 14 additional patients with clinically important GI tumours including: advanced adenomas (n = 11), appendiceal goblet cell carcinoid (n = 1), appendiceal mucinous adenoma (n = 1) and metastatic ileocolonic carcinoid (n = 1). All positive patients including the incident carcinoma are alive at the time of review. Clinically presenting colorectal adenocarcinoma is rare in the 5 years following negative screening CTC, suggesting that current strategies, including non-reporting of diminutive lesions, are appropriate. (orig.)
Five year colorectal cancer outcomes in a large negative CT colonography screening cohort
International Nuclear Information System (INIS)
Kim, David H.; Pooler, B.D.; Pickhardt, Perry J.; Weiss, Jennifer M.
2012-01-01
To assess the 5-year incidence of clinically presenting colorectal cancers following a negative CT colonography (CTC) screening examination, as few patient outcome data regarding a negative CTC screening result exist. Negative CTC screening patients (n = 1,050) in the University of Wisconsin Health system over a 14-month period were included. An electronic medical record (EMR) review was undertaken, encompassing provider, colonoscopy, imaging and histopathology reports. Incident colorectal cancers and other important GI tumours were recorded. Of the 1,050 cohort (mean [±SD] age 56.9 ± 7.4 years), 39 (3.7%) patients were excluded owing to lack of follow-up within our system beyond the initial screening CTC. The remaining 1,011 patients were followed for an average of 4.73 ± 1.15 years. One incident colorectal adenocarcinoma represented a crude cancer incidence of 0.2 cancers per 1,000 patient years. EMR revealed 14 additional patients with clinically important GI tumours including: advanced adenomas (n = 11), appendiceal goblet cell carcinoid (n = 1), appendiceal mucinous adenoma (n = 1) and metastatic ileocolonic carcinoid (n = 1). All positive patients including the incident carcinoma are alive at the time of review. Clinically presenting colorectal adenocarcinoma is rare in the 5 years following negative screening CTC, suggesting that current strategies, including non-reporting of diminutive lesions, are appropriate. (orig.)
Sight-threatening diabetic retinopathy at presentation to screening services in Fiji.
Damato, Erika M; Murray, Neil; Szetu, John; Sikivou, Biu Telaite; Emma, Stephanie; McGhee, Charles N J
2014-10-01
To report the spectrum of retinopathy at first presentation to photoscreening services, to determine the proportion of patients that present with sight-threatening diabetic retinopathy (STDR), and to raise awareness of the burden of diabetic eye disease in Fiji. This retrospective observational cohort study used data from the initial visit of all new patients presenting to the diabetes retinal screening service at the Pacific Eye Institute in Fiji over the 3-month period between July and September 2012. Patients were assessed using a detailed questionnaire regarding diabetes type, duration of disease, medications, complications and co-morbidities, and blood sugar control. Patients subsequently underwent non-mydriatic fundus photography according to Pacific diabetes retinal screening guidelines. Images were graded at the time of acquisition, and data were entered onto a computerized database. For the purposes of this study, information regarding retinopathy grading, visual acuity and patient demographics was used. A total of 522 new patients were screened over the 3-month period. STDR was observed in 27% of patients, with 15% observed to have bilateral STDR. Diabetes control was generally poor. Blindness and visual impairment were observed in 2.7% and 6.7% of the cohort, respectively. Severe and advanced diabetic retinopathy was present in this population presenting to screening. This was observed 4 years after the formal expansion of the screening services and reflects the high prevalence of diabetes in the population. The need for increased public awareness and greater resource allocation into diabetes and its complications is emphasized.
Automation in high-content flow cytometry screening.
Naumann, U; Wand, M P
2009-09-01
High-content flow cytometric screening (FC-HCS) is a 21st Century technology that combines robotic fluid handling, flow cytometric instrumentation, and bioinformatics software, so that relatively large numbers of flow cytometric samples can be processed and analysed in a short period of time. We revisit a recent application of FC-HCS to the problem of cellular signature definition for acute graft-versus-host-disease. Our focus is on automation of the data processing steps using recent advances in statistical methodology. We demonstrate that effective results, on par with those obtained via manual processing, can be achieved using our automatic techniques. Such automation of FC-HCS has the potential to drastically improve diagnosis and biomarker identification.
Su, HaiFeng; Lin, JiaFu; Wang, YuanHong; Chen, Qiao; Wang, GuangWei; Tan, FuRong
2017-09-01
Biosynthesis of advanced biofuels by engineered non-natural microorganisms has been proposed to be the most promising approach for the replacement of dwindling fossil fuel resources. Brevibacterium flavum (Bf) is a model brevibacterium aerobe which lacks basic and applied research that could enable this species to produce biofuels. There are no reports regarding engineering this microorganism to produce advanced alcohols before. Here, for the first time, we developed the bacterium as a novel biosynthetic platform for advanced alcohols production via the mutagenesis and engineering to produce 2-ketoacids derived alcohols. In order to enhance the strain's capability of producing advanced alcohols, we preferentially improved intrinsic metabolism ability of the strain to obtain improved expression host (IEH) via generating mutagenesis libraries by whole cell mutagenesis (WCM). The IEH was determined via screening out the mutant strain with the highest production of branched-chain organic acids (BCOA) using high throughput screening method.. Subsequently, a novel vector system for Bf was established, and the corresponding biosynthetic pathway of directing carbon flux into the target advanced alcohols was recruited to make the bacterium possess the capability of producing advanced alcohols and further enhance the production using the IEH. Specifically, we generated bioengineered strains that were able to synthesize up to the highest 5362 and 4976 mg/L isobutanol, 1945 and 1747 mg/L 2-methyl-1-butanol (2 MB), and 785.34 and 781 mg/L 3-methyl-1-butanol (3 MB) from pure glucose and duckweed substrates, respectively. Our findings confirmed the feasibility and potential of using Bf as a novel biosynthetic platform to generate advanced biofuels with glucose and inexpensive renewable feedstock-duckweed as a fermentation substrate. Biotechnol. Bioeng. 2017;114: 1946-1958. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Advanced Plasmonic Materials for Dynamic Color Display.
Shao, Lei; Zhuo, Xiaolu; Wang, Jianfang
2018-04-01
Plasmonic structures exhibit promising applications in high-resolution and durable color generation. Research on advanced hybrid plasmonic materials that allow dynamically reconfigurable color control has developed rapidly in recent years. Some of these results may give rise to practically applicable reflective displays in living colors with high performance and low power consumption. They will attract broad interest from display markets, compared with static plasmonic color printing, for example, in applications such as digital signage, full-color electronic paper, and electronic device screens. In this progress report, the most promising recent examples of utilizing advanced plasmonic materials for the realization of dynamic color display are highlighted and put into perspective. The performances, advantages, and disadvantages of different technologies are discussed, with emphasis placed on both the potential and possible limitations of various hybrid materials for dynamic plasmonic color display. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Lau, Wan F.; Withka, Jane M.; Hepworth, David; Magee, Thomas V.; Du, Yuhua J.; Bakken, Gregory A.; Miller, Michael D.; Hendsch, Zachary S.; Thanabal, Venkataraman; Kolodziej, Steve A.; Xing, Li; Hu, Qiyue; Narasimhan, Lakshmi S.; Love, Robert; Charlton, Maura E.; Hughes, Samantha; van Hoorn, Willem P.; Mills, James E.
2011-07-01
Fragment Based Drug Discovery (FBDD) continues to advance as an efficient and alternative screening paradigm for the identification and optimization of novel chemical matter. To enable FBDD across a wide range of pharmaceutical targets, a fragment screening library is required to be chemically diverse and synthetically expandable to enable critical decision making for chemical follow-up and assessing new target druggability. In this manuscript, the Pfizer fragment library design strategy which utilized multiple and orthogonal metrics to incorporate structure, pharmacophore and pharmacological space diversity is described. Appropriate measures of molecular complexity were also employed to maximize the probability of detection of fragment hits using a variety of biophysical and biochemical screening methods. In addition, structural integrity, purity, solubility, fragment and analog availability as well as cost were important considerations in the selection process. Preliminary analysis of primary screening results for 13 targets using NMR Saturation Transfer Difference (STD) indicates the identification of uM-mM hits and the uniqueness of hits at weak binding affinities for these targets.
Engineering aspects of Passavant screening
International Nuclear Information System (INIS)
Siddle, K.R.; Sharma, R.K.
1978-01-01
The Passavant screen was developed in Europe almost 30 years ago. The Passavant screen is a vertical traveling screen; however, the basic difference between the conventional vertical traveling screen and the Passavant screen is that in the conventional screen water passes through the front screen belt and then the back screen belt, whereas in the Passavant screen the water enters in between the two belts and passes laterally through either of the belts. Thus, theoretically, the screening surface of the Passavant screen is doubled as compared to the same size conventional vertical traveling screen. Various design and operational modifications of the Passavant screen are possible to yield optimum design and performance characteristics which make it amenable to installation at power plants for safe removal of not only fish but also smaller organisms such as fish eggs and larvae. In this paper, details of the screen design and operational characteristics are discussed with notes on how these features can be modified to suit site- and organism-specific requirements
Advanced resin systems and 3D textile preforms for low cost composite structures
Shukla, J. G.; Bayha, T. D.
1993-01-01
Advanced resin systems and 3D textile preforms are being evaluated at Lockheed Aeronautical Systems Company (LASC) under NASA's Advanced Composites Technology (ACT) Program. This work is aimed towards the development of low-cost, damage-tolerant composite fuselage structures. Resin systems for resin transfer molding and powder epoxy towpreg materials are being evaluated for processability, performance and cost. Three developmental epoxy resin systems for resin transfer molding (RTM) and three resin systems for powder towpregging are being investigated. Various 3D textile preform architectures using advanced weaving and braiding processes are also being evaluated. Trials are being conducted with powdered towpreg, in 2D weaving and 3D braiding processes for their textile processability and their potential for fabrication in 'net shape' fuselage structures. The progress in advanced resin screening and textile preform development is reviewed here.
... this page: //medlineplus.gov/ency/article/003578.htm Toxicology screen To use the sharing features on this page, please enable JavaScript. A toxicology screen refers to various tests that determine the ...
Advances in imaging for oncology guidance
International Nuclear Information System (INIS)
Amies, Christopher J.
2008-01-01
Over the last 30 years major improvements in medical imaging have played a significant role to help advance the management of oncology diseases. These advances have covered the continuum of care from screening, diagnosis, staging, treatment planning and intervention. More recently image guided radiation therapy (IGRT) has placed sophisticated imaging closer to the treatment event. The opportunity to improve care seems obvious; however the clinical benefits of IGRT are at present not easily proven and yet contribute to the complexity of treatment and the rising costs of care. It is proposed that this is in part due to the present immaturity of IGRT technology development, which is predominantly determined by the challenge of achieving precise delivery of radiation in one or many episodes (fractions) for very different diseases. There is no single type or mode of imaging that will be suitable to address all radiotherapy guidance challenges whether defined by the general criteria identified for a specific disease or the unique characteristics encountered with an individual patient. Finally the wide adoption of this or any medical technology general requires the attainment of a sufficient degree of safety and efficiency. I present the challenges faced by industry as well as select interesting technology based solutions and concepts that may help advance the field of oncology guidance
Probability of an Abnormal Screening PSA Result Based on Age, Race, and PSA Threshold
Espaldon, Roxanne; Kirby, Katharine A.; Fung, Kathy Z.; Hoffman, Richard M.; Powell, Adam A.; Freedland, Stephen J.; Walter, Louise C.
2014-01-01
Objective To determine the distribution of screening PSA values in older men and how different PSA thresholds affect the proportion of white, black, and Latino men who would have an abnormal screening result across advancing age groups. Methods We used linked national VA and Medicare data to determine the value of the first screening PSA test (ng/mL) of 327,284 men age 65+ who underwent PSA screening in the VA healthcare system in 2003. We calculated the proportion of men with an abnormal PSA result based on age, race, and common PSA thresholds. Results Among men age 65+, 8.4% had a PSA >4.0ng/mL. The percentage of men with a PSA >4.0ng/mL increased with age and was highest in black men (13.8%) versus white (8.0%) or Latino men (10.0%) (PPSA >4.0ng/mL ranged from 5.1% of Latino men age 65–69 to 27.4% of black men age 85+. Raising the PSA threshold from >4.0ng/mL to >10.0ng/mL, reclassified the greatest percentage of black men age 85+ (18.3% absolute change) and the lowest percentage of Latino men age 65–69 (4.8% absolute change) as being under the biopsy threshold (PPSA threshold together affect the pre-test probability of an abnormal screening PSA result. Based on screening PSA distributions, stopping screening among men whose PSA 10ng/ml has the greatest effect on reducing the number of older black men who will face biopsy decisions after screening. PMID:24439009
Mental Health Screening Center
... Releases & Announcements Public Service Announcements Partnering with DBSA Mental Health Screening Center These online screening tools are not ... you have any concerns, see your doctor or mental health professional. Depression Screening for Adult Depression Screening for ...
Screening history in women with cervical cancer in a Danish population-based screening program
DEFF Research Database (Denmark)
Kirschner, Benny; Poll, Susanne; Rygaard, Carsten
2011-01-01
The aim of this study was to explore the screening histories of all cervical cancers in a Danish screening population. The intention was to decide suboptimal sides of the screening program and to evaluate the significance of routine screening in the development of cervical cancer.......The aim of this study was to explore the screening histories of all cervical cancers in a Danish screening population. The intention was to decide suboptimal sides of the screening program and to evaluate the significance of routine screening in the development of cervical cancer....
DEFF Research Database (Denmark)
Schückel, Julia; Kracun, Stjepan Kresimir; Willats, William George Tycho
2016-01-01
for this is that advances in genome and transcriptome sequencing, together with associated bioinformatics tools allow for rapid identification of candidate CAZymes, but technology for determining an enzyme's biochemical characteristics has advanced more slowly. To address this technology gap, a novel high-throughput assay...... CPH and ICB substrates are provided in a 96-well high-throughput assay system. The CPH substrates can be made in four different colors, enabling them to be mixed together and thus increasing assay throughput. The protocol describes a 96-well plate assay and illustrates how this assay can be used...... for screening the activities of enzymes, enzyme cocktails, and broths....
Peterson, Curtis W.; Mink, Jonah; Levitz, David
2017-03-01
Cervical cancer disproportionately affects women living in low- and middle-income countries. To address this global crisis, many governments and NGOs have implemented community-based screening and treatment programs at outreach camps. Here, high volumes of patients are able to access care: screening and diagnosis followed by immediate treatment of precancerous lesions onsite. However, monitoring and evaluation (M&E) of these efforts presents challenges, since each event typically relies on a different health workforce, and refers patients to different facilities for follow up and advanced care. To address these challenges, a digital imaging intervention was deployed at several screening camps in East Africa. Trained nurses screened women using a connected low-cost mobile colposcope built around a smartphone. A decision support job aid was integrated into the app controlling the device, guiding nurses and recording their diagnosis and treatment decisions. Aggregating the data from the job aid allowed M&E of the screening camp in real-time. In this paper, the M&E data from 2 different screening camps in East Africa are compared. Additionally, screening camps are compared to stationary clinics. Differences in the patient screening times, treatment rates, and individual nurse statistics were all documented through the job aid allowing for much improved epidemiological information following outreach events thus enabling targeted program improvements and provider training. Reporting data from screening camps were also shared online via public web pages, facilitating broader dissemination of health needs in specific East African communities, and sparking conversations with regional stakeholders about local disease burden.
Screening, diagnosis, and management of intrauterine growth restriction.
Lausman, Andrea; McCarthy, Fergus P; Walker, Melissa; Kingdom, John
2012-01-01
To provide comprehensive background knowledge relevant to the SOGC Maternal-Fetal Medicine Committee-approved guideline entitled "Intrauterine Growth Restriction: Screening, Diagnosis, and Management." Publications in English were retrieved through searches of PubMed or Medline, CINAHL, and the Cochrane Library in January 2011 using appropriate controlled vocabulary via MeSH terms (fetal growth restriction and small for gestational age) and any key words (fetal growth, restriction, growth retardation, intrauterine growth restriction [IUGR], low birth weight, small for gestational age). Results were restricted to systematic reviews, randomized controlled trials or controlled clinical trials, and high-quality prospective and retrospective observational studies. Grey (unpublished) literature was identified through searching the websites of health technology assessment and health technology assessment-related agencies, clinical practice guideline collections, clinical trial registries, and national and international medical specialty societies. Evidence obtained from at least one properly randomized controlled trial, Cochrane Reviews, and high quality cohort data have been combined to provide clinicians with evidence to optimize their practice for screening, diagnosis, and management of intrauterine growth restriction. Considerable advances have been made to improve clinicians' ability to screen, diagnose, and manage pregnancies with suspected IUGR more effectively, including several properly randomized controlled trials. Pregnancies with late-onset IUGR may be managed equally effectively by early delivery or delayed delivery (with increased surveillance) anticipating favourable outcomes. By contrast, many aspects of the management of early-onset IUGR require further clinical trials.
Brunner, Stefan; Delcourt, David
2008-01-01
In the only book that completely covers ScreenOS, six key members of Juniper Network's ScreenOS development team help you troubleshoot secure networks using ScreenOS firewall appliances. Over 200 recipes address a wide range of security issues, provide step-by-step solutions, and include discussions of why the recipes work, so you can easily set up and keep ScreenOS systems on track. The easy-to-follow format enables you to find the topic and specific recipe you need right away.
Lewis, Carmen L; Kistler, Christine E; Dalton, Alexandra F; Morris, Carolyn; Ferrari, Renée; Barclay, Colleen; Brewer, Noel T; Dolor, Rowena; Harris, Russell; Vu, Maihan; Golin, Carol E
2018-07-01
Concerns have been raised about both over- and underutilization of colorectal cancer (CRC) screening in older patients and the need to align screening behavior with likelihood of net benefit. The purpose of this study was to test a novel use of a patient decision aid (PtDA) to promote appropriate CRC screening in older adults. A total of 424 patients ages 70 to 84 y who were not up to date with CRC screening participated in a double-blinded randomized controlled trial of a PtDA targeted to older adults making decisions about whether to undergo CRC screening from March 2012 to February 2015. Patients were randomized to a targeted PtDA or an attention control. The PtDA was designed to facilitate individualized decision making-helping patients understand the potential risks, benefits, and uncertainties of CRC screening given advanced age, health state, preferences, and values. Two composite outcomes, appropriate CRC screening behavior 6 mo after the index visit and appropriate screening intent immediately after the visit, were defined as completed screening or intent for patients in good health, discussion about screening with their provider for patients in intermediate health, and no screening or intent for patients in poor health. Health state was determined by age and Charlson Comorbidity Index. Four hundred twelve (97%) and 421 (99%) patients were analyzed for the primary and secondary outcomes, respectively. Appropriate screening behavior at 6 mo was higher in the intervention group (55% v. 45%, P = 0.023) as was appropriate screening intent following the provider visit (61% v. 47%, P = 0.003). The study took place in a single geographic region. The appropriate CRC screening classification system used in this study has not been formally validated. A PtDA for older adults promoted appropriate CRC screening behavior and intent. Clinicaltrials.gov, registration number NCT01575990. https://clinicaltrials.gov/ct2/show/NCT01575990?term=epic-d&rank=1.
Mandelblatt, Jeanne S; Stout, Natasha K; Schechter, Clyde B; van den Broek, Jeroen J; Miglioretti, Diana L; Krapcho, Martin; Trentham-Dietz, Amy; Munoz, Diego; Lee, Sandra J; Berry, Donald A; van Ravesteyn, Nicolien T; Alagoz, Oguzhan; Kerlikowske, Karla; Tosteson, Anna N A; Near, Aimee M; Hoeffken, Amanda; Chang, Yaojen; Heijnsdijk, Eveline A; Chisholm, Gary; Huang, Xuelin; Huang, Hui; Ergun, Mehmet Ali; Gangnon, Ronald; Sprague, Brian L; Plevritis, Sylvia; Feuer, Eric; de Koning, Harry J; Cronin, Kathleen A
2016-02-16
Controversy persists about optimal mammography screening strategies. To evaluate screening outcomes, taking into account advances in mammography and treatment of breast cancer. Collaboration of 6 simulation models using national data on incidence, digital mammography performance, treatment effects, and other-cause mortality. United States. Average-risk U.S. female population and subgroups with varying risk, breast density, or comorbidity. Eight strategies differing by age at which screening starts (40, 45, or 50 years) and screening interval (annual, biennial, and hybrid [annual for women in their 40s and biennial thereafter]). All strategies assumed 100% adherence and stopped at age 74 years. Benefits (breast cancer-specific mortality reduction, breast cancer deaths averted, life-years, and quality-adjusted life-years); number of mammograms used; harms (false-positive results, benign biopsies, and overdiagnosis); and ratios of harms (or use) and benefits (efficiency) per 1000 screens. Biennial strategies were consistently the most efficient for average-risk women. Biennial screening from age 50 to 74 years avoided a median of 7 breast cancer deaths versus no screening; annual screening from age 40 to 74 years avoided an additional 3 deaths, but yielded 1988 more false-positive results and 11 more overdiagnoses per 1000 women screened. Annual screening from age 50 to 74 years was inefficient (similar benefits, but more harms than other strategies). For groups with a 2- to 4-fold increased risk, annual screening from age 40 years had similar harms and benefits as screening average-risk women biennially from 50 to 74 years. For groups with moderate or severe comorbidity, screening could stop at age 66 to 68 years. Other imaging technologies, polygenic risk, and nonadherence were not considered. Biennial screening for breast cancer is efficient for average-risk populations. Decisions about starting ages and intervals will depend on population characteristics and the
Effects of repeated mammographic screening on breast cancer stage distribution
International Nuclear Information System (INIS)
Fagerberg, G.; Baldetorp, L.; Groentoft, O.; Lundstroem, B.; Maanson, J.C.; Nordenskjoeld, B.
1985-01-01
A randomised controlled trial of mass screening for breast cancer by single-view mammography was begun in Sweden in 1977. All women aged 40 and older and resident in the counties of Koppaberg and Oestergoetland were enrolled. The present report is confined to the Oestergoetland study, which started in 1978 and comprised 92934 women. After randomisation, which was done on the basis of communities rather than individuals, 47001 women were allocated to the study group and offered repeated mammographic screening; 45933 were allocated to the control group. As compliance among women over 74 years of age was poor these were excluded from the present report. The yearly incidence of stage II or more advanced breast cancers after the initial screening round up to and including the second was reduced by 40 per cent in the study group compared with the controls. This effect was less marked in the age group 40-49. After 5.5 years average from the date of entry the absolute number of women with stage II-IV disease in the control group exceeded that for the study group by 44, whereas there was a large excess of cancer in situ and stage I cancer in the study group. (orig.)
Risk assessment and clinical decision making for colorectal cancer screening.
Schroy, Paul C; Caron, Sarah E; Sherman, Bonnie J; Heeren, Timothy C; Battaglia, Tracy A
2015-10-01
Shared decision making (SDM) related to test preference has been advocated as a potentially effective strategy for increasing adherence to colorectal cancer (CRC) screening, yet primary care providers (PCPs) are often reluctant to comply with patient preferences if they differ from their own. Risk stratification advanced colorectal neoplasia (ACN) provides a rational strategy for reconciling these differences. To assess the importance of risk stratification in PCP decision making related to test preference for average-risk patients and receptivity to use of an electronic risk assessment tool for ACN to facilitate SDM. Mixed methods, including qualitative key informant interviews and a cross-sectional survey. PCPs at an urban, academic safety-net institution. Screening preferences, factors influencing patient recommendations and receptivity to use of a risk stratification tool. Nine PCPs participated in interviews and 57 completed the survey. Despite an overwhelming preference for colonoscopy by 95% of respondents, patient risk (67%) and patient preferences (63%) were more influential in their decision making than patient comorbidities (31%; P decision making, yet few providers considered risk factors other than age for average-risk patients. Providers were receptive to the use of a risk assessment tool for ACN when recommending an appropriate screening test for select patients. © 2013 John Wiley & Sons Ltd.
Cao, Yongmei; Jiang, Zhen; Zeng, Zhen; Liu, Yujing; Gu, Yuchun; Ji, Yingying; Zhao, Yupeng; Li, Yingchuan
2016-01-01
Pulmonary arterial hypertension (PAH) is a life-threatening disorder that ultimately causes heart failure. While the underlying causes of this condition are not well understood, previous studies suggest that the anti-apoptotic nature of pulmonary microvascular endothelial cells (PMVECs) in hypoxic environments contributes to PAH pathogenesis. In this study, we focus on the contribution of Bcl-2 and hypoxia response element (HRE) to apoptosis-resistant endothelial cells and investigate the mechanism. PMVECs obtained from either normal rats or apoptosis-resistant PMVECs obtained from PAH rats were transduced with recombinant lentiviral vectors carrying either Bcl-2-shRNA or HRE combined Bcl-2-shRNA, and then cultured these cells for 24 h under hypoxic (5% O2) or normoxic (21% O2) conditions. In normal PMVECs, Bcl-2-shRNA or HRE combined with Bcl-2-shRNA transduction successfully decreased Bcl-2 expression, while increasing apoptosis as well as caspase-3 and P53 expression in a normoxic environment. In a hypoxic environment, the effects of Bcl-2-shRNA treatment on cell apoptosis, and on Bcl-2, caspase-3, P53 expression were significantly suppressed. Conversely, HRE activation combined with Bcl-2-shRNA transduction markedly enhanced cell apoptosis and upregulated caspase-3 and P53 expression, while decreasing Bcl-2 expression. Furthermore, in apoptosis-resistant PMVECs, HRE-mediated Bcl-2 silencing effectively enhanced cell apoptosis and caspase-3 activity. The apoptosis rate was significantly depressed when Lv-HRE-Bcl-2-shRNA was combined with Lv-P53-shRNA or Lv-caspase3-shRNA transduction in a hypoxic environment. These results suggest that HRE-mediated Bcl-2 inhibition can effectively attenuate hypoxia-induced apoptosis resistance in PMVECs by downregulating Bcl-2 expression and upregulating caspase-3 and P53 expression. This study therefore reveals critical insight into potential therapeutic targets for treating PAH.
Treatment of advanced rectal cancer after renal transplantation
Institute of Scientific and Technical Information of China (English)
Hai-Yi Liu; Xiao-Bo Liang; Yao-Ping Li; Yi Feng; Dong-Bo Liu; Wen-Da Wang
2011-01-01
Renal transplantation is a standard procedure for end-stage renal disease today. Due to immunosuppressive drugs and increasing survival time after renal trans-plantation, patients with transplanted kidneys carry an increased risk of developing malignant tumors. In this case report, 3 patients with advanced rectal can-cer after renal transplantation for renal failure were treated with anterior resection or abdominoperineal resection plus total mesorectal excision, followed by adjuvant chemotherapy. One patient eventually died of metastasized cancer 31 mo after therapy, although his organ grafts functioned well until his death. The other 2 patients were well during the 8 and 21 mo follow-up periods after rectal resection. We therefore strongly argue that patients with advanced rectal cancer should receive standard oncology treatment, including opera-tion and adjuvant treatment after renal transplantation. Colorectal cancer screening in such patients appears justified.
Advanced Light Water Reactor Program: Program management and staff review methodology
International Nuclear Information System (INIS)
Moran, D.H.
1986-12-01
This report summarizes the NRC/EPRI coordinated effort to develop design requirements for a standardized advanced light water reactor (ALWR) and the procedures for screening and applying new generic safety issues to this program. The end-product will be an NRC-approved ALWR Requirements Document for use by the nuclear industry in generating designs of LWRs to be constructed for operation in the 1990s and beyond
Nassali, Mercy Nkuba; Tadele, Melese; Nkuba, Robert Michael; Modimowame, Jamieson; Enyeribe, Iwuh; Katse, Edwin
2018-05-23
The aim of this study was to determine predictors of locally advanced disease at presentation and clinical outcomes among cervical cancer patients in Botswana to inform interventional strategies. Retrospective review of 149 medical records of new cervical cancer patients was conducted between August 2016 and February 2017 at the Princess Marina Hospital. Data collected included sociodemographics, presenting symptoms, stage of disease, comorbidities, interventions, and clinical outcomes. STATA 12 was used for data analysis. Frequencies were used to describe patient demographics and clinical variables. Bivariate and multivariate binary logistic regression analyses were used to determine association between stage of disease at presentation and patient characteristics. P ≤ 0.05 was considered significant. Mean age was 49.5 years. Nine (89.2%) in 10 patients had locally advanced cervical cancer (stage IB1-IVB). Two thirds (65.1%) were human immunodeficiency virus positive. Previous cervical cancer screening was low at 38.3%. Common symptoms were abnormal vaginal bleeding, low abdominal pain, and malodorous vaginal discharge reported among 75.8%, 66.4%, and 39.6% of cases, respectively. Overall, 32 (21.5%) were declared cured, 52 (34.9%) improved, and 11 (7.4%) opted for home-based care. Hospital deaths were 41 (27.5%). Major causes of death were renal failure (48.7%) and severe anemia (39%). Thirteen (8.7%) were lost to follow-up. Being unmarried (odds ratio [OR], 3.9), lack of cervical cancer screening (OR, 6.68), presentation with vaginal bleeding (OR, 7.69), and low abdominal pain (OR, 4.69) were associated with advanced disease at presentation. Lack of cervical cancer screening, vaginal bleeding, low abdominal pain, and unmarried status were associated with advanced disease at presentation. We recommend scale-up of cervical cancer screening and its integration into routine human immunodeficiency virus care. Capacity building in gynecologic oncology and palliative
Preimplantation genetic screening.
Harper, Joyce C
2018-03-01
Preimplantation genetic diagnosis was first successfully performed in 1989 as an alternative to prenatal diagnosis for couples at risk of transmitting a genetic or chromosomal abnormality, such as cystic fibrosis, to their child. From embryos generated in vitro, biopsied cells are genetically tested. From the mid-1990s, this technology has been employed as an embryo selection tool for patients undergoing in vitro fertilisation, screening as many chromosomes as possible, in the hope that selecting chromosomally normal embryos will lead to higher implantation and decreased miscarriage rates. This procedure, preimplantation genetic screening, was initially performed using fluorescent in situ hybridisation, but 11 randomised controlled trials of screening using this technique showed no improvement in in vitro fertilisation delivery rates. Progress in genetic testing has led to the introduction of array comparative genomic hybridisation, quantitative polymerase chain reaction, and next generation sequencing for preimplantation genetic screening, and three small randomised controlled trials of preimplantation genetic screening using these new techniques indicate a modest benefit. Other trials are still in progress but, regardless of their results, preimplantation genetic screening is now being offered globally. In the near future, it is likely that sequencing will be used to screen the full genetic code of the embryo.
Konerman, Monica A; Thomson, Mary; Gray, Kristen; Moore, Meghan; Choxi, Hetal; Seif, Elizabeth; Lok, Anna S F
2017-12-01
Despite effective treatment for chronic hepatitis C, deficiencies in diagnosis and access to care preclude disease elimination. Screening of baby boomers remains low. The aims of this study were to assess the impact of an electronic health record-based prompt on hepatitis C virus (HCV) screening rates in baby boomers in primary care and access to specialty care and treatment among those newly diagnosed. We implemented an electronic health record-based "best practice advisory" (BPA) that prompted primary care providers to perform HCV screening for patients seen in primary care clinic (1) born between 1945 and 1965, (2) who lacked a prior diagnosis of HCV infection, and (3) who lacked prior documented anti-HCV testing. The BPA had associated educational materials, order set, and streamlined access to specialty care for newly diagnosed patients. Pre-BPA and post-BPA screening rates were compared, and care of newly diagnosed patients was analyzed. In the 3 years prior to BPA implementation, 52,660 baby boomers were seen in primary care clinics and 28% were screened. HCV screening increased from 7.6% for patients with a primary care provider visit in the 6 months prior to BPA to 72% over the 1 year post-BPA. Of 53 newly diagnosed patients, all were referred for specialty care, 11 had advanced fibrosis or cirrhosis, 20 started treatment, and 9 achieved sustained virologic response thus far. Implementation of an electronic health record-based prompt increased HCV screening rates among baby boomers in primary care by 5-fold due to efficiency in determining needs for HCV screening and workflow design. Streamlined access to specialty care enabled patients with previously undiagnosed advanced disease to be cured. This intervention can be easily integrated into electronic health record systems to increase HCV diagnosis and linkage to care. (Hepatology 2017;66:1805-1813). © 2017 by the American Association for the Study of Liver Diseases.
Whitehurst, Charles E; Annis, D Allen
2008-07-01
Advances in combinatorial chemistry and genomics have inspired the development of novel affinity selection-based screening techniques that rely on mass spectrometry to identify compounds that preferentially bind to a protein target. Of the many affinity selection-mass spectrometry techniques so far documented, only a few solution-based implementations that separate target-ligand complexes away from unbound ligands persist today as routine high throughput screening platforms. Because affinity selection-mass spectrometry techniques do not rely on radioactive or fluorescent reporters or enzyme activities, they can complement traditional biochemical and cell-based screening assays and enable scientists to screen targets that may not be easily amenable to other methods. In addition, by employing mass spectrometry for ligand detection, these techniques enable high throughput screening of massive library collections of pooled compound mixtures, vastly increasing the chemical space that a target can encounter during screening. Of all drug targets, G protein coupled receptors yield the highest percentage of therapeutically effective drugs. In this manuscript, we present the emerging application of affinity selection-mass spectrometry to the high throughput screening of G protein coupled receptors. We also review how affinity selection-mass spectrometry can be used as an analytical tool to guide receptor purification, and further used after screening to characterize target-ligand binding interactions, enabling the classification of orthosteric and allosteric binders.
Computed tomographic characteristics of interval and post screen carcinomas in lung cancer screening
International Nuclear Information System (INIS)
Scholten, Ernst T.; Horeweg, Nanda; Koning, Harry J. de; Vliegenthart, Rozemarijn; Oudkerk, Matthijs; Mali, Willem P.T.M.; Jong, Pim A. de
2015-01-01
To analyse computed tomography (CT) findings of interval and post-screen carcinomas in lung cancer screening. Consecutive interval and post-screen carcinomas from the Dutch-Belgium lung cancer screening trial were included. The prior screening and the diagnostic chest CT were reviewed by two experienced radiologists in consensus with knowledge of the tumour location on the diagnostic CT. Sixty-one participants (53 men) were diagnosed with an interval or post-screen carcinoma. Twenty-two (36 %) were in retrospect visible on the prior screening CT. Detection error occurred in 20 cancers and interpretation error in two cancers. Errors involved intrabronchial tumour (n = 5), bulla with wall thickening (n = 5), lymphadenopathy (n = 3), pleural effusion (n = 1) and intraparenchymal solid nodules (n = 8). These were missed because of a broad pleural attachment (n = 4), extensive reticulation surrounding a nodule (n = 1) and extensive scarring (n = 1). No definite explanation other than human error was found in two cases. None of the interval or post-screen carcinomas involved a subsolid nodule. Interval or post-screen carcinomas that were visible in retrospect were mostly due to detection errors of solid nodules, bulla wall thickening or endobronchial lesions. Interval or post-screen carcinomas without explanation other than human errors are rare. (orig.)
Computed tomographic characteristics of interval and post screen carcinomas in lung cancer screening
Energy Technology Data Exchange (ETDEWEB)
Scholten, Ernst T. [University Medical Centre, Department of Radiology, Utrecht (Netherlands); Kennemer Gasthuis, Department of Radiology, Haarlem (Netherlands); Horeweg, Nanda [Erasmus University Medical Centre, Department of Public Health, Rotterdam (Netherlands); Erasmus University Medical Centre, Department of Pulmonary Medicine, Rotterdam (Netherlands); Koning, Harry J. de [Erasmus University Medical Centre, Department of Public Health, Rotterdam (Netherlands); Vliegenthart, Rozemarijn [University of Groningen, University Medical Centre Groningen, Department of Radiology, Groningen (Netherlands); University of Groningen, University Medical Centre Groningen, Center for Medical Imaging-North East Netherlands, Groningen (Netherlands); Oudkerk, Matthijs [University of Groningen, University Medical Centre Groningen, Center for Medical Imaging-North East Netherlands, Groningen (Netherlands); Mali, Willem P.T.M.; Jong, Pim A. de [University Medical Centre, Department of Radiology, Utrecht (Netherlands)
2015-01-15
To analyse computed tomography (CT) findings of interval and post-screen carcinomas in lung cancer screening. Consecutive interval and post-screen carcinomas from the Dutch-Belgium lung cancer screening trial were included. The prior screening and the diagnostic chest CT were reviewed by two experienced radiologists in consensus with knowledge of the tumour location on the diagnostic CT. Sixty-one participants (53 men) were diagnosed with an interval or post-screen carcinoma. Twenty-two (36 %) were in retrospect visible on the prior screening CT. Detection error occurred in 20 cancers and interpretation error in two cancers. Errors involved intrabronchial tumour (n = 5), bulla with wall thickening (n = 5), lymphadenopathy (n = 3), pleural effusion (n = 1) and intraparenchymal solid nodules (n = 8). These were missed because of a broad pleural attachment (n = 4), extensive reticulation surrounding a nodule (n = 1) and extensive scarring (n = 1). No definite explanation other than human error was found in two cases. None of the interval or post-screen carcinomas involved a subsolid nodule. Interval or post-screen carcinomas that were visible in retrospect were mostly due to detection errors of solid nodules, bulla wall thickening or endobronchial lesions. Interval or post-screen carcinomas without explanation other than human errors are rare. (orig.)
Barriers and Motivators Related to Cervical and Breast Cancer Screening
Directory of Open Access Journals (Sweden)
M Bokaee
2004-10-01
Full Text Available Introduction: modern knowledge could protect against cancer for individuals in community with early stage and premalignat state. Screening of cancer is best instrument for early detection of malignancy. Between women’s cancers breast and cervical cancer have more incidence and mortality than other cancers . But could be prevented by simple and cheep screening programs. Despite specific statistics in Iran evidence shows that women’s participation in screening program is poor , so cancers are diagnosed in advanced stage. The purpose of this study was to identify major barriers and motivators for breast and cervical screening . Methods: This survey was a descriptive study in which 400 women participated in health and treatment centers in Yazd. Sampling method was done in two simple and random stages. Data was collected by inventory and questionnaire . Then data were analyzed by SPSS soft ware . Results: Findings showed that 80% of them never refereed to a health provider for clinical breast exam (C B E and only 3% of them did regularly C B E . 46% of them had never done pap smear and only 14.5 % of them did regularly pap smear. The findings showed that major motivators were as follow: advice of health’s personnel , using of contraceptive methods , and awareness of media. Also the major barriers were as follow : Not having knowledge of these exams , not having knowledge of the existence of these centers of education and practice , not having precious health problems , fear of examination , Embarrassment of examination and health providers not to teach them . to consider the most important barriers were propounded which showed that health education role to eliminate barriers for referring women for screening . Discussion: Based on the results of this sample , screening was the least expected . considering barriers and motivators observed it was revealed that health education was required for prevention of common women’s cancers. Also
Miller, Daniel L; Mayfield, William R; Luu, Theresa D; Helms, Gerald A; Muster, Alan R; Beckler, Vickie J; Cann, Aaron
2016-05-01
Lung cancer is the most common cause of cancer deaths in the United States. Overall survival is less than 20%, with the majority of patients presenting with advanced disease. The National Lung Screening Trial, performed mainly in academic medical centers, showed that cancer mortality can be reduced with computed tomography (CT) screening compared with chest radiography in high-risk patients. To determine whether this survival advantage can be duplicated in a community-based multidisciplinary thoracic oncology program, we initiated a CT scan screening program for lung cancer within an established health care system. In 2008, we launched a lung cancer CT screening program within the WellStar Health System (WHS) consisting of five hospitals, three health parks, 140 outpatient medical offices, and 12 imaging centers that provide care in a five-county area of approximately 1.4 million people in Metro-Atlanta. Screening criteria incorporated were the International Early Lung Cancer Action Program (2008 to 2010) and National Comprehensive Cancer Network guidelines (2011 to 2013) for moderate- and high-risk patients. A total of 1,267 persons underwent CT lung cancer screening in WHS from 2008 through 2013; 53% were men, 87% were 50 years of age or older, and 83% were current or former smokers. Noncalcified indeterminate pulmonary nodules were found in 518 patients (41%). Thirty-six patients (2.8%) underwent a diagnostic procedure for positive findings on their CT scan; 30 proved to have cancer, 28 (2.2%) primary lung cancer and 2 metastatic cancer, and 6 had benign disease. Fourteen patients (50%) had their lung cancer discovered on their initial CT scan, 11 on subsequent scans associated with indeterminate pulmonary nodules growth and 3 patients who had a new indeterminate pulmonary nodules. Only 15 (54%) of these 28 patients would have qualified as a National Lung Screening Trial high-risk patient; 75% had stage I or II disease. Overall 5-year survival was 64% and 5-year
Ceres, Marc; Quinn, Gwendolyn P; Loscalzo, Matthew; Rice, David
2018-02-01
To describe the current state of cancer screening and uptake for lesbian, gay, bisexual, and transgender (LGBT) persons and to propose cancer screening considerations for LGBT persons. Current and historic published literature on cancer screening and LGBT cancer screening; published national guidelines. Despite known cancer risks for members of the LGBT community, cancer screening rates are often low, and there are gaps in screening recommendations for LGBT persons. We propose evidence-based cancer screening considerations derived from the current literature and extant cancer screening recommendations. The oncology nurse plays a key role in supporting patient preventive care and screening uptake through assessment, counseling, education, advocacy, and intervention. As oncology nurses become expert in the culturally competent care of LGBT persons, they can contribute to the improvement of quality of care and overall well-being of this health care disparity population. Copyright © 2017 Elsevier Inc. All rights reserved.
Sarcopenia is associated with an increased risk of advanced colorectal neoplasia.
Park, Youn Su; Kim, Ji Won; Kim, Byeong Gwan; Lee, Kook Lae; Lee, Jae Kyung; Kim, Joo Sung; Koh, Seong-Joon
2017-04-01
Although sarcopenia is associated with an increased risk for mortality after the curative resection of colorectal cancer, its influence on the development of advanced colonic neoplasia remains unclear. This study included 1270 subjects aged 40 years or older evaluated with first-time screening colonoscopy at Seoul National University Boramae Health Care Center from January 2010 to February 2015. Skeletal muscle mass was measured with a body composition analyzer (direct segmental multifrequency bioelectrical impedance analysis method). Multiple logistic regression analysis was performed to determine whether sarcopenia is associated with advanced colorectal neoplasia. Of 1270 subjects, 139 (10.9%) were categorized into the sarcopenia group and 1131 (89.1%) into the non-sarcopenia group. In the non-sarcopenia group, 55 subjects (4.9%) had advanced colorectal neoplasia. However, in the sarcopenia group, 19 subjects (13.7%) had advanced colorectal neoplasia, including 1 subject with invasive colorectal cancer (0.7%). In addition, subjects with sarcopenia had a higher prevalence of advanced adenoma (P sarcopenia. According to the multiple logistic regression analysis adjusted for variable confounders, age (odds ratio 1.062, 95% confidence interval 1.032-1.093; P sarcopenia (odds ratio 2.347, 95% confidence interval 1.311-4.202; P = 0.004) were associated with an advanced colorectal neoplasia. Sarcopenia is associated with an increased risk of advanced colorectal neoplasia.
Wire screens as a tool for survey measurements of the unattached radon progeny in mines
International Nuclear Information System (INIS)
Janica, R.
1996-07-01
The radon hazard in mines is assessed by measuring the radioactivity accumulated on filters through which air is forced to flow. The filter collects both forms of the short-lived radon progeny, attached and unattached, and, therefore, the assessment is based on the measurement of the total radon progeny. Because of the special radiological significance of the unattached fraction of the short-lived radon progeny, the estimation of the radiation hazard to miners would be improved if the unattached fraction could be measured. This report describes two methods of measurement for the simultaneous determination of the unattached and the total radon progeny. The proposed methods comply with the criterion of practicality (imposed by the working conditions in the mine environment), that is, they are implemented using standard survey equipment and simple procedures. Both methods use wire screens to collect, preferentially, the unattached fraction. According to the first method, air is sampled through a wire screen and a backup filter, and the radioactivity accumulated on both the filter and the wire screen are measured separately using standard counting protocols (e.g. the Kusnetz protocol). The wire screen's efficiency for collecting the unattached radon progeny is determined, in advance, under laboratory conditions. The method assumes the validity of the collection efficiencies when the screens are used under field conditions. To avoid the uncertainty of the lab-determined collection efficiency, a new measuring method was proposed based on the sampling of air through two screens in series and a backup filter. The measurement of the ratio of the activities deposited on both screens allows an estimation of the screen collection efficiency under field conditions. Once this is done, the 'unattached fraction' and total radon progeny are determined by counting only one of the screens and the backup filter as described in the previous method. (author). 73 refs., 8 tabs., 21 figs
Vibration characteristics of an inclined flip-flow screen panel in banana flip-flow screens
Xiong, Xiaoyan; Niu, Linkai; Gu, Chengxiang; Wang, Yinhua
2017-12-01
A banana flip-flow screen is an effective solution for the screening of high-viscosity, high-water and fine materials. As one of the key components, the vibration characteristics of the inclined flip-flow screen panel largely affects the screen performance and the processing capacity. In this paper, a mathematical model for the vibration characteristic of the inclined flip-flow screen panel is proposed based on Catenary theory. The reasonability of Catenary theory in analyzing the vibration characteristic of flip-flow screen panels is verified by a published experiment. Moreover, the effects of the rotation speed of exciters, the incline angle, the slack length and the characteristics of the screen on the vertical deflection, the vertical velocity and the vertical acceleration of the screen panel are investigated parametrically. The results show that the rotation speed of exciters, the incline angle, the slack length and the characteristics of the screen have significant effects on the vibrations of an inclined flip-flow screen panel, and these parameters should be optimized.
Directory of Open Access Journals (Sweden)
Panda L
2018-06-01
Full Text Available Lapam Panda,1 Taraprasad Das,1 Suryasmita Nayak,1 Umasankar Barik,2 Bikash C Mohanta,1 Jachin Williams,3 Vivekanand Warkad,4 Guha Poonam Tapas Kumar,5 Rohit C Khanna3 1Indian Oil Center for Rural Eye Health, GPR ICARE, L V Prasad Eye Institute, MTC Campus, Bhubaneswar, India; 2Naraindas Morbai Budhrani Eye Centre, L V Prasad Eye Institute, Rayagada, India; 3Gullapalli Pratibha Rao International Center for Advancement of Rural Eye Care, L V Prasad Eye Institute, KAR Campus, Hyderabad, India; 4Miriam Hyman Children Eye Care Center, L V Prasad Eye Institute, MTC Campus, Bhubaneswar, India; 5District Administration, Government of Odisha, Rayagada, India Purpose: To describe program planning and effectiveness of multistage school eye screening and assess accuracy of teachers in vision screening and detection of other ocular anomalies in Rayagada District School Sight Program, Odisha, India.Methods: This multistage screening of students included as follows: stage I: screening for vision and other ocular anomalies by school teachers in the school; stage II: photorefraction, subjective correction and other ocular anomaly confirmation by optometrists in the school; stage III: comprehensive ophthalmologist examination in secondary eye center; and stage IV: pediatric ophthalmologist examination in tertiary eye center. Sensitivity, specificity, positive predictive value (PPV and negative predictive value (NPV of teachers for vision screening and other ocular anomaly detection were calculated vis-à-vis optometrist (gold standard.Results: In the study, 216 teachers examined 153,107 (95.7% of enrolled students aged 5–15 years. Teachers referred 8,363 (5.4% of examined students and 5,990 (71.6% of referred were examined in stage II. After prescribing spectacles to 443, optometrists referred 883 students to stage III. The sensitivity (80.51% and PPV (93.05% of teachers for vision screening were high, but specificity (53.29% and NPV (26.02% were low. The
Lane, Dorothy S; Messina, Catherine R; Cavanagh, Mary F; Anderson, Joseph C
2013-08-01
Current and pending legislation provides colorectal cancer screening reimbursement for previously uninsured populations. Colonoscopy is currently the screening method most frequently recommended by physicians for insured patients. The experience of the SCOPE (Suffolk County Preventive Endoscopy) demonstration project (Project SCOPE) at Stony Brook University Medical Center provides a model for delivering colonoscopy screening to low-income populations to meet anticipated increasing demands. Project SCOPE, based in the Department of Preventive Medicine, featured internal collaboration with the academic medical center's large gastroenterology practice and external collaboration with the Suffolk County Department of Health Services' network of community health centers. Colonoscopies were performed by faculty gastroenterologists or supervised fellows. Measures of colonoscopy performance were compared with quality indicators and differences between faculty and supervised fellows were identified. During a 40-month screening period, 800 initial colonoscopies were performed. Approximately 21% of women screened were found to have adenomatous polyps compared with 36% of men. Five cancers were detected. The majority of the population screened (70%) were members of minority populations. African American individuals had a higher percentage of proximally located adenomas (78%) compared with white individuals (65%) and Hispanics (49%), based on the location of the most advanced lesion. Hispanic individuals had a 36% lower risk of adenomas compared with white individuals. Performance measures including the percentage of procedures with adequate bowel preparation, cecum reached, scope withdrawal time, and adenoma detection rate met quality benchmarks when performed by either faculty or supervised fellows. Project SCOPE's operational strategies demonstrated a feasible method for an academic medical center to provide high-quality screening colonoscopy for low-income populations.
Santos, Radleigh G; Appel, Jon R; Giulianotti, Marc A; Edwards, Bruce S; Sklar, Larry A; Houghten, Richard A; Pinilla, Clemencia
2013-05-30
In the past 20 years, synthetic combinatorial methods have fundamentally advanced the ability to synthesize and screen large numbers of compounds for drug discovery and basic research. Mixture-based libraries and positional scanning deconvolution combine two approaches for the rapid identification of specific scaffolds and active ligands. Here we present a quantitative assessment of the screening of 32 positional scanning libraries in the identification of highly specific and selective ligands for two formylpeptide receptors. We also compare and contrast two mixture-based library approaches using a mathematical model to facilitate the selection of active scaffolds and libraries to be pursued for further evaluation. The flexibility demonstrated in the differently formatted mixture-based libraries allows for their screening in a wide range of assays.
DEFF Research Database (Denmark)
Toft, Tanya Søndergaard
2014-01-01
During the past one and a half decade, a curatorial orientation towards "screen practice" has expanded the moving image and digital art into the public domain, exploring alternative artistic uses of the screen. The emergence of urban LED screens in the late 1990s provided a new venue that allowed...... for digital art to expand into public space. It also offered a political point of departure, inviting for confrontation with the Spectacle and with the politics and ideology of the screen as a mass communication medium that instrumentalized spectator positions. In this article I propose that screen practice...... to the dispositif of screen practice in curating, resulting in a medium-based curatorial discourse. With reference to the nomadic exhibition project Nordic Outbreak that I co-curated with Nina Colosi in 2013 and 2014, I suggest that the topos of the defined visual display area, frequently still known as "the screen...
Roder, David; Farshid, Gelareh; Gill, Grantley; Kollias, Jim; Koczwara, Bogda; Karapetis, Chris; Adams, Jacqui; Joshi, Rohit; Keefe, Dorothy; Powell, Kate; Fusco, Kellie; Eckert, Marion; Buckley, Elizabeth; Beckmann, Kerri
2017-06-01
Screening has been found to reduce breast cancer mortality at a population level in Australia, but these studies did not address local settings where numbers of deaths would generally have been too low for evaluation. Clinicians, administrators, and consumer groups are also interested in local service outcomes. We therefore use more common prognostic and treatment measures and survivals to gain evidence of screening effects among patients attending 4 local hospitals for treatment. To compare prognostic, treatment, and survival measures by screening history to determine whether expected screening effects are occurring. Employing routine clinical registry and linked screening data to investigate associations of screening history with these measures, using unadjusted and adjusted analyses. Screened women had a 10-year survival from breast cancer of 92%, compared with 78% for unscreened women; and 79% of screened surgical cases had breast conserving surgery compared with 64% in unscreened women. Unadjusted analyses indicated that recently screened cases had earlier tumor node metastasis stages, smaller diameters, less nodal involvement, better tumor differentiation, more oestrogen and progesterone receptor positive lesions, more hormone therapy, and less chemotherapy. Radiotherapy tended to be more common in screening participants. More frequent use of adjunctive radiotherapy applied when breast conserving surgery was used. Results confirm the screening effects expected from the scientific literature and demonstrate the value of opportunistic use of available registry and linked screening data for indicating to local health administrations, practitioners, and consumers whether local screening services are having the effects expected. © 2016 John Wiley & Sons, Ltd.
Management of Locally Advanced Cancer Cervix an Indian Perspective.
Singh, J K; Chauhan, Richa
2015-01-01
Cervical cancer has a major impact on the lives of Indian women with an estimated 122, 844 new cases of cervical cancer in the year 2012. About 80% of these cases present in a locally advanced stage leading to high morbidity and mortality. Because of lack of public awareness and infrastructure for screening and early detection in developing countries, this late presentation is likely to continue in the coming years. Radiation therapy has been the treatment of choice for patients with locally advanced cancer cervix. Many clinical trials and meta-analyses have shown a significant improvement in overall and progression-free survival with decreased local and distant recurrences with the use of concurrent chemotherapy with radiation. Most of these trials have been done in women from developed countries where the patient and disease profile are entirely different from ours. Recently, few trials from India have also shown promising results in locally advanced cancer cervix with concurrent chemoradiotherapy but toxicities remain a major concern. Further exploration is required for the use of concurrent chemo radiation prior to incorporating it into routine clinical practice.
Plevritis, Sylvia K; Munoz, Diego; Kurian, Allison W; Stout, Natasha K; Alagoz, Oguzhan; Near, Aimee M; Lee, Sandra J; van den Broek, Jeroen J; Huang, Xuelin; Schechter, Clyde B; Sprague, Brian L; Song, Juhee; de Koning, Harry J; Trentham-Dietz, Amy; van Ravesteyn, Nicolien T; Gangnon, Ronald; Chandler, Young; Li, Yisheng; Xu, Cong; Ergun, Mehmet Ali; Huang, Hui; Berry, Donald A; Mandelblatt, Jeanne S
2018-01-09
Given recent advances in screening mammography and adjuvant therapy (treatment), quantifying their separate and combined effects on US breast cancer mortality reductions by molecular subtype could guide future decisions to reduce disease burden. To evaluate the contributions associated with screening and treatment to breast cancer mortality reductions by molecular subtype based on estrogen-receptor (ER) and human epidermal growth factor receptor 2 (ERBB2, formerly HER2 or HER2/neu). Six Cancer Intervention and Surveillance Network (CISNET) models simulated US breast cancer mortality from 2000 to 2012 using national data on plain-film and digital mammography patterns and performance, dissemination and efficacy of ER/ERBB2-specific treatment, and competing mortality. Multiple US birth cohorts were simulated. Screening mammography and treatment. The models compared age-adjusted, overall, and ER/ERBB2-specific breast cancer mortality rates from 2000 to 2012 for women aged 30 to 79 years relative to the estimated mortality rate in the absence of screening and treatment (baseline rate); mortality reductions were apportioned to screening and treatment. In 2000, the estimated reduction in overall breast cancer mortality rate was 37% (model range, 27%-42%) relative to the estimated baseline rate in 2000 of 64 deaths (model range, 56-73) per 100 000 women: 44% (model range, 35%-60%) of this reduction was associated with screening and 56% (model range, 40%-65%) with treatment. In 2012, the estimated reduction in overall breast cancer mortality rate was 49% (model range, 39%-58%) relative to the estimated baseline rate in 2012 of 63 deaths (model range, 54-73) per 100 000 women: 37% (model range, 26%-51%) of this reduction was associated with screening and 63% (model range, 49%-74%) with treatment. Of the 63% associated with treatment, 31% (model range, 22%-37%) was associated with chemotherapy, 27% (model range, 18%-36%) with hormone therapy, and 4% (model range, 1
A roadmap to directed enzyme evolution and screening systems for biotechnological applications
Directory of Open Access Journals (Sweden)
Ronny Martínez
2013-01-01
Full Text Available Enzymes have been long used in man-made biochemical processes, from brewing and fermentation to current industrial production of fine chemicals. The ever-growing demand for enzymes in increasingly specific applications requires tailoring naturally occurring enzymes to the non-natural conditions found in industrial processes. Relationships between enzyme sequence, structure and activity are far from understood, thus hindering the capacity to design tailored biocatalysts. In the field of protein engineering, directed enzyme evolution is a powerful algorithm to generate and identify novel and improved enzymes through iterative rounds of mutagenesis and screening applying a specific evolutive pressure. In practice, critical checkpoints in directed evolution are: selection of the starting point, generation of the mutant library, development of the screening assay and analysis of the output of the screening campaign. Each step in directed evolution can be performed using conceptually and technically different approaches, all having inherent advantages and challenges. In this article, we present and discuss in a general overview, challenges of designing and performing a directed enzyme evolution campaign, current advances in methods, as well as highlighting some examples of its applications in industrially relevant enzymes.
Determination of Plasma Screening Effects for Thermonuclear Reactions in Laser-generated Plasmas
Energy Technology Data Exchange (ETDEWEB)
Wu, Yuanbin; Pálffy, Adriana, E-mail: yuanbin.wu@mpi-hd.mpg.de, E-mail: Palffy@mpi-hd.mpg.de [Max-Planck-Institut für Kernphysik, Saupfercheckweg 1, D-69117 Heidelberg (Germany)
2017-03-20
Due to screening effects, nuclear reactions in astrophysical plasmas may behave differently than in the laboratory. The possibility to determine the magnitude of these screening effects in colliding laser-generated plasmas is investigated theoretically, having as a starting point a proposed experimental setup with two laser beams at the Extreme Light Infrastructure facility. A laser pulse interacting with a solid target produces a plasma through the Target Normal Sheath Acceleration scheme, and this rapidly streaming plasma (ion flow) impacts a secondary plasma created by the interaction of a second laser pulse on a gas jet target. We model this scenario here and calculate the reaction events for the astrophysically relevant reaction {sup 13}C({sup 4}He, n ){sup 16}O. We find that it should be experimentally possible to determine the plasma screening enhancement factor for fusion reactions by detecting the difference in reaction events between two scenarios of ion flow interacting with the plasma target and a simple gas target. This provides a way to evaluate nuclear reaction cross-sections in stellar environments and can significantly advance the field of nuclear astrophysics.
Recent Advances in Screening of Anti-Campylobacter Activity in Probiotics for Use in Poultry
Saint-Cyr, Manuel J.; Guyard-Nicodème, Muriel; Messaoudi, Soumaya; Chemaly, Marianne; Cappelier, Jean-Michel; Dousset, Xavier; Haddad, Nabila
2016-01-01
Campylobacteriosis is the most common cause of bacterial gastroenteritis worldwide. Campylobacter species involved in this infection usually include the thermotolerant species Campylobacter jejuni. The major reservoir for C. jejuni leading to human infections is commercial broiler chickens. Poultry flocks are frequently colonized by C. jejuni without any apparent symptoms. Risk assessment analyses have identified the handling and consumption of poultry meat as one of the most important sources of human campylobacteriosis, so elimination of Campylobacter in the poultry reservoir is a crucial step in the control of this foodborne infection. To date, the use of probiotics has demonstrated promising results to reduce Campylobacter colonization. This review provides recent insights into methods used for probiotic screening to reduce the prevalence and colonization of Campylobacter at the farm level. Different eukaryotic epithelial cell lines are employed to screen probiotics with an anti-Campylobacter activity and yield useful information about the inhibition mechanism involved. These in vitro virulence models involve only human intestinal or cervical cell lines whereas the use of avian cell lines could be a preliminary step to investigate mechanisms of C. jejuni colonization in poultry in the presence of probiotics. In addition, in vivo trials to evaluate the effect of probiotics on Campylobacter colonization are conducted, taking into account the complexity introduced by the host, the feed, and the microbiota. However, the heterogeneity of the protocols used and the short time duration of the experiments lead to results that are difficult to compare and draw conclusions at the slaughter-age of broilers. Nevertheless, the combined approach using complementary in vitro and in vivo tools (cell cultures and animal experiments) leads to a better characterization of probiotic strains and could be employed to assess reduced Campylobacter spp. colonization in chickens if some
Bourlet, Thomas; Memmi, Meriam; Saoudin, Henia; Pozzetto, Bruno
2013-09-01
Nuclear acid testing is more and more used for the diagnosis of infectious diseases. This paper focuses on the use of molecular tools for HIV screening. The term 'screening' will be used under the meaning of first-line HIV molecular techniques performed on a routine basis, which excludes HIV molecular tests designed to confirm or infirm a newly discovered HIV-seropositive patient or other molecular tests performed for the follow-up of HIV-infected patients. The following items are developed successively: i) presentation of the variety of molecular tools used for molecular HIV screening, ii) use of HIV molecular tools for the screening of blood products, iii) use of HIV molecular tools for the screening of organs and tissue from human origin, iv) use of HIV molecular tools in medically assisted procreation and v) use of HIV molecular tools in neonates from HIV-infected mothers.
Quintero, Enrique; Saito, Yutaka; Hassan, Cessare; Senore, Carlo
2012-01-01
Colorectal cancer, which is the leading cancer in Singapore, can be prevented by increased use of screening and polypectomy. A range of screening strategies such as stool-based tests, flexible sigmoidoscopy, colonoscopy and computed tomography colonography are available, each with different strengths and limitations. Primary care physicians should discuss appropriate screening modalities with their patients, tailored to their individual needs. Physicians, patients and the government should wo...
International Nuclear Information System (INIS)
Barlow, J.W.
1991-01-01
The screen dealing system provides a facility whereby buyers and sellers of spot thermal coal can make bids and offers via the medium of the Reuters screen. A sale results when a market participant notifies his acceptance of a price to a central dealing desk. Use of the system is available to all genuine participants in the coal trade. This paper reports that it provides a focus for information and for the visible making of coal prices. For years screen trading has been used successfully to trade other commodities. At last coal is being traded electronically. It makes sense. It works. Users like it
Kung, Justin W; Levine, Marc S; Glick, Seth N; Lakhani, Paras; Rubesin, Stephen E; Laufer, Igor
2006-09-01
To retrospectively determine the diagnostic yield of double-contrast barium enema examinations performed for colorectal cancer screening of neoplasms 1 cm or larger or advanced neoplastic lesions of any size in average-risk adults older than 50 years. The Institutional Review Board at the affiliated Veterans Affairs Medical Center approved this HIPAA-compliant study protocol and did not require informed consent from patients. Computerized databases revealed 276 double-contrast barium enema examinations performed for colorectal cancer screening in average-risk adults older than 50 years. Radiographic and pathologic reports were reviewed to determine the number of patients who had polypoid lesions 1 cm or larger, polyps smaller than 1 cm, or advanced neoplastic lesions of any size. Forty-five (16.3%) of the 276 patients underwent follow-up sigmoidoscopy or colonoscopy. Medical, endoscopic, and pathologic records were reviewed and compared with radiographic findings. The results of double-contrast barium enema examination revealed 74 (26.8%) of 276 patients with 104 polypoid lesions in the colon, including 32 patients (11.6%) with 41 polypoid lesions 1 cm or larger, 15 patients (5.4%) with 19 polyps 6-9 mm, and 27 patients (9.8%) with 44 polyps 5 mm or smaller. Endoscopy was performed in 24 (75%) of 32 patients, the results of which confirmed 23 (72%) of 32 radiographically diagnosed lesions 1 cm or larger in 16 (67%) of 24 patients. In two of these individuals, the polyps were hyperplastic. The remaining 14 patients had a total of 21 neoplastic lesions 1 cm or larger, including 11 tubular adenomas, seven tubulovillous adenomas, one villous adenoma with marked dysplasia, and two cancers. The diagnostic yield of screening double-contrast barium enema examination was 5.1% (14 of 276 patients) for neoplastic lesions 1 cm or larger and 6.2% (17 of 276 patients) for advanced neoplastic lesions of any size. Double-contrast barium enema examinations performed in average
... page: //medlineplus.gov/ency/patientinstructions/000355.htm Screen time and children To use the sharing features on ... videos is considered unhealthy screen time. Current Screen Time Guidelines Children under age 2 should have no ...
Benefits and harms of CT screening for lung cancer: a systematic review.
Bach, Peter B; Mirkin, Joshua N; Oliver, Thomas K; Azzoli, Christopher G; Berry, Donald A; Brawley, Otis W; Byers, Tim; Colditz, Graham A; Gould, Michael K; Jett, James R; Sabichi, Anita L; Smith-Bindman, Rebecca; Wood, Douglas E; Qaseem, Amir; Detterbeck, Frank C
2012-06-13
Lung cancer is the leading cause of cancer death. Most patients are diagnosed with advanced disease, resulting in a very low 5-year survival. Screening may reduce the risk of death from lung cancer. To conduct a systematic review of the evidence regarding the benefits and harms of lung cancer screening using low-dose computed tomography (LDCT). A multisociety collaborative initiative (involving the American Cancer Society, American College of Chest Physicians, American Society of Clinical Oncology, and National Comprehensive Cancer Network) was undertaken to create the foundation for development of an evidence-based clinical guideline. MEDLINE (Ovid: January 1996 to April 2012), EMBASE (Ovid: January 1996 to April 2012), and the Cochrane Library (April 2012). Of 591 citations identified and reviewed, 8 randomized trials and 13 cohort studies of LDCT screening met criteria for inclusion. Primary outcomes were lung cancer mortality and all-cause mortality, and secondary outcomes included nodule detection, invasive procedures, follow-up tests, and smoking cessation. Critical appraisal using predefined criteria was conducted on individual studies and the overall body of evidence. Differences in data extracted by reviewers were adjudicated by consensus. Three randomized studies provided evidence on the effect of LDCT screening on lung cancer mortality, of which the National Lung Screening Trial was the most informative, demonstrating that among 53,454 participants enrolled, screening resulted in significantly fewer lung cancer deaths (356 vs 443 deaths; lung cancer−specific mortality, 274 vs 309 events per 100,000 person-years for LDCT and control groups, respectively; relative risk, 0.80; 95% CI, 0.73-0.93; absolute risk reduction, 0.33%; P = .004). The other 2 smaller studies showed no such benefit. In terms of potential harms of LDCT screening, across all trials and cohorts, approximately 20% of individuals in each round of screening had positive results requiring
Screening for abdominalt aortaaneurisme
DEFF Research Database (Denmark)
Lindholt, J S; Juul, Svend; Henneberg, E W
1997-01-01
rupture. Ultrasonographic screening for AAA takes 10 minutes per scan, and the sensitivity and specificity are high. Ultrasonographic screening for AAA is a reliable, safe and inexpensive method for screening, and screening for AAA is discussed worldwide. One point four percent of deaths among men from 65...... to 80 year of age are caused by ruptured AAA. Screening men over 65 for AAA can theoretically prevent a substantial number of deaths. Our calculations predict one prevented AAA-death per 200-300 scans for a cost of about 4000 DKK per saved year of life. However, cost-benefit analyses are based...... on uncertain assumptions concerning prevalence, incidence and risk of rupture. Therefore a randomized trial screening of 65-73 year old males is taking place in the County of Viborg in Denmark. Udgivelsesdato: 1997-Mar-24...
Advances in Mammalian Cell Line Development Technologies for Recombinant Protein Production
Directory of Open Access Journals (Sweden)
Say Kong Ng
2013-04-01
Full Text Available From 2006 to 2011, an average of 15 novel recombinant protein therapeutics have been approved by US Food and Drug Administration (FDA annually. In addition, the expiration of blockbuster biologics has also spurred the emergence of biosimilars. The increasing numbers of innovator biologic products and biosimilars have thus fuelled the demand of production cell lines with high productivity. Currently, mammalian cell line development technologies used by most biopharmaceutical companies are based on either the methotrexate (MTX amplification technology or the glutamine synthetase (GS system. With both systems, the cell clones obtained are highly heterogeneous, as a result of random genome integration by the gene of interest and the gene amplification process. Consequently, large numbers of cell clones have to be screened to identify rare stable high producer cell clones. As such, the cell line development process typically requires 6 to 12 months and is a time, capital and labour intensive process. This article reviews established advances in protein expression and clone screening which are the core technologies in mammalian cell line development. Advancements in these component technologies are vital to improve the speed and efficiency of generating robust and highly productive cell line for large scale production of protein therapeutics.
Use of advanced commercial ICs (COTS) for space application
International Nuclear Information System (INIS)
Strobel, D.J.; Czajkowski, D.R.; Layton, P.; Shanken, S.
1999-01-01
A product line of space-qualified radiation-tolerant ICs based on a high-volume commercial-off-the-shelf (COTS) silicon has been developed. The basic results from over 300 lots of COTS silicon, assembled and screened to Class B and Class S requirements will be presented. Intelligent use of commercial ICs engineered to improve radiation performance, is effective in introducing advanced technology to new satellite systems. Space Electronics has introduced over 125 space-qualified microelectronics standard products, that are used on over 90 space projects. (authors)
International Nuclear Information System (INIS)
Altaf, Fadwa J.
2004-01-01
Breast cancer is a very common health problem in Saudi females that can be reduced by early detection through introducing breast cancer screening. Literature review reveals significant reduction in breast cancer incidence and outcome after the beginning of breast cancer screening. The objectives of this article are to highlight the significance of breast cancer screening in different international societies and to write the major guidelines of breast cancer screening in relation to other departments involved with more emphasis on the Pathology Department guidelines in tissue handling, diagnostic criteria and significance of the diagnosis. This article summaries and acknowledges major work carried out before, and recommends similar modified work in order to meet the requirement for the Saudi society. (author)
Stomach (Gastric) Cancer Screening
... Stomach Cancer Prevention Stomach Cancer Screening Research Stomach (Gastric) Cancer Screening (PDQ®)–Patient Version What is screening? Go ... are called diagnostic tests . General Information About Stomach (Gastric) Cancer Key Points Stomach cancer is a disease in ...
International Nuclear Information System (INIS)
Ohuchi, Noriaki; Ishida, Takanori; Kawai, Masaaki; Narikawa, Yoko; Yamamoto, Seiichiro; Sobue, Tomotaka
2011-01-01
In cancer screening, it is essential to undertake effective screening with appropriate methodology, which should be supported by evidence of a reduced mortality rate. At present, mammography is the only method for breast cancer screening with such evidence. However, mammography does not achieve sufficient accuracy in breasts with high density at ages below 50. Although ultrasonography achieves better accuracy in Breast Cancer detection even in dense breasts, the effectiveness has not been verified. We have planned a randomized controlled trial to assess the effectiveness of ultrasonography in women aged 40-49, with a design to study 50,000 women with mammography and ultrasonography (intervention group), and 50,000 controls with mammography only (control group). The participants are scheduled to take second round screening with the same modality 2 years on. The primary endpoints are sensitivity and specificity, and the secondary endpoint is the rate of advanced breast cancers. (author)
MacArthur, Taleen; Bachmann, Gloria; Ayers, Charletta
2016-07-01
As more postreproductive women opt to pursue pregnancy with advanced assisted reproductive technologies (ART), the menopausal practitioner will become more involved in counseling, screening, and referral of premenopausal, perimenopausal, and postmenopausal women for these services. This review was conducted with the aim of (1) evaluating ART screening practices as they pertain to postreproductive women, and (2) reviewing the outcomes of ART using oocyte donation in postreproductive women. A total of 950 unique records were found on PubMed, Clinical Key, and Google Scholar. Of these, 252 records were screened for relevance based on their titles and abstracts. With further review of these 252 records, 93 full-text articles were assessed for eligibility, and 63 were excluded based on relevance to our study. Finally, 30 studies were included in our qualitative synthesis. Despite the increasing use of ART in postreproductive women, there are limited guidelines for determining candidacy with regard to maternal health, the most comprehensive of which are the guidelines from the American Society for Reproductive Medicine (ASRM). Although the American Society for Reproductive Medicine guidelines state that healthy women over 50 who are prepared for parenthood are candidates for ART through oocyte donation, they note that older women should be counseled as to the increased obstetric risk associated with advanced maternal age. With aging, particularly for those women who are menopausal and postmenopausal, the woman and her fetus, however, are at risk of increased morbidity and mortality as compared with younger, healthy pregnant women. Because national trends suggest that women are delaying childbearing, the cohort of postreproductive women looking toward ART using donor oocytes as a fertility option will expand and menopausal practitioners will often participate in the ART counseling of these women. Because maternal and fetal morbidity and mortality increase in
Optofluidic time-stretch microscopy: recent advances
Lei, Cheng; Nitta, Nao; Ozeki, Yasuyuki; Goda, Keisuke
2018-04-01
Flow cytometry is an indispensable method for valuable applications in numerous fields such as immunology, pathology, pharmacology, molecular biology, and marine biology. Optofluidic time-stretch microscopy is superior to conventional flow cytometry methods for its capability to acquire high-quality images of single cells at a high-throughput exceeding 10,000 cells per second. This makes it possible to extract copious information from cellular images for accurate cell detection and analysis with the assistance of machine learning. Optofluidic time-stretch microscopy has proven its effectivity in various applications, including microalga-based biofuel production, evaluation of thrombotic disorders, as well as drug screening and discovery. In this review, we discuss the principles and recent advances of optofluidic time-stretch microscopy.
Beverley, Charles St. Clare, Jr.
2013-01-01
Introduction: Breast cancer affects the lives of millions of women each year in the United States. Early detection by mammography screening can reduce the risk for advanced stages of breast cancer and improve the probability of long-term survival in women. Electronic medical records (EMRs) have been identified as a successful approach for…
Saraste, D; Martling, A; Nilsson, P J; Blom, J; Törnberg, S; Janson, M
2017-06-01
Objectives To compare preoperative staging, multidisciplinary team-assessment, and treatment in patients with screening detected and non-screening detected colorectal cancer. Methods Data on patient and tumour characteristics, staging, multidisciplinary team-assessment and treatment in patients with screening and non-screening detected colorectal cancer from 2008 to 2012 were collected from the Stockholm-Gotland screening register and the Swedish Colorectal Cancer Registry. Results The screening group had a higher proportion of stage I disease (41 vs. 15%; p team-assessed than the non-screening group ( p team-assessed than patients with surgically resected cancers ( p team assessed more extensively than patients with non-screening detected cancers. Staging and multidisciplinary team assessment prior to endoscopic resection was less complete compared with surgical resection. Extensive surgical and (neo)adjuvant treatment was given in stage I disease. Participation in screening reduced the risk of emergency surgery for colorectal cancer.
Predictors of cervical cancer being at an advanced stage at diagnosis in Sudan
DEFF Research Database (Denmark)
Ibrahim, Ahmed; Rasch, Vibeke; Pukkala, Eero
2011-01-01
Cervical cancer is the second most common cancer among women in Sudan, with more than two-thirds of all women with invasive cervical cancer being diagnosed at an advanced stage (stages III and IV). The lack of a screening program for cervical cancer in Sudan may contribute to the late presentation...... of this cancer, but other factors potentially associated with advanced stages of cervical cancer at diagnosis are unknown. The purpose of this research was to investigate the relationship between age, marital status, ethnicity, health insurance coverage, residence in an urban vs a rural setting, and stage (at...... diagnosis) of cervical cancer in Sudan....
Plumb, A. A.; Halligan, S.
2015-01-01
Colorectal cancer is a major public health burden worldwide. There is clear-cut evidence that screening will reduce colorectal cancer mortality and the only contentious issue is which screening tool to use. Most evidence points towards screening with fecal occult blood testing. The immunochemical fecal occult blood tests have a higher sensitivity than the guaiac-based tests. In addition, their automation and haemoglobin quantification allows a threshold for colonoscopy to be selected that can...
Retinopathy of prematurity screening criteria in Iran: new screening guidelines.
Roohipoor, Ramak; Karkhaneh, Reza; Farahani, Afsar; Ebrahimiadib, Nazanin; Modjtahedi, Bobeck; Fotouhi, Akbar; Yaseri, Mehdi; Khodabande, Alireza; Zarei, Mohammad; Imani Fuladi, Marjan; Taheri, Arash; Riazi Esfahani, Mohammad; Loewenstein, John
2016-07-01
To test the applicability of existing retinopathy of prematurity (ROP) guidelines on Iranian patients and to develop novel ROP screening criteria in Iran. Both eyes of 1932 infants born ≤37 weeks of gestation and/or weighting ≤3000 g were included in this prospective cohort study that was conducted across nine neonatal intensive care units and a tertiary eye hospital ROP clinic. The patients were examined for ROP and the need for treatment (type 1 ROP or worse). All the patients were screened 4 weeks after birth or at 31 weeks of postmenstrual age, whichever was later. The patients were followed until retinal vascularisation was completed or the patients reached 50 weeks of gestational age (GA) without prethreshold ROP. A receiver operating characteristic curve was used to determine the best screening criteria for ROP. Screening criteria from other countries were applied to our patient data to determine their ability to appropriately detect ROP. Patients with ROP requiring treatment. The mean GA±SD and birth weight (BW)±SD of the screened patients were 32±2.7 weeks and 1713±516 g, respectively. Using criteria of GA≤32 weeks or BW ≤2000 yielded sensitivity and specificity of 100% and 26.7%, respectively, for treatment requiring ROP regardless of clinical comorbidities. Using screening recommendations of American Academy of Pediatrics would miss 25.4% of ROP and 8.4%ROP requiring treatment in our cohort. Other countries screening recommendations would result in a significant amount of missed cases of treatment requiring ROP when applied to Iran. As a result, we have proposed new guidelines for premature babies in Iran. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/
Houssami, Nehmat; Lång, Kristina; Bernardi, Daniela; Tagliafico, Alberto; Zackrisson, Sophia; Skaane, Per
2016-04-01
This pictorial review highlights cancers detected only at tomosynthesis screening and screens falsely recalled in the course of breast tomosynthesis screening, illustrating both true-positive (TP) and false-positive (FP) detection attributed to tomosynthesis. Images and descriptive data were used to characterise cases of screen-detection with tomosynthesis, sourced from prospective screening trials that performed standard (2D) digital mammography (DM) and tomosynthesis (3D-mammography) in the same screening participants. Exemplar cases from four trials highlight common themes of relevance to screening practice including: the type of lesions frequently made more conspicuous or perceptible by tomosynthesis (spiculated masses, and architectural distortions); the histologic findings (both TP and FP) of tomosynthesis-only detection; and the need to extend breast work-up protocols (additional imaging including ultrasound and MRI, and tomosynthesis-guided biopsy) if tomosynthesis is adopted for primary screening. Copyright © 2016 Elsevier Ltd. All rights reserved.
Mesa, Matthew G.; Rose, Brien P.; Copeland, Elizabeth S.
2010-01-01
Screens are commonly installed at water diversion sites to reduce entrainment of fish. Recently, the Farmers Irrigation District in Hood River, Oregon, developed a new flat-plate screen design that offers passive operation and may result in reduced operation and installation costs to irrigators. To evaluate the performance (its biological effect on fish) of this type of screen, two size classes of juvenile coho salmon (Oncorhynchus kistuch) were released over a small version of this screen in the field-the Herman Creek screen. The performance of the screen was evaluated over a range of inflow [0.02 to 0.42 m3/s (cubic meters per second)] and diversion flows (0.02 to 0.34 m3/s) at different weir wall heights. The mean approach velocities for the screen ranged from 0 to 5 cm/s (centimeters per second) and mean sweeping velocities ranged from 36 to 178 cm/s. Water depths over the screen surface ranged from 1 to 25 centimeters and were directly related to weir wall height and inflow. Passage of juvenile coho salmon over the screen under a variety of hydraulic conditions did not severely injure them or cause delayed mortality. For all fish, the mean percentage of body surface area that was injured after passage over the screen ranged from about 0.4 to 3.0%. This occurred even though many fish contacted the screen surface during passage. No fish were observed becoming impinged on the screen surface (greater than 1 second contact with the screen). When operated within its design criteria (diversion flows of about 0.28 m3/s), the screen provided safe and effective downstream passage of juvenile salmonids under a variety of hydraulic conditions. However, we do not recommend operating the screen at inflows less than 0.14 m3/s (5 ft3/s) because water depth can get quite shallow and the screen can completely dewater, particularly at very low flows.
Storm, P; Aits, S; Puthia, M K; Urbano, A; Northen, T; Powers, S; Bowen, B; Chao, Y; Reindl, W; Lee, D Y; Sullivan, N L; Zhang, J; Trulsson, M; Yang, H; Watson, J D; Svanborg, C
2011-12-01
HAMLET is the first member of a new family of tumoricidal protein-lipid complexes that kill cancer cells broadly, while sparing healthy, differentiated cells. Many and diverse tumor cell types are sensitive to the lethal effect, suggesting that HAMLET identifies and activates conserved death pathways in cancer cells. Here, we investigated the molecular basis for the difference in sensitivity between cancer cells and healthy cells. Using a combination of small-hairpin RNA (shRNA) inhibition, proteomic and metabolomic technology, we identified the c-Myc oncogene as one essential determinant of HAMLET sensitivity. Increased c-Myc expression levels promoted sensitivity to HAMLET and shRNA knockdown of c-Myc suppressed the lethal response, suggesting that oncogenic transformation with c-Myc creates a HAMLET-sensitive phenotype. Furthermore, HAMLET sensitivity was modified by the glycolytic state of tumor cells. Glucose deprivation sensitized tumor cells to HAMLET-induced cell death and in the shRNA screen, hexokinase 1 (HK1), 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 and hypoxia-inducible factor 1α modified HAMLET sensitivity. HK1 was shown to bind HAMLET in a protein array containing ∼8000 targets, and HK activity decreased within 15 min of HAMLET treatment, before morphological signs of tumor cell death. In parallel, HAMLET triggered rapid metabolic paralysis in carcinoma cells. Tumor cells were also shown to contain large amounts of oleic acid and its derivatives already after 15 min. The results identify HAMLET as a novel anti-cancer agent that kills tumor cells by exploiting unifying features of cancer cells such as oncogene addiction or the Warburg effect.
Toward the integration of optical sensors in smartphone screens using femtosecond laser writing.
Lapointe, Jerome; Parent, Francois; de Lima Filho, Elton Soares; Loranger, Sébastien; Kashyap, Raman
2015-12-01
We demonstrate a new type of sensor incorporated directly into Corning Gorilla glass, an ultraresistant glass widely used in the screen of popular devices such as smartphones, tablets, and smart watches. Although physical space is limited in portable devices, the screens have been so far neglected in regard to functionalization. Our proof-of-concept shows a new niche for photonics device development, in which the screen becomes an active component integrated into the device. The sensor itself is a near-surface waveguide, sensitive to refractive index changes, enabling the analysis of liquids directly on the screen of a smartphone, without the need for any add-ons, thus opening this part of the device to advanced functionalization. The primary function of the screen is unaffected, since the sensor and waveguide are effectively invisible to the naked eye. We fabricated a waveguide just below the glass surface, directly written without any surface preparation, in which the change in refractive index on the surface-air interface changes the light guidance, thus the transmission of light. This work reports on sensor fabrication, using a femtosecond pulsed laser, and the light-interaction model of the beam propagating at the surface is discussed and compared with experimental measurement for refractive indexes in the range 1.3-1.7. A new and improved model, including input and output reflections due to the effective mode index change, is also proposed and yields a better match with our experimental measurements and also with previous measurements reported in the literature.
Family-based cardiac screening in relatives of victims of sudden arrhythmic death syndrome.
LENUS (Irish Health Repository)
McGorrian, Catherine
2013-02-03
AIMS: Sudden arrhythmic death syndrome (SADS) occurs when a person suffers a sudden, unexpected death, with no cause found at postmortem examination. We aimed to describe the cardiac screening outcomes in a population of relatives of SADS victimsMETHODS AND RESULTS: Prospective and retrospective cohort study of consecutive families attending the Family Heart Screening clinic at the Mater Misericordiae Hospital in Dublin, Ireland, from January 2007 to September 2011. Family members of SADS victims underwent a standard screening protocol. Adjunct clinical and postmortem information was sought on the proband. Families who had an existing diagnosis, or where the proband had epilepsy, were excluded. Of 115 families identified, 73 were found to fit inclusion criteria and were retained for analysis, with data available on 262 relatives. Over half of the screened family members were female, and the mean age was 38.6 years (standard deviation 15.6). In 22 of 73 families (30%), and 36 of 262 family members (13.7%), a potentially inheritable cause of SADS was detected. Of the population screened, 32 patients (12.2%) were treated with medication, and 5 (1.9%) have received implantable cardiac defibrillators. Of the five families with long QT syndrome (LQTS) who had a pathogenic gene mutation identified, three carried two such mutations.CONCLUSION: In keeping with international estimates, 30% of families of SADS victims were found to have a potentially inherited cardiac disease. The most common positive finding was LQTS. Advances in postmortem standards and genetic studies may assist in achieving more diagnoses in these families.
Understanding Task Force Recommendations Screening for Glaucoma The U.S. Preventive Services Task Force (Task Force) has issued a final recommendation statement on Screening for Glaucoma . This final recommendation statement ...
Expanded Newborn Screening Program in Saudi Arabia: Incidence of screened disorders.
Alfadhel, Majid; Al Othaim, Ali; Al Saif, Saif; Al Mutairi, Fuad; Alsayed, Moeenaldeen; Rahbeeni, Zuhair; Alzaidan, Hamad; Alowain, Mohammed; Al-Hassnan, Zuhair; Saeedi, Mohamad; Aljohery, Saeed; Alasmari, Ali; Faqeih, Eissa; Alwakeel, Mansour; AlMashary, Maher; Almohameed, Sulaiman; Alzahrani, Mohammed; Migdad, Abeer; Al-Dirbashi, Osama Y; Rashed, Mohamed; Alamoudi, Mohamed; Jacob, Minnie; Alahaidib, Lujane; El-Badaoui, Fahd; Saadallah, Amal; Alsulaiman, Ayman; Eyaid, Wafaa; Al-Odaib, Ali
2017-06-01
To address the implementation of the National Newborn Screening Program (NBS) in Saudi Arabia and stratify the incidence of the screened disorders. A retrospective study conducted between 1 August 2005 and 31 December 2012, total of 775 000 newborns were screened from 139 hospitals distributed among all regions of Saudi Arabia. The NBS Program screens for 16 disorders from a selective list of inborn errors of metabolism (IEM) and endocrine disorders. Heel prick dry blood spot samples were obtained from all newborns for biochemical and immunoassay testing. Recall screening testing was performed for Initial positive results and confirmed by specific biochemical assays. A total of 743 cases were identified giving an overall incidence of 1:1043. Frequently detected disorders nationwide were congenital hypothyroidism and congenital adrenal hyperplasia with an incidence of 1:7175 and 1:7908 correspondingly. The highest incidence among the IEM was propionic acidaemia with an incidence rate of 1:14 000. The article highlights the experience of the NBS Program in Saudi Arabia and providing data on specific regional incidences of all the screened disorders included in the programme; and showed that the incidence of these disorders is one of the highest reported so far world-wide. © 2017 Paediatrics and Child Health Division (The Royal Australasian College of Physicians).
International Nuclear Information System (INIS)
Vandenbroucke, A.
1987-01-01
Many studies have shown that breast cancer screening is able to reduce breast cancer mortality, including the HIP study, the Swedish Trial and the Netherlands studies. Mammography is considered as the most effective method for breast cancer screening but it might be unfeasible for some reasons: - the population acceptability of the method might be low. Indeed, most populations of the South of Europe are less compliant to mass screening than populations of the North of Europe; - the medical equipment and personnel - radiologists and pathologists - might be insufficient; - it might be too costly for the National Health Service, specially where the incidence rate of breast cancer is relatively low (i.e. Greece, Portugal). The validity of screening tests is judged by their sensitivity and their specificity
DEFF Research Database (Denmark)
Manotaya, S.; Xu, H.; Uerpairojkit, B.
2016-01-01
-risk pregnancies, either with advanced maternal age or positive serum biochemical tests, and 1889 low-risk pregnancies without conventional indications; 99.9% (4732/4736) of the participants with a median maternal age of 35years old received reports, and 1.3% (63/4732) were classified as test positive, including...... testing (NIPT) has enabled efficient and accurate screening for T21, T18 and T13. Various professional societies suggested that NIPT could be considered as a second-tier screening test for women at high risk for aneuploidy. What does this study add? This study reports the performance of NIPT...
Judson, Richard S.; Houck, Keith A.; Kavlock, Robert J.; Knudsen, Thomas B.; Martin, Matthew T.; Mortensen, Holly M.; Reif, David M.; Rotroff, Daniel M.; Shah, Imran; Richard, Ann M.; Dix, David J.
2009-01-01
Background Chemical toxicity testing is being transformed by advances in biology and computer modeling, concerns over animal use, and the thousands of environmental chemicals lacking toxicity data. The U.S. Environmental Protection Agency?s ToxCast program aims to address these concerns by screening and prioritizing chemicals for potential human toxicity using in vitro assays and in silico approaches. Objectives This project aims to evaluate the use of in vitro assays for understanding the ty...
International Nuclear Information System (INIS)
Ongeval, Chantal van; Steen, Andre van; Zanca, Federica; Bosmans, Hilde; Marchal, Guy; Putte, Gretel vande; Limbergen, Erik van
2010-01-01
To evaluate if the screening performance parameters of digital mammography (DM) in a decentralized screening organization were comparable with film-screen mammography (FSM). A nationwide screening program was launched in 2001, and since 2005 screening with DM has been allowed. Firstly, the parameters of the three regional screening units (RSUs) that first switched to DM (11,355 women) were compared with the FSM period of the same three RSUs (23,325 women). Secondly, they were compared with the results of the whole central breast unit (CBU). The recall rate (RR) of the DM group in the initial round was 2.64% [2.40% for FSM (p = 0.43)] and in the subsequent round 1.20% [1.58% for FSM (p = 0.03)]. The cancer detection rate (CDR) was 0.59% for DM and 0.64% for FSM (p = 0.56). The percentage of ductal carcinoma in situ was 0.07% for DM and 0.16% for FSM (p = 0.02). The positive predictive value was high in the subsequent rounds (DM 48.00%, FSM 45.93%) and lower in the initial round (DM 24.05%, FSM 24.86%). Compared with the results of the whole CBU, DM showed no significant difference. DM can be introduced in a decentralized screening organization with a high CDR without increasing the RR. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Liang, Wenqing, E-mail: liangwenqing_1234@126.com [Department of Orthopaedics, Shaoxing People' s Hospital, 568 Zhongxing North Road, Shaoxing 312000 (China); Yang, Chengwei [Department of Spinal Surgery, Lanzhou General Hospital, Lanzhou Military Area Command, 333 Nanbinhe Road, Lanzhou 730050 (China); Qian, Yu [Department of Orthopaedics, Shaoxing People' s Hospital, 568 Zhongxing North Road, Shaoxing 312000 (China); Fu, Qiang, E-mail: chyygklwq@hotmail.com [Department of Orthopaedics, Changhai Hospital, Second Military Medical University, 168 Changhai Road, Shanghai 200433 (China)
2012-06-15
Highlights: Black-Right-Pointing-Pointer {beta}-Catenin expression were markedly down-regulated by CTNNB1 shRNA. Black-Right-Pointing-Pointer CTNNB1 shRNA could inhibit the proliferation of RPMI8226 cells. Black-Right-Pointing-Pointer Significantly profound apoptotic cell death in CTNNB1 shRNA cells. Black-Right-Pointing-Pointer In vivo, CTNNB1 silence led to a growth inhibition of myeloma growth. Black-Right-Pointing-Pointer c-myc and {beta}-catenin in the expression cells of cleaved caspase-3 were increased. -- Abstract: Multiple myeloma (MM) is thrombogenic as a consequence of multiple hemostatic effects. Overexpression of {beta}-catenin has been observed in several types of malignant tumors, including MM. However, the relationship between {beta}-catenin expression and MM remains unclear. In the present study, RNA interference was used to inhibit {beta}-catenin expression in RPMI8226 cells. RT-PCR and Western blotting analyses showed that {beta}-catenin mRNA and protein expression were markedly down-regulated by CTNNB1 shRNA. Western blotting showed that the protein levels of cyclin D1 and glutamine synthetase were downregulated and supported the transcriptional regulatory function of {beta}-catenin. The MTT assay showed that CTNNB1 shRNA could have significant inhibitory effects on the proliferation of RPMI8226 cells. The TOPflash reporter assay demonstrated significant downregulation after CTNNB1 shRNA transfection in RPMI8226 cells. Flow cytometric analyses also showed significantly profound apoptosis in CTNNB1 shRNA cells. We found CTNNB1 silence led to growth inhibition of MM growth in vivo. Immunohistochemical analyses showed that c-myc and {beta}-catenin were reduced in CTNNB1 shRNA tumor tissues, but that expression of cleaved caspase-3 was increased. These results show that {beta}-catenin could be a new therapeutic agent that targets the biology of MM cells.
A retrospective audit of the first screening round of the Maltese breast screening programme
International Nuclear Information System (INIS)
Mizzi, D.; Zarb, F.; Dennis, A.
2017-01-01
Purpose: To analyse whether the screening performance parameters of the Maltese National Breast Screening Programme first screening round met requirements set by European standards. The association between screening age and results of screening performance parameters was also investigated. Method: Quantitative methodology was used to review examinations of women who were recalled for a technical recall or further assessment rates. All accessible members of the population recalled during the first round were retrospectively reviewed resulting in a sample of 2300 recalled examinations. Results: Malta's first screening round met the European Guidelines recommendations for technical repeat rate (0.26%), early recall rate (0.45%), breast cancer detection rate (13.77 per 1000 women) and Positive Predictive Value of screening test (7.58%). However, local recall rate (18.53%) and further assessment rate (18.27%) were higher than recommended. The Chi square test showed a statistically significant difference (p ≤ 0.05) in recall rates between the compared age groups, as younger women (51–55 years) were more likely to have a negative diagnosis after the initial mammogram whereas older women (56–60 years) were more likely to be recalled. There was no age discrepancy (p ≥ 0.05) in local breast cancer detection rate and positive predictive value of screening test. Conclusion: Although the Maltese first screening round performed well, this study found deficiencies in recall and further assessment rates, which according to literature may result in psychological morbidity and inefficient use of screening resources. This study also concluded that when a cohort is analysed, age is not as significant as the screening round itself (first/subsequent). - Highlights: • The Maltese technical and early recall rates complied with European guidelines. • Breast cancer detection rate and positive predictive value conformed to guidelines. • The recall and further
Vendrell, Xavier; Bautista-Llácer, Rosa
2012-12-01
The genetic diagnosis and screening of preimplantation embryos generated by assisted reproduction technology has been consolidated in the prenatal care framework. The rapid evolution of DNA technologies is tending to molecular approaches. Our intention is to present a detailed methodological view, showing different diagnostic strategies based on molecular techniques that are currently applied in preimplantation genetic diagnosis. The amount of DNA from one single, or a few cells, obtained by embryo biopsy is a limiting factor for the molecular analysis. In this sense, genetic laboratories have developed molecular protocols considering this restrictive condition. Nevertheless, the development of whole-genome amplification methods has allowed preimplantation genetic diagnosis for two or more indications simultaneously, like the selection of histocompatible embryos plus detection of monogenic diseases or aneuploidies. Moreover, molecular techniques have permitted preimplantation genetic screening to progress, by implementing microarray-based comparative genome hybridization. Finally, a future view of the embryo-genetics field based on molecular advances is proposed. The normalization, cost-effectiveness analysis, and new technological tools are the next topics for preimplantation genetic diagnosis and screening. Concomitantly, these additions to assisted reproduction technologies could have a positive effect on the schedules of preimplantation studies.
Multiparameter telemetry as a sensitive screening method to detect vaccine reactogenicity in mice.
Directory of Open Access Journals (Sweden)
Margarete Arras
Full Text Available Refined vaccines and adjuvants are urgently needed to advance immunization against global infectious challenges such as HIV, hepatitis C, tuberculosis and malaria. Large-scale screening efforts are ongoing to identify adjuvants with improved efficacy profiles. Reactogenicity often represents a major hurdle to the clinical use of new substances. Yet, irrespective of its importance, this parameter has remained difficult to screen for, owing to a lack of sensitive small animal models with a capacity for high throughput testing. Here we report that continuous telemetric measurements of heart rate, heart rate variability, body core temperature and locomotor activity in laboratory mice readily unmasked systemic side-effects of vaccination, which went undetected by conventional observational assessment and clinical scoring. Even minor aberrations in homeostasis were readily detected, ranging from sympathetic activation over transient pyrogenic effects to reduced physical activity and apathy. Results in real-time combined with the potential of scalability and partial automation in the industrial context suggest multiparameter telemetry in laboratory mice as a first-line screen for vaccine reactogenicity. This may accelerate vaccine discovery in general and may further the success of vaccines in combating infectious disease and cancer.
Tornqvist, Egil
1996-01-01
Ingmar Bergman is worldwide known as a film and stage director. Yet no-one has attempted to compare his stage and screen activities. In Between stage and screen Egil Tornqvist examines formal and thematical correspondences and differences between a number of Bergman's stage, screen, and radio
Patra, Somdatta; Upadhyay, Madhu; Chhabra, Pragti
2017-01-01
Cervical cancer is one of the most common malignancies among women in India. There is a high mortality as patients usually present at an advanced stage because of lack of awareness and nonexistent screening programs. This study was planned to find out awareness about cervical cancer among women and their willingness to utilize screening services in an urban resettlement colony of Delhi, India. A community-based, cross-sectional study was carried out in a resettlement colony of North-West Delhi. Semi-structured interview schedule was used to collect information regarding different aspects of cervical cancer. Analysis was done using SPSS package (SPSS version 16 (UCMS and GTBH, Delhi, India)). A total of 373 women were included in the study. Mean age of study participants was 39.14 years. Two-third of the study population were illiterate. Half of the study population was aware of cervical cancer, and only one-fourth of population were willing to participate in a screening test. Willingness was higher among educated, ever user of family planning method and having knowledge about at least one risk factor, signs or symptoms, or possibility of early diagnosis of cancer cervix. The country's national program advocates for opportunistic and targeted screening of women. An understanding of the factors that influences womens' willingness to participate in screening program is essential for the success of such programs. Hence, this study emphasizes the need for dissemination of knowledge about various aspects of cancer cervix which is critical for uptake of any screening program in a developing country.
DEFF Research Database (Denmark)
2013-01-01
The present invention relates to screening of one-bead-one-compound (OBOC) combinatorial libraries which is useful for the discovery of compounds displaying molecular interactions with a biological or a physicochemical system, such as substrates and inhibitors of enzymes and the like. The invention...... provides a method for screening a library of compounds for their interaction with a physico- chemical or biological system and a corresponding kit for performing the method of screening a one-bead-one-compound library of compounds....
Tumour screening by means of tomography methods
International Nuclear Information System (INIS)
Diederich, S.
2005-01-01
Tomography methods such as computer tomography (CT), magnetic resonance tomography (MRT), and sonography/ultrasound examinations make it possible to detect small asymptomatic tumours, thus potentially preventing their manifestation at an advanced stage and improving survival prospects for the patients concerned. There are data available on various common tumours which show that modern tomography methods are capable of detecting not only small asymptomatic tumours but also their benign precursors (e.g. polyps of the large intestine). This has been demonstrated for lung cancer, colon cancer and breast cancer. However, it has not been possible to date to show for any tomography method or any type of tumour that the systematic use of such diagnostic procedures does anything to lower the mortality rate for that tumour. For other types of tumour (pancreatic cancer, kidney cancer, ovary cancer) the above named methods are either not sufficiently sensitive or the body of data that has accumulated on their respective use is too small to judge the benefit of tomography screenings. Current technical developments make it appear probable that for many types of cancer the reliability with which small tumours can be detected will improve in future. Studies aimed at clarifying the potential of screenings for reducing mortality rates are already underway for lung cancer and would be worthwhile performing for other tumour types
Mammography for women in their 40s : to screen or not to screen
International Nuclear Information System (INIS)
Le Heron, J.
1997-01-01
In the United States there is currently a raging controversy as to whether women in their 40s should be screened for breast cancer, with responsible medical bodies each issuing divergent recommendations. With the imminent commencement of the national breast screening programme in New Zealand, it is relevant to briefly review what underlies these differences. The evicence from international studies is that breast cancer deaths on the population of women aged 50 to 69 can be reduced by about 30% by good mammography screening programes. However the evidence in not so unequivocal for the 40 to 49 age group. Breast cancer in younger women tends to be more virulent, growing faster, and killing faster, and detection of cancer in younger breasts is more difficult than in breasts of older women due to the presence of greater amounts of glandular tissue. Where does this leave breast screening in New Zealand? The nationwide breast screening programme will commence with asymmptomatic women aged 50-64 eligible for screening. Extension to women older than 64 will be considered again once the programme is in place and running well. The Ministry of Health has not recommended routine screening for women in their 40s, but will continue to monitor the latest information and if, sufficient new evidence becomes availabe, the screening guidelines will be reassessed. (author)
Elkin, L L; Harden, D G; Saldanha, S; Ferguson, H; Cheney, D L; Pieniazek, S N; Maloney, D P; Zewinski, J; O'Connell, J; Banks, M
2015-06-01
Compound pooling, or multiplexing more than one compound per well during primary high-throughput screening (HTS), is a controversial approach with a long history of limited success. Many issues with this approach likely arise from long-term storage of library plates containing complex mixtures of compounds at high concentrations. Due to the historical difficulties with using multiplexed library plates, primary HTS often uses a one-compound-one-well approach. However, as compound collections grow, innovative strategies are required to increase the capacity of primary screening campaigns. Toward this goal, we have developed a novel compound pooling method that increases screening capacity without compromising data quality. This method circumvents issues related to the long-term storage of complex compound mixtures by using acoustic dispensing to enable "just-in-time" compound pooling directly in the assay well immediately prior to assay. Using this method, we can pool two compounds per well, effectively doubling the capacity of a primary screen. Here, we present data from pilot studies using just-in-time pooling, as well as data from a large >2-million-compound screen using this approach. These data suggest that, for many targets, this method can be used to vastly increase screening capacity without significant reduction in the ability to detect screening hits. © 2015 Society for Laboratory Automation and Screening.
Preimplantation development of embryos in women of advanced maternal age
Directory of Open Access Journals (Sweden)
O. V. Chaplia
2014-04-01
Full Text Available In order to reveal the influence of genetic component on the early embryo development, the retrospective study of morphokinetic characteristics of 717 embryos subjected to preimplantation genetic testing was conducted. Blastomere biopsy for FISH-based preimplantation genetic screening of 7 chromosomes was performed on the third day of culture, while embryo developmental potential and morphological features at the cleavage and blastulation stage were studied regarding maternal age particularly in the group of younger women and patients older than 36. Results of genetic testing revealed that euploid embryos rate gradually decreased with maternal age comprising 39.9% in young women group and 25.3% of specimen belonging to elder patients. At the cleavage stage, morphological characteristics of aneuploid and euploid embryos didn’t differ significantly regardless of the age of patients that could be accounted for the transcriptional silence of embryo genome till the third day of its development. However, in case of prolonged culture chromosomally balanced embryos rarely faced developmental arrest (in 7.9% and formed blastocysts half more frequently compared to aberrant embryos (respectively 75.6 versus 49.8%. Nevertheless, no substantial difference was found between blastocyst formation rate among embryos with similar genetic component regardless of the maternal age. Taking into consideration high rate of chromosomally unbalanced embryos specific to patients of advanced maternal age, the relative proportion of aneuplouid blastocysts was significantly higher in this group of embryos. Thus, without genetic screening there is a possibility of inaccurate selection of embryos for women of advanced reproductive age for transfer procedure even in case of prolonged culture. Consequently, increase of aneuploid embryos frequency associated with permanent preimplantation natural selection effectiveness along with the postimplantation natural selection failure
No advanced retinopathy of prematurity stages 4 or 5 in a large high-risk German cohort.
Muether, Philipp S; Kribs, Angela; Hahn, Moritz; Schumacher, Jasmin; Eifinger, Frank; Kirchhof, Bernd; Roth, Bernhard; Fauser, Sascha
2012-03-01
Retinopathy of prematurity (ROP) remains a major cause of juvenile blindness. As screening recommendations are refined, decreasing gestational age (GA) and birth weight (BW) constitute an increasing risk for ROP. This retrospective case series reviews the screening results of a very immature cohort in Germany. We conducted ROP screening according to the German guidelines of 1999: all preterm infants with a GA of 3 days, were assigned for screening. Dense laser coagulation was performed according to the current treatment criteria. All 767 consecutive inborn (patients born at the Department of Neonatology, University Hospital of Cologne, Germany) preterm infants of a tertiary medical centre of maximum care underwent complete screening from 2001 to 2009. The treatment incidence was 7.0%. No preterm infant developed stage 4/5 ROP. Mean GA and BW of untreated/treated preterm infants were 28.4/24.6 weeks and 1109/635 g, respectively. Increasing treatment incidence was associated with lower GA, but not with lower BW in logistic regression analysis. In this very immature high-risk cohort, advanced stages 4 and 5 were avoided throughout 9 years of screening. We suggest three factors that contributed to this outcome: (1) strict adherence to current ROP screening and treatment guidelines; (2) prompt and very dense laser coagulation if necessary; and (3) a specialised neonatal intensive care unit with experience of very immature babies.
Photon attenuation by intensifying screens
International Nuclear Information System (INIS)
Holje, G.
1983-01-01
The photon attenuation by intensifying screens of different chemical composition has been determined. The attenuation of photons between 20 keV and 120 keV was measured by use of a multi-channel analyzer and a broad bremsstrahlung distribution. The attenuation by the intensifying screens was hereby determined simultaneously at many different monoenergetic photon energies. Experimentally determined attenuations were found to agree well with attenuation calculated from mass attenuation coefficients. The attenuation by the screens was also determined at various bremsstrahlung distributions, simulating those occurring behind the patient in various diagnostic X-ray examinations. The high attenuation in some of the intensifying screens form the basis for an analysis of the construction of asymmetric screen pairs. Single screen systems are suggested as a favourable alternative to thick screen pair systems. (Author)
The Role of the Advanced Practice Nurse in Geriatric Oncology Care.
Morgan, Brianna; Tarbi, Elise
2016-02-01
To describe how the Advanced Practice Nurse (APN) is uniquely suited to meet the needs of older adults throughout the continuum of cancer, to explore the progress that APNs have made in gero-oncology care, and make suggestions for future directions. Google Scholar, PubMed, and CINAHL. Search terms included: "gero-oncology," "geriatric oncology," "Advanced Practice Nurse," "Nurse Practitioner," "older adult," "elderly," and "cancer." Over the last decade, APNs have made advances in caring for older adults with cancer by playing a role in prevention, screening, and diagnosis; through evidence-based gero-oncology care during cancer treatment; and in designing tailored survivorship care models. APNs must combat ageism in treatment choice for older adults, standardize comprehensive geriatric assessments, and focus on providing person-centered care, specifically during care transitions. APNs are well-positioned to help understand the complex relationship between risk factors, geriatric syndromes, and frailty and translate research into practice. Palliative care must expand beyond specialty providers and shift toward APNs with a focus on early advanced care planning. Finally, APNs should continue to establish multidisciplinary survivorship models across care settings, with a focus on primary care. Copyright © 2015 Elsevier Inc. All rights reserved.
Characteristics and screening outcome of women referred twice at screening mammography
International Nuclear Information System (INIS)
Setz-Pels, Wikke; Duijm, Lucien E.M.; Jansen, Frits H.; Louwman, Marieke W.J.; Roumen, Rudi M.H.; Voogd, Adri C.
2012-01-01
To determine the characteristics and screening outcome of women referred twice at screening mammography. We included 424,703 consecutive screening mammograms and collected imaging, biopsy and surgery reports of women with screen-detected breast cancer. Review of screening mammograms was performed to determine whether or not an initial and second referral comprised the same lesion. The overall positive predictive value of referral for cancer was 38.6% (95% CI 37.3-39.8%). Of 147 (2.6%) women referred twice, 86 had been referred for a different lesion at second referral and 32 of these proved malignant (37.2%, 95% CI 27.0-47.4%). Sixty-one women had been referred twice for the same lesion, of which 22 proved malignant (36.1%, 95% CI 24.1-48.0%). Characteristics of these women were comparable to women with cancer diagnosed after first referral. Compared with women without cancer at second referral for the same lesion, women with cancer more frequently showed suspicious densities at screening mammography (86.4% vs 53.8%, P = 0.02) and work-up at first referral had less frequently included biopsy (22.7% vs 61.5%, P = 0.004). Cancer risk in women referred twice for the same lesion is similar to that observed in women referred once, or referred for a second time but for a different lesion. (orig.)
... Cancer found early may be easier to treat. Cervical cancer screening is usually part of a woman's health ... may do more tests, such as a biopsy. Cervical cancer screening has risks. The results can sometimes be ...
International Nuclear Information System (INIS)
Oblow, E.M.; Perey, F.G.
1984-01-01
A comprehensive rigorous theory is developed for screening sensitivity coefficients in largescale modeling applications. The theory uses Bayesian inference and group theory to establish a probabilistic framework for solving an underdetermined system of linear equations. The underdetermined problem is directly related to statistical screening sensitivity theory as developed in recent years. Several examples of the new approach to screening are worked out in detail and comparisons are made with statistical approaches to the problem. The drawbacks of these latter methods are discussed at some length
Fragment-based screening in tandem with phenotypic screening provides novel antiparasitic hits.
Blaazer, Antoni R; Orrling, Kristina M; Shanmugham, Anitha; Jansen, Chimed; Maes, Louis; Edink, Ewald; Sterk, Geert Jan; Siderius, Marco; England, Paul; Bailey, David; de Esch, Iwan J P; Leurs, Rob
2015-01-01
Methods to discover biologically active small molecules include target-based and phenotypic screening approaches. One of the main difficulties in drug discovery is elucidating and exploiting the relationship between drug activity at the protein target and disease modification, a phenotypic endpoint. Fragment-based drug discovery is a target-based approach that typically involves the screening of a relatively small number of fragment-like (molecular weight <300) molecules that efficiently cover chemical space. Here, we report a fragment screening on TbrPDEB1, an essential cyclic nucleotide phosphodiesterase (PDE) from Trypanosoma brucei, and human PDE4D, an off-target, in a workflow in which fragment hits and a series of close analogs are subsequently screened for antiparasitic activity in a phenotypic panel. The phenotypic panel contained T. brucei, Trypanosoma cruzi, Leishmania infantum, and Plasmodium falciparum, the causative agents of human African trypanosomiasis (sleeping sickness), Chagas disease, leishmaniasis, and malaria, respectively, as well as MRC-5 human lung cells. This hybrid screening workflow has resulted in the discovery of various benzhydryl ethers with antiprotozoal activity and low toxicity, representing interesting starting points for further antiparasitic optimization. © 2014 Society for Laboratory Automation and Screening.
Hierarchical screening for multiple mental disorders.
Batterham, Philip J; Calear, Alison L; Sunderland, Matthew; Carragher, Natacha; Christensen, Helen; Mackinnon, Andrew J
2013-10-01
There is a need for brief, accurate screening when assessing multiple mental disorders. Two-stage hierarchical screening, consisting of brief pre-screening followed by a battery of disorder-specific scales for those who meet diagnostic criteria, may increase the efficiency of screening without sacrificing precision. This study tested whether more efficient screening could be gained using two-stage hierarchical screening than by administering multiple separate tests. Two Australian adult samples (N=1990) with high rates of psychopathology were recruited using Facebook advertising to examine four methods of hierarchical screening for four mental disorders: major depressive disorder, generalised anxiety disorder, panic disorder and social phobia. Using K6 scores to determine whether full screening was required did not increase screening efficiency. However, pre-screening based on two decision tree approaches or item gating led to considerable reductions in the mean number of items presented per disorder screened, with estimated item reductions of up to 54%. The sensitivity of these hierarchical methods approached 100% relative to the full screening battery. Further testing of the hierarchical screening approach based on clinical criteria and in other samples is warranted. The results demonstrate that a two-phase hierarchical approach to screening multiple mental disorders leads to considerable increases efficiency gains without reducing accuracy. Screening programs should take advantage of prescreeners based on gating items or decision trees to reduce the burden on respondents. © 2013 Elsevier B.V. All rights reserved.
2010-04-01
... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Screening. 654.408 Section 654.408 Employees... EMPLOYMENT SERVICE SYSTEM Housing for Agricultural Workers Housing Standards § 654.408 Screening. (a) All outside openings shall be protected with screening of not less than 16 mesh. (b) All screen doors shall be...
Lee, Hee; Ghebre, Rahel; Le, Chap; Jang, Yoo Jeong; Sharratt, Monica; Yee, Douglas
2017-11-07
Despite the increasing breast cancer incidence and mortality rates, Korean American immigrant women have one of the lowest rates of breast cancer screening across racial groups in the United States. Mobile health (mHealth), defined as the delivery of health care information or services through mobile communication devices, has been utilized to successfully improve a variety of health outcomes. This study adapted the principles of mHealth to advance breast cancer prevention efforts among Korean American immigrant women, an underserved community. Using a randomized controlled trial design, 120 Korean American women aged 40 to 77 years were recruited and randomly assigned to either the mMammogram intervention group (n=60) to receive culturally and personally tailored multilevel and multimedia messages through a mobile phone app along with health navigator services or the usual care control group (n=60) to receive a printed brochure. Outcome measures included knowledge, attitudes, and beliefs about breast cancer screening, readiness for mammography, and mammogram receipt. The feasibility and acceptability of the mMammogram intervention was also assessed. The intervention group showed significantly greater change on scores of knowledge of breast cancer and screening guidelines (P=.01). The intervention group also showed significantly greater readiness for mammography use after the intervention compared with the control group. A significantly higher proportion of women who received the mMammogram intervention (75%, 45/60) completed mammograms by the 6-month follow-up compared with the control group (30%, 18/60; Pservice was a feasible, acceptable, and effective intervention mechanism to promote breast cancer screening in Korean American immigrant women. A flexible, easily tailored approach that relies on recent technological advancements can reach underserved and hard-to-recruit populations that bear disproportionate cancer burdens. Clinicaltrials.gov NCT01972048;
Advances in Microfluidic Platforms for Analyzing and Regulating Human Pluripotent Stem Cells
Qian, Tongcheng; Shusta, Eric V.; Palecek, Sean P.
2015-01-01
Microfluidic devices employ submillimeter length scale control of flow to achieve high-resolution spatial and temporal control over the microenvironment, providing powerful tools to elucidate mechanisms of human pluripotent stem cell (hPSC) regulation and to elicit desired hPSC fates. In addition, microfluidics allow control of paracrine and juxtracrine signaling, thereby enabling fabrication of microphysiological systems comprised of multiple cell types organized into organs-on-a-chip. Microfluidic cell culture systems can also be integrated with actuators and sensors, permitting construction of high-density arrays of cell-based biosensors for screening applications. This review describes recent advances in using microfluidics to understand mechanisms by which the microenvironment regulates hPSC fates and applications of microfluidics to realize the potential of hPSCs for in vitro modeling and screening applications. PMID:26313850
Randomized Controlled Trial of Family Therapy in Advanced Cancer Continued Into Bereavement.
Kissane, David W; Zaider, Talia I; Li, Yuelin; Hichenberg, Shira; Schuler, Tammy; Lederberg, Marguerite; Lavelle, Lisa; Loeb, Rebecca; Del Gaudio, Francesca
2016-06-01
Systematic family-centered cancer care is needed. We conducted a randomized controlled trial of family therapy, delivered to families identified by screening to be at risk from dysfunctional relationships when one of their relatives has advanced cancer. Eligible patients with advanced cancer and their family members screened above the cut-off on the Family Relationships Index. After screening 1,488 patients or relatives at Memorial Sloan Kettering Cancer Center or three related community hospice programs, 620 patients (42%) were recruited, which represented 170 families. Families were stratified by three levels of family dysfunction (low communicating, low involvement, and high conflict) and randomly assigned to one of three arms: standard care or 6 or 10 sessions of a manualized family intervention. Primary outcomes were the Complicated Grief Inventory-Abbreviated (CGI) and Beck Depression Inventory-II (BDI-II). Generalized estimating equations allowed for clustered data in an intention-to-treat analysis. On the CGI, a significant treatment effect (Wald χ(2) = 6.88; df = 2; P = .032) and treatment by family-type interaction was found (Wald χ(2) = 20.64; df = 4; P families. Low-communicating families improved by 6 months of bereavement. In the standard care arm, 15.5% of the bereaved developed a prolonged grief disorder at 13 months of bereavement compared with 3.3% of those who received 10 sessions of intervention (Wald χ(2) = 8.31; df = 2; P =.048). No significant treatment effects were found on the BDI-II. Family-focused therapy delivered to high-risk families during palliative care and continued into bereavement reduced the severity of complicated grief and the development of prolonged grief disorder. © 2016 by American Society of Clinical Oncology.
Low-dose CT: new tool for screening lung cancer?
International Nuclear Information System (INIS)
Diederich, S.; Wormanns, D.; Heindel, W.
2001-01-01
Lung cancer is the leading cause of death from malignant tumours as it is very common and has a poor prognosis at advanced tumour stages. Prognosis could be improved by treatment at early stages. As these stages are usually asymptomatic, a diagnostic test that would allow detection of early tumour stages in a population at risk could potentially reduce mortality from lung cancer. Previous approaches using chest radiography and sputum cytology in smokers have been disappointing. Fluorescent bronchoscopy and molecular markers are not yet applicable in clinical routine. Because of its high sensitivity for small pulmonary nodules, which are the most common manifestation of early lung cancer, CT appears suitable as a screening test. Low-dose examination parameters can and should be used for this purpose. From clinical practice it is well known that chest CT often demonstrates small pulmonary nodules, which do not represent lung cancer. Therefore, non-invasive diagnostic algorithms are required to avoid unnecessary biopsies in benign lesions. In preliminary studies of low-dose CT using algorithms based on size and density of detected nodules a large proportion of asymptomatic lung cancers and a large proportion of early, resectable tumour stages were found with a small proportion of invasive procedures for benign nodules. Before this technology can be recommended for broad application, however, further information is required regarding appropriate inclusion criteria (smoking habits, age groups) and screening intervals. Most importantly, further data are required to clarify whether lung cancer screening using low-dose CT can actually reduce mortality from lung cancer. (orig.)
[Advances in the application of smart phones in modern medicine].
Wang, Lin; Hu, Jie; Li, Fei; Wei, Huilin; Li, Ying; Lu, Tianjian; Wang, Shuqi; Xu, Feng
2014-02-01
Since smart phones have been developed, significant advances in the function of mobile phone due to the development of software, hardware and accessories have been reached. Till now, smart phones have been engaged in daily life with an increasing impact. As a new medical model, mobile phone medicine is emerging and has found wide spread applications in medicine, especially in diagnosing, monitoring and screening various diseases. In addition, mo bile phone medical application shows great potential trend to improve healthcare in resource-limited regions due to its advantageous features of portability and information communication capability. Nowadays, the scientific and technological issues related to mobile phone medicine have attracted worldwide attention. In this review, we summarize state-of-the-art advances of mobile phone medicine with focus on its diagnostics applications in order to expand the fields of their applications and promote healthcare informatization.
Vallet, Fanny; Guillaume, Elodie; Dejardin, Olivier; Guittet, Lydia; Bouvier, Véronique; Mignon, Astrid; Berchi, Célia; Salinas, Agnès; Launoy, Guy; Christophe, Véronique
2016-08-01
The aim of the study was to test whether a screening navigation program leads to more favorable health beliefs and decreases social inequalities in them. The selected 261 noncompliant participants in a screening navigation versus a usual screening program arm had to respond to health belief measures inspired by the Protection Motivation Theory. Regression analyses showed that social inequalities in perceived efficacy of screening, favorable attitude, and perceived facility were reduced in the screening navigation compared to the usual screening program. These results highlight the importance of health beliefs to understand the mechanism of screening navigation programs in reducing social inequalities. © The Author(s) 2014.
PinAPL-Py: A comprehensive web-application for the analysis of CRISPR/Cas9 screens.
Spahn, Philipp N; Bath, Tyler; Weiss, Ryan J; Kim, Jihoon; Esko, Jeffrey D; Lewis, Nathan E; Harismendy, Olivier
2017-11-20
Large-scale genetic screens using CRISPR/Cas9 technology have emerged as a major tool for functional genomics. With its increased popularity, experimental biologists frequently acquire large sequencing datasets for which they often do not have an easy analysis option. While a few bioinformatic tools have been developed for this purpose, their utility is still hindered either due to limited functionality or the requirement of bioinformatic expertise. To make sequencing data analysis of CRISPR/Cas9 screens more accessible to a wide range of scientists, we developed a Platform-independent Analysis of Pooled Screens using Python (PinAPL-Py), which is operated as an intuitive web-service. PinAPL-Py implements state-of-the-art tools and statistical models, assembled in a comprehensive workflow covering sequence quality control, automated sgRNA sequence extraction, alignment, sgRNA enrichment/depletion analysis and gene ranking. The workflow is set up to use a variety of popular sgRNA libraries as well as custom libraries that can be easily uploaded. Various analysis options are offered, suitable to analyze a large variety of CRISPR/Cas9 screening experiments. Analysis output includes ranked lists of sgRNAs and genes, and publication-ready plots. PinAPL-Py helps to advance genome-wide screening efforts by combining comprehensive functionality with user-friendly implementation. PinAPL-Py is freely accessible at http://pinapl-py.ucsd.edu with instructions and test datasets.
[Breast cancer screening in Austria: Key figures, age limits, screening intervals and evidence].
Jeitler, Klaus; Semlitsch, Thomas; Posch, Nicole; Siebenhofer, Andrea; Horvath, Karl
2015-01-01
In January 2014, the first nationwide quality-assured breast cancer screening program addressing women aged ≥ 40 years was introduced in Austria. As part of the process of developing a patient information leaflet, the Evidence Based Medicine (EBM) Review Center of the Medical University of Graz was charged with the task of assessing the potential benefits and harms of breast cancer screening from the available evidence. Based on these results, key figures were derived for mortality, false-positive and false-negative mammography results, and overdiagnosis, considering Austria-specific incidence rates for breast cancer and breast cancer mortality. Furthermore, the current evidence regarding age limits and screening interval, which were the subjects of controversial public discussions, was analyzed. A systematic search for primary and secondary literature was performed and additional evidence was screened, e. g., evaluation reports of European breast cancer screening programs. On the basis of the available evidence and of the Austrian breast cancer mortality and incidence rates, it can be assumed that - depending on the age group - 1 to 4 breast cancer deaths can be avoided per 1,000 women screened in a structured breast cancer screening program, while the overall mortality remains unchanged. On the other hand, 150 to 200 of these 1,000 women will be affected by false-positive results and 1 to 9 women by overdiagnosis due to the structured breast cancer screening. Therefore, the overall benefit-harm balance is uncertain. If women from 40 to 44 or above 70 years of age are considered, who can also participate in the Austrian screening program, even a negative benefit-harm balance seems possible. However, with the implementation of quality standards in breast cancer screening and the dissemination of a patient information leaflet, an improvement in the medical treatment situation, specifically in terms of informed decision-making, can be expected. Copyright © 2015
Holloway, Edith E; Sturrock, Bonnie A; Lamoureux, Ecosse L; Keeffe, Jill E; Rees, Gwyneth
2015-12-01
To investigate characteristics associated with screening positive for depressive symptoms among older adults accessing low-vision rehabilitation and eye-care services and to determine client acceptability of depression screening using the Patient Health Questionnaire-2 (PHQ-2) in these settings. One-hundred and twenty-four older adults (mean = 77.02 years, SD = 9.12) attending low-vision rehabilitation and eye-care services across Australia were screened for depression and invited to complete a telephone-administered questionnaire to determine characteristics associated with depressive symptoms and client acceptability of screening in these settings. Thirty-seven per cent (n = 46/124) of participants screened positive for depressive symptoms, and the majority considered the new depression screening method to be a 'good idea' in vision services (85%). Severe vision loss (<6/60 in the better eye) was associated with an increased odds of screening positive for depressive symptoms (odds ratio 2.37; 95% confidence interval 1.08-6.70) even after adjusting for potential confounders. Participants who screened positive had a preference for 'talking' therapy or a combination of medication and 'talking therapy' delivered within their own home (73%) or via telephone (67%). The PHQ-2 appears to be an acceptable method for depression screening in eye-care settings among older adults. Targeted interventions that incorporate home-based or telephone delivered therapy sessions may improve outcomes for depression in this group. © 2014 ACOTA.
Girotra, Shantanu; Yeghiazaryan, Kristina; Golubnitschaja, Olga
2016-09-01
Breast cancer (BC) prevalence has reached an epidemic scale with half a million deaths annually. Current deficits in BC management include predictive and preventive approaches, optimized screening programs, individualized patient profiling, highly sensitive detection technologies for more precise diagnostics and therapy monitoring, individualized prediction and effective treatment of BC metastatic disease. To advance BC management, paradigm shift from delayed to predictive, preventive and personalized medical services is essential. Corresponding step forwards requires innovative multilevel diagnostics procuring specific panels of validated biomarkers. Here, we discuss current instrumental advancements including genomics, proteomics, epigenetics, miRNA, metabolomics, circulating tumor cells and cancer stem cells with a focus on biomarker discovery and multilevel diagnostic panels. A list of the recommended biomarker candidates is provided.
Baldwin, Richard S.; Bennet, William R.; Wong, Eunice K.; Lewton, MaryBeth R.; Harris, Megan K.
2010-01-01
To address the future performance and safety requirements for the electrical energy storage technologies that will enhance and enable future NASA manned aerospace missions, advanced rechargeable, lithium-ion battery technology development is being pursued within the scope of the NASA Exploration Technology Development Program s (ETDP's) Energy Storage Project. A critical cell-level component of a lithium-ion battery which significantly impacts both overall electrochemical performance and safety is the porous separator that is sandwiched between the two active cell electrodes. To support the selection of the optimal cell separator material(s) for the advanced battery technology and chemistries under development, laboratory characterization and screening procedures were established to assess and compare separator material-level attributes and associated separator performance characteristics.
[Overdiagnosis in cancer screening].
Cervera Deval, J; Sentís Crivillé, M; Zulueta, J J
2015-01-01
In screening programs, overdiagnosis is defined as the detection of a disease that would have gone undetected without screening when that disease would not have resulted in morbimortality and was treated unnecessarily. Overdiagnosis is a bias inherent in screening and an undesired effect of secondary prevention and improved sensitivity of diagnostic techniques. It is difficult to discriminate a priori between clinically relevant diagnoses and those in which treatment is unnecessary. To minimize the effects of overdiagnosis, screening should be done in patients at risk. Copyright © 2014 SERAM. Published by Elsevier España, S.L.U. All rights reserved.
Screening for colorectal cancer
DEFF Research Database (Denmark)
Nielsen, Hans J.; Jakobsen, Karen V.; Christensen, Ib J.
2011-01-01
Emerging results indicate that screening improves survival of patients with colorectal cancer. Therefore, screening programs are already implemented or are being considered for implementation in Asia, Europe and North America. At present, a great variety of screening methods are available including...... into improvements of screening for colorectal cancer includes blood-based biological markers, such as proteins, DNA and RNA in combination with various demographically and clinically parameters into a "risk assessment evaluation" (RAE) test. It is assumed that such a test may lead to higher acceptance among...... procedures for colorectal cancer. Therefore, results of present research, validating RAE tests, are awaited with interest....
de Jong, Bouke; Siewers, Verena; Nielsen, Jens
2012-08-01
Transportation fuels will gradually shift from oil based fuels towards alternative fuel resources like biofuels. Current bioethanol and biodiesel can, however, not cover the increasing demand for biofuels and there is therefore a need for advanced biofuels with superior fuel properties. Novel cell factories will provide a production platform for advanced biofuels. However, deep cellular understanding is required for improvement of current biofuel cell factories. Fast screening and analysis (-omics) methods and metabolome-wide mathematical models are promising techniques. An integrated systems approach of these techniques drives diversity and quantity of several new biofuel compounds. This review will cover the recent technological developments that support improvement of the advanced biofuels 1-butanol, biodiesels and jetfuels. Copyright © 2011 Elsevier Ltd. All rights reserved.
... information is collected, stored or sent over the Internet. To ensure complete privacy, exit your web browser after completing this screening. ... information is collected, stored or sent over the Internet. To ensure complete privacy, exit your web browser after completing this screening. ...
Directory of Open Access Journals (Sweden)
Suh Beomseok
2012-11-01
Full Text Available Abstract Background While knowledge and risk perception have been associated with screening for second primary cancer (SPC, there are no clinically useful indicators to identify who is at risk of not being properly screened for SPC. We investigated whether the mode of primary cancer detection (i.e. screen-detected vs. non-screen-detected is associated with subsequent completion of all appropriate SPC screening in cancer survivors. Methods Data were collected from cancer patients treated at the National Cancer Center and nine regional cancer centers across Korea. A total of 512 cancer survivors older than 40, time since diagnosis more than 2 years, and whose first primary cancer was not advanced or metastasized were selected. Multivariate logistic regression was used to examine factors, including mode of primary cancer detection, associated with completion of all appropriate SPC screening according to national cancer screening guidelines. Results Being screen-detected for their first primary cancer was found to be significantly associated with completion of all appropriate SPC screening (adjusted odds ratio, 2.13; 95% confidence interval, 1.36–3.33, after controlling for demographic and clinical variables. Screen-detected cancer survivors were significantly more likely to have higher household income, have other comorbidities, and be within 5 years since diagnosis. Conclusions The mode of primary cancer detection, a readily available clinical information, can be used as an indicator for screening practice for SPC in cancer survivors. Education about the importance of SPC screening will be helpful particularly for cancer survivors whose primary cancer was not screen-detected.
WE-D-207-03: CT Protocols for Screening and the ACR Designated Lung Screening Program
International Nuclear Information System (INIS)
McNitt-Gray, M.
2015-01-01
In the United States, Lung Cancer is responsible for more cancer deaths than the next four cancers combined. In addition, the 5 year survival rate for lung cancer patients has not improved over the past 40 to 50 years. To combat this deadly disease, in 2002 the National Cancer Institute launched a very large Randomized Control Trial called the National Lung Screening Trial (NLST). This trial would randomize subjects who had substantial risk of lung cancer (due to age and smoking history) into either a Chest X-ray arm or a low dose CT arm. In November 2010, the National Cancer Institute announced that the NLST had demonstrated 20% fewer lung cancer deaths among those who were screened with low-dose CT than with chest X-ray. In December 2013, the US Preventive Services Task Force recommended the use of Lung Cancer Screening using low dose CT and a little over a year later (Feb. 2015), CMS announced that Medicare would also cover Lung Cancer Screening using low dose CT. Thus private and public insurers are required to provide Lung Cancer Screening programs using CT to the appropriate population(s). The purpose of this Symposium is to inform medical physicists and prepare them to support the implementation of Lung Screening programs. This Symposium will focus on the clinical aspects of lung cancer screening, requirements of a screening registry for systematically capturing and tracking screening patients and results (such as required Medicare data elements) as well as the role of the medical physicist in screening programs, including the development of low dose CT screening protocols. Learning Objectives: To understand the clinical basis and clinical components of a lung cancer screening program, including eligibility criteria and other requirements. To understand the data collection requirements, workflow, and informatics infrastructure needed to support the tracking and reporting components of a screening program. To understand the role of the medical physicist in
Current and future role of genetic screening in gynecologic malignancies.
Ring, Kari L; Garcia, Christine; Thomas, Martha H; Modesitt, Susan C
2017-11-01
The world of hereditary cancers has seen exponential growth in recent years. While hereditary breast and ovarian cancer and Lynch syndrome account for the majority of mutations encountered by gynecologists, newly identified deleterious genetic mutations continue to be unearthed with their associated risks of malignancies. However, these advances in genetic cancer predispositions then force practitioners and their patients to confront the uncertainties of these less commonly identified mutations and the fact that there is limited evidence to guide them in expected cancer risk and appropriate risk-reduction strategies. Given the speed of information, it is imperative to involve cancer genetics experts when counseling these patients. In addition, coordination of screening and care in conjunction with specialty high-risk clinics, if available, allows for patients to have centralized management for multiple cancer risks under the guidance of physicians with experience counseling these patients. The objective of this review is to present the current literature regarding genetic mutations associated with gynecologic malignancies as well to propose screening and risk-reduction options for these high-risk patients. Copyright © 2017 Elsevier Inc. All rights reserved.
Screen or not to screen for peripheral arterial disease: guidance from a decision model.
Vaidya, Anil; Joore, Manuela A; Ten Cate-Hoek, Arina J; Ten Cate, Hugo; Severens, Johan L
2014-01-29
Asymptomatic Peripheral Arterial Disease (PAD) is associated with greater risk of acute cardiovascular events. This study aims to determine the cost-effectiveness of one time only PAD screening using Ankle Brachial Index (ABI) test and subsequent anti platelet preventive treatment (low dose aspirin or clopidogrel) in individuals at high risk for acute cardiovascular events compared to no screening and no treatment using decision analytic modelling. A probabilistic Markov model was developed to evaluate the life time cost-effectiveness of the strategy of selective PAD screening and consequent preventive treatment compared to no screening and no preventive treatment. The analysis was conducted from the Dutch societal perspective and to address decision uncertainty, probabilistic sensitivity analysis was performed. Results were based on average values of 1000 Monte Carlo simulations and using discount rates of 1.5% and 4% for effects and costs respectively. One way sensitivity analyses were performed to identify the two most influential model parameters affecting model outputs. Then, a two way sensitivity analysis was conducted for combinations of values tested for these two most influential parameters. For the PAD screening strategy, life years and quality adjusted life years gained were 21.79 and 15.66 respectively at a lifetime cost of 26,548 Euros. Compared to no screening and treatment (20.69 life years, 15.58 Quality Adjusted Life Years, 28,052 Euros), these results indicate that PAD screening and treatment is a dominant strategy. The cost effectiveness acceptability curves show 88% probability of PAD screening being cost effective at the Willingness To Pay (WTP) threshold of 40000 Euros. In a scenario analysis using clopidogrel as an alternative anti-platelet drug, PAD screening strategy remained dominant. This decision analysis suggests that targeted ABI screening and consequent secondary prevention of cardiovascular events using low dose aspirin or
Langlois, Sylvie; Johnson, JoAnn; Audibert, François; Gekas, Jean; Forest, Jean-Claude; Caron, André; Harrington, Keli; Pastuck, Melanie; Meddour, Hasna; Tétu, Amélie; Little, Julian; Rousseau, François
2017-12-01
This study evaluates the impact of offering cell-free DNA (cfDNA) screening as a first-tier test for trisomies 21 and 18. This is a prospective study of pregnant women undergoing conventional prenatal screening who were offered cfDNA screening in the first trimester with clinical outcomes obtained on all pregnancies. A total of 1198 pregnant women were recruited. The detection rate of trisomy 21 with standard screening was 83% with a false positive rate (FPR) of 5.5% compared with 100% detection and 0% FPR for cfDNA screening. The FPR of cfDNA screening for trisomies 18 and 13 was 0.09% for each. Two percent of women underwent an invasive diagnostic procedure based on screening or ultrasound findings; without the cfDNA screening, it could have been as high as 6.8%. Amongst the 640 women with negative cfDNA results and a nuchal translucency (NT) ultrasound, only 3 had an NT greater or equal to 3.5 mm: one had a normal outcome and two lost their pregnancy before 20 weeks. cfDNA screening has the potential to be a highly effective first-tier screening approach leading to a significant reduction of invasive diagnostic procedures. For women with a negative cfDNA screening result, NT measurement has limited clinical utility. © 2017 John Wiley & Sons, Ltd.
Stewart, D L; Pearlman, A
1994-11-01
Congenital deafness is a relatively common problem with an incidence of 1/300 to 1/1000. Most states have no mass screening program for hearing loss, but the state of Kentucky compiles a High Risk Registry which is a historical survey of parents relating to risk factors for hearing loss. Unfortunately this survey can miss 50% of those who have a hearing deficit. If not detected prior to discharge, there is often a delay in diagnosis of deafness which prevents early intervention. We report 2 years' experience at Kosair Children's Hospital where 1,987 infants admitted to well baby, intermediate, or intensive care nurseries were screened using the ALGO-1 screener (Natus Medical Inc, Foster City, CA) which is a modified auditory brain stem evoked response (ABR). Our screening of this population led to an 11% incidence of referral for complete audiological evaluation. There were no significant complications. Forty-eight infants were found to have nonspecified, sensorineural, or conductive hearing loss. The positive predictive value of the test was 96%. Therefore, we feel that the use of the modified ABR in the newborn is a timely, cost efficient method of screening for hearing loss and should be used for mass screening of all newborns.
Schroy, Paul C; Duhovic, Emir; Chen, Clara A; Heeren, Timothy C; Lopez, William; Apodaca, Danielle L; Wong, John B
2016-05-01
Eliciting patient preferences within the context of shared decision making has been advocated for colorectal cancer (CRC) screening, yet providers often fail to comply with patient preferences that differ from their own. To determine whether risk stratification for advanced colorectal neoplasia (ACN) influences provider willingness to comply with patient preferences when selecting a desired CRC screening option. Randomized controlled trial. Asymptomatic, average-risk patients due for CRC screening in an urban safety net health care setting. Patients were randomized 1:1 to a decision aid alone (n= 168) or decision aid plus risk assessment (n= 173) arm between September 2012 and September 2014. The primary outcome was concordance between patient preference and test ordered; secondary outcomes included patient satisfaction with the decision-making process, screening intentions, test completion rates, and provider satisfaction. Although providers perceived risk stratification to be useful in selecting an appropriate screening test for their average-risk patients, no significant differences in concordance were observed between the decision aid alone and decision aid plus risk assessment groups (88.1% v. 85.0%,P= 0.40) or high- and low-risk groups (84.5% v. 87.1%,P= 0.51). Concordance was highest for colonoscopy and relatively low for tests other than colonoscopy, regardless of study arm or risk group. Failure to comply with patient preferences was negatively associated with satisfaction with the decision-making process, screening intentions, and test completion rates. Single-institution setting; lack of provider education about the utility of risk stratification into their decision making. Providers perceived risk stratification to be useful in their decision making but often failed to comply with patient preferences for tests other than colonoscopy, even among those deemed to be at low risk of ACN. © The Author(s) 2016.
Screening for abdominalt aortaaneurisme
DEFF Research Database (Denmark)
Lindholt, Jes Sanddal; Juul, Søren; Henneberg, E W
1997-01-01
In spite of increasing number of elective resections of abdominal aortic aneurysms (AAA) the mortality or ruptured AAA is increasing. The advantages of elective operations are obvious; the lethality is 2-6% while the lethality of ruptured AAA is 75-95%. However, AAA seldom causes symptoms before...... rupture. Ultrasonographic screening for AAA takes 10 minutes per scan, and the sensitivity and specificity are high. Ultrasonographic screening for AAA is a reliable, safe and inexpensive method for screening, and screening for AAA is discussed worldwide. One point four percent of deaths among men from 65...... to 80 year of age are caused by ruptured AAA. Screening men over 65 for AAA can theoretically prevent a substantial number of deaths. Our calculations predict one prevented AAA-death per 200-300 scans for a cost of about 4000 DKK per saved year of life. However, cost-benefit analyses are based...
Clarifying the debate on population-based screening for breast cancer with mammography
Chen, Tony Hsiu-Hsi; Yen, Amy Ming-Fang; Fann, Jean Ching-Yuan; Gordon, Paula; Chen, Sam Li-Sheng; Chiu, Sherry Yueh-Hsia; Hsu, Chen-Yang; Chang, King-Jen; Lee, Won-Chul; Yeoh, Khay Guan; Saito, Hiroshi; Promthet, Supannee; Hamashima, Chisato; Maidin, Alimin; Robinson, Fredie; Zhao, Li-Zhong
2017-01-01
Abstract Background: The recent controversy about using mammography to screen for breast cancer based on randomized controlled trials over 3 decades in Western countries has not only eclipsed the paradigm of evidence-based medicine, but also puts health decision-makers in countries where breast cancer screening is still being considered in a dilemma to adopt or abandon such a well-established screening modality. Methods: We reanalyzed the empirical data from the Health Insurance Plan trial in 1963 to the UK age trial in 1991 and their follow-up data published until 2015. We first performed Bayesian conjugated meta-analyses on the heterogeneity of attendance rate, sensitivity, and over-detection and their impacts on advanced stage breast cancer and death from breast cancer across trials using Bayesian Poisson fixed- and random-effect regression model. Bayesian meta-analysis of causal model was then developed to assess a cascade of causal relationships regarding the impact of both attendance and sensitivity on 2 main outcomes. Results: The causes of heterogeneity responsible for the disparities across the trials were clearly manifested in 3 components. The attendance rate ranged from 61.3% to 90.4%. The sensitivity estimates show substantial variation from 57.26% to 87.97% but improved with time from 64% in 1963 to 82% in 1980 when Bayesian conjugated meta-analysis was conducted in chronological order. The percentage of over-detection shows a wide range from 0% to 28%, adjusting for long lead-time. The impacts of the attendance rate and sensitivity on the 2 main outcomes were statistically significant. Causal inference made by linking these causal relationships with emphasis on the heterogeneity of the attendance rate and sensitivity accounted for the variation in the reduction of advanced breast cancer (none-30%) and of mortality (none-31%). We estimated a 33% (95% CI: 24–42%) and 13% (95% CI: 6–20%) breast cancer mortality reduction for the best scenario (90
Directory of Open Access Journals (Sweden)
Virginia R Roth
Full Text Available The literature remains conflicted regarding the most effective way to screen for MRSA. This study was designed to assess costs associated with universal versus risk factor-based screening for the reduction of nosocomial MRSA transmission.The study was conducted at The Ottawa Hospital, a large multi-centre tertiary care facility with approximately 47,000 admissions annually. From January 2006-December 2007, patients underwent risk factor-based screening for MRSA on admission. From January 2008 to August 2009 universal MRSA screening was implemented. A comparison of costs incurred during risk factor-based screening and universal screening was conducted. The model incorporated probabilities relating to the likelihood of being tested and the results of polymerase chain reaction (PCR testing with associated effects in terms of MRSA bacteremia and true positive and negative test results. Inputted costs included laboratory testing, contact precautions and infection control, private room costs, housekeeping, and length of hospital stay. Deterministic sensitivity analyses were conducted.The risk factor-based MRSA screening program screened approximately 30% of admitted patients and cost the hospital over $780 000 annually. The universal screening program screened approximately 83% of admitted patients and cost over $1.94 million dollars, representing an excess cost of $1.16 million per year. The estimated additional cost per patient screened was $17.76.This analysis demonstrated that a universal MRSA screening program was costly from a hospital perspective and was previously known to not be clinically effective at reducing MRSA transmission. These results may be useful to inform future model-based economic analyses of MRSA interventions.
Obesity Prevention and Screening.
Mackey, Eleanor R; Olson, Alexandra; DiFazio, Marc; Cassidy, Omni
2016-03-01
Obesity is widespread, associated with several physical and psychosocial comorbidities, and is difficult to treat. Prevention of obesity across the lifespan is critical to improving the health of individuals and society. Screening and prevention efforts in primary care are an important step in addressing the obesity epidemic. Each period of human development is associated with unique risks, challenges, and opportunities for prevention and intervention. Screening tools for overweight/obesity, although imperfect, are quick and easy to administer. Screening should be conducted at every primary care visit and tracked longitudinally. Screening tools and cutoffs for overweight and obesity vary by age group. Copyright © 2016 Elsevier Inc. All rights reserved.
Mammography screening in Denmark
DEFF Research Database (Denmark)
Vejborg, Ilse; Mikkelsen, Ellen Margrethe; Garne, Jens Peter
2011-01-01
Mammography screening is offered healthy women, and a high standard on professional and organizational level is mandatory not only in the screening programme but even in the diagnostic work-up and treatment. The main goal is to achieve a substantial reduction in disease specific mortality......, but it is not possible to evaluate the effect on mortality until several years later, and continuously monitoring of the quality of all aspects of a screening programme is necessary. Based on other European guidelines, 11 quality indicators have been defined, and guidelines concerning organizational requirements...... for a Danish screening programme as well as recommendations for the radiographic and radiological work have been drawn up....
Recent Advances in Electrochemical Glycobiosensing
Directory of Open Access Journals (Sweden)
Germarie Sánchez-Pomales
2011-01-01
Full Text Available Biosensors based on electrochemical transduction mechanisms have recently made advances into the field of glycan analysis. These glyco-biosensors offer simple, rapid, sensitive, and economical approaches to the measurement need for rapid glycan analysis for biomarker detection, cancer and disease diagnostics, and bioprocess monitoring of therapeutic glycoproteins. Although the prevalent methods of glycan analysis (high-performance liquid chromatography, mass spectrometry, and nuclear magnetic resonance spectroscopy provide detailed identification and structural analysis of glycan species, there are significantly few low-cost, rapid glycan assays available for diagnostic and screening applications. Here we review instances in which glyco-biosensors have been used for glycan analysis using a variety of electrochemical transduction mechanisms (e.g., amperometric, potentiometric, impedimetric, and voltammetric, selective binding agents (e.g., lectins and antibodies, and redox species (e.g., enzyme substrates, inorganic, and nanomaterial.
Mass screening in breast cancer
International Nuclear Information System (INIS)
Strax, P.
1977-01-01
Some questions about mass screening in breast cancer are answered it being concluded that: 1. mass screening for the detection of early breast cancer is the only means with proven potential for lowering the death rate of the disease; 2. mammography is an importante - if not the most important modality in mass screening; 3. new film - screen combinations generally available are capable of producing mammograms of excelent quality with radiation doses down to .1 rad into the body of breast. The risk of malignant changes from such dosage - even when given periodically is negligeable. New equipment, to be available, shortly, will use the new film - screen combinations in an automated manner with must reduce cost in time, filme, personnel and processing - of more than 50%. This would make mass screening more practical. (M.A.) [pt
Current Cervical Carcinoma Screening Guidelines
Directory of Open Access Journals (Sweden)
Megan J. Schlichte
2015-05-01
Full Text Available A formidable threat to the health of women, cervical carcinoma can be prevented in many cases with adequate screening. The current guidelines for cervical carcinoma screening were created as joint recommendations of the American Cancer Society (ACS, the American Society for Colposcopy and Cervical Pathology (ASCCP and the American Society for Clinical Pathology (ASCP in 2012, and later accepted and promoted by the American Congress of Obstetricians and Gynecologists (ACOG. The 2012 recommendations underscore the utility of molecular testing as an adjunct to cytology screening for certain women and provide guidance to clinicians based on different risk-benefit considerations for different ages. This manuscript will review screening techniques and current recommendations for cervical cancer screening and human papilloma virus (HPV testing, as well as possible future screening strategies.
Zhao, X L; Remila, Rezhake; Hu, S Y; Zhang, L; Xu, X Q; Chen, F; Pan, Q J; Zhang, X; Zhao, F H
2018-05-06
Objective: To evaluate and compare the screening performance of primary high-risk HPV(HR-HPV) screening and HR-HPV screening plus liquid-based cytology (LBC) cotesting in diagnosis of cervical cancer and precancerous lesions (CIN2+). Methods: We pooled 17 population-based cross-sectional studies which were conducted across China from 1999 to 2008. After obtaining informed consent, all women received liquid-based cytology(LBC)testing, HR-HPV DNA testing. Totally 28 777 women with complete LBC, HPV and biopsy results were included in the final analysis. Screening performance of primary HR-HPV DNA screening and HPV screening plus LBC co-testing in diagnosis of CIN2+ were calculated and compared among different age groups. Results: Among the whole population, the detection rates of primary HR-HPV screening and HR-HPV screening plus LBC co-testing are 3.05% (879 CIN2+) and 3.13%(900 CIN2+), respectively. The sensitivity were 96.4% and 98.7% (χ(2)=19.00, PHPV screening performed better than co-testing (AUC were 0.913 and 0.888; Z= 6.16, PHPV screening, co-testing showed significantly higher colposcopy referral rates (16.5% and 23.6%, respectively, χ(2)=132.00, PHPV screening in diagnosis of CIN2+, and was 12.5 (15.7%(288 cases) vs 1.3%(23 cases)) times as much as the detection rate of HR-HPV screening plus cytology contesting. Conclusion: Compared with primary HR-HPV screening, HR-HPV screening plus cytology co-testing does not show better results in the screening performance for CIN2+ detection, and the cost-effectiveness is not good enough, especially in younger age group.
Advanced kinetics for calorimetric techniques and thermal stability screening of sulfide minerals
International Nuclear Information System (INIS)
Iliyas, Abduljelil; Hawboldt, Kelly; Khan, Faisal
2010-01-01
Thermal methods of analysis such as differential scanning calorimetry (DSC) provide a powerful methodology for the study of solid reactions. This paper proposes an improved thermal analysis methodology for thermal stability investigation of complex solid-state reactions. The proposed methodology is based on differential iso-conversional approach and involves peak separation, individual peak analysis and combination of isothermal/non-isothermal DSC measurements for kinetic analysis and prediction. The proposed thermal analysis, which coupled with Mineral Libration Analyzer (MLA) technique was employed to investigate thermal behavior of sulfide mineral oxidation. The importance of various experimental variables such as particle size, heating rate and atmosphere were investigated and discussed. The information gained from such an advanced thermal analysis method is useful for scale-up processes with potential of significant savings in plant operations, as well as in mitigating adverse environmental and safety issues arising from handling and storage of sulfide minerals.
Kadambari, S; Luck, S; Davis, A; Williams, Ej; Berrington, J; Griffiths, Pd; Sharland, M
2013-10-01
Screening for a condition should only be undertaken if certain strict criteria are met. Congenital CMV (cCMV) is a leading cause of sensorineuronal hearing loss (SNHL) and meets many of these criteria, but is not currently screened for in the UK. Ganciclovir reduces CMV-induced progressive SNHL if treatment is begun in the first month of life. The Newborn Hearing Screening Programme (NHSP) has been shown to identify SNHL at the earliest possible age. The potential of integrating screening for cCMV into the NHSP is discussed to consolidate the link between screening, early diagnosis and management. The early diagnosis and treatment of cCMV may prevent a small proportion of late SNHL. In the absence of any screening programme, we provide evidence that clinically targeted screening through the NHSP is a potential option in the UK, enhancing the diagnostic pathway and enabling appropriate early treatment to reduce long-term morbidity. ©2013 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.
Empirical study of supervised gene screening
Directory of Open Access Journals (Sweden)
Ma Shuangge
2006-12-01
Full Text Available Abstract Background Microarray studies provide a way of linking variations of phenotypes with their genetic causations. Constructing predictive models using high dimensional microarray measurements usually consists of three steps: (1 unsupervised gene screening; (2 supervised gene screening; and (3 statistical model building. Supervised gene screening based on marginal gene ranking is commonly used to reduce the number of genes in the model building. Various simple statistics, such as t-statistic or signal to noise ratio, have been used to rank genes in the supervised screening. Despite of its extensive usage, statistical study of supervised gene screening remains scarce. Our study is partly motivated by the differences in gene discovery results caused by using different supervised gene screening methods. Results We investigate concordance and reproducibility of supervised gene screening based on eight commonly used marginal statistics. Concordance is assessed by the relative fractions of overlaps between top ranked genes screened using different marginal statistics. We propose a Bootstrap Reproducibility Index, which measures reproducibility of individual genes under the supervised screening. Empirical studies are based on four public microarray data. We consider the cases where the top 20%, 40% and 60% genes are screened. Conclusion From a gene discovery point of view, the effect of supervised gene screening based on different marginal statistics cannot be ignored. Empirical studies show that (1 genes passed different supervised screenings may be considerably different; (2 concordance may vary, depending on the underlying data structure and percentage of selected genes; (3 evaluated with the Bootstrap Reproducibility Index, genes passed supervised screenings are only moderately reproducible; and (4 concordance cannot be improved by supervised screening based on reproducibility.
International Nuclear Information System (INIS)
Lin, C.Y.; Ho, Y.K.
2010-01-01
The screening effects due to the exponential-cosine-screened Coulomb and screened Coulomb (Yukawa) potentials on photoionization processes are explored within the framework of complex coordinate rotation method. The energy levels of H and He + in both screened potentials shifted with various Debye screening lengths are presented. The photoionization cross sections illustrate the considerable screening effects on photoionization processes in low energy region. The shape resonances can be found near ionization thresholds for certain of Debye screening lengths. The relations between the appearance of resonances and the existence of quasi-bound states under shielding conditions are discussed. (authors)
Developing a Bacteroides System for Function-Based Screening of DNA from the Human Gut Microbiome.
Lam, Kathy N; Martens, Eric C; Charles, Trevor C
2018-01-01
Functional metagenomics is a powerful method that allows the isolation of genes whose role may not have been predicted from DNA sequence. In this approach, first, environmental DNA is cloned to generate metagenomic libraries that are maintained in Escherichia coli, and second, the cloned DNA is screened for activities of interest. Typically, functional screens are carried out using E. coli as a surrogate host, although there likely exist barriers to gene expression, such as lack of recognition of native promoters. Here, we describe efforts to develop Bacteroides thetaiotaomicron as a surrogate host for screening metagenomic DNA from the human gut. We construct a B. thetaiotaomicron-compatible fosmid cloning vector, generate a fosmid clone library using DNA from the human gut, and show successful functional complementation of a B. thetaiotaomicron glycan utilization mutant. Though we were unable to retrieve the physical fosmid after complementation, we used genome sequencing to identify the complementing genes derived from the human gut microbiome. Our results demonstrate that the use of B. thetaiotaomicron to express metagenomic DNA is promising, but they also exemplify the challenges that can be encountered in the development of new surrogate hosts for functional screening. IMPORTANCE Human gut microbiome research has been supported by advances in DNA sequencing that make it possible to obtain gigabases of sequence data from metagenomes but is limited by a lack of knowledge of gene function that leads to incomplete annotation of these data sets. There is a need for the development of methods that can provide experimental data regarding microbial gene function. Functional metagenomics is one such method, but functional screens are often carried out using hosts that may not be able to express the bulk of the environmental DNA being screened. We expand the range of current screening hosts and demonstrate that human gut-derived metagenomic libraries can be
Directory of Open Access Journals (Sweden)
Ridley Kate
2010-12-01
Full Text Available Abstract Background Much attention has been paid to adolescents' screen time, however very few studies have examined non-screen sedentary time (NSST. This study aimed to (1 describe the magnitude and composition of screen sedentary time (SST and NSST in Australian adolescents, (2 describe the socio-demographic correlates of SST and NSST, and (3 determine whether screen time is an adequate surrogate for total sedentary behaviour in this population. Methods 2200 9-16 year old Australians provided detailed use of time data for four days. Non-screen sedentary time (NSST included time spent participating in activities expected to elicit Results Adolescents spent a mean (SD of 345 (105 minutes/day in NSST, which constituted 60% of total sedentary time. School activities contributed 42% of NSST, socialising 19%, self-care (mainly eating 16%, and passive transport 15%. Screen time and NSST showed opposite patterns in relation to key socio-demographic characteristics, including sex, age, weight status, household income, parental education and day type. Because screen time was negatively correlated with NSST (r = -0.58, and exhibited a moderate correlation (r = 0.53 with total sedentary time, screen time was only a moderately effective surrogate for total sedentary time. Conclusions To capture a complete picture of young people's sedentary time, studies should endeavour to measure both screen time and NSST.
Moss, Sue; Mathews, Christopher; Day, T J; Smith, Steve; Seaman, Helen E; Snowball, Julia; Halloran, Stephen P
2017-09-01
The National Health Service Bowel Cancer Screening Programme (BCSP) in England uses a guaiac-based faecal occult blood test (gFOBt). A quantitative faecal immunochemical test (FIT) for haemoglobin (Hb) has many advantages, including being specific for human blood, detecting Hb at a much lower concentration with a single faecal sample and improved uptake. In 2014, a large comparative pilot study was performed within BCSP to establish the acceptability and diagnostic performance of FIT. Over a 6-month period, 40 930 (1 in 28) subjects were sent a FIT (OC-SENSOR) instead of a gFOBt. A bespoke FIT package was used to mail FIT sampling devices to and from FIT subjects. All participants positive with either gFOBt or FIT (cut-off 20 µg Hb/g faeces) were referred for follow-up. Subgroup analysis included cut-off concentrations, age, sex, screening history and deprivation quintile. While overall uptake increased by over 7 percentage points with FIT (66.4% vs 59.3%, OR 1.35, 95% CI 1.33 to 1.38), uptake by previous non-responders almost doubled (FIT 23.9% vs gFOBt 12.5%, OR 2.20, 95% CI 2.10 to 2.29). The increase in overall uptake was significantly higher in men than women and was observed across all deprivation quintiles. With the conventional 20 µg/g cut-off, FIT positivity was 7.8% and ranged from 5.7% in 59-64-year-old women to 11.1% in 70-75-year-old men. Cancer detection increased twofold and that for advanced adenomas nearly fivefold. Detection rates remained higher with FIT for advanced adenomas, even at 180 µg Hb/g. Markedly improved participation rates were achieved in a mature gFOBt-based national screening programme and disparities between men and women were reduced. High positivity rates, particularly in men and previous non-respondents, challenge the available colonoscopy resource, but improvements in neoplasia detection are still achievable within this limited resource. Published by the BMJ Publishing Group Limited. For permission to use (where not
Tabassum, Nadia; Tai, Hongmei; Jung, Da-Woon; Williams, Darren R
2015-01-01
Diabetes mellitus affects millions of people worldwide and significantly impacts their quality of life. Moreover, life threatening diseases, such as myocardial infarction, blindness, and renal disorders, increase the morbidity rate associated with diabetes. Various natural products from medicinal plants have shown potential as antidiabetes agents in cell-based screening systems. However, many of these potential "hits" fail in mammalian tests, due to issues such as poor pharmacokinetics and/or toxic side effects. To address this problem, the zebrafish (Danio rerio) model has been developed as a "bridge" to provide an experimentally convenient animal-based screening system to identify drug candidates that are active in vivo. In this review, we discuss the application of zebrafish to drug screening technologies for diabetes research. Specifically, the discovery of natural product-based antidiabetes compounds using zebrafish will be described. For example, it has recently been demonstrated that antidiabetic natural compounds can be identified in zebrafish using activity guided fractionation of crude plant extracts. Moreover, the development of fluorescent-tagged glucose bioprobes has allowed the screening of natural product-based modulators of glucose homeostasis in zebrafish. We hope that the discussion of these advances will illustrate the value and simplicity of establishing zebrafish-based assays for antidiabetic compounds in natural products-based laboratories.
Moshina, Nataliia; Ursin, Giske; Roman, Marta; Sebuødegård, Sofie; Hofvind, Solveig
2016-01-01
To investigate the probability of breast cancer among women recalled due to abnormal findings on the screening mammograms (PPV-1) and among women who underwent an invasive procedure (PPV-2) by mammographic density (MD), screening mode and age. We used information about 28,826 recall examinations from 26,951 subsequently screened women in the Norwegian Breast Cancer Screening Program, 1996-2010. The radiologists who performed the recall examinations subjectively classified MD on the mammograms into three categories: fatty (70%). Screening mode was defined as screen-film mammography (SFM) and full-field digital mammography (FFDM). We examined trends of PPVs by MD, screening mode and age. We used logistic regression to estimate odds ratio (OR) of screen-detected breast cancer associated with MD among women recalled, adjusting for screening mode and age. PPV-1 and PPV-2 decreased by increasing MD, regardless of screening mode (p for trend breasts. Among women recalled, the adjusted OR of breast cancer decreased with increasing MD. Compared with women with fatty breasts, the OR was 0.90 (95% CI: 0.84-0.96) for those with medium dense breasts and 0.85 (95% CI: 0.76-0.95) for those with dense breasts. PPVs decreased by increasing MD. Fewer women needed to be recalled or undergo an invasive procedure to detect one breast cancer among those with fatty versus dense breasts in the screening program in Norway, 1996-2010. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Happell, Brenda; Scott, David; Nankivell, Janette; Platania-Phung, Chris
2013-08-01
To explore nurses' views on the role of nurses in screening and monitoring for physical care of consumers with serious mental illness, at a regional mental health care service. People with serious mental illness experience heightened incidence of preventable and treatable physical illnesses such as cardiovascular disease and diabetes. Screening and monitoring are considered universal clinical safeguards. Nurses can potentially facilitate systematic screening, but their views on physical health care practices are rarely investigated. Qualitative exploratory study. Focus group interviews with 38 nurses of a regional mental health care service district of Australia. To facilitate discussion, participants were presented with a screening system, called the Health Improvement Profile (HIP), as an exemplar of screening of physical health risks by nurses. Inductive data analysis and theme development were guided by a thematic analysis framework. Nurses argued that treatable and preventable physical health problems were common. Four main themes were identified: screening - essential for good practice; the policy-practice gap; 'screening then what?' and, is HIP the answer? Screening and monitoring were considered crucial to proper diagnosis and treatment, however, were not performed systematically or consistently. Nurse readiness for an enhanced role in screening was shaped by: role and responsibility issues, legal liability concerns, funding and staff shortages. Participants were concerned that lack of follow up would limit effectiveness of these interventions. Screening was considered an important clinical step in effective diagnosis and treatment; however, identified barriers need to be addressed to ensure screening is part of a systemic approach to improve physical health of consumers with serious mental illness. Nurses have potential to influence improvement in physical health outcomes for consumers of mental health services. Such potential can only be realised if a
Risks of Colorectal Cancer Screening
... Genetics of Colorectal Cancer Colorectal Cancer Screening Research Colorectal Cancer Screening (PDQ®)–Patient Version What is screening? Go ... These are called diagnostic tests . General Information About Colorectal Cancer Key Points Colorectal cancer is a disease in ...
Cervical cancer - screening and prevention
Cancer cervix - screening; HPV - cervical cancer screening; Dysplasia - cervical cancer screening; Cervical cancer - HPV vaccine ... Almost all cervical cancers are caused by HPV (human papilloma virus). HPV is a common virus that spreads through sexual contact. Certain ...
Expanded newborn screening by mass spectrometry: New tests, future perspectives.
Ombrone, Daniela; Giocaliere, Elisa; Forni, Giulia; Malvagia, Sabrina; la Marca, Giancarlo
2016-01-01
Tandem mass spectrometry (MS/MS) has become a leading technology used in clinical chemistry and has shown to be particularly sensitive and specific when used in newborn screening (NBS) tests. The success of tandem mass spectrometry is due to important advances in hardware, software and clinical applications during the last 25 years. MS/MS permits a very rapid measurement of many metabolites in different biological specimens by using filter paper spots or directly on biological fluids. Its use in NBS give us the chance to identify possible treatable metabolic disorders even when asymptomatic and the benefits gained by this type of screening is now recognized worldwide. Today the use of MS/MS for second-tier tests and confirmatory testing is promising especially in the early detection of new disorders such as some lysosomal storage disorders, ADA and PNP SCIDs, X-adrenoleucodistrophy (X-ALD), Wilson disease, guanidinoacetate methyltransferase deficiency (GAMT), and Duchenne muscular dystrophy. The new challenge for the future will be reducing the false positive rate by using second-tier tests, avoiding false negative results by using new specific biomarkers and introducing new treatable disorders in NBS programs. © 2015 Wiley Periodicals, Inc.
Screening for thyroid disorders in asymptomatic adults from Brazilian populations
Directory of Open Access Journals (Sweden)
Isabela Benseñor
Full Text Available Advances in thyroid disorder diagnosis have created new thyroid disorder categories such as subclinical hyperthyroidism and subclinical hypothyroidism. In the 1980s, immunometric assaying for thyroid stimulating hormone (TSH emerged and became defined as the most cost-effective test in thyroid disorder screening. The second step in the screening of thyroid disorders is to determine free thyroxine (FT4, and cost-effective methods for its detection are now available. Using TSH and FT4, it is possible to determine four situations: clinical hyperthyroidism, clinical hypothyroidism, subclinical hyperthyroidism and subclinical hypothyroidism. Subclinical hypothyroidism can be a strong indicator of risk for atherosclerosis and myocardial infarction in elderly women. Cardiovascular mortality among Brazilian women is one of the highest in the Western world. The best-known risk factors for cardiovascular diseases are high blood pressure, smoking, diabetes, and hypercholesterolemia. Although these are recognized as primary risk factors, there are other risk factors that could be identified as primordial risk factors. This may be the case for subclinical hypothyroidism. Early detection of thyroid disorders in women over fifty could be a highly cost-effective option in the prevention of cardiovascular disorders among Brazilian women.
Salimzadeh, Hamideh; Bishehsari, Faraz; Delavari, Alireza; Barzin, Gilda; Amani, Mohammad; Majidi, Azam; Sadjadi, Alireza; Malekzadeh, Reza
2016-12-20
We aimed to measure cancer knowledge and feasibility of a screening colonoscopy among a cohort of individuals at higher risk of colon cancer. This study was conducted as part of an ongoing screening cohort, in which first degree relatives (FDRs) of patients with colon cancer are invited to participate in a free of charge screening colonoscopy. We enrolled 1017 FDRs in the study between 2013 and 2014 measuring their data on demographics, cancer knowledge and colonoscopy uptake. A p value of aware of their increased risk for cancer, near 35.0% had ever heard about colonoscopy with 22% aware of the correct age to start screening. Comparing cancer knowledge of FDRs at high risk versus those at moderate risk, we recorded non-significant differences (p>0.05). Almost two-thirds of FDRs expressed willingness to undergo a colonoscopy and 49.2% completed the procedure, of which 12.8% had advanced neoplasm. Our data indicated that remarkable numbers of FDRs were not still informed of their cancer risk or never received a physician recommendation for screening. The desirable uptake at first invitation, which would be higher over successive invitations, supports the feasibility of a family-based recruitment approach for early screening. This has promising implications to introduce targeted screening colonoscopy into the healthcare system in Iran and other developing nations. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.
Development and validation process of the advanced main control board for next Japanese PWR plants
International Nuclear Information System (INIS)
Tani, M.; Ito, K.; Yokoyama, M.; Imase, M.; Okamoto, H.
2000-01-01
The purpose of main control room improvement is to reduce operator workload and potential human errors by offering a better working environment where operators can maximize their abilities. Japanese pressurized water reactor (PWR) utilities and Mitsubishi group have developed a touch -screen-based main control console (i.e. advanced main control room) the next generation PWRs to further improve the plant operability using a state of the art electronics technology. The advanced main control room consists of an operator console, a supervisor console and large display panels. The functional specifications were evaluated by utility operators using a prototype main control console connected to a plant simulator. (author)
Screening diagnostic program breast cancer
International Nuclear Information System (INIS)
Portnoj, L.M.; Zhakova, I.I.; Budnikova, N.V.; Rukhlyadko, E.D.
1995-01-01
The authors propose their screening program for detection of breast cancer. It includes the entire complex of present-day screening diagnostic methods, starting from an original system for the formation of groups at risk of breast cancer and completed by the direct diagnostic model of detection of the condition, oriented at a differentiated approach to the use of mammographic techniques. The proposed organizational and methodologic screening measures are both economic and diagnostically effective, thus meeting the principal requirements to screening programs. Screening of 8541 risk-groups patients helped detect 867 nodular formations, 244 of which were cancer and 623 benign formations. 8 refs., 3 figs.,
The comparative evaluation of film-screen combinations
International Nuclear Information System (INIS)
Choi, Gyung Ja; Choi, Syng Kyu
1988-01-01
This study was to compare the quality of image by different screen and film combinations. Using the sensitometer measured the speed and average gradient of blue sensitive films and orthochromatic films. The films was combined with rare earth screen LR, Lm, LF and conventional screen OM, OH, XOR, OKa and exposed the stepwedge to impulse 2, 3, 4, 6, 10, 15, 24, 38, 60 and measured the density. The following results were obtained: 1. The density of film and film-screen combinations showed significant difference, then in film-screen combinations was significantly different by the screens than films. 2. The speed of blue sensitive films was little different, the TMG of orthochromatic films producted high speed, and the AX films was high average gradient. 3. The relative speed of film-screen combinations showed significant difference, and was high in the OKa of the conventional screens and in the LR of the rare earth screens, especially that of LR screen in the combination with blue sensitive films was high. 4. The average gradient of film-screen combinations showed no significant difference, and was high in the OKa screen and LR/OG combination, and that of OKa/AX combination was highest. 5. The latitude of film-screen combinations showed significant difference by screens, and was high in the LM screen in combination with blue sensitive films and in the OM screen in combination with orthochromatic films. 6. The subject contrast of film-screen combinations showed significant difference by screen, and was high in the LR screen in combination with blue sensitive AX film and orthochromatic TMG film.
The In Situ Enzymatic Screening (ISES) Approach to Reaction Discovery and Catalyst Identification.
Swyka, Robert A; Berkowitz, David B
2017-12-14
The importance of discovering new chemical transformations and/or optimizing catalytic combinations has led to a flurry of activity in reaction screening. The in situ enzymatic screening (ISES) approach described here utilizes biological tools (enzymes/cofactors) to advance chemistry. The protocol interfaces an organic reaction layer with an adjacent aqueous layer containing reporting enzymes that act upon the organic reaction product, giving rise to a spectroscopic signal. ISES allows the experimentalist to rapidly glean information on the relative rates of a set of parallel organic/organometallic reactions under investigation, without the need to quench the reactions or draw aliquots. In certain cases, the real-time enzymatic readout also provides information on sense and magnitude of enantioselectivity and substrate specificity. This article contains protocols for single-well (relative rate) and double-well (relative rate/enantiomeric excess) ISES, in addition to a colorimetric ISES protocol and a miniaturized double-well procedure. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.
Smoking cessation and lung cancer screening
DEFF Research Database (Denmark)
Pedersen, Jesper Johannes Holst; Tønnesen, Philip; Ashraf, Haseem
2016-01-01
Smoking behavior may have a substantial influence on the overall effect of lung cancer screening. Non-randomized studies of smoking behavior during screening have indicated that computer tomography (CT) screening induces smoking cessation. Randomized studies have further elaborated that this effect...... and decrease smoking relapse rate. Also low smoking dependency and high motivation to quit smoking at baseline predicted smoking abstinence in screening trials. Lung cancer screening therefore seems to be a teachable moment for smoking cessation. Targeted smoking cessation counselling should be an integrated...... part of future lung cancer screening trials....
Panwar, Nishtha; Huang, Philemon; Lee, Jiaying; Keane, Pearse A; Chuan, Tjin Swee; Richhariya, Ashutosh; Teoh, Stephen; Lim, Tock Han; Agrawal, Rupesh
2016-03-01
The introduction of fundus photography has impacted retinal imaging and retinal screening programs significantly. Fundus cameras play a vital role in addressing the cause of preventive blindness. More attention is being turned to developing countries, where infrastructure and access to healthcare are limited. One of the major limitations for tele-ophthalmology is restricted access to the office-based fundus camera. Recent advances in access to telecommunications coupled with introduction of portable cameras and smartphone-based fundus imaging systems have resulted in an exponential surge in available technologies for portable fundus photography. Retinal cameras in the near future would have to cater to these needs by featuring a low-cost, portable design with automated controls and digitalized images with Web-based transfer. In this review, we aim to highlight the advances of fundus photography for retinal screening as well as discuss the advantages, disadvantages, and implications of the various technologies that are currently available.
Panwar, Nishtha; Huang, Philemon; Lee, Jiaying; Keane, Pearse A.; Chuan, Tjin Swee; Richhariya, Ashutosh; Teoh, Stephen; Lim, Tock Han
2016-01-01
Abstract Background: The introduction of fundus photography has impacted retinal imaging and retinal screening programs significantly. Literature Review: Fundus cameras play a vital role in addressing the cause of preventive blindness. More attention is being turned to developing countries, where infrastructure and access to healthcare are limited. One of the major limitations for tele-ophthalmology is restricted access to the office-based fundus camera. Results: Recent advances in access to telecommunications coupled with introduction of portable cameras and smartphone-based fundus imaging systems have resulted in an exponential surge in available technologies for portable fundus photography. Retinal cameras in the near future would have to cater to these needs by featuring a low-cost, portable design with automated controls and digitalized images with Web-based transfer. Conclusions: In this review, we aim to highlight the advances of fundus photography for retinal screening as well as discuss the advantages, disadvantages, and implications of the various technologies that are currently available. PMID:26308281
Newborn Screening for Severe Combined Immunodeficiency in 11 Screening Programs in the United States
Kwan, Antonia; Abraham, Roshini S.; Currier, Robert; Brower, Amy; Andruszewski, Karen; Abbott, Jordan K.; Baker, Mei; Ballow, Mark; Bartoshesky, Louis E.; Bonagura, Vincent R.; Bonilla, Francisco A.; Brokopp, Charles; Brooks, Edward; Caggana, Michele; Celestin, Jocelyn; Church, Joseph A.; Comeau, Anne Marie; Connelly, James A.; Cowan, Morton J.; Cunningham-Rundles, Charlotte; Dasu, Trivikram; Dave, Nina; De La Morena, Maria T.; Duffner, Ulrich; Fong, Chin-To; Forbes, Lisa; Freedenberg, Debra; Gelfand, Erwin W.; Hale, Jaime E.; Celine Hanson, I.; Hay, Beverly N.; Hu, Diana; Infante, Anthony; Johnson, Daisy; Kapoor, Neena; Kay, Denise M.; Kohn, Donald B.; Lee, Rachel; Lehman, Heather; Lin, Zhili; Lorey, Fred; Abdel-Mageed, Aly; Manning, Adrienne; McGhee, Sean; Moore, Theodore B.; Naides, Stanley J.; Notarangelo, Luigi D.; Orange, Jordan S.; Pai, Sung-Yun; Porteus, Matthew; Rodriguez, Ray; Romberg, Neil; Routes, John; Ruehle, Mary; Rubenstein, Arye; Saavedra-Matiz, Carlos A.; Scott, Ginger; Scott, Patricia M.; Secord, Elizabeth; Seroogy, Christine; Shearer, William T.; Siegel, Subhadra; Silvers, Stacy K.; Stiehm, E. Richard; Sugerman, Robert W.; Sullivan, John L.; Tanksley, Susan; Tierce, Millard L.; Verbsky, James; Vogel, Beth; Walker, Rosalyn; Walkovich, Kelly; Walter, Jolan E.; Wasserman, Richard L.; Watson, Michael S.; Weinberg, Geoffrey A.; Weiner, Leonard B.; Wood, Heather; Yates, Anne B.; Puck, Jennifer M.
2015-01-01
IMPORTANCE Newborn screening for severe combined immunodeficiency (SCID) using assays to detect T-cell receptor excision circles (TRECs) began in Wisconsin in 2008, and SCID was added to the national recommended uniform panel for newborn screened disorders in 2010. Currently 23 states, the District of Columbia, and the Navajo Nation conduct population-wide newborn screening for SCID. The incidence of SCID is estimated at 1 in 100 000 births. OBJECTIVES To present data from a spectrum of SCID newborn screening programs, establish population-based incidence for SCID and other conditions with T-cell lymphopenia, and document early institution of effective treatments. DESIGN Epidemiological and retrospective observational study. SETTING Representatives in states conducting SCID newborn screening were invited to submit their SCID screening algorithms, test performance data, and deidentified clinical and laboratory information regarding infants screened and cases with nonnormal results. Infants born from the start of each participating program from January 2008 through the most recent evaluable date prior to July 2013 were included. Representatives from 10 states plus the Navajo Area Indian Health Service contributed data from 3 030 083 newborns screened with a TREC test. MAIN OUTCOMES AND MEASURES Infants with SCID and other diagnoses of T-cell lymphopenia were classified. Incidence and, where possible, etiologies were determined. Interventions and survival were tracked. RESULTS Screening detected 52 cases of typical SCID, leaky SCID, and Omenn syndrome, affecting 1 in 58 000 infants (95%CI, 1/46 000-1/80 000). Survival of SCID-affected infants through their diagnosis and immune reconstitution was 87%(45/52), 92%(45/49) for infants who received transplantation, enzyme replacement, and/or gene therapy. Additional interventions for SCID and non-SCID T-cell lymphopenia included immunoglobulin infusions, preventive antibiotics, and avoidance of live vaccines. Variations in
International Nuclear Information System (INIS)
Kim, Hyea Young
2015-01-01
Lung cancer is the leading cause of cancer deaths worldwide as well as in Korea. A recent National Lung Screening Trial in U.S. revealed that low-dose CT (LDCT) screening reduced lung cancer specific mortality by 20% in high risk individuals as compared to chest radiograph screening. Based on this evidence, several expert societies in U.S. and Korean multisociety collaborative committee developed guidelines for recommendation of lung cancer screening using annual LDCT in high risk populations. In most of the societies high risk groups are defined as persons aged 55 to 74 years, who are current smokers with history of smoking of more than 30 packs per year or ex-smokers, who quit smoking up to 15 or more years ago. The benefits of LDCT screening are modestly higher than the harms in high risk individuals. The harms included a high rate of false-positive findings, over-diagnosis and radiation-related deaths. Invasive diagnostic procedure due to false positive findings may lead to complications. LDCT should be performed in qualified hospitals and interpreted by expert radiologists. Recently, the American College of Radiology released the current version of Lung cancer CT screening Reporting and Data Systems. Education and actions to stop smoking must be offered to current smokers
Energy Technology Data Exchange (ETDEWEB)
Kim, Hyea Young [Dept. of Radiology, Center for Lung Cancer, National Cancer Center, Goyang (Korea, Republic of)
2015-09-15
Lung cancer is the leading cause of cancer deaths worldwide as well as in Korea. A recent National Lung Screening Trial in U.S. revealed that low-dose CT (LDCT) screening reduced lung cancer specific mortality by 20% in high risk individuals as compared to chest radiograph screening. Based on this evidence, several expert societies in U.S. and Korean multisociety collaborative committee developed guidelines for recommendation of lung cancer screening using annual LDCT in high risk populations. In most of the societies high risk groups are defined as persons aged 55 to 74 years, who are current smokers with history of smoking of more than 30 packs per year or ex-smokers, who quit smoking up to 15 or more years ago. The benefits of LDCT screening are modestly higher than the harms in high risk individuals. The harms included a high rate of false-positive findings, over-diagnosis and radiation-related deaths. Invasive diagnostic procedure due to false positive findings may lead to complications. LDCT should be performed in qualified hospitals and interpreted by expert radiologists. Recently, the American College of Radiology released the current version of Lung cancer CT screening Reporting and Data Systems. Education and actions to stop smoking must be offered to current smokers.
Toward forward genetic screens in malaria-causing parasites using the piggyBac transposon
Directory of Open Access Journals (Sweden)
de Koning-Ward Tania F
2011-03-01
Full Text Available Abstract The ability to analyze gene function in malaria-causing Plasmodium parasites has received a boost with a recent paper in BMC Genomics that describes a genome-wide mutagenesis system in the rodent malaria species Plasmodium berghei using the transposon piggyBac. This advance holds promise for identifying and validating new targets for intervention against malaria. But further improvements are still needed for the full power of genome-wide molecular genetic screens to be utilized in this organism. See research article: http://www.biomedcentral.com/1471-2164/12/155
Wood, Molly F; Hughes, Sarah C; Hache, Lauren P; Naylor, Edwin W; Abdel-Hamid, Hoda Z; Barmada, M Michael; Dobrowolski, Steven F; Stickler, David E; Clemens, Paula R
2014-06-01
Disease inclusion in the newborn screening (NBS) panel should consider the opinions of those most affected by the outcome of screening. We assessed the level and factors that affect parent attitudes regarding NBS panel inclusion of Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), and spinal muscular atrophy (SMA). The attitudes toward NBS for DMD, BMD, and SMA were surveyed and compared for 2 categories of parents, those with children affected with DMD, BMD, or SMA and expectant parents unselected for known family medical history. The level of support for NBS for DMD, BMD, and SMA was 95.9% among parents of children with DMD, BMD, or SMA and 92.6% among expectant parents. There was strong support for NBS for DMD, BMD, and SMA in both groups of parents. Given advances in diagnostics and promising therapeutic approaches, discussion of inclusion in NBS should continue. Copyright © 2013 Wiley Periodicals, Inc.
Study of the usefulness of large intestine screening inspections using multi-slice CT (MSCT)
International Nuclear Information System (INIS)
Yamasaki, Michihiro; Nonogaki, Hidehiko; Hara, Koji; Naruse, Yutaka; Hara, Hiroto; Suematsu, Seiji; Yanase, Tadahiko; Otou, Taiji
2005-01-01
CT-colonography (CT-C), a new diagnostic imaging technique for cancer of the large intestine-which is increasing rapidly owing to westernized eating habits-has advanced from the developmental stage to the stage of practical application, thanks to progress in MSCT and workstation development. Therefore, based on the results of CT-C application using 16 lines of MSCT to a screening test, we reviewed the usefulness of CT-C in our clinic. We supplemented defective depiction, and found that change of position was effective for virtual image exclusion. We consider that CT-C can support diagnosis if the target of screening tests is a polypoid lesion of more than 6 mm. In addition, it is expected that the number of examinations performed during office visits will increase because of the decreased invasiveness of the procedure, its lack of pain, and its ability to provide early lesion detection. (author)
Keenan, Martine; Alexander, Paul W; Chaplin, Jason H; Abbott, Michael J; Diao, Hugo; Wang, Zhisen; Best, Wayne M; Perez, Catherine J; Cornwall, Scott M J; Keatley, Sarah K; Thompson, R C Andrew; Charman, Susan A; White, Karen L; Ryan, Eileen; Chen, Gong; Ioset, Jean-Robert; von Geldern, Thomas W; Chatelain, Eric
2013-10-01
Inhibitors of Trypanosoma cruzi with novel mechanisms of action are urgently required to diversify the current clinical and preclinical pipelines. Increasing the number and diversity of hits available for assessment at the beginning of the discovery process will help to achieve this aim. We report the evaluation of multiple hits generated from a high-throughput screen to identify inhibitors of T. cruzi and from these studies the discovery of two novel series currently in lead optimization. Lead compounds from these series potently and selectively inhibit growth of T. cruzi in vitro and the most advanced compound is orally active in a subchronic mouse model of T. cruzi infection. High-throughput screening of novel compound collections has an important role to play in diversifying the trypanosomatid drug discovery portfolio. A new T. cruzi inhibitor series with good drug-like properties and promising in vivo efficacy has been identified through this process.
Measuring lip force by oral screens. Part 1: Importance of screen size and individual variability.
Wertsén, Madeleine; Stenberg, Manne
2017-06-01
To reduce drooling and facilitate food transport in rehabilitation of patients with oral motor dysfunction, lip force can be trained using an oral screen. Longitudinal studies evaluating the effect of training require objective methods. The aim of this study was to evaluate a method for measuring lip strength, to investigate normal values and fluctuation of lip force in healthy adults on 1 occasion and over time, to study how the size of the screen affects the force, to evaluate the most appropriate measure of reliability, and to identify force performed in relation to gender. Three different sizes of oral screens were used to measure the lip force for 24 healthy adults on 3 different occasions, during a period of 6 months, using an apparatus based on strain gauge. The maximum lip force as evaluated with this method depends on the area of the screen size. By calculating the projected area of the screen, the lip force could be normalized to an oral screen pressure quantity expressed in kPa, which can be used for comparing measurements from screens with different sizes. Both the mean value and standard deviation were shown to vary between individuals. The study showed no differences regarding gender and only small variation with age. Normal variation over time (months) may be up to 3 times greater than the standard error of measurement at a certain occasion. The lip force increases in relation to the projected area of the screen. No general standard deviation can be assigned to the method and all measurements should be analyzed individually based on oral screen pressure to compensate for different screen sizes.
[Organized breast cancer screening].
Rouëssé, Jacques; Sancho-Garnier, Hélèn
2014-02-01
Breast screening programs are increasingly controversial, especially regarding two points: the number of breast cancer deaths they avoid, and the problem of over-diagnosis and over-treatment. The French national breast cancer screening program was extended to cover the whole country in 2004. Ten years later it is time to examine the risk/benefit ratio of this program and to discuss the need for change. Like all forms of cancer management, screening must be regularly updated, taking into account the state of the art, new evidence, and uncertainties. All screening providers should keep themselves informed of the latest findings. In the French program, women aged 50-74 with no major individual or familial risk factors for breast cancer are offered screening mammography and clinical breast examination every two years. Images considered non suspicious of malignancy by a first reader are re-examined by a second reader. The devices and procedures are subjected to quality controls. Participating radiologists (both public and private) are required to read at least 500 mammographies per year. The program's national participation rate was 52.7 % in 2012. When individual screening outside of the national program is taken into account (nearly 15 % of women), coverage appears close to the European recommendation of 65 %. Breast cancer mortality has been falling in France by 0.6 % per year for over 30 years, starting before mass screening was implemented, and by 1.5 % since 2005. This decline can be attributed in part to earlier diagnosis and better treatment, so that the specific impact of screening cannot easily be measured. Over-treatment, defined as the detection and treatment of low-malignancy tumors that would otherwise not have been detected in a person's lifetime, is a major negative effect of screening, but its frequency is not precisely known (reported to range from 1 % to 30 %). In view of these uncertainties, it would be advisable to modify the program in order to
Teaching Chinese Film in an Advanced Language Class
Directory of Open Access Journals (Sweden)
Luying Chen
2011-04-01
Full Text Available Instructors often face a dilemma when using film in language classes. While film is appealing for the rich cultural and linguistic information it offers, finding the balance between teaching content and building language skills can present significant challenges for an instructor. Common approaches to using film in courses taught in English, such as screening one film a week, reading critical essays about the films, and class discussions and lectures, seldom offer the same benefits in a foreign language course due to the fact that students with only three years of foreign language study frequently lack the language skills necessary to discuss films in a foreign language. Yanfang Tang and Qianghai Chen, authors of the textbook 'Advanced Chinese: Intention, Strategy, & Communication '(2005, have argued that “[n]either interpreting textual meanings nor decoding linguistic patterns leads naturally to the productive skills needed” for communicating in the target language at the advanced level. They further suggest that “practice, in a conscious but meaningful way is the key to successful transformation of input knowledge into productive output skills.”
Factors Influencing Colorectal Cancer Screening Participation
Directory of Open Access Journals (Sweden)
Antonio Z. Gimeno García
2012-01-01
Full Text Available Colorectal cancer (CRC is a major health problem worldwide. Although population-based CRC screening is strongly recommended in average-risk population, compliance rates are still far from the desirable rates. High levels of screening uptake are necessary for the success of any screening program. Therefore, the investigation of factors influencing participation is crucial prior to design and launches a population-based organized screening campaign. Several studies have identified screening behaviour factors related to potential participants, providers, or health care system. These influencing factors can also be classified in non-modifiable (i.e., demographic factors, education, health insurance, or income and modifiable factors (i.e., knowledge about CRC and screening, patient and provider attitudes or structural barriers for screening. Modifiable determinants are of great interest as they are plausible targets for interventions. Interventions at different levels (patient, providers or health care system have been tested across the studies with different results. This paper analyzes factors related to CRC screening behaviour and potential interventions designed to improve screening uptake.
Advanced supersonic propulsion study, phases 3 and 4. [variable cycle engines
Allan, R. D.; Joy, W.
1977-01-01
An evaluation of various advanced propulsion concepts for supersonic cruise aircraft resulted in the identification of the double-bypass variable cycle engine as the most promising concept. This engine design utilizes special variable geometry components and an annular exhaust nozzle to provide high take-off thrust and low jet noise. The engine also provides good performance at both supersonic cruise and subsonic cruise. Emission characteristics are excellent. The advanced technology double-bypass variable cycle engine offers an improvement in aircraft range performance relative to earlier supersonic jet engine designs and yet at a lower level of engine noise. Research and technology programs required in certain design areas for this engine concept to realize its potential benefits include refined parametric analysis of selected variable cycle engines, screening of additional unconventional concepts, and engine preliminary design studies. Required critical technology programs are summarized.
DEFF Research Database (Denmark)
Grønvold, Mogens; Petersen, Morten Aagaard; Damkier, Anette
2017-01-01
with advanced cancer were screened for palliative needs. Patients with scores exceeding a predefined threshold for problems with physical, emotional or role function, or nausea/vomiting, pain, dyspnoea or lack of appetite according to the European Organisation for Research and Treatment of Cancer Quality...
Advanced Light Source beam diagnostics systems
International Nuclear Information System (INIS)
Hinkson, J.
1993-10-01
The Advanced Light Source (ALS), a third-generation synchrotron light source, has been recently commissioned. Beam diagnostics were very important to the success of the operation. Each diagnostic system is described in this paper along with detailed discussion of its performance. Some of the systems have been in operation for two years. Others, in the storage ring, have not yet been fully commissioned. These systems were, however, working well enough to provide the essential information needed to store beam. The devices described in this paper include wall current monitors, a beam charge monitor, a 50 ohm Faraday cup, DC current transformers, broad-hand striplines, fluorescence screens, beam collimators and scrapers, and beam position monitors. Also, the means by which waveforms are digitized and displayed in the control room is discussed
Dietz, C.; Swinkels, S.H.N.; Daalen, E. van; Engeland, H.M. van; Buitelaar, J.K.
2006-01-01
A two-stage protocol for screening for autistic spectrum disorders (ASD) was evaluated in a random population of 31,724 children aged 14-15 months. Children were first pre-screened by physicians at well-baby clinics using a 4-item screening instrument. Infants that screened positive were then
Frischbier, H J
1994-01-01
The results of screening studies conducted in the United States and in Europe in females between the ages of 40 and 50 are analysed. It is shown, that the results of this study on mortality reduction are less favourable, the poorer the technique of mammography (foregoing of general two-view mammography) and the longer the time interval between two mammography screenings. Arguments are presented, that are brought forward when declining to perform general mammography screening in this age group. The author's own results, obtained in the Hamburg mammography screening study, which included from 1971 to 1986 also premenopausal women, show, that the survival rates of patients below 50 years of age with mammographically detected carcinomas of the breast do not differ from those in patients older than 50 years, according to a relevant age group classification. The advances in the technique of mammography in recent years are analysed on the basis of the author's own patient material. It is evident, that the positive predictive value has been doubled, especially in the age group between 40 and 50. An analysis of the distribution of diagnosed noninvasive carcinomas compared with the invasive carcinomas reveals, that particularly this age group has the highest percentage of identification of prognostically favourable carcinoma stages. Further analyses show, why the randomised European mammography studies could not yield a significant mortality rate improvement. A prerequisite for the inclusion of mammography screening in the legally prescribed early detection of carcinoma examinations, however, are the quality controls, whose realisation, in our health system, will have to be confirmed by the German mammography study.
Anti-nuclear antibody screening using HEp-2 cells.
Buchner, Carol; Bryant, Cassandra; Eslami, Anna; Lakos, Gabriella
2014-06-23
The American College of Rheumatology position statement on ANA testing stipulates the use of IIF as the gold standard method for ANA screening(1). Although IIF is an excellent screening test in expert hands, the technical difficulties of processing and reading IIF slides--such as the labor intensive slide processing, manual reading, the need for experienced, trained technologists and the use of dark room--make the IIF method difficult to fit in the workflow of modern, automated laboratories. The first and crucial step towards high quality ANA screening is careful slide processing. This procedure is labor intensive, and requires full understanding of the process, as well as attention to details and experience. Slide reading is performed by fluorescent microscopy in dark rooms, and is done by trained technologists who are familiar with the various patterns, in the context of cell cycle and the morphology of interphase and dividing cells. Provided that IIF is the first line screening tool for SARD, understanding the steps to correctly perform this technique is critical. Recently, digital imaging systems have been developed for the automated reading of IIF slides. These systems, such as the NOVA View Automated Fluorescent Microscope, are designed to streamline the routine IIF workflow. NOVA View acquires and stores high resolution digital images of the wells, thereby separating image acquisition from interpretation; images are viewed an interpreted on high resolution computer monitors. It stores images for future reference and supports the operator's interpretation by providing fluorescent light intensity data on the images. It also preliminarily categorizes results as positive or negative, and provides pattern recognition for positive samples. In summary, it eliminates the need for darkroom, and automates and streamlines the IIF reading/interpretation workflow. Most importantly, it increases consistency between readers and readings. Moreover, with the use of barcoded
Directory of Open Access Journals (Sweden)
Gregory D. Bowden
2018-04-01
Full Text Available The apicomplexan parasite Sarcocystis neurona is the primary etiologic agent of equine protozoal myeloencephalitis (EPM, a serious neurologic disease of horses. Many horses in the U.S. are at risk of developing EPM; approximately 50% of all horses in the U.S. have been exposed to S. neurona and treatments for EPM are 60–70% effective. Advancement of treatment requires new technology to identify new drugs for EPM. To address this critical need, we developed, validated, and implemented a high-throughput screen to test 725 FDA-approved compounds from the NIH clinical collections library for anti-S. neurona activity. Our screen identified 18 compounds with confirmed inhibitory activity against S. neurona growth, including compounds active in the nM concentration range. Many identified inhibitory compounds have well-defined mechanisms of action, making them useful tools to study parasite biology in addition to being potential therapeutic agents. In comparing the activity of inhibitory compounds identified by our screen to that of other screens against other apicomplexan parasites, we found that most compounds (15/18; 83% have activity against one or more related apicomplexans. Interestingly, nearly half (44%; 8/18 of the inhibitory compounds have reported activity against dopamine receptors. We also found that dantrolene, a compound already formulated for horses with a peak plasma concentration of 37.8 ± 12.8 ng/ml after 500 mg dose, inhibits S. neurona parasites at low concentrations (0.065 μM [0.036–0.12; 95% CI] or 21.9 ng/ml [12.1–40.3; 95% CI]. These studies demonstrate the use of a new tool for discovering new chemotherapeutic agents for EPM and potentially providing new reagents to elucidate biologic pathways required for successful S. neurona infection. Keywords: Drug repurposing, High-throughput screen, Sarcocystis neurona, Equine protozoal myeloencephalitis