WorldWideScience

Sample records for shrna screens advance

  1. A genome-wide shRNA screen identifies GAS1 as a novel melanoma metastasis suppressor gene.

    Science.gov (United States)

    Gobeil, Stephane; Zhu, Xiaochun; Doillon, Charles J; Green, Michael R

    2008-11-01

    Metastasis suppressor genes inhibit one or more steps required for metastasis without affecting primary tumor formation. Due to the complexity of the metastatic process, the development of experimental approaches for identifying genes involved in metastasis prevention has been challenging. Here we describe a genome-wide RNAi screening strategy to identify candidate metastasis suppressor genes. Following expression in weakly metastatic B16-F0 mouse melanoma cells, shRNAs were selected based upon enhanced satellite colony formation in a three-dimensional cell culture system and confirmed in a mouse experimental metastasis assay. Using this approach we discovered 22 genes whose knockdown increased metastasis without affecting primary tumor growth. We focused on one of these genes, Gas1 (Growth arrest-specific 1), because we found that it was substantially down-regulated in highly metastatic B16-F10 melanoma cells, which contributed to the high metastatic potential of this mouse cell line. We further demonstrated that Gas1 has all the expected properties of a melanoma tumor suppressor including: suppression of metastasis in a spontaneous metastasis assay, promotion of apoptosis following dissemination of cells to secondary sites, and frequent down-regulation in human melanoma metastasis-derived cell lines and metastatic tumor samples. Thus, we developed a genome-wide shRNA screening strategy that enables the discovery of new metastasis suppressor genes.

  2. shRNA screening identifies JMJD1C as being required for leukemia maintenance

    DEFF Research Database (Denmark)

    Sroczynska, Patrycja; Cruickshank, V Adam; Bukowski, John-Paul

    2014-01-01

    Epigenetic regulatory mechanisms are implicated in the pathogenesis of acute myeloid and lymphoid leukemia (AML and ALL). Recent progress suggests that proteins involved in epigenetic control are amenable to drug intervention, but little is known about the cancer-specific dependency on epigenetic...... candidate drug targets identified in these screens was Jmjd1c. Depletion of Jmjd1c impairs growth and colony formation of mouse MLL-AF9 cells in vitro, as well as establishment of leukemia after transplantation. Depletion of JMJD1C impairs expansion and colony formation of human leukemic cell lines......, with the strongest effect observed in the MLL-rearranged ALL cell line, SEM. In both mouse and human leukemic cells, the growth defect upon JMJD1C depletion appears to be primarily due to increased apoptosis, which implicates JMJD1C as a potential therapeutic target in leukemia....

  3. Kinome-wide shRNA Screen Identifies the Receptor Tyrosine Kinase AXL as a Key Regulator for Mesenchymal Glioblastoma Stem-like Cells

    Directory of Open Access Journals (Sweden)

    Peng Cheng

    2015-05-01

    Full Text Available Glioblastoma is a highly lethal cancer for which novel therapeutics are urgently needed. Two distinct subtypes of glioblastoma stem-like cells (GSCs were recently identified: mesenchymal (MES and proneural (PN. To identify mechanisms to target the more aggressive MES GSCs, we combined transcriptomic expression analysis and kinome-wide short hairpin RNA screening of MES and PN GSCs. In comparison to PN GSCs, we found significant upregulation and phosphorylation of the receptor tyrosine kinase AXL in MES GSCs. Knockdown of AXL significantly decreased MES GSC self-renewal capacity in vitro and inhibited the growth of glioblastoma patient-derived xenografts. Moreover, inhibition of AXL with shRNA or pharmacologic inhibitors also increased cell death significantly more in MES GSCs. Clinically, AXL expression was elevated in the MES GBM subtype and significantly correlated with poor prognosis in multiple cancers. In conclusion, we identified AXL as a potential molecular target for novel approaches to treat glioblastoma and other solid cancers.

  4. Novel HIV-1 knockdown targets identified by an enriched kinases/phosphatases shRNA library using a long-term iterative screen in Jurkat T-cells.

    Directory of Open Access Journals (Sweden)

    Sylvie Rato

    2010-02-01

    Full Text Available HIV-1 is a complex retrovirus that uses host machinery to promote its replication. Understanding cellular proteins involved in the multistep process of HIV-1 infection may result in the discovery of more adapted and effective therapeutic targets. Kinases and phosphatases are a druggable class of proteins critically involved in regulation of signal pathways of eukaryotic cells. Here, we focused on the discovery of kinases and phosphatases that are essential for HIV-1 replication but dispensable for cell viability. We performed an iterative screen in Jurkat T-cells with a short-hairpin-RNA (shRNA library highly enriched for human kinases and phosphatases. We identified 14 new proteins essential for HIV-1 replication that do not affect cell viability. These proteins are described to be involved in MAPK, JNK and ERK pathways, vesicular traffic and DNA repair. Moreover, we show that the proteins under study are important in an early step of HIV-1 infection before viral integration, whereas some of them affect viral transcription/translation. This study brings new insights for the complex interplay of HIV-1/host cell and opens new possibilities for antiviral strategies.

  5. Advances in cervical screening technology.

    Science.gov (United States)

    Stoler, M H

    2000-03-01

    The Pap smear unquestionably is a successful screening test for cervical cancer. However, recent advances in technology have raised questions regarding whether the conventional Pap smear is still the standard of care. This article relates issues of screening and cost-effectiveness to the state of the art in thin layer preparations, cytology automation, human papillomavirus screening, human papillomavirus vaccines, and other cervical screening adjuncts. Perhaps nowhere in medicine is clinical decision making being more strongly influenced by market and other external forces than in cervical cytopathology.

  6. Advanced breast cancer and its prevention by screening

    NARCIS (Netherlands)

    de Koning, H. J.; van Ineveld, B. M.; de Haes, J. C.; van Oortmarssen, G. J.; Klijn, J. G.; van der Maas, P. J.

    1992-01-01

    In discussions on breast cancer screening, much attention has been focussed on the possible morbidity generated by screening. Favourable effects like the prevention of advanced disease seem underestimated, probably because quantification is that difficult. To analyse the amount of care and treatment

  7. Advances in CRC prevention: screening and surveillance

    NARCIS (Netherlands)

    Dekker, Evelien; Rex, Douglas K.

    2018-01-01

    Colorectal cancer (CRC) is amongst the most commonly diagnosed cancers and causes of death from cancer across the world. CRC can, however, be detected in asymptomatic patients at a curable stage, and several studies have shown lower mortality among patients who undergo screening compared to those

  8. Advances in CRC Prevention: Screening and Surveillance.

    Science.gov (United States)

    Dekker, Evelien; Rex, Douglas K

    2018-05-01

    Colorectal cancer (CRC) is among the most commonly diagnosed cancers and causes of death from cancer across the world. CRC can, however, be detected in asymptomatic patients at a curable stage, and several studies have shown lower mortality among patients who undergo screening compared with those who do not. Using colonoscopy in CRC screening also results in the detection of precancerous polyps that can be directly removed during the procedure, thereby reducing the incidence of cancer. In the past decade, convincing evidence has appeared that the effectiveness of colonoscopy as CRC prevention tool is associated with the quality of the procedure. This review aims to provide an up-to-date overview of recent efforts to improve colonoscopy effectiveness by enhancing detection and improving the completeness and safety of resection of colorectal lesions. Copyright © 2018 AGA Institute. Published by Elsevier Inc. All rights reserved.

  9. Advances in preimplantation genetic diagnosis/screening.

    Science.gov (United States)

    Yan, LiYing; Wei, Yuan; Huang, Jin; Zhu, XiaoHui; Shi, XiaoDan; Xia, Xi; Yan, Jie; Lu, CuiLing; Lian, Ying; Li, Rong; Liu, Ping; Qiao, Jie

    2014-07-01

    Preimplantation genetic diagnosis (PGD) gives couples who have a high risk of transmitting genetic disorders to their baby the chance to have a healthy offspring through embryo genetic analysis and selection. Preimplantation genetic screening (PGS) is an effective method to select euploid embryos that may prevent repeated implantation failure or miscarriage. However, how and to whom PGS should be provided is a controversial topic. The first successful case of PGD of a human being was reported in 1990, and there have been tremendous improvements in this technology since then. Both embryo biopsy and genetic technologies have been improved dramatically, which increase the accuracy and expand the indications of PGD/PGS.

  10. Fragment screening by SPR and advanced application to GPCRs.

    Science.gov (United States)

    Shepherd, Claire A; Hopkins, Andrew L; Navratilova, Iva

    2014-01-01

    Surface plasmon resonance (SPR) is one of the primary biophysical methods for the screening of low molecular weight 'fragment' libraries, due to its low protein consumption and 'label-free' methodology. SPR biosensor interaction analysis is employed to both screen and confirm the binding of compounds in fragment screening experiments, as it provides accurate information on the affinity and kinetics of molecular interactions. The most advanced application of the use of SPR for fragment screening is against membrane protein drug targets, such G-protein coupled receptors (GPCRs). Biophysical GPCR assays using SPR have been validated with pharmacological measurements approximate to cell-based methods, yet provide the advantage of biophysical methods in their ability to measure the weak affinities of low molecular weight fragments. A number of SPR fragment screens against GPCRs have now been disclosed in the literature. SPR fragment screening is proving versatile to screen both thermostabilised GPCRs and solubilised wild type receptors. In this chapter, we discuss the state-of-the-art in GPCR fragment screening by SPR and the technical considerations in performing such experiments. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  11. 77 FR 65395 - Air Cargo Advance Screening (ACAS) Pilot Program

    Science.gov (United States)

    2012-10-26

    ... DEPARTMENT OF HOMELAND SECURITY U.S. Customs and Border Protection Air Cargo Advance Screening (ACAS) Pilot Program Correction In notice document 2012-26031 appearing on pages 65006-65009 in the issue of October 24, 2012 make the following correction: On page 65007, in the first column, under the...

  12. A simple and robust vector-based shRNA expression system used for RNA interference.

    Science.gov (United States)

    Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi

    2013-01-01

    RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

  13. A simple and robust vector-based shRNA expression system used for RNA interference.

    Directory of Open Access Journals (Sweden)

    Xue-jun Wang

    Full Text Available BACKGROUND: RNA interference (RNAi mediated by small interfering RNAs (siRNAs or short hairpin RNAs (shRNAs has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. RESULTS: In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. CONCLUSION: This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

  14. Predictors of advanced colorectal neoplasia for colorectal cancer screening.

    Science.gov (United States)

    Wong, Martin C S; Lam, Thomas Y T; Tsoi, Kelvin K F; Chan, Victor C W; Hirai, Hoyee W; Ching, Jessica Y L; Sung, Joseph J Y

    2014-05-01

    The Asia-Pacific Colorectal Screening (APCS) score based on age, gender, family history, and smoking is useful to predict advanced colorectal neoplasia (ACN) in asymptomatic Asian subjects. To evaluate the factors in addition to those of APCS associated with ACN colonoscopic findings. Data from 5,220 asymptomatic subjects aged between 50 and 70 years who underwent screening colonoscopy in a community center between 2008 and 2012 were analyzed. One binary logistic regression analysis was conducted in 2013 with the presence of ACN or cancer as the outcome, controlling for APCS score, alcohol consumption, BMI, hypertension, and other chronic diseases as independent variables. The average participant age was 57.7 years (SD=4.9) and 47.5% were men. Advanced neoplasms or cancers were identified at colonoscopy in 5.6% of all screening participants. From multivariate regression analysis, APCS score≥4 (adjusted OR [AOR]=1.74, 95% CI=1.34, 2.25, pstatistic of APCS score alone was 0.560 (95% CI=0.524, 0.595, p=0.001) and that of APCS score plus BMI, hypertension, and alcohol consumption was 0.613 (95% CI=0.578, 0.648, p<0.001). Alcohol consumption, hypertension, and BMI are independent predictors of ACN, which could be incorporated into the APCS for prioritizing Asian asymptomatic subjects for colorectal cancer screening. Copyright © 2014. Published by Elsevier Inc.

  15. Costs of Finding an Advanced Adenoma in Colorectal Screening

    Directory of Open Access Journals (Sweden)

    Jerome B Simon

    2004-01-01

    Full Text Available The authors used computerized decision analysis to estimate the costs of finding and removing an advanced colonic adenoma in patients referred because of a positive fecal occult blood test. An advanced adenoma was defined as a villous adenoma, a tubular adenoma 10 mm or more in size, or a lesion that harboured highgrade dysplasia or cancer. Four strategies were compared: flexible sigmoidoscopy, flexible sigmoidoscopy plus air contrast barium enema, virtual colonoscopy (CT colography and colonoscopy. Colonoscopy with polypectomy was undertaken if any of the methods detected a polyp. Probabilities and test characteristics were determined from the literature, and costs were estimated from the provincial fee schedule (Ontario and local hospital sources. With an assumed 17% probability of an advanced adenoma being present, sigmoidoscopy was the most cost effective strategy at $1930 to find and clear an advanced lesion, but the procredure missed between one-third and almost one-half of the lesions, depending on the depth of insertion. At $2290, colonoscopy was slightly more expensive than sigmoidoscopy and more cost effective than either sigmoidoscopy plus barium enema ($2840 or virtual colonoscopy ($3681, neither of which detected as many advanced adenomas. The authors concluded that colonoscopy is the preferred investigative strategy and that improved access to colonoscopy is an important goal for occult blood screening programs.

  16. Construction of lentiviral shRNA expression vector targeting ...

    African Journals Online (AJOL)

    DNA oligo was cloned into lentiviral expression vector, and then polymerase chain reaction (PCR) and sequencing analyses were conducted to verify the constructs. The verified vectors were co-transfected into 293FT cells that could produce lentiviral. shRNA lentiviruses from the selected constructs were propagated and ...

  17. Construction of lentiviral shRNA expression vector targeting ...

    African Journals Online (AJOL)

    ajl yemi

    2011-10-26

    Oct 26, 2011 ... was then selected, while the titer of lentiviral packing PLD2-shRNA was 3.47 × 104 TU/ml and the virus was successfully ... MATERIALS AND METHODS .... such as: transfecting cells not only in mitotic active phase but also in ...

  18. Advances in High Throughput Screening of Biomass Recalcitrance (Poster)

    Energy Technology Data Exchange (ETDEWEB)

    Turner, G. B.; Decker, S. R.; Tucker, M. P.; Law, C.; Doeppke, C.; Sykes, R. W.; Davis, M. F.; Ziebell, A.

    2012-06-01

    This was a poster displayed at the Symposium. Advances on previous high throughput screening of biomass recalcitrance methods have resulted in improved conversion and replicate precision. Changes in plate reactor metallurgy, improved preparation of control biomass, species-specific pretreatment conditions, and enzymatic hydrolysis parameters have reduced overall coefficients of variation to an average of 6% for sample replicates. These method changes have improved plate-to-plate variation of control biomass recalcitrance and improved confidence in sugar release differences between samples. With smaller errors plant researchers can have a higher degree of assurance more low recalcitrance candidates can be identified. Significant changes in plate reactor, control biomass preparation, pretreatment conditions and enzyme have significantly reduced sample and control replicate variability. Reactor plate metallurgy significantly impacts sugar release aluminum leaching into reaction during pretreatment degrades sugars and inhibits enzyme activity. Removal of starch and extractives significantly decreases control biomass variability. New enzyme formulations give more consistent and higher conversion levels, however required re-optimization for switchgrass. Pretreatment time and temperature (severity) should be adjusted to specific biomass types i.e. woody vs. herbaceous. Desalting of enzyme preps to remove low molecular weight stabilizers and improved conversion levels likely due to water activity impacts on enzyme structure and substrate interactions not attempted here due to need to continually desalt and validate precise enzyme concentration and activity.

  19. Design and screening of nanoprecipitates-strengthened advanced ferritic alloys

    Energy Technology Data Exchange (ETDEWEB)

    Tan, Lizhen [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Yang, Ying [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Chen, Tianyi [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Sridharan, K. [Univ. of Wisconsin, Madison, WI (United States); He, Li [Univ. of Wisconsin, Madison, WI (United States)

    2016-12-30

    Advanced nuclear reactors as well as the life extension of light water reactors require advanced alloys capable of satisfactory operation up to neutron damage levels approaching 200 displacements per atom (dpa). Extensive studies, including fundamental theories, have demonstrated the superior resistance to radiation-induced swelling in ferritic steels, primarily inherited from their body-centered cubic (bcc) structure. This study aims at developing nanoprecipitates strengthened advanced ferritic alloys for advanced nuclear reactor applications. To be more specific, this study aims at enhancing the amorphization ability of some precipitates, such as Laves phase and other types of intermetallic phases, through smart alloying strategy, and thereby promote the crystalline®amorphous transformation of these precipitates under irradiation.

  20. Advances in Predictive Toxicology for Discovery Safety through High Content Screening.

    Science.gov (United States)

    Persson, Mikael; Hornberg, Jorrit J

    2016-12-19

    High content screening enables parallel acquisition of multiple molecular and cellular readouts. In particular the predictive toxicology field has progressed from the advances in high content screening, as more refined end points that report on cellular health can be studied in combination, at the single cell level, and in relatively high throughput. Here, we discuss how high content screening has become an essential tool for Discovery Safety, the discipline that integrates safety and toxicology in the drug discovery process to identify and mitigate safety concerns with the aim to design drug candidates with a superior safety profile. In addition to customized mechanistic assays to evaluate target safety, routine screening assays can be applied to identify risk factors for frequently occurring organ toxicities. We discuss the current state of high content screening assays for hepatotoxicity, cardiotoxicity, neurotoxicity, nephrotoxicity, and genotoxicity, including recent developments and current advances.

  1. Advanced Lung Cancer Screening: An Individualized Molecular Nanotechnology Approach

    Science.gov (United States)

    2016-03-01

    proportion of smokers , former 146 smokers and never smokers was not different between cases and controls. 147 Detection of DNA Methylation 148 We...highest risk smokers for an expensive screening modality such as CT scanning. Hypothesis: DNA methylation testing is more specific in selecting those...with non -cancerous nodules, and have completed the writing of a manuscript containing these results. The abstract of that manuscript is as follows

  2. Genetic and epigenetic markers in colorectal cancer screening: recent advances.

    Science.gov (United States)

    Singh, Manish Pratap; Rai, Sandhya; Suyal, Shradha; Singh, Sunil Kumar; Singh, Nand Kumar; Agarwal, Akash; Srivastava, Sameer

    2017-07-01

    Colorectal cancer (CRC) is a heterogenous disease which develops from benign intraepithelial lesions known as adenomas to malignant carcinomas. Acquired alterations in Wnt signaling, TGFβ, MAPK pathway genes and clonal propagation of altered cells are responsible for this transformation. Detection of adenomas or early stage cancer in asymptomatic patients and better prognostic and predictive markers is important for improving the clinical management of CRC. Area covered: In this review, the authors have evaluated the potential of genetic and epigenetic alterations as markers for early detection, prognosis and therapeutic predictive potential in the context of CRC. We have discussed molecular heterogeneity present in CRC and its correlation to prognosis and response to therapy. Expert commentary: Molecular marker based CRC screening methods still fail to gain trust of clinicians. Invasive screening methods, molecular heterogeneity, chemoresistance and low quality test samples are some key challenges which need to be addressed in the present context. New sequencing technologies and integrated omics data analysis of individual or population cohort results in GWAS. MPE studies following a GWAS could be future line of research to establish accurate correlations between CRC and its risk factors. This strategy would identify most reliable biomarkers for CRC screening and management.

  3. Blunt Cerebrovascular Injuries: Advances in Screening, Imaging, and Management Trends.

    Science.gov (United States)

    Nagpal, P; Policeni, B A; Bathla, G; Khandelwal, A; Derdeyn, C; Skeete, D

    2017-10-12

    Blunt cerebrovascular injury is a relatively uncommon but sometimes life-threatening injury, particularly in patients presenting with ischemic symptoms in that vascular territory. The decision to pursue vascular imaging (generally CT angiography) is based on clinical and imaging findings. Several grading scales or screening criteria have been developed to guide the decision to pursue vascular imaging, as well as to recommend different treatment options for various injuries. The data supporting many of these guidelines and options are limited however. The purpose of this article is to review and compare these scales and criteria and the data supporting clinical efficacy and to make recommendations for future research in this area. © 2017 by American Journal of Neuroradiology.

  4. Recent advances in preimplantation genetic diagnosis and screening.

    Science.gov (United States)

    Lu, Lina; Lv, Bo; Huang, Kevin; Xue, Zhigang; Zhu, Xianmin; Fan, Guoping

    2016-09-01

    Preimplantation genetic diagnosis/screening (PGD/PGS) aims to help couples lower the risks of transmitting genetic defects to their offspring, implantation failure, and/or miscarriage during in vitro fertilization (IVF) cycles. However, it is still being debated with regard to the practicality and diagnostic accuracy of PGD/PGS due to the concern of invasive biopsy and the potential mosaicism of embryos. Recently, several non-invasive and high-throughput assays have been developed to help overcome the challenges encountered in the conventional invasive biopsy and low-throughput analysis in PGD/PGS. In this mini-review, we will summarize the recent progresses of these new methods for PGD/PGS and discuss their potential applications in IVF clinics.

  5. Clinical Implications of Technological Advances in Screening for Atrial Fibrillation.

    Science.gov (United States)

    Singh, Nikhil; Chun, Sung; Hadley, David; Froelicher, Victor

    The incidence of atrial fibrillation (AF) continues to increase worldwide as people live longer. AF is the leading cause of stroke among patients older than 75 years and is responsible for at least 15% of all strokes. Industry has responded to this problem with a plethora of monitoring devices. These include single lead ECG adhesive sensors, implantable loop recorders, smartphone attachments and wearables. This review will concentrate on clinical studies using these technologies. There are wearables including watches and watch-like devices that will be mentioned but these have not been validated for clinical use. This review will begin with a background regarding screening for AF and at the end present findings from Cardiac Implantable devices that could influence use of the new mobile health technologies. Copyright © 2018 Elsevier Inc. All rights reserved.

  6. Is TNF-a-targeted short hairpin RNA (shRNA) a novel potential therapeutic tool in psoriasis treatment?

    DEFF Research Database (Denmark)

    Stenderup, Karin; Jakobsen, Maria; Rosada, Cecilia

    2008-01-01

      TNF-α is a well known target in psoriasis treatment and biological treatments targeting TNF-a are already clinically used against psoriasis and psoriasis arthritis. Attention is however given to a novel therapeutic tool: RNA interference that controls gene silencing. This study investigates...... the efficiency of targeting TNF-a with specific short hairpin RNA (shRNA) and explores its potential in treating psoriasis. ShRNAs targeting human TNF-α mRNA were generated. Their efficiency in down-regulating TNF-a protein expression was evaluated using a Renilla luciferase screening-assay and a transient co...... TNF-a shRNA was used to transduce HEK293 cells and verify vector-derived TNF-a knockdown in vitro. In vivo, psoriasis skin was exposed to lentiviral TNF-a shRNAs by a single intra-dermal injection. Psoriasis skin for the in vivo study was obtained from psoriatic plaque skin biopsies that were...

  7. [Lentivirus-mediated shRNA silencing of LAMP2A inhibits the proliferation of multiple myeloma cells].

    Science.gov (United States)

    Li, Lixuan; Li, Jia

    2015-05-01

    To study the effects of lentivirus-mediated short hairpin RNA (shRNA) silencing of lysosome-associated membrane protein type 2A (LAMP2A) expression on the proliferation of multiple myeloma cells. The constructed shRNA lentiviral vector was applied to infect human multiple myeloma cell line MM.1S, and stable expression cell line was obtained by puromycin screening. Western blotting was used to verify the inhibitory effect on LAMP2A protein expression. MTT assay was conducted to detect the effect of knocked-down LAMP2A on MM.1S cell proliferation, and the anti-tumor potency of suberoylanilide hydroxamic acid (SAHA) against the obtained MM.1S LAMP2A(shRNA) stable cell line. Lactate assay was performed to observe the impact of low LAMP2A expression on cell glycolysis. The stable cell line with low LAMP2A expression were obtained with the constructed human LAMP2A-shRNA lentiviral vector. Down-regulation of LAMP2A expression significantly inhibited MM.1S cell proliferation and enhanced the anti-tumor activity of SAHA. Interestingly, decreased LAMP2A expression also inhibited MM.1S cell lactic acid secretion. Down-regulation of LAMP2A expression could inhibit cell proliferation in multiple myeloma cells.

  8. Reduction in advanced breast cancer after introduction of a mammography screening program in Tyrol/Austria.

    Science.gov (United States)

    Oberaigner, W; Geiger-Gritsch, Sabine; Edlinger, M; Daniaux, M; Knapp, R; Hubalek, M; Siebert, U; Marth, C; Buchberger, W

    2017-06-01

    We analysed all female breast cancer (BC) cases in Tyrol/Austria regarding the shift in cancer characteristics, especially the shift in advanced BC, for the group exposed to screening as compared to the group unexposed to screening. The analysis was based on all BC cases diagnosed in women aged 40-69 years, resident in Tyrol, and diagnosed between 2009 and 2013. The data were linked to the Tyrolean mammography screening programme database to classify BC cases as "exposed to screening" or "unexposed to screening". Age-adjusted relative risks (RR) were estimated by relating the exposed to the unexposed group. In a total of about 145,000 women aged 40-69 years living in Tyrol during the study period, 1475 invasive BC cases were registered. We estimated an age-adjusted relative risk (RR) for tumour size ≥ 21 mm of 0.72 (95% confidence interval (CI) 0.60 to 0.86), for metastatic BC of 0.27 (95% CI 0.17 to 0.46) and for advanced BC of 0.83 (95% CI 0.71 to 0.96), each comparing those exposed to those unexposed to screening, respectively. In our population-based registry analysis we observed that participation in the mammography screening programme in Tyrol is associated with a 28% decrease in risk for BC cases with tumour size ≥ 21 mm and a 17% decrease in risk for advanced BC. We therefore expect the Tyrolean mammography programme to show a reduction in BC mortality. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Short Hairpin RNA (shRNA): Design, Delivery, and Assessment of Gene Knockdown

    Science.gov (United States)

    Moore, Chris B.; Guthrie, Elizabeth H.; Huang, Max Tze-Han; Taxman, Debra J.

    2013-01-01

    Shortly after the cellular mechanism of RNA interference (RNAi) was first described, scientists began using this powerful technique to study gene function. This included designing better methods for the successful delivery of small interfering RNAs (siRNAs) and short hairpin RNAs (shRNAs) into mammalian cells. While the simplest method for RNAi is the cytosolic delivery of siRNA oligonucleotides, this technique is limited to cells capable of transfection and is primarily utilized during transient in vitro studies. The introduction of shRNA into mammalian cells through infection with viral vectors allows for stable integration of shRNA and long-term knockdown of the targeted gene; however, several challenges exist with the implementation of this technology. Here we describe some well-tested protocols which should increase the chances of successful design, delivery, and assessment of gene knockdown by shRNA. We provide suggestions for designing shRNA targets and controls, a protocol for sequencing through the secondary structure of the shRNA hairpin structure, and protocols for packaging and delivery of shRNA lentiviral particles. Using real-time PCR and functional assays we demonstrate the successful knockdown of ASC, an inflammatory adaptor molecule. These studies demonstrate the practicality of including two shRNAs with different efficacies of knockdown to provide an additional level of control and to verify dose dependency of functional effects. Along with the methods described here, as new techniques and algorithms are designed in the future, shRNA is likely to include further promising application and continue to be a critical component of gene discovery. PMID:20387148

  10. Large screen mimic display design research for advanced main control room in nuclear power plant

    International Nuclear Information System (INIS)

    Zheng Mingguang; Yang Yanhua; Xu Jijun; Zhang Qinshun; Ning Zhonghe

    2002-01-01

    Firstly the evolution of mimic diagrams or displays used in the main control room of nuclear power plant was introduced. The active functions of mimic diagrams were analyzed on the release of operator psychological burden and pressure, the assistance of operator for the information searching, status understanding, manual actuation, correct decision making as well as the safe and reliable operation of the nuclear power plant. The importance and necessity to use the (large screen) mimic diagrams in advanced main control room of nuclear power plant, the design principle, design details and verification measures of large screen mimic display are also described

  11. An infinitely expandable cloning strategy plus repeat-proof PCR for working with multiple shRNA.

    Directory of Open Access Journals (Sweden)

    Glen John McIntyre

    Full Text Available Vector construction with restriction enzymes (REs typically involves the ligation of a digested donor fragment (insert to a reciprocally digested recipient fragment (vector backbone. Creating a suitable cloning plan becomes increasingly difficult for complex strategies requiring repeated insertions such as constructing multiple short hairpin RNA (shRNA expression vectors for RNA interference (RNAi studies. The problem lies in the reduced availability of suitable RE recognition sites with an increasing number of cloning events and or vector size. This report details a technically simple, directional cloning solution using REs with compatible cohesive ends that are repeatedly destroyed and simultaneously re-introduced with each round of cloning. Donor fragments can be made by PCR or sub-cloned from pre-existing vectors and inserted ad infinitum in any combination. The design incorporates several cloning cores in order to be compatible with as many donor sequences as possible. We show that joining sub-combinations made in parallel is more time-efficient than sequential construction (of one cassette at a time for any combination of 4 or more insertions. Screening for the successful construction of combinations using Taq polymerase based PCR became increasingly difficult with increasing number of repeated sequence elements. A Pfu polymerase based PCR was developed and successfully used to amplify combinations of up to eleven consecutive hairpin expression cassettes. The identified PCR conditions can be beneficial to others working with multiple shRNA or other repeated sequences, and the infinitely expandable cloning strategy serves as a general solution applicable to many cloning scenarios.

  12. Screens

    OpenAIRE

    2016-01-01

    This Sixth volume in the series The Key Debates. Mutations and Appropriations in European Film Studies investigates the question of screens in the context both of the dematerialization due to digitalization and the multiplication of media screens. Scholars offer various infomations and theories of topics such as the archeology of screen, film and media theories, contemporary art, pragmatics of new ways of screening (from home video to street screening).

  13. Permanent, lowered HLA class I expression using lentivirus vectors with shRNA constructs: Averting cytotoxicity by alloreactive T lymphocytes.

    Science.gov (United States)

    Haga, K; Lemp, N A; Logg, C R; Nagashima, J; Faure-Kumar, E; Gomez, G G; Kruse, C A; Mendez, R; Stripecke, R; Kasahara, N; Kasahara, N A; Cicciarelli, J C

    2006-12-01

    Transplantation of many tissues requires histocompatibility matching of human leukocyte antigens (HLA) to prevent graft rejection, to reduce the level of immunosuppression needed to maintain graft survival, and to minimize the risk of graft-versus-host disease, particularly in the case of bone marrow transplantation. However, recent advances in fields of gene delivery and genetic regulation technologies have opened the possibility of engineering grafts that display reduced levels of HLA expression. Suppression of HLA expression could help to overcome the limitations imposed by extensive HLA polymorphisms that restrict the availability of suitable donors, necessitate the maintenance of large donor registries, and complicate the logistics of procuring and delivering matched tissues and organs to the recipient. Accordingly, we investigated whether knockdown of HLA by RNA interference (RNAi), a ubiquitous regulatory system that can efficiently and selectively inhibit the expression of specific gene products, would enable allogeneic cells to evade immune recognition. For efficient and stable delivery of short hairpin-type RNAi constructs (shRNA), we employed lentivirus-based gene transfer vectors, which provide a delivery system that can achieve integration into genomic DNA, thereby permanently modifying transduced graft cells. Our results show that lentivirus-mediated delivery of shRNA targeting pan-Class I and allele-specific HLA can achieve efficient and dose-dependent reduction in surface expression of HLA in human cells, associated with enhanced resistance to alloreactive T lymphocyte-mediated cytotoxicity, while avoiding MHC-non-restricted killing. We hypothesize that RNAi-induced silencing of HLA expression has the potential to create histocompatibility-enhanced, and, eventually, perhaps "universally" compatible cellular grafts.

  14. Deep Sequencing Insights in Therapeutic shRNA Processing and siRNA Target Cleavage Precision.

    Science.gov (United States)

    Denise, Hubert; Moschos, Sterghios A; Sidders, Benjamin; Burden, Frances; Perkins, Hannah; Carter, Nikki; Stroud, Tim; Kennedy, Michael; Fancy, Sally-Ann; Lapthorn, Cris; Lavender, Helen; Kinloch, Ross; Suhy, David; Corbau, Romu

    2014-02-04

    TT-034 (PF-05095808) is a recombinant adeno-associated virus serotype 8 (AAV8) agent expressing three short hairpin RNA (shRNA) pro-drugs that target the hepatitis C virus (HCV) RNA genome. The cytosolic enzyme Dicer cleaves each shRNA into multiple, potentially active small interfering RNA (siRNA) drugs. Using next-generation sequencing (NGS) to identify and characterize active shRNAs maturation products, we observed that each TT-034-encoded shRNA could be processed into as many as 95 separate siRNA strands. Few of these appeared active as determined by Sanger 5' RNA Ligase-Mediated Rapid Amplification of cDNA Ends (5-RACE) and through synthetic shRNA and siRNA analogue studies. Moreover, NGS scrutiny applied on 5-RACE products (RACE-seq) suggested that synthetic siRNAs could direct cleavage in not one, but up to five separate positions on targeted RNA, in a sequence-dependent manner. These data support an on-target mechanism of action for TT-034 without cytotoxicity and question the accepted precision of substrate processing by the key RNA interference (RNAi) enzymes Dicer and siRNA-induced silencing complex (siRISC).Molecular Therapy-Nucleic Acids (2014) 3, e145; doi:10.1038/mtna.2013.73; published online 4 February 2014.

  15. A Risk Prediction Index for Advanced Colorectal Neoplasia at Screening Colonoscopy.

    Science.gov (United States)

    Schroy, Paul C; Wong, John B; O'Brien, Michael J; Chen, Clara A; Griffith, John L

    2015-07-01

    Eliciting patient preferences within the context of shared decision making has been advocated for colorectal cancer screening. Risk stratification for advanced colorectal neoplasia (ACN) might facilitate more effective shared decision making when selecting an appropriate screening option. Our objective was to develop and validate a clinical index for estimating the probability of ACN at screening colonoscopy. We conducted a cross-sectional analysis of 3,543 asymptomatic, mostly average-risk patients 50-79 years of age undergoing screening colonoscopy at two urban safety net hospitals. Predictors of ACN were identified using multiple logistic regression. Model performance was internally validated using bootstrapping methods. The final index consisted of five independent predictors of risk (age, smoking, alcohol intake, height, and a combined sex/race/ethnicity variable). Smoking was the strongest predictor (net reclassification improvement (NRI), 8.4%) and height the weakest (NRI, 1.5%). Using a simplified weighted scoring system based on 0.5 increments of the adjusted odds ratio, the risk of ACN ranged from 3.2% (95% confidence interval (CI), 2.6-3.9) for the low-risk group (score ≤2) to 8.6% (95% CI, 7.4-9.7) for the intermediate/high-risk group (score 3-11). The model had moderate to good overall discrimination (C-statistic, 0.69; 95% CI, 0.66-0.72) and good calibration (P=0.73-0.93). A simple 5-item risk index based on readily available clinical data accurately stratifies average-risk patients into low- and intermediate/high-risk categories for ACN at screening colonoscopy. Uptake into clinical practice could facilitate more effective shared decision-making for CRC screening, particularly in situations where patient and provider test preferences differ.

  16. A scoring model for predicting advanced colorectal neoplasia in a screened population of asymptomatic Japanese individuals.

    Science.gov (United States)

    Sekiguchi, Masau; Kakugawa, Yasuo; Matsumoto, Minori; Matsuda, Takahisa

    2018-01-22

    Risk stratification of screened populations could help improve colorectal cancer (CRC) screening. Use of the modified Asia-Pacific Colorectal Screening (APCS) score has been proposed in the Asia-Pacific region. This study was performed to build a new useful scoring model for CRC screening. Data were reviewed from 5218 asymptomatic Japanese individuals who underwent their first screening colonoscopy. Multivariate logistic regression was used to investigate risk factors for advanced colorectal neoplasia (ACN), and a new scoring model for the prediction of ACN was developed based on the results. The discriminatory capability of the new model and the modified APCS score were assessed and compared. Internal validation was also performed. ACN was detected in 225 participants. An 8-point scoring model for the prediction of ACN was developed using five independent risk factors for ACN (male sex, higher age, presence of two or more first-degree relatives with CRC, body mass index of > 22.5 kg/m 2 , and smoking history of > 18.5 pack-years). The prevalence of ACN was 1.6% (34/2172), 5.3% (127/2419), and 10.2% (64/627) in participants with scores of statistic of the scoring model was 0.70 (95% confidence interval, 0.67-0.73) in both the development and internal validation sets, and this value was higher than that of the modified APCS score [0.68 (95% confidence interval, 0.65-0.71), P = 0.03]. We built a new simple scoring model for prediction of ACN in a Japanese population that could stratify the screened population into low-, moderate-, and high-risk groups.

  17. Creating Transgenic shRNA Mice by Recombinase-Mediated Cassette Exchange

    Science.gov (United States)

    Premsrirut, Prem K.; Dow, Lukas E.; Park, Youngkyu; Hannon, Gregory J.; Lowe, Scott W.

    2014-01-01

    RNA interference (RNAi) enables sequence-specific, experimentally induced silencing of virtually any gene by tapping into innate regulatory mechanisms that are conserved among most eukaryotes. The principles that enable transgenic RNAi in cell lines can also be used to create transgenic animals, which express short-hairpin RNAs (shRNAs) in a regulated or tissue-specific fashion. However, RNAi in transgenic animals is somewhat more challenging than RNAi in cultured cells. The activities of promoters that are commonly used for shRNA expression in cell culture can vary enormously in different tissues, and founder lines also typically vary in transgene expression due to the effects of their single integration sites. There are many ways to produce mice carrying shRNA transgenes and the method described here uses recombinase-mediated cassette exchange (RMCE). RMCE permits insertion of the shRNA transgene into a well-characterized locus that gives reproducible and predictable expression in each founder and enhances the probability of potent expression in many cell types. This procedure is more involved and complex than simple pronuclear injection, but if even a few shRNA mice are envisioned, for example, to probe the functions of several genes, the effort of setting up the processes outlined below are well worthwhile. Note that when creating a transgenic mouse, one should take care to use the most potent shRNA possible. As a rule of thumb, the sequence chosen should provide >90% knockdown when introduced into cultured cells at single copy (e.g., on retroviral infection at a multiplicity of ≤0.3). PMID:24003198

  18. Advances in genome-wide RNAi cellular screens: a case study using the Drosophila JAK/STAT pathway

    Science.gov (United States)

    2012-01-01

    Background Genome-scale RNA-interference (RNAi) screens are becoming ever more common gene discovery tools. However, whilst every screen identifies interacting genes, less attention has been given to how factors such as library design and post-screening bioinformatics may be effecting the data generated. Results Here we present a new genome-wide RNAi screen of the Drosophila JAK/STAT signalling pathway undertaken in the Sheffield RNAi Screening Facility (SRSF). This screen was carried out using a second-generation, computationally optimised dsRNA library and analysed using current methods and bioinformatic tools. To examine advances in RNAi screening technology, we compare this screen to a biologically very similar screen undertaken in 2005 with a first-generation library. Both screens used the same cell line, reporters and experimental design, with the SRSF screen identifying 42 putative regulators of JAK/STAT signalling, 22 of which verified in a secondary screen and 16 verified with an independent probe design. Following reanalysis of the original screen data, comparisons of the two gene lists allows us to make estimates of false discovery rates in the SRSF data and to conduct an assessment of off-target effects (OTEs) associated with both libraries. We discuss the differences and similarities between the resulting data sets and examine the relative improvements in gene discovery protocols. Conclusions Our work represents one of the first direct comparisons between first- and second-generation libraries and shows that modern library designs together with methodological advances have had a significant influence on genome-scale RNAi screens. PMID:23006893

  19. Screening of ten advanced chickpea lines for blight and wilt resistance

    International Nuclear Information System (INIS)

    Jamil, F.F.; Haq, I.; Sarwar, N.; Alam, S.S.; Khan, J.A.; Hanif, M.; Khan, I.A.; Sarwar, M.; Haq, M.A.

    2002-01-01

    Ten advanced chickpea lines developed at NIAB were screened for resistance to Ascochyta blight and Fusarium wilt diseases in different sets of experiments conducted under controlled environment. Inoculation of plants by spore suspension of virulent strains of Ascochyta rabiei revealed that one line (97313) was resistant tolerant, two lines (97305, 97392) were tolerant, six lines (97306, 97310, 97311, 97303, 97302, 97393) were tolerant/susceptible and one line (97301) was susceptible. Screening of the same lines against Fusarium wilt by water culture method showed that two lines (97301, 97313) were moderately resistant, four lines (97302, 97303, 97306, 97393) were tolerant and the remaining four lines were susceptible. Screening through phytotoxic culture filtrates revealed that two lines (97302, 97313) were less sensitive to culture filtrates of Ascochyta rabiei and Fusarium oxysporum than the resistant check (CM88). These lines were also analyzed spectrophotometrically for peroxidase enzyme activity. Maximum enzyme activity was detected after 48 hours of inoculation with A. rabiei in three lines (97305, 97311, 97313) and resistant check (CM88) while enzyme activity in the remaining lines reached its maximum after 72 hours of inoculation which was comparable to the susceptible check (Pb-1). These studies lead to the conclusion that one line (97313) exhibited resistance against both the diseases and can be used as a source of resistance for further improvement of chickpea germplasm. (author)

  20. The Effect of Treatment Advances on the Mortality Results of Breast Cancer Screening Trials: A Microsimulation Model.

    Science.gov (United States)

    Birnbaum, Jeanette; Gadi, Vijayakrishna K; Markowitz, Elan; Etzioni, Ruth

    2016-02-16

    Mammography trials, which are the primary sources of evidence for screening benefit, were conducted decades ago. Whether advances in systemic therapies have rendered previously observed benefits of screening less significant is unknown. To compare the outcomes of breast cancer screening trials had they been conducted using contemporary systemic treatments with outcomes of trials conducted with previously used treatments. Computer simulation model of 3 virtual screening trials with similar reductions in advanced-stage cancer cases but reflecting treatment patterns in 1975 (prechemotherapy era), 1999, or 2015 (treatment according to receptor status). Meta-analyses of screening and treatment trials; study of dissemination of primary systemic treatments; SEER (Surveillance, Epidemiology, and End Results) registry. U.S. women aged 50 to 74 years. 10 and 25 years. Population. Mammography, chemotherapy, tamoxifen, aromatase inhibitors, and trastuzumab. Breast cancer mortality rate ratio (MRR) and absolute risk reduction (ARR) obtained by the difference in cumulative breast cancer mortality between control and screening groups. At 10 years, screening in a 1975 trial yielded an MRR of 90% and an ARR of 5 deaths per 10,000 women. A 2015 screening trial yielded a 10-year MRR of 90% and an ARR of 3 deaths per 10,000 women. Greater reductions in advanced-stage disease yielded a greater screening effect, but MRRs remained similar across trials. However, ARRs were consistently lower under contemporary treatments. When contemporary treatments were available only for early-stage cases, the MRR was 88%. Disease models simplify reality and cannot capture all breast cancer subtypes. Advances in systemic therapies for breast cancer have not substantively reduced the relative benefits of screening but have likely reduced the absolute benefits because of their positive effect on breast cancer survival. University of Washington and National Cancer Institute.

  1. Suppression of IL-6 Gene by shRNA Augments Gemcitabine Chemosensitization in Pancreatic Adenocarcinoma Cells

    Directory of Open Access Journals (Sweden)

    Hai-Bo Xing

    2018-01-01

    Full Text Available Pancreatic adenocarcinoma has an exceedingly poor prognosis, accounting for five-year survival of less than 5%. Presently, improving the efficacy of pancreatic adenocarcinoma treatment has been the focus of medical researchers worldwide. Recently, it has been suggested that deregulation of interleukin- (IL- 6 is caused by a key gene involved in the beginning and development of pancreatic adenocarcinoma. Herein, we investigated whether suppression of IL-6 could augment gemcitabine sensitivity in the PANC-1 cells. We found considerably higher expression of IL-6 in pancreatic adenocarcinoma tissues than that in the adjacent nontumorous tissues. Suppression of IL-6 by shRNA resulted in apoptosis as well as inhibition of cell proliferation and tumorigenicity. In addition, suppression of IL-6 remarkably promoted antitumor effect of gemcitabine, indicating that the combination of shRNA targeting IL-6 with gemcitabine may provide a potential clinical approach for pancreatic cancer therapy.

  2. Dietary patterns and risk of advanced colorectal neoplasms: A large population based screening study in Germany.

    Science.gov (United States)

    Erben, Vanessa; Carr, Prudence R; Holleczek, Bernd; Stegmaier, Christa; Hoffmeister, Michael; Brenner, Hermann

    2018-06-01

    Specific components of the diet such as red and processed meat have been associated with the risk of developing colorectal cancer. However, evidence on the association of dietary patterns with colorectal neoplasms is sparse. The aim of this study was to analyze the association of dietary patterns with prevalence of advanced colorectal neoplasms among older adults in Germany. A cross-sectional study was conducted among participants of screening colonoscopy in Saarland, Germany, who were enrolled in the KolosSal study (Effektivität der Früherkennungs-Koloskopie: eine Saarland-weite Studie) from 2005 to 2013. Information on diet and lifestyle factors was obtained through questionnaires and colonoscopy results were extracted from physicians' reports. Associations of a priori defined dietary patterns (vegetarian or adapted versions of the Healthy Eating Index [HEI] and the Dietary Approaches to Stop Hypertension [DASH] index) with the risk of advanced colorectal neoplasms were assessed by multiple logistic regression analyses with comprehensive adjustment for potential confounders. A total of 14,309 participants were included (1561 with advanced colorectal neoplasms). Healthier eating behavior was associated with lower prevalence of advanced colorectal neoplasms in a dose-response manner. Adjusted odds ratios (95% confidence intervals) comparing the highest with the lowest categories of adapted HEI and DASH were 0.61 (0.50, 0.76) and 0.70 (0.55, 0.89), respectively. No significant associations were observed for a vegetarian eating pattern (adjusted OR 0.80 (0.55, 1.17)). Healthy dietary patterns, as described by a high HEI or DASH score, but not a vegetarian diet alone, are associated with reduced risk of advanced colorectal neoplasms. Copyright © 2018 Elsevier Inc. All rights reserved.

  3. Case study: technology initiative led to advanced lead optimization screening processes at Bristol-Myers Squibb, 2004-2009.

    Science.gov (United States)

    Zhang, Litao; Cvijic, Mary Ellen; Lippy, Jonathan; Myslik, James; Brenner, Stephen L; Binnie, Alastair; Houston, John G

    2012-07-01

    In this paper, we review the key solutions that enabled evolution of the lead optimization screening support process at Bristol-Myers Squibb (BMS) between 2004 and 2009. During this time, technology infrastructure investment and scientific expertise integration laid the foundations to build and tailor lead optimization screening support models across all therapeutic groups at BMS. Together, harnessing advanced screening technology platforms and expanding panel screening strategy led to a paradigm shift at BMS in supporting lead optimization screening capability. Parallel SAR and structure liability relationship (SLR) screening approaches were first and broadly introduced to empower more-rapid and -informed decisions about chemical synthesis strategy and to broaden options for identifying high-quality drug candidates during lead optimization. Copyright © 2012 Elsevier Ltd. All rights reserved.

  4. Quantum screening effects on the electron-ion occurrence scattering time advance in strongly coupled semiclassical plasmas

    International Nuclear Information System (INIS)

    Song, Mi-Young; Jung, Young-Dae

    2003-01-01

    Quantum screening effects on the occurrence scattering time advance for elastic electron-ion collisions in strongly coupled semiclassical plasmas are investigated using the second-order eikonal analysis. The electron-ion interaction in strongly coupled semiclassical plasmas is obtained by the pseudopotential model taking into account the plasma screening and quantum effects. It is found that the quantum-mechanical effects significantly reduce the occurrence scattering time advance. It is also found that the occurrence scattering time advance increases with increasing Debye length. It is quite interesting to note that the domain of the maximum occurrence time advance is localized for the forward scattering case. The region of the scaled thermal de Broglie wave length (λ-bar) for the maximum occurrence time advance is found to be 0.4≤λ-bar≤1.4

  5. A rapid echocardiographic screening protocol for rheumatic heart disease in Samoa: a high prevalence of advanced disease.

    Science.gov (United States)

    Allen, Marvin; Allen, John; Naseri, Take; Gardner, Rebecca; Tolley, Dennis; Allen, Lori

    2017-10-01

    Echocardiography has been proposed as a method to screen children for rheumatic heart disease. The World Heart Federation has established guidelines for echocardiographic screening. In this study, we describe a rapid echocardiogram screening protocol according to the World Heart Federation guidelines in Samoa, endemic for rheumatic heart disease. We performed echocardiogram screening in schoolchildren in Samoa between 2013 and 2015. A brief screening echocardiogram was performed on all students. Children with predefined criteria suspicious for rheumatic hear diseases were referred for a more comprehensive echocardiogram. Complete echocardiograms were classified according to the World Heart Federation guidelines and severity of valve disease. Echocardiographic screening was performed on 11,434 children, with a mean age of 10.2 years; 51% of them were females. A total of 558 (4.8%) children underwent comprehensive echocardiography, including 49 students who were randomly selected as controls. Definite rheumatic heart disease was observed in 115 students (10.0 per 1000): 92 students were classified as borderline (8.0 per 1000) and 23 with CHD. Advanced disease was identified in 50 students (4.4 per 1000): 15 with severe mitral regurgitation, five with severe aortic regurgitation, 11 with mitral stenoses, and 19 with mitral and aortic valve disease. We successfully applied a rapid echocardiographic screening protocol to a large number of students over a short time period - 28 days of screening over a 3-year time period - to identify a high prevalence of rheumatic heart disease. We also reported a significantly higher rate of advanced disease compared with previously published echocardiographic screening programmes.

  6. The Offer of Advanced Imaging Techniques Leads to Higher Acceptance Rates for Screening Colonoscopy - a Prospective Study.

    Science.gov (United States)

    Albrecht, Heinz; Gallitz, Julia; Hable, Robert; Vieth, Michael; Tontini, Gian Eugenio; Neurath, Markus Friedrich; Riemann, Jurgen Ferdinand; Neumann, Helmut

    2016-01-01

    Colonoscopy plays a fundamental role in early diagnosis and management of colorectal cancer and requires public and professional acceptance to ensure the ongoing success of screening programs. The aim of the study was to prospectively assess whether patient acceptance rates to undergo screening colonoscopy could be improved by the offer of advanced imaging techniques. Overall, 372 randomly selected patients were prospectively included. A standardized questionnaire was developed that inquired of the patients their knowledge regarding advanced imaging techniques. Second, several media campaigns and information events were organized reporting about advanced imaging techniques, followed by repeated evaluation. After one year the evaluation ended. At baseline, 64% of the patients declared that they had no knowledge about new endoscopic methods. After twelve months the overall grade of information increased significantly from 14% at baseline to 34%. The percentage of patients who decided to undergo colonoscopy because of the offer of new imaging methods also increased significantly from 12% at baseline to 42% after 12 months. Patients were highly interested in the offer of advanced imaging techniques. Knowledge about these techniques could relatively easy be provided using local media campaigns. The offer of advanced imaging techniques leads to higher acceptance rates for screening colonoscopies.

  7. Influence of Expression Plasmid of Connective Tissue Growth Factor and Tissue Inhibitor of Metalloproteinase-1 shRNA on Hepatic Precancerous Fibrosis in Rats.

    Science.gov (United States)

    Zhang, Qun; Shu, Fu-Li; Jiang, Yu-Feng; Huang, Xin-En

    2015-01-01

    In this study, influence caused by expression plasmids of connective tissue growth factor (CTGF) and tissue inhibitor of metalloproteinase-1 (TIMP-1) short hairpin RNA (shRNA) on mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII in hepatic tissue with hepatic fibrosis, a precancerous condition, in rats is analyzed. To screen and construct shRNA expression plasimid which effectively interferes RNA targets of CTGF and TIMP-1 in rats. 50 cleaning Wistar male rats are allocated randomly at 5 different groups after precancerous fibrosis models and then injection of shRNA expression plasimids. Plasmid psiRNA-GFP-Com (CTGF and TIMP-1 included), psiRNA-GFP-CTGF, psiRNA-GFP-TIMP-1 and psiRNA- DUO-GFPzeo of blank plasmid are injected at group A, B, C and D, respectively, and as model control group that none plasimid is injected at group E. In 2 weeks after last injection, to hepatic tissue at different groups, protein expression of CTGF, TIMP-1, procol-α1and PC III is tested by immunohistochemical method and,mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII is measured by real-time PCR. One-way ANOVA is used to comparison between-groups. Compared with model group, there is no obvious difference of mRNA expression among CTGF,TIMP-1,procol-α1,PC III and of protein expression among CTGF, TIMP-1, procol-α1, PC III in hepatic tissue at group injected with blank plasmid. Expression quantity of mRNA of CTGF, TIMP-1, procol-α1 and PCIII at group A, B and C decreases, protein expression of CTGF, TIMP-1, procol-α1, PC III in hepatic tissue is lower, where the inhibition of combination RNA interference group (group A) on procol-α1 mRNA transcription and procol-α1 protein expression is superior to that of single interference group (group B and C) (P<0.01 or P<0.05). RNA interference on CTGF and/or TIMP-1 is obviously a inhibiting factor for mRNA and protein expression of CTGF, TIMP-1, procol-α1 and PCIII. Combination RNA interference on genes of CTGF and TIMP-1 is superior

  8. AAV-based shRNA silencing of NF-κB ameliorates muscle pathologies in mdx mice.

    Science.gov (United States)

    Yang, Q; Tang, Y; Imbrogno, K; Lu, A; Proto, J D; Chen, A; Guo, F; Fu, F H; Huard, J; Wang, B

    2012-12-01

    Chronic inflammation, promoted by an upregulated NF-kappa B (NF-κB) pathway, has a key role in Duchenne muscular dystrophy (DMD) patients' pathogenesis. Blocking the NF-κB pathway has been shown to be a viable approach to diminish chronic inflammation and necrosis in the dystrophin-defective mdx mouse, a murine DMD model. In this study, we used the recombinant adeno-associated virus serotype 9 (AAV9) carrying an short hairpin RNA (shRNA) specifically targeting the messenger RNA of NF-κB/p65 (p65-shRNA), the major subunit of NF-κB associated with chronic inflammation in mdx mice. We examined whether i.m. AAV9-mediated delivery of p65-shRNA could decrease NF-κB activation, allowing for amelioration of muscle pathologies in 1- and 4-month-old mdx mice. At 1 month after treatment, NF-κB/p65 levels were significantly decreased by AAV gene transfer of p65-shRNA in the two ages of treatment groups, with necrosis significantly decreased compared with controls. Quantitative analysis revealed that central nucleation (CN) of the myofibers of p65-shRNA-treated 1-month-old mdx muscles was reduced from 67 to 34%, but the level of CN was not significantly decreased in treated 4-month-old mdx mice. Moreover, delivery of the p65-shRNA enhanced the capacity of myofiber regeneration in old mdx mice treated at 4 months of age when the dystrophic myofibers were most exhausted; however, such p65 silencing diminished the myofiber regeneration in young mdx mice treated at 1 month of age. Taken together, these findings demonstrate that the AAV-mediated delivery of p65-shRNA has the capacity to ameliorate muscle pathologies in mdx mice by selectively reducing NF-κB/p65 activity.

  9. Cervical cancer screening in adolescents: an evidence-based internet education program for practice improvement among advanced practice nurses.

    Science.gov (United States)

    Choma, Kim; McKeever, Amy E

    2015-02-01

    The literature reports great variation in the knowledge levels and application of the recent changes of cervical cancer screening guidelines into clinical practice. Evidence-based screening guidelines for the prevention and early detection of cervical cancer offers healthcare providers the opportunity to improve practice patterns among female adolescents by decreasing psychological distress as well as reducing healthcare costs and morbidities associated with over-screening. The purpose of this pilot intervention study was to determine the effects of a Web-based continuing education unit (CEU) program on advanced practice nurses' (APNs) knowledge of current cervical cancer screening evidence-based recommendations and their application in practice. This paper presents a process improvement project as an example of a way to disseminate updated evidence-based practice guidelines among busy healthcare providers. This Web-based CEU program was developed, piloted, and evaluated specifically for APNs. The program addressed their knowledge level of cervical cancer and its relationship with high-risk human papillomavirus. It also addressed the new cervical cancer screening guidelines and the application of those guidelines into clinical practice. Results of the study indicated that knowledge gaps exist among APNs about cervical cancer screening in adolescents. However, when provided with a CEU educational intervention, APNs' knowledge levels increased and their self-reported clinical practice behaviors changed in accordance with the new cervical cancer screening guidelines. Providing convenient and readily accessible up-to-date electronic content that provides CEU enhances the adoption of clinical practice guidelines, thereby decreasing the potential of the morbidities associated with over-screening for cervical cancer in adolescents and young women. © 2014 Sigma Theta Tau International.

  10. Advances in directed monooxygenase evolution : from diversity generation and flow cytometry screening to tailor-made monooxygenases

    OpenAIRE

    Ruff, Anna Joëlle

    2012-01-01

    Directed Evolution became a powerful tool for proteins engineers to generate tailor-made biocatalyst. Directed protein evolution consist of the following three consecutive main steps, which are performed in iterative cycles; Step 1 the gene diversity generation, Step 2 the screening for improved variants and Step 3 the isolation of gene encoding for improved proteins. In this thesis, methodological advancements in the two key steps of the directed evolution, the diversity generation (SeSaM me...

  11. Advanced breast cancer rates in the epoch of service screening: The 400,000 women cohort study from Italy.

    Science.gov (United States)

    Puliti, Donella; Bucchi, Lauro; Mancini, Silvia; Paci, Eugenio; Baracco, Susanna; Campari, Cinzia; Canuti, Debora; Cirilli, Claudia; Collina, Natalina; Conti, Giovanni Maria; Di Felice, Enza; Falcini, Fabio; Michiara, Maria; Negri, Rossella; Ravaioli, Alessandra; Sassoli De' Bianchi, Priscilla; Serafini, Monica; Zorzi, Manuel; Caldarella, Adele; Cataliotti, Luigi; Zappa, Marco

    2017-04-01

    The objective of this study was to evaluate if mammography screening attendance is associated with a reduction in late-stage breast cancer incidence. The cohort included over 400,000 Italian women who were first invited to participate in regional screening programmes during the 1990s and were followed for breast cancer incidence for 13 years. We obtained individual data on their exposure to screening and correlated this with total and stage-specific breast cancer incidence. Socio-economic status and pre-screening incidence data were used to assess the presence of self-selection bias. Overall, screening attendance was associated with a 10% excess risk of in situ and invasive breast cancer (IRR = 1.10; 95% confidence interval (CI): 1.06-1.14), which dropped to 5% for invasive cancers only (IRR = 1.05; 95% CI: 1.01-1.09). There were significant reductions among attenders for specific cancer stages; we observed a 39% reduction for T2 or larger (IRR = 0.61; 95% CI: 0.57-0.66), 19% for node positives (IRR = 0.81; 95% CI: 0.76-0.86) and 28% for stage II and higher (IRR = 0.72; 95% CI: 0.68-0.76). Our data suggest that the presence of self-selection bias is limited and, overall, invited women experienced a 17% reduction of advanced cancers compared with pre-screening rates. Comparing attenders' and non-attenders' stage-specific breast cancer incidence, we have estimated that screening attendance is associated with a reduction of nearly 30% for stages II+. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Therapeutic effects of lentivirus-mediated shRNA targeting of cyclin D1 in human gastric cancer

    International Nuclear Information System (INIS)

    Seo, Jin-Hee; Jeong, Eui-Suk; Choi, Yang-Kyu

    2014-01-01

    Gastric cancer is the second most common cause of cancer-related death in males and the fourth in females. Traditional treatment has poor prognosis because of recurrence and systemic side effects. Therefore, the development of new therapeutic strategies is an important issue. Lentivirus-mediated shRNA stably inhibits target genes and can efficiently transduce most cells. Since overexpressed cyclin D1 is closely related to human gastric cancer progression, inhibition of cyclin D1 using specific targeting could be an effective treatment method of human gastric cancer. The therapeutic effect of lentivirus-mediated shRNA targeting of cyclin D1 (ShCCND1) was analyzed both in vitro and in vivo experiments. In vitro, NCI-N87 cells with downregulation of cyclin D1 by ShCCND1 showed significant inhibition of cell proliferation, cell motility, and clonogenicity. Downregulation of cyclin D1 in NCI-N87 cells also resulted in significantly increased G1 arrest and apoptosis. In vivo, stable NCI-N87 cells expressing ShCCND1 were engrafted into nude mice. Then, the cancer-growth inhibition effect of lentivirus was confirmed. To assess lentivirus including ShCCND1 as a therapeutic agent, intratumoral injection was conducted. Tumor growth of the lentivirus-treated group was significantly inhibited compared to growth of the control group. These results are in accordance with the in vitro data and lend support to the mitotic figure count and apoptosis analysis of the tumor mass. The lentivirus-mediated ShCCND1 was constructed, which effectively inhibited growth of NCI-N87-derived cancer both in vitro and in vivo. The efficiency of shRNA knockdown and variation in the degree of inhibition is mediated by different shRNA sequences and cancer cell lines. These experimental results suggest the possibility of developing new gastric cancer therapies using lentivirus-mediated shRNA

  13. Advances in prenatal screening for Down syndrome: II first trimester testing, integrated testing, and future directions.

    Science.gov (United States)

    Benn, Peter A

    2002-10-01

    The acceptability of prenatal screening and diagnosis of Down syndrome is dependent, in part, on the gestational age at which the testing is offered. First trimester screening could be advantageous if it has sufficient efficacy and can be effectively delivered. Two first trimester maternal serum screening markers, pregnancy-associated plasma protein-A (PAPP-A) and free beta-human chorionic gonadotropin (beta-hCG), are useful for identifying women at increased risk for fetal Down syndrome. In addition, measurement of an enlarged thickness of the subcutaneous fluid-filled space at the back of the neck of the developing fetus (referred to as nuchal translucency or NT) has been demonstrated to be an indicator for these high-risk pregnancies. When these three parameters are combined, estimates for Down syndrome efficacy exceed those currently attainable in the second trimester. Women who are screen-positive in the first trimester can elect to receive cytogenetic testing of a chorionic villus biopsy. The first trimester tests could also, theoretically, be combined with the second trimester maternal serum screening tests (integrated screening) to obtain even higher levels of efficacy. There are, however, several practical limitations to first trimester and integrated screening. These include scheduling of testing within relatively narrow gestational age intervals, availability of appropriately trained ultrasonographers for NT measurement, risks associated with chorionic villus biopsy, and costs. There is also increasing evidence that an enlarged NT measurement is indicative of a high risk for spontaneous abortion and for fetal abnormalities that are not detectable by cytogenetic analysis. Women whose fetuses show enlarged NT, therefore, need first trimester counseling regarding their Down syndrome risks and the possibility of other adverse pregnancy outcomes. Follow-up ultrasound and fetal echocardiography in the second trimester are also indicated. First trimester

  14. Osteoblastic lesion screening with an advanced post-processing package enabling in-plane rib reading in CT-images.

    Science.gov (United States)

    Seuss, Hannes; Dankerl, Peter; Cavallaro, Alexander; Uder, Michael; Hammon, Matthias

    2016-05-20

    To evaluate screening and diagnostic accuracy for the detection of osteoblastic rib lesions using an advanced post-processing package enabling in-plane rib reading in CT-images. We retrospectively assessed the CT-data of 60 consecutive prostate cancer patients by applying dedicated software enabling in-plane rib reading. Reading the conventional multiplanar reconstructions was considered to be the reference standard. To simulate clinical practice, the reader was given 10 s to screen for sclerotic rib lesions in each patient applying both approaches. Afterwards, every rib was evaluated individually with both approaches without a time limit. Sensitivities, specificities, positive/negative predictive values and the time needed for detection were calculated depending on the lesion's size (largest diameter  10 mm). In 53 of 60 patients, all ribs were properly displayed in plane, in five patients ribs were partially displayed correctly, and in two patients none of the ribs were displayed correctly. During the 10-s screening approach all patients with sclerotic rib lesions were correctly identified reading the in-plane images (including the patients without a correct rib segmentation), whereas 14 of 23 patients were correctly identified reading conventional multiplanar images. Overall screening sensitivity, specificity, and positive/negative predictive values were 100/27.0/46.0/100 %, respectively, for in-plane reading and 60.9/100/100/80.4 %, respectively, for multiplanar reading. Overall diagnostic (no time limit) sensitivity, specificity, and positive/negative predictive values of in-plane reading were 97.8/92.8/74.6/99.5 %, respectively. False positive results predominantly occurred for lesions <5 mm in size. In-plane reading of the ribs allows reliable detection of osteoblastic lesions for screening purposes. The limited specificity results from false positives predominantly occurring for small lesions.

  15. Advancing early detection of autism spectrum disorder by applying an integrated two-stage screening approach

    NARCIS (Netherlands)

    Oosterling, Iris J.; Wensing, Michel; Swinkels, Sophie H.; van der Gaag, Rutger Jan; Visser, Janne C.; Woudenberg, Tim; Minderaa, Ruud; Steenhuis, Mark-Peter; Buitelaar, Jan K.

    Background: Few field trials exist on the impact of implementing guidelines for the early detection of autism spectrum disorders (ASD). The aims of the present study were to develop and evaluate a clinically relevant integrated early detection programme based on the two-stage screening approach of

  16. Advancing Social Workers' Responsiveness to Health Disparities: The Case of Breast Cancer Screening

    Science.gov (United States)

    Altpeter, Mary; Mitchell, James F.; Pennell, Joan

    2005-01-01

    This study provides the basis for customizing culturally responsive social work health promotion programs aimed at eliminating breast cancer screening and mortality disparities between white and African American women. Survey data collected from a random sample of 853 women in rural North Carolina were used to explore the impact of psychosocial…

  17. A comprehensive platform for highly multiplexed mammalian functional genetic screens

    Directory of Open Access Journals (Sweden)

    Cheung-Ong Kahlin

    2011-05-01

    Full Text Available Abstract Background Genome-wide screening in human and mouse cells using RNA interference and open reading frame over-expression libraries is rapidly becoming a viable experimental approach for many research labs. There are a variety of gene expression modulation libraries commercially available, however, detailed and validated protocols as well as the reagents necessary for deconvolving genome-scale gene screens using these libraries are lacking. As a solution, we designed a comprehensive platform for highly multiplexed functional genetic screens in human, mouse and yeast cells using popular, commercially available gene modulation libraries. The Gene Modulation Array Platform (GMAP is a single microarray-based detection solution for deconvolution of loss and gain-of-function pooled screens. Results Experiments with specially constructed lentiviral-based plasmid pools containing ~78,000 shRNAs demonstrated that the GMAP is capable of deconvolving genome-wide shRNA "dropout" screens. Further experiments with a larger, ~90,000 shRNA pool demonstrate that equivalent results are obtained from plasmid pools and from genomic DNA derived from lentivirus infected cells. Parallel testing of large shRNA pools using GMAP and next-generation sequencing methods revealed that the two methods provide valid and complementary approaches to deconvolution of genome-wide shRNA screens. Additional experiments demonstrated that GMAP is equivalent to similar microarray-based products when used for deconvolution of open reading frame over-expression screens. Conclusion Herein, we demonstrate four major applications for the GMAP resource, including deconvolution of pooled RNAi screens in cells with at least 90,000 distinct shRNAs. We also provide detailed methodologies for pooled shRNA screen readout using GMAP and compare next-generation sequencing to GMAP (i.e. microarray based deconvolution methods.

  18. Identifying Psychosocial Distress and Stressors Using Distress-screening Instruments in Patients With Localized and Advanced Penile Cancer.

    Science.gov (United States)

    Dräger, Désirée Louise; Protzel, Chris; Hakenberg, Oliver W

    2017-10-01

    We examined the effects of treatment on the psychological well-being of patients with localized or advanced penile cancer using screening questionnaires to determine the consecutive need for psychosocial care. Penile cancer is a rare, but highly aggressive, malignancy. The psychological stress of patients with penile cancer arises from the cancer diagnosis per se and the corresponding consequences of treatment. In addition, cancer-specific distress results (eg, fear of metastasis, progression, relapse, death). Studies of the psychosocial stress of penile cancer patients are rare. We undertook a prospective analysis of the data from patients with penile cancer who had undergone surgery or chemotherapy from August 2014 to October 2016 at our department. Patients were evaluated using standardized questionnaires for stress screening and the identification for the need for psychosocial care (National Comprehensive Cancer Network Distress Thermometer and Hornheider screening instrument) and by assessing the actual use of psychosocial support. The average stress level was 4.5. Of all the patients, 42.5% showed increased care needs at the time of the survey. Younger patients, patients undergoing chemotherapy, and patients with recurrence were significantly more integrated with the psychosocial care systems. Finally, 67% of all patients received inpatient psychosocial care. Owing to the potentially mutilating surgery, patients with penile cancer experience increased psychological stress and, consequently, have an increased need for psychosocial care. Therefore, the emotional stress of these patients should be recognized and support based on interdisciplinary collaboration offered. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Quantitative Evaluation of Myostatin Gene in Stably Transfected Caprine Fibroblast Cells by Anti-Myostatin shRNA.

    Science.gov (United States)

    Jain, Sudhir Kumar; Jain, Hemlata; Kumar, Dharmendra; Bedekar, Megha Kadam; Pandey, Akhilesh Kumar; Sarkhel, Bikash Chandra

    2015-09-01

    Skeletal muscle is the major component of lean tissue that is used for consumption, and myostatin is a negative regulator of skeletal muscle growth. Downregulation of this gene therefore offers a strategy for developing superior animals with enhanced muscle growth. Knockdown of myostatin was achieved by RNA interference technology. The anti-myostatin shRNA were designed and stably transfected in caprine fibroblast cells. The reduced expression of target gene was achieved and measured in clonal fibroblast cells by real-time PCR. Two single-cell clones induced significant decrease of myostatin gene expression by 73.96 and 72.66 %, respectively (P < 0.05). To ensure the appropriate growth of transfected cell, seven media were tested. The best suited media was used for transfected fibroblast cell proliferation. The findings suggest that shRNA provides a novel potential tool for gene knockdown and these stably transfected cells can be used as the donor cells for animal cloning.

  20. Current advances in screening for bioactive components from medicinal plants by affinity ultrafiltration mass spectrometry.

    Science.gov (United States)

    Chen, Guilin; Huang, Bill X; Guo, Mingquan

    2018-05-21

    Medicinal plants have played an important role in maintaining human health for thousands of years. However, the interactions between the active components in medicinal plants and some certain biological targets during a disease are still unclear in most cases. To conduct the high-throughput screening for small active molecules that can interact with biological targets, which is of great theoretical significance and practical value. The ultrafiltration mass spectrometry (UF-LC/MS) is a powerful bio-analytical method by combining affinity ultrafiltration and liquid chromatography-mass spectrometry (LC/MS), which could rapidly screen and identify small active molecules that bind to biological targets of interest at the same time. Compared with other analytical methods, affinity UF-LC/MS has the characteristics of fast, sensitive and high throughput, and is especially suitable for the complicated extracts of medicinal plants. In this review, the basic principle, characteristics and some most recent challenges in UF-LC/MS have been demonstrated. Meanwhile, the progress and applications of affinity UF-LC/MS in the discovery of the active components from natural medicinal plants and the interactions between small molecules and biological target proteins are also briefly summarised. In addition, the future directions for UF-LC/MS are also prospected. Affinity UF-LC/MS is a powerful tool in studies on the interactions between small active molecules and biological protein targets, especially in the high-throughput screening of active components from the natural medicinal plants. Copyright © 2018 John Wiley & Sons, Ltd.

  1. Evaluation of a clinical risk index for advanced colorectal neoplasia among a North American population of screening age.

    Science.gov (United States)

    Ruco, Arlinda; Stock, David; Hilsden, Robert J; McGregor, S Elizabeth; Paszat, Lawrence F; Saskin, Refik; Rabeneck, Linda

    2015-11-19

    A clinical risk index employing age, sex, family history of colorectal cancer (CRC), smoking history and body mass index (BMI) may be useful for prioritizing screening with colonoscopy. The aim of this study was to conduct an external evaluation of a previously published risk index for advanced neoplasia (AN) in a large, well-characterized cohort. Five thousand one hundred thirty-seven asymptomatic persons aged 50 to 74 (54.9 % women) with a mean age (SD) of 58.3 (6.2) years were recruited for the study from a teaching hospital and colorectal cancer screening centre between 2003 and 2011. All participants underwent a complete screening colonoscopy and removal of all polyps. AN was defined as cancer or a tubular adenoma, traditional serrated adenoma (TSA), or sessile serrated adenoma (SSA) with villous characteristics (≥25% villous component), and/or high-grade dysplasia and/or diameter ≥10 mm. Risk scores for each participant were summed to derive an overall score (0-8). The c-statistic was used to measure discriminating ability of the risk index. The prevalence of AN in the study cohort was 6.8 %. The likelihood of detecting AN increased from 3.6 to 13.1 % for those with a risk score of 1 to 6 respectively. The c-statistic for the multivariable logistic model in our cohort was 0.64 (95 % CI = 0.61-067) indicating modest overlap between risk scores. The risk index for AN using age, sex, family history, smoking history and BMI was found to be of limited discriminating ability upon external validation. The index requires further refinement to better predict AN in average risk persons of screening age.

  2. Recent Advances in Screening of Anti-Campylobacter Activity in Probiotics for Use in Poultry

    Science.gov (United States)

    Saint-Cyr, Manuel J.; Guyard-Nicodème, Muriel; Messaoudi, Soumaya; Chemaly, Marianne; Cappelier, Jean-Michel; Dousset, Xavier; Haddad, Nabila

    2016-01-01

    Campylobacteriosis is the most common cause of bacterial gastroenteritis worldwide. Campylobacter species involved in this infection usually include the thermotolerant species Campylobacter jejuni. The major reservoir for C. jejuni leading to human infections is commercial broiler chickens. Poultry flocks are frequently colonized by C. jejuni without any apparent symptoms. Risk assessment analyses have identified the handling and consumption of poultry meat as one of the most important sources of human campylobacteriosis, so elimination of Campylobacter in the poultry reservoir is a crucial step in the control of this foodborne infection. To date, the use of probiotics has demonstrated promising results to reduce Campylobacter colonization. This review provides recent insights into methods used for probiotic screening to reduce the prevalence and colonization of Campylobacter at the farm level. Different eukaryotic epithelial cell lines are employed to screen probiotics with an anti-Campylobacter activity and yield useful information about the inhibition mechanism involved. These in vitro virulence models involve only human intestinal or cervical cell lines whereas the use of avian cell lines could be a preliminary step to investigate mechanisms of C. jejuni colonization in poultry in the presence of probiotics. In addition, in vivo trials to evaluate the effect of probiotics on Campylobacter colonization are conducted, taking into account the complexity introduced by the host, the feed, and the microbiota. However, the heterogeneity of the protocols used and the short time duration of the experiments lead to results that are difficult to compare and draw conclusions at the slaughter-age of broilers. Nevertheless, the combined approach using complementary in vitro and in vivo tools (cell cultures and animal experiments) leads to a better characterization of probiotic strains and could be employed to assess reduced Campylobacter spp. colonization in chickens if some

  3. Sensitivity of 2-[18F]fluoro-2-deoxyglucose positron emission tomography for advanced colorectal neoplasms: a large-scale analysis of 7505 asymptomatic screening individuals.

    Science.gov (United States)

    Sekiguchi, Masau; Kakugawa, Yasuo; Terauchi, Takashi; Matsumoto, Minori; Saito, Hiroshi; Muramatsu, Yukio; Saito, Yutaka; Matsuda, Takahisa

    2016-12-01

    The sensitivity of 2-[ 18 F]fluoro-2-deoxyglucose positron emission tomography (FDG-PET) for advanced colorectal neoplasms among healthy subjects is not yet fully understood. The present study aimed to clarify the sensitivity by analyzing large-scale data from an asymptomatic screening population. A total of 7505 asymptomatic screenees who underwent both FDG-PET and colonoscopy at our Cancer Screening Division between February 2004 and March 2013 were analyzed. FDG-PET and colonoscopy were performed on consecutive days, and each examination was interpreted in a blinded fashion. The results of the two examinations were compared for each of the divided six colonic segments, with those from colonoscopy being set as the reference. The relationships between the sensitivity of FDG-PET and clinicopathological features of advanced neoplasms were also evaluated. Two hundred ninety-one advanced neoplasms, including 24 invasive cancers, were detected in 262 individuals. Thirteen advanced neoplasms (advanced adenomas) were excluded from the analysis because of the coexistence of lesions in the same colonic segment. The sensitivity, specificity, and positive and negative predictive values of FDG-PET for advanced neoplasms were 16.9 % [95 % confidence interval (CI) 12.7-21.8 %], 99.3 % (95 % CI 99.2-99.4 %), 13.5 % (95 % CI 10.1-17.6 %), and 99.4 % (95 % CI 99.3-99.5 %), respectively. The sensitivity was lower for lesions with less advanced histological grade, of smaller size, and flat-type morphology, and for those located in the proximal part of the colon. FDG-PET is believed to be difficult to use as a primary screening tool in population-based colorectal cancer screening because of its low sensitivity for advanced neoplasms. Even when it is used in opportunistic cancer screening, the limit of its sensitivity should be considered.

  4. RNAi Screening in Spodoptera frugiperda.

    Science.gov (United States)

    Ghosh, Subhanita; Singh, Gatikrushna; Sachdev, Bindiya; Kumar, Ajit; Malhotra, Pawan; Mukherjee, Sunil K; Bhatnagar, Raj K

    2016-01-01

    RNA interference is a potent and precise reverse genetic approach to carryout large-scale functional genomic studies in a given organism. During the past decade, RNAi has also emerged as an important investigative tool to understand the process of viral pathogenesis. Our laboratory has successfully generated transgenic reporter and RNAi sensor line of Spodoptera frugiperda (Sf21) cells and developed a reversal of silencing assay via siRNA or shRNA guided screening to investigate RNAi factors or viral pathogenic factors with extraordinary fidelity. Here we describe empirical approaches and conceptual understanding to execute successful RNAi screening in Spodoptera frugiperda 21-cell line.

  5. An RNA polymerase II-driven Ebola virus minigenome system as an advanced tool for antiviral drug screening.

    Science.gov (United States)

    Nelson, Emily V; Pacheco, Jennifer R; Hume, Adam J; Cressey, Tessa N; Deflubé, Laure R; Ruedas, John B; Connor, John H; Ebihara, Hideki; Mühlberger, Elke

    2017-10-01

    Ebola virus (EBOV) causes a severe disease in humans with the potential for significant international public health consequences. Currently, treatments are limited to experimental vaccines and therapeutics. Therefore, research into prophylaxis and antiviral strategies to combat EBOV infections is of utmost importance. The requirement for high containment laboratories to study EBOV infection is a limiting factor for conducting EBOV research. To overcome this issue, minigenome systems have been used as valuable tools to study EBOV replication and transcription mechanisms and to screen for antiviral compounds at biosafety level 2. The most commonly used EBOV minigenome system relies on the ectopic expression of the T7 RNA polymerase (T7), which can be limiting for certain cell types. We have established an improved EBOV minigenome system that utilizes endogenous RNA polymerase II (pol II) as a driver for the synthesis of minigenome RNA. We show here that this system is as efficient as the T7-based minigenome system, but works in a wider range of cell types, including biologically relevant cell types such as bat cells. Importantly, we were also able to adapt this system to a reliable and cost-effective 96-well format antiviral screening assay with a Z-factor of 0.74, indicative of a robust assay. Using this format, we identified JG40, an inhibitor of Hsp70, as an inhibitor of EBOV replication, highlighting the potential for this system as a tool for antiviral drug screening. In summary, this updated EBOV minigenome system provides a convenient and effective means of advancing the field of EBOV research. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Large Scale Screening of Low Cost Ferritic Steel Designs For Advanced Ultra Supercritical Boiler Using First Principles Methods

    Energy Technology Data Exchange (ETDEWEB)

    Ouyang, Lizhi [Tennessee State Univ. Nashville, TN (United States)

    2016-11-29

    Advanced Ultra Supercritical Boiler (AUSC) requires materials that can operate in corrosive environment at temperature and pressure as high as 760°C (or 1400°F) and 5000psi, respectively, while at the same time maintain good ductility at low temperature. We develop automated simulation software tools to enable fast large scale screening studies of candidate designs. While direct evaluation of creep rupture strength and ductility are currently not feasible, properties such as energy, elastic constants, surface energy, interface energy, and stack fault energy can be used to assess their relative ductility and creeping strength. We implemented software to automate the complex calculations to minimize human inputs in the tedious screening studies which involve model structures generation, settings for first principles calculations, results analysis and reporting. The software developed in the project and library of computed mechanical properties of phases found in ferritic steels, many are complex solid solutions estimated for the first time, will certainly help the development of low cost ferritic steel for AUSC.

  7. Anti-cancer effect of oncolytic adenovirus-armed shRNA targeting MYCN gene on doxorubicin-resistant neuroblastoma cells.

    Science.gov (United States)

    Li, Yuan; Zhuo, Baobiao; Yin, Yiyu; Han, Tao; Li, Shixian; Li, Zhengwei; Wang, Jian

    2017-09-09

    Chemotherapy is one of the few effective choices for patients with neuroblastoma. However, the development of muti-drug resistance (MDR) to chemotherapy is a major obstacle to the effective treatment of advanced or recurrent neuroblastoma. The muti-drug resistance-associated protein (MRP), which encodes a transmembrane glycoprotein, is a key regulator of MDR. The expression of MRP is a close correlation with MYCN oncogene in neuroblastoma. We have recently shown ZD55-shMYCN (oncolytic virus armed with shRNA against MYCN) can down-regulate MYCN to inhibit tumor cells proliferation and induce apoptosis in neuroblastoma. Here we further report ZD55-shMYCN re-sensitized doxorubicin-resistant cells to doxorubicin (as shown by reduced proliferation, increased apoptosis, and inhibited cell migration), and reduced the in vivo growth rate of neuroblastoma xenografts by down-regulation of MRP expression. Sequential therapy with doxorubicin did not affect the replication of ZD55-shMYCN in doxorubicin-resistant neuroblastoma cells, but decreased the expression of Bcl-2, Bcl-X L , MMP-1. Thus, this synergistic effect of ZD55-shMYCN in combination with doxorubicin provides a novel therapy strategy for doxorubicin-resistant neuroblastoma, and is a promising approach for further clinical development. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Advanced kinetics for calorimetric techniques and thermal stability screening of sulfide minerals

    International Nuclear Information System (INIS)

    Iliyas, Abduljelil; Hawboldt, Kelly; Khan, Faisal

    2010-01-01

    Thermal methods of analysis such as differential scanning calorimetry (DSC) provide a powerful methodology for the study of solid reactions. This paper proposes an improved thermal analysis methodology for thermal stability investigation of complex solid-state reactions. The proposed methodology is based on differential iso-conversional approach and involves peak separation, individual peak analysis and combination of isothermal/non-isothermal DSC measurements for kinetic analysis and prediction. The proposed thermal analysis, which coupled with Mineral Libration Analyzer (MLA) technique was employed to investigate thermal behavior of sulfide mineral oxidation. The importance of various experimental variables such as particle size, heating rate and atmosphere were investigated and discussed. The information gained from such an advanced thermal analysis method is useful for scale-up processes with potential of significant savings in plant operations, as well as in mitigating adverse environmental and safety issues arising from handling and storage of sulfide minerals.

  9. Expression of plasmid-based shRNA against the E1 and nsP1 genes effectively silenced Chikungunya virus replication.

    Directory of Open Access Journals (Sweden)

    Shirley Lam

    Full Text Available BACKGROUND: Chikungunya virus (CHIKV is a re-emerging alphavirus that causes chikungunya fever and persistent arthralgia in humans. Currently, there is no effective vaccine or antiviral against CHIKV infection. Therefore, this study evaluates whether RNA interference which targets at viral genomic level may be a novel antiviral strategy to inhibit the medically important CHIKV infection. METHODS: Plasmid-based small hairpin RNA (shRNA was investigated for its efficacy in inhibiting CHIKV replication. Three shRNAs designed against CHIKV Capsid, E1 and nsP1 genes were transfected to establish stable shRNA-expressing cell clones. Following infection of stable shRNA cells clones with CHIKV at M.O.I. 1, viral plaque assay, Western blotting and transmission electron microscopy were performed. The in vivo efficacy of shRNA against CHIKV replication was also evaluated in a suckling murine model of CHIKV infection. RESULTS: Cell clones expressing shRNAs against CHIKV E1 and nsP1 genes displayed significant inhibition of infectious CHIKV production, while shRNA Capsid demonstrated a modest inhibitory effect as compared to scrambled shRNA cell clones and non-transfected cell controls. Western blot analysis of CHIKV E2 protein expression and transmission electron microscopy of shRNA E1 and nsP1 cell clones collectively demonstrated similar inhibitory trends against CHIKV replication. shRNA E1 showed non cell-type specific anti-CHIKV effects and broad-spectrum silencing against different geographical strains of CHIKV. Furthermore, shRNA E1 clones did not exert any inhibition against Dengue virus and Sindbis virus replication, thus indicating the high specificity of shRNA against CHIKV replication. Moreover, no shRNA-resistant CHIKV mutant was generated after 50 passages of CHIKV in the stable cell clones. More importantly, strong and sustained anti-CHIKV protection was conferred in suckling mice pre-treated with shRNA E1. CONCLUSION: Taken together, these

  10. Hypoxia-response plasmid vector producing bcl-2 shRNA enhances the apoptotic cell death of mouse rectum carcinoma.

    Science.gov (United States)

    Fujioka, Takashi; Matsunaga, Naoya; Okazaki, Hiroyuki; Koyanagi, Satoru; Ohdo, Shigehiro

    2010-01-01

    Hypoxia-induced gene expression frequently occurs in malignant solid tumors because they often have hypoxic areas in which circulation is compromised due to structurally disorganized blood vessels. Hypoxia-response elements (HREs) are responsible for activating gene transcription in response to hypoxia. In this study, we constructed a hypoxia-response plasmid vector producing short hairpin RNA (shRNA) against B-cell leukemia/lymphoma-2 (bcl-2), an anti-apoptotic factor. The hypoxia-response promoter was made by inserting tandem repeats of HREs upstream of cytomegalovirus (CMV) promoter (HRE-CMV). HRE-CMV shbcl-2 vector consisted of bcl-2 shRNA under the control of HRE-CMV promoter. In hypoxic mouse rectum carcinoma cells (colon-26), the production of bcl-2 shRNA driven by HRE-CMV promoter was approximately 2-fold greater than that driven by CMV promoter. A single intratumoral (i.t.) injection of 40 microg HRE-CMV shbcl-2 to colon-26 tumor-bearing mice caused apoptotic cell death, and repetitive treatment with HRE-CMV shbcl-2 (40 microg/mouse, i.t.) also significantly suppressed the growth of colon-26 tumor cells implanted in mice. Apoptotic and anti-tumor effects were not observed in tumor-bearing mice treated with CMV shbcl-2. These results reveal the ability of HRE-CMV shbcl-2 vector to suppress the expression of bcl-2 in hypoxic tumor cells and suggest the usefulness of our constructed hypoxia-response plasmid vector to treat malignant tumors. [Supplementary Figures: available only at http://dx.doi.org/10.1254/jphs.10054FP].

  11. The discriminatory capability of existing scores to predict advanced colorectal neoplasia: a prospective colonoscopy study of 5,899 screening participants.

    Science.gov (United States)

    Wong, Martin C S; Ching, Jessica Y L; Ng, Simpson; Lam, Thomas Y T; Luk, Arthur K C; Wong, Sunny H; Ng, Siew C; Ng, Simon S M; Wu, Justin C Y; Chan, Francis K L; Sung, Joseph J Y

    2016-02-03

    We evaluated the performance of seven existing risk scoring systems in predicting advanced colorectal neoplasia in an asymptomatic Chinese cohort. We prospectively recruited 5,899 Chinese subjects aged 50-70 years in a colonoscopy screening programme(2008-2014). Scoring systems under evaluation included two scoring tools from the US; one each from Spain, Germany, and Poland; the Korean Colorectal Screening(KCS) scores; and the modified Asia Pacific Colorectal Screening(APCS) scores. The c-statistics, sensitivity, specificity, positive predictive values(PPVs), and negative predictive values(NPVs) of these systems were evaluated. The resources required were estimated based on the Number Needed to Screen(NNS) and the Number Needed to Refer for colonoscopy(NNR). Advanced neoplasia was detected in 364 (6.2%) subjects. The German system referred the least proportion of subjects (11.2%) for colonoscopy, whilst the KCS scoring system referred the highest (27.4%). The c-statistics of all systems ranged from 0.56-0.65, with sensitivities ranging from 0.04-0.44 and specificities from 0.74-0.99. The modified APCS scoring system had the highest c-statistics (0.65, 95% C.I. 0.58-0.72). The NNS (12-19) and NNR (5-10) were similar among the scoring systems. The existing scoring systems have variable capability to predict advanced neoplasia among asymptomatic Chinese subjects, and further external validation should be performed.

  12. Three new shRNA expression vectors targeting the CYP3A4 coding sequence to inhibit its expression

    Directory of Open Access Journals (Sweden)

    Siyun Xu

    2014-10-01

    Full Text Available RNA interference (RNAi is useful for selective gene silencing. Cytochrome P450 3A4 (CYP3A4, which metabolizes approximately 50% of drugs in clinical use, plays an important role in drug metabolism. In this study, we aimed to develop a short hairpin RNA (shRNA to modulate CYP3A4 expression. Three new shRNAs (S1, S2 and S3 were designed to target the coding sequence (CDS of CYP3A4, cloned into a shRNA expression vector, and tested in different cells. The mixture of three shRNAs produced optimal reduction (55% in CYP3A4 CDS-luciferase activity in both CHL and HEK293 cells. Endogenous CYP3A4 expression in HepG2 cells was decreased about 50% at both mRNA and protein level after transfection of the mixture of three shRNAs. In contrast, CYP3A5 gene expression was not altered by the shRNAs, supporting the selectivity of CYP3A4 shRNAs. In addition, HepG2 cells transfected with CYP3A4 shRNAs were less sensitive to Ginkgolic acids, whose toxic metabolites are produced by CYP3A4. These results demonstrate that vector-based shRNAs could modulate CYP3A4 expression in cells through their actions on CYP3A4 CDS, and CYP3A4 shRNAs may be utilized to define the role of CYP3A4 in drug metabolism and toxicity.

  13. A retrospective cohort study on the association between periapical abscess, advanced periodontal disease, and the national oral health screening program among Korean adults.

    Science.gov (United States)

    Ha, Jung-Eun; Jung, Se-Hwan; Jin, Bo-Hyoung; Lee, Byoung-Jin; Bae, Kwang-Hak

    2013-09-01

    The National Oral Health Screening Program (NOHSP) is a general population-based program in Korea. The objective of this study was to assess the association between participation in the NOHSP and dental visit for periapical abscess (PA) and advanced periodontal disease (APD) among Korean adults. Data were obtained for subjects from the National Health Insurance database. The authors conducted a retrospective cohort study of 9358 randomly selected subjects who were between 40 and 64 years old in 2002. The outcomes of dental visit for PA or APD from the years 2003 to 2007 were compared between the screening and nonscreening groups. The nonscreening group had 19% higher risk of PA and 15% higher risk of APD. This study suggests that the NOHSP may decrease the risk of dental visit because of PA and APD by preventing the progress of lesion to the advanced stage among Korean adults.

  14. Inhibitors of MyD88-dependent proinflammatory cytokine production identified utilizing a novel RNA interference screening approach.

    Directory of Open Access Journals (Sweden)

    John S Cho

    2009-09-01

    Full Text Available The events required to initiate host defenses against invading pathogens involve complex signaling cascades comprised of numerous adaptor molecules, kinases, and transcriptional elements, ultimately leading to the production of proinflammatory cytokines, such as tumor necrosis factor alpha (TNF-alpha. How these signaling cascades are regulated, and the proteins and regulatory elements participating are still poorly understood.We report here the development a completely random short-hairpin RNA (shRNA library coupled with a novel forward genetic screening strategy to identify inhibitors of Toll-like receptor (TLR dependent proinflammatory responses. We developed a murine macrophage reporter cell line stably transfected with a construct expressing diphtheria toxin-A (DT-A under the control of the TNF-alpha-promoter. Stimulation of the reporter cell line with the TLR ligand lipopolysaccharide (LPS resulted in DT-A induced cell death, which could be prevented by the addition of an shRNA targeting the TLR adaptor molecule MyD88. Utilizing this cell line, we screened a completely random lentiviral short hairpin RNA (shRNA library for sequences that inhibited TLR-mediated TNF-alpha production. Recovery of shRNA sequences from surviving cells led to the identification of unique shRNA sequences that significantly inhibited TLR4-dependent TNF-alpha gene expression. Furthermore, these shRNA sequences specifically blocked TLR2 but not TLR3-dependent TNF-alpha production.Thus, we describe the generation of novel tools to facilitate large-scale forward genetic screens in mammalian cells and the identification of potent shRNA inhibitors of TLR2 and TLR4- dependent proinflammatory responses.

  15. Effects and mechanism of integrin-β1 gene expression inhibited by shRNA in invasion of pancreatic carcinoma PANC-1 cells.

    Science.gov (United States)

    Yu, Feng; Li, Hua; Bu, Xuefeng; Zhang, Yongjun

    2012-01-01

    To investigate the effects of integrin-β1 gene expression inhibited by shRNA on invasion of pancreatic carcinoma PANC-1 cells in vitro. The eukaryotic expression plasmid of short hairpin RNA (shRNA) targeting integrin-β1 gene (integrin-β1-shRNA) was constructed and transfected into PANC-1 cells. The expressions of integrin-β1 mRNA and protein were detected by real-time quantitative polymerase chain reaction (PCR) and western blot assay, respectively. The invasive ability of PANC-1 cells was observed with a transwell cell culture chamber and the expressions of MMP-2 and MMP-9 were assayed. Compared to the untransfected group, recombinant expression plasmid integrin-β1-shRNA resulted in reduction of integrin-β1 mRNA and protein by 78.58%±7.24% and 92.88%±3.18%, respectively and the average number of invading PANC-1 cells were decreased from 52±5 to 21±4 (pPANC-1 cells in vitro significantly.

  16. The influence of survivin shRNA on the cell cycle and the invasion of SW480 cells of colorectal carcinoma

    Directory of Open Access Journals (Sweden)

    Yu Jin

    2008-07-01

    Full Text Available Abstract Background The objective was to understand the influence of Survivin plasmid with short hairpin RNA (shRNA on the cell cycle, invasion, and the silencing effect of Survivin gene in the SW480 cell of colorectal carcinoma. Methods A eukaryotic expression vector, PGCH1/Survivin shRNA, a segment sequence of Survivin as target, was created and transfected into colorectal carcinoma cell line SW480 by the non-lipid method. The influence on the Survivin protein was analyzed by Western blotting, while the cell cycle, cell apoptosis were analyzed by flow cytometry, and invasion of the cell was analyzed by Transwell's chamber method. Results After the transfection of PGCH1/Survivin shRNA, the expression of Survivin protein in SW480 cells was dramatically decreased by 60.68%, in which the cells were stopped at G2/M phase, even though no apoptosis was detected. The number of transmembranous cells of the experimental group, negative control group, and blank control group were 14.46 ± 2.11, 25.12 ± 8.37, and 25.86 ± 7.45, respectively (P 0.05. Conclusion Survivin shRNA could significantly reduce the expression of Survivin protein and invasion of SW480 cells. Changes in cell cycle were observed, but no apoptosis was induced.

  17. New Advances of Preimplantation and Prenatal Genetic Screening and Noninvasive Testing as a Potential Predictor of Health Status of Babies

    Directory of Open Access Journals (Sweden)

    Tanya Milachich

    2014-01-01

    Full Text Available The current morphologically based selection of human embryos for transfer cannot detect chromosome aneuploidies. So far, only biopsy techniques have been able to screen for chromosomal aneuploidies in the in vitro fertilization (IVF embryos. Preimplantation genetic diagnosis (PGD or screening (PGS involves the biopsy of oocyte polar bodies or embryonic cells and has become a routine clinical procedure in many IVF clinics worldwide, including recent development of comprehensive chromosome screening of all 23 pairs of chromosomes by microarrays for aneuploidy screening. The routine preimplantation and prenatal genetic diagnosis (PND require testing in an aggressive manner. These procedures may be invasive to the growing embryo and fetus and potentially could compromise the clinical outcome. Therefore the aim of this review is to summarize not only the new knowledge on preimplantation and prenatal genetic diagnosis in humans, but also on the development of potential noninvasive embryo and fetal testing that might play an important role in the future.

  18. New Advances of Preimplantation and Prenatal Genetic Screening and Noninvasive Testing as a Potential Predictor of Health Status of Babies

    Science.gov (United States)

    2014-01-01

    The current morphologically based selection of human embryos for transfer cannot detect chromosome aneuploidies. So far, only biopsy techniques have been able to screen for chromosomal aneuploidies in the in vitro fertilization (IVF) embryos. Preimplantation genetic diagnosis (PGD) or screening (PGS) involves the biopsy of oocyte polar bodies or embryonic cells and has become a routine clinical procedure in many IVF clinics worldwide, including recent development of comprehensive chromosome screening of all 23 pairs of chromosomes by microarrays for aneuploidy screening. The routine preimplantation and prenatal genetic diagnosis (PND) require testing in an aggressive manner. These procedures may be invasive to the growing embryo and fetus and potentially could compromise the clinical outcome. Therefore the aim of this review is to summarize not only the new knowledge on preimplantation and prenatal genetic diagnosis in humans, but also on the development of potential noninvasive embryo and fetal testing that might play an important role in the future. PMID:24783200

  19. Downregulation of mouse CCR3 by lentiviral shRNA inhibits proliferation and induces apoptosis of mouse eosinophils.

    Science.gov (United States)

    Zhu, Xin-Hua; Liao, Bing; Xu, Yi; Liu, Ke; Huang, Yun; Huang, Quan-Long; Liu, Yue-Hui

    2017-02-01

    RNA interference has been considered as an effective gene silencing method in basic and preclinical investigations. The aims of the present study were to construct a lentiviral vector expressing a short hairpin RNA (shRNA) targeting the murine CC chemokine receptor 3 (mCCR3), and to investigate its effects on the proliferation and apoptosis of mouse eosinophils. A recombinant lentiviral vector expressing four fragments of mouse CCR3 shRNA (pLVX‑mCCR3‑1+2+3+4‑shRNA) was constructed using subcloning techniques. This novel lentivirus was then packaged into 293T cells by co‑transduction with plasmids, including Baculo p35, pCMV R8.2 and VSV. The interference effects of the vector were verified using polymerase chain reaction (PCR) and western blot analyses. The effects of the interference on the proliferation and apoptosis of mouse eosinophils were investigated using 3‑(4,5‑dimethylthiazol‑2‑yl)‑5‑(3‑carboxymethoxyphenyl)‑2‑(4‑sulfophenyl)‑2H‑tetrazolium and terminal deoxynucleotidyl transferase dUTP nick end labeling methods, respectively. The results of the PCR and western blot analyses confirmed that the novel recombinant vector, pLVX‑mCCR3‑1+2+3+4‑shRNA, had high efficiency in inhibiting the mRNA and protein expression levels of mCCR3 in mouse eosinophils. The downregulation of mCCR3 significantly inhibited proliferation of the eosinophils. Furthermore, the present study found that the downregulation of mCCR3 significantly promoted apoptosis of the eosinophils. Therefore, the downregulation of mCCR3 led to the inhibition of proliferation and induction of apoptosis in mouse eosinophils. The predominant characteristics of allergic rhinitis are eosinophil infiltration and release of inflammatory mediators, which appear in a variety of clinical manifestations. The results of the present study indicate that mCCR3 silencing may serve as a putative approach for the treatment of allergic rhinitis.

  20. RNAi screening of subtracted transcriptomes reveals tumor suppression by taurine-activated GABAA receptors involved in volume regulation

    Science.gov (United States)

    van Nierop, Pim; Vormer, Tinke L.; Foijer, Floris; Verheij, Joanne; Lodder, Johannes C.; Andersen, Jesper B.; Mansvelder, Huibert D.; te Riele, Hein

    2018-01-01

    To identify coding and non-coding suppressor genes of anchorage-independent proliferation by efficient loss-of-function screening, we have developed a method for enzymatic production of low complexity shRNA libraries from subtracted transcriptomes. We produced and screened two LEGO (Low-complexity by Enrichment for Genes shut Off) shRNA libraries that were enriched for shRNA vectors targeting coding and non-coding polyadenylated transcripts that were reduced in transformed Mouse Embryonic Fibroblasts (MEFs). The LEGO shRNA libraries included ~25 shRNA vectors per transcript which limited off-target artifacts. Our method identified 79 coding and non-coding suppressor transcripts. We found that taurine-responsive GABAA receptor subunits, including GABRA5 and GABRB3, were induced during the arrest of non-transformed anchor-deprived MEFs and prevented anchorless proliferation. We show that taurine activates chloride currents through GABAA receptors on MEFs, causing seclusion of cell volume in large membrane protrusions. Volume seclusion from cells by taurine correlated with reduced proliferation and, conversely, suppression of this pathway allowed anchorage-independent proliferation. In human cholangiocarcinomas, we found that several proteins involved in taurine signaling via GABAA receptors were repressed. Low GABRA5 expression typified hyperproliferative tumors, and loss of taurine signaling correlated with reduced patient survival, suggesting this tumor suppressive mechanism operates in vivo. PMID:29787571

  1. snoSeeker: an advanced computational package for screening of guide and orphan snoRNA genes in the human genome

    OpenAIRE

    Yang, Jian-Hua; Zhang, Xiao-Chen; Huang, Zhan-Peng; Zhou, Hui; Huang, Mian-Bo; Zhang, Shu; Chen, Yue-Qin; Qu, Liang-Hu

    2006-01-01

    Small nucleolar RNAs (snoRNAs) represent an abundant group of non-coding RNAs in eukaryotes. They can be divided into guide and orphan snoRNAs according to the presence or absence of antisense sequence to rRNAs or snRNAs. Current snoRNA-searching programs, which are essentially based on sequence complementarity to rRNAs or snRNAs, exist only for the screening of guide snoRNAs. In this study, we have developed an advanced computational package, snoSeeker, which includes CDseeker and ACAseeker ...

  2. Efficient and nontoxic biological response carrier delivering TNF-α shRNA for gene silencing in a murine model of rheumatoid arthritis

    Directory of Open Access Journals (Sweden)

    Jialin Song

    2016-08-01

    Full Text Available Small interfering RNA (siRNA is an effective and specific method for silencing genes. However, an efficient and nontoxic carrier is needed to deliver the siRNA into the target cells. Tumor necrosis factor α (TNF-α plays a central role in the occurrence and progression of rheumatoid arthritis. In this study, we pre-synthetized a degradable cationic polymer (PDAPEI from 2,6-pyridinedicarboxaldehyde and low molecular weight polyethyleneimine (PEI, Mw=1.8 kDa as a gene vector for the delivery of TNF-α shRNA. The PDAPEI/pDNA complex showed a suitable particle size and stable zeta potential for transfection. In vitro study of the PDAPEI/pDNA complex revealed a lower cytotoxicity and higher transfection efficiency when transfecting TNF-α shRNA to macrophages by significantly down-regulating the expression of TNF-α. Moreover, the complex was extremely efficient in decreasing the severity of arthritis in mice with collagen-induced arthritis (CIA. PDAPEI delivered TNF-α shRNA has great potential in the treatment of rheumatoid arthritis.

  3. Screening for depression in advanced disease: psychometric properties, sensitivity, and specificity of two items of the Palliative Care Outcome Scale (POS).

    Science.gov (United States)

    Antunes, Bárbara; Murtagh, Fliss; Bausewein, Claudia; Harding, Richard; Higginson, Irene J

    2015-02-01

    Depression is common among patients with advanced disease but often difficult to detect. To assess the Palliative care Outcome Scale (POS) (10 items) against the Geriatric Depression Scale (GDS)-10 total score and the Hospital Anxiety and Depression Scale (HADS)-Depression subscale total score and determine if the POS has appropriate items to screen for depression among people with advanced disease. This was a secondary analysis performed on five studies. Four psychometric properties were assessed: data quality, scaling assumptions, acceptability, and internal consistency (reliability). Receiver operating characteristic (ROC) curves were used to determine the area under the curve. Sensitivity, specificity, positive and negative predictive values, false positive and negative rates, and positive and negative likelihood ratios were computed. The overall sample had 416 patients from Germany and England: 144 had cancer and 267 had nonmalignant conditions. Prevalence of depression across the sample was 17.5%. Floor and ceiling effects were rare. Cronbach's alpha coefficients for POS items 7 and 8 summed, GDS-10 and HADS-Depression items varied: 0.61 (heart failure) and 0.80 (cancer). Two items combined (Item 7-feeling depressed and Item 8-feeling good about yourself) consistently presented the highest area under the ROC curve, ranging from 0.76 (95% CI 0.60, 0.93) (Germany, lung cancer) to 0.97 (95% CI 0.91, 1.0) (heart failure), highest negative predictive value, and lowest false negative rate. For the overall sample, the cutoff 2/3 presented a negative predictive value of 89.4% (95% CI 84.7, 92.8) and false negative rate of 10.6 (95% CI 7.2, 15.3). POS items 7 and 8 summed are potentially useful to screen for depression in advanced disease populations. Copyright © 2015 American Academy of Hospice and Palliative Medicine. Published by Elsevier Inc. All rights reserved.

  4. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  5. Hypoxia-inducible bidirectional shRNA expression vector delivery using PEI/chitosan-TBA copolymers for colorectal Cancer gene therapy.

    Science.gov (United States)

    Javan, Bita; Atyabi, Fatemeh; Shahbazi, Majid

    2018-04-12

    This investigation was conducted to construct a hypoxia/colorectal dual-specific bidirectional short hairpin RNA (shRNA) expression vector and to transfect it into the colon cancer cell line HT-29 with PEI/chitosan-TBA nanoparticles for the simultaneous knock down of β-catenin and Bcl-2 under hypoxia. To construct a pRNA-bipHRE-CEA vector, the carcinoma embryonic antigen (CEA) promoter designed in two directions and the vascular endothelial growth factor (VEGF) enhancer were inserted between two promoters for hypoxic cancer specific gene expression. To confirm the therapeutic effect of the dual-specific vector, β-catenin and Bcl-2 shRNAs were inserted downstream of each promoter. The physicochemical properties, the cytotoxicity, and the transfection efficiency of these PEI/chitosan-TBA nanoparticles were investigated. In addition, the antitumor effects of the designed vector on the expression of β-catenin and Bcl-2, cell cycle distribution, and apoptosis were investigated in vitro. The silencing effect of the hypoxia-response shRNA expression vector was relatively low (18%-25%) under normoxia, whereas it was significantly increased to approximately 50%-60% in the HT-29 cell line. Moreover, the cancer cells showed significant G0/G1 arrest and increased apoptosis due to gene silencing under hypoxia. Furthermore, MTS assay, fluorescence microscopy images, and flow cytometry analyses confirmed that the PEI/chitosan-TBA blend system provided effective transfection with low cytotoxicity. This novel hypoxia-responsive shRNA expression vector may be useful for RNA interference (RNAi)-based cancer gene therapy in hypoxic colorectal tumors. Moreover, the PEI/chitosan-TBA copolymer might be a promising gene carrier for use in gene transfer in vivo. Copyright © 2017. Published by Elsevier Inc.

  6. Suppression of human breast tumors in NOD/SCID mice by CD44 shRNA gene therapy combined with doxorubicin treatment

    Directory of Open Access Journals (Sweden)

    Pham PV

    2012-05-01

    Full Text Available Phuc Van Pham1, Ngoc Bich Vu1, Thuy Thanh Duong1, Tam Thanh Nguyen1, Nhung Hai Truong1, Nhan Lu Chinh Phan1, Tue Gia Vuong1, Viet Quoc Pham1, Hoang Minh Nguyen1, Kha The Nguyen1, Nhung Thi Nguyen1, Khue Gia Nguyen1, Lam Tan Khat1, Dong Van Le2, Kiet Dinh Truong1, Ngoc Kim Phan11Laboratory of Stem Cell Research and Application, University of Science, Vietnam National University, HCM City, 2Military Medical University, Ha Noi, VietnamBackground: Breast cancer stem cells with a CD44+CD24- phenotype are the origin of breast tumors. Strong CD44 expression in this population indicates its important role in maintaining the stem cell phenotype. Previous studies show that CD44 down-regulation causes CD44+CD24- breast cancer stem cells to differentiate into non-stem cells that are sensitive to antitumor drugs and lose many characteristics of the original cells. In this study, we determined tumor suppression in non-obese severe combined immunodeficiency mice using CD44 shRNA therapy combined with doxorubicin treatment.Methods: Tumor-bearing non-obese severe combined immunodeficiency mice were established by injection of CD44+CD24- cells. To track CD44+CD24- cells, green fluorescence protein was stably transduced using a lentiviral vector prior to injection into mice. The amount of CD44 shRNA lentiviral vector used for transduction was based on CD44 down-regulation by in vitro CD44 shRNA transduction. Mice were treated with direct injection of CD44 shRNA lentiviral vector into tumors followed by doxorubicin administration after 48 hours. The effect was evaluated by changes in the size and weight of tumors compared with that of the control.Results: The combination of CD44 down-regulation and doxorubicin strongly suppressed tumor growth with significant differences in tumor sizes and weights compared with that of CD44 down-regulation or doxorubicin treatment alone. In the combination of CD44 down-regulation and doxorubicin group, the tumor weight was

  7. In vivo targeting of ADAM9 gene expression using lentivirus-delivered shRNA suppresses prostate cancer growth by regulating REG4 dependent cell cycle progression.

    Directory of Open Access Journals (Sweden)

    Che-Ming Liu

    Full Text Available Cancer cells respond to stress by activating a variety of survival signaling pathways. A disintegrin and metalloproteinase (ADAM 9 is upregulated during cancer progression and hormone therapy, functioning in part through an increase in reactive oxygen species. Here, we present in vitro and in vivo evidence that therapeutic targeting of ADAM9 gene expression by lentivirus-delivered small hairpin RNA (shRNA significantly inhibited proliferation of human prostate cancer cell lines and blocked tumor growth in a murine model of prostate cancer bone metastasis. Cell cycle studies confirmed an increase in the G1-phase and decrease in the S-phase population of cancer cells under starvation stress conditions, which correlated with elevated intracellular superoxide levels. Microarray data showed significantly decreased levels of regenerating islet-derived family member 4 (REG4 expression in prostate cancer cells with knockdown of ADAM9 gene expression. This REG4 downregulation also resulted in induction of expression of p21(Cip1/WAF1, which negatively regulates cyclin D1 and blocks the G1/S transition. Our data reveal a novel molecular mechanism of ADAM9 in the regulation of prostate cancer cell proliferation, and suggests a combined modality of ADAM9 shRNA gene therapy and cytotoxic agents for hormone refractory and bone metastatic prostate cancer.

  8. Depression Screening

    Science.gov (United States)

    ... Depression Screening Substance Abuse Screening Alcohol Use Screening Depression Screening (PHQ-9) - Instructions The following questions are ... this tool, there is also text-only version . Depression Screening - Manual Instructions The following questions are a ...

  9. Intravitreal Injection of Ranibizumab and CTGF shRNA Improves Retinal Gene Expression and Microvessel Ultrastructure in a Rodent Model of Diabetes

    Directory of Open Access Journals (Sweden)

    Bojie Hu

    2014-01-01

    Full Text Available Therapeutic modalities targeting vascular endothelial growth factor (VEGF have been used to treat neovascularization and macular edema. However, anti-VEGF treatment alone may cause up-regulation of connective tissue growth factor (CTGF in the retina, increasing the risk of fibrosis and tractional retinal detachment. Therefore, in this study, we employ a novel dual-target intervention that involves intravitreal injection of the VEGF inhibitor ranibizumab and a transfection reagent-treated non-viral vector carrying anti-CTGF short hairpin RNA (shRNA driven by human RNA polymerase III promoter U6. The effects of the dual-target intervention on the expression of VEGF and CTGF and on microvessel ultrastructure were examined in retina of streptozocin-induced diabetic rats. CTGF was significantly up-regulated at week 8 after diabetic induction, whereas VEGF was not up-regulated until week 10. The high expression of both genes was maintained at week 12. Transmission electron microscopy also revealed progressive exacerbation of microvessel ultrastructure during the same period. In addition, ranibizumab significantly lowered VEGF but elevated CTGF mRNA, whereas CTGF shRNA significantly reduced the mRNA levels of both CTGF and VEGF in diabetic retinas. Importantly, dual-target intervention normalized the transcript levels of both target genes and ameliorated retinal microvessel ultrastructural damage better than either single-target intervention. These results suggest the advantages of dual-target over single-target interventions in diabetic retina and reveal a novel therapeutic modality for diabetic retinopathy.

  10. Advanced screening of electrode couples

    Science.gov (United States)

    Giner, J. D.; Cahill, K.

    1980-01-01

    The chromium (Cr(3+)/Cr(2+)) redox couple (electrolyte and electrode) was investigated to determine its suitability as negative electrode for the iron (Fe(3+)/Fe(2+))-chromium (Cr(3+)/Cr(2+)) redox flow battery. Literature search and laboratory investigation established that the solubility and stability of aqueous acidic solutions of chromium(3) chloride and chromium(2) chloride are sufficient for redox battery application. Four categories of electrode materials were tested; namely, metals and metalloid materials (elements and compounds), alloys, plated materials, and Teflon-bonded materials. In all, the relative performance of 26 candidate electrode materials was evaluated on the basis of slow scan rate linear sweep voltammetry in stirred solution. No single material tested gave both acceptable anodic an acceptable cathodic performance. However, the identification of lead as a good cathodic electrocatalyst and gold as a good anodic electrocatalyst led to the invention of the lead/gold combination electrocatalyst. This type of catalyst can be fabricated in several ways and appears to offer the advantages of each metal without the disadvantages associated with their use as single materials. This lead/gold electrocatalyst was tested by NASA-Lewis Research Center in complete, flowing, redox batteries comprising a stack of several cells. A large improvement in the battery's coulombic and energy efficiency was observed.

  11. 植入前遗传学诊断/筛查技术指征进展%Advances in indications of preimplantation genetic diagnosis/screening

    Institute of Scientific and Technical Information of China (English)

    雷彩霞; 张月萍; 孙晓溪

    2017-01-01

    植入前遗传学诊断/筛查(PGD/PGS)技术发展多年,其指征始终存在争议.PGD指征较为明确,单基因遗传病、染色体异常人群、人类白细胞抗原(HLA)配型为其适用人群.PGS的指征争议较多,主要面向反复流产、反复植入失败、高龄人群,目的是提高妊娠率及活产率.然而第一代PGS技术[PGS#1,卵裂球活检及荧光原位杂交(FISH)-PGS]技术未显示明显效果,甚至降低了妊娠率及活产率.第二代PGS技术(PGS2.0)增加了严重男性因素不育为指征,其核心为囊胚活检及全染色体筛查(CCS),对上述人群的临床效果较为明显,降低了流产风险并提高了成功率及活产率.PGS2.0已极大地改变了辅助生殖技术(ART)面貌,可能成为未来生殖中心对所有患者的一个常规项目.目前仍然需要多中心前瞻性随机病例对照研究重新评估PGS.%Controversies in indications of preimplantation genetic diagnosis (PGD)/preimplantation genetic screening (PGS) are developing with the rapid improvement of the technology for years.PGD is clearly indicated for monogenetic diseases,chromosome abnormalities and HLA typing,while PGS is ambiguous in indications,with the purpose to improve fertility rate and take-home baby rate for patients suffered from recurrent spontaneous abortion (RSA),recurrent implantation failure and advanced maternal age.However,the first generation PGS technology [PGS#1,biopsy of blastomere plus fluorescent in situ hybridization (FISH)-PGS] has failed to provide promising clinical effect,and to the contrary decreased the fertility and take-home baby rate.The second generation PGS technology (PGS2.0),which is focused on biopsy ofblastocyst plus comprehensive chromosome screening (CCS) and adds severe male infertility factor as an indicator,has shown promising clinical effect of decreased abortion rate and increased fertility and take-home baby rate.PGS2.0 has dramatically changed features of assisted reproductive

  12. High-Throughput Screening as a Supplemental Tool for the Development of Advanced Emission Control Catalysts: Methodological Approaches and Data Processing

    Directory of Open Access Journals (Sweden)

    Andreas Sundermann

    2016-01-01

    Full Text Available A high-throughput (HT screening platform developed at hte with the application focus on automotive catalysis is described. hte HT units are configured for performing steady-state testing, as well as dynamic tests with fast feed switches, such as lean/rich excursions for the evaluation of NOx storage capacity and efficiency of lean NOx traps (LNT, ammonia storage capacity for selective catalytic reduction (SCR, evaluation of oxygen storage capacity (OSC, as well as lambda sweep tests for screening of three-way catalysts (TWC. Even though catalysts are screened on a rather small scale (~100 mg powder, experience showed that dosing rather complex gas mixtures in concentrations close to that found in real exhaust for the given application is mandatory to generate relevant data. The objective of this work is to give additional insight into HT technology. In the industrial research laboratory, HT screening has matured to become a reliable approach for rapid screening of both reaction parameter spaces, as well as material properties relevant for exhaust gas catalyst development. Due to the speed of optimized screening involving 48 parallel reactors, automated handling of primary data is an imported requirement. Software for data reduction, like estimation of light-off temperature, needs to be robust and handle results for diverse sample libraries in an unattended fashion. In combination with the statistical design of experiment and multivariate data analysis, HT testing has become a valuable enhancement to automotive catalyst development.

  13. In vivo knockdown of antisense non-coding mitochondrial RNAs by a lentiviral-encoded shRNA inhibits melanoma tumor growth and lung colonization.

    Science.gov (United States)

    Varas-Godoy, Manuel; Lladser, Alvaro; Farfan, Nicole; Villota, Claudio; Villegas, Jaime; Tapia, Julio C; Burzio, Luis O; Burzio, Veronica A; Valenzuela, Pablo D T

    2018-01-01

    The family of non-coding mitochondrial RNAs (ncmtRNA) is differentially expressed according to proliferative status. Normal proliferating cells express sense (SncmtRNA) and antisense ncmtRNAs (ASncmtRNAs), whereas tumor cells express SncmtRNA and downregulate ASncmtRNAs. Knockdown of ASncmtRNAs with oligonucleotides induces apoptotic cell death of tumor cells, leaving normal cells unaffected, suggesting a potential application for developing a novel cancer therapy. In this study, we knocked down the ASncmtRNAs in melanoma cell lines with a lentiviral-encoded shRNA approach. Transduction with lentiviral constructs targeted to the ASncmtRNAs induced apoptosis in murine B16F10 and human A375 melanoma cells in vitro and significantly retarded B16F10 primary tumor growth in vivo. Moreover, the treatment drastically reduced the number of lung metastatic foci in a tail vein injection assay, compared to controls. These results provide additional proof of concept to the knockdown of ncmtRNAs for cancer therapy and validate lentiviral-shRNA vectors for gene therapy. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. RNA interference-based therapeutics for human immunodeficiency virus HIV-1 treatment: synthetic siRNA or vector-based shRNA?

    Science.gov (United States)

    Subramanya, Sandesh; Kim, Sang-Soo; Manjunath, N; Shankar, Premlata

    2010-02-01

    Despite the clinical benefits of highly active antiretroviral therapy (HAART), the prospect of life-long antiretroviral treatment poses significant problems, which has spurred interest in developing new drugs and strategies to treat HIV infection and eliminate persistent viral reservoirs. RNAi has emerged as a therapeutic possibility for HIV. We discuss progress in overcoming hurdles to translating transient and stable RNAi enabling technologies to clinical application for HIV; covering the past 2 - 3 years. HIV inhibition can be achieved by transfection of chemically or enzymatically synthesized siRNAs or by DNA-based vector systems expressing short hairpin RNAs (shRNAs) that are processed intracellularly into siRNA. We compare these approaches, focusing on technical and safety issues that will guide the choice of strategy for clinical use. Introduction of synthetic siRNA into cells or its stable endogenous production using vector-driven shRNA have been shown to suppress HIV replication in vitro and, in some instances, in vivo. Each method has advantages and limitations in terms of ease of delivery, duration of silencing, emergence of escape mutants and potential toxicity. Both appear to have potential as future therapeutics for HIV, once the technical and safety issues of each approach are overcome.

  15. Prevalence of any size adenomas and advanced adenomas in 40- to 49-year-old individuals undergoing screening colonoscopy because of a family history of colorectal carcinoma in a first-degree relative.

    Science.gov (United States)

    Gupta, Akshay K; Samadder, Jewel; Elliott, Eric; Sethi, Saurabh; Schoenfeld, Philip

    2011-07-01

    Per current guidelines, patients with a first-degree relative (FDR) with colorectal cancer (CRC) should get screened at least at age 40. Data about the prevalence of adenomas and advanced adenomas (AAs) in these patients are lacking. To examine the prevalence of adenomas and AAs in 40- to 49-year-old individuals undergoing screening colonoscopy for family history of CRC. Retrospective chart review. Asymptomatic patients 40 to 49 years of age undergoing their first screening colonoscopy at the University of Michigan during the period 1999 to 2009 because of an FDR with CRC. Prevalence of adenomas (any size), AAs, and risk factors associated with adenomas. Among 640 study patients, the prevalence of adenomas (any size) was 15.4% and 3.3% for AAs. Adenoma prevalence was lower if the FDR with CRC was younger than 60 years of age versus an FDR with CRC older than 60 years of age (12.4% vs 19%, P = .034). Male sex (odds ratio 2.6; 95% CI, 1.06-4.4) and advancing age (odds ratio 1.16; 95% CI, 1.03-1.31) were associated with adenomas. Limited data on risk factor exposure and insufficient sample size to assess risk factors for AAs. Among 40- to 49-year-old patients undergoing screening colonoscopy because of an FDR with CRC, the prevalence of adenomas and AAs is low. Further research should determine whether these individuals have a higher prevalence of adenomas compared with average-risk individuals. Copyright © 2011 American Society for Gastrointestinal Endoscopy. Published by Mosby, Inc. All rights reserved.

  16. Virus-mediated shRNA knockdown of prodynorphin in the rat nucleus accumbens attenuates depression-like behavior and cocaine locomotor sensitization.

    Science.gov (United States)

    Cohen, Ami; Whitfield, Timothy W; Kreifeldt, Max; Koebel, Pascale; Kieffer, Brigitte L; Contet, Candice; George, Olivier; Koob, George F

    2014-01-01

    Dynorphins, endogenous opioid peptides that arise from the precursor protein prodynorphin (Pdyn), are hypothesized to be involved in the regulation of mood states and the neuroplasticity associated with addiction. The current study tested the hypothesis that dynorphin in the nucleus accumbens (NAcc) mediates such effects. More specifically, we examined whether knockdown of Pdyn within the NAcc in rats would alter the expression of depressive-like and anxiety-like behavior, as well as cocaine locomotor sensitization. Wistar rats were injected with adeno-associated viral (AAV) vectors encoding either a Pdyn-specific short hairpin RNA (AAV-shPdyn) or a scrambled shRNA (AAV-shScr) as control. Four weeks later, rats were tested for anxiety-like behavior in the elevated plus maze test and depressive-like behavior in the forced swim test (FST). Finally, rats received one daily injection of saline or cocaine (20 mg/kg, i.p.), followed by assessment of locomotion for 4 consecutive days. Following 3 days of abstinence, the rats completed 2 additional daily cocaine/saline locomotor trials. Pdyn knockdown in the NAcc led to a significant reduction in depressive-like behavior in the FST, but had no effect on anxiety-like behavior in the elevated plus maze. Pdyn knockdown did not alter baseline locomotor behavior, the locomotor response to acute cocaine, or the initial sensitization of the locomotor response to cocaine over the first 4 cocaine treatment days. However, following 3 days abstinence the locomotor response to the cocaine challenge returned to their original levels in the AAV-shPdyn rats while remaining heightened in the AAV-shScr rats. These results suggest that dynorphin in a very specific area of the nucleus accumbens contributes to depressive-like states and may be involved in neuroadaptations in the NAcc that contribute to the development of cocaine addiction as a persistent and lasting condition.

  17. [Selection and construction of cell line stably expressing survivin gene in lower level through eukaryotic plasmid vector of shRNA].

    Science.gov (United States)

    Wang, Wen-Xia; Sun, Shan-Zhen; Song, Ying

    2008-06-01

    To construct a short hairpin RNA(shRNA) interference expression plasmid vector of survivin gene, transfect tongue squamous cell carcinoma line Tca8113 which expressed survivin gene in a high level, and choose the cells whose survivin gene were suppressed significantly. Two pairs of oligonucleotide sequences specific for survivin gene were designed and synthesized, and cloned into pSilencer-2.1U6-neo plasmid. The recombinant plasmids (named PS1 and PS2) were amplified in Ecoli. DH5alpha was identified by restriction digestion, PCR and sequencing. The vectors were transfected into Tca8113 cells with lipofectamine 2000. After selection with G418, the stable cell clones were attained. Survivn expression was assayed with real-time quantitative PCR and Western blotting. SAS8.0 software package was used for Student t test. Two vectors were constructed successfully and stable cell clones with PS1 or PS2 plasmid were obtained. As compared with those of control, survivin expression of transfected cell with PS1 or PS2 in mRNA level was significantly suppressed (P<0.05). In protein level, only those of transfected cell with PS2 was significantly suppressed (P<0.01). The shRNA interference expression plasmid vectors of survivin gene are successfully constructed, and Tca8113 cells which express survivin gene in a stable lower level are attained, which enable us to carry out further research on gene therapy of oral squamous cell carcinoma. Supported by National Natural Science Foundation of China (Grant No.30572056).

  18. Virus-mediated shRNA knockdown of prodynorphin in the rat nucleus accumbens attenuates depression-like behavior and cocaine locomotor sensitization.

    Directory of Open Access Journals (Sweden)

    Ami Cohen

    Full Text Available Dynorphins, endogenous opioid peptides that arise from the precursor protein prodynorphin (Pdyn, are hypothesized to be involved in the regulation of mood states and the neuroplasticity associated with addiction. The current study tested the hypothesis that dynorphin in the nucleus accumbens (NAcc mediates such effects. More specifically, we examined whether knockdown of Pdyn within the NAcc in rats would alter the expression of depressive-like and anxiety-like behavior, as well as cocaine locomotor sensitization. Wistar rats were injected with adeno-associated viral (AAV vectors encoding either a Pdyn-specific short hairpin RNA (AAV-shPdyn or a scrambled shRNA (AAV-shScr as control. Four weeks later, rats were tested for anxiety-like behavior in the elevated plus maze test and depressive-like behavior in the forced swim test (FST. Finally, rats received one daily injection of saline or cocaine (20 mg/kg, i.p., followed by assessment of locomotion for 4 consecutive days. Following 3 days of abstinence, the rats completed 2 additional daily cocaine/saline locomotor trials. Pdyn knockdown in the NAcc led to a significant reduction in depressive-like behavior in the FST, but had no effect on anxiety-like behavior in the elevated plus maze. Pdyn knockdown did not alter baseline locomotor behavior, the locomotor response to acute cocaine, or the initial sensitization of the locomotor response to cocaine over the first 4 cocaine treatment days. However, following 3 days abstinence the locomotor response to the cocaine challenge returned to their original levels in the AAV-shPdyn rats while remaining heightened in the AAV-shScr rats. These results suggest that dynorphin in a very specific area of the nucleus accumbens contributes to depressive-like states and may be involved in neuroadaptations in the NAcc that contribute to the development of cocaine addiction as a persistent and lasting condition.

  19. Polymorphism screening of four genes encoding advanced glycation end-product putative receptors. Association study with nephropathy in type 1 diabetic patients

    DEFF Research Database (Denmark)

    Poirier, Odette; Nicaud, Viviane; Vionnet, N

    2001-01-01

    Advanced glycation end-products (AGEs) may play an important role in the pathogenesis and progression of cardiovascular and renal complications of diabetes. Four putative AGE receptors (RAGEs), AGE-R1, AGE-R2, and AGE-R3 have been described. In this study, we scanned the sequence of the genes enc...

  20. Lentiviral transgenic microRNA-based shRNA suppressed mouse cytochromosome P450 3A (CYP3A expression in a dose-dependent and inheritable manner.

    Directory of Open Access Journals (Sweden)

    Yong Wang

    Full Text Available Cytochomosome P450 enzymes (CYP are heme-containing monooxygenases responsible for oxidative metabolism of many exogenous and endogenous compounds including drugs. The species difference of CYP limits the extent to which data obtained from animals can be translated to humans in pharmacodynamics or pharmacokinetics studies. Transgenic expression of human CYP in animals lacking or with largely reduced endogenous CYP counterparts is recognized as an ideal strategy to correct CYP species difference. CYP3A is the most abundant CYP subfamily both in human and mammals. In this study, we designed a microRNA-based shRNA (miR-shRNA simultaneously targeting four members of mouse CYP3A subfamily (CYP3A11, CYP3A16, CYP3A41 and CYP3A44, and transgenic mice expressing the designed miR-shRNA were generated by lentiviral transgenesis. Results showed that the CYP3A expression level in transgenic mice was markedly reduced compared to that in wild type or unrelated miR-shRNA transgenic mice, and was inversely correlated to the miR-shRNA expression level. The CYP3A expression levels in transgenic offspring of different generations were also remarkably lower compared to those of controls, and moreover the inhibition rate of CYP3A expression remained comparable over generations. The ratio of the targeted CYP3A transcriptional levels was comparable between knockdown and control mice of the same gender as detected by RT-PCR DGGE analysis. These data suggested that transgenic miR-shRNA suppressed CYP3A expression in a dose-dependent and inheritable manner, and transcriptional levels of the targeted CYP3As were suppressed to a similar extent. The observed knockdown efficacy was further confirmed by enzymatic activity analysis, and data showed that CYP3A activities in transgenic mice were markedly reduced compared to those in wild-type or unrelated miR-shRNA transgenic controls (1.11±0.71 vs 5.85±1.74, 5.9±2.4; P<0.01. This work laid down a foundation to further knock

  1. Toxicology screen

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/003578.htm Toxicology screen To use the sharing features on this page, please enable JavaScript. A toxicology screen refers to various tests that determine the ...

  2. An image-based, dual fluorescence reporter assay to evaluate the efficacy of shRNA for gene silencing at the single-cell level [v1; ref status: indexed, http://f1000r.es/2tt

    Directory of Open Access Journals (Sweden)

    Shin-ichiro Kojima

    2014-02-01

    Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.

  3. An image-based, dual fluorescence reporter assay to evaluate the efficacy of shRNA for gene silencing at the single-cell level [v2; ref status: indexed, http://f1000r.es/39j

    Directory of Open Access Journals (Sweden)

    Shin-ichiro Kojima

    2014-05-01

    Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.

  4. Colon cancer screening

    Science.gov (United States)

    Screening for colon cancer; Colonoscopy - screening; Sigmoidoscopy - screening; Virtual colonoscopy - screening; Fecal immunochemical test; Stool DNA test; sDNA test; Colorectal cancer - screening; Rectal ...

  5. Mammography. Advanced, intensive course and atlas. Senology, screening, radiographic morphology, differential diagnosis, unusual findings, false treatment as a case in court

    International Nuclear Information System (INIS)

    Barth, V.

    1994-01-01

    Differential diagnosis is the focal point of this richly illustrated atlas intended for experienced mammographers. Mammographs of different histology but with similar features are presented side by side for easy comparison; pinpointed questions accompanying the pictures are guiding the reader to systematically develop the differential dioagnosis, with correct answers being given on the next pages together with characteristic and typical pictures explaining the correct and false diagnoses, including clinical photographs and sonographic images. Unusual mammographic findings are discussed in a separate chapter, and other chapters deal with the history of senology and with problems encountered in examinations for early diagnosis, as reported in the German Mammography Study and in international screening projects. The concluding chapter deals with legal aspects such as liability of the physician in case of missed detection of tumors, explaining the most frequent causes of false diagnosis as a guide to preventing errors, and giving practical hints and information for the event of damages being claimed from a physician. (orig.) [de

  6. Quality-of-Life (QOL during Screening for Phase 1 Trial Studies in Patients with Advanced Solid Tumors and Its Impact on Risk for Serious Adverse Events

    Directory of Open Access Journals (Sweden)

    Sidra Anwar

    2017-06-01

    Full Text Available Background: Serious adverse events (SAEs and subject replacements occur frequently in phase 1 oncology clinical trials. Whether baseline quality-of-life (QOL or social support can predict risk for SAEs or subject replacement among these patients is not known. Methods: Between 2011–2013, 92 patients undergoing screening for enrollment into one of 22 phase 1 solid tumor clinical trials at Roswell Park Cancer Institute were included in this study. QOL Questionnaires (EORTC QLQ-C30 and FACT-G, Medical Outcomes Study Social Support Survey (MOSSSS, Charlson comorbidity scores (CCS and Royal Marsden scores (RMS were obtained at baseline. Frequency of dose limiting toxicities (DLTs, subject replacement and SAEs that occurred within the first 4 cycles of treatment were recorded. Fisher’s exact test and Mann-Whitney-Wilcoxon test were used to study the association between categorical and continuous variables, respectively. A linear transformation was used to standardize QOL scores. p-value ≤ 0.05 was considered statistically significant. Results: Baseline QOL, MOSSSS, CCS and RMS were not associated with subject replacement nor DLTs. Baseline EORTC QLQ-C30 scores were significantly lower among patients who encountered SAEs within the first 4 cycles (p = 0.04. Conclusions: Lower (worse EORTC QLQ-C30 score at baseline is associated with SAE occurrence during phase 1 oncology trials.

  7. UV/H2O2 advanced oxidation for abatement of organophosphorous pesticides and the effects on various toxicity screening assays.

    Science.gov (United States)

    Parker, Austa M; Lester, Yaal; Spangler, Emily K; von Gunten, Urs; Linden, Karl G

    2017-09-01

    Advanced oxidation processes (AOPs) are utilized due to their ability to treat emerging contaminants with the fast reacting and non-selective hydroxyl radical (OH). Organophosphorous insecticides are common drinking water contaminants, with 12 different compounds of this class being found on the US EPA's most recent Candidate Contaminant List (CCL4). The use of the AOP UV/H 2 O 2 for the treatment of organophosphorous insecticides was explored in this study, by coupling biological and analytical tools to follow the abatement of the target compounds. Four insecticides were explored for advanced oxidation treatment: acephate, dicrotophos, fenamiphos, and methamidophos. All four compounds were fast reacting with OH, all reacting with second order rate constants ≥5.5 × 10 9  M -1 s -1 . Three major endpoints of toxicity were studied: estrogenicity, genotoxicity (mutagenicity) and neurotoxicity. None of the target compounds showed any estrogenic activity, while all compounds showed an active genotoxic (mutagenic) response (AMES II assay) and most compounds had some level of neurotoxic activity. AOP treatment did not induce any estrogenic activity, and reduced the compounds' neurotoxicity and genotoxicity in all but one case. Methamidophos degradation by UV/H 2 O 2 resulted in an increase in genotoxicity, likely due to the formation of toxic transformation products. The increase in toxicity gradually decreased with time, possibly due to hydrolysis of the transformation products formed. This study provides insights into parent compound abatement and the changes in toxicity due to transformation products. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Using Serum Advanced Glycation End Products-Peptides to Improve the Efficacy of World Health Organization Fasting Plasma Glucose Criterion in Screening for Diabetes in High-Risk Chinese Subjects.

    Directory of Open Access Journals (Sweden)

    Zilin Sun

    Full Text Available The efficacy of using fasting plasma glucose (FPG alone as a preferred screening test for diabetes has been questioned. This study was aimed to evaluate whether the use of serum advanced glycation end products-peptides (sAGEP would help to improve the efficacy of FPG in diabetes screening among high-risk Chinese subjects with FPG <7.0 mmol/L. FPG, 2-h plasma glucose (2h-PG, serum glycated haemoglobin A1c (HbA1c, and sAGEP were measured in 857 Chinese subjects with risk factors for diabetes. The areas under receiver operating characteristic (ROC curves generated by logistic regression models were assessed and compared to find the best model for diabetes screening in subjects with FPG <7.0 mmol/L. The optimal critical line was determined by maximizing the sum of sensitivity and specificity. Among the enrolled subjects, 730 of them had FPG <7.0 mmol/L, and only 41.7% new diabetes cases were identified using the 1999 World Health Organization FPG criterion (FPG ≥7.0 mmol/L. The area under ROC curves generated by the model on FPG-sAGEP was the largest compared with that on FPG-HbA1c, sAGEP, HbA1c or FPG in subjects with FPG <7.0 mmol/L. By maximizing the sum of sensitivity and specificity, the optimal critical line was determined as 0.69×FPG + 0.14×sAGEP = 7.03, giving a critical sensitivity of 91.2% in detecting 2h-PG ≥11.1 mmol/L, which was significantly higher than that of FPG-HbA1c or HbA1c. The model on FPG-sAGEP improves the efficacy of using FPG alone in detecting diabetes among high-risk Chinese subjects with FPG <7.0 mmol/L, and is worth being promoted for future diabetes screening.

  9. Screening for skin cancer.

    Science.gov (United States)

    Helfand, M; Mahon, S M; Eden, K B; Frame, P S; Orleans, C T

    2001-04-01

    Malignant melanoma is often lethal, and its incidence in the United States has increased rapidly over the past 2 decades. Nonmelanoma skin cancer is seldom lethal, but, if advanced, can cause severe disfigurement and morbidity. Early detection and treatment of melanoma might reduce mortality, while early detection and treatment of nonmelanoma skin cancer might prevent major disfigurement and to a lesser extent prevent mortality. Current recommendations from professional societies regarding screening for skin cancer vary. To examine published data on the effectiveness of routine screening for skin cancer by a primary care provider, as part of an assessment for the U.S. Preventive Services Task Force. We searched the MEDLINE database for papers published between 1994 and June 1999, using search terms for screening, physical examination, morbidity, and skin neoplasms. For information on accuracy of screening tests, we used the search terms sensitivity and specificity. We identified the most important studies from before 1994 from the Guide to Clinical Preventive Services, second edition, and from high-quality reviews. We used reference lists and expert recommendations to locate additional articles. Two reviewers independently reviewed a subset of 500 abstracts. Once consistency was established, the remainder were reviewed by one reviewer. We included studies if they contained data on yield of screening, screening tests, risk factors, risk assessment, effectiveness of early detection, or cost effectiveness. We abstracted the following descriptive information from full-text published studies of screening and recorded it in an electronic database: type of screening study, study design, setting, population, patient recruitment, screening test description, examiner, advertising targeted at high-risk groups or not targeted, reported risk factors of participants, and procedure for referrals. We also abstracted the yield of screening data including probabilities and numbers

  10. A fast, simple method for screening radiation susceptibility genes by RNA interference

    International Nuclear Information System (INIS)

    Tsuji, Atsushi B.; Sudo, Hitomi; Sugyo, Aya; Otsuki, Marika; Miyagishi, Makoto; Taira, Kazunari; Imai, Takashi; Harada, Yoshi-nobu

    2005-01-01

    Radiotherapy can cause unacceptable levels of damage to normal tissues in some cancer patients. To understand the molecular mechanisms underlying radiation-induced physiological responses, and to be able to predict the radiation susceptibility of normal tissues in individual patients, it is important to identify a comprehensive set of genes responsible for radiation susceptibility. We have developed a simple and rapid 96-well screening protocol using cell proliferation assays and RNA interference to identify genes associated with radiation susceptibility. We evaluated the performance of alamarBlue-, BrdU-, and sulforhodamine B-based cell proliferation assays using the 96-well format. Each proliferation assay detected the known radiation susceptibility gene, PRKDC. In a trial screen using 28 shRNA vectors, another known gene, CDKN1A, and one new radiation susceptibility gene, ATP5G3, were identified. Our results indicate that this method may be useful for large-scale screens designed to identify novel radiation susceptibility genes

  11. Screen dealing

    International Nuclear Information System (INIS)

    Barlow, J.W.

    1991-01-01

    The screen dealing system provides a facility whereby buyers and sellers of spot thermal coal can make bids and offers via the medium of the Reuters screen. A sale results when a market participant notifies his acceptance of a price to a central dealing desk. Use of the system is available to all genuine participants in the coal trade. This paper reports that it provides a focus for information and for the visible making of coal prices. For years screen trading has been used successfully to trade other commodities. At last coal is being traded electronically. It makes sense. It works. Users like it

  12. Breast Cancer Screening in Denmark

    DEFF Research Database (Denmark)

    Jørgensen, Karsten Juhl; Gøtzsche, Peter C; Kalager, Mette

    2017-01-01

    Background: Effective breast cancer screening should detect early-stage cancer and prevent advanced disease. Objective: To assess the association between screening and the size of detected tumors and to estimate overdiagnosis (detection of tumors that would not become clinically relevant). Design......) and nonadvanced (≤20 mm) breast cancer tumors in screened and nonscreened women were measured. Two approaches were used to estimate the amount of overdiagnosis: comparing the incidence of advanced and nonadvanced tumors among women aged 50 to 84 years in screening and nonscreening areas; and comparing...... rate ratio, 1.49 [95% CI, 1.43 to 1.54]). The first estimation approach found that 271 invasive breast cancer tumors and 179 ductal carcinoma in situ (DCIS) lesions were overdiagnosed in 2010 (overdiagnosis rate of 24.4% [including DCIS] and 14.7% [excluding DCIS]). The second approach, which accounted...

  13. Airport Screening

    Science.gov (United States)

    Health Physics Society Specialists in Radiation Safety Airport Screening Fact Sheet Adopted: May 2011 Photo courtesy of Dan ... a safe level. An American National Standards Institute/Health Physics Society industry standard states that the maxi- mum ...

  14. Hypertension screening

    Science.gov (United States)

    Foulke, J. M.

    1975-01-01

    An attempt was made to measure the response to an announcement of hypertension screening at the Goddard Space Center, to compare the results to those of previous statistics. Education and patient awareness of the problem were stressed.

  15. Carrier Screening

    Science.gov (United States)

    ... How accurate is carrier screening? No test is perfect. In a small number of cases, test results ... in which an egg is removed from a woman’s ovary, fertilized in a laboratory with the man’s ...

  16. Advanced behavioural screening: automated home cage ethology.

    Science.gov (United States)

    Spruijt, Berry M; DeVisser, Leonie

    2006-01-01

    Animal behaviour has been studied using two approaches, (1) well-controlled experiments focusing on specific responses and (2) those with natural - fuzzy - but biologically relevant conditions. Ideally, one behavioural test should be able to address both. The home cage provided with various stimuli is proposed as an all-in-one possibility. This, however, results in an exponential increase in complexity regarding observation and analysis tools. It seems difficult to accept that behavioural expressions need a mathematical approach to unravel its organisation and meaning. Developments in artificial intelligence and data mining are essential to accelerate this necessary evolution in behavioural sciences.: � 2006 Elsevier Ltd . All rights reserved.

  17. Luminescent screens

    International Nuclear Information System (INIS)

    Lu, C.-I.

    1982-01-01

    Luminescent screens which are useful for such purposes as intensifying screens for radiographs are comprised of a support bearing a layer of finely divided particles of a phosphor dispersed in a cross-linked polymeric matrix formed by heat-curing of a coating composition comprising an unsaturated cross-linkable polymer, a polymerizable acrylic monomer, a thermoplastic polyurethane elastomer, and a heat-activatable polymerization initiator. The phosphor layer includes voids formed by evaporation of an evaporable component which is present in the coating composition from which such layer is formed. (author)

  18. Alcohol Use Screening

    Science.gov (United States)

    ... Depression Screening Substance Abuse Screening Alcohol Use Screening Alcohol Use Screening (AUDIT-C) - Instructions The following questions ... this tool, there is also text-only version . Alcohol Use Screening (AUDIT-C) - Manual Instructions The following ...

  19. Hearing Screening

    Science.gov (United States)

    Johnson-Curiskis, Nanette

    2012-01-01

    Hearing levels are threatened by modern life--headsets for music, rock concerts, traffic noises, etc. It is crucial we know our hearing levels so that we can draw attention to potential problems. This exercise requires that students receive a hearing screening for their benefit as well as for making the connection of hearing to listening.

  20. Vision Screening

    Science.gov (United States)

    ... an efficient and cost-effective method to identify children with visual impairment or eye conditions that are likely to lead ... main goal of vision screening is to identify children who have or are at ... visual impairment unless treated in early childhood. Other problems that ...

  1. Rare earth phosphors and phosphor screens

    International Nuclear Information System (INIS)

    Buchanan, R.A.; Maple, T.G.; Sklensky, A.F.

    1981-01-01

    Advances in the use of stabilized rare earth phosphors and of conversion screens using these materials are examined. In particular the new phosphors discussed in this invention consist of oxybromides of yttrium, lanthanum and gadolinium with a luminescent activator ion stabilized by an oxychloride or oxyfluoride surface layer and the conversion screens include trivalent cerium as the activator ion. (U.K.)

  2. Vision Screening

    Science.gov (United States)

    1993-01-01

    The Visi Screen OSS-C, marketed by Vision Research Corporation, incorporates image processing technology originally developed by Marshall Space Flight Center. Its advantage in eye screening is speed. Because it requires no response from a subject, it can be used to detect eye problems in very young children. An electronic flash from a 35 millimeter camera sends light into a child's eyes, which is reflected back to the camera lens. The photorefractor then analyzes the retinal reflexes generated and produces an image of the child's eyes, which enables a trained observer to identify any defects. The device is used by pediatricians, day care centers and civic organizations that concentrate on children with special needs.

  3. Water screen

    Energy Technology Data Exchange (ETDEWEB)

    Kutepov, A.I.; Fedotov, I.N.; Prokopov, O.I.

    1981-01-01

    The invention refers to ventilation and can be used for repair-fitting operations in a blasting-dangerous gas condition, for example, during elimination of gas-oil gushers, repair of gas-oil pipelines, equipment etc. In order to improve safety of labor, the nozzle adapters of the water collector are oriented towards each other. The collector is installed on a support with the possibility of rotating and vertical movement. The proposed screen excludes the possibility of blasting-dangerous concentrations of gases and guarantees extinguishing of the impact spark during operation of the tool.

  4. RBC Antibody Screen

    Science.gov (United States)

    ... C Cystic Fibrosis (CF) Gene Mutations Testing Cytomegalovirus (CMV) Tests D-dimer Dengue Fever Testing Des-gamma- ... Index of Screening Recommendations Not Listed? Not Listed? Newborn Screening Screening Tests for Infants Screening Tests for ...

  5. Mental Health Screening Center

    Science.gov (United States)

    ... Releases & Announcements Public Service Announcements Partnering with DBSA Mental Health Screening Center These online screening tools are not ... you have any concerns, see your doctor or mental health professional. Depression Screening for Adult Depression Screening for ...

  6. Breast cancer screening

    Science.gov (United States)

    Mammogram - breast cancer screening; Breast exam - breast cancer screening; MRI - breast cancer screening ... is performed to screen women to detect early breast cancer when it is more likely to be cured. ...

  7. Enhanced functional recombinant factor VII production by HEK 293 cells stably transfected with VKORC1 where the gamma-carboxylase inhibitor calumenin is stably suppressed by shRNA transfection.

    Science.gov (United States)

    Wajih, Nadeem; Owen, John; Wallin, Reidar

    2008-01-01

    Recombinant members of the vitamin K-dependent protein family (factors IX and VII and protein C) have become important pharmaceuticals in treatment of bleeding disorders and sepsis. However, because the in vivo gamma-carboxylation system in stable cell lines used for transfection has a limited capacity of post translational gamma-carboxylation, the recovery of fully gamma-carboxylated and functional proteins is low. In this work we have engineered recombinant factor VII producing HEK 293 cells to stably overexpress VKORC1, the reduced vitamin K gamma-carboxylase cofactor and in addition stably silenced the gamma-carboxylase inhibitory protein calumenin. Stable cell lines transfected with only a factor VII cDNA had a 9% production of functional recombinant factor VII. On the other hand, these recombinant factor VII producing cells when engineered to overexpress VKORC1 and having calumenin stably suppressed more than 80% by shRNA expression, produced 68% functional factor VII. The technology presented should be applicable to all vertebrae members of the vitamin K-dependent protein family and should lower the production cost of the clinically used factors VII, IX and protein C.

  8. Vibrational spectroscopy in diagnosis and screening

    CERN Document Server

    Severcan, F

    2012-01-01

    In recent years there has been a tremendous growth in the use of vibrational spectroscopic methods for diagnosis and screening. These applications range from diagnosis of disease states in humans, such as cancer, to rapid identification and screening of microorganisms. The growth in such types of studies has been possible thanks to advances in instrumentation and associated computational and mathematical tools for data processing and analysis. This volume of Advances in Biomedical Spectroscopy contains chapters from leading experts who discuss the latest advances in the application of Fourier

  9. iScreen: Image-Based High-Content RNAi Screening Analysis Tools.

    Science.gov (United States)

    Zhong, Rui; Dong, Xiaonan; Levine, Beth; Xie, Yang; Xiao, Guanghua

    2015-09-01

    High-throughput RNA interference (RNAi) screening has opened up a path to investigating functional genomics in a genome-wide pattern. However, such studies are often restricted to assays that have a single readout format. Recently, advanced image technologies have been coupled with high-throughput RNAi screening to develop high-content screening, in which one or more cell image(s), instead of a single readout, were generated from each well. This image-based high-content screening technology has led to genome-wide functional annotation in a wider spectrum of biological research studies, as well as in drug and target discovery, so that complex cellular phenotypes can be measured in a multiparametric format. Despite these advances, data analysis and visualization tools are still largely lacking for these types of experiments. Therefore, we developed iScreen (image-Based High-content RNAi Screening Analysis Tool), an R package for the statistical modeling and visualization of image-based high-content RNAi screening. Two case studies were used to demonstrate the capability and efficiency of the iScreen package. iScreen is available for download on CRAN (http://cran.cnr.berkeley.edu/web/packages/iScreen/index.html). The user manual is also available as a supplementary document. © 2014 Society for Laboratory Automation and Screening.

  10. Is the tide turning against breast screening?

    DEFF Research Database (Denmark)

    Jørgensen, Karsten Juhl

    2012-01-01

    ABSTRACT: Herein I argue that mammographic screening has not delivered on its fundamental premise: to reduce the incidence of advanced breast cancer. Indeed, achieving this goal is required if screening is to reduce breast cancer mortality or mastectomy use. Rather, screening has caused substantial...... increases in the incidence of in situ and early invasive cancers. Moreover, evidence indicates that these screen-detected cancers are unlikely to be cases that were 'caught early', but instead represent women who would not have been diagnosed in the absence of screening and who, as a result, have received...... harmful, unnecessary treatment. If true, these observations raise the specter that screening creates breast cancer patients and that this practice carries little or no benefit....

  11. In Vivo RNA Interference Screening Identifies a Leukemia-Specific Dependence on Integrin Beta 3 Signaling

    Science.gov (United States)

    Miller, Peter G.; Al-Shahrour, Fatima; Hartwell, Kimberly A.; Chu, Lisa P.; Järås, Marcus; Puram, Rishi V.; Puissant, Alexandre; Callahan, Kevin P.; Ashton, John; McConkey, Marie E.; Poveromo, Luke P.; Cowley, Glenn S.; Kharas, Michael G.; Labelle, Myriam; Shterental, Sebastian; Fujisaki, Joji; Silberstein, Lev; Alexe, Gabriela; Al-Hajj, Muhammad A.; Shelton, Christopher A.; Armstrong, Scott A.; Root, David E.; Scadden, David T.; Hynes, Richard O.; Mukherjee, Siddhartha; Stegmaier, Kimberly; Jordan, Craig T.; Ebert, Benjamin L.

    2013-01-01

    SUMMARY We used an in vivo short hairpin RNA (shRNA) screening approach to identify genes that are essential for MLL-AF9 acute myeloid leukemia (AML). We found that Integrin Beta 3 (Itgb3) is essential for murine leukemia cells in vivo, and for human leukemia cells in xenotransplantation studies. In leukemia cells, Itgb3 knockdown impaired homing, downregulated LSC transcriptional programs, and induced differentiation via the intracellular kinase, Syk. In contrast, loss of Itgb3 in normal HSPCs did not affect engraftment, reconstitution, or differentiation. Finally, we confirmed that Itgb3 is dispensable for normal hematopoiesis and required for leukemogenesis using an Itgb3 knockout mouse model. Our results establish the significance of the Itgb3 signaling pathway as a potential therapeutic target in AML. PMID:23770013

  12. Skin Cancer Screening

    Science.gov (United States)

    ... Genetics of Skin Cancer Skin Cancer Screening Research Skin Cancer Screening (PDQ®)–Patient Version What is screening? ... These are called diagnostic tests . General Information About Skin Cancer Key Points Skin cancer is a disease ...

  13. Screening for Cancer

    Science.gov (United States)

    Cancer screening is checking for cancer in people who don't have symptoms. Screening tests can help doctors find and treat several types of cancer early, but cancer screening can have harms as well as benefits.

  14. Colorectal Cancer Screening

    Science.gov (United States)

    ... Genetics of Colorectal Cancer Colorectal Cancer Screening Research Colorectal Cancer Screening (PDQ®)–Patient Version What is screening? Go ... These are called diagnostic tests . General Information About Colorectal Cancer Key Points Colorectal cancer is a disease in ...

  15. Screen time and children

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/patientinstructions/000355.htm Screen time and children To use the sharing features on ... videos is considered unhealthy screen time. Current Screen Time Guidelines Children under age 2 should have no ...

  16. Stomach (Gastric) Cancer Screening

    Science.gov (United States)

    ... Stomach Cancer Prevention Stomach Cancer Screening Research Stomach (Gastric) Cancer Screening (PDQ®)–Patient Version What is screening? Go ... are called diagnostic tests . General Information About Stomach (Gastric) Cancer Key Points Stomach cancer is a disease in ...

  17. Mammography screening: A major issue in medicine.

    Science.gov (United States)

    Autier, Philippe; Boniol, Mathieu

    2018-02-01

    Breast cancer mortality is declining in most high-income countries. The role of mammography screening in these declines is much debated. Screening impacts cancer mortality through decreasing the incidence of number of advanced cancers with poor prognosis, while therapies and patient management impact cancer mortality through decreasing the fatality of cancers. The effectiveness of cancer screening is the ability of a screening method to curb the incidence of advanced cancers in populations. Methods for evaluating cancer screening effectiveness are based on the monitoring of age-adjusted incidence rates of advanced cancers that should decrease after the introduction of screening. Likewise, cancer-specific mortality rates should decline more rapidly in areas with screening than in areas without or with lower levels of screening but where patient management is similar. These two criteria have provided evidence that screening for colorectal and cervical cancer contributes to decreasing the mortality associated with these two cancers. In contrast, screening for neuroblastoma in children was discontinued in the early 2000s because these two criteria were not met. In addition, overdiagnosis - i.e. the detection of non-progressing occult neuroblastoma that would not have been life-threatening during the subject's lifetime - is a major undesirable consequence of screening. Accumulating epidemiological data show that in populations where mammography screening has been widespread for a long time, there has been no or only a modest decline in the incidence of advanced cancers, including that of de novo metastatic (stage IV) cancers at diagnosis. Moreover, breast cancer mortality reductions are similar in areas with early introduction and high penetration of screening and in areas with late introduction and low penetration of screening. Overdiagnosis is commonplace, representing 20% or more of all breast cancers among women invited to screening and 30-50% of screen

  18. Prenatal screening and genetics

    DEFF Research Database (Denmark)

    Alderson, P; Aro, A R; Dragonas, T

    2001-01-01

    Although the term 'genetic screening' has been used for decades, this paper discusses how, in its most precise meaning, genetic screening has not yet been widely introduced. 'Prenatal screening' is often confused with 'genetic screening'. As we show, these terms have different meanings, and we...... examine definitions of the relevant concepts in order to illustrate this point. The concepts are i) prenatal, ii) genetic screening, iii) screening, scanning and testing, iv) maternal and foetal tests, v) test techniques and vi) genetic conditions. So far, prenatal screening has little connection...... with precisely defined genetics. There are benefits but also disadvantages in overstating current links between them in the term genetic screening. Policy making and professional and public understandings about screening could be clarified if the distinct meanings of prenatal screening and genetic screening were...

  19. Stable shRNA Silencing of Lactate Dehydrogenase A (LDHA) in Human MDA-MB-231 Breast Cancer Cells Fails to Alter Lactic Acid Production, Glycolytic Activity, ATP or Survival.

    Science.gov (United States)

    Mack, Nzinga; Mazzio, Elizabeth A; Bauer, David; Flores-Rozas, Hernan; Soliman, Karam F A

    2017-03-01

    In the US, African Americans have a high death rate from triple-negative breast cancer (TNBC), characterized by lack of hormone receptors (ER, PR, HER2/ERRB2) which are otherwise valuable targets of chemotherapy. There is a need to identify novel targets that negatively impact TNBC tumorigenesis. TNBCs release an abundance of lactic acid, under normoxic, hypoxic and hyperoxic conditions; this referred to as the Warburg effect. Accumulated lactic acid sustains peri-cellular acidity which propels metastatic invasion and malignant aggressive transformation. The source of lactic acid is believed to be via conversion of pyruvate by lactate dehydrogenase (LDH) in the last step of glycolysis, with most studies focusing on the LDHA isoform. In this study, LDHA was silenced using long-term MISSION® shRNA lentivirus in human breast cancer MDA-MB-231 cells. Down-regulation of LDHA transcription and protein expression was confirmed by western blot, immunocytochemistry and qPCR. A number of parameters were measured in fully viable vector controls versus knock-down (KD) clones, including levels of lactic acid produced, glucose consumed, ATP and basic metabolic rates. The data show that lentivirus V-165 generated a knock-down clone most effective in reducing both gene and protein levels to less than 1% of vector controls. Stable KD showed absolutely no changes in cell viability, lactic acid production, ATP, glucose consumption or basic metabolic rate. Given the complete absence of impact on any observed parameter by LDH-A KD and this being somewhat contrary to findings in the literature, further analysis was required to determine why. Whole-transcriptome analytic profile on MDA-MB-231 for LDH subtypes using Agilent Human Genome 4×44k microarrays, where the data show the following component breakdown. Transcripts: 30.47 % LDHA, 69.36% LDHB, 0.12% LDHC and 0.05% LDHD. These findings underscore the importance of alternative isoforms of LDH in cancer cells to produce lactic acid

  20. Advancing Public Health in Cancer - Annual Plan

    Science.gov (United States)

    Cancer is the leading cause of death from disease among Americans under 85. Learn how NCI advances public health by conducting research to improve the delivery of quality cancer prevention, screening, and treatment to all Americans.

  1. Advanced Ceramics

    International Nuclear Information System (INIS)

    1989-01-01

    The First Florida-Brazil Seminar on Materials and the Second State Meeting about new materials in Rio de Janeiro State show the specific technical contribution in advanced ceramic sector. The others main topics discussed for the development of the country are the advanced ceramic programs the market, the national technic-scientific capacitation, the advanced ceramic patents, etc. (C.G.C.) [pt

  2. High-throughput screening of effective siRNAs using luciferase-linked chimeric mRNA.

    Directory of Open Access Journals (Sweden)

    Shen Pang

    Full Text Available The use of siRNAs to knock down gene expression can potentially be an approach to treat various diseases. To avoid siRNA toxicity the less transcriptionally active H1 pol III promoter, rather than the U6 promoter, was proposed for siRNA expression. To identify highly efficacious siRNA sequences, extensive screening is required, since current computer programs may not render ideal results. Here, we used CCR5 gene silencing as a model to investigate a rapid and efficient screening approach. We constructed a chimeric luciferase-CCR5 gene for high-throughput screening of siRNA libraries. After screening approximately 900 shRNA clones, 12 siRNA sequences were identified. Sequence analysis demonstrated that most (11 of the 12 sequences of these siRNAs did not match those identified by available siRNA prediction algorithms. Significant inhibition of CCR5 in a T-lymphocyte cell line and primary T cells by these identified siRNAs was confirmed using the siRNA lentiviral vectors to infect these cells. The inhibition of CCR5 expression significantly protected cells from R5 HIV-1JRCSF infection. These results indicated that the high-throughput screening method allows efficient identification of siRNA sequences to inhibit the target genes at low levels of expression.

  3. Hot Topic: Preimplantation aneuploidy screening

    Directory of Open Access Journals (Sweden)

    Kayhan Yakın

    2009-03-01

    Full Text Available Preimplantation Genetic Screening (PGS is a technique that has been introduced into clinical practice to screen and eliminate aneuploid embryos form transfer with the intention to improve implantation rates and decrease pregnancy wastage. Although practiced widely throughout the world the PGS unfortunately has been adopted without being subjected to rigorous scientific validation. Data from recent prospective randomized trials have shed doubt on the efficacy of the procedure when used in women with advanced age, one of the target populations for PGS. Other purported indications for the application of this complicated technique such as recurrent implantation failure and recurrent spontaneous abortion have not been subjected to randomized controlled trials. For the best interest of patients, we feel it is timely for a debate regarding the efficacy and safety of PGS.

  4. Expanded newborn screening: social and ethical issues.

    Science.gov (United States)

    Dhondt, Jean-Louis

    2010-10-01

    Newborn screening and genetic testing have expanded rapidly in the last decade with the advent of multiplex (e.g., tandem mass spectrometry) and/or DNA technologies. However, screening panels include a large number of disorders, which may not meet all of the traditional screening criteria, established in late 1960s, and used for years to justify screening programs. After a period of expansion driven by technological advances, many reports have reconsidered the justification of expanded programs. Many factors have contributed to test-panel discrepancies between countries. The test-panel review methodology, the way health benefits are weighed against harms, and the socioeconomic-political environment all play a role. Expansion of screening also requires reconsideration of the infrastructure (ideally, in the context of national plans for rare diseases) to support testing, counselling, education, treatment, and follow-up. Consequently, economic aspects cannot be ignored and can be a limitation for expansion. New ethical questions have emerged: risks of discrimination or stigmatization, respect of the autonomy of persons to make decisions, parental anxiety resulting from a false positive test (especially when reporting to parents screening results for untreatable conditions identified as by-products of screening), etc. For disorders where there is not yet confirmation of benefit, it may be prudent to recommend pilot screening and to have a mechanism that can be used to adapt or even to stop a program.

  5. Optimizing Outcomes of Colorectal Cancer Screening

    NARCIS (Netherlands)

    R.G.S. Meester (Reinier)

    2017-01-01

    markdownabstractColorectal cancer is a leading cause of cancer deaths. Screening for colorectal cancer is implemented in an increasing number of settings, but performance of programs is often suboptimal. In this thesis, advanced modeling, informed by empirical data, was used to identify areas for

  6. Interactive Screen Experiments with Single Photons

    Science.gov (United States)

    Bronner, Patrick; Strunz, Andreas; Silberhorn, Christine; Meyn, Jan-Peter

    2009-01-01

    Single photons are used for fundamental quantum physics experiments as well as for applications. Originally being a topic of advance courses, such experiments are increasingly a subject of undergraduate courses. We provide interactive screen experiments (ISE) for supporting the work in a real laboratory, and for students who do not have access to…

  7. A Large-Scale RNAi Screen Identifies SGK1 as a Key Survival Kinase for GBM Stem Cells.

    Science.gov (United States)

    Kulkarni, Shreya; Goel-Bhattacharya, Surbhi; Sengupta, Sejuti; Cochran, Brent H

    2018-01-01

    Glioblastoma multiforme (GBM) is the most common type of primary malignant brain cancer and has a very poor prognosis. A subpopulation of cells known as GBM stem-like cells (GBM-SC) have the capacity to initiate and sustain tumor growth and possess molecular characteristics similar to the parental tumor. GBM-SCs are known to be enriched in hypoxic niches and may contribute to therapeutic resistance. Therefore, to identify genetic determinants important for the proliferation and survival of GBM stem cells, an unbiased pooled shRNA screen of 10,000 genes was conducted under normoxic as well as hypoxic conditions. A number of essential genes were identified that are required for GBM-SC growth, under either or both oxygen conditions, in two different GBM-SC lines. Interestingly, only about a third of the essential genes were common to both cell lines. The oxygen environment significantly impacts the cellular genetic dependencies as 30% of the genes required under hypoxia were not required under normoxic conditions. In addition to identifying essential genes already implicated in GBM such as CDK4, KIF11 , and RAN , the screen also identified new genes that have not been previously implicated in GBM stem cell biology. The importance of the serum and glucocorticoid-regulated kinase 1 (SGK1) for cellular survival was validated in multiple patient-derived GBM stem cell lines using shRNA, CRISPR, and pharmacologic inhibitors. However, SGK1 depletion and inhibition has little effect on traditional serum grown glioma lines and on differentiated GBM-SCs indicating its specific importance in GBM stem cell survival. Implications: This study identifies genes required for the growth and survival of GBM stem cells under both normoxic and hypoxic conditions and finds SGK1 as a novel potential drug target for GBM. Mol Cancer Res; 16(1); 103-14. ©2017 AACR . ©2017 American Association for Cancer Research.

  8. Screening for Glaucoma

    Science.gov (United States)

    Understanding Task Force Recommendations Screening for Glaucoma The U.S. Preventive Services Task Force (Task Force) has issued a final recommendation statement on Screening for Glaucoma . This final recommendation statement ...

  9. Liver (Hepatocellular) Cancer Screening

    Science.gov (United States)

    ... Treatment Liver Cancer Prevention Liver Cancer Screening Research Liver (Hepatocellular) Cancer Screening (PDQ®)–Patient Version What is ... These are called diagnostic tests . General Information About Liver (Hepatocellular) Cancer Key Points Liver cancer is a ...

  10. Hearing Loss: Screening Newborns

    Science.gov (United States)

    ... of this page please turn JavaScript on. Feature: Hearing Loss Screening Newborns Past Issues / Spring 2015 Table ... deafness, which account for most cases. Screening Newborns' Hearing Now Standard In 1993, children born in the ...

  11. Cervical Cancer Screening

    Science.gov (United States)

    ... Cancer found early may be easier to treat. Cervical cancer screening is usually part of a woman's health ... may do more tests, such as a biopsy. Cervical cancer screening has risks. The results can sometimes be ...

  12. Screening for Cervical Cancer

    Science.gov (United States)

    Understanding Task Force Recommendations Screening for Cervical Cancer The U.S. Preventive Services Task Force (Task Force) has issued final recommendations on Screening for Cervical Cancer . These recommendations are for women ...

  13. Prostate cancer screening in Ghana - a clinical benefit? | Arthur ...

    African Journals Online (AJOL)

    In Ghana and most African countries, prostate cancer is the most common cancer in males after hepatocellular carcinoma. Whereas in the advanced countries, screening for prostate specific antigen (PSA) has led to early detection and management of the disease, screening has been very low in Ghana, thus leading to low ...

  14. Advanced teleoperation in nuclear applications

    International Nuclear Information System (INIS)

    Hamel, W.R.; Feldman, M.J.; Martin, H.L.

    1984-01-01

    A new generation of integrated remote maintenance systems is being developed to meet the needs of future nuclear fuel reprocessing at the Oak Ridge National Laboratory. Development activities cover all aspects of an advanced teleoperated maintenance system with particular emphasis on a new force-reflecting servomanipulator concept. The new manipulator, called the advanced servomanipulator, is microprocessor controlled and is designed to achieve force-reflection performance near that of mechanical master/slave manipulators. The advanced servomanipulator uses a gear-drive transmission which permits modularization for remote maintainability (by other advanced servomanipulators) and increases reliability. Human factors analysis has been used to develop an improved man/machine interface concept based upon colorgraphic displays and menu-driven tough screens. Initial test and evaluation of two advanced servomanipulator slave arms and several other development components have begun. 9 references, 5 figures

  15. In Vivo Loss of Function Screening Reveals Carbonic Anhydrase IX as a Key Modulator of Tumor Initiating Potential in Primary Pancreatic Tumors

    Directory of Open Access Journals (Sweden)

    Nabendu Pore

    2015-06-01

    Full Text Available Reprogramming of energy metabolism is one of the emerging hallmarks of cancer. Up-regulation of energy metabolism pathways fuels cell growth and division, a key characteristic of neoplastic disease, and can lead to dependency on specific metabolic pathways. Thus, targeting energy metabolism pathways might offer the opportunity for novel therapeutics. Here, we describe the application of a novel in vivo screening approach for the identification of genes involved in cancer metabolism using a patient-derived pancreatic xenograft model. Lentiviruses expressing short hairpin RNAs (shRNAs targeting 12 different cell surface protein transporters were separately transduced into the primary pancreatic tumor cells. Transduced cells were pooled and implanted into mice. Tumors were harvested at different times, and the frequency of each shRNA was determined as a measure of which ones prevented tumor growth. Several targets including carbonic anhydrase IX (CAIX, monocarboxylate transporter 4, and anionic amino acid transporter light chain, xc- system (xCT were identified in these studies and shown to be required for tumor initiation and growth. Interestingly, CAIX was overexpressed in the tumor initiating cell population. CAIX expression alone correlated with a highly tumorigenic subpopulation of cells. Furthermore, CAIX expression was essential for tumor initiation because shRNA knockdown eliminated the ability of cells to grow in vivo. To the best of our knowledge, this is the first parallel in vivo assessment of multiple novel oncology target genes using a patient-derived pancreatic tumor model.

  16. [Generalized neonatal screening based on laboratory tests].

    Science.gov (United States)

    Ardaillou, Raymond; Le Gall, Jean-Yves

    2006-11-01

    Implementation of a generalized screening program for neonatal diseases must obey precise rules. The disease must be severe, recognizable at an early stage, amenable to an effective treatment, detectable with a non expensive and widely applicable test; it must also be a significant public health problem. Subjects with positive results must be offered immediate treatment or prevention. All screening programs must be regularly evaluated. In France, since 1978, a national screening program has been organized by a private association ("Association française pour le dépistage et la prévention des handicaps de l'enfant") and supervised by the "Caisse nationale d'assurance maladie" and "Direction Générale de la Sante". Five diseases are now included in the screening program: phenylketonuria, hypothyroidism, congenital adrenal hyperplasia, cystic fibrosis and sickle cell disease (the latter only in at-risk newborns). Toxoplasmosis is a particular problem because only the children of mothers who were not tested during the pregnancy or who seroconverted are screened. Neonatal screening for phenylketonuria and hypothyrodism is unanimously recommended. Screening for congenital adrenal hyperplasia is approved in most countries. Cases of sickle cell disease and cystic fibrosis are more complex because--not all children who carry the mutations develop severe forms;--there is no curative treatment;--parents may become anxious, even though the phenotype is sometimes mild or even asymptomatic. Supporters of screening stress the benefits of early diagnosis (which extends the life expectancy of these children, particularly in the case of sickle cell disease), the fact that it opens up the possibility of prenatal screening of future pregnancies, and the utility of informing heterozygous carriers identified by familial screening. Neonatal screening for other diseases is under discussion. Indeed, technical advances such as tandem mass spectrometry make it possible to detect about 50

  17. Between Stage and Screen

    NARCIS (Netherlands)

    Tornqvist, Egil

    1996-01-01

    Ingmar Bergman is worldwide known as a film and stage director. Yet no-one has attempted to compare his stage and screen activities. In Between stage and screen Egil Tornqvist examines formal and thematical correspondences and differences between a number of Bergman's stage, screen, and radio

  18. Screening for colorectal cancer.

    Science.gov (United States)

    He, Jin; Efron, Jonathan E

    2011-01-01

    March is national colorectal cancer awareness month. It is estimated that as many as 60% of colorectal cancer deaths could be prevented if all men and women aged 50 years or older were screened routinely. In 2000, Katie Couric's televised colonoscopy led to a 20% increase in screening colonoscopies across America, a stunning rise called the "Katie Couric Effect". This event demonstrated how celebrity endorsement affects health behavior. Currently, discussion is ongoing about the optimal strategy for CRC screening, particularly the costs of screening colonoscopy. The current CRC screening guidelines are summarized in Table 2. Debates over the optimum CRC screening test continue in the face of evidence that 22 million Americans aged 50 to 75 years are not screened for CRC by any modality and 25,000 of those lives may have been saved if they had been screened for CRC. It is clear that improving screening rates and reducing disparities in underscreened communities and population subgroups could further reduce colorectal cancer morbidity and mortality. National Institutes of Health consensus identified the following priority areas to enhance the use and quality of colorectal cancer screening: Eliminate financial barriers to colorectal cancer screening and appropriate follow-up of positive results of colorectal cancer screening. Develop systems to ensure the high quality of colorectal cancer screening programs. Conduct studies to determine the comparative effectiveness of the various colorectal cancer screening methods in usual practice settings. Encouraging population adherence to screening tests and allowing patients to select the tests they prefer may do more good (as long as they choose something) than whatever procedure is chosen by the medical profession as the preferred test.

  19. Retinal Imaging Techniques for Diabetic Retinopathy Screening

    Science.gov (United States)

    Goh, James Kang Hao; Cheung, Carol Y.; Sim, Shaun Sebastian; Tan, Pok Chien; Tan, Gavin Siew Wei; Wong, Tien Yin

    2016-01-01

    Due to the increasing prevalence of diabetes mellitus, demand for diabetic retinopathy (DR) screening platforms is steeply increasing. Early detection and treatment of DR are key public health interventions that can greatly reduce the likelihood of vision loss. Current DR screening programs typically employ retinal fundus photography, which relies on skilled readers for manual DR assessment. However, this is labor-intensive and suffers from inconsistency across sites. Hence, there has been a recent proliferation of automated retinal image analysis software that may potentially alleviate this burden cost-effectively. Furthermore, current screening programs based on 2-dimensional fundus photography do not effectively screen for diabetic macular edema (DME). Optical coherence tomography is becoming increasingly recognized as the reference standard for DME assessment and can potentially provide a cost-effective solution for improving DME detection in large-scale DR screening programs. Current screening techniques are also unable to image the peripheral retina and require pharmacological pupil dilation; ultra-widefield imaging and confocal scanning laser ophthalmoscopy, which address these drawbacks, possess great potential. In this review, we summarize the current DR screening methods using various retinal imaging techniques, and also outline future possibilities. Advances in retinal imaging techniques can potentially transform the management of patients with diabetes, providing savings in health care costs and resources. PMID:26830491

  20. Smart material screening machines using smart materials and controls

    Science.gov (United States)

    Allaei, Daryoush; Corradi, Gary; Waigand, Al

    2002-07-01

    The objective of this product is to address the specific need for improvements in the efficiency and effectiveness in physical separation technologies in the screening areas. Currently, the mining industry uses approximately 33 billion kW-hr per year, costing 1.65 billion dollars at 0.05 cents per kW-hr, of electrical energy for physical separations. Even though screening and size separations are not the single most energy intensive process in the mining industry, they are often the major bottleneck in the whole process. Improvements to this area offer tremendous potential in both energy savings and production improvements. Additionally, the vibrating screens used in the mining processing plants are the most costly areas from maintenance and worker health and safety point of views. The goal of this product is to reduce energy use in the screening and total processing areas. This goal is accomplished by developing an innovative screening machine based on smart materials and smart actuators, namely smart screen that uses advanced sensory system to continuously monitor the screening process and make appropriate adjustments to improve production. The theory behind the development of Smart Screen technology is based on two key technologies, namely smart actuators and smart Energy Flow ControlT (EFCT) strategies, developed initially for military applications. Smart Screen technology controls the flow of vibration energy and confines it to the screen rather than shaking much of the mass that makes up the conventional vibratory screening machine. Consequently, Smart Screens eliminates and downsizes many of the structural components associated with conventional vibratory screening machines. As a result, the surface area of the screen increases for a given envelope. This increase in usable screening surface area extends the life of the screens, reduces required maintenance by reducing the frequency of screen change-outs and improves throughput or productivity.

  1. Four Principles to Consider Before Advising Women on Screening Mammography

    DEFF Research Database (Denmark)

    Keen, John D; Juhl Jørgensen, Karsten

    2015-01-01

    This article reviews four important screening principles applicable to screening mammography in order to facilitate informed choice. The first principle is that screening may help, hurt, or have no effect. In order to reduce mortality and mastectomy rates, screening must reduce the rate of advanced...... of a screening intervention. Disease-specific mortality is biased due to difficulties in attribution of cause of death and to increased mortality due to overdiagnosis and the resulting overtreatment with radiotherapy and chemotherapy. To enhance participation, the benefit from screening is often presented...... in relative instead of absolute terms. Third, some screening statistics must be interpreted with caution. Increased survival time and the percentage of early-stage tumors at detection sound plausible, but are affected by lead-time and length biases. In addition, analyses that only include women who attend...

  2. Screen Practice in Curating

    DEFF Research Database (Denmark)

    Toft, Tanya Søndergaard

    2014-01-01

    During the past one and a half decade, a curatorial orientation towards "screen practice" has expanded the moving image and digital art into the public domain, exploring alternative artistic uses of the screen. The emergence of urban LED screens in the late 1990s provided a new venue that allowed...... for digital art to expand into public space. It also offered a political point of departure, inviting for confrontation with the Spectacle and with the politics and ideology of the screen as a mass communication medium that instrumentalized spectator positions. In this article I propose that screen practice...... to the dispositif of screen practice in curating, resulting in a medium-based curatorial discourse. With reference to the nomadic exhibition project Nordic Outbreak that I co-curated with Nina Colosi in 2013 and 2014, I suggest that the topos of the defined visual display area, frequently still known as "the screen...

  3. Screening for heart transplantation and left ventricular assist system

    DEFF Research Database (Denmark)

    Lund, Lars H; Trochu, Jean-Noel; Meyns, Bart

    2018-01-01

    BACKGROUND: Heart transplantation (HTx) and implantable left ventricular assist systems (LVAS) improve outcomes in advanced heart failure but may be underutilized. We hypothesized that screening can identify appropriate candidates. METHODS AND RESULTS: The ScrEEning for advanced Heart Failure...... treatment (SEE-HF) study was a multicentre prospective study screening patients with existing cardiac resynchronization therapy (CRT) and/or implantable cardioverter-defibrillator (ICD) for ejection fraction ≤40% and New York Heart Association (NYHA) class III-IV, and subsequently for guideline-based HTx...

  4. ADVANCE PAYMENTS

    CERN Multimedia

    Human Resources Division

    2002-01-01

    Administrative Circular Nº 8 makes provision for the granting of advance payments, repayable in several monthly instalments, by the Organization to the members of its personnel. Members of the personnel are reminded that these advances are only authorized in exceptional circumstances and at the discretion of the Director-General. In view of the current financial situation of the Organization, and in particular the loans it will have to incur, the Directorate has decided to restrict the granting of such advances to exceptional or unforeseen circumstances entailing heavy expenditure and more specifically those pertaining to social issues. Human Resources Division Tel. 73962

  5. Advance payments

    CERN Multimedia

    Human Resources Division

    2003-01-01

    Administrative Circular N 8 makes provision for the granting of advance payments, repayable in several monthly instalments, by the Organization to the members of its personnel. Members of the personnel are reminded that these advances are only authorized in exceptional circumstances and at the discretion of the Director-General. In view of the current financial situation of the Organization, and in particular the loans it will have to incur, the Directorate has decided to restrict the granting of such advances to exceptional or unforeseen circumstances entailing heavy expenditure and more specifically those pertaining to social issues. Human Resources Division Tel. 73962

  6. Advanced Electronics

    Science.gov (United States)

    2017-07-21

    AFRL-RV-PS- AFRL-RV-PS- TR-2017-0114 TR-2017-0114 ADVANCED ELECTRONICS Ashwani Sharma 21 Jul 2017 Interim Report APPROVED FOR PUBLIC RELEASE...NUMBER Advanced Electronics 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 62601F 6. AUTHOR(S) 5d. PROJECT NUMBER 4846 Ashwani Sharma 5e. TASK NUMBER...Approved for public release; distribution is unlimited. (RDMX-17-14919 dtd 20 Mar 2018) 13. SUPPLEMENTARY NOTES 14. ABSTRACT The Space Electronics

  7. Automated Groundwater Screening

    International Nuclear Information System (INIS)

    Taylor, Glenn A.; Collard, Leonard B.

    2005-01-01

    The Automated Intruder Analysis has been extended to include an Automated Ground Water Screening option. This option screens 825 radionuclides while rigorously applying the National Council on Radiation Protection (NCRP) methodology. An extension to that methodology is presented to give a more realistic screening factor for those radionuclides which have significant daughters. The extension has the promise of reducing the number of radionuclides which must be tracked by the customer. By combining the Automated Intruder Analysis with the Automated Groundwater Screening a consistent set of assumptions and databases is used. A method is proposed to eliminate trigger values by performing rigorous calculation of the screening factor thereby reducing the number of radionuclides sent to further analysis. Using the same problem definitions as in previous groundwater screenings, the automated groundwater screening found one additional nuclide, Ge-68, which failed the screening. It also found that 18 of the 57 radionuclides contained in NCRP Table 3.1 failed the screening. This report describes the automated groundwater screening computer application

  8. Validation of the BetaStar® Advanced for Beta-lactams Test Kit for the Screening of Bulk Tank and Tanker Truck Milks for the Presence of Beta-lactam Drug Residues.

    Science.gov (United States)

    Denhartigh, Andrew; Reynolds, Lindsay; Palmer, Katherine; Klein, Frank; Rice, Jennifer; Rejman, John J

    2018-05-18

    A validation study was conducted for an immunochromatographic method (BetaStar ® Advanced for Beta-lactams) for the detection of beta-lactam residues in raw, commingled bovine milk. The assay detected amoxicillin, ampicillin, cloxacillin, penicillin, cephapirin, and ceftiofur below the U.S. Food and Drug Administration tolerance levels but above the maximum sensitivity thresholds established by the National Conference on Interstate Milk Shipments. The results of internal and independent laboratory dose-response studies employing spiked samples were in agreement. The test detected all six drugs at the approximate 90/95% sensitivity levels in milk from cows treated with each drug. Selectivity of the assay was 100%, as no false-positive results were obtained in testing 1148 control milk samples. Testing the estimated 90/95% sensitivity level for amoxicillin (8.5 ppb), ampicillin (6.9 ppb), cloxacillin (8.9 ppb), penicillin (4.2 ppb), and cephapirin (17.6 ppb), and at 100 ppb for each antibiotic, resulted in 94-100% positive tests for each of the beta-lactam drugs. The results of ruggedness experiments established the operating parameter tolerances for the assay. Cross-reactivity testing established that the assay detects other certain beta-lactam drugs, but it does not cross-react with any of 30 drugs belonging to seven different drug classes. Abnormally high bacterial or somatic cell counts in raw milk produced no assay interference.

  9. Using lessons from breast, cervical, and colorectal cancer screening to inform the development of lung cancer screening programs.

    Science.gov (United States)

    Armstrong, Katrina; Kim, Jane J; Halm, Ethan A; Ballard, Rachel M; Schnall, Mitchell D

    2016-05-01

    Multiple advisory groups now recommend that high-risk smokers be screened for lung cancer by low-dose computed tomography. Given that the development of lung cancer screening programs will face many of the same issues that have challenged other cancer screening programs, the National Cancer Institute-funded Population-based Research Optimizing Screening through Personalized Regimens (PROSPR) consortium was used to identify lessons learned from the implementation of breast, cervical, and colorectal cancer screening that should inform the introduction of lung cancer screening. These lessons include the importance of developing systems for identifying and recruiting eligible individuals in primary care, ensuring that screening centers are qualified and performance is monitored, creating clear communication standards for reporting screening results to referring physicians and patients, ensuring follow-up is available for individuals with abnormal test results, avoiding overscreening, remembering primary prevention, and leveraging advances in cancer genetics and immunology. Overall, this experience emphasizes that effective cancer screening is a multistep activity that requires robust strategies to initiate, report, follow up, and track each step as well as a dynamic and ongoing oversight process to revise current screening practices as new evidence regarding screening is created, new screening technologies are developed, new biological markers are identified, and new approaches to health care delivery are disseminated. Cancer 2016;122:1338-1342. © 2016 American Cancer Society. © 2016 American Cancer Society.

  10. AdvancED Flex 4

    CERN Document Server

    Tiwari, Shashank; Schulze, Charlie

    2010-01-01

    AdvancED Flex 4 makes advanced Flex 4 concepts and techniques easy. Ajax, RIA, Web 2.0, mashups, mobile applications, the most sophisticated web tools, and the coolest interactive web applications are all covered with practical, visually oriented recipes. * Completely updated for the new tools in Flex 4* Demonstrates how to use Flex 4 to create robust and scalable enterprise-grade Rich Internet Applications.* Teaches you to build high-performance web applications with interactivity that really engages your users.* What you'll learn Practiced beginners and intermediate users of Flex, especially

  11. [Screening of ovarian cancer : not for tomorrow].

    Science.gov (United States)

    Vuilleumier, Aurélie; Labidi-Galy, Intidhar

    2017-05-17

    As the worldwide incidence of cancer continuously rises, one of the measures to reduce mortality is early diagnosis while the disease is still curable. Colonoscopy screening and PAP-smears are worthwhile examples illustrating the impact of early diagnosis on mortality. Ovarian cancer is the first cause of mortality by gynecological cancers in Switzerland (incidence of 600 new cases / year), mostly diagnosed at advanced stages with a poor prognosis. Could surveillance measures improve survival ? Three large-scale randomized control trials failed to show mortality reduction from ovarian cancer with the methods currently available. A better comprehension of pathogenesis can allow the development of new strategies of screening.

  12. Integrative screening approach identifies regulators of polyploidization and targets for acute megakaryocytic leukemia

    Science.gov (United States)

    Wen, Qiang; Goldenson, Benjamin; Silver, Serena J.; Schenone, Monica; Dancik, Vladimir; Huang, Zan; Wang, Ling-Zhi; Lewis, Timothy; An, W. Frank; Li, Xiaoyu; Bray, Mark-Anthony; Thiollier, Clarisse; Diebold, Lauren; Gilles, Laure; Vokes, Martha S.; Moore, Christopher B.; Bliss-Moreau, Meghan; VerPlank, Lynn; Tolliday, Nicola J.; Mishra, Rama; Vemula, Sasidhar; Shi, Jianjian; Wei, Lei; Kapur, Reuben; Lopez, Cécile K.; Gerby, Bastien; Ballerini, Paola; Pflumio, Francoise; Gilliland, D. Gary; Goldberg, Liat; Birger, Yehudit; Izraeli, Shai; Gamis, Alan S.; Smith, Franklin O.; Woods, William G.; Taub, Jeffrey; Scherer, Christina A.; Bradner, James; Goh, Boon-Cher; Mercher, Thomas; Carpenter, Anne E.; Gould, Robert J.; Clemons, Paul A.; Carr, Steven A.; Root, David E.; Schreiber, Stuart L.; Stern, Andrew M.; Crispino, John D.

    2012-01-01

    Summary The mechanism by which cells decide to skip mitosis to become polyploid is largely undefined. Here we used a high-content image-based screen to identify small-molecule probes that induce polyploidization of megakaryocytic leukemia cells and serve as perturbagens to help understand this process. We found that dimethylfasudil (diMF, H-1152P) selectively increased polyploidization, mature cell-surface marker expression, and apoptosis of malignant megakaryocytes. A broadly applicable, highly integrated target identification approach employing proteomic and shRNA screening revealed that a major target of diMF is Aurora A kinase (AURKA), which has not been studied extensively in megakaryocytes. Moreover, we discovered that MLN8237 (Alisertib), a selective inhibitor of AURKA, induced polyploidization and expression of mature megakaryocyte markers in AMKL blasts and displayed potent anti-AMKL activity in vivo. This research provides the rationale to support clinical trials of MLN8237 and other inducers of polyploidization in AMKL. Finally, we have identified five networks of kinases that regulate the switch to polyploidy. PMID:22863010

  13. Screening for abdominalt aortaaneurisme

    DEFF Research Database (Denmark)

    Lindholt, J S; Juul, Svend; Henneberg, E W

    1997-01-01

    rupture. Ultrasonographic screening for AAA takes 10 minutes per scan, and the sensitivity and specificity are high. Ultrasonographic screening for AAA is a reliable, safe and inexpensive method for screening, and screening for AAA is discussed worldwide. One point four percent of deaths among men from 65...... to 80 year of age are caused by ruptured AAA. Screening men over 65 for AAA can theoretically prevent a substantial number of deaths. Our calculations predict one prevented AAA-death per 200-300 scans for a cost of about 4000 DKK per saved year of life. However, cost-benefit analyses are based...... on uncertain assumptions concerning prevalence, incidence and risk of rupture. Therefore a randomized trial screening of 65-73 year old males is taking place in the County of Viborg in Denmark. Udgivelsesdato: 1997-Mar-24...

  14. Cathode ray tube screens

    International Nuclear Information System (INIS)

    Cockayne, B.; Robbins, D.J.; Glasper, J.L.

    1982-01-01

    An improved cathode ray tube screen is described which consists of a single- or a poly-crystalline slice of a material such as yttrium aluminium garnet in which dopants such as Tb 3 + , Eu 3 + , Ce 3 + or Tm 3 + are ion implanted to different depths or in different areas of the screen. Annealing the screen removes lattice damage caused by the ion implanting and assists the diffusion of the dopant into the crystal. (U.K.)

  15. Colorectal Cancer Screening

    OpenAIRE

    Quintero, Enrique; Saito, Yutaka; Hassan, Cessare; Senore, Carlo

    2012-01-01

    Colorectal cancer, which is the leading cancer in Singapore, can be prevented by increased use of screening and polypectomy. A range of screening strategies such as stool-based tests, flexible sigmoidoscopy, colonoscopy and computed tomography colonography are available, each with different strengths and limitations. Primary care physicians should discuss appropriate screening modalities with their patients, tailored to their individual needs. Physicians, patients and the government should wo...

  16. Colorectal cancer screening

    OpenAIRE

    Plumb, A. A.; Halligan, S.

    2015-01-01

    Colorectal cancer is a major public health burden worldwide. There is clear-cut evidence that screening will reduce colorectal cancer mortality and the only contentious issue is which screening tool to use. Most evidence points towards screening with fecal occult blood testing. The immunochemical fecal occult blood tests have a higher sensitivity than the guaiac-based tests. In addition, their automation and haemoglobin quantification allows a threshold for colonoscopy to be selected that can...

  17. In-bead screening

    DEFF Research Database (Denmark)

    2013-01-01

    The present invention relates to screening of one-bead-one-compound (OBOC) combinatorial libraries which is useful for the discovery of compounds displaying molecular interactions with a biological or a physicochemical system, such as substrates and inhibitors of enzymes and the like. The invention...... provides a method for screening a library of compounds for their interaction with a physico- chemical or biological system and a corresponding kit for performing the method of screening a one-bead-one-compound library of compounds....

  18. Screening for colorectal cancer

    DEFF Research Database (Denmark)

    Nielsen, Hans J.; Jakobsen, Karen V.; Christensen, Ib J.

    2011-01-01

    Emerging results indicate that screening improves survival of patients with colorectal cancer. Therefore, screening programs are already implemented or are being considered for implementation in Asia, Europe and North America. At present, a great variety of screening methods are available including...... into improvements of screening for colorectal cancer includes blood-based biological markers, such as proteins, DNA and RNA in combination with various demographically and clinically parameters into a "risk assessment evaluation" (RAE) test. It is assumed that such a test may lead to higher acceptance among...... procedures for colorectal cancer. Therefore, results of present research, validating RAE tests, are awaited with interest....

  19. [Overdiagnosis in cancer screening].

    Science.gov (United States)

    Cervera Deval, J; Sentís Crivillé, M; Zulueta, J J

    2015-01-01

    In screening programs, overdiagnosis is defined as the detection of a disease that would have gone undetected without screening when that disease would not have resulted in morbimortality and was treated unnecessarily. Overdiagnosis is a bias inherent in screening and an undesired effect of secondary prevention and improved sensitivity of diagnostic techniques. It is difficult to discriminate a priori between clinically relevant diagnoses and those in which treatment is unnecessary. To minimize the effects of overdiagnosis, screening should be done in patients at risk. Copyright © 2014 SERAM. Published by Elsevier España, S.L.U. All rights reserved.

  20. Cancer screening guidelines.

    Science.gov (United States)

    Zoorob, R; Anderson, R; Cefalu, C; Sidani, M

    2001-03-15

    Numerous medical organizations have developed cancer screening guidelines. Faced with the broad, and sometimes conflicting, range of recommendations for cancer screening, family physicians must determine the most reasonable and up-to-date method of screening. Major medical organizations have generally achieved consensus on screening guidelines for breast, cervical and colorectal cancer. For breast cancer screening in women ages 50 to 70, clinical breast examination and mammography are generally recommended every one or two years, depending on the medical organization. For cervical cancer screening, most organizations recommend a Papanicolaou test and pelvic examination at least every three years in patients between 20 and 65 years of age. Annual fecal occult blood testing along with flexible sigmoidoscopy at five-year to 10-year intervals is the standard recommendation for colorectal cancer screening in patients older than 50 years. Screening for prostate cancer remains a matter of debate. Some organizations recommend digital rectal examination and a serum prostate-specific antigen test for men older than 50 years, while others do not. In the absence of compelling evidence to indicate a high risk of endometrial cancer, lung cancer, oral cancer and ovarian cancer, almost no medical organizations have developed cancer screening guidelines for these types of cancer.

  1. Obesity Prevention and Screening.

    Science.gov (United States)

    Mackey, Eleanor R; Olson, Alexandra; DiFazio, Marc; Cassidy, Omni

    2016-03-01

    Obesity is widespread, associated with several physical and psychosocial comorbidities, and is difficult to treat. Prevention of obesity across the lifespan is critical to improving the health of individuals and society. Screening and prevention efforts in primary care are an important step in addressing the obesity epidemic. Each period of human development is associated with unique risks, challenges, and opportunities for prevention and intervention. Screening tools for overweight/obesity, although imperfect, are quick and easy to administer. Screening should be conducted at every primary care visit and tracked longitudinally. Screening tools and cutoffs for overweight and obesity vary by age group. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. ScreenOS Cookbook

    CERN Document Server

    Brunner, Stefan; Delcourt, David

    2008-01-01

    In the only book that completely covers ScreenOS, six key members of Juniper Network's ScreenOS development team help you troubleshoot secure networks using ScreenOS firewall appliances. Over 200 recipes address a wide range of security issues, provide step-by-step solutions, and include discussions of why the recipes work, so you can easily set up and keep ScreenOS systems on track. The easy-to-follow format enables you to find the topic and specific recipe you need right away.

  3. Mammography screening in Denmark

    DEFF Research Database (Denmark)

    Vejborg, Ilse; Mikkelsen, Ellen Margrethe; Garne, Jens Peter

    2011-01-01

    Mammography screening is offered healthy women, and a high standard on professional and organizational level is mandatory not only in the screening programme but even in the diagnostic work-up and treatment. The main goal is to achieve a substantial reduction in disease specific mortality......, but it is not possible to evaluate the effect on mortality until several years later, and continuously monitoring of the quality of all aspects of a screening programme is necessary. Based on other European guidelines, 11 quality indicators have been defined, and guidelines concerning organizational requirements...... for a Danish screening programme as well as recommendations for the radiographic and radiological work have been drawn up....

  4. Advanced calculus

    CERN Document Server

    Nickerson, HK; Steenrod, NE

    2011-01-01

    ""This book is a radical departure from all previous concepts of advanced calculus,"" declared the Bulletin of the American Mathematics Society, ""and the nature of this departure merits serious study of the book by everyone interested in undergraduate education in mathematics."" Classroom-tested in a Princeton University honors course, it offers students a unified introduction to advanced calculus. Starting with an abstract treatment of vector spaces and linear transforms, the authors introduce a single basic derivative in an invariant form. All other derivatives - gradient, divergent, curl,

  5. American Indian Men's Perceptions of Breast Cancer Screening for American Indian Women.

    Science.gov (United States)

    Filippi, Melissa K; Pacheco, Joseph; James, Aimee S; Brown, Travis; Ndikum-Moffor, Florence; Choi, Won S; Greiner, K Allen; Daley, Christine M

    2014-01-01

    Screening, especially screening mammography, is vital for decreasing breast cancer incidence and mortality. Screening rates in American Indian women are low compared to other racial/ethnic groups. In addition, American Indian women are diagnosed at more advanced stages and have lower 5-year survival rate than others. To better address the screening rates of American Indian women, focus groups (N=8) were conducted with American Indian men (N=42) to explore their perceptions of breast cancer screening for American Indian women. Our intent was to understand men's support level toward screening. Using a community-based participatory approach, focus groups were audio-taped, transcribed verbatim, and analyzed using a text analysis approach developed by our team. Topics discussed included breast cancer and screening knowledge, barriers to screening, and suggestions to improve screening rates. These findings can guide strategies to improve knowledge and awareness, communication among families and health care providers, and screening rates in American Indian communities.

  6. International Cancer Screening Network

    Science.gov (United States)

    The International Cancer Screening Network promotes evidence-based cancer screening implementation and evaluation with cooperation from multilateral organizations around the globe. Learn more about how ICSN aims to reduce the global burden of cancer by supporting research and international collaboration.

  7. Touch screens go optical

    DEFF Research Database (Denmark)

    Hanson, Steen Grüner; Jakobsen, Michael Linde; Pedersen, Henrik Chresten

    2012-01-01

    A simple optical implementation of a touch screen is made possible by disrupting the total internal reflection in a 2D waveguide.......A simple optical implementation of a touch screen is made possible by disrupting the total internal reflection in a 2D waveguide....

  8. EIA screening in Denmark

    DEFF Research Database (Denmark)

    Nielsen, Eskild Holm; Christensen, Per; Kørnøv, Lone

    2005-01-01

    The article points out that EIA screening is effectively a regulatory instrument and it can be a cost-effective instrument with environmental benefits.......The article points out that EIA screening is effectively a regulatory instrument and it can be a cost-effective instrument with environmental benefits....

  9. Substance Abuse Screening

    Science.gov (United States)

    ... information is collected, stored or sent over the Internet. To ensure complete privacy, exit your web browser after completing this screening. ... information is collected, stored or sent over the Internet. To ensure complete privacy, exit your web browser after completing this screening. ...

  10. Hospitalized women's willingness to pay for an inpatient screening mammogram.

    Science.gov (United States)

    Khaliq, Waseem; Harris, Ché Matthew; Landis, Regina; Bridges, John F P; Wright, Scott M

    2014-01-01

    Lower rates for breast cancer screening persist among low income and uninsured women. Although Medicare and many other insurance plans would pay for screening mammograms done during hospital stays, breast cancer screening has not been part of usual hospital care. This study explores the mean amount of money that hospitalized women were willing to contribute towards the cost of a screening mammogram. Of the 193 enrolled patients, 72% were willing to pay a mean of $83.41 (95% CI, $71.51-$95.31) in advance towards inpatient screening mammogram costs. The study's findings suggest that hospitalized women value the prospect of screening mammography during the hospitalization. It may be wise policy to offer mammograms to nonadherent hospitalized women, especially those who are at high risk for developing breast cancer. © 2014 Annals of Family Medicine, Inc.

  11. Screen-film mammography

    International Nuclear Information System (INIS)

    Logan, W.W.; Janus, J.A.

    1987-01-01

    The development of screen-film mammography has resulted in the re-emergence of confidence, rather than fear, in mammography. When screen-film mammography is performed with state-of-the-art dedicated equipment utilizing vigorous breast compression and a ''soft'' x-ray beam for improved contrast, screen-film images are equivalent or superior to those of reduced-dose xeromammography and superior to those of nonscreen film mammography. Technological aids for conversion from xeromammographic or nonscreen film mammographic techniques to screen-film techniques have been described. Screen-film mammography should not be attempted until dedicated equipment has been obtained and the importance of vigorous compression has been understood

  12. Molecular HIV screening.

    Science.gov (United States)

    Bourlet, Thomas; Memmi, Meriam; Saoudin, Henia; Pozzetto, Bruno

    2013-09-01

    Nuclear acid testing is more and more used for the diagnosis of infectious diseases. This paper focuses on the use of molecular tools for HIV screening. The term 'screening' will be used under the meaning of first-line HIV molecular techniques performed on a routine basis, which excludes HIV molecular tests designed to confirm or infirm a newly discovered HIV-seropositive patient or other molecular tests performed for the follow-up of HIV-infected patients. The following items are developed successively: i) presentation of the variety of molecular tools used for molecular HIV screening, ii) use of HIV molecular tools for the screening of blood products, iii) use of HIV molecular tools for the screening of organs and tissue from human origin, iv) use of HIV molecular tools in medically assisted procreation and v) use of HIV molecular tools in neonates from HIV-infected mothers.

  13. Screening for abdominalt aortaaneurisme

    DEFF Research Database (Denmark)

    Lindholt, Jes Sanddal; Juul, Søren; Henneberg, E W

    1997-01-01

    In spite of increasing number of elective resections of abdominal aortic aneurysms (AAA) the mortality or ruptured AAA is increasing. The advantages of elective operations are obvious; the lethality is 2-6% while the lethality of ruptured AAA is 75-95%. However, AAA seldom causes symptoms before...... rupture. Ultrasonographic screening for AAA takes 10 minutes per scan, and the sensitivity and specificity are high. Ultrasonographic screening for AAA is a reliable, safe and inexpensive method for screening, and screening for AAA is discussed worldwide. One point four percent of deaths among men from 65...... to 80 year of age are caused by ruptured AAA. Screening men over 65 for AAA can theoretically prevent a substantial number of deaths. Our calculations predict one prevented AAA-death per 200-300 scans for a cost of about 4000 DKK per saved year of life. However, cost-benefit analyses are based...

  14. Education for screen use as holistic praxis

    Directory of Open Access Journals (Sweden)

    Lic. José Antonio Gabelas Barroso

    2007-09-01

    Full Text Available New generations maintain a very close daily relationship with screens (television, Internet, video consoles and mobile telephones. A lot of their leisure time centres on these means of communication with a double purpose: either for playing or communicating with others. These are the two dimensions (recreational and social that dominate the choice of these types of communication in order to entertain oneself and/or establish relationships with their groups of friends. The trend in the consumption of screens has distanced television from its previous monopoly and has meant that it has to share young people’s leisure time with other advanced technological supports. The health of children and adolescents involves educating them towards a healthy and responsible consumption of all screens, in a balanced way as regards dosis and planning, and with criteria as regards the content that could endanger them and the level of their cognitive development.

  15. Staged anticonvulsant screening for chronic epilepsy

    OpenAIRE

    Berdichevsky, Yevgeny; Saponjian, Yero; Park, Kyung‐Il; Roach, Bonnie; Pouliot, Wendy; Lu, Kimberly; Swiercz, Waldemar; Dudek, F. Edward; Staley, Kevin J.

    2016-01-01

    Abstract Objective: Current anticonvulsant screening programs are based on seizures evoked in normal animals. One‐third of epileptic patients do not respond to the anticonvulsants discovered with these models. We evaluated a tiered program based on chronic epilepsy and spontaneous seizures, with compounds advancing from high‐throughput in vitro models to low‐throughput in vivo models. Methods: Epileptogenesis in organotypic hippocampal slice cultures was quantified by lactate production and l...

  16. Breast Cancer Screening in an Era of Personalized Regimens

    Science.gov (United States)

    Onega, Tracy; Beaber, Elisabeth F.; Sprague, Brian L.; Barlow, William E.; Haas, Jennifer S.; Tosteson, Anna N.A.; Schnall, Mitchell D.; Armstrong, Katrina; Schapira, Marilyn M.; Geller, Berta; Weaver, Donald L.; Conant, Emily F.

    2014-01-01

    Breast cancer screening holds a prominent place in public health, health care delivery, policy, and women’s health care decisions. Several factors are driving shifts in how population-based breast cancer screening is approached, including advanced imaging technologies, health system performance measures, health care reform, concern for “overdiagnosis,” and improved understanding of risk. Maximizing benefits while minimizing the harms of screening requires moving from a “1-size-fits-all” guideline paradigm to more personalized strategies. A refined conceptual model for breast cancer screening is needed to align women’s risks and preferences with screening regimens. A conceptual model of personalized breast cancer screening is presented herein that emphasizes key domains and transitions throughout the screening process, as well as multilevel perspectives. The key domains of screening awareness, detection, diagnosis, and treatment and survivorship are conceptualized to function at the level of the patient, provider, facility, health care system, and population/policy arena. Personalized breast cancer screening can be assessed across these domains with both process and outcome measures. Identifying, evaluating, and monitoring process measures in screening is a focus of a National Cancer Institute initiative entitled PROSPR (Population-based Research Optimizing Screening through Personalized Regimens), which will provide generalizable evidence for a risk-based model of breast cancer screening, The model presented builds on prior breast cancer screening models and may serve to identify new measures to optimize benefits-to-harms tradeoffs in population-based screening, which is a timely goal in the era of health care reform. PMID:24830599

  17. Preimplantation genetic screening.

    Science.gov (United States)

    Harper, Joyce C

    2018-03-01

    Preimplantation genetic diagnosis was first successfully performed in 1989 as an alternative to prenatal diagnosis for couples at risk of transmitting a genetic or chromosomal abnormality, such as cystic fibrosis, to their child. From embryos generated in vitro, biopsied cells are genetically tested. From the mid-1990s, this technology has been employed as an embryo selection tool for patients undergoing in vitro fertilisation, screening as many chromosomes as possible, in the hope that selecting chromosomally normal embryos will lead to higher implantation and decreased miscarriage rates. This procedure, preimplantation genetic screening, was initially performed using fluorescent in situ hybridisation, but 11 randomised controlled trials of screening using this technique showed no improvement in in vitro fertilisation delivery rates. Progress in genetic testing has led to the introduction of array comparative genomic hybridisation, quantitative polymerase chain reaction, and next generation sequencing for preimplantation genetic screening, and three small randomised controlled trials of preimplantation genetic screening using these new techniques indicate a modest benefit. Other trials are still in progress but, regardless of their results, preimplantation genetic screening is now being offered globally. In the near future, it is likely that sequencing will be used to screen the full genetic code of the embryo.

  18. Advanced Virgo

    CERN Multimedia

    Virgo, a first-generation interferometric gravitational wave (GW) detector, located in the European Gravitational Observatory, EGO, Cascina (Pisa-Italy) and constructed by the collaboration of French and Italian institutes (CNRS and INFN) has successfully completed its long-duration data taking runs. It is now undergoing a fundamental upgrade that exploits available cutting edges technology to open an exciting new window on the universe, with the first detection of a gravitational wave signal. Advanced Virgo (AdV) is the project to upgrade the Virgo detector to a second-generation instrument. AdV will be able to scan a volume of the Universe 1000 times larger than initial Virgo. AdV will be hosted in the same infrastructures as Virgo. The Advanced VIRGO project is funded and at present carried on by a larger collaboration of institutes belonging to CNRS- France , RMKI - Hungary, INFN- Italy, Nikhef - The Netherlands Polish Academy of Science - Poland.

  19. Screening sensitivity theory

    International Nuclear Information System (INIS)

    Oblow, E.M.; Perey, F.G.

    1984-01-01

    A comprehensive rigorous theory is developed for screening sensitivity coefficients in largescale modeling applications. The theory uses Bayesian inference and group theory to establish a probabilistic framework for solving an underdetermined system of linear equations. The underdetermined problem is directly related to statistical screening sensitivity theory as developed in recent years. Several examples of the new approach to screening are worked out in detail and comparisons are made with statistical approaches to the problem. The drawbacks of these latter methods are discussed at some length

  20. Advanced Combustion

    Energy Technology Data Exchange (ETDEWEB)

    Holcomb, Gordon R. [NETL

    2013-03-11

    The activity reported in this presentation is to provide the mechanical and physical property information needed to allow rational design, development and/or choice of alloys, manufacturing approaches, and environmental exposure and component life models to enable oxy-fuel combustion boilers to operate at Ultra-Supercritical (up to 650{degrees}C & between 22-30 MPa) and/or Advanced Ultra-Supercritical conditions (760{degrees}C & 35 MPa).

  1. Risks of Colorectal Cancer Screening

    Science.gov (United States)

    ... Genetics of Colorectal Cancer Colorectal Cancer Screening Research Colorectal Cancer Screening (PDQ®)–Patient Version What is screening? Go ... These are called diagnostic tests . General Information About Colorectal Cancer Key Points Colorectal cancer is a disease in ...

  2. Cervical cancer - screening and prevention

    Science.gov (United States)

    Cancer cervix - screening; HPV - cervical cancer screening; Dysplasia - cervical cancer screening; Cervical cancer - HPV vaccine ... Almost all cervical cancers are caused by HPV (human papilloma virus). HPV is a common virus that spreads through sexual contact. Certain ...

  3. Prostate Cancer Screening

    Science.gov (United States)

    ... treat. There is no standard screening test for prostate cancer. Researchers are studying different tests to find those ... PSA level may be high if you have prostate cancer. It can also be high if you have ...

  4. SCREENING FOR CERVICAL CANCER

    African Journals Online (AJOL)

    Enrique

    Cervical cancer remains a major health concern worldwide, especially in devel- ... Important aspects of cervical cancer screening include the age at which .... High-risk types HPV (16,18) are impli- cated in the pathogenesis of cervical cancer.

  5. Breast Cancer Screening

    International Nuclear Information System (INIS)

    Altaf, Fadwa J.

    2004-01-01

    Breast cancer is a very common health problem in Saudi females that can be reduced by early detection through introducing breast cancer screening. Literature review reveals significant reduction in breast cancer incidence and outcome after the beginning of breast cancer screening. The objectives of this article are to highlight the significance of breast cancer screening in different international societies and to write the major guidelines of breast cancer screening in relation to other departments involved with more emphasis on the Pathology Department guidelines in tissue handling, diagnostic criteria and significance of the diagnosis. This article summaries and acknowledges major work carried out before, and recommends similar modified work in order to meet the requirement for the Saudi society. (author)

  6. Urine drug screen

    Science.gov (United States)

    Drug screen - urine ... detect the presence of illegal and some prescription drugs in your urine. Their presence may indicate that you recently used these drugs. Some drugs may remain in your system for ...

  7. Breast cancer screening

    International Nuclear Information System (INIS)

    Vandenbroucke, A.

    1987-01-01

    Many studies have shown that breast cancer screening is able to reduce breast cancer mortality, including the HIP study, the Swedish Trial and the Netherlands studies. Mammography is considered as the most effective method for breast cancer screening but it might be unfeasible for some reasons: - the population acceptability of the method might be low. Indeed, most populations of the South of Europe are less compliant to mass screening than populations of the North of Europe; - the medical equipment and personnel - radiologists and pathologists - might be insufficient; - it might be too costly for the National Health Service, specially where the incidence rate of breast cancer is relatively low (i.e. Greece, Portugal). The validity of screening tests is judged by their sensitivity and their specificity

  8. Neonatal cystic fibrosis screening test

    Science.gov (United States)

    Cystic fibrosis screening - neonatal; Immunoreactive trypsinogen; IRT test; CF - screening ... Cystic fibrosis is a disease passed down through families. CF causes thick, sticky mucus to build up in ...

  9. Lung cancer screening: Update

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Hyea Young [Dept. of Radiology, Center for Lung Cancer, National Cancer Center, Goyang (Korea, Republic of)

    2015-09-15

    Lung cancer is the leading cause of cancer deaths worldwide as well as in Korea. A recent National Lung Screening Trial in U.S. revealed that low-dose CT (LDCT) screening reduced lung cancer specific mortality by 20% in high risk individuals as compared to chest radiograph screening. Based on this evidence, several expert societies in U.S. and Korean multisociety collaborative committee developed guidelines for recommendation of lung cancer screening using annual LDCT in high risk populations. In most of the societies high risk groups are defined as persons aged 55 to 74 years, who are current smokers with history of smoking of more than 30 packs per year or ex-smokers, who quit smoking up to 15 or more years ago. The benefits of LDCT screening are modestly higher than the harms in high risk individuals. The harms included a high rate of false-positive findings, over-diagnosis and radiation-related deaths. Invasive diagnostic procedure due to false positive findings may lead to complications. LDCT should be performed in qualified hospitals and interpreted by expert radiologists. Recently, the American College of Radiology released the current version of Lung cancer CT screening Reporting and Data Systems. Education and actions to stop smoking must be offered to current smokers.

  10. Lung cancer screening: Update

    International Nuclear Information System (INIS)

    Kim, Hyea Young

    2015-01-01

    Lung cancer is the leading cause of cancer deaths worldwide as well as in Korea. A recent National Lung Screening Trial in U.S. revealed that low-dose CT (LDCT) screening reduced lung cancer specific mortality by 20% in high risk individuals as compared to chest radiograph screening. Based on this evidence, several expert societies in U.S. and Korean multisociety collaborative committee developed guidelines for recommendation of lung cancer screening using annual LDCT in high risk populations. In most of the societies high risk groups are defined as persons aged 55 to 74 years, who are current smokers with history of smoking of more than 30 packs per year or ex-smokers, who quit smoking up to 15 or more years ago. The benefits of LDCT screening are modestly higher than the harms in high risk individuals. The harms included a high rate of false-positive findings, over-diagnosis and radiation-related deaths. Invasive diagnostic procedure due to false positive findings may lead to complications. LDCT should be performed in qualified hospitals and interpreted by expert radiologists. Recently, the American College of Radiology released the current version of Lung cancer CT screening Reporting and Data Systems. Education and actions to stop smoking must be offered to current smokers

  11. Advanced calculus

    CERN Document Server

    Friedman, Avner

    2007-01-01

    This rigorous two-part treatment advances from functions of one variable to those of several variables. Intended for students who have already completed a one-year course in elementary calculus, it defers the introduction of functions of several variables for as long as possible, and adds clarity and simplicity by avoiding a mixture of heuristic and rigorous arguments.The first part explores functions of one variable, including numbers and sequences, continuous functions, differentiable functions, integration, and sequences and series of functions. The second part examines functions of several

  12. Advanced calculus

    CERN Document Server

    Fitzpatrick, Patrick M

    2009-01-01

    Advanced Calculus is intended as a text for courses that furnish the backbone of the student's undergraduate education in mathematical analysis. The goal is to rigorously present the fundamental concepts within the context of illuminating examples and stimulating exercises. This book is self-contained and starts with the creation of basic tools using the completeness axiom. The continuity, differentiability, integrability, and power series representation properties of functions of a single variable are established. The next few chapters describe the topological and metric properties of Euclide

  13. Advanced trigonometry

    CERN Document Server

    Durell, C V; Robson, A

    1950-01-01

    This volume will provide a welcome resource for teachers seeking an undergraduate text on advanced trigonometry, when few are readily available. Ideal for self-study, this text offers a clear, logical presentation of topics and an extensive selection of problems with answers. Contents include the properties of the triangle and the quadrilateral; equations, sub-multiple angles, and inverse functions; hyperbolic, logarithmic, and exponential functions; and expansions in power-series. Further topics encompass the special hyperbolic functions; projection and finite series; complex numbers; de Moiv

  14. Advanced glycation end product-induced astrocytic differentiation of cultured neurospheres through inhibition of Notch-Hes1 pathway-mediated neurogenesis.

    Science.gov (United States)

    Guo, Yijing; Wang, Pin; Sun, Haixia; Cai, Rongrong; Xia, Wenqing; Wang, Shaohua

    2013-12-23

    This study aims to investigate the roles of the Notch-Hes1 pathway in the advanced glycation end product (AGE)-mediated differentiation of neural stem cells (NSCs). We prepared pLentiLox3.7 lentiviral vectors that express short hairpin RNA (shRNA) against Notch1 and transfected it into NSCs. Cell differentiation was analyzed under confocal laser-scanning microscopy. The percentage of neurons and astrocytes was quantified by normalizing the total number of TUJ1+ (Neuron-specific class III β-tubulin) and GFAP+ (Glial fibrillary acidic protein) cells to the total number of Hoechst 33342-labeled cell nuclei. The protein and gene expression of Notch-Hes1 pathway components was examined via western blot analysis and real-time PCR. After 1 week of incubation, we found that AGE-bovine serum albumin (BSA) (400 μg/mL) induced the astrocytic differentiation of cultured neurospheres and inhibited neuronal formation. The expression of Notch-Hes1 pathway components was upregulated in the cells in the AGE-BSA culture medium. Immunoblot analysis indicated that shRNA silencing of Notch1 expression in NSCs significantly increases neurogenesis and suppresses astrocytic differentiation in NSCs incubated with AGE-BSA. AGEs promote the astrocytic differentiation of cultured neurospheres by inhibiting neurogenesis through the Notch-Hes1 pathway, providing a potential therapeutic target for hyperglycemia-related cognitive deficits.

  15. [Organized breast cancer screening].

    Science.gov (United States)

    Rouëssé, Jacques; Sancho-Garnier, Hélèn

    2014-02-01

    Breast screening programs are increasingly controversial, especially regarding two points: the number of breast cancer deaths they avoid, and the problem of over-diagnosis and over-treatment. The French national breast cancer screening program was extended to cover the whole country in 2004. Ten years later it is time to examine the risk/benefit ratio of this program and to discuss the need for change. Like all forms of cancer management, screening must be regularly updated, taking into account the state of the art, new evidence, and uncertainties. All screening providers should keep themselves informed of the latest findings. In the French program, women aged 50-74 with no major individual or familial risk factors for breast cancer are offered screening mammography and clinical breast examination every two years. Images considered non suspicious of malignancy by a first reader are re-examined by a second reader. The devices and procedures are subjected to quality controls. Participating radiologists (both public and private) are required to read at least 500 mammographies per year. The program's national participation rate was 52.7 % in 2012. When individual screening outside of the national program is taken into account (nearly 15 % of women), coverage appears close to the European recommendation of 65 %. Breast cancer mortality has been falling in France by 0.6 % per year for over 30 years, starting before mass screening was implemented, and by 1.5 % since 2005. This decline can be attributed in part to earlier diagnosis and better treatment, so that the specific impact of screening cannot easily be measured. Over-treatment, defined as the detection and treatment of low-malignancy tumors that would otherwise not have been detected in a person's lifetime, is a major negative effect of screening, but its frequency is not precisely known (reported to range from 1 % to 30 %). In view of these uncertainties, it would be advisable to modify the program in order to

  16. 78 FR 18287 - Passenger Screening Using Advanced Imaging Technology

    Science.gov (United States)

    2013-03-26

    ... Exposure to Time-Varying Electric, Magnetic, and Electromagnetic Fields, Health Physics 74(4); 494-522... radiation safety standard of the American National Standards Institute (ANSI) \\44\\ and Health Physics... waves emissions are well below applicable safety and health standards, and are so low as to present a...

  17. Advanced Lung Cancer Screening: An Individualized Molecular Nanotechnology Approach

    Science.gov (United States)

    2014-08-01

    Services, Directorate for Information Operations and Reports (0704-0188), 1215 Jefferson Davis Highway, Suite 1204, Arlington, VA 22202- 4302...study appointments, includ- ing contacting subjects before appointments, providing minimal financial remuneration for attendance at each visit, and...upper lobe–predominant emphysema observed in HIV subjects. Despite patient navigators and remuneration for contin- ued participation, this study is

  18. 77 FR 65006 - Air Cargo Advance Screening (ACAS) Pilot Program

    Science.gov (United States)

    2012-10-24

    ... electronic cargo information by way of a CBP-approved electronic data interchange (EDI) system before the... electronically receive certain information regarding that cargo through a CBP-approved EDI system no later than... the above information regarding that cargo through a CBP-approved EDI system no later than the time of...

  19. Physics in Screening Environments

    Science.gov (United States)

    Certik, Ondrej

    In the current study, we investigated atoms in screening environments like plasmas. It is common practice to extract physical data, such as temperature and electron densities, from plasma experiments. We present results that address inherent computational difficulties that arise when the screening approach is extended to include the interaction between the atomic electrons. We show that there may arise an ambiguity in the interpretation of physical properties, such as temperature and charge density, from experimental data due to the opposing effects of electron-nucleus screening and electron-electron screening. The focus of the work, however, is on the resolution of inherent computational challenges that appear in the computation of two-particle matrix elements. Those enter already at the Hartree-Fock level. Furthermore, as examples of post Hartree-Fock calculations, we show second-order Green's function results and many body perturbation theory results of second order. A self-contained derivation of all necessary equations has been included. The accuracy of the implementation of the method is established by comparing standard unscreened results for various atoms and molecules against literature for Hartree-Fock as well as Green's function and many body perturbation theory. The main results of the thesis are presented in the chapter called Screened Results, where the behavior of several atomic systems depending on electron-electron and electron-nucleus Debye screening was studied. The computer code that we have developed has been made available for anybody to use. Finally, we present and discuss results obtained for screened interactions. We also examine thoroughly the computational details of the calculations and particular implementations of the method.

  20. Providing information about prenatal screening for Down syndrome

    DEFF Research Database (Denmark)

    Skjøth, Mette Maria; Draborg, Eva; Pedersen, Claus Duedal

    2015-01-01

    BACKGROUND: In recent decades there have been advances in the options for prenatal screening. Screening programmes for Down syndrome are well established in many countries. It is important that pregnant women are well informed about the benefits and risks of screening. A variety of interventions...... screening for Down syndrome. DESIGN: SYSTEMATIC REVIEW: METHODS: A systematic search was performed using the PUBMED and EMBASE databases. The search terms included MeSH terms and free text and were combined by Boolean terms (AND, OR) with no restriction on language or time. MAIN OUTCOME MEASURES: Main...... information about prenatal screening for Down syndrome can improve their ability to make an informed choice. This article is protected by copyright. All rights reserved....

  1. Artificial intelligence for breast cancer screening: Opportunity or hype?

    Science.gov (United States)

    Houssami, Nehmat; Lee, Christoph I; Buist, Diana S M; Tao, Dacheng

    2017-12-01

    Interpretation of mammography for breast cancer (BC) screening can confer a mortality benefit through early BC detection, can miss a cancer that is present or fast growing, or can result in false-positives. Efforts to improve screening outcomes have mostly focused on intensifying imaging practices (double instead of single-reading, more frequent screens, or supplemental imaging) that may add substantial resource expenditures and harms associated with population screening. Less attention has been given to making mammography screening practice 'smarter' or more efficient. Artificial intelligence (AI) is capable of advanced learning using large complex datasets and has the potential to perform tasks such as image interpretation. With both highly-specific capabilities, and also possible un-intended (and poorly understood) consequences, this viewpoint considers the promise and current reality of AI in BC detection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. More comprehensive discussion of CRC screening associated with higher screening.

    Science.gov (United States)

    Mosen, David M; Feldstein, Adrianne C; Perrin, Nancy A; Rosales, A Gabriella; Smith, David H; Liles, Elizabeth G; Schneider, Jennifer L; Meyers, Ronald E; Elston-Lafata, Jennifer

    2013-04-01

    Examine association of comprehensiveness of colorectal cancer (CRC) screening discussion by primary care physicians (PCPs) with completion of CRC screening. Observational study in Kaiser Permanente Northwest, a group-model health maintenance organization. A total of 883 participants overdue for CRC screening received an automated telephone call (ATC) between April and June 2009 encouraging CRC screening. Between January and March 2010, participants completed a survey on PCPs' discussion of CRC screening and patient beliefs regarding screening. receipt of CRC screening (assessed by electronic medical record [EMR], 9 months after ATC). Primary independent variable: comprehensiveness of CRC screening discussion by PCPs (7-item scale). Secondary independent variables: perceived benefits of screening (4-item scale assessing respondents' agreement with benefits of timely screening) and primary care utilization (EMR; 9 months after ATC). The independent association of variables with CRC screening was assessed with logistic regression. Average scores for comprehensiveness of CRC discussion and perceived benefits were 0.4 (range 0-1) and 4.0 (range 1-5), respectively. A total of 28.2% (n = 249) completed screening, 84% of whom had survey assessments after their screening date. Of screeners, 95.2% completed the fecal immunochemical test. More comprehensive discussion of CRC screening was associated with increased screening (odds ratio [OR] = 1.51, 95% confidence interval [CI] = 1.03-2.21). Higher perceived benefits (OR = 1.46, 95% CI = 1.13-1.90) and 1 or more PCP visits (OR = 5.82, 95% CI = 3.87-8.74) were also associated with increased screening. More comprehensive discussion of CRC screening was independently associated with increased CRC screening. Primary care utilization was even more strongly associated with CRC screening, irrespective of discussion of CRC screening.

  3. Nanofabrication strategies for advanced electrode materials

    Directory of Open Access Journals (Sweden)

    Chen Kunfeng

    2017-09-01

    Full Text Available The development of advanced electrode materials for high-performance energy storage devices becomes more and more important for growing demand of portable electronics and electrical vehicles. To speed up this process, rapid screening of exceptional materials among various morphologies, structures and sizes of materials is urgently needed. Benefitting from the advance of nanotechnology, tremendous efforts have been devoted to the development of various nanofabrication strategies for advanced electrode materials. This review focuses on the analysis of novel nanofabrication strategies and progress in the field of fast screening advanced electrode materials. The basic design principles for chemical reaction, crystallization, electrochemical reaction to control the composition and nanostructure of final electrodes are reviewed. Novel fast nanofabrication strategies, such as burning, electrochemical exfoliation, and their basic principles are also summarized. More importantly, colloid system served as one up-front design can skip over the materials synthesis, accelerating the screening rate of highperformance electrode. This work encourages us to create innovative design ideas for rapid screening high-active electrode materials for applications in energy-related fields and beyond.

  4. Global Screening of Antiviral Genes that Suppress Baculovirus Transgene Expression in Mammalian Cells.

    Science.gov (United States)

    Wang, Chia-Hung; Naik, Nenavath Gopal; Liao, Lin-Li; Wei, Sung-Chan; Chao, Yu-Chan

    2017-09-15

    Although baculovirus has been used as a safe and convenient gene delivery vector in mammalian cells, baculovirus-mediated transgene expression is less effective in various mammalian cell lines. Identification of the negative regulators in host cells is necessary to improve baculovirus-based expression systems. Here, we performed high-throughput shRNA library screening, targeting 176 antiviral innate immune genes, and identified 43 host restriction factor genes in a human A549 lung carcinoma cell line. Among them, suppression of receptor interaction protein kinase 1 (RIP1, also known as RIPK1) significantly increased baculoviral transgene expression without resulting in significant cell death. Silencing of RIP1 did not affect viral entry or cell viability, but it did inhibit nuclear translocation of the IRF3 and NF-κB transcription factors. Also, activation of downstream signaling mediators (such as TBK1 and IRF7) was affected, and subsequent interferon and cytokine gene expression levels were abolished. Further, Necrostatin-1 (Nec-1)-an inhibitor of RIP1 kinase activity-dramatically increased baculoviral transgene expression in RIP1-silenced cells. Using baculovirus as a model system, this study presents an initial investigation of large numbers of human cell antiviral innate immune response factors against a "nonadaptive virus." In addition, our study has made baculovirus a more efficient gene transfer vector for some of the most frequently used mammalian cell systems.

  5. Newborn hearing screening.

    Science.gov (United States)

    Stewart, D L; Pearlman, A

    1994-11-01

    Congenital deafness is a relatively common problem with an incidence of 1/300 to 1/1000. Most states have no mass screening program for hearing loss, but the state of Kentucky compiles a High Risk Registry which is a historical survey of parents relating to risk factors for hearing loss. Unfortunately this survey can miss 50% of those who have a hearing deficit. If not detected prior to discharge, there is often a delay in diagnosis of deafness which prevents early intervention. We report 2 years' experience at Kosair Children's Hospital where 1,987 infants admitted to well baby, intermediate, or intensive care nurseries were screened using the ALGO-1 screener (Natus Medical Inc, Foster City, CA) which is a modified auditory brain stem evoked response (ABR). Our screening of this population led to an 11% incidence of referral for complete audiological evaluation. There were no significant complications. Forty-eight infants were found to have nonspecified, sensorineural, or conductive hearing loss. The positive predictive value of the test was 96%. Therefore, we feel that the use of the modified ABR in the newborn is a timely, cost efficient method of screening for hearing loss and should be used for mass screening of all newborns.

  6. Advanced Pacemaker

    Science.gov (United States)

    1990-01-01

    Synchrony, developed by St. Jude Medical's Cardiac Rhythm Management Division (formerly known as Pacesetter Systems, Inc.) is an advanced state-of-the-art implantable pacemaker that closely matches the natural rhythm of the heart. The companion element of the Synchrony Pacemaker System is the Programmer Analyzer APS-II which allows a doctor to reprogram and fine tune the pacemaker to each user's special requirements without surgery. The two-way communications capability that allows the physician to instruct and query the pacemaker is accomplished by bidirectional telemetry. APS-II features 28 pacing functions and thousands of programming combinations to accommodate diverse lifestyles. Microprocessor unit also records and stores pertinent patient data up to a year.

  7. Pharmacological screening technologies for venom peptide discovery.

    Science.gov (United States)

    Prashanth, Jutty Rajan; Hasaballah, Nojod; Vetter, Irina

    2017-12-01

    Venomous animals occupy one of the most successful evolutionary niches and occur on nearly every continent. They deliver venoms via biting and stinging apparatuses with the aim to rapidly incapacitate prey and deter predators. This has led to the evolution of venom components that act at a number of biological targets - including ion channels, G-protein coupled receptors, transporters and enzymes - with exquisite selectivity and potency, making venom-derived components attractive pharmacological tool compounds and drug leads. In recent years, plate-based pharmacological screening approaches have been introduced to accelerate venom-derived drug discovery. A range of assays are amenable to this purpose, including high-throughput electrophysiology, fluorescence-based functional and binding assays. However, despite these technological advances, the traditional activity-guided fractionation approach is time-consuming and resource-intensive. The combination of screening techniques suitable for miniaturization with sequence-based discovery approaches - supported by advanced proteomics, mass spectrometry, chromatography as well as synthesis and expression techniques - promises to further improve venom peptide discovery. Here, we discuss practical aspects of establishing a pipeline for venom peptide drug discovery with a particular emphasis on pharmacology and pharmacological screening approaches. This article is part of the Special Issue entitled 'Venom-derived Peptides as Pharmacological Tools.' Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. High content screening in microfluidic devices

    Science.gov (United States)

    Cheong, Raymond; Paliwal, Saurabh; Levchenko, Andre

    2011-01-01

    Importance of the field Miniaturization is key to advancing the state-of-the-art in high content screening (HCS), in order to enable dramatic cost savings through reduced usage of expensive biochemical reagents and to enable large-scale screening on primary cells. Microfluidic technology offers the potential to enable HCS to be performed with an unprecedented degree of miniaturization. Areas covered in this review This perspective highlights a real-world example from the authors’ work of HCS assays implemented in a highly miniaturized microfluidic format. Advantages of this technology are discussed, including cost savings, high throughput screening on primary cells, improved accuracy, the ability to study complex time-varying stimuli, and ease of automation, integration, and scaling. What the reader will gain The reader will understand the capabilities of a new microfluidics-based platform for HCS, and the advantages it provides over conventional plate-based HCS. Take home message Microfluidics technology will drive significant advancements and broader usage and applicability of HCS in drug discovery. PMID:21852997

  9. Maximizing gain in high-throughput screening using conformal prediction.

    Science.gov (United States)

    Svensson, Fredrik; Afzal, Avid M; Norinder, Ulf; Bender, Andreas

    2018-02-21

    Iterative screening has emerged as a promising approach to increase the efficiency of screening campaigns compared to traditional high throughput approaches. By learning from a subset of the compound library, inferences on what compounds to screen next can be made by predictive models, resulting in more efficient screening. One way to evaluate screening is to consider the cost of screening compared to the gain associated with finding an active compound. In this work, we introduce a conformal predictor coupled with a gain-cost function with the aim to maximise gain in iterative screening. Using this setup we were able to show that by evaluating the predictions on the training data, very accurate predictions on what settings will produce the highest gain on the test data can be made. We evaluate the approach on 12 bioactivity datasets from PubChem training the models using 20% of the data. Depending on the settings of the gain-cost function, the settings generating the maximum gain were accurately identified in 8-10 out of the 12 datasets. Broadly, our approach can predict what strategy generates the highest gain based on the results of the cost-gain evaluation: to screen the compounds predicted to be active, to screen all the remaining data, or not to screen any additional compounds. When the algorithm indicates that the predicted active compounds should be screened, our approach also indicates what confidence level to apply in order to maximize gain. Hence, our approach facilitates decision-making and allocation of the resources where they deliver the most value by indicating in advance the likely outcome of a screening campaign.

  10. A note on the catch-up time method for estimating lead or sojourn time in prostate cancer screening

    NARCIS (Netherlands)

    G. Draisma (Gerrit); J.M. van Rosmalen (Joost)

    2013-01-01

    textabstractModels of cancer screening assume that cancers are detectable by screening before being diagnosed clinically through symptoms. The duration of this preclinical phase is called sojourn time, and it determines how much diagnosis might be advanced in time by the screening test (lead time).

  11. Screening for oral cancer.

    Science.gov (United States)

    Jitender, Solanki; Sarika, Gupta; Varada, Hiremath R; Omprakash, Yadav; Mohsin, Khan

    2016-11-01

    Oral cancer is considered as a serious health problem resulting in high morbidity and mortality. Early detection and prevention play a key role in controlling the burden of oral cancer worldwide. The five-year survival rate of oral cancer still remains low and delayed diagnosis is considered as one of the major reasons. This increases the demand for oral screening. Currently, screening of oral cancer is largely based on visual examination. Various evidence strongly suggest the validity of visual inspection in reducing mortality in patients at risk for oral cancer. Simple visual examination is accompanied with adjunctive techniques for subjective interpretation of dysplastic changes. These include toluidine blue staining, brush biopsy, chemiluminescence and tissue autofluorescence. This review highlights the efficacy of various diagnostic methods in screening of oral cancer. © 2016 Old City Publishing, Inc.

  12. Radiographic intensifying screens

    International Nuclear Information System (INIS)

    Van Landeghem, W.K.; Suys, A.R.

    1979-01-01

    A fluorescent x-ray image intensifying screen is described which comprises discrete particles of fluorescent material dispersed in a binder layer. Intensifying screens are employed to increase the exposure of a photosensitive plate or film without increasing the x-ray exposure dose when struck by x-rays. The screen has an outermost layer containing solid particulate material protruding from a coherent film-forming organic binder medium and having a static friction coefficient at room temperature not higher than 0.50 on steel. The outermost layer may be characterized by micro-unevennesses of at least 3 μm and at least 9 protruding particles per 0.35 sq. cm. These particles have a static friction coefficient less than 0.3 and are made of a solid polystyrene, polyaklylene and/or a solid organic fluorinated polymer. (JTA)

  13. Screening Risk Evaluation methodology

    International Nuclear Information System (INIS)

    Hopper, K.M.

    1994-01-01

    The Screening Risk Evaluation (SRE) Guidance document is a set of guidelines provided for the uniform implementation of SREs performed on D ampersand D facilities. These guidelines are designed specifically for the completion of the second (semi-quantitative screening) phase of the D ampersand D Risk-Based Process. The SRE Guidance produces screening risk scores reflecting levels of risk through the use of risk ranking indices. Five types of possible risk are calculated from the SRE: current releases, worker exposures, future releases, physical hazards, and criticality. The Current Release Index (CRI) calculates the risk to human health and the environment from ongoing or probable releases within a one year time period. The Worker Exposure Index (WEI) calculates the risk to workers, occupants, and visitors in D ampersand D facilities of contaminant exposure. The Future Release Index (FRI) calculates the risk of future releases of contaminants, after one year, to human health and the environment. The Physical Hazards Index (PHI) calculates the risk-to human health due to factors other than that of contaminants. The index of Criticality is approached as a modifying factor to the entire SRE, due to the fact that criticality issues are strictly regulated under DOE. Screening risk results will be tabulated in matrix form and Total Risk will be calculated (weighted equation) to produce a score on which to base early action recommendations. Other recommendations from the screening risk scores will be made based either on individual index scores or from reweighted Total Risk calculations. All recommendations based on the SRE will be made based on a combination of screening risk scores, decision drivers, and other considerations, determined on a project by project basis. The SRE is the first and most important step in the overall D ampersand D project level decision making process

  14. Newborn screening for galactosaemia.

    Science.gov (United States)

    Lak, Rohollah; Yazdizadeh, Bahareh; Davari, Majid; Nouhi, Mojtaba; Kelishadi, Roya

    2017-12-23

    Classical galactosaemia is an autosomal recessive inborn error of metabolism caused by a deficiency of the enzyme galactose-1-phosphate uridyltransferase. This is a rare and potentially lethal condition that classically presents in the first week of life once milk feeds have commenced. Affected babies may present with any or all of the following: cataracts; fulminant liver failure; prolonged jaundice; or Escherichia coli sepsis. Once the diagnosis is suspected, feeds containing galactose must be stopped immediately and replaced with a soya-based formula. The majority of babies will recover, however a number will not survive. There are long-term complications of galactosaemia, despite treatment, including learning disabilities and female infertility. It has been postulated that galactosaemia could be detected on newborn screening and this would prevent the immediate severe liver dysfunction and sepsis. To assess whether there is evidence that newborn screening for galactosaemia prevents or reduces mortality and morbidity and improves clinical outcomes in affected neonates and the quality of life in older children. We searched the Cochrane Cystic Fibrosis and Genetic Disorders Group Trials Register comprising references identified from electronic database searches, handsearches of relevant journals and conference abstract books. We also searched online trials registries and the reference lists of relevant articles and reviews.Date of the most recent search of Cochrane Cystic Fibrosis Group's Trials Register: 18 December 2017.Date of the most recent search of additional resources: 11 October 2017. Randomised controlled studies and controlled clinical studies, published or unpublished comparing the use of any newborn screening test to diagnose infants with galactosaemia and presenting a comparison between a screened population versus a non-screened population. No studies of newborn screening for galactosaemia were found. No studies were identified for inclusion in the

  15. Colorectal cancer screening

    OpenAIRE

    McLoughlin, Monica Ramona

    2008-01-01

    Colorectal cancer is a major public health burden and is the most common cause of mortality from cancer in Europe. Over the last two decades robust evidence from randomised clinical trials and case-control series have confirmed that the mortality from colorectal cancer can be reduced by screening. The challenge over the next decade is how to implement this in clinical practice. This is what we set out to answer with this thesis. Not all individuals are equal when it comes to screening and tho...

  16. Lunar Dust Mitigation Screens

    Science.gov (United States)

    Knutson, Shawn; Holloway, Nancy

    With plans for the United States to return to the moon, and establish a sustainable human presence on the lunar surface many issues must be successfully overcome. Lunar dust is one of a number of issues with the potential to create a myriad of problems if not adequately addressed. Samples of dust brought back from Apollo missions show it to be soft, yet sharp and abrasive. The dust consists of a variety of morphologies including spherical, angular blocks, shards, and a number of irregular shapes. One of the main issues with lunar dust is its attraction to stick to anything it comes in contact with (i.e. astronauts, equipment, habitats, etc.). Ionized radiation from the sun strikes the moon's surface and creates an electrostatic charge on the dust. Further, the dust harbors van der Waals forces making it especially difficult to separate once it sticks to a surface. During the Apollo missions, it was discovered that trying to brush the lunar dust from spacesuits was not effective, and rubbing it caused degradation of the suit material. Further, when entering the lunar module after moonwalks, the astronauts noted that the dust was so prolific inside the cabin that they inhaled and ingested it, causing at least one of them, Harrison "Jack" Schmidt, to report irritation of the throat and lungs. It is speculated that the dust could also harm an astronaut's nervous and cardiovascular systems, especially during an extended stay. In addition to health issues, the dust can also cause problems by scouring reflective coatings off of thermal blankets, and roughening surfaces of windows and optics. Further, panels on solar cells and photovoltaics can also be compromised due to dust sticking on the surfaces. Lunar dust has the capacity to penetrate seals, interfere with connectors, as well as mechanisms on digging machines, all of which can lead to problems and failure. To address lunar dust issues, development of electrostatic screens to mitigate dust on sur-faces is currently

  17. Staged anticonvulsant screening for chronic epilepsy.

    Science.gov (United States)

    Berdichevsky, Yevgeny; Saponjian, Yero; Park, Kyung-Il; Roach, Bonnie; Pouliot, Wendy; Lu, Kimberly; Swiercz, Waldemar; Dudek, F Edward; Staley, Kevin J

    2016-12-01

    Current anticonvulsant screening programs are based on seizures evoked in normal animals. One-third of epileptic patients do not respond to the anticonvulsants discovered with these models. We evaluated a tiered program based on chronic epilepsy and spontaneous seizures, with compounds advancing from high-throughput in vitro models to low-throughput in vivo models. Epileptogenesis in organotypic hippocampal slice cultures was quantified by lactate production and lactate dehydrogenase release into culture media as rapid assays for seizure-like activity and cell death, respectively. Compounds that reduced these biochemical measures were retested with in vitro electrophysiological confirmation (i.e., second stage). The third stage involved crossover testing in the kainate model of chronic epilepsy, with blinded analysis of spontaneous seizures after continuous electrographic recordings. We screened 407 compound-concentration combinations. The cyclooxygenase inhibitor, celecoxib, had no effect on seizures evoked in normal brain tissue but demonstrated robust antiseizure activity in all tested models of chronic epilepsy. The use of organotypic hippocampal cultures, where epileptogenesis occurs on a compressed time scale, and where seizure-like activity and seizure-induced cell death can be easily quantified with biomarker assays, allowed us to circumvent the throughput limitations of in vivo chronic epilepsy models. Ability to rapidly screen compounds in a chronic model of epilepsy allowed us to find an anticonvulsant that would be missed by screening in acute models.

  18. Fecal Molecular Markers for Colorectal Cancer Screening

    Directory of Open Access Journals (Sweden)

    Rani Kanthan

    2012-01-01

    Full Text Available Despite multiple screening techniques, including colonoscopy, flexible sigmoidoscopy, radiological imaging, and fecal occult blood testing, colorectal cancer remains a leading cause of death. As these techniques improve, their sensitivity to detect malignant lesions is increasing; however, detection of precursor lesions remains problematic and has generated a lack of general acceptance for their widespread usage. Early detection by an accurate, noninvasive, cost-effective, simple-to-use screening technique is central to decreasing the incidence and mortality of this disease. Recent advances in the development of molecular markers in faecal specimens are encouraging for its use as a screening tool. Genetic mutations and epigenetic alterations that result from the carcinogenetic process can be detected by coprocytobiology in the colonocytes exfoliated from the lesion into the fecal matter. These markers have shown promising sensitivity and specificity in the detection of both malignant and premalignant lesions and are gaining popularity as a noninvasive technique that is representative of the entire colon. In this paper, we summarize the genetic and epigenetic fecal molecular markers that have been identified as potential targets in the screening of colorectal cancer.

  19. Approaches to virtual screening and screening library selection.

    Science.gov (United States)

    Wildman, Scott A

    2013-01-01

    The ease of access to virtual screening (VS) software in recent years has resulted in a large increase in literature reports. Over 300 publications in the last year report the use of virtual screening techniques to identify new chemical matter or present the development of new virtual screening techniques. The increased use is accompanied by a corresponding increase in misuse and misinterpretation of virtual screening results. This review aims to identify many of the common difficulties associated with virtual screening and allow researchers to better assess the reliability of their virtual screening effort.

  20. An experimental investigation of head loss through a triangular “V- shaped” screen

    Directory of Open Access Journals (Sweden)

    Mahmoud Zayed

    2018-03-01

    Full Text Available Common traditional screens (screens perpendicular and vertical to the flow direction face extensive problems with screen blockage, which can result in adverse hydraulic, environmental, and economic consequences. Experimentally, this paper presents an advanced trash screen concept to reduce traditional screen problems and improve the hydraulic performance of screens. The traditional screen is re-developed using a triangular V shape with circular bars in the flow direction. Triangular V-shaped screen models with different angles, blockage ratios, circular bar designs, and flow discharges were tested in a scaled physical model. The analyses provide promising results. The findings showed that the head loss coefficients were effectively reduced by using the triangular V-shaped screens with circular bars (α < 90° in comparison with the traditional trash screen (α = 90. Additionally, the results indicated that the head loss across the screen increased with increasing flow discharge and blockage ratio. The losses considerably increase by large percentages when the screen becomes blocked by 40%. Low head losses were recorded at low screen angles for the circular bars. A new head loss equation is recommended for triangular screens with circular bars.

  1. Advanced Energy Validated Photovoltaic Inverter Technology at NREL | Energy

    Science.gov (United States)

    Inverter Technology at NREL Advanced Energy Industries-NREL's first partner at the Energy Systems Integration Facility (ESIF)-validated its advanced photovoltaic (PV) inverter technology using the ESIF's computer screen in a laboratory, with power inverter hardware in the background Photo by Dennis Schroeder

  2. Screening for Atrial Fibrillation

    DEFF Research Database (Denmark)

    Freedman, Ben; Camm, John; Calkins, Hugh

    2017-01-01

    Approximately 10% of ischemic strokes are associated with atrial fibrillation (AF) first diagnosed at the time of stroke. Detecting asymptomatic AF would provide an opportunity to prevent these strokes by instituting appropriate anticoagulation. The AF-SCREEN international collaboration was formed...

  3. Early Dementia Screening

    Directory of Open Access Journals (Sweden)

    Peter K. Panegyres

    2016-01-01

    Full Text Available As the population of the world increases, there will be larger numbers of people with dementia and an emerging need for prompt diagnosis and treatment. Early dementia screening is the process by which a patient who might be in the prodromal phases of a dementing illness is determined as having, or not having, the hallmarks of a neurodegenerative condition. The concepts of mild cognitive impairment, or mild neurocognitive disorder, are useful in analyzing the patient in the prodromal phase of a dementing disease; however, the transformation to dementia may be as low as 10% per annum. The search for early dementia requires a comprehensive clinical evaluation, cognitive assessment, determination of functional status, corroborative history and imaging (including MRI, FDG-PET and maybe amyloid PET, cerebrospinal fluid (CSF examination assaying Aβ1–42, T-τ and P-τ might also be helpful. Primary care physicians are fundamental in the screening process and are vital in initiating specialist investigation and treatment. Early dementia screening is especially important in an age where there is a search for disease modifying therapies, where there is mounting evidence that treatment, if given early, might influence the natural history—hence the need for cost-effective screening measures for early dementia.

  4. Hazard screening application guide

    International Nuclear Information System (INIS)

    1992-06-01

    The basic purpose of hazard screening is to group precesses, facilities, and proposed modifications according to the magnitude of their hazards so as to determine the need for and extent of follow on safety analysis. A hazard is defined as a material, energy source, or operation that has the potential to cause injury or illness in human beings. The purpose of this document is to give guidance and provide standard methods for performing hazard screening. Hazard screening is applied to new and existing facilities and processes as well as to proposed modifications to existing facilities and processes. The hazard screening process evaluates an identified hazards in terms of the effects on people, both on-site and off-site. The process uses bounding analyses with no credit given for mitigation of an accident with the exception of certain containers meeting DOT specifications. The process is restricted to human safety issues only. Environmental effects are addressed by the environmental program. Interfaces with environmental organizations will be established in order to share information

  5. Radiological protective screen

    International Nuclear Information System (INIS)

    Flaugnatti, R.B.

    1976-01-01

    A radiological screen for placing on a patient's skin is discussed, comprising a flat jacket containing a fine particulate filler and a settable resin binder, the fine particulate filler being of a material which absorbs medical radiation, and the jacket including a window to transmit such radiation through the flat jacket. 16 claims, 4 drawing figures

  6. Screening Devices at School

    DEFF Research Database (Denmark)

    Ratner, Helene Gad

    2011-01-01

    ethnographic data from a Danish school, the article explores,first, the script and agencement of the SMTTE and, second, how the screening properties of the SMTTE are achieved, including how these properties challenge management-­‐teacher relations when the SMTTE travels to other networks at the school...

  7. Colorec tal cancer screening

    African Journals Online (AJOL)

    2009-05-12

    May 12, 2009 ... The operator must be skilled in the management of adverse events. • The operator must arrange appropriate follow-up of histopathological results. • The operator must provide appropriate recommendations for follow-up surveil- lance and screening. The average- risk person has a lifetime risk of developing.

  8. [ASCUS in screening].

    Science.gov (United States)

    Caprara, L; Monari, F; De Bianchi, P S; Amadori, A; Bondi, A

    2001-12-01

    The significance and use of the cytological diagnosis "atypical squamous cells of undetermined significance" (ASCUS) remain a major problem in cervical cancer screening. The prevalence of ASCUS by patient age has seldom been investigated. The present paper reports the prevalence of ASCUS in a large series of screening Pap smears from the Italian region of Emilia-Romagna. The study was based on the data collected by the Department of Health of the Emilia-Romagna Region for the first 3-year round (1997-1999) of a population-based screening programme (target age, 25-64 years). The age-specific frequency of ASCUS has been calculated as a prevalence rate per 1000 screened patients. A total of 597,386 women participated in the programme. Women diagnosed with ASCUS (n = 8205 or 13.7 per 1000) accounted for 49% of the recalls for colposcopy (n = 16,871, or 28.2 per 1000). The prevalence of diagnoses of low-grade squamous intraepithelial lesions (LG-SIL) decreased progressively with age while that of high-grade SIL was slightly higher between 30 and 39 years. The prevalence of ASCUS peaked at age 45-49 years (17.3 per 1000 subjects). The observed peak reflects the prevalence of (1) cytological changes closely associated with perimenopausal age and at least compatible with the ASCUS diagnosis, and (2) cytological abnormalities induced by hormone replacement therapy.

  9. Screening for lung cancer

    DEFF Research Database (Denmark)

    Infante, Maurizio V; Pedersen, Jesper H

    2010-01-01

    In lung cancer screening with low-dose spiral computed tomography (LDCT), the proportion of stage I disease is 50-85%, and the survival rate for resected stage I disease can exceed 90%, but proof of real benefit in terms of lung cancer mortality reduction must come from the several randomized...

  10. Screening for asbestbetingede sygdomme?

    DEFF Research Database (Denmark)

    Brauer, Charlotte; Baandrup, Ulrik; Jacobsen, Peter

    2009-01-01

    in asbestos-exposed populations. Data do not currently support implementation of screening programs for asbestos-exposed persons in Denmark. Since mesothelioma is most often an occupational disease, these patients should be admitted to an occupational clinic for aetiological evaluation. Udgivelsesdato: 2009...

  11. Engineering aspects of Passavant screening

    International Nuclear Information System (INIS)

    Siddle, K.R.; Sharma, R.K.

    1978-01-01

    The Passavant screen was developed in Europe almost 30 years ago. The Passavant screen is a vertical traveling screen; however, the basic difference between the conventional vertical traveling screen and the Passavant screen is that in the conventional screen water passes through the front screen belt and then the back screen belt, whereas in the Passavant screen the water enters in between the two belts and passes laterally through either of the belts. Thus, theoretically, the screening surface of the Passavant screen is doubled as compared to the same size conventional vertical traveling screen. Various design and operational modifications of the Passavant screen are possible to yield optimum design and performance characteristics which make it amenable to installation at power plants for safe removal of not only fish but also smaller organisms such as fish eggs and larvae. In this paper, details of the screen design and operational characteristics are discussed with notes on how these features can be modified to suit site- and organism-specific requirements

  12. Do doctors understand the test characteristics of lung cancer screening?

    Science.gov (United States)

    Schmidt, Richard; Breyer, Marie; Breyer-Kohansal, Robab; Urban, Matthias; Funk, Georg-Christian

    2018-04-01

    Screening for lung cancer with a low-dose computed tomography (CT) scan is estimated to prevent 3 deaths per 1000 individuals at high risk; however, false positive results and radiation exposure are relevant harms and deserve careful consideration. Screening candidates can only make an autonomous decision if doctors correctly inform them of the pros and cons of the method; therefore, this study aimed to evaluate whether doctors understand the test characteristics of lung cancer screening. In a randomized trial 556 doctors (members of the Austrian Respiratory Society) were invited to answer questions regarding lung cancer screening based on online case vignettes. Half of the participants were randomized to the group 'solutions provided' and received the correct solutions in advance. The group 'solutions withheld' had to rely on prior knowledge or estimates. The primary endpoint was the between-group difference in the estimated number of deaths preventable by screening. Secondary endpoints were the between-group differences in the prevalence of lung cancer, prevalence of a positive screening results, sensitivity, specificity, positive predictive value, and false negative rate. Estimations were also compared with current data from the literature. The response rate was 29% in both groups. The reduction in the number of deaths due to screening was overestimated six-fold (95% confidence interval CI: 4-8) compared with the actual data, and there was no effect of group allocation. Providing the correct solutions to doctors had no systematic effect on their answers. Doctors poorly understand the test characteristics of lung cancer screening. Providing the correct solutions in advance did not improve the answers. Continuing education regarding lung cancer screening and the interpretation of test characteristics may be a simple remedy. Clinical trial registered with www.clinicaltrials.gov (NCT02542332).

  13. A multi-infrastructure gateway for virtual drug screening

    NARCIS (Netherlands)

    Jaghoori, Mohammad Mahdi; van Altena, Allard J.; Bleijlevens, Boris; Ramezani, Sara; Font, Juan Luis; Olabarriaga, Silvia D.

    2015-01-01

    In computer-aided drug design, software tools are used to narrow down possible drug candidates, thereby reducing the amount of expensive in vitro research, by a process called virtual screening. This process includes large computations that require advanced computing infrastructure; however, using

  14. Screening for chlamydial infection.

    Science.gov (United States)

    Nelson, H D; Helfand, M

    2001-04-01

    To examine data on the effectiveness of screening for chlamydial infection by a physician or other health care professional. Specifically, we examine the evidence that early treatment of chlamydial infection improves health outcomes, as well as evidence of the effectiveness of screening strategies in nonpregnant women, pregnant women, and men, and the accuracy of tests used for screening. This review updates the literature since the last recommendation of the U.S. Preventive Services Task Force published in 1996. We searched the topic of chlamydia in the MEDLINE, HealthSTAR, and Cochrane Library databases from January 1994 to July 2000, supplemented by reference lists of relevant articles and from experts in the field. Articles published prior to 1994 and research abstracts were cited if particularly important to the key questions or to the interpretation of included articles. A single reader reviewed all English abstracts. Articles were selected for full review if they were about Chlamydia trachomatis genitourinary infections in nonpregnant women, pregnant women, or men and were relevant to key questions in the analytic framework. Investigators read the full-text version of the retrieved articles and applied additional eligibility criteria. For all topics, we excluded articles if they did not provide sufficient information to determine the methods for selecting subjects and for analyzing data. We systematically reviewed three types of studies about screening in nonpregnant women that relate to three key questions: (1) studies about the effectiveness of screening programs in reducing prevalence rates of infection, (2) studies about risk factors for chlamydial infection in women, and (3) studies about chlamydial screening tests in women. Our search found too few studies on pregnant women to systematically review, although pertinent studies are described. We systematically reviewed two types of studies about screening in men: (1) studies about prevalence rates and

  15. Breast Cancer Screening in Denmark: A Cohort Study of Tumor Size and Overdiagnosis.

    Science.gov (United States)

    Jørgensen, Karsten Juhl; Gøtzsche, Peter C; Kalager, Mette; Zahl, Per-Henrik

    2017-03-07

    Effective breast cancer screening should detect early-stage cancer and prevent advanced disease. To assess the association between screening and the size of detected tumors and to estimate overdiagnosis (detection of tumors that would not become clinically relevant). Cohort study. Denmark from 1980 to 2010. Women aged 35 to 84 years. Screening programs offering biennial mammography for women aged 50 to 69 years beginning in different regions at different times. Trends in the incidence of advanced (>20 mm) and nonadvanced (≤20 mm) breast cancer tumors in screened and nonscreened women were measured. Two approaches were used to estimate the amount of overdiagnosis: comparing the incidence of advanced and nonadvanced tumors among women aged 50 to 84 years in screening and nonscreening areas; and comparing the incidence for nonadvanced tumors among women aged 35 to 49, 50 to 69, and 70 to 84 years in screening and nonscreening areas. Screening was not associated with lower incidence of advanced tumors. The incidence of nonadvanced tumors increased in the screening versus prescreening periods (incidence rate ratio, 1.49 [95% CI, 1.43 to 1.54]). The first estimation approach found that 271 invasive breast cancer tumors and 179 ductal carcinoma in situ (DCIS) lesions were overdiagnosed in 2010 (overdiagnosis rate of 24.4% [including DCIS] and 14.7% [excluding DCIS]). The second approach, which accounted for regional differences in women younger than the screening age, found that 711 invasive tumors and 180 cases of DCIS were overdiagnosed in 2010 (overdiagnosis rate of 48.3% [including DCIS] and 38.6% [excluding DCIS]). Regional differences complicate interpretation. Breast cancer screening was not associated with a reduction in the incidence of advanced cancer. It is likely that 1 in every 3 invasive tumors and cases of DCIS diagnosed in women offered screening represent overdiagnosis (incidence increase of 48.3%). None.

  16. Radon screening for XENON1T

    Energy Technology Data Exchange (ETDEWEB)

    Lindemann, Sebastian [Max-Planck-Institut fuer Kernphysik, Heidelberg (Germany)

    2015-07-01

    Radon with its isotope {sup 222}Rn is one of the dominant sources of internal background in liquid xenon detectors searching for low energetic rare events like WIMP-nucleon scattering. In my talk I briefly review the problem posed by {sup 222}Rn and motivate the screening strategy followed by XENON1T. I introduce the radon emanation technique making use of ultra low background proportional counters and present selected results obtained during the design and construction phases of XENON1T. Finally, I sketch advances in radon emanation assay techniques and give a short outlook on upcoming measurements.

  17. Screening for Chronic Kidney Disease

    Science.gov (United States)

    Understanding Task Force Recommendations Screening for Chronic Kidney Disease The U.S. Preventive Services Task Force (Task Force) has issued a final recommendation on Screening for Chronic Kidney Disease (CKD) . This recommendation ...

  18. Glucose screening tests during pregnancy

    Science.gov (United States)

    Oral glucose tolerance test - pregnancy; OGTT - pregnancy; Glucose challenge test - pregnancy; Gestational diabetes - glucose screening ... screening test between 24 and 28 weeks of pregnancy. The test may be done earlier if you ...

  19. Risks of Endometrial Cancer Screening

    Science.gov (United States)

    ... Health history and certain medicines can affect the risk of developing endometrial cancer. Anything that increases your ... have abnormal vaginal bleeding, check with your doctor. Risks of Endometrial Cancer Screening Key Points Screening tests ...

  20. Risks of Esophageal Cancer Screening

    Science.gov (United States)

    ... alcohol use, and Barrett esophagus can affect the risk of developing esophageal cancer. Anything that increases the ... tissue gives off less light than normal tissue. Risks of Esophageal Cancer Screening Key Points Screening tests ...

  1. Risks of Cervical Cancer Screening

    Science.gov (United States)

    ... women. Human papillomavirus (HPV) infection is the major risk factor for cervical cancer. Although most women with ... clinical trials is available from the NCI website . Risks of Cervical Cancer Screening Key Points Screening tests ...

  2. Mammographic screening programmes in Europe

    DEFF Research Database (Denmark)

    Giordano, Livia; von Karsa, Lawrence; Tomatis, Mariano

    2012-01-01

    To summarize participation and coverage rates in population mammographic screening programmes for breast cancer in Europe.......To summarize participation and coverage rates in population mammographic screening programmes for breast cancer in Europe....

  3. Detection of lung cancer through low-dose CT screening (NELSON): a prespecified analysis of screening test performance and interval cancers.

    Science.gov (United States)

    Horeweg, Nanda; Scholten, Ernst Th; de Jong, Pim A; van der Aalst, Carlijn M; Weenink, Carla; Lammers, Jan-Willem J; Nackaerts, Kristiaan; Vliegenthart, Rozemarijn; ten Haaf, Kevin; Yousaf-Khan, Uraujh A; Heuvelmans, Marjolein A; Thunnissen, Erik; Oudkerk, Matthijs; Mali, Willem; de Koning, Harry J

    2014-11-01

    median follow-up of 8·16 years (IQR 7·56-8·56). 187 (3%) of 7155 screened participants were diagnosed with 196 screen-detected lung cancers, and another 34 (advanced stages (29 [83%] of 35 interval cancers vs 44 [22%] of 196 screen-detected cancers diagnosed in stage III or IV; pNELSON trial yielded high specificity and sensitivity, with only a small number of interval cancers. The results of this study could be used to improve screening algorithms, and reduce the number of missed cancers. Zorgonderzoek Nederland Medische Wetenschappen and Koningin Wilhelmina Fonds. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. Relation between breast cancer mortality and screening effectiveness: systematic review of the mammography trials

    DEFF Research Database (Denmark)

    Gøtzsche, Peter C

    2011-01-01

    The mammography screening trials have shown varying results. This could be because screening was better in some trials than in others at advancing the time of diagnosis. If so, more cancers would be identified in such trials relative to the control group, and fewer of the cancers would have reach...

  5. Exploring Urban Screens

    Directory of Open Access Journals (Sweden)

    Zlatan Krajina

    2009-12-01

    Full Text Available There is a tautological tendency in the widespread claims that urban space is 'me-diated'. Never before has the citizen, it is argued, been confronted with such an unprecedented array of signage. I depart from the rhetoric of 'biggest-ever-saturation' as not necessarily untrue, but as insufficient in exploring the diverse spatial operations of urban screens. I examine some contemporary cases of ani-mated architectural surfaces, informational panels, and advertising billboards, with reference to much longer standing cultural practices of spatial management in modern cities, such as illumination, to suggest that the contemporary display media do not mediate the city anew but re-invent urban space as a field of ubiqui-tous mediation. From that standpoint I suggest exploring urban screens as a both singular visual agents and indivisible items in plural structural assemblages, b complementary forces of public illumination, and c complex perceptual platforms in visual play of scale and distance.

  6. An experience of qualified preventive screening: shiraz smart screening software.

    Science.gov (United States)

    Islami Parkoohi, Parisa; Zare, Hashem; Abdollahifard, Gholamreza

    2015-01-01

    Computerized preventive screening software is a cost effective intervention tool to address non-communicable chronic diseases. Shiraz Smart Screening Software (SSSS) was developed as an innovative tool for qualified screening. It allows simultaneous smart screening of several high-burden chronic diseases and supports reminder notification functionality. The extent in which SSSS affects screening quality is also described. Following software development, preventive screening and annual health examinations of 261 school staff (Medical School of Shiraz, Iran) was carried out in a software-assisted manner. To evaluate the quality of the software-assisted screening, we used quasi-experimental study design and determined coverage, irregular attendance and inappropriateness proportions in relation with the manual and software-assisted screening as well as the corresponding number of requested tests. In manual screening method, 27% of employees were covered (with 94% irregular attendance) while by software-assisted screening, the coverage proportion was 79% (attendance status will clear after the specified time). The frequency of inappropriate screening test requests, before the software implementation, was 41.37% for fasting plasma glucose, 41.37% for lipid profile, 0.84% for occult blood, 0.19% for flexible sigmoidoscopy/colonoscopy, 35.29% for Pap smear, 19.20% for mammography and 11.2% for prostate specific antigen. All of the above were corrected by the software application. In total, 366 manual screening and 334 software-assisted screening tests were requested. SSSS is an innovative tool to improve the quality of preventive screening plans in terms of increased screening coverage, reduction in inappropriateness and the total number of requested tests.

  7. Ellipticity Weakens Chameleon Screening

    OpenAIRE

    Burrage, Clare; Copeland, Edmund J.; Stevenson, James

    2014-01-01

    The chameleon mechanism enables a long range fifth force to be screened in dense environments when non-trivial self interactions of the field cause its mass to increase with the local density. To date, chameleon fifth forces have mainly been studied for spherically symmetric sources, however the non-linear self interactions mean that the chameleon responds to changes in the shape of the source differently to gravity. In this work we focus on ellipsoidal departures from spherical symmetry and ...

  8. New generation expandable sand screens

    OpenAIRE

    Syltøy, Christer

    2014-01-01

    Master's thesis in Petroleum engineering This thesis aims to give a general insight into sand control and various sorts of sand control measures and applications of sand control tools. Special focus will be given to expandable sand screens – a technology which came about in the late 1990’s through the use of flexible, expandable tubulars as base pipe in sand screens. More specifically Darcy’s Hydraulic Endurance Screens, a compliant sand screen system using hydraulic activation, and the fu...

  9. An updated Asia Pacific Consensus Recommendations on colorectal cancer screening.

    Science.gov (United States)

    Sung, J J Y; Ng, S C; Chan, F K L; Chiu, H M; Kim, H S; Matsuda, T; Ng, S S M; Lau, J Y W; Zheng, S; Adler, S; Reddy, N; Yeoh, K G; Tsoi, K K F; Ching, J Y L; Kuipers, E J; Rabeneck, L; Young, G P; Steele, R J; Lieberman, D; Goh, K L

    2015-01-01

    Since the publication of the first Asia Pacific Consensus on Colorectal Cancer (CRC) in 2008, there are substantial advancements in the science and experience of implementing CRC screening. The Asia Pacific Working Group aimed to provide an updated set of consensus recommendations. Members from 14 Asian regions gathered to seek consensus using other national and international guidelines, and recent relevant literature published from 2008 to 2013. A modified Delphi process was adopted to develop the statements. Age range for CRC screening is defined as 50-75 years. Advancing age, male, family history of CRC, smoking and obesity are confirmed risk factors for CRC and advanced neoplasia. A risk-stratified scoring system is recommended for selecting high-risk patients for colonoscopy. Quantitative faecal immunochemical test (FIT) instead of guaiac-based faecal occult blood test (gFOBT) is preferred for average-risk subjects. Ancillary methods in colonoscopy, with the exception of chromoendoscopy, have not proven to be superior to high-definition white light endoscopy in identifying adenoma. Quality of colonoscopy should be upheld and quality assurance programme should be in place to audit every aspects of CRC screening. Serrated adenoma is recognised as a risk for interval cancer. There is no consensus on the recruitment of trained endoscopy nurses for CRC screening. Based on recent data on CRC screening, an updated list of recommendations on CRC screening is prepared. These consensus statements will further enhance the implementation of CRC screening in the Asia Pacific region. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  10. SCREENING FOR PERSONALITY DISORDERS

    Science.gov (United States)

    Morse, Jennifer Q.; Pilkonis, Paul A.

    2010-01-01

    A brief but valid self-report measure to screen for personality disorders (PDs) would be a valuable tool in making decisions about further assessment and in planning optimal treatments. In psychiatric and nonpsychiatric samples, we compared the validity of three screening measures: the PD scales from the Inventory of Interpersonal Problems, a self-report version of the Iowa Personality Disorder Screen, and the self-directedness scale of the Temperament and Character Inventory. Despite their different theoretical origins, the screeners were highly correlated in a range from .71 to .77. As a result, the use of multiple screeners was not a significant improvement over any individual screener, and no single screener stood out as clearly superior to the others. Each performed modestly in predicting the presence of any PD diagnosis in both the psychiatric and nonpsychiatric groups. Performance was best when predicting a more severe PD diagnosis in the psychiatric sample. The results also highlight the potential value of multiple assessments when relying on self-reports. PMID:17492920

  11. Automated screening for retinopathy

    Directory of Open Access Journals (Sweden)

    A. S. Rodin

    2014-07-01

    Full Text Available Retinal pathology is a common cause of an irreversible decrease of central vision commonly found amongst senior population. Detection of the earliest signs of retinal diseases can be facilitated by viewing retinal images available from the telemedicine networks. To facilitate the process of retinal images, screening software applications based on image recognition technology are currently on the various stages of development.Purpose: To develop and implement computerized image recognition software that can be used as a decision support technologyfor retinal image screening for various types of retinopathies.Methods: The software application for the retina image recognition has been developed using C++ language. It was tested on dataset of 70 images with various types of pathological features (age related macular degeneration, chorioretinitis, central serous chorioretinopathy and diabetic retinopathy.Results: It was shown that the system can achieve a sensitivity of 73 % and specificity of 72 %.Conclusion: Automated detection of macular lesions using proposed software can significantly reduce manual grading workflow. In addition, automated detection of retinal lesions can be implemented as a clinical decision support system for telemedicine screening. It is anticipated that further development of this technology can become a part of diagnostic image analysis system for the electronic health records.

  12. Screening Resonances In Plasmas

    International Nuclear Information System (INIS)

    Winkler, P.

    1998-01-01

    When it was suggested that a new recombination mechanism (Resonant Radiative Recombination (RRR)) which, based on very general physical arguments, should happen in dense plasmas and promises to provide useful information for the local temperature and density diagnostics of plasmas, they assumed the existence of screening resonances. For model potentials the existence of screening resonances has been demonstrated beyond reasonable doubt in a number of calculations. The key question, how well those potentials describe the dominant effects of a real plasma remains open. The relation of theoretical predictions to experimentally measurable effects is an important issue at the present stage of their research. In particular, RRR is expected to account for enhanced recombination rates of low energetic electrons with their ions, since the first stage is the resonant capture of a slow electron by an atom or ion. The mechanism that traps an electron is a combination of complicated many-body interactions of the ions and electrons. For clarity they start here, however, with a discussion in terms of local potential traps the shapes of which are determined predominantly and in an average way by two factors: the degree of screening present at the ionic site and the degree of short-range order in the immediate neighborhood of this ion

  13. Nutrition screening: science behind simplicity

    African Journals Online (AJOL)

    Nutrition screening triggers entry into the nutrition care process.1 Screening has informally been described as simple, quick or low-intensity proxy for more complex procedures. More formal definitions for the nutrition setting have been proposed, describing nutrition screening as a process of identifying patients, clients, or ...

  14. Push for the Second Screen

    DEFF Research Database (Denmark)

    Sørensen, Jannick Kirk; Sørensen, Lene Tolstrup

    Users’ perception of the relation between the TV screen and a secondary screen (e.g. smartphone or tablet) is examined empirically in a pilot project through a low-fi prototype and interviews. Early observations indicate that the user value/acceptance of push-messages delivered to the second screen...

  15. Premarital HIV screening in Johor--(2002-2004).

    Science.gov (United States)

    Khebir, B V; Adam, M A; Daud, A R; Shahrom, C M D

    2007-03-01

    A descriptive study was conducted on premarital HIV screening programme in Johor over a three year period. HIV screenings were done at government clinics and confirmed by accredited laboratories. As a result, 123 new HIV cases were detected (0.17%) from 74,210 respondents. In 2004, 24 cases (64.9%) advanced to marriage (n = 37) after they underwent counselling and six of them married among themselves. Positivity rate from this programme (0.17%) is higher than antenatal screening (0.05%). Despite the implementation of the premarital HIV screening programme, marriage application in Johor rose 2.8% in 2004 compared with 2002. This programme had partly contributed to public awareness against HIV and provides another option in early detection of the disease.

  16. Abnormal Cervical Cancer Screening Test Results

    Science.gov (United States)

    ... AQ FREQUENTLY ASKED QUESTIONS FAQ187 GYNECOLOGIC PROBLEMS Abnormal Cervical Cancer Screening Test Results • What is cervical cancer screening? • What causes abnormal cervical cancer screening test ...

  17. Adenoma detection in patients undergoing a comprehensive colonoscopy screening

    International Nuclear Information System (INIS)

    Raju, Gottumukkala S; Vadyala, Vikram; Slack, Rebecca; Krishna, Somashekar G; Ross, William A; Lynch, Patrick M; Bresalier, Robert S; Hawk, Ernest; Stroehlein, John R

    2013-01-01

    Measures shown to improve the adenoma detection during colonoscopy (excellent bowel preparation, cecal intubation, cap fitted colonoscope to examine behind folds, patient position change to optimize colon distention, trained endoscopy team focusing on detection of subtle flat lesions, and incorporation of optimum endoscopic examination with adequate withdrawal time) are applicable to clinical practice and, if incorporated are projected to facilitate comprehensive colonoscopy screening program for colon cancer prevention. To determine adenoma and serrated polyp detection rate under conditions designed to optimize quality parameters for comprehensive screening colonoscopy. Retrospective analysis of data obtained from a comprehensive colon cancer screening program designed to optimize quality parameters. Academic medical center. Three hundred and forty-three patients between the ages of 50 years and 75 years who underwent first screening colonoscopy between 2009 and 2011 among 535 consecutive patients undergoing colonoscopy. Comprehensive colonoscopy screening program was utilized to screen all patients. Cecal intubation was successful in 98.8% of patients. The Boston Bowel Preparation Scale for quality of colonoscopy was 8.97 (95% confidence interval [CI]; 8.94, 9.00). The rate of adenoma detection was 60% and serrated lesion (defined as serrated adenomas or hyperplastic polyps proximal to the splenic flexure) detection was 23%. The rate of precancerous lesion detection (adenomas and serrated lesions) was 66%. The mean number of adenomas per screening procedure was 1.4 (1.2, 1.6) and the mean number of precancerous lesions (adenomas or serrated lesions) per screening procedure was 1.6 (1.4, 1.8). Retrospective study and single endoscopist experience. A comprehensive colonoscopy screening program results in high-quality screening with high detection of adenomas, advanced adenomas, serrated adenomas, and multiple adenomas

  18. Screening diagnostic program breast cancer

    International Nuclear Information System (INIS)

    Portnoj, L.M.; Zhakova, I.I.; Budnikova, N.V.; Rukhlyadko, E.D.

    1995-01-01

    The authors propose their screening program for detection of breast cancer. It includes the entire complex of present-day screening diagnostic methods, starting from an original system for the formation of groups at risk of breast cancer and completed by the direct diagnostic model of detection of the condition, oriented at a differentiated approach to the use of mammographic techniques. The proposed organizational and methodologic screening measures are both economic and diagnostically effective, thus meeting the principal requirements to screening programs. Screening of 8541 risk-groups patients helped detect 867 nodular formations, 244 of which were cancer and 623 benign formations. 8 refs., 3 figs.,

  19. Photon attenuation by intensifying screens

    International Nuclear Information System (INIS)

    Holje, G.

    1983-01-01

    The photon attenuation by intensifying screens of different chemical composition has been determined. The attenuation of photons between 20 keV and 120 keV was measured by use of a multi-channel analyzer and a broad bremsstrahlung distribution. The attenuation by the intensifying screens was hereby determined simultaneously at many different monoenergetic photon energies. Experimentally determined attenuations were found to agree well with attenuation calculated from mass attenuation coefficients. The attenuation by the screens was also determined at various bremsstrahlung distributions, simulating those occurring behind the patient in various diagnostic X-ray examinations. The high attenuation in some of the intensifying screens form the basis for an analysis of the construction of asymmetric screen pairs. Single screen systems are suggested as a favourable alternative to thick screen pair systems. (Author)

  20. Observed and Predicted Risk of Breast Cancer Death in Randomized Trials on Breast Cancer Screening.

    Science.gov (United States)

    Autier, Philippe; Boniol, Mathieu; Smans, Michel; Sullivan, Richard; Boyle, Peter

    2016-01-01

    The role of breast screening in breast cancer mortality declines is debated. Screening impacts cancer mortality through decreasing the number of advanced cancers with poor diagnosis, while cancer treatment works through decreasing the case-fatality rate. Hence, reductions in cancer death rates thanks to screening should directly reflect reductions in advanced cancer rates. We verified whether in breast screening trials, the observed reductions in the risk of breast cancer death could be predicted from reductions of advanced breast cancer rates. The Greater New York Health Insurance Plan trial (HIP) is the only breast screening trial that reported stage-specific cancer fatality for the screening and for the control group separately. The Swedish Two-County trial (TCT)) reported size-specific fatalities for cancer patients in both screening and control groups. We computed predicted numbers of breast cancer deaths, from which we calculated predicted relative risks (RR) and (95% confidence intervals). The Age trial in England performed its own calculations of predicted relative risk. The observed and predicted RR of breast cancer death were 0.72 (0.56-0.94) and 0.98 (0.77-1.24) in the HIP trial, and 0.79 (0.78-1.01) and 0.90 (0.80-1.01) in the Age trial. In the TCT, the observed RR was 0.73 (0.62-0.87), while the predicted RR was 0.89 (0.75-1.05) if overdiagnosis was assumed to be negligible and 0.83 (0.70-0.97) if extra cancers were excluded. In breast screening trials, factors other than screening have contributed to reductions in the risk of breast cancer death most probably by reducing the fatality of advanced cancers in screening groups. These factors were the better management of breast cancer patients and the underreporting of breast cancer as the underlying cause of death. Breast screening trials should publish stage-specific fatalities observed in each group.

  1. QSAR Methods to Screen Endocrine Disruptors

    Directory of Open Access Journals (Sweden)

    Nicola Porta

    2016-08-01

    Full Text Available The identification of endocrine disrupting chemicals (EDCs is one of the important goals of environmental chemical hazard screening. We report on in silico methods addressing toxicological studies about EDCs with a special focus on the application of QSAR models for screening purpose. Since Estrogen-like (ER activity has been extensively studied, the majority of the available models are based on ER-related endpoints. Some of these models are here reviewed and described. As example for their application, we screen an assembled dataset of candidate substitutes for some known EDCs belonging to the chemical classes of phthalates, bisphenols and parabens, selected considering their toxicological relevance and broad application, with the general aim of preliminary assessing their ED potential. The goal of the substitution processes is to advance inherently safer chemicals and products, consistent with the principles of green chemistry. Results suggest that the integration of a family of different models accounting for different endpoints can be a convenient way to describe ED as properly as possible and allow also both to increase the confidence of the predictions and to maximize the probability that most active compounds are correctly found.

  2. Final screening round of the NELSON lung cancer screening trial: the effect of a 2.5-year screening interval

    NARCIS (Netherlands)

    Yousaf-Khan, U.; Aalst, C. van der; Jong, P.A. de; Heuvelmans, M.; Scholten, E.T.; Lammers, J.-W.J.; Ooijen, P. van; Nackaerts, K.; Weenink, C.; Groen, H.; Vliegenthart, R.; Haaf, K. Ten; Oudkerk, M.; Koning, H. de

    2016-01-01

    In the USA annual lung cancer screening is recommended. However, the optimal screening strategy (eg, screening interval, screening rounds) is unknown. This study provides results of the fourth screening round after a 2.5-year interval in the Dutch-Belgian Lung Cancer Screening trial

  3. Final screening round of the NELSON lung cancer screening trial : the effect of a 2.5-year screening interval

    NARCIS (Netherlands)

    Yousaf-Khan, Uraujh; van der Aalst, Carlijn; de Jong, Pim A; Heuvelmans, Marjolein; Scholten, Ernst; Lammers, Jan-Willem; van Ooijen, Peter; Nackaerts, Kristiaan; Weenink, Carla; Groen, Harry; Vliegenthart, Rozemarijn; Ten Haaf, Kevin; Oudkerk, Matthijs; de Koning, Harry

    BACKGROUND: In the USA annual lung cancer screening is recommended. However, the optimal screening strategy (eg, screening interval, screening rounds) is unknown. This study provides results of the fourth screening round after a 2.5-year interval in the Dutch-Belgian Lung Cancer Screening trial

  4. Final screening round of the NELSON lung cancer screening trial : the effect of a 2.5-year screening interval

    NARCIS (Netherlands)

    Yousaf-Khan, Uraujh; van der Aalst, Carlijn; de Jong, Pim A.; Heuvelmans, Marjolein; Scholten, Ernst; Lammers, Jan-Willem; van Ooijen, Peter; Nackaerts, Kristiaan; Weenink, Carla; Groen, Harry; Vliegenthart, Rozemarijn; Ten Haaf, Kevin; Oudkerk, Matthijs; de Koning, Harry

    Background In the USA annual lung cancer screening is recommended. However, the optimal screening strategy (eg, screening interval, screening rounds) is unknown. This study provides results of the fourth screening round after a 2.5-year interval in the Dutch-Belgian Lung Cancer Screening trial

  5. Korean Screen Cultures

    DEFF Research Database (Denmark)

    Screen Cultures sets out to redress this imbalance with a broad selection of essays spanning both North and South as well as different methodological approaches, from ethnographic and audience studies to cultural materialist readings. The first section of the book, «The South», highlights popular media...... new approaches to Korean popular culture beyond national borders and includes work on K-pop and Korean television drama. This book is a vital addition to existing scholarship on Korean popular culture, offering a unique view by providing an imaginary unification of the two Koreas negotiated through...

  6. Air-water screen

    Energy Technology Data Exchange (ETDEWEB)

    Prokopov, O.I.; Kutepov, A.I.

    1980-12-08

    The air-water screen based on inventor's certificate No. 577364 contains horizontal water and air lines with water and air nozzles. The air line is situated inside the water line eccentrically and contracts it in the area of the nozzle, whose orifices are situated along the line of contact, while the orifices of the water nozzle are situated symmetrically relative to the air orifices and are located at an acute angle to them. To raise the protective properties, on the end of the water line is a lateral nozzle water distributor is an additional nozzle, connected to this container.

  7. Molecular screening in galactosemia

    Energy Technology Data Exchange (ETDEWEB)

    Elsas, L.J.; Singh, R.; Fernhoff, P.M. [Emory Univ., Atlanta, GA (United States)] [and others

    1994-09-01

    Classical galactosemia (G/G) is caused by the absence of galactose-1-phosphate uridyl transferase (GALT) activity while the Duarte allele produces partial impairment and a specific biochemical phenotype. Cloning and sequencing of the human GALT gene has enabled the identification of prevalent mutations for both Classical and Duarte alleles. The G allele is caused by a Q188R codon mutation in exon 6 in 70% of a Caucasian population while the D allele is caused by an N134D codon mutation in exon 10. Since the Q188R sequence creates a new Hpa II site and the N314D sequence creates a new Sin I site, it is relatively easy to screen for both mutations by multiplex PCR and restriction digest. Here we describe a method for detection of new mutations producing impaired GALT. Patient DNAs are subjected to SSCP (single strand conformational polymorphism) analysis of their 11 GALT exons. Direct sequencing of the exons targeted by SSCP has revealed many codon changes: IVSC 956 (a splice acceptor site loss), S135L, V151A, E203K, A320T, and Y323D. Two of these codon changes, V151A and S135L, have been confirmed as mutations by finding impaired GALT activity in a yeast expression system. We conclude that molecular screening of GALT DNA will clarify the structural biology of GALT and the pathophysiology of galactosemia.

  8. SUPER-screening

    Energy Technology Data Exchange (ETDEWEB)

    Brax, Philippe, E-mail: Philippe.Brax@cea.fr [Institut de Physique Theorique, CEA, IPhT, CNRS, URA 2306, F-91191Gif/Yvette Cedex (France); Davis, Anne-Christine, E-mail: A.C.Davis@damtp.cam.ac.uk [DAMTP, Centre for Mathematical Sciences, University of Cambridge, Wilberforce Road, Cambridge CB3 0WA (United Kingdom); Sakstein, Jeremy, E-mail: J.A.Sakstein@damtp.cam.ac.uk [DAMTP, Centre for Mathematical Sciences, University of Cambridge, Wilberforce Road, Cambridge CB3 0WA (United Kingdom)

    2013-02-26

    We present a framework for embedding scalar–tensor models of screened modified gravity such as chameleons, symmetrons and environmental dilatons into global supersymmetry. This achieved by secluding the dark sector from both the observable and supersymmetry breaking sectors. We examine the resulting supersymmetric features in a model-independent manner and find that, when the theory follows from an underlying supergravity, the mediation of supersymmetry breaking to the dark sector induces a soft mass for the scalar of order the gravitino mass. This is enough to forbid the construction of supersymmetric symmetrons and ensures that when other screening mechanisms operate, no object in the Universe is unscreened thereby precluding any observable signatures. In view of a possible origin of modified gravity within fundamental physics, we find that only no-scale models can circumvent these features. We also present a novel mechanism where the coupling of the scalar to two other scalars charged under U(1) can dynamically generate a small cosmological constant at late times in the form of a Fayet–Iliopoulos term.

  9. [Primary cervical cancer screening].

    Science.gov (United States)

    Vargas-Hernández, Víctor Manuel; Vargas-Aguilar, Víctor Manuel; Tovar-Rodríguez, José María

    2015-01-01

    Cervico-uterine cancer screening with cytology decrease incidence by more than 50%. The cause of this cancer is the human papilloma virus high risk, and requires a sensitive test to provide sufficient sensitivity and specificity for early detection and greater interval period when the results are negative. The test of the human papilloma virus high risk, is effective and safe because of its excellent sensitivity, negative predictive value and optimal reproducibility, especially when combined with liquid-based cytology or biomarkers with viral load, with higher sensitivity and specificity, by reducing false positives for the detection of cervical intraepithelial neoplasia grade 2 or greater injury, with excellent clinical benefits to cervical cancer screening and related infection of human papilloma virus diseases, is currently the best test for early detection infection of human papillomavirus and the risk of carcinogenesis. Copyright © 2015 Academia Mexicana de Cirugía A.C. Published by Masson Doyma México S.A. All rights reserved.

  10. Advanced Breast Cancer as Indicator of Quality Mammography

    International Nuclear Information System (INIS)

    Gaona, Enrique

    2003-01-01

    Breast cancer is the most frequently diagnosed cancer and is the second leading cause of cancer death among women in the Mexican Republic. Mammography is the more important screening tool for detecting early breast cancer. Screening mammography involves taking x-rays from two views from each breast, typically from above (cranial-caudal view, CC) and from an oblique or angled view (mediolateral-oblique, MLO). The purpose of this study was to carry out an exploratory survey of the issue of patients with advanced breast cancer who have had a screening mammography. A general result of the survey is that 22.5% of all patients (102) with advanced breast cancer that participated in the study had previous screening mammography. But we should consider that 10% of breast cancers are not detected by mammography. Only 70% of the family doctors prescribed a diagnostic mammography when the first symptoms were diagnosed

  11. Introduction to sump screen downstream effect analysis of AP1000 nuclear power plant

    International Nuclear Information System (INIS)

    Zhang Qinghua; Liu Yu; Chai Guohan

    2010-01-01

    The design of AP1000 takes into account the potential impact of debris clogging on sump screen. In this article, the technical background of sump screen issue and the design characteristics of AP1000 to address the sump screen blockage issue are introduced. The article focuses on the 'downstream effect' analysis method, acceptance criteria and analysis result of AP1000 sump screen. Although the design of AP1000 is different with traditional PWR, the author expects to bring some reference to advance the downstream effect analysis in China through the introduction. (authors)

  12. Disposable Screen Printed Electrochemical Sensors: Tools for Environmental Monitoring

    Directory of Open Access Journals (Sweden)

    Akhtar Hayat

    2014-06-01

    Full Text Available Screen printing technology is a widely used technique for the fabrication of electrochemical sensors. This methodology is likely to underpin the progressive drive towards miniaturized, sensitive and portable devices, and has already established its route from “lab-to-market” for a plethora of sensors. The application of these sensors for analysis of environmental samples has been the major focus of research in this field. As a consequence, this work will focus on recent important advances in the design and fabrication of disposable screen printed sensors for the electrochemical detection of environmental contaminants. Special emphasis is given on sensor fabrication methodology, operating details and performance characteristics for environmental applications.

  13. [Screening for colorectal cancer in Italy, 2010 survey].

    Science.gov (United States)

    Zorzi, Manuel; Fedato, Chiara; Grazzini, Grazia; Sassoli de' Bianchi, Priscilla; Naldoni, Carlo; Pendenza, Melania; Sassatelli, Romano; Senore, Carlo; Visioli, Carmen Beatriz; Zappa, Marco

    2012-01-01

    We present the main results of the 2010 survey of the Italian screening programmes for colorectal cancer carried out by the National centre for screening monitoring (Osservatorio nazionale screening, ONS) on behalf of the Ministry of health. By the end of 2010, 105 programmes were active, 9 of which had been activated during the year, and 65% of Italians aged 50-69 years were residing in areas covered by organised screening programmes (theoretical extension). Twelve regions had their whole population covered. In the South of Italy and Islands, 5 new programmes were activated in 2010, with a theoretical extension of 29%. The majority of programmes employed the faecal occult blood test (FIT), while some adopted flexible sigmoidoscopy (FS) once in a lifetime and FIT for non-responders to FS. Overall, about 3,404,000 subjects were invited to undergo FIT, 47.2% of those to be invited within the year. The adjusted attendance rate was 48% and approximately 1,568,796 subjects were screened. Large differences in the attendance rate were observed among regions: 10% of programmes reported values lower than 24%. Positivity rate of FIT programmes was 5.5% at first screening (range: 1.6-11.3%) and 4.3% at repeat screening (range: 3.2-6.7%). The average attendance rate to total colonoscopy (TC) was 81.4% and in one region it was lower than 70%. Completion rate for total colonoscopy (TC) was 88.7%. Among the 740,281 subjects attending screening for the first time, the detection rate (DR) per 1,000 screened subjects was 2.4 for invasive cancer and 10.3 for advanced adenomas (AA - adenomas with a diameter ≥1 cm, with villous/tubulo-villous type or with high-grade dysplasia). As expected, the corresponding figures in the 843,204 subjects at repeat screening were lower (1.2‰ and 7.6‰ for invasive cancer and AA, respectively). The DR of cancer and adenomas increased with age and was higher among males. Many programmes reported some difficulties in guaranteeing TC in the

  14. Mass screening in breast cancer

    International Nuclear Information System (INIS)

    Strax, P.

    1977-01-01

    Some questions about mass screening in breast cancer are answered it being concluded that: 1. mass screening for the detection of early breast cancer is the only means with proven potential for lowering the death rate of the disease; 2. mammography is an importante - if not the most important modality in mass screening; 3. new film - screen combinations generally available are capable of producing mammograms of excelent quality with radiation doses down to .1 rad into the body of breast. The risk of malignant changes from such dosage - even when given periodically is negligeable. New equipment, to be available, shortly, will use the new film - screen combinations in an automated manner with must reduce cost in time, filme, personnel and processing - of more than 50%. This would make mass screening more practical. (M.A.) [pt

  15. Current Cervical Carcinoma Screening Guidelines

    Directory of Open Access Journals (Sweden)

    Megan J. Schlichte

    2015-05-01

    Full Text Available A formidable threat to the health of women, cervical carcinoma can be prevented in many cases with adequate screening. The current guidelines for cervical carcinoma screening were created as joint recommendations of the American Cancer Society (ACS, the American Society for Colposcopy and Cervical Pathology (ASCCP and the American Society for Clinical Pathology (ASCP in 2012, and later accepted and promoted by the American Congress of Obstetricians and Gynecologists (ACOG. The 2012 recommendations underscore the utility of molecular testing as an adjunct to cytology screening for certain women and provide guidance to clinicians based on different risk-benefit considerations for different ages. This manuscript will review screening techniques and current recommendations for cervical cancer screening and human papilloma virus (HPV testing, as well as possible future screening strategies.

  16. Luminescence studies on phosphor screens

    International Nuclear Information System (INIS)

    Panayiotakis, G.; Nomikos, C.; Bakas, A.; Proimos, B.

    1994-01-01

    We report our results on x-ray phosphor screens prepared of some new materials focusing attention on their efficiency under fluoroscopy conditions, on optimization conditions and on comparisons among the various materials. All data are presented in absolute values. A theoretical model is presented, that takes into account the granular structure of the screens, permitting the explanation and prediction of the luminescence properties of the screens. (authors)

  17. Luminescence studies on phosphor screens

    Energy Technology Data Exchange (ETDEWEB)

    Panayiotakis, G; Nomikos, C; Bakas, A; Proimos, B [Medical Physics Department, University of Patras, 265 00 Patras, Greece (Greece)

    1994-12-31

    We report our results on x-ray phosphor screens prepared of some new materials focusing attention on their efficiency under fluoroscopy conditions, on optimization conditions and on comparisons among the various materials. All data are presented in absolute values. A theoretical model is presented, that takes into account the granular structure of the screens, permitting the explanation and prediction of the luminescence properties of the screens. (authors). 12 refs, 3 figs.

  18. Newborn Screening for Phenylketonuria

    Directory of Open Access Journals (Sweden)

    Gustavo J. C. Borrajo PhD

    2016-12-01

    Full Text Available Newborn screening (NBS for phenylketonuria in Latin America gave its first step in an organized way 3 decades ago when the first national NBS program was implemented in Cuba. From then onward, it experienced a slow but continuous growing, being currently possible to find from countries where no NBS activity is known to several countries with consolidated NBS programs. This complex scenario gave rise to a great diversity in the criteria used for sample collection, selection of analytical methods, and definition of cutoff values. Considering this context, a consensus meeting was held in order to unify such criteria, focusing the discussion in the following aspects—recommended blood specimens and sample collection time; influence of early discharge, fasting, parenteral nutrition, blood transfusions, extracorporeal life support, and antibiotics; main causes of transient hyperphenylalaninemias; required characteristics for methods used in phenylalanine measurement; and finally, criteria to define the more appropriate cutoff values.

  19. Taking place, screening place

    DEFF Research Database (Denmark)

    Hansen, Kim Toft; Waade, Anne Marit

    2019-01-01

    We introduce location studies as a new empirical approach to screen studies. Location studies represent an interdisciplinary perspective, including media, aesthetics and geography, and reflect a growing interest in places in a global media and consumption culture. The chapter analyses two recent......) with one being traditional and the other being commercial; both dramas include discussions of localities and social heritage, and both use local sports as a common metaphor for social cohesion; and both series have been partly funded by a local film Danish commissioner. However, The Legacy is shot...... to a large extent in studios, while Norskov is shot entirely on location. The study is based on interviews with producers, broadcasters, location scouts, production designers and writers, as well as quantitative and qualitative textual analyses of television drama series, the geographical places, and related...

  20. Congenital cataract screening

    Directory of Open Access Journals (Sweden)

    Zhale Rajavi

    2016-01-01

    Full Text Available Congenital cataract is a leading cause of visual deprivation which can damage the developing visual system of a child; therefore early diagnosis, management and long-term follow-up are essential. It is recommended that all neonates be screened by red reflex examination at birth and suspected cases be referred to ophthalmic centers. Early surgery (1 year is highly recommended. After surgery, amblyopia treatment and periodic follow-up examinations should be started as soon as possible to achieve a satisfactory visual outcome. Practitioners should consider the possibility of posterior capsular opacity, elevated intraocular pressure and amblyopia during follow-up, especially in eyes with microphthalmia and/or associated congenital anomalies. All strabismic children should undergo slit lamp examination prior to strabismus surgery to rule out congenital lens opacities. From a social point of view, equal and fair medical care should be provided to all children regardless of gender.

  1. Diabetes screening in the workplace.

    Science.gov (United States)

    Gulley, Tauna; Boggs, Dusta; Mullins, Rebecca; Brock, Emily

    2014-11-01

    The prevalence of diabetes has increased worldwide and the pathophysiological problems associated with diabetes increase the potential for employees' physical disabilities. These complications, including neuropathy, nephropathy, and visual impairment, negatively impact the job performance of employees and compromise workplace safety. Occupational health nurses can provide diabetes screening programs to employees and identify chronic disease risk factors early. This article describes an occupational diabetes screening program at a major corporation in Belize, Central America, defines diabetes, outlines the diabetes teaching plan, and presents the demographics of the participants and results of the screening. Cultural considerations and recommendations for future occupational diabetes screenings are proposed. Copyright 2014, SLACK Incorporated.

  2. Industrial screening programs for workers

    International Nuclear Information System (INIS)

    Lavine, M.P.

    1982-01-01

    Industrial screening efforts to identify classes of workers who are more susceptible to workplace hazards, by virtue of their fertility, genetic, or lifestyle characteristics, represent a relatively new approach to reducing workplace risks. Screening has already raised some important economic, legal, social, medical, and moral questions. Employers, employees, administrative agencies, and the courts are offering different, often conflicting answers. Ultimately the acceptability of various screening schemes rests upon judgments about how a society justifies the distribution of risk. The questions that industrial screening programs raise are only partially answered by empirical evidence; the rest is a matter of values

  3. Subtypes of Ovarian Cancer and Ovarian Cancer Screening

    Directory of Open Access Journals (Sweden)

    Masafumi Koshiyama

    2017-03-01

    Full Text Available Ovarian cancer is the foremost cause of gynecological cancer death in the developed world, as it is usually diagnosed at an advanced stage. In this paper we discuss current issues, the efficacy and problems associated with ovarian cancer screening, and compare the characteristics of ovarian cancer subtypes. There are two types of ovarian cancer: Type I carcinomas, which are slow-growing, indolent neoplasms thought to arise from a precursor lesion, which are relatively common in Asia; and Type II carcinomas, which are clinically aggressive neoplasms that can develop de novo from serous tubal intraepithelial carcinomas (STIC and/or ovarian surface epithelium and are common in Europe and the USA. One of the most famous studies on the subject reported that annual screening using CA125/transvaginal sonography (TVS did not reduce the ovarian cancer mortality rate in the USA. In contrast, a recent study in the UK showed an overall average mortality reduction of 20% in the screening group. Another two studies further reported that the screening was associated with decreased stage at detection. Theoretically, annual screening using CA125/TVS could easily detect precursor lesions and could be more effective in Asia than in Europe and the USA. The detection of Type II ovarian carcinoma at an early stage remains an unresolved issue. The resolving power of CA125 or TVS screening alone is unlikely to be successful at resolving STICs. Biomarkers for the early detection of Type II carcinomas such as STICs need to be developed.

  4. Subtypes of Ovarian Cancer and Ovarian Cancer Screening.

    Science.gov (United States)

    Koshiyama, Masafumi; Matsumura, Noriomi; Konishi, Ikuo

    2017-03-02

    Ovarian cancer is the foremost cause of gynecological cancer death in the developed world, as it is usually diagnosed at an advanced stage. In this paper we discuss current issues, the efficacy and problems associated with ovarian cancer screening, and compare the characteristics of ovarian cancer subtypes. There are two types of ovarian cancer: Type I carcinomas, which are slow-growing, indolent neoplasms thought to arise from a precursor lesion, which are relatively common in Asia; and Type II carcinomas, which are clinically aggressive neoplasms that can develop de novo from serous tubal intraepithelial carcinomas (STIC) and/or ovarian surface epithelium and are common in Europe and the USA. One of the most famous studies on the subject reported that annual screening using CA125/transvaginal sonography (TVS) did not reduce the ovarian cancer mortality rate in the USA. In contrast, a recent study in the UK showed an overall average mortality reduction of 20% in the screening group. Another two studies further reported that the screening was associated with decreased stage at detection. Theoretically, annual screening using CA125/TVS could easily detect precursor lesions and could be more effective in Asia than in Europe and the USA. The detection of Type II ovarian carcinoma at an early stage remains an unresolved issue. The resolving power of CA125 or TVS screening alone is unlikely to be successful at resolving STICs. Biomarkers for the early detection of Type II carcinomas such as STICs need to be developed.

  5. A Decision Aid to Promote Appropriate Colorectal Cancer Screening among Older Adults: A Randomized Controlled Trial.

    Science.gov (United States)

    Lewis, Carmen L; Kistler, Christine E; Dalton, Alexandra F; Morris, Carolyn; Ferrari, Renée; Barclay, Colleen; Brewer, Noel T; Dolor, Rowena; Harris, Russell; Vu, Maihan; Golin, Carol E

    2018-07-01

    Concerns have been raised about both over- and underutilization of colorectal cancer (CRC) screening in older patients and the need to align screening behavior with likelihood of net benefit. The purpose of this study was to test a novel use of a patient decision aid (PtDA) to promote appropriate CRC screening in older adults. A total of 424 patients ages 70 to 84 y who were not up to date with CRC screening participated in a double-blinded randomized controlled trial of a PtDA targeted to older adults making decisions about whether to undergo CRC screening from March 2012 to February 2015. Patients were randomized to a targeted PtDA or an attention control. The PtDA was designed to facilitate individualized decision making-helping patients understand the potential risks, benefits, and uncertainties of CRC screening given advanced age, health state, preferences, and values. Two composite outcomes, appropriate CRC screening behavior 6 mo after the index visit and appropriate screening intent immediately after the visit, were defined as completed screening or intent for patients in good health, discussion about screening with their provider for patients in intermediate health, and no screening or intent for patients in poor health. Health state was determined by age and Charlson Comorbidity Index. Four hundred twelve (97%) and 421 (99%) patients were analyzed for the primary and secondary outcomes, respectively. Appropriate screening behavior at 6 mo was higher in the intervention group (55% v. 45%, P = 0.023) as was appropriate screening intent following the provider visit (61% v. 47%, P = 0.003). The study took place in a single geographic region. The appropriate CRC screening classification system used in this study has not been formally validated. A PtDA for older adults promoted appropriate CRC screening behavior and intent. Clinicaltrials.gov, registration number NCT01575990. https://clinicaltrials.gov/ct2/show/NCT01575990?term=epic-d&rank=1.

  6. Studies Comparing Screen-Film Mammography and Full-Field Digital Mammography in Breast Cancer Screening: Updated Review

    International Nuclear Information System (INIS)

    Skaane, P.

    2009-01-01

    Full-field digital mammography (FFDM) has several potential benefits as compared with screen-film mammography (SFM) in mammography screening. Digital technology also opens for implementation of advanced applications, including computer-aided detection (CAD) and tomosynthesis. Phantom studies and experimental clinical studies have shown that FFDM is equal or slightly superior to SFM for detection and characterization of mammographic abnormalities. Despite obvious advantages, the conversion to digital mammography has been slower than anticipated, and not only due to higher costs. Until very recently, some countries did not even permit the use of digital mammography in breast cancer screening. The reason for this reluctant attitude was concern about lower spatial resolution and about using soft-copy reading. Furthermore, there was a lack of data supporting improved diagnostic accuracy using FFDM in a screening setting, since two pioneer trials both showed nonsignificantly lower cancer detection rate at FFDM. The 10 studies comparing FFDM and SFM in mammography screening published so far have shown divergent and rather conflicting results. Nevertheless, there is a rapid conversion to digital mammography in breast cancer screening in many western countries. The aim of this article is to give an updated review of these studies, discuss the conflicting findings, and draw some conclusions from the results

  7. Recent advances in neutron tomography

    International Nuclear Information System (INIS)

    McFarland, E.; Massachusetts Inst. of Technology, Cambridge, MA; Lanza, R.

    1993-01-01

    Neutron imaging has been shown to be an excellent imaging tool for many nondestructive evaluation applications. Significantly improved contrast over X-ray images is possible for materials commonly found in engineering assemblies. The major limitations have been the neutron source and detection. A low cost, position sensitive neutron tomography detector system has been designed and built based on an electro-optical detector system using a LiF-ZnS scintillator screen and a cooled charge coupled device. This detector system can be used for neutron radiography as well as two and three-dimensional neutron tomography. Calculated performance of the system predicted near-quantum efficiency for position sensitive neutron detection. Experimental data was recently taken using this system at McClellan Air Force Base, Air Logistics Center, Sacramento, CA. With increased availability of low cost neutron sources and advanced image processing, neutron tomography will become an increasingly important nondestructive imaging method

  8. Recent Advances in Electrochemical Glycobiosensing

    Directory of Open Access Journals (Sweden)

    Germarie Sánchez-Pomales

    2011-01-01

    Full Text Available Biosensors based on electrochemical transduction mechanisms have recently made advances into the field of glycan analysis. These glyco-biosensors offer simple, rapid, sensitive, and economical approaches to the measurement need for rapid glycan analysis for biomarker detection, cancer and disease diagnostics, and bioprocess monitoring of therapeutic glycoproteins. Although the prevalent methods of glycan analysis (high-performance liquid chromatography, mass spectrometry, and nuclear magnetic resonance spectroscopy provide detailed identification and structural analysis of glycan species, there are significantly few low-cost, rapid glycan assays available for diagnostic and screening applications. Here we review instances in which glyco-biosensors have been used for glycan analysis using a variety of electrochemical transduction mechanisms (e.g., amperometric, potentiometric, impedimetric, and voltammetric, selective binding agents (e.g., lectins and antibodies, and redox species (e.g., enzyme substrates, inorganic, and nanomaterial.

  9. Developments in Colorectal Cancer Screening

    Science.gov (United States)

    ... of this page please turn JavaScript on. Feature: Colorectal Cancer Developments in Colorectal Cancer Screening Past Issues / Summer 2016 Table of ... at the National Cancer Institute, shared developments in colorectal cancer screening methods with NIH MedlinePlus magazine. What ...

  10. Costs of Colorectal Cancer Screening

    Centers for Disease Control (CDC) Podcasts

    2017-04-04

    A health economist talks about studies on figuring out the costs of running a colorectal cancer screening program, and how this can lead to better screening.  Created: 4/4/2017 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 4/4/2017.

  11. Screening College Students for Hypercholesterolemia.

    Science.gov (United States)

    Faigel, Harris C.

    1992-01-01

    Describes one college's mandatory mass cholesterol screening for new students. Each year, over 30 beginning students with unknown hypercholesterolemia were detected. The program suggests that mass screening efficiently and economically identifies students who would benefit from cholesterol reduction, a modifiable risk in coronary artery disease.…

  12. Overdiagnosis in breast cancer screening

    DEFF Research Database (Denmark)

    Lynge, Elsebeth; Beau, Anna-Belle; Christiansen, Peer

    2017-01-01

    Overdiagnosis in breast cancer screening is an important issue. A recent study from Denmark concluded that one in three breast cancers diagnosed in screening areas in women aged 50-69 years were overdiagnosed. The purpose of this short communication was to disentangle the study's methodology...

  13. Why mammography screening has not lived up to expectations from the randomised trials

    DEFF Research Database (Denmark)

    Gøtzsche, Peter C; Jørgensen, Karsten Juhl; Zahl, Per-Henrik

    2012-01-01

    adjuvant therapy and breast cancer awareness, not screening. We also believe it is more important to reduce the incidence of cancer than to detect it 'early.' Avoiding getting screening mammograms reduces the risk of becoming a breast cancer patient by one-third.......We analysed the relation between tumour sizes and stages and the reported effects on breast cancer mortality with and without screening in trials and observational studies. The average tumour sizes in all the trials suggest only a 12% reduction in breast cancer mortality, which agrees with the 10......% reported in the most reliable trials. Recent studies of tumour sizes and tumour stages show that screening has not lowered the rate of advanced cancers. In agreement with this, recent observational studies of breast cancer mortality have failed to find an effect of screening. In contrast, screening leads...

  14. Colorectal cancers detected through screening are associated with lower stages and improved survival

    DEFF Research Database (Denmark)

    Lindebjerg, Jan; Osler, Merete; Bisgaard, Claus Hedebo

    2014-01-01

    in the feasibility study cohort were reviewed with respect to the effect of screening participation on stages and survival. MATERIAL AND METHODS: All cases of CRC in a feasibility study cohort diagnosed from the beginning of the study until two years after the study ended were identified. Differences...... in the distribution of colon cancer stages and rectal cancer groups between the various screening categories were analysed through χ(2)-tests. Survival analysis with respect to screening groups was done by Kaplan-Meier and Cox-Mantel hazard ratios, and survival was corrected for lead time. RESULTS: Colon cancers...... detected through screening were diagnosed at significantly lower stages than among screening non-responders. There were relatively fewer locally advanced rectal cancers among patients diagnosed through positive FOBT than among non-responders. Survival among screening cancer patients was superior...

  15. Immunochemical faecal occult blood test for colorectal cancer screening: a systematic review.

    Science.gov (United States)

    Syful Azlie, M F; Hassan, M R; Junainah, S; Rugayah, B

    2015-02-01

    A systematic review on the effectiveness and costeffectiveness of Immunochemical faecal occult IFOBT for CRC screening was carried out. A total of 450 relevant titles were identified, 41 abstracts were screened and 18 articles were included in the results. There was fair level of retrievable evidence to suggest that the sensitivity and specificity of IFOBT varies with the cut-off point of haemoglobin, whereas the diagnostic accuracy performance was influenced by high temperature and haemoglobin stability. A screening programme using IFOBT can be effective for prevention of advanced CRC and reduced mortality. There was also evidence to suggest that IFOBT is cost-effective in comparison with no screening, whereby a two-day faecal collection method was found to be costeffective as a means of screening for CRC. Based on the review, quantitative IFOBT method can be used in Malaysia as a screening test for CRC. The use of fully automated IFOBT assay would be highly desirable.

  16. Value of audits in breast cancer screening quality assurance programmes.

    Science.gov (United States)

    Geertse, Tanya D; Holland, Roland; Timmers, Janine M H; Paap, Ellen; Pijnappel, Ruud M; Broeders, Mireille J M; den Heeten, Gerard J

    2015-11-01

    Our aim was to retrospectively evaluate the results of all audits performed in the past and to assess their value in the quality assurance of the Dutch breast cancer screening programme. The audit team of the Dutch Reference Centre for Screening (LRCB) conducts triennial audits of all 17 reading units. During audits, screening outcomes like recall rates and detection rates are assessed and a radiological review is performed. This study investigates and compares the results of four audit series: 1996-2000, 2001-2005, 2003-2007 and 2010-2013. The analysis shows increased recall rates (from 0.66%, 1.07%, 1.22% to 1.58%), increased detection rates (from 3.3, 4.5, 4.8 to 5.4 per 1000) and increased sensitivity (from 64.5%, 68.7%, 70.5% to 71.6%), over the four audit series. The percentage of 'missed cancers' among interval cancers and advanced screen-detected cancers did not change (p = 0.4). Our audits not only provide an opportunity for assessing screening outcomes, but also provide moments of self-reflection with peers. For radiologists, an accurate understanding of their performance is essential to identify points of improvement. We therefore recommend a radiological review of screening examinations and immediate feedback as part of an audit. • Radiological review and immediate feedback are recommended as part of an audit. • For breast screening radiologists, audits provide moments of self-reflection with peers. • Radiological review of screening examinations provides insights in recall behaviour. • Accurate understanding of radiologists' performance is essential to identify points of improvement.

  17. Prenatal Screening Using Maternal Markers

    Directory of Open Access Journals (Sweden)

    Howard Cuckle

    2014-05-01

    Full Text Available Maternal markers are widely used to screen for fetal neural tube defects (NTDs, chromosomal abnormalities and cardiac defects. Some are beginning to broaden prenatal screening to include pregnancy complications such as pre-eclampsia. The methods initially developed for NTDs using a single marker have since been built upon to develop high performance multi-maker tests for chromosomal abnormalities. Although cell-free DNA testing is still too expensive to be considered for routine application in public health settings, it can be cost-effective when used in combination with existing multi-maker marker tests. The established screening methods can be readily applied in the first trimester to identify pregnancies at high risk of pre-eclampsia and offer prevention though aspirin treatment. Prenatal screening for fragile X syndrome might be adopted more widely if the test was to be framed as a form of maternal marker screening.

  18. Cervical cancer screening at crossroads

    DEFF Research Database (Denmark)

    Lynge, Elsebeth; Rygaard, Carsten; Baillet, Miguel Vazquez-Prada

    2014-01-01

    Cervical screening has been one of the most successful public health prevention programmes. For 50 years, cytology formed the basis for screening, and detected cervical intraepithelial lesions (CIN) were treated surgically to prevent progression to cancer. In a high-risk country as Denmark......, screening decreased the incidence of cervical cancer from 34 to 11 per 100,000, age-standardized rate (World Standard Population). Screening is, however, also expensive; Denmark (population: 5.6 million) undertakes close to half a million tests per year, and has 6-8 CIN-treated women for each prevented...... cancer case. The discovery of human papillomavirus (HPV) as the cause of cervical cancer dramatically changed perspectives for disease control. Screening with HPV testing was launched around 1990, and preventive HPV vaccination was licensed in 2006. Long-term randomized controlled trials (RCT...

  19. From screen to structure with a harvestable microfluidic device

    International Nuclear Information System (INIS)

    Stojanoff, Vivian; Jakoncic, Jean; Oren, Deena A.; Nagarajan, V.; Navarro Poulsen, Jens-Christian; Adams-Cioaba, Melanie A.; Bergfors, Terese; Sommer, Morten O. A.

    2011-01-01

    Microfluidic crystallization using the Crystal Former improves the identification of initial crystallization conditions relative to screening via vapour diffusion. Advances in automation have facilitated the widespread adoption of high-throughput vapour-diffusion methods for initial crystallization screening. However, for many proteins, screening thousands of crystallization conditions fails to yield crystals of sufficient quality for structural characterization. Here, the rates of crystal identification for thaumatin, catalase and myoglobin using microfluidic Crystal Former devices and sitting-drop vapour-diffusion plates are compared. It is shown that the Crystal Former results in a greater number of identified initial crystallization conditions compared with vapour diffusion. Furthermore, crystals of thaumatin and lysozyme obtained in the Crystal Former were used directly for structure determination both in situ and upon harvesting and cryocooling. On the basis of these results, a crystallization strategy is proposed that uses multiple methods with distinct kinetic trajectories through the protein phase diagram to increase the output of crystallization pipelines

  20. Screening of 20 patients with X-linked mental retardation using chromosome X-specific array-MAPH.

    NARCIS (Netherlands)

    Kousoulidou, L.; Parkel, S.; Zilina, O.; Palta, P.; Puusepp, H.; Remm, M.; Turner, G.; Boyle, J.; Bokhoven, J.H.L.M. van; Brouwer, A.; Esch, H. van; Froyen, G.; Ropers, H.H.; Chelly, J.; Moraine, C.; Gecz, J.; Kurg, A.; Patsalis, P.C.

    2007-01-01

    The rapid advancement of high-resolution DNA copy number assessment methods revealed the significant contribution of submicroscopic genetic imbalances to abnormal phenotypes, including mental retardation. In order to detect submicroscopic genetic imbalances, we have screened 20 families with

  1. Dysphonia risk screening protocol

    Directory of Open Access Journals (Sweden)

    Katia Nemr

    2016-03-01

    Full Text Available OBJECTIVE: To propose and test the applicability of a dysphonia risk screening protocol with score calculation in individuals with and without dysphonia. METHOD: This descriptive cross-sectional study included 365 individuals (41 children, 142 adult women, 91 adult men and 91 seniors divided into a dysphonic group and a non-dysphonic group. The protocol consisted of 18 questions and a score was calculated using a 10-cm visual analog scale. The measured value on the visual analog scale was added to the overall score, along with other partial scores. Speech samples allowed for analysis/assessment of the overall degree of vocal deviation and initial definition of the respective groups and after six months, the separation of the groups was confirmed using an acoustic analysis. RESULTS: The mean total scores were different between the groups in all samples. Values ranged between 37.0 and 57.85 in the dysphonic group and between 12.95 and 19.28 in the non-dysphonic group, with overall means of 46.09 and 15.55, respectively. High sensitivity and specificity were demonstrated when discriminating between the groups with the following cut-off points: 22.50 (children, 29.25 (adult women, 22.75 (adult men, and 27.10 (seniors. CONCLUSION: The protocol demonstrated high sensitivity and specificity in differentiating groups of individuals with and without dysphonia in different sample groups and is thus an effective instrument for use in voice clinics.

  2. Data Quality Screening Service

    Science.gov (United States)

    Strub, Richard; Lynnes, Christopher; Hearty, Thomas; Won, Young-In; Fox, Peter; Zednik, Stephan

    2013-01-01

    A report describes the Data Quality Screening Service (DQSS), which is designed to help automate the filtering of remote sensing data on behalf of science users. Whereas this process often involves much research through quality documents followed by laborious coding, the DQSS is a Web Service that provides data users with data pre-filtered to their particular criteria, while at the same time guiding the user with filtering recommendations of the cognizant data experts. The DQSS design is based on a formal semantic Web ontology that describes data fields and the quality fields for applying quality control within a data product. The accompanying code base handles several remote sensing datasets and quality control schemes for data products stored in Hierarchical Data Format (HDF), a common format for NASA remote sensing data. Together, the ontology and code support a variety of quality control schemes through the implementation of the Boolean expression with simple, reusable conditional expressions as operands. Additional datasets are added to the DQSS simply by registering instances in the ontology if they follow a quality scheme that is already modeled in the ontology. New quality schemes are added by extending the ontology and adding code for each new scheme.

  3. Dysphonia risk screening protocol

    Science.gov (United States)

    Nemr, Katia; Simões-Zenari, Marcia; da Trindade Duarte, João Marcos; Lobrigate, Karen Elena; Bagatini, Flavia Alves

    2016-01-01

    OBJECTIVE: To propose and test the applicability of a dysphonia risk screening protocol with score calculation in individuals with and without dysphonia. METHOD: This descriptive cross-sectional study included 365 individuals (41 children, 142 adult women, 91 adult men and 91 seniors) divided into a dysphonic group and a non-dysphonic group. The protocol consisted of 18 questions and a score was calculated using a 10-cm visual analog scale. The measured value on the visual analog scale was added to the overall score, along with other partial scores. Speech samples allowed for analysis/assessment of the overall degree of vocal deviation and initial definition of the respective groups and after six months, the separation of the groups was confirmed using an acoustic analysis. RESULTS: The mean total scores were different between the groups in all samples. Values ranged between 37.0 and 57.85 in the dysphonic group and between 12.95 and 19.28 in the non-dysphonic group, with overall means of 46.09 and 15.55, respectively. High sensitivity and specificity were demonstrated when discriminating between the groups with the following cut-off points: 22.50 (children), 29.25 (adult women), 22.75 (adult men), and 27.10 (seniors). CONCLUSION: The protocol demonstrated high sensitivity and specificity in differentiating groups of individuals with and without dysphonia in different sample groups and is thus an effective instrument for use in voice clinics. PMID:27074171

  4. Magnetic field screens

    International Nuclear Information System (INIS)

    Mansfield, P.; Turner, R.; Chapman, B.L.W.; Bowley, R.M.

    1990-01-01

    A screen for a magnetic coil, for producing, for example, a homogeneous, gradient or RF field in nuclear magnetic resonance imaging, is described. It is provided by surround the coil with a set of electrical conductors. The currents within the conductors are controlled in such a manner that the field is neutralised in a specific region of space. The current distribution within the conductors is determined by calculating the current within a hypothetical superconductive shield which would have the effect of neutralising the field, the current through the conductors thereby being a substitute for the superconductive shield. The conductors may be evenly spaced and connected in parallel, their resistances being determined by thickness or composition to provide the desired current, or they may carry equal currents but be differently spaced. A further set or sets of controlled conductors outside the first set may ensure that the first set does not upset the field from the NMR coil. The shield may selectively reflect certain fields while transmitting others and may prevent acoustic vibration e.g. when switching gradient fields. An RF coil arrangement may consist of two orthogonal coils, one coil within the other for use as a transmit/receive set or as a double resonance transmitter; a shield between the coils is in series with, and formed from the same winding as, the inner coil. (author)

  5. Touch/Screen

    Directory of Open Access Journals (Sweden)

    Daniel Ross

    2015-12-01

    Full Text Available In 2004 Bernard Stiegler posed “the tragic question of cinema” as that of the germ of regres-­‐‑ sion to television and pornography it has always contained, just as in 1944 Adorno and Hork-­‐‑ heimer argued that Enlightenment reason has always contained a germ of regression making possible a prostitution of theory leading only to the threat of fascism. If comparable threats attend Stiegler’s cinematic question, then this implies the need for an account of this potential for regression, that is, an account of the relationship between desire, technology and knowledge. Tracing the aporias of the origin of desire and trauma in psychoanalysis is one crucial way to pursue this account. Exiting these aporias depends on recognizing that the origin of desire has for human beings always been technical, and hence that the instruments of desire form its conditions and condition its forms. By thus analysing the staging of desire and the setting of fantasy it becomes possible to reflect, for example, on what it means that for Genet fascism was theatre, that for Syberberg Hitler was cinema, and that for Stiegler the new prostitution of the tele-­‐‑visual graphic is digital and algorithmic. Hence arises the potentially tragic question of the possibility or otherwise, in the age of the ubiquitous screen, of a new cinematic invention and a new cinematic practice.

  6. [Toxicologic blood emergency screening].

    Science.gov (United States)

    Cohen, Sabine; Manat, Aurélie; Dumont, Benoit; Bévalot, Fabien; Manchon, Monique; Berny, Claudette

    2010-01-01

    In order to overcome the stop marketing by Biorad company of automated high performance liquid chromatograph with UV detection (Remedi), we developed a gas chromatography-mass spectrometry (GC-MS) to detect and to give an approximation of the overdose of molecules frequently encountered in drug intoxications. Therefore two hundred eighty seventeen blood samples were collected over a period of one year and allowed us to evaluate and compare the performance of these two techniques. As identification, GC-MS does not identify all molecules detected by Remedi in 24.2% of cases; there is a lack of sensitivity for opiates and the systematic absence of certain molecules such as betablockers. However, in 75.8% of cases the GC-MS detects all molecules found by Remedi and other molecules such as meprobamate, paracetamol, benzodiazepines and phenobarbital. The concentrations obtained are interpreted in terms of overdose showed 15.7% of discrepancy and 84.3% of concordance between the two techniques. The GC-MS technique described here is robust, fast and relatively simple to implement; the identification is facilitated by macro commands and the semi quantification remains manual. Despite a sequence of cleaning the column after each sample, carryover of a sample to the next remains possible. This technique can be used for toxicologic screening in acute intoxications. Nevertheless it must be supplemented by a HPLC with UV detection if molecules such as betablockers are suspected.

  7. iScreen: world's first cloud-computing web server for virtual screening and de novo drug design based on TCM database@Taiwan.

    Science.gov (United States)

    Tsai, Tsung-Ying; Chang, Kai-Wei; Chen, Calvin Yu-Chian

    2011-06-01

    The rapidly advancing researches on traditional Chinese medicine (TCM) have greatly intrigued pharmaceutical industries worldwide. To take initiative in the next generation of drug development, we constructed a cloud-computing system for TCM intelligent screening system (iScreen) based on TCM Database@Taiwan. iScreen is compacted web server for TCM docking and followed by customized de novo drug design. We further implemented a protein preparation tool that both extract protein of interest from a raw input file and estimate the size of ligand bind site. In addition, iScreen is designed in user-friendly graphic interface for users who have less experience with the command line systems. For customized docking, multiple docking services, including standard, in-water, pH environment, and flexible docking modes are implemented. Users can download first 200 TCM compounds of best docking results. For TCM de novo drug design, iScreen provides multiple molecular descriptors for a user's interest. iScreen is the world's first web server that employs world's largest TCM database for virtual screening and de novo drug design. We believe our web server can lead TCM research to a new era of drug development. The TCM docking and screening server is available at http://iScreen.cmu.edu.tw/.

  8. iScreen: world's first cloud-computing web server for virtual screening and de novo drug design based on TCM database@Taiwan

    Science.gov (United States)

    Tsai, Tsung-Ying; Chang, Kai-Wei; Chen, Calvin Yu-Chian

    2011-06-01

    The rapidly advancing researches on traditional Chinese medicine (TCM) have greatly intrigued pharmaceutical industries worldwide. To take initiative in the next generation of drug development, we constructed a cloud-computing system for TCM intelligent screening system (iScreen) based on TCM Database@Taiwan. iScreen is compacted web server for TCM docking and followed by customized de novo drug design. We further implemented a protein preparation tool that both extract protein of interest from a raw input file and estimate the size of ligand bind site. In addition, iScreen is designed in user-friendly graphic interface for users who have less experience with the command line systems. For customized docking, multiple docking services, including standard, in-water, pH environment, and flexible docking modes are implemented. Users can download first 200 TCM compounds of best docking results. For TCM de novo drug design, iScreen provides multiple molecular descriptors for a user's interest. iScreen is the world's first web server that employs world's largest TCM database for virtual screening and de novo drug design. We believe our web server can lead TCM research to a new era of drug development. The TCM docking and screening server is available at http://iScreen.cmu.edu.tw/.

  9. Cost analysis of colorectal cancer screening with CT colonography in Italy.

    Science.gov (United States)

    Mantellini, Paola; Lippi, Giuseppe; Sali, Lapo; Grazzini, Grazia; Delsanto, Silvia; Mallardi, Beatrice; Falchini, Massimo; Castiglione, Guido; Carozzi, Francesca Maria; Mascalchi, Mario; Milani, Stefano; Ventura, Leonardo; Zappa, Marco

    2018-06-01

    Unit costs of screening CT colonography (CTC) can be useful for cost-effectiveness analyses and for health care decision-making. We evaluated the unit costs of CTC as a primary screening test for colorectal cancer in the setting of a randomized trial in Italy. Data were collected within the randomized SAVE trial. Subjects were invited to screening CTC by mail and requested to have a pre-examination consultation. CTCs were performed with 64- and 128-slice CT scanners after reduced or full bowel preparation. Activity-based costing was used to determine unit costs per-process, per-participant to screening CTC, and per-subject with advanced neoplasia. Among 5242 subjects invited to undergo screening CTC, 1312 had pre-examination consultation and 1286 ultimately underwent CTC. Among 129 subjects with a positive CTC, 126 underwent assessment colonoscopy and 67 were ultimately diagnosed with advanced neoplasia (i.e., cancer or advanced adenoma). Cost per-participant of the entire screening CTC pathway was €196.80. Average cost per-participant for the screening invitation process was €17.04 and €9.45 for the pre-examination consultation process. Average cost per-participant of the CTC execution and reading process was €146.08 and of the diagnostic assessment colonoscopy process was €24.23. Average cost per-subject with advanced neoplasia was €3777.30. Cost of screening CTC was €196.80 per-participant. Our data suggest that the more relevant cost of screening CTC, amenable of intervention, is related to CTC execution and reading process.

  10. Increased breast cancer screening and downstaging in Colombian women: A randomized trial of opportunistic breast-screening.

    Science.gov (United States)

    Murillo, Raúl; Díaz, Sandra; Perry, Fernando; Poveda, César; Piñeros, Marion; Sánchez, Oswaldo; Buitrago, Lina; Gamboa, Oscar; Lozano, Teófilo; Yu, Hsiang; Wang, Ching-Yun; Duggan, Catherine; Thomas, David B; Anderson, Benjamin O

    2016-02-01

    The lack of breast cancer screening in low and middle-income countries results in later stage diagnosis and worsened outcomes for women. A cluster randomized trial was performed in Bogotá, Colombia between 2008 and 2012 to evaluate effects of opportunistic breast cancer screening. Thirteen clinics were randomized to an intervention arm and 13 to a control arm. Physicians in intervention clinics were instructed to perform clinical breast examination on all women aged 50-69 years attending clinics for non-breast health issues, and then refer them for mammographic screening. Physicians in control clinics were not explicitly instructed to perform breast screening or mammography referrals, but could do so if they thought it indicated ("usual care"). Women were followed for 2-years postrandomization. 7,436 women were enrolled and 7,419 (99.8%) screened in intervention clinics, versus 8,419 enrolled and 1,108 (13.1%) screened in control clinics. Incidence ratios (IR) of early, advanced and all breast cancers were 2.9 (95% CI 1.1-9.2), 1.0 (0.3-3.5) and 1.9 (0.9-4.1) in the first (screening) year of the trial, and the cumulative IR for all breast cancers converged to 1.4 (0.7-2.8) by the end of follow-up (Year 2). Eighteen (69.2%) of 26 women with early stage disease had breast conservation surgery (BCS) versus 6 (42.5%) of 14 women with late-stage disease (p = 0.02). Fifteen (68.2%) of 22 women with breast cancer in the intervention group had BCS versus nine (50.0%) of 18 women in the control group (p = 0.34). Well-designed opportunistic clinic-based breast cancer screening programs may be useful for early breast cancer detection in LMICs. © 2015 The Authors. Published by Wiley Periodicals, Inc. on behalf of UICC.

  11. Trends in quality of screening colonoscopy in Austria.

    Science.gov (United States)

    Waldmann, Elisabeth; Gessl, Irina; Sallinger, Daniela; Jeschek, Philip; Britto-Arias, Martha; Heinze, Georg; Fasching, Elisabeth; Weiss, Werner; Gschwantler, Michael; Trauner, Michael; Ferlitsch, Monika

    2016-12-01

    Background and study aim: Screening colonoscopy only effectively prevents colorectal cancer if performed with high quality. The aim of this study was to analyze the detection rates of premalignant colorectal lesions in screening colonoscopies performed within a nationwide quality control program for screening colonoscopy in Austria. Methods: Data from electronic records of the screening program from its implementation in 2007 until December 2014 were analyzed in order to calculate detection rates for adenomas, advanced adenomas, polyps, and proximal lesions, and rates of cecal intubation, sedation, complications, and adequate bowel preparation. Results were evaluated to identify trends and changes in quality parameters over the 8-year study period. Results: During the study period, 301 endoscopists provided data from 159 246 screening colonoscopies. Mean age of screened individuals was 61.1 years, and 49.1 % were women. Significant increases over time were found for age- and sex-adjusted adenoma detection rates (ADRs), which increased from a mean of 22.2 % (SD 10.7 %) in 2007/2008 to 24.2 % (SD 11.6 %) in 2013/2014. On average, each endoscopist increased their individual ADR by + 1.5 percentage points per 2-year period (95 % confidence interval [CI] 0.9 - 2.2 percentage points; P  Austria between 2007 and 2014. Although, overall ADR increased significantly during the study period, there was a decrease in the rate of advanced adenoma detection. © Georg Thieme Verlag KG Stuttgart · New York.

  12. Pediatric MDS: GATA screen the germline.

    Science.gov (United States)

    Stieglitz, Elliot; Loh, Mignon L

    2016-03-17

    In this issue of Blood, Wlodarski and colleagues demonstrate that as many as 72% of adolescents diagnosed with myelodysplastic syndrome (MDS) and monosomy 7 harbor germline mutations in GATA2. Although pediatric MDS is a very rare diagnosis, occurring in 0.8 to 4 cases per million, Wlodarski et al screened >600 cases of primary or secondary MDS in children and adolescents who were enrolled in the European Working Group on MDS consortium over a period of 15 years. The overall frequency of germline GATA2 mutations in children with primary MDS was 7%, and 15% in those presenting with advanced disease. Notably, mutations in GATA2 were absent in patients with therapy-related MDS or acquired aplastic anemia.

  13. Advanced Chemical Propulsion

    Science.gov (United States)

    Bai, S. Don

    2000-01-01

    Design, propellant selection, and launch assistance for advanced chemical propulsion system is discussed. Topics discussed include: rocket design, advance fuel and high energy density materials, launch assist, and criteria for fuel selection.

  14. Trends in adherence to recommended cancer screening: The US population and working cancer survivors

    Directory of Open Access Journals (Sweden)

    Tainya C. Clarke

    2012-12-01

    Full Text Available Introduction: Over the past decade the United States has seen a decrease in advanced cancer diagnoses. There has also been an increase in the number of cancer survivors returning to work. Cancer screening behaviors among survivors may play an important role in their return-to-work process. Adherence to a post-treatment cancer screening protocol increases early detection of secondary tumors and reduces potentially limiting side-effects. We compared screening trends among all cancer survivors, working survivors, and the general population over the last decade.Methods: Trends in adherence to recommended screening were analyzed by site-specific cancer. We used the Healthy People goals as a measure of desired adherence. We selected participants 18+ years from 1997 to 2010 National Health Interview Survey (NHIS for years where detailed cancer screening information was available. Using the recommendations of the American Cancer Society as a guide, we assessed adherence to cancer screening across the decade. There were 174,393 participants. Analyses included 7,528 working cancer survivors representing 3.8 million US workers, and 119,374 adults representing more than 100 million working Americans with no cancer history.Results: The US population met the Healthy People 2010 goal for colorectal screening, but declined in all other recommended cancer screening. Cancer survivors met and maintained the HP2010 goal for all, except cervical cancer screening. Survivors had higher screening rates than the general population. Among survivors, white-collar and service occupations had higher screening rates than blue-collar survivors.Conclusions: Cancer survivors report higher screening rates than the general population. Nevertheless, national screening rates are lower than desired, and disparities exist by cancer history and occupation. Understanding existing disparities, and the impact of cancer screening on survivors is crucial as the number of working survivors

  15. Population-based mammography screening below age 50: Balancing radiation-induced vs prevented breast cancer deaths

    NARCIS (Netherlands)

    R. de Gelder (Rianne); G. Draisma (Gerrit); E.A.M. Heijnsdijk (Eveline); H.J. de Koning (Harry)

    2011-01-01

    textabstractIntroduction:Exposure to ionizing radiation at mammography screening may cause breast cancer. Because the radiation risk increases with lower exposure age, advancing the lower age limit may affect the balance between screening benefits and risks. The present study explores the

  16. Comparing the outcomes of two strategies for colorectal tumor detection: Policy-promoted screening program versus health promotion service

    Directory of Open Access Journals (Sweden)

    Ping-Hsiu Wu

    2013-06-01

    Conclusion: In comparison with the outcomes of the HPS database, the screening efficacy of the PPS database is even for detecting colorectal carcinoma but is limited in detecting advanced adenoma. HPS may provide comprehensive validity indicators and will be helpful in adjusting current policies for improving screening performance.

  17. Domestic violence screening in pregnancy.

    Science.gov (United States)

    Bunn, Mikiko Yazawa; Higa, Nicole A; Parker, Willie J; Kaneshiro, Bliss

    2009-11-01

    Domestic violence is an important health concern that has been shown to have adverse effects on maternal and neonatal outcomes. The objectives of this study were to compare the prevalence of prenatal screening for domestic violence in a hospital-based resident clinic setting with screening practices in private obstetric offices in Honolulu, Hawai'i and to explore physician attitudes towards domestic violence screening during pregnancy. A retrospective chart review was conducted at Queen's Medical Center in Honolulu, Hawai'i in women who delivered between 2003 and 2004. A 6 item written survey was also given to all attending and resident physicians with obstetric privileges. Descriptive statistics including frequency measures were generated and chi square tests were used to compare categorical variables. A total of 270 charts were reviewed. There was a statistically significant difference (p obstetric practices (39.3 percent) that were screened for domestic violence. While the majority of respondents (77.6%) to the domestic violence survey were aware that the American College of Obstetricians and Gynecologists recommends domestic violence screening in pregnancy most respondents (69.0 percent) indicated that they "never or rarely" screened their patients for domestic violence. Despite professional recommendations and an awareness of these recommendations, between 2003 and 2004, routine prenatal screening for domestic violence was markedly lacking for patients in this study population.

  18. Promoting breast screening in Glasgow.

    Science.gov (United States)

    Cohen, L; Dobson, H; McGuire, F

    2000-03-01

    To establish whether there is a role for advertising in the promotion of the Breast Screening Programme and what the role of advertising might be. Four hundred and sixty questionnaires were completed by women attending their breast screening appointment. Quantitative and qualitative data were collected from the static unit at Calder Street and the mobile unit in Govan. The advertising (budget 30,000 Pounds) campaign ran over an eight week period in the Govan, Paisley Road West and Cardonald areas of Glasgow. Media used included press advertising, The Glasgow Underground, adshells, bus advertising (interiors) and poster distribution via local outlets. Forty-two per cent of the sample were aware of the campaign. Ninety-seven per cent liked the campaign images. Eighty eight per cent felt that breast screening should be advertised more. Screening uptake increased in the areas covered by the advertising campaign. Govan -58%-71% and Ibrox (Paisley Road West and Cardonald) -59%-61%. Women were very supportive of the role of advertising for the Breast Screening Programme. In particular they found the campaign images and messages reassuring, supportive and credible. Their views suggest that the role of advertising should be: To raise awareness of the service To make women more conscious of the benefits of screening To change public perceptions of the screening process However, it is recognised that a fully integrated approach is required for the promotion of the service to account for the improvement in uptake, as advertising cannot be expected to work in isolation.

  19. Tumour screening by means of tomography methods

    International Nuclear Information System (INIS)

    Diederich, S.

    2005-01-01

    Tomography methods such as computer tomography (CT), magnetic resonance tomography (MRT), and sonography/ultrasound examinations make it possible to detect small asymptomatic tumours, thus potentially preventing their manifestation at an advanced stage and improving survival prospects for the patients concerned. There are data available on various common tumours which show that modern tomography methods are capable of detecting not only small asymptomatic tumours but also their benign precursors (e.g. polyps of the large intestine). This has been demonstrated for lung cancer, colon cancer and breast cancer. However, it has not been possible to date to show for any tomography method or any type of tumour that the systematic use of such diagnostic procedures does anything to lower the mortality rate for that tumour. For other types of tumour (pancreatic cancer, kidney cancer, ovary cancer) the above named methods are either not sufficiently sensitive or the body of data that has accumulated on their respective use is too small to judge the benefit of tomography screenings. Current technical developments make it appear probable that for many types of cancer the reliability with which small tumours can be detected will improve in future. Studies aimed at clarifying the potential of screenings for reducing mortality rates are already underway for lung cancer and would be worthwhile performing for other tumour types

  20. Screening in dense ionic fluids

    International Nuclear Information System (INIS)

    Tosi, M.P.

    1991-01-01

    There has been great progress in recent years in determining and understanding the structure of molten salts. I focus on molten alkali halides and discuss two main points concerning their liquid structure and its relationship with static electrical response in these dense ionic conductors. These are (i) the nature of screening and the related definitions and properties of the screening length and of the dielectric function, and (ii) developments in integral equations techniques for the evaluation of molten salt structure and static screening from given pair potentials. (author). 26 refs, 3 figs, 2 tabs

  1. Virtual screening of compound libraries.

    Science.gov (United States)

    Cerqueira, Nuno M F S A; Sousa, Sérgio F; Fernandes, Pedro A; Ramos, Maria João

    2009-01-01

    During the last decade, Virtual Screening (VS) has definitively established itself as an important part of the drug discovery and development process. VS involves the selection of likely drug candidates from large libraries of chemical structures by using computational methodologies, but the generic definition of VS encompasses many different methodologies. This chapter provides an introduction to the field by reviewing a variety of important aspects, including the different types of virtual screening methods, and the several steps required for a successful virtual screening campaign within a state-of-the-art approach, from target selection to postfilter application. This analysis is further complemented with a small collection important VS success stories.

  2. Intensifying screens in transaxial tomography

    International Nuclear Information System (INIS)

    Debelder, M.H.; Bollen, R.H.

    1981-01-01

    This patent claim by Agfa-Gevaert relates to a method for the production of transaxial tomographs, a combination of materials therefor and X-ray intensifying screens incorporating at least one reflecting element for use in transaxial tomography, wherein the exposure of a photographic silver halide emulsion material proceeds at an angle within the range of 2 0 to 10 0 in conjunction with an X-ray fluorescent intensifying screen including an ultra-violet and/or visible radiation reflective coating or sheet to increase the radiation output of the screen and to reduce the exposure time and radiation dose e.g. in medical X-ray applications. (author)

  3. Newborn Screening: MedlinePlus Health Topic

    Science.gov (United States)

    ... more articles Reference Desk Glossary (National Center for Biotechnology Information) Find an Expert Eunice Kennedy Shriver National ... other than English on Newborn Screening NIH MedlinePlus Magazine Hearing Loss: Screening Newborns Screening Newborns' Hearing Now ...

  4. BREAST CANCER SCREENING IN A RESOURCE POOR ...

    African Journals Online (AJOL)

    al rates of breast cancer, hence screening of asympto- matic, apparently healthy ... screening tools in women who attended free breast cancer screening exercise in a ..... signs of malignancy. www.appliedradiology.mobi/uploadedfiles/Issues/2.

  5. Risk Profiling May Improve Lung Cancer Screening

    Science.gov (United States)

    A new modeling study suggests that individualized, risk-based selection of ever-smokers for lung cancer screening may prevent more lung cancer deaths and improve the effectiveness and efficiency of screening compared with current screening recommendations

  6. Advanced CANDU reactors

    International Nuclear Information System (INIS)

    Dunn, J.T.; Finlay, R.B.; Olmstead, R.A.

    1988-12-01

    AECL has undertaken the design and development of a series of advanced CANDU reactors in the 700-1150 MW(e) size range. These advanced reactor designs are the product of ongoing generic research and development programs on CANDU technology and design studies for advanced CANDU reactors. The prime objective is to create a series of advanced CANDU reactors which are cost competitive with coal-fired plants in the market for large electricity generating stations. Specific plant designs in the advanced CANDU series will be ready for project commitment in the early 1990s and will be capable of further development to remain competitive well into the next century

  7. Advances in chemical Physics

    CERN Document Server

    Rice, Stuart A

    2011-01-01

    The Advances in Chemical Physics series-the cutting edge of research in chemical physics The Advances in Chemical Physics series provides the chemical physics and physical chemistry fields with a forum for critical, authoritative evaluations of advances in every area of the discipline. Filled with cutting-edge research reported in a cohesive manner not found elsewhere in the literature, each volume of the Advances in Chemical Physics series offers contributions from internationally renowned chemists and serves as the perfect supplement to any advanced graduate class devoted to the study of che

  8. Advances in chemical physics

    CERN Document Server

    Rice, Stuart A

    2012-01-01

    The Advances in Chemical Physics series-the cutting edge of research in chemical physics The Advances in Chemical Physics series provides the chemical physics field with a forum for critical, authoritative evaluations of advances in every area of the discipline. Filled with cutting-edge research reported in a cohesive manner not found elsewhere in the literature, each volume of the Advances in Chemical Physics series serves as the perfect supplement to any advanced graduate class devoted to the study of chemical physics. This volume explores: Quantum Dynamical Resonances in Ch

  9. Advances in chemical physics

    CERN Document Server

    Rice, Stuart A

    2011-01-01

    The Advances in Chemical Physics series-the cutting edge of research in chemical physics The Advances in Chemical Physics series provides the chemical physics and physical chemistry fields with a forum for critical, authoritative evaluations of advances in every area of the discipline. Filled with cutting-edge research reported in a cohesive manner not found elsewhere in the literature, each volume of the Advances in Chemical Physics series offers contributions from internationally renowned chemists and serves as the perfect supplement to any advanced graduate class devoted to the study of che

  10. ACR-700 advanced technologies

    International Nuclear Information System (INIS)

    Tapping, R.L.; Turner, C.W.; Yu, S.K.W.; Olmstead, R.; Speranzini, R.A.

    2004-01-01

    A successful advanced reactor plant will have optimized economics including reduced operating and maintenance costs, improved performance, and enhanced safety. Incorporating improvements based on advanced technologies ensures cost, safety and operational competitiveness of the ACR-700. These advanced technologies include modern configuration management; construction technologies; operational technology for the control centre and information systems for plant monitoring and analysis. This paper summarizes the advanced technologies used to achieve construction and operational improvements to enhance plant economic competitiveness, advances in the operational technology used for reactor control, and presents the development of the Smart CANDU suite of tools and its application to existing operating reactors and to the ACR-700. (author)

  11. Inventions on GUI for Touch Sensitive Screens

    OpenAIRE

    Mishra, Umakant

    2014-01-01

    A touch sensitive screen displays the information on the screen and also receives the input by sensing a user's touch on the same screen. This mechanism facilitates system interaction directly through the screen without needing a mouse or keyboard. This method has the advantage to make the system compact by removing keyboard, mouse and similar interactive device. However there are certain difficulties to implement a touch screen interface. The display screens of portable devices are becoming ...

  12. Mining collections of compounds with Screening Assistant 2.

    Science.gov (United States)

    Guilloux, Vincent Le; Arrault, Alban; Colliandre, Lionel; Bourg, Stéphane; Vayer, Philippe; Morin-Allory, Luc

    2012-08-31

    High-throughput screening assays have become the starting point of many drug discovery programs for large pharmaceutical companies as well as academic organisations. Despite the increasing throughput of screening technologies, the almost infinite chemical space remains out of reach, calling for tools dedicated to the analysis and selection of the compound collections intended to be screened. We present Screening Assistant 2 (SA2), an open-source JAVA software dedicated to the storage and analysis of small to very large chemical libraries. SA2 stores unique molecules in a MySQL database, and encapsulates several chemoinformatics methods, among which: providers management, interactive visualisation, scaffold analysis, diverse subset creation, descriptors calculation, sub-structure / SMART search, similarity search and filtering. We illustrate the use of SA2 by analysing the composition of a database of 15 million compounds collected from 73 providers, in terms of scaffolds, frameworks, and undesired properties as defined by recently proposed HTS SMARTS filters. We also show how the software can be used to create diverse libraries based on existing ones. Screening Assistant 2 is a user-friendly, open-source software that can be used to manage collections of compounds and perform simple to advanced chemoinformatics analyses. Its modular design and growing documentation facilitate the addition of new functionalities, calling for contributions from the community. The software can be downloaded at http://sa2.sourceforge.net/.

  13. Mining collections of compounds with Screening Assistant 2

    Directory of Open Access Journals (Sweden)

    Guilloux Vincent

    2012-08-01

    Full Text Available Abstract Background High-throughput screening assays have become the starting point of many drug discovery programs for large pharmaceutical companies as well as academic organisations. Despite the increasing throughput of screening technologies, the almost infinite chemical space remains out of reach, calling for tools dedicated to the analysis and selection of the compound collections intended to be screened. Results We present Screening Assistant 2 (SA2, an open-source JAVA software dedicated to the storage and analysis of small to very large chemical libraries. SA2 stores unique molecules in a MySQL database, and encapsulates several chemoinformatics methods, among which: providers management, interactive visualisation, scaffold analysis, diverse subset creation, descriptors calculation, sub-structure / SMART search, similarity search and filtering. We illustrate the use of SA2 by analysing the composition of a database of 15 million compounds collected from 73 providers, in terms of scaffolds, frameworks, and undesired properties as defined by recently proposed HTS SMARTS filters. We also show how the software can be used to create diverse libraries based on existing ones. Conclusions Screening Assistant 2 is a user-friendly, open-source software that can be used to manage collections of compounds and perform simple to advanced chemoinformatics analyses. Its modular design and growing documentation facilitate the addition of new functionalities, calling for contributions from the community. The software can be downloaded at http://sa2.sourceforge.net/.

  14. Generalizability of results from the National Lung Screening Trial

    International Nuclear Information System (INIS)

    Heuvers, Marlies E.; Wisnivesky, Juan; Stricker, Bruno H.; Aerts, Joachim G.

    2012-01-01

    Lung cancer is the major cause of cancer-related death worldwide, with a 5-year survival of only 16 %. Most lung cancer cases are diagnosed at an advanced incurable stage. As earlier stages have a better prognosis, the key to reducing mortality could be early diagnosis of the disease. At present, low-dose computed tomographic (CT) screening has shown promising data. Lung cancer death rates were reduced by 20 % when CT screening is compared to chest radiography in a high-risk group. There are many advantages of CT screening in lung cancer, however there are also some important issues that should be taken into account. Therefore, the applicability of the results to clinical practice is not clear yet. In this Commentary we discuss different aspects that play important roles in the balance between harms and benefits of screening, including overdiagnosis, availability of treatment options worldwide, ethical considerations, costs, and prolonged life expectancy. We conclude that clinicians should be cautious in generalizing findings to the total population of smokers and take into account that the use of lung cancer screening in clinical practice may have limitations.

  15. Mining collections of compounds with Screening Assistant 2

    Science.gov (United States)

    2012-01-01

    Background High-throughput screening assays have become the starting point of many drug discovery programs for large pharmaceutical companies as well as academic organisations. Despite the increasing throughput of screening technologies, the almost infinite chemical space remains out of reach, calling for tools dedicated to the analysis and selection of the compound collections intended to be screened. Results We present Screening Assistant 2 (SA2), an open-source JAVA software dedicated to the storage and analysis of small to very large chemical libraries. SA2 stores unique molecules in a MySQL database, and encapsulates several chemoinformatics methods, among which: providers management, interactive visualisation, scaffold analysis, diverse subset creation, descriptors calculation, sub-structure / SMART search, similarity search and filtering. We illustrate the use of SA2 by analysing the composition of a database of 15 million compounds collected from 73 providers, in terms of scaffolds, frameworks, and undesired properties as defined by recently proposed HTS SMARTS filters. We also show how the software can be used to create diverse libraries based on existing ones. Conclusions Screening Assistant 2 is a user-friendly, open-source software that can be used to manage collections of compounds and perform simple to advanced chemoinformatics analyses. Its modular design and growing documentation facilitate the addition of new functionalities, calling for contributions from the community. The software can be downloaded at http://sa2.sourceforge.net/. PMID:23327565

  16. From virtuality to reality - Virtual screening in lead discovery and lead optimization: a medicinal chemistry perspective.

    Science.gov (United States)

    Rester, Ulrich

    2008-07-01

    Drug discovery and development is an interdisciplinary, expensive and time-consuming process. Scientific advancements during the past two decades have altered the way pharmaceutical research produces novel bio-active molecules. Advances in computational techniques and hardware solutions have enabled in silico methods, and in particular virtual screening, to speed up modern lead identification and lead optimization. Recent successes have proven the power of combining virtual screening with complementary and synergistic biophysical methods, such as X-ray crystallography, NMR spectroscopy and isothermal titration calorimetry (ITC). This review addresses key issues, challenges and recent improvements of virtual screening methods and strategies. Examples highlighting the impact of an integrated virtual screening and biophysical characterization platform in the lead identification and optimization process are presented and discussed.

  17. Effectiveness of testis cancer screening

    International Nuclear Information System (INIS)

    Feucht, H.

    1983-04-01

    In the Federal Republic of Germany there are about thousand to two-thousand incidences of testis cancer yearly. The screening (and examination) program currently used for the early detection of cancer includes the screening of malignant tumours of the testis. Since only males 45 years and older are invited to make use of the preventive measures, the most seriously affected age-group between twenty and forty is hereby not considered. The objective of this study is to find out which of the generally conceivable preventive measures could lead to an improvement of the present situation. The analysis shows that, for a diagnostic accuracy of 1 and a participation of 100%, the quantifyable cost of a yearly performed special screening is higher than the quantifyable cost savings achieved. A final judgement of other ways of execution is only possible when the diagnostic accuracy of suitable screening methods and the percentage of the participants of the groups of people concerned are known. (orig.)

  18. RAS - Screens & Assays - Drug Discovery

    Science.gov (United States)

    The RAS Drug Discovery group aims to develop assays that will reveal aspects of RAS biology upon which cancer cells depend. Successful assay formats are made available for high-throughput screening programs to yield potentially effective drug compounds.

  19. Screening for Abdominal Aortic Aneurysm

    Science.gov (United States)

    ... benefits. When there is not enough evidence to judge benefits and harms, the Task Force does not ... nurse practitioners, physician assistants, and nurses. selectively offer Decide whether screening is right for a patient on ...

  20. Screening Tests for Birth Defects

    Science.gov (United States)

    ... that best fit your needs. What are the advantages and disadvantages of diagnostic tests compared with screening ... Us Contact Us Copyright Information Privacy Statement RSS Advertising Opportunities Careers at ACOG Sitemap Website Feedback American ...

  1. PHYTOCHEMICAL SCREENING AND THROMBOLYTIC ACTIVITY ...

    African Journals Online (AJOL)

    2014-12-31

    Dec 31, 2014 ... followed by chemical screening, random selection followed by one or more biological ... These were identified by characteristic color changes .... [1] Samuelsson, G. Drugs of Natural Origin: A Textbook of Pharmacognosy.

  2. X-ray screening materials

    International Nuclear Information System (INIS)

    Wardley, R.B.

    1981-01-01

    This invention relates to x-ray screening materials and especially to materials in sheet form for use in the production of, for example, protective clothing such as aprons and lower back shields, curtains, mobile screens and suspended shields. The invention is based on the observation that x-ray screening materials in sheet form having greater flexiblity than the hitherto known x-ray screening materials of the same x-ray absorber content can be produced if, instead of using a single sheet of filled sheet material of increased thickness, one uses a plurality of sheets of lesser thickness together forming a laminar material of the desired thickness and one bonds the individual sheets together at their edges and, optionally, at other spaced apart points away from the edges thereby allowing one sheet to move relative to another. (U.K.)

  3. Risks of Lung Cancer Screening

    Science.gov (United States)

    ... in women. Different factors increase or decrease the risk of lung cancer. Anything that increases your chance ... been studied to see if they decrease the risk of dying from lung cancer. The following screening ...

  4. Pennsylvania's experience in mass screening

    International Nuclear Information System (INIS)

    Gerusky, T.M.

    1975-01-01

    A policy statement issued in 1972 by the Assistant Secretary for Health and Scientific Affairs of the Department of Health, Education, and Welfare recommended that community chest x-ray surveys should not be used as a screening procedure for the detection of cardiopulmonary disorders and that when chest x-ray screening programs are justified for selected population groups, the full size photograph, rather than the miniature film, is preferred. A survey conducted in 1974--75 revealed that chest x rays were required for prisoners, prison employees, school employees, food handlers, and students who wished to participate in sports. Meetings were held with medical associations in the hope of stopping the local mass-screening operations. Of 27 groups in Pennsylvania involved in tuberculosis screening, 12 groups refused or were unwilling to phase out their photofluorographic procedures. The problem will be resolved by regulation

  5. Transforming Security Screening With Biometrics

    National Research Council Canada - National Science Library

    Hearnsberger, Brian J

    2003-01-01

    ... and identity theft to dramatically improve physical security. Today, biometric technology could be implemented to transform physical security by enhancing screening procedures currently in use at U.S...

  6. Laboratory screening markers in gastroenterology--state of the art.

    Science.gov (United States)

    Kocna, Petr; Vanickova, Zdislava; Zima, Tomas

    2013-06-01

    Screening tests for gastrointestinal diseases acceptable for population with a high sensitivity and high specificity can now be offered by clinical laboratories. This paper summarizes major recent advances in this area of laboratory medicine. Relevant articles published within the last 5 years in the NLM (National Library of Medicine) PubMed - Medline database covering the three gastrointestinal diseases - colorectal cancer, coeliac disease, and atrophic gastritis were included for this overview. In Europe, colorectal cancer (CRCA) is the second most frequent malignant disease. Quantitative immunochemical analysis of the stool for haemoglobin provides the best screening test to date, with both sensitivity and specificity approaching 95%. Even though coeliac disease (CD) affects approximately 1% of the general population, it remains largely unrecognised. Recommended methods for screening currently involve the detection of IgA and IgG antibodies against tissue transglutaminase and deamidated gliadin peptide. Evaluations of screening are now discussed for other diseases of the gastrointestinal tract - such as chronic atrophic gastritis (CAG), and inflammatory bowel disease (IBD). Detection of infection by Helicobacter pylori and stomach-specific plasmatic biomarkers, especially pepsinogen I/II ratio, could help with the prevention of gastric carcinomas. The use of faecal calprotectin as a screening test could substantially reduce the number of invasive methods necessary for the diagnostic work-up of patients with IBD. Screening tests for CRCA and CD have been used worldwide for many years. Screening strategies for gastrointestinal diseases are suggested in the text, based on recent basic science, clinical papers as well as our own experience.

  7. THE DEVELOPMENT OF SCREEN TRANSLATION

    OpenAIRE

    Sang Ayu Isnu Maharani

    2014-01-01

    Screen translations involve oral translation known as dubbing and revoicing. Re-voicing consists of lip-sync dubbing, free commentary, narration and voice over. The written version is called subtitle. Dubbing and subtitling are two preferred mode used in the screen translation even though various numbers of current options are available nowadays. Dubbing commenced to be used in larger countries in Europe meanwhile smaller countries apply subtitling because it is more...

  8. Industrial radiography with phosphor screens

    International Nuclear Information System (INIS)

    Broadhead, P.

    1981-01-01

    An experimental system that comprises a film of low silver content and a pair of high resolution phosphor intensifying screens and a commercial industrial X-ray film of similar speed are compared for image quality. It is concluded that the use of phosphor screens offers an increase in image quality when the information is limited by the graininess or quantum mottle of a radiograph which is frequently the case in practical radiography. (author)

  9. Stem cells: a model for screening, discovery and development of drugs.

    Science.gov (United States)

    Kitambi, Satish Srinivas; Chandrasekar, Gayathri

    2011-01-01

    The identification of normal and cancerous stem cells and the recent advances made in isolation and culture of stem cells have rapidly gained attention in the field of drug discovery and regenerative medicine. The prospect of performing screens aimed at proliferation, directed differentiation, and toxicity and efficacy studies using stem cells offers a reliable platform for the drug discovery process. Advances made in the generation of induced pluripotent stem cells from normal or diseased tissue serves as a platform to perform drug screens aimed at developing cell-based therapies against conditions like Parkinson's disease and diabetes. This review discusses the application of stem cells and cancer stem cells in drug screening and their role in complementing, reducing, and replacing animal testing. In addition to this, target identification and major advances in the field of personalized medicine using induced pluripotent cells are also discussed.

  10. Fish screens at hydroelectric diversions

    International Nuclear Information System (INIS)

    Ott, R.F.

    1994-01-01

    Preventing downstream migrating fish from entering the turbines at hydroelectric projects is a standard mitigation goal of state and federal fishery management agencies. The object is to minimize the adverse impacts to the fish associated with the exclusion and passage through the bypass water conveyance facilities. In the western United States, most of the fishery management agencies have fish screen design criteria that focus on the approach and transportational velocities, maximum opening dimensions of the screen material, and the cleaning standards. Recently, more attention has been given to fish behavioral traits such as attraction and sustained and darting swimming speed, which has resulted in more attention to the position of the screens to the flow and the length of time the downstream migrants are exposed to the screens. Criteria for length of time of exposure, size and position of bypass, flow and velocities in the bypass entrances, discharge requirements back into the receiving water, and exposure to predation have created unique challenges to the fish screen designer. This paper discusses some of the more recent types of fixed fish screens that are being installed at hydroelectric plants that meet these challenges

  11. Retinopathy of prematurity screening criteria in Iran: new screening guidelines.

    Science.gov (United States)

    Roohipoor, Ramak; Karkhaneh, Reza; Farahani, Afsar; Ebrahimiadib, Nazanin; Modjtahedi, Bobeck; Fotouhi, Akbar; Yaseri, Mehdi; Khodabande, Alireza; Zarei, Mohammad; Imani Fuladi, Marjan; Taheri, Arash; Riazi Esfahani, Mohammad; Loewenstein, John

    2016-07-01

    To test the applicability of existing retinopathy of prematurity (ROP) guidelines on Iranian patients and to develop novel ROP screening criteria in Iran. Both eyes of 1932 infants born ≤37 weeks of gestation and/or weighting ≤3000 g were included in this prospective cohort study that was conducted across nine neonatal intensive care units and a tertiary eye hospital ROP clinic. The patients were examined for ROP and the need for treatment (type 1 ROP or worse). All the patients were screened 4 weeks after birth or at 31 weeks of postmenstrual age, whichever was later. The patients were followed until retinal vascularisation was completed or the patients reached 50 weeks of gestational age (GA) without prethreshold ROP. A receiver operating characteristic curve was used to determine the best screening criteria for ROP. Screening criteria from other countries were applied to our patient data to determine their ability to appropriately detect ROP. Patients with ROP requiring treatment. The mean GA±SD and birth weight (BW)±SD of the screened patients were 32±2.7 weeks and 1713±516 g, respectively. Using criteria of GA≤32 weeks or BW ≤2000 yielded sensitivity and specificity of 100% and 26.7%, respectively, for treatment requiring ROP regardless of clinical comorbidities. Using screening recommendations of American Academy of Pediatrics would miss 25.4% of ROP and 8.4%ROP requiring treatment in our cohort. Other countries screening recommendations would result in a significant amount of missed cases of treatment requiring ROP when applied to Iran. As a result, we have proposed new guidelines for premature babies in Iran. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  12. Dynamic screening and electron dynamics in low-dimensional metal systems

    International Nuclear Information System (INIS)

    Silkin, V.M.; Quijada, M.; Vergniory, M.G.; Alducin, M.; Borisov, A.G.; Diez Muino, R.; Juaristi, J.I.; Sanchez-Portal, D.; Chulkov, E.V.; Echenique, P.M.

    2007-01-01

    Recent advances in the theoretical description of dynamic screening and electron dynamics in metallic media are reviewed. The time-dependent building-up of screening in different situations is addressed. Perturbative and non-perturbative theories are used to study electron dynamics in low-dimensional systems, such as metal clusters, image states, surface states and quantum wells. Modification of the electronic lifetimes due to confinement effects is analyzed as well

  13. Variations in screening outcome among pairs of screening radiologists at non-blinded double reading of screening mammograms: a population-based study

    NARCIS (Netherlands)

    Klompenhouwer, E. G.; Duijm, L. E. M.; Voogd, A. C.; den Heeten, G. J.; Nederend, J.; Jansen, F. H.; Broeders, M. J. M.

    2014-01-01

    Substantial inter-observer variability in screening mammography interpretation has been reported at single reading. However, screening results of pairs of screening radiologists have not yet been published. We determined variations in screening performances among pairs of screening radiologists at

  14. Advanced Cancer Detection Center

    National Research Council Canada - National Science Library

    Ruckdeschel, John

    1999-01-01

    ... through screening, and the testing of methods to prevent cancer. In addition, the Center created and supports education programs to provide increased cancer awareness and established working collaborations with the James...

  15. Cancer Screening Practice among Iranian Middle-aged Women

    Directory of Open Access Journals (Sweden)

    Behnaz Enjezab

    2016-10-01

    Full Text Available Background & aim: Breast, cervical, and colorectal cancers are the leading causes of mortality among women, the incidence rate of which has an upward trend with advancing age. Although cost-effective, easy, and available screening programs can help control these types of cancer in their early stages, it seems that cancer screening programs have not been implemented effectively. In this study, we investigated the rate of cancer screening practice in middle-aged women and explained the influential factors. Methods: This cross-sectional study with a sequential mixed method approach was conducted on 483 middle-age women selected through cluster random sampling in Yazd, Iran. Data were obtained by a research made questionnaire and analyzed with descriptive statistics and performing Pearson product-moment correlation, Student’s t-test, and One-way ANOVA tests, using SPSS version 16. In the second phase of the study, qualitative, semi-structured interviews were performed and data were analyzed through content analysis. Results: The majority of the subjects had never been screened for cancer through mammogram (87.7%, Pap test (64.2%, or fecal occult blood test (FOBT (89.8%. Educational level, employment status, perceived adequacy of income, perceived health status, and the number of children were significantly associated with breast and colon cancer screening practice. Qualitative data showed that lack of knowledge, the cost of screening exams, lack of financial independence, negligence of spouse, fear of cancer, embarrassment, and belief in destiny were the main reasons for non-adherence to cancer screening tests. In addition, knowledge and observing cancer in acquaintances and relatives were the main motivators of cancer screening. Conclusion: Middle-aged housewives, as well as women with low educational level and income were the most vulnerable groups, who did not adhere to cancer screening. Planning and management of cancer preventive programs and

  16. Screening_mgmt: a Python module for managing screening data.

    Science.gov (United States)

    Helfenstein, Andreas; Tammela, Päivi

    2015-02-01

    High-throughput screening is an established technique in drug discovery and, as such, has also found its way into academia. High-throughput screening generates a considerable amount of data, which is why specific software is used for its analysis and management. The commercially available software packages are often beyond the financial limits of small-scale academic laboratories and, furthermore, lack the flexibility to fulfill certain user-specific requirements. We have developed a Python module, screening_mgmt, which is a lightweight tool for flexible data retrieval, analysis, and storage for different screening assays in one central database. The module reads custom-made analysis scripts and plotting instructions, and it offers a graphical user interface to import, modify, and display the data in a uniform manner. During the test phase, we used this module for the management of 10,000 data points of various origins. It has provided a practical, user-friendly tool for sharing and exchanging information between researchers. © 2014 Society for Laboratory Automation and Screening.

  17. Melanoma and medical education: student’s perceptions of skin cancer screening in three medical schools

    Directory of Open Access Journals (Sweden)

    Margaret Finn

    2018-04-01

    Full Text Available Background: This study evaluated how the level of medical education affected confidence of counseling on skin health, performing skin examinations, and the likelihood of using those skills in future screenings. Material and Methods: An online survey was distributed to students at three midwest medical schools that assessed sun protection behaviors, and the student’s perception of education and comfort on the complete skin examination and counseling on skin health. Results: 51.6% (n=243 indicated they were in the last two years of medical school and were considered advanced students, compared to less advanced students in the first two years. Advanced students were significantly more comfortable in performing a complete skin examination and counseling patients on skin health when compared to less advanced students (p < 0.001. However, they were also statistically less likely to indicate they would provide skin screening on future patients when compared to less advanced students (p < 0.001. Only 29.5% (n = 139 and 60.7% (n = 286 of students indicated they had been educated on performing a complete skin examination and counseling on skin health, respectively. Conclusions: Although advanced students were more likely to report education and comfortability in skin cancer screening they were not as likely to indicate they would practice these skills in the future compared to less advanced students. Also, only a small number of students perceived themselves to be educated in these aspects.

  18. Japan's advanced medicine.

    Science.gov (United States)

    Sho, Ri; Narimatsu, Hiroto; Murakami, Masayasu

    2013-10-01

    Like health care systems in other developed countries, Japan's health care system faces significant challenges due to aging of the population and economic stagnation. Advanced medicine (Senshin Iryou) is a unique system of medical care in Japan offering highly technology-driven medical care that is not covered by public health insurance. Advanced medicine has recently developed and expanded as part of health care reform. Will it work? To answer this question, we briefly trace the historical development of advanced medicine and describe the characteristics and current state of advanced medical care in Japan. We then offer our opinions on the future of advanced medicine with careful consideration of its pros and cons. We believe that developing advanced medicine is an attempt to bring health care reform in line rather than the goal of health care reform.

  19. Advanced accumulator for PWR

    International Nuclear Information System (INIS)

    Ichimura, Taiki; Chikahata, Hideyuki

    1997-01-01

    Advanced accumulators have been incorporated into the APWR design in order to simplify the safety system configuration and to improve reliability. The advanced accumulators refill the reactor vessel with a large discharge flow rate in a large LOCA, then switch to a small flow rate to continue safety injection for core reflooding. The functions of the conventional accumulator and the low head safety injection pump are integrated into this advanced accumulator. Injection performance tests simulating LOCA conditions and visualization tests for new designs have been carried out. This paper describes the APWR ECCS configuration, the advanced accumulator design and some of the injection performance and visualization test results. It was verified that the flow resistance of the advanced accumulator is independent of the model scale. The similarity law and performance data of the advanced accumulator for applying APWR was established. (author)

  20. CLAD DEGRADATION - FEPS SCREENING ARGUMENTS

    International Nuclear Information System (INIS)

    R. Schreiner

    2004-01-01

    The purpose of this report is to evaluate and document the screening of the clad degradation features, events, and processes (FEPs) with respect to modeling used to support the Total System Performance Assessment-License Application (TSPA-LA). This report also addresses the effect of certain FEPs on both the cladding and the commercial spent nuclear fuel (CSNF), DOE-owned spent nuclear fuel (DSNF), and defense high-level waste (DHLW) waste forms, as appropriate to address the effects on multiple materials and both components (FEPs 2.1.09.09.0A, 2.1.09.11.0A, 2.1.11.05.0A, 2.1.12.02.0A, and 2.1.12.03.0A). These FEPs are expected to affect the repository performance during the postclosure regulatory period of 10,000 years after permanent closure. Table 1-1 provides the list of cladding FEPs, including their screening decisions (include or exclude). The primary purpose of this report is to identify and document the analysis, screening decision, and TSPA-LA disposition (for included FEPs) or screening argument (for excluded FEPs) for these FEPs related to clad degradation. In some cases, where a FEP covers multiple technical areas and is shared with other FEP reports, this report may provide only a partial technical basis for the screening of the FEP. The full technical basis for shared FEPs is addressed collectively by the sharing FEP reports. The screening decisions and associated TSPA-LA dispositions or screening arguments from all of the FEP reports are cataloged in a project-specific FEPs database

  1. Interval Cancers in a Population-Based Screening Program for Colorectal Cancer in Catalonia, Spain

    Directory of Open Access Journals (Sweden)

    M. Garcia

    2015-01-01

    Full Text Available Objective. To analyze interval cancers among participants in a screening program for colorectal cancer (CRC during four screening rounds. Methods. The study population consisted of participants of a fecal occult blood test-based screening program from February 2000 to September 2010, with a 30-month follow-up (n = 30,480. We used hospital administration data to identify CRC. An interval cancer was defined as an invasive cancer diagnosed within 30 months of a negative screening result and before the next recommended examination. Gender, age, stage, and site distribution of interval cancers were compared with those in the screen-detected group. Results. Within the study period, 97 tumors were screen-detected and 74 tumors were diagnosed after a negative screening. In addition, 17 CRC (18.3% were found after an inconclusive result and 2 cases were diagnosed within the surveillance interval (2.1%. There was an increase of interval cancers over the four rounds (from 32.4% to 46.0%. When compared with screen-detected cancers, interval cancers were found predominantly in the rectum (OR: 3.66; 95% CI: 1.51–8.88 and at more advanced stages (P=0.025. Conclusion. There are large numbers of cancer that are not detected through fecal occult blood test-based screening. The low sensitivity should be emphasized to ensure that individuals with symptoms are not falsely reassured.

  2. Advances in Applied Mechanics

    OpenAIRE

    2013-01-01

    Advances in Applied Mechanics draws together recent significant advances in various topics in applied mechanics. Published since 1948, Advances in Applied Mechanics aims to provide authoritative review articles on topics in the mechanical sciences, primarily of interest to scientists and engineers working in the various branches of mechanics, but also of interest to the many who use the results of investigations in mechanics in various application areas, such as aerospace, chemical, civil, en...

  3. Advanced fuels safety comparisons

    International Nuclear Information System (INIS)

    Grolmes, M.A.

    1977-01-01

    The safety considerations of advanced fuels are described relative to the present understanding of the safety of oxide fueled Liquid Metal Fast Breeder Reactors (LMFBR). Safety considerations important for the successful implementation of advanced fueled reactors must early on focus on the accident energetics issues of fuel coolant interactions and recriticality associated with core disruptive accidents. It is in these areas where the thermal physical property differences of the advanced fuel have the greatest significance

  4. Overdiagnosis in breast cancer screening: The impact of study design and calculations.

    Science.gov (United States)

    Lynge, Elsebeth; Beau, Anna-Belle; Christiansen, Peer; von Euler-Chelpin, My; Kroman, Niels; Njor, Sisse; Vejborg, Ilse

    2017-07-01

    Overdiagnosis in breast cancer screening is an important issue. A recent study from Denmark concluded that one in three breast cancers diagnosed in screening areas in women aged 50-69 years were overdiagnosed. The purpose of this short communication was to disentangle the study's methodology in order to evaluate the soundness of this conclusion. We found that both the use of absolute differences as opposed to ratios; the sole focus on non-advanced tumours and the crude allocation of tumours and person-years by screening history for women aged 70-84 years, all contributed to the very high estimate of overdiagnosis. Screening affects cohorts of screened women. Danish registers allow very accurate mapping of the fate of every woman. We should be past the phase where studies of overdiagnosis are based on the fixed age groups from routine statistics. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  5. Influence of screening on longitudinal-optical phonon scattering in quantum cascade lasers

    International Nuclear Information System (INIS)

    Ezhov, Ivan; Jirauschek, Christian

    2016-01-01

    We theoretically investigate the influence of screening on electron-longitudinal optical phonon scattering in quantum cascade lasers. By employing ensemble Monte Carlo simulations, an advanced screening model based on the random-phase approximation is compared to the more elementary Thomas-Fermi and Debye models. For mid-infrared structures, and to a lesser extent also for terahertz designs, the inclusion of screening is shown to affect the simulated current and optical output power. Furthermore, it is demonstrated that by using the electron temperature rather than the lattice temperature, the Debye model can be significantly improved

  6. Advanced Photon Source (APS)

    Data.gov (United States)

    Federal Laboratory Consortium — The Advanced Photon Source (APS) at the U.S. Department of Energy's Argonne National Laboratoryprovides this nation's (in fact, this hemisphere's) brightest storage...

  7. Advanced Simulation Center

    Data.gov (United States)

    Federal Laboratory Consortium — The Advanced Simulation Center consists of 10 individual facilities which provide missile and submunition hardware-in-the-loop simulation capabilities. The following...

  8. Advanced Manufacturing Laboratory

    Data.gov (United States)

    Federal Laboratory Consortium — The Advanced Manufacturing Laboratory at the University of Maryland provides the state of the art facilities for realizing next generation products and educating the...

  9. Screening on urogenital Chlamydia trachomatis

    Directory of Open Access Journals (Sweden)

    Busse, Reinhard

    2005-12-01

    Full Text Available Introduction: Around 92 million urogenital infections are caused yearly by Chlamydia trachomatis worldwide [1]. The overall incidence of sexually transmitted diseases is increasing, as shown by the increases in the number of reported cases of syphilis and gonorrhea [2]. Chlamydia trachomatis infections are associated with various serious diseases in women, men and newborns, which could be, at least partially, avoided by means of early diagnosis and therapy. The Federal Joint Committee - responsible for decision-making concerning the benefit package of the German Social Health Insurance - has publicly announced the starting of deliberations on the issue of screening for Chlamydia trachomatis. Research Questions: The leading question to be answered is whether screening for Chlamydia trachomatis should be included in the German benefit basket. The aim of this report is to provide a summary of the available evidence concerning the issue of screening for Chlamydia trachomatis. Methods: The summary of published scientific evidence, including HTA reports, systematic reviews, guidelines and primary research is represented. The synthesis follows the structure given by the criteria of Wilson and Jungner [3] for the introduction of screening in a population: relevance of the condition, availability of an adequate test, effectiveness of screening, acceptance of the programme, and economical issues. A literature search was conducted for each aspect of the synthesis and the evidence has been summarised in evidence tables. Results: We identified five HTA reports from three European agencies [4], [5], [6], [7] and one from the USA [8]. In addition, we identified four guidelines from Northamerica [9], [10], [11], [12] and one from Europe [13]. A total of 56 primary research publications were included: relevance of the disease (n=26, availability of test (n=1, effectiveness of screening (n=11, acceptance of the programme (n=11, economical issues (n=7. Discussion

  10. 20 CFR 654.408 - Screening.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Screening. 654.408 Section 654.408 Employees... EMPLOYMENT SERVICE SYSTEM Housing for Agricultural Workers Housing Standards § 654.408 Screening. (a) All outside openings shall be protected with screening of not less than 16 mesh. (b) All screen doors shall be...

  11. The Diabetic Retinopathy Screening Workflow

    Science.gov (United States)

    Bolster, Nigel M.; Giardini, Mario E.; Bastawrous, Andrew

    2015-01-01

    Complications of diabetes mellitus, namely diabetic retinopathy and diabetic maculopathy, are the leading cause of blindness in working aged people. Sufferers can avoid blindness if identified early via retinal imaging. Systematic screening of the diabetic population has been shown to greatly reduce the prevalence and incidence of blindness within the population. Many national screening programs have digital fundus photography as their basis. In the past 5 years several techniques and adapters have been developed that allow digital fundus photography to be performed using smartphones. We review recent progress in smartphone-based fundus imaging and discuss its potential for integration into national systematic diabetic retinopathy screening programs. Some systems have produced promising initial results with respect to their agreement with reference standards. However further multisite trialling of such systems’ use within implementable screening workflows is required if an evidence base strong enough to affect policy change is to be established. If this were to occur national diabetic retinopathy screening would, for the first time, become possible in low- and middle-income settings where cost and availability of trained eye care personnel are currently key barriers to implementation. As diabetes prevalence and incidence is increasing sharply in these settings, the impact on global blindness could be profound. PMID:26596630

  12. Advanced teleoperation in nuclear applications: consolidated fuel reprocessing program

    International Nuclear Information System (INIS)

    Hamel, W.R.; Feldman, M.J.; Martin, H.L.

    1984-01-01

    A new generation of integrated remote maintenance systems is being developed to meet the needs of future nuclear fuel reprocessing at the Oak Ridge National Laboratory. Development activities cover all aspects of an advanced teleoperated maintenance system with particular emphasis on a new force-reflecting servomanipulator concept. The new manipulator, called the advanced servomanipulator, is microprocessor controlled and is designed to achieve force-reflection performance near that of mechanical master/slave manipulators. The advanced servomanipulator uses a gear-drive transmission which permits modularization for remote maintainability (by other advanced servomanipulators) and increases reliability. Human factors analysis has been used to develop an improved man/machine interface concept based upon colographic displays and menu-driven touch screens. Initial test and evaluation of two advanced servomanipulator slave arms and several other development components have begun. 9 references, 5 figures

  13. Mass spectrometry for fragment screening.

    Science.gov (United States)

    Chan, Daniel Shiu-Hin; Whitehouse, Andrew J; Coyne, Anthony G; Abell, Chris

    2017-11-08

    Fragment-based approaches in chemical biology and drug discovery have been widely adopted worldwide in both academia and industry. Fragment hits tend to interact weakly with their targets, necessitating the use of sensitive biophysical techniques to detect their binding. Common fragment screening techniques include differential scanning fluorimetry (DSF) and ligand-observed NMR. Validation and characterization of hits is usually performed using a combination of protein-observed NMR, isothermal titration calorimetry (ITC) and X-ray crystallography. In this context, MS is a relatively underutilized technique in fragment screening for drug discovery. MS-based techniques have the advantage of high sensitivity, low sample consumption and being label-free. This review highlights recent examples of the emerging use of MS-based techniques in fragment screening. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  14. Colour screening and quark confinement

    International Nuclear Information System (INIS)

    Mack, G.

    1978-03-01

    It is proposed that in Quantum Chromodynamics the colour charge of gluons and of anything with zero triality is screened by a dynamical Higgs mechanism with Higgs scalars made out of gluons. The center Z 3 of the gauge group SU(3) is left unbroken in this way, and single quarks, which have nonzero triality, cannot be screened. Long range forces between them persist therefore. Given that the Higgs mechanism produces a mass gap, the most favorable configuration of field lines between e.g. quark and antiquark will be in strings analogous to magnetic field lines in a superconductor. The strings confine the quarks. The screening mechanism, on the other hand, produces not only the mass gap (which leads to string formation) but is also responsible for saturation of forces, i.e. absence of bound states of six quarks etc. (orig.) [de

  15. Colour screening and quark confinement

    International Nuclear Information System (INIS)

    Mack, G.

    1978-01-01

    It is proposed that in quantum chromodynamics the colour charge of gluons and of anything with zero triality is screened by a dynamic Higgs mechanism with Higgs scalars made out of gluons, but the center Z 3 of the gauge group SU(3) is left unbroken, and single quarks, which have nonzero triality, are not screened. Long range forces between them persist therefore. Given that the Higgs mechanism produces a mass gap, the most favourable configuration of field lines between e.g., quark and antiquark will be in strings analogous to magnetic field lines in a superconductor. The string confine the quarks. The screening mechanism, on the other hand, produces not only the mass gap (which leads to string formation) but is also responsible for saturation of forces, i.e. absence of bound states of six quarks, etc. (Auth.)

  16. More misinformation on breast cancer screening

    OpenAIRE

    Kopans, Daniel B.

    2017-01-01

    Unfortunately, a great deal of misinformation has accumulated in the breast cancer screening literature that is based on flawed analyses in an effort to reduce access to screening. Quite remarkably, much of this has come from publications in previously highly respected medical journals. In several papers the intervention (mammography screening) is faulted yet the analyses provided no data on who participated in mammography screening, and which cancers were detected by mammography screening. I...

  17. Advanced Plasmonic Materials for Dynamic Color Display.

    Science.gov (United States)

    Shao, Lei; Zhuo, Xiaolu; Wang, Jianfang

    2018-04-01

    Plasmonic structures exhibit promising applications in high-resolution and durable color generation. Research on advanced hybrid plasmonic materials that allow dynamically reconfigurable color control has developed rapidly in recent years. Some of these results may give rise to practically applicable reflective displays in living colors with high performance and low power consumption. They will attract broad interest from display markets, compared with static plasmonic color printing, for example, in applications such as digital signage, full-color electronic paper, and electronic device screens. In this progress report, the most promising recent examples of utilizing advanced plasmonic materials for the realization of dynamic color display are highlighted and put into perspective. The performances, advantages, and disadvantages of different technologies are discussed, with emphasis placed on both the potential and possible limitations of various hybrid materials for dynamic plasmonic color display. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Arvelig hemokromatose - nytten av screening

    Directory of Open Access Journals (Sweden)

    Arne Åsberg

    2009-10-01

    Full Text Available Arvelig hemokromatose fører til jernopphopning i kroppen, men gir sjelden alvorlig helseskade. Nesten alle hemokromatosepasienter i vårt land er homozygote for C282Y-mutasjonen i HFE-genet. Omtrent 7 per 1000 innbyggere har denne genotypen. Alvorlig syke blir bare omkring 5-15% av homozygote menn og nesten ingen kvinner. Likevel er det holdepunkter for at screening for hemokromatose blant friske, yngre menn kan være kostnadseffektivt. Det er relativt lett å påvise om en person er disponert for sykdommen, i god tid før den bryter ut, og forebyggende behandling er billig og effektiv. Imidlertid kan vi ikke forutsi hvilke screeningpositive personer som ubehandlet får alvorlig sykdom. Et kontrollert forsøk med screening bør gjennomføresHereditary hemochromatosis – benefits of screening. Hereditary hemochromatosis leads to iron accumulation in the body; however, serious illness due to hemochromatosis is rare. In Norway, almost all patients with hemochromatosis are homozygous for the C282Ymutation in the HFE-gene, a genotype carried by about 7 per 1000 inhabitants. Serious complications are seen in only about 5-15% of homozygous men and in very few women. Nevertheless, screening young men for hemochromatosis may be cost-effective. Detecting predisposed men is relatively straightforward, and prophylactic treatment is cheap and effective. However, we can not predict, among screen-positive men, the few who untreated will become seriously ill. A controlled screening trial should be conducted.

  19. Advances in dental materials.

    Science.gov (United States)

    Fleming, Garry J P

    2014-05-01

    The dental market is replete with new resorative materials marketed on the basis of novel technological advances in materials chemistry, bonding capability or reduced operator time and/or technique sensitivity. This paper aims to consider advances in current materials, with an emphasis on their role in supporting contemporary clinical practice.

  20. Advanced Manufacturing Technologies

    Science.gov (United States)

    Fikes, John

    2016-01-01

    Advanced Manufacturing Technologies (AMT) is developing and maturing innovative and advanced manufacturing technologies that will enable more capable and lower-cost spacecraft, launch vehicles and infrastructure to enable exploration missions. The technologies will utilize cutting edge materials and emerging capabilities including metallic processes, additive manufacturing, composites, and digital manufacturing. The AMT project supports the National Manufacturing Initiative involving collaboration with other government agencies.

  1. Planning for Advanced Cancer

    Science.gov (United States)

    Find out what issues need to be addressed when dealing with an advanced or metastatic cancer diagnosis. Completing advance directives, looking at health insurance, organizing records and documents, and looking at the meanings in your life are some of the things to think about.

  2. Advanced uranium enrichment technologies

    International Nuclear Information System (INIS)

    Merriman, R.

    1983-01-01

    The Advanced Gas Centrifuge and Atomic Vapor Laser Isotope Separation methods are described. The status and potential of the technologies are summarized, the programs outlined, and the economic incentives are noted. How the advanced technologies, once demonstrated, might be deployed so that SWV costs in the 1990s can be significantly reduced is described

  3. Advanced research technology transfer

    International Nuclear Information System (INIS)

    Naraghi, Masud

    1977-01-01

    The importance of advanced research in the less developed countries of the world is described. Advanced research is a way of building from the top; it helps industrial development; it provides ''know-how'' economically; it enhances international understanding; it prevents the brain drain to developed countries and is of mutual benefit. The problems concerned with this type of research are pointed out

  4. Screening for deformed teeth; Screening for saere taender

    Energy Technology Data Exchange (ETDEWEB)

    Vermeulen, A.; Dall, P.C.; Hansen, F.G.

    1996-04-01

    Water pollution by pesticides and heavy metals causes sublethal effects in larvae of the Chironomidae midges. These effects are particularly noticeable in the deformities of the oral parts and antennae. Possibilities of using these deformities for the purpose of water/sediment biomonitoring are very promising. Here the first results of screening in a Danish stream are presented. (EG) 9 refs.

  5. Nutritional Screening of Children: A Manual for Screening & Followup.

    Science.gov (United States)

    Bureau of Community Health Services (DHHS/PHS), Rockville, MD.

    This manual shows health providers how to perform precisely and expertly each step of several procedures used in screening children for nutritional problems. It is intended for all health providers who are involved in weighing and measuring children, recording and plotting measurements on growth charts, taking blood samples to test for iron…

  6. Faraday screen sputtering on TPX

    International Nuclear Information System (INIS)

    Ehst, D.A.

    1994-12-01

    The TPX design stipulates that the ion-cyclotron resonance frequency (ICRF) antenna must have a Faraday screen (FS). The author considers here possible low Z coatings for the screen, as well as sputtering behavior of the Ni and Ti substrates. The theory of rf-induced sputtering has been developed, and he follows those theoretical approaches. The author's emphasis will be on both impurity generation as a possible source of increased Z eff , and also on actual erosion-lifetime of the materials under worst case conditions

  7. THE DEVELOPMENT OF SCREEN TRANSLATION

    Directory of Open Access Journals (Sweden)

    Sang Ayu Isnu Maharani

    2014-05-01

    Full Text Available Screen translations involve oral translation known as dubbing and revoicing. Re-voicing consists of lip-sync dubbing, free commentary, narration and voice over. The written version is called subtitle. Dubbing and subtitling are two preferred mode used in the screen translation even though various numbers of current options are available nowadays. Dubbing commenced to be used in larger countries in Europe meanwhile smaller countries apply subtitling because it is more economical than dubbing. In Indonesia, the use of dubbing as well as subtitle are found.

  8. Icons and Emoticons: Screen Wars

    OpenAIRE

    Duerfahrd, Lance

    2015-01-01

    The cinema is being upstaged by a device paradoxically meant (in part) to transmit it: the iPhone. How do films change, how is their impact altered, when viewed on these devices? What aspects of the movie screen (and subsequently our movie experience) are lost or threatened when they are displaced by this new technological format? This is not an abstract war: it is going on (in the dark) every time we attend a screening. My paper will explore what is at stake in our decision to illuminate our...

  9. Hierarchical screening for multiple mental disorders.

    Science.gov (United States)

    Batterham, Philip J; Calear, Alison L; Sunderland, Matthew; Carragher, Natacha; Christensen, Helen; Mackinnon, Andrew J

    2013-10-01

    There is a need for brief, accurate screening when assessing multiple mental disorders. Two-stage hierarchical screening, consisting of brief pre-screening followed by a battery of disorder-specific scales for those who meet diagnostic criteria, may increase the efficiency of screening without sacrificing precision. This study tested whether more efficient screening could be gained using two-stage hierarchical screening than by administering multiple separate tests. Two Australian adult samples (N=1990) with high rates of psychopathology were recruited using Facebook advertising to examine four methods of hierarchical screening for four mental disorders: major depressive disorder, generalised anxiety disorder, panic disorder and social phobia. Using K6 scores to determine whether full screening was required did not increase screening efficiency. However, pre-screening based on two decision tree approaches or item gating led to considerable reductions in the mean number of items presented per disorder screened, with estimated item reductions of up to 54%. The sensitivity of these hierarchical methods approached 100% relative to the full screening battery. Further testing of the hierarchical screening approach based on clinical criteria and in other samples is warranted. The results demonstrate that a two-phase hierarchical approach to screening multiple mental disorders leads to considerable increases efficiency gains without reducing accuracy. Screening programs should take advantage of prescreeners based on gating items or decision trees to reduce the burden on respondents. © 2013 Elsevier B.V. All rights reserved.

  10. Advanced Chemical Propulsion Study

    Science.gov (United States)

    Woodcock, Gordon; Byers, Dave; Alexander, Leslie A.; Krebsbach, Al

    2004-01-01

    A study was performed of advanced chemical propulsion technology application to space science (Code S) missions. The purpose was to begin the process of selecting chemical propulsion technology advancement activities that would provide greatest benefits to Code S missions. Several missions were selected from Code S planning data, and a range of advanced chemical propulsion options was analyzed to assess capabilities and benefits re these missions. Selected beneficial applications were found for higher-performing bipropellants, gelled propellants, and cryogenic propellants. Technology advancement recommendations included cryocoolers and small turbopump engines for cryogenic propellants; space storable propellants such as LOX-hydrazine; and advanced monopropellants. It was noted that fluorine-bearing oxidizers offer performance gains over more benign oxidizers. Potential benefits were observed for gelled propellants that could be allowed to freeze, then thawed for use.

  11. Cost Effective Community Based Dementia Screening: A Markov Model Simulation

    Directory of Open Access Journals (Sweden)

    Erin Saito

    2014-01-01

    Full Text Available Background. Given the dementia epidemic and the increasing cost of healthcare, there is a need to assess the economic benefit of community based dementia screening programs. Materials and Methods. Markov model simulations were generated using data obtained from a community based dementia screening program over a one-year period. The models simulated yearly costs of caring for patients based on clinical transitions beginning in pre dementia and extending for 10 years. Results. A total of 93 individuals (74 female, 19 male were screened for dementia and 12 meeting clinical criteria for either mild cognitive impairment (n=7 or dementia (n=5 were identified. Assuming early therapeutic intervention beginning during the year of dementia detection, Markov model simulations demonstrated 9.8% reduction in cost of dementia care over a ten-year simulation period, primarily through increased duration in mild stages and reduced time in more costly moderate and severe stages. Discussion. Community based dementia screening can reduce healthcare costs associated with caring for demented individuals through earlier detection and treatment, resulting in proportionately reduced time in more costly advanced stages.

  12. ESR/ERS white paper on lung cancer screening

    Energy Technology Data Exchange (ETDEWEB)

    Kauczor, Hans-Ulrich; Stackelberg, Oyunbileg von [University Hospital Heidelberg, Dept of Diagnostic and Interventional Radiology, Heidelberg (Germany); Member of the German Lung Research Center, Translational Lung Research Center, Heidelberg (Germany); Bonomo, Lorenzo [A. Gemelli University Hospital, Institute of Radiology, Rome (Italy); Gaga, Mina [Athens Chest Hospital, 7th Resp. Med. Dept and Asthma Center, Athens (Greece); Nackaerts, Kristiaan [KU Leuven-University of Leuven, University Hospitals Leuven, Department of Respiratory Diseases/Respiratory Oncology Unit, Leuven (Belgium); Peled, Nir [Tel Aviv University, Davidoff Cancer Center, Rabin Medical Center, Tel Aviv (Israel); Prokop, Mathias [Radboud University Medical Center, Department of Radiology and Nuclear Medicine, Nijmegen (Netherlands); Remy-Jardin, Martine [Department of Thoracic Imaging, Hospital Calmette (EA 2694), CHRU et Universite de Lille, Lille (France); Sculier, Jean-Paul [Universite Libre de Bruxelles, Thoracic oncology, Institut Jules Bordet, Brussels (Belgium); Collaboration: on behalf of the European Society of Radiology (ESR) and the European Respiratory Society (ERS)

    2015-09-15

    Lung cancer is the most frequently fatal cancer, with poor survival once the disease is advanced. Annual low-dose computed tomography has shown a survival benefit in screening individuals at high risk for lung cancer. Based on the available evidence, the European Society of Radiology and the European Respiratory Society recommend lung cancer screening in comprehensive, quality-assured, longitudinal programmes within a clinical trial or in routine clinical practice at certified multidisciplinary medical centres. Minimum requirements include: standardised operating procedures for low-dose image acquisition, computer-assisted nodule evaluation, and positive screening results and their management; inclusion/exclusion criteria; expectation management; and smoking cessation programmes. Further refinements are recommended to increase quality, outcome and cost-effectiveness of lung cancer screening: inclusion of risk models, reduction of effective radiation dose, computer-assisted volumetric measurements and assessment of comorbidities (chronic obstructive pulmonary disease and vascular calcification). All these requirements should be adjusted to the regional infrastructure and healthcare system, in order to exactly define eligibility using a risk model, nodule management and a quality assurance plan. The establishment of a central registry, including a biobank and an image bank, and preferably on a European level, is strongly encouraged. (orig.)

  13. ESR/ERS white paper on lung cancer screening

    International Nuclear Information System (INIS)

    Kauczor, Hans-Ulrich; Stackelberg, Oyunbileg von; Bonomo, Lorenzo; Gaga, Mina; Nackaerts, Kristiaan; Peled, Nir; Prokop, Mathias; Remy-Jardin, Martine; Sculier, Jean-Paul

    2015-01-01

    Lung cancer is the most frequently fatal cancer, with poor survival once the disease is advanced. Annual low-dose computed tomography has shown a survival benefit in screening individuals at high risk for lung cancer. Based on the available evidence, the European Society of Radiology and the European Respiratory Society recommend lung cancer screening in comprehensive, quality-assured, longitudinal programmes within a clinical trial or in routine clinical practice at certified multidisciplinary medical centres. Minimum requirements include: standardised operating procedures for low-dose image acquisition, computer-assisted nodule evaluation, and positive screening results and their management; inclusion/exclusion criteria; expectation management; and smoking cessation programmes. Further refinements are recommended to increase quality, outcome and cost-effectiveness of lung cancer screening: inclusion of risk models, reduction of effective radiation dose, computer-assisted volumetric measurements and assessment of comorbidities (chronic obstructive pulmonary disease and vascular calcification). All these requirements should be adjusted to the regional infrastructure and healthcare system, in order to exactly define eligibility using a risk model, nodule management and a quality assurance plan. The establishment of a central registry, including a biobank and an image bank, and preferably on a European level, is strongly encouraged. (orig.)

  14. Screening for iron deficiency and iron deficiency anaemia in pregnancy: a structured review and gap analysis against UK national screening criteria.

    Science.gov (United States)

    Rukuni, Ruramayi; Knight, Marian; Murphy, Michael F; Roberts, David; Stanworth, Simon J

    2015-10-20

    Iron deficiency anaemia is a common problem in pregnancy despite national recommendations and guidelines for treatment. The aim of this study was to appraise the evidence against the UK National Screening Committee (UKNSC) criteria as to whether a national screening programme could reduce the prevalence of iron deficiency anaemia and/or iron deficiency in pregnancy and improve maternal and fetal outcomes. Search strategies were developed for the Cochrane library, Medline and Embase to identify evidence relevant to UK National Screening Committee (UKNSC) appraisal criteria which cover the natural history of iron deficiency and iron deficiency anaemia, the tests for screening, clinical management and evidence of cost effectiveness. Many studies evaluated haematological outcomes of anaemia, but few analysed clinical consequences. Haemoglobin and ferritin appeared the most suitable screening tests, although future options may follow recent advances in understanding iron homeostasis. The clinical consequences of iron deficiency without anaemia are unknown. Oral and intravenous iron are effective in improving haemoglobin and iron parameters. There have been no trials or economic evaluations of a national screening programme for iron deficiency anaemia in pregnancy. Iron deficiency in pregnancy remains an important problem although effective tests and treatment exist. A national screening programme could be of value for early detection and intervention. However, high quality studies are required to confirm whether this would reduce maternal and infant morbidity and be cost effective.

  15. Collaborative Modeling of the Benefits and Harms Associated With Different U.S. Breast Cancer Screening Strategies.

    Science.gov (United States)

    Mandelblatt, Jeanne S; Stout, Natasha K; Schechter, Clyde B; van den Broek, Jeroen J; Miglioretti, Diana L; Krapcho, Martin; Trentham-Dietz, Amy; Munoz, Diego; Lee, Sandra J; Berry, Donald A; van Ravesteyn, Nicolien T; Alagoz, Oguzhan; Kerlikowske, Karla; Tosteson, Anna N A; Near, Aimee M; Hoeffken, Amanda; Chang, Yaojen; Heijnsdijk, Eveline A; Chisholm, Gary; Huang, Xuelin; Huang, Hui; Ergun, Mehmet Ali; Gangnon, Ronald; Sprague, Brian L; Plevritis, Sylvia; Feuer, Eric; de Koning, Harry J; Cronin, Kathleen A

    2016-02-16

    Controversy persists about optimal mammography screening strategies. To evaluate screening outcomes, taking into account advances in mammography and treatment of breast cancer. Collaboration of 6 simulation models using national data on incidence, digital mammography performance, treatment effects, and other-cause mortality. United States. Average-risk U.S. female population and subgroups with varying risk, breast density, or comorbidity. Eight strategies differing by age at which screening starts (40, 45, or 50 years) and screening interval (annual, biennial, and hybrid [annual for women in their 40s and biennial thereafter]). All strategies assumed 100% adherence and stopped at age 74 years. Benefits (breast cancer-specific mortality reduction, breast cancer deaths averted, life-years, and quality-adjusted life-years); number of mammograms used; harms (false-positive results, benign biopsies, and overdiagnosis); and ratios of harms (or use) and benefits (efficiency) per 1000 screens. Biennial strategies were consistently the most efficient for average-risk women. Biennial screening from age 50 to 74 years avoided a median of 7 breast cancer deaths versus no screening; annual screening from age 40 to 74 years avoided an additional 3 deaths, but yielded 1988 more false-positive results and 11 more overdiagnoses per 1000 women screened. Annual screening from age 50 to 74 years was inefficient (similar benefits, but more harms than other strategies). For groups with a 2- to 4-fold increased risk, annual screening from age 40 years had similar harms and benefits as screening average-risk women biennially from 50 to 74 years. For groups with moderate or severe comorbidity, screening could stop at age 66 to 68 years. Other imaging technologies, polygenic risk, and nonadherence were not considered. Biennial screening for breast cancer is efficient for average-risk populations. Decisions about starting ages and intervals will depend on population characteristics and the

  16. Newborn screening for MCAD deficiency

    DEFF Research Database (Denmark)

    Horvath, Gabriella A; Davidson, A G F; Stockler-Ipsiroglu, Sylvia G

    2008-01-01

    . Both C8 and C8/C10 ratios remained abnormal in all confirmed MCAD cases. Positive predictive value of screening was 58% with no false negative results. Seven patients were homozygous for the common c.985A > G MCAD mutation and three others were compound heterozygous for the c.985A > G and a second...

  17. Transitivity and partial screening off

    NARCIS (Netherlands)

    Peijnenburg, Jeanne; Atkinson, David

    2013-01-01

    The notion of probabilistic support is beset by well-known problems. In this paper we add a new one to the list: the problem of transitivity. Tomoji Shogenji has shown that positive probabilistic support, or confirmation, is transitive under the condition of screening off. However, under that same

  18. Developments in SPR Fragment Screening.

    Science.gov (United States)

    Chavanieu, Alain; Pugnière, Martine

    2016-01-01

    Fragment-based approaches have played an increasing role alongside high-throughput screening in drug discovery for 15 years. The label-free biosensor technology based on surface plasmon resonance (SPR) is now sensitive and informative enough to serve during primary screens and validation steps. In this review, the authors discuss the role of SPR in fragment screening. After a brief description of the underlying principles of the technique and main device developments, they evaluate the advantages and adaptations of SPR for fragment-based drug discovery. SPR can also be applied to challenging targets such as membrane receptors and enzymes. The high-level of immobilization of the protein target and its stability are key points for a relevant screening that can be optimized using oriented immobilized proteins and regenerable sensors. Furthermore, to decrease the rate of false negatives, a selectivity test may be performed in parallel on the main target bearing the binding site mutated or blocked with a low-off-rate ligand. Fragment-based drug design, integrated in a rational workflow led by SPR, will thus have a predominant role for the next wave of drug discovery which could be greatly enhanced by new improvements in SPR devices.

  19. Screening Tools for Kindergarten Children

    Directory of Open Access Journals (Sweden)

    Georgia Kokkalia

    2017-12-01

    Full Text Available The current paper review gives a brief and representative description of some of the most used screening tools for kindergarten education. The significant role that early education plays in every child’s academic life is underlined by the importance of tools that give his learning profiles.  Therefore many researchers note that screening tools paly a notable role for the kindergarten teachers, the family and of course for the child in order to offer the appropriate intervention program, the proper support and draw the most suitable teaching method for the child and the class. Thus, the research team of this paper gives the description of some screening tools that are used by kindergarten teachers and specialist’s worldwide-with focus in Greek kindergarten- scoping to underlie strengths and weaknesses of preschoolers. Finally, it is thought worthwhile to say that the screening tools that are presented are used with the traditional way while some of them with the support of new technology.

  20. Disciplining and Screening Top Executives

    NARCIS (Netherlands)

    S. Dominguez Martinez (Silvia); O.H. Swank (Otto); B. Visser (Bauke)

    2006-01-01

    textabstractBoards of directors face the twin task of disciplining and screening executives. To perform these tasks directors do not have detailed information about executives' behaviour, and only infrequently have information about the success or failure of initiated strategies, reorganizations,

  1. Comparative Phytochemical screening and Physicochemical ...

    African Journals Online (AJOL)

    Physicochemical characterization was carried out to determine the saponification value, refractive index, specific gravity, peroxide value and acid value of the oil. The results of the phytochemical screening showed that alkaloid, carbohydrate, saponins, glycosides were present in the sample obtained from Romi New ...

  2. Keuringspanele ("Screening Panels") as Gepaste ...

    African Journals Online (AJOL)

    In this particular article attention is paid to screening panels as pre-trial mechanism with the exclusive purpose to select malpractice disputes, discourage unfounded disputes and to encourage an early settlement in case of a prima facie case. Several objections have been raised by critics in this regard, for instance, ...

  3. Shadows Cast on the Screen?

    DEFF Research Database (Denmark)

    Jensen, Sisse Siggaard

    cast on the screen. This understanding is questioned with reference to a semiotic understanding of avatars if seen as triadic relationships of sign processes—that is, as something that stands for something for someone. This understanding is exemplified by the case of Thomas and his businessman avatar...

  4. Colorectal Cancer Awareness and Screening

    Centers for Disease Control (CDC) Podcasts

    2017-04-06

    An oncologist (cancer doctor) shares her medical and personal advice for people between the ages of 50 and 75 about getting screened for colorectal cancer.  Created: 4/6/2017 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 4/6/2017.

  5. FAST MRI breast screening revisited

    International Nuclear Information System (INIS)

    Jain, Manish; Jain, Arushi; Hyzy, Marek D.; Werth, Graziella

    2017-01-01

    Screening for breast cancer in high-risk women takes about 40 minutes to acquire an MRI scan and is time-intensive to report. There is recent interest in the performance of an abbreviated MRI protocol (FAST) in the screening setting. FAST scans have a reported negative predictive value of 99.8%. This study evaluates the false positive rates (FPR) and recall rates for FAST scans as compared to full diagnostic studies (FD). A database of all screening breast MRI scans performed at our institution between 30 June 2013 and 1 July 2014 (n = 591) was created by one of the researchers, who did not subsequently analyse the MRI scans. The T1W and first post-contrast and subtracted images from each of these scans (FAST protocol) were assessed by experienced breast MRI radiologists, blinded to the final diagnosis. The findings were then compared with the FD result. The recall rates were 6.6% for FAST scans and 5.8% for FD scans. FPR rates were 4.7% and 3.9% respectively. There is no statistically significant difference in the recall rates or FPR of FAST scans in comparison with full diagnostic studies. Given the absence of statistically significant difference in the FPR and recall rates in comparison with FD, FAST scans can replace FD for screening of breast cancer.

  6. Screen violence and youth behavior

    NARCIS (Netherlands)

    Anderson, Craig A.; Bushman, Brad J.; Bartholow, Bruce D.; Cantor, Joanne; Christakis, Dimitri; Coyne, Sarah M.; Donnerstein, Edward; Brockmyer, Jeanne Funk; Gentile, Douglas A.; Green, C. Shawn; Huesmann, Rowell; Hummer, Tom; Krahé, Barbara; Strasburger, Victor C.; Warburton, Wayne; Wilson, Barbara J.; Ybarra, Michele

    2017-01-01

    Violence in screen entertainment media (ie, television, film, video games, and the Internet), defined as depictions of characters (or players) trying to physically harm other characters (or players), is ubiquitous. The Workgroup on Media Violence and Violent Video Games reviewed numerous

  7. Screening for autologous blood transfusions

    DEFF Research Database (Denmark)

    Mørkeberg, J; Belhage, B; Ashenden, M

    2009-01-01

    parameter in the screening for autologous blood doping. Three bags of blood (approximately 201+/-11 g of Hb) were withdrawn from 16 males and stored at either -80 degrees C (-80 T, n=8) or +4 degrees C (+4 T, n=8) and reinfused 10 weeks or 4 weeks later, respectively. Seven subjects served as controls...

  8. Walkthrough screening evaluation field guide

    International Nuclear Information System (INIS)

    Eder, S.J.; Eli, M.W.; Salmon, M.W.

    1993-11-01

    The US Department of Energy (DOE) has a large inventory of existing facilities. Many of these facilities were not designed and constructed to current natural phenomena hazard (NPH) criteria. The NPH events include earthquakes, extreme winds and tornadoes, and floods. DOE Order 5480.28 establishes policy and requirements for NPH mitigation for DOE facilities. DOE is conducting a multiyear project to develop evaluation guidelines for assessing the condition and determining the need for upgrades at DOE facilities. One element of the NPH evaluation guidelines' development involves the existing systems and components at DOE facilities. This effort is described in detail in a cited reference. In the interim period prior to availability of the final guidelines, DOE facilities are encouraged to implement an NPH walk through screening evaluation process by which systems and components that need attention can be rapidly identified. Guidelines for conducting the walk through screening evaluations are contained herein. The result of the NPH walk through screening evaluation should be a prioritized list of systems and components that need further action. Simple and inexpensive fixes for items identified in the walk through as marginal or inadequate should be implemented without further study. By implementing an NPH walk through screening evaluation, DOE facilities may realize significant reduction in risk from NPH in the short term

  9. Review of Autism Screening Tests

    Directory of Open Access Journals (Sweden)

    Farin Soleimani

    2014-10-01

    Full Text Available Background: Autism is a neurodevelopmental disorder that onset in the first 3 years of life and led to lifelong disability.Despite the early onset of symptoms, diagnosis of thissyndromedoes not happenuntil severalyears later, somany childrenlosethe opportunityfor earlyintervention.There arevarious toolsforscreening anddiagnosis, buttheirdesign, strengths and weaknesses aredifferent. The aim of this study was assess these tools from various aspects to provide a comprehensive view. Materials and methods: This study is a narrative literature review on screeningtoolsof autism. Comprehensive searches of the scientific literature were conducted in textbooks and 8 electronic databases(proquest,wiley,google scholar,SID,Scopus, Web of Science ،Science Direct ، and Medline and Pediatric book. language restriction (Persian and English was applied. The search strategy consisted of keywords and medical subject headings for autism and various screening tests. Result: In this study, 28 screening tests were identified from 1992 to 2014. CHAT is oldest test and the most recent test is CAST The minimum age that can perform the screening is six months that related to ITC. Minimum time of testing was 5 minutes  for CHAT and the maximum time was 90-120 minutes for ASIEP-3.RAADS-R test was the highest specificity and specificity (100% and the lowest specificity was 14% in ESAT test Conclusion: The results of this study indicate that any of the autism screening tools consider specific skill and various aspects of the disease, careful evaluation is need to choose proper test.

  10. Improving Electronic Sensor Reliability by Robust Outlier Screening

    Directory of Open Access Journals (Sweden)

    Federico Cuesta

    2013-10-01

    Full Text Available Electronic sensors are widely used in different application areas, and in some of them, such as automotive or medical equipment, they must perform with an extremely low defect rate. Increasing reliability is paramount. Outlier detection algorithms are a key component in screening latent defects and decreasing the number of customer quality incidents (CQIs. This paper focuses on new spatial algorithms (Good Die in a Bad Cluster with Statistical Bins (GDBC SB and Bad Bin in a Bad Cluster (BBBC and an advanced outlier screening method, called Robust Dynamic Part Averaging Testing (RDPAT, as well as two practical improvements, which significantly enhance existing algorithms. Those methods have been used in production in Freescale® Semiconductor probe factories around the world for several years. Moreover, a study was conducted with production data of 289,080 dice with 26 CQIs to determine and compare the efficiency and effectiveness of all these algorithms in identifying CQIs.

  11. A review of current sleep screening applications for smartphones.

    Science.gov (United States)

    Behar, Joachim; Roebuck, Aoife; Domingos, João S; Gederi, Elnaz; Clifford, Gari D

    2013-07-01

    Sleep disorders are a common problem and contribute to a wide range of healthcare issues. The societal and financial costs of sleep disorders are enormous. Sleep-related disorders are often diagnosed with an overnight sleep test called a polysomnogram, or sleep study involving the measurement of brain activity through the electroencephalogram. Other parameters monitored include oxygen saturation, respiratory effort, cardiac activity (through the electrocardiogram), as well as video recording, sound and movement activity. Monitoring can be costly and removes the patients from their normal sleeping environment, preventing repeated unbiased studies. The recent increase in adoption of smartphones, with high quality on-board sensors has led to the proliferation of many sleep screening applications running on the phone. However, with the exception of simple questionnaires, no existing sleep-related application available for smartphones is based on scientific evidence. This paper reviews the existing smartphone applications landscape used in the field of sleep disorders and proposes possible advances to improve screening approaches.

  12. Primary care colorectal cancer screening correlates with breast cancer screening: implications for colorectal cancer screening improvement interventions.

    Science.gov (United States)

    Weiss, Jennifer M; Pandhi, Nancy; Kraft, Sally; Potvien, Aaron; Carayon, Pascale; Smith, Maureen A

    2018-04-25

    National colorectal cancer (CRC) screening rates have plateaued. To optimize interventions targeting those unscreened, a better understanding is needed of how this preventive service fits in with multiple preventive and chronic care needs managed by primary care providers (PCPs). This study examines whether PCP practices of other preventive and chronic care needs correlate with CRC screening. We performed a retrospective cohort study of 90 PCPs and 33,137 CRC screening-eligible patients. Five PCP quality metrics (breast cancer screening, cervical cancer screening, HgbA1c and LDL testing, and blood pressure control) were measured. A baseline correlation test was performed between these metrics and PCP CRC screening rates. Multivariable logistic regression with clustering at the clinic-level estimated odds ratios and 95% confidence intervals for these PCP quality metrics, patient and PCP characteristics, and their relationship to CRC screening. PCP CRC screening rates have a strong correlation with breast cancer screening rates (r = 0.7414, p < 0.001) and a weak correlation with the other quality metrics. In the final adjusted model, the only PCP quality metric that significantly predicted CRC screening was breast cancer screening (OR 1.25; 95% CI 1.11-1.42; p < 0.001). PCP CRC screening rates are highly concordant with breast cancer screening. CRC screening is weakly concordant with cervical cancer screening and chronic disease management metrics. Efforts targeting PCPs to increase CRC screening rates could be bundled with breast cancer screening improvement interventions to increase their impact and success.

  13. "Is It Worth Knowing?" Focus Group Participants' Perceived Utility of Genomic Preconception Carrier Screening.

    Science.gov (United States)

    Schneider, Jennifer L; Goddard, Katrina A B; Davis, James; Wilfond, Benjamin; Kauffman, Tia L; Reiss, Jacob A; Gilmore, Marian; Himes, Patricia; Lynch, Frances L; Leo, Michael C; McMullen, Carmit

    2016-02-01

    As genome sequencing technology advances, research is needed to guide decision-making about what results can or should be offered to patients in different clinical settings. We conducted three focus groups with individuals who had prior preconception genetic testing experience to explore perceived advantages and disadvantages of genome sequencing for preconception carrier screening, compared to usual care. Using a discussion guide, a trained qualitative moderator facilitated the audio-recorded focus groups. Sixteen individuals participated. Thematic analysis of transcripts started with a grounded approach and subsequently focused on participants' perceptions of the value of genetic information. Analysis uncovered two orientations toward genomic preconception carrier screening: "certain" individuals desiring all possible screening information; and "hesitant" individuals who were more cautious about its value. Participants revealed valuable information about barriers to screening: fear/anxiety about results; concerns about the method of returning results; concerns about screening necessity; and concerns about partner participation. All participants recommended offering choice to patients to enhance the value of screening and reduce barriers. Overall, two groups of likely users of genome sequencing for preconception carrier screening demonstrated different perceptions of the advantages or disadvantages of screening, suggesting tailored approaches to education, consent, and counseling may be warranted with each group.

  14. Editorial: Advanced learning technologies

    Directory of Open Access Journals (Sweden)

    Yu-Ju Lan

    2012-03-01

    Full Text Available Recent rapid development of advanced information technology brings high expectations of its potential to improvement and innovations in learning. This special issue is devoted to using some of the emerging technologies issues related to the topic of education and knowledge sharing, involving several cutting edge research outcomes from recent advancement of learning technologies. Advanced learning technologies are the composition of various related technologies and concepts such as mobile technologies and social media towards learner centered learning. This editorial note provides an overview of relevant issues discussed in this special issue.

  15. Advancing Ethical Neuroscience Research.

    Science.gov (United States)

    Borah, B Rashmi; Strand, Nicolle K; Chillag, Kata L

    2016-12-01

    As neuroscience research advances, researchers, clinicians, and other stakeholders will face a host of ethical challenges. The Presidential Commission for the Study of Bioethical Issues (Bioethics Commission) has published two reports that provide recommendations on how to advance research endeavors ethically. The commission addressed, among other issues, how to prioritize different types of neuroscience research and how to include research participants who have impaired consent capacity. The Bioethics Commission's recommendations provide a foundation for ethical guidelines as neuroscience research advances and progresses. © 2016 American Medical Association. All Rights Reserved.

  16. Advanced information society(7)

    Science.gov (United States)

    Chiba, Toshihiro

    Various threats are hiding in advanced informationalized society. As we see car accident problems in motorization society light aspects necessarily accompy shady ones. Under the changing circumstances of advanced informationalization added values of information has become much higher. It causes computer crime, hacker, computer virus to come to the surface. In addition it can be said that infringement of intellectual property and privacy are threats brought by advanced information. Against these threats legal, institutional and insurance measures have been progressed, and newly security industry has been established. However, they are not adequate individually or totally. The future vision should be clarified, and countermeasures according to the visions have to be considered.

  17. Indian advanced nuclear reactors

    International Nuclear Information System (INIS)

    Saha, D.; Sinha, R.K.

    2005-01-01

    For sustainable development of nuclear energy, a number of important issues like safety, waste management, economics etc. are to be addressed. To do this, a number of advanced reactor designs as well as fuel cycle technologies are being pursued worldwide. The advanced reactors being developed in India are the AHWR and the CHTR. Both the reactors use thorium based fuel and have many passive features. This paper describes the Indian advanced reactors and gives a brief account of the international initiatives for the sustainable development of nuclear energy. (author)

  18. Chemical compatibility screening test results

    International Nuclear Information System (INIS)

    Nigrey, P.J.; Dickens, T.G.

    1997-12-01

    A program for evaluating packaging components that may be used in transporting mixed-waste forms has been developed and the first phase has been completed. This effort involved the screening of ten plastic materials in four simulant mixed-waste types. These plastics were butadiene-acrylonitrile copolymer rubber, cross-linked polyethylene (XLPE), epichlorohydrin rubber, ethylene-propylene rubber (EPDM), fluorocarbon (Viton or Kel-F), polytetrafluoroethylene, high-density polyethylene (HDPE), isobutylene-isoprene copolymer rubber (butyl), polypropylene, and styrene-butadiene rubber (SBR). The selected simulant mixed wastes were (1) an aqueous alkaline mixture of sodium nitrate and sodium nitrite; (2) a chlorinated hydrocarbon mixture; (3) a simulant liquid scintillation fluid; and (4) a mixture of ketones. The testing protocol involved exposing the respective materials to 286,000 rads of gamma radiation followed by 14-day exposures to the waste types at 60 degrees C. The seal materials were tested using vapor transport rate (VTR) measurements while the liner materials were tested using specific gravity as a metric. For these tests, a screening criterion of 0.9 g/hr/m 2 for VTR and a specific gravity change of 10% was used. Based on this work, it was concluded that while all seal materials passed exposure to the aqueous simulant mixed waste, EPDM and SBR had the lowest VTRs. In the chlorinated hydrocarbon simulant mixed waste, only Viton passed the screening tests. In both the simulant scintillation fluid mixed waste and the ketone mixture simulant mixed waste, none of the seal materials met the screening criteria. For specific gravity testing of liner materials, the data showed that while all materials with the exception of polypropylene passed the screening criteria, Kel-F, HDPE, and XLPE offered the greatest resistance to the combination of radiation and chemicals

  19. High-grade cervical intraepithelial neoplasia in human papillomavirus self-sampling of screening non-attenders

    DEFF Research Database (Denmark)

    Lam, J U H; Elfström, K M; Ejegod, D. M.

    2018-01-01

    precancer lesions. Here, we compare the cervical intraepithelial neoplasia grade 2 or worse (⩾CIN2) detection rate between non-attenders who participated in self-sampling and women attending routine screening. METHODS: A total of 23 632 women who were qualified as non-attenders in the Copenhagen Region were......BACKGROUND: Self-sampling for human papillomavirus (HPV) offered to women who do not participate in cervical cancer screening is an increasingly popular method to increase screening coverage. The rationale behind self-sampling is that unscreened women harbour a high proportion of undetected...... higher detection rates for ⩾CIN2 than routine cytology-based screening, and similar detection rates as HPV and cytology co-testing. This reinforces the importance of self-sampling for screening non-attenders in organised cervical cancer screening.British Journal of Cancer advance online publication, 14...

  20. Advanced and tendencies in the development of display technologies

    Science.gov (United States)

    Kompanets, I. N.

    2006-06-01

    Advances and key display applications are discussed. Computer, compact mobile, TV and collective large screen displays are mentioned. Flat panel displays step on CRT devices to leave them behind in 2007. Materials, active matricies and applications of bright radiative field emission and organic LED displays are developing successively and pressing other technologies to be used in photo-cameras, cellular phones, auto-cars and avionics. Progress in flexible screens can substantially extend the display design and application soon. 3D display systems are under intensive development, and laser is an important unit in some vaiants of holographic and volumetric 3D displays. Value forecast of different display markets is presented.

  1. Stem cells: a model for screening, discovery and development of drugs

    Directory of Open Access Journals (Sweden)

    Kitambi SS

    2011-09-01

    Full Text Available Satish Srinivas Kitambi1, Gayathri Chandrasekar21Department of Medical Biochemistry and Biophysics; 2Department of Biosciences, Karolinska Institutet, Stockholm, SwedenAbstract: The identification of normal and cancerous stem cells and the recent advances made in isolation and culture of stem cells have rapidly gained attention in the field of drug discovery and regenerative medicine. The prospect of performing screens aimed at proliferation, directed differentiation, and toxicity and efficacy studies using stem cells offers a reliable platform for the drug discovery process. Advances made in the generation of induced pluripotent stem cells from normal or diseased tissue serves as a platform to perform drug screens aimed at developing cell-based therapies against conditions like Parkinson's disease and diabetes. This review discusses the application of stem cells and cancer stem cells in drug screening and their role in complementing, reducing, and replacing animal testing. In addition to this, target identification and major advances in the field of personalized medicine using induced pluripotent cells are also discussed.Keywords: therapeutics, stem cells, cancer stem cells, screening models, drug development, high throughput screening

  2. Smoking cessation and lung cancer screening

    DEFF Research Database (Denmark)

    Pedersen, Jesper Johannes Holst; Tønnesen, Philip; Ashraf, Haseem

    2016-01-01

    Smoking behavior may have a substantial influence on the overall effect of lung cancer screening. Non-randomized studies of smoking behavior during screening have indicated that computer tomography (CT) screening induces smoking cessation. Randomized studies have further elaborated that this effect...... and decrease smoking relapse rate. Also low smoking dependency and high motivation to quit smoking at baseline predicted smoking abstinence in screening trials. Lung cancer screening therefore seems to be a teachable moment for smoking cessation. Targeted smoking cessation counselling should be an integrated...... part of future lung cancer screening trials....

  3. Increasing Cervical Cancer Screening in Underserved Populations.

    Science.gov (United States)

    Dorsainvil, Merlyn A

    The incidence of cervical cancer has declined dramatically due to Papanicolaou smear testing. However, some minority populations continue to suffer with high incidences and/or death rates of cervical cancer, due to lack of screening. This article updates on cervical cancer screening and prevention and discusses cultural impacts on screening. Knowledge deficits disproportionately affect ethnic minority groups and contribute to cancer incidence, whereas lack of healthcare coverage and low socioeconomic status contribute to screening disparities. Although minority women have cultural beliefs and practices that influence screening, recommendation and/or education from a provider often lead to screening.

  4. Opportunistic mammography screening provides effective detection rates in a limited resource healthcare system.

    Science.gov (United States)

    Teh, Yew-Ching; Tan, Gie-Hooi; Taib, Nur Aishah; Rahmat, Kartini; Westerhout, Caroline Judy; Fadzli, Farhana; See, Mee-Hoong; Jamaris, Suniza; Yip, Cheng-Har

    2015-05-15

    available, population-based screening of women 50 and above is effective. Opportunistic mammographic screening is feasible and effective in a middle income country with performance indicators within international standards. Waiting until women are symptomatic will lead to more advanced cancers.

  5. Applying operations research to optimize a novel population management system for cancer screening.

    Science.gov (United States)

    Zai, Adrian H; Kim, Seokjin; Kamis, Arnold; Hung, Ken; Ronquillo, Jeremiah G; Chueh, Henry C; Atlas, Steven J

    2014-02-01

    To optimize a new visit-independent, population-based cancer screening system (TopCare) by using operations research techniques to simulate changes in patient outreach staffing levels (delegates, navigators), modifications to user workflow within the information technology (IT) system, and changes in cancer screening recommendations. TopCare was modeled as a multiserver, multiphase queueing system. Simulation experiments implemented the queueing network model following a next-event time-advance mechanism, in which systematic adjustments were made to staffing levels, IT workflow settings, and cancer screening frequency in order to assess their impact on overdue screenings per patient. TopCare reduced the average number of overdue screenings per patient from 1.17 at inception to 0.86 during simulation to 0.23 at steady state. Increases in the workforce improved the effectiveness of TopCare. In particular, increasing the delegate or navigator staff level by one person improved screening completion rates by 1.3% or 12.2%, respectively. In contrast, changes in the amount of time a patient entry stays on delegate and navigator lists had little impact on overdue screenings. Finally, lengthening the screening interval increased efficiency within TopCare by decreasing overdue screenings at the patient level, resulting in a smaller number of overdue patients needing delegates for screening and a higher fraction of screenings completed by delegates. Simulating the impact of changes in staffing, system parameters, and clinical inputs on the effectiveness and efficiency of care can inform the allocation of limited resources in population management.

  6. Non-visit-based cancer screening using a novel population management system.

    Science.gov (United States)

    Atlas, Steven J; Zai, Adrian H; Ashburner, Jeffrey M; Chang, Yuchiao; Percac-Lima, Sanja; Levy, Douglas E; Chueh, Henry C; Grant, Richard W

    2014-01-01

    Advances in information technology (IT) now permit population-based preventive screening, but the best methods remain uncertain. We evaluated whether involving primary care providers (PCPs) in a visit-independent population management IT application led to more effective cancer screening. We conducted a cluster-randomized trial involving 18 primary care practice sites and 169 PCPs from June 15, 2011, to June 14, 2012. Participants included adults eligible for breast, cervical, and/or colorectal cancer screening. In practices randomized to the intervention group, PCPs reviewed real-time rosters of their patients overdue for screening and provided individualized contact (via a letter, practice delegate, or patient navigator) or deferred screening (temporarily or permanently). In practices randomized to the comparison group, overdue patients were automatically sent reminder letters and transferred to practice delegate lists for follow-up. Intervention patients without PCP action within 8 weeks defaulted to the automated control version. The primary outcome was adjusted average cancer screening completion rates over 1-year follow-up, accounting for clustering by physician or practice. Baseline cancer screening rates (80.8% vs 80.3%) were similar among patients in the intervention (n = 51,071) and comparison group (n = 52,799). Most intervention providers used the IT application (88 of 101, 87%) and users reviewed 7984 patients overdue for at least 1 cancer screening (73% sent reminder letter, 6% referred directly to a practice delegate or patient navigator, and 21% deferred screening). In addition, 6128 letters were automatically sent to patients in the intervention group (total of 12,002 letters vs 16,378 letters in comparison practices; P management IT application resulted in similar cancer screening rates compared with an automated reminder system, but fewer patients were sent reminder letters. This suggests that PCPs were able to identify and exclude from contact

  7. Applying operations research to optimize a novel population management system for cancer screening

    Science.gov (United States)

    Zai, Adrian H; Kim, Seokjin; Kamis, Arnold; Hung, Ken; Ronquillo, Jeremiah G; Chueh, Henry C; Atlas, Steven J

    2014-01-01

    Objective To optimize a new visit-independent, population-based cancer screening system (TopCare) by using operations research techniques to simulate changes in patient outreach staffing levels (delegates, navigators), modifications to user workflow within the information technology (IT) system, and changes in cancer screening recommendations. Materials and methods TopCare was modeled as a multiserver, multiphase queueing system. Simulation experiments implemented the queueing network model following a next-event time-advance mechanism, in which systematic adjustments were made to staffing levels, IT workflow settings, and cancer screening frequency in order to assess their impact on overdue screenings per patient. Results TopCare reduced the average number of overdue screenings per patient from 1.17 at inception to 0.86 during simulation to 0.23 at steady state. Increases in the workforce improved the effectiveness of TopCare. In particular, increasing the delegate or navigator staff level by one person improved screening completion rates by 1.3% or 12.2%, respectively. In contrast, changes in the amount of time a patient entry stays on delegate and navigator lists had little impact on overdue screenings. Finally, lengthening the screening interval increased efficiency within TopCare by decreasing overdue screenings at the patient level, resulting in a smaller number of overdue patients needing delegates for screening and a higher fraction of screenings completed by delegates. Conclusions Simulating the impact of changes in staffing, system parameters, and clinical inputs on the effectiveness and efficiency of care can inform the allocation of limited resources in population management. PMID:24043318

  8. Screening history in women with cervical cancer in a Danish population-based screening program

    DEFF Research Database (Denmark)

    Kirschner, Benny; Poll, Susanne; Rygaard, Carsten

    2011-01-01

    The aim of this study was to explore the screening histories of all cervical cancers in a Danish screening population. The intention was to decide suboptimal sides of the screening program and to evaluate the significance of routine screening in the development of cervical cancer.......The aim of this study was to explore the screening histories of all cervical cancers in a Danish screening population. The intention was to decide suboptimal sides of the screening program and to evaluate the significance of routine screening in the development of cervical cancer....

  9. Advanced Design of Dumbbell-shaped Genetic Minimal Vectors Improves Non-coding and Coding RNA Expression.

    Science.gov (United States)

    Jiang, Xiaoou; Yu, Han; Teo, Cui Rong; Tan, Genim Siu Xian; Goh, Sok Chin; Patel, Parasvi; Chua, Yiqiang Kevin; Hameed, Nasirah Banu Sahul; Bertoletti, Antonio; Patzel, Volker

    2016-09-01

    Dumbbell-shaped DNA minimal vectors lacking nontherapeutic genes and bacterial sequences are considered a stable, safe alternative to viral, nonviral, and naked plasmid-based gene-transfer systems. We investigated novel molecular features of dumbbell vectors aiming to reduce vector size and to improve the expression of noncoding or coding RNA. We minimized small hairpin RNA (shRNA) or microRNA (miRNA) expressing dumbbell vectors in size down to 130 bp generating the smallest genetic expression vectors reported. This was achieved by using a minimal H1 promoter with integrated transcriptional terminator transcribing the RNA hairpin structure around the dumbbell loop. Such vectors were generated with high conversion yields using a novel protocol. Minimized shRNA-expressing dumbbells showed accelerated kinetics of delivery and transcription leading to enhanced gene silencing in human tissue culture cells. In primary human T cells, minimized miRNA-expressing dumbbells revealed higher stability and triggered stronger target gene suppression as compared with plasmids and miRNA mimics. Dumbbell-driven gene expression was enhanced up to 56- or 160-fold by implementation of an intron and the SV40 enhancer compared with control dumbbells or plasmids. Advanced dumbbell vectors may represent one option to close the gap between durable expression that is achievable with integrating viral vectors and short-term effects triggered by naked RNA.

  10. Advanced Light Source (ALS)

    Data.gov (United States)

    Federal Laboratory Consortium — The Advanced Light Source (ALS), a world leader in soft x-ray science, generates light in the wavelengths needed for examining the atomic and electronic structure of...

  11. Advance Payment ACO Model

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Advance Payment Model is designed for physician-based and rural providers who have come together voluntarily to give coordinated high quality care to the...

  12. Advanced Welding Concepts

    Science.gov (United States)

    Ding, Robert J.

    2010-01-01

    Four advanced welding techniques and their use in NASA are briefly reviewed in this poster presentation. The welding techniques reviewed are: Solid State Welding, Friction Stir Welding (FSW), Thermal Stir Welding (TSW) and Ultrasonic Stir Welding.

  13. Advanced Missile Signature Center

    Data.gov (United States)

    Federal Laboratory Consortium — The Advanced Missile Signature Center (AMSC) is a national facility supporting the Missile Defense Agency (MDA) and other DoD programs and customers with analysis,...

  14. Advanced walling systems

    CSIR Research Space (South Africa)

    De Villiers, A

    2010-01-01

    Full Text Available The question addressed by this chapter is: How should advanced walling systems be planned, designed, built, refurbished, and end their useful lives, to classify as smart, sustainable, green or eco-building environments?...

  15. [Advanced resuscitation of adults

    DEFF Research Database (Denmark)

    Lippert, F.K.; Lauritsen, T.L.; Torp-Pedersen, C.

    2008-01-01

    International and European Resuscitation Council (ERC) Guidelines for Resuscitation 2005 implicate major changes in resuscitation, including new universal treatment algorithms. This brief summary of Guidelines 2005 for advanced resuscitation of adult cardiac arrest victims is based upon the ERC...

  16. Advanced Chemistry Laboratory

    Data.gov (United States)

    Federal Laboratory Consortium — Description/History: Chemistry laboratoryThe Advanced Chemistry Laboratory (ACL) is a unique facility designed for working with the most super toxic compounds known...

  17. Advanced Electron Linacs

    Energy Technology Data Exchange (ETDEWEB)

    Siemann, R.

    2005-02-14

    The research into advanced acceleration concepts for electron linear accelerators being pursued at SLAC is reviewed. This research includes experiments in laser acceleration, plasma wakefield acceleration, and mmwavelength RF driven accelerators.

  18. Advanced Transportation Institute 2008.

    Science.gov (United States)

    2009-02-01

    The seventh version of the Advanced Transportation Institute (ATI-08) was conducted in 2008 to encourage high school students to pursue careers in the field of transportation engineering. The University Transportation Center for Alabama partnered wit...

  19. Advanced Transportation Institute 2009.

    Science.gov (United States)

    2009-09-01

    The eighth version of the Advanced Transportation Institute (ATI-09) was conducted in 2009 to encourage high school students to pursue careers in the field of transportation engineering. The University Transportation Center for Alabama partnered with...

  20. Advanced Microanalysis Facility

    Data.gov (United States)

    Federal Laboratory Consortium — The Advanced Microanalysis Facility fully integrates capabilities for chemical and structural analysis of electronic materials and devices for the U.S. Army and DoD....

  1. Ferumoxtran-10 advanced magnetics.

    NARCIS (Netherlands)

    Leenders, W.P.J.

    2003-01-01

    Ferumoxtran-10 (Combidex) is an ultra-small superparamagnetic iron oxide molecular resonance imaging contrast agent under development by Advanced Magnetics Ltd and Guerbet for the principal indication of lymph node imaging.

  2. Advances in Numerical Methods

    CERN Document Server

    Mastorakis, Nikos E

    2009-01-01

    Features contributions that are focused on significant aspects of current numerical methods and computational mathematics. This book carries chapters that advanced methods and various variations on known techniques that can solve difficult scientific problems efficiently.

  3. Advanced Propulsion Study

    National Research Council Canada - National Science Library

    Davis, Eric

    2004-01-01

    ... that show promise of leading to a major advance in Earth-to-orbit (ETO) propulsion. The study also reviewed and evaluated a select number of credible far-term breakthrough propulsion physics concepts pertaining...

  4. Population-based colorectal cancer screening by fecal immunochemical testing over multiple rounds

    NARCIS (Netherlands)

    van der Vlugt, M.

    2017-01-01

    Colorectal cancer (CRC) is one of the major causes of death in the Netherlands, accounting for over 5100 deaths in 2015. Population screening aims to detect CRC or its precursors, advanced adenoma, in an early phase, thereby reducing CRC morbidity and mortality. A recent observational study

  5. Defining the taxonomic domain of applicability for mammalian-based high-throughput screening assays

    Science.gov (United States)

    Cell-based high throughput screening (HTS) technologies are becoming mainstream in chemical safety evaluations. The US Environmental Protection Agency (EPA) Toxicity Forecaster (ToxCastTM) and the multi-agency Tox21 Programs have been at the forefront in advancing this science, m...

  6. Advanced Welding Applications

    Science.gov (United States)

    Ding, Robert J.

    2010-01-01

    Some of the applications of advanced welding techniques are shown in this poster presentation. Included are brief explanations of the use on the Ares I and Ares V launch vehicle and on the Space Shuttle Launch vehicle. Also included are microstructural views from four advanced welding techniques: Variable Polarity Plasma Arc (VPPA) weld (fusion), self-reacting friction stir welding (SR-FSW), conventional FSW, and Tube Socket Weld (TSW) on aluminum.

  7. Joining of advanced materials

    CERN Document Server

    Messler, Robert W

    1993-01-01

    Provides an unusually complete and readable compilation of the primary and secondary options for joining conventional materials in non-conventional ways. Provides unique coverage of adhesive bonding using both organic and inorganic adhesives, cements and mortars. Focuses on materials issues without ignoring issues related to joint design, production processing, quality assurance, process economics, and joining performance in service.Joining of advanced materials is a unique treatment of joining of both conventional and advanced metals andalloys, intermetallics, ceramics, glasses, polymers, a

  8. Advances in atomic spectroscopy

    CERN Document Server

    Sneddon, J

    1997-01-01

    This series describes selected advances in the area of atomic spectroscopy. It is primarily intended for the reader who has a background in atmoic spectroscopy; suitable to the novice and expert. Although a widely used and accepted method for metal and non-metal analysis in a variety of complex samples, Advances in Atomic Spectroscopy covers a wide range of materials. Each Chapter will completely cover an area of atomic spectroscopy where rapid development has occurred.

  9. Advances in bistatic radar

    CERN Document Server

    Willis, Nick

    2007-01-01

    Advances in Bistatic Radar updates and extends bistatic and multistatic radar developments since publication of Willis' Bistatic Radar in 1991. New and recently declassified military applications are documented. Civil applications are detailed including commercial and scientific systems. Leading radar engineers provide expertise to each of these applications. Advances in Bistatic Radar consists of two major sections: Bistatic/Multistatic Radar Systems and Bistatic Clutter and Signal Processing. Starting with a history update, the first section documents the early and now declassified military

  10. Advanced Tokamak Stability Theory

    Science.gov (United States)

    Zheng, Linjin

    2015-03-01

    The intention of this book is to introduce advanced tokamak stability theory. We start with the derivation of the Grad-Shafranov equation and the construction of various toroidal flux coordinates. An analytical tokamak equilibrium theory is presented to demonstrate the Shafranov shift and how the toroidal hoop force can be balanced by the application of a vertical magnetic field in tokamaks. In addition to advanced theories, this book also discusses the intuitive physics pictures for various experimentally observed phenomena.

  11. Recent advances in quantitative high throughput and high content data analysis.

    Science.gov (United States)

    Moutsatsos, Ioannis K; Parker, Christian N

    2016-01-01

    High throughput screening has become a basic technique with which to explore biological systems. Advances in technology, including increased screening capacity, as well as methods that generate multiparametric readouts, are driving the need for improvements in the analysis of data sets derived from such screens. This article covers the recent advances in the analysis of high throughput screening data sets from arrayed samples, as well as the recent advances in the analysis of cell-by-cell data sets derived from image or flow cytometry application. Screening multiple genomic reagents targeting any given gene creates additional challenges and so methods that prioritize individual gene targets have been developed. The article reviews many of the open source data analysis methods that are now available and which are helping to define a consensus on the best practices to use when analyzing screening data. As data sets become larger, and more complex, the need for easily accessible data analysis tools will continue to grow. The presentation of such complex data sets, to facilitate quality control monitoring and interpretation of the results will require the development of novel visualizations. In addition, advanced statistical and machine learning algorithms that can help identify patterns, correlations and the best features in massive data sets will be required. The ease of use for these tools will be important, as they will need to be used iteratively by laboratory scientists to improve the outcomes of complex analyses.

  12. A focus group study of consumer attitudes toward genetic testing and newborn screening for deafness.

    Science.gov (United States)

    Burton, Sarah K; Withrow, Kara; Arnos, Kathleen S; Kalfoglou, Andrea L; Pandya, Arti

    2006-12-01

    Progress in identifying genes for deafness together with implementation of universal audiologic screening of newborns has provided the opportunity for more widespread use of molecular tests to detect genetic forms of hearing loss. Efforts to assess consumer attitudes toward these advances have lagged behind. Consumer focus groups were held to explore attitudes toward genetic advances and technologies for hearing loss, views about newborn hearing screening, and reactions to the idea of adding molecular screening for hearing loss at birth. Focus group discussions were recorded, transcribed and analyzed. Five focus groups with 44 participants including hearing parents of deaf children, deaf parents and young deaf adults were held. Focus group participants supported the use of genetic tests to identify the etiology of hearing loss but were concerned that genetic information might influence reproductive decisions. Molecular newborn screening was advocated by some; however, others expressed concern about its effectiveness. Documenting the attitudes of parents and other consumers toward genetic technologies establishes the framework for discussions on the appropriateness of molecular newborn screening for hearing loss and informs specialists about potential areas of public education necessary prior to the implementation of such screening.

  13. Advanced TCA Backplane Tester

    CERN Document Server

    Oltean, Alexandra Dana

    2004-01-01

    At the beginning of 2003, the PICMG group adopted the AdvancedTCA (Advanced Telecom Computing Architecture) standard. The 10Gb/s backplane of the AdvancedTCA chassis is well specified in the standard but it remains however a high end product, which can be itself subject to printed circuit board manufacturing control problems that could greatly affect its quality control. In order to study the practical aspects of high speed Ethernet switching at 10Gb/s and to validate the signal integrity of the AdvancedTCA backplane, we developed a Backplane Tester. The tester system is able of running monitored PRBS traffic at 3.125Gb/s over every link on the AdvancedTCA backplane simultaneously and to monitor any possible connectivity failure immediately in terms of link and slot position inside the chassis. The present report presents the architectural hardware design, the control structure and software aspects of the AdvancedTCA Backplane Tester design.

  14. United States advanced technologies

    International Nuclear Information System (INIS)

    Longenecker, J.R.

    1985-01-01

    In the United States, the advanced technologies have been applied to uranium enrichment as a means by which it can be assured that nuclear fuel cost will remain competitive in the future. The United States is strongly committed to the development of advanced enrichment technology, and has brought both advanced gas centrifuge (AGC) and atomic vapor laser isotope separation (AVLIS) programs to a point of significant technical refinement. The ability to deploy advanced technologies is the basis for the confidence in competitive future price. Unfortunately, the development of advanced technologies is capital intensive. The year 1985 is the key year for advanced technology development in the United States, since the decision on the primary enrichment technology for the future, AGC or AVLIS, will be made shortly. The background on the technology selection process, the highlights of AGC and AVLIS programs and the way to proceed after the process selection are described. The key objective is to maximize the sales volume and minimize the operating cost. This will help the utilities in other countries supply low cost energy on a reliable, long term basis. (Kako, I.)

  15. Internet-based screening for dementia risk.

    Science.gov (United States)

    Brandt, Jason; Sullivan, Campbell; Burrell, Larry E; Rogerson, Mark; Anderson, Allan

    2013-01-01

    The Dementia Risk Assessment (DRA) is an online tool consisting of questions about known risk factors for dementia, a novel verbal memory test, and an informant report of cognitive decline. Its primary goal is to educate the public about dementia risk factors and encourage clinical evaluation where appropriate. In Study 1, more than 3,000 anonymous persons over age 50 completed the DRA about themselves; 1,000 people also completed proxy reports about another person. Advanced age, lower education, male sex, complaints of severe memory impairment, and histories of cerebrovascular disease, Parkinson's disease, and brain tumor all contributed significantly to poor memory performance. A high correlation was obtained between proxy-reported decline and actual memory test performance. In Study 2, 52 persons seeking first-time evaluation at dementia clinics completed the DRA prior to their visits. Their responses (and those of their proxy informants) were compared to the results of independent evaluation by geriatric neuropsychiatrists. The 30 patients found to meet criteria for probable Alzheimer's disease, vascular dementia, or frontotemporal dementia differed on the DRA from the 22 patients without dementia (most other neuropsychiatric conditions). Scoring below criterion on the DRA's memory test had moderately high predictive validity for clinically diagnosed dementia. Although additional studies of larger clinical samples are needed, the DRA holds promise for wide-scale screening for dementia risk.

  16. Screening Sex: revelando e dissimulando o sexo Screening Sex

    Directory of Open Access Journals (Sweden)

    Linda Williams

    2012-06-01

    Full Text Available Neste texto, procura-se contar a história da exibição do sexo em filmes majoritariamente produzidos nos Estados Unidos no período de quase um século. Ao se perguntar quando, porque e como os Estados Unidos se transformaram de uma cultura que não exibia o sexo em uma que o exibe, a autora insiste no duplo significado do verbo screen (tanto como uma revelação quanto uma dissimulação. Exibir é revelar em uma tela. Mas um segundo e igualmente importante significado, como diz o dicionário é "proteger ou esconder atrás de uma tela". Os filmes tanto revelam como escondem. O artigo analisa a forma como mudanças sociais ocorridas nos Estados Unidos, como, por exemplo, a Revolução sexual dos anos 60 e novas visões a respeito da sexualidade, possibilitaram novas maneiras de representação do sexo no cinema, reorganizando a relação entre o público e o privado. O artigo se pergunta também sobre como nossos corpos e sentidos reagem ao encontro com o sexo na tela, introduzindo a ideia de "saber carnal" (carnal knowledge.In this paper, we try to tell the history of the exhibition of sex in movies mainly produced in the United States in almost a century. Asking when, why and how the United States became - from a culture that did not exhibit sex - into a culture that exhibits it, the author insists in the double sense of the verb to screen (as both a revelation and a dissimulation. To exhibit is to reveal in a screen. But another, and important, sense, as says the dictionary, is "to protect or hide behind a screen". Movies show as well as they reveal. The paper analyzes the way social change in the United States, for example the sexual revolution of the sixties and new views on sexuality allowed new ways of representing sex in the movies, creating a new relation between public and private. The paper also asks how our bodies and senses react to sex in the screen, introducing the idea of "carnal knowledge".

  17. Screening and classification of ceramic powders

    Science.gov (United States)

    Miwa, S.

    1983-01-01

    A summary is given of the classification technology of ceramic powders. Advantages and disadvantages of the wet and dry screening and classification methods are discussed. Improvements of wind force screening devices are described.

  18. Prostate Cancer Screening Results from PLCO

    Science.gov (United States)

    Learn the results of the Prostate, Lung, Colorectal, and Ovarian (PLCO) Cancer Screening Trial, a large-scale clinical trial to determine whether certain cancer screening tests can help reduce deaths from prostate, lung, colorectal, and ovarian cancer.

  19. Screening for Hepatitis C Infections in Adults

    Science.gov (United States)

    Understanding Task Force Recommendations Screening for Hepatitis C Virus Infection in Adults The U.S. Preventive Services Task Force (Task Force) has issued a final recommendation statement on Screening for Hepatitis C Virus ...

  20. Breast cancer screening: ''reassuring'' the worried well?

    DEFF Research Database (Denmark)

    Brodersen, John; Siersma, Volkert; Ryle, Mette

    2011-01-01

    of women offered screening compared to a population of women not offered screening for breast cancer. METHODS: One thousand women, aged 50-69 years, were randomly drawn from the Danish Civil Registration System to receive part I of the questionnaire Consequences of Screening in Breast Cancer (COS-BC1......): the sample consisted of 500 women living in a geographical area where screening mammography had been offered for more than 10 years and 500 women living in an area where the public health authorities had never invited women to breast cancer screening. RESULTS: A total of 759 women returned the questionnaire....... Those living in areas where screening was not offered reported more negative psychosocial aspects compared to women living in areas where screening was offered. CONCLUSIONS: The results indicate that women tend to perceive breast cancer screening as a reassuring preventive initiative. Alternatively...

  1. Health Screening: MedlinePlus Health Topic

    Science.gov (United States)

    ... I Have an Eye Exam? (Prevent Blindness America) Lipid Panel (American Association for Clinical Chemistry) Lung Cancer Screening (Mayo Foundation for Medical Education and Research) Also in Spanish Skin Cancer Screening (National Cancer ...

  2. Retinopathy of prematurity screening criteria and workload ...

    African Journals Online (AJOL)

    Larger infants require screening to include a few outliers, but they ... Making local screening criteria narrower on the basis of a limited evidence base may be dangerous. Risk factors for CSROP in larger infants need to be researched.

  3. Retinopathy of prematurity screening criteria and workload ...

    African Journals Online (AJOL)

    Larger infants require screening to include a few outliers, but they require ... Making local screening criteria narrower on the basis of a limited evidence base may be dangerous. Risk factors for CSROP in larger infants need to be researched.

  4. Screening candidate systems engineers: a research design

    CSIR Research Space (South Africa)

    Goncalves, DP

    2009-07-01

    Full Text Available engineering screening methodology that could be used to screen potential systems engineers. According to their design, this can be achieved by defining a system engineering profile according to specific psychological attributes, and using this profile...

  5. Sites Pre-Screened for Wind Energy

    Data.gov (United States)

    U.S. Environmental Protection Agency — The RE-Powering Screening Dataset spreadsheet contains detailed site information on over 80,000 contaminated lands, landfills, and mine sites with screening results...

  6. Risks of Liver (Hepatocellular) Cancer Screening

    Science.gov (United States)

    ... cancer. Having hepatitis or cirrhosis can increase the risk of developing liver cancer. Anything that increases the ... clinical trials is available from the NCI website . Risks of Liver (Hepatocellular) Cancer Screening Key Points Screening ...

  7. Phytochemical screening and antiproliferative effects of methanol ...

    African Journals Online (AJOL)

    Preliminary Phytochemical screening. Thin layer chromatographic profile (TLC) of methanol crude extract and antiproliferative studies were carried out in this research. Phytochemical screening revealed the presence of carbohydrate, glycoside, anthraquinone, steroid, triterpenes, saponin, tannins, flavonoids and alkaloid.

  8. Sites Pre-Screened for Solar Energy

    Data.gov (United States)

    U.S. Environmental Protection Agency — The RE-Powering Screening Dataset spreadsheet contains detailed site information on over 80,000 contaminated lands, landfills, and mine sites with screening results...

  9. Testing Precision Screening for Breast Cancer

    Science.gov (United States)

    An NCI research article about individualized approaches that could help identify those at risk of breast cancer who need to be screened and testing screening intervals that are appropriate for each person’s level of risk.

  10. Systemic treatment of advanced, persistent or recurrent cervical cancer

    International Nuclear Information System (INIS)

    Reckova, M.

    2015-01-01

    The cervical cancer is the third most common malignancy in women in the world. Despite advances in screening and treatment there are a relatively large number of patients who are diagnosed with advanced stage of disease, or who have inoperable recurrence. In this group of patients, the main aim of a treatment is palliative intent. The main cytotoxic agent is cisplatin, but the responses are also observed with other chemotherapy agents. Improved therapeutic results are observed with combined platinum-based chemotherapy regimens as compared to cisplatin monotherapy. Overall, however, the treatment results in advanced, persistent and recurrent cervical cancer are unfavorable and disease is considered to be relatively chemo resistant. The new treatment approaches are searched and a significant therapeutic benefit, as far as progression-free and overall survival, has been recently demonstrated when adding bevacizumab to systemic chemotherapy. The current article is a review of systemic treatment in advanced, persistent and recurrent metastatic carcinoma of the cervix. (author)

  11. Clad Degradation - FEPs Screening Arguments

    International Nuclear Information System (INIS)

    E. Siegmann

    2004-01-01

    The purpose of this report is to document the screening of the cladding degradation features, events, and processes (FEPs) for commercial spent nuclear fuel (CSNF). This report also addresses the effect of some FEPs on both the cladding and the CSNF, DSNF, and HLW waste forms where it was considered appropriate to address the effects on both materials together. This report summarizes the work of others to screen clad degradation FEPs in a manner consistent with, and used in, the Total System Performance Assessment-License Application (TSPA-LA). This document was prepared according to ''Technical Work Plan for Waste Form Degradation Modeling, Testing, and Analyses in Support of LA'' (BSC 2004a [DIRS 167796])

  12. Screening for pulmonary arteriovenous malformations

    DEFF Research Database (Denmark)

    Oxhøj, H; Kjeldsen, A D; Nielsen, G

    2000-01-01

    Pulmonary arteriovenous malformations (PAVM) cause right-to-left shunt and imply risk of paradoxical embolism and cerebral abscess. These complications can be prevented by appropriate treatment. Detection of PAVMs is therefore important, so simple and reliable screening methods are needed...... for this purpose. The aim of this investigation was to compare pulse oximetry and contrast echocardiography as screening tools for detection of pulmonary arteriovenous malformations. Eighty-five hereditary haemorrhagic telangiectasia (HHT) patients and first-degree relatives identified in a comprehensive study...... echocardiography with intravenous injection of echo contrast was performed in all subjects. Outcome measures were oxygen saturation change >2% units on changing body position and echo contrast observed in the left-sided heart chambers. Positive contrast echocardiography indicating the presence of PAVM was found...

  13. Environmental impact assessment screening tool

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-05-01

    An environmental assessment and impact planning software, SCREENER, was tested at a pilot project at the Cameco site (Port Hope). SCREENER was used to screen the impacts of a new construction project in accordance with the process and reporting requirements laid out in the Canadian Environmental Assessment Act. The software test concentrated on the activities that are directly involved with the structure construction and site preparation activities. In addition, a two and one half day training course was given to three AECB staff using the test case as a hands on example. The conclusion of this project is that an automated tool such as SCREENER (or Calyx, the new generation of environmental assessment tools from ESSA Software Ltd.), will help the AECB to standardize the approach to environmental assessment, assist in project planning, and save resources in the screening process. The new approach could allow to allocate AECB limited resources to the detailed assessments required for maximum impact activities. 2 figs. 7 refs.

  14. Environmental impact assessment screening tool

    International Nuclear Information System (INIS)

    1995-05-01

    An environmental assessment and impact planning software, SCREENER, was tested at a pilot project at the Cameco site (Port Hope). SCREENER was used to screen the impacts of a new construction project in accordance with the process and reporting requirements laid out in the Canadian Environmental Assessment Act. The software test concentrated on the activities that are directly involved with the structure construction and site preparation activities. In addition, a two and one half day training course was given to three AECB staff using the test case as a hands on example. The conclusion of this project is that an automated tool such as SCREENER (or Calyx, the new generation of environmental assessment tools from ESSA Software Ltd.), will help the AECB to standardize the approach to environmental assessment, assist in project planning, and save resources in the screening process. The new approach could allow to allocate AECB limited resources to the detailed assessments required for maximum impact activities

  15. Profiling, Screening and Criminal Recruitment

    OpenAIRE

    Christopher Cotton; Cheng Li

    2012-01-01

    We model major criminal activity as a game in which a law enforcement officer chooses the rate at which to screen different population groups and a criminal organization (e.g., drug cartel, terrorist cell) chooses the observable characteristics of its recruits. Our model best describes smuggling or terrorism activities at borders, airports and other security checkpoints. When the social costs of crime are high, law enforcement is most-effective when it is unconstrained in its ability to profi...

  16. Film-screen digital radiography

    International Nuclear Information System (INIS)

    Schwenker, R.P.; Eger, H.

    1985-01-01

    The excellent performance of the digital film-screen system as a receptor for projection radiographic data is discussed. An experimental system for obtaining high quality digital radiographic data by laser scanning radiographic films is described. This system is being used to evaluate the clinical utility of various digital image processing algorithms. Future plans include an investigation of quantitative analysis of projection radiographic data. Digital data obtained by film scanning can be used with digital image archiving and communications systems. (author)

  17. Employee Screening : Theory and Evidence

    OpenAIRE

    Fali Huang; Peter Cappelli

    2007-01-01

    Arguably the fundamental problem faced by employers is how to elicit effort from employees. Most models suggest that employers meet this challenge by monitoring employees carefully to prevent shirking. But there is another option that relies on heterogeneity across employees, and that is to screen job candidates to find workers with a stronger work ethic who require less monitoring. This should be especially useful in work systems where monitoring by supervisors is more difficult, such as tea...

  18. Methods for Cervical Cancer Screening

    Directory of Open Access Journals (Sweden)

    Tatiana Vargas-Revilla

    2014-12-01

    This article is divided in three sections: the first one focuses on the general impact of cervical cancer has hadin CostaRica, these condsection gathers information about different methodologies used around the world to detect this cancer and the third one makes reference to the current development of the screening devise in Mexico that works as a monitoring system and can used by women without external assistance.

  19. 3D mosquito screens to create window double screen traps for mosquito control.

    Science.gov (United States)

    Khattab, Ayman; Jylhä, Kaisa; Hakala, Tomi; Aalto, Mikko; Malima, Robert; Kisinza, William; Honkala, Markku; Nousiainen, Pertti; Meri, Seppo

    2017-08-29

    Mosquitoes are vectors for many diseases such as malaria. Insecticide-treated bed nets and indoor residual spraying of insecticides are the principal malaria vector control tools used to prevent malaria in the tropics. Other interventions aim at reducing man-vector contact. For example, house screening provides additive or synergistic effects to other implemented measures. We used commercial screen materials made of polyester, polyethylene or polypropylene to design novel mosquito screens that provide remarkable additional benefits to those commonly used in house screening. The novel design is based on a double screen setup made of a screen with 3D geometric structures parallel to a commercial mosquito screen creating a trap between the two screens. Owing to the design of the 3D screen, mosquitoes can penetrate the 3D screen from one side but cannot return through the other side, making it a unidirectional mosquito screen. Therefore, the mosquitoes are trapped inside the double screen system. The permissiveness of both sides of the 3D screens for mosquitoes to pass through was tested in a wind tunnel using the insectary strain of Anopheles stephensi. Among twenty-five tested 3D screen designs, three designs from the cone, prism, or cylinder design groups were the most efficient in acting as unidirectional mosquito screens. The three cone-, prism-, and cylinder-based screens allowed, on average, 92, 75 and 64% of Anopheles stephensi mosquitoes released into the wind tunnel to penetrate the permissive side and 0, 0 and 6% of mosquitoes to escape through the non-permissive side, respectively. A cone-based 3D screen fulfilled the study objective. It allowed capturing 92% of mosquitoes within the double screen setup inside the wind tunnel and blocked 100% from escaping. Thus, the cone-based screen effectively acted as a unidirectional mosquito screen. This 3D screen-based trap design could therefore be used in house screening as a means of avoiding infective bites and

  20. Bacterial contamination of computer touch screens.

    Science.gov (United States)

    Gerba, Charles P; Wuollet, Adam L; Raisanen, Peter; Lopez, Gerardo U

    2016-03-01

    The goal of this study was to determine the occurrence of opportunistic bacterial pathogens on the surfaces of computer touch screens used in hospitals and grocery stores. Opportunistic pathogenic bacteria were isolated on touch screens in hospitals; Clostridium difficile and vancomycin-resistant Enterococcus and in grocery stores; methicillin-resistant Staphylococcus aureus. Enteric bacteria were more common on grocery store touch screens than on hospital computer touch screens. Published by Elsevier Inc.