WorldWideScience

Sample records for short-hairpin rna shrna

  1. Short Hairpin RNA (shRNA): Design, Delivery, and Assessment of Gene Knockdown

    Science.gov (United States)

    Moore, Chris B.; Guthrie, Elizabeth H.; Huang, Max Tze-Han; Taxman, Debra J.

    2013-01-01

    Shortly after the cellular mechanism of RNA interference (RNAi) was first described, scientists began using this powerful technique to study gene function. This included designing better methods for the successful delivery of small interfering RNAs (siRNAs) and short hairpin RNAs (shRNAs) into mammalian cells. While the simplest method for RNAi is the cytosolic delivery of siRNA oligonucleotides, this technique is limited to cells capable of transfection and is primarily utilized during transient in vitro studies. The introduction of shRNA into mammalian cells through infection with viral vectors allows for stable integration of shRNA and long-term knockdown of the targeted gene; however, several challenges exist with the implementation of this technology. Here we describe some well-tested protocols which should increase the chances of successful design, delivery, and assessment of gene knockdown by shRNA. We provide suggestions for designing shRNA targets and controls, a protocol for sequencing through the secondary structure of the shRNA hairpin structure, and protocols for packaging and delivery of shRNA lentiviral particles. Using real-time PCR and functional assays we demonstrate the successful knockdown of ASC, an inflammatory adaptor molecule. These studies demonstrate the practicality of including two shRNAs with different efficacies of knockdown to provide an additional level of control and to verify dose dependency of functional effects. Along with the methods described here, as new techniques and algorithms are designed in the future, shRNA is likely to include further promising application and continue to be a critical component of gene discovery. PMID:20387148

  2. Is TNF-a-targeted short hairpin RNA (shRNA) a novel potential therapeutic tool in psoriasis treatment?

    DEFF Research Database (Denmark)

    Stenderup, Karin; Jakobsen, Maria; Rosada, Cecilia

    2008-01-01

      TNF-α is a well known target in psoriasis treatment and biological treatments targeting TNF-a are already clinically used against psoriasis and psoriasis arthritis. Attention is however given to a novel therapeutic tool: RNA interference that controls gene silencing. This study investigates...... the efficiency of targeting TNF-a with specific short hairpin RNA (shRNA) and explores its potential in treating psoriasis. ShRNAs targeting human TNF-α mRNA were generated. Their efficiency in down-regulating TNF-a protein expression was evaluated using a Renilla luciferase screening-assay and a transient co...... TNF-a shRNA was used to transduce HEK293 cells and verify vector-derived TNF-a knockdown in vitro. In vivo, psoriasis skin was exposed to lentiviral TNF-a shRNAs by a single intra-dermal injection. Psoriasis skin for the in vivo study was obtained from psoriatic plaque skin biopsies that were...

  3. Short hairpin RNA interference therapy for ischemic heart disease

    Science.gov (United States)

    Huang, Mei; Chan, Denise; Jia, Fangjun; Xie, Xiaoyan; Li, Zongjin; Hoyt, Grant; Robbins, Robert C.; Chen, Xiaoyuan; Giaccia, Amato; Wu, Joseph C.

    2013-01-01

    Background During hypoxia, upregulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Here we hypothesize that short hairpin RNA (shRNA) interference therapy targeting PHD2 can be used for treatment of myocardial ischemia and this process can be followed noninvasively by molecular imaging. Methods and Results PHD2 was cloned from mouse embryonic stem (ES) cells by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted into the pSuper vector driven by the H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct was used to transfect mouse C2C12 myoblast cell line for in vitro confirmation. Compared to the control short hairpin scramble (shScramble) as control, inhibition of PHD2 increased levels of HIF-1α protein and several downstream angiogenic genes by >30% (P<0.01). Afterwards, shRNA targeting PHD2 (shPHD2) plasmid was injected intramyocardially following ligation of left anterior descending (LAD) artery in mice. Animals were randomized into shPHD2 group (n=20) versus shScramble sequence as control (n=20). Bioluminescence imaging detected transgene expression for 4–5 weeks. Echocardiographic study showed the shPHD2 group had improved fractional shortening compared with the shScramble group at week 4 (33.7%±1.9% vs. 28.4%±2.8%; P<0.05). Postmortem analysis showed increased presence of small capillaries and venules in the infarcted zones by CD31 staining. Finally, Western blot anlaysis of explanted hearts also confirm that animals treated with shPHD2 had significantly higher levels of HIF-1α protein. Conclusions This is the first study to image the biological role of shRNA therapy for improving cardiac function. Inhibition of PHD2 by shRNA led to

  4. RNA polymerase II mediated transcription from the polymerase III promoters in short hairpin RNA expression vector

    International Nuclear Information System (INIS)

    Rumi, Mohammad; Ishihara, Shunji; Aziz, Monowar; Kazumori, Hideaki; Ishimura, Norihisa; Yuki, Takafumi; Kadota, Chikara; Kadowaki, Yasunori; Kinoshita, Yoshikazu

    2006-01-01

    RNA polymerase III promoters of human ribonuclease P RNA component H1, human U6, and mouse U6 small nuclear RNA genes are commonly used in short hairpin RNA (shRNA) expression vectors due their precise initiation and termination sites. During transient transfection of shRNA vectors, we observed that H1 or U6 promoters also express longer transcripts enough to express several reporter genes including firefly luciferase, green fluorescent protein EGFP, and red fluorescent protein JRed. Expression of such longer transcripts was augmented by upstream RNA polymerase II enhancers and completely inhibited by downstream polyA signal sequences. Moreover, the transcription of firefly luciferase from human H1 promoter was sensitive to RNA polymerase II inhibitor α-amanitin. Our findings suggest that commonly used polymerase III promoters in shRNA vectors are also prone to RNA polymerase II mediated transcription, which may have negative impacts on their targeted use

  5. Lentiviral Delivery of a Vesicular Glutamate Transporter 1 (VGLUT1)-Targeting Short Hairpin RNA Vector Into the Mouse Hippocampus Impairs Cognition

    NARCIS (Netherlands)

    King, Madeleine V.; Kurian, Nisha; Qin, Si; Papadopoulou, Nektaria; Westerink, Ben H. C.; Cremers, Thomas I.; Epping-Jordan, Mark P.; Le Poul, Emmanuel; Ray, David E.; Fone, Kevin C. F.; Kendall, David A.; Marsden, Charles A.; Sharp, Tyson V.

    Glutamate is the principle excitatory neurotransmitter in the mammalian brain, and dysregulation of glutamatergic neurotransmission is implicated in the pathophysiology of several psychiatric and neurological diseases. This study utilized novel lentiviral short hairpin RNA (shRNA) vectors to target

  6. Multi-resistance strategy for viral diseases and short hairpin RNA verification method in pigs

    Directory of Open Access Journals (Sweden)

    Jong-nam Oh

    2018-04-01

    Full Text Available Objective Foot and mouth disease (FMD and porcine reproductive and respiratory syndrome (PRRS are major diseases that interrupt porcine production. Because they are viral diseases, vaccinations are of only limited effectiveness in preventing outbreaks. To establish an alternative multi-resistant strategy against FMD virus (FMDV and PRRS virus (PRRSV, the present study introduced two genetic modification techniques to porcine cells. Methods First, cluster of differentiation 163 (CD163, the PRRSV viral receptor, was edited with the clustered regularly interspaced short palindromic repeats-CRISPR-associated protein 9 technique. The CD163 gene sequences of edited cells and control cells differed. Second, short hairpin RNA (shRNAs were integrated into the cells. The shRNAs, targeting the 3D gene of FMDV and the open reading frame 7 (ORF7 gene of PRRSV, were transferred into fibroblasts. We also developed an in vitro shRNA verification method with a target gene expression vector. Results shRNA activity was confirmed in vitro with vectors that expressed the 3D and ORF7 genes in the cells. Cells containing shRNAs showed lower transcript levels than cells with only the expression vectors. The shRNAs were integrated into CD163-edited cells to combine the two techniques, and the viral genes were suppressed in these cells. Conclusion We established a multi-resistant strategy against viral diseases and an in vitro shRNA verification method.

  7. Novel guanidinylated bioresponsive poly(amidoamines designed for short hairpin RNA delivery

    Directory of Open Access Journals (Sweden)

    Yu J

    2016-12-01

    Full Text Available Jiankun Yu,1 Jinmin Zhang,1 Haonan Xing,1 Yanping Sun,1 Zhen Yang,1 Tianzhi Yang,2 Cuifang Cai,1 Xiaoyun Zhao,3 Li Yang,1 Pingtian Ding1 1School of Pharmacy, Shenyang Pharmaceutical University, Shenyang, China; 2Department of Basic Pharmaceutical Sciences, School of Pharmacy, Husson University, Bangor, ME, USA; 3Department of Microbiology and Cell Biology, School of Life Science and Biopharmaceutics, Shenyang Pharmaceutical University, Shenyang, China Abstract: Two different disulfide (SS-containing poly(amidoamine (PAA polymers were constructed using guanidino (Gua-containing monomers (ie, arginine [Arg] and agmatine [Agm] and N,N'-cystamine bisacrylamide (CBA by Michael-addition polymerization. In order to characterize these two Gua-SS-PAA polymers and investigate their potentials as short hairpin RNA (shRNA-delivery carriers, pSilencer 4.1-CMV FANCF shRNA was chosen as a model plasmid DNA to form complexes with these two polymers. The Gua-SS-PAAs and plasmid DNA complexes were determined with particle sizes less than 90 nm and positive ζ-potentials under 20 mV at nucleic acid:polymer weight ratios lower than 1:24. Bioresponsive release of plasmid DNA was observed from both newly constructed complexes. Significantly lower cytotoxicity was observed for both polymer complexes compared with polyethylenimine and Lipofectamine 2000, two widely used transfection reagents as reference carriers. Arg-CBA showed higher transfection efficiency and gene-silencing efficiency in MCF7 cells than Agm-CBA and the reference carriers. In addition, the cellular uptake of Arg-CBA in MCF7 cells was found to be higher and faster than Agm-CBA and the reference carriers. Similarly, plasmid DNA transport into the nucleus mediated by Arg-CBA was more than that by Agm-CBA and the reference carriers. The study suggested that guanidine and carboxyl introduced into Gua-SS-PAAs polymers resulted in a better nuclear localization effect, which played a key role in the

  8. Miniature short hairpin RNA screens to characterize antiproliferative drugs.

    Science.gov (United States)

    Kittanakom, Saranya; Arnoldo, Anthony; Brown, Kevin R; Wallace, Iain; Kunavisarut, Tada; Torti, Dax; Heisler, Lawrence E; Surendra, Anuradha; Moffat, Jason; Giaever, Guri; Nislow, Corey

    2013-08-07

    The application of new proteomics and genomics technologies support a view in which few drugs act solely by inhibiting a single cellular target. Indeed, drug activity is modulated by complex, often incompletely understood cellular mechanisms. Therefore, efforts to decipher mode of action through genetic perturbation such as RNAi typically yields "hits" that fall into several categories. Of particular interest to the present study, we aimed to characterize secondary activities of drugs on cells. Inhibiting a known target can result in clinically relevant synthetic phenotypes. In one scenario, drug perturbation could, for example, improperly activate a protein that normally inhibits a particular kinase. In other cases, additional, lower affinity targets can be inhibited as in the example of inhibition of c-Kit observed in Bcr-Abl-positive cells treated with Gleevec. Drug transport and metabolism also play an important role in the way any chemicals act within the cells. Finally, RNAi per se can also affect cell fitness by more general off-target effects, e.g., via the modulation of apoptosis or DNA damage repair. Regardless of the root cause of these unwanted effects, understanding the scope of a drug's activity and polypharmacology is essential for better understanding its mechanism(s) of action, and such information can guide development of improved therapies. We describe a rapid, cost-effective approach to characterize primary and secondary effects of small-molecules by using small-scale libraries of virally integrated short hairpin RNAs. We demonstrate this principle using a "minipool" composed of shRNAs that target the genes encoding the reported protein targets of approved drugs. Among the 28 known reported drug-target pairs, we successfully identify 40% of the targets described in the literature and uncover several unanticipated drug-target interactions based on drug-induced synthetic lethality. We provide a detailed protocol for performing such screens and for

  9. Adeno-Associated Viral Vector-Mediated mTOR Inhibition by Short Hairpin RNA Suppresses Laser-Induced Choroidal Neovascularization

    Directory of Open Access Journals (Sweden)

    Tae Kwann Park

    2017-09-01

    Full Text Available Choroidal neovascularization (CNV is the defining characteristic feature of the wet subtype of age-related macular degeneration (AMD and may result in irreversible blindness. Based on anti-vascular endothelial growth factor (anti-VEGF, the current therapeutic approaches to CNV are fraught with difficulties, and mammalian target of rapamycin (mTOR has recently been proposed as a possible therapeutic target, although few studies have been conducted. Here, we show that a recombinant adeno-associated virus-delivered mTOR-inhibiting short hairpin RNA (rAAV-mTOR shRNA, which blocks the activity of both mTOR complex 1 and 2, represents a promising therapeutic approach for the treatment of CNV. Eight-week-old male C57/B6 mice were treated with the short hairpin RNA (shRNA after generating CNV lesions in the eyes via laser photocoagulation. The recombinant adeno-associated virus (rAAV delivery vehicle was able to effectively transduce cells in the inner retina, and significantly fewer inflammatory cells and less extensive CNV were observed in the animals treated with rAAV-mTOR shRNA when compared with control- and rAAV-scrambled shRNA-treated groups. Presumably related to the reduction of CNV, increased autophagy was detected in CNV lesions treated with rAAV-mTOR shRNA, whereas significantly fewer apoptotic cells detected in the outer nuclear layer around the CNV indicate that mTOR inhibition may also have neuroprotective effects. Taken together, these results demonstrate the therapeutic potential of mTOR inhibition, resulting from rAAV-mTOR shRNA activity, in the treatment of AMD-related CNV. Keywords: retinal neovascularization, choroidal neovascularization, adeno-associated virus, mTOR, RNA interference, mTOR shRNA, autophagy

  10. An optimized lentiviral vector system for conditional RNAi and efficient cloning of microRNA embedded short hairpin RNA libraries.

    Science.gov (United States)

    Adams, Felix F; Heckl, Dirk; Hoffmann, Thomas; Talbot, Steven R; Kloos, Arnold; Thol, Felicitas; Heuser, Michael; Zuber, Johannes; Schambach, Axel; Schwarzer, Adrian

    2017-09-01

    RNA interference (RNAi) and CRISPR-Cas9-based screening systems have emerged as powerful and complementary tools to unravel genetic dependencies through systematic gain- and loss-of-function studies. In recent years, a series of technical advances helped to enhance the performance of virally delivered RNAi. For instance, the incorporation of short hairpin RNAs (shRNAs) into endogenous microRNA contexts (shRNAmiRs) allows the use of Tet-regulated promoters for synchronous onset of gene knockdown and precise interrogation of gene dosage effects. However, remaining challenges include lack of efficient cloning strategies, inconsistent knockdown potencies and leaky expression. Here, we present a simple, one-step cloning approach for rapid and efficient cloning of miR-30 shRNAmiR libraries. We combined a human miR-30 backbone retaining native flanking sequences with an optimized all-in-one lentiviral vector system for conditional RNAi to generate a versatile toolbox characterized by higher doxycycline sensitivity, reduced leakiness and enhanced titer. Furthermore, refinement of existing shRNA design rules resulted in substantially improved prediction of powerful shRNAs. Our approach was validated by accurate quantification of the knockdown potency of over 250 single shRNAmiRs. To facilitate access and use by the scientific community, an online tool was developed for the automated design of refined shRNA-coding oligonucleotides ready for cloning into our system. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Short hairpin RNA-mediated knockdown of protein expression in Entamoeba histolytica

    Directory of Open Access Journals (Sweden)

    Singh Upinder

    2009-02-01

    Full Text Available Abstract Background Entamoeba histolytica is an intestinal protozoan parasite of humans. The genome has been sequenced, but the study of individual gene products has been hampered by the lack of the ability to generate gene knockouts. We chose to test the use of RNA interference to knock down gene expression in Entamoeba histolytica. Results An episomal vector-based system, using the E. histolytica U6 promoter to drive expression of 29-basepair short hairpin RNAs, was developed to target protein-encoding genes in E. histolytica. The short hairpin RNAs successfully knocked down protein levels of all three unrelated genes tested with this system: Igl, the intermediate subunit of the galactose- and N-acetyl-D-galactosamine-inhibitable lectin; the transcription factor URE3-BP; and the membrane binding protein EhC2A. Igl levels were reduced by 72%, URE3-BP by 89%, and EhC2A by 97%. Conclusion Use of the U6 promoter to drive expression of 29-basepair short hairpin RNAs is effective at knocking down protein expression for unrelated genes in Entamoeba histolytica, providing a useful tool for the study of this parasite.

  12. Short hairpin RNA-mediated knockdown of protein expression in Entamoeba histolytica.

    Science.gov (United States)

    Linford, Alicia S; Moreno, Heriberto; Good, Katelyn R; Zhang, Hanbang; Singh, Upinder; Petri, William A

    2009-02-17

    Entamoeba histolytica is an intestinal protozoan parasite of humans. The genome has been sequenced, but the study of individual gene products has been hampered by the lack of the ability to generate gene knockouts. We chose to test the use of RNA interference to knock down gene expression in Entamoeba histolytica. An episomal vector-based system, using the E. histolytica U6 promoter to drive expression of 29-basepair short hairpin RNAs, was developed to target protein-encoding genes in E. histolytica. The short hairpin RNAs successfully knocked down protein levels of all three unrelated genes tested with this system: Igl, the intermediate subunit of the galactose- and N-acetyl-D-galactosamine-inhibitable lectin; the transcription factor URE3-BP; and the membrane binding protein EhC2A. Igl levels were reduced by 72%, URE3-BP by 89%, and EhC2A by 97%. Use of the U6 promoter to drive expression of 29-basepair short hairpin RNAs is effective at knocking down protein expression for unrelated genes in Entamoeba histolytica, providing a useful tool for the study of this parasite.

  13. Adenoviral short hairpin RNA therapy targeting phosphodiesterase 5a relieves cardiac remodeling and dysfunction following myocardial infarction

    Science.gov (United States)

    Li, Longhu; Haider, Husnain Kh.; Wang, Linlin; Lu, Gang

    2012-01-01

    We previously showed that treatment with tadalafil, a long-acting phosphodiesterase-5a (PDE5a) inhibitor, effectively prevented adverse left ventricular (LV) remodeling of the infarcted heart. We hypothesized that short-hairpin RNA (shRNA) therapy targeting PDE5a would simulate the effects of pharmacological intervention for treatment of postinfarction LV remodeling and dysfunction. Experimental model of myocardial infarction was developed in female mice by permanent ligation of left coronary artery. Immediately after that, an adenoviral vector encoding for shRNA sequence targeting PDE5a (Ad-shPDE5a) was injected intramyocardially, which specifically inhibited PDE5a in the heart. Four weeks later, Ad-shPDE5a treated mice showed significant mitigation of the left ventricle (LV) dilatation and dysfunction as indicated by smaller LV cavity and more preserved ejection fraction and fractional shortening. Infarction size and fibrosis were significantly reduced in Ad-shPDE5a-treated mice. Additionally, more salvaged cardiomyocytes, significantly reduced collagen contents, and higher blood vessel density were observed in Ad-shPDE5a-treated mice. The cytoprotective effects of Ad-shPDE5a were demonstrated in vitro in Ad-shPDE5a transfected cardiomyocytes cultured under oxygen glucose deprivation. Among downstream mediators of PDE5a signaling, cyclic GMP (cGMP) and cGMP-dependent protein kinase G (PKG) were activated with concomitant reduction in caspase-3 activity. However, no significant change in PKA and cAMP activities were observed in Ad-shPDE5a-treated hearts. Inhibition with shRNA improved cardiac remodeling and dysfunction by reducing infarction size and cardiac fibrosis and increased cGMP and PKG activity. These findings suggest that PDE5 inhibition with Ad-shPDE5a is a novel approach for treatment of myocardial infarction. PMID:22447941

  14. Dicer-independent processing of short hairpin RNAs

    NARCIS (Netherlands)

    Liu, Ying Poi; Schopman, Nick C. T.; Berkhout, Ben

    2013-01-01

    Short hairpin RNAs (shRNAs) are widely used to induce RNA interference (RNAi). We tested a variety of shRNAs that differed in stem length and terminal loop size and revealed strikingly different RNAi activities and shRNA-processing patterns. Interestingly, we identified a specific shRNA design that

  15. Short hairpin RNA targeting 2B gene of coxsackievirus B3 exhibits potential antiviral effects both in vitro and in vivo

    Directory of Open Access Journals (Sweden)

    Yao Hailan

    2012-08-01

    Full Text Available Abstract Background Coxsackievirus B3 is an important infectious agent of viral myocarditis, pancreatitis and aseptic meningitis, but there are no specific antiviral therapeutic reagents in clinical use. RNA interference-based technology has been developed to prevent the viral infection. Methods To evaluate the impact of RNA interference on viral replication, cytopathogenicity and animal survival, short hairpin RNAs targeting the viral 2B region (shRNA-2B expressed by a recombinant vector (pGCL-2B or a recombinant lentivirus (Lenti-2B were tansfected in HeLa cells or transduced in mice infected with CVB3. Results ShRNA-2B exhibited a significant effect on inhibition of viral production in HeLa cells. Furthermore, shRNA-2B improved mouse survival rate, reduced the viral tissues titers and attenuated tissue damage compared with those of the shRNA-NC treated control group. Lenti-2B displayed more effective role in inhibition of viral replication than pGCL-2B in vivo. Conclusions Coxsackievirus B3 2B is an effective target of gene silencing against coxsackievirus B3 infection, suggesting that shRNA-2B is a potential agent for further development into a treatment for enterviral diseases.

  16. Shortcomings of short hairpin RNA-based transgenic RNA interference in mouse oocytes

    Czech Academy of Sciences Publication Activity Database

    Sarnová, Lenka; Malík, Radek; Sedláček, Radislav; Svoboda, Petr

    2010-01-01

    Roč. 9, č. 8 (2010), s. 1-10 ISSN 1477-5751 R&D Project s: GA MŠk ME09039 Grant - others:EMBO SDIG(DE) project 1483 Institutional research plan: CEZ:AV0Z50520514 Keywords : transgenic RNAi * shRNA * oocyte Subject RIV: EB - Genetics ; Molecular Biology http://www.jnrbm.com/content/9/1/8

  17. Shortcomings of short hairpin RNA-based transgenic RNA interference in mouse oocytes

    Czech Academy of Sciences Publication Activity Database

    Sarnová, Lenka; Malík, Radek; Sedláček, Radislav; Svoboda, Petr

    2010-01-01

    Roč. 9, č. 8 (2010), s. 1-10 ISSN 1477-5751 R&D Projects: GA MŠk ME09039 Grant - others:EMBO SDIG(DE) project 1483 Institutional research plan: CEZ:AV0Z50520514 Keywords : transgenic RNAi * shRNA * oocyte Subject RIV: EB - Genetics ; Molecular Biology http://www.jnrbm.com/content/9/1/8

  18. Short Hairpin RNA Silencing of PHD-2 Improves Neovascularization and Functional Outcomes in Diabetic Wounds and Ischemic Limbs.

    Directory of Open Access Journals (Sweden)

    Kevin J Paik

    Full Text Available The transcription factor hypoxia-inducible factor 1-alpha (HIF-1α is responsible for the downstream expression of over 60 genes that regulate cell survival and metabolism in hypoxic conditions as well as those that enhance angiogenesis to alleviate hypoxia. However, under normoxic conditions, HIF-1α is hydroxylated by prolyl hydroxylase 2, and subsequently degraded, with a biological half-life of less than five minutes. Here we investigated the therapeutic potential of inhibiting HIF-1α degradation through short hairpin RNA silencing of PHD-2 in the setting of diabetic wounds and limb ischemia. Treatment of diabetic mouse fibroblasts with shPHD-2 in vitro resulted in decreased levels of PHD-2 transcript demonstrated by qRT-PCR, higher levels of HIF-1α as measured by western blot, and higher expression of the downstream angiogenic genes SDF-1 and VEGFα, as measured by qRT-PCR. In vivo, shPHD-2 accelerated healing of full thickness excisional wounds in diabetic mice compared to shScr control, (14.33 ± 0.45 days vs. 19 ± 0.33 days and was associated with an increased vascular density. Delivery of shPHD-2 also resulted in improved perfusion of ischemic hind limbs compared to shScr, prevention of distal digit tip necrosis, and increased survival of muscle tissue. Knockdown of PHD-2 through shRNA treatment has the potential to stimulate angiogenesis through overexpression of HIF-1α and upregulation of pro-angiogenic genes downstream of HIF-1α, and may represent a viable, non-viral approach to gene therapy for ischemia related applications.

  19. Preclinical safety and efficacy of an anti–HIV-1 lentiviral vector containing a short hairpin RNA to CCR5 and the C46 fusion inhibitor

    Directory of Open Access Journals (Sweden)

    Orit Wolstein

    2014-01-01

    Full Text Available Gene transfer has therapeutic potential for treating HIV-1 infection by generating cells that are resistant to the virus. We have engineered a novel self-inactivating lentiviral vector, LVsh5/C46, using two viral-entry inhibitors to block early steps of HIV-1 cycle. The LVsh5/C46 vector encodes a short hairpin RNA (shRNA for downregulation of CCR5, in combination with the HIV-1 fusion inhibitor, C46. We demonstrate here the effective delivery of LVsh5/C46 to human T cell lines, peripheral blood mononuclear cells, primary CD4+ T lymphocytes, and CD34+ hematopoietic stem/progenitor cells (HSPC. CCR5-targeted shRNA (sh5 and C46 peptide were stably expressed in the target cells and were able to effectively protect gene-modified cells against infection with CCR5- and CXCR4-tropic strains of HIV-1. LVsh5/C46 treatment was nontoxic as assessed by cell growth and viability, was noninflammatory, and had no adverse effect on HSPC differentiation. LVsh5/C46 could be produced at a scale sufficient for clinical development and resulted in active viral particles with very low mutagenic potential and the absence of replication-competent lentivirus. Based on these in vitro results, plus additional in vivo safety and efficacy data, LVsh5/C46 is now being tested in a phase 1/2 clinical trial for the treatment of HIV-1 disease.

  20. Adenovirus delivered short hairpin RNA targeting a conserved site in the 5' non-translated region inhibits all four serotypes of dengue viruses.

    Directory of Open Access Journals (Sweden)

    Anil Babu Korrapati

    Full Text Available BACKGROUND: Dengue is a mosquito-borne viral disease caused by four closely related serotypes of Dengue viruses (DENVs. This disease whose symptoms range from mild fever to potentially fatal haemorrhagic fever and hypovolemic shock, threatens nearly half the global population. There is neither a preventive vaccine nor an effective antiviral therapy against dengue disease. The difference between severe and mild disease appears to be dependent on the viral load. Early diagnosis may enable timely therapeutic intervention to blunt disease severity by reducing the viral load. Harnessing the therapeutic potential of RNA interference (RNAi to attenuate DENV replication may offer one approach to dengue therapy. METHODOLOGY/PRINCIPAL FINDINGS: We screened the non-translated regions (NTRs of the RNA genomes of representative members of the four DENV serotypes for putative siRNA targets mapping to known transcription/translation regulatory elements. We identified a target site in the 5' NTR that maps to the 5' upstream AUG region, a highly conserved cis-acting element essential for viral replication. We used a replication-defective human adenovirus type 5 (AdV5 vector to deliver a short-hairpin RNA (shRNA targeting this site into cells. We show that this shRNA matures to the cognate siRNA and is able to inhibit effectively antigen secretion, viral RNA replication and infectious virus production by all four DENV serotypes. CONCLUSION/SIGNIFICANCE: The data demonstrate the feasibility of using AdV5-mediated delivery of shRNAs targeting conserved sites in the viral genome to achieve inhibition of all four DENV serotypes. This paves the way towards exploration of RNAi as a possible therapeutic strategy to curtail DENV infection.

  1. Deep Sequencing Insights in Therapeutic shRNA Processing and siRNA Target Cleavage Precision.

    Science.gov (United States)

    Denise, Hubert; Moschos, Sterghios A; Sidders, Benjamin; Burden, Frances; Perkins, Hannah; Carter, Nikki; Stroud, Tim; Kennedy, Michael; Fancy, Sally-Ann; Lapthorn, Cris; Lavender, Helen; Kinloch, Ross; Suhy, David; Corbau, Romu

    2014-02-04

    TT-034 (PF-05095808) is a recombinant adeno-associated virus serotype 8 (AAV8) agent expressing three short hairpin RNA (shRNA) pro-drugs that target the hepatitis C virus (HCV) RNA genome. The cytosolic enzyme Dicer cleaves each shRNA into multiple, potentially active small interfering RNA (siRNA) drugs. Using next-generation sequencing (NGS) to identify and characterize active shRNAs maturation products, we observed that each TT-034-encoded shRNA could be processed into as many as 95 separate siRNA strands. Few of these appeared active as determined by Sanger 5' RNA Ligase-Mediated Rapid Amplification of cDNA Ends (5-RACE) and through synthetic shRNA and siRNA analogue studies. Moreover, NGS scrutiny applied on 5-RACE products (RACE-seq) suggested that synthetic siRNAs could direct cleavage in not one, but up to five separate positions on targeted RNA, in a sequence-dependent manner. These data support an on-target mechanism of action for TT-034 without cytotoxicity and question the accepted precision of substrate processing by the key RNA interference (RNAi) enzymes Dicer and siRNA-induced silencing complex (siRISC).Molecular Therapy-Nucleic Acids (2014) 3, e145; doi:10.1038/mtna.2013.73; published online 4 February 2014.

  2. Short-hairpin RNA-mediated stable silencing of Grb2 impairs cell growth and DNA synthesis

    International Nuclear Information System (INIS)

    Di Fulvio, Mauricio; Henkels, Karen M.; Gomez-Cambronero, Julian

    2007-01-01

    Grb2 is an SH2-SH3 protein adaptor responsible for linking growth factor receptors with intracellular signaling cascades. To study the role of Grb2 in cell growth, we have generated a new COS7 cell line (COS7 shGrb2 ), based on RNAi technology, as null mutations in mammalian Grb2 genes are lethal in early development. This novel cell line continuously expresses a short hairpin RNA that targets endogenous Grb2. Stable COS7 shGrb2 cells had the shGrb2 integrated into the genomic DNA and carried on SiL construct (made refractory to the shRNA-mediated interference), but not with an SH2-deficient mutant (R86K). Thus, a viable knock-down and rescue protocol has demonstrated that Grb2 is crucial for cell proliferation

  3. Engineering HIV-1-resistant T-cells from short-hairpin RNA-expressing hematopoietic stem/progenitor cells in humanized BLT mice.

    Directory of Open Access Journals (Sweden)

    Gene-Errol E Ringpis

    Full Text Available Down-regulation of the HIV-1 coreceptor CCR5 holds significant potential for long-term protection against HIV-1 in patients. Using the humanized bone marrow/liver/thymus (hu-BLT mouse model which allows investigation of human hematopoietic stem/progenitor cell (HSPC transplant and immune system reconstitution as well as HIV-1 infection, we previously demonstrated stable inhibition of CCR5 expression in systemic lymphoid tissues via transplantation of HSPCs genetically modified by lentiviral vector transduction to express short hairpin RNA (shRNA. However, CCR5 down-regulation will not be effective against existing CXCR4-tropic HIV-1 and emergence of resistant viral strains. As such, combination approaches targeting additional steps in the virus lifecycle are required. We screened a panel of previously published shRNAs targeting highly conserved regions and identified a potent shRNA targeting the R-region of the HIV-1 long terminal repeat (LTR. Here, we report that human CD4(+ T-cells derived from transplanted HSPC engineered to co-express shRNAs targeting CCR5 and HIV-1 LTR are resistant to CCR5- and CXCR4- tropic HIV-1-mediated depletion in vivo. Transduction with the combination vector suppressed CXCR4- and CCR5- tropic viral replication in cell lines and peripheral blood mononuclear cells in vitro. No obvious cytotoxicity or interferon response was observed. Transplantation of combination vector-transduced HSPC into hu-BLT mice resulted in efficient engraftment and subsequent stable gene marking and CCR5 down-regulation in human CD4(+ T-cells within peripheral blood and systemic lymphoid tissues, including gut-associated lymphoid tissue, a major site of robust viral replication, for over twelve weeks. CXCR4- and CCR5- tropic HIV-1 infection was effectively inhibited in hu-BLT mouse spleen-derived human CD4(+ T-cells ex vivo. Furthermore, levels of gene-marked CD4(+ T-cells in peripheral blood increased despite systemic infection with either

  4. A simple and robust vector-based shRNA expression system used for RNA interference.

    Science.gov (United States)

    Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi

    2013-01-01

    RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

  5. A simple and robust vector-based shRNA expression system used for RNA interference.

    Directory of Open Access Journals (Sweden)

    Xue-jun Wang

    Full Text Available BACKGROUND: RNA interference (RNAi mediated by small interfering RNAs (siRNAs or short hairpin RNAs (shRNAs has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. RESULTS: In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. CONCLUSION: This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

  6. A Conserved Target Site in HIV-1 Gag RNA is Accessible to Inhibition by Both an HDV Ribozyme and a Short Hairpin RNA

    Directory of Open Access Journals (Sweden)

    Robert J Scarborough

    2014-01-01

    Full Text Available Antisense-based molecules targeting HIV-1 RNA have the potential to be used as part of gene or drug therapy to treat HIV-1 infection. In this study, HIV-1 RNA was screened to identify more conserved and accessible target sites for ribozymes based on the hepatitis delta virus motif. Using a quantitative screen for effects on HIV-1 production, we identified a ribozyme targeting a highly conserved site in the Gag coding sequence with improved inhibitory potential compared to our previously described candidates targeting the overlapping Tat/Rev coding sequence. We also demonstrate that this target site is highly accessible to short hairpin directed RNA interference, suggesting that it may be available for the binding of antisense RNAs with different modes of action. We provide evidence that this target site is structurally conserved in diverse viral strains and that it is sufficiently different from the human transcriptome to limit off-target effects from antisense therapies. We also show that the modified hepatitis delta virus ribozyme is more sensitive to a mismatch in its target site compared to the short hairpin RNA. Overall, our results validate the potential of a new target site in HIV-1 RNA to be used for the development of antisense therapies.

  7. Identification of short hairpin RNA targeting foot-and-mouth disease virus with transgenic bovine fetal epithelium cells.

    Directory of Open Access Journals (Sweden)

    Hongmei Wang

    Full Text Available BACKGROUND: Although it is known that RNA interference (RNAi targeting viral genes protects experimental animals, such as mice, from the challenge of Foot-and-mouth disease virus (FMDV, it has not been previously investigated whether shRNAs targeting FMDV in transgenic dairy cattle or primary transgenic bovine epithelium cells will confer resistance against FMDV challenge. PRINCIPAL FINDING: Here we constructed three recombinant lentiviral vectors containing shRNA against VP2 (RNAi-VP2, VP3 (RNAi-VP3, or VP4 (RNAi-VP4 of FMDV, and found that all of them strongly suppressed the transient expression of a FLAG-tagged viral gene fusion protein in 293T cells. In BHK-21 cells, RNAi-VP4 was found to be more potent in inhibition of viral replication than the others with over 98% inhibition of viral replication. Therefore, recombinant lentiviral vector RNAi-VP4 was transfected into bovine fetal fibroblast cells to generate transgenic nuclear donor cells. With subsequent somatic cell cloning, we generated forty transgenic blastocysts, and then transferred them to 20 synchronized recipient cows. Three transgenic bovine fetuses were obtained after pregnant period of 4 months, and integration into chromosome in cloned fetuses was confirmed by Southern hybridization. The primary tongue epithelium cells of transgenic fetuses were isolated and inoculated with 100 TCID(50 of FMDV, and it was observed that shRNA significantly suppressed viral RNA synthesis and inhibited over 91% of viral replication after inoculation of FMDV for 48 h. CONCLUSION: RNAi-VP4 targeting viral VP4 gene appears to prevent primary epithelium cells of transgenic bovine fetus from FMDV infection, and it could be a candidate shRNA used for cultivation of transgenic cattle against FMDV.

  8. Creating Transgenic shRNA Mice by Recombinase-Mediated Cassette Exchange

    Science.gov (United States)

    Premsrirut, Prem K.; Dow, Lukas E.; Park, Youngkyu; Hannon, Gregory J.; Lowe, Scott W.

    2014-01-01

    RNA interference (RNAi) enables sequence-specific, experimentally induced silencing of virtually any gene by tapping into innate regulatory mechanisms that are conserved among most eukaryotes. The principles that enable transgenic RNAi in cell lines can also be used to create transgenic animals, which express short-hairpin RNAs (shRNAs) in a regulated or tissue-specific fashion. However, RNAi in transgenic animals is somewhat more challenging than RNAi in cultured cells. The activities of promoters that are commonly used for shRNA expression in cell culture can vary enormously in different tissues, and founder lines also typically vary in transgene expression due to the effects of their single integration sites. There are many ways to produce mice carrying shRNA transgenes and the method described here uses recombinase-mediated cassette exchange (RMCE). RMCE permits insertion of the shRNA transgene into a well-characterized locus that gives reproducible and predictable expression in each founder and enhances the probability of potent expression in many cell types. This procedure is more involved and complex than simple pronuclear injection, but if even a few shRNA mice are envisioned, for example, to probe the functions of several genes, the effort of setting up the processes outlined below are well worthwhile. Note that when creating a transgenic mouse, one should take care to use the most potent shRNA possible. As a rule of thumb, the sequence chosen should provide >90% knockdown when introduced into cultured cells at single copy (e.g., on retroviral infection at a multiplicity of ≤0.3). PMID:24003198

  9. Effects of short-hairpin RNA-inhibited {beta}-catenin expression on the growth of human multiple myeloma cells in vitro and in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Liang, Wenqing, E-mail: liangwenqing_1234@126.com [Department of Orthopaedics, Shaoxing People' s Hospital, 568 Zhongxing North Road, Shaoxing 312000 (China); Yang, Chengwei [Department of Spinal Surgery, Lanzhou General Hospital, Lanzhou Military Area Command, 333 Nanbinhe Road, Lanzhou 730050 (China); Qian, Yu [Department of Orthopaedics, Shaoxing People' s Hospital, 568 Zhongxing North Road, Shaoxing 312000 (China); Fu, Qiang, E-mail: chyygklwq@hotmail.com [Department of Orthopaedics, Changhai Hospital, Second Military Medical University, 168 Changhai Road, Shanghai 200433 (China)

    2012-06-15

    Highlights: Black-Right-Pointing-Pointer {beta}-Catenin expression were markedly down-regulated by CTNNB1 shRNA. Black-Right-Pointing-Pointer CTNNB1 shRNA could inhibit the proliferation of RPMI8226 cells. Black-Right-Pointing-Pointer Significantly profound apoptotic cell death in CTNNB1 shRNA cells. Black-Right-Pointing-Pointer In vivo, CTNNB1 silence led to a growth inhibition of myeloma growth. Black-Right-Pointing-Pointer c-myc and {beta}-catenin in the expression cells of cleaved caspase-3 were increased. -- Abstract: Multiple myeloma (MM) is thrombogenic as a consequence of multiple hemostatic effects. Overexpression of {beta}-catenin has been observed in several types of malignant tumors, including MM. However, the relationship between {beta}-catenin expression and MM remains unclear. In the present study, RNA interference was used to inhibit {beta}-catenin expression in RPMI8226 cells. RT-PCR and Western blotting analyses showed that {beta}-catenin mRNA and protein expression were markedly down-regulated by CTNNB1 shRNA. Western blotting showed that the protein levels of cyclin D1 and glutamine synthetase were downregulated and supported the transcriptional regulatory function of {beta}-catenin. The MTT assay showed that CTNNB1 shRNA could have significant inhibitory effects on the proliferation of RPMI8226 cells. The TOPflash reporter assay demonstrated significant downregulation after CTNNB1 shRNA transfection in RPMI8226 cells. Flow cytometric analyses also showed significantly profound apoptosis in CTNNB1 shRNA cells. We found CTNNB1 silence led to growth inhibition of MM growth in vivo. Immunohistochemical analyses showed that c-myc and {beta}-catenin were reduced in CTNNB1 shRNA tumor tissues, but that expression of cleaved caspase-3 was increased. These results show that {beta}-catenin could be a new therapeutic agent that targets the biology of MM cells.

  10. AAV-based shRNA silencing of NF-κB ameliorates muscle pathologies in mdx mice.

    Science.gov (United States)

    Yang, Q; Tang, Y; Imbrogno, K; Lu, A; Proto, J D; Chen, A; Guo, F; Fu, F H; Huard, J; Wang, B

    2012-12-01

    Chronic inflammation, promoted by an upregulated NF-kappa B (NF-κB) pathway, has a key role in Duchenne muscular dystrophy (DMD) patients' pathogenesis. Blocking the NF-κB pathway has been shown to be a viable approach to diminish chronic inflammation and necrosis in the dystrophin-defective mdx mouse, a murine DMD model. In this study, we used the recombinant adeno-associated virus serotype 9 (AAV9) carrying an short hairpin RNA (shRNA) specifically targeting the messenger RNA of NF-κB/p65 (p65-shRNA), the major subunit of NF-κB associated with chronic inflammation in mdx mice. We examined whether i.m. AAV9-mediated delivery of p65-shRNA could decrease NF-κB activation, allowing for amelioration of muscle pathologies in 1- and 4-month-old mdx mice. At 1 month after treatment, NF-κB/p65 levels were significantly decreased by AAV gene transfer of p65-shRNA in the two ages of treatment groups, with necrosis significantly decreased compared with controls. Quantitative analysis revealed that central nucleation (CN) of the myofibers of p65-shRNA-treated 1-month-old mdx muscles was reduced from 67 to 34%, but the level of CN was not significantly decreased in treated 4-month-old mdx mice. Moreover, delivery of the p65-shRNA enhanced the capacity of myofiber regeneration in old mdx mice treated at 4 months of age when the dystrophic myofibers were most exhausted; however, such p65 silencing diminished the myofiber regeneration in young mdx mice treated at 1 month of age. Taken together, these findings demonstrate that the AAV-mediated delivery of p65-shRNA has the capacity to ameliorate muscle pathologies in mdx mice by selectively reducing NF-κB/p65 activity.

  11. Short-hairpin RNA-mediated Heat shock protein 90 gene silencing inhibits human breast cancer cell growth in vitro and in vivo

    International Nuclear Information System (INIS)

    Zuo, Keqiang; Li, Dan; Pulli, Benjamin; Yu, Fei; Cai, Haidong; Yuan, Xueyu; Zhang, Xiaoping; Lv, Zhongwei

    2012-01-01

    Highlights: ► Hsp90 is over-expressed in human breast cancer. ► The shRNA-mediated gene silencing of Hsp90 resulted in inhibition of cell growth. ► Akt and NF-kB were down-regulation after transfection due to Hsp90 silencing. ► The tumor growth ratio was decline due to Hsp90 silencing. ► The PCNA expression was down-regulation due to Hsp90 silencing. -- Abstract: Hsp90 interacts with proteins that mediate signaling pathways involved in the regulation of essential processes such as proliferation, cell cycle control, angiogenesis and apoptosis. Hsp90 inhibition is therefore an attractive strategy for blocking abnormal pathways that are crucial for cancer cell growth. In the present study, the role of Hsp90 in human breast cancer MCF-7 cells was examined by stably silencing Hsp90 gene expression with an Hsp90-silencing vector (Hsp90-shRNA). RT-PCR and Western blot analyses showed that Hsp90-shRNA specifically and markedly down-regulated Hsp90 mRNA and protein expression. NF-kB and Akt protein levels were down-regulated in Hsp90-shRNA transfected cells, indicating that Hsp90 knockout caused a reduction of survival factors and induced apoptosis. Treatment with Hsp90-shRNA significantly increased apoptotic cell death and caused cell cycle arrest in the G1/S phase in MCF-7 cells, as shown by flow cytometry. Silencing of Hsp90 also reduced cell viability, as determined by MTT assay. In vivo experiments showed that MCF-7 cells stably transfected with Hsp90-shRNA grew slowly in nude mice as compared with control groups. In summary, the Hsp90-shRNA specifically silenced the Hsp90 gene, and inhibited MCF-7 cell growth in vitro and in vivo. Possible molecular mechanisms underlying the effects of Hsp90-shRNA include the degradation of Hsp90 breast cancer-related client proteins, the inhibition of survival signals and the upregulation of apoptotic pathways. shRNA-mediated interference may have potential therapeutic utility in human breast cancer.

  12. Efficient immortalization of primary human cells by p16INK4a-specific short hairpin RNA or Bmi-1, combined with introduction of hTERT.

    Science.gov (United States)

    Haga, Kei; Ohno, Shin-ichi; Yugawa, Takashi; Narisawa-Saito, Mako; Fujita, Masatoshi; Sakamoto, Michiie; Galloway, Denise A; Kiyono, Tohru

    2007-02-01

    Activation of telomerase is sufficient for immortalization of some types of human cells but additional factors may also be essential. It has been proposed that stress imposed by inadequate culture conditions induces senescence due to accumulation of p16(INK4a). Here, we present evidence that many human cell types undergo senescence by activation of the p16(INK4a)/Rb pathway, and that introduction of Bmi-1 can inhibit p16(INK4a) expression and extend the life span of human epithelial cells derived from skin, mammary gland and lung. Introduction of p16(INK4a)-specific short hairpin RNA, as well as Bmi-1, suppressed p16(INK4a) expression in human mammary epithelial cells without promoter methylation, and extended their life span. Subsequent introduction of hTERT, the telomerase catalytic subunit, into cells with low p16(INK4a) levels resulted in efficient immortalization of three cell types without crisis or growth arrest. The majority of the human mammary epithelial cells thus immortalized showed almost normal ploidy as judged by G-banding and spectral karyotyping analysis. Our data suggest that inhibition of p16(INK4a) and introduction of hTERT can immortalize many human cell types with little chromosomal instability.

  13. [Lentivirus-mediated shRNA silencing of LAMP2A inhibits the proliferation of multiple myeloma cells].

    Science.gov (United States)

    Li, Lixuan; Li, Jia

    2015-05-01

    To study the effects of lentivirus-mediated short hairpin RNA (shRNA) silencing of lysosome-associated membrane protein type 2A (LAMP2A) expression on the proliferation of multiple myeloma cells. The constructed shRNA lentiviral vector was applied to infect human multiple myeloma cell line MM.1S, and stable expression cell line was obtained by puromycin screening. Western blotting was used to verify the inhibitory effect on LAMP2A protein expression. MTT assay was conducted to detect the effect of knocked-down LAMP2A on MM.1S cell proliferation, and the anti-tumor potency of suberoylanilide hydroxamic acid (SAHA) against the obtained MM.1S LAMP2A(shRNA) stable cell line. Lactate assay was performed to observe the impact of low LAMP2A expression on cell glycolysis. The stable cell line with low LAMP2A expression were obtained with the constructed human LAMP2A-shRNA lentiviral vector. Down-regulation of LAMP2A expression significantly inhibited MM.1S cell proliferation and enhanced the anti-tumor activity of SAHA. Interestingly, decreased LAMP2A expression also inhibited MM.1S cell lactic acid secretion. Down-regulation of LAMP2A expression could inhibit cell proliferation in multiple myeloma cells.

  14. Effects and mechanism of integrin-β1 gene expression inhibited by shRNA in invasion of pancreatic carcinoma PANC-1 cells.

    Science.gov (United States)

    Yu, Feng; Li, Hua; Bu, Xuefeng; Zhang, Yongjun

    2012-01-01

    To investigate the effects of integrin-β1 gene expression inhibited by shRNA on invasion of pancreatic carcinoma PANC-1 cells in vitro. The eukaryotic expression plasmid of short hairpin RNA (shRNA) targeting integrin-β1 gene (integrin-β1-shRNA) was constructed and transfected into PANC-1 cells. The expressions of integrin-β1 mRNA and protein were detected by real-time quantitative polymerase chain reaction (PCR) and western blot assay, respectively. The invasive ability of PANC-1 cells was observed with a transwell cell culture chamber and the expressions of MMP-2 and MMP-9 were assayed. Compared to the untransfected group, recombinant expression plasmid integrin-β1-shRNA resulted in reduction of integrin-β1 mRNA and protein by 78.58%±7.24% and 92.88%±3.18%, respectively and the average number of invading PANC-1 cells were decreased from 52±5 to 21±4 (pPANC-1 cells in vitro significantly.

  15. Tumor-targeting magnetic lipoplex delivery of short hairpin RNA suppresses IGF-1R overexpression of lung adenocarcinoma A549 cells in vitro and in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Chunmao; Ding, Chao; Kong, Minjian [Department of Cardiothoracic Surgery, Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou 310009 (China); Dong, Aiqiang, E-mail: dr_dongaiqiang@sina.com [Department of Cardiothoracic Surgery, Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou 310009 (China); Qian, Jianfang; Jiang, Daming; Shen, Zhonghua [Department of Cardiothoracic Surgery, Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou 310009 (China)

    2011-07-08

    Highlights: {yields} We compared lipofection with magnetofection about difference of transfection efficiency on delivery a therapeutic gene in vitro and in vivo. {yields} We investigated the difference of shRNA induced by magnetofection and lipofection into A549 cell and subcutaneous tumor to knockdown IGF-1R overexpressed in A549 cell and A549 tumor. {yields} We investigated in vivo shRNA silenced IGF-1R overexpression 24, 48, and 72 h after shRNA intravenous injection into tumor-bearing mice by way of magnetofection and lipofection. {yields} Our results showed that magnetofection could achieve therapeutic gene targeted delivery into special site, which contributed to targeted gene therapy of lung cancers. -- Abstract: Liposomal magnetofection potentiates gene transfection by applying a magnetic field to concentrate magnetic lipoplexes onto target cells. Magnetic lipoplexes are self-assembling ternary complexes of cationic lipids with plasmid DNA associated with superparamagnetic iron oxide nanoparticles (SPIONs). Type1insulin-like growth factor receptor (IGF-1R), an important oncogene, is frequently overexpressed in lung cancer and mediates cancer cell proliferation and tumor growth. In this study, we evaluated the transfection efficiency (percentage of transfected cells) and therapeutic potential (potency of IGF-1R knockdown) of liposomal magnetofection of plasmids expressing GFP and shRNAs targeting IGF-1R (pGFPshIGF-1Rs) in A549 cells and in tumor-bearing mice as compared to lipofection using Lipofectamine 2000. Liposomal magnetofection provided a threefold improvement in transgene expression over lipofection and transfected up to 64.1% of A549 cells in vitro. In vitro, IGF-1R specific-shRNA transfected by lipofection inhibited IGF-1R protein by 56.1 {+-} 6% and by liposomal magnetofection by 85.1 {+-} 3%. In vivo delivery efficiency of the pGFPshIGF-1R plasmid into the tumor was significantly higher in the liposomal magnetofection group than in the

  16. Tumor-targeting magnetic lipoplex delivery of short hairpin RNA suppresses IGF-1R overexpression of lung adenocarcinoma A549 cells in vitro and in vivo

    International Nuclear Information System (INIS)

    Wang, Chunmao; Ding, Chao; Kong, Minjian; Dong, Aiqiang; Qian, Jianfang; Jiang, Daming; Shen, Zhonghua

    2011-01-01

    Highlights: → We compared lipofection with magnetofection about difference of transfection efficiency on delivery a therapeutic gene in vitro and in vivo. → We investigated the difference of shRNA induced by magnetofection and lipofection into A549 cell and subcutaneous tumor to knockdown IGF-1R overexpressed in A549 cell and A549 tumor. → We investigated in vivo shRNA silenced IGF-1R overexpression 24, 48, and 72 h after shRNA intravenous injection into tumor-bearing mice by way of magnetofection and lipofection. → Our results showed that magnetofection could achieve therapeutic gene targeted delivery into special site, which contributed to targeted gene therapy of lung cancers. -- Abstract: Liposomal magnetofection potentiates gene transfection by applying a magnetic field to concentrate magnetic lipoplexes onto target cells. Magnetic lipoplexes are self-assembling ternary complexes of cationic lipids with plasmid DNA associated with superparamagnetic iron oxide nanoparticles (SPIONs). Type1insulin-like growth factor receptor (IGF-1R), an important oncogene, is frequently overexpressed in lung cancer and mediates cancer cell proliferation and tumor growth. In this study, we evaluated the transfection efficiency (percentage of transfected cells) and therapeutic potential (potency of IGF-1R knockdown) of liposomal magnetofection of plasmids expressing GFP and shRNAs targeting IGF-1R (pGFPshIGF-1Rs) in A549 cells and in tumor-bearing mice as compared to lipofection using Lipofectamine 2000. Liposomal magnetofection provided a threefold improvement in transgene expression over lipofection and transfected up to 64.1% of A549 cells in vitro. In vitro, IGF-1R specific-shRNA transfected by lipofection inhibited IGF-1R protein by 56.1 ± 6% and by liposomal magnetofection by 85.1 ± 3%. In vivo delivery efficiency of the pGFPshIGF-1R plasmid into the tumor was significantly higher in the liposomal magnetofection group than in the lipofection group. In vivo IGF-1R

  17. The influence of survivin shRNA on the cell cycle and the invasion of SW480 cells of colorectal carcinoma

    Directory of Open Access Journals (Sweden)

    Yu Jin

    2008-07-01

    Full Text Available Abstract Background The objective was to understand the influence of Survivin plasmid with short hairpin RNA (shRNA on the cell cycle, invasion, and the silencing effect of Survivin gene in the SW480 cell of colorectal carcinoma. Methods A eukaryotic expression vector, PGCH1/Survivin shRNA, a segment sequence of Survivin as target, was created and transfected into colorectal carcinoma cell line SW480 by the non-lipid method. The influence on the Survivin protein was analyzed by Western blotting, while the cell cycle, cell apoptosis were analyzed by flow cytometry, and invasion of the cell was analyzed by Transwell's chamber method. Results After the transfection of PGCH1/Survivin shRNA, the expression of Survivin protein in SW480 cells was dramatically decreased by 60.68%, in which the cells were stopped at G2/M phase, even though no apoptosis was detected. The number of transmembranous cells of the experimental group, negative control group, and blank control group were 14.46 ± 2.11, 25.12 ± 8.37, and 25.86 ± 7.45, respectively (P 0.05. Conclusion Survivin shRNA could significantly reduce the expression of Survivin protein and invasion of SW480 cells. Changes in cell cycle were observed, but no apoptosis was induced.

  18. Construction of lentiviral shRNA expression vector targeting ...

    African Journals Online (AJOL)

    DNA oligo was cloned into lentiviral expression vector, and then polymerase chain reaction (PCR) and sequencing analyses were conducted to verify the constructs. The verified vectors were co-transfected into 293FT cells that could produce lentiviral. shRNA lentiviruses from the selected constructs were propagated and ...

  19. Construction of lentiviral shRNA expression vector targeting ...

    African Journals Online (AJOL)

    ajl yemi

    2011-10-26

    Oct 26, 2011 ... was then selected, while the titer of lentiviral packing PLD2-shRNA was 3.47 × 104 TU/ml and the virus was successfully ... MATERIALS AND METHODS .... such as: transfecting cells not only in mitotic active phase but also in ...

  20. Hypoxia-response plasmid vector producing bcl-2 shRNA enhances the apoptotic cell death of mouse rectum carcinoma.

    Science.gov (United States)

    Fujioka, Takashi; Matsunaga, Naoya; Okazaki, Hiroyuki; Koyanagi, Satoru; Ohdo, Shigehiro

    2010-01-01

    Hypoxia-induced gene expression frequently occurs in malignant solid tumors because they often have hypoxic areas in which circulation is compromised due to structurally disorganized blood vessels. Hypoxia-response elements (HREs) are responsible for activating gene transcription in response to hypoxia. In this study, we constructed a hypoxia-response plasmid vector producing short hairpin RNA (shRNA) against B-cell leukemia/lymphoma-2 (bcl-2), an anti-apoptotic factor. The hypoxia-response promoter was made by inserting tandem repeats of HREs upstream of cytomegalovirus (CMV) promoter (HRE-CMV). HRE-CMV shbcl-2 vector consisted of bcl-2 shRNA under the control of HRE-CMV promoter. In hypoxic mouse rectum carcinoma cells (colon-26), the production of bcl-2 shRNA driven by HRE-CMV promoter was approximately 2-fold greater than that driven by CMV promoter. A single intratumoral (i.t.) injection of 40 microg HRE-CMV shbcl-2 to colon-26 tumor-bearing mice caused apoptotic cell death, and repetitive treatment with HRE-CMV shbcl-2 (40 microg/mouse, i.t.) also significantly suppressed the growth of colon-26 tumor cells implanted in mice. Apoptotic and anti-tumor effects were not observed in tumor-bearing mice treated with CMV shbcl-2. These results reveal the ability of HRE-CMV shbcl-2 vector to suppress the expression of bcl-2 in hypoxic tumor cells and suggest the usefulness of our constructed hypoxia-response plasmid vector to treat malignant tumors. [Supplementary Figures: available only at http://dx.doi.org/10.1254/jphs.10054FP].

  1. Three new shRNA expression vectors targeting the CYP3A4 coding sequence to inhibit its expression

    Directory of Open Access Journals (Sweden)

    Siyun Xu

    2014-10-01

    Full Text Available RNA interference (RNAi is useful for selective gene silencing. Cytochrome P450 3A4 (CYP3A4, which metabolizes approximately 50% of drugs in clinical use, plays an important role in drug metabolism. In this study, we aimed to develop a short hairpin RNA (shRNA to modulate CYP3A4 expression. Three new shRNAs (S1, S2 and S3 were designed to target the coding sequence (CDS of CYP3A4, cloned into a shRNA expression vector, and tested in different cells. The mixture of three shRNAs produced optimal reduction (55% in CYP3A4 CDS-luciferase activity in both CHL and HEK293 cells. Endogenous CYP3A4 expression in HepG2 cells was decreased about 50% at both mRNA and protein level after transfection of the mixture of three shRNAs. In contrast, CYP3A5 gene expression was not altered by the shRNAs, supporting the selectivity of CYP3A4 shRNAs. In addition, HepG2 cells transfected with CYP3A4 shRNAs were less sensitive to Ginkgolic acids, whose toxic metabolites are produced by CYP3A4. These results demonstrate that vector-based shRNAs could modulate CYP3A4 expression in cells through their actions on CYP3A4 CDS, and CYP3A4 shRNAs may be utilized to define the role of CYP3A4 in drug metabolism and toxicity.

  2. RNA interference-based therapeutics for human immunodeficiency virus HIV-1 treatment: synthetic siRNA or vector-based shRNA?

    Science.gov (United States)

    Subramanya, Sandesh; Kim, Sang-Soo; Manjunath, N; Shankar, Premlata

    2010-02-01

    Despite the clinical benefits of highly active antiretroviral therapy (HAART), the prospect of life-long antiretroviral treatment poses significant problems, which has spurred interest in developing new drugs and strategies to treat HIV infection and eliminate persistent viral reservoirs. RNAi has emerged as a therapeutic possibility for HIV. We discuss progress in overcoming hurdles to translating transient and stable RNAi enabling technologies to clinical application for HIV; covering the past 2 - 3 years. HIV inhibition can be achieved by transfection of chemically or enzymatically synthesized siRNAs or by DNA-based vector systems expressing short hairpin RNAs (shRNAs) that are processed intracellularly into siRNA. We compare these approaches, focusing on technical and safety issues that will guide the choice of strategy for clinical use. Introduction of synthetic siRNA into cells or its stable endogenous production using vector-driven shRNA have been shown to suppress HIV replication in vitro and, in some instances, in vivo. Each method has advantages and limitations in terms of ease of delivery, duration of silencing, emergence of escape mutants and potential toxicity. Both appear to have potential as future therapeutics for HIV, once the technical and safety issues of each approach are overcome.

  3. An infinitely expandable cloning strategy plus repeat-proof PCR for working with multiple shRNA.

    Directory of Open Access Journals (Sweden)

    Glen John McIntyre

    Full Text Available Vector construction with restriction enzymes (REs typically involves the ligation of a digested donor fragment (insert to a reciprocally digested recipient fragment (vector backbone. Creating a suitable cloning plan becomes increasingly difficult for complex strategies requiring repeated insertions such as constructing multiple short hairpin RNA (shRNA expression vectors for RNA interference (RNAi studies. The problem lies in the reduced availability of suitable RE recognition sites with an increasing number of cloning events and or vector size. This report details a technically simple, directional cloning solution using REs with compatible cohesive ends that are repeatedly destroyed and simultaneously re-introduced with each round of cloning. Donor fragments can be made by PCR or sub-cloned from pre-existing vectors and inserted ad infinitum in any combination. The design incorporates several cloning cores in order to be compatible with as many donor sequences as possible. We show that joining sub-combinations made in parallel is more time-efficient than sequential construction (of one cassette at a time for any combination of 4 or more insertions. Screening for the successful construction of combinations using Taq polymerase based PCR became increasingly difficult with increasing number of repeated sequence elements. A Pfu polymerase based PCR was developed and successfully used to amplify combinations of up to eleven consecutive hairpin expression cassettes. The identified PCR conditions can be beneficial to others working with multiple shRNA or other repeated sequences, and the infinitely expandable cloning strategy serves as a general solution applicable to many cloning scenarios.

  4. Permanent, lowered HLA class I expression using lentivirus vectors with shRNA constructs: Averting cytotoxicity by alloreactive T lymphocytes.

    Science.gov (United States)

    Haga, K; Lemp, N A; Logg, C R; Nagashima, J; Faure-Kumar, E; Gomez, G G; Kruse, C A; Mendez, R; Stripecke, R; Kasahara, N; Kasahara, N A; Cicciarelli, J C

    2006-12-01

    Transplantation of many tissues requires histocompatibility matching of human leukocyte antigens (HLA) to prevent graft rejection, to reduce the level of immunosuppression needed to maintain graft survival, and to minimize the risk of graft-versus-host disease, particularly in the case of bone marrow transplantation. However, recent advances in fields of gene delivery and genetic regulation technologies have opened the possibility of engineering grafts that display reduced levels of HLA expression. Suppression of HLA expression could help to overcome the limitations imposed by extensive HLA polymorphisms that restrict the availability of suitable donors, necessitate the maintenance of large donor registries, and complicate the logistics of procuring and delivering matched tissues and organs to the recipient. Accordingly, we investigated whether knockdown of HLA by RNA interference (RNAi), a ubiquitous regulatory system that can efficiently and selectively inhibit the expression of specific gene products, would enable allogeneic cells to evade immune recognition. For efficient and stable delivery of short hairpin-type RNAi constructs (shRNA), we employed lentivirus-based gene transfer vectors, which provide a delivery system that can achieve integration into genomic DNA, thereby permanently modifying transduced graft cells. Our results show that lentivirus-mediated delivery of shRNA targeting pan-Class I and allele-specific HLA can achieve efficient and dose-dependent reduction in surface expression of HLA in human cells, associated with enhanced resistance to alloreactive T lymphocyte-mediated cytotoxicity, while avoiding MHC-non-restricted killing. We hypothesize that RNAi-induced silencing of HLA expression has the potential to create histocompatibility-enhanced, and, eventually, perhaps "universally" compatible cellular grafts.

  5. Pathogenic effects of Rift Valley fever virus NSs gene are alleviated in cultured cells by expressed antiviral short hairpin RNAs.

    Science.gov (United States)

    Scott, Tristan; Paweska, Janusz T; Arbuthnot, Patrick; Weinberg, Marc S

    2012-01-01

    Rift Valley fever virus (RVFV), a member of the Bunyaviridae family, may cause severe hepatitis, encephalitis and haemorrhagic fever in humans. There are currently no available licensed vaccines or therapies to treat the viral infection in humans. RNA interference (RNAi)-based viral gene silencing offers a promising approach to inhibiting replication of this highly pathogenic virus. The small (S) segment of the RVFV tripartite genome carries the genetic determinates for pathogenicity during infection. This segment encodes the non-structural S (NSs) and essential nucleocapsid (N) genes. To advance RNAi-based inhibition of RVFV replication, we designed several Pol III short hairpin RNA (shRNA) expression cassettes against the NSs and N genes, including a multimerized plasmid vector that included four shRNA expression cassettes. Effective target silencing was demonstrated using full- and partial-length target reporter assays, and confirmed by western blot analysis of exogenous N and NSs expression. Small RNA northern blots showed detectable RNAi guide strand formation from single and multimerized shRNA constructs. Using a cell culture model of RVFV replication, shRNAs targeting the N gene decreased intracellular nucleocapsid protein concentration and viral replication. The shRNAs directed against the NSs gene reduced NSs protein concentrations and alleviated NSs-mediated cytotoxicity, which may be caused by host transcription suppression. These data are the first demonstration that RNAi activators have a potential therapeutic benefit for countering RVFV infection.

  6. Hypoxia-inducible bidirectional shRNA expression vector delivery using PEI/chitosan-TBA copolymers for colorectal Cancer gene therapy.

    Science.gov (United States)

    Javan, Bita; Atyabi, Fatemeh; Shahbazi, Majid

    2018-04-12

    This investigation was conducted to construct a hypoxia/colorectal dual-specific bidirectional short hairpin RNA (shRNA) expression vector and to transfect it into the colon cancer cell line HT-29 with PEI/chitosan-TBA nanoparticles for the simultaneous knock down of β-catenin and Bcl-2 under hypoxia. To construct a pRNA-bipHRE-CEA vector, the carcinoma embryonic antigen (CEA) promoter designed in two directions and the vascular endothelial growth factor (VEGF) enhancer were inserted between two promoters for hypoxic cancer specific gene expression. To confirm the therapeutic effect of the dual-specific vector, β-catenin and Bcl-2 shRNAs were inserted downstream of each promoter. The physicochemical properties, the cytotoxicity, and the transfection efficiency of these PEI/chitosan-TBA nanoparticles were investigated. In addition, the antitumor effects of the designed vector on the expression of β-catenin and Bcl-2, cell cycle distribution, and apoptosis were investigated in vitro. The silencing effect of the hypoxia-response shRNA expression vector was relatively low (18%-25%) under normoxia, whereas it was significantly increased to approximately 50%-60% in the HT-29 cell line. Moreover, the cancer cells showed significant G0/G1 arrest and increased apoptosis due to gene silencing under hypoxia. Furthermore, MTS assay, fluorescence microscopy images, and flow cytometry analyses confirmed that the PEI/chitosan-TBA blend system provided effective transfection with low cytotoxicity. This novel hypoxia-responsive shRNA expression vector may be useful for RNA interference (RNAi)-based cancer gene therapy in hypoxic colorectal tumors. Moreover, the PEI/chitosan-TBA copolymer might be a promising gene carrier for use in gene transfer in vivo. Copyright © 2017. Published by Elsevier Inc.

  7. Downregulation of mouse CCR3 by lentiviral shRNA inhibits proliferation and induces apoptosis of mouse eosinophils.

    Science.gov (United States)

    Zhu, Xin-Hua; Liao, Bing; Xu, Yi; Liu, Ke; Huang, Yun; Huang, Quan-Long; Liu, Yue-Hui

    2017-02-01

    RNA interference has been considered as an effective gene silencing method in basic and preclinical investigations. The aims of the present study were to construct a lentiviral vector expressing a short hairpin RNA (shRNA) targeting the murine CC chemokine receptor 3 (mCCR3), and to investigate its effects on the proliferation and apoptosis of mouse eosinophils. A recombinant lentiviral vector expressing four fragments of mouse CCR3 shRNA (pLVX‑mCCR3‑1+2+3+4‑shRNA) was constructed using subcloning techniques. This novel lentivirus was then packaged into 293T cells by co‑transduction with plasmids, including Baculo p35, pCMV R8.2 and VSV. The interference effects of the vector were verified using polymerase chain reaction (PCR) and western blot analyses. The effects of the interference on the proliferation and apoptosis of mouse eosinophils were investigated using 3‑(4,5‑dimethylthiazol‑2‑yl)‑5‑(3‑carboxymethoxyphenyl)‑2‑(4‑sulfophenyl)‑2H‑tetrazolium and terminal deoxynucleotidyl transferase dUTP nick end labeling methods, respectively. The results of the PCR and western blot analyses confirmed that the novel recombinant vector, pLVX‑mCCR3‑1+2+3+4‑shRNA, had high efficiency in inhibiting the mRNA and protein expression levels of mCCR3 in mouse eosinophils. The downregulation of mCCR3 significantly inhibited proliferation of the eosinophils. Furthermore, the present study found that the downregulation of mCCR3 significantly promoted apoptosis of the eosinophils. Therefore, the downregulation of mCCR3 led to the inhibition of proliferation and induction of apoptosis in mouse eosinophils. The predominant characteristics of allergic rhinitis are eosinophil infiltration and release of inflammatory mediators, which appear in a variety of clinical manifestations. The results of the present study indicate that mCCR3 silencing may serve as a putative approach for the treatment of allergic rhinitis.

  8. Influence of Expression Plasmid of Connective Tissue Growth Factor and Tissue Inhibitor of Metalloproteinase-1 shRNA on Hepatic Precancerous Fibrosis in Rats.

    Science.gov (United States)

    Zhang, Qun; Shu, Fu-Li; Jiang, Yu-Feng; Huang, Xin-En

    2015-01-01

    In this study, influence caused by expression plasmids of connective tissue growth factor (CTGF) and tissue inhibitor of metalloproteinase-1 (TIMP-1) short hairpin RNA (shRNA) on mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII in hepatic tissue with hepatic fibrosis, a precancerous condition, in rats is analyzed. To screen and construct shRNA expression plasimid which effectively interferes RNA targets of CTGF and TIMP-1 in rats. 50 cleaning Wistar male rats are allocated randomly at 5 different groups after precancerous fibrosis models and then injection of shRNA expression plasimids. Plasmid psiRNA-GFP-Com (CTGF and TIMP-1 included), psiRNA-GFP-CTGF, psiRNA-GFP-TIMP-1 and psiRNA- DUO-GFPzeo of blank plasmid are injected at group A, B, C and D, respectively, and as model control group that none plasimid is injected at group E. In 2 weeks after last injection, to hepatic tissue at different groups, protein expression of CTGF, TIMP-1, procol-α1and PC III is tested by immunohistochemical method and,mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII is measured by real-time PCR. One-way ANOVA is used to comparison between-groups. Compared with model group, there is no obvious difference of mRNA expression among CTGF,TIMP-1,procol-α1,PC III and of protein expression among CTGF, TIMP-1, procol-α1, PC III in hepatic tissue at group injected with blank plasmid. Expression quantity of mRNA of CTGF, TIMP-1, procol-α1 and PCIII at group A, B and C decreases, protein expression of CTGF, TIMP-1, procol-α1, PC III in hepatic tissue is lower, where the inhibition of combination RNA interference group (group A) on procol-α1 mRNA transcription and procol-α1 protein expression is superior to that of single interference group (group B and C) (P<0.01 or P<0.05). RNA interference on CTGF and/or TIMP-1 is obviously a inhibiting factor for mRNA and protein expression of CTGF, TIMP-1, procol-α1 and PCIII. Combination RNA interference on genes of CTGF and TIMP-1 is superior

  9. Tumor-targeting magnetic lipoplex delivery of short hairpin RNA suppresses IGF-1R overexpression of lung adenocarcinoma A549 cells in vitro and in vivo.

    Science.gov (United States)

    Wang, Chunmao; Ding, Chao; Kong, Minjian; Dong, Aiqiang; Qian, Jianfang; Jiang, Daming; Shen, Zhonghua

    2011-07-08

    Liposomal magnetofection potentiates gene transfection by applying a magnetic field to concentrate magnetic lipoplexes onto target cells. Magnetic lipoplexes are self-assembling ternary complexes of cationic lipids with plasmid DNA associated with superparamagnetic iron oxide nanoparticles (SPIONs). Type1 insulin-like growth factor receptor (IGF-1R), an important oncogene, is frequently overexpressed in lung cancer and mediates cancer cell proliferation and tumor growth. In this study, we evaluated the transfection efficiency (percentage of transfected cells) and therapeutic potential (potency of IGF-1R knockdown) of liposomal magnetofection of plasmids expressing GFP and shRNAs targeting IGF-1R (pGFPshIGF-1Rs) in A549 cells and in tumor-bearing mice as compared to lipofection using Lipofectamine 2000. Liposomal magnetofection provided a threefold improvement in transgene expression over lipofection and transfected up to 64.1% of A549 cells in vitro. In vitro, IGF-1R specific-shRNA transfected by lipofection inhibited IGF-1R protein by 56.1±6% and by liposomal magnetofection by 85.1±3%. In vivo delivery efficiency of the pGFPshIGF-1R plasmid into the tumor was significantly higher in the liposomal magnetofection group than in the lipofection group. In vivo IGF-1R specific-shRNA by lipofection inhibited IGF-1R protein by an average of 43.8±5.3%; that by liposomal magnetofection inhibited IGF-1R protein by 43.4±5.7%, 56.3±9.6%, and 72.2±6.8%, at 24, 48, and 72 h, respectively, after pGFPshIGF-1R injection. Our findings indicate that liposomal magnetofection may be a promising method that allows the targeting of gene therapy to lung cancer. Copyright © 2011 Elsevier Inc. All rights reserved.

  10. Intravitreal Injection of Ranibizumab and CTGF shRNA Improves Retinal Gene Expression and Microvessel Ultrastructure in a Rodent Model of Diabetes

    Directory of Open Access Journals (Sweden)

    Bojie Hu

    2014-01-01

    Full Text Available Therapeutic modalities targeting vascular endothelial growth factor (VEGF have been used to treat neovascularization and macular edema. However, anti-VEGF treatment alone may cause up-regulation of connective tissue growth factor (CTGF in the retina, increasing the risk of fibrosis and tractional retinal detachment. Therefore, in this study, we employ a novel dual-target intervention that involves intravitreal injection of the VEGF inhibitor ranibizumab and a transfection reagent-treated non-viral vector carrying anti-CTGF short hairpin RNA (shRNA driven by human RNA polymerase III promoter U6. The effects of the dual-target intervention on the expression of VEGF and CTGF and on microvessel ultrastructure were examined in retina of streptozocin-induced diabetic rats. CTGF was significantly up-regulated at week 8 after diabetic induction, whereas VEGF was not up-regulated until week 10. The high expression of both genes was maintained at week 12. Transmission electron microscopy also revealed progressive exacerbation of microvessel ultrastructure during the same period. In addition, ranibizumab significantly lowered VEGF but elevated CTGF mRNA, whereas CTGF shRNA significantly reduced the mRNA levels of both CTGF and VEGF in diabetic retinas. Importantly, dual-target intervention normalized the transcript levels of both target genes and ameliorated retinal microvessel ultrastructural damage better than either single-target intervention. These results suggest the advantages of dual-target over single-target interventions in diabetic retina and reveal a novel therapeutic modality for diabetic retinopathy.

  11. Kinome-wide shRNA Screen Identifies the Receptor Tyrosine Kinase AXL as a Key Regulator for Mesenchymal Glioblastoma Stem-like Cells

    Directory of Open Access Journals (Sweden)

    Peng Cheng

    2015-05-01

    Full Text Available Glioblastoma is a highly lethal cancer for which novel therapeutics are urgently needed. Two distinct subtypes of glioblastoma stem-like cells (GSCs were recently identified: mesenchymal (MES and proneural (PN. To identify mechanisms to target the more aggressive MES GSCs, we combined transcriptomic expression analysis and kinome-wide short hairpin RNA screening of MES and PN GSCs. In comparison to PN GSCs, we found significant upregulation and phosphorylation of the receptor tyrosine kinase AXL in MES GSCs. Knockdown of AXL significantly decreased MES GSC self-renewal capacity in vitro and inhibited the growth of glioblastoma patient-derived xenografts. Moreover, inhibition of AXL with shRNA or pharmacologic inhibitors also increased cell death significantly more in MES GSCs. Clinically, AXL expression was elevated in the MES GBM subtype and significantly correlated with poor prognosis in multiple cancers. In conclusion, we identified AXL as a potential molecular target for novel approaches to treat glioblastoma and other solid cancers.

  12. Novel HIV-1 knockdown targets identified by an enriched kinases/phosphatases shRNA library using a long-term iterative screen in Jurkat T-cells.

    Directory of Open Access Journals (Sweden)

    Sylvie Rato

    2010-02-01

    Full Text Available HIV-1 is a complex retrovirus that uses host machinery to promote its replication. Understanding cellular proteins involved in the multistep process of HIV-1 infection may result in the discovery of more adapted and effective therapeutic targets. Kinases and phosphatases are a druggable class of proteins critically involved in regulation of signal pathways of eukaryotic cells. Here, we focused on the discovery of kinases and phosphatases that are essential for HIV-1 replication but dispensable for cell viability. We performed an iterative screen in Jurkat T-cells with a short-hairpin-RNA (shRNA library highly enriched for human kinases and phosphatases. We identified 14 new proteins essential for HIV-1 replication that do not affect cell viability. These proteins are described to be involved in MAPK, JNK and ERK pathways, vesicular traffic and DNA repair. Moreover, we show that the proteins under study are important in an early step of HIV-1 infection before viral integration, whereas some of them affect viral transcription/translation. This study brings new insights for the complex interplay of HIV-1/host cell and opens new possibilities for antiviral strategies.

  13. [Selection and construction of cell line stably expressing survivin gene in lower level through eukaryotic plasmid vector of shRNA].

    Science.gov (United States)

    Wang, Wen-Xia; Sun, Shan-Zhen; Song, Ying

    2008-06-01

    To construct a short hairpin RNA(shRNA) interference expression plasmid vector of survivin gene, transfect tongue squamous cell carcinoma line Tca8113 which expressed survivin gene in a high level, and choose the cells whose survivin gene were suppressed significantly. Two pairs of oligonucleotide sequences specific for survivin gene were designed and synthesized, and cloned into pSilencer-2.1U6-neo plasmid. The recombinant plasmids (named PS1 and PS2) were amplified in Ecoli. DH5alpha was identified by restriction digestion, PCR and sequencing. The vectors were transfected into Tca8113 cells with lipofectamine 2000. After selection with G418, the stable cell clones were attained. Survivn expression was assayed with real-time quantitative PCR and Western blotting. SAS8.0 software package was used for Student t test. Two vectors were constructed successfully and stable cell clones with PS1 or PS2 plasmid were obtained. As compared with those of control, survivin expression of transfected cell with PS1 or PS2 in mRNA level was significantly suppressed (P<0.05). In protein level, only those of transfected cell with PS2 was significantly suppressed (P<0.01). The shRNA interference expression plasmid vectors of survivin gene are successfully constructed, and Tca8113 cells which express survivin gene in a stable lower level are attained, which enable us to carry out further research on gene therapy of oral squamous cell carcinoma. Supported by National Natural Science Foundation of China (Grant No.30572056).

  14. Virus-mediated shRNA knockdown of prodynorphin in the rat nucleus accumbens attenuates depression-like behavior and cocaine locomotor sensitization.

    Science.gov (United States)

    Cohen, Ami; Whitfield, Timothy W; Kreifeldt, Max; Koebel, Pascale; Kieffer, Brigitte L; Contet, Candice; George, Olivier; Koob, George F

    2014-01-01

    Dynorphins, endogenous opioid peptides that arise from the precursor protein prodynorphin (Pdyn), are hypothesized to be involved in the regulation of mood states and the neuroplasticity associated with addiction. The current study tested the hypothesis that dynorphin in the nucleus accumbens (NAcc) mediates such effects. More specifically, we examined whether knockdown of Pdyn within the NAcc in rats would alter the expression of depressive-like and anxiety-like behavior, as well as cocaine locomotor sensitization. Wistar rats were injected with adeno-associated viral (AAV) vectors encoding either a Pdyn-specific short hairpin RNA (AAV-shPdyn) or a scrambled shRNA (AAV-shScr) as control. Four weeks later, rats were tested for anxiety-like behavior in the elevated plus maze test and depressive-like behavior in the forced swim test (FST). Finally, rats received one daily injection of saline or cocaine (20 mg/kg, i.p.), followed by assessment of locomotion for 4 consecutive days. Following 3 days of abstinence, the rats completed 2 additional daily cocaine/saline locomotor trials. Pdyn knockdown in the NAcc led to a significant reduction in depressive-like behavior in the FST, but had no effect on anxiety-like behavior in the elevated plus maze. Pdyn knockdown did not alter baseline locomotor behavior, the locomotor response to acute cocaine, or the initial sensitization of the locomotor response to cocaine over the first 4 cocaine treatment days. However, following 3 days abstinence the locomotor response to the cocaine challenge returned to their original levels in the AAV-shPdyn rats while remaining heightened in the AAV-shScr rats. These results suggest that dynorphin in a very specific area of the nucleus accumbens contributes to depressive-like states and may be involved in neuroadaptations in the NAcc that contribute to the development of cocaine addiction as a persistent and lasting condition.

  15. Virus-mediated shRNA knockdown of prodynorphin in the rat nucleus accumbens attenuates depression-like behavior and cocaine locomotor sensitization.

    Directory of Open Access Journals (Sweden)

    Ami Cohen

    Full Text Available Dynorphins, endogenous opioid peptides that arise from the precursor protein prodynorphin (Pdyn, are hypothesized to be involved in the regulation of mood states and the neuroplasticity associated with addiction. The current study tested the hypothesis that dynorphin in the nucleus accumbens (NAcc mediates such effects. More specifically, we examined whether knockdown of Pdyn within the NAcc in rats would alter the expression of depressive-like and anxiety-like behavior, as well as cocaine locomotor sensitization. Wistar rats were injected with adeno-associated viral (AAV vectors encoding either a Pdyn-specific short hairpin RNA (AAV-shPdyn or a scrambled shRNA (AAV-shScr as control. Four weeks later, rats were tested for anxiety-like behavior in the elevated plus maze test and depressive-like behavior in the forced swim test (FST. Finally, rats received one daily injection of saline or cocaine (20 mg/kg, i.p., followed by assessment of locomotion for 4 consecutive days. Following 3 days of abstinence, the rats completed 2 additional daily cocaine/saline locomotor trials. Pdyn knockdown in the NAcc led to a significant reduction in depressive-like behavior in the FST, but had no effect on anxiety-like behavior in the elevated plus maze. Pdyn knockdown did not alter baseline locomotor behavior, the locomotor response to acute cocaine, or the initial sensitization of the locomotor response to cocaine over the first 4 cocaine treatment days. However, following 3 days abstinence the locomotor response to the cocaine challenge returned to their original levels in the AAV-shPdyn rats while remaining heightened in the AAV-shScr rats. These results suggest that dynorphin in a very specific area of the nucleus accumbens contributes to depressive-like states and may be involved in neuroadaptations in the NAcc that contribute to the development of cocaine addiction as a persistent and lasting condition.

  16. Suppression of IL-6 Gene by shRNA Augments Gemcitabine Chemosensitization in Pancreatic Adenocarcinoma Cells

    Directory of Open Access Journals (Sweden)

    Hai-Bo Xing

    2018-01-01

    Full Text Available Pancreatic adenocarcinoma has an exceedingly poor prognosis, accounting for five-year survival of less than 5%. Presently, improving the efficacy of pancreatic adenocarcinoma treatment has been the focus of medical researchers worldwide. Recently, it has been suggested that deregulation of interleukin- (IL- 6 is caused by a key gene involved in the beginning and development of pancreatic adenocarcinoma. Herein, we investigated whether suppression of IL-6 could augment gemcitabine sensitivity in the PANC-1 cells. We found considerably higher expression of IL-6 in pancreatic adenocarcinoma tissues than that in the adjacent nontumorous tissues. Suppression of IL-6 by shRNA resulted in apoptosis as well as inhibition of cell proliferation and tumorigenicity. In addition, suppression of IL-6 remarkably promoted antitumor effect of gemcitabine, indicating that the combination of shRNA targeting IL-6 with gemcitabine may provide a potential clinical approach for pancreatic cancer therapy.

  17. Therapeutic effects of lentivirus-mediated shRNA targeting of cyclin D1 in human gastric cancer

    International Nuclear Information System (INIS)

    Seo, Jin-Hee; Jeong, Eui-Suk; Choi, Yang-Kyu

    2014-01-01

    Gastric cancer is the second most common cause of cancer-related death in males and the fourth in females. Traditional treatment has poor prognosis because of recurrence and systemic side effects. Therefore, the development of new therapeutic strategies is an important issue. Lentivirus-mediated shRNA stably inhibits target genes and can efficiently transduce most cells. Since overexpressed cyclin D1 is closely related to human gastric cancer progression, inhibition of cyclin D1 using specific targeting could be an effective treatment method of human gastric cancer. The therapeutic effect of lentivirus-mediated shRNA targeting of cyclin D1 (ShCCND1) was analyzed both in vitro and in vivo experiments. In vitro, NCI-N87 cells with downregulation of cyclin D1 by ShCCND1 showed significant inhibition of cell proliferation, cell motility, and clonogenicity. Downregulation of cyclin D1 in NCI-N87 cells also resulted in significantly increased G1 arrest and apoptosis. In vivo, stable NCI-N87 cells expressing ShCCND1 were engrafted into nude mice. Then, the cancer-growth inhibition effect of lentivirus was confirmed. To assess lentivirus including ShCCND1 as a therapeutic agent, intratumoral injection was conducted. Tumor growth of the lentivirus-treated group was significantly inhibited compared to growth of the control group. These results are in accordance with the in vitro data and lend support to the mitotic figure count and apoptosis analysis of the tumor mass. The lentivirus-mediated ShCCND1 was constructed, which effectively inhibited growth of NCI-N87-derived cancer both in vitro and in vivo. The efficiency of shRNA knockdown and variation in the degree of inhibition is mediated by different shRNA sequences and cancer cell lines. These experimental results suggest the possibility of developing new gastric cancer therapies using lentivirus-mediated shRNA

  18. Quantitative Evaluation of Myostatin Gene in Stably Transfected Caprine Fibroblast Cells by Anti-Myostatin shRNA.

    Science.gov (United States)

    Jain, Sudhir Kumar; Jain, Hemlata; Kumar, Dharmendra; Bedekar, Megha Kadam; Pandey, Akhilesh Kumar; Sarkhel, Bikash Chandra

    2015-09-01

    Skeletal muscle is the major component of lean tissue that is used for consumption, and myostatin is a negative regulator of skeletal muscle growth. Downregulation of this gene therefore offers a strategy for developing superior animals with enhanced muscle growth. Knockdown of myostatin was achieved by RNA interference technology. The anti-myostatin shRNA were designed and stably transfected in caprine fibroblast cells. The reduced expression of target gene was achieved and measured in clonal fibroblast cells by real-time PCR. Two single-cell clones induced significant decrease of myostatin gene expression by 73.96 and 72.66 %, respectively (P < 0.05). To ensure the appropriate growth of transfected cell, seven media were tested. The best suited media was used for transfected fibroblast cell proliferation. The findings suggest that shRNA provides a novel potential tool for gene knockdown and these stably transfected cells can be used as the donor cells for animal cloning.

  19. Expression of plasmid-based shRNA against the E1 and nsP1 genes effectively silenced Chikungunya virus replication.

    Directory of Open Access Journals (Sweden)

    Shirley Lam

    Full Text Available BACKGROUND: Chikungunya virus (CHIKV is a re-emerging alphavirus that causes chikungunya fever and persistent arthralgia in humans. Currently, there is no effective vaccine or antiviral against CHIKV infection. Therefore, this study evaluates whether RNA interference which targets at viral genomic level may be a novel antiviral strategy to inhibit the medically important CHIKV infection. METHODS: Plasmid-based small hairpin RNA (shRNA was investigated for its efficacy in inhibiting CHIKV replication. Three shRNAs designed against CHIKV Capsid, E1 and nsP1 genes were transfected to establish stable shRNA-expressing cell clones. Following infection of stable shRNA cells clones with CHIKV at M.O.I. 1, viral plaque assay, Western blotting and transmission electron microscopy were performed. The in vivo efficacy of shRNA against CHIKV replication was also evaluated in a suckling murine model of CHIKV infection. RESULTS: Cell clones expressing shRNAs against CHIKV E1 and nsP1 genes displayed significant inhibition of infectious CHIKV production, while shRNA Capsid demonstrated a modest inhibitory effect as compared to scrambled shRNA cell clones and non-transfected cell controls. Western blot analysis of CHIKV E2 protein expression and transmission electron microscopy of shRNA E1 and nsP1 cell clones collectively demonstrated similar inhibitory trends against CHIKV replication. shRNA E1 showed non cell-type specific anti-CHIKV effects and broad-spectrum silencing against different geographical strains of CHIKV. Furthermore, shRNA E1 clones did not exert any inhibition against Dengue virus and Sindbis virus replication, thus indicating the high specificity of shRNA against CHIKV replication. Moreover, no shRNA-resistant CHIKV mutant was generated after 50 passages of CHIKV in the stable cell clones. More importantly, strong and sustained anti-CHIKV protection was conferred in suckling mice pre-treated with shRNA E1. CONCLUSION: Taken together, these

  20. Inhibitors of MyD88-dependent proinflammatory cytokine production identified utilizing a novel RNA interference screening approach.

    Directory of Open Access Journals (Sweden)

    John S Cho

    2009-09-01

    Full Text Available The events required to initiate host defenses against invading pathogens involve complex signaling cascades comprised of numerous adaptor molecules, kinases, and transcriptional elements, ultimately leading to the production of proinflammatory cytokines, such as tumor necrosis factor alpha (TNF-alpha. How these signaling cascades are regulated, and the proteins and regulatory elements participating are still poorly understood.We report here the development a completely random short-hairpin RNA (shRNA library coupled with a novel forward genetic screening strategy to identify inhibitors of Toll-like receptor (TLR dependent proinflammatory responses. We developed a murine macrophage reporter cell line stably transfected with a construct expressing diphtheria toxin-A (DT-A under the control of the TNF-alpha-promoter. Stimulation of the reporter cell line with the TLR ligand lipopolysaccharide (LPS resulted in DT-A induced cell death, which could be prevented by the addition of an shRNA targeting the TLR adaptor molecule MyD88. Utilizing this cell line, we screened a completely random lentiviral short hairpin RNA (shRNA library for sequences that inhibited TLR-mediated TNF-alpha production. Recovery of shRNA sequences from surviving cells led to the identification of unique shRNA sequences that significantly inhibited TLR4-dependent TNF-alpha gene expression. Furthermore, these shRNA sequences specifically blocked TLR2 but not TLR3-dependent TNF-alpha production.Thus, we describe the generation of novel tools to facilitate large-scale forward genetic screens in mammalian cells and the identification of potent shRNA inhibitors of TLR2 and TLR4- dependent proinflammatory responses.

  1. Establishment and Evaluation of Stable Cell Lines Inhibiting Foot-and-Mouth Disease Virus by RNA Interference

    Directory of Open Access Journals (Sweden)

    Yuan-xing Gu

    2014-01-01

    Full Text Available RNA interference (RNAi has been proved to be a powerful tool for foot-and-mouth disease virus FMDV inhibition in vitro and in vivo. We established five stable baby hamster kidney 21 cell lines (BHK-21 containing five short hairpin RNAs (shRNAs expression plasmids (p3D1shRNA, p3D2shRNA, p3D3shRNA, p3D4shRNA, and p3D5shRNA targeting 3D gene of FMDV. Immunofluorescent assay, virus titration, and real-time quantitative reverse transcription polymerase chain reaction (Q-RT-PCR were conducted to detect the effect of shRNAs on FMDV replication. After challenged with FMDV of O/CHA/99, two cell lines (p3D1shRNA and p3D4shRNA showed a significant reduction in the synthesis of viral protein and RNA, accompanied by a sharp decrease in viral yield, and the inhibition could last for at least thirty passages. We developed an efficient procedure for the establishment and evaluation of stable cell lines for anti-FMDV research based on RNAi technology, which can be a candidate method for anti-FMDV research.

  2. Silencing effect of shRNA expression vectors with stem length of 21 ...

    African Journals Online (AJOL)

    Then, the recombinant plasmids were transfected into mouse embryonic fibroblast with lipofection and injected into leg muscle of mouse. The mRNA expression level of the green fluorescent protein gene was checked by real-time quantitative polymerase chain reaction (RT-PCR). The silencing effect of the 29 bp shRNA ...

  3. Apolipoprotein B knockdown by AAV-delivered shRNA lowers plasma cholesterol in mice

    NARCIS (Netherlands)

    Koornneef, Annemart; Maczuga, Piotr; van Logtenstein, Richard; Borel, Florie; Blits, Bas; Ritsema, Tita; van Deventer, Sander; Petry, Harald; Konstantinova, Pavlina

    2011-01-01

    Serum low-density lipoprotein cholesterol (LDL-C) levels are proportionate to the risk of atherosclerotic cardiovascular disease. In order to reduce serum total cholesterol and LDL-C levels in mice, RNA interference (RNAi) was used to inhibit expression of the structural protein of LDL-C,

  4. Efficient and nontoxic biological response carrier delivering TNF-α shRNA for gene silencing in a murine model of rheumatoid arthritis

    Directory of Open Access Journals (Sweden)

    Jialin Song

    2016-08-01

    Full Text Available Small interfering RNA (siRNA is an effective and specific method for silencing genes. However, an efficient and nontoxic carrier is needed to deliver the siRNA into the target cells. Tumor necrosis factor α (TNF-α plays a central role in the occurrence and progression of rheumatoid arthritis. In this study, we pre-synthetized a degradable cationic polymer (PDAPEI from 2,6-pyridinedicarboxaldehyde and low molecular weight polyethyleneimine (PEI, Mw=1.8 kDa as a gene vector for the delivery of TNF-α shRNA. The PDAPEI/pDNA complex showed a suitable particle size and stable zeta potential for transfection. In vitro study of the PDAPEI/pDNA complex revealed a lower cytotoxicity and higher transfection efficiency when transfecting TNF-α shRNA to macrophages by significantly down-regulating the expression of TNF-α. Moreover, the complex was extremely efficient in decreasing the severity of arthritis in mice with collagen-induced arthritis (CIA. PDAPEI delivered TNF-α shRNA has great potential in the treatment of rheumatoid arthritis.

  5. A genome-wide shRNA screen identifies GAS1 as a novel melanoma metastasis suppressor gene.

    Science.gov (United States)

    Gobeil, Stephane; Zhu, Xiaochun; Doillon, Charles J; Green, Michael R

    2008-11-01

    Metastasis suppressor genes inhibit one or more steps required for metastasis without affecting primary tumor formation. Due to the complexity of the metastatic process, the development of experimental approaches for identifying genes involved in metastasis prevention has been challenging. Here we describe a genome-wide RNAi screening strategy to identify candidate metastasis suppressor genes. Following expression in weakly metastatic B16-F0 mouse melanoma cells, shRNAs were selected based upon enhanced satellite colony formation in a three-dimensional cell culture system and confirmed in a mouse experimental metastasis assay. Using this approach we discovered 22 genes whose knockdown increased metastasis without affecting primary tumor growth. We focused on one of these genes, Gas1 (Growth arrest-specific 1), because we found that it was substantially down-regulated in highly metastatic B16-F10 melanoma cells, which contributed to the high metastatic potential of this mouse cell line. We further demonstrated that Gas1 has all the expected properties of a melanoma tumor suppressor including: suppression of metastasis in a spontaneous metastasis assay, promotion of apoptosis following dissemination of cells to secondary sites, and frequent down-regulation in human melanoma metastasis-derived cell lines and metastatic tumor samples. Thus, we developed a genome-wide shRNA screening strategy that enables the discovery of new metastasis suppressor genes.

  6. Short hairpin-loop-structured oligodeoxynucleotides reduce HSV-1 replication

    Directory of Open Access Journals (Sweden)

    Heinrich Jochen

    2009-04-01

    Full Text Available Abstract The Herpes simplex virus (HSV is known as an infectious agent and widespread in the human population. The symptoms of HSV infections can range from mild to life threatening, especially in immune-compromised individuals. HSV infections are commonly treated with the guanosine analogue Aciclovir, but reports of resistance are increasing. Efforts are made to establish single-stranded antisense oligodeoxynucleotides (as and small interfering ribonucleic acids (siRNAs for antiviral treatment. Recently, another class of short interfering nucleic acids, partially double-stranded hairpin loop-structured 54 mer oligodeoxynucleotides (ODNs, was shown to allow hydrolysis of HIV RNA by binding to the viral RNA. This leads to a substrate for the viral RNase H. To assess the potential of such ODNs for inhibition of HSV-1 replication, five partially double-stranded ODNs were designed based on the sequences of known siRNAs against HSV-1 with antiviral activity. Three of them are directed against early and two against leaky late genes. Primary human lung fibroblasts, MRC-5, and African green monkey kidney cells, Vero, were transfected with ODNs and subsequently infected. The effect on HSV-1 replication was determined by analyzing the virus titer in cell culture supernatants by quantitative PCR and plaque assays. An inhibitory effect was observed with all five selected ODNs, with two cases showing statistical significance in both cell types. The observed effect was sequence-specific and dose dependent. In one case the ODN was more efficient than a previously described siRNA directed against the same target site in the mRNA of UL5, a component of the helicase/primase complex. HSV-1 virions and ODNs can be applied simultaneously without transfection reagent, but at a 50-fold higher concentration to Vero cells with similar efficiencies. The results underline the potential of partially double-stranded hairpin loop-structured ODNs as antiviral agents.

  7. Lentiviral transgenic microRNA-based shRNA suppressed mouse cytochromosome P450 3A (CYP3A expression in a dose-dependent and inheritable manner.

    Directory of Open Access Journals (Sweden)

    Yong Wang

    Full Text Available Cytochomosome P450 enzymes (CYP are heme-containing monooxygenases responsible for oxidative metabolism of many exogenous and endogenous compounds including drugs. The species difference of CYP limits the extent to which data obtained from animals can be translated to humans in pharmacodynamics or pharmacokinetics studies. Transgenic expression of human CYP in animals lacking or with largely reduced endogenous CYP counterparts is recognized as an ideal strategy to correct CYP species difference. CYP3A is the most abundant CYP subfamily both in human and mammals. In this study, we designed a microRNA-based shRNA (miR-shRNA simultaneously targeting four members of mouse CYP3A subfamily (CYP3A11, CYP3A16, CYP3A41 and CYP3A44, and transgenic mice expressing the designed miR-shRNA were generated by lentiviral transgenesis. Results showed that the CYP3A expression level in transgenic mice was markedly reduced compared to that in wild type or unrelated miR-shRNA transgenic mice, and was inversely correlated to the miR-shRNA expression level. The CYP3A expression levels in transgenic offspring of different generations were also remarkably lower compared to those of controls, and moreover the inhibition rate of CYP3A expression remained comparable over generations. The ratio of the targeted CYP3A transcriptional levels was comparable between knockdown and control mice of the same gender as detected by RT-PCR DGGE analysis. These data suggested that transgenic miR-shRNA suppressed CYP3A expression in a dose-dependent and inheritable manner, and transcriptional levels of the targeted CYP3As were suppressed to a similar extent. The observed knockdown efficacy was further confirmed by enzymatic activity analysis, and data showed that CYP3A activities in transgenic mice were markedly reduced compared to those in wild-type or unrelated miR-shRNA transgenic controls (1.11±0.71 vs 5.85±1.74, 5.9±2.4; P<0.01. This work laid down a foundation to further knock

  8. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  9. Suppression of human breast tumors in NOD/SCID mice by CD44 shRNA gene therapy combined with doxorubicin treatment

    Directory of Open Access Journals (Sweden)

    Pham PV

    2012-05-01

    Full Text Available Phuc Van Pham1, Ngoc Bich Vu1, Thuy Thanh Duong1, Tam Thanh Nguyen1, Nhung Hai Truong1, Nhan Lu Chinh Phan1, Tue Gia Vuong1, Viet Quoc Pham1, Hoang Minh Nguyen1, Kha The Nguyen1, Nhung Thi Nguyen1, Khue Gia Nguyen1, Lam Tan Khat1, Dong Van Le2, Kiet Dinh Truong1, Ngoc Kim Phan11Laboratory of Stem Cell Research and Application, University of Science, Vietnam National University, HCM City, 2Military Medical University, Ha Noi, VietnamBackground: Breast cancer stem cells with a CD44+CD24- phenotype are the origin of breast tumors. Strong CD44 expression in this population indicates its important role in maintaining the stem cell phenotype. Previous studies show that CD44 down-regulation causes CD44+CD24- breast cancer stem cells to differentiate into non-stem cells that are sensitive to antitumor drugs and lose many characteristics of the original cells. In this study, we determined tumor suppression in non-obese severe combined immunodeficiency mice using CD44 shRNA therapy combined with doxorubicin treatment.Methods: Tumor-bearing non-obese severe combined immunodeficiency mice were established by injection of CD44+CD24- cells. To track CD44+CD24- cells, green fluorescence protein was stably transduced using a lentiviral vector prior to injection into mice. The amount of CD44 shRNA lentiviral vector used for transduction was based on CD44 down-regulation by in vitro CD44 shRNA transduction. Mice were treated with direct injection of CD44 shRNA lentiviral vector into tumors followed by doxorubicin administration after 48 hours. The effect was evaluated by changes in the size and weight of tumors compared with that of the control.Results: The combination of CD44 down-regulation and doxorubicin strongly suppressed tumor growth with significant differences in tumor sizes and weights compared with that of CD44 down-regulation or doxorubicin treatment alone. In the combination of CD44 down-regulation and doxorubicin group, the tumor weight was

  10. In vivo targeting of ADAM9 gene expression using lentivirus-delivered shRNA suppresses prostate cancer growth by regulating REG4 dependent cell cycle progression.

    Directory of Open Access Journals (Sweden)

    Che-Ming Liu

    Full Text Available Cancer cells respond to stress by activating a variety of survival signaling pathways. A disintegrin and metalloproteinase (ADAM 9 is upregulated during cancer progression and hormone therapy, functioning in part through an increase in reactive oxygen species. Here, we present in vitro and in vivo evidence that therapeutic targeting of ADAM9 gene expression by lentivirus-delivered small hairpin RNA (shRNA significantly inhibited proliferation of human prostate cancer cell lines and blocked tumor growth in a murine model of prostate cancer bone metastasis. Cell cycle studies confirmed an increase in the G1-phase and decrease in the S-phase population of cancer cells under starvation stress conditions, which correlated with elevated intracellular superoxide levels. Microarray data showed significantly decreased levels of regenerating islet-derived family member 4 (REG4 expression in prostate cancer cells with knockdown of ADAM9 gene expression. This REG4 downregulation also resulted in induction of expression of p21(Cip1/WAF1, which negatively regulates cyclin D1 and blocks the G1/S transition. Our data reveal a novel molecular mechanism of ADAM9 in the regulation of prostate cancer cell proliferation, and suggests a combined modality of ADAM9 shRNA gene therapy and cytotoxic agents for hormone refractory and bone metastatic prostate cancer.

  11. In vivo knockdown of antisense non-coding mitochondrial RNAs by a lentiviral-encoded shRNA inhibits melanoma tumor growth and lung colonization.

    Science.gov (United States)

    Varas-Godoy, Manuel; Lladser, Alvaro; Farfan, Nicole; Villota, Claudio; Villegas, Jaime; Tapia, Julio C; Burzio, Luis O; Burzio, Veronica A; Valenzuela, Pablo D T

    2018-01-01

    The family of non-coding mitochondrial RNAs (ncmtRNA) is differentially expressed according to proliferative status. Normal proliferating cells express sense (SncmtRNA) and antisense ncmtRNAs (ASncmtRNAs), whereas tumor cells express SncmtRNA and downregulate ASncmtRNAs. Knockdown of ASncmtRNAs with oligonucleotides induces apoptotic cell death of tumor cells, leaving normal cells unaffected, suggesting a potential application for developing a novel cancer therapy. In this study, we knocked down the ASncmtRNAs in melanoma cell lines with a lentiviral-encoded shRNA approach. Transduction with lentiviral constructs targeted to the ASncmtRNAs induced apoptosis in murine B16F10 and human A375 melanoma cells in vitro and significantly retarded B16F10 primary tumor growth in vivo. Moreover, the treatment drastically reduced the number of lung metastatic foci in a tail vein injection assay, compared to controls. These results provide additional proof of concept to the knockdown of ncmtRNAs for cancer therapy and validate lentiviral-shRNA vectors for gene therapy. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  12. Towards Antiviral shRNAs Based on the AgoshRNA Design.

    Directory of Open Access Journals (Sweden)

    Ying Poi Liu

    Full Text Available RNA interference (RNAi can be induced by intracellular expression of a short hairpin RNA (shRNA. Processing of the shRNA requires the RNaseIII-like Dicer enzyme to remove the loop and to release the biologically active small interfering RNA (siRNA. Dicer is also involved in microRNA (miRNA processing to liberate the mature miRNA duplex, but recent studies indicate that miR-451 is not processed by Dicer. Instead, this miRNA is processed by the Argonaute 2 (Ago2 protein, which also executes the subsequent cleavage of a complementary mRNA target. Interestingly, shRNAs that structurally resemble miR-451 can also be processed by Ago2 instead of Dicer. The key determinant of these "AgoshRNA" molecules is a relatively short basepaired stem, which avoids Dicer recognition and consequently allows alternative processing by Ago2. AgoshRNA processing yields a single active RNA strand, whereas standard shRNAs produce a duplex with guide and passenger strands and the latter may cause adverse off-target effects. In this study, we converted previously tested active anti-HIV-1 shRNA molecules into AgoshRNA. We tested several designs that could potentially improve AgoshRNA activity, including extension of the complementarity between the guide strand and the mRNA target and reduction of the thermodynamic stability of the hairpins. We demonstrate that active AgoshRNAs can be generated. However, the RNAi activity is reduced compared to the matching shRNAs. Despite reduced RNAi activity, comparison of an active AgoshRNA and the matching shRNA in a sensitive cell toxicity assay revealed that the AgoshRNA is much less toxic.

  13. Anti-cancer effect of oncolytic adenovirus-armed shRNA targeting MYCN gene on doxorubicin-resistant neuroblastoma cells.

    Science.gov (United States)

    Li, Yuan; Zhuo, Baobiao; Yin, Yiyu; Han, Tao; Li, Shixian; Li, Zhengwei; Wang, Jian

    2017-09-09

    Chemotherapy is one of the few effective choices for patients with neuroblastoma. However, the development of muti-drug resistance (MDR) to chemotherapy is a major obstacle to the effective treatment of advanced or recurrent neuroblastoma. The muti-drug resistance-associated protein (MRP), which encodes a transmembrane glycoprotein, is a key regulator of MDR. The expression of MRP is a close correlation with MYCN oncogene in neuroblastoma. We have recently shown ZD55-shMYCN (oncolytic virus armed with shRNA against MYCN) can down-regulate MYCN to inhibit tumor cells proliferation and induce apoptosis in neuroblastoma. Here we further report ZD55-shMYCN re-sensitized doxorubicin-resistant cells to doxorubicin (as shown by reduced proliferation, increased apoptosis, and inhibited cell migration), and reduced the in vivo growth rate of neuroblastoma xenografts by down-regulation of MRP expression. Sequential therapy with doxorubicin did not affect the replication of ZD55-shMYCN in doxorubicin-resistant neuroblastoma cells, but decreased the expression of Bcl-2, Bcl-X L , MMP-1. Thus, this synergistic effect of ZD55-shMYCN in combination with doxorubicin provides a novel therapy strategy for doxorubicin-resistant neuroblastoma, and is a promising approach for further clinical development. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. An image-based, dual fluorescence reporter assay to evaluate the efficacy of shRNA for gene silencing at the single-cell level [v1; ref status: indexed, http://f1000r.es/2tt

    Directory of Open Access Journals (Sweden)

    Shin-ichiro Kojima

    2014-02-01

    Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.

  15. An image-based, dual fluorescence reporter assay to evaluate the efficacy of shRNA for gene silencing at the single-cell level [v2; ref status: indexed, http://f1000r.es/39j

    Directory of Open Access Journals (Sweden)

    Shin-ichiro Kojima

    2014-05-01

    Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.

  16. siRNA-mediated Erc gene silencing suppresses tumor growth in Tsc2 mutant renal carcinoma model.

    Science.gov (United States)

    Imamura, Osamu; Okada, Hiroaki; Takashima, Yuuki; Zhang, Danqing; Kobayashi, Toshiyuki; Hino, Okio

    2008-09-18

    Silencing of gene expression by small interfering RNAs (siRNAs) is rapidly becoming a powerful tool for genetic analysis and represents a potential strategy for therapeutic product development. However, there are no reports of systemic delivery of siRNAs for stable treatment except short hairpin RNAs (shRNAs). On the other hand, there are many reports of systemic delivery of siRNAs for transient treatment using liposome carriers and others. With regard to shRNAs, a report showed fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways. Therefore, we decided to use original siRNA microspheres instead of shRNA for stable treatment of disease. In this study, we designed rat-specific siRNA sequences for Erc/mesothelin, which is a tumor-specific gene expressed in the Eker (Tsc2 mutant) rat model of hereditary renal cancer and confirmed the efficacy of gene silencing in vitro. Then, by using siRNA microspheres, we found that the suppression of Erc/mesothelin caused growth inhibition of Tsc2 mutant renal carcinoma cells in tumor implantation experiments in mice.

  17. Interference RNA (RNAi)-based silencing of endogenous thrombopoietin receptor (Mpl) in Dami cells resulted in decreased hNUDC-mediated megakaryocyte proliferation and differentiation

    International Nuclear Information System (INIS)

    Pang, Shi-Feng; Li, Xiao-Kun; Zhang, Qiang; Yang, Fang; Xu, Peilin

    2009-01-01

    Recently our laboratory reported evidence showing that hNUDC acts as an additional cytokine for thrombopoietin receptor (Mpl). Previously known as the human homolog of a fungal nuclear migration protein, hNUDC plays a critical role in megakaryocyte differentiation and maturation. Here we sought to further clarify the hNUDC-Mpl ligand-receptor relationship by utilizing interference RNA (RNAi) to knockdown Mpl expression in a megakaryocyte cell line. We created U6 promoter driven constructs to express short hairpin RNAs (shRNA) with affinity for different sites on Mpl mRNA. By including Mpl-EGFP fusion protein in these constructs, we were able to effectively screen the shRNA that was most efficient in inhibiting Mpl mRNA expression. This shRNA was subsequently transferred into a lentivirus vector and transduced into Dami cells, a cell line which constitutively expresses endogenous Mpl. This lentiviral vector was also designed to simultaneously express EGFP to monitor transfection efficiency. Our results show that lentivirus can be used to effectively deliver shRNAs into Dami cells and cause specific inhibition of Mpl protein expression after transduction. Furthermore, we show the functional effects of shRNA-mediated Mpl silencing by demonstrating reduced hNUDC stimulated megakaryocyte proliferation and differentiation. Thus, the use of a RNAi knockdown strategy has allowed us to pinpoint the connection of hNUDC with Mpl in the regulation of megakaryocyte maturation.

  18. Towards RNAi based therapy of liver diseases : diversity and complexity of shRNA and miRNA processing and functions

    NARCIS (Netherlands)

    Maczuga, Piotr

    2013-01-01

    Familial hypercholesterolemia (FH) is a genetic disorder characterized by high levels of low density lipoprotein cholesterol (LDL-C) and increasing the risk of cardio vascular diseases. FH and many other liver diseases can possibly be treated with RNA interference (RNAi). RNAi is a natural process

  19. In Vivo RNA Interference Screening Identifies a Leukemia-Specific Dependence on Integrin Beta 3 Signaling

    Science.gov (United States)

    Miller, Peter G.; Al-Shahrour, Fatima; Hartwell, Kimberly A.; Chu, Lisa P.; Järås, Marcus; Puram, Rishi V.; Puissant, Alexandre; Callahan, Kevin P.; Ashton, John; McConkey, Marie E.; Poveromo, Luke P.; Cowley, Glenn S.; Kharas, Michael G.; Labelle, Myriam; Shterental, Sebastian; Fujisaki, Joji; Silberstein, Lev; Alexe, Gabriela; Al-Hajj, Muhammad A.; Shelton, Christopher A.; Armstrong, Scott A.; Root, David E.; Scadden, David T.; Hynes, Richard O.; Mukherjee, Siddhartha; Stegmaier, Kimberly; Jordan, Craig T.; Ebert, Benjamin L.

    2013-01-01

    SUMMARY We used an in vivo short hairpin RNA (shRNA) screening approach to identify genes that are essential for MLL-AF9 acute myeloid leukemia (AML). We found that Integrin Beta 3 (Itgb3) is essential for murine leukemia cells in vivo, and for human leukemia cells in xenotransplantation studies. In leukemia cells, Itgb3 knockdown impaired homing, downregulated LSC transcriptional programs, and induced differentiation via the intracellular kinase, Syk. In contrast, loss of Itgb3 in normal HSPCs did not affect engraftment, reconstitution, or differentiation. Finally, we confirmed that Itgb3 is dispensable for normal hematopoiesis and required for leukemogenesis using an Itgb3 knockout mouse model. Our results establish the significance of the Itgb3 signaling pathway as a potential therapeutic target in AML. PMID:23770013

  20. A novel bidirectional expression system for simultaneous expression of both the protein-coding genes and short hairpin RNAs in mammalian cells

    International Nuclear Information System (INIS)

    Hung, C.-F.; Cheng, T.-L.; Wu, R.-H.; Teng, C.-F.; Chang, W.-T.

    2006-01-01

    RNA interference (RNAi) is an extremely powerful and widely used gene silencing approach for reverse functional genomics and molecular therapeutics. In mammals, the conserved poly(ADP-ribose) polymerase 2 (PARP-2)/RNase P bidirectional control promoter simultaneously expresses both the PARP-2 protein and RNase P RNA by RNA polymerase II- and III-dependent mechanisms, respectively. To explore this unique bidirectional control system in RNAi-mediated gene silencing strategy, we have constructed two novel bidirectional expression vectors, pbiHsH1 and pbiMmH1, which contained the PARP-2/RNase P bidirectional control promoters from human and mouse, for simultaneous expression of both the protein-coding genes and short hairpin RNAs. Analyses of the dual transcriptional activities indicated that these two bidirectional expression vectors could not only express enhanced green fluorescent protein as a functional reporter but also simultaneously transcribe shLuc for inhibiting the firefly luciferase expression. In addition, to extend its utility for the establishment of inherited stable clones, we have also reconstructed this bidirectional expression system with the blasticidin S deaminase gene, an effective dominant drug resistance selectable marker, and examined both the selection and inhibition efficiencies in drug resistance and gene expression. Moreover, we have further demonstrated that this bidirectional expression system could efficiently co-regulate the functionally important genes, such as overexpression of tumor suppressor protein p53 and inhibition of anti-apoptotic protein Bcl-2 at the same time. In summary, the bidirectional expression vectors, pbiHsH1 and pbiMmH1, should provide a simple, convenient, and efficient novel tool for manipulating the gene function in mammalian cells

  1. Deep Sequence Analysis of AgoshRNA Processing Reveals 3' A Addition and Trimming.

    Science.gov (United States)

    Harwig, Alex; Herrera-Carrillo, Elena; Jongejan, Aldo; van Kampen, Antonius Hubertus; Berkhout, Ben

    2015-07-14

    The RNA interference (RNAi) pathway, in which microprocessor and Dicer collaborate to process microRNAs (miRNA), was recently expanded by the description of alternative processing routes. In one of these noncanonical pathways, Dicer action is replaced by the Argonaute2 (Ago2) slicer function. It was recently shown that the stem-length of precursor-miRNA or short hairpin RNA (shRNA) molecules is a major determinant for Dicer versus Ago2 processing. Here we present the results of a deep sequence study on the processing of shRNAs with different stem length and a top G·U wobble base pair (bp). This analysis revealed some unexpected properties of these so-called AgoshRNA molecules that are processed by Ago2 instead of Dicer. First, we confirmed the gradual shift from Dicer to Ago2 processing upon shortening of the hairpin length. Second, hairpins with a stem larger than 19 base pair are inefficiently cleaved by Ago2 and we noticed a shift in the cleavage site. Third, the introduction of a top G·U bp in a regular shRNA can promote Ago2-cleavage, which coincides with a loss of Ago2-loading of the Dicer-cleaved 3' strand. Fourth, the Ago2-processed AgoshRNAs acquire a short 3' tail of 1-3 A-nucleotides (nt) and we present evidence that this product is subsequently trimmed by the poly(A)-specific ribonuclease (PARN).

  2. Inhibition of osteoclastogenesis by RNA interference targeting RANK

    Directory of Open Access Journals (Sweden)

    Ma Ruofan

    2012-08-01

    Full Text Available Abstract Background Osteoclasts and osteoblasts regulate bone resorption and formation to allow bone remodeling and homeostasis. The balance between bone resorption and formation is disturbed by abnormal recruitment of osteoclasts. Osteoclast differentiation is dependent on the receptor activator of nuclear factor NF-kappa B (RANK ligand (RANKL as well as the macrophage colony-stimulating factor (M-CSF. The RANKL/RANK system and RANK signaling induce osteoclast formation mediated by various cytokines. The RANK/RANKL pathway has been primarily implicated in metabolic, degenerative and neoplastic bone disorders or osteolysis. The central role of RANK/RANKL interaction in osteoclastogenesis makes RANK an attractive target for potential therapies in treatment of osteolysis. The purpose of this study was to assess the effect of inhibition of RANK expression in mouse bone marrow macrophages on osteoclast differentiation and bone resorption. Methods Three pairs of short hairpin RNAs (shRNA targeting RANK were designed and synthesized. The optimal shRNA was selected among three pairs of shRNAs by RANK expression analyzed by Western blot and Real-time PCR. We investigated suppression of osteoclastogenesis of mouse bone marrow macrophages (BMMs using the optimal shRNA by targeting RANK. Results Among the three shRANKs examined, shRANK-3 significantly suppressed [88.3%] the RANK expression (p Conclusions These findings suggest that retrovirus-mediated shRNA targeting RANK inhibits osteoclast differentiation and osteolysis. It may appear an attractive target for preventing osteolysis in humans with a potential clinical application.

  3. HIV-1 nef suppression by virally encoded microRNA

    Directory of Open Access Journals (Sweden)

    Brisibe Ebiamadon

    2004-12-01

    Full Text Available Abstract Background MicroRNAs (miRNAs are 21~25-nucleotides (nt long and interact with mRNAs to trigger either translational repression or RNA cleavage through RNA interference (RNAi, depending on the degree of complementarity with the target mRNAs. Our recent study has shown that HIV-1 nef dsRNA from AIDS patients who are long-term non-progressors (LTNPs inhibited the transcription of HIV-1. Results Here, we show the possibility that nef-derived miRNAs are produced in HIV-1 persistently infected cells. Furthermore, nef short hairpin RNA (shRNA that corresponded to a predicted nef miRNA (~25 nt, miR-N367 can block HIV-1 Nef expression in vitro and the suppression by shRNA/miR-N367 would be related with low viremia in an LTNP (15-2-2. In the 15-2-2 model mice, the weight loss, which may be rendered by nef was also inhibited by shRNA/miR-N367 corresponding to suppression of nef expression in vivo. Conclusions These data suggest that nef/U3 miRNAs produced in HIV-1-infected cells may suppress both Nef function and HIV-1 virulence through the RNAi pathway.

  4. Expression of RNA interference triggers from an oncolytic herpes simplex virus results in specific silencing in tumour cells in vitro and tumours in vivo

    International Nuclear Information System (INIS)

    Anesti, Anna-Maria; Simpson, Guy R; Price, Toby; Pandha, Hardev S; Coffin, Robert S

    2010-01-01

    Delivery of small interfering RNA (siRNA) to tumours remains a major obstacle for the development of RNA interference (RNAi)-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV) OncoVEX GM-CSF , we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA) or artificial microRNA (miRNA) against the reporter genes green fluorescent protein (eGFP) and β-galactosidase (lacZ). These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen in human clinical trials

  5. The acquired radioresistance in HeLa cells under conditions mimicking hypoxia was attenuated by a decreased expression of HIF subunit genes induced by RNA interference

    International Nuclear Information System (INIS)

    Doi, Nobutaka; Ogawa, Ryohei; Cui, Zheng-Guo; Morii, Akihiro; Watanabe, Akihiko; Kanayama, Shinji; Yoneda, Yuko; Kondo, Takashi

    2015-01-01

    The cancer cells residing in the hypoxic layer are resistant to radiation and these are ones responsible for cancer recurrence after radiation therapy. One of the reasons why hypoxic cancer cells acquire radioresistance may be attributable to changes in the gene expression profile by the activation of hypoxia inducible factors (HIFs). However, the details underlying this process remain unknown. In this study, we investigated the effects of knockdown of HIF subunit genes to elucidate how HIF subunit genes may be involved in the radioresistance acquired by HeLa cells following exposure to a hypoxia mimic. Interestingly, HIF-1α and HIF-2α seemed mutually complementary for each other when either of them was suppressed. We thus suppressed the expression of both genes simultaneously. To do this, we developed a short hairpin RNA (shRNA) targeting a high homology region between HIF-1α and HIF-2α. It was shown that the expression of the shRNA effectively suppressed the acquisition of radioresistance following the hypoxia mimic. Moreover, it was confirmed that suppression of both subunits resulted in the downregulation of stem cell markers and the suppression of spheroid formation during the hypoxia mimicking-conditions. This shRNA-mediated knockdown method targeting a common region shared by a family of genes may offer a new candidate cancer treatment. - Highlights: • Incubation with CoCl 2 confers radioresistance to HeLa cells. • Both HIF-1α and HIF-2α are involved in the acquisition of radioresistance. • An shRNA to a homology region of HIF-1α and HIF-2α suppressed the radioresistance. • The shRNA decreased cells with stem cell markers and a stem cell phenotype

  6. The acquired radioresistance in HeLa cells under conditions mimicking hypoxia was attenuated by a decreased expression of HIF subunit genes induced by RNA interference

    Energy Technology Data Exchange (ETDEWEB)

    Doi, Nobutaka [Department of Radiological Sciences, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama 930-0194 (Japan); New Products Research & Development, Gene Engineering Division, NIPPON GENE Co., Ltd. (Japan); Ogawa, Ryohei, E-mail: ogawa@med.u-toyama.ac.jp [Department of Radiological Sciences, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama 930-0194 (Japan); Cui, Zheng-Guo [Department of Public Health, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama (Japan); Morii, Akihiro; Watanabe, Akihiko [Department of Urology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama (Japan); Kanayama, Shinji; Yoneda, Yuko [New Products Research & Development, Gene Engineering Division, NIPPON GENE Co., Ltd. (Japan); Kondo, Takashi [Department of Radiological Sciences, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama 930-0194 (Japan)

    2015-05-01

    The cancer cells residing in the hypoxic layer are resistant to radiation and these are ones responsible for cancer recurrence after radiation therapy. One of the reasons why hypoxic cancer cells acquire radioresistance may be attributable to changes in the gene expression profile by the activation of hypoxia inducible factors (HIFs). However, the details underlying this process remain unknown. In this study, we investigated the effects of knockdown of HIF subunit genes to elucidate how HIF subunit genes may be involved in the radioresistance acquired by HeLa cells following exposure to a hypoxia mimic. Interestingly, HIF-1α and HIF-2α seemed mutually complementary for each other when either of them was suppressed. We thus suppressed the expression of both genes simultaneously. To do this, we developed a short hairpin RNA (shRNA) targeting a high homology region between HIF-1α and HIF-2α. It was shown that the expression of the shRNA effectively suppressed the acquisition of radioresistance following the hypoxia mimic. Moreover, it was confirmed that suppression of both subunits resulted in the downregulation of stem cell markers and the suppression of spheroid formation during the hypoxia mimicking-conditions. This shRNA-mediated knockdown method targeting a common region shared by a family of genes may offer a new candidate cancer treatment. - Highlights: • Incubation with CoCl{sub 2} confers radioresistance to HeLa cells. • Both HIF-1α and HIF-2α are involved in the acquisition of radioresistance. • An shRNA to a homology region of HIF-1α and HIF-2α suppressed the radioresistance. • The shRNA decreased cells with stem cell markers and a stem cell phenotype.

  7. Inhibition of CD147 expression by RNA interference reduces proliferation, invasion and increases chemosensitivity in cancer stem cell-like HT-29 cells.

    Science.gov (United States)

    Chen, Jie; Pan, Yuqin; He, Bangshun; Ying, Houqun; Wang, Feng; Sun, Huiling; Deng, Qiwen; Liu, Xian; Lin, Kang; Peng, Hongxin; Cho, William C; Wang, Shukui

    2015-10-01

    The association between CD147 and cancer stem cells (CSCs) provides a new angle for cancer treatments. The aim of this study was to investigate the biological roles of CD147 in colorectal CSCs. The Oct4-green fluorescent protein (GFP) vector was used to isolate CSCs and pYr-mir30-shRNA was used to generate short hairpin RNA (shRNA) specifically for CD147. After RNA interference (RNAi), CD147 was evaluated by reverse transcription‑quantitative PCR and western blot analysis, and its biological functions were assessed by MTT and invasion assays. The results showed that the differentiation of isolated CSC-like HT-29 cells was blocked and these cells were highly positive for CD44 and CD147. RNAi-mediated CD147 silencing reduced the expression of CD147 at both mRNA and protein levels. Moreover, the activities of proliferation and invasion were decreased obviously in CSCs. Knockdown of CD147 increased the chemosensitivity of CSC-like cells to gemcitabine, cisplatin, docetaxel at 0.1, 1 and 10 µM respectively, however, there was no significant difference among the three groups to paclitaxel at 10 µM. In conclusion, these results suggest that CD147 plays an important role in colorectal CSCs and might be regarded as a novel CSC-specific targeted strategy against colorectal cancer.

  8. Silencing of the hTERT gene by shRNA inhibits colon cancer SW480 cell growth in vitro and in vivo.

    Directory of Open Access Journals (Sweden)

    Ai-Qun Liu

    Full Text Available Human telomerase reverse transcriptase (hTERT is the key enzyme responsible for synthesizing and maintaining the telomeres on the ends of chromosomes, and it is essential for cell proliferation. This has made hTERT a focus of oncology research and an attractive target for anticancer drug development. In this study, we designed a small interfering RNA (siRNA targeting the catalytic subunit of hTERT and tested its effects on the growth of telomerase-positive human colon carcinoma SW480 cells in vitro, as well as on the tumorigenicity of these cells in nude mice. Transient and stable transfection of hTERT siRNA into colon cancer SW480 cells suppressed hTERT expression, reduced telomerase activity and inhibited cell growth and proliferation. Knocking down hTERT expression in SW480 tumors xenografted into nude mice significantly slowed tumor growth and promoted tumor cell apoptosis. Our results suggest that hTERT is involved in carcinogenesis of human colon carcinoma, and they highlight the therapeutic potential of a hTERT knock-down approach.

  9. Enhanced functional recombinant factor VII production by HEK 293 cells stably transfected with VKORC1 where the gamma-carboxylase inhibitor calumenin is stably suppressed by shRNA transfection.

    Science.gov (United States)

    Wajih, Nadeem; Owen, John; Wallin, Reidar

    2008-01-01

    Recombinant members of the vitamin K-dependent protein family (factors IX and VII and protein C) have become important pharmaceuticals in treatment of bleeding disorders and sepsis. However, because the in vivo gamma-carboxylation system in stable cell lines used for transfection has a limited capacity of post translational gamma-carboxylation, the recovery of fully gamma-carboxylated and functional proteins is low. In this work we have engineered recombinant factor VII producing HEK 293 cells to stably overexpress VKORC1, the reduced vitamin K gamma-carboxylase cofactor and in addition stably silenced the gamma-carboxylase inhibitory protein calumenin. Stable cell lines transfected with only a factor VII cDNA had a 9% production of functional recombinant factor VII. On the other hand, these recombinant factor VII producing cells when engineered to overexpress VKORC1 and having calumenin stably suppressed more than 80% by shRNA expression, produced 68% functional factor VII. The technology presented should be applicable to all vertebrae members of the vitamin K-dependent protein family and should lower the production cost of the clinically used factors VII, IX and protein C.

  10. Downregulation of CD147 expression by RNA interference inhibits HT29 cell proliferation, invasion and tumorigenicity in vitro and in vivo.

    Science.gov (United States)

    Li, Rui; Pan, Yuqin; He, Bangshun; Xu, Yeqiong; Gao, Tianyi; Song, Guoqi; Sun, Huiling; Deng, Qiwen; Wang, Shukui

    2013-12-01

    We investigated the effect of CD147 silencing on HT29 cell proliferation and invasion. We constructed a novel short hairpin RNA (shRNA) expression vector pYr-mir30-shRNA. The plasmid was transferred to HT29 cells. The expression of CD147, MCT1 (lactate transporters monocarboxylate transporter 1) and MCT4 (lactate transporters monocarboxylate transporter 4) were monitored by quantitative PCR and western blotting, respectively. The MMP-2 (matrix metalloproteinase-2) and MMP-9 (matrix metalloproteinase-9) activities were determined by gelatin zymography assay, while the intracellular lactate concentration was determined by the lactic acid assay kit. WST-8 assay was used to determine the HT29 cell proliferation and the chemosensitivity. Invasion assay was used to determine the invasion of HT29 cells. In addition, we established a colorectal cancer model, and detected CD147 expression in vivo. The results showed that the expression of CD147 and MCT1 was significantly reduced at both mRNA and protein levels, and also the activity of MMP-2 and MMP-9 was reduced. The proliferation and invasion were decreased, but chemosensitivity to cisplatin was increased. In vivo, the CD147 expression was also significantly decreased, and reduced the tumor growth after CD147 gene silencing. The results demonstrated that silencing of CD147 expression inhibited the proliferation and invasion, suggesting CD147 silencing might be an adjuvant gene therapy strategy to chemotherapy.

  11. Adenovirally delivered shRNA strongly inhibits Na+-Ca2+ exchanger expression but does not prevent contraction of neonatal cardiomyocytes.

    Science.gov (United States)

    Hurtado, Cecilia; Ander, Bradley P; Maddaford, Thane G; Lukas, Anton; Hryshko, Larry V; Pierce, Grant N

    2005-04-01

    The cardiac Na(+)-Ca(2+) exchanger (NCX1) is the main mechanism for Ca(2+) efflux in the heart and is thought to serve an essential role in cardiac excitation-contraction (E-C) coupling. The demonstration that an NCX1 gene knock-out is embryonic lethal provides further support for this essential role. However, a recent report employing the Cre/loxP technique for cardiac specific knock-out of NCX1 has revealed that cardiac function is remarkably preserved in these mice, which survived to adulthood. This controversy highlights the necessity for further investigation of NCX1 function in the heart. In this study, we report on a novel approach for depletion of NCX1 in postnatal rat myocytes that utilizes RNA interference (RNAi), administered with high efficiency via adenoviral transfection. Depletion of NCX1 was confirmed by immunocytochemical detection, Western blots and radioisotopic assays of Na(+)-Ca(2+) exchange activity. Exchanger expression was inhibited by up to approximately 94%. Surprisingly, spontaneous beating of these cardiomyocytes was still maintained, although at a lower frequency. Electrical stimulation could elicit a normal beating rhythm, although NCX depleted cells exhibited a depressed Ca(2+) transient amplitude, a depressed rate of Ca(2+) rise and decline, elevated diastolic [Ca(2+)], and shorter action potentials. We also observed a compensatory increase in sarcolemmal Ca(2+) pump expression. Our data support an important, though non-essential, role for the NCX1 in E-C coupling in these neonatal heart cells. Furthermore, this approach provides a valuable means for assessing the role of NCX1 and could be utilized to examine other cardiac proteins in physiological and pathological studies.

  12. Reduction of adenovirus E1A mRNA by RNAi results in enhanced recombinant protein expression in transiently transfected HEK293 cells.

    Science.gov (United States)

    Hacker, David L; Bertschinger, Martin; Baldi, Lucia; Wurm, Florian M

    2004-10-27

    Human embryonic kidney 293 (HEK293) cells, a widely used host for large-scale transient expression of recombinant proteins, are transformed with the adenovirus E1A and E1B genes. Because the E1A proteins function as transcriptional activators or repressors, they may have a positive or negative effect on transient transgene expression in this cell line. Suspension cultures of HEK293 EBNA (HEK293E) cells were co-transfected with a reporter plasmid expressing the GFP gene and a plasmid expressing a short hairpin RNA (shRNA) targeting the E1A mRNAs for degradation by RNA interference (RNAi). The presence of the shRNA in HEK293E cells reduced the steady state level of E1A mRNA up to 75% and increased transient GFP expression from either the elongation factor-1alpha (EF-1alpha) promoter or the human cytomegalovirus (HCMV) immediate early promoter up to twofold. E1A mRNA depletion also resulted in a twofold increase in transient expression of a recombinant IgG in both small- and large-scale suspension cultures when the IgG light and heavy chain genes were controlled by the EF-1alpha promoter. Finally, transient IgG expression was enhanced 2.5-fold when the anti-E1A shRNA was expressed from the same vector as the IgG light chain gene. These results demonstrated that E1A has a negative effect on transient gene expression in HEK293E cells, and they established that RNAi can be used to enhance recombinant protein expression in mammalian cells.

  13. Short-hairpin Mediated Myostatin Knockdown Resulted in Altered Expression of Myogenic Regulatory Factors with Enhanced Myoblast Proliferation in Fetal Myoblast Cells of Goats.

    Science.gov (United States)

    Kumar, Rohit; Singh, Satyendra Pal; Mitra, Abhijit

    2018-01-02

    Myostatin (MSTN) is a well-known negative regulator of skeletal muscle development. Reduced expression due to natural mutations in the coding region and knockout as well as knockdown of MSTN results in an increase in the muscle mass. In the present study, we demonstrated as high as 60 and 52% downregulation (p < 0.01) of MSTN mRNA and protein in the primary fetal myoblast cells of goats using synthetic shRNAs (n = 3), without any interferon response. We, for the first time, evaluated the effect of MSTN knockdown on the expression of MRFs (namely, MyoD, Myf5), follistatin (FST), and IGFs (IGF-1 & IGF-2) in goat myoblast cells. MSTN knockdown caused an upregulation (p < 0.05) of MyoD and downregulation (p < 0.01) of MYf5 and FST expression. Moreover, we report up to ∼four fold (p < 0.001) enhanced proliferation in myoblasts after four days of culture. The anti-MSTN shRNA demonstrated in the present study could be used for the production of transgenic goats to increase the muscle mass.

  14. Deep Sequence Analysis of AgoshRNA Processing Reveals 3’ A Addition and Trimming

    Directory of Open Access Journals (Sweden)

    Alex Harwig

    2015-01-01

    Full Text Available The RNA interference (RNAi pathway, in which microprocessor and Dicer collaborate to process microRNAs (miRNA, was recently expanded by the description of alternative processing routes. In one of these noncanonical pathways, Dicer action is replaced by the Argonaute2 (Ago2 slicer function. It was recently shown that the stem-length of precursor-miRNA or short hairpin RNA (shRNA molecules is a major determinant for Dicer versus Ago2 processing. Here we present the results of a deep sequence study on the processing of shRNAs with different stem length and a top G·U wobble base pair (bp. This analysis revealed some unexpected properties of these so-called AgoshRNA molecules that are processed by Ago2 instead of Dicer. First, we confirmed the gradual shift from Dicer to Ago2 processing upon shortening of the hairpin length. Second, hairpins with a stem larger than 19 base pair are inefficiently cleaved by Ago2 and we noticed a shift in the cleavage site. Third, the introduction of a top G·U bp in a regular shRNA can promote Ago2-cleavage, which coincides with a loss of Ago2-loading of the Dicer-cleaved 3’ strand. Fourth, the Ago2-processed AgoshRNAs acquire a short 3’ tail of 1–3 A-nucleotides (nt and we present evidence that this product is subsequently trimmed by the poly(A-specific ribonuclease (PARN.

  15. Stable shRNA Silencing of Lactate Dehydrogenase A (LDHA) in Human MDA-MB-231 Breast Cancer Cells Fails to Alter Lactic Acid Production, Glycolytic Activity, ATP or Survival.

    Science.gov (United States)

    Mack, Nzinga; Mazzio, Elizabeth A; Bauer, David; Flores-Rozas, Hernan; Soliman, Karam F A

    2017-03-01

    In the US, African Americans have a high death rate from triple-negative breast cancer (TNBC), characterized by lack of hormone receptors (ER, PR, HER2/ERRB2) which are otherwise valuable targets of chemotherapy. There is a need to identify novel targets that negatively impact TNBC tumorigenesis. TNBCs release an abundance of lactic acid, under normoxic, hypoxic and hyperoxic conditions; this referred to as the Warburg effect. Accumulated lactic acid sustains peri-cellular acidity which propels metastatic invasion and malignant aggressive transformation. The source of lactic acid is believed to be via conversion of pyruvate by lactate dehydrogenase (LDH) in the last step of glycolysis, with most studies focusing on the LDHA isoform. In this study, LDHA was silenced using long-term MISSION® shRNA lentivirus in human breast cancer MDA-MB-231 cells. Down-regulation of LDHA transcription and protein expression was confirmed by western blot, immunocytochemistry and qPCR. A number of parameters were measured in fully viable vector controls versus knock-down (KD) clones, including levels of lactic acid produced, glucose consumed, ATP and basic metabolic rates. The data show that lentivirus V-165 generated a knock-down clone most effective in reducing both gene and protein levels to less than 1% of vector controls. Stable KD showed absolutely no changes in cell viability, lactic acid production, ATP, glucose consumption or basic metabolic rate. Given the complete absence of impact on any observed parameter by LDH-A KD and this being somewhat contrary to findings in the literature, further analysis was required to determine why. Whole-transcriptome analytic profile on MDA-MB-231 for LDH subtypes using Agilent Human Genome 4×44k microarrays, where the data show the following component breakdown. Transcripts: 30.47 % LDHA, 69.36% LDHB, 0.12% LDHC and 0.05% LDHD. These findings underscore the importance of alternative isoforms of LDH in cancer cells to produce lactic acid

  16. LncRNA TUG1 sponges miR-204-5p to promote osteoblast differentiation through upregulating Runx2 in aortic valve calcification.

    Science.gov (United States)

    Yu, Cong; Li, Lifu; Xie, Fei; Guo, Shichao; Liu, Fayuan; Dong, Nianguo; Wang, Yongjun

    2018-01-01

    Emerging evidence indicates that long non-coding RNAs (lncRNAs) play a vital role in cardiovascular physiology and pathology. Although the lncRNA TUG1 is implicated in atherosclerosis, its function in calcific aortic valve disease (CAVD) remains unknown. In this study, we found that TUG1 was highly expressed in human aortic valves and primary valve interstitial cells (VICs). Moreover, TUG1 knockdown induced inhibition of osteoblast differentiation in CAVD both in vitro and in vivo. Mechanistically, silencing of TUG1 increased the expression of miR-204-5p and subsequently inhibited Runx2 expression at the post-transcriptional level. Importantly, TUG1 directly interacted with miR-204-5p and downregulation of miR-204-5p efficiently reversed the suppression of Runx2 induced by TUG1 short hairpin RNA (shRNA). Thus, TUG1 positively regulated the expression of Runx2, through sponging miR-204-5p, and promoted osteogenic differentiation in CAVD. All together, the evidence generated by our study elucidates the role of lncRNA TUG1 as a miRNA sponge in CAVD, and sheds new light on lncRNA-directed diagnostics and therapeutics in CAVD. Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2017. For permissions please email: journals.permissions@oup.com.

  17. Double-stranded RNA transcribed from vector-based oligodeoxynucleotide acts as transcription factor decoy

    International Nuclear Information System (INIS)

    Xiao, Xiao; Gang, Yi; Wang, Honghong; Wang, Jiayin; Zhao, Lina; Xu, Li; Liu, Zhiguo

    2015-01-01

    Highlights: • A shRNA vector based transcription factor decoy, VB-ODN, was designed. • VB-ODN for NF-κB inhibited cell viability in HEK293 cells. • VB-ODN inhibited expression of downstream genes of target transcription factors. • VB-ODN may enhance nuclear entry ratio for its feasibility of virus production. - Abstract: In this study, we designed a short hairpin RNA vector-based oligodeoxynucleotide (VB-ODN) carrying transcription factor (TF) consensus sequence which could function as a decoy to block TF activity. Specifically, VB-ODN for Nuclear factor-κB (NF-κB) could inhibit cell viability and decrease downstream gene expression in HEK293 cells without affecting expression of NF-κB itself. The specific binding between VB-ODN produced double-stranded RNA and NF-κB was evidenced by electrophoretic mobility shift assay. Moreover, similar VB-ODNs designed for three other TFs also inhibit their downstream gene expression but not that of themselves. Our study provides a new design of decoy for blocking TF activity

  18. Double-stranded RNA transcribed from vector-based oligodeoxynucleotide acts as transcription factor decoy

    Energy Technology Data Exchange (ETDEWEB)

    Xiao, Xiao [State Key Laboratory of Cancer Biology and Xijing Hospital of Digestive Diseases, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China); Gang, Yi [State Key Laboratory of Cancer Biology and Xijing Hospital of Digestive Diseases, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China); Department of Infectious Diseases, Tangdu Hospital, Fourth Military Medical University, Xi’an 710038, Shaanxi Province (China); Wang, Honghong [No. 518 Hospital of Chinese People’s Liberation Army, Xi’an 710043, Shaanxi Province (China); Wang, Jiayin [The Genome Institute, Washington University in St. Louis, St. Louis, MO 63108 (United States); Zhao, Lina [Department of Radiation Oncology, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China); Xu, Li, E-mail: lxuhelen@163.com [State Key Laboratory of Cancer Biology and Xijing Hospital of Digestive Diseases, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China); Liu, Zhiguo, E-mail: liuzhiguo@fmmu.edu.cn [State Key Laboratory of Cancer Biology and Xijing Hospital of Digestive Diseases, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China)

    2015-02-06

    Highlights: • A shRNA vector based transcription factor decoy, VB-ODN, was designed. • VB-ODN for NF-κB inhibited cell viability in HEK293 cells. • VB-ODN inhibited expression of downstream genes of target transcription factors. • VB-ODN may enhance nuclear entry ratio for its feasibility of virus production. - Abstract: In this study, we designed a short hairpin RNA vector-based oligodeoxynucleotide (VB-ODN) carrying transcription factor (TF) consensus sequence which could function as a decoy to block TF activity. Specifically, VB-ODN for Nuclear factor-κB (NF-κB) could inhibit cell viability and decrease downstream gene expression in HEK293 cells without affecting expression of NF-κB itself. The specific binding between VB-ODN produced double-stranded RNA and NF-κB was evidenced by electrophoretic mobility shift assay. Moreover, similar VB-ODNs designed for three other TFs also inhibit their downstream gene expression but not that of themselves. Our study provides a new design of decoy for blocking TF activity.

  19. RNA interference targeting cytosolic NADP(+)-dependent isocitrate dehydrogenase exerts anti-obesity effect in vitro and in vivo.

    Science.gov (United States)

    Nam, Woo Suk; Park, Kwon Moo; Park, Jeen-Woo

    2012-08-01

    A metabolic abnormality in lipid biosynthesis is frequently associated with obesity and hyperlipidemia. Nicotinamide adenine dinucleotide phosphate-oxidase (NADPH) is an essential reducing equivalent for numerous enzymes required in fat and cholesterol biosynthesis. Cytosolic NADP(+)-dependent isocitrate dehydrogenase (IDPc) has been proposed as a key enzyme for supplying cytosolic NADPH. We report here that knockdown of IDPc expression by Ribonucleic acid (RNA) interference (RNAi) inhibited adipocyte differentiation and lipogenesis in 3T3-L1 preadipocytes and mice. Attenuated IDPc expression by IDPc small interfering RNA (siRNA) resulted in a reduction of differentiation and triglyceride level and adipogenic protein expression as well as suppression of glucose uptake in cultured adipocytes. In addition, the attenuation of Nox activity and Reactive oxygen species (ROS) generation accompanied with knockdown of IDPc was associated with inhibition of adipogenesis and lipogenesis. The loss of body weight and the reduction of triglyceride level were also observed in diet-induced obese mice transduced with IDPc short-hairpin (shRNA). Taken together, the inhibiting effect of RNAi targeting IDPc on adipogenesis and lipid biosynthesis is considered to be of therapeutic value in the treatment and prevention of obesity and obesity-associated metabolic syndrome. © 2012 Elsevier B.V. All rights reserved.

  20. shRNA-seq data analysis with edgeR [v1; ref status: indexed, http://f1000r.es/38s

    Directory of Open Access Journals (Sweden)

    Zhiyin Dai

    2014-04-01

    Full Text Available Pooled short hairpin RNA sequencing (shRNA-seq screens are becoming increasingly popular in functional genomics research, and there is a need to establish optimal analysis tools to handle such data. Our open-source shRNA processing pipeline in edgeR provides a complete analysis solution for shRNA-seq screen data, that begins with the raw sequence reads and ends with a ranked lists of candidate shRNAs for downstream biological validation. We first summarize the raw data contained in a fastq file into a matrix of counts (samples in the columns, hairpins in the rows with options for allowing mismatches and small shifts in hairpin position. Diagnostic plots, normalization and differential representation analysis can then be performed using established methods to prioritize results in a statistically rigorous way, with the choice of either the classic exact testing methodology or a generalized linear modelling that can handle complex experimental designs. A detailed users’ guide that demonstrates how to analyze screen data in edgeR along with a point-and-click implementation of this workflow in Galaxy are also provided. The edgeR package is freely available from http://www.bioconductor.org.

  1. Lentivirus mediated RNA interference of EMMPRIN (CD147) gene inhibits the proliferation, matrigel invasion and tumor formation of breast cancer cells.

    Science.gov (United States)

    Yang, Jing; Wang, Rong; Li, Hongjiang; Lv, Qing; Meng, Wentong; Yang, Xiaoqin

    2016-07-08

    Overexpression of extracellular matrix metalloproteinase inducer (EMMPRIN) or cluster of differentiation 147 (CD147), a glycoprotein enriched on the plasma membrane of tumor cells, promotes proliferation, invasion, metastasis, and survival of malignant tumor cells. In this study, we sought to examine the expression of EMMPRIN in breast tumors, and to identify the potential roles of EMMPRIN on breast cancer cells. EMMPRIN expression in breast cancer tissues was assessed by immunohistochemistry. We used a lentivirus vector-based RNA interference (RNAi) approach expressing short hairpin RNA (shRNA) to knockdown EMMPRIN gene in breast cancer cell lines MDA-MB-231 and MCF-7. In vitro, Cell proliferative, invasive potential were determined by Cell Counting Kit (CCK-8), cell cycle analysis and matrigel invasion assay, respectively. In vivo, tumorigenicity was monitored by inoculating tumor cells into breast fat pad of female nude mice. EMMPRIN was over-expressed in breast tumors and breast cancer cell lines. Down-regulation of EMMPRIN by lentivirus vector-based RNAi led to decreased cell proliferative, decreased matrigel invasion in vitro, and attenuated tumor formation in vivo. High expression of EMMPRIN plays a crucial role in breast cancer cell proliferation, matrigel invasion and tumor formation.

  2. Phosphorylation of eIF2α is required for mRNA translation inhibition and survival during moderate hypoxia

    International Nuclear Information System (INIS)

    Koritzinsky, Marianne; Rouschop, Kasper M.A.; Beucken, Twan van den; Magagnin, Michael G.; Savelkouls, Kim; Lambin, Philippe; Wouters, Bradly G.

    2007-01-01

    Abstracts: Background and purpose: Human tumors are characterized by temporal fluctuations in oxygen tension. The biological pathways that respond to the dynamic tumor microenvironment represent potential molecular targets for cancer therapy. Anoxic conditions result in eIF2α dependent inhibition of overall mRNA translation, differential gene expression, hypoxia tolerance and tumor growth. The signaling pathway which governs eIF2α phosphorylation has therefore emerged as a potential molecular target. In this study, we investigated the role of eIF2α in regulating mRNA translation and hypoxia tolerance during moderate hypoxia. Since other molecular pathways that regulate protein synthesis are frequently mutated in cancer, we also assessed mRNA translation in a panel of cell lines from different origins. Materials and methods: Immortalized human fibroblast, transformed mouse embryo fibroblasts (MEFs) and cells from six cancer cell lines were exposed to 0.2% or 0.0% oxygen. We assayed global mRNA translation efficiency by polysome analysis, as well as proliferation and clonogenic survival. The role of eIF2α was assessed in MEFs harboring a homozygous inactivating mutation (S51A) as well as in U373-MG cells overexpressing GADD34 (C-term) under a tetracycline-dependent promoter. The involvement of eIF4E regulation was investigated in HeLa cells stably expressing a short hairpin RNA (shRNA) targeting 4E-BP1. Results: All cells investigated inhibited mRNA translation severely in response to anoxia and modestly in response to hypoxia. Two independent genetic cell models demonstrated that inhibition of mRNA translation in response to moderate hypoxia was dependent on eIF2α phosphorylation. Disruption of eIF2α phosphorylation caused sensitivity to hypoxia and anoxia. Conclusions: Disruption of eIF2α phosphorylation is a potential target for hypoxia-directed molecular cancer therapy

  3. Efficient nanoparticle mediated sustained RNA interference in human primary endothelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Mukerjee, Anindita; Shankardas, Jwalitha; Ranjan, Amalendu P; Vishwanatha, Jamboor K, E-mail: Jamboor.vishwanatha@unthsc.edu [Department of Molecular Biology and Immunology and Institute for Cancer Research, Graduate School of Biomedical Sciences, University of North Texas Health Science Center, Fort Worth, TX 76107 (United States)

    2011-11-04

    Endothelium forms an important target for drug and/or gene therapy since endothelial cells play critical roles in angiogenesis and vascular functions and are associated with various pathophysiological conditions. RNA mediated gene silencing presents a new therapeutic approach to overcome many such diseases, but the major challenge of such an approach is to ensure minimal toxicity and effective transfection efficiency of short hairpin RNA (shRNA) to primary endothelial cells. In the present study, we formulated shAnnexin A2 loaded poly(D,L-lactide-co-glycolide) (PLGA) nanoparticles which produced intracellular small interfering RNA (siRNA) against Annexin A2 and brought about the downregulation of Annexin A2. The per cent encapsulation of the plasmid within the nanoparticle was found to be 57.65%. We compared our nanoparticle based transfections with Lipofectamine mediated transfection, and our studies show that nanoparticle based transfection efficiency is very high ({approx}97%) and is more sustained compared to conventional Lipofectamine mediated transfections in primary retinal microvascular endothelial cells and human cancer cell lines. Our findings also show that the shAnnexin A2 loaded PLGA nanoparticles had minimal toxicity with almost 95% of cells being viable 24 h post-transfection while Lipofectamine based transfections resulted in only 30% viable cells. Therefore, PLGA nanoparticle based transfection may be used for efficient siRNA transfection to human primary endothelial and cancer cells. This may serve as a potential adjuvant treatment option for diseases such as diabetic retinopathy, retinopathy of prematurity and age related macular degeneration besides various cancers.

  4. Efficient nanoparticle mediated sustained RNA interference in human primary endothelial cells

    Science.gov (United States)

    Mukerjee, Anindita; Shankardas, Jwalitha; Ranjan, Amalendu P.; Vishwanatha, Jamboor K.

    2011-11-01

    Endothelium forms an important target for drug and/or gene therapy since endothelial cells play critical roles in angiogenesis and vascular functions and are associated with various pathophysiological conditions. RNA mediated gene silencing presents a new therapeutic approach to overcome many such diseases, but the major challenge of such an approach is to ensure minimal toxicity and effective transfection efficiency of short hairpin RNA (shRNA) to primary endothelial cells. In the present study, we formulated shAnnexin A2 loaded poly(D,L-lactide-co-glycolide) (PLGA) nanoparticles which produced intracellular small interfering RNA (siRNA) against Annexin A2 and brought about the downregulation of Annexin A2. The per cent encapsulation of the plasmid within the nanoparticle was found to be 57.65%. We compared our nanoparticle based transfections with Lipofectamine mediated transfection, and our studies show that nanoparticle based transfection efficiency is very high (~97%) and is more sustained compared to conventional Lipofectamine mediated transfections in primary retinal microvascular endothelial cells and human cancer cell lines. Our findings also show that the shAnnexin A2 loaded PLGA nanoparticles had minimal toxicity with almost 95% of cells being viable 24 h post-transfection while Lipofectamine based transfections resulted in only 30% viable cells. Therefore, PLGA nanoparticle based transfection may be used for efficient siRNA transfection to human primary endothelial and cancer cells. This may serve as a potential adjuvant treatment option for diseases such as diabetic retinopathy, retinopathy of prematurity and age related macular degeneration besides various cancers.

  5. Efficient nanoparticle mediated sustained RNA interference in human primary endothelial cells

    International Nuclear Information System (INIS)

    Mukerjee, Anindita; Shankardas, Jwalitha; Ranjan, Amalendu P; Vishwanatha, Jamboor K

    2011-01-01

    Endothelium forms an important target for drug and/or gene therapy since endothelial cells play critical roles in angiogenesis and vascular functions and are associated with various pathophysiological conditions. RNA mediated gene silencing presents a new therapeutic approach to overcome many such diseases, but the major challenge of such an approach is to ensure minimal toxicity and effective transfection efficiency of short hairpin RNA (shRNA) to primary endothelial cells. In the present study, we formulated shAnnexin A2 loaded poly(D,L-lactide-co-glycolide) (PLGA) nanoparticles which produced intracellular small interfering RNA (siRNA) against Annexin A2 and brought about the downregulation of Annexin A2. The per cent encapsulation of the plasmid within the nanoparticle was found to be 57.65%. We compared our nanoparticle based transfections with Lipofectamine mediated transfection, and our studies show that nanoparticle based transfection efficiency is very high (∼97%) and is more sustained compared to conventional Lipofectamine mediated transfections in primary retinal microvascular endothelial cells and human cancer cell lines. Our findings also show that the shAnnexin A2 loaded PLGA nanoparticles had minimal toxicity with almost 95% of cells being viable 24 h post-transfection while Lipofectamine based transfections resulted in only 30% viable cells. Therefore, PLGA nanoparticle based transfection may be used for efficient siRNA transfection to human primary endothelial and cancer cells. This may serve as a potential adjuvant treatment option for diseases such as diabetic retinopathy, retinopathy of prematurity and age related macular degeneration besides various cancers.

  6. shRNA-Mediated XRCC2 Gene Knockdown Efficiently Sensitizes Colon Tumor Cells to X-ray Irradiation in Vitro and in Vivo

    Directory of Open Access Journals (Sweden)

    Qin Wang

    2014-01-01

    Full Text Available Colon cancer is one of the most common tumors of the digestive tract. Resistance to ionizing radiation (IR decreased therapeutic efficiency in these patients’ radiotherapy. XRCC2 is the key protein of DNA homologous recombination repair, and its high expression is associated with enhanced resistance to DNA damage induced by IR. Here, we investigated the effect of XRCC2 silencing on colon tumor cells’ growth and sensitivity to X-radiation in vitro and in vivo. Colon tumor cells (T84 cell line were cultivated in vitro and tumors originated from the cell line were propagated as xenografts in nude mice. The suppression of XRCC2 expression was achieved by using vector-based short hairpin RNA (shRNA in T84 cells. We found that the knockdown of XRCC2 expression effectively decreased T84 cellular proliferation and colony formation, and led to cell apoptosis and cell cycle arrested in G2/M phase induced by X-radiation in vitro. In addition, tumor xenograft studies suggested that XRCC2 silencing inhibited tumorigenicity after radiation treatment in vivo. Our data suggest that the suppression of XRCC2 expression rendered colon tumor cells more sensitive to radiation therapy in vitro and in vivo, implying XRCC2 as a promising therapeutic target for the treatment of radioresistant human colon cancer.

  7. FUNDAMENTAL STUDY OF DETECTION OF MUSCLE HYPERTROPHY-ORIENTED GENE DOPING BY MYOSTATIN KNOCK DOWN USING RNA INTERFERENCE

    Directory of Open Access Journals (Sweden)

    Tohru Takemasa

    2012-06-01

    Full Text Available To investigate the feasibility of developing a method for detection of gene doping in power-athletes, we devised an experimental model system. Myostatin is a potent negative regulator of skeletal muscle development and growth, and myostatin-knockout mice exhibit a double-muscle phenotype. To achieve knockdown, we constructed plasmids expressing short hairpin interfering RNAs (shRNAs against myostatin. These shRNAs were transfected into C2C12 cultured cells or injected into the tibialis anterior (TA muscle of adult mice. By performing in vitro and in vivo experiments, we found that some shRNAs effectively reduced the expression of myostatin, and that the TA muscle showed hypertrophy of up to 27.9%. Then, using real-time PCR, we tried to detect the shRNA plasmid in the serum or muscles of mice into which it had been injected. Although we were unable to detect the plasmid in serum samples, it was detectable in the treated muscle at least four weeks after induction. We were also able to detect the plasmid in muscle in the vicinity of the TA. This gene doping model system will be useful for further studies aimed at doping control

  8. HBV-Specific shRNA is Capable of Reducing the Formation of Hepatitis B Virus Covalently Closed Circular DNA, but has No Effect on Established Covalently Closed Circular DNA in vitro

    OpenAIRE

    Starkey, Jason L.; Chiari, Estelle F.; Isom, Harriet C.

    2009-01-01

    Hepatitis B virus (HBV) covalently closed circular DNA (CCC DNA) is the source of HBV transcripts and persistence in chronically infected patients. The novel aspect of this study was to determine the effect of RNA interference (RNAi) on HBV CCC DNA when administered prior to establishment of HBV replication or during chronic HBV infection. HBV replication was initiated in HepG2 cells by transduction with HBV baculovirus. Subculture of HBV expressing HepG2 cells at 10 days post-transduction ge...

  9. MicroRNA 107 partly inhibits endothelial progenitor cells differentiation via HIF-1β.

    Directory of Open Access Journals (Sweden)

    Shu Meng

    Full Text Available Endothelial progenitor cells (EPCs play an important role in tissue repair after ischemic heart disease. In particular, the recovery of endothelial function is reliant on the ability and rate of EPCs differentiate into mature endothelial cells. The present study evaluated the effect of microRNA 107 (miR-107 on the mechanism of EPCs differentiation. EPCs were isolated from rats' bone marrow and miR-107 expression of EPCs in hypoxic and normoxic conditions were measured by real-time qualitative PCR. CD31 was analyzed by flow cytometry and eNOS was examined by real-time qualitative PCR and western blotting and these were used as markers of EPC differentiation. In order to reveal the mechanism, we used miR107 inhibitor and lentiviral vector expressing a short hairpin RNA (shRNA that targets miR-107 and hypoxia-inducible factor-1 β (HIF-1β to alter miR107 and HIF-1β expression. MiR-107 expression were increased in EPCs under hypoxic conditions. Up-regulation of miR-107 partly suppressed the EPCs differentiation induced in hypoxia, while down-regulation of miR-107 promoted EPC differentiation. HIF-1β was the target. This study indicated that miR-107 was up-regulated in hypoxia to prevent EPCs differentiation via its target HIF-1β. The physiological mechanisms of miR-107 must be evaluated if it is to be used as a potential anti-ischemia therapeutic regime.

  10. Hepatitis C virus (HCV) induces formation of stress granules whose proteins regulate HCV RNA replication and virus assembly and egress.

    Science.gov (United States)

    Garaigorta, Urtzi; Heim, Markus H; Boyd, Bryan; Wieland, Stefan; Chisari, Francis V

    2012-10-01

    Stress granules (SGs) are cytoplasmic structures that are induced in response to environmental stress, including viral infections. Here we report that hepatitis C virus (HCV) triggers the appearance of SGs in a PKR- and interferon (IFN)-dependent manner. Moreover, we show an inverse correlation between the presence of stress granules and the induction of IFN-stimulated proteins, i.e., MxA and USP18, in HCV-infected cells despite high-level expression of the corresponding MxA and USP18 mRNAs, suggesting that interferon-stimulated gene translation is inhibited in stress granule-containing HCV-infected cells. Finally, in short hairpin RNA (shRNA) knockdown experiments, we found that the stress granule proteins T-cell-restricted intracellular antigen 1 (TIA-1), TIA1-related protein (TIAR), and RasGAP-SH3 domain binding protein 1 (G3BP1) are required for efficient HCV RNA and protein accumulation at early time points in the infection and that G3BP1 and TIA-1 are required for intracellular and extracellular infectious virus production late in the infection, suggesting that they are required for virus assembly. In contrast, TIAR downregulation decreases extracellular infectious virus titers with little effect on intracellular RNA content or infectivity late in the infection, suggesting that it is required for infectious particle release. Collectively, these results illustrate that HCV exploits the stress granule machinery at least two ways: by inducing the formation of SGs by triggering PKR phosphorylation, thereby downregulating the translation of antiviral interferon-stimulated genes, and by co-opting SG proteins for its replication, assembly, and egress.

  11. Cellular toxicity following application of adeno-associated viral vector-mediated RNA interference in the nervous system

    Directory of Open Access Journals (Sweden)

    Verhaagen Joost

    2010-02-01

    Full Text Available Abstract Background After a spinal cord lesion, axon regeneration is inhibited by the presence of a diversity of inhibitory molecules in the lesion environment. At and around the lesion site myelin-associated inhibitors, chondroitin sulfate proteoglycans (CSPGs and several axon guidance molecules, including all members of the secreted (class 3 Semaphorins, are expressed. Interfering with multiple inhibitory signals could potentially enhance the previously reported beneficial effects of blocking single molecules. RNA interference (RNAi is a tool that can be used to simultaneously silence expression of multiple genes. In this study we aimed to employ adeno-associated virus (AAV mediated expression of short hairpin RNAs (shRNAs to target all Semaphorin class 3 signaling by knocking down its receptors, Neuropilin 1 (Npn-1 and Neuropilin 2 (Npn-2. Results We have successfully generated shRNAs that knock down Npn-1 and Npn-2 in a neuronal cell line. We detected substantial knockdown of Npn-2 mRNA when AAV5 viral vector particles expressing Npn-2 specific shRNAs were injected in dorsal root ganglia (DRG of the rat. Unexpectedly however, AAV1-mediated expression of Npn-2 shRNAs and a control shRNA in the red nucleus resulted in an adverse tissue response and neuronal degeneration. The observed toxicity was dose dependent and was not seen with control GFP expressing AAV vectors, implicating the shRNAs as the causative toxic agents. Conclusions RNAi is a powerful tool to knock down Semaphorin receptor expression in neuronal cells in vitro and in vivo. However, when shRNAs are expressed at high levels in CNS neurons, they trigger an adverse tissue response leading to neuronal degradation.

  12. Fundamental study of detection of muscle hypertrophy-oriented gene doping by myostatin knock down using RNA interference.

    Science.gov (United States)

    Takemasa, Tohru; Yakushiji, Naohisa; Kikuchi, Dale Manjiro; Deocaris, Custer; Widodo; Machida, Masanao; Kiyosawa, Hidenori

    2012-01-01

    To investigate the feasibility of developing a method for detection of gene doping in power-athletes, we devised an experimental model system. Myostatin is a potent negative regulator of skeletal muscle development and growth, and myostatin-knockout mice exhibit a double-muscle phenotype. To achieve knockdown, we constructed plasmids expressing short hairpin interfering RNAs (shRNAs) against myostatin. These shRNAs were transfected into C2C12 cultured cells or injected into the tibialis anterior (TA) muscle of adult mice. By performing in vitro and in vivo experiments, we found that some shRNAs effectively reduced the expression of myostatin, and that the TA muscle showed hypertrophy of up to 27.9%. Then, using real-time PCR, we tried to detect the shRNA plasmid in the serum or muscles of mice into which it had been injected. Although we were unable to detect the plasmid in serum samples, it was detectable in the treated muscle at least four weeks after induction. We were also able to detect the plasmid in muscle in the vicinity of the TA. This gene doping model system will be useful for further studies aimed at doping control. Key pointsUsing a myostatin knockdown plasmid, we have succeeded in creating a model system for gene doping using mice that resulted in muscle hypertrophy greater than that reported previously.We confirmed that there was a limit of gene doping detection using real-time PCR, either from serum or muscle smple.This model experimental system can be utilized for examining indirect methods of gene doping detection such as immune responses to gene transfer or a profiling approach using DNA microarray.

  13. Lymphotoxin β receptor activation promotes mRNA expression of RelA and pro-inflammatory cytokines TNFα and IL-1β in bladder cancer cells.

    Science.gov (United States)

    Shen, Mo; Zhou, Lianlian; Zhou, Ping; Zhou, Wu; Lin, Xiangyang

    2017-07-01

    The role of inflammation in tumorigenesis and development is currently well established. Lymphotoxin β receptor (LTβR) activation induces canonical and noncanonical nuclear factor (NF)‑κB signaling pathways, which are linked to inflammation‑induced carcinogenesis. In the present study, 5,637 bladder cancer cells were cultured and the activation of LTβR was induced by functional ligand, lymphotoxin (LT) α1β2, and silencing with shRNA. Reverse transcription‑quantitative polymerase chain reaction was utilized to detect the mRNA expression levels of NF‑κB family members RelA and RelB, cytokines including LTα, LTβ, tumor necrosis factor (TNF)α, TNF superfamily member 14, interleukin (IL)‑6 and IL‑1β, and proliferation‑related genes including CyclinD1 and Survivin. The expression of phospho‑p65 was determined by western blotting. Activation of LTβR on bladder cancer 5,637 cells was demonstrated to upregulate the mRNA expression levels of the RELA proto‑oncogene, RelA, by 2.5‑fold compared with unstimulated cells, while no significant change was observed in the RELB proto‑oncogene NF‑κB member mRNA levels. Expression of pro‑inflammatory cytokines tumor necrosis factor (TNF)α and interleukin (IL)‑1β mRNA levels were significantly increased nearly 5‑fold and 1.5‑fold, respectively, following LTβR activation compared with unstimulated cells. The LTβR‑induced upregulation of RelA, TNFα and IL‑1β was decreased by ~33, 27, and 26% respectively when LTβR was silenced via short hairpin RNA. Activation of LTβR had no effect on 5,637 cell growth, despite CyclinD1 and Survivin mRNA levels increasing by ~2.7 and 1.3‑fold, respectively, compared with unstimulated cells. In conclusion, activation of LTβR induced the expression of RelA mRNA levels. LTβR activation might be an important mediator in promoting an inflammatory microenvironment in bladder cancer, via the upregulation of TNFα and IL‑1β mRNA levels. LTβR may

  14. RNA.

    Science.gov (United States)

    Darnell, James E., Jr.

    1985-01-01

    Ribonucleic acid (RNA) converts genetic information into protein and usually must be processed to serve its function. RNA types, chemical structure, protein synthesis, translation, manufacture, and processing are discussed. Concludes that the first genes might have been spliced RNA and that humans might be closer than bacteria to primitive…

  15. shRNA screening identifies JMJD1C as being required for leukemia maintenance

    DEFF Research Database (Denmark)

    Sroczynska, Patrycja; Cruickshank, V Adam; Bukowski, John-Paul

    2014-01-01

    Epigenetic regulatory mechanisms are implicated in the pathogenesis of acute myeloid and lymphoid leukemia (AML and ALL). Recent progress suggests that proteins involved in epigenetic control are amenable to drug intervention, but little is known about the cancer-specific dependency on epigenetic...... candidate drug targets identified in these screens was Jmjd1c. Depletion of Jmjd1c impairs growth and colony formation of mouse MLL-AF9 cells in vitro, as well as establishment of leukemia after transplantation. Depletion of JMJD1C impairs expansion and colony formation of human leukemic cell lines......, with the strongest effect observed in the MLL-rearranged ALL cell line, SEM. In both mouse and human leukemic cells, the growth defect upon JMJD1C depletion appears to be primarily due to increased apoptosis, which implicates JMJD1C as a potential therapeutic target in leukemia....

  16. Silencing effect of shRNA expression vectors with stem length of 21 ...

    African Journals Online (AJOL)

    AJL

    2011-02-14

    Feb 14, 2011 ... construct itself or its delivery vehicle (Rao et al., 2009). Through choosing ... Cell culture, transfection and intramuscular injection. MEFs were isolated ..... A system for stable expression of ... Adv. Drug Deliv. Rev. 61: 746-759.

  17. ShRNA en tratamiento in vivo: perspectiva terapéutica en la enfermedad de Alzheimer

    Directory of Open Access Journals (Sweden)

    Kenneth Kosik

    2005-03-01

    Full Text Available Las enfermedades neurodegenerativas son un problema creciente en la población senil, con más de 20 millones de personas afectadas por la enfermedad de Alzheimer (EA esporádica en el mundo y más de 5.000 portadores de EA familiar sólo en el departamento de Antioquia.

  18. [Effect of DOT1L gene silence on proliferation of acute monocytic leukemia cell line THP-1].

    Science.gov (United States)

    Zhang, Yu-Juan; Li, Hua-Wen; Chang, Guo-Qiang; Zhang, Hong-Ju; Wang, Jian; Lin, Ya-Ni; Zhou, Jia-Xi; Li, Qing-Hua; Pang, Tian-Xiang

    2013-08-01

    This study was aimed to investigate the influence of short hairpin RNA (shRNA) on proliferation of human leukemia cell line THP-1. The shRNA targeting the site 732-752 of DOT1L mRNA was designed and chemically synthesized, then a single-vector lentiviral, tet-inducible shRNA-DOT1L system (Plko-Tet-On) was generated. Thereafter, the THP-1 cells with lentivirus were infected to create stable cell line with regulatable shRNA expression. The expression of DOT1L in the THP-1 cell line was assayed by RT-PCR. Effect of shRNA-DOT1L on the proliferation of THP-1 cells was detected with MTT method,and the change of colony forming potential of THP-1 cells was analyzed by colony forming unit test. Cell cycle distribution was tested by flow cytometry. The results indicated that the expression of DOT1L was statistically lower than that in the control groups. The proliferation and colony forming capacity of THP-1 cells were significantly inhibited. The percentage of cells at G0/G1 phase increased in THP-1/shRNA cells treated with Dox while the percentage of cells at S phase significantly decreased as compared with that in the control group. It is concluded that the shRNA targeting DOT1L can effectively inhibit the proliferation of acute monocytic leukemia cell line THP-1.

  19. Identification of microRNA-Like RNAs in the filamentous fungus Trichoderma reesei by solexa sequencing.

    Directory of Open Access Journals (Sweden)

    Kang Kang

    Full Text Available microRNAs (miRNAs are non-coding small RNAs (sRNAs capable of negatively regulating gene expression. Recently, microRNA-like small RNAs (milRNAs were discovered in several filamentous fungi but not yet in Trichoderma reesei, an industrial filamentous fungus that can secrete abundant hydrolases. To explore the presence of milRNA in T. reesei and evaluate their expression under induction of cellulose, two T. reesei sRNA libraries of cellulose induction (IN and non-induction (CON were generated and sequenced using Solexa sequencing technology. A total of 726 and 631 sRNAs were obtained from the IN and CON samples, respectively. Global expression analysis showed an extensively differential expression of sRNAs in T. reesei under the two conditions. Thirteen predicted milRNAs were identified in T. reesei based on the short hairpin structure analysis. The milRNA profiles obtained in deep sequencing were further validated by RT-qPCR assay. Computational analysis predicted a number of potential targets relating to many processes including regulation of enzyme expression. The presence and differential expression of T. reesei milRNAs imply that milRNA might play a role in T. reesei growth and cellulase induction. This work lays foundation for further functional study of fungal milRNAs and their industrial application.

  20. Tumor-specific RNA interference targeting Pokemon suppresses tumor growth and induces apoptosis in prostate cancer.

    Science.gov (United States)

    Li, Yining; Xu, Shuxiong; Wang, Xiangwei; Shi, Hua; Sun, Zhaolin; Yang, Zhao

    2013-02-01

    To explore the exact mechanism of Pokemon in prostate cancer. Pokemon is a member of the POK family of transcriptional repressors. Its main function is suppression of the p14ARF (alternate reading frame) tumor suppressor gene. Although Pokemon expression has been found to be increased in various types of lymphoma, the exact mechanism of the gene in prostate cancer is not clear. In the present study, prostate cancer cells were transfected with the specific short hairpin ribonucleic acid (RNA) expression vector targeting Pokemon. The expression of Pokemon messenger RNA and its protein was detected by semiquantitative reverse transcriptase-polymerase chain reaction and Western blotting, respectively. The cell growth and cell apoptosis were also examined using the methyl thiazolyl tetrazolium assay and flow cytometry. The results demonstrated that specific RNA interference (RNAi) could decrease the expression levels of Pokemon gene messenger RNA and protein in prostate cancer cells. In addition, that specific RNAi significantly inhibited the cell proliferation and increased the apoptotic rate. In vivo experiments showed that specific RNAi inhibited the tumorigenicity of prostate cancer cells and significantly suppressed tumor growth. Therefore, an RNAi-targeted Pokemon gene strategy could be a potential approach to prostate cancer therapy. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. Influence of silencing the MC4R gene by lentivirusmediated RNA ...

    African Journals Online (AJOL)

    Melanocortin receptor 4 (MC4R) is a key element in the mechanisms used to regulate both aspects of keeping the balance between energy uptake and energy expenditure. MC4R was knocked down by lentivirus-mediated shRNA expressing plasmids, which were controlled by the U6 promoter in bovine fibroblast cells, and ...

  2. [Construction and identification of eukaryotic plasmid pGC-silencer-U6/Neo/GFP/ABCG2].

    Science.gov (United States)

    Yu, Yanping; Zhang, Song; Kong, Weijia

    2010-09-01

    To construct three short hairpin RNA (shRNA) interference expression plasmid vectors of human ABCG2 gene, to assay the expression of ABCG2 in a human nasopharyngeal carcinoma (NPC) cell line, CEN-2 cell line, and to detect the RNAi effect of shRNA. Targeting ABCG2 gene sequence, three plasmid expression vectors coding for shRNA and a control vector containing random DNA fragment were constructed. The recombinant plasmids were amplified in Ecoli. DH5 and then identified by restriction digestion, PCR and sequencing. The recombinant plasmids were transfected into CEN-2 cells. ABCG2 expression was assayed by real-time quantitative PCR and Western blot. The construction of pGC-silencer-U6/Neo/GFP/ABCG2 was succeed. The shRNA plasmids significantly down-regulated the ABCG2 expression in CEN-2 cells, at both mRNA level and protein level. Recombinant plasmid 1 had the strongest effect compared with plasmids 2 and 3 (P < 0.05), with an inhibition ratio of 75% at the mRNA level and 68% at the protein level. pGC-silencer-U6/Neo/GFP/ABCG2 has been successfully constructed and it can down-regulate ABCG2 expression after transfected into CEN-2 cells, which could help further studies of ABCG2 functions CEN-2 cell line and contribute to the NPC gene therapy.

  3. Role of RNA interference (RNAi) in the moss Physcomitrella patens

    KAUST Repository

    Arif, Muhammad Asif; Frank, Wolfgang; Khraiwesh, Basel

    2013-01-01

    RNA interference (RNAi) is a mechanism that regulates genes by either transcriptional (TGS) or posttranscriptional gene silencing (PTGS), required for genome maintenance and proper development of an organism. Small non-coding RNAs are the key players in RNAi and have been intensively studied in eukaryotes. In plants, several classes of small RNAs with specific sizes and dedicated functions have evolved. The major classes of small RNAs include microRNAs (miRNAs) and small interfering RNAs (siRNAs), which differ in their biogenesis. miRNAs are synthesized from a short hairpin structure while siRNAs are derived from long double-stranded RNAs (dsRNA). Both miRNA and siRNAs control the expression of cognate target RNAs by binding to reverse complementary sequences mediating cleavage or translational inhibition of the target RNA. They also act on the DNA and cause epigenetic changes such as DNA methylation and histone modifications. In the last years, the analysis of plant RNAi pathways was extended to the bryophyte Physcomitrella patens, a non-flowering, non-vascular ancient land plant that diverged from the lineage of seed plants approximately 450 million years ago. Based on a number of characteristic features and its phylogenetic key position in land plant evolution P. patens emerged as a plant model species to address basic as well as applied topics in plant biology. Here we summarize the current knowledge on the role of RNAi in P. patens that shows functional overlap with RNAi pathways from seed plants, and also unique features specific to this species. 2013 by the authors; licensee MDPI, Basel, Switzerland.

  4. Role of RNA interference (RNAi) in the moss Physcomitrella patens

    KAUST Repository

    Arif, Muhammad Asif

    2013-01-14

    RNA interference (RNAi) is a mechanism that regulates genes by either transcriptional (TGS) or posttranscriptional gene silencing (PTGS), required for genome maintenance and proper development of an organism. Small non-coding RNAs are the key players in RNAi and have been intensively studied in eukaryotes. In plants, several classes of small RNAs with specific sizes and dedicated functions have evolved. The major classes of small RNAs include microRNAs (miRNAs) and small interfering RNAs (siRNAs), which differ in their biogenesis. miRNAs are synthesized from a short hairpin structure while siRNAs are derived from long double-stranded RNAs (dsRNA). Both miRNA and siRNAs control the expression of cognate target RNAs by binding to reverse complementary sequences mediating cleavage or translational inhibition of the target RNA. They also act on the DNA and cause epigenetic changes such as DNA methylation and histone modifications. In the last years, the analysis of plant RNAi pathways was extended to the bryophyte Physcomitrella patens, a non-flowering, non-vascular ancient land plant that diverged from the lineage of seed plants approximately 450 million years ago. Based on a number of characteristic features and its phylogenetic key position in land plant evolution P. patens emerged as a plant model species to address basic as well as applied topics in plant biology. Here we summarize the current knowledge on the role of RNAi in P. patens that shows functional overlap with RNAi pathways from seed plants, and also unique features specific to this species. 2013 by the authors; licensee MDPI, Basel, Switzerland.

  5. Upregulation of Long Noncoding RNA Small Nucleolar RNA Host Gene 18 Promotes Radioresistance of Glioma by Repressing Semaphorin 5A

    Energy Technology Data Exchange (ETDEWEB)

    Zheng, Rong [Department of Radiation Oncology, Nanfang Hospital, Southern Medical University, Guangzhou, Guangdong (China); Department of Radiation Oncology, Fujian Medical University Union Hospital, Fuzhou, Fujian (China); Yao, Qiwei [Department of Radiation Oncology, Nanfang Hospital, Southern Medical University, Guangzhou, Guangdong (China); Department of Radiation Oncology, Teaching Hospital of Fujian Medical University, Fujian Provincial Cancer Hospital, Fuzhou, Fujian (China); Ren, Chen; Liu, Ying; Yang, Hongli; Xie, Guozhu; Du, Shasha [Department of Radiation Oncology, Nanfang Hospital, Southern Medical University, Guangzhou, Guangdong (China); Yang, Kaijun [Department of Neurosurgery, Nanfang Hospital, Southern Medical University, Guangzhou, Guangdong (China); Yuan, Yawei, E-mail: yuanyawei2015@outlook.com [Department of Radiation Oncology, Nanfang Hospital, Southern Medical University, Guangzhou, Guangdong (China); Department of Radiation Oncology, Cancer Hospital Center of Guangzhou Medical University, Guangzhou, Guangdong (China)

    2016-11-15

    Purpose: Although increasing evidence has shown that long noncoding RNAs play an important regulatory role in carcinogenesis and tumor progression, little is known about the role of small nucleolar RNA host gene 18 (SNHG18) in cancer. The goal of this study was to investigate the expression of SNHG18 and its clinical significance in glioma. Methods and Materials: Differences in the lncRNA expression profile between M059K and M059J cells were assessed by lncRNA expression microarray analysis. The expression and localization of SNHG18 in glioma cells or tissues was evaluated by quantitative reverse transcription-polymerase chain reaction (qRT-PCR) and in situ hybridization (ISH), respectively. the clinical associations of SNHG18 in glioma was evaluated by qRT-PCR, ISH and immunohistochemistry. The role of SNHG18 in glioma radiosensitivity was evaluated by colony formation assays, immunofluorescence, Western blot and tumor growth inhibition study. Results: The present study investigated the clinical associations of SNHG18 and its role in glioma. Our results showed that the expression of SNHG18 was remarkably upregulated in clinical glioma tissues compared with normal brain tissues. SNHG18 expression was associated with the clinical tumor grade and correlated negatively with isocitrate dehydrogenase 1 mutation. In addition, knockdown of SNHG18 with short hairpin RNA suppressed the radioresistance of glioma cells, and transgenic expression of SNHG18 had the opposite effect. Furthermore, xenograft tumors grown from cells with SNHG18 deletion were more radiosensitive than tumors grown from control cells. Further studies revealed that SNHG18 promotes radioresistance by inhibiting semaphorin 5A and that inhibition of semaphorin 5A expression abrogated the radiosensitizing effect caused by SNHG18 deletion. Conclusions: Our findings provide new insights into the role of SNHG18 in glioma and suggest its potential as a target for glioma therapy.

  6. Upregulation of Long Noncoding RNA Small Nucleolar RNA Host Gene 18 Promotes Radioresistance of Glioma by Repressing Semaphorin 5A

    International Nuclear Information System (INIS)

    Zheng, Rong; Yao, Qiwei; Ren, Chen; Liu, Ying; Yang, Hongli; Xie, Guozhu; Du, Shasha; Yang, Kaijun; Yuan, Yawei

    2016-01-01

    Purpose: Although increasing evidence has shown that long noncoding RNAs play an important regulatory role in carcinogenesis and tumor progression, little is known about the role of small nucleolar RNA host gene 18 (SNHG18) in cancer. The goal of this study was to investigate the expression of SNHG18 and its clinical significance in glioma. Methods and Materials: Differences in the lncRNA expression profile between M059K and M059J cells were assessed by lncRNA expression microarray analysis. The expression and localization of SNHG18 in glioma cells or tissues was evaluated by quantitative reverse transcription-polymerase chain reaction (qRT-PCR) and in situ hybridization (ISH), respectively. the clinical associations of SNHG18 in glioma was evaluated by qRT-PCR, ISH and immunohistochemistry. The role of SNHG18 in glioma radiosensitivity was evaluated by colony formation assays, immunofluorescence, Western blot and tumor growth inhibition study. Results: The present study investigated the clinical associations of SNHG18 and its role in glioma. Our results showed that the expression of SNHG18 was remarkably upregulated in clinical glioma tissues compared with normal brain tissues. SNHG18 expression was associated with the clinical tumor grade and correlated negatively with isocitrate dehydrogenase 1 mutation. In addition, knockdown of SNHG18 with short hairpin RNA suppressed the radioresistance of glioma cells, and transgenic expression of SNHG18 had the opposite effect. Furthermore, xenograft tumors grown from cells with SNHG18 deletion were more radiosensitive than tumors grown from control cells. Further studies revealed that SNHG18 promotes radioresistance by inhibiting semaphorin 5A and that inhibition of semaphorin 5A expression abrogated the radiosensitizing effect caused by SNHG18 deletion. Conclusions: Our findings provide new insights into the role of SNHG18 in glioma and suggest its potential as a target for glioma therapy.

  7. The Long Non-Coding RNA RHPN1-AS1 Promotes Uveal Melanoma Progression

    Directory of Open Access Journals (Sweden)

    Linna Lu

    2017-01-01

    Full Text Available Increasing evidence suggests that aberrant long non-coding RNAs (lncRNAs are significantly correlated with the pathogenesis, development and metastasis of cancers. RHPN1 antisense RNA 1 (RHPN1-AS1 is a 2030-bp transcript originating from human chromosome 8q24. However, the role of RHPN1-AS1 in uveal melanoma (UM remains to be clarified. In this study, we aimed to elucidate the molecular function of RHPN1-AS1 in UM. The RNA levels of RHPN1-AS1 in UM cell lines were examined using the quantitative real-time polymerase chain reaction (qRT-PCR. Short interfering RNAs (siRNAs were designed to quench RHPN1-AS1 expression, and UM cells stably expressing short hairpin (sh RHPN1-AS1 were established. Next, the cell proliferation and migration abilities were determined using a colony formation assay and a transwell migration/invasion assay. A tumor xenograft model in nude mice was established to confirm the function of RHPN1-AS1 in vivo. RHPN1-AS1 was significantly upregulated in a number of UM cell lines compared with the normal human retinal pigment epithelium (RPE cell line. RHPN1-AS1 knockdown significantly inhibited UM cell proliferation and migration in vitro and in vivo. Our data suggest that RHPN1-AS1 could be an oncoRNA in UM, which may serve as a candidate prognostic biomarker and target for new therapies in malignant UM.

  8. Inhibition of STAT-3 results in radiosensitization of human squamous cell carcinoma

    International Nuclear Information System (INIS)

    Bonner, James A.; Trummell, Hoa Q.; Willey, Christopher D.; Plants, Brian A.; Raisch, Kevin P.

    2009-01-01

    Background: Signal transducer and activator of transcription-3 (STAT-3) is a downstream component of the Epidermal Growth Factor Receptor (EGFr) signaling process that may facilitate the resistance of tumor cells to conventional cancer treatments. Studies were performed to determine if inhibition of this downstream protein produces radiosensitization. Methods/Results: A431 cells (human squamous cell carcinoma cells with EGFr overexpression) were found to be sensitized to radiation after treatment with STAT-3 small interfering RNA (siRNA). Therefore, a short hairpin RNA (shRNA) against STAT-3 was designed and cloned into a pBABE vector system modified for shRNA expression. Following transfection, clone 2.1 was selected for further study as it showed a dramatic reduction of STAT-3 protein (and mRNA) when compared to A431 parental cells or a negative control shRNA cell line (transfected with STAT-3 shRNA with 2 base pairs mutated). A431 2.1 showed doubling times of 25-31 h as compared to 18-24 h for the parental cell line. The A431 shRNA knockdown STAT-3 cells A431 were more sensitive to radiation than A431 parental or negative STAT-3 control cells. Conclusion: A431 cells stably transfected with shRNA against STAT-3 resulted in enhanced radiosensitivity. Further work will be necessary to determine whether the inhibition of STAT-3 phosphorylation is a necessary step for the radiosensitization that is induced by the inhibition of EGFr.

  9. Neuron-specific RNA interference using lentiviral vectors

    DEFF Research Database (Denmark)

    Nielsen, Troels Tolstrup; Marion, Ingrid van; Hasholt, Lis

    2009-01-01

    BACKGROUND: Viral vectors have been used in several different settings for the delivery of small hairpin (sh) RNAs. However, most vectors have utilized ubiquitously-expressing polymerase (pol) III promoters to drive expression of the hairpin as a result of the strict requirement for precise...... transcriptional initiation and termination. Recently, pol II promoters have been used to construct vectors for RNA interference (RNAi). By embedding the shRNA into a micro RNA-context (miRNA) the endogenous miRNA processing machinery is exploited to achieve the mature synthetic miRNA (smiRNA), thereby expanding...... the possible promoter choices and eventually allowing cell type specific down-regulation of target genes. METHODS: In the present study, we constructed lentiviral vectors expressing smiRNAs under the control of pol II promoters to knockdown gene expression in cell culture and in the brain. RESULTS: We...

  10. Stable RNA interference of ErbB-2 gene synergistic with epirubicin suppresses breast cancer growth in vitro and in vivo

    International Nuclear Information System (INIS)

    Hu Xiaoqu; Su Fengxi; Qin Li; Jia Weijuan; Gong Chang; Yu Fengyan; Guo Jujiang; Song Erwei

    2006-01-01

    Overexpression of human epidermal growth factor receptor-2 (Her2, ErbB-2) contributes to the progression and metastasis of breast cancer, implying that Her2 gene is a suitable target of RNA interference (RNAi) for breast cancer therapy. Here, we employed plasmid-mediated expression of 2 different Her2-shRNAs (pU6-Her2shRNAs) efficiently silenced the target gene expression on Her2 expressing SKBR-3 breast cancer cells in both mRNA and protein levels. Consequently, pU6-Her2shRNA increased apoptosis and reduced proliferation of SKBR-3 cells assayed by TUNEL and MTT, respectively. In vivo, intra-tumor injection of pU6-Her2shRNA inhibited the growth of SKBR-3 tumors inoculated subcutaneously in nude mice. Furthermore, pU6-Her2shRNA synergized the tumor suppression effect of epirubicin to SKBR-3 cells in vitro and implanted subcutaneously in nude mice. Therefore, we concluded that stable silencing of Her2 gene expression with plasmid expressing shRNA may hold great promise as a novel therapy for Her2 expressing breast cancers alone or in combination with anthracycline chemotherapy

  11. A large-scale RNA interference screen identifies genes that regulate autophagy at different stages.

    Science.gov (United States)

    Guo, Sujuan; Pridham, Kevin J; Virbasius, Ching-Man; He, Bin; Zhang, Liqing; Varmark, Hanne; Green, Michael R; Sheng, Zhi

    2018-02-12

    Dysregulated autophagy is central to the pathogenesis and therapeutic development of cancer. However, how autophagy is regulated in cancer is not well understood and genes that modulate cancer autophagy are not fully defined. To gain more insights into autophagy regulation in cancer, we performed a large-scale RNA interference screen in K562 human chronic myeloid leukemia cells using monodansylcadaverine staining, an autophagy-detecting approach equivalent to immunoblotting of the autophagy marker LC3B or fluorescence microscopy of GFP-LC3B. By coupling monodansylcadaverine staining with fluorescence-activated cell sorting, we successfully isolated autophagic K562 cells where we identified 336 short hairpin RNAs. After candidate validation using Cyto-ID fluorescence spectrophotometry, LC3B immunoblotting, and quantitative RT-PCR, 82 genes were identified as autophagy-regulating genes. 20 genes have been reported previously and the remaining 62 candidates are novel autophagy mediators. Bioinformatic analyses revealed that most candidate genes were involved in molecular pathways regulating autophagy, rather than directly participating in the autophagy process. Further autophagy flux assays revealed that 57 autophagy-regulating genes suppressed autophagy initiation, whereas 21 candidates promoted autophagy maturation. Our RNA interference screen identifies identified genes that regulate autophagy at different stages, which helps decode autophagy regulation in cancer and offers novel avenues to develop autophagy-related therapies for cancer.

  12. EWS Knockdown and Taxifolin Treatment Induced Differentiation and Removed DNA Methylation from p53 Promoter to Promote Expression of Puma and Noxa for Apoptosis in Ewing's Sarcoma.

    Science.gov (United States)

    Hossain, Mohammad Motarab; Ray, Swapan Kumar

    2014-10-01

    Ewing's sarcoma is a pediatric tumor that mainly occurs in soft tissues and bones. Malignant characteristics of Ewing's sarcoma are correlated with expression of EWS oncogene. We achieved knockdown of EWS expression using a plasmid vector encoding EWS short hairpin RNA (shRNA) to increase anti-tumor mechanisms of taxifolin (TFL), a new flavonoid, in human Ewing's sarcoma cells in culture and animal models. Immunofluorescence microscopy and flow cytometric analysis showed high expression of EWS in human Ewing's sarcoma SK-N-MC and RD-ES cell lines. EWS shRNA plus TFL inhibited 80% cell viability and caused the highest decreases in EWS expression at mRNA and protein levels in both cell lines. Knockdown of EWS expression induced morphological features of differentiation. EWS shRNA plus TFL caused more alterations in molecular markers of differentiation than either agent alone. EWS shRNA plus TFL caused the highest decreases in cell migration with inhibition of survival, angiogenic and invasive factors. Knockdown of EWS expression was associated with removal of DNA methylation from p53 promoter, promoting expression of p53, Puma, and Noxa. EWS shRNA plus TFL induced the highest amounts of apoptosis with activation of extrinsic and intrinsic pathways in both cell lines in culture. EWS shRNA plus TFL also inhibited growth of Ewing's sarcoma tumors in animal models due to inhibition of differentiation inhibitors and angiogenic and invasive factors and also induction of activation of caspase-3 for apoptosis. Collectively, knockdown of EWS expression increased various anti-tumor mechanisms of TFL in human Ewing's sarcoma in cell culture and animal models.

  13. Sustained miRNA-mediated knockdown of mutant AAT with simultaneous augmentation of wild-type AAT has minimal effect on global liver miRNA profiles.

    Science.gov (United States)

    Mueller, Christian; Tang, Qiushi; Gruntman, Alisha; Blomenkamp, Keith; Teckman, Jeffery; Song, Lina; Zamore, Phillip D; Flotte, Terence R

    2012-03-01

    α-1 antitrypsin (AAT) deficiency can exhibit two pathologic states: a lung disease that is primarily due to the loss of AAT's antiprotease function, and a liver disease resulting from a toxic gain-of-function of the PiZ-AAT (Z-AAT) mutant protein. We have developed several recombinant adeno-associated virus (rAAV) vectors that incorporate microRNA (miRNA) sequences targeting the AAT gene while also driving the expression of miRNA-resistant wild-type AAT-PiM (M-AAT) gene, thus achieving concomitant Z-AAT knockdown in the liver and increased expression of M-AAT. Transgenic mice expressing the human PiZ allele treated with dual-function rAAV9 vectors showed that serum PiZ was stably and persistently reduced by an average of 80%. Treated animals showed knockdown of Z-AAT in liver and serum with concomitant increased serum M-AAT as determined by allele-specific enzyme-linked immunosorbent assays (ELISAs). In addition, decreased globular accumulation of misfolded Z-AAT in hepatocytes and a reduction in inflammatory infiltrates in the liver was observed. Results from microarray studies demonstrate that endogenous miRNAs were minimally affected by this treatment. These data suggests that miRNA mediated knockdown does not saturate the miRNA pathway as has been seen with viral vector expression of short hairpin RNAs (shRNAs). This safe dual-therapy approach can be applied to other disorders such as amyotrophic lateral sclerosis, Huntington disease, cerebral ataxia, and optic atrophies.

  14. Characterization of the TRBP domain required for Dicer interaction and function in RNA interference

    Directory of Open Access Journals (Sweden)

    El Far Mohamed

    2009-05-01

    Full Text Available Abstract Background Dicer, Ago2 and TRBP are the minimum components of the human RNA-induced silencing complex (RISC. While Dicer and Ago2 are RNases, TRBP is the double-stranded RNA binding protein (dsRBP that loads small interfering RNA into the RISC. TRBP binds directly to Dicer through its C-terminal domain. Results We show that the TRBP binding site in Dicer is a 165 amino acid (aa region located between the ATPase and the helicase domains. The binding site in TRBP is a 69 aa domain, called C4, located at the C-terminal end of TRBP. The TRBP1 and TRBP2 isoforms, but not TRBPs lacking the C4 site (TRBPsΔC4, co-immunoprecipitated with Dicer. The C4 domain is therefore necessary to bind Dicer, irrespective of the presence of RNA. Immunofluorescence shows that while full-length TRBPs colocalize with Dicer, TRBPsΔC4 do not. tarbp2-/- cells, which do not express TRBP, do not support RNA interference (RNAi mediated by short hairpin or micro RNAs against EGFP. Both TRBPs, but not TRBPsΔC4, were able to rescue RNAi function. In human cells with low RNAi activity, addition of TRBP1 or 2, but not TRBPsΔC4, rescued RNAi function. Conclusion The mapping of the interaction sites between TRBP and Dicer show unique domains that are required for their binding. Since TRBPsΔC4 do not interact or colocalize with Dicer, we suggest that TRBP and Dicer, both dsRBPs, do not interact through bound dsRNA. TRBPs, but not TRBPsΔC4, rescue RNAi activity in RNAi-compromised cells, indicating that the binding of Dicer to TRBP is critical for RNAi function.

  15. New families of human regulatory RNA structures identified by comparative analysis of vertebrate genomes.

    Science.gov (United States)

    Parker, Brian J; Moltke, Ida; Roth, Adam; Washietl, Stefan; Wen, Jiayu; Kellis, Manolis; Breaker, Ronald; Pedersen, Jakob Skou

    2011-11-01

    Regulatory RNA structures are often members of families with multiple paralogous instances across the genome. Family members share functional and structural properties, which allow them to be studied as a whole, facilitating both bioinformatic and experimental characterization. We have developed a comparative method, EvoFam, for genome-wide identification of families of regulatory RNA structures, based on primary sequence and secondary structure similarity. We apply EvoFam to a 41-way genomic vertebrate alignment. Genome-wide, we identify 220 human, high-confidence families outside protein-coding regions comprising 725 individual structures, including 48 families with known structural RNA elements. Known families identified include both noncoding RNAs, e.g., miRNAs and the recently identified MALAT1/MEN β lincRNA family; and cis-regulatory structures, e.g., iron-responsive elements. We also identify tens of new families supported by strong evolutionary evidence and other statistical evidence, such as GO term enrichments. For some of these, detailed analysis has led to the formulation of specific functional hypotheses. Examples include two hypothesized auto-regulatory feedback mechanisms: one involving six long hairpins in the 3'-UTR of MAT2A, a key metabolic gene that produces the primary human methyl donor S-adenosylmethionine; the other involving a tRNA-like structure in the intron of the tRNA maturation gene POP1. We experimentally validate the predicted MAT2A structures. Finally, we identify potential new regulatory networks, including large families of short hairpins enriched in immunity-related genes, e.g., TNF, FOS, and CTLA4, which include known transcript destabilizing elements. Our findings exemplify the diversity of post-transcriptional regulation and provide a resource for further characterization of new regulatory mechanisms and families of noncoding RNAs.

  16. High-Throughput Silencing Using the CRISPR-Cas9 System: A Review of the Benefits and Challenges.

    Science.gov (United States)

    Wade, Mark

    2015-09-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)/Cas system has been seized upon with a fervor enjoyed previously by small interfering RNA (siRNA) and short hairpin RNA (shRNA) technologies and has enormous potential for high-throughput functional genomics studies. The decision to use this approach must be balanced with respect to adoption of existing platforms versus awaiting the development of more "mature" next-generation systems. Here, experience from siRNA and shRNA screening plays an important role, as issues such as targeting efficiency, pooling strategies, and off-target effects with those technologies are already framing debates in the CRISPR field. CRISPR/Cas can be exploited not only to knockout genes but also to up- or down-regulate gene transcription-in some cases in a multiplex fashion. This provides a powerful tool for studying the interaction among multiple signaling cascades in the same genetic background. Furthermore, the documented success of CRISPR/Cas-mediated gene correction (or the corollary, introduction of disease-specific mutations) provides proof of concept for the rapid generation of isogenic cell lines for high-throughput screening. In this review, the advantages and limitations of CRISPR/Cas are discussed and current and future applications are highlighted. It is envisaged that complementarities between CRISPR, siRNA, and shRNA will ensure that all three technologies remain critical to the success of future functional genomics projects. © 2015 Society for Laboratory Automation and Screening.

  17. Multifunctional PLGA Nanobubbles as Theranostic Agents: Combining Doxorubicin and P-gp siRNA Co-Delivery Into Human Breast Cancer Cells and Ultrasound Cellular Imaging.

    Science.gov (United States)

    Yang, Hong; Deng, Liwei; Li, Tingting; Shen, Xue; Yan, Jie; Zuo, Liangming; Wu, Chunhui; Liu, Yiyao

    2015-12-01

    Multidrug resistance (MDR) is a major impediment to the success of cancer chemotherapy. One of the effective approaches to overcome MDR is to use nanoparticle-mediated the gene silence of chemotherapeutic export proteins by RNA interference to increase drug accumulation in drug resistant cancer cells. In this work, a new co-delivery system, DOX-PLGA/PEI/P-gp shRNA nanobubbles (NBs) around 327 nm, to overcome doxorubicin (DOX) resistance in MCF-7 human breast cancer was designed and developed. Positively charged polyethylenimine (PEI) were modified onto the surface of DOX-PLGA NBs through DCC/NHS crosslinking, and could efficiently condense P-gp shRNA into DOX-PLGA/PEI NBs at vector/shRNA weight ratios of 70:1 and above. An in vitro release profile demonstrated an efficient DOX release (more than 80%) from DOX-PLGA/PEI NBs at pH 4.4, suggesting a pH-responsive drug release for the multifunctionalized NBs. Cellular experimental results further showed that DOX-PLGA/PEI/P-gp shRNA NBs could facilitate cellular uptake of DOX into cells and increase the cell proliferation suppression effect of DOX against MCF-7/ADR cells (a DOX-resistant and P-glycoprotein (P-gp) over-expression cancer cell line). The IC50 of DOX-PLGA NBs against MCF-7/ADR cells was 2-fold lower than that of free DOX. The increased cellular uptake and nuclear accumulation of DOX delivered by DOX-PLGA/PEI/P-gp shRNA NBs in MCF-7/ADR cells was confirmed by fluorescence microscopy and fluorescence spectrophotometry, and might be owning to the down-regulation of P-gp and reduced the efflux of DOX. The cellular uptake mechanism of DOX-PLGA/PEI/P-gp shRNA NBs indicated that the macropinocytosis was one of the pathways for the uptake of NBs by MCF-7/ADR cells, which was also an energy-dependent process. Furthermore, the in vitro cellular ultrasound imaging suggested that the employment of the DOX-PLGA/PEI/P-gp shRNA NBs could efficiently enhance ultrasound imaging of cancer cells. These results demonstrated

  18. Knockdown of E2f1 by RNA interference impairs proliferation of rat cells in vitro

    Directory of Open Access Journals (Sweden)

    Luciana dos Reis Vasques

    2010-01-01

    Full Text Available E2F1 plays a key role in cell-cycle regulation in mammals, since its transcription factor activity controls genes required for DNA synthesis and apoptosis. E2F1 deregulation is a common feature among different tumor types and can be a major cause of cell proliferation. Thus, blocking E2F1 expression by RNA interference represents a promising therapeutic approach. In this study, the introduction of specific short hairpin RNAs (shRNAs reduced E2f1 expression by up to 77%, and impaired rat glioma cell proliferation by approximately 70%, as compared to control cells. Furthermore, we investigated the expression of E2f1 target genes, Cyclin A and Cyclin E. Cyclin A was found to be down-regulated, whereas Cyclin E had similar expression to control cells, indicating that gene(s other than E2f1 control its transcription. Other E2f family members, E2f2 and E2f3, which have been classified in the same subgroup of transcriptional activators, were also analyzed. Expression of both E2f2 and E2f3 was similar to control cells, showing no cross-inactivation or up-regulation to compensate for the absence of E2f1. Nevertheless, their expression was insufficient to maintain the initial proliferation potential. Taken together, our results suggest that shE2f1 is a promising therapy to control tumor cell proliferation.

  19. Knock down of the myostatin gene by RNA interference increased body weight in chicken.

    Science.gov (United States)

    Bhattacharya, T K; Shukla, R; Chatterjee, R N; Dushyanth, K

    2017-01-10

    Myostatin is a negative regulator of muscular growth in poultry and other animals. Of several approaches, knocking down the negative regulator is an important aspect to augment muscular growth in chicken. Knock down of myostatin gene has been performed by shRNA acting against the expression of gene in animals. Two methods of knock down of gene in chicken such as embryo manipulation and sperm mediated method have been performed. The hatching percentage in embryo manipulation and sperm mediated method of knock down was 58.0 and 41.5%, respectively. The shRNA in knock down chicken enhanced body weight at 6 weeks by 26.9%. The dressing percentage and serum biochemical parameters such as SGPT and alkaline phosphatase differed significantly (Pknock down and control birds. It is concluded that knocking down the myostatin gene successfully augmented growth in chicken. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Serum long non coding RNA MALAT-1 protected by exosomes is up-regulated and promotes cell proliferation and migration in non-small cell lung cancer.

    Science.gov (United States)

    Zhang, Rui; Xia, Yuhong; Wang, Zhixin; Zheng, Jie; Chen, Yafei; Li, Xiaoli; Wang, Yu; Ming, Huaikun

    2017-08-19

    Circulating lncRNAs have been defined as a novel biomarker for non-small cell lung cancer (NSCLC), MALAT-1 was first identified lncRNA that was related to lung cancer metastasis. However, the relationship between exosomal lncRNAs and the diagnosis and prognosis of NSCLC was poorly understood. The aim of this study is to evaluate the clinical significance of serum exosomal MALAT-1 as a biomarker in the metastasis of NSCLC. In this study, we firstly isolated the exosomes from healthy subjects and NSCLC patients. Then we measured the expression levels of MALAT-1 contained in exosomes, and found that exosomal MALAT-1 was highly expressed in NSCLC patients, more importantly, the levels of exosomal MALAT-1 were positively associated with tumor stage and lymphatic metastasis. In addition, we decreased MALAT-1 expression by short hairpin RNA and conducted a series of assays including MTT, cell cycle, colony formation, wound-healing scratch and Annexin/V PI by flow cytometry in human lung cancer cell lines. These in vitro studies demonstrated that serum exosome-derived long noncoding RNA MALAT-1 promoted the tumor growth and migration, and prevented tumor cells from apoptosis in lung cancer cell lines. Taken together, this study shed a light on utilizing MALAT-1 in exosomes as a non-invasive serum-based tumor biomarker for diagnosis and prognosis of NSCLC. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Blocking hepatic metastases of colon cancer cells using an shRNA against Rac1 delivered by activatable cell-penetrating peptide.

    Science.gov (United States)

    Bao, Ying; Guo, Huihui; Lu, Yongliang; Feng, Wenming; Sun, Xinrong; Tang, Chengwu; Wang, Xiang; Shen, Mo

    2016-11-22

    Hepatic metastasis is one of the critical progressions of colon cancer. Blocking this process is key to prolonging survival time in cancer patients. Studies on activatable cell-penetrating peptides (dtACPPs) have demonstrated their potential as gene carriers. It showed high tumor cell-targeting specificity and transfection efficiency and low cytotoxicity in the in vitro settings of drug delivery. However, using this system to silence target genes to inhibit metastasis in colorectal cancer cells has not been widely reported and requires further investigation. In this study, we observed that expression of Rac1, a key molecule for cytoskeletal reorganization, was higher in hepatic metastatic tumor tissue compared with prime colon cancer tissue and that patients with high Rac1-expressing colon cancer showed shorter survival time. Base on these findings, we created dtACPP-PEG-DGL (dtACPPD)/shRac1 nanoparticles and demonstrated that they downregulated Rac1 expression in colon cancer cells. Moreover, we observed inhibitory effects on migration, invasion and adhesion in HCT116 colorectal cancer cells in vitro, and our results showed that Rac1 regulated colon cancer cell matrix adhesion through the regulation of cytofilament dynamics. Moreover, mechanically, repression of Rac1 inhibiting cells migration and invasion by enhancing cell to cell adhesion and reducing cell to extracellular matrix adhesion. Furthermore, when atCDPPD/shRac1 nanoparticles were administered intravenously to a HCT116 xenograft model, significant tumor metastasis to the liver was inhibited. Our results suggest that atCDPP/shRac1 nanoparticles may enable the blockade of hepatic metastasis in colon cancer.

  2. Gene Electrotransfer of Plasmid with Tissue Specific Promoter Encoding shRNA against Endoglin Exerts Antitumor Efficacy against Murine TS/A Tumors by Vascular Targeted Effects.

    Directory of Open Access Journals (Sweden)

    Monika Stimac

    Full Text Available Vascular targeted therapies, targeting specific endothelial cell markers, are promising approaches for the treatment of cancer. One of the targets is endoglin, transforming growth factor-β (TGF-β co-receptor, which mediates proliferation, differentiation and migration of endothelial cells forming neovasculature. However, its specific, safe and long-lasting targeting remains the challenge. Therefore, in our study we evaluated the transfection efficacy, vascular targeted effects and therapeutic potential of the plasmid silencing endoglin with the tissue specific promoter, specific for endothelial cells marker endothelin-1 (ET (TS plasmid, in comparison to the plasmid with constitutive promoter (CON plasmid, in vitro and in vivo. Tissue specificity of TS plasmid was demonstrated in vitro on several cell lines, and its antiangiogenic efficacy was demonstrated by reducing tube formation of 2H11 endothelial cells. In vivo, on a murine mammary TS/A tumor model, we demonstrated good antitumor effect of gene electrotransfer (GET of either of both plasmids in treatment of smaller tumors still in avascular phase of growth, as well as on bigger tumors, already well vascularized. In support to the observations on predominantly vascular targeted effects of endoglin, histological analysis has demonstrated an increase in necrosis and a decrease in the number of blood vessels in therapeutic groups. A significant antitumor effect was observed in tumors in avascular and vascular phase of growth, possibly due to both, the antiangiogenic and the vascular disrupting effect. Furthermore, the study indicates on the potential use of TS plasmid in cancer gene therapy since the same efficacy as of CON plasmid was determined.

  3. Gene Electrotransfer of Plasmid with Tissue Specific Promoter Encoding shRNA against Endoglin Exerts Antitumor Efficacy against Murine TS/A Tumors by Vascular Targeted Effects.

    Science.gov (United States)

    Stimac, Monika; Dolinsek, Tanja; Lampreht, Ursa; Cemazar, Maja; Sersa, Gregor

    2015-01-01

    Vascular targeted therapies, targeting specific endothelial cell markers, are promising approaches for the treatment of cancer. One of the targets is endoglin, transforming growth factor-β (TGF-β) co-receptor, which mediates proliferation, differentiation and migration of endothelial cells forming neovasculature. However, its specific, safe and long-lasting targeting remains the challenge. Therefore, in our study we evaluated the transfection efficacy, vascular targeted effects and therapeutic potential of the plasmid silencing endoglin with the tissue specific promoter, specific for endothelial cells marker endothelin-1 (ET) (TS plasmid), in comparison to the plasmid with constitutive promoter (CON plasmid), in vitro and in vivo. Tissue specificity of TS plasmid was demonstrated in vitro on several cell lines, and its antiangiogenic efficacy was demonstrated by reducing tube formation of 2H11 endothelial cells. In vivo, on a murine mammary TS/A tumor model, we demonstrated good antitumor effect of gene electrotransfer (GET) of either of both plasmids in treatment of smaller tumors still in avascular phase of growth, as well as on bigger tumors, already well vascularized. In support to the observations on predominantly vascular targeted effects of endoglin, histological analysis has demonstrated an increase in necrosis and a decrease in the number of blood vessels in therapeutic groups. A significant antitumor effect was observed in tumors in avascular and vascular phase of growth, possibly due to both, the antiangiogenic and the vascular disrupting effect. Furthermore, the study indicates on the potential use of TS plasmid in cancer gene therapy since the same efficacy as of CON plasmid was determined.

  4. Short-term cytotoxic effects and long-term instability of RNAi delivered using lentiviral vectors

    Directory of Open Access Journals (Sweden)

    Kruithof Egbert KO

    2004-08-01

    Full Text Available Abstract Background RNA interference (RNAi can potently reduce target gene expression in mammalian cells and is in wide use for loss-of-function studies. Several recent reports have demonstrated that short double-stranded RNAs (dsRNAs, used to mediate RNAi, can also induce an interferon-based response resulting in changes in the expression of many interferon-responsive genes. Off-target gene silencing has also been described, bringing into question the validity of certain RNAi-based approaches for studying gene function. We have targeted the plasminogen activator inhibitor-2 (PAI-2 or SERPINB2 mRNA using lentiviral vectors for delivery of U6 promoter-driven PAI-2-targeted short hairpin RNA (shRNA expression. PAI-2 is reported to have anti-apoptotic activity, thus reduction of endogenous expression may be expected to make cells more sensitive to programmed cell death. Results As expected, we encountered a cytotoxic phenotype when targeting the PAI-2 mRNA with vector-derived shRNA. However, this predicted phenotype was a potent non-specific effect of shRNA expression, as functional overexpression of the target protein failed to rescue the phenotype. By decreasing the shRNA length or modifying its sequence we maintained PAI-2 silencing and reduced, but did not eliminate, cytotoxicity. ShRNA of 21 complementary nucleotides (21 mers or more increased expression of the oligoadenylate synthase-1 (OAS1 interferon-responsive gene. 19 mer shRNA had no effect on OAS1 expression but long-term selective pressure on cell growth was observed. By lowering lentiviral vector titre we were able to reduce both expression of shRNA and induction of OAS1, without a major impact on the efficacy of gene silencing. Conclusions Our data demonstrate a rapid cytotoxic effect of shRNAs expressed in human tumor cell lines. There appears to be a cut-off of 21 complementary nucleotides below which there is no interferon response while target gene silencing is maintained

  5. Cooperation of decay-accelerating factor and membrane cofactor protein in regulating survival of human cervical cancer cells

    International Nuclear Information System (INIS)

    Gao, Ling-Juan; Guo, Shu-Yu; Cai, You-Qun; Gu, Ping-Qing; Su, Ya-Juan; Gong, Hui; Liu, Yun; Chen, Chen

    2009-01-01

    Decay-accelerating factor (DAF) and membrane cofactor protein (MCP) are the key molecules involved in cell protection against autologus complement, which restricts the action of complement at critical stages of the cascade reaction. The cooperative effect of DAF and MCP on the survival of human cervical cancer cell (ME180) has not been demonstrated. In this study we applied, for the first time, short hairpin RNA (shRNA) to knock down the expression of the DAF and MCP with the aim of exploiting complement more effectively for tumor cell damage. Meanwhile, we investigated the cooperative effects of DAF and MCP on the viability and migration, moreover the proliferation of ME180 cell. The results showed that shRNA inhibition of DAF and MCP expression enhanced complement-dependent cytolysis (CDC) up to 39% for MCP and up to 36% for DAF, and the combined inhibition of both regulators yielded further additive effects in ME180 cells. Thus, the activities of DAF and MCP, when present together, are greater than the sum of the two protein individually. These data indicated that combined DAF and MCP shRNA described in this study may offer an additional alternative to improve the efficacy of antibody-and complement-based cancer immunotherapy

  6. Implication of p53-dependent cellular senescence related gene, TARSH in tumor suppression

    International Nuclear Information System (INIS)

    Wakoh, Takeshi; Uekawa, Natsuko; Terauchi, Kunihiko; Sugimoto, Masataka; Ishigami, Akihito; Shimada, Jun-ichi; Maruyama, Mitsuo

    2009-01-01

    A novel target of NESH-SH3 (TARSH) was identified as a cellular senescence related gene in mouse embryonic fibroblasts (MEFs) replicative senescence, the expression of which has been suppressed in primary clinical lung cancer specimens. However, the molecular mechanism underlying the regulation of TARSH involved in pulmonary tumorigenesis remains unclear. Here we demonstrate that the reduction of TARSH gene expression by short hairpin RNA (shRNA) system robustly inhibited the MEFs proliferation with increase in senescence-associated β-galactosidase (SA-β-gal) activity. Using p53 -/- MEFs, we further suggest that this growth arrest by loss of TARSH is evoked by p53-dependent p21 Cip1 accumulation. Moreover, we also reveal that TARSH reduction induces multicentrosome in MEFs, which is linked in chromosome instability and tumor development. These results suggest that TARSH plays an important role in proliferation of replicative senescence and may serve as a trigger of tumor development.

  7. RNA Crystallization

    Science.gov (United States)

    Golden, Barbara L.; Kundrot, Craig E.

    2003-01-01

    RNA molecules may be crystallized using variations of the methods developed for protein crystallography. As the technology has become available to syntheisize and purify RNA molecules in the quantities and with the quality that is required for crystallography, the field of RNA structure has exploded. The first consideration when crystallizing an RNA is the sequence, which may be varied in a rational way to enhance crystallizability or prevent formation of alternate structures. Once a sequence has been designed, the RNA may be synthesized chemically by solid-state synthesis, or it may be produced enzymatically using RNA polymerase and an appropriate DNA template. Purification of milligram quantities of RNA can be accomplished by HPLC or gel electrophoresis. As with proteins, crystallization of RNA is usually accomplished by vapor diffusion techniques. There are several considerations that are either unique to RNA crystallization or more important for RNA crystallization. Techniques for design, synthesis, purification, and crystallization of RNAs will be reviewed here.

  8. Expression of the proto-oncogene Pokemon in colorectal cancer--inhibitory effects of an siRNA.

    Science.gov (United States)

    Zhao, Gan-Ting; Yang, Li-Juan; Li, Xi-Xia; Cui, Hui-Lin; Guo, Rui

    2013-01-01

    This study aimed to investigate expression of the proto-oncogene POK erythroid myeloid ontogenic factor (Pokemon) in colorectal cancer (CRC), and assess inhibitory effects of a small interference RNA (siRNA) expression vector in SW480 and SW620 cells. Semi-quantitative reverse transcription-polymerase chain reaction (PCR) and immunohistochemistry were performed to determine mRNA and protein expression levels of Pokemon in CRC tissues. Indirect immunofluorescence staining was applied to investigate the location of Pokemon in SW480 and SW620 cells. The siRNA expression vectors that were constructed to express a short hairpin RNA against Pokemon were transfected to the SW480 and SW620 cells with a liposome. Expression levels of Pokemon mRNA and protein were examined by real-time quantitative-fluorescent PCR and western blot analysis. The effects of Pokemon silencing on proliferation of SW480 and SW620 cells were evaluated with reference to growth curves with MTT assays. The mRNA expression level of Pokemon in tumor tissues (0.845 ± 0.344) was significantly higher than that in adjacent tumor specimens (0.321 ± 0.197). The positive expression ratio of Pokemon protein in CRC (87.0%) was significantly higher than that in the adjacent tissues (19.6%). Strong fluorescence staining of Pokemon protein was observed in the cytoplasm of the SW480 and SW620 cells. The inhibition ratios of Pokemon mRNA and protein in the SW480 cells were 83.1% and 73.5% at 48 and 72 h, respectively, compared with those of the negative control cells with the siRNA. In the SW620 cells, the inhibition ratios of Pokemon mRNA and protein were 76.3% and 68.7% at 48 and 72 h, respectively. MTT showed that Pokemon gene silencing inhibited the proliferation of SW480 and SW620 cells. Overexpression of Pokemon in CRC may have a function in carcinogenesis and progression. siRNA expression vectors could effectively inhibit mRNA and protein expression of Pokemon in SW480 and SW620 cells, thereby reducing

  9. Chronic Cardiac-Targeted RNA Interference for the Treatment of Heart Failure Restores Cardiac Function and Reduces Pathological Hypertrophy

    Science.gov (United States)

    Suckau, Lennart; Fechner, Henry; Chemaly, Elie; Krohn, Stefanie; Hadri, Lahouaria; Kockskämper, Jens; Westermann, Dirk; Bisping, Egbert; Ly, Hung; Wang, Xiaomin; Kawase, Yoshiaki; Chen, Jiqiu; Liang, Lifan; Sipo, Isaac; Vetter, Roland; Weger, Stefan; Kurreck, Jens; Erdmann, Volker; Tschope, Carsten; Pieske, Burkert; Lebeche, Djamel; Schultheiss, Heinz-Peter; Hajjar, Roger J.; Poller, Wolfgang Ch.

    2009-01-01

    Background RNA interference (RNAi) has the potential to be a novel therapeutic strategy in diverse areas of medicine. We report on targeted RNAi for the treatment of heart failure (HF), an important disorder in humans resulting from multiple etiologies. Successful treatment of HF is demonstrated in a rat model of transaortic banding by RNAi targeting of phospholamban (PLB), a key regulator of cardiac Ca2+ homeostasis. Whereas gene therapy rests on recombinant protein expression as its basic principle, RNAi therapy employs regulatory RNAs to achieve its effect. Methods and Results We describe structural requirements to obtain high RNAi activity from adenoviral (AdV) and adeno-associated virus (AAV9) vectors and show that an AdV short hairpin RNA vector (AdV-shRNA) silenced PLB in cardiomyocytes (NRCMs) and improved hemodynamics in HF rats 1 month after aortic root injection. For simplified long-term therapy we developed a dimeric cardiotropic AAV vector (rAAV9-shPLB) delivering RNAi activity to the heart via intravenous injection. Cardiac PLB protein was reduced to 25% and SERCA2a suppression in the HF groups was rescued. In contrast to traditional vectors rAAV9 shows high affinity for myocardium, but low affinity for liver and other organs. rAAV9-shPLB therapy restored diastolic (LVEDP, dp/dtmin, Tau) and systolic (fractional shortening) functional parameters to normal range. The massive cardiac dilation was normalized and the cardiac hypertrophy, cardiomyocyte diameter and cardiac fibrosis significantly reduced. Importantly, there was no evidence of microRNA deregulation or hepatotoxicity during these RNAi therapies. Conclusion Our data show, for the first time, high efficacy of an RNAi therapeutic strategy in a cardiac disease. PMID:19237664

  10. SETD1A modulates cell cycle progression through a miRNA network that regulates p53 target genes

    OpenAIRE

    Tajima, Ken; Yae, Toshifumi; Javaid, Sarah; Tam, Oliver; Comaills, Valentine; Morris, Robert; Wittner, Ben S.; Liu, Mingzhu; Engstrom, Amanda; Takahashi, Fumiyuki; Black, Joshua C.; Ramaswamy, Sridhar; Shioda, Toshihiro; Hammell, Molly; Haber, Daniel A.

    2015-01-01

    Expression of the p53-inducible antiproliferative gene BTG2 is suppressed in many cancers in the absence of inactivating gene mutations, suggesting alternative mechanisms of silencing. Using a shRNA screen targeting 43 histone lysine methyltransferases (KMTs), we show that SETD1A suppresses BTG2 expression through its induction of several BTG2-targeting miRNAs. This indirect but highly specific mechanism, by which a chromatin regulator that mediates transcriptional activating marks can lead t...

  11. RNA Origami

    DEFF Research Database (Denmark)

    Sparvath, Steffen Lynge

    introducerede vores gruppe den enkeltstrengede RNA-origami metode, der giver mulighed for cotranscriptional foldning af veldefinerede nanostrukturer, og er en central del af arbejdet præsenteret heri. Denne ph.d.-afhandling udforsker potentielle anvendelser af RNA-origami nanostrukturer, som nanomedicin eller...... biosensorer. Afhandlingen består af en introduktion til RNA-nanoteknologi feltet, en introduktion af enkeltstrenget RNA-origami design, og fire studier, der beskriver design, produktion og karakterisering af både strukturelle og funktionelle RNA-origamier. Flere RNA-origami designs er blevet undersøgt, og...... projekterne, der indgår i denne afhandling, inkluderer de nyeste fremskridt indenfor strukturel RNA-nanoteknologi og udvikling af funktionelle RNA-baserede enheder. Det første studie beskriver konstruktion og karakterisering af en enkeltstrenget 6-helix RNA-origami stuktur, som er den første demonstration af...

  12. The role of integrin-α5 in the proliferation and odontogenic differentiation of human dental pulp stem cells.

    Science.gov (United States)

    Cui, Li; Xu, Shuaimei; Ma, Dandan; Gao, Jie; Liu, Ying; Yue, Jing; Wu, Buling

    2014-02-01

    It has been reported that integrin-α5 (ITGA5) activity is related to cell proliferation, differentiation, migration, and organ development. However, the involvement of ITGA5 in the biological functions of human dental pulp stem cells (hDPSCs) has not been explored. The aim of this study was to investigate the role of ITGA5 in the proliferation and odontogenic differentiation of hDPSCs. We knocked down ITGA5 in hDPSCs using lentivirus-mediated ITGA5 short hairpin RNA (shRNA). Changes in the proliferation in hDPSCs infected with lentiviruses expressing ITGA5-specific shRNA or negative control shRNA were examined using the 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay and 5-ethynyl-2'-deoxyuridine labeling. Both ITGA5 knockdown cells and shMock cells were cultured in mineralization medium for 3 weeks, and the differentiation of cells was detected with alizarin red S staining. The expression of odontogenic differentiation-related molecular markers was assessed using real-time polymerase chain reaction and Western blot assays. The knockdown of ITGA5 decreased the proliferation capacity of hDPSCs. ITGA5 shRNA promoted odontogenic differentiation of hDPSCs with the enhanced formation of mineralized nodules. It also up-regulated the messenger RNA expression of multiple markers of odontogenesis and the expression of dentin sialophosphoprotein protein. These findings suggest that ITGA5 plays an important role in maintaining hDPSCs in a proliferative state. The inhibition of ITGA5 signaling promotes the odontogenic differentiation of hDPSCs. Copyright © 2014 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  13. Production of cloned pigs with targeted attenuation of gene expression.

    Directory of Open Access Journals (Sweden)

    Vilceu Bordignon

    Full Text Available The objective of this study was to demonstrate that RNA interference (RNAi and somatic cell nuclear transfer (SCNT technologies can be used to attenuate the expression of specific genes in tissues of swine, a large animal species. Apolipoprotein E (apoE, a secreted glycoprotein known for its major role in lipid and lipoprotein metabolism and transport, was selected as the target gene for this study. Three synthetic small interfering RNAs (siRNA targeting the porcine apoE mRNA were tested in porcine granulosa cells in primary culture and reduced apoE mRNA abundance ranging from 45-82% compared to control cells. The most effective sequence was selected for cloning into a short hairpin RNA (shRNA expression vector under the control of RNA polymerase III (U6 promoter. Stably transfected fetal porcine fibroblast cells were generated and used to produce embryos with in vitro matured porcine oocytes, which were then transferred into the uterus of surrogate gilts. Seven live and one stillborn piglet were born from three gilts that became pregnant. Integration of the shRNA expression vector into the genome of clone piglets was confirmed by PCR and expression of the GFP transgene linked to the expression vector. Analysis showed that apoE protein levels in the liver and plasma of the clone pigs bearing the shRNA expression vector targeting the apoE mRNA was significantly reduced compared to control pigs cloned from non-transfected fibroblasts of the same cell line. These results demonstrate the feasibility of applying RNAi and SCNT technologies for introducing stable genetic modifications in somatic cells for eventual attenuation of gene expression in vivo in large animal species.

  14. HIV-1 resistance conferred by siRNA cosuppression of CXCR4 and CCR5 coreceptors by a bispecific lentiviral vector

    Directory of Open Access Journals (Sweden)

    Akkina Ramesh

    2005-01-01

    Full Text Available Abstract Background RNA interference (RNAi mediated by small interfering RNAs (siRNAs has proved to be a highly effective gene silencing mechanism with great potential for HIV/AIDS gene therapy. Previous work with siRNAs against cellular coreceptors CXCR4 and CCR5 had shown that down regulation of these surface molecules could prevent HIV-1 entry and confer viral resistance. Since monospecific siRNAs targeting individual coreceptors are inadequate in protecting against both T cell tropic (X4 and monocyte tropic (R5 viral strains simultaneously, bispecific constructs with dual specificity are required. For effective long range therapy, the bispecific constructs need to be stably transduced into HIV-1 target cells via integrating viral vectors. Results To achieve this goal, lentiviral vectors incorporating both CXCR4 and CCR5 siRNAs of short hairpin design were constructed. The CXCR4 siRNA was driven by a U6 promoter whereas the CCR5 siRNA was driven by an H1 promoter. A CMV promoter driven EGFP reporter gene is also incorporated in the bispecific construct. High efficiency transduction into coreceptor expressing Magi and Ghost cell lines with a concomitant down regulation of respective coreceptors was achieved with lentiviral vectors. When the siRNA expressing transduced cells were challenged with X4 and R5 tropic HIV-1, they demonstrated marked viral resistance. HIV-1 resistance was also observed in bispecific lentiviral vector transduced primary PBMCs. Conclusions Both CXCR4 and CCR5 coreceptors could be simultaneously targeted for down regulation by a single combinatorial lentiviral vector incorporating respective anti-coreceptor siRNAs. Stable down regulation of both the coreceptors protects cells against infection by both X4 and R5 tropic HIV-1. Stable down regulation of cellular molecules that aid in HIV-1 infection will be an effective strategy for long range HIV gene therapy.

  15. Suppression of the expression of hypoxia-inducible factor-1α by RNA interference alleviates hypoxia-induced pulmonary hypertension in adult rats.

    Science.gov (United States)

    Li, Ying; Shi, Bo; Huang, Liping; Wang, Xin; Yu, Xiaona; Guo, Baosheng; Ren, Weidong

    2016-12-01

    Hypoxia-inducible factor-1α (HIF-1α) has been implicated in the pathogenesis of hypoxic pulmonary hypertension (PH). However, the potential clinical value of HIF-1α as a therapeutic target in the treatment of PH has not yet been evaluated. In this study, an animal model of hypoxia-induced PH was established by exposing adult rats to 10% O2 for 3 weeks, and the effects of the lentivirus-mediated delivery of HIF-1α short hairpin RNA (shRNA) by intratracheal instillation prior to exposure to hypoxia on the manifestations of hypoxia-induced PH were assessed. The successful delivery of HIF-1α shRNA into the pulmonary arteries effectively suppressed the hypoxia-induced upregulation of HIF-1α, accompanied by the prominent attenuation the symptoms associated with hypoxia-induced PH, including the elevation of pulmonary arterial pressure, hypertrophy and hyperplasia of pulmonary artery smooth muscle cells (PASMCs), as well as the muscularization of pulmonary arterioles. In addition, the knockdown of HIF-1α in cultured rat primary PASMCs significantly inhibited the hypoxia-induced acceleration of the cell cycle and the proliferation of the PASMCs, suggesting that HIF-1α may be a direct mediator of PASMC hyperplasia in hypoxia-induced PH. In conclusion, this study demonstrates the potent suppressive effects of HIF-1α shRNA on hypoxia-induced PH and PASMC hyperplasia, providing evidence for the potential application of HIF-1α shRNA in the treatment of hypoxic PH.

  16. Expression of a single siRNA against a conserved region of NP gene strongly inhibits in vitro replication of different Influenza A virus strains of avian and swine origin.

    Science.gov (United States)

    Stoppani, Elena; Bassi, Ivan; Dotti, Silvia; Lizier, Michela; Ferrari, Maura; Lucchini, Franco

    2015-08-01

    Influenza A virus is the principal agent responsible of the respiratory tract's infections in humans. Every year, highly pathogenic and infectious strains with new antigenic assets appear, making ineffective vaccines so far developed. The discovery of RNA interference (RNAi) opened the way to the progress of new promising drugs against Influenza A virus and also to the introduction of disease resistance traits in genetically modified animals. In this paper, we show that Madin-Darby Canine Kidney (MDCK) cell line expressing short hairpin RNAs (shRNAs) cassette, designed on a specific conserved region of the nucleoprotein (NP) viral genome, can strongly inhibit the viral replication of four viral strains sharing the target sequence, reducing the viral mRNA respectively to 2.5×10(-4), 7.5×10(-5), 1.7×10(-3), 1.9×10(-4) compared to the control, as assessed by real-time PCR. Moreover, we demonstrate that during the challenge with a viral strain bearing a single mismatch on the target sequence, although a weaker inhibition is observed, viral mRNA is still lowered down to 1.2×10(-3) folds in the shRNA-expressing clone compared to the control, indicating a broad potential use of this approach. In addition, we developed a highly predictive and fast screening test of siRNA sequences based on dual-luciferase assay, useful for the in vitro prediction of the potential effect of viral inhibition. In conclusion, these findings reveal new siRNA sequences able to inhibit Influenza A virus replication and provide a basis for the development of siRNAs as prophylaxis and therapy for influenza infection both in humans and animals. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Enhancement of antiproliferative activity of interferons by RNA interference-mediated silencing of SOCS gene expression in tumor cells.

    Science.gov (United States)

    Takahashi, Yuki; Kaneda, Haruka; Takasuka, Nana; Hattori, Kayoko; Nishikawa, Makiya; Watanabe, Yoshihiko; Takakura, Yoshinobu

    2008-08-01

    The suppressor of cytokine signaling (SOCS) proteins, negative regulators of interferon (IFN)-induced signaling pathways, is involved in IFN resistance of tumor cells. To improve the growth inhibitory effect of IFN-beta and IFN-gamma on a murine melanoma cell line, B16-BL6, and a murine colon carcinoma cell line, Colon26 cells, SOCS-1 and SOCS-3 gene expression in tumor cells was downregulated by transfection of plasmid DNA expressing short hairpin RNA targeting one of these genes (pshSOCS-1 and pshSOCS-3, respectively). Transfection of pshSOCS-1 significantly increased the antiproliferative effect of IFN-gamma on B16-BL6 cells. However, any other combinations of plasmids and IFN had little effect on the growth of B16-BL6 cells. In addition, transfection of pshSOCS-1 and pshSOCS-3 produced little improvement in the effect of IFN on Colon26 cells. To understand the mechanism underlining these findings, the level of SOCS gene expression was measured by real time polymerase chain reaction. Addition of IFN-gamma greatly increased the SOCS-1 mRNA expression in B16-BL6 cells. Taking into account the synergistic effect of pshSOCS-1 and IFN-gamma on the growth of B16-BL6 cells, these findings suggest that IFN-gamma-induced high SOCS-1 gene expression in B16-BL6 cells significantly interferes with the antiproliferative effect of IFN-gamma. These results indicate that silencing SOCS gene expression can be an effective strategy to enhance the antitumor effect of IFN under conditions in which the SOCS gene expression is upregulated by IFN.

  18. Lentiviral-mediated RNAi targeting caspase-3 inhibits apoptosis induced by serum deprivation in rat endplate chondrocytes in vitro

    International Nuclear Information System (INIS)

    Ding, L.; Wu, J.P.; Xu, G.; Zhu, B.; Zeng, Q.M.; Li, D.F.; Lu, W.

    2014-01-01

    Current studies find that degenerated cartilage endplates (CEP) of vertebrae, with fewer diffusion areas, decrease nutrient supply and accelerate intervertebral disc degeneration. Many more apoptotic cells have been identified in degenerated than in normal endplates, and may be responsible for the degenerated grade. Previous findings suggest that inhibition of apoptosis is one possible approach to improve disc regeneration. It is postulated that inhibition of CEP cell apoptosis may be responsible for the regeneration of endplates. Caspase-3, involved in the execution phase of apoptosis, is a candidate for regulating the apoptotic process. In the present study, CEP cells were incubated in 1% fetal bovine serum. Activated caspases were detected to identify the apoptotic pathway, and apoptosis was quantified by flow cytometry. Lentiviral caspase-3 short hairpin RNA (shRNA) was employed to study its protective effects against serum deprivation. Silencing of caspase-3 expression was quantified by reverse transcription-polymerase chain reaction and Western blots, and inhibition of apoptosis was quantified by flow cytometry. Serum deprivation increased apoptosis of rat CEP cells through activation of a caspase cascade. Lentiviral caspase-3 shRNA was successfully transduced into CEP cells, and specifically silenced endogenous caspase-3 expression. Surviving cells were protected by the downregulation of caspase-3 expression and activation. Thus, lentiviral caspase-3 shRNA-mediated RNAi successfully silenced endogenous caspase-3 expression, preventing inappropriate or premature apoptosis

  19. Zinc finger protein 598 inhibits cell survival by promoting UV-induced apoptosis.

    Science.gov (United States)

    Yang, Qiaohong; Gupta, Romi

    2018-01-19

    UV is one of the major causes of DNA damage induced apoptosis. However, cancer cells adopt alternative mechanisms to evade UV-induced apoptosis. To identify factors that protect cancer cells from UV-induced apoptosis, we performed a genome wide short-hairpin RNA (shRNA) screen, which identified Zinc finger protein 598 (ZNF598) as a key regulator of UV-induced apoptosis. Here, we show that UV irradiation transcriptionally upregulates ZNF598 expression. Additionally, ZNF598 knockdown in cancer cells inhibited UV-induced apoptosis. In our study, we observe that ELK1 mRNA level as well as phosphorylated ELK1 levels was up regulated upon UV irradiation, which was necessary for UV irradiation induced upregulation of ZNF598. Cells expressing ELK1 shRNA were also resistant to UV-induced apoptosis, and phenocopy ZNF598 knockdown. Upon further investigation, we found that ZNF598 knockdown inhibits UV-induced apoptotic gene expression, which matches with decrease in percentage of annexin V positive cell. Similarly, ectopic expression of ZNF598 promoted apoptotic gene expression and also increased annexin V positive cells. Collectively, these results demonstrate that ZNF598 is a UV irradiation regulated gene and its loss results in resistance to UV-induced apoptosis.

  20. Lentiviral-mediated RNAi targeting caspase-3 inhibits apoptosis induced by serum deprivation in rat endplate chondrocytes in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Ding, L.; Wu, J.P. [Fudan University, Jinshan Hospital, Department of Orthopaedics, Shanghai, China, Department of Orthopaedics, Jinshan Hospital, Fudan University, Shanghai (China); Xu, G. [Fudan University, Jinshan Hospital, Center Laboratory, Shanghai, China, Center Laboratory, Jinshan Hospital, Fudan University, Shanghai (China); Zhu, B.; Zeng, Q.M.; Li, D.F.; Lu, W. [Fudan University, Jinshan Hospital, Department of Orthopaedics, Shanghai, China, Department of Orthopaedics, Jinshan Hospital, Fudan University, Shanghai (China)

    2014-05-09

    Current studies find that degenerated cartilage endplates (CEP) of vertebrae, with fewer diffusion areas, decrease nutrient supply and accelerate intervertebral disc degeneration. Many more apoptotic cells have been identified in degenerated than in normal endplates, and may be responsible for the degenerated grade. Previous findings suggest that inhibition of apoptosis is one possible approach to improve disc regeneration. It is postulated that inhibition of CEP cell apoptosis may be responsible for the regeneration of endplates. Caspase-3, involved in the execution phase of apoptosis, is a candidate for regulating the apoptotic process. In the present study, CEP cells were incubated in 1% fetal bovine serum. Activated caspases were detected to identify the apoptotic pathway, and apoptosis was quantified by flow cytometry. Lentiviral caspase-3 short hairpin RNA (shRNA) was employed to study its protective effects against serum deprivation. Silencing of caspase-3 expression was quantified by reverse transcription-polymerase chain reaction and Western blots, and inhibition of apoptosis was quantified by flow cytometry. Serum deprivation increased apoptosis of rat CEP cells through activation of a caspase cascade. Lentiviral caspase-3 shRNA was successfully transduced into CEP cells, and specifically silenced endogenous caspase-3 expression. Surviving cells were protected by the downregulation of caspase-3 expression and activation. Thus, lentiviral caspase-3 shRNA-mediated RNAi successfully silenced endogenous caspase-3 expression, preventing inappropriate or premature apoptosis.

  1. Lentiviral-mediated RNAi targeting caspase-3 inhibits apoptosis induced by serum deprivation in rat endplate chondrocytes in vitro

    Directory of Open Access Journals (Sweden)

    L. Ding

    2014-06-01

    Full Text Available Current studies find that degenerated cartilage endplates (CEP of vertebrae, with fewer diffusion areas, decrease nutrient supply and accelerate intervertebral disc degeneration. Many more apoptotic cells have been identified in degenerated than in normal endplates, and may be responsible for the degenerated grade. Previous findings suggest that inhibition of apoptosis is one possible approach to improve disc regeneration. It is postulated that inhibition of CEP cell apoptosis may be responsible for the regeneration of endplates. Caspase-3, involved in the execution phase of apoptosis, is a candidate for regulating the apoptotic process. In the present study, CEP cells were incubated in 1% fetal bovine serum. Activated caspases were detected to identify the apoptotic pathway, and apoptosis was quantified by flow cytometry. Lentiviral caspase-3 short hairpin RNA (shRNA was employed to study its protective effects against serum deprivation. Silencing of caspase-3 expression was quantified by reverse transcription-polymerase chain reaction and Western blots, and inhibition of apoptosis was quantified by flow cytometry. Serum deprivation increased apoptosis of rat CEP cells through activation of a caspase cascade. Lentiviral caspase-3 shRNA was successfully transduced into CEP cells, and specifically silenced endogenous caspase-3 expression. Surviving cells were protected by the downregulation of caspase-3 expression and activation. Thus, lentiviral caspase-3 shRNA-mediated RNAi successfully silenced endogenous caspase-3 expression, preventing inappropriate or premature apoptosis.

  2. Stable replication of the EBNA1/OriP-mediated baculovirus vector and its application to anti-HCV gene therapy

    Directory of Open Access Journals (Sweden)

    Chang Myint OO

    2009-10-01

    Full Text Available Abstract Background Hepatitis C virus (HCV is one of the main causes of liver-related morbidity and mortality. Although combined interferon-α-ribavirin therapy is effective for about 50% of the patients with HCV, better therapies are needed and preventative vaccines have yet to be developed. Short-hairpin RNAs (shRNAs inhibit gene expression by RNA interference. The application of transient shRNA expression is limited, however, due to the inability of the shRNA to replicate in mammalian cells and its inefficient transduction. The duration of transgene (shRNA expression in mammalian cells can be significantly extended using baculovirus-based shRNA-expressing vectors that contain the latent viral protein Epstein-Barr nuclear antigen 1 (EBNA1 and the origin of latent viral DNA replication (OriP sequences. These recombinant vectors contain compatible promoters and are highly effective for infecting primary hepatocyte and hepatoma cell lines, making them very useful tools for studies of hepatitis B and hepatitis C viruses. Here, we report the use of these baculovirus-based vector-derived shRNAs to inhibit core-protein expression in full-length hepatitis C virus (HCV replicon cells. Results We constructed a long-term transgene shRNA expression vector that contains the EBV EBNA1 and OriP sequences. We also designed baculovirus vector-mediated shRNAs against the highly conserved core-protein region of HCV. HCV core protein expression was inhibited by the EBNA1/OriP baculovirus vector for at least 14 days, which was considerably longer than the 3 days of inhibition produced by the wild-type baculovirus vector. Conclusion These findings indicate that we successfully constructed a long-term transgene (shRNA expression vector (Ac-EP-shRNA452 using the EBNA1/OriP system, which was propagated in Escherichia coli and converted into mammalian cells. The potential anti-HCV activity of the long-term transgene (shRNA expression vector was evaluated with the view

  3. Enhancement of allele discrimination by introduction of nucleotide mismatches into siRNA in allele-specific gene silencing by RNAi.

    Directory of Open Access Journals (Sweden)

    Yusuke Ohnishi

    Full Text Available Allele-specific gene silencing by RNA interference (RNAi is therapeutically useful for specifically inhibiting the expression of disease-associated alleles without suppressing the expression of corresponding wild-type alleles. To realize such allele-specific RNAi (ASP-RNAi, the design and assessment of small interfering RNA (siRNA duplexes conferring ASP-RNAi is vital; however, it is also difficult. In a previous study, we developed an assay system to assess ASP-RNAi with mutant and wild-type reporter alleles encoding the Photinus and Renilla luciferase genes. In line with experiments using the system, we realized that it is necessary and important to enhance allele discrimination between mutant and corresponding wild-type alleles. Here, we describe the improvement of ASP-RNAi against mutant alleles carrying single nucleotide variations by introducing base substitutions into siRNA sequences, where original variations are present in the central position. Artificially mismatched siRNAs or short-hairpin RNAs (shRNAs against mutant alleles of the human Prion Protein (PRNP gene, which appear to be associated with susceptibility to prion diseases, were examined using this assessment system. The data indicates that introduction of a one-base mismatch into the siRNAs and shRNAs was able to enhance discrimination between the mutant and wild-type alleles. Interestingly, the introduced mismatches that conferred marked improvement in ASP-RNAi, appeared to be largely present in the guide siRNA elements, corresponding to the 'seed region' of microRNAs. Due to the essential role of the 'seed region' of microRNAs in their association with target RNAs, it is conceivable that disruption of the base-pairing interactions in the corresponding seed region, as well as the central position (involved in cleavage of target RNAs, of guide siRNA elements could influence allele discrimination. In addition, we also suggest that nucleotide mismatches at the 3'-ends of sense

  4. Long non-coding RNA ANRIL is up-regulated in bladder cancer and regulates bladder cancer cell proliferation and apoptosis through the intrinsic pathway

    International Nuclear Information System (INIS)

    Zhu, Hongxue; Li, Xuechao; Song, Yarong; Zhang, Peng; Xiao, Yajun; Xing, Yifei

    2015-01-01

    Antisense non-coding RNA in the INK4 locus (ANRIL) is a member of long non-coding RNAs and has been reported to be dysregulated in several human cancers. However, the role of ANRIL in bladder cancer remains unclear. This present study aimed to investigate whether and how ANRIL involved in bladder cancer. Our results showed up-regulation of ANRIL in bladder cancer tissues versus the corresponding adjacent non-tumor tissues. To explore the specific mechanisms, ANRIL was silenced by small interfering RNA or short hairpin RNA transfection in human bladder cancer T24 and EJ cells. Knockdown of ANRIL repressed cell proliferation and increased cell apoptosis, along with decreased expression of Bcl-2 and increased expressions of Bax, cytoplasmic cytochrome c and Smac and cleaved caspase-9, caspase-3 and PARP. However, no change of cleaved caspase-8 level was observed. Furthermore, in vivo experiment confirmed that knockdown of ANRIL inhibited tumorigenic ability of EJ cells in nude mice. Meanwhile, in accordance with in vitro study, knockdown of ANRIL inhibited expression of Bcl-2 and up-regulated expressions of Bax and cleaved caspase-9, but did not affect cleaved caspase-8 level. In conclusion, we first report that ANRIL possibly serves as an oncogene in bladder cancer and regulates bladder cancer cell proliferation and apoptosis through the intrinsic apoptosis pathway. - Highlights: • We first report the role of ANRIL in bladder cancer. • ANRIL is obviously up-regulated in bladder cancer tissues. • ANRIL regulates bladder cancer cell proliferation and cell apoptosis through the intrinsic pathway.

  5. Polyetherimide-grafted Fe3O4@SiO2 nanoparticles as theranostic agents for simultaneous VEGF siRNA delivery and magnetic resonance cell imaging

    Directory of Open Access Journals (Sweden)

    Li T

    2015-07-01

    Full Text Available Tingting Li,1 Xue Shen,1 Yin Chen,1 Chengchen Zhang,1 Jie Yan,1 Hong Yang,1 Chunhui Wu,1,2 Hongjun Zeng,1,2 Yiyao Liu1,21Department of Biophysics, School of Life Science and Technology, 2Center for Information in Biomedicine, University of Electronic Science and Technology of China, Chengdu, Sichuan, People’s Republic of ChinaAbstract: Engineering a safe and high-efficiency delivery system for efficient RNA interference is critical for successful gene therapy. In this study, we designed a novel nanocarrier system of polyethyleneimine (PEI-modified Fe3O4@SiO2, which allows high efficient loading of VEGF small hairpin (shRNA to form Fe3O4@SiO2/PEI/VEGF shRNA nanocomposites for VEGF gene silencing as well as magnetic resonance (MR imaging. The size, morphology, particle stability, magnetic properties, and gene-binding capacity and protection were determined. Low cytotoxicity and hemolyticity against human red blood cells showed the excellent biocompatibility of the multifunctional nanocomposites, and also no significant coagulation was observed. The nanocomposites maintain their superparamagnetic property at room temperature and no appreciable change in magnetism, even after PEI modification. The qualitative and quantitative analysis of cellular internalization into MCF-7 human breast cancer cells by Prussian blue staining and inductively coupled plasma atomic emission spectroscopy analysis, respectively, demonstrated that the Fe3O4@SiO2/PEI/VEGF shRNA nanocomposites could be easily internalized by MCF-7 cells, and they exhibited significant inhibition of VEGF gene expression. Furthermore, the MR cellular images showed that the superparamagnetic iron oxide core of our Fe3O4@SiO2/PEI/VEGF shRNA nanocomposites could also act as a T2-weighted contrast agent for cancer MR imaging. Our data highlight multifunctional Fe3O4@SiO2/PEI/VEGF shRNA nanocomposites as a potential platform for simultaneous gene delivery and MR cell imaging, which are promising

  6. Inhibition of GLO1 in Glioblastoma Multiforme Increases DNA-AGEs, Stimulates RAGE Expression, and Inhibits Brain Tumor Growth in Orthotopic Mouse Models

    Directory of Open Access Journals (Sweden)

    Rahul Jandial

    2018-01-01

    Full Text Available Cancers that exhibit the Warburg effect may elevate expression of glyoxylase 1 (GLO1 to detoxify the toxic glycolytic byproduct methylglyoxal (MG and inhibit the formation of pro-apoptotic advanced glycation endproducts (AGEs. Inhibition of GLO1 in cancers that up-regulate glycolysis has been proposed as a therapeutic targeting strategy, but this approach has not been evaluated for glioblastoma multiforme (GBM, the most aggressive and difficult to treat malignancy of the brain. Elevated GLO1 expression in GBM was established in patient tumors and cell lines using bioinformatics tools and biochemical approaches. GLO1 inhibition in GBM cell lines and in an orthotopic xenograft GBM mouse model was examined using both small molecule and short hairpin RNA (shRNA approaches. Inhibition of GLO1 with S-(p-bromobenzyl glutathione dicyclopentyl ester (p-BrBzGSH(Cp2 increased levels of the DNA-AGE N2-1-(carboxyethyl-2′-deoxyguanosine (CEdG, a surrogate biomarker for nuclear MG exposure; substantially elevated expression of the immunoglobulin-like receptor for AGEs (RAGE; and induced apoptosis in GBM cell lines. Targeting GLO1 with shRNA similarly increased CEdG levels and RAGE expression, and was cytotoxic to glioma cells. Mice bearing orthotopic GBM xenografts treated systemically with p-BrBzGSH(Cp2 exhibited tumor regression without significant off-target effects suggesting that GLO1 inhibition may have value in the therapeutic management of these drug-resistant tumors.

  7. Inhibition of GLO1 in Glioblastoma Multiforme Increases DNA-AGEs, Stimulates RAGE Expression, and Inhibits Brain Tumor Growth in Orthotopic Mouse Models.

    Science.gov (United States)

    Jandial, Rahul; Neman, Josh; Lim, Punnajit P; Tamae, Daniel; Kowolik, Claudia M; Wuenschell, Gerald E; Shuck, Sarah C; Ciminera, Alexandra K; De Jesus, Luis R; Ouyang, Ching; Chen, Mike Y; Termini, John

    2018-01-30

    Cancers that exhibit the Warburg effect may elevate expression of glyoxylase 1 (GLO1) to detoxify the toxic glycolytic byproduct methylglyoxal (MG) and inhibit the formation of pro-apoptotic advanced glycation endproducts (AGEs). Inhibition of GLO1 in cancers that up-regulate glycolysis has been proposed as a therapeutic targeting strategy, but this approach has not been evaluated for glioblastoma multiforme (GBM), the most aggressive and difficult to treat malignancy of the brain. Elevated GLO1 expression in GBM was established in patient tumors and cell lines using bioinformatics tools and biochemical approaches. GLO1 inhibition in GBM cell lines and in an orthotopic xenograft GBM mouse model was examined using both small molecule and short hairpin RNA (shRNA) approaches. Inhibition of GLO1 with S -( p -bromobenzyl) glutathione dicyclopentyl ester ( p- BrBzGSH(Cp)₂) increased levels of the DNA-AGE N ²-1-(carboxyethyl)-2'-deoxyguanosine (CEdG), a surrogate biomarker for nuclear MG exposure; substantially elevated expression of the immunoglobulin-like receptor for AGEs (RAGE); and induced apoptosis in GBM cell lines. Targeting GLO1 with shRNA similarly increased CEdG levels and RAGE expression, and was cytotoxic to glioma cells. Mice bearing orthotopic GBM xenografts treated systemically with p -BrBzGSH(Cp)₂ exhibited tumor regression without significant off-target effects suggesting that GLO1 inhibition may have value in the therapeutic management of these drug-resistant tumors.

  8. Homeobox gene Dlx-2 is implicated in metabolic stress-induced necrosis

    Directory of Open Access Journals (Sweden)

    Lim Sung-Chul

    2011-09-01

    Full Text Available Abstract Background In contrast to tumor-suppressive apoptosis and autophagic cell death, necrosis promotes tumor progression by releasing the pro-inflammatory and tumor-promoting cytokine high mobility group box 1 (HMGB1, and its presence in tumor patients is associated with poor prognosis. Thus, necrosis has important clinical implications in tumor development; however, its molecular mechanism remains poorly understood. Results In the present study, we show that Distal-less 2 (Dlx-2, a homeobox gene of the Dlx family that is involved in embryonic development, is induced in cancer cell lines dependently of reactive oxygen species (ROS in response to glucose deprivation (GD, one of the metabolic stresses occurring in solid tumors. Increased Dlx-2 expression was also detected in the inner regions, which experience metabolic stress, of human tumors and of a multicellular tumor spheroid, an in vitro model of solid tumors. Dlx-2 short hairpin RNA (shRNA inhibited metabolic stress-induced increase in propidium iodide-positive cell population and HMGB1 and lactate dehydrogenase (LDH release, indicating the important role(s of Dlx-2 in metabolic stress-induced necrosis. Dlx-2 shRNA appeared to exert its anti-necrotic effects by preventing metabolic stress-induced increases in mitochondrial ROS, which are responsible for triggering necrosis. Conclusions These results suggest that Dlx-2 may be involved in tumor progression via the regulation of metabolic stress-induced necrosis.

  9. Loss of Selenium-Binding Protein 1 Decreases Sensitivity to Clastogens and Intracellular Selenium Content in HeLa Cells.

    Science.gov (United States)

    Zhao, Changhui; Zeng, Huawei; Wu, Ryan T Y; Cheng, Wen-Hsing

    2016-01-01

    Selenium-binding protein 1 (SBP1) is not a selenoprotein but structurally binds selenium. Loss of SBP1 during carcinogenesis usually predicts poor prognosis. Because genome instability is a hallmark of cancer, we hypothesize that SBP1 sequesters cellular selenium and sensitizes cancer cells to DNA-damaging agents. To test this hypothesis, we knocked down SBP1 expression in HeLa cervical cancer cells by employing a short hairpin RNA (shRNA) approach. Reduced sensitivity to hydrogen peroxide, paraquat and camptothecin, reactive oxygen species content, and intracellular retention of selenium after selenomethionine treatment were observed in SBP1 shRNA HeLa cells. Results from Western analyses showed that treatment of HeLa cells with selenomethionine resulted in increased SBP1 protein expression in a dose-dependent manner. Knockdown of SBP1 rendered HeLa cells increased expression of glutathione peroxidase-1 but not glutathione peroxidase-4 protein levels and accelerated migration from a wound. Altogether, SBP1 retains supplemental selenium and sensitizes HeLa cancer cells to clastogens, suggesting a new cancer treatment strategy by sequestering selenium through SBP1.

  10. Advanced glycation end product-induced astrocytic differentiation of cultured neurospheres through inhibition of Notch-Hes1 pathway-mediated neurogenesis.

    Science.gov (United States)

    Guo, Yijing; Wang, Pin; Sun, Haixia; Cai, Rongrong; Xia, Wenqing; Wang, Shaohua

    2013-12-23

    This study aims to investigate the roles of the Notch-Hes1 pathway in the advanced glycation end product (AGE)-mediated differentiation of neural stem cells (NSCs). We prepared pLentiLox3.7 lentiviral vectors that express short hairpin RNA (shRNA) against Notch1 and transfected it into NSCs. Cell differentiation was analyzed under confocal laser-scanning microscopy. The percentage of neurons and astrocytes was quantified by normalizing the total number of TUJ1+ (Neuron-specific class III β-tubulin) and GFAP+ (Glial fibrillary acidic protein) cells to the total number of Hoechst 33342-labeled cell nuclei. The protein and gene expression of Notch-Hes1 pathway components was examined via western blot analysis and real-time PCR. After 1 week of incubation, we found that AGE-bovine serum albumin (BSA) (400 μg/mL) induced the astrocytic differentiation of cultured neurospheres and inhibited neuronal formation. The expression of Notch-Hes1 pathway components was upregulated in the cells in the AGE-BSA culture medium. Immunoblot analysis indicated that shRNA silencing of Notch1 expression in NSCs significantly increases neurogenesis and suppresses astrocytic differentiation in NSCs incubated with AGE-BSA. AGEs promote the astrocytic differentiation of cultured neurospheres by inhibiting neurogenesis through the Notch-Hes1 pathway, providing a potential therapeutic target for hyperglycemia-related cognitive deficits.

  11. FAT/CD36: a major regulator of neuronal fatty acid sensing and energy homeostasis in rats and mice.

    Science.gov (United States)

    Le Foll, Christelle; Dunn-Meynell, Ambrose; Musatov, Serguei; Magnan, Christophe; Levin, Barry E

    2013-08-01

    Hypothalamic "metabolic-sensing" neurons sense glucose and fatty acids (FAs) and play an integral role in the regulation of glucose, energy homeostasis, and the development of obesity and diabetes. Using pharmacologic agents, we previously found that ~50% of these neurons responded to oleic acid (OA) by using the FA translocator/receptor FAT/CD36 (CD36). For further elucidation of the role of CD36 in neuronal FA sensing, ventromedial hypothalamus (VMH) CD36 was depleted using adeno-associated viral (AAV) vector expressing CD36 short hairpin RNA (shRNA) in rats. Whereas their neuronal glucosensing was unaffected by CD36 depletion, the percent of neurons that responded to OA was decreased specifically in glucosensing neurons. A similar effect was seen in total-body CD36-knockout mice. Next, weanling rats were injected in the VMH with CD36 AAV shRNA. Despite significant VMH CD36 depletion, there was no effect on food intake, body weight gain, or total carcass adiposity on chow or 45% fat diets. However, VMH CD36-depleted rats did have increased plasma leptin and subcutaneous fat deposition and markedly abnormal glucose tolerance. These results demonstrate that CD36 is a critical factor in both VMH neuronal FA sensing and the regulation of energy and glucose homeostasis.

  12. Circulating Long Noncoding RNA HOTAIR is an Essential Mediator of Acute Myocardial Infarction

    Directory of Open Access Journals (Sweden)

    Lu Gao

    2017-12-01

    coronary artery ligation and in cultured cardiomyocytes exposed to hypoxia. Furthermore, we observed that the adenovirus vector-driven overexpression of HOTAIR dramatically limited hypoxia-induced myocyte apoptosis, whereas knockdown HOTAIR by AdshHOTAIR (adenoviral short hairpin HOTAIR exhibited the opposite phenotype. Mechanistically, we discovered that the cardioprotective function of HOTAIR is partly based on the negative regulation of miR-1. Conclusions: Taken together, the results of our study suggest that HOTAIR is a protective factor for cardiomyocytes and that the plasma concentration of HOTAIR may serve as a biomarker for human AMI diagnosis.

  13. An approach to the construction of tailor-made amphiphilic peptides that strongly and selectively bind to hairpin RNA targets.

    Science.gov (United States)

    Lee, Su Jin; Hyun, Soonsil; Kieft, Jeffrey S; Yu, Jaehoon

    2009-02-18

    The hairpin RNA motif is one of the most frequently observed secondary structures and is often targeted by therapeutic agents. An amphiphilic peptide with seven lysine and eight leucine residues and its derivatives were designed for use as ligands against RNA hairpin motifs. We hypothesized that variations in both the hydrophobic leucine-rich and hydrophilic lysine-rich spheres of these amphiphilic peptides would create extra attractive interactions with hairpin RNA targets. A series of alanine-scanned peptides were probed to identify the most influential lysine residues in the hydrophilic sphere. The binding affinities of these modified peptides with several hairpins, such as RRE, TAR from HIV, a short hairpin from IRES of HCV, and a hairpin from the 16S A-site stem from rRNA, were determined. Since the hairpin from IRES of HCV was the most susceptible to the initial series of alanine-scanned peptides, studies investigating how further variations in the peptides effect binding employed the IRES hairpin. Next, the important Lys residues were substituted by shorter chain amines, such as ornithine, to place the peptide deeper into the hairpin groove. In a few cases, a 70-fold improved binding was observed for peptides that contained the specifically located shorter amine side chains. To further explore changes in binding affinities brought about by alterations in the hydrophobic sphere, tryptophan residues were introduced in place of leucine. A few peptides with tryptophan in specific positions also displayed 70-fold improved binding affinities. Finally, double mutant peptides incorporating both specifically located shorter amine side chains in the hydrophilic region and tryptophan residues in the hydrophobic region were synthesized. The binding affinities of peptides containing the simple double modification were observed to be 80 times lower, and their binding specificities were increased 40-fold. The results of this effort provide important information about

  14. Combinatorial RNA Interference Therapy Prevents Selection of Pre-existing HBV Variants in Human Liver Chimeric Mice

    Science.gov (United States)

    Shih, Yao-Ming; Sun, Cheng-Pu; Chou, Hui-Hsien; Wu, Tzu-Hui; Chen, Chun-Chi; Wu, Ping-Yi; Enya Chen, Yu-Chen; Bissig, Karl-Dimiter; Tao, Mi-Hua

    2015-01-01

    Selection of escape mutants with mutations within the target sequence could abolish the antiviral RNA interference activity. Here, we investigated the impact of a pre-existing shRNA-resistant HBV variant on the efficacy of shRNA therapy. We previously identified a highly potent shRNA, S1, which, when delivered by an adeno-associated viral vector, effectively inhibits HBV replication in HBV transgenic mice. We applied the “PICKY” software to systemically screen the HBV genome, then used hydrodynamic transfection and HBV transgenic mice to identify additional six highly potent shRNAs. Human liver chimeric mice were infected with a mixture of wild-type and T472C HBV, a S1-resistant HBV variant, and then treated with a single or combined shRNAs. The presence of T472C mutant compromised the therapeutic efficacy of S1 and resulted in replacement of serum wild-type HBV by T472C HBV. In contrast, combinatorial therapy using S1 and P28, one of six potent shRNAs, markedly reduced titers for both wild-type and T472C HBV. Interestingly, treatment with P28 alone led to the emergence of escape mutants with mutations in the P28 target region. Our results demonstrate that combinatorial RNAi therapy can minimize the escape of resistant viral mutants in chronic HBV patients. PMID:26482836

  15. RNA oxidation

    DEFF Research Database (Denmark)

    Kjaer, L. K.; Cejvanovic, V.; Henriken, T.

    2015-01-01

    .9 significant hazard ratio for death compared with the quartile with the lowest 8oxoGuo excretion when adjusted for age, sex, BMI, smoker status, s-HbA1c, urine protein excretion and s-cholesterol. We conclude that it is now established that RNA oxidation is an independent risk factor for death in type 2...

  16. Study of RNA interference inhibiting rat ovarian androgen biosynthesis by depressing 17alpha-hydroxylase/17, 20-lyase activity in vivo

    Directory of Open Access Journals (Sweden)

    Yang Xing

    2009-07-01

    Full Text Available Abstract Background 17alpha-hydroxylase/17, 20-lyase encoded by CYP17 is the key enzyme in androgen biosynthesis pathway. Previous studies demonstrated the accentuation of the enzyme in patients with polycystic ovary syndrome (PCOS was the most important mechanism of androgen excess. We chose CYP17 as the therapeutic target, trying to suppress the activity of 17alpha-hydroxylase/17, 20-lyase and inhibit androgen biosynthesis by silencing the expression of CYP17 in the rat ovary. Methods Three CYP17-targeting and one negative control oligonucleotides were designed and used in the present study. The silence efficiency of lentivirus shRNA was assessed by qRT-PCR, Western blotting and hormone assay. After subcapsular injection of lentivirus shRNA in rat ovary, the delivery efficiency was evaluated by GFP fluorescence and qPCR. Total RNA was extracted from rat ovary for CYP17 mRNA determination and rat serum was collected for hormone measurement. Results In total, three CYP17-targeting lentivirus shRNAs were synthesized. The results showed that all of them had a silencing effect on CYP17 mRNA and protein. Moreover, androstenedione secreted by rat theca interstitial cells (TIC in the RNAi group declined significantly compared with that in the control group. Two weeks after rat ovarian subcapsular injection of chosen CYP17 shRNA, the GFP fluorescence of frozen ovarian sections could be seen clearly under fluorescence microscope. It also showed that the GFP DNA level increased significantly, and its relative expression level was 7.42 times higher than that in the control group. Simultaneously, shRNA treatment significantly decreased CYP17 mRNA and protein levels at 61% and 54%, respectively. Hormone assay showed that all the levels of androstenedione, 17-hydroxyprogesterone and testosterone declined to a certain degree, but progesterone levels declined significantly. Conclusion The present study proves for the first time that ovarian androgen

  17. In Vivo Loss of Function Screening Reveals Carbonic Anhydrase IX as a Key Modulator of Tumor Initiating Potential in Primary Pancreatic Tumors

    Directory of Open Access Journals (Sweden)

    Nabendu Pore

    2015-06-01

    Full Text Available Reprogramming of energy metabolism is one of the emerging hallmarks of cancer. Up-regulation of energy metabolism pathways fuels cell growth and division, a key characteristic of neoplastic disease, and can lead to dependency on specific metabolic pathways. Thus, targeting energy metabolism pathways might offer the opportunity for novel therapeutics. Here, we describe the application of a novel in vivo screening approach for the identification of genes involved in cancer metabolism using a patient-derived pancreatic xenograft model. Lentiviruses expressing short hairpin RNAs (shRNAs targeting 12 different cell surface protein transporters were separately transduced into the primary pancreatic tumor cells. Transduced cells were pooled and implanted into mice. Tumors were harvested at different times, and the frequency of each shRNA was determined as a measure of which ones prevented tumor growth. Several targets including carbonic anhydrase IX (CAIX, monocarboxylate transporter 4, and anionic amino acid transporter light chain, xc- system (xCT were identified in these studies and shown to be required for tumor initiation and growth. Interestingly, CAIX was overexpressed in the tumor initiating cell population. CAIX expression alone correlated with a highly tumorigenic subpopulation of cells. Furthermore, CAIX expression was essential for tumor initiation because shRNA knockdown eliminated the ability of cells to grow in vivo. To the best of our knowledge, this is the first parallel in vivo assessment of multiple novel oncology target genes using a patient-derived pancreatic tumor model.

  18. Down-regulation of human endogenous retrovirus type K (HERV-K) viral env RNA in pancreatic cancer cells decreases cell proliferation and tumor growth

    Science.gov (United States)

    Li, Ming; Radvanyi, Laszlo; Yin, Bingnan; Li, Jia; Chivukula, Raghavender; Lin, Kevin; Lu, Yue; Shen, JianJun; Chang, David Z.; Li, Donghui; Johanning, Gary L.; Wang-Johanning, Feng

    2017-01-01

    Purpose We investigated the role of the human endogenous retrovirus type K (HERV-K) envelope (env) gene in pancreatic cancer (PC). Experimental Design shRNA was employed to knockdown (KD) the expression of HERV-K in PC cells. Results HERV-K env expression was detected in seven PC cell lines and in 80% of PC patient biopsies, but not in two normal pancreatic cell lines or uninvolved normal tissues. A new HERV-K splice variant was discovered in several PC cell lines. RT activity and virus-like particles were observed in culture media supernatant obtained from Panc-1 and Panc-2 cells. HERV-K viral RNA levels and anti-HERV-K antibody titers were significantly higher in PC patient sera (N=106) than in normal donor sera (N=40). Importantly, the in vitro and in vivo growth rates of three PC cell lines were significantly reduced after HERV-K KD by shRNA targeting HERV-K env, and there was reduced metastasis to lung after treatment. RNA-seq results revealed changes in gene expression after HERV-K env KD, including RAS and TP53. Furthermore, downregulation of HERV-K Env protein expression by shRNA also resulted in decreased expression of RAS, p-ERK, p-RSK, and p-AKT in several PC cells or tumors. Conclusion These results demonstrate that HERV-K influences signal transduction via the RAS-ERK-RSK pathway in PC. Our data highlight the potentially important role of HERV-K in tumorigenesis and progression of PC, and indicate that HERV-K viral proteins may be attractive biomarkers and/or tumor-associated antigens, as well as potentially useful targets for detection, diagnosis and immunotherapy of PC. PMID:28679769

  19. Recent Findings Concerning PAMAM Dendrimer Conjugates with Cyclodextrins as Carriers of DNA and RNA

    Directory of Open Access Journals (Sweden)

    Keiichi Motoyama

    2009-08-01

    Full Text Available We have evaluated the potential use of various polyamidoamine (PAMAM dendrimer [dendrimer, generation (G 2-4] conjugates with cyclodextrins (CyDs as novel DNA and RNA carriers. Among the various dendrimer conjugates with CyDs, the dendrimer (G3 conjugate with α-CyD having an average degree of substitution (DS of 2.4 [α-CDE (G3, DS2] displayed remarkable properties as DNA, shRNA and siRNA delivery carriers through the sensor function of α-CDEs toward nucleic acid drugs, cell surface and endosomal membranes. In an attempt to develop cell-specific gene transfer carriers, we prepared sugar-appended α-CDEs. Of the various sugar-appended α-CDEs prepared, galactose- or mannose-appended α-CDEs provided superior gene transfer activity to α-CDE in various cells, but not cell-specific gene delivery ability. However, lactose-appended α-CDE [Lac-α-CDE (G2] was found to possess asialoglycoprotein receptor (AgpR-mediated hepatocyte-selective gene transfer activity, both in vitro and in vivo. Most recently, we prepared folate-poly(ethylene glycol-appended α-CDE [Fol-PαC (G3] and revealed that Fol-PαC (G3 imparted folate receptor (FR-mediated cancer cell-selective gene transfer activity. Consequently, α-CDEs bearing integrated, multifunctional molecules may possess the potential to be novel carriers for DNA, shRNA and siRNA.

  20. Advanced Design of Dumbbell-shaped Genetic Minimal Vectors Improves Non-coding and Coding RNA Expression.

    Science.gov (United States)

    Jiang, Xiaoou; Yu, Han; Teo, Cui Rong; Tan, Genim Siu Xian; Goh, Sok Chin; Patel, Parasvi; Chua, Yiqiang Kevin; Hameed, Nasirah Banu Sahul; Bertoletti, Antonio; Patzel, Volker

    2016-09-01

    Dumbbell-shaped DNA minimal vectors lacking nontherapeutic genes and bacterial sequences are considered a stable, safe alternative to viral, nonviral, and naked plasmid-based gene-transfer systems. We investigated novel molecular features of dumbbell vectors aiming to reduce vector size and to improve the expression of noncoding or coding RNA. We minimized small hairpin RNA (shRNA) or microRNA (miRNA) expressing dumbbell vectors in size down to 130 bp generating the smallest genetic expression vectors reported. This was achieved by using a minimal H1 promoter with integrated transcriptional terminator transcribing the RNA hairpin structure around the dumbbell loop. Such vectors were generated with high conversion yields using a novel protocol. Minimized shRNA-expressing dumbbells showed accelerated kinetics of delivery and transcription leading to enhanced gene silencing in human tissue culture cells. In primary human T cells, minimized miRNA-expressing dumbbells revealed higher stability and triggered stronger target gene suppression as compared with plasmids and miRNA mimics. Dumbbell-driven gene expression was enhanced up to 56- or 160-fold by implementation of an intron and the SV40 enhancer compared with control dumbbells or plasmids. Advanced dumbbell vectors may represent one option to close the gap between durable expression that is achievable with integrating viral vectors and short-term effects triggered by naked RNA.

  1. Silencing Nrf2 impairs glioma cell proliferation via AMPK-activated mTOR inhibition

    Energy Technology Data Exchange (ETDEWEB)

    Jia, Yue [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Wang, Handong, E-mail: njhdwang@hotmail.com [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Wang, Qiang [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Ding, Hui [Department of Neurosurgery, Jinling Hospital, School of Medicine, Southern Medical University (Guangzhou), 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Wu, Heming [Department of Neurosurgery, Nanjing Jingdu Hospital, No. 34, Biao 34, Yanggongjing Road, Nanjing 210002, Jiangsu Province (China); Pan, Hao [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China)

    2016-01-15

    Gliomas are the leading cause of death among adults with primary brain malignancies. Treatment for malignant gliomas remains limited, and targeted therapies have been incompletely explored. Nuclear factor erythroid 2-related factor 2 (Nrf2), a key transcription regulator for antioxidant and detoxification enzymes, is abundantly expressed in cancer cells. In this study, the role and mechanism of Nrf2 in cancer cell proliferation was investigated in multiple glioma cell lines. We first evaluated the expression patterns of Nrf2 in four glioma cell lines and found all four cell lines expressed Nrf2, but the highest level was observed in U251 cells. We further evaluated the biological functions of Nrf2 in U251 glioma cell proliferation by specific inhibition of Nrf2 using short hairpin RNA (shRNA). We found that Nrf2 depletion inhibited glioma cell proliferation. Nrf2 depletion also decreased colony formation in U251 cells stably expressing Nrf2 shRNA compared to scrambled control shRNA. Moreover, suppression of Nrf2 expression could lead to ATP depletion (with concomitant rise in AMP/ATP ratio) and consequently to AMPK-activated mTOR inhibition. Finally, activation of adenosine monophosphate–activated protein kinase (AMPK) by treated with phenformin, an AMPK agonist, can mimic the inhibitory effect of Nrf2 knockdown in U251 cells. In conclusion, our findings will shed light to the role and mechanism of Nrf2 in regulating glioma proliferation via ATP-depletion-induced AMPK activation and consequent mTOR inhibition, a novel insight into our understanding the role and mechanism of Nrf2 in glioma pathoetiology. To our knowledge, this is also the first report to provide a rationale for the implication of cross-linking between Nrf2 and mTOR signaling.

  2. Decreased expression of RNA interference machinery, Dicer and Drosha, is associated with poor outcome in ovarian cancer patients

    Energy Technology Data Exchange (ETDEWEB)

    Merritt, William M.; Lin, Yvonne G.; Han, Liz Y.; Kamat, Aparna A.; Spannuth, Whitney A.; Schmandt, Rosemarie; Urbauer, Diana; Pennacchio, Len A.; Cheng, Jan-Fang; Zeidan, Alexandra; Wang, Hua; Mueller, Peter; Lenburg, Marc E.; Gray, Joe W.; Mok, Samuel; Birrer, Michael J.; Lopez-Berestein, Gabriel; Coleman, Robert L.; Bar-Eli, Menashe; Sood, Anil K.

    2008-05-06

    The clinical and functional significance of RNA interference (RNAi) machinery, Dicer and Drosha, in ovarian cancer is not known and was examined. Dicer and Drosha expression was measured in ovarian cancer cell lines (n=8) and invasive epithelial ovarian cancer specimens (n=111) and correlated with clinical outcome. Validation was performed with previously published cohorts of ovarian, breast, and lung cancer patients. Anti-Galectin-3 siRNA and shRNA transfections were used for in vitro functional studies. Dicer and Drosha mRNA and protein levels were decreased in 37% to 63% of ovarian cancer cell lines and in 60% and 51% of human ovarian cancer specimens, respectively. Low Dicer was significantly associated with advanced tumor stage (p=0.007), and low Drosha with suboptimal surgical cytoreduction (p=0.02). Tumors with both high Dicer and Drosha were associated with increased median patient survival (>11 years vs. 2.66 years for other groups; p<0.001). In multivariate analysis, high Dicer (HR=0.48; p=0.02), high-grade histology (HR=2.46; p=0.03), and poor chemoresponse (HR=3.95; p<0.001) were identified as independent predictors of disease-specific survival. Findings of poor clinical outcome with low Dicer expression were validated in separate cohorts of cancer patients. Galectin-3 silencing with siRNA transfection was superior to shRNA in cell lines with low Dicer (78-95% vs. 4-8% compared to non-targeting sequences), and similar in cell lines with high Dicer. Our findings demonstrate the clinical and functional impact of RNAi machinery alterations in ovarian carcinoma and support the use of siRNA constructs that do not require endogenous Dicer and Drosha for therapeutic applications.

  3. Survivin knockdown increased anti-cancer effects of (-)-epigallocatechin-3-gallate in human malignant neuroblastoma SK-N-BE2 and SH-SY5Y cells

    Energy Technology Data Exchange (ETDEWEB)

    Hossain, Md. Motarab [Department of Pathology, Microbiology, and Immunology, University of South Carolina School of Medicine, Columbia, SC (United States); Banik, Naren L. [Department of Neurosciences, Medical University of South Carolina, Charleston, SC (United States); Ray, Swapan K., E-mail: swapan.ray@uscmed.sc.edu [Department of Pathology, Microbiology, and Immunology, University of South Carolina School of Medicine, Columbia, SC (United States)

    2012-08-01

    Neuroblastoma is a solid tumor that mostly occurs in children. Malignant neuroblastomas have poor prognosis because conventional chemotherapeutic agents are hardly effective. Survivin, which is highly expressed in some malignant neuroblastomas, plays a significant role in inhibiting differentiation and apoptosis and promoting cell proliferation, invasion, and angiogenesis. We examined consequences of survivin knockdown by survivin short hairpin RNA (shRNA) plasmid and then treatment with (-)-epigallocatechin-3-gallate (EGCG), a green tea flavonoid, in malignant neuroblastoma cells. Our Western blotting and laser scanning confocal immunofluorescence microscopy showed that survivin was highly expressed in malignant neuroblastoma SK-N-BE2 and SH-SY5Y cell lines and slightly in SK-N-DZ cell line. Expression of survivin was very faint in malignant neuroblastoma IMR32 cell line. We transfected SK-N-BE2 and SH-SY-5Y cells with survivin shRNA, treated with EGCG, and confirmed knockdown of survivin at mRNA and protein levels. Survivin knockdown induced morphological features of neuronal differentiation, as we observed following in situ methylene blue staining. Combination of survivin shRNA and EGCG promoted neuronal differentiation biochemically by increases in the expression of NFP, NSE, and e-cadherin and also decreases in the expression of Notch-1, ID2, hTERT, and PCNA. Our in situ Wright staining and Annexin V-FITC/PI staining showed that combination therapy was highly effective in inducing, respectively, morphological and biochemical features of apoptosis. Apoptosis occurred with activation of caspase-8 and cleavage of Bid to tBid, increase in Bax:Bcl-2 ratio, mitochondrial release of cytochrome c, and increases in the expression and activity of calpain and caspase-3. Combination therapy decreased migration of cells through matrigel and inhibited proliferative (p-Akt and NF-{kappa}B), invasive (MMP-2 and MMP-9), and angiogenic (VEGF and b-FGF) factors. Also, in vitro

  4. Survivin knockdown increased anti-cancer effects of (−)-epigallocatechin-3-gallate in human malignant neuroblastoma SK-N-BE2 and SH-SY5Y cells

    International Nuclear Information System (INIS)

    Hossain, Md. Motarab; Banik, Naren L.; Ray, Swapan K.

    2012-01-01

    Neuroblastoma is a solid tumor that mostly occurs in children. Malignant neuroblastomas have poor prognosis because conventional chemotherapeutic agents are hardly effective. Survivin, which is highly expressed in some malignant neuroblastomas, plays a significant role in inhibiting differentiation and apoptosis and promoting cell proliferation, invasion, and angiogenesis. We examined consequences of survivin knockdown by survivin short hairpin RNA (shRNA) plasmid and then treatment with (−)-epigallocatechin-3-gallate (EGCG), a green tea flavonoid, in malignant neuroblastoma cells. Our Western blotting and laser scanning confocal immunofluorescence microscopy showed that survivin was highly expressed in malignant neuroblastoma SK-N-BE2 and SH-SY5Y cell lines and slightly in SK-N-DZ cell line. Expression of survivin was very faint in malignant neuroblastoma IMR32 cell line. We transfected SK-N-BE2 and SH-SY-5Y cells with survivin shRNA, treated with EGCG, and confirmed knockdown of survivin at mRNA and protein levels. Survivin knockdown induced morphological features of neuronal differentiation, as we observed following in situ methylene blue staining. Combination of survivin shRNA and EGCG promoted neuronal differentiation biochemically by increases in the expression of NFP, NSE, and e-cadherin and also decreases in the expression of Notch-1, ID2, hTERT, and PCNA. Our in situ Wright staining and Annexin V-FITC/PI staining showed that combination therapy was highly effective in inducing, respectively, morphological and biochemical features of apoptosis. Apoptosis occurred with activation of caspase-8 and cleavage of Bid to tBid, increase in Bax:Bcl-2 ratio, mitochondrial release of cytochrome c, and increases in the expression and activity of calpain and caspase-3. Combination therapy decreased migration of cells through matrigel and inhibited proliferative (p-Akt and NF-κB), invasive (MMP-2 and MMP-9), and angiogenic (VEGF and b-FGF) factors. Also, in vitro

  5. A fast, simple method for screening radiation susceptibility genes by RNA interference

    International Nuclear Information System (INIS)

    Tsuji, Atsushi B.; Sudo, Hitomi; Sugyo, Aya; Otsuki, Marika; Miyagishi, Makoto; Taira, Kazunari; Imai, Takashi; Harada, Yoshi-nobu

    2005-01-01

    Radiotherapy can cause unacceptable levels of damage to normal tissues in some cancer patients. To understand the molecular mechanisms underlying radiation-induced physiological responses, and to be able to predict the radiation susceptibility of normal tissues in individual patients, it is important to identify a comprehensive set of genes responsible for radiation susceptibility. We have developed a simple and rapid 96-well screening protocol using cell proliferation assays and RNA interference to identify genes associated with radiation susceptibility. We evaluated the performance of alamarBlue-, BrdU-, and sulforhodamine B-based cell proliferation assays using the 96-well format. Each proliferation assay detected the known radiation susceptibility gene, PRKDC. In a trial screen using 28 shRNA vectors, another known gene, CDKN1A, and one new radiation susceptibility gene, ATP5G3, were identified. Our results indicate that this method may be useful for large-scale screens designed to identify novel radiation susceptibility genes

  6. RNA interference mediated pten knock-down inhibit the formation of polycystic ovary.

    Science.gov (United States)

    Ouyang, Jie-Xiu; Luo, Tao; Sun, Hui-Yun; Huang, Jian; Tang, Dan-Feng; Wu, Lei; Zheng, Yue-Hui; Zheng, Li-Ping

    2013-08-01

    Pten (phosphatase and tensin homolog deleted on chromosome 10), a kind of tumor suppressor gene, plays important roles in female reproductive system. But its expression and roles in the formation of polycystic ovaries are yet to be known. In this study, we constructed a rat model of PCOS using norethindrone and HCG injections and found the expressions of pten mRNA and PTEN protein increased significantly in the polycystic ovary tissue by immunohistochemistry, RT-PCR, and western blot. Furthermore, the results showed that in vivo ovaries could be effectively transfected by lentiviral vectors through the ovarian microinjection method and indicated that pten shRNA may inhibit the formation of polycystic ovaries by pten down-regulation. Our study provides new information regarding the role of PTEN in female reproductive disorders, such as polycystic ovary syndrome.

  7. Synthetic RNAs for Gene Regulation: Design Principles and Computational Tools

    International Nuclear Information System (INIS)

    Laganà, Alessandro; Shasha, Dennis; Croce, Carlo Maria

    2014-01-01

    The use of synthetic non-coding RNAs for post-transcriptional regulation of gene expression has not only become a standard laboratory tool for gene functional studies but it has also opened up new perspectives in the design of new and potentially promising therapeutic strategies. Bioinformatics has provided researchers with a variety of tools for the design, the analysis, and the evaluation of RNAi agents such as small-interfering RNA (siRNA), short-hairpin RNA (shRNA), artificial microRNA (a-miR), and microRNA sponges. More recently, a new system for genome engineering based on the bacterial CRISPR-Cas9 system (Clustered Regularly Interspaced Short Palindromic Repeats), was shown to have the potential to also regulate gene expression at both transcriptional and post-transcriptional level in a more specific way. In this mini review, we present RNAi and CRISPRi design principles and discuss the advantages and limitations of the current design approaches.

  8. Synthetic RNAs for Gene Regulation: Design Principles and Computational Tools

    Energy Technology Data Exchange (ETDEWEB)

    Laganà, Alessandro [Department of Molecular Virology, Immunology and Medical Genetics, Comprehensive Cancer Center, The Ohio State University, Columbus, OH (United States); Shasha, Dennis [Courant Institute of Mathematical Sciences, New York University, New York, NY (United States); Croce, Carlo Maria [Department of Molecular Virology, Immunology and Medical Genetics, Comprehensive Cancer Center, The Ohio State University, Columbus, OH (United States)

    2014-12-11

    The use of synthetic non-coding RNAs for post-transcriptional regulation of gene expression has not only become a standard laboratory tool for gene functional studies but it has also opened up new perspectives in the design of new and potentially promising therapeutic strategies. Bioinformatics has provided researchers with a variety of tools for the design, the analysis, and the evaluation of RNAi agents such as small-interfering RNA (siRNA), short-hairpin RNA (shRNA), artificial microRNA (a-miR), and microRNA sponges. More recently, a new system for genome engineering based on the bacterial CRISPR-Cas9 system (Clustered Regularly Interspaced Short Palindromic Repeats), was shown to have the potential to also regulate gene expression at both transcriptional and post-transcriptional level in a more specific way. In this mini review, we present RNAi and CRISPRi design principles and discuss the advantages and limitations of the current design approaches.

  9. High-throughput screening of effective siRNAs using luciferase-linked chimeric mRNA.

    Directory of Open Access Journals (Sweden)

    Shen Pang

    Full Text Available The use of siRNAs to knock down gene expression can potentially be an approach to treat various diseases. To avoid siRNA toxicity the less transcriptionally active H1 pol III promoter, rather than the U6 promoter, was proposed for siRNA expression. To identify highly efficacious siRNA sequences, extensive screening is required, since current computer programs may not render ideal results. Here, we used CCR5 gene silencing as a model to investigate a rapid and efficient screening approach. We constructed a chimeric luciferase-CCR5 gene for high-throughput screening of siRNA libraries. After screening approximately 900 shRNA clones, 12 siRNA sequences were identified. Sequence analysis demonstrated that most (11 of the 12 sequences of these siRNAs did not match those identified by available siRNA prediction algorithms. Significant inhibition of CCR5 in a T-lymphocyte cell line and primary T cells by these identified siRNAs was confirmed using the siRNA lentiviral vectors to infect these cells. The inhibition of CCR5 expression significantly protected cells from R5 HIV-1JRCSF infection. These results indicated that the high-throughput screening method allows efficient identification of siRNA sequences to inhibit the target genes at low levels of expression.

  10. Targeting RNA transcription and translation in ovarian cancer cells with pharmacological inhibitor CDKI-73.

    Science.gov (United States)

    Lam, Frankie; Abbas, Abdullahi Y; Shao, Hao; Teo, Theodosia; Adams, Julian; Li, Peng; Bradshaw, Tracey D; Fischer, Peter M; Walsby, Elisabeth; Pepper, Chris; Chen, Yi; Ding, Jian; Wang, Shudong

    2014-09-15

    Dysregulation of cellular transcription and translation is a fundamental hallmark of cancer. As CDK9 and Mnks play pivotal roles in the regulation of RNA transcription and protein synthesis, respectively, they are important targets for drug development. We herein report the cellular mechanism of a novel CDK9 inhibitor CDKI-73 in an ovarian cancer cell line (A2780). We also used shRNA-mediated CDK9 knockdown to investigate the importance of CDK9 in the maintenance of A2780 cells. This study revealed that CDKI-73 rapidly inhibited cellular CDK9 kinase activity and down-regulated the RNAPII phosphorylation. This subsequently caused a decrease in the eIF4E phosphorylation by blocking Mnk1 kinase activity. Consistently, CDK9 shRNA was also found to down-regulate the Mnk1 expression. Both CDKI-73 and CDK9 shRNA decreased anti-apoptotic proteins Mcl-1 and Bcl-2 and induced apoptosis. The study confirmed that CDK9 is required for cell survival and that ovarian cancer may be susceptible to CDK9 inhibition strategy. The data also implied a role of CDK9 in eIF4E-mediated translational control, suggesting that CDK9 may have important implication in the Mnk-eIF4E axis, the key determinants of PI3K/Akt/mTOR- and Ras/Raf/MAPK-mediated tumorigenic activity. As such, CDK9 inhibitor drug candidate CDKI-73 should have a major impact on these pathways in human cancers.

  11. Sipi soup inhibits cancer‑associated fibroblast activation and the inflammatory process by downregulating long non‑coding RNA HIPK1‑AS.

    Science.gov (United States)

    Zhou, Bingxiu; Yu, Yuanyuan; Yu, Lixia; Que, Binfu; Qiu, Rui

    2018-06-06

    Sipi soup (SPS), the aqueous extract derived from the root bark of Sophora japonical L, Salix babylonica L., Morus alba L., as well as Amygdalus davidiana (Carr.) C. de Vos, is a traditional Chinese medicine frequently used to prevent and treat infection and inflammation. However, the role of SPS in cancer‑associated fibroblasts (CAFs) require further investigation. In the present study, the effects of SPS on fibroblast inactivation and the underlying mechanism were investigated. Reverse transcription‑quantitative polymerase chain reaction was used to analyze the mRNA expression levels of fibroblast activation protein (FAP), interleukin (IL)‑6, α‑smooth muscle actin (α‑SMA) and programmed cell death 4 (PDCD4). Flow cytometry was used to evaluate cell apoptosis. Immunofluorescence was used to determine the number of activated fibroblasts. The present study reported that SPS treatment did not affect the proliferative apoptotic potential of fibroblasts. Treatment with HeLa cell culture medium (CM) induced a significant increase in the expression levels of FAP, IL‑6 and α‑SMA, but reduced the expression of PDCD4. SPS reversed the effects of HeLa CM on the expression of these genes. Analysis with a long non‑coding (lnc)RNA array of numerous differentially expressed lncRNAs revealed that the expression levels of the lncRNA homeodomain‑interacting protein kinase 1 antisense RNA (HIPK1‑AS) were increased in cervicitis tissues and cervical squamous cell carcinoma tissues compared with in normal cervical tissues. HIPK1‑AS expression levels were upregulated in response to HeLa CM, but were decreased under SPS treatment. The downregulation of HIPK1‑AS expression via short hairpin RNA abolished the effects of HeLa CM on the expression of inflammation‑associated genes. The findings of the present study suggested that SPS may prevent the progression of cervical cancer by inhibiting the activation of CAF and the inflammatory process by reducing HIPK1

  12. TRB3 reverses chemotherapy resistance and mediates crosstalk between endoplasmic reticulum stress and AKT signaling pathways in MHCC97H human hepatocellular carcinoma cells.

    Science.gov (United States)

    Li, Yang; Zhu, Danxi; Hou, Lidan; Hu, Bin; Xu, Min; Meng, Xiangjun

    2018-01-01

    Tribbles homolog 3 (TRB3), a type of pseudokinase that contains a consensus serine/threonine kinase catalytic core structure, is upregulated in hepatocellular carcinoma. However, the effect of TRB3 expression in hepatocellular carcinoma and the molecular mechanisms underlying TRB3-mediated effects on tumorigenesis in hepatocellular carcinoma have not been fully elucidated. The present study focused on the effect of TRB3 expression in MHCC97H hepatocellular carcinoma cells and investigated the underlying molecular mechanisms in MHCC97H cells. In the present study, it was revealed that TRB3 was significantly overexpressed in the MHCC97H hepatocellular carcinoma cell compared with L-02 normal hepatic cells. Under endoplasmic reticulum (ER) stress induced by thapsigargin and tunicamycin, the levels of TRB3, CCAAT/enhancer binding protein homologous protein (CHOP), protein kinase B (AKT) and phosphorylated (p)AKT expression were upregulated. Furthermore, when the expression of TRB3 was silenced by short hairpin (sh)RNA, the survival of MHCC97H hepatocellular carcinoma cells was increased. Notably, following transduction with lentiviral containing TRB3-shRNA, cell survival also increased after treatment with chemotherapy drug cisplatin. The present study demonstrated that knockdown of CHOP by shRNA was able to reduce TRB3 expression, and the knockdown of TRB3 markedly increased the level of pAKT. TRB3 was overexpressed in MHCC97H hepatocellular carcinoma cells, particularly under endoplasmic reticulum stress. Knockdown of TRB3 was able to increase cell survival. Therefore, TRB3 expression may induce apoptosis and reverse resistance to chemotherapy in MHCC97H hepatic carcinoma cells. The present study suggests that TRB3 is a key molecule that mediates the crosstalk between ER stress and AKT signal pathways. Furthermore, the present study may provide further insight into the cancer biology of hepatocellular carcinoma and the development of anticancer drugs targeting the ER

  13. [Construction of lentiviral mediated CyPA siRNA and its functions in non-small cell lung cancer].

    Science.gov (United States)

    FENG, Yan-ming; WU, Yi-ming; TU, Xin-ming; XU, Zheng-shun; WU, Wei-dong

    2010-02-01

    To construct a lentiviral-vector-mediated CyPA small interference RNA (siRNA) and study its function in non-small cell lung cancer. First, four target sequences were selected according to CyPA mRNA sequence, the complementary DNA contained both sense and antisense oligonucleotides were designed, synthesized and cloned into the pGCL-GFP vector, which contained U6 promoter and green fluorescent protein (GFP). The resulting lentiviral vector containing CyPA shRNA was named Lv-shCyPA, and it was confirmed by PCR and sequencing. Next, it was cotransfected by Lipofectamine 2000 along with pHelper1.0 and pHelper 2.0 into 293T cells to package lentivirus particles. At the same time, the packed virus infected non-small cell lung cancer cell (A549), the level of CyPA protein at 5 d after infection was detected by Western Blot to screen the target of CyPA. A549 were infected with Lv-shCyPA and grown as xenografts in severe combined immunodeficient mice. Cell cycle and apoptosis were measured by FCM. It was confirmed by PCR and DNA sequencing that lentiviral-vector-mediated CyPA siRNA (Lv-shCyPA) producing CyPA shRNA was constructed successfully. The titer of concentrated virus were 1 x 10(7) TU/ml. Flow cytometric analysis demonstrated G2-M phase (11.40% +/- 0.68%) was decreased relatively in A549/LvshCyPA compared with control groups (14.52% +/- 1.19%) (Ppathways may lead to new targeted therapies for non-small cell lung cancer.

  14. Extracellular RNA Communication (ExRNA)

    Data.gov (United States)

    Federal Laboratory Consortium — Until recently, scientists believed RNA worked mostly inside the cell that produced it. Some types of RNA help translate genes into proteins that are necessary for...

  15. Knockdown of HOXA10 reverses the multidrug resistance of human chronic mylogenous leukemia K562/ADM cells by downregulating P-gp and MRP-1.

    Science.gov (United States)

    Yi, Ying-Jie; Jia, Xiu-Hong; Wang, Jian-Yong; Li, You-Jie; Wang, Hong; Xie, Shu-Yang

    2016-05-01

    Multidrug resistance (MDR) of leukemia cells is a major obstacle in chemotherapeutic treatment. The high expression and constitutive activation of P-glycoprotein (P-gp) and multidrug resistance protein-1 (MRP-1) have been reported to play a vital role in enhancing cell resistance to anticancer drugs in many tumors. The present study aimed to investigate the reversal of MDR by silencing homeobox A10 (HOXA10) in adriamycin (ADR)-resistant human chronic myelogenous leukemia (CML) K562/ADM cells by modulating the expression of P-gp and MRP-1. K562/ADM cells were stably transfected with HOXA10-targeted short hairpin RNA (shRNA). The results of reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and western blot analysis showed that the mRNA and protein expression of HOXA10 was markedly suppressed following transfection with a shRNA-containing vector. The sensitivity of the K562/ADM cells to ADR was enhanced by the silencing of HOXA10, due to the increased intracellular accumulation of ADR. The accumulation of ADR induced by the silencing of HOXA10 may be due to the downregulation of P-gp and MRP-1. Western blot analysis revealed that downregulating HOXA10 inhibited the protein expression of P-gp and MRP-1. Taken together, these results suggest that knockdown of HOXA10 combats resistance and that HOXA10 is a potential target for resistant human CML.

  16. Silencing the Girdin gene enhances radio-sensitivity of hepatocellular carcinoma via suppression of glycolytic metabolism.

    Science.gov (United States)

    Yu, Li; Sun, Yifan; Li, Jingjing; Wang, Yan; Zhu, Yuxing; Shi, Yong; Fan, Xiaojun; Zhou, Jianda; Bao, Ying; Xiao, Jie; Cao, Ke; Cao, Peiguo

    2017-08-15

    Radiotherapy has been used increasingly to treat primary hepatocellular carcinoma. Clinically, the main cause of radiotherapy failure is cellular radioresistance, conferred via glycolytic metabolism. Our previous study demonstrated that Girdin is upregulated in primary hepatocellular carcinoma and promotes the invasion and metastasis of tumor cells. However, whether Girdin underlies the radio-sensitivity of hepatocellular carcinoma remains unclear. A short hairpin RNA (shRNA) was used to silence CCDC88A (encoding Girdin), and real-time PCR was performed to determine CCDC88A mRNA expression. Then, cell proliferation, colony formation, flow cytometric, scratch, and transwell assays were to examine the influence of Girdin silencing on cellular radiosensitivity. Glycolysis assays were conducted to exam cell glycolysis process. Western blotting was performed to explore the signaling pathway downstream of Girdin. Finally, animal experiments were performed to demonstrate the effect of CCDC88A silencing on the radiosensitivity of hepatoma in vivo. shRNA-induced Girdin silencing suppressed glycolysis and enhanced the radio-sensitivity of hepatic cell lines, HepG2 and Huh-7. Furthermore, silencing of Girdin inhibited the PI3K/AKT/HIF-1α signaling pathway, which is a central regulator of glycolysis. Girdin can regulate glycolysis in hepatocellular carcinoma cells through the PI3K/AKT/HIF-1α signaling pathway, which decreases the sensitivity of tumor cells to radiotherapy.

  17. Knockdown of ZFR suppresses cell proliferation and invasion of human pancreatic cancer

    Directory of Open Access Journals (Sweden)

    Xiaolan Zhao

    Full Text Available BACKGROUND: Zinc finger RNA binding protein (ZFR is involved in the regulation of growth and cancer development. However, little is known about ZFR function in pancreatic cancer. METHODS: Herein, to investigate whether ZFR is involved in tumor growth, Oncomine microarray data was firstly used to evaluate ZFR gene expression in human pancreatic tumors. Then short hairpin RNA (shRNA targeting ZFR was designed and delivered into PANC-1 pancreatic cancer cells to knock down ZFR expression. Cell viability, cell proliferation and cell cycle analysis after ZFR knockdown were determined by MTT, colony forming and FACS, respectively. In addition, cell migration and invasion were assessed using the Transwell system. RESULTS: The expression of ZFR was significantly higher in pancreatic tumors than normal pancreas tissues by Oncomine database analysis. Knockdown of ZFR by shRNA-expressing lentivirus significantly decreased the viability and invasion ability of pancreatic cancer cells. Moreover, FACS analysis showed that knockdown of ZFR in PANC-1 cells caused a significant cell cycle arrest at G0/G1 phase. Furthermore, knockdown of ZFR decreased the levels of CDK2, CDK4, CyclinA and CyclinD1 and enhanced the expression of p27, which has evidenced by qRT-PCR and Western blot analysis. CONCLUSIONS: Knockdown of ZFR might provide a novel alternative to targeted therapy of pancreatic cancer and deserves further investigation.

  18. ATM-Dependent Phosphorylation of MEF2D Promotes Neuronal Survival after DNA Damage

    Science.gov (United States)

    Chan, Shing Fai; Sances, Sam; Brill, Laurence M.; Okamoto, Shu-ichi; Zaidi, Rameez; McKercher, Scott R.; Akhtar, Mohd W.; Nakanishi, Nobuki

    2014-01-01

    Mutations in the ataxia telangiectasia mutated (ATM) gene, which encodes a kinase critical for the normal DNA damage response, cause the neurodegenerative disorder ataxia-telangiectasia (AT). The substrates of ATM in the brain are poorly understood. Here we demonstrate that ATM phosphorylates and activates the transcription factor myocyte enhancer factor 2D (MEF2D), which plays a critical role in promoting survival of cerebellar granule cells. ATM associates with MEF2D after DNA damage and phosphorylates the transcription factor at four ATM consensus sites. Knockdown of endogenous MEF2D with a short-hairpin RNA (shRNA) increases sensitivity to etoposide-induced DNA damage and neuronal cell death. Interestingly, substitution of endogenous MEF2D with an shRNA-resistant phosphomimetic MEF2D mutant protects cerebellar granule cells from cell death after DNA damage, whereas an shRNA-resistant nonphosphorylatable MEF2D mutant does not. In vivo, cerebella in Mef2d knock-out mice manifest increased susceptibility to DNA damage. Together, our results show that MEF2D is a substrate for phosphorylation by ATM, thus promoting survival in response to DNA damage. Moreover, dysregulation of the ATM–MEF2D pathway may contribute to neurodegeneration in AT. PMID:24672010

  19. Effect of proline rich 15-deficiency on trophoblast viability and survival.

    Directory of Open Access Journals (Sweden)

    Katherine C Gates

    Full Text Available Deviations from the normal program of gene expression during early pregnancy can lead to early embryonic loss as well as dysfunctional placentation, which can cause significant morbidity and mortality. Proline rich 15 (PRR15 is a low molecular weight nuclear protein expressed by the trophoblast during early gestation. Lentivirus-mediated knockdown of PRR15 mRNA in ovine trophectoderm led to demise of the embryo by gestational day 15, providing compelling evidence that PRR15 expression is critical during this precarious window of development. Our objective was to determine the effect of PRR15 knockdown on trophoblast gene expression, proliferation, and survival. The first-trimester human trophoblast cell line, ACH-3P, was infected with control lentivirus or a lentivirus expressing a short hairpin (shRNA to target PRR15 mRNA for degradation, resulting in a 68% reduction in PRR15 mRNA. Microarray analysis of these cell lines revealed differential expression of genes related to cancer, focal adhesion, and p53 signaling. These changes included significant up-regulation of GDF15, a cytokine increased in pregnancies with preeclampsia. Viability and proliferation decreased in PRR15-deficient cells, which was consistent with down-regulation of cell cycle-related genes CCND1 and CDK6 and an up-regulation of CCNG2 and CDKN1A in the PRR15-deficient cells. TNFSF10, a tumor necrosis factor superfamily member known to induce apoptosis increased significantly in the PRR15-deficient cells. Migration through a basement membrane matrix decreased and an increased population of apoptotic cells was present when treated with shRNA to target PRR15. These results suggest that PRR15 enhances trophoblast viability and survival during early implantation and placentation.

  20. Combinatorics of RNA-RNA interaction

    DEFF Research Database (Denmark)

    Li, Thomas J X; Reidys, Christian

    2012-01-01

    RNA-RNA binding is an important phenomenon observed for many classes of non-coding RNAs and plays a crucial role in a number of regulatory processes. Recently several MFE folding algorithms for predicting the joint structure of two interacting RNA molecules have been proposed. Here joint structure...... means that in a diagram representation the intramolecular bonds of each partner are pseudoknot-free, that the intermolecular binding pairs are noncrossing, and that there is no so-called "zigzag" configuration. This paper presents the combinatorics of RNA interaction structures including...

  1. IBTK Differently Modulates Gene Expression and RNA Splicing in HeLa and K562 Cells

    Directory of Open Access Journals (Sweden)

    Giuseppe Fiume

    2016-11-01

    Full Text Available The IBTK gene encodes the major protein isoform IBTKα that was recently characterized as substrate receptor of Cul3-dependent E3 ligase, regulating ubiquitination coupled to proteasomal degradation of Pdcd4, an inhibitor of translation. Due to the presence of Ankyrin-BTB-RCC1 domains that mediate several protein-protein interactions, IBTKα could exert expanded regulatory roles, including interaction with transcription regulators. To verify the effects of IBTKα on gene expression, we analyzed HeLa and K562 cell transcriptomes by RNA-Sequencing before and after IBTK knock-down by shRNA transduction. In HeLa cells, 1285 (2.03% of 63,128 mapped transcripts were differentially expressed in IBTK-shRNA-transduced cells, as compared to cells treated with control-shRNA, with 587 upregulated (45.7% and 698 downregulated (54.3% RNAs. In K562 cells, 1959 (3.1% of 63128 mapped RNAs were differentially expressed in IBTK-shRNA-transduced cells, including 1053 upregulated (53.7% and 906 downregulated (46.3%. Only 137 transcripts (0.22% were commonly deregulated by IBTK silencing in both HeLa and K562 cells, indicating that most IBTKα effects on gene expression are cell type-specific. Based on gene ontology classification, the genes responsive to IBTK are involved in different biological processes, including in particular chromatin and nucleosomal organization, gene expression regulation, and cellular traffic and migration. In addition, IBTK RNA interference affected RNA maturation in both cell lines, as shown by the evidence of alternative 3′- and 5′-splicing, mutually exclusive exons, retained introns, and skipped exons. Altogether, these results indicate that IBTK differently modulates gene expression and RNA splicing in HeLa and K562 cells, demonstrating a novel biological role of this protein.

  2. IBTK Differently Modulates Gene Expression and RNA Splicing in HeLa and K562 Cells.

    Science.gov (United States)

    Fiume, Giuseppe; Scialdone, Annarita; Rizzo, Francesca; De Filippo, Maria Rosaria; Laudanna, Carmelo; Albano, Francesco; Golino, Gaetanina; Vecchio, Eleonora; Pontoriero, Marilena; Mimmi, Selena; Ceglia, Simona; Pisano, Antonio; Iaccino, Enrico; Palmieri, Camillo; Paduano, Sergio; Viglietto, Giuseppe; Weisz, Alessandro; Scala, Giuseppe; Quinto, Ileana

    2016-11-07

    The IBTK gene encodes the major protein isoform IBTKα that was recently characterized as substrate receptor of Cul3-dependent E3 ligase, regulating ubiquitination coupled to proteasomal degradation of Pdcd4, an inhibitor of translation. Due to the presence of Ankyrin-BTB-RCC1 domains that mediate several protein-protein interactions, IBTKα could exert expanded regulatory roles, including interaction with transcription regulators. To verify the effects of IBTKα on gene expression, we analyzed HeLa and K562 cell transcriptomes by RNA-Sequencing before and after IBTK knock-down by shRNA transduction. In HeLa cells, 1285 (2.03%) of 63,128 mapped transcripts were differentially expressed in IBTK -shRNA-transduced cells, as compared to cells treated with control-shRNA, with 587 upregulated (45.7%) and 698 downregulated (54.3%) RNAs. In K562 cells, 1959 (3.1%) of 63128 mapped RNAs were differentially expressed in IBTK -shRNA-transduced cells, including 1053 upregulated (53.7%) and 906 downregulated (46.3%). Only 137 transcripts (0.22%) were commonly deregulated by IBTK silencing in both HeLa and K562 cells, indicating that most IBTKα effects on gene expression are cell type-specific. Based on gene ontology classification, the genes responsive to IBTK are involved in different biological processes, including in particular chromatin and nucleosomal organization, gene expression regulation, and cellular traffic and migration. In addition, IBTK RNA interference affected RNA maturation in both cell lines, as shown by the evidence of alternative 3'- and 5'-splicing, mutually exclusive exons, retained introns, and skipped exons. Altogether, these results indicate that IBTK differently modulates gene expression and RNA splicing in HeLa and K562 cells, demonstrating a novel biological role of this protein.

  3. The Role of Repeat Administration of Adventitial Delivery of Lentivirus-shRNA-Vegf-A in Arteriovenous Fistula to Prevent Venous Stenosis Formation.

    Science.gov (United States)

    Janardhanan, Rajiv; Yang, Binxia; Kilari, Sreenivasulu; Leof, Edward B; Mukhopadhyay, Debabrata; Misra, Sanjay

    2016-04-01

    To determine if a second dose of a lentivirus mediated small hairpin RNA that inhibits Vegf-A gene expression (LV-shRNA-Vegf-A) can improve lumen vessel area (LVA) of the outflow vein of an arteriovenous fistula (AVF) and decrease venous neointimal hyperplasia. Chronic kidney disease was created in C57BL/6 mice; 28 days later, an AVF was created by connecting the right carotid artery to the ipsilateral jugular vein. Immediately after AVF creation, 5 × 10(6) plaque-forming units of LV-shRNA-Vegf-A or control shRNA was administered to the adventitia of the outflow vein, and a second dose of the same treatment was administered 14 days later. Animals were sacrificed at 21 days, 28 days, and 42 days after AVF creation for reverse transcription polymerase chain reaction and histomorphometric analyses. By day 21, there was a 125% increase in the average LVA (day 21, P = .11), with a decrease in cell proliferation (day 21, P = .0079; day 28, P = .28; day 42, P = .5), decrease in α-smooth muscle cell actin staining (day 21, P < .0001; day 28, P < .05; day 42, P = .59), and decrease in hypoxic stress (day 21, P < .001; day 28, P = .28; day 42, P = .46) in LV versus control shRNA vessels. A second dose of LV-shRNA-Vegf-A administration results in a moderate improvement in LVA at day 21. Copyright © 2016 SIR. Published by Elsevier Inc. All rights reserved.

  4. Idh2 Deficiency Exacerbates Acrolein-Induced Lung Injury through Mitochondrial Redox Environment Deterioration

    Directory of Open Access Journals (Sweden)

    Jung Hyun Park

    2017-01-01

    Full Text Available Acrolein is known to be involved in acute lung injury and other pulmonary diseases. A number of studies have suggested that acrolein-induced toxic effects are associated with depletion of antioxidants, such as reduced glutathione and protein thiols, and production of reactive oxygen species. Mitochondrial NADP+-dependent isocitrate dehydrogenase (idh2 regulates mitochondrial redox balance and reduces oxidative stress-induced cell injury via generation of NADPH. Therefore, we evaluated the role of idh2 in acrolein-induced lung injury using idh2 short hairpin RNA- (shRNA- transfected Lewis lung carcinoma (LLC cells and idh2-deficient (idh2−/− mice. Downregulation of idh2 expression increased susceptibility to acrolein via induction of apoptotic cell death due to elevated mitochondrial oxidative stress. Idh2 deficiency also promoted acrolein-induced lung injury in idh2 knockout mice through the disruption of mitochondrial redox status. In addition, acrolein-induced toxicity in idh2 shRNA-transfected LLC cells and in idh2 knockout mice was ameliorated by the antioxidant, N-acetylcysteine, through attenuation of oxidative stress resulting from idh2 deficiency. In conclusion, idh2 deficiency leads to mitochondrial redox environment deterioration, which causes acrolein-mediated apoptosis of LLC cells and acrolein-induced lung injury in idh2−/− mice. The present study supports the central role of idh2 deficiency in inducing oxidative stress resulting from acrolein-induced disruption of mitochondrial redox status in the lung.

  5. Idh2 Deficiency Exacerbates Acrolein-Induced Lung Injury through Mitochondrial Redox Environment Deterioration.

    Science.gov (United States)

    Park, Jung Hyun; Ku, Hyeong Jun; Lee, Jin Hyup; Park, Jeen-Woo

    2017-01-01

    Acrolein is known to be involved in acute lung injury and other pulmonary diseases. A number of studies have suggested that acrolein-induced toxic effects are associated with depletion of antioxidants, such as reduced glutathione and protein thiols, and production of reactive oxygen species. Mitochondrial NADP + -dependent isocitrate dehydrogenase ( idh2 ) regulates mitochondrial redox balance and reduces oxidative stress-induced cell injury via generation of NADPH. Therefore, we evaluated the role of idh2 in acrolein-induced lung injury using idh2 short hairpin RNA- (shRNA-) transfected Lewis lung carcinoma (LLC) cells and idh2 -deficient ( idh2 -/- ) mice. Downregulation of idh2 expression increased susceptibility to acrolein via induction of apoptotic cell death due to elevated mitochondrial oxidative stress. Idh2 deficiency also promoted acrolein-induced lung injury in idh2 knockout mice through the disruption of mitochondrial redox status. In addition, acrolein-induced toxicity in idh2 shRNA-transfected LLC cells and in idh2 knockout mice was ameliorated by the antioxidant, N-acetylcysteine, through attenuation of oxidative stress resulting from idh2 deficiency. In conclusion, idh2 deficiency leads to mitochondrial redox environment deterioration, which causes acrolein-mediated apoptosis of LLC cells and acrolein-induced lung injury in idh2 -/- mice. The present study supports the central role of idh2 deficiency in inducing oxidative stress resulting from acrolein-induced disruption of mitochondrial redox status in the lung.

  6. Lentiviral Vector Mediated Claudin1 Silencing Inhibits Epithelial to Mesenchymal Transition in Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Xianqi Zhao

    2015-06-01

    Full Text Available Breast cancer has a high incidence and mortality rate worldwide. Several viral vectors including lentiviral, adenoviral and adeno-associated viral vectors have been used in gene therapy for various forms of human cancer, and have shown promising effects in controlling tumor development. Claudin1 (CLDN1 is a member of the tetraspan transmembrane protein family that plays a major role in tight junctions and is associated with tumor metastasis. However, the role of CLDN1 in breast cancer is largely unexplored. In this study, we tested the therapeutic potential of silencing CLDN1 expression in two breast cancer (MDA-MB-231 and MCF7 cell lines using lentiviral vector mediated RNA interference. We found that a CLDN1 short hairpin (shRNA construct efficiently silenced CLDN1 expression in both breast cancer cell lines, and CLDN1 knockdown resulted in reduced cell proliferation, survival, migration and invasion. Furthermore, silencing CLDN1 inhibited epithelial to mesenchymal transition (EMT by upregulating the epithelial cell marker, E-cadherin, and downregulating mesenchymal markers, smooth muscle cell alpha-actin (SMA and Snai2. Our data demonstrated that lentiviral vector mediated CLDN1 RNA interference has great potential in breast cancer gene therapy by inhibiting EMT and controlling tumor cell growth.

  7. The MCM-associated protein MCM-BP is important for human nuclear morphology.

    Science.gov (United States)

    Jagannathan, Madhav; Sakwe, Amos M; Nguyen, Tin; Frappier, Lori

    2012-01-01

    Mini-chromosome maintenance complex-binding protein (MCM-BP) was discovered as a protein that is strongly associated with human MCM proteins, known to be crucial for DNA replication in providing DNA helicase activity. The Xenopus MCM-BP homologue appears to play a role in unloading MCM complexes from chromatin after DNA synthesis; however, the importance of MCM-BP and its functional contribution to human cells has been unclear. Here we show that depletion of MCM-BP by sustained expression of short hairpin RNA (shRNA) results in highly abnormal nuclear morphology and centrosome amplification. The abnormal nuclear morphology was not seen with depletion of other MCM proteins and was rescued with shRNA-resistant MCM-BP. MCM-BP depletion was also found to result in transient activation of the G2 checkpoint, slowed progression through G2 and increased replication protein A foci, indicative of replication stress. In addition, MCM-BP depletion led to increased cellular levels of MCM proteins throughout the cell cycle including soluble MCM pools. The results suggest that MCM-BP makes multiple contributions to human cells that are not limited to unloading of the MCM complex.

  8. Inactivation of a single copy of Crebbp selectively alters pre-mRNA processing in mouse hematopoietic stem cells.

    Directory of Open Access Journals (Sweden)

    Madeleine E Lemieux

    Full Text Available Global expression analysis of fetal liver hematopoietic stem cells (FL HSCs revealed the presence of unspliced pre-mRNA for a number of genes in normal FL HSCs. In a subset of these genes, Crebbp+/- FL HSCs had less unprocessed pre-mRNA without a corresponding reduction in total mRNA levels. Among the genes thus identified were the key regulators of HSC function Itga4, Msi2 and Tcf4. A similar but much weaker effect was apparent in Ep300+/- FL HSCs, indicating that, in this context as in others, the two paralogs are not interchangeable. As a group, the down-regulated intronic probe sets could discriminate adult HSCs from more mature cell types, suggesting that the underlying mechanism is regulated with differentiation stage and is active in both fetal and adult hematopoiesis. Consistent with increased myelopoiesis in Crebbp hemizygous mice, targeted reduction of CREBBP abundance by shRNA in the multipotent EML cell line triggered spontaneous myeloid differentiation in the absence of the normally required inductive signals. In addition, differences in protein levels between phenotypically distinct EML subpopulations were better predicted by taking into account not only the total mRNA signal but also the amount of unspliced message present. CREBBP thus appears to selectively influence the timing and degree of pre-mRNA processing of genes essential for HSC regulation and thereby has the potential to alter subsequent cell fate decisions in HSCs.

  9. A novel vector-based method for exclusive overexpression of star-form microRNAs.

    Directory of Open Access Journals (Sweden)

    Bo Qu

    Full Text Available The roles of microRNAs (miRNAs as important regulators of gene expression have been studied intensively. Although most of these investigations have involved the highly expressed form of the two mature miRNA species, increasing evidence points to essential roles for star-form microRNAs (miRNA*, which are usually expressed at much lower levels. Owing to the nature of miRNA biogenesis, it is challenging to use plasmids containing miRNA coding sequences for gain-of-function experiments concerning the roles of microRNA* species. Synthetic microRNA mimics could introduce specific miRNA* species into cells, but this transient overexpression system has many shortcomings. Here, we report that specific miRNA* species can be overexpressed by introducing artificially designed stem-loop sequences into short hairpin RNA (shRNA overexpression vectors. By our prototypic plasmid, designed to overexpress hsa-miR-146b-3p, we successfully expressed high levels of hsa-miR-146b-3p without detectable change of hsa-miR-146b-5p. Functional analysis involving luciferase reporter assays showed that, like natural miRNAs, the overexpressed hsa-miR-146b-3p inhibited target gene expression by 3'UTR seed pairing. Our demonstration that this method could overexpress two other miRNAs suggests that the approach should be broadly applicable. Our novel strategy opens the way for exclusively stable overexpression of miRNA* species and analyzing their unique functions both in vitro and in vivo.

  10. RNA modifications by oxidation

    DEFF Research Database (Denmark)

    Poulsen, Henrik E; Specht, Elisabeth; Broedbaek, Kasper

    2012-01-01

    to encompass various classes of novel regulatory RNAs, including, e.g., microRNAs. It is well known that DNA is constantly oxidized and repaired by complex genome maintenance mechanisms. Analogously, RNA also undergoes significant oxidation, and there are now convincing data suggesting that oxidation......The past decade has provided exciting insights into a novel class of central (small) RNA molecules intimately involved in gene regulation. Only a small percentage of our DNA is translated into proteins by mRNA, yet 80% or more of the DNA is transcribed into RNA, and this RNA has been found......, and the consequent loss of integrity of RNA, is a mechanism for disease development. Oxidized RNA is found in a large variety of diseases, and interest has been especially devoted to degenerative brain diseases such as Alzheimer disease, in which up to 50-70% of specific mRNA molecules are reported oxidized, whereas...

  11. Downregulation of microRNA-130a contributes to endothelial progenitor cell dysfunction in diabetic patients via its target Runx3.

    Directory of Open Access Journals (Sweden)

    Shu Meng

    Full Text Available Dysfunction of endothelial progenitor cells (EPCs contributes to diabetic vascular disease. MicroRNAs (miRs have emerged as key regulators of diverse cellular processes including angiogenesis. We recently reported that miR-126, miR-130a, miR-21, miR-27a, and miR-27b were downregulated in EPCs from type II diabetes mellitus (DM patients, and downregulation of miR-126 impairs EPC function. The present study further explored whether dysregulated miR-130a were also related to EPC dysfunction. EPCs were cultured from peripheral blood mononuclear cells of diabetic patients and healthy controls. Assays on EPC function (proliferation, migration, differentiation, apoptosis, and colony and tubule formation were performed. Bioinformatics analyses were used to identify the potential targets of miR-130a in EPCs. Gene expression of miR-103a and Runx3 was measured by real-time PCR, and protein expression of Runx3, extracellular signal-regulated kinase (ERK, vascular endothelial growth factor (VEGF and Akt was measured by Western blotting. Runx3 promoter activity was measured by luciferase reporter assay. A miR-130a inhibitor or mimic and lentiviral vectors expressing miR-130a, or Runx3, or a short hairpin RNA targeting Runx3 were transfected into EPCs to manipulate miR-130a and Runx3 levels. MiR-130a was decreased in EPCs from DM patients. Anti-miR-130a inhibited whereas miR-130a overexpression promoted EPC function. miR-130a negatively regulated Runx3 (mRNA, protein and promoter activity in EPCs. Knockdown of Runx3 expression enhanced EPC function. MiR-130a also upregulated protein expression of ERK/VEGF and Akt in EPCs. In conclusion, miR-130a plays an important role in maintaining normal EPC function, and decreased miR-130a in EPCs from DM contributes to impaired EPC function, likely via its target Runx3 and through ERK/VEGF and Akt pathways.

  12. Working with RNA

    DEFF Research Database (Denmark)

    Nielsen, Henrik

    2011-01-01

    Working with RNA is not a special discipline in molecular biology. However, RNA is chemically and structurally different from DNA and a few simple work rules have to be implemented to maintain the integrity of the RNA. Alkaline pH, high temperatures, and heavy metal ions should be avoided when po...

  13. Functional characterization of Pol III U6 promoters for gene knockdown and knockout in Plutella xylostella.

    Science.gov (United States)

    Huang, Yuping; Wang, Yajun; Zeng, Baosheng; Liu, Zhaoxia; Xu, Xuejiao; Meng, Qian; Huang, Yongping; Yang, Guang; Vasseur, Liette; Gurr, Geoff M; You, Minsheng

    2017-10-01

    RNA polymerase type III (Pol-III) promoters such as U6 are commonly used to express small RNAs, including short hairpin RNAs (shRNAs) and single guide RNAs (sgRNAs). Functional U6 promoters are widely used in CRISPR systems, and their characterization can facilitate genome editing of non-model organisms. In the present study, six U6 small nuclear RNA (snRNA) promoters containing two conserved elements of a proximal sequence element (PSEA) and a TATA box, were identified and characterized in the diamondback moth (Plutella xylostella) genome. Relative efficiency of the U6 promoters to express shRNA induced EGFP knockdown was tested in a P. xylostella cell line, revealing that the PxU6:3 promoter had the strongest expression effect. Further work with the PxU6:3 promoter showed its efficacy in EGFP knockout using CRISPR/Cas9 system in the cells. The expression plasmids with versatile Pxabd-A gene specific sgRNA driven by the PxU6:3 promoter, combined with Cas9 mRNA, could induce mutagenesis at specific genomic loci in vivo. The phenotypes induced by sgRNA expression plasmids were similar to those done in vitro transcription sgRNAs. A plasmid with two tandem arranged PxU6:3:sgRNA expression cassettes targeting Pxabd-A loci was generated, which caused a 28,856 bp fragment deletion, suggesting that the multi-sgRNA expression plasmid can be used for multi-targeting. Our work indicates that U6 snRNA promoters can be used for functional studies of genes with the approach of reverse genetics in P. xylostella. These essential promoters also provide valuable potential for CRISPR-derived gene drive as a tactic for population control in this globally significant pest. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Methods for RNA Analysis

    DEFF Research Database (Denmark)

    Olivarius, Signe

    of the transcriptome, 5’ end capture of RNA is combined with next-generation sequencing for high-throughput quantitative assessment of transcription start sites by two different methods. The methods presented here allow for functional investigation of coding as well as noncoding RNA and contribute to future...... RNAs rely on interactions with proteins, the establishment of protein-binding profiles is essential for the characterization of RNAs. Aiming to facilitate RNA analysis, this thesis introduces proteomics- as well as transcriptomics-based methods for the functional characterization of RNA. First, RNA...

  15. Cytoplasmic Z-RNA

    International Nuclear Information System (INIS)

    Zarling, D.A.; Calhoun, C.J.; Hardin, C.C.; Zarling, A.H.

    1987-01-01

    Specific immunochemical probes for Z-RNA were generated and characterized to search for possible Z-RNA-like double helices in cells. Z-RNA was detected in the cytoplasm of fixed protozoan cells by immunofluorescence microscopy using these anti-Z-RNA IgCs. In contrast, autoimmune or experimentally elicited anti-DNA antibodies, specifically reactive with B-DNA or Z-DNA, stained the nuclei. Pre-or nonimmune IgGs did not bind to the cells. RNase A or T1 digestion eliminated anti-Z-RNA IgG binding to cytoplasmic determinants; however, DNase I or mung bean nuclease had no effect. Doxorubicin and ethidium bromide prevented anti-Z-RNA antibody binding; however, actinomycin D, which does not bind double-stranded RNA, did not. Anti-Z-RNA immunofluorescence was specifically blocked in competition assays by synthetic Z-RNA but not Z-DNA, A-RNA, or single-stranded RNAs. Thus, some cytoplasmic sequences in fixed cells exist in the left-handed Z-RNA conformation

  16. Effect of a Dual Charge on the DNA-Conjugated Redox Probe on DNA Sensing by Short Hairpin Beacons Tethered to Gold Electrodes.

    Science.gov (United States)

    Kékedy-Nagy, László; Shipovskov, Stepan; Ferapontova, Elena E

    2016-08-16

    Charges of redox species can critically affect both the interfacial state of DNA and electrochemistry of DNA-conjugated redox labels and, as a result, the electroanalytical performance of those systems. Here, we show that the kinetics of electron transfer (ET) between the gold electrode and methylene blue (MB) label conjugated to a double-stranded (ds) DNA tethered to gold strongly depend on the charge of the MB molecule, and that affects the performance of genosensors exploiting MB-labeled hairpin DNA beacons. Positively charged MB binds to dsDNA via electrostatic and intercalative/groove binding, and this binding allows the DNA-mediated electrochemistry of MB intercalated into the duplex and, as a result, a complex mode of the electrochemical signal change upon hairpin hybridization to the target DNA, dominated by the "on-off" signal change mode at nanomolar levels of the analyzed DNA. When MB bears an additional carboxylic group, the negative charge provided by this group prevents intimate interactions between MB and DNA, and then the ET in duplexes is limited by the diffusion of the MB-conjugated dsDNA (the phenomenon first shown in Farjami , E. ; Clima , L. ; Gothelf , K. ; Ferapontova , E. E. Anal. Chem. 2011 , 83 , 1594 ) providing the robust "off-on" nanomolar DNA sensing. Those results can be extended to other intercalating redox probes and are of strategic importance for design and development of electrochemical hybridization sensors exploiting DNA nanoswitchable architectures.

  17. PHD-2 Suppression in Mesenchymal Stromal Cells Enhances Wound Healing.

    Science.gov (United States)

    Ko, Sae Hee; Nauta, Allison C; Morrison, Shane D; Hu, Michael S; Zimmermann, Andrew S; Chung, Michael T; Glotzbach, Jason P; Wong, Victor W; Walmsley, Graham G; Peter Lorenz, H; Chan, Denise A; Gurtner, Geoffrey C; Giaccia, Amato J; Longaker, Michael T

    2018-01-01

    Cell therapy with mesenchymal stromal cells is a promising strategy for tissue repair. Restoration of blood flow to ischemic tissues is a key step in wound repair, and mesenchymal stromal cells have been shown to be proangiogenic. Angiogenesis is critically regulated by the hypoxia-inducible factor (HIF) superfamily, consisting of transcription factors targeted for degradation by prolyl hydroxylase domain (PHD)-2. The aim of this study was to enhance the proangiogenic capability of mesenchymal stromal cells and to use these modified cells to promote wound healing. Mesenchymal stromal cells harvested from mouse bone marrow were transduced with short hairpin RNA (shRNA) against PHD-2; control cells were transduced with scrambled shRNA (shScramble) construct. Gene expression quantification, human umbilical vein endothelial cell tube formation assays, and wound healing assays were used to assess the effect of PHD knockdown mesenchymal stromal cells on wound healing dynamics. PHD-2 knockdown mesenchymal stromal cells overexpressed HIF-1α and multiple angiogenic factors compared to control (p cells treated with conditioned medium from PHD-2 knockdown mesenchymal stromal cells exhibited increased formation of capillary-like structures and enhanced migration compared with human umbilical vein endothelial cells treated with conditioned medium from shScramble-transduced mesenchymal stromal cells (p cells healed at a significantly accelerated rate compared with wounds treated with shScramble mesenchymal stromal cells (p cells (p cells augments their proangiogenic potential in wound healing therapy. This effect appears to be mediated by overexpression of HIF family transcription factors and up-regulation of multiple downstream angiogenic factors.

  18. Protective Effect of Klotho against Ischemic Brain Injury Is Associated with Inhibition of RIG-I/NF-κB Signaling

    Directory of Open Access Journals (Sweden)

    Hong-Jing Zhou

    2018-01-01

    Full Text Available Aging is the greatest independent risk factor for the occurrence of stroke and poor outcomes, at least partially through progressive increases in oxidative stress and inflammation with advanced age. Klotho is an antiaging gene, the expression of which declines with age. Klotho may protect against neuronal oxidative damage that is induced by glutamate. The present study investigated the effects of Klotho overexpression and knockdown by an intracerebroventricular injection of a lentiviral vector that encoded murine Klotho (LV-KL or rat Klotho short-hairpin RNA (LV-KL shRNA on cerebral ischemia injury and the underlying anti-neuroinflammatory mechanism. The overexpression of Klotho induced by LV-KL significantly improved neurobehavioral deficits and increased the number of live neurons in the hippocampal CA1 and caudate putamen subregions 72 h after cerebral hypoperfusion that was induced by transient bilateral common carotid artery occlusion (2VO in mice. The overexpression of Klotho significantly decreased the immunoreactivity of glial fibrillary acidic protein and ionized calcium binding adaptor molecule-1, the expression of retinoic-acid-inducible gene-I, the nuclear translocation of nuclear factor-κB, and the production of proinflammatory cytokines (tumor necrosis factor α and interleukin-6 in 2VO mice. The knockdown of Klotho mediated by LV-KL shRNA in the brain exacerbated neurological dysfunction and cerebral infarct after 22 h of reperfusion following 2 h middle cerebral artery occlusion in rats. These findings suggest that Klotho itself or enhancers of Klotho may compensate for its aging-related decline, thus providing a promising therapeutic approach for acute ischemic stroke during advanced age.

  19. Inhibition of STAT-3 results in greater cetuximab sensitivity in head and neck squamous cell carcinoma

    International Nuclear Information System (INIS)

    Bonner, James A.; Yang, Eddy S.; Trummell, Hoa Q.; Nowsheen, Somaira; Willey, Christopher D.; Raisch, Kevin P.

    2011-01-01

    Objective: The inhibition of epidermal growth factor receptor (EGFr) with the monoclonal antibody cetuximab reduces cell proliferation and survival which correlates with increased DNA damage. Since the signal transducer and activator of transcription-3 (STAT-3) is involved in the EGFr-induced signaling pathway, we hypothesized that depletion of STAT-3 may augment cetuximab-induced processes in human head and neck cancer cells. Materials and methods: Human head and neck squamous carcinoma cells (UM-SCC-5) were transfected with short hairpin RNA (shRNA) against STAT-3 (STAT3-2.4 and 2.9 cells). A mutated form of this shRNA was transfected for a control (NEG4.17 cells). Radiosensitivity was assessed by a standard colony formation assay. Proliferation was assessed by daily cell counts following treatment and apoptosis was assessed by an annexin V-FITC assay. The alkaline comet assay was used to assess DNA damage. Results: The STAT-3 knockdown cells (STAT3-2.4 and STAT3-2.9 cells) demonstrated enhanced radiosensitivity compared to control NEG4.17 cells, which correlated with increased apoptosis. Also, the STAT-3 knockdown cells demonstrated decreased proliferation with cetuximab treatments compared to control cells (NEG4.17). The increased cetuximab sensitivity of the STAT-3 knockdown cells correlated with increased apoptosis and DNA damage compared to control cells (NEG4.17). Conclusion: These studies revealed that the greater anti-proliferative effects and increased cytotoxicity of cetuximab in the STAT3-2.4 and STAT3-2.9 cells compared to control NEG4.17 cells, may be a result of STAT3-mediated effects on cellular apoptosis and DNA damage.

  20. Inhibiting cholesterol degradation induces neuronal sclerosis and epileptic activity in mouse hippocampus

    Science.gov (United States)

    Chali, Farah; Djelti, Fathia; Eugene, Emmanuel; Valderrama, Mario; Marquer, Catherine; Aubourg, Patrick; Duykaerts, Charles; Miles, Richard; Cartier, Nathalie; Navarro, Vincent

    2015-01-01

    Elevations in neuronal cholesterol have been associated with several degenerative diseases. An enhanced excitability and synchronous firing in surviving neurons are among the sequels of neuronal death in these diseases and also in some epileptic syndromes. Here, we attempted to increase neuronal cholesterol levels, using a short hairpin RNA (shRNA) to suppress expression of the enzyme CYP46A1. This protein hydroxylates cholesterol and so facilitates trans-membrane extrusion. A sh-RNA CYP46A1construction coupled to an adeno-associated virus (AAV5) was injected focally and unilaterally into mouse hippocampus. It was selectively expressed first in neurons of the CA3a region. Cytoplasmic and membrane cholesterol increased, neuronal soma volume increased and then decreased before pyramidal cells died. As CA3a pyramidal cells died, inter-ictal EEG events occurred during exploration and non-REM sleep. With time, neuronal death spread to involve pyramidal cells and interneurons of the CA1 region. CA1 neuronal death was correlated with a delayed local expression of phosphorylated tau. Astrocytes were activated throughout the hippocampus and microglial activation was specific to regions of neuronal death. CA1 neuronal death was correlated with distinct aberrant EEG activity. During exploratory behaviour and rapid eye movement sleep, EEG oscillations at 7-10 Hz (theta) could accelerate to 14-21 Hz (beta) waves. They were accompanied by low amplitude, high-frequency oscillations of peak power at ~300Hz and a range of 250-350 Hz. While episodes of EEG acceleration were not correlated with changes in exploratory behaviour, they were followed in some animals by structured seizure-like discharges. These data strengthen links between increased cholesterol, neuronal sclerosis and epileptic behavior PMID:25847620

  1. Clinical significance of proliferation, apoptosis and senescence of nasopharyngeal cells by the simultaneously blocking EGF, IGF-1 receptors and Bcl-xl genes

    International Nuclear Information System (INIS)

    Dai, Guodong; Peng, Tao; Zhou, Xuhong; Zhu, Jun; Kong, Zhihua; Ma, Li; Xiong, Zhi; Yuan, Yulin

    2013-01-01

    Highlight: •Construction of shRNA segments expression vectors is valid by the investigation of RT-PCR for IGF1R, EGFR and Bcl-xl mRNA and protein expression. •Studies have suggested that the vectors in blocking these genes of the growth factor receptors and anti- apoptosis is capable of breaking the balance of tumor growth so that tumor trend apoptosis and senescence. •Simultaneously blocking multiple genes that are abnormally expressed may be more effective in treating cancer cells than silencing a single gene. -- Abstract: Background: In previous work, we constructed short hairpin RNA (shRNA) expression plasmids that targeted human EGF and IGF-1 receptors messenger RNA, respectively, and demonstrated that these vectors could induce apoptosis of human nasopharyngeal cell lines (CNE2) and inhibit ligand-induced pAkt and pErk activation. Method: We have constructed multiple shRNA expression vectors of targeting EGFR, IGF1R and Bcl-xl, which were transfected to the CNE2 cells. The mRNA expression was assessed by RT-PCR. The growth of the cells, cell cycle progression, apoptosis of the cells, senescent tumor cells and the proteins of EGFR, IGF1R and Bcl-xl were analyzed by MTT, flow cytometry, cytochemical therapy or Western blot. Results: In group of simultaneously blocking EGFR, IGF1R and Bcl-xl genes, the mRNA of EGFR, IGF1R and Bcl-xl expression was decreased by (66.66 ± 3.42)%, (73.97 ± 2.83)% and (64.79 ± 2.83)%, and the protein expressions was diminished to (67.69 ± 4.02)%, (74.32 ± 2.30)%, and (60.00 ± 3.34)%, respectively. Meanwhile, the cell apoptosis increased by 65.32 ± 0.18%, 65.16 ± 0.25% and 55.47 ± 0.45%, and senescent cells increased by 1.42 ± 0.15%, 2.26 ± 0.15% and 3.22 ± 0.15% in the second, third and fourth day cultures, respectively. Conclusions: Simultaneously blocking EGFR, IGF1R and Bcl-xl genes is capable of altering the balance between proliferating versus apoptotic and senescent cells in the favor of both of apoptosis and

  2. Clinical significance of proliferation, apoptosis and senescence of nasopharyngeal cells by the simultaneously blocking EGF, IGF-1 receptors and Bcl-xl genes

    Energy Technology Data Exchange (ETDEWEB)

    Dai, Guodong [Anatomy and Embryology, Wuhan University School of Medicine, Wuhan, Hubei 430071 (China); Peng, Tao; Zhou, Xuhong [Department of Otolaryngology-Head and Neck Surgery, Zhongnan Hospital of Wuhan University, Wuhan 430071 (China); Zhu, Jun; Kong, Zhihua; Ma, Li; Xiong, Zhi [Anatomy and Embryology, Wuhan University School of Medicine, Wuhan, Hubei 430071 (China); Yuan, Yulin, E-mail: yuanyulin19620120@126.com [Anatomy and Embryology, Wuhan University School of Medicine, Wuhan, Hubei 430071 (China)

    2013-11-01

    Highlight: •Construction of shRNA segments expression vectors is valid by the investigation of RT-PCR for IGF1R, EGFR and Bcl-xl mRNA and protein expression. •Studies have suggested that the vectors in blocking these genes of the growth factor receptors and anti- apoptosis is capable of breaking the balance of tumor growth so that tumor trend apoptosis and senescence. •Simultaneously blocking multiple genes that are abnormally expressed may be more effective in treating cancer cells than silencing a single gene. -- Abstract: Background: In previous work, we constructed short hairpin RNA (shRNA) expression plasmids that targeted human EGF and IGF-1 receptors messenger RNA, respectively, and demonstrated that these vectors could induce apoptosis of human nasopharyngeal cell lines (CNE2) and inhibit ligand-induced pAkt and pErk activation. Method: We have constructed multiple shRNA expression vectors of targeting EGFR, IGF1R and Bcl-xl, which were transfected to the CNE2 cells. The mRNA expression was assessed by RT-PCR. The growth of the cells, cell cycle progression, apoptosis of the cells, senescent tumor cells and the proteins of EGFR, IGF1R and Bcl-xl were analyzed by MTT, flow cytometry, cytochemical therapy or Western blot. Results: In group of simultaneously blocking EGFR, IGF1R and Bcl-xl genes, the mRNA of EGFR, IGF1R and Bcl-xl expression was decreased by (66.66 ± 3.42)%, (73.97 ± 2.83)% and (64.79 ± 2.83)%, and the protein expressions was diminished to (67.69 ± 4.02)%, (74.32 ± 2.30)%, and (60.00 ± 3.34)%, respectively. Meanwhile, the cell apoptosis increased by 65.32 ± 0.18%, 65.16 ± 0.25% and 55.47 ± 0.45%, and senescent cells increased by 1.42 ± 0.15%, 2.26 ± 0.15% and 3.22 ± 0.15% in the second, third and fourth day cultures, respectively. Conclusions: Simultaneously blocking EGFR, IGF1R and Bcl-xl genes is capable of altering the balance between proliferating versus apoptotic and senescent cells in the favor of both of apoptosis and

  3. RPA Interacts with HIRA and Regulates H3.3 Deposition at Gene Regulatory Elements in Mammalian Cells.

    Science.gov (United States)

    Zhang, Honglian; Gan, Haiyun; Wang, Zhiquan; Lee, Jeong-Heon; Zhou, Hui; Ordog, Tamas; Wold, Marc S; Ljungman, Mats; Zhang, Zhiguo

    2017-01-19

    The histone chaperone HIRA is involved in depositing histone variant H3.3 into distinct genic regions, including promoters, enhancers, and gene bodies. However, how HIRA deposits H3.3 to these regions remains elusive. Through a short hairpin RNA (shRNA) screening, we identified single-stranded DNA binding protein replication protein A (RPA) as a regulator of the deposition of newly synthesized H3.3 into chromatin. We show that RPA physically interacts with HIRA to form RPA-HIRA-H3.3 complexes, and it co-localizes with HIRA and H3.3 at gene promoters and enhancers. Depletion of RPA1, the largest subunit of the RPA complex, dramatically reduces both HIRA association with chromatin and the deposition of newly synthesized H3.3 at promoters and enhancers and leads to altered transcription at gene promoters. These results support a model whereby RPA, best known for its role in DNA replication and repair, recruits HIRA to promoters and enhancers and regulates deposition of newly synthesized H3.3 to these regulatory elements for gene regulation. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Sonic hedgehog signaling regulates amygdalar neurogenesis and extinction of fear memory.

    Science.gov (United States)

    Hung, Hui-Chi; Hsiao, Ya-Hsin; Gean, Po-Wu

    2015-10-01

    It is now recognized that neurogenesis occurs throughout life predominantly in the subgranular zone (SGZ) of the hippocampus and the subventricular zone (SVZ) of the lateral ventricle. In the present study, we investigated the relationship between neurogenesis in the amygdala and extinction of fear memory. Mice received 15 tone-footshock pairings. Twenty-four hours after training, the mice were given 15 tone-alone trials (extinction training) once per day for 7 days. Two hours before extinction training, the mice were injected intraperitoneally with 5-bromo-3-deoxyuridine (BrdU). BrdU-positive and NeuN-positive cells were analyzed 52 days after the training. A group of mice that received tone-footshock pairings but no extinction training served as controls (FC+No-Ext). The number of BrdU(+)/NeuN(+) cells was significantly higher in the extinction (FC+Ext) than in the FC+No-Ext mice. Proliferation inhibitor methylazoxymethanol acetate (MAM) or DNA synthesis inhibitor cytosine arabinoside (Ara-C) reduced neurogenesis and retarded extinction. Silencing Sonic hedgehog (Shh) gene with short hairpin interfering RNA (shRNA) by means of a retrovirus expression system to knockdown Shh specifically in the mitotic neurons reduced neurogenesis and retarded extinction. By contrast, over-expression of Shh increased neurogenesis and facilitated extinction. These results suggest that amygdala neurogenesis and Shh signaling are involved in the extinction of fear memory. Copyright © 2015 Elsevier B.V. and ECNP. All rights reserved.

  5. Differential expression and interaction of host factors augment HIV-1 gene expression in neonatal mononuclear cells

    International Nuclear Information System (INIS)

    Sundaravaradan, Vasudha; Mehta, Roshni; Harris, David T.; Zack, Jerome A.; Ahmad, Nafees

    2010-01-01

    We have previously shown a higher level of HIV-1 replication and gene expression in neonatal (cord) blood mononuclear cells (CBMC) compared with adult blood cells (PBMC), which could be due to differential expression of host factors. We performed the gene expression profile of CBMC and PBMC and found that 8013 genes were expressed at higher levels in CBMC than PBMC and 8028 genes in PBMC than CBMC, including 1181 and 1414 genes upregulated after HIV-1 infection in CBMC and PBMC, respectively. Several transcription factors (NF-κB, E2F, HAT-1, TFIIE, Cdk9, Cyclin T1), signal transducers (STAT3, STAT5A) and cytokines (IL-1β, IL-6, IL-10) were upregulated in CBMC than PBMC, which are known to influence HIV-1 replication. In addition, a repressor of HIV-1 transcription, YY1, was down regulated in CBMC than PBMC and several matrix metalloproteinase (MMP-7, -12, -14) were significantly upregulated in HIV-1 infected CBMC than PBMC. Furthermore, we show that CBMC nuclear extracts interacted with a higher extent to HIV-1 LTR cis-acting sequences, including NF-κB, NFAT, AP1 and NF-IL6 compared with PBMC nuclear extracts and retroviral based short hairpin RNA (shRNA) for STAT3 and IL-6 down regulated their own and HIV-1 gene expression, signifying that these factors influenced differential HIV-1 gene expression in CBMC than PBMC.

  6. Cleaved CD147 shed from the surface of malignant melanoma cells activates MMP2 produced by fibroblasts.

    Science.gov (United States)

    Hatanaka, Miho; Higashi, Yuko; Fukushige, Tomoko; Baba, Naoko; Kawai, Kazuhiro; Hashiguchi, Teruto; Su, Juan; Zeng, Weiqi; Chen, Xiang; Kanekura, Takuro

    2014-12-01

    Cluster of differentiation 147 (CD147)/basigin on the malignant tumor cell surface is critical for tumor proliferation, invasiveness, metastasis, and angiogenesis. CD147 expressed on malignant melanoma cells can induce tumor cell invasion by stimulating the production of matrix metalloproteinases (MMPs) by surrounding fibroblasts. Membrane vesicles, microvesicles and exosomes have attracted attention, as vehicles of functional molecules and their association with CD147 has been reported. Cleaved CD147 fragments released from tumor cells were reported to interact with fibroblasts. We investigated the intercellular mechanisms by which CD147 stimulates fibroblasts to induce MMP2 activity. CD147 was knocked-down using short hairpin RNA (shRNA). The stimulatory effect of CD147 in cell culture supernatants, microvesicles, and exosomes on the enzymatic activity of MMP2 was examined by gelatin zymography. Supernatants from A375 control cells induced increased enzymatic activity of fibroblasts; such activity was significantly lower in CD147 knock-down cells. Cleaved CD147 plays a pivotal role in stimulating fibroblasts to induce MMP2 activity. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  7. Distal C terminus of CaV1.2 channels plays a crucial role in the neural differentiation of dental pulp stem cells.

    Directory of Open Access Journals (Sweden)

    Jianping Ge

    Full Text Available L-type voltage-dependent CaV1.2 channels play an important role in the maintenance of intracellular calcium homeostasis, and influence multiple cellular processes. C-terminal cleavage of CaV1.2 channels was reported in several types of excitable cells, but its expression and possible roles in non-excitable cells is still not clear. The aim of this study was to determine whether distal C-terminal fragment of CaV1.2 channels is present in rat dental pulp stem cells and its possible role in the neural differentiation of rat dental pulp stem cells. We generated stable CaV1.2 knockdown cells via short hairpin RNA (shRNA. Rat dental pulp stem cells with deleted distal C-terminal of CaV1.2 channels lost the potential of differentiation to neural cells. Re-expression of distal C-terminal of CaV1.2 rescued the effect of knocking down the endogenous CaV1.2 on the neural differentiation of rat dental pulp stem cells, indicating that the distal C-terminal of CaV1.2 is required for neural differentiation of rat dental pulp stem cells. These results provide new insights into the role of voltage-gated Ca(2+ channels in stem cells during differentiation.

  8. Binding of Candida albicans to Human CEACAM1 and CEACAM6 Modulates the Inflammatory Response of Intestinal Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Esther Klaile

    2017-03-01

    Full Text Available Candida albicans colonizes human mucosa, including the gastrointestinal tract, as a commensal. In immunocompromised patients, C. albicans can breach the intestinal epithelial barrier and cause fatal invasive infections. Carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM1; CD66a, CEACAM5 (CEA, and CEACAM6 (CD66c are immunomodulatory receptors expressed on human mucosa and are recruited by bacterial and viral pathogens. Here we show for the first time that a fungal pathogen (i.e., C. albicans also binds directly to the extracellular domain of human CEACAM1, CEACAM3, CEACAM5, and CEACAM6. Binding was specific for human CEACAMs and mediated by the N-terminal IgV-like domain. In enterocytic C2BBe1 cells, C. albicans caused a transient tyrosine phosphorylation of CEACAM1 and induced higher expression of membrane-bound CEACAM1 and soluble CEACAM6. Lack of the CEACAM1 receptor after short hairpin RNA (shRNA knockdown abolished CXCL8 (interleukin-8 secretion by C2BBe1 cells in response to C. albicans. In CEACAM1-competent cells, the addition of recombinant soluble CEACAM6 reduced the C. albicans-induced CXCL8 secretion.

  9. RNAi-mediated silencing of CD147 inhibits tumor cell proliferation, invasion and increases chemosensitivity to cisplatin in SGC7901 cells in vitro

    Directory of Open Access Journals (Sweden)

    Zhu Chan

    2010-06-01

    Full Text Available Abstract Background CD147 is a widely distributed cell surface glycoprotein that belongs to the Ig superfamily. CD147 has been implicated in numerous physiological and pathological activities. Enriched on the surface of many tumor cells, CD147 promotes tumor growth, invasion, metastasis and angiogenesis and confers resistance to some chemotherapeutic drugs. In this study, we investigated the possible role of CD147 in the progression of gastric cancer. Methods Short hairpin RNA (shRNA expressing vectors targeting CD147 were constructed and transfected into human gastric cancer cells SGC7901 and CD147 expression was monitored by quantitative realtime RT-PCR and Western blot. Cell proliferation, the activities of MMP-2 and MMP-9, the invasive potential and chemosensitivity to cisplatin of SGC7901 cells were determined by MTT, gelatin zymography, Transwell invasion assay and MTT, respectively. Results Down-regulation of CD147 by RNAi approach led to decreased cell proliferation, MMP-2 and MMP-9 activities and invasive potential of SGC7901 cells as well as increased chemosensitivity to cisplatin. Conclusion CD147 involves in proliferation, invasion and chemosensitivity of human gastric cancer cell line SGC7901, indicating that CD147 may be a promising therapeutic target for gastric cancer.

  10. N-Myc knockdown and apigenin treatment controlled growth of malignant neuroblastoma cells having N-Myc amplification.

    Science.gov (United States)

    Hossain, Md Motarab; Banik, Naren L; Ray, Swapan K

    2013-10-15

    Malignant neuroblastomas mostly occur in children and are frequently associated with N-Myc amplification. Oncogene amplification, which is selective increase in copy number of the oncogene, provides survival advantages in solid tumors including malignant neuroblastoma. We have decreased expression of N-Myc oncogene using short hairpin RNA (shRNA) plasmid to increase anti-tumor efficacy of the isoflavonoid apigenin (APG) in human malignant neuroblastoma SK-N-DZ and SK-N-BE2 cell lines that harbor N-Myc amplification. N-Myc knockdown induced morphological and biochemical features of neuronal differentiation. Combination of N-Myc knockdown and APG most effectively induced morphological and biochemical features of apoptotic death. This combination therapy also prevented cell migration and decreased N-Myc driven survival, angiogenic, and invasive factors. Collectively, N-Myc knockdown and APG treatment is a promising strategy for controlling the growth of human malignant neuroblastoma cell lines that harbor N-Myc amplification. © 2013 Elsevier B.V. All rights reserved.

  11. Anti-Proliferation and Anti-Invasion Effects of Diosgenin on Gastric Cancer BGC-823 Cells with HIF-1α shRNAs

    Directory of Open Access Journals (Sweden)

    Yuan-Neng Chou

    2012-05-01

    Full Text Available Drug resistance is a major factor for the limited efficacy of chemotherapy in gastric cancer treatment. Hypoxia-inducible factor-1α (HIF-1α, a central transcriptional factor in hypoxia, is suggested to participate in the resistance. Here, we identified a hypoxia-mimic (cobalt chloride sensitive gastric cell line BGC-823 to explore whether diosgenin, an aglycone of steroidal saponins, can inhibit cancer cell invasion and survival of solid tumor in a hypoxic mimic microenvironment. We have shown that diosgenin is a potent candidate for decreasing the ability of invasion and survival in cobalt chloride treated BGC-823 cells. In addition, when combined with HIF-1α specific short hairpin RNA (shRNA, diosgenin can inhibit BGC-823 cells more effectively. The anti-invasion role of diosgenin may be related to E-cadherin, integrinα5 and integrinβ6. These results suggest that diosgenin may be a useful compound in controlling gastric cancer cells in hypoxia condition, especially when combined with down-regulated HIF-1α.

  12. Oligopeptide complex for targeted non-viral gene delivery to adipocytes

    Science.gov (United States)

    Won, Young-Wook; Adhikary, Partho Protim; Lim, Kwang Suk; Kim, Hyung Jin; Kim, Jang Kyoung; Kim, Yong-Hee

    2014-12-01

    Commercial anti-obesity drugs acting in the gastrointestinal tract or the central nervous system have been shown to have limited efficacy and severe side effects. Anti-obesity drug development is thus focusing on targeting adipocytes that store excess fat. Here, we show that an adipocyte-targeting fusion-oligopeptide gene carrier consisting of an adipocyte-targeting sequence and 9-arginine (ATS-9R) selectively transfects mature adipocytes by binding to prohibitin. Injection of ATS-9R into obese mice confirmed specific binding of ATS-9R to fat vasculature, internalization and gene expression in adipocytes. We also constructed a short-hairpin RNA (shRNA) for silencing fatty-acid-binding protein 4 (shFABP4), a key lipid chaperone in fatty-acid uptake and lipid storage in adipocytes. Treatment of obese mice with ATS-9R/shFABP4 led to metabolic recovery and body-weight reduction (>20%). The ATS-9R/shFABP4 oligopeptide complex could prove to be a safe therapeutic approach to regress and treat obesity as well as obesity-induced metabolic syndromes.

  13. Essential role of the small GTPase Ran in postnatal pancreatic islet development.

    Directory of Open Access Journals (Sweden)

    Fang Xia

    Full Text Available The small GTPase Ran orchestrates pleiotropic cellular responses of nucleo-cytoplasmic shuttling, mitosis and subcellular trafficking, but whether deregulation of these pathways contributes to disease pathogenesis has remained elusive. Here, we generated transgenic mice expressing wild type (WT Ran, loss-of-function Ran T24N mutant or constitutively active Ran G19V mutant in pancreatic islet β cells under the control of the rat insulin promoter. Embryonic pancreas and islet development, including emergence of insulin(+ β cells, was indistinguishable in control or transgenic mice. However, by one month after birth, transgenic mice expressing any of the three Ran variants exhibited overt diabetes, with hyperglycemia, reduced insulin production, and nearly complete loss of islet number and islet mass, in vivo. Deregulated Ran signaling in transgenic mice, adenoviral over-expression of WT or mutant Ran in isolated islets, or short hairpin RNA (shRNA silencing of endogenous Ran in model insulinoma INS-1 cells, all resulted in decreased expression of the pancreatic and duodenal homeobox transcription factor, PDX-1, and reduced β cell proliferation, in vivo. These data demonstrate that a finely-tuned balance of Ran GTPase signaling is essential for postnatal pancreatic islet development and glucose homeostasis, in vivo.

  14. Protein phosphatase 5 promotes hepatocarcinogenesis through interaction with AMP-activated protein kinase.

    Science.gov (United States)

    Chen, Yao-Li; Hung, Man-Hsin; Chu, Pei-Yi; Chao, Tzu-I; Tsai, Ming-Hsien; Chen, Li-Ju; Hsiao, Yung-Jen; Shih, Chih-Ting; Hsieh, Feng-Shu; Chen, Kuen-Feng

    2017-08-15

    The serine-threonine protein phosphatase family members are known as critical regulators of various cellular functions, such as survival and transformation. Growing evidence suggests that pharmacological manipulation of phosphatase activity exhibits therapeutic benefits. Ser/Thr protein phosphatase 5 (PP5) is known to participate in glucocorticoid receptor (GR) and stress-induced signaling cascades that regulate cell growth and apoptosis, and has been shown to be overexpressed in various human malignant diseases. However, the role of PP5 in hepatocellular carcinoma (HCC) and whether PP5 may be a viable therapeutic target for HCC treatment are unknown. Here, by analyzing HCC clinical samples obtained from 215 patients, we found that overexpression of PP5 is tumor specific and associated with worse clinical outcomes. We further characterized the oncogenic properties of PP5 in HCC cells. Importantly, both silencing of PP5 with lentiviral-mediated short hairpin RNA (shRNA) and chemical inhibition of PP5 phosphatase activity using the natural compound cantharidin/norcantharidin markedly suppressed the growth of HCC cells and tumors in vitro and in vivo. Moreover, we identified AMP-activated protein kinase (AMPK) as a novel downstream target of oncogenic PP5 and demonstrated that the antitumor mechanisms underlying PP5 inhibition involve activation of AMPK signaling. Overall, our results establish a pathological function of PP5 in hepatocarcinogenesis via affecting AMPK signaling and suggest that PP5 inhibition is an attractive therapeutic approach for HCC. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Neuronal Orphan G-Protein Coupled Receptor Proteins Mediate Plasmalogens-Induced Activation of ERK and Akt Signaling.

    Directory of Open Access Journals (Sweden)

    Md Shamim Hossain

    Full Text Available The special glycerophospholipids plasmalogens (Pls are enriched in the brain and reported to prevent neuronal cell death by enhancing phosphorylation of Akt and ERK signaling in neuronal cells. Though the activation of Akt and ERK was found to be necessary for the neuronal cells survival, it was not known how Pls enhanced cellular signaling. To answer this question, we searched for neuronal specific orphan GPCR (G-protein coupled receptor proteins, since these proteins were believed to play a role in cellular signal transduction through the lipid rafts, where both Pls and some GPCRs were found to be enriched. In the present study, pan GPCR inhibitor significantly reduced Pls-induced ERK signaling in neuronal cells, suggesting that Pls could activate GPCRs to induce signaling. We then checked mRNA expression of 19 orphan GPCRs and 10 of them were found to be highly expressed in neuronal cells. The knockdown of these 10 neuronal specific GPCRs by short hairpin (sh-RNA lentiviral particles revealed that the Pls-mediated phosphorylation of ERK was inhibited in GPR1, GPR19, GPR21, GPR27 and GPR61 knockdown cells. We further found that the overexpression of these GPCRs enhanced Pls-mediated phosphorylation of ERK and Akt in cells. Most interestingly, the GPCRs-mediated cellular signaling was reduced significantly when the endogenous Pls were reduced. Our cumulative data, for the first time, suggest a possible mechanism for Pls-induced cellular signaling in the nervous system.

  16. GOLGA2/GM130, cis-Golgi matrix protein, is a novel target of anticancer gene therapy.

    Science.gov (United States)

    Chang, Seung-Hee; Hong, Seong-Ho; Jiang, Hu-Lin; Minai-Tehrani, Arash; Yu, Kyeong-Nam; Lee, Jae-Ho; Kim, Ji-Eun; Shin, Ji-Young; Kang, Bitna; Park, Sungjin; Han, Kiwon; Chae, Chanhee; Cho, Myung-Haing

    2012-11-01

    Achievement of long-term survival of patients with lung cancer treated with conventional chemotherapy is still difficult for treatment of metastatic and advanced tumors. Despite recent progress in investigational therapies, survival rates are still disappointingly low and novel adjuvant and systemic therapies are urgently needed. A recently elucidated secretory pathway is attracting considerable interest as a promising anticancer target. The cis-Golgi matrix protein, GOLGA2/GM130, plays an important role in glycosylation and transport of protein in the secretory pathway. In this study, the effects of short hairpin RNA (shRNA) constructs targeting GOLGA2/GM130 (shGOLGA2) on autophagy and lung cancer growth were evaluated in vitro and in vivo. Downregulation of GOLGA2/GM130 led to induction of autophagy and inhibition of glycosylation in A549 cells and in the lungs of K-ras(LA1) mice. Furthermore, downregulation of GOLGA2/GM130 decreased angiogenesis and cancer cell invasion in vitro and suppressed tumorigenesis in lung cancer mice model. The tumor specificity of sequence targeting GOLGA2/GM130 was also demonstrated. Taken together, these results suggest that induction of autophagy by shGOLGA2 may induce cell death rather than cell survival. Therefore, downregulation of GOLGA2/GM130 may be a potential therapeutic option for lung cancer.

  17. Gemfibrozil has antidepressant effects in mice: Involvement of the hippocampal brain-derived neurotrophic factor system.

    Science.gov (United States)

    Ni, Yu-Fei; Wang, Hao; Gu, Qiu-Yan; Wang, Fei-Ying; Wang, Ying-Jie; Wang, Jin-Liang; Jiang, Bo

    2018-04-01

    Major depressive disorder has become one of the most serious neuropsychiatric disorders worldwide. However, currently available antidepressants used in clinical practice are ineffective for a substantial proportion of patients and always have side effects. Besides being a lipid-regulating agent, gemfibrozil is an agonist of peroxisome proliferator-activated receptor-α (PPAR-α). We investigated the antidepressant effects of gemfibrozil on C57BL/6J mice using the forced swim test (FST) and tail suspension test (TST), as well as the chronic unpredictable mild stress (CUMS) model of depression. The changes in brain-derived neurotrophic factor (BDNF) signaling cascade in the brain after CUMS and gemfibrozil treatment were further assessed. Pharmacological inhibitors and lentivirus-expressed short hairpin RNA (shRNA) were also used to clarify the antidepressant mechanisms of gemfibrozil. Gemfibrozil exhibited significant antidepressant actions in the FST and TST without affecting the locomotor activity of mice. Chronic gemfibrozil administration fully reversed CUMS-induced depressive-like behaviors in the FST, TST and sucrose preference test. Gemfibrozil treatment also restored CUMS-induced inhibition of the hippocampal BDNF signaling pathway. Blocking PPAR-α and BDNF but not the serotonergic system abolished the antidepressant effects of gemfibrozil on mice. Gemfibrozil produced antidepressant effects in mice by promoting the hippocampal BDNF system.

  18. Identification of the Interaction between P-Glycoprotein and Anxa2 in Multidrug-resistant Human Breast Cancer Cells

    International Nuclear Information System (INIS)

    Zhang, Hai-chang; Zhang, Fei; Wu, Bing; Han, Jing-hua; Ji, Wei; Zhou, Yan; Niu, Rui-fang

    2012-01-01

    To explore the interaction of Anxa2 with P-Glycoprotein (P-gp) in the migration and invasion of the multidrug-resistant (MDR) human breast cancer cell line MCF-7/ADR. A pair of short hairpin RNA (shRNA) targeting P-gp was transfected into MCF-7/ADR cells, and monoclonal cell strains were screened. The expression of P-gp was detected by Western blot. Transwell chambers were used to observe the cell migration capacity and invasion ability. The interaction between P-gp and Anxa2 was examined by immunoprecipitation and immunofluorescence confocal microscopy analyses. P-gp expression was significantly knocked down, and there were notable decreasing trends in the migration and invasion capability of MDR breast cancer cells (P<0.05). There was a close interaction between Anxa2 and P-gp. MCF-7/ADR is an MDR human breast cancer cell line with high migration and invasion abilities. The knockdown of P-gp notably impaired the migration and invasion abilities of the tumor cells. The interaction of Anxa2 with P-pg may play an important role in the enhanced invasiveness of MDR human breast cancer cells

  19. Synergistic anticancer effects of the 9.2.27PE immunotoxin and ABT-737 in melanoma.

    Directory of Open Access Journals (Sweden)

    Karianne Risberg

    Full Text Available In cancer, combinations of drugs targeting different cellular functions is well accepted to improve tumor control. We studied the effects of a Pseudomonas exotoxin A (PE-based immunotoxin, the 9.2.27PE, and the BH-3 mimetic compound ABT-737 in a panel of melanoma cell lines. The drug combination resulted in synergistic cytotoxicity, and the cell death observed was associated with apoptosis, as activation of caspase-3, inactivation of Poly (ADP-ribose polymerase (PARP and increased DNA fragmentation could be prevented by pre-treatment with caspase and cathepsin inhibitors. We further show that ABT-737 caused endoplasmic reticulum (ER stress with increased GRP78 and phosphorylated eIF2α protein levels. Moreover, treatment with ABT-737 increased the intracellular calcium levels, an effect which was enhanced by 9.2.27PE, which as a single entity drug had minimal effect on calcium release from the ER. In addition, silencing of Mcl-1 by short hairpin RNA (shRNA enhanced the intracellular calcium levels and cytotoxicity caused by ABT-737. Notably, the combination of 9.2.27PE and ABT-737 caused growth delay in a human melanoma xenograft mice model, supporting further investigations of this particular drug combination.

  20. CCR5 Targeted Cell Therapy for HIV and Prevention of Viral Escape

    Directory of Open Access Journals (Sweden)

    Gero Hütter

    2015-07-01

    Full Text Available Allogeneic transplantation with CCR5-delta 32 (CCR5-d32 homozygous stem cells in an HIV infected individual in 2008, led to a sustained virus control and probably eradication of HIV. Since then there has been a high degree of interest to translate this approach to a wider population. There are two cellular ways to do this. The first one is to use a CCR5 negative cell source e.g., hematopoietic stem cells (HSC to copy the initial finding. However, a recent case of a second allogeneic transplantation with CCR5-d32 homozygous stem cells suffered from viral escape of CXCR4 quasi-species. The second way is to knock down CCR5 expression by gene therapy. Currently, there are five promising techniques, three of which are presently being tested clinically. These techniques include zinc finger nucleases (ZFN, clustered regularly interspaced palindromic repeats/CRISPR-associated protein 9 nuclease (CRISPR/Cas9, transcription activator-like effectors nuclease (TALEN, short hairpin RNA (shRNA, and a ribozyme. While there are multiple gene therapy strategies being tested, in this review we reflect on our current knowledge of inhibition of CCR5 specifically and whether this approach allows for consequent viral escape.

  1. High expression of BAG3 predicts a poor prognosis in human medulloblastoma.

    Science.gov (United States)

    Yang, Dong; Zhou, Ji; Wang, Hao; Wang, Yutao; Yang, Ge; Zhang, Yundong

    2016-10-01

    Bcl2-associated athanogene 3 (BAG3), a co-chaperone of the heat shock protein (Hsp) 70, regulates various physiological and pathological processes. However, its role in human medulloblastoma has not been clarified. First of all, the expression of BAG3 was examined in formalin-fixed, paraffin-embedded specimens by immunohistochemical staining. And then, the prognostic role of BAG3 was analyzed in 51 medulloblastoma samples. Finally, the roles of BAG3 in the proliferation, migration, and invasion of Daoy medulloblastoma cell were investigated using a specific short hairpin RNA (shRNA). The expression of BAG3 in medulloblastoma tissues was higher than nontumorous samples. Furthermore, BAG3 overexpression significantly correlated with poor prognosis of patients with medulloblastoma. The overall survival and tumor-free survival in patients with BAG3 low expression were higher than high expression. Univariate and multivariate analysis showed that BAG3 overexpression was an independent prognostic marker for medulloblastoma. After the BAG3 knockdown, the Daoy cells exhibited decreased the ability to proliferate and form neurosphere. The preliminary mechanism study showed that overexpression of BAG3 might facilitate the cell cycle transition from G1 to S phase by modulating the cyclin-dependent kinase 2 (CDK2) and cyclin E expression. Additionally, we found that BAG3 might enhance the medulloblastoma cell migratory and invasive ability. In summary, BAG3 overexpression may regulate the survival and invasive properties of medulloblastoma and may serve as a potential therapy target for medulloblastoma.

  2. Stem cell gene therapy for HIV: strategies to inhibit viral entry and replication.

    Science.gov (United States)

    DiGiusto, David L

    2015-03-01

    Since the demonstration of a cure of an HIV+ patient with an allogeneic stem cell transplant using naturally HIV-resistant cells, significant interest in creating similar autologous products has fueled the development of a variety of "cell engineering" approaches to stem cell therapy for HIV. Among the more well-studied strategies is the inhibition of viral entry through disruption of expression of viral co-receptors or through competitive inhibitors of viral fusion with the cell membrane. Preclinical evaluation of these approaches often starts in vitro but ultimately is tested in animal models prior to clinical implementation. In this review, we trace the development of several key approaches (meganucleases, short hairpin RNA (shRNA), and fusion inhibitors) to modification of hematopoietic stem cells designed to impart resistance to HIV to their T-cell and monocytic progeny. The basic evolution of technologies through in vitro and in vivo testing is discussed as well as the pros and cons of each approach and how the addition of postentry inhibitors may enhance the overall antiviral efficacy of these approaches.

  3. Noxa/Mcl-1 Balance Regulates Susceptibility of Cells to Camptothecin-Induced Apoptosis

    Directory of Open Access Journals (Sweden)

    Yide Mei

    2007-10-01

    Full Text Available Although camptothecin (CPT has been reported to induce apoptosis in various cancer cells, the molecular details of this regulation remain largely unknown. In this study, we demonstrate that 131-113-only protein Noxa is upregulated during CPT-induced apoptosis, which is independent of p53. In addition, we show that phosphatidylinositol 3-kinase (PI3K/Akt signaling pathway is responsible for Noxa's induction. Luciferase assay, cAMP response element binding protein (CREB knockdown experiments further demonstrate that CREB is involved in the transcriptional upregulation of Noxa. Moreover, blocking Noxa expression using specific small interfering ribonucleic acid (siRNA significantly reduces the apoptosis in response to CPT, indicating that Noxa is an essential mediator for CPT-induced apoptosis. Interestingly, antiapoptotic Mcl-1 was also upregulated through PI3K/Akt signaling pathway upon CPT treatment. Using immunoprecipitation assay, Noxa was found to interact with Mcl-1 in the presence or absence of CPT. Knockdown of Mcl-1 expression by short hairpin ribonucleic acid (shRNA was shown to potentiate CPT-induced apoptosis. Consistently, ectopic overexpression of Mcl-1 rescued cells from apoptosis induced by CPT. Cells coexpressing Noxa, Mcl-1 at different ratio correlates well with the extent of apoptosis, suggesting that the balance between Noxa, Mcl-1 may determine the susceptibility of HeLa cells to CPT-induced apoptosis.

  4. Noxa/Mcl-1 Balance Regulates Susceptibility of Cells to Camptothecin-Induced Apoptosis1

    Science.gov (United States)

    Mei, Yide; Xie, Chongwei; Xie, Wei; Tian, Xu; Li, Mei; Wu, Mian

    2007-01-01

    Although camptothecin (CPT) has been reported to induce apoptosis in various cancer cells, the molecular details of this regulation remain largely unknown. In this study, we demonstrate that BH3-only protein Noxa is upregulated during CPT-induced apoptosis, which is independent of p53. In addition, we show that phosphatidylinositol 3-kinase (PI3K)/Akt signaling pathway is responsible for Noxa's induction. Luciferase assay and cAMP response element binding protein (CREB) knockdown experiments further demonstrate that CREB is involved in the transcriptional upregulation of Noxa. Moreover, blocking Noxa expression using specific small interfering ribonucleic acid (siRNA) significantly reduces the apoptosis in response to CPT, indicating that Noxa is an essential mediator for CPT-induced apoptosis. Interestingly, antiapoptotic Mcl-1 was also upregulated through PI3K/Akt signaling pathway upon CPT treatment. Using immunoprecipitation assay, Noxa was found to interact with Mcl-1 in the presence or absence of CPT. Knockdown of Mcl-1 expression by short hairpin ribonucleic acid (shRNA) was shown to potentiate CPT-induced apoptosis. Consistently, ectopic overexpression of Mcl-1 rescued cells from apoptosis induced by CPT. Cells coexpressing Noxa and Mcl-1 at different ratio correlates well with the extent of apoptosis, suggesting that the balance between Noxa and Mcl-1 may determine the susceptibility of HeLa cells to CPT-induced apoptosis. PMID:17971907

  5. Rho A Regulates Epidermal Growth Factor-Induced Human Osteosarcoma MG63 Cell Migration

    Directory of Open Access Journals (Sweden)

    Jinyang Wang

    2018-05-01

    Full Text Available Osteosarcoma, the most common primary bone tumor, occurs most frequently in children and adolescents and has a 5-year survival rate, which is unsatisfactory. As epidermal growth factor receptor (EGFR positively correlates with TNM (tumor-node-metastasis stage in osteosarcoma, EGFR may play an important role in its progression. The purpose of this study was to explore potential mechanisms underlying this correlation. We found that EGF promotes MG63 cell migration and invasion as well as stress fiber formation via Rho A activation and that these effects can be reversed by inhibiting Rho A expression. In addition, molecules downstream of Rho A, including ROCK1, LIMK2, and Cofilin, are activated by EGF in MG63 cells, leading to actin stress fiber formation and cell migration. Moreover, inhibition of ROCK1, LIMK2, or Cofilin in MG63 cells using known inhibitors or short hairpin RNA (shRNA prevents actin stress fiber formation and cell migration. Thus, we conclude that Rho A/ROCK1/LIMK2/Cofilin signaling mediates actin microfilament formation in MG63 cells upon EGFR activation. This novel pathway provides a promising target for preventing osteosarcoma progression and for treating this cancer.

  6. RNA decay by messenger RNA interferases

    DEFF Research Database (Denmark)

    Christensen-Dalsgaard, Mikkel; Overgaard, Martin; Winther, Kristoffer Skovbo

    2008-01-01

    Two abundant toxin-antitoxin (TA) gene families, relBE and mazEF, encode mRNA cleaving enzymes whose ectopic overexpression abruptly inhibits translation and thereby induces a bacteriostatic condition. Here we describe and discuss protocols for the overproduction, purification, and analysis of mR...... cleaving enzymes such as RelE of Escherichia coli and the corresponding antitoxin RelB. In particular, we describe a set of plasmid vectors useful for the detailed analysis of cleavage sites in model mRNAs.......Two abundant toxin-antitoxin (TA) gene families, relBE and mazEF, encode mRNA cleaving enzymes whose ectopic overexpression abruptly inhibits translation and thereby induces a bacteriostatic condition. Here we describe and discuss protocols for the overproduction, purification, and analysis of mRNA...

  7. Characterization of the loss of SUMO pathway function on cancer cells and tumor proliferation.

    Directory of Open Access Journals (Sweden)

    Xingyue He

    Full Text Available SUMOylation is a post-translational ubiquitin-like protein modification pathway that regulates important cellular processes including chromosome structure, kinetochore function, chromosome segregation, nuclear and sub-nuclear organization, transcription and DNA damage repair. There is increasing evidence that the SUMO pathway is dysregulated in cancer, raising the possibility that modulation of this pathway may have therapeutic potential. To investigate the importance of the SUMO pathway in the context of cancer cell proliferation and tumor growth, we applied lentivirus-based short hairpin RNAs (shRNA to knockdown SUMO pathway genes in human cancer cells. shRNAs for SAE2 and UBC9 reduced SUMO conjugation activity and inhibited proliferation of human cancer cells. To expand upon these observations, we generated doxycycline inducible conditional shRNA cell lines for SAE2 to achieve acute and reversible SAE2 knockdown. Conditional SAE2 knockdown in U2OS and HCT116 cells slowed cell growth in vitro, and SAE2 knockdown induced multiple terminal outcomes including apoptosis, endoreduplication and senescence. Multinucleated cells became senescent and stained positive for the senescence marker, SA-β Gal, and displayed elevated levels of p53 and p21. In an attempt to explain these phenotypes, we confirmed that loss of SUMO pathway activity leads to a loss of SUMOylated Topoisomerase IIα and the appearance of chromatin bridges which can impair proper cytokinesis and lead to multinucleation. Furthermore, knockdown of SAE2 induces disruption of PML nuclear bodies which may further promote apoptosis or senescence. In an in vivo HCT116 xenograft tumor model, conditional SAE2 knockdown strongly impaired tumor growth. These data demonstrate that the SUMO pathway is required for cancer cell proliferation in vitro and tumor growth in vivo, implicating the SUMO pathway as a potential cancer therapeutic target.

  8. A novel artificial microRNA expressing AAV vector for phospholamban silencing in cardiomyocytes improves Ca2+ uptake into the sarcoplasmic reticulum.

    Directory of Open Access Journals (Sweden)

    Tobias Gröβl

    Full Text Available In failing rat hearts, post-transcriptonal inhibition of phospholamban (PLB expression by AAV9 vector-mediated cardiac delivery of short hairpin RNAs directed against PLB (shPLBr improves both impaired SERCA2a controlled Ca2+ cycling and contractile dysfunction. Cardiac delivery of shPLB, however, was reported to cause cardiac toxicity in canines. Thus we developed a new AAV vector, scAAV6-amiR155-PLBr, expressing a novel engineered artificial microRNA (amiR155-PLBr directed against PLB under control of a heart-specific hybrid promoter. Its PLB silencing efficiency and safety were compared with those of an AAV vector expressing shPLBr (scAAV6-shPLBr from an ubiquitously active U6 promoter. Investigations were carried out in cultured neonatal rat cardiomyocytes (CM over a period of 14 days. Compared to shPLBr, amiR155-PLBr was expressed at a significantly lower level, resulting in delayed and less pronounced PLB silencing. Despite decreased knockdown efficiency of scAAV6-amiR155-PLBr, a similar increase of the SERCA2a-catalyzed Ca2+ uptake into sarcoplasmic reticulum (SR vesicles was observed for both the shPLBr and amiR155-PLBr vectors. Proteomic analysis confirmed PLB silencing of both therapeutic vectors and revealed that shPLBr, but not the amiR155-PLBr vector, increased the proinflammatory proteins STAT3, STAT1 and activated STAT1 phosphorylation at the key amino acid residue Tyr701. Quantitative RT-PCR analysis detected alterations in the expression of several cardiac microRNAs after treatment of CM with scAAV6-shPLBr and scAAV6-amiR155-PLBr, as well as after treatment with its related amiR155- and shRNAs-expressing control AAV vectors. The results demonstrate that scAAV6-amiR155-PLBr is capable of enhancing the Ca2+ transport function of the cardiac SR PLB/SERCA2a system as efficiently as scAAV6-shPLBr while offering a superior safety profile.

  9. Topology of RNA-RNA interaction structures

    DEFF Research Database (Denmark)

    Andersen, Jørgen Ellegaard; Huang, Fenix Wenda; Penner, Robert

    2012-01-01

    Abstract The topological filtration of interacting RNA complexes is studied, and the role is analyzed of certain diagrams called irreducible shadows, which form suitable building blocks for more general structures. We prove that, for two interacting RNAs, called interaction structures, there exist...

  10. ERK1/2 signalling pathway is involved in CD147-mediated gastric cancer cell line SGC7901 proliferation and invasion.

    Science.gov (United States)

    Chen, Liping; Pan, Yuqin; Gu, Ling; Nie, Zhenlin; He, Bangshun; Song, Guoqi; Li, Rui; Xu, Yeqiong; Gao, Tianyi; Wang, Shukui

    2013-08-01

    This study aimed to investigate the role of CD147 in the progression of gastric cancer and the signalling pathway involved in CD147-mediated gastric cancer cell line SGC7901 proliferation and invasion. Short hairpin RNA (shRNA) expression vectors targeting CD147 were constructed to silence CD147, and the expression of CD147 was monitored by quantitative realtime reverse transcriptase polymerase chain reaction and Western blot and further confirmed by immunohistochemistry in vivo. Cell proliferation was determined by Cell Counting Kit-8 assay, the activities of matrix metalloproteinase (MMP)-2 and MMP-9 were determined by gelatin zymography, and the invasion of SGC7901 was determined by invasion assay. The phosphorylation and non-phosphorylation of the mitogen-activated protein kinases, extracellular signal-regulated kinase1/2 (ERK1/2), P38 and c-Jun NH2-terminal kinase were examined by Western blot. Additionally, the ERK1/2 inhibitor U0126 were used to confirm the signalling pathway involved in CD147-mediated SGC7901 progression. The BALB/c nude mice were used to study tumour progression in vivo. The results revealed that CD147 silencing inhibited the proliferation and invasion of SGC7901 cells, and down-regulated the activities of MMP-2 and MMP-9 and the phosphorylation of the ERK1/2 in SGC7901 cells. ERK1/2 inhibitor U0126 decreased the proliferation, and invasion of SGC7901 cells, and down-regulated the MMP-2 and MMP-9 activities. In a nude mouse model of subcutaneous xenografts, the tumour volume was significantly smaller in the SGC7901/shRNA group compared to the SGC7901 and SGC7901/snc-RNA group. Immunohistochemistry analysis showed that CD147 and p-ERK1/2 protein expressions were down-regulated in the SGC7901/shRNA2 group compared to the SGC7901 and SGC7901/snc-RNA group. These results suggest that ERK1/2 pathway involves in CD147-mediated gastric cancer growth and invasion. These findings further highlight the importance of CD147 in cancer progression

  11. RNA Localization in Astrocytes

    DEFF Research Database (Denmark)

    Thomsen, Rune

    2012-01-01

    , regulation of the blood brain barrier and glial scar tissue formation. Despite the involvement in various CNS functions only a limited number of studies have addressed mRNA localization in astrocytes. This PhD project was initially focused on developing and implementing methods that could be used to asses mRNA......Messenger RNA (mRNA) localization is a mechanism by which polarized cells can regulate protein synthesis to specific subcellular compartments in a spatial and temporal manner, and plays a pivotal role in multiple physiological processes from embryonic development to cell differentiation...... localization in astrocyte protrusions, and following look into the subcellular localization pattern of specific mRNA species of both primary astrocytes isolated from cortical hemispheres of newborn mice, and the mouse astrocyte cell line, C8S. The Boyden chamber cell fractionation assay was optimized, in a way...

  12. A versatile method to design stem-loop primer-based quantitative PCR assays for detecting small regulatory RNA molecules.

    Directory of Open Access Journals (Sweden)

    Zsolt Czimmerer

    Full Text Available Short regulatory RNA-s have been identified as key regulators of gene expression in eukaryotes. They have been involved in the regulation of both physiological and pathological processes such as embryonal development, immunoregulation and cancer. One of their relevant characteristics is their high stability, which makes them excellent candidates for use as biomarkers. Their number is constantly increasing as next generation sequencing methods reveal more and more details of their synthesis. These novel findings aim for new detection methods for the individual short regulatory RNA-s in order to be able to confirm the primary data and characterize newly identified subtypes in different biological conditions. We have developed a flexible method to design RT-qPCR assays that are very sensitive and robust. The newly designed assays were tested extensively in samples from plant, mouse and even human formalin fixed paraffin embedded tissues. Moreover, we have shown that these assays are able to quantify endogenously generated shRNA molecules. The assay design method is freely available for anyone who wishes to use a robust and flexible system for the quantitative analysis of matured regulatory RNA-s.

  13. CD147 stimulates hepatoma cells escaping from immune surveillance of T cells by interaction with Cyclophilin A.

    Science.gov (United States)

    Ren, Yi-Xin; Wang, Shu-Jing; Fan, Jian-Hui; Sun, Shi-Jie; Li, Xia; Padhiar, Arshad Ahmed; Zhang, Jia-Ning

    2016-05-01

    T cells play an important role in tumor immune surveillance. CD147 is a member of immunoglobulin superfamily present on the surface of many tumor cells and mediates malignant cell behaviors. Cyclophilin A (CypA) is an intracellular protein promoting inflammation when released from cells. CypA is a natural ligand for CD147. In this study, CD147 specific short hairpin RNAs (shRNA) were transfected into murine hepatocellular carcinoma Hepa1-6 cells to assess the effects of CD147 on hepatoma cells escaping from immune surveillance of T cells. We found extracellular CypA stimulated cell proliferation through CD147 by activating ERK1/2 signaling pathway. Downregulation of CD147 expression on Hepa1-6 cells significantly suppressed tumor progression in vivo, and decreased cell viability when co-cultured with T cells in vitro. Importantly, knockdown of CD147 on Hepa1-6 cells resulted in significantly increased T cells chemotaxis induced by CypA both in vivo and in vitro. These findings provide novel mechanisms how tumor cells escaping from immune surveillance of T cells. We provide a potential therapy for hepatocellular carcinoma by targeting CD147 or CD147-CypA interactions. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  14. Gene Transfer of Brain-derived Neurotrophic Factor (BDNF) Prevents Neurodegeneration Triggered by FXN Deficiency.

    Science.gov (United States)

    Katsu-Jiménez, Yurika; Loría, Frida; Corona, Juan Carlos; Díaz-Nido, Javier

    2016-05-01

    Friedreich's ataxia is a predominantly neurodegenerative disease caused by recessive mutations that produce a deficiency of frataxin (FXN). Here, we have used a herpesviral amplicon vector carrying a gene encoding for brain-derived neurotrophic factor (BDNF) to drive its overexpression in neuronal cells and test for its effect on FXN-deficient neurons both in culture and in the mouse cerebellum in vivo. Gene transfer of BDNF to primary cultures of mouse neurons prevents the apoptosis which is triggered by the knockdown of FXN gene expression. This neuroprotective effect of BDNF is also observed in vivo in a viral vector-based knockdown mouse cerebellar model. The injection of a lentiviral vector carrying a minigene encoding for a FXN-specific short hairpin ribonucleic acid (shRNA) into the mouse cerebellar cortex triggers a FXN deficit which is accompanied by significant apoptosis of granule neurons as well as loss of calbindin in Purkinje cells. These pathological changes are accompanied by a loss of motor coordination of mice as assayed by the rota-rod test. Coinjection of a herpesviral vector encoding for BDNF efficiently prevents both the development of cerebellar neuropathology and the ataxic phenotype. These data demonstrate the potential therapeutic usefulness of neurotrophins like BDNF to protect FXN-deficient neurons from degeneration.

  15. The knockdown of each component of the cysteine proteinase-adhesin complex of Entamoeba histolytica (EhCPADH) affects the expression of the other complex element as well as the in vitro and in vivo virulence.

    Science.gov (United States)

    Ocádiz-Ruiz, Ramón; Fonseca, Wendy; Linford, Alicia S; Yoshino, Timothy P; Orozco, Esther; Rodríguez, Mario A

    2016-01-01

    Entamoeba histolytica is the protozoan parasite causative of human amoebiasis, disease responsible for 40 000-100 000 deaths annually. The cysteine proteinase-adhesin complex of this parasite (EhCPADH) is a heterodimeric protein formed by a cysteine protease (EhCP112) and an adhesin (EhADH) that plays an important role in the cytopathic mechanism of this parasite. The coding genes for EhCP112 and EhADH are adjacent in the E. histolytica genome, suggesting that their expression may be co-regulated, but this hypothesis has not yet been confirmed. Here, we performed the knockdown of EhCP112 and EhADH using gene-specific short-hairpin RNAs (shRNA), and the effect of these knockdowns on the expression of both complex components as well as on the in vitro and in vivo virulence was analysed. Results showed that the knockdown of one of the EhCPADH components produced a simultaneous downregulation of the other protein. Accordingly, a concomitant reduction in the overall expression of the complex was observed. The downregulation of each component also produced a significant decrease in the in vitro and in vivo virulence of trophozoites. These results demonstrated that the expression of EhCP112 and EhADH is co-regulated and confirmed that the EhCPADH complex plays an important role in E. histolytica virulence.

  16. Assembling RNA Nanoparticles.

    Science.gov (United States)

    Xiao, Shou-Jun

    2017-01-01

    RNA nanoparticles are designed and self-assembled according to noncanonical interactions of naturally conserved RNA motifs and/or canonical Watson-Crick base-pairing interactions, which have potential applications in gene therapy and nanomedicine. These artificially engineered nanoparticles are mainly synthesized from in vitro transcribed RNAs, purified by denaturing and native polyacrylamide gel electrophoresis (PAGE), and characterized with native PAGE, AFM, and TEM technologies. The protocols of in vitro transcription, denaturing and native PAGE, and RNA nanoparticle self-assembly are described in detail.

  17. Survivin knockdown increased anti-cancer effects of (−)-epigallocatechin-3-gallate in human malignant neuroblastoma SK-N- BE2 and SH-SY5Y cells

    Science.gov (United States)

    Hossain, Md. Motarab; Banik, Naren L.; Ray, Swapan K.

    2012-01-01

    Neuroblastoma is a solid tumor that mostly occurs in children. Malignant neuroblastomas have poor prognosis because conventional chemotherapeutic agents are hardly effective. Survivin, which is highly expressed in some malignant neuroblastomas, plays a significant role in inhibiting differentiation and apoptosis and promoting cell proliferation, invasion, and angiogenesis. We examined consequences of survivin knockdown by survivin short hairpin RNA (shRNA) plasmid and then treatment with (−)-epigallocatechin-3-gallate (EGCG), a green tea flavonoid, in malignant neuroblastoma cells. Our Western blotting and laser scanning confocal immunofluorescence microscopy showed that survivin was highly expressed in malignant neuroblastoma SK-N-BE2 and SH-SY5Y cell lines and slightly in SK-N-DZ cell line. Expression of survivin was very faint in malignant neuroblastoma IMR32 cell line. We transfected SK-N-BE2 and SH-SY-5Y cells with survivin shRNA, treated with EGCG, and confirmed knockdown of survivin at mRNA and protein levels. Survivin knockdown induced morphological features of neuronal differentiation, as we observed following in situ methylene blue staining. Combination of survivin shRNA and EGCG promoted neuronal differentiation biochemically by increases in expression of NFP, NSE, and e-cadherin and also decreases in expression of Notch-1, ID2, hTERT, and PCNA. Our in situ Wright staining and Annexin V-FITC/PI staining showed that combination therapy was highly effective in inducing, respectively, morphological and biochemical features of apoptosis. Apoptosis occurred with activation of caspase-8 and cleavage of Bid to tBid, increase in Bax:Bcl-2 ratio, mitochondrial release of cytochrome c, and increases in expression and activity of calpain and caspase-3. Combination therapy decreased migration of cells through matrigel and inhibited proliferative (p-Akt and NF-κB), invasive (MMP-2 and MMP-9), and angiogenic (VEGF and b-FGF) factors. Also, in vitro network

  18. Survivin knockdown increased anti-cancer effects of (-)-epigallocatechin-3-gallate in human malignant neuroblastoma SK-N-BE2 and SH-SY5Y cells.

    Science.gov (United States)

    Hossain, Md Motarab; Banik, Naren L; Ray, Swapan K

    2012-08-01

    Neuroblastoma is a solid tumor that mostly occurs in children. Malignant neuroblastomas have poor prognosis because conventional chemotherapeutic agents are hardly effective. Survivin, which is highly expressed in some malignant neuroblastomas, plays a significant role in inhibiting differentiation and apoptosis and promoting cell proliferation, invasion, and angiogenesis. We examined consequences of survivin knockdown by survivin short hairpin RNA (shRNA) plasmid and then treatment with (-)-epigallocatechin-3-gallate (EGCG), a green tea flavonoid, in malignant neuroblastoma cells. Our Western blotting and laser scanning confocal immunofluorescence microscopy showed that survivin was highly expressed in malignant neuroblastoma SK-N-BE2 and SH-SY5Y cell lines and slightly in SK-N-DZ cell line. Expression of survivin was very faint in malignant neuroblastoma IMR32 cell line. We transfected SK-N-BE2 and SH-SY-5Y cells with survivin shRNA, treated with EGCG, and confirmed knockdown of survivin at mRNA and protein levels. Survivin knockdown induced morphological features of neuronal differentiation, as we observed following in situ methylene blue staining. Combination of survivin shRNA and EGCG promoted neuronal differentiation biochemically by increases in the expression of NFP, NSE, and e-cadherin and also decreases in the expression of Notch-1, ID2, hTERT, and PCNA. Our in situ Wright staining and Annexin V-FITC/PI staining showed that combination therapy was highly effective in inducing, respectively, morphological and biochemical features of apoptosis. Apoptosis occurred with activation of caspase-8 and cleavage of Bid to tBid, increase in Bax:Bcl-2 ratio, mitochondrial release of cytochrome c, and increases in the expression and activity of calpain and caspase-3. Combination therapy decreased migration of cells through matrigel and inhibited proliferative (p-Akt and NF-κB), invasive (MMP-2 and MMP-9), and angiogenic (VEGF and b-FGF) factors. Also, in vitro

  19. Plant RNA binding proteins for control of RNA virus infection

    Directory of Open Access Journals (Sweden)

    Sung Un eHuh

    2013-12-01

    Full Text Available Plant RNA viruses have effective strategies to infect host plants through either direct or indirect interactions with various host proteins, thus suppressing the host immune system. When plant RNA viruses enter host cells exposed RNAs of viruses are recognized by the host immune system through processes such as siRNA-dependent silencing. Interestingly, some host RNA binding proteins have been involved in the inhibition of RNA virus replication, movement, and translation through RNA-specific binding. Host plants intensively use RNA binding proteins for defense against viral infections in nature. In this mini review, we will summarize the function of some host RNA binding proteins which act in a sequence-specific binding manner to the infecting virus RNA. It is important to understand how plants effectively suppresses RNA virus infections via RNA binding proteins, and this defense system can be potentially developed as a synthetic virus defense strategy for use in crop engineering.

  20. Shapes of interacting RNA complexes

    DEFF Research Database (Denmark)

    Fu, Benjamin Mingming; Reidys, Christian

    2014-01-01

    Shapes of interacting RNA complexes are studied using a filtration via their topological genus. A shape of an RNA complex is obtained by (iteratively) collapsing stacks and eliminating hairpin loops.This shape-projection preserves the topological core of the RNA complex and for fixed topological...... genus there are only finitely many such shapes. Our main result is a new bijection that relates the shapes of RNA complexes with shapes of RNA structures. This allows to compute the shape polynomial of RNA complexes via the shape polynomial of RNA structures. We furthermore present a linear time uniform...... sampling algorithm for shapes of RNA complexes of fixed topological genus....

  1. Remote Network Access (RNA)

    National Research Council Canada - National Science Library

    2002-01-01

    .... Remote Network Access (RNA) includes or is associated with all communication devices/software, firewalls, intrusion detection systems and virus protection applications to ensure security of the OIG, DoD, Network from remote...

  2. RNA/PNA Approach

    Indian Academy of Sciences (India)

    In this approach we want to develop structural analogue of the leader that might have higher affinity towards the Phosphoprotein, but would impair the dimerization process and viral leader RNA binding.

  3. Effects of DCK knockdown on proliferation, apoptosis and tumorigenicity in vivo of cervical cancer HeLa cells.

    Science.gov (United States)

    Shang, Q-Y; Wu, C-S; Gao, H-R

    2017-09-01

    The present study explored the effect that deoxycytidine kinase (DCK) knockdown had on proliferation, apoptosis and tumorigenicity in vivo of cervical cancer HeLa cells. Human cervical cancer HeLa cells that had received no prior treatment were selected from the HeLa group. The HeLa-negative control (NC) group consisted of cells that had undergone an empty vector treatment, and finally the HeLa-short hairpin RNA (shRNA) group included cells that were treated by means of shRNA-DCK expression. DCK expressions were evaluated by quantitative real-time polymerase chain reaction in addition to western blotting assays. Cell proliferation was estimated using the Cell Counting Kit-8 (CCK-8) assay and cell cycle progression. Cell apoptosis was determined by flow cytometry. BALB/c nude mice (n=24) were selected to establish transplanted tumor models, with gross tumor volume measured every 3 days. The results in vitro were as follows: compared with the HeLa group, the HeLa-shRNA group exhibited downregulation of DCK expression and inhibition of cell proliferation at 48, 72 and 96 h. Additionally, more cells in the HeLa-shRNA group were arrested in G0/G1 stage and less in S and G2/M stages, as well as in promotion of cell apoptosis. In vivo results are as follows: when comparing the HeLa and HeLa-NC groups, the gross tumor volume of the transplanted tumor in nude mice in the HeLa-shRNA group was found to have decreased in 13, 16, 19 and 22 days. Based on these findings, our study suggests that DCK knockdown facilitates apoptosis while inhibiting proliferation and tumorigenicity in vivo of cervical cancer HeLa cells.

  4. Application of shRNA-containing herpes simplex virus type 1 (HSV-1)-based gene therapy for HSV-2-induced genital herpes.

    Science.gov (United States)

    Liu, Zhihong; Xiang, Yang; Wei, Zhun; Yu, Bo; Shao, Yong; Zhang, Jie; Yang, Hong; Li, Manmei; Guan, Ming; Wan, Jun; Zhang, Wei

    2013-11-01

    HSV-1-based vectors have been widely used to achieve targeted delivery of genes into the nervous system. In the current study, we aim to use shRNA-containing HSV-1-based gene delivery system for the therapy of HSV-2 infection. Guinea pigs were infected intravaginally with HSV-2 and scored daily for 100 days for the severity of vaginal disease. HSV-2 shRNA-containing HSV-1 was applied intravaginally daily between 8 and 14 days after HSV-2 challenge. Delivery of HSV-2 shRNA-containing HSV-1 had no effect on the onset of disease and acute virus shedding in animals, but resulted in a significant reduction in both the cumulative recurrent lesion days and the number of days with recurrent disease. Around half of the animals in the HSV-2 shRNA group did not develop recurrent disease 100 days post HSV-2 infection. In conclusion, HSV-2 shRNA-containing HSV-1 particles are effective in reducing the recurrence of genital herpes caused by HSV-2. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. Switching off small RNA regulation with trap-mRNA

    DEFF Research Database (Denmark)

    Overgaard, Martin; Johansen, Jesper; Møller-Jensen, Jakob

    2009-01-01

    to operate at the level of transcription initiation. By employing a highly sensitive genetic screen we uncovered a novel RNA-based regulatory principle in which induction of a trap-mRNA leads to selective degradation of a small regulatory RNA molecule, thereby abolishing the sRNA-based silencing of its...

  6. A multiplexed miRNA and transgene expression platform for simultaneous repression and expression of protein coding sequences.

    Science.gov (United States)

    Seyhan, Attila A

    2016-01-01

    Knockdown of single or multiple gene targets by RNA interference (RNAi) is necessary to overcome escape mutants or isoform redundancy. It is also necessary to use multiple RNAi reagents to knockdown multiple targets. It is also desirable to express a transgene or positive regulatory elements and inhibit a target gene in a coordinated fashion. This study reports a flexible multiplexed RNAi and transgene platform using endogenous intronic primary microRNAs (pri-miRNAs) as a scaffold located in the green fluorescent protein (GFP) as a model for any functional transgene. The multiplexed intronic miRNA - GFP transgene platform was designed to co-express multiple small RNAs within the polycistronic cluster from a Pol II promoter at more moderate levels to reduce potential vector toxicity. The native intronic miRNAs are co-transcribed with a precursor GFP mRNA as a single transcript and presumably cleaved out of the precursor-(pre) mRNA by the RNA splicing machinery, spliceosome. The spliced intron with miRNA hairpins will be further processed into mature miRNAs or small interfering RNAs (siRNAs) capable of triggering RNAi effects, while the ligated exons become a mature messenger RNA for the translation of the functional GFP protein. Data show that this approach led to robust RNAi-mediated silencing of multiple Renilla Luciferase (R-Luc)-tagged target genes and coordinated expression of functional GFP from a single transcript in transiently transfected HeLa cells. The results demonstrated that this design facilitates the coordinated expression of all mature miRNAs either as individual miRNAs or as multiple miRNAs and the associated protein. The data suggest that, it is possible to simultaneously deliver multiple negative (miRNA or shRNA) and positive (transgene) regulatory elements. Because many cellular processes require simultaneous repression and activation of downstream pathways, this approach offers a platform technology to achieve that dual manipulation efficiently

  7. A ribosome without RNA

    Directory of Open Access Journals (Sweden)

    Harold S Bernhardt

    2015-11-01

    Full Text Available It was Francis Crick who first asked why the ribosome contains so much RNA, and discussed the implications of this for the direct flow of genetic information from DNA to protein. Remarkable advances in our understanding of the ribosome and protein synthesis, including the recent publication of two mammalian mitochondrial ribosome structures, have shed new light on this intriguing aspect of evolution in molecular biology. We examine here whether RNA is indispensable for coded protein synthesis, or whether an all-protein ‘ribosome’ (or ‘synthosome’ might be possible, with a protein enzyme catalyzing peptide synthesis, and release factor-like protein adaptors able to read a message composed of deoxyribonucleotides. We also compare the RNA world hypothesis with the alternative ‘proteins first’ hypothesis in terms of their different understandings of the evolution of the ribosome, and whether this might have been preceded by an ancestral form of nonribosomal peptide synthesis catalyzed by protein enzymes.

  8. Isoform-specific regulation of osteogenic factors by polypeptide N-Acetylgalactosaminyltransferases 1 and 4

    International Nuclear Information System (INIS)

    Tang, Juan; Zheng, Hanxi; Chen, Ling; Gao, Shangshang; Shi, Xiaorui; Liu, Jingjing; Xu, Lan

    2017-01-01

    The family of UDP-GalNAc polypeptide: N-Acetylgalactosaminlytransfersases (ppGalNAcTs) catalyzes the initial step of O-linked protein glycosylation. Mucin-type O-glycoproteins are abundant in the bone and may play an important role in osteogenesis. Herein, we examined the effects of ppGalNAc-T isoforms on osteogenesis of MC3T3-E1 pre-osteoblasts. We found that ppGalNAc-T1 and -T4 isoforms were highly expressed during osteogenesis of MC3T3-E1 and their knockdown by short hairpin RNA (shRNA) decreased osteoblast formation and bone mineralization. Knockdown of ppGalNAc-T1 or -T4 decreased mRNA and protein levels of bone sialoprotein (BSP). Knockdown of ppGalNAc-T1decreased mRNA levels of osteocalcin (OC), osteoprotegerin (OPG). Knockdown ofppGalNAc-T4 isoform decreased mRNA levels of OC, OPG and vitamin D receptor (VDR). While knockdown of T1 or T4 isoforms did not change the expression of osteopontin (OPN), COLLI, receptor activator for nuclear factor-κB ligand (RANKL) and transforming growth factor-β (TGF-β). Our results demonstrated that the ppGalNAc-T4 was highly expressed in MC3T3-E1 cells during osteogenesis for the first time. We also found that ppGalNAc-T1 and -T4 affected the expression of different osteogenic factors, suggesting distinct roles ppGalNAc-T isoformsplay in regulating osteogenesis in vitro. - Highlights: • ppGalNAc-T1 and T4 are highly expressed during MC3T3 cell osteogenesis. • Knockdown of ppGalNAc-T1 and -T4 decreases osteogenic differentiation and mineralization. • Expression of osteogenic factors are differentially affected by decreased ppGalNAc-T1 and -T4 expression.

  9. Advanced glycation end products promote the proliferation and migration of primary rat vascular smooth muscle cells via the upregulation of BAG3.

    Science.gov (United States)

    Li, Cunshu; Chang, Ye; Li, Yuan; Chen, Shuang; Chen, Yintao; Ye, Ning; Dai, Dongxue; Sun, Yingxian

    2017-05-01

    The present study was aimed to investigate the role of reactive oxygen species (ROS) on advanced glycation end product (AGE)-induced proliferation and migration of vascular smooth muscle cells (VSMCs) and whether Bcl-2‑associated athanogene 3 (BAG3) is involved in the process. Primary rat VSMCs were extracted and cultured in vitro. Cell viability was detected by MTT assay and cell proliferation was detected by EdU incorporation assay. Cell migration was detected by wound healing and Transwell assays. BAG3 was detected using qPCR and western blot analysis. Transcriptional and translational inhibitors (actinomycin D and cycloheximide, respectively) were used to study the effect of AGEs on the expression of BAG3 in VSMCs. Lentiviral plasmids containing short hairpin RNA (shRNA) against rat BAG3 or control shRNA were transduced into VSMCs. Cellular ROS were detected by 2',7'-dichlorofluorescein diacetate (DCFH-DA) staining. Mitochondrial membrane potential was detected by tetramethylrhodamine methyl ester (TMRE) staining. AGEs significantly increased the expression of BAG3 in a dose-and time-dependent manner. Furthermore, AGEs mainly increased the expression of BAG3 mRNA by increasing the RNA synthesis rather than inhibiting the RNA translation. BAG3 knockdown reduced the proliferation and migration of VSMCs induced by AGEs. BAG3 knockdown reduced the generation of ROS and sustained the mitochondrial membrane potential of VSMCs. Reduction of ROS production by N-acetylcysteine (NAC), a potent antioxidant, also reduced the proliferation and migration of VSMCs. On the whole, the present study demonstrated for the first time that AGEs could increase ROS production and promote the proliferation and migration of VSMCs by upregulating BAG3 expression. This study indicated that BAG3 should be considered as a potential target for the prevention and/or treatment of vascular complications of diabetes.

  10. Pyrite footprinting of RNA

    International Nuclear Information System (INIS)

    Schlatterer, Jörg C.; Wieder, Matthew S.; Jones, Christopher D.; Pollack, Lois; Brenowitz, Michael

    2012-01-01

    Highlights: ► RNA structure is mapped by pyrite mediated · OH footprinting. ► Repetitive experiments can be done in a powdered pyrite filled cartridge. ► High · OH reactivity of nucleotides imply dynamic role in Diels–Alderase catalysis. -- Abstract: In RNA, function follows form. Mapping the surface of RNA molecules with chemical and enzymatic probes has revealed invaluable information about structure and folding. Hydroxyl radicals ( · OH) map the surface of nucleic acids by cutting the backbone where it is accessible to solvent. Recent studies showed that a microfluidic chip containing pyrite (FeS 2 ) can produce sufficient · OH to footprint DNA. The 49-nt Diels–Alder RNA enzyme catalyzes the C–C bond formation between a diene and a dienophile. A crystal structure, molecular dynamics simulation and atomic mutagenesis studies suggest that nucleotides of an asymmetric bulge participate in the dynamic architecture of the ribozyme’s active center. Of note is that residue U42 directly interacts with the product in the crystallized RNA/product complex. Here, we use powdered pyrite held in a commercially available cartridge to footprint the Diels–Alderase ribozyme with single nucleotide resolution. Residues C39 to U42 are more reactive to · OH than predicted by the solvent accessibility calculated from the crystal structure suggesting that this loop is dynamic in solution. The loop’s flexibility may contribute to substrate recruitment and product release. Our implementation of pyrite-mediated · OH footprinting is a readily accessible approach to gleaning information about the architecture of small RNA molecules.

  11. RNA Regulation of Estrogen

    Science.gov (United States)

    2010-08-01

    Berglund, Rodger Voelker, Paul Barber and Julien Diegel 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7. PERFORMING...estrogen  receptors  [reviewed  in  (3,  4)],  also   functions   by  interacting  directly  with  RNA  to  alter  RNA...Mog myelin oligodendrocyte glycoprotein 6.06 207115_x_at mbtd1 mbt domain containing 1 6.06 208004_at Prol1 proline rich, lacrimal 1 6.06 205247_at

  12. RNA Regulation by Estrogen

    Science.gov (United States)

    2011-08-01

    Julien Diegel, Amy Mahady, and Micah Bodner 5e. TASK NUMBER E-Mail: aberglund@molbio.uoregon.edu 5f. WORK UNIT NUMBER 7. PERFORMING...4)],  also   functions   by  interacting  directly  with  RNA  to  alter  RNA  processing  events  such  as  splicing...1 6.06 208004_at Prol1 proline rich, lacrimal 1 6.06 205247_at NOTCH4 Notch homolog 4 (Drosophila) 6.06 211203_s_at Cntn1 contactin 1 6.06 220689_at

  13. Sensing of RNA viruses

    DEFF Research Database (Denmark)

    Jensen, Søren; Thomsen, Allan Randrup

    2012-01-01

    pathogen-associated molecular patterns have emerged in great detail. This review presents an overview of our current knowledge regarding the receptors used to detect RNA virus invasion, the molecular structures these receptors sense, and the involved downstream signaling pathways.......Our knowledge regarding the contribution of the innate immune system in recognizing and subsequently initiating a host response to an invasion of RNA virus has been rapidly growing over the last decade. Descriptions of the receptors involved and the molecular mechanisms they employ to sense viral...

  14. LncRNA GAS5 Represses Osteosarcoma Cells Growth and Metastasis via Sponging MiR-203a

    Directory of Open Access Journals (Sweden)

    Yang Wang

    2018-01-01

    Full Text Available Background/Aims: LncRNA GAS5, a growth suppressor, has been reported to exert anti-tumor actions in various cancers, whereas the exact mechanism underling the anti-tumor action is still unclear. This study was aimed to investigate the effect of lncRNA GAS5 on osteosarcoma and tried to decode the underling mechanisms. Methods: Expressions of lncRNA GAS5 in MG-63 cells were silenced by shRNA transfection, while were overexpressed by vector transfection. Cell viability, migration, invasion and apoptosis were respectively assessed by MTT, Transwell assay and flow cytometry. Regulations between lncRNA GAS5 and miR-203a, as well as between miR-203a and TIMP2 were detected by qPCR, western blot and dual luciferase activity assay. Results: LncRNA GAS5 was down-regulated in MG-63 and OS-732 cells compared to hFOB1.19 cells. Silence of lncRNA GAS5 significantly promoted MG-63 cells viability, migration and invasion, and up-regulated Cyclin D1, Cyclin B1, CDK1 and CDK4 expressions. miR-203a was negatively regulated by lncRNA GAS5. The promoting activities of lncRNA GAS5 silence on MG-63 cells growth and metastasis were reversed by miR-203a suppression. TIMP2 was a target of miR-203a and the anti-growth and anti-metastasis actions of miR-203a suppression were reversed by TIMP2 silence. Further, lncRNA GAS5 silence, miR-203a overexpression, and TIMP2 silence could activate PI3K/AKT/GSK3β signaling while block NF-κB signaling. Conclusion: LncRNA GAS5 might be a tumor suppressor in osteosarcoma via sponging miR-203a, sequestering miR-203a away from TIMP2.

  15. RNA STRAND: The RNA Secondary Structure and Statistical Analysis Database

    Directory of Open Access Journals (Sweden)

    Andronescu Mirela

    2008-08-01

    Full Text Available Abstract Background The ability to access, search and analyse secondary structures of a large set of known RNA molecules is very important for deriving improved RNA energy models, for evaluating computational predictions of RNA secondary structures and for a better understanding of RNA folding. Currently there is no database that can easily provide these capabilities for almost all RNA molecules with known secondary structures. Results In this paper we describe RNA STRAND – the RNA secondary STRucture and statistical ANalysis Database, a curated database containing known secondary structures of any type and organism. Our new database provides a wide collection of known RNA secondary structures drawn from public databases, searchable and downloadable in a common format. Comprehensive statistical information on the secondary structures in our database is provided using the RNA Secondary Structure Analyser, a new tool we have developed to analyse RNA secondary structures. The information thus obtained is valuable for understanding to which extent and with which probability certain structural motifs can appear. We outline several ways in which the data provided in RNA STRAND can facilitate research on RNA structure, including the improvement of RNA energy models and evaluation of secondary structure prediction programs. In order to keep up-to-date with new RNA secondary structure experiments, we offer the necessary tools to add solved RNA secondary structures to our database and invite researchers to contribute to RNA STRAND. Conclusion RNA STRAND is a carefully assembled database of trusted RNA secondary structures, with easy on-line tools for searching, analyzing and downloading user selected entries, and is publicly available at http://www.rnasoft.ca/strand.

  16. Studying RNA-protein interactions in vivo by RNA immunoprecipitation

    DEFF Research Database (Denmark)

    Selth, Luke A; Close, Pierre; Svejstrup, Jesper Q

    2011-01-01

    and have significant effects on gene expression. RNA immunoprecipitation (RIP) is a powerful technique used to detect direct and indirect interactions between individual proteins and specific RNA molecules in vivo. Here, we describe RIP methods for both yeast and mammalian cells.......The crucial roles played by RNA-binding proteins in all aspects of RNA metabolism, particularly in the regulation of transcription, have become increasingly evident. Moreover, other factors that do not directly interact with RNA molecules can nevertheless function proximally to RNA polymerases...

  17. Branched RNA: A New Architecture for RNA Interference

    Directory of Open Access Journals (Sweden)

    Anna Aviñó

    2011-01-01

    Full Text Available Branched RNAs with two and four strands were synthesized. These structures were used to obtain branched siRNA. The branched siRNA duplexes had similar inhibitory capacity as those of unmodified siRNA duplexes, as deduced from gene silencing experiments of the TNF-α protein. Branched RNAs are considered novel structures for siRNA technology, and they provide an innovative tool for specific gene inhibition. As the method described here is compatible with most RNA modifications described to date, these compounds may be further functionalized to obtain more potent siRNA derivatives and can be attached to suitable delivery systems.

  18. MicroRNA-129-5p inhibits the development of autoimmune encephalomyelitis-related epilepsy by targeting HMGB1 through the TLR4/NF-kB signaling pathway.

    Science.gov (United States)

    Liu, Ai-Hua; Wu, Ya-Ting; Wang, Yu-Ping

    2017-06-01

    The study aimed to explore the effects of microRNA-129-5p (miR-129-5p) on the development of autoimmune encephalomyelitis (AE)-related epilepsy by targeting HMGB1 through the TLR4/NF-kB signaling pathway in a rat model. AE-related epilepsy models were established. Sprague-Dawley (SD) rats were randomly divided into control, model, miR-129-5p mimics, miR-129-5p inhibitor, HMGB1 shRNA, TLR4/NF-kB (TLR4/NF-kB signaling pathway was inhibited) and miR-129-5p mimics+HMGB1 shRNA groups respectively. Latency to a first epilepsy seizure attack was recorded. Neuronal injuries in the hippocampus regions were detected using HE, Nissl and FJB staining methods 24h following model establishment. Microglial cells were detected by OX-42 immunohistochemistry. Expressions of miR-129-5p, HMGB1 and TLR4/NF-kB signaling pathway-related proteins were detected by qRT-PCR. Protein expressions of HMGB1 and TLR4/NF-kB signaling pathway-related proteins were detected by Western blotting. Dual luciferase reporter gene assay showed that miR-129-5p was negatively targeting HMGB1. Neurons of hippocampal tissues in rats were heavily injured by an injection of lithium chloride. Compared with the model and control groups, neuronal injury of the hippocampus and AE-related epilepsy decreased and microglial cells increased in the miR-129-5p mimics, HMGB1 shRNA and TLR4/NF-kB groups; however, in the miR-129-5p inhibitor group, miR-129-5p expression decreased, HMGB1 expression increased, TLR4/NF-kB signaling pathway was activated, latency to a first epilepsy seizure attack was shortened, and neuronal injury increased. This study provides evidence that miR-129-5p inhibits the development of AE-related epilepsy by suppressing HMGB1 expression and inhibiting TLR4/NF-kB signaling pathway. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. The RNA gene information: retroelement-microRNA entangling as the RNA quantum code.

    Science.gov (United States)

    Fujii, Yoichi Robertus

    2013-01-01

    MicroRNA (miRNA) and retroelements may be a master of regulator in our life, which are evolutionally involved in the origin of species. To support the Darwinism from the aspect of molecular evolution process, it has tremendously been interested in the molecular information of naive RNA. The RNA wave model 2000 consists of four concepts that have altered from original idea of the miRNA genes for crosstalk among embryonic stem cells, their niche cells, and retroelements as a carrier vesicle of the RNA genes. (1) the miRNA gene as a mobile genetic element induces transcriptional and posttranscriptional silencing via networking-processes (no hierarchical architecture); (2) the RNA information supplied by the miRNA genes expands to intracellular, intercellular, intraorgan, interorgan, intraspecies, and interspecies under the cycle of life into the global environment; (3) the mobile miRNAs can self-proliferate; and (4) cells contain two types information as resident and genomic miRNAs. Based on RNA wave, we have developed an interest in investigation of the transformation from RNA information to quantum bits as physicochemical characters of RNA with the measurement of RNA electron spin. When it would have been given that the fundamental bases for the acquired characters in genetics can be controlled by RNA gene information, it may be available to apply for challenging against RNA gene diseases, such as stress-induced diseases.

  20. Plant RNA Regulatory Network and RNA Granules in Virus Infection

    Directory of Open Access Journals (Sweden)

    Kristiina Mäkinen

    2017-12-01

    Full Text Available Regulation of post-transcriptional gene expression on mRNA level in eukaryotic cells includes translocation, translation, translational repression, storage, mRNA decay, RNA silencing, and nonsense-mediated decay. These processes are associated with various RNA-binding proteins and cytoplasmic ribonucleoprotein complexes many of which are conserved across eukaryotes. Microscopically visible aggregations formed by ribonucleoprotein complexes are termed RNA granules. Stress granules where the translationally inactive mRNAs are stored and processing bodies where mRNA decay may occur present the most studied RNA granule types. Diverse RNP-granules are increasingly being assigned important roles in viral infections. Although the majority of the molecular level studies on the role of RNA granules in viral translation and replication have been conducted in mammalian systems, some studies link also plant virus infection to RNA granules. An increasing body of evidence indicates that plant viruses require components of stress granules and processing bodies for their replication and translation, but how extensively the cellular mRNA regulatory network is utilized by plant viruses has remained largely enigmatic. Antiviral RNA silencing, which is an important regulator of viral RNA stability and expression in plants, is commonly counteracted by viral suppressors of RNA silencing. Some of the RNA silencing suppressors localize to cellular RNA granules and have been proposed to carry out their suppression functions there. Moreover, plant nucleotide-binding leucine-rich repeat protein-mediated virus resistance has been linked to enhanced processing body formation and translational repression of viral RNA. Many interesting questions relate to how the pathways of antiviral RNA silencing leading to viral RNA degradation and/or repression of translation, suppression of RNA silencing and viral RNA translation converge in plants and how different RNA granules and

  1. Plant RNA Regulatory Network and RNA Granules in Virus Infection.

    Science.gov (United States)

    Mäkinen, Kristiina; Lõhmus, Andres; Pollari, Maija

    2017-01-01

    Regulation of post-transcriptional gene expression on mRNA level in eukaryotic cells includes translocation, translation, translational repression, storage, mRNA decay, RNA silencing, and nonsense-mediated decay. These processes are associated with various RNA-binding proteins and cytoplasmic ribonucleoprotein complexes many of which are conserved across eukaryotes. Microscopically visible aggregations formed by ribonucleoprotein complexes are termed RNA granules. Stress granules where the translationally inactive mRNAs are stored and processing bodies where mRNA decay may occur present the most studied RNA granule types. Diverse RNP-granules are increasingly being assigned important roles in viral infections. Although the majority of the molecular level studies on the role of RNA granules in viral translation and replication have been conducted in mammalian systems, some studies link also plant virus infection to RNA granules. An increasing body of evidence indicates that plant viruses require components of stress granules and processing bodies for their replication and translation, but how extensively the cellular mRNA regulatory network is utilized by plant viruses has remained largely enigmatic. Antiviral RNA silencing, which is an important regulator of viral RNA stability and expression in plants, is commonly counteracted by viral suppressors of RNA silencing. Some of the RNA silencing suppressors localize to cellular RNA granules and have been proposed to carry out their suppression functions there. Moreover, plant nucleotide-binding leucine-rich repeat protein-mediated virus resistance has been linked to enhanced processing body formation and translational repression of viral RNA. Many interesting questions relate to how the pathways of antiviral RNA silencing leading to viral RNA degradation and/or repression of translation, suppression of RNA silencing and viral RNA translation converge in plants and how different RNA granules and their individual

  2. RNA-Catalyzed Polymerization and Replication of RNA

    Science.gov (United States)

    Horning, D. P.; Samantha, B.; Tjhung, K. F.; Joyce, G. F.

    2017-07-01

    In an effort to reconstruct RNA-based life, in vitro evolution was used to obtain an RNA polymerase ribozyme that can synthesize a variety of complex functional RNAs and can catalyze the exponential amplification of short RNAs.

  3. SUN1 silencing inhibits cell growth through G0/G1 phase arrest in lung adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Huang W

    2017-06-01

    Full Text Available Weiyi Huang,* Haihua Huang,* Lei Wang, Jiong Hu, Weifeng Song Department of Oncology, The First People’s Hospital Affiliated to Shanghai Jiaotong University, Shanghai, People’s Republic of China *These authors contributed equally to this work Purpose: Cytoskeleton is critical for carcinoma cell proliferation, migration, and invasion. Sad-1 and UNC-84 domain containing 1 (SUN1 is one of the core linkers of nucleoskeleton and cytoskeleton. However, the functions of SUN1 in lung adenocarcinoma are largely unknown.Methods: In this study, we first transduced the lentivirus delivering the short hairpin RNA (shRNA against SUN1 to lung adenocarcinoma cells (A549 and 95D cells with high efficiency. After lentivirus infection, quantitative real-time polymerase chain reaction and Western blotting were used to detect the expressions of SUN1 mRNA and protein. The cell proliferation and colony formation were detected by MTT assay and colony formation assay, respectively. The cell distribution in the cell cycle was analyzed by flow cytometry.Results: Both mRNA and protein levels of SUN1 were significantly decreased in A549 and 95D cells after lentivirus infection, as indicated by quantitative real-time polymerase chain reaction and Western blot. Next, we found that cell proliferation and colony formation were markedly reduced in SUN1 silenced cells. Moreover, suppression of SUN1 led to cell cycle arrest at G0/G1 phase. Furthermore, Cyclin D1, CDK6, and CDK2 expressions were obviously reduced in A549 cells after SUN1 silencing.Conclusion: These results suggest that SUN1 plays an essential role in proliferation of lung adenocarcinoma cells in vitro and may be used as a potential therapeutic target for the treatment of lung adenocarcinoma in the future. Keywords: SUN1, lung cancer, proliferation

  4. Gene silencing of indoleamine 2,3-dioxygenase 2 in melanoma cells induces apoptosis through the suppression of NAD+ and inhibits in vivo tumor growth.

    Science.gov (United States)

    Liu, Yanling; Zhang, Yujuan; Zheng, Xiufen; Zhang, Xusheng; Wang, Hongmei; Li, Qin; Yuan, Keng; Zhou, Nanjing; Yu, Yanrong; Song, Na; Fu, Jiamin; Min, Weiping

    2016-05-31

    Indoleamine 2,3-dioxygenase 2 (IDO2) is a newly discovered enzyme that catalyzes the initial and rate-limiting step in the degradation of tryptophan. As a homologous protein of IDO1, IDO2 plays an inhibitory role in T cell proliferation, and it is essential for regulatory T cell (Treg) generation in healthy conditions. Little is known about the immune-independent functions of IDO2 relevant to its specific contributions to physiology and pathophysiology in cancer cells. The purpose of this study was to assess the impact of IDO2 gene silencing as a way to inhibit B16-BL6 cancer cells in a murine model. Here, for the first time, we show that knockdown of IDO2 using small interfering RNA (siRNA) inhibits cancer cell proliferation, arrests cell cycle in G1, induces greater cell apoptosis, and reduces cell migration in vitro. Knockdown of IDO2 decreased the generation of nicotinamide adenine dinucleotide (NAD+) while increasing the generation of reactive oxygen species (ROS). We further demonstrate that cell apoptosis, induced by IDO2 downregulation, can be weakened by addition of exogenous NAD+, suggesting a novel mechanism by which IDO2 promotes tumor growth through its metabolite product NAD+. In addition to in vitro findings, we also demonstrate that IDO2 silencing in tumor cells using short hairpin RNA (shRNA) delayed tumor formation and arrested tumor growth in vivo. In conclusion, this study demonstrates a new non-immune-associated mechanism of IDO2 in vitro and IDO2 expression in B16-BL6 cells contributes to cancer development and progression. Our research provides evidence of a novel target for gene silencing that has the potential to enhance cancer therapy.

  5. Natural RNA circles function as efficient microRNA sponges

    DEFF Research Database (Denmark)

    Hansen, Thomas Birkballe; Jensen, Trine I; Clausen, Bettina Hjelm

    2013-01-01

    MicroRNAs (miRNAs) are important post-transcriptional regulators of gene expression that act by direct base pairing to target sites within untranslated regions of messenger RNAs. Recently, miRNA activity has been shown to be affected by the presence of miRNA sponge transcripts, the so-called comp......MicroRNAs (miRNAs) are important post-transcriptional regulators of gene expression that act by direct base pairing to target sites within untranslated regions of messenger RNAs. Recently, miRNA activity has been shown to be affected by the presence of miRNA sponge transcripts, the so......-called competing endogenous RNA in humans and target mimicry in plants. We previously identified a highly expressed circular RNA (circRNA) in human and mouse brain. Here we show that this circRNA acts as a miR-7 sponge; we term this circular transcript ciRS-7 (circular RNA sponge for miR-7). ciRS-7 contains more...... sponge, suggesting that miRNA sponge effects achieved by circRNA formation are a general phenomenon. This study serves as the first, to our knowledge, functional analysis of a naturally expressed circRNA....

  6. Strategies underlying RNA silencing suppression by negative strand RNA viruses

    NARCIS (Netherlands)

    Hemmes, J.C.

    2007-01-01

    The research described in this thesis focused on the strategies of negative strand RNA viruses to counteract antiviral RNA silencing. In plants and insects, RNA silencing has been shown to act as a sequence specific antiviral defence mechanism that is characterised by the processing of double

  7. RNA Interference - Towards RNA becoming a Medicine -42 ...

    Indian Academy of Sciences (India)

    research. A brief history of the development ofRNAi is shown in. Box 2. Mechanism of ... new RNA strand using target RNA as the template and thereby converting it ... thought to excise precursor stRNA from their -70 nt stem loop precursor to ...

  8. Semiautomated improvement of RNA alignments

    DEFF Research Database (Denmark)

    Andersen, Ebbe Sloth; Lind-Thomsen, Allan; Knudsen, Bjarne

    2007-01-01

    connects to external tools to provide a flexible semiautomatic editing environment. A new method, Pcluster, is introduced for dividing the sequences of an RNA alignment into subgroups with secondary structure differences. Pcluster was used to evaluate 574 seed alignments obtained from the Rfam database...... and we identified 71 alignments with significant prediction of inconsistent base pairs and 102 alignments with significant prediction of novel base pairs. Four RNA families were used to illustrate how SARSE can be used to manually or automatically correct the inconsistent base pairs detected by Pcluster......: the mir-399 RNA, vertebrate telomase RNA (vert-TR), bacterial transfer-messenger RNA (tmRNA), and the signal recognition particle (SRP) RNA. The general use of the method is illustrated by the ability to accommodate pseudoknots and handle even large and divergent RNA families. The open architecture...

  9. Comparative RNA genomics

    DEFF Research Database (Denmark)

    Backofen, Rolf; Gorodkin, Jan; Hofacker, Ivo L.

    2018-01-01

    Over the last two decades it has become clear that RNA is much more than just a boring intermediate in protein expression. Ancient RNAs still appear in the core information metabolism and comprise a surprisingly large component in bacterial gene regulation. A common theme with these types of mostly...... small RNAs is their reliance of conserved secondary structures. Large scale sequencing projects, on the other hand, have profoundly changed our understanding of eukaryotic genomes. Pervasively transcribed, they give rise to a plethora of large and evolutionarily extremely flexible noncoding RNAs...... that exert a vastly diverse array of molecule functions. In this chapter we provide a—necessarily incomplete—overview of the current state of comparative analysis of noncoding RNAs, emphasizing computational approaches as a means to gain a global picture of the modern RNA world....

  10. MicroRNA from tuberculosis RNA: A bioinformatics study

    OpenAIRE

    Wiwanitkit, Somsri; Wiwanitkit, Viroj

    2012-01-01

    The role of microRNA in the pathogenesis of pulmonary tuberculosis is the interesting topic in chest medicine at present. Recently, it was proposed that the microRNA can be a useful biomarker for monitoring of pulmonary tuberculosis and might be the important part in pathogenesis of disease. Here, the authors perform a bioinformatics study to assess the microRNA within known tuberculosis RNA. The microRNA part can be detected and this can be important key information in further study of the p...

  11. RNA binding and replication by the poliovirus RNA polymerase

    International Nuclear Information System (INIS)

    Oberste, M.S.

    1988-01-01

    RNA binding and RNA synthesis by the poliovirus RNA-dependent RNA polymerase were studied in vitro using purified polymerase. Templates for binding and RNA synthesis studies were natural RNAs, homopolymeric RNAs, or subgenomic poliovirus-specific RNAs synthesized in vitro from cDNA clones using SP6 or T7 RNA polymerases. The binding of the purified polymerase to poliovirion and other RNAs was studied using a protein-RNA nitrocellulose filter binding assay. A cellular poly(A)-binding protein was found in the viral polymerase preparations, but was easily separated from the polymerase by chromatography on poly(A) Sepharose. The binding of purified polymerase to 32 P-labeled ribohomopolymeric RNAs was examined, and the order of binding observed was poly(G) >>> poly(U) > poly(C) > poly(A). The K a for polymerase binding to poliovirion RNA and to a full-length negative strand transcript was about 1 x 10 9 M -1 . The polymerase binds to a subgenomic RNAs which contain the 3' end of the genome with a K a similar to that for virion RNA, but binds less well to 18S rRNA, globin mRNA, and subgenomic RNAs which lack portions of the 3' noncoding region

  12. Genetic relatedness of orbiviruses by RNA-RNA blot hybridization

    International Nuclear Information System (INIS)

    Bodkin, D.K.

    1985-01-01

    RNA-RNA blot hybridization was developed in order to identify type-specific genes among double-stranded (ds) RNA viruses, to assess the genetic relatedness of dsRNA viruses and to classify new strains. Viral dsRNA segments were electrophoresed through 10% polyacrylamide gels, transferred to membranes, and hybridized to [5' 32 P]-pCp labeled genomic RNA from a related strain. Hybridization was performed at 52 0 C, 50% formamide, 5X SSC. Under these conditions heterologous RNA species must share ≥ 74% sequence homology in order to form stable dsRNA hybrids. Cognate genes of nine members of the Palyam serogroup of orbiviruses were identified and their sequence relatedness to the prototype. Palyam virus, was determined. Reciprocal blot hybridizations were performed using radiolabeled genomic RNA of all members of the Palyam serogroup. Unique and variant genes were identified by lack of cross-homology or by weak homology between segments. Since genes 2 and 6 exhibited the highest degree of sequence variability, response to the vertebrate immune system may be a major cause of sequence divergence among members of a single serogroup. Changuinola serogroup isolates were compared by dot-blot hybridization, while Colorado tick fever (CTF) serogroup isolates were compared by the RNA-RNA blot hybridization procedure described for reovirus and Palyam serogroup isolates. Preliminary blot hybridization data were also obtained on the relatedness of members of different Orbivirus serogroups

  13. RNA-SSPT: RNA Secondary Structure Prediction Tools.

    Science.gov (United States)

    Ahmad, Freed; Mahboob, Shahid; Gulzar, Tahsin; Din, Salah U; Hanif, Tanzeela; Ahmad, Hifza; Afzal, Muhammad

    2013-01-01

    The prediction of RNA structure is useful for understanding evolution for both in silico and in vitro studies. Physical methods like NMR studies to predict RNA secondary structure are expensive and difficult. Computational RNA secondary structure prediction is easier. Comparative sequence analysis provides the best solution. But secondary structure prediction of a single RNA sequence is challenging. RNA-SSPT is a tool that computationally predicts secondary structure of a single RNA sequence. Most of the RNA secondary structure prediction tools do not allow pseudoknots in the structure or are unable to locate them. Nussinov dynamic programming algorithm has been implemented in RNA-SSPT. The current studies shows only energetically most favorable secondary structure is required and the algorithm modification is also available that produces base pairs to lower the total free energy of the secondary structure. For visualization of RNA secondary structure, NAVIEW in C language is used and modified in C# for tool requirement. RNA-SSPT is built in C# using Dot Net 2.0 in Microsoft Visual Studio 2005 Professional edition. The accuracy of RNA-SSPT is tested in terms of Sensitivity and Positive Predicted Value. It is a tool which serves both secondary structure prediction and secondary structure visualization purposes.

  14. RNA meets disease in paradise.

    Science.gov (United States)

    Winter, Julia; Roth, Anna; Diederichs, Sven

    2011-01-01

    Getting off the train in Jena-Paradies, 60 participants joined for the 12 (th) Young Scientist Meeting of the German Society for Cell Biology (DGZ) entitled "RNA & Disease". Excellent speakers from around the world, graduate students, postdocs and young group leaders enjoyed a meeting in a familiar atmosphere to exchange inspiring new data and vibrant scientific discussions about the fascinating history and exciting future of non-coding RNA research including microRNA, piRNA and long non-coding RNA as well as their function in cancer, diabetes and neurodegenerative diseases.

  15. RNA interference gene therapy in dominant retinitis pigmentosa and cone-rod dystrophy mouse models caused by GCAP1 mutations

    Directory of Open Access Journals (Sweden)

    Li eJiang

    2014-04-01

    Full Text Available RNA interference (RNAi knockdown is an efficacious therapeutic strategy for silencing genes causative for dominant retinal dystrophies. To test this, we used self-complementary (sc AAV2/8 vector to develop an RNAi-based therapy in two dominant retinal degeneration mouse models. The allele-specific model expresses transgenic bovine GCAP1(Y99C establishing a rapid RP-like phenotype, whereas the nonallele-specific model expresses mouse GCAP1(L151F producing a slowly progressing cone/rod dystrophy (CORD. The late onset GCAP1(L151F-CORD mimics the dystrophy observed in human GCAP1-CORD patients. Subretinal injection of scAAV2/8 carrying shRNA expression cassettes specific for bovine or mouse GCAP1 showed strong expression at one week post-injection. In both allele-specific (GCAP1(Y99C-RP and nonallele-specific (GCAP1(L151F-CORD models of dominant retinal dystrophy, RNAi-mediated gene silencing enhanced photoreceptor survival, delayed onset of degeneration and improved visual function. Such results provide a proof of concept toward effective RNAi-based gene therapy mediated by scAAV2/8 for dominant retinal disease based on GCAP1 mutation. Further, nonallele-specific RNAi knockdown of GCAP1 may prove generally applicable toward the rescue of any human GCAP1-based dominant cone-rod dystrophy.

  16. From "Cellular" RNA to "Smart" RNA: Multiple Roles of RNA in Genome Stability and Beyond.

    Science.gov (United States)

    Michelini, Flavia; Jalihal, Ameya P; Francia, Sofia; Meers, Chance; Neeb, Zachary T; Rossiello, Francesca; Gioia, Ubaldo; Aguado, Julio; Jones-Weinert, Corey; Luke, Brian; Biamonti, Giuseppe; Nowacki, Mariusz; Storici, Francesca; Carninci, Piero; Walter, Nils G; Fagagna, Fabrizio d'Adda di

    2018-03-30

    Coding for proteins has been considered the main function of RNA since the "central dogma" of biology was proposed. The discovery of noncoding transcripts shed light on additional roles of RNA, ranging from the support of polypeptide synthesis, to the assembly of subnuclear structures, to gene expression modulation. Cellular RNA has therefore been recognized as a central player in often unanticipated biological processes, including genomic stability. This ever-expanding list of functions inspired us to think of RNA as a "smart" phone, which has replaced the older obsolete "cellular" phone. In this review, we summarize the last two decades of advances in research on the interface between RNA biology and genome stability. We start with an account of the emergence of noncoding RNA, and then we discuss the involvement of RNA in DNA damage signaling and repair, telomere maintenance, and genomic rearrangements. We continue with the depiction of single-molecule RNA detection techniques, and we conclude by illustrating the possibilities of RNA modulation in hopes of creating or improving new therapies. The widespread biological functions of RNA have made this molecule a reoccurring theme in basic and translational research, warranting it the transcendence from classically studied "cellular" RNA to "smart" RNA.

  17. Transfer RNA and human disease

    Directory of Open Access Journals (Sweden)

    Jamie A Abbott

    2014-06-01

    Full Text Available Pathological mutations in tRNA genes and tRNA processing enzymes are numerous and result in very complicated clinical phenotypes. Mitochondrial tRNA (mt-tRNA genes are hotspots for pathological mutations and over 200 mt-tRNA mutations have been linked to various disease states. Often these mutations prevent tRNA aminoacylation. Disrupting this primary function affects protein synthesis and the expression, folding, and function of oxidative phosphorylation enzymes. Mitochondrial tRNA mutations manifest in a wide panoply of diseases related to cellular energetics, including COX deficiency (cytochrome C oxidase, mitochondrial myopathy, MERRF (Myoclonic Epilepsy with Ragged Red Fibers, and MELAS (mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes. Diseases caused by mt-tRNA mutations can also affect very specific tissue types, as in the case of neurosensory non-syndromic hearing loss and pigmentary retinopathy, diabetes mellitus, and hypertrophic cardiomyopathy. Importantly, mitochondrial heteroplasmy plays a role in disease severity and age of onset as well. Not surprisingly, mutations in enzymes that modify cytoplasmic and mitochondrial tRNAs are also linked to a diverse range of clinical phenotypes. In addition to compromised aminoacylation of the tRNAs, mutated modifying enzymes can also impact tRNA expression and abundance, tRNA modifications, tRNA folding, and even tRNA maturation (e.g., splicing. Some of these pathological mutations in tRNAs and processing enzymes are likely to affect non-canonical tRNA functions, and contribute to the diseases without significantly impacting on translation. This chapter will review recent literature on the relation of mitochondrial and cytoplasmic tRNA, and enzymes that process tRNAs, to human disease. We explore the mechanisms involved in the clinical presentation of these various diseases with an emphasis on neurological disease.

  18. Transfer RNA and human disease.

    Science.gov (United States)

    Abbott, Jamie A; Francklyn, Christopher S; Robey-Bond, Susan M

    2014-01-01

    Pathological mutations in tRNA genes and tRNA processing enzymes are numerous and result in very complicated clinical phenotypes. Mitochondrial tRNA (mt-tRNA) genes are "hotspots" for pathological mutations and over 200 mt-tRNA mutations have been linked to various disease states. Often these mutations prevent tRNA aminoacylation. Disrupting this primary function affects protein synthesis and the expression, folding, and function of oxidative phosphorylation enzymes. Mitochondrial tRNA mutations manifest in a wide panoply of diseases related to cellular energetics, including COX deficiency (cytochrome C oxidase), mitochondrial myopathy, MERRF (Myoclonic Epilepsy with Ragged Red Fibers), and MELAS (mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes). Diseases caused by mt-tRNA mutations can also affect very specific tissue types, as in the case of neurosensory non-syndromic hearing loss and pigmentary retinopathy, diabetes mellitus, and hypertrophic cardiomyopathy. Importantly, mitochondrial heteroplasmy plays a role in disease severity and age of onset as well. Not surprisingly, mutations in enzymes that modify cytoplasmic and mitochondrial tRNAs are also linked to a diverse range of clinical phenotypes. In addition to compromised aminoacylation of the tRNAs, mutated modifying enzymes can also impact tRNA expression and abundance, tRNA modifications, tRNA folding, and even tRNA maturation (e.g., splicing). Some of these pathological mutations in tRNAs and processing enzymes are likely to affect non-canonical tRNA functions, and contribute to the diseases without significantly impacting on translation. This chapter will review recent literature on the relation of mitochondrial and cytoplasmic tRNA, and enzymes that process tRNAs, to human disease. We explore the mechanisms involved in the clinical presentation of these various diseases with an emphasis on neurological disease.

  19. RNA Thermodynamic Structural Entropy.

    Science.gov (United States)

    Garcia-Martin, Juan Antonio; Clote, Peter

    2015-01-01

    Conformational entropy for atomic-level, three dimensional biomolecules is known experimentally to play an important role in protein-ligand discrimination, yet reliable computation of entropy remains a difficult problem. Here we describe the first two accurate and efficient algorithms to compute the conformational entropy for RNA secondary structures, with respect to the Turner energy model, where free energy parameters are determined from UV absorption experiments. An algorithm to compute the derivational entropy for RNA secondary structures had previously been introduced, using stochastic context free grammars (SCFGs). However, the numerical value of derivational entropy depends heavily on the chosen context free grammar and on the training set used to estimate rule probabilities. Using data from the Rfam database, we determine that both of our thermodynamic methods, which agree in numerical value, are substantially faster than the SCFG method. Thermodynamic structural entropy is much smaller than derivational entropy, and the correlation between length-normalized thermodynamic entropy and derivational entropy is moderately weak to poor. In applications, we plot the structural entropy as a function of temperature for known thermoswitches, such as the repression of heat shock gene expression (ROSE) element, we determine that the correlation between hammerhead ribozyme cleavage activity and total free energy is improved by including an additional free energy term arising from conformational entropy, and we plot the structural entropy of windows of the HIV-1 genome. Our software RNAentropy can compute structural entropy for any user-specified temperature, and supports both the Turner'99 and Turner'04 energy parameters. It follows that RNAentropy is state-of-the-art software to compute RNA secondary structure conformational entropy. Source code is available at https://github.com/clotelab/RNAentropy/; a full web server is available at http

  20. RNA Thermodynamic Structural Entropy.

    Directory of Open Access Journals (Sweden)

    Juan Antonio Garcia-Martin

    Full Text Available Conformational entropy for atomic-level, three dimensional biomolecules is known experimentally to play an important role in protein-ligand discrimination, yet reliable computation of entropy remains a difficult problem. Here we describe the first two accurate and efficient algorithms to compute the conformational entropy for RNA secondary structures, with respect to the Turner energy model, where free energy parameters are determined from UV absorption experiments. An algorithm to compute the derivational entropy for RNA secondary structures had previously been introduced, using stochastic context free grammars (SCFGs. However, the numerical value of derivational entropy depends heavily on the chosen context free grammar and on the training set used to estimate rule probabilities. Using data from the Rfam database, we determine that both of our thermodynamic methods, which agree in numerical value, are substantially faster than the SCFG method. Thermodynamic structural entropy is much smaller than derivational entropy, and the correlation between length-normalized thermodynamic entropy and derivational entropy is moderately weak to poor. In applications, we plot the structural entropy as a function of temperature for known thermoswitches, such as the repression of heat shock gene expression (ROSE element, we determine that the correlation between hammerhead ribozyme cleavage activity and total free energy is improved by including an additional free energy term arising from conformational entropy, and we plot the structural entropy of windows of the HIV-1 genome. Our software RNAentropy can compute structural entropy for any user-specified temperature, and supports both the Turner'99 and Turner'04 energy parameters. It follows that RNAentropy is state-of-the-art software to compute RNA secondary structure conformational entropy. Source code is available at https://github.com/clotelab/RNAentropy/; a full web server is available at http

  1. Identifying microRNA/mRNA dysregulations in ovarian cancer.

    Science.gov (United States)

    Miles, Gregory D; Seiler, Michael; Rodriguez, Lorna; Rajagopal, Gunaretnam; Bhanot, Gyan

    2012-03-27

    MicroRNAs are a class of noncoding RNA molecules that co-regulate the expression of multiple genes via mRNA transcript degradation or translation inhibition. Since they often target entire pathways, they may be better drug targets than genes or proteins. MicroRNAs are known to be dysregulated in many tumours and associated with aggressive or poor prognosis phenotypes. Since they regulate mRNA in a tissue specific manner, their functional mRNA targets are poorly understood. In previous work, we developed a method to identify direct mRNA targets of microRNA using patient matched microRNA/mRNA expression data using an anti-correlation signature. This method, applied to clear cell Renal Cell Carcinoma (ccRCC), revealed many new regulatory pathways compromised in ccRCC. In the present paper, we apply this method to identify dysregulated microRNA/mRNA mechanisms in ovarian cancer using data from The Cancer Genome Atlas (TCGA). TCGA Microarray data was normalized and samples whose class labels (tumour or normal) were ambiguous with respect to consensus ensemble K-Means clustering were removed. Significantly anti-correlated and correlated genes/microRNA differentially expressed between tumour and normal samples were identified. TargetScan was used to identify gene targets of microRNA. We identified novel microRNA/mRNA mechanisms in ovarian cancer. For example, the expression level of RAD51AP1 was found to be strongly anti-correlated with the expression of hsa-miR-140-3p, which was significantly down-regulated in the tumour samples. The anti-correlation signature was present separately in the tumour and normal samples, suggesting a direct causal dysregulation of RAD51AP1 by hsa-miR-140-3p in the ovary. Other pairs of potentially biological relevance include: hsa-miR-145/E2F3, hsa-miR-139-5p/TOP2A, and hsa-miR-133a/GCLC. We also identified sets of positively correlated microRNA/mRNA pairs that are most likely result from indirect regulatory mechanisms. Our findings identify

  2. Analyzing Pseudophosphatase Function.

    Science.gov (United States)

    Hinton, Shantá D

    2016-01-01

    Pseudophosphatases regulate signal transduction cascades, but their mechanisms of action remain enigmatic. Reflecting this mystery, the prototypical pseudophosphatase STYX (phospho-serine-threonine/tyrosine-binding protein) was named with allusion to the river of the dead in Greek mythology to emphasize that these molecules are "dead" phosphatases. Although proteins with STYX domains do not catalyze dephosphorylation, this in no way precludes their having other functions as integral elements of signaling networks. Thus, understanding their roles in signaling pathways may mark them as potential novel drug targets. This chapter outlines common strategies used to characterize the functions of pseudophosphatases, using as an example MK-STYX [mitogen-activated protein kinase (MAPK) phospho-serine-threonine/tyrosine binding], which has been linked to tumorigenesis, apoptosis, and neuronal differentiation. We start with the importance of "restoring" (when possible) phosphatase activity in a pseudophosphatase so that the active mutant may be used as a comparison control throughout immunoprecipitation and mass spectrometry analyses. To this end, we provide protocols for site-directed mutagenesis, mammalian cell transfection, co-immunoprecipitation, phosphatase activity assays, and immunoblotting that we have used to investigate MK-STYX and the active mutant MK-STYXactive. We also highlight the importance of utilizing RNA interference (RNAi) "knockdown" technology to determine a cellular phenotype in various cell lines. Therefore, we outline our protocols for introducing short hairpin RNA (shRNA) expression plasmids into mammalians cells and quantifying knockdown of gene expression with real-time quantitative PCR (qPCR). A combination of cellular, molecular, biochemical, and proteomic techniques has served as powerful tools in identifying novel functions of the pseudophosphatase MK-STYX. Likewise, the information provided here should be a helpful guide to elucidating the

  3. Lappaol F, a novel anticancer agent isolated from plant arctium Lappa L.

    Science.gov (United States)

    Sun, Qing; Liu, Kanglun; Shen, Xiaoling; Jin, Weixin; Jiang, Lingyan; Sheikh, M Saeed; Hu, Yingjie; Huang, Ying

    2014-01-01

    In an effort to search for new cancer-fighting therapeutics, we identified a novel anticancer constituent, Lappaol F, from plant Arctium Lappa L. Lappaol F suppressed cancer cell growth in a time- and dose-dependent manner in human cancer cell lines of various tissue types. We found that Lappaol F induced G(1) and G(2) cell-cycle arrest, which was associated with strong induction of p21 and p27 and reduction of cyclin B1 and cyclin-dependent kinase 1 (CDK1). Depletion of p21 via genetic knockout or short hairpin RNA (shRNA) approaches significantly abrogated Lappaol F-mediated G(2) arrest and CDK1 and cyclin B1 suppression. These results suggest that p21 seems to play a crucial role in Lappaol F-mediated regulation of CDK1 and cyclin B1 and G(2) arrest. Lappaol F-mediated p21 induction was found to occur at the mRNA level and involved p21 promoter activation. Lappaol F was also found to induce cell death in several cancer cell lines and to activate caspases. In contrast with its strong growth inhibitory effects on tumor cells, Lappaol F had minimal cytotoxic effects on nontumorigenic epithelial cells tested. Importantly, our data also demonstrate that Lappaol F exhibited strong growth inhibition of xenograft tumors in nude mice. Lappaol F was well tolerated in treated animals without significant toxicity. Taken together, our results, for the first time, demonstrate that Lappaol F exhibits antitumor activity in vitro and in vivo and has strong potential to be developed as an anticancer therapeutic.

  4. Adenovirus Detection by the cGAS/STING/TBK1 DNA Sensing Cascade

    Science.gov (United States)

    Lam, Eric; Stein, Saskia

    2014-01-01

    Adenovirus (Ad) infection triggers a cell-specific antiviral response following exposure of viral DNA to the intracellular compartment. A variety of DNA sensors (DAI, AIM2, DDx41, RNA polymerase [Pol] III, and IFI16 [p204]) have been identified in recent years; however, the DNA sensor involved in detection of adenovirus has not been established. Cyclic GMP-AMP synthase (cGAS), a DNA sensor that produces a cyclic guanine-adenine dinucleotide (cGAMP) inducer of STING, has been examined to determine its role in generating an antiadenoviral response. Short hairpin RNA (shRNA) lentiviral vectors targeting TBK1, STING, and cGAS were established in murine MS1 endothelial and RAW 264.7 macrophage cell lines. Knockdown of TBK1, STING, and cGAS results in a dramatic reduction in the activation of the primary antiviral response marker phosphorylated interferon (IFN) response factor 3 (IRF3) following exposure to adenovirus. Furthermore, activation of secondary type I IFN signaling targets (ptyrSTAT1 and ptyrSTAT2 [ptyrSTAT1/2]) was also compromised. Consistent with compromised activation of primary and secondary response markers, transcriptional activation of IRF3-responsive genes (beta IFN [IFN-β], ISG15, ISG54) and secondary response transcripts were diminished in cells knocked down in cGAS, STING, or TBK1. These data establish cGAS as the dominant cytosolic DNA sensor responsible for detection of internalized adenovirus leading to induction of the type I interferon antiviral cascade. PMID:24198409

  5. Attenuated food anticipatory activity and abnormal circadian locomotor rhythms in Rgs16 knockdown mice.

    Directory of Open Access Journals (Sweden)

    Naoto Hayasaka

    Full Text Available Regulators of G protein signaling (RGS are a multi-functional protein family, which functions in part as GTPase-activating proteins (GAPs of G protein α-subunits to terminate G protein signaling. Previous studies have demonstrated that the Rgs16 transcripts exhibit robust circadian rhythms both in the suprachiasmatic nucleus (SCN, the master circadian light-entrainable oscillator (LEO of the hypothalamus, and in the liver. To investigate the role of RGS16 in the circadian clock in vivo, we generated two independent transgenic mouse lines using lentiviral vectors expressing short hairpin RNA (shRNA targeting the Rgs16 mRNA. The knockdown mice demonstrated significantly shorter free-running period of locomotor activity rhythms and reduced total activity as compared to the wild-type siblings. In addition, when feeding was restricted during the daytime, food-entrainable oscillator (FEO-driven elevated food-anticipatory activity (FAA observed prior to the scheduled feeding time was significantly attenuated in the knockdown mice. Whereas the restricted feeding phase-advanced the rhythmic expression of the Per2 clock gene in liver and thalamus in the wild-type animals, the above phase shift was not observed in the knockdown mice. This is the first in vivo demonstration that a common regulator of G protein signaling is involved in the two separate, but interactive circadian timing systems, LEO and FEO. The present study also suggests that liver and/or thalamus regulate the food-entrained circadian behavior through G protein-mediated signal transduction pathway(s.

  6. FTY720 and two novel butterfly derivatives exert a general anti-inflammatory potential by reducing immune cell adhesion to endothelial cells through activation of S1P(3) and phosphoinositide 3-kinase.

    Science.gov (United States)

    Imeri, Faik; Blanchard, Olivier; Jenni, Aurelio; Schwalm, Stephanie; Wünsche, Christin; Zivkovic, Aleksandra; Stark, Holger; Pfeilschifter, Josef; Huwiler, Andrea

    2015-12-01

    Sphingosine-1-phosphate (S1P) is a key lipid regulator of a variety of cellular responses including cell proliferation and survival, cell migration, and inflammatory reactions. Here, we investigated the effect of S1P receptor activation on immune cell adhesion to endothelial cells under inflammatory conditions. We show that S1P reduces both tumor necrosis factor (TNF)-α- and lipopolysaccharide (LPS)-stimulated adhesion of Jurkat and U937 cells to an endothelial monolayer. The reducing effect of S1P was reversed by the S1P1+3 antagonist VPC23019 but not by the S1P1 antagonist W146. Additionally, knockdown of S1P3, but not S1P1, by short hairpin RNA (shRNA) abolished the reducing effect of S1P, suggesting the involvement of S1P3. A suppression of immune cell adhesion was also seen with the immunomodulatory drug FTY720 and two novel butterfly derivatives ST-968 and ST-1071. On the molecular level, S1P and all FTY720 derivatives reduced the mRNA expression of LPS- and TNF-α-induced adhesion molecules including ICAM-1, VCAM-1, E-selectin, and CD44 which was reversed by the PI3K inhibitor LY294002, but not by the MEK inhibitor U0126.In summary, our data demonstrate a novel molecular mechanism by which S1P, FTY720, and two novel butterfly derivatives acted anti-inflammatory that is by suppressing gene transcription of various endothelial adhesion molecules and thereby preventing adhesion of immune cells to endothelial cells and subsequent extravasation.

  7. Androgen receptor activity modulates responses to cisplatin treatment in bladder cancer.

    Science.gov (United States)

    Kashiwagi, Eiji; Ide, Hiroki; Inoue, Satoshi; Kawahara, Takashi; Zheng, Yichun; Reis, Leonardo O; Baras, Alexander S; Miyamoto, Hiroshi

    2016-08-02

    Cisplatin (CDDP)-based combination chemotherapy remains the mainstream treatment for advanced bladder cancer. However, its efficacy is often limited due to the development of resistance for which underlying mechanisms are poorly understood. Meanwhile, emerging evidence has indicated the involvement of androgen-mediated androgen receptor (AR) signals in bladder cancer progression. In this study, we aimed to investigate whether AR signals have an impact on sensitivity to CDDP in bladder cancer cells. UMUC3-control-short hairpin RNA (shRNA) cells with endogenous AR and AR-negative 647V/5637 cells stably expressing AR were significantly more resistant to CDDP treatment at its pharmacological concentrations, compared with UMUC3-AR-shRNA and 647V-vector/5637-vector control cells, respectively. A synthetic androgen R1881 significantly reduced CDDP sensitivity in UMUC3, 647V-AR, or 5637-AR cells, and the addition of an anti-androgen hydroxyflutamide inhibited the effect of R1881. In these AR-positive cells, R1881 treatment also induced the expression levels of NF-κB, which is known to involve CDDP resistance, and its phosphorylated form, as well as nuclear translocation of NF-κB. In CDDP-resistant bladder cancer sublines established following long-term culture with CDDP, the expression levels of AR as well as NF-κB and phospho-NF-κB were considerably elevated, compared with respective control sublines. In bladder cancer specimens, there was a strong trend to correlate between AR positivity and chemoresistance. These results suggest that AR activation correlates with CDDP resistance presumably via modulating NF-κB activity in bladder cancer cells. Targeting AR during chemotherapy may thus be a useful strategy to overcome CDDP resistance in patients with AR-positive bladder cancer.

  8. RNA-PAIRS: RNA probabilistic assignment of imino resonance shifts

    International Nuclear Information System (INIS)

    Bahrami, Arash; Clos, Lawrence J.; Markley, John L.; Butcher, Samuel E.; Eghbalnia, Hamid R.

    2012-01-01

    The significant biological role of RNA has further highlighted the need for improving the accuracy, efficiency and the reach of methods for investigating RNA structure and function. Nuclear magnetic resonance (NMR) spectroscopy is vital to furthering the goals of RNA structural biology because of its distinctive capabilities. However, the dispersion pattern in the NMR spectra of RNA makes automated resonance assignment, a key step in NMR investigation of biomolecules, remarkably challenging. Herein we present RNA Probabilistic Assignment of Imino Resonance Shifts (RNA-PAIRS), a method for the automated assignment of RNA imino resonances with synchronized verification and correction of predicted secondary structure. RNA-PAIRS represents an advance in modeling the assignment paradigm because it seeds the probabilistic network for assignment with experimental NMR data, and predicted RNA secondary structure, simultaneously and from the start. Subsequently, RNA-PAIRS sets in motion a dynamic network that reverberates between predictions and experimental evidence in order to reconcile and rectify resonance assignments and secondary structure information. The procedure is halted when assignments and base-parings are deemed to be most consistent with observed crosspeaks. The current implementation of RNA-PAIRS uses an initial peak list derived from proton-nitrogen heteronuclear multiple quantum correlation ( 1 H– 15 N 2D HMQC) and proton–proton nuclear Overhauser enhancement spectroscopy ( 1 H– 1 H 2D NOESY) experiments. We have evaluated the performance of RNA-PAIRS by using it to analyze NMR datasets from 26 previously studied RNAs, including a 111-nucleotide complex. For moderately sized RNA molecules, and over a range of comparatively complex structural motifs, the average assignment accuracy exceeds 90%, while the average base pair prediction accuracy exceeded 93%. RNA-PAIRS yielded accurate assignments and base pairings consistent with imino resonances for a

  9. RNA-PAIRS: RNA probabilistic assignment of imino resonance shifts

    Energy Technology Data Exchange (ETDEWEB)

    Bahrami, Arash; Clos, Lawrence J.; Markley, John L.; Butcher, Samuel E. [National Magnetic Resonance Facility at Madison (United States); Eghbalnia, Hamid R., E-mail: eghbalhd@uc.edu [University of Cincinnati, Department of Molecular and Cellular Physiology (United States)

    2012-04-15

    The significant biological role of RNA has further highlighted the need for improving the accuracy, efficiency and the reach of methods for investigating RNA structure and function. Nuclear magnetic resonance (NMR) spectroscopy is vital to furthering the goals of RNA structural biology because of its distinctive capabilities. However, the dispersion pattern in the NMR spectra of RNA makes automated resonance assignment, a key step in NMR investigation of biomolecules, remarkably challenging. Herein we present RNA Probabilistic Assignment of Imino Resonance Shifts (RNA-PAIRS), a method for the automated assignment of RNA imino resonances with synchronized verification and correction of predicted secondary structure. RNA-PAIRS represents an advance in modeling the assignment paradigm because it seeds the probabilistic network for assignment with experimental NMR data, and predicted RNA secondary structure, simultaneously and from the start. Subsequently, RNA-PAIRS sets in motion a dynamic network that reverberates between predictions and experimental evidence in order to reconcile and rectify resonance assignments and secondary structure information. The procedure is halted when assignments and base-parings are deemed to be most consistent with observed crosspeaks. The current implementation of RNA-PAIRS uses an initial peak list derived from proton-nitrogen heteronuclear multiple quantum correlation ({sup 1}H-{sup 15}N 2D HMQC) and proton-proton nuclear Overhauser enhancement spectroscopy ({sup 1}H-{sup 1}H 2D NOESY) experiments. We have evaluated the performance of RNA-PAIRS by using it to analyze NMR datasets from 26 previously studied RNAs, including a 111-nucleotide complex. For moderately sized RNA molecules, and over a range of comparatively complex structural motifs, the average assignment accuracy exceeds 90%, while the average base pair prediction accuracy exceeded 93%. RNA-PAIRS yielded accurate assignments and base pairings consistent with imino

  10. RNA SURVEILLANCE– AN EMERGING ROLE FOR RNA REGULATORY NETWORKS IN AGING

    OpenAIRE

    Montano, Monty; Long, Kimberly

    2010-01-01

    In this review, we describe recent advances in the field of RNA regulatory biology and relate these advances to aging science. We introduce a new term, RNA surveillance, an RNA regulatory process that is conserved in metazoans, and describe how RNA surveillance represents molecular cross-talk between two emerging RNA regulatory systems – RNA interference and RNA editing. We discuss how RNA surveillance mechanisms influence mRNA and microRNA expression and activity during lifespan. Additionall...

  11. α-Fetoprotein promoter-driven Cre/LoxP-switched RNA interference for hepatocellular carcinoma tissue-specific target therapy.

    Directory of Open Access Journals (Sweden)

    Yuan-Fei Peng

    Full Text Available RNA interference (RNAi has recently emerged as a potential treatment modality for hepatocellular carcinoma (HCC therapy, but the lack of cellular targets and sustained efficacy limits its application. The purpose of this study is to develop an HCC tissue-specific RNAi system and investigate its possibility for HCC treatment.Two different HCC-specific RNAi systems in which therapeutic miRNA or shRNA against target gene (Beclin 1 was directly or indirectly driven by alpha-fetoprotein promoter (AFP-miRNA and AFP-Cre/LoxP-shRNA were constructed. Human HCC cell lines (HepG2, Hep3B and HCCLM3 and non-HCC cell lines (L-02, Hela and SW1116 were infected with the systems. The effectiveness and tissue-specificity of the systems were examined by Q-PCR and western blot analysis. The efficacy of the systems was further tested in mouse model of HCC by intravenous or intratumoral administration. The feasibility of the system for HCC treatment was evaluated by applying the system as adjuvant therapy to enhance sorafenib treatment. An AFP-Cre/LoxP-shRNA system targeting Atg5 gene (AFP-Cre/LoxP-shRNA-Atg5 was constructed and its efficacy in sensitizing HCC cells (MHCC97L/PLC to sorafenib treatment was examined by apoptosis assay in vitro and tumorigenesis assay in vivo.The AFP-miRNA system could silence target gene (Beclin 1 but required a high titer which was lethal to target cells. The AFP-Cre/LoxP-shRNA system could efficiently knockdown target gene while maintain high HCC specificity. Intratumoral injection of the AFP-Cre/LoxP-shRNA system could efficiently silence target gene (Beclin 1 in vivo while intravenous administration could not. The AFP-Cre/LoxP-shRNA system target Atg5 gene could significantly sensitize MHCC97L/PLC cells to sorafenib-induced apoptosis in vitro and tumor growth suppression in vivo.An efficient HCC tissue-specific RNAi system (AFP-Cre/LoxP-shRNA was successfully established. The system provides a usable tool for HCC-specific RNAi

  12. On RNA-RNA interaction structures of fixed topological genus.

    Science.gov (United States)

    Fu, Benjamin M M; Han, Hillary S W; Reidys, Christian M

    2015-04-01

    Interacting RNA complexes are studied via bicellular maps using a filtration via their topological genus. Our main result is a new bijection for RNA-RNA interaction structures and a linear time uniform sampling algorithm for RNA complexes of fixed topological genus. The bijection allows to either reduce the topological genus of a bicellular map directly, or to lose connectivity by decomposing the complex into a pair of single stranded RNA structures. Our main result is proved bijectively. It provides an explicit algorithm of how to rewire the corresponding complexes and an unambiguous decomposition grammar. Using the concept of genus induction, we construct bicellular maps of fixed topological genus g uniformly in linear time. We present various statistics on these topological RNA complexes and compare our findings with biological complexes. Furthermore we show how to construct loop-energy based complexes using our decomposition grammar. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. A large-scale RNA interference screen identifies genes that regulate autophagy at different stages

    DEFF Research Database (Denmark)

    Guo, Sujuan; Pridham, Kevin J; Virbasius, Ching-Man

    2018-01-01

    Dysregulated autophagy is central to the pathogenesis and therapeutic development of cancer. However, how autophagy is regulated in cancer is not well understood and genes that modulate cancer autophagy are not fully defined. To gain more insights into autophagy regulation in cancer, we performed...... with fluorescence-activated cell sorting, we successfully isolated autophagic K562 cells where we identified 336 short hairpin RNAs. After candidate validation using Cyto-ID fluorescence spectrophotometry, LC3B immunoblotting, and quantitative RT-PCR, 82 genes were identified as autophagy-regulating genes. 20 genes...... have been reported previously and the remaining 62 candidates are novel autophagy mediators. Bioinformatic analyses revealed that most candidate genes were involved in molecular pathways regulating autophagy, rather than directly participating in the autophagy process. Further autophagy flux assays...

  14. antaRNA: ant colony-based RNA sequence design.

    Science.gov (United States)

    Kleinkauf, Robert; Mann, Martin; Backofen, Rolf

    2015-10-01

    RNA sequence design is studied at least as long as the classical folding problem. Although for the latter the functional fold of an RNA molecule is to be found ,: inverse folding tries to identify RNA sequences that fold into a function-specific target structure. In combination with RNA-based biotechnology and synthetic biology ,: reliable RNA sequence design becomes a crucial step to generate novel biochemical components. In this article ,: the computational tool antaRNA is presented. It is capable of compiling RNA sequences for a given structure that comply in addition with an adjustable full range objective GC-content distribution ,: specific sequence constraints and additional fuzzy structure constraints. antaRNA applies ant colony optimization meta-heuristics and its superior performance is shown on a biological datasets. http://www.bioinf.uni-freiburg.de/Software/antaRNA CONTACT: backofen@informatik.uni-freiburg.de Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.

  15. Preclinical Biodistribution and Safety Evaluation of a pbi-shRNA STMN1 Lipoplex after Subcutaneous Delivery.

    Science.gov (United States)

    Wang, Zhaohui; Jay, Christopher M; Evans, Courtney; Kumar, Padmasini; Phalon, Connor; Rao, Donald D; Senzer, Neil; Nemunaitis, John

    2017-02-01

    Stathmin-1 (STMN1) is a microtubule-destabilizing protein which is overexpressed in cancer. Its overexpression is associated with poor prognosis and also serves as a predictive marker to taxane therapy. We have developed a proprietary bi-functional shRNA (bi-shRNA) platform to execute RNA interference (RNAi)-mediated gene silencing and a liposome-carrier complex to systemically deliver the pbi-shRNA plasmids. In vitro and in vivo testing demonstrated efficacy and specificity of pbi-shRNA plasmid in targeting STMN1 (Phadke, A. P., Jay, C. M., Wang, Z., Chen, S., Liu, S., Haddock, C., Kumar, P., Pappen, B. O., Rao, D. D., Templeton, N. S., et al. (2011). In vivo safety and antitumor efficacy of bifunctional small hairpin RNAs specific for the human Stathmin 1 oncoprotein. DNA Cell Biol. 30, 715-726.). Biodistribution and toxicology studies in bio-relevant Sprague Dawley rats with pbi-shRNA STMN1 lipoplex revealed that the plasmid DNA was delivered to a broad distribution of organs after a single subcutaneous injection. Specifically, plasmid was detected within the first week using QPCR (threshold 50 copies plasmid/1 µg genomic DNA) at the injection site, lung, spleen, blood, skin, ovary (limited), lymph nodes, and liver. It was not detected in the heart, testis or bone marrow. No plasmid was detected from any organ 30 days after injection. Treatment was well tolerated. Minimal inflammation/erythema was observed at the injection site. Circulating cytokine response was also examined by ELISA. The IL-6 levels were induced within 6 h then declined to the vehicle control level 72 h after the injection. TNFα induction was transiently observed 4 days after the DNA lipoplex treatment. In summary, the pbi-shRNA STMN1 lipoplex was well tolerated and displayed broad distribution after a single subcutaneous injection. The pre-clinical data has been filed to FDA and the pbi-shRNA STMN1 lipoplex is being investigated in a phase I clinical study. © The Author 2016. Published

  16. RNA İNTERFERANS (RNAİ)

    OpenAIRE

    GÜNDOĞDU, Ramazan; ÇELİK, Venhar

    2009-01-01

    RNA interferans, uygun çift zincirli RNA’nın hücreye girdiği zaman, endojenik komplementer mRNA dizisinin parçalanmasına yol açan, transkripsiyon sonrası gen susturma mekanizmasıdır. RNA interferans, Dicer adı verilen bir RNase III enzimi tarafından çift zincirli RNA’nın küçük engelleyici RNA’lara (siRNA) kesilmesi ile başlamaktadır. Bu siRNA’lar daha sonra, bir multiprotein-RNA nükleaz kompleksi olan, RNA- indükleyici baskılama kompleksine (RISC) bağlanır. RISC, siRNA’ları komplementer mRNA’...

  17. Radiation sensitivity of messenger RNA

    International Nuclear Information System (INIS)

    Ponta, H.; Pfennig-Yeh, M.L.; Herrlich, P.; Karlsruhe Univ.; Wagner, E.F.; Schweiger, M.

    1979-01-01

    Messenger RNA function is inactivated by irradiation with ultraviolet light. A unit length mRNA (in bases) is 2-3 times more sensitive than a unit length of DNA (in base pairs) with respect to the inactivation of template function. These data stem from four experimental systems all of which do not repair DNA: the translation of E. coli mRNA in rifampicin-treated cells, of T7 mRNA in infected E.coli, of f2 phage RNA in vivo, and of stable mRNA in chromosomeless minicells. The comparison of relative sensitivities to UV is relevant to the technique of UV mapping of transcription units which enjoys increasing popularity in pro- and eukaryotic genetic research. (orig.) [de

  18. Radiation sensitivity of messenger RNA

    Energy Technology Data Exchange (ETDEWEB)

    Ponta, H; Pfennig-Yeh, M L; Herrlich, P [Kernforschungszentrum Karlsruhe G.m.b.H. (Germany, F.R.). Inst. fuer Genetik und Toxikologie von Spaltstoffen; Karlsruhe Univ. (TH) (Germany, F.R.). Inst. fuer Genetik); Wagner, E F; Schweiger, M [Innsbruck Univ. (Austria). Inst. fuer Biochemie

    1979-08-01

    Messenger RNA function is inactivated by irradiation with ultraviolet light. A unit length mRNA (in bases) is 2-3 times more sensitive than a unit length of DNA (in base pairs) with respect to the inactivation of template function. These data stem from four experimental systems all of which do not repair DNA: the translation of E. coli mRNA in rifampicin-treated cells, of T7 mRNA in infected E.coli, of f2 phage RNA in vivo, and of stable mRNA in chromosomeless minicells. The comparison of relative sensitivities to UV is relevant to the technique of UV mapping of transcription units which enjoys increasing popularity in pro- and eukaryotic genetic research.

  19. Targeting SPARC by lentivirus-mediated RNA interference inhibits cervical cancer cell growth and metastasis

    International Nuclear Information System (INIS)

    Chen, Jie; Shi, Dehuan; Liu, Xiaoyan; Fang, Shuang; Zhang, Jie; Zhao, Yueran

    2012-01-01

    Secreted protein acidic and rich in cysteine (SPARC), a calcium-binding matricellular glycoprotein, is implicated in the progressions of some cancers. However, no information has been available to date regarding the function of SPARC in cervical cancer cell growth and metastasis. In this study, we isolated and established high invasive subclones and low invasive subclones from human cervical cancer cell lines HeLa and SiHa by the limited dilution method. Real-time q-RT-PCR, Western Blot and ICC were performed to investigate SPARC mRNA and protein expressions in high invasive subclones and low invasive subclones. Then lentivirus vector with SPARC shRNA was constructed and infected the highly invasive subclones. Real-time q-RT-PCR, Western Blot and ICC were also performed to investigate the changes of SPARC expression after viral infection. In functional assays, effects of SPARC knockdown on the biological behaviors of cervical cancer cells were investigated. The mechanisms of SPARC in cervical cancer proliferation, apoptosis and invasion were also researched. SPARC was over-expressed in the highly invasive subclones compared with the low invasive subclones. Knockdown of SPARC significantly suppressed cervical cancer cell proliferation, and induced cell cycle arrest at the G1/G0 phase through the p53/p21 pathway, also caused cell apoptosis accompanied by the decreased ratio of Bcl-2/Bax, and inhibited cell invasion and metastasis accompanied by down-regulated MMP2 and MMP9 expressions and up-regulated E-cadherin expression. SPARC is related to the invasive phenotype of cervical cancer cells. Knockdown of SPARC significantly suppresses cervical cancer cell proliferation, induces cell apoptosis and inhibits cell invasion and metastasis. SPARC as a promoter improves cervical cancer cell growth and metastasis

  20. Targeting SPARC by lentivirus-mediated RNA interference inhibits cervical cancer cell growth and metastasis

    Directory of Open Access Journals (Sweden)

    Chen Jie

    2012-10-01

    Full Text Available Abstract Background Secreted protein acidic and rich in cysteine (SPARC, a calcium-binding matricellular glycoprotein, is implicated in the progressions of some cancers. However, no information has been available to date regarding the function of SPARC in cervical cancer cell growth and metastasis. Methods In this study, we isolated and established high invasive subclones and low invasive subclones from human cervical cancer cell lines HeLa and SiHa by the limited dilution method. Real-time q-RT-PCR, Western Blot and ICC were performed to investigate SPARC mRNA and protein expressions in high invasive subclones and low invasive subclones. Then lentivirus vector with SPARC shRNA was constructed and infected the highly invasive subclones. Real-time q-RT-PCR, Western Blot and ICC were also performed to investigate the changes of SPARC expression after viral infection. In functional assays, effects of SPARC knockdown on the biological behaviors of cervical cancer cells were investigated. The mechanisms of SPARC in cervical cancer proliferation, apoptosis and invasion were also researched. Results SPARC was over-expressed in the highly invasive subclones compared with the low invasive subclones. Knockdown of SPARC significantly suppressed cervical cancer cell proliferation, and induced cell cycle arrest at the G1/G0 phase through the p53/p21 pathway, also caused cell apoptosis accompanied by the decreased ratio of Bcl-2/Bax, and inhibited cell invasion and metastasis accompanied by down-regulated MMP2 and MMP9 expressions and up-regulated E-cadherin expression. Conclusion SPARC is related to the invasive phenotype of cervical cancer cells. Knockdown of SPARC significantly suppresses cervical cancer cell proliferation, induces cell apoptosis and inhibits cell invasion and metastasis. SPARC as a promoter improves cervical cancer cell growth and metastasis.

  1. RNase-assisted RNA chromatography

    Science.gov (United States)

    Michlewski, Gracjan; Cáceres, Javier F.

    2010-01-01

    RNA chromatography combined with mass spectrometry represents a widely used experimental approach to identify RNA-binding proteins that recognize specific RNA targets. An important drawback of most of these protocols is the high background due to direct or indirect nonspecific binding of cellular proteins to the beads. In many cases this can hamper the detection of individual proteins due to their low levels and/or comigration with contaminating proteins. Increasing the salt concentration during washing steps can reduce background, but at the cost of using less physiological salt concentrations and the likely loss of important RNA-binding proteins that are less stringently bound to a given RNA, as well as the disassembly of protein or ribonucleoprotein complexes. Here, we describe an improved RNA chromatography method that relies on the use of a cocktail of RNases in the elution step. This results in the release of proteins specifically associated with the RNA ligand and almost complete elimination of background noise, allowing a more sensitive and thorough detection of RNA-binding proteins recognizing a specific RNA transcript. PMID:20571124

  2. RNA interference in Lepidoptera

    DEFF Research Database (Denmark)

    Terenius, Ole; Papanicolaou, Alexie; Garbutt, Jennie S.

    2011-01-01

    in RNAi experiments in Lepidoptera are discussed. The review also points to a need to further investigate the mechanism of RNAi in lepidopteran insects and its possible connection to the innate immune response. Our general understanding of RNAi in Lepidoptera will be further aided in the future as our...... experiments have not been collected in such a way that they are possible to analyze. In this review, we have collected detailed data from more than 150 experiments including all to date published and many unpublished experiments. Despite a large variation in the data, trends that are found are that RNAi...... is particularly successful in the family Saturniidae and in genes involved in immunity. On the contrary, gene expression in epidermal tissues seems to be most difficult to silence. In addition, gene silencing by feeding dsRNA requires high concentrations for success. Possible causes for the variability of success...

  3. Concepts and introduction to RNA bioinformatics

    DEFF Research Database (Denmark)

    Gorodkin, Jan; Hofacker, Ivo L.; Ruzzo, Walter L.

    2014-01-01

    RNA bioinformatics and computational RNA biology have emerged from implementing methods for predicting the secondary structure of single sequences. The field has evolved to exploit multiple sequences to take evolutionary information into account, such as compensating (and structure preserving) base...... for interactions between RNA and proteins.Here, we introduce the basic concepts of predicting RNA secondary structure relevant to the further analyses of RNA sequences. We also provide pointers to methods addressing various aspects of RNA bioinformatics and computational RNA biology....

  4. Identification of Subtype Specific miRNA-mRNA Functional Regulatory Modules in Matched miRNA-mRNA Expression Data: Multiple Myeloma as a Case

    OpenAIRE

    Zhang, Yunpeng; Liu, Wei; Xu, Yanjun; Li, Chunquan; Wang, Yingying; Yang, Haixiu; Zhang, Chunlong; Su, Fei; Li, Yixue; Li, Xia

    2015-01-01

    Identification of miRNA-mRNA modules is an important step to elucidate their combinatorial effect on the pathogenesis and mechanisms underlying complex diseases. Current identification methods primarily are based upon miRNA-target information and matched miRNA and mRNA expression profiles. However, for heterogeneous diseases, the miRNA-mRNA regulatory mechanisms may differ between subtypes, leading to differences in clinical behavior. In order to explore the pathogenesis of each subtype, it i...

  5. Expression of an estrogen-regulated variant transcript of the peroxisomal branched chain fatty acid oxidase ACOX2 in breast carcinomas

    International Nuclear Information System (INIS)

    Bjørklund, Sunniva Stordal; Kristensen, Vessela N.; Seiler, Michael; Kumar, Surendra; Alnæs, Grethe I. Grenaker; Ming, Yao; Kerrigan, John; Naume, Bjørn; Sachidanandam, Ravi; Bhanot, Gyan; Børresen-Dale, Anne-Lise; Ganesan, Shridar

    2015-01-01

    Alternate transcripts from a single gene locus greatly enhance the combinatorial flexibility of the human transcriptome. Different patterns of exon usage have been observed when comparing normal tissue to cancers, suggesting that variant transcripts may play a role in the tumor phenotype. Ribonucleic acid-sequencing (RNA-seq) data from breast cancer samples was used to identify an intronic start variant transcript of Acyl-CoA oxidase 2, ACOX2 (ACOX2-i9). Difference in expression between Estrogen Receptor (ER) positive and ER negative patients was assessed by the Wilcoxon rank sum test, and the findings validated in The Cancer Genome Atlas (TCGA) breast cancer dataset (BRCA). ACOX2-i9 expression was also assessed in cell lines using both quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) and Western blot analysis. Knock down by short hairpin RNA (shRNA) and colony formation assays were used to determine whether ACOX2-i9 expression would influence cellular fitness. The effect of ACOX2-i9 expression on patient survival was assessed by the Kaplan-Meier survival function, and association to clinical parameters was analyzed using a Fisher exact test. The expression and translation of ACOX2-i9 into a 25 kDa protein was demonstrated in HepG2 cells as well as in several breast cancer cell lines. shRNA knock down of the ACOX2-i9 variant resulted in decreased cell viability of T47D and MDA-MB 436 cells. Moreover, expression of ACOX2-i9 was shown to be estrogen regulated, being induced by propyl pyrazoletriol and inhibited by tamoxifen and fulvestrant in ER+ T47D and Mcf-7 cells, but not in the ER- MDA-MB 436 cell line. This variant transcript showed expression predominantly in ER-positive breast tumors as assessed in our initial set of 53 breast cancers and further validated in 87 tumor/normal pairs from the TCGA breast cancer dataset, and expression was associated with better outcome in ER positive patients. ACOX2-i9 is specifically enriched in ER+ breast

  6. Translocation of p53 to Mitochondria Is Regulated by Its Lipid Binding Property to Anionic Phospholipids and It Participates in Cell Death Control

    Directory of Open Access Journals (Sweden)

    Ching-Hao Li

    2010-02-01

    Full Text Available p53, can regulate cell apoptosis in both transcription-dependent and -independent manners. The transcription-independent pathway was demonstrated by the translocation of p53 to mitochondria. Our study showed that p53 mitochondrial translocation was found in mitomycin C (MMC-treated HepG2. The p53 C-terminal domain is clustered with potential nuclear leading sequences and showed strong electrostatic ion-ion interactions with cardiolipin, phosphatidylglycerol and phosphatidic acid in vitro. Disruption of cardiolipin biosynthesis by phosphatidylglycero-phosphate synthase (PGS or CDP-diacylglycerol synthase 2 (CDS-2 short hairpin RNA (shRNA transfection eliminated the MMC-induced translocation of mitochondrial p53. The elimination of mitochondrial p53 translocation also reduced Bcl-xL and Bcl-2 mitochondrial distribution. In HEK 293T models with saturated p53 expression, the mitochondrial partition of p53, Bcl-xL, and Bcl-2 obviously decreased in their PGS shRNA- or CDS-2 shRNA-expressing stable clones. In p53-null H1299 models, both the mitochondrial partitions of Bcl-xL and Bcl-2 were strongly reduced in relation to the HEK 293T models. The Bcl-xL mitochondrial partition was elevated in H1299 models expressing pCEP4-p53wt suggesting the direct carrier role of p53 in transporting Bcl-xL to the mitochondria. We also found that the cytosolic pool of Bcl-xL and Bcl-2 remained unaffected in the low-dose MMC treatment but decreased in the high-dose MMC treatment. The cytosolic pool of Bcl-2 and Bcl-xL directly regulated their amounts in p53-dependent mitochondrial distribution. In the low-dose MMC treatment, the increased mitochondrial p53, Bcl-xL, and Bcl-2 could attenuate apoptosis. However, in the high-dose MMC treatment, only the p53 translocated to the mitochondria and resulted in apoptosis progression. On the basis of this study, we thought mitochondrial p53 might regulate apoptosis in a biphasic manner.

  7. Expression of an estrogen-regulated variant transcript of the peroxisomal branched chain fatty acid oxidase ACOX2 in breast carcinomas.

    Science.gov (United States)

    Bjørklund, Sunniva Stordal; Kristensen, Vessela N; Seiler, Michael; Kumar, Surendra; Alnæs, Grethe I Grenaker; Ming, Yao; Kerrigan, John; Naume, Bjørn; Sachidanandam, Ravi; Bhanot, Gyan; Børresen-Dale, Anne-Lise; Ganesan, Shridar

    2015-07-17

    Alternate transcripts from a single gene locus greatly enhance the combinatorial flexibility of the human transcriptome. Different patterns of exon usage have been observed when comparing normal tissue to cancers, suggesting that variant transcripts may play a role in the tumor phenotype. Ribonucleic acid-sequencing (RNA-seq) data from breast cancer samples was used to identify an intronic start variant transcript of Acyl-CoA oxidase 2, ACOX2 (ACOX2-i9). Difference in expression between Estrogen Receptor (ER) positive and ER negative patients was assessed by the Wilcoxon rank sum test, and the findings validated in The Cancer Genome Atlas (TCGA) breast cancer dataset (BRCA). ACOX2-i9 expression was also assessed in cell lines using both quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) and Western blot analysis. Knock down by short hairpin RNA (shRNA) and colony formation assays were used to determine whether ACOX2-i9 expression would influence cellular fitness. The effect of ACOX2-i9 expression on patient survival was assessed by the Kaplan-Meier survival function, and association to clinical parameters was analyzed using a Fisher exact test. The expression and translation of ACOX2-i9 into a 25 kDa protein was demonstrated in HepG2 cells as well as in several breast cancer cell lines. shRNA knock down of the ACOX2-i9 variant resulted in decreased cell viability of T47D and MDA-MB 436 cells. Moreover, expression of ACOX2-i9 was shown to be estrogen regulated, being induced by propyl pyrazoletriol and inhibited by tamoxifen and fulvestrant in ER+ T47D and Mcf-7 cells, but not in the ER- MDA-MB 436 cell line. This variant transcript showed expression predominantly in ER-positive breast tumors as assessed in our initial set of 53 breast cancers and further validated in 87 tumor/normal pairs from the TCGA breast cancer dataset, and expression was associated with better outcome in ER positive patients. ACOX2-i9 is specifically enriched in ER+ breast

  8. Bifurcations in the interplay of messenger RNA, protein and nonprotein coding RNA

    International Nuclear Information System (INIS)

    Zhdanov, Vladimir P

    2008-01-01

    The interplay of messenger RNA (mRNA), protein, produced via translation of this RNA, and nonprotein coding RNA (ncRNA) may include regulation of the ncRNA production by protein and (i) ncRNA-protein association resulting in suppression of the protein regulatory activity or (ii) ncRNA-mRNA association resulting in degradation of the miRNA-mRNA complex. The kinetic models describing these two scenarios are found to predict bistability provided that protein suppresses the ncRNA formation

  9. 34A, miRNA-944, miRNA-101 and miRNA-218 in cervical cancer

    African Journals Online (AJOL)

    RNAs (21 - 24 nucleotides in length) that are critical for many important processes such as development, ... RNA extraction and reverse transcription. Total RNA was extracted from each of the experimental groups using ... used as an endogenous control to normalize the expression of miRNA-143, miRNA-34A, miRNA-.

  10. Nuclear Export of Messenger RNA

    Directory of Open Access Journals (Sweden)

    Jun Katahira

    2015-03-01

    Full Text Available Transport of messenger RNA (mRNA from the nucleus to the cytoplasm is an essential step of eukaryotic gene expression. In the cell nucleus, a precursor mRNA undergoes a series of processing steps, including capping at the 5' ends, splicing and cleavage/polyadenylation at the 3' ends. During this process, the mRNA associates with a wide variety of proteins, forming a messenger ribonucleoprotein (mRNP particle. Association with factors involved in nuclear export also occurs during transcription and processing, and thus nuclear export is fully integrated into mRNA maturation. The coupling between mRNA maturation and nuclear export is an important mechanism for providing only fully functional and competent mRNA to the cytoplasmic translational machinery, thereby ensuring accuracy and swiftness of gene expression. This review describes the molecular mechanism of nuclear mRNA export mediated by the principal transport factors, including Tap-p15 and the TREX complex.

  11. RNA viruses in the sea.

    Science.gov (United States)

    Lang, Andrew S; Rise, Matthew L; Culley, Alexander I; Steward, Grieg F

    2009-03-01

    Viruses are ubiquitous in the sea and appear to outnumber all other forms of marine life by at least an order of magnitude. Through selective infection, viruses influence nutrient cycling, community structure, and evolution in the ocean. Over the past 20 years we have learned a great deal about the diversity and ecology of the viruses that constitute the marine virioplankton, but until recently the emphasis has been on DNA viruses. Along with expanding knowledge about RNA viruses that infect important marine animals, recent isolations of RNA viruses that infect single-celled eukaryotes and molecular analyses of the RNA virioplankton have revealed that marine RNA viruses are novel, widespread, and genetically diverse. Discoveries in marine RNA virology are broadening our understanding of the biology, ecology, and evolution of viruses, and the epidemiology of viral diseases, but there is still much that we need to learn about the ecology and diversity of RNA viruses before we can fully appreciate their contributions to the dynamics of marine ecosystems. As a step toward making sense of how RNA viruses contribute to the extraordinary viral diversity in the sea, we summarize in this review what is currently known about RNA viruses that infect marine organisms.

  12. Nuclear Export of Messenger RNA

    Science.gov (United States)

    Katahira, Jun

    2015-01-01

    Transport of messenger RNA (mRNA) from the nucleus to the cytoplasm is an essential step of eukaryotic gene expression. In the cell nucleus, a precursor mRNA undergoes a series of processing steps, including capping at the 5' ends, splicing and cleavage/polyadenylation at the 3' ends. During this process, the mRNA associates with a wide variety of proteins, forming a messenger ribonucleoprotein (mRNP) particle. Association with factors involved in nuclear export also occurs during transcription and processing, and thus nuclear export is fully integrated into mRNA maturation. The coupling between mRNA maturation and nuclear export is an important mechanism for providing only fully functional and competent mRNA to the cytoplasmic translational machinery, thereby ensuring accuracy and swiftness of gene expression. This review describes the molecular mechanism of nuclear mRNA export mediated by the principal transport factors, including Tap-p15 and the TREX complex. PMID:25836925

  13. Incorrect dosage of IQSEC2, a known intellectual disability and epilepsy gene, disrupts dendritic spine morphogenesis

    Science.gov (United States)

    Hinze, S J; Jackson, M R; Lie, S; Jolly, L; Field, M; Barry, S C; Harvey, R J; Shoubridge, C

    2017-01-01

    There is considerable genetic and phenotypic heterogeneity associated with intellectual disability (ID), specific learning disabilities, attention-deficit hyperactivity disorder, autism and epilepsy. The intelligence quotient (IQ) motif and SEC7 domain containing protein 2 gene (IQSEC2) is located on the X-chromosome and harbors mutations that contribute to non-syndromic ID with and without early-onset seizure phenotypes in both sexes. Although IQ and Sec7 domain mutations lead to partial loss of IQSEC2 enzymatic activity, the in vivo pathogenesis resulting from these mutations is not known. Here we reveal that IQSEC2 has a key role in dendritic spine morphology. Partial loss-of-function mutations were modeled using a lentiviral short hairpin RNA (shRNA) approach, which achieved a 57% knockdown of Iqsec2 expression in primary hippocampal cell cultures from mice. Investigating gross morphological parameters after 8 days of in vitro culture (8DIV) identified a 32% reduction in primary axon length, in contrast to a 27% and 31% increase in the number and complexity of dendrites protruding from the cell body, respectively. This increase in dendritic complexity and spread was carried through dendritic spine development, with a 34% increase in the number of protrusions per dendritic segment compared with controls at 15DIV. Although the number of dendritic spines had normalized by 21DIV, a reduction was noted in the number of immature spines. In contrast, when modeling increased dosage, overexpression of wild-type IQSEC2 led to neurons with shorter axons that were more compact and displayed simpler dendritic branching. Disturbances to dendritic morphology due to knockdown of Iqsec2 were recapitulated in neurons from Iqsec2 knockout mice generated in our laboratory using CRISPR/Cas9 technology. These observations provide evidence of dosage sensitivity for IQSEC2, which normally escapes X-inactivation in females, and links these disturbances in expression to alterations in

  14. Alpha-CaMKII plays a critical role in determining the aggressive behavior of human osteosarcoma.

    Science.gov (United States)

    Daft, Paul G; Yuan, Kaiyu; Warram, Jason M; Klein, Michael J; Siegal, Gene P; Zayzafoon, Majd

    2013-04-01

    Osteosarcoma is among the most frequently occurring primary bone tumors, primarily affecting adolescents and young adults. Despite improvements in osteosarcoma treatment, more specific molecular targets are needed as potential therapeutic options. One target of interest is α-Ca(2+)/calmodulin-dependent protein kinase II (α-CaMKII), a ubiquitous mediator of Ca(2+)-linked signaling, which has been shown to regulate tumor cell proliferation and differentiation. Here, we investigate the role of α-CaMKII in the growth and tumorigenicity of human osteosarcoma. We show that α-CaMKII is highly expressed in primary osteosarcoma tissue derived from 114 patients, and is expressed in varying levels in different human osteosarcoma (OS) cell lines [MG-63, N-methyl-N'-nitro-N-nitrosoguanidine (MNNG)/HOS, and 143B). To examine whether α-CaMKII regulates osteosarcoma tumorigenic properties, we genetically inhibited α-CaMKII in two osteosarcoma cell lines using two different α-CaMKII shRNAs delivered by lentiviral vectors and overexpressed α-CaMKII by retrovirus. The genetic deletion of α-CaMKII by short hairpin RNA (shRNA) in MG-63 and 143B cells resulted in decreased proliferation (50% and 41%), migration (22% and 25%), and invasion (95% and 90%), respectively. The overexpression of α-CaMKII in HOS cells resulted in increased proliferation (240%), migration (640%), and invasion (10,000%). Furthermore, α-CaMKII deletion in MG-63 cells significantly reduced tumor burden in vivo (65%), whereas α-CaMKII overexpression resulted in tumor formation in a previously nontumor forming osteosarcoma cell line (HOS). Our results suggest that α-CaMKII plays a critical role in determining the aggressive phenotype of osteosarcoma, and its inhibition could be an attractive therapeutic target to combat this devastating adolescent disease. ©2013 AACR.

  15. In Vitro and In Vivo Prostate Cancer Metastasis and Chemoresistance Can Be Modulated by Expression of either CD44 or CD147

    Science.gov (United States)

    Hao, Jingli; Madigan, Michele C.; Khatri, Aparajita; Power, Carl A.; Hung, Tzong-Tyng; Beretov, Julia; Chang, Lei; Xiao, Weiwei; Cozzi, Paul J.; Graham, Peter H.; Kearsley, John H.; Li, Yong

    2012-01-01

    CD44 and CD147 are associated with cancer metastasis and progression. Our purpose in the study was to investigate the effects of down-regulation of CD44 or CD147 on the metastatic ability of prostate cancer (CaP) cells, their docetaxel (DTX) responsiveness and potential mechanisms involved in vitro and in vivo. CD44 and CD147 were knocked down (KD) in PC-3M-luc CaP cells using short hairpin RNA (shRNA). Expression of CD44, CD147, MRP2 (multi-drug resistance protein-2) and MCT4 (monocarboxylate tranporter-4) was evaluated using immunofluorescence and Western blotting. The DTX dose-response and proliferation was measured by MTT and colony assays, respectively. The invasive potential was assessed using a matrigel chamber assay. Signal transduction proteins in PI3K/Akt and MAPK/Erk pathways were assessed by Western blotting. An in vivo subcutaneous (s.c.) xenograft model was established to assess CaP tumorigenecity, lymph node metastases and DTX response. Our results indicated that KD of CD44 or CD147 decreased MCT4 and MRP2 expression, reduced CaP proliferation and invasive potential and enhanced DTX sensitivity; and KD of CD44 or CD147 down-regulated p-Akt and p-Erk, the main signal modulators associated with cell growth and survival. In vivo, CD44 or CD147-KD PC-3M-luc xenografts displayed suppressed tumor growth with increased DTX responsiveness compared to control xenografts. Both CD44 and CD147 enhance metastatic capacity and chemoresistance of CaP cells, potentially mediated by activation of the PI3K and MAPK pathways. Selective targeting of CD44/CD147 alone or combined with DTX may limit CaP metastasis and increase chemosensitivity, with promise for future CaP treatment. PMID:22870202

  16. In vitro and in vivo prostate cancer metastasis and chemoresistance can be modulated by expression of either CD44 or CD147.

    Directory of Open Access Journals (Sweden)

    Jingli Hao

    Full Text Available CD44 and CD147 are associated with cancer metastasis and progression. Our purpose in the study was to investigate the effects of down-regulation of CD44 or CD147 on the metastatic ability of prostate cancer (CaP cells, their docetaxel (DTX responsiveness and potential mechanisms involved in vitro and in vivo. CD44 and CD147 were knocked down (KD in PC-3M-luc CaP cells using short hairpin RNA (shRNA. Expression of CD44, CD147, MRP2 (multi-drug resistance protein-2 and MCT4 (monocarboxylate tranporter-4 was evaluated using immunofluorescence and Western blotting. The DTX dose-response and proliferation was measured by MTT and colony assays, respectively. The invasive potential was assessed using a matrigel chamber assay. Signal transduction proteins in PI3K/Akt and MAPK/Erk pathways were assessed by Western blotting. An in vivo subcutaneous (s.c. xenograft model was established to assess CaP tumorigenecity, lymph node metastases and DTX response. Our results indicated that KD of CD44 or CD147 decreased MCT4 and MRP2 expression, reduced CaP proliferation and invasive potential and enhanced DTX sensitivity; and KD of CD44 or CD147 down-regulated p-Akt and p-Erk, the main signal modulators associated with cell growth and survival. In vivo, CD44 or CD147-KD PC-3M-luc xenografts displayed suppressed tumor growth with increased DTX responsiveness compared to control xenografts. Both CD44 and CD147 enhance metastatic capacity and chemoresistance of CaP cells, potentially mediated by activation of the PI3K and MAPK pathways. Selective targeting of CD44/CD147 alone or combined with DTX may limit CaP metastasis and increase chemosensitivity, with promise for future CaP treatment.

  17. Unexpected neuronal protection of SU5416 against 1-Methyl-4-phenylpyridinium ion-induced toxicity via inhibiting neuronal nitric oxide synthase.

    Directory of Open Access Journals (Sweden)

    Wei Cui

    Full Text Available SU5416 was originally designed as a potent and selective inhibitor of vascular endothelial growth factor receptor-2 (VEGFR-2 for cancer therapy. In this study, we have found for the first time that SU5416 unexpectedly prevented 1-methyl-4-phenylpyridinium ion (MPP(+-induced neuronal apoptosis in cerebellar granule neurons, and decreased 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP-induced loss of dopaminergic neurons and impairment of swimming behavior in zebrafish in a concentration-dependent manner. However, VEGFR-2 kinase inhibitor II, another specific VEGFR-2 inhibitor, failed to reverse neurotoxicity at the concentration exhibiting anti-angiogenic activity, strongly suggesting that the neuroprotective effect of SU5416 is independent from its anti-angiogenic action. SU5416 potently reversed MPP(+-increased intracellular nitric oxide level with an efficacy similar to 7-nitroindazole, a specific neuronal nitric oxide synthase (nNOS inhibitor. Western blotting analysis showed that SU5416 reduced the elevation of nNOS protein expression induced by MPP(+. Furthermore, SU5416 directly inhibited the enzyme activity of rat cerebellum nNOS with an IC(50 value of 22.7 µM. In addition, knock-down of nNOS expression using short hairpin RNA (shRNA abolished the neuroprotective effects of SU5416 against MPP(+-induced neuronal loss. Our results strongly demonstrate that SU5416 might exert its unexpected neuroprotective effects by concurrently reducing nNOS protein expression and directly inhibiting nNOS enzyme activity. In view of the capability of SU5416 to cross the blood-brain barrier and the safety for human use, our findings further indicate that SU5416 might be a novel drug candidate for neurodegenerative disorders, particularly those associated with NO-mediated neurotoxicity.

  18. Live-Cell Imaging Visualizes Frequent Mitotic Skipping During Senescence-Like Growth Arrest in Mammary Carcinoma Cells Exposed to Ionizing Radiation

    International Nuclear Information System (INIS)

    Suzuki, Masatoshi; Yamauchi, Motohiro; Oka, Yasuyoshi; Suzuki, Keiji; Yamashita, Shunichi

    2012-01-01

    Purpose: Senescence-like growth arrest in human solid carcinomas is now recognized as the major outcome of radiotherapy. This study was designed to analyze cell cycle during the process of senescence-like growth arrest in mammary carcinoma cells exposed to X-rays. Methods and Materials: Fluorescent ubiquitination-based cell cycle indicators were introduced into the human mammary carcinoma cell line MCF-7. Cell cycle was sequentially monitored by live-cell imaging for up to 5 days after exposure to 10 Gy of X-rays. Results: Live-cell imaging revealed that cell cycle transition from G2 to G1 phase without mitosis, so-called mitotic skipping, was observed in 17.1% and 69.8% of G1- and G2-irradiated cells, respectively. Entry to G1 phase was confirmed by the nuclear accumulation of mKO 2 -hCdt1 as well as cyclin E, which was inversely correlated to the accumulation of G2-specific markers such as mAG-hGeminin and CENP-F. More than 90% of cells skipping mitosis were persistently arrested in G1 phase and showed positive staining for the senescent biochemical marker, which is senescence-associated ß-galactosidase, indicating induction of senescence-like growth arrest accompanied by mitotic skipping. While G2 irradiation with higher doses of X-rays induced mitotic skipping in approximately 80% of cells, transduction of short hairpin RNA (shRNA) for p53 significantly suppressed mitotic skipping, suggesting that ionizing radiation-induced mitotic skipping is associated with p53 function. Conclusions: The present study found the pathway of senescence-like growth arrest in G1 phase without mitotic entry following G2-irradiation.

  19. Live-Cell Imaging Visualizes Frequent Mitotic Skipping During Senescence-Like Growth Arrest in Mammary Carcinoma Cells Exposed to Ionizing Radiation

    Energy Technology Data Exchange (ETDEWEB)

    Suzuki, Masatoshi, E-mail: msuzuki@nagasaki-u.ac.jp [Department of Radiation Medical Sciences, Atomic Bomb Disease Institute, Nagasaki University Graduate School of Biomedical Sciences, Nagasaki (Japan); Yamauchi, Motohiro; Oka, Yasuyoshi; Suzuki, Keiji; Yamashita, Shunichi [Department of Radiation Medical Sciences, Atomic Bomb Disease Institute, Nagasaki University Graduate School of Biomedical Sciences, Nagasaki (Japan)

    2012-06-01

    Purpose: Senescence-like growth arrest in human solid carcinomas is now recognized as the major outcome of radiotherapy. This study was designed to analyze cell cycle during the process of senescence-like growth arrest in mammary carcinoma cells exposed to X-rays. Methods and Materials: Fluorescent ubiquitination-based cell cycle indicators were introduced into the human mammary carcinoma cell line MCF-7. Cell cycle was sequentially monitored by live-cell imaging for up to 5 days after exposure to 10 Gy of X-rays. Results: Live-cell imaging revealed that cell cycle transition from G2 to G1 phase without mitosis, so-called mitotic skipping, was observed in 17.1% and 69.8% of G1- and G2-irradiated cells, respectively. Entry to G1 phase was confirmed by the nuclear accumulation of mKO{sub 2}-hCdt1 as well as cyclin E, which was inversely correlated to the accumulation of G2-specific markers such as mAG-hGeminin and CENP-F. More than 90% of cells skipping mitosis were persistently arrested in G1 phase and showed positive staining for the senescent biochemical marker, which is senescence-associated ss-galactosidase, indicating induction of senescence-like growth arrest accompanied by mitotic skipping. While G2 irradiation with higher doses of X-rays induced mitotic skipping in approximately 80% of cells, transduction of short hairpin RNA (shRNA) for p53 significantly suppressed mitotic skipping, suggesting that ionizing radiation-induced mitotic skipping is associated with p53 function. Conclusions: The present study found the pathway of senescence-like growth arrest in G1 phase without mitotic entry following G2-irradiation.

  20. PKR-like endoplasmic reticulum kinase is necessary for lipogenic activation during HCMV infection.

    Directory of Open Access Journals (Sweden)

    Yongjun Yu

    Full Text Available PKR-like endoplasmic reticulum (ER kinase (PERK is an ER-associated stress sensor protein which phosphorylates eukaryotic initiation factor 2α (eIF2α to induce translation attenuation in response to ER stress. PERK is also a regulator of lipogenesis during adipocyte differentiation through activation of the cleavage of sterol regulatory element binding protein 1 (SREBP1, resulting in the upregulation of lipogenic enzymes. Our recent studies have shown that human cytomegalovirus (HCMV infection in human fibroblasts (HF induces adipocyte-like lipogenesis through the activation of SREBP1. Here, we report that PERK expression is highly increased in HCMV-infected cells and is necessary for HCMV growth. Depletion of PERK, using short hairpin RNA (shRNA, resulted in attenuation of HCMV growth, inhibition of lipid synthesis and reduction of lipogenic gene expression. Examination of the cleavage of SREBP proteins showed PERK depletion inhibited the cleavage of SREBP1, but not SREBP2, in HCMV-infected cells, suggesting different cleavage regulatory mechanisms for SREBP1 and 2. Further studies showed that the depletion of SREBP1, but not SREBP2, reduced lipid synthesis in HCMV infection, suggesting that activation of SREBP1 is sufficient to induce lipogenesis in HCMV infection. The reduction of lipid synthesis by PERK depletion can be partially restored by expressing a Flag-tagged nuclear form of SREBP1a. Our studies also suggest that the induction of PERK in HCMV-infected cells stimulates SREBP1 cleavage by reducing levels of Insig1 (Insulin inducible gene 1 protein; this occurs independent of the phosphorylation of eIF2α. Introduction of an exogenous Insig1-Myc into HCMV infected cells significantly reduced HCMV growth and lipid synthesis. Our data demonstrate that the induction of PERK during HCMV infection is necessary for full activation of lipogenesis; this effect appears to be mediated by limiting the levels of Insig1 thus freeing SREBP1-SCAP

  1. TOB1 Deficiency Enhances the Effect of Bone Marrow-Derived Mesenchymal Stem Cells on Tendon-Bone Healing in a Rat Rotator Cuff Repair Model

    Directory of Open Access Journals (Sweden)

    Yulei Gao

    2016-01-01

    Full Text Available Background/Aims: This study investigated the effect of silencing TOB1 (Transducer of ERBB2, 1 expression in bone marrow-derived mesenchymal stem cells (MSCs on MSC-facilitated tendon-bone healing in a rat supraspinatus repair model. Methods: Rat MSCs were transduced with a recombinant lentivirus encoding short hairpin RNA (shRNA against TOB1. MSC cell proliferation was analyzed by 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assays. The effect of MSCs with TOB1 deficiency on tendon-bone healing in a rat rotator cuff repair model was evaluated by biomechanical testing, histological analysis and collagen type I and II gene expression. An upstream regulator (miR-218 of TOB1 was determined in MSCs. Results: We found that knockdown of TOB1 significantly increased the proliferative activity of rat MSCs in vitro. When MSCs with TOB1 deficiency were injected into injured rat supraspinatus tendon-bone junctions, the effect on tendon-bone healing was enhanced compared to treatment with control MSCs with normal TOB1 expression, as evidenced by elevated levels of ultimate load to failure and stiffness, increased amount of fibrocartilage and augmented expression of collagen type I and type II genes. In addition, we found that the TOB1 3′ untranslated region is a direct target of miR-218. Similar to the effect of TOB1 deficiency, overexpression of miR-218 effectively promoted tendon-bone healing in rat. Conclusion: These results suggest that TOB1 may play a negative role in the effect of MSCs on tendon-bone healing, and imply that expression of TOB1 may be regulated by miR-218.

  2. Transfecting Human Monocytes with RNA.

    Science.gov (United States)

    Dannull, Jens; Nair, Smita K

    2016-01-01

    Targeting monocytes as a delivery system for drugs or nucleic acids, and thereby harnessing their natural tissue-infiltrating capacity, has become an area of intense investigation in both basic and clinical research. Herein we describe an efficient method to deliver mRNA (messenger RNA) or siRNA (small interfering RNA) into human monocytes by electroporation. This method can be applied in the laboratory to monocytes isolated via magnetic bead-based techniques, or in a clinical setting using monocytes that were collected via counterflow centrifugation elutriation using the Elutra(®) Cell Separation System. We further demonstrate that electroporation of monocytes with RNA represents a robust and highly relevant approach to modify monocytes for cell-based therapies. Last, the procedure described can readily be adapted to monocytes from different species, hence facilitating research in animal models.

  3. Fast prediction of RNA-RNA interaction using heuristic algorithm.

    Science.gov (United States)

    Montaseri, Soheila

    2015-01-01

    Interaction between two RNA molecules plays a crucial role in many medical and biological processes such as gene expression regulation. In this process, an RNA molecule prohibits the translation of another RNA molecule by establishing stable interactions with it. Some algorithms have been formed to predict the structure of the RNA-RNA interaction. High computational time is a common challenge in most of the presented algorithms. In this context, a heuristic method is introduced to accurately predict the interaction between two RNAs based on minimum free energy (MFE). This algorithm uses a few dot matrices for finding the secondary structure of each RNA and binding sites between two RNAs. Furthermore, a parallel version of this method is presented. We describe the algorithm's concurrency and parallelism for a multicore chip. The proposed algorithm has been performed on some datasets including CopA-CopT, R1inv-R2inv, Tar-Tar*, DIS-DIS, and IncRNA54-RepZ in Escherichia coli bacteria. The method has high validity and efficiency, and it is run in low computational time in comparison to other approaches.

  4. The RNA synthesis machinery of negative-stranded RNA viruses

    Energy Technology Data Exchange (ETDEWEB)

    Ortín, Juan, E-mail: jortin@cnb.csic.es [Department of Molecular and Cellular Biology, Centro Nacional de Biotecnología (CSIC) and CIBER de Enfermedades Respiratorias (ISCIII), Madrid (Spain); Martín-Benito, Jaime, E-mail: jmartinb@cnb.csic.es [Department of Macromolecular Structures, Centro Nacional de Biotecnología (CSIC), Madrid (Spain)

    2015-05-15

    The group of Negative-Stranded RNA Viruses (NSVs) includes many human pathogens, like the influenza, measles, mumps, respiratory syncytial or Ebola viruses, which produce frequent epidemics of disease and occasional, high mortality outbreaks by transmission from animal reservoirs. The genome of NSVs consists of one to several single-stranded, negative-polarity RNA molecules that are always assembled into mega Dalton-sized complexes by association to many nucleoprotein monomers. These RNA-protein complexes or ribonucleoproteins function as templates for transcription and replication by action of the viral RNA polymerase and accessory proteins. Here we review our knowledge on these large RNA-synthesis machines, including the structure of their components, the interactions among them and their enzymatic activities, and we discuss models showing how they perform the virus transcription and replication programmes. - Highlights: • Overall organisation of NSV RNA synthesis machines. • Structure and function of the ribonucleoprotein components: Atomic structure of the RNA polymerase complex. • Commonalities and differences between segmented- and non-segmented NSVs. • Transcription versus replication programmes.

  5. The RNA synthesis machinery of negative-stranded RNA viruses

    International Nuclear Information System (INIS)

    Ortín, Juan; Martín-Benito, Jaime

    2015-01-01

    The group of Negative-Stranded RNA Viruses (NSVs) includes many human pathogens, like the influenza, measles, mumps, respiratory syncytial or Ebola viruses, which produce frequent epidemics of disease and occasional, high mortality outbreaks by transmission from animal reservoirs. The genome of NSVs consists of one to several single-stranded, negative-polarity RNA molecules that are always assembled into mega Dalton-sized complexes by association to many nucleoprotein monomers. These RNA-protein complexes or ribonucleoproteins function as templates for transcription and replication by action of the viral RNA polymerase and accessory proteins. Here we review our knowledge on these large RNA-synthesis machines, including the structure of their components, the interactions among them and their enzymatic activities, and we discuss models showing how they perform the virus transcription and replication programmes. - Highlights: • Overall organisation of NSV RNA synthesis machines. • Structure and function of the ribonucleoprotein components: Atomic structure of the RNA polymerase complex. • Commonalities and differences between segmented- and non-segmented NSVs. • Transcription versus replication programmes

  6. Long non-coding RNA TUG1 is involved in cell growth and chemoresistance of small cell lung cancer by regulating LIMK2b via EZH2.

    Science.gov (United States)

    Niu, Yuchun; Ma, Feng; Huang, Weimei; Fang, Shun; Li, Man; Wei, Ting; Guo, Linlang

    2017-01-09

    Taurine upregulated gene1 (TUG1) as a 7.1-kb lncRNA, has been shown to play an oncogenic role in various cancers. However, the biological functions of lncRNA TUG1 in small cell lung cancer (SCLC) remain unknown. The aim of this study is to explore the roles of TUG1 in cell growth and chemoresistance of SCLC and its possible molecular mechanism. The expression of TUG1 in thirty-three cases of SCLC tissues and SCLC cell line were examined by quantitative RT-PCR (qRT-PCR). The functional roles of TUG1 in SCLC were demonstrated by CCK8 assay, colony formation assay, wound healing assay and transwell assay, flow cytometry analysis and in vivo study through siRNA or shRNA mediated knockdown. Western blot assays were used to evaluate gene and protein expression in cell lines. Chromatin immunoprecipitation (ChIP) and RNA binding protein immunoprecipitation (RIP) were performed to confirm the molecular mechanism of TUG1 involved in cell growth and chemoresistance of small cell lung cancer. We found that TUG1 was overexpressed in SCLC tissues, and its expression was correlated with the clinical stage and the shorter survival time of SCLC patients. Moreover, downregulation of TUG1 expression could impair cell proliferation and increased cell sensitivity to anticancer drugs both in vitro and in vivo. We also discovered that TUG1 knockdown significantly promoted cell apoptosis and cell cycle arrest, and inhibited cell migration and invasion in vitro . We further demonstrated that TUG1 can regulate the expression of LIMK2b (a splice variant of LIM-kinase 2) via binding with enhancer of zeste homolog 2 (EZH2), and then promoted cell growth and chemoresistance of SCLC. Together, these results suggested that TUG1 mediates cell growth and chemoresistance of SCLC by regulating LIMK2b via EZH2.

  7. Generation of miRNA sponge constructs

    NARCIS (Netherlands)

    Kluiver, Joost; Slezak-Prochazka, Izabella; Smigielska-Czepiel, Katarzyna; Halsema, Nancy; Kroesen, Bart-Jan; van den Berg, Anke

    2012-01-01

    MicroRNA (miRNA) sponges are RNA molecules with repeated miRNA antisense sequences that can sequester miRNAs from their endogenous targets and thus serve as a decoy. Stably expressed miRNA sponges are especially valuable for long-term loss-of-function studies and can be used in vitro and in vivo. We

  8. microRNA-independent recruitment of Argonaute 1 to nanos mRNA through the Smaug RNA-binding protein

    OpenAIRE

    Pinder, Benjamin D; Smibert, Craig A

    2012-01-01

    Argonaute 1 directly interacts with the RNA binding protein Smaug in Drosophila, is thereby recruited to the Smaug target nanos mRNA and is required for Smaug-mediated translational repression of the nanos mRNA.

  9. IntaRNA 2.0: enhanced and customizable prediction of RNA-RNA interactions.

    Science.gov (United States)

    Mann, Martin; Wright, Patrick R; Backofen, Rolf

    2017-07-03

    The IntaRNA algorithm enables fast and accurate prediction of RNA-RNA hybrids by incorporating seed constraints and interaction site accessibility. Here, we introduce IntaRNAv2, which enables enhanced parameterization as well as fully customizable control over the prediction modes and output formats. Based on up to date benchmark data, the enhanced predictive quality is shown and further improvements due to more restrictive seed constraints are highlighted. The extended web interface provides visualizations of the new minimal energy profiles for RNA-RNA interactions. These allow a detailed investigation of interaction alternatives and can reveal potential interaction site multiplicity. IntaRNAv2 is freely available (source and binary), and distributed via the conda package manager. Furthermore, it has been included into the Galaxy workflow framework and its already established web interface enables ad hoc usage. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Direct, rapid RNA sequence analysis

    International Nuclear Information System (INIS)

    Peattie, D.A.

    1987-01-01

    The original methods of RNA sequence analysis were based on enzymatic production and chromatographic separation of overlapping oligonucleotide fragments from within an RNA molecule followed by identification of the mononucleotides comprising the oligomer. Over the past decade the field of nucleic acid sequencing has changed dramatically, however, and RNA molecules now can be sequenced in a variety of more streamlined fashions. Most of the more recent advances in RNA sequencing have involved one-dimensional electrophoretic separation of 32 P-end-labeled oligoribonucleotides on polyacrylamide gels. In this chapter the author discusses two of these methods for determining the nucleotide sequences of RNA molecules rapidly: the chemical method and the enzymatic method. Both methods are direct and degradative, i.e., they rely on fragmatic and chemical approaches should be utilized. The single-strand-specific ribonucleases (A, T 1 , T 2 , and S 1 ) provide an efficient means to locate double-helical regions rapidly, and the chemical reactions provide a means to determine the RNA sequence within these regions. In addition, the chemical reactions allow one to assign interactions to specific atoms and to distinguish secondary interactions from tertiary ones. If the RNA molecule is small enough to be sequenced directly by the enzymatic or chemical method, the probing reactions can be done easily at the same time as sequencing reactions

  11. Cofactors in the RNA World

    Science.gov (United States)

    Ditzler, Mark A.

    2014-01-01

    RNA world theories figure prominently in many scenarios for the origin and early evolution of life. These theories posit that RNA molecules played a much larger role in ancient biology than they do now, acting both as the dominant biocatalysts and as the repository of genetic information. Many features of modern RNA biology are potential examples of molecular fossils from an RNA world, such as the pervasive involvement of nucleotides in coenzymes, the existence of natural aptamers that bind these coenzymes, the existence of natural ribozymes, a biosynthetic pathway in which deoxynucleotides are produced from ribonucleotides, and the central role of ribosomal RNA in protein synthesis in the peptidyl transferase center of the ribosome. Here, we uses both a top-down approach that evaluates RNA function in modern biology and a bottom-up approach that examines the capacities of RNA independent of modern biology. These complementary approaches exploit multiple in vitro evolution techniques coupled with high-throughput sequencing and bioinformatics analysis. Together these complementary approaches advance our understanding of the most primitive organisms, their early evolution, and their eventual transition to modern biochemistry.

  12. Efficient RNA structure comparison algorithms.

    Science.gov (United States)

    Arslan, Abdullah N; Anandan, Jithendar; Fry, Eric; Monschke, Keith; Ganneboina, Nitin; Bowerman, Jason

    2017-12-01

    Recently proposed relative addressing-based ([Formula: see text]) RNA secondary structure representation has important features by which an RNA structure database can be stored into a suffix array. A fast substructure search algorithm has been proposed based on binary search on this suffix array. Using this substructure search algorithm, we present a fast algorithm that finds the largest common substructure of given multiple RNA structures in [Formula: see text] format. The multiple RNA structure comparison problem is NP-hard in its general formulation. We introduced a new problem for comparing multiple RNA structures. This problem has more strict similarity definition and objective, and we propose an algorithm that solves this problem efficiently. We also develop another comparison algorithm that iteratively calls this algorithm to locate nonoverlapping large common substructures in compared RNAs. With the new resulting tools, we improved the RNASSAC website (linked from http://faculty.tamuc.edu/aarslan ). This website now also includes two drawing tools: one specialized for preparing RNA substructures that can be used as input by the search tool, and another one for automatically drawing the entire RNA structure from a given structure sequence.

  13. Alternative RNA splicing and cancer

    Science.gov (United States)

    Liu, Sali; Cheng, Chonghui

    2015-01-01

    Alternative splicing of pre-messenger RNA (mRNA) is a fundamental mechanism by which a gene can give rise to multiple distinct mRNA transcripts, yielding protein isoforms with different, even opposing, functions. With the recognition that alternative splicing occurs in nearly all human genes, its relationship with cancer-associated pathways has emerged as a rapidly growing field. In this review, we summarize recent findings that have implicated the critical role of alternative splicing in cancer and discuss current understandings of the mechanisms underlying dysregulated alternative splicing in cancer cells. PMID:23765697

  14. The ViennaRNA web services.

    Science.gov (United States)

    Gruber, Andreas R; Bernhart, Stephan H; Lorenz, Ronny

    2015-01-01

    The ViennaRNA package is a widely used collection of programs for thermodynamic RNA secondary structure prediction. Over the years, many additional tools have been developed building on the core programs of the package to also address issues related to noncoding RNA detection, RNA folding kinetics, or efficient sequence design considering RNA-RNA hybridizations. The ViennaRNA web services provide easy and user-friendly web access to these tools. This chapter describes how to use this online platform to perform tasks such as prediction of minimum free energy structures, prediction of RNA-RNA hybrids, or noncoding RNA detection. The ViennaRNA web services can be used free of charge and can be accessed via http://rna.tbi.univie.ac.at.

  15. [Effect of ginsenoside Rg3 on Pim-3 and Bad proteins in human pancreatic cancer cell line PANC-1].

    Science.gov (United States)

    Jian, Jie; Hu, Zhi-Fang; Huang, Yuan

    2009-05-01

    Ginsenoside Rg3 is a traditional Chinese medicine monomer which possesses anticancer effects. This study was to investigate the effects of ginsenoside Rg3 on Pim-3 and phosphorylated Bad (pBad) proteins, pBad (Ser112) and pBad (Ser136) in human pancreatic cancer cell line PANC-1. PANC-1 cells were exposed to 10, 20, 40 and 80 micromol/L ginsenoside Rg3 for 24 h. A short hairpin RNA (shRNA) of Pim-3 was cloned and inserted into a eukaryotic expression vector pSilencer 3.1-H1 Neo to construct pSilencer 3.1-H1 Neo-Pim-3. pSilencer 3.1-H1 Neo-Pim-3 was then transfected into PANC-1 cells. Cell proliferation was measured by MTT assay; cell apoptosis was observed under an invert microscope and measured by flow cytometry with Annexin V/PI staining; protein expressions of Pim-3, Bad, pBad (Ser112) and pBad (Ser136) were measured by Western blot. The inhibitory rates of 10, 20, 40 and 80 micromol/L ginsenoside Rg3 on PANC-1 cells were 20.2%, 33.4%, 52.8% and 65.3%, respectively. Typical morphological changes in apoptosis were induced by ginsenoside Rg3. The apoptotic rate of PANC-1 cells was significantly higher in the ginsenoside Rg3 treatment group (80 micromol/L) than in the control group (12.2% vs. 3.3%, PPANC-1 cells. Compared with the control group, the percentages of early and total apoptotic cells were significantly increased in PANC-1 cells transfected with pim-3-shRNA [(11.5+/-3.7)% vs. (5.8+/-2.2)%,P<0.01;(20.8+/-2.6)% vs.(13.0+/-4.1)%,P<0.05], while the expressions of pim-3 and pBad (Ser112) were both decreased. The anti-tumor effect of ginsenoside Rg3 may be associated with the decrease of Pim-3 and pBad (Ser112).

  16. The T-box transcription factor Brachyury regulates epithelial–mesenchymal transition in association with cancer stem-like cells in adenoid cystic carcinoma cells

    International Nuclear Information System (INIS)

    Shimoda, Miyuki; Sugiura, Tsuyoshi; Imajyo, Ikumi; Ishii, Kotaro; Chigita, Satomi; Seki, Katsuhiro; Kobayashi, Yousuke; Shirasuna, Kanemitsu

    2012-01-01

    The high frequencies of recurrence and distant metastasis of adenoid cystic carcinoma (AdCC) emphasize the need to better understand the biological factors associated with these outcomes. To analyze the mechanisms of AdCC metastasis, we established the green fluorescence protein (GFP)-transfected subline ACCS-GFP from the AdCC parental cell line and the metastatic ACCS-M GFP line from an in vivo metastasis model. Using these cell lines, we investigated the involvement of the epithelial–mesenchymal transition (EMT) and cancer stem cell (CSCs) in AdCC metastasis by real-time RT-PCR for EMT related genes and stem cell markers. Characteristics of CSCs were also analyzed by sphere-forming ability and tumorigenicity. Short hairpin RNA (shRNA) silencing of target gene was also performed. ACCS-M GFP demonstrated characteristics of EMT and additionally displayed sphere-forming ability and high expression of EMT-related genes (Snail, Twist1, Twist2, Slug, zinc finger E-box binding homeobox 1 and 2 [Zeb1 and Zeb2], glycogen synthase kinase 3 beta [Gsk3β and transforming growth factor beta 2 [Tgf-β2]), stem cell markers (Nodal, Lefty, Oct-4, Pax6, Rex1, and Nanog), and differentiation markers (sex determining region Y [Sox2], Brachyury, and alpha fetoprotein [Afp]). These observations suggest that ACCS-M GFP shows the characteristics of CSCs and CSCs may be involved in the EMT of AdCC. Surprisingly, shRNA silencing of the T-box transcription factor Brachyury (also a differentiation marker) resulted in downregulation of the EMT and stem cell markers. In addition, sphere-forming ability, EMT characteristics, and tumorigenicity were simultaneously lost. Brachyury expression in clinical samples of AdCC was extremely high and closely related to EMT. This finding suggests that regulation of EMT by Brachyury in clinical AdCC may parallel that observed in vitro in this study. The use of a single cell line is a limitation of this study. However, parallel data from in vitro and

  17. Natural resistance to ascorbic acid induced oxidative stress is mainly mediated by catalase activity in human cancer cells and catalase-silencing sensitizes to oxidative stress

    Directory of Open Access Journals (Sweden)

    Klingelhoeffer Christoph

    2012-05-01

    Full Text Available Abstract Background Ascorbic acid demonstrates a cytotoxic effect by generating hydrogen peroxide, a reactive oxygen species (ROS involved in oxidative cell stress. A panel of eleven human cancer cell lines, glioblastoma and carcinoma, were exposed to serial dilutions of ascorbic acid (5-100 mmol/L. The purpose of this study was to analyse the impact of catalase, an important hydrogen peroxide-detoxifying enzyme, on the resistance of cancer cells to ascorbic acid mediated oxidative stress. Methods Effective concentration (EC50 values, which indicate the concentration of ascorbic acid that reduced the number of viable cells by 50%, were detected with the crystal violet assay. The level of intracellular catalase protein and enzyme activity was determined. Expression of catalase was silenced by catalase-specific short hairpin RNA (sh-RNA in BT-20 breast carcinoma cells. Oxidative cell stress induced apoptosis was measured by a caspase luminescent assay. Results The tested human cancer cell lines demonstrated obvious differences in their resistance to ascorbic acid mediated oxidative cell stress. Forty-five percent of the cell lines had an EC50 > 20 mmol/L and fifty-five percent had an EC50 50 of 2.6–5.5 mmol/L, glioblastoma cells were the most susceptible cancer cell lines analysed in this study. A correlation between catalase activity and the susceptibility to ascorbic acid was observed. To study the possible protective role of catalase on the resistance of cancer cells to oxidative cell stress, the expression of catalase in the breast carcinoma cell line BT-20, which cells were highly resistant to the exposure to ascorbic acid (EC50: 94,9 mmol/L, was silenced with specific sh-RNA. The effect was that catalase-silenced BT-20 cells (BT-20 KD-CAT became more susceptible to high concentrations of ascorbic acid (50 and 100 mmol/L. Conclusions Fifty-five percent of the human cancer cell lines tested were unable to protect themselves

  18. Hepatitis B virus X protein promotes interleukin-7 receptor expression via NF-κB and Notch1 pathway to facilitate proliferation and migration of hepatitis B virus-related hepatoma cells

    Directory of Open Access Journals (Sweden)

    Fanyun Kong

    2016-11-01

    Full Text Available Abstract Background Interleukin-7 receptor (IL-7R is involved in the abnormal function of solid tumors, but the role and regulatory mechanisms of IL-7R in HBV-related hepatocellular carcinoma (HCC are still unclear. Methods Gene and protein expression levels of IL-7R were examined in hepatoma cells transfected with hepatitis B virus (HBV plasmids and in hepatoma cells transfected with the multifunctional nonstructural protein X (HBX. The expression of HBX and IL-7R was measured by immunohistochemical analysis in HBV-related HCC tissues. The role of NF-κB and Notch1 pathways in HBX-mediated expression of IL-7R in hepatoma cells was examined. Activation of IL-7R downstream of intracellular signaling proteins AKT, JNK, STAT5, and the associated molecules CyclinD1 and matrix metalloproteinase-9 (MMP-9, was assessed in HBX-positive cells with or without treatment with IL-7R short hairpin RNA (shRNA. Additionally, the role of IL-7R in HBX-mediated proliferation and migration of hepatoma cells was investigated. Results The expression of IL-7R was increased in hepatoma cells transfected with HBV plasmids; HBX was responsible for the HBV-mediated upregulation of IL-7R. Compared to adjacent tissues, the expression of HBX and IL-7R was increased in HBV-related HCC tissues. Additionally, the relative expression levels of HBX were associated with IL-7R in HBV-related HCC tissues. The activation of NF-κB pathways and expression of Notch1 were increased in hepatoma cells transfected with HBX, and inhibition of NF-κB and Notch1 pathways significantly decreased HBX-mediated expression of IL-7R. The activation of AKT and JNK and the expression of CyclinD1 and MMP-9 were increased in HBX-positive cells. When cells were treated with IL-7R shRNA, the activation of AKT and JNK, as well as the expression of CyclinD1 and MMP-9, were significantly inhibited. Additionally, IL-7R was responsible for HBX-induced proliferation and migration ability of hepatoma cells

  19. Rapid Generation of MicroRNA Sponges for MicroRNA Inhibition

    NARCIS (Netherlands)

    Kluiver, Joost; Gibcus, Johan H.; Hettinga, Chris; Adema, Annelies; Richter, Mareike K. S.; Halsema, Nancy; Slezak-Prochazka, Izabella; Ding, Ye; Kroesen, Bart-Jan; van den Berg, Anke

    2012-01-01

    MicroRNA (miRNA) sponges are transcripts with repeated miRNA antisense sequences that can sequester miRNAs from endogenous targets. MiRNA sponges are valuable tools for miRNA loss-of-function studies both in vitro and in vivo. We developed a fast and flexible method to generate miRNA sponges and

  20. Silencing of RhoA and RhoC expression by RNA interference suppresses human colorectal carcinoma growth in vivo

    Directory of Open Access Journals (Sweden)

    Wang Haibo

    2010-09-01

    Full Text Available Abstract Background RhoA and RhoC have been proved to be over-expressed in many solid cancers, including colorectal cancer. The reduction of RhoA and RhoC expression by RNA interference (RNAi resulted growth inhibition of cancer cells. The present study was to evaluate the effect of silencing of RhoA and RhoC expression by RNAi on growth of human colorectal carcinoma (CRC in tumor-bearing nude mice in vivo. Methods To establish HCT116 cell transplantable model, the nude mice were subcutaneously inoculated with 1.0 × 107 HCT116 cells and kept growing till the tumor xenografts reached 5-7 mm in diameter. Then the mice were randomly assigned to three groups(seven mice in each group: (1 normal saline(NS group, (2replication-defective recombinant adenovirus carrying the negative control shRNA (Ad-HK group and (3replication-defective recombinant adenovirus carrying the 4-tandem linked RhoA and RhoC shRNAs (Ad-RhoA-RhoC group. Ad-HK (4 × 108 pfu, 30 ul/mouse, Ad-RhoA-RhoC (4 × 108 pfu, 30 ul/mouse or PBS (30 ul/mouse was injected intratumorally four times once every other day. The weight and volumes of tumor xenografts were recorded. The levels of RhoA and RhoC mRNA transcripts and proteins in tumor xenografts were detected by reverse quantitative transcription polymerase chain reaction (QRT-PCR and immunohistochemical staining respectively. The terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL assay was used to detect the death of cells. Results The xenografts in mice could be seen at 5th day from the implantation of HCT116 cells and all had reached 5-7 mm in size at 9th day. After injection intratumorally, the growth speed of tumor xenografts in Ad-RhoA-RhoC group was significantly delayed compared with those in NS and Ad-HK group(P RhoA and RhoC reduced more in Ad-RhoA-RhoC group than those in NS and Ad-HK group. The relative RhoA and RhoC mRNA transcripts were decreased to 48% and 43% respectively (P RhoA and Rho

  1. Identification of Subtype Specific miRNA-mRNA Functional Regulatory Modules in Matched miRNA-mRNA Expression Data: Multiple Myeloma as a Case

    Directory of Open Access Journals (Sweden)

    Yunpeng Zhang

    2015-01-01

    Full Text Available Identification of miRNA-mRNA modules is an important step to elucidate their combinatorial effect on the pathogenesis and mechanisms underlying complex diseases. Current identification methods primarily are based upon miRNA-target information and matched miRNA and mRNA expression profiles. However, for heterogeneous diseases, the miRNA-mRNA regulatory mechanisms may differ between subtypes, leading to differences in clinical behavior. In order to explore the pathogenesis of each subtype, it is important to identify subtype specific miRNA-mRNA modules. In this study, we integrated the Ping-Pong algorithm and multiobjective genetic algorithm to identify subtype specific miRNA-mRNA functional regulatory modules (MFRMs through integrative analysis of three biological data sets: GO biological processes, miRNA target information, and matched miRNA and mRNA expression data. We applied our method on a heterogeneous disease, multiple myeloma (MM, to identify MM subtype specific MFRMs. The constructed miRNA-mRNA regulatory networks provide modular outlook at subtype specific miRNA-mRNA interactions. Furthermore, clustering analysis demonstrated that heterogeneous MFRMs were able to separate corresponding MM subtypes. These subtype specific MFRMs may aid in the further elucidation of the pathogenesis of each subtype and may serve to guide MM subtype diagnosis and treatment.

  2. Data on the effect of in vivo knockdown using artificial ErbB3 miRNA on Remak bundle structure

    Directory of Open Access Journals (Sweden)

    Yuki Miyamoto

    2017-06-01

    Full Text Available Mature Schwann cells, the peripheral nervous system (PNS glial cells, have two major roles for neuronal axons (Bunge, 1993 [1]. For large diameter axons, Schwann cells form myelin sheaths with multiple layers. For small diameter axons, they form Remak bundle composed only of single layer of the Schwann cell plasma membrane. In the PNS, ErbB3 forms a dimer with ErbB2 on the Schwann cell plasma membrane. ErbB3 plays a key role in myelination by myelinating Schwann cells, that is to say, its role in myelin thickness. Herein we provide the data regarding the effect of in vivo knockdown of ErbB3 on the thickness between an axon and a neighboring axon in Remak bundle, which is formed by non-myelinating Schwann cells. Since ErbB3 knockout mice are embryonically lethal, Schwann cell lineage-specific transgenic mice transcribing ErbB3 shRNA with an artificial miRNA backbone were generated and used in these experiments (Torii et al., 2014 [2].

  3. Predicting and Modeling RNA Architecture

    Science.gov (United States)

    Westhof, Eric; Masquida, Benoît; Jossinet, Fabrice

    2011-01-01

    SUMMARY A general approach for modeling the architecture of large and structured RNA molecules is described. The method exploits the modularity and the hierarchical folding of RNA architecture that is viewed as the assembly of preformed double-stranded helices defined by Watson-Crick base pairs and RNA modules maintained by non-Watson-Crick base pairs. Despite the extensive molecular neutrality observed in RNA structures, specificity in RNA folding is achieved through global constraints like lengths of helices, coaxiality of helical stacks, and structures adopted at the junctions of helices. The Assemble integrated suite of computer tools allows for sequence and structure analysis as well as interactive modeling by homology or ab initio assembly with possibilities for fitting within electronic density maps. The local key role of non-Watson-Crick pairs guides RNA architecture formation and offers metrics for assessing the accuracy of three-dimensional models in a more useful way than usual root mean square deviation (RMSD) values. PMID:20504963

  4. Inhibiting trophoblast PAR-1 overexpression suppresses sFlt-1-induced anti-angiogenesis and abnormal vascular remodeling: a possible therapeutic approach for preeclampsia.

    Science.gov (United States)

    Zhao, Yin; Zheng, YanFang; Liu, XiaoXia; Luo, QingQing; Wu, Di; Liu, XiaoPing; Zou, Li

    2018-03-01

    Is it possible to improve vascular remodeling by inhibiting the excessive expression of protease-activated receptor 1 (PAR-1) in trophoblast of abnormal placenta? Inhibition of trophoblast PAR-1 overexpression may promote placental angiogenesis and vascular remodeling, offering an alternative therapeutic approach for preeclampsia. PAR-1 is high-affinity receptor of thrombin. Thrombin increases sFlt-1 secretion in trophoblast via the activation of PAR-1. It is reported that the expression of both thrombin and PAR-1 expression are increased in placentas of preeclampsia patients compared with normal placentas. Trophoblast cells were transfected with PAR-1 short hairpin RNA (shRNA) or PAR-1 overexpression plasmids in vitro. Tube formation assays and a villus-decidua co-culture system were used to study the effect of PAR-1 inhibition on placental angiogenesis and vascular remodeling, respectively. Placentas from rats with preeclampsia were transfected with PAR-1 shRNA to confirm the effect of inhibiting PAR-1 overexpression in placenta. The trophoblast cell line HTR-8/SVneo was transfected with PAR-1 shRNA or PAR-1 overexpression plasmids. After 48 h, supernatant was collected and the level of sFlt-1 secretion was measured by ELISA. Human umbilical cord epithelial cells and a villus-decidua co-culture system were treated with conditioned media to study the effect of PAR-1 inhibition on tube formation and villi vascular remodeling. A preeclampsia rat model was established by intraperitoneal injection of L-NAME. Plasmids were injected into the placenta of the preeclampsia rats and systolic blood pressure was measured on Days 15 and 19. The effect of different treatments was evaluated by proteinuria, placental weights, fetal weights and fetal numbers in study and control groups. The level of serum sFlt-1 in rats with preeclampsia was also measured. Changes in the placenta microvessels were studied by histopathological staining. PAR-1 shRNA inhibited PAR-1 expression and

  5. Shielding the messenger (RNA): microRNA-based anticancer therapies

    Science.gov (United States)

    Sotillo, Elena; Thomas-Tikhonenko, Andrei

    2011-01-01

    It has been a decade since scientists realized that microRNAs (miRNAs) are not an oddity invented by worms to regulate gene expression at post-transcriptional levels. Rather, many of these 21–22-nucleotide-short RNAs exist in invertebrates and vertebrates alike and some of them are in fact highly conserved. miRNAs are now recognized as an important class of non-coding small RNAs that inhibit gene expression by targeting mRNA stability and translation. In the last ten years, our knowledge of the miRNAs world was expanding at vertiginous speed, propelled by the development of computational engines for miRNA identification and target prediction, biochemical tools and techniques to modulate miRNA activity, and last but not least, the emergence of miRNA-centric animal models. One important conclusion that has emerged from this effort is that many microRNAs and their cognate targets are strongly implicated in cancer, either as oncogenes or tumor and metastasis suppressors. In this review we will discuss the diverse role that miRNAs play in cancer initiation and progression and also the tools with which miRNA expression could be corrected in vivo. While the idea of targeting microRNAs towards therapeutic ends is getting considerable traction, basic, translational, and clinical research done in the next few years will tell whether this promise is well-founded. PMID:21514318

  6. MicroRNA-29b regulates TGF-β1-mediated epithelial–mesenchymal transition of retinal pigment epithelial cells by targeting AKT2

    Energy Technology Data Exchange (ETDEWEB)

    Li, Min; Li, Hui; Liu, Xiaoqiang; Xu, Ding; Wang, Fang, E-mail: milwang_122@msn.com

    2016-07-15

    The role of microRNA (miRNA) in proliferative vitreoretinopathy (PVR) progression has not been studied extensively, especially in retinal pigment epithelial–mesenchymal transition (EMT) which is the main reason for formation of PVR. In this study, we first investigated the miRNA expression profile in transforming growth factor beta 1 (TGF-β1) mediated EMT of ARPE-19 cells. Among the five changed miRNAs, miR-29b showed the most significant downregulation. Enhanced expression of miR-29b could reverse TGF-β1 induced EMT through targeting Akt2. Akt2 downregulation could inhibit TGF-β1-induced EMT. Furthermore, inhibition of miR-29b in ARPE-19 cells directly triggered EMT process, which characterized by the phenotypic transition and the upregulation of α-smooth muscle actin (α-SMA) and downregulation of E-cadherin and zona occludin-1 (ZO-1) with increased cell migration. Akt2-shRNA also inhibited miR-29 inhibitor-induced EMT process. These data indicate that miR-29b plays an important role in TGF-β1-mediated EMT in ARPE-19 cells by targeting Akt2. - Highlights: • MiR-29b expression is decreased in TGF-β1-induced EMT of ARPE-19 cells. • MiR-29b inhibits TGF-β1-induced EMT in ARPE-19 cells. • MiR-29b inhibitor induces EMT in ARPE-19 cells. • Akt2 is the target for miR-29b. • Downregulation of Akt2 prevents TGF-β1-induced EMT of ARPE-19 cells.

  7. Chaperoning 5S RNA assembly.

    Science.gov (United States)

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-07-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. © 2015 Madru et al.; Published by Cold Spring Harbor Laboratory Press.

  8. Differential Regulation of rRNA and tRNA Transcription from the rRNA-tRNA Composite Operon in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Hiraku Takada

    Full Text Available Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon, within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons

  9. RegRNA: an integrated web server for identifying regulatory RNA motifs and elements

    OpenAIRE

    Huang, Hsi-Yuan; Chien, Chia-Hung; Jen, Kuan-Hua; Huang, Hsien-Da

    2006-01-01

    Numerous regulatory structural motifs have been identified as playing essential roles in transcriptional and post-transcriptional regulation of gene expression. RegRNA is an integrated web server for identifying the homologs of regulatory RNA motifs and elements against an input mRNA sequence. Both sequence homologs and structural homologs of regulatory RNA motifs can be recognized. The regulatory RNA motifs supported in RegRNA are categorized into several classes: (i) motifs in mRNA 5′-untra...

  10. Human p38δ MAP kinase mediates UV irradiation induced up-regulation of the gene expression of chemokine BRAK/CXCL14

    International Nuclear Information System (INIS)

    Ozawa, Shigeyuki; Ito, Shin; Kato, Yasumasa; Kubota, Eiro; Hata, Ryu-Ichiro

    2010-01-01

    The mitogen-activated protein kinase (MAPK) family comprises ERK, JNK, p38 and ERK5 (big-MAPK, BMK1). UV irradiation of squamous cell carcinoma cells induced up-regulation of gene expression of chemokine BRAK/CXCL14, stimulated p38 phosphorylation, and down-regulated the phosphorylation of ERK. Human p38 MAPKs exist in 4 isoforms: p38α, β, γ and δ. The UV stimulation of p38 phosphorylation was not inhibited by the presence of SB203580 or PD169316, inhibitors of p38α and β, suggesting p38 phosphorylation was not dependent on these 2 isoforms and that p38γ and/or δ was responsible for the phosphorylation. In fact, inhibition of each of these 4 p38 isoforms by the introduction of short hairpin (sh) RNAs for respective isoforms revealed that only shRNA for p38δ attenuated the UV-induced up-regulation of BRAK/CXCL14 gene expression. In addition, over-expression of p38 isoforms in the cells showed the association of p38δ with ERK1 and 2, concomitant with down-regulation of ERK phosphorylation. The usage of p38δ isoform by UV irradiation is not merely due to the abundance of this p38 isoform in the cells. Because serum deprivation of the cells also induced an increase in BRAK/CXCL14 gene expression, and in this case p38α and/or β isoform is responsible for up-regulation of BRAK/CXCL14 gene expression. Taken together, the data indicate that the respective stress-dependent action of p38 isoforms is responsible for the up-regulation of the gene expression of the chemokine BRAK/CXCL14.

  11. Breast cancer cell cyclooxygenase-2 expression alters extracellular matrix structure and function and numbers of cancer associated fibroblasts.

    Science.gov (United States)

    Krishnamachary, Balaji; Stasinopoulos, Ioannis; Kakkad, Samata; Penet, Marie-France; Jacob, Desmond; Wildes, Flonne; Mironchik, Yelena; Pathak, Arvind P; Solaiyappan, Meiyappan; Bhujwalla, Zaver M

    2017-03-14

    Cyclooxygenase-2 (COX-2) is a critically important mediator of inflammation that significantly influences tumor angiogenesis, invasion, and metastasis. We investigated the role of COX-2 expressed by triple negative breast cancer cells in altering the structure and function of the extracellular matrix (ECM). COX-2 downregulation effects on ECM structure and function were investigated using magnetic resonance imaging (MRI) and second harmonic generation (SHG) microscopy of tumors derived from triple negative MDA-MB-231 breast cancer cells, and a derived clone stably expressing a short hairpin (shRNA) molecule downregulating COX-2. MRI of albumin-GdDTPA was used to characterize macromolecular fluid transport in vivo and SHG microscopy was used to quantify collagen 1 (Col1) fiber morphology. COX-2 downregulation decreased Col1 fiber density and altered macromolecular fluid transport. Immunohistochemistry identified significantly fewer activated cancer associated fibroblasts (CAFs) in low COX-2 expressing tumors. Metastatic lung nodules established by COX-2 downregulated cells were infrequent, smaller, and contained fewer Col1 fibers.COX-2 overexpression studies were performed with tumors derived from triple negative SUM-149 breast cancer cells lentivirally transduced to overexpress COX-2. SHG microscopy identified significantly higher Col1 fiber density in COX-2 overexpressing tumors with an increase of CAFs. These data expand upon the roles of COX-2 in shaping the structure and function of the ECM in primary and metastatic tumors, and identify the potential role of COX-2 in modifying the number of CAFs in tumors that may have contributed to the altered ECM.

  12. Analysis of intermolecular RNA-RNA recombination by rubella virus

    International Nuclear Information System (INIS)

    Adams, Sandra D.; Tzeng, W.-P.; Chen, M.-H.; Frey, Teryl K.

    2003-01-01

    To investigate whether rubella virus (RUB) undergoes intermolecular RNA-RNA recombination, cells were cotransfected with pairs of in vitro transcripts from genomic cDNA plasmid vectors engineered to contain nonoverlapping deletions: the replicative transcript maintained the 5'-proximal nonstructural (NS) ORF (which contained the replicase, making it RNA replication competent), had a deletion in the 3'-proximal structural protein (SP) ORF, and maintained the 3' end of the genome, including the putative 3' cis-acting elements (CSE), while the nonreplicative transcript consisted of the 3' half of the genome including the SP-ORF and 3' CSE. Cotransfection yielded plaque-forming virus that synthesized the standard genomic and subgenomic RNAs and thus was generated by RNA-RNA recombination. Using transcripts tagged with a 3'-terminal deletion, it was found that recombinants contained the 3' end derived from the replicative strand, indicating a cis-preference for initiation of negative-strand synthesis. In cotransfections in which the replicative transcript lacked the 3' CSE, recombination occurred, albeit at lower efficiency, indicating that initiation in trans from the NS-ORF can occur. The 3' CSE was sufficient as a nonreplicative transcript, showing that it can serve as a promoter for negative-strand RNA synthesis. While deletion mutagenesis showed that the presence of the junction untranslated region (J-UTR) between the ORFs appeared to be necessary on both transcripts for recombination in this region of the genome, analysis with transcripts tagged with restriction sites showed that the J-UTR was not a hot spot for recombination compared to neighboring regions in both ORFs. Sequence analysis of recombinants revealed that both precise (homologous) and imprecise recombination (aberrant, homologous resulting in duplications) occurred; however, imprecise recombination only involved the J-UTR or the 3' end of the NS-ORF and the J-UTR (maintaining the NS-ORF), indicating

  13. MicroRNA mimicry blocks pulmonary fibrosis

    NARCIS (Netherlands)

    Montgomery, Rusty L; Yu, Guoying; Latimer, Paul A; Stack, Christianna; Robinson, Kathryn; Dalby, Christina M; Kaminski, Naftali; van Rooij, Eva

    2014-01-01

    Over the last decade, great enthusiasm has evolved for microRNA (miRNA) therapeutics. Part of the excitement stems from the fact that a miRNA often regulates numerous related mRNAs. As such, modulation of a single miRNA allows for parallel regulation of multiple genes involved in a particular

  14. Biochemistry and Function of the RNA Exosomes

    DEFF Research Database (Denmark)

    Lubas, Michal Szymon; Chlebowski, Aleksander; Dziembowski, Andrzej

    2012-01-01

    Discovery of the evolutionary conserved RNA exosome was a milestone in RNA biology. First identified as an activity essential for the processing of ribosomal RNA, the exosome has since proved to be central for RNA processing and degradation in both the nucleus and the cytoplasm of eukaryotic cell...

  15. The crystal structure of tRNA

    Indian Academy of Sciences (India)

    Madhu

    of yeast alanine tRNA by Robert Holley's group at Cornell. University ... decode nonsense codons) with John Smith and Brenner. However, my ... tRNA from 10 g of unfractionated tRNA. ... tRNA crystals were, in fact, protein (Hendrikson et al.

  16. A discontinuous RNA platform mediates RNA virus replication: building an integrated model for RNA-based regulation of viral processes.

    Directory of Open Access Journals (Sweden)

    Baodong Wu

    2009-03-01

    Full Text Available Plus-strand RNA viruses contain RNA elements within their genomes that mediate a variety of fundamental viral processes. The traditional view of these elements is that of local RNA structures. This perspective, however, is changing due to increasing discoveries of functional viral RNA elements that are formed by long-range RNA-RNA interactions, often spanning thousands of nucleotides. The plus-strand RNA genomes of tombusviruses exemplify this concept by possessing different long-range RNA-RNA interactions that regulate both viral translation and transcription. Here we report that a third fundamental tombusvirus process, viral genome replication, requires a long-range RNA-based interaction spanning approximately 3000 nts. In vivo and in vitro analyses suggest that the discontinuous RNA platform formed by the interaction facilitates efficient assembly of the viral RNA replicase. This finding has allowed us to build an integrated model for the role of global RNA structure in regulating the reproduction of a eukaryotic RNA virus, and the insights gained have extended our understanding of the multifunctional nature of viral RNA genomes.

  17. Glia to axon RNA transfer.

    Science.gov (United States)

    Sotelo, José Roberto; Canclini, Lucía; Kun, Alejandra; Sotelo-Silveira, José Roberto; Calliari, Aldo; Cal, Karina; Bresque, Mariana; Dipaolo, Andrés; Farias, Joaquina; Mercer, John A

    2014-03-01

    The existence of RNA in axons has been a matter of dispute for decades. Evidence for RNA and ribosomes has now accumulated to a point at which it is difficult to question, much of the disputes turned to the origin of these axonal RNAs. In this review, we focus on studies addressing the origin of axonal RNAs and ribosomes. The neuronal soma as the source of most axonal RNAs has been demonstrated and is indisputable. However, the surrounding glial cells may be a supplemental source of axonal RNAs, a matter scarcely investigated in the literature. Here, we review the few papers that have demonstrated that glial-to-axon RNA transfer is not only feasible, but likely. We describe this process in both invertebrate axons and vertebrate axons. Schwann cell to axon ribosomes transfer was conclusively demonstrated (Court et al. [2008]: J. Neurosci 28:11024-11029; Court et al. [2011]: Glia 59:1529-1539). However, mRNA transfer still remains to be demonstrated in a conclusive way. The intercellular transport of mRNA has interesting implications, particularly with respect to the integration of glial and axonal function. This evolving field is likely to impact our understanding of the cell biology of the axon in both normal and pathological conditions. Most importantly, if the synthesis of proteins in the axon can be controlled by interacting glia, the possibilities for clinical interventions in injury and neurodegeneration are greatly increased. Copyright © 2013 Wiley Periodicals, Inc.

  18. On topological RNA interaction structures.

    Science.gov (United States)

    Qin, Jing; Reidys, Christian M

    2013-07-01

    Recently a folding algorithm of topological RNA pseudoknot structures was presented in Reidys et al. (2011). This algorithm folds single-stranded γ-structures, that is, RNA structures composed by distinct motifs of bounded topological genus. In this article, we set the theoretical foundations for the folding of the two backbone analogues of γ structures: the RNA γ-interaction structures. These are RNA-RNA interaction structures that are constructed by a finite number of building blocks over two backbones having genus at most γ. Combinatorial properties of γ-interaction structures are of practical interest since they have direct implications for the folding of topological interaction structures. We compute the generating function of γ-interaction structures and show that it is algebraic, which implies that the numbers of interaction structures can be computed recursively. We obtain simple asymptotic formulas for 0- and 1-interaction structures. The simplest class of interaction structures are the 0-interaction structures, which represent the two backbone analogues of secondary structures.

  19. Tapping the RNA world for therapeutics.

    Science.gov (United States)

    Lieberman, Judy

    2018-04-16

    A recent revolution in RNA biology has led to the identification of new RNA classes with unanticipated functions, new types of RNA modifications, an unexpected multiplicity of alternative transcripts and widespread transcription of extragenic regions. This development in basic RNA biology has spawned a corresponding revolution in RNA-based strategies to generate new types of therapeutics. Here, I review RNA-based drug design and discuss barriers to broader applications and possible ways to overcome them. Because they target nucleic acids rather than proteins, RNA-based drugs promise to greatly extend the domain of 'druggable' targets beyond what can be achieved with small molecules and biologics.

  20. RNA-Based Vaccines in Cancer Immunotherapy

    Directory of Open Access Journals (Sweden)

    Megan A. McNamara

    2015-01-01

    Full Text Available RNA vaccines traditionally consist of messenger RNA synthesized by in vitro transcription using a bacteriophage RNA polymerase and template DNA that encodes the antigen(s of interest. Once administered and internalized by host cells, the mRNA transcripts are translated directly in the cytoplasm and then the resulting antigens are presented to antigen presenting cells to stimulate an immune response. Alternatively, dendritic cells can be loaded with either tumor associated antigen mRNA or total tumor RNA and delivered to the host to elicit a specific immune response. In this review, we will explain why RNA vaccines represent an attractive platform for cancer immunotherapy, discuss modifications to RNA structure that have been developed to optimize mRNA vaccine stability and translational efficiency, and describe strategies for nonviral delivery of mRNA vaccines, highlighting key preclinical and clinical data related to cancer immunotherapy.

  1. A Regulatory RNA Inducing Transgenerationally Inherited Phenotypes

    DEFF Research Database (Denmark)

    Jensen, Lea Møller

    . The variation in Arabidopsis enables different regulatory networks and mechanisms to shape the phenotypic characteristics. The thesis describes the identification of regulatory RNA encoded by an enzyme encoding gene. The RNA regulates by inducing transgenerationally inherited phenotypes. The function of the RNA...... is dependent on the genetic background illustrating that polymorphisms are found in either interactors or target genes of the RNA. Furthermore, the RNA provides a mechanistic link between accumulation of glucosinolate and onset of flowering....

  2. Screening of Modified RNA duplexes

    DEFF Research Database (Denmark)

    Schyth, Brian Dall; Bramsen, Jesper Bertram; Kjems, Jørgen

    protection against a fish pathogenic virus. This protection corresponded with an interferon response in the fish. Here we use this fish model to screen siRNAs containing various chemical modifications of the RNA backbone for their antiviral activity, the overall aim being identification of an siRNA form......Because of sequence specific gene targeting activity siRNAs are regarded as promising active compounds in gene medicine. But one serious problem with delivering siRNAs as treatment is the now well-established non-specific activities of some RNA duplexes. Cellular reactions towards double stranded...... RNAs include the 2´-5´ oligoadenylate synthetase system, the protein kinase R, RIG-I and Toll-like receptor activated pathways all resulting in antiviral defence mechanism. We have previously shown that antiviral innate immune reactions against double stranded RNAs could be detected in vivo as partial...

  3. TargetRNA: a tool for predicting targets of small RNA action in bacteria

    OpenAIRE

    Tjaden, Brian

    2008-01-01

    Many small RNA (sRNA) genes in bacteria act as posttranscriptional regulators of target messenger RNAs. Here, we present TargetRNA, a web tool for predicting mRNA targets of sRNA action in bacteria. TargetRNA takes as input a genomic sequence that may correspond to an sRNA gene. TargetRNA then uses a dynamic programming algorithm to search each annotated message in a specified genome for mRNAs that evince basepair-binding potential to the input sRNA sequence. Based on the calculated basepair-...

  4. RNA-dependent RNA polymerases from cowpea mosaic virus-infected cowpea leaves

    NARCIS (Netherlands)

    Dorssers, L.

    1983-01-01

    The aim of the research described in this thesis was the purification and identification of the RNA-dependent RNA polymerase engaged in replicating viral RNA in cowpea mosaic virus (CPMV)- infected cowpea leaves.

    Previously, an RNA-dependent RNA polymerase produced upon infection of

  5. RNA Study Using DNA Nanotechnology.

    Science.gov (United States)

    Tadakuma, Hisashi; Masubuchi, Takeya; Ueda, Takuya

    2016-01-01

    Transcription is one of the fundamental steps of gene expression, where RNA polymerases (RNAPs) bind to their template genes and make RNAs. In addition to RNAP and the template gene, many molecules such as transcription factors are involved. The interaction and the effect of these factors depend on the geometry. Molecular layout of these factors, RNAP and gene is thus important. DNA nanotechnology is a promising technology that allows controlling of the molecular layout in the range of nanometer to micrometer scale with nanometer resolution; thus, it is expected to expand the RNA study beyond the current limit. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Isolation of Microarray-Grade Total RNA, MicroRNA, and DNA from a Single PAXgene Blood RNA Tube

    DEFF Research Database (Denmark)

    Kruhøffer, Mogens; Andersen, Lars Dyrskjøt; Voss, Thorsten

    2007-01-01

    We have developed a procedure for isolation of microRNA and genomic DNA in addition to total RNA from whole blood stabilized in PAXgene Blood RNA tubes. The procedure is based on automatic extraction on a BioRobot MDx and includes isolation of DNA from a fraction of the stabilized blood...... and recovery of small RNA species that are otherwise lost. The procedure presented here is suitable for large-scale experiments and is amenable to further automation. Procured total RNA and DNA was tested using Affymetrix Expression and single-nucleotide polymorphism GeneChips, respectively, and isolated micro......RNA was tested using spotted locked nucleic acid-based microarrays. We conclude that the yield and quality of total RNA, microRNA, and DNA from a single PAXgene blood RNA tube is sufficient for downstream microarray analysis....

  7. microRNA-independent recruitment of Argonaute 1 to nanos mRNA through the Smaug RNA-binding protein.

    Science.gov (United States)

    Pinder, Benjamin D; Smibert, Craig A

    2013-01-01

    Argonaute (Ago) proteins are typically recruited to target messenger RNAs via an associated small RNA such as a microRNA (miRNA). Here, we describe a new mechanism of Ago recruitment through the Drosophila Smaug RNA-binding protein. We show that Smaug interacts with the Ago1 protein, and that Ago1 interacts with and is required for the translational repression of the Smaug target, nanos mRNA. The Ago1/nanos mRNA interaction does not require a miRNA, but it does require Smaug. Taken together, our data suggest a model whereby Smaug directly recruits Ago1 to nanos mRNA in a miRNA-independent manner, thereby repressing translation.

  8. Cyclophilin B stimulates RNA synthesis by the HCV RNA dependent RNA polymerase.

    Science.gov (United States)

    Heck, Julie A; Meng, Xiao; Frick, David N

    2009-04-01

    Cyclophilins are cellular peptidyl isomerases that have been implicated in regulating hepatitis C virus (HCV) replication. Cyclophilin B (CypB) is a target of cyclosporin A (CsA), an immunosuppressive drug recently shown to suppress HCV replication in cell culture. Watashi et al. recently demonstrated that CypB is important for efficient HCV replication, and proposed that it mediates the anti-HCV effects of CsA through an interaction with NS5B [Watashi K, Ishii N, Hijikata M, Inoue D, Murata T, Miyanari Y, et al. Cyclophilin B is a functional regulator of hepatitis C virus RNA polymerase. Mol Cell 2005;19:111-22]. We examined the effects of purified CypB proteins on the enzymatic activity of NS5B. Recombinant CypB purified from insect cells directly stimulated NS5B-catalyzed RNA synthesis. CypB increased RNA synthesis by NS5B derived from genotype 1a, 1b, and 2a HCV strains. Stimulation appears to arise from an increase in productive RNA binding. NS5B residue Pro540, a previously proposed target of CypB peptidyl-prolyl isomerase activity, is not required for stimulation of RNA synthesis.

  9. Role of CBCA in RNA biogenesis

    DEFF Research Database (Denmark)

    Iasillo, Claudia

    RNA transcription and RNA processing are key steps in eukaryotic gene expression, which includes, therefore, RNA synthesis by RNA polymerase enzymes and a range of modifications of the pre-mRNA before the transcript can leave the nucleus and reach the cytoplasm for translation. Interestingly......, a large body of evidence suggests that these RNA processing events occur often already during transcription. One of these modifications, the co-transcriptional 5’ end capping of a nascent RNA, is occurring specifically during RNA polymerase II (RNAPII) transcription. The 5’ cap exerts its role via...... the nuclear Cap Binding Complex (CBC). This thesis focuses on the protein ARS2, which binds the CBC to form the CBCA complex. CBCA can further associate with different proteins playing different roles in RNA metabolism. For example, CBCA binds the Nuclear Exosome Targeting Complex (NEXT), which...

  10. Hydration dependent dynamics in RNA

    International Nuclear Information System (INIS)

    Olsen, Greg L.; Bardaro, Michael F.; Echodu, Dorothy C.; Drobny, Gary P.; Varani, Gabriele

    2009-01-01

    The essential role played by local and collective motions in RNA function has led to a growing interest in the characterization of RNA dynamics. Recent investigations have revealed that even relatively simple RNAs experience complex motions over multiple time scales covering the entire ms-ps motional range. In this work, we use deuterium solid-state NMR to systematically investigate motions in HIV-1 TAR RNA as a function of hydration. We probe dynamics at three uridine residues in different structural environments ranging from helical to completely unrestrained. We observe distinct and substantial changes in 2 H solid-state relaxation times and lineshapes at each site as hydration levels increase. By comparing solid-state and solution state 13 C relaxation measurements, we establish that ns-μs motions that may be indicative of collective dynamics suddenly arise in the RNA as hydration reaches a critical point coincident with the onset of bulk hydration. Beyond that point, we observe smaller changes in relaxation rates and lineshapes in these highly hydrated solid samples, compared to the dramatic activation of motion occurring at moderate hydration

  11. RNA Editing in Plant Mitochondria

    Science.gov (United States)

    Hiesel, Rudolf; Wissinger, Bernd; Schuster, Wolfgang; Brennicke, Axel

    1989-12-01

    Comparative sequence analysis of genomic and complementary DNA clones from several mitochondrial genes in the higher plant Oenothera revealed nucleotide sequence divergences between the genomic and the messenger RNA-derived sequences. These sequence alterations could be most easily explained by specific post-transcriptional nucleotide modifications. Most of the nucleotide exchanges in coding regions lead to altered codons in the mRNA that specify amino acids better conserved in evolution than those encoded by the genomic DNA. Several instances show that the genomic arginine codon CGG is edited in the mRNA to the tryptophan codon TGG in amino acid positions that are highly conserved as tryptophan in the homologous proteins of other species. This editing suggests that the standard genetic code is used in plant mitochondria and resolves the frequent coincidence of CGG codons and tryptophan in different plant species. The apparently frequent and non-species-specific equivalency of CGG and TGG codons in particular suggests that RNA editing is a common feature of all higher plant mitochondria.

  12. Nucleocapsid-Independent Specific Viral RNA Packaging via Viral Envelope Protein and Viral RNA Signal

    OpenAIRE

    Narayanan, Krishna; Chen, Chun-Jen; Maeda, Junko; Makino, Shinji

    2003-01-01

    For any of the enveloped RNA viruses studied to date, recognition of a specific RNA packaging signal by the virus's nucleocapsid (N) protein is the first step described in the process of viral RNA packaging. In the murine coronavirus a selective interaction between the viral transmembrane envelope protein M and the viral ribonucleoprotein complex, composed of N protein and viral RNA containing a short cis-acting RNA element, the packaging signal, determines the selective RNA packaging into vi...

  13. Modular arrangement of regulatory RNA elements.

    Science.gov (United States)

    Roßmanith, Johanna; Narberhaus, Franz

    2017-03-04

    Due to their simple architecture and control mechanism, regulatory RNA modules are attractive building blocks in synthetic biology. This is especially true for riboswitches, which are natural ligand-binding regulators of gene expression. The discovery of various tandem riboswitches inspired the design of combined RNA modules with activities not yet found in nature. Riboswitches were placed in tandem or in combination with a ribozyme or temperature-responsive RNA thermometer resulting in new functionalities. Here, we compare natural examples of tandem riboswitches with recently designed artificial RNA regulators suggesting substantial modularity of regulatory RNA elements. Challenges associated with modular RNA design are discussed.

  14. MicroRNA Delivery for Regenerative Medicine

    OpenAIRE

    Peng, Bo; Chen, Yongming; Leong, Kam W.

    2015-01-01

    MicroRNA (miRNA) directs post-transcriptional regulation of a network of genes by targeting mRNA. Although relatively recent in development, many miRNAs direct differentiation of various stem cells including induced pluripotent stem cells (iPSCs), a major player in regenerative medicine. An effective and safe delivery of miRNA holds the key to translating miRNA technologies. Both viral and nonviral delivery systems have seen success in miRNA delivery, and each approach possesses advantages an...

  15. Viral RNA polymerase scanning and the gymnastics of Sendai virus RNA synthesis

    International Nuclear Information System (INIS)

    Kolakofsky, Daniel; Le Mercier, Philippe; Iseni, Frederic; Garcin, Dominique

    2004-01-01

    mRNA synthesis from nonsegmented negative-strand RNA virus (NNV) genomes is unique in that the genome RNA is embedded in an N protein assembly (the nucleocapsid) and the viral RNA polymerase does not dissociate from the template after release of each mRNA, but rather scans the genome RNA for the next gene-start site. A revised model for NNV RNA synthesis is presented, in which RNA polymerase scanning plays a prominent role. Polymerase scanning of the template is known to occur as the viral transcriptase negotiates gene junctions without falling off the template

  16. iDoRNA: An Interacting Domain-based Tool for Designing RNA-RNA Interaction Systems

    Directory of Open Access Journals (Sweden)

    Jittrawan Thaiprasit

    2016-03-01

    Full Text Available RNA-RNA interactions play a crucial role in gene regulation in living organisms. They have gained increasing interest in the field of synthetic biology because of their potential applications in medicine and biotechnology. However, few novel regulators based on RNA-RNA interactions with desired structures and functions have been developed due to the challenges of developing design tools. Recently, we proposed a novel tool, called iDoDe, for designing RNA-RNA interacting sequences by first decomposing RNA structures into interacting domains and then designing each domain using a stochastic algorithm. However, iDoDe did not provide an optimal solution because it still lacks a mechanism to optimize the design. In this work, we have further developed the tool by incorporating a genetic algorithm (GA to find an RNA solution with maximized structural similarity and minimized hybridized RNA energy, and renamed the tool iDoRNA. A set of suitable parameters for the genetic algorithm were determined and found to be a weighting factor of 0.7, a crossover rate of 0.9, a mutation rate of 0.1, and the number of individuals per population set to 8. We demonstrated the performance of iDoRNA in comparison with iDoDe by using six RNA-RNA interaction models. It was found that iDoRNA could efficiently generate all models of interacting RNAs with far more accuracy and required far less computational time than iDoDe. Moreover, we compared the design performance of our tool against existing design tools using forty-four RNA-RNA interaction models. The results showed that the performance of iDoRNA is better than RiboMaker when considering the ensemble defect, the fitness score and computation time usage. However, it appears that iDoRNA is outperformed by NUPACK and RNAiFold 2.0 when considering the ensemble defect. Nevertheless, iDoRNA can still be an useful alternative tool for designing novel RNA-RNA interactions in synthetic biology research. The source code of iDoRNA

  17. Comprehensive characterization of lncRNA-mRNA related ceRNA network across 12 major cancers

    Science.gov (United States)

    Feng, Li; Li, Feng; Sun, Zeguo; Wu, Tan; Shi, Xinrui; Li, Jing; Li, Xia

    2016-01-01

    Recent studies indicate that long noncoding RNAs (lncRNAs) can act as competing endogenous RNAs (ceRNAs) to indirectly regulate mRNAs through shared microRNAs, which represents a novel layer of RNA crosstalk and plays critical roles in the development of tumor. However, the global regulation landscape and characterization of these lncRNA related ceRNA crosstalk in cancers is still largely unknown. Here, we systematically characterized the lncRNA related ceRNA interactions across 12 major cancers and the normal physiological states by integrating multidimensional molecule profiles of more than 5000 samples. Our study suggest the large difference of ceRNA regulation between normal and tumor states and the higher similarity across similar tissue origin of tumors. The ceRNA related molecules have more conserved features in tumor networks and they play critical roles in both the normal and tumorigenesis processes. Besides, lncRNAs in the pan-cancer ceRNA network may be potential biomarkers of tumor. By exploring hub lncRNAs, we found that these conserved key lncRNAs dominate variable tumor hallmark processes across pan-cancers. Network dynamic analysis highlights the critical roles of ceRNA regulation in tumorigenesis. By analyzing conserved ceRNA interactions, we found that miRNA mediate ceRNA regulation showed different patterns across pan-cancer; while analyzing the cancer specific ceRNA interactions reveal that lncRNAs synergistically regulated tumor driver genes of cancer hallmarks. Finally, we found that ceRNA modules have the potential to predict patient survival. Overall, our study systematically dissected the lncRNA related ceRNA networks in pan-cancer that shed new light on understanding the molecular mechanism of tumorigenesis. PMID:27580177

  18. Inhibition of the Mitochondrial Glutamate Carrier SLC25A22 in Astrocytes Leads to Intracellular Glutamate Accumulation

    Directory of Open Access Journals (Sweden)

    Emmanuelle Goubert

    2017-05-01

    Full Text Available The solute carrier family 25 (SLC25 drives the import of a large diversity of metabolites into mitochondria, a key cellular structure involved in many metabolic functions. Mutations of the mitochondrial glutamate carrier SLC25A22 (also named GC1 have been identified in early epileptic encephalopathy (EEE and migrating partial seizures in infancy (MPSI but the pathophysiological mechanism of GC1 deficiency is still unknown, hampered by the absence of an in vivo model. This carrier is mainly expressed in astrocytes and is the principal gate for glutamate entry into mitochondria. A sufficient supply of energy is essential for the proper function of the brain and mitochondria have a pivotal role in maintaining energy homeostasis. In this work, we wanted to study the consequences of GC1 absence in an in vitro model in order to understand if glutamate catabolism and/or mitochondrial function could be affected. First, short hairpin RNA (shRNA designed to specifically silence GC1 were validated in rat C6 glioma cells. Silencing GC1 in C6 resulted in a reduction of the GC1 mRNA combined with a decrease of the mitochondrial glutamate carrier activity. Then, primary astrocyte cultures were prepared and transfected with shRNA-GC1 or mismatch-RNA (mmRNA constructs using the Neon® Transfection System in order to target a high number of primary astrocytes, more than 64%. Silencing GC1 in primary astrocytes resulted in a reduced nicotinamide adenine dinucleotide (Phosphate (NAD(PH formation upon glutamate stimulation. We also observed that the mitochondrial respiratory chain (MRC was functional after glucose stimulation but not activated by glutamate, resulting in a lower level of cellular adenosine triphosphate (ATP in silenced astrocytes compared to control cells. Moreover, GC1 inactivation resulted in an intracellular glutamate accumulation. Our results show that mitochondrial glutamate transport via GC1 is important in sustaining glutamate homeostasis in

  19. Application of Live-Cell RNA Imaging Techniques to the Study of Retroviral RNA Trafficking

    Directory of Open Access Journals (Sweden)

    Darrin V. Bann

    2012-06-01

    Full Text Available Retroviruses produce full-length RNA that serves both as a genomic RNA (gRNA, which is encapsidated into virus particles, and as an mRNA, which directs the synthesis of viral structural proteins. However, we are only beginning to understand the cellular and viral factors that influence trafficking of retroviral RNA and the selection of the RNA for encapsidation or translation. Live cell imaging studies of retroviral RNA trafficking have provided important insight into many aspects of the retrovirus life cycle including transcription dynamics, nuclear export of viral RNA, translational regulation, membrane targeting, and condensation of the gRNA during virion assembly. Here, we review cutting-edge techniques to visualize single RNA molecules in live cells and discuss the application of these systems to studying retroviral RNA trafficking.

  20. How the RNA isolation method can affect microRNA microarray results

    DEFF Research Database (Denmark)

    Podolska, Agnieszka; Kaczkowski, Bogumil; Litman, Thomas

    2011-01-01

    RNA microarray analysis on porcine brain tissue. One method is a phenol-guanidine isothiocyanate-based procedure that permits isolation of total RNA. The second method, miRVana™ microRNA isolation, is column based and recovers the small RNA fraction alone. We found that microarray analyses give different results...... that depend on the RNA fraction used, in particular because some microRNAs appear very sensitive to the RNA isolation method. We conclude that precautions need to be taken when comparing microarray studies based on RNA isolated with different methods.......The quality of RNA is crucial in gene expression experiments. RNA degradation interferes in the measurement of gene expression, and in this context, microRNA quantification can lead to an incorrect estimation. In the present study, two different RNA isolation methods were used to perform micro...

  1. Topology and prediction of RNA pseudoknots

    DEFF Research Database (Denmark)

    Reidys, Christian; Huang, Fenix; Andersen, Jørgen Ellegaard

    2011-01-01

    Motivation: Several dynamic programming algorithms for predicting RNA structures with pseudoknots have been proposed that differ dramatically from one another in the classes of structures considered. Results: Here, we use the natural topological classification of RNA structures in terms...

  2. RNA Structural Alignments, Part I

    DEFF Research Database (Denmark)

    Havgaard, Jakob Hull; Gorodkin, Jan

    2014-01-01

    Simultaneous alignment and secondary structure prediction of RNA sequences is often referred to as "RNA structural alignment." A class of the methods for structural alignment is based on the principles proposed by Sankoff more than 25 years ago. The Sankoff algorithm simultaneously folds and aligns...... is so high that it took more than a decade before the first implementation of a Sankoff style algorithm was published. However, with the faster computers available today and the improved heuristics used in the implementations the Sankoff-based methods have become practical. This chapter describes...... the methods based on the Sankoff algorithm. All the practical implementations of the algorithm use heuristics to make them run in reasonable time and memory. These heuristics are also described in this chapter....

  3. Fatgraph models of RNA structure

    Directory of Open Access Journals (Sweden)

    Huang Fenix

    2017-01-01

    Full Text Available In this review paper we discuss fatgraphs as a conceptual framework for RNA structures. We discuss various notions of coarse-grained RNA structures and relate them to fatgraphs.We motivate and discuss the main intuition behind the fatgraph model and showcase its applicability to canonical as well as noncanonical base pairs. Recent discoveries regarding novel recursions of pseudoknotted (pk configurations as well as their translation into context-free grammars for pk-structures are discussed. This is shown to allow for extending the concept of partition functions of sequences w.r.t. a fixed structure having non-crossing arcs to pk-structures. We discuss minimum free energy folding of pk-structures and combine these above results outlining how to obtain an inverse folding algorithm for PK structures.

  4. RNA

    African Journals Online (AJOL)

    SARAH

    30 nov. 2013 ... Keywords: FMNR, mode of management, re-greening, leadership, evolutionary trend. INTRODUCTION .... régénération : L'évolution de la densité des ligneux entre. 2005 et 2012 ..... la production et la qualité fourragères de la.

  5. Nonradioactive RNA mobility shift with chemiluminescent detection ...

    African Journals Online (AJOL)

    hesham

    RNA mobility shift is one among many procedures used to study RNA-protein interaction. Yet, there are some limitations for the radioactive RNA mobility shift including; 1) the risk of using radiolabeled nucleotides, 2) the long time to get the results; this could range from days to weeks, and 3) its high cost as compared to ...

  6. Optimization of chemiluminescent detection of mitochondrial RNA ...

    African Journals Online (AJOL)

    RNA mobility shift is one among many procedures used to study RNA-protein interaction. Yet, there are some limitations for the radioactive RNA mobility shift including; 1) the risk of using radiolabeled nucleotides, 2) the long time to get the results; this could range from days to weeks, and 3) its high cost as compared to ...

  7. RNA polymerase activity of Ustilago maydis virus

    Energy Technology Data Exchange (ETDEWEB)

    Yie, S.W.

    1986-01-01

    Ustilago maydis virus has an RNA polymerase enzyme which is associated with virion capsids. In the presence of Mg/sup 2 +/ ion and ribonucleotide triphosphate, the enzyme catalyzes the in vitro synthesis of mRNA by using dsRNA as a template. The products of the UmV RNA polymerase were both ssRNA and dsRNA. The dsRNA was determined by characteristic mobilities in gel electrophoresis, lack of sensitivity to RNase, and specific hybridization tests. The ssRNAs were identified by elution from a CF-11 column and by their RNase sensitivity. On the basis of the size of ssRNAs, it was concluded that partial transcripts were produced from H dsRNA segments, and full length transcripts were produced from M and L dsRNA segments. The following observations indicates that transcription occurs by strand displacement; (1) Only the positive strand of M2 dsRNA was labeled by the in vitro reaction. (2) The M2 dsRNA which had been labeled with /sup 32/''P-UTP in vitro could be chased from dsRNA with unlabeled UTP. The transcription products of three UmV strains were compared, and the overall pattern of transcription was very similar among them.

  8. Analysis of RNA metabolism in fission yeast

    DEFF Research Database (Denmark)

    Wise, Jo Ann; Nielsen, Olaf

    2017-01-01

    Here we focus on the biogenesis and function of messenger RNA (mRNA) in fission yeast cells. Following a general introduction that also briefly touches on other classes of RNA, we provide an overview of methods used to analyze mRNAs throughout their life cycles....

  9. Tospovirus : induction and suppression of RNA silencing

    NARCIS (Netherlands)

    Hedil, Marcio

    2016-01-01

    While infecting their hosts, viruses must deal with host immunity. In plants the antiviral RNA silencing pathway is an important part of plant innate immunity. Tospoviruses are segmented negative-stranded RNA viruses of plants. To counteract the antiviral RNA silencing response in plants,

  10. A Specific Hepatic Transfer RNA for Phosphoserine*

    Science.gov (United States)

    Mäenpää, Pekka H.; Bernfield, Merton R.

    1970-01-01

    Radioactive O-phosphoryl-L-serine was detected after alkaline deacylation of rat and rooster liver [3H]seryl-tRNA acylated in vitro with homologous synthetases. Ribonuclease treatment of this tRNA yielded a compound with the properties of phosphoseryl-adenosine. Benzoylated DEAE-cellulose chromatography of seryl-tRNA yielded four distinct peaks, only one of which contained phosphoserine. A unique fraction for phosphoserine was also found on chromatography of nonacylated tRNA. In ribosome binding studies, this fraction responded very slightly with poly(U,C), but not with any of the known serine trinucleotide codons. Substantial incorporation of [3H]-serine into protein from this tRNA species was observed in an aminoacyl-tRNA dependent polysomal system derived from chick oviducts. No phosphoserine was found in Escherichia coli or yeast seryl-tRNA acylated with homologous enzymes, nor in E. coli seryl-tRNA acylated with liver synthetase. In the absence of tRNA, free phosphoserine was not formed in reaction mixtures, which suggests that phosphoseryl-tRNA arises by phosphorylation of the unique seryl-tRNA species. These results demonstrate a discrete tRNASer species in rat and rooster liver containing phosphoserine and suggest that this tRNA is involved in ribosomal polypeptide synthesis. PMID:4943179

  11. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    Directory of Open Access Journals (Sweden)

    Gayani N. P. Dedduwa-Mudalige

    2015-09-01

    Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

  12. Small catalytic RNA: Structure, function and application

    Energy Technology Data Exchange (ETDEWEB)

    Monforte, Joseph Albert [Univ. of California, Berkeley, CA (United States)

    1991-04-01

    We have utilized a combination of photochemical cross-linking techniques and site-directed mutagenesis to obtain secondary and tertiary structure information for the self-cleaving, self-ligating subsequence of RNA from the negative strand of Satellite Tobacco Ringspot Virus. We have found that the helical regions fold about a hinge to promoting four different possible tertiary interactions, creating a molecular of similar shape to a paperclip. A model suggesting that the ``paperclip`` and ``hammerhead`` RNAs share a similar three dimensional structure is proposed. We have used a self-cleaving RNA molecule related to a subsequence of plant viroids, a ``hammerhead,`` to study the length-dependent folding of RNA produced during transcription by RNA polymerase. We have used this method to determine the length of RNA sequestered within elongating E. coli and T7 RNA polymerase complexes. The data show that for E. coli RNA polymerase 121±s are sequestered within the ternary complex, which is consistent with the presence of an RNA-DNA hybrid within the transcription bubble, as proposed by others. The result for T7 RNA polymerase differs from E. coli RNA polymerase, with only 10{plus_minus}1 nucleotides sequestered within the ternary complex, setting a new upper limit for the minimum RNA-DNA required for a stable elongating complex. Comparisons between E. coli and T7 RNA polymerase are made. The relevance of the results to models or transcription termination, abortive initiation, and initiation to elongation mode transitions are discussed.

  13. Supplementary data: Materials and methods RNA expression ...

    Indian Academy of Sciences (India)

    ritt8

    Supplementary data: Materials and methods. RNA expression analysis. Freshly collected tissue was taken in TRIzol reagent for total RNA isolation according to the manufacturer's protocol. The cDNA synthesis was carried out in 1 μg total RNA using Random hexamer (Invitrogen, Carlsbad, USA) and Superscript III ...

  14. Regulatory RNAs derived from transfer RNA?

    Science.gov (United States)

    Pederson, Thoru

    2010-10-01

    Four recent studies suggest that cleavages of transfer RNAs generate products with microRNA-like features, with some evidence of function. If their regulatory functions were to be confirmed, these newly revealed RNAs would add to the expanding repertoire of small noncoding RNAs and would also provide new perspectives on the coevolution of transfer RNA and messenger RNA.

  15. Regulatory BC1 RNA in Cognitive Control

    Science.gov (United States)

    Iacoangeli, Anna; Dosunmu, Aderemi; Eom, Taesun; Stefanov, Dimitre G.; Tiedge, Henri

    2017-01-01

    Dendritic regulatory BC1 RNA is a non-protein-coding (npc) RNA that operates in the translational control of gene expression. The absence of BC1 RNA in BC1 knockout (KO) animals causes translational dysregulation that entails neuronal phenotypic alterations including prolonged epileptiform discharges, audiogenic seizure activity in vivo, and…

  16. Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

    DEFF Research Database (Denmark)

    Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine

    2015-01-01

    ) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...

  17. Effective Anti-miRNA Oligonucleotides Show High Releasing Rate of MicroRNA from RNA-Induced Silencing Complex.

    Science.gov (United States)

    Ariyoshi, Jumpei; Matsuyama, Yohei; Kobori, Akio; Murakami, Akira; Sugiyama, Hiroshi; Yamayoshi, Asako

    2017-10-01

    MicroRNAs (miRNAs) regulate gene expression by forming RNA-induced silencing complexes (RISCs) and have been considered as promising therapeutic targets. MiRNA is an essential component of RISC for the modulation of gene expression. Therefore, the release of miRNA from RISC is considered as an effective method for the inhibition of miRNA functions. In our previous study, we reported that anti-miRNA oligonucleotides (AMOs), which are composed of the 2'-O-methyl (2'-OMe) RNA, could induce the release of miRNA from RISC. However, the mechanisms underlying the miRNA-releasing effects of chemically modified AMOs, which are conventionally used as anti-cancer drugs, are still unclear. In this study, we investigated the relationship between the miRNA releasing rate from RISC and the inhibitory effect on RISC activity (IC 50 ) using conventional chemically modified AMOs. We demonstrated that the miRNA-releasing effects of AMOs are directly proportional to the IC 50 values, and AMOs, which have an ability to promote the release of miRNA from RISC, can effectively inhibit RISC activity in living cells.

  18. Diverging affinity of tospovirus RNA silencing suppressor proteins, NSs, for various RNA duplex molecules.

    Science.gov (United States)

    Schnettler, Esther; Hemmes, Hans; Huismann, Rik; Goldbach, Rob; Prins, Marcel; Kormelink, Richard

    2010-11-01

    The tospovirus NSs protein was previously shown to suppress the antiviral RNA silencing mechanism in plants. Here the biochemical analysis of NSs proteins from different tospoviruses, using purified NSs or NSs containing cell extracts, is described. The results showed that all tospoviral NSs proteins analyzed exhibited affinity to small double-stranded RNA molecules, i.e., small interfering RNAs (siRNAs) and micro-RNA (miRNA)/miRNA* duplexes. Interestingly, the NSs proteins from tomato spotted wilt virus (TSWV), impatiens necrotic spot virus (INSV), and groundnut ringspot virus (GRSV) also showed affinity to long double-stranded RNA (dsRNA), whereas tomato yellow ring virus (TYRV) NSs did not. The TSWV NSs protein was shown to be capable of inhibiting Dicer-mediated cleavage of long dsRNA in vitro. In addition, it suppressed the accumulation of green fluorescent protein (GFP)-specific siRNAs during coinfiltration with an inverted-repeat-GFP RNA construct in Nicotiana benthamiana. In vivo interference of TSWV NSs in the miRNA pathway was shown by suppression of an enhanced GFP (eGFP) miRNA sensor construct. The ability to stabilize miRNA/miRNA* by different tospovirus NSs proteins in vivo was demonstrated by increased accumulation and detection of both miRNA171c and miRNA171c* in tospovirus-infected N. benthamiana. All together, these data suggest that tospoviruses interfere in the RNA silencing pathway by sequestering siRNA and miRNA/miRNA* molecules before they are uploaded into their respective RNA-induced silencing complexes. The observed affinity to long dsRNA for only a subset of the tospoviruses studied is discussed in light of evolutional divergence and their ancestral relation to the animal-infecting members of the Bunyaviridae.

  19. Targeted CRISPR disruption reveals a role for RNase MRP RNA in human preribosomal RNA processing.

    Science.gov (United States)

    Goldfarb, Katherine C; Cech, Thomas R

    2017-01-01

    MRP RNA is an abundant, essential noncoding RNA whose functions have been proposed in yeast but are incompletely understood in humans. Mutations in the genomic locus for MRP RNA cause pleiotropic human diseases, including cartilage hair hypoplasia (CHH). Here we applied CRISPR-Cas9 genome editing to disrupt the endogenous human MRP RNA locus, thereby attaining what has eluded RNAi and RNase H experiments: elimination of MRP RNA in the majority of cells. The resulting accumulation of ribosomal RNA (rRNA) precursor-analyzed by RNA fluorescent in situ hybridization (FISH), Northern blots, and RNA sequencing-implicates MRP RNA in pre-rRNA processing. Amelioration of pre-rRNA imbalance is achieved through rescue of MRP RNA levels by ectopic expression. Furthermore, affinity-purified MRP ribonucleoprotein (RNP) from HeLa cells cleaves the human pre-rRNA in vitro at at least one site used in cells, while RNP isolated from cells with CRISPR-edited MRP loci loses this activity, and ectopic MRP RNA expression restores cleavage activity. Thus, a role for RNase MRP in human pre-rRNA processing is established. As demonstrated here, targeted CRISPR disruption is a valuable tool for functional studies of essential noncoding RNAs that are resistant to RNAi and RNase H-based degradation. © 2017 Goldfarb and Cech; Published by Cold Spring Harbor Laboratory Press.

  20. The early history of tRNA recognition by aminoacyl-tRNA synthetases

    Indian Academy of Sciences (India)

    Madhu

    2006-10-04

    Oct 4, 2006 ... Discovery of aminoacyl-tRNA synthetases and importance ... The pioneering work of Fritz Lipmann on the high-energy ... the peculiar structural and functional relationships tRNAs ... a bulk of only 20 families of tRNA molecules in contrast ...... balance of tRNA and aminoacyl-tRNA synthetase; Science 242.

  1. CCR5 Gene Disruption via Lentiviral Vectors Expressing Cas9 and Single Guided RNA Renders Cells Resistant to HIV-1 Infection

    Science.gov (United States)

    Liu, Jingjing; Zhang, Di; Kimata, Jason T.; Zhou, Paul

    2014-01-01

    CCR5, a coreceptor for HIV-1 entry, is a major target for drug and genetic intervention against HIV-1. Genetic intervention strategies have knocked down CCR5 expression levels by shRNA or disrupted the CCR5 gene using zinc finger nucleases (ZFN) or Transcription activator-like effector nuclease (TALEN). In the present study, we silenced CCR5 via CRISPR associated protein 9 (Cas9) and single guided RNAs (sgRNAs). We constructed lentiviral vectors expressing Cas9 and CCR5 sgRNAs. We show that a single round transduction of lentiviral vectors expressing Cas9 and CCR5 sgRNAs into HIV-1 susceptible human CD4+ cells yields high frequencies of CCR5 gene disruption. CCR5 gene-disrupted cells are not only resistant to R5-tropic HIV-1, including transmitted/founder (T/F) HIV-1 isolates, but also have selective advantage over CCR5 gene-undisrupted cells during R5-tropic HIV-1 infection. Importantly, using T7 endonuclease I assay we did not detect genome mutations at potential off-target sites that are highly homologous to these CCR5 sgRNAs in stably transduced cells even at 84 days post transduction. Thus we conclude that silencing of CCR5 via Cas9 and CCR5-specific sgRNAs could be a viable alternative strategy for engineering resistance against HIV-1. PMID:25541967

  2. Cooperation of an RNA Packaging Signal and a Viral Envelope Protein in Coronavirus RNA Packaging

    OpenAIRE

    Narayanan, Krishna; Makino, Shinji

    2001-01-01

    Murine coronavirus mouse hepatitis virus (MHV) produces a genome-length mRNA, mRNA 1, and six or seven species of subgenomic mRNAs in infected cells. Among these mRNAs, only mRNA 1 is efficiently packaged into MHV particles. MHV N protein binds to all MHV mRNAs, whereas envelope M protein interacts only with mRNA 1. This M protein-mRNA 1 interaction most probably determines the selective packaging of mRNA 1 into MHV particles. A short cis-acting MHV RNA packaging signal is necessary and suffi...

  3. Sequence analysis of RNase MRP RNA reveals its origination from eukaryotic RNase P RNA

    Science.gov (United States)

    Zhu, Yanglong; Stribinskis, Vilius; Ramos, Kenneth S.; Li, Yong

    2006-01-01

    RNase MRP is a eukaryote-specific endoribonuclease that generates RNA primers for mitochondrial DNA replication and processes precursor rRNA. RNase P is a ubiquitous endoribonuclease that cleaves precursor tRNA transcripts to produce their mature 5′ termini. We found extensive sequence homology of catalytic domains and specificity domains between their RNA subunits in many organisms. In Candida glabrata, the internal loop of helix P3 is 100% conserved between MRP and P RNAs. The helix P8 of MRP RNA from microsporidia Encephalitozoon cuniculi is identical to that of P RNA. Sequence homology can be widely spread over the whole molecule of MRP RNA and P RNA, such as those from Dictyostelium discoideum. These conserved nucleotides between the MRP and P RNAs strongly support the hypothesis that the MRP RNA is derived from the P RNA molecule in early eukaryote evolution. PMID:16540690

  4. Using RNA Interference to Study Protein Function

    OpenAIRE

    Curtis, Carol D.; Nardulli, Ann M.

    2009-01-01

    RNA interference can be extremely useful in determining the function of an endogenously-expressed protein in its normal cellular environment. In this chapter, we describe a method that uses small interfering RNA (siRNA) to knock down mRNA and protein expression in cultured cells so that the effect of a putative regulatory protein on gene expression can be delineated. Methods of assessing the effectiveness of the siRNA procedure using real time quantitative PCR and Western analysis are also in...

  5. Analysis of extracellular RNA by digital PCR

    Directory of Open Access Journals (Sweden)

    Kenji eTakahashi

    2014-06-01

    Full Text Available The transfer of extracellular RNA is emerging as an important mechanism for intracellular communication. The ability for the transfer of functionally active RNA molecules from one cell to another within vesicles such as exosomes enables a cell to modulate cellular signaling and biological processes within recipient cells. The study of extracellular RNA requires sensitive methods for the detection of these molecules. In this methods article, we will describe protocols for the detection of such extracellular RNA using sensitive detection technologies such as digital PCR. These protocols should be valuable to researchers interested in the role and contribution of extracellular RNA to tumor cell biology.

  6. Functional genomics identifies specific vulnerabilities in PTEN-deficient breast cancer.

    Science.gov (United States)

    Tang, Yew Chung; Ho, Szu-Chi; Tan, Elisabeth; Ng, Alvin Wei Tian; McPherson, John R; Goh, Germaine Yen Lin; Teh, Bin Tean; Bard, Frederic; Rozen, Steven G

    2018-03-22

    Phosphatase and tensin homolog (PTEN) is one of the most frequently inactivated tumor suppressors in breast cancer. While PTEN itself is not considered a druggable target, PTEN synthetic-sick or synthetic-lethal (PTEN-SSL) genes are potential drug targets in PTEN-deficient breast cancers. Therefore, with the aim of identifying potential targets for precision breast cancer therapy, we sought to discover PTEN-SSL genes present in a broad spectrum of breast cancers. To discover broad-spectrum PTEN-SSL genes in breast cancer, we used a multi-step approach that started with (1) a genome-wide short interfering RNA (siRNA) screen of ~ 21,000 genes in a pair of isogenic human mammary epithelial cell lines, followed by (2) a short hairpin RNA (shRNA) screen of ~ 1200 genes focused on hits from the first screen in a panel of 11 breast cancer cell lines; we then determined reproducibility of hits by (3) identification of overlaps between our results and reanalyzed data from 3 independent gene-essentiality screens, and finally, for selected candidate PTEN-SSL genes we (4) confirmed PTEN-SSL activity using either drug sensitivity experiments in a panel of 19 cell lines or mutual exclusivity analysis of publicly available pan-cancer somatic mutation data. The screens (steps 1 and 2) and the reproducibility analysis (step 3) identified six candidate broad-spectrum PTEN-SSL genes (PIK3CB, ADAMTS20, AP1M2, HMMR, STK11, and NUAK1). PIK3CB was previously identified as PTEN-SSL, while the other five genes represent novel PTEN-SSL candidates. Confirmation studies (step 4) provided additional evidence that NUAK1 and STK11 have PTEN-SSL patterns of activity. Consistent with PTEN-SSL status, inhibition of the NUAK1 protein kinase by the small molecule drug HTH-01-015 selectively impaired viability in multiple PTEN-deficient breast cancer cell lines, while mutations affecting STK11 and PTEN were largely mutually exclusive across large pan-cancer data sets. Six genes showed PTEN

  7. Characteristics and Prediction of RNA Structure

    Directory of Open Access Journals (Sweden)

    Hengwu Li

    2014-01-01

    Full Text Available RNA secondary structures with pseudoknots are often predicted by minimizing free energy, which is NP-hard. Most RNAs fold during transcription from DNA into RNA through a hierarchical pathway wherein secondary structures form prior to tertiary structures. Real RNA secondary structures often have local instead of global optimization because of kinetic reasons. The performance of RNA structure prediction may be improved by considering dynamic and hierarchical folding mechanisms. This study is a novel report on RNA folding that accords with the golden mean characteristic based on the statistical analysis of the real RNA secondary structures of all 480 sequences from RNA STRAND, which are validated by NMR or X-ray. The length ratios of domains in these sequences are approximately 0.382L, 0.5L, 0.618L, and L, where L is the sequence length. These points are just the important golden sections of sequence. With this characteristic, an algorithm is designed to predict RNA hierarchical structures and simulate RNA folding by dynamically folding RNA structures according to the above golden section points. The sensitivity and number of predicted pseudoknots of our algorithm are better than those of the Mfold, HotKnots, McQfold, ProbKnot, and Lhw-Zhu algorithms. Experimental results reflect the folding rules of RNA from a new angle that is close to natural folding.

  8. siRNA and innate immunity.

    Science.gov (United States)

    Robbins, Marjorie; Judge, Adam; MacLachlan, Ian

    2009-06-01

    Canonical small interfering RNA (siRNA) duplexes are potent activators of the mammalian innate immune system. The induction of innate immunity by siRNA is dependent on siRNA structure and sequence, method of delivery, and cell type. Synthetic siRNA in delivery vehicles that facilitate cellular uptake can induce high levels of inflammatory cytokines and interferons after systemic administration in mammals and in primary human blood cell cultures. This activation is predominantly mediated by immune cells, normally via a Toll-like receptor (TLR) pathway. The siRNA sequence dependency of these pathways varies with the type and location of the TLR involved. Alternatively nonimmune cell activation may also occur, typically resulting from siRNA interaction with cytoplasmic RNA sensors such as RIG1. As immune activation by siRNA-based drugs represents an undesirable side effect due to the considerable toxicities associated with excessive cytokine release in humans, understanding and abrogating this activity will be a critical component in the development of safe and effective therapeutics. This review describes the intracellular mechanisms of innate immune activation by siRNA, the design of appropriate sequences and chemical modification approaches, and suitable experimental methods for studying their effects, with a view toward reducing siRNA-mediated off-target effects.

  9. TruSeq Stranded mRNA and Total RNA Sample Preparation Kits

    Science.gov (United States)

    Total RNA-Seq enabled by ribosomal RNA (rRNA) reduction is compatible with formalin-fixed paraffin embedded (FFPE) samples, which contain potentially critical biological information. The family of TruSeq Stranded Total RNA sample preparation kits provides a unique combination of unmatched data quality for both mRNA and whole-transcriptome analyses, robust interrogation of both standard and low-quality samples and workflows compatible with a wide range of study designs.

  10. MysiRNA-designer: a workflow for efficient siRNA design.

    Directory of Open Access Journals (Sweden)

    Mohamed Mysara

    Full Text Available The design of small interfering RNA (siRNA is a multi factorial problem that has gained the attention of many researchers in the area of therapeutic and functional genomics. MysiRNA score was previously introduced that improves the correlation of siRNA activity prediction considering state of the art algorithms. In this paper, a new program, MysiRNA-Designer, is described which integrates several factors in an automated work-flow considering mRNA transcripts variations, siRNA and mRNA target accessibility, and both near-perfect and partial off-target matches. It also features the MysiRNA score, a highly ranked correlated siRNA efficacy prediction score for ranking the designed siRNAs, in addition to top scoring models Biopredsi, DISR, Thermocomposition21 and i-Score, and integrates them in a unique siRNA score-filtration technique. This multi-score filtration layer filters siRNA that passes the 90% thresholds calculated from experimental dataset features. MysiRNA-Designer takes an accession, finds conserved regions among its transcript space, finds accessible regions within the mRNA, designs all possible siRNAs for these regions, filters them based on multi-scores thresholds, and then performs SNP and off-target filtration. These strict selection criteria were tested against human genes in which at least one active siRNA was designed from 95.7% of total genes. In addition, when tested against an experimental dataset, MysiRNA-Designer was found capable of rejecting 98% of the false positive siRNAs, showing superiority over three state of the art siRNA design programs. MysiRNA is a freely accessible (Microsoft Windows based desktop application that can be used to design siRNA with a high accuracy and specificity. We believe that MysiRNA-Designer has the potential to play an important role in this area.

  11. 5S rRNA and ribosome.

    Science.gov (United States)

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  12. Kin Selection in the RNA World.

    Science.gov (United States)

    Levin, Samuel R; West, Stuart A

    2017-12-05

    Various steps in the RNA world required cooperation. Why did life's first inhabitants, from polymerases to synthetases, cooperate? We develop kin selection models of the RNA world to answer these questions. We develop a very simple model of RNA cooperation and then elaborate it to model three relevant issues in RNA biology: (1) whether cooperative RNAs receive the benefits of cooperation; (2) the scale of competition in RNA populations; and (3) explicit replicator diffusion and survival. We show: (1) that RNAs are likely to express partial cooperation; (2) that RNAs will need mechanisms for overcoming local competition; and (3) in a specific example of RNA cooperation, persistence after replication and offspring diffusion allow for cooperation to overcome competition. More generally, we show how kin selection can unify previously disparate answers to the question of RNA world cooperation.

  13. MicroRNA and cancer

    DEFF Research Database (Denmark)

    Jansson, Martin D; Lund, Anders H

    2012-01-01

    biological phenomena and pathologies. The best characterized non-coding RNA family consists in humans of about 1400 microRNAs for which abundant evidence have demonstrated fundamental importance in normal development, differentiation, growth control and in human diseases such as cancer. In this review, we...... summarize the current knowledge and concepts concerning the involvement of microRNAs in cancer, which have emerged from the study of cell culture and animal model systems, including the regulation of key cancer-related pathways, such as cell cycle control and the DNA damage response. Importantly, micro...

  14. RNA2DMut: a web tool for the design and analysis of RNA structure mutations.

    Science.gov (United States)

    Moss, Walter N

    2018-03-01

    With the widespread application of high-throughput sequencing, novel RNA sequences are being discovered at an astonishing rate. The analysis of function, however, lags behind. In both the cis - and trans -regulatory functions of RNA, secondary structure (2D base-pairing) plays essential regulatory roles. In order to test RNA function, it is essential to be able to design and analyze mutations that can affect structure. This was the motivation for the creation of the RNA2DMut web tool. With RNA2DMut, users can enter in RNA sequences to analyze, constrain mutations to specific residues, or limit changes to purines/pyrimidines. The sequence is analyzed at each base to determine the effect of every possible point mutation on 2D structure. The metrics used in RNA2DMut rely on the calculation of the Boltzmann structure ensemble and do not require a robust 2D model of RNA structure for designing mutations. This tool can facilitate a wide array of uses involving RNA: for example, in designing and evaluating mutants for biological assays, interrogating RNA-protein interactions, identifying key regions to alter in SELEX experiments, and improving RNA folding and crystallization properties for structural biology. Additional tools are available to help users introduce other mutations (e.g., indels and substitutions) and evaluate their effects on RNA structure. Example calculations are shown for five RNAs that require 2D structure for their function: the MALAT1 mascRNA, an influenza virus splicing regulatory motif, the EBER2 viral noncoding RNA, the Xist lncRNA repA region, and human Y RNA 5. RNA2DMut can be accessed at https://rna2dmut.bb.iastate.edu/. © 2018 Moss; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  15. RNA versatility, flexibility, and thermostability for practice in RNA nanotechnology and biomedical applications.

    Science.gov (United States)

    Haque, Farzin; Pi, Fengmei; Zhao, Zhengyi; Gu, Shanqing; Hu, Haibo; Yu, Hang; Guo, Peixuan

    2018-01-01

    In recent years, RNA has attracted widespread attention as a unique biomaterial with distinct biophysical properties for designing sophisticated architectures in the nanometer scale. RNA is much more versatile in structure and function with higher thermodynamic stability compared to its nucleic acid counterpart DNA. Larger RNA molecules can be viewed as a modular structure built from a combination of many 'Lego' building blocks connected via different linker sequences. By exploiting the diversity of RNA motifs and flexibility of structure, varieties of RNA architectures can be fabricated with precise control of shape, size, and stoichiometry. Many structural motifs have been discovered and characterized over the years and the crystal structures of many of these motifs are available for nanoparticle construction. For example, using the flexibility and versatility of RNA structure, RNA triangles, squares, pentagons, and hexagons can be constructed from phi29 pRNA three-way-junction (3WJ) building block. This review will focus on 2D RNA triangles, squares, and hexamers; 3D and 4D structures built from basic RNA building blocks; and their prospective applications in vivo as imaging or therapeutic agents via specific delivery and targeting. Methods for intracellular cloning and expression of RNA molecules and the in vivo assembly of RNA nanoparticles will also be reviewed. WIREs RNA 2018, 9:e1452. doi: 10.1002/wrna.1452 This article is categorized under: RNA Methods > RNA Nanotechnology RNA Structure and Dynamics > RNA Structure, Dynamics and Chemistry RNA in Disease and Development > RNA in Disease Regulatory RNAs/RNAi/Riboswitches > Regulatory RNAs. © 2017 Wiley Periodicals, Inc.

  16. Evaluation of microRNA alignment techniques

    Science.gov (United States)

    Kaspi, Antony; El-Osta, Assam

    2016-01-01

    Genomic alignment of small RNA (smRNA) sequences such as microRNAs poses considerable challenges due to their short length (∼21 nucleotides [nt]) as well as the large size and complexity of plant and animal genomes. While several tools have been developed for high-throughput mapping of longer mRNA-seq reads (>30 nt), there are few that are specifically designed for mapping of smRNA reads including microRNAs. The accuracy of these mappers has not been systematically determined in the case of smRNA-seq. In addition, it is unknown whether these aligners accurately map smRNA reads containing sequence errors and polymorphisms. By using simulated read sets, we determine the alignment sensitivity and accuracy of 16 short-read mappers and quantify their robustness to mismatches, indels, and nontemplated nucleotide additions. These were explored in the context of a plant genome (Oryza sativa, ∼500 Mbp) and a mammalian genome (Homo sapiens, ∼3.1 Gbp). Analysis of simulated and real smRNA-seq data demonstrates that mapper selection impacts differential expression results and interpretation. These results will inform on best practice for smRNA mapping and enable more accurate smRNA detection and quantification of expression and RNA editing. PMID:27284164

  17. MicroRNA mimicry blocks pulmonary fibrosis

    Science.gov (United States)

    Montgomery, Rusty L; Yu, Guoying; Latimer, Paul A; Stack, Christianna; Robinson, Kathryn; Dalby, Christina M; Kaminski, Naftali; van Rooij, Eva

    2014-01-01

    Over the last decade, great enthusiasm has evolved for microRNA (miRNA) therapeutics. Part of the excitement stems from the fact that a miRNA often regulates numerous related mRNAs. As such, modulation of a single miRNA allows for parallel regulation of multiple genes involved in a particular disease. While many studies have shown therapeutic efficacy using miRNA inhibitors, efforts to restore or increase the function of a miRNA have been lagging behind. The miR-29 family has gained a lot of attention for its clear function in tissue fibrosis. This fibroblast-enriched miRNA family is downregulated in fibrotic diseases which induces a coordinate increase of many extracellular matrix genes. Here, we show that intravenous injection of synthetic RNA duplexes can increase miR-29 levels in vivo for several days. Moreover, therapeutic delivery of these miR-29 mimics during bleomycin-induced pulmonary fibrosis restores endogenous miR-29 function whereby decreasing collagen expression and blocking and reversing pulmonary fibrosis. Our data support the feasibility of using miRNA mimics to therapeutically increase miRNAs and indicate miR-29 to be a potent therapeutic miRNA for treating pulmonary fibrosis. PMID:25239947

  18. Modulation of RNA function by aminoglycoside antibiotics.

    Science.gov (United States)

    Schroeder, R; Waldsich, C; Wank, H

    2000-01-04

    One of the most important families of antibiotics are the aminoglycosides, including drugs such as neomycin B, paromomycin, gentamicin and streptomycin. With the discovery of the catalytic potential of RNA, these antibiotics became very popular due to their RNA-binding capacity. They serve for the analysis of RNA function as well as for the study of RNA as a potential therapeutic target. Improvements in RNA structure determination recently provided first insights into the decoding site of the ribosome at high resolution and how aminoglycosides might induce misreading of the genetic code. In addition to inhibiting prokaryotic translation, aminoglycosides inhibit several catalytic RNAs such as self-splicing group I introns, RNase P and small ribozymes in vitro. Furthermore, these antibiotics interfere with human immunodeficiency virus (HIV) replication by disrupting essential RNA-protein contacts. Most exciting is the potential of many RNA-binding antibiotics to stimulate RNA activities, conceiving small-molecule partners for the hypothesis of an ancient RNA world. SELEX (systematic evolution of ligands by exponential enrichment) has been used in this evolutionary game leading to small synthetic RNAs, whose NMR structures gave valuable information on how aminoglycosides interact with RNA, which could possibly be used in applied science.

  19. Movement of regulatory RNA between animal cells.

    Science.gov (United States)

    Jose, Antony M

    2015-07-01

    Recent studies suggest that RNA can move from one cell to another and regulate genes through specific base-pairing. Mechanisms that modify or select RNA for secretion from a cell are unclear. Secreted RNA can be stable enough to be detected in the extracellular environment and can enter the cytosol of distant cells to regulate genes. Mechanisms that import RNA into the cytosol of an animal cell can enable uptake of RNA from many sources including other organisms. This role of RNA is akin to that of steroid hormones, which cross cell membranes to regulate genes. The potential diagnostic use of RNA in human extracellular fluids has ignited interest in understanding mechanisms that enable the movement of RNA between animal cells. Genetic model systems will be essential to gain more confidence in proposed mechanisms of RNA transport and to connect an extracellular RNA with a specific biological function. Studies in the worm C. elegans and in other animals have begun to reveal parts of this novel mechanism of cell-to-cell communication. Here, I summarize the current state of this nascent field, highlight the many unknowns, and suggest future directions. © 2015 Wiley Periodicals, Inc.

  20. Comparison of protocols and RNA carriers for plasma miRNA isolation. Unraveling RNA carrier influence on miRNA isolation

    Science.gov (United States)

    Martos, Laura; Fernández-Pardo, Álvaro; Oto, Julia; Medina, Pilar; España, Francisco; Navarro, Silvia

    2017-01-01

    microRNAs are promising biomarkers in biological fluids in several diseases. Different plasma RNA isolation protocols and carriers are available, but their efficiencies have been scarcely compared. Plasma microRNAs were isolated using a phenol and column-based procedure and a column-based procedure, in the presence or absence of two RNA carriers (yeast RNA and MS2 RNA). We evaluated the presence of PCR inhibitors and the relative abundance of certain microRNAs by qRT-PCR. Furthermore, we analyzed the association between different isolation protocols, the relative abundance of the miRNAs in the sample, the GC content and the free energy of microRNAs. In all microRNAs analyzed, the addition of yeast RNA as a carrier in the different isolation protocols used gave lower raw Cq values, indicating higher microRNA recovery. Moreover, this increase in microRNAs recovery was dependent on their own relative abundance in the sample, their GC content and the free-energy of their own most stable secondary structure. Furthermore, the normalization of microRNA levels by an endogenous microRNA is more reliable than the normalization by plasma volume, as it reduced the difference in microRNA fold abundance between the different isolation protocols evaluated. Our thorough study indicates that a standardization of pre- and analytical conditions is necessary to obtain reproducible inter-laboratory results in plasma microRNA studies. PMID:29077772

  1. Henipavirus RNA in African bats.

    Directory of Open Access Journals (Sweden)

    Jan Felix Drexler

    Full Text Available BACKGROUND: Henipaviruses (Hendra and Nipah virus are highly pathogenic members of the family Paramyxoviridae. Fruit-eating bats of the Pteropus genus have been suggested as their natural reservoir. Human Henipavirus infections have been reported in a region extending from Australia via Malaysia into Bangladesh, compatible with the geographic range of Pteropus. These bats do not occur in continental Africa, but a whole range of other fruit bats is encountered. One of the most abundant is Eidolon helvum, the African Straw-coloured fruit bat. METHODOLOGY/PRINCIPAL FINDINGS: Feces from E. helvum roosting in an urban setting in Kumasi/Ghana were tested for Henipavirus RNA. Sequences of three novel viruses in phylogenetic relationship to known Henipaviruses were detected. Virus RNA concentrations in feces were low. CONCLUSIONS/SIGNIFICANCE: The finding of novel putative Henipaviruses outside Australia and Asia contributes a significant extension of the region of potential endemicity of one of the most pathogenic virus genera known in humans.

  2. REDIdb: the RNA editing database.

    Science.gov (United States)

    Picardi, Ernesto; Regina, Teresa Maria Rosaria; Brennicke, Axel; Quagliariello, Carla

    2007-01-01

    The RNA Editing Database (REDIdb) is an interactive, web-based database created and designed with the aim to allocate RNA editing events such as substitutions, insertions and deletions occurring in a wide range of organisms. The database contains both fully and partially sequenced DNA molecules for which editing information is available either by experimental inspection (in vitro) or by computational detection (in silico). Each record of REDIdb is organized in a specific flat-file containing a description of the main characteristics of the entry, a feature table with the editing events and related details and a sequence zone with both the genomic sequence and the corresponding edited transcript. REDIdb is a relational database in which the browsing and identification of editing sites has been simplified by means of two facilities to either graphically display genomic or cDNA sequences or to show the corresponding alignment. In both cases, all editing sites are highlighted in colour and their relative positions are detailed by mousing over. New editing positions can be directly submitted to REDIdb after a user-specific registration to obtain authorized secure access. This first version of REDIdb database stores 9964 editing events and can be freely queried at http://biologia.unical.it/py_script/search.html.

  3. 5S rRNA-derived and tRNA-derived SINEs in fruit bats.

    Science.gov (United States)

    Gogolevsky, Konstantin P; Vassetzky, Nikita S; Kramerov, Dmitri A

    2009-05-01

    Most short retroposons (SINEs) descend from cellular tRNA of 7SL RNA. Here, four new SINEs were found in megabats (Megachiroptera) but neither in microbats nor in other mammals. Two of them, MEG-RS and MEG-RL, descend from another cellular RNA, 5S rRNA; one (MEG-T2) is a tRNA-derived SINE; and MEG-TR is a hybrid tRNA/5S rRNA SINE. Insertion locus analysis suggests that these SINEs were active in the recent fruit bat evolution. Analysis of MEG-RS and MEG-RL in comparison with other few 5S rRNA-derived SINEs demonstrates that the internal RNA polymerase III promoter is their most invariant region, while the secondary structure is more variable. The mechanisms underlying the modular structure of these and other SINEs as well as their variation are discussed. The scenario of evolution of MEG SINEs is proposed.

  4. RNA-Binding Proteins Revisited – The Emerging Arabidopsis mRNA Interactome

    KAUST Repository

    Kö ster, Tino; Marondedze, Claudius; Meyer, Katja; Staiger, Dorothee

    2017-01-01

    RNA–protein interaction is an important checkpoint to tune gene expression at the RNA level. Global identification of proteins binding in vivo to mRNA has been possible through interactome capture – where proteins are fixed to target RNAs by UV crosslinking and purified through affinity capture of polyadenylated RNA. In Arabidopsis over 500 RNA-binding proteins (RBPs) enriched in UV-crosslinked samples have been identified. As in mammals and yeast, the mRNA interactomes came with a few surprises. For example, a plethora of the proteins caught on RNA had not previously been linked to RNA-mediated processes, for example proteins of intermediary metabolism. Thus, the studies provide unprecedented insights into the composition of the mRNA interactome, highlighting the complexity of RNA-mediated processes.

  5. RNA-Binding Proteins Revisited – The Emerging Arabidopsis mRNA Interactome

    KAUST Repository

    Köster, Tino

    2017-04-13

    RNA–protein interaction is an important checkpoint to tune gene expression at the RNA level. Global identification of proteins binding in vivo to mRNA has been possible through interactome capture – where proteins are fixed to target RNAs by UV crosslinking and purified through affinity capture of polyadenylated RNA. In Arabidopsis over 500 RNA-binding proteins (RBPs) enriched in UV-crosslinked samples have been identified. As in mammals and yeast, the mRNA interactomes came with a few surprises. For example, a plethora of the proteins caught on RNA had not previously been linked to RNA-mediated processes, for example proteins of intermediary metabolism. Thus, the studies provide unprecedented insights into the composition of the mRNA interactome, highlighting the complexity of RNA-mediated processes.

  6. Construction of RNA nanocages by re-engineering the packaging RNA of Phi29 bacteriophage

    Science.gov (United States)

    Hao, Chenhui; Li, Xiang; Tian, Cheng; Jiang, Wen; Wang, Guansong; Mao, Chengde

    2014-05-01

    RNA nanotechnology promises rational design of RNA nanostructures with wide array of structural diversities and functionalities. Such nanostructures could be used in applications such as small interfering RNA delivery and organization of in vivo chemical reactions. Though having impressive development in recent years, RNA nanotechnology is still quite limited and its programmability and complexity could not rival the degree of its closely related cousin: DNA nanotechnology. Novel strategies are needed for programmed RNA self-assembly. Here, we have assembled RNA nanocages by re-engineering a natural, biological RNA motif: the packaging RNA of phi29 bacteriophage. The resulting RNA nanostructures have been thoroughly characterized by gel electrophoresis, cryogenic electron microscopy imaging and dynamic light scattering.

  7. Role of RNase MRP in viral RNA degradation and RNA recombination.

    Science.gov (United States)

    Jaag, Hannah M; Lu, Qiasheng; Schmitt, Mark E; Nagy, Peter D

    2011-01-01

    RNA degradation, together with RNA synthesis, controls the steady-state level of viral RNAs in infected cells. The endoribonucleolytic cleavage of viral RNA is important not only for viral RNA degradation but for RNA recombination as well, due to the participation of some RNA degradation products in the RNA recombination process. To identify host endoribonucleases involved in degradation of Tomato bushy stunt virus (TBSV) in a Saccharomyces cerevisiae model host, we tested eight known endoribonucleases. Here we report that downregulation of SNM1, encoding a component of the RNase MRP, and a temperature-sensitive mutation in the NME1 gene, coding for the RNA component of RNase MRP, lead to reduced production of the endoribonucleolytically cleaved TBSV RNA in yeast. We also show that the highly purified yeast RNase MRP cleaves the TBSV RNA in vitro, resulting in TBSV RNA degradation products similar in size to those observed in yeast cells. Knocking down the NME1 homolog in Nicotiana benthamiana also led to decreased production of the cleaved TBSV RNA, suggesting that in plants, RNase MRP is involved in TBSV RNA degradation. Altogether, this work suggests a role for the host endoribonuclease RNase MRP in viral RNA degradation and recombination.

  8. Fragment-based modelling of single stranded RNA bound to RNA recognition motif containing proteins

    Science.gov (United States)

    de Beauchene, Isaure Chauvot; de Vries, Sjoerd J.; Zacharias, Martin

    2016-01-01

    Abstract Protein-RNA complexes are important for many biological processes. However, structural modeling of such complexes is hampered by the high flexibility of RNA. Particularly challenging is the docking of single-stranded RNA (ssRNA). We have developed a fragment-based approach to model the structure of ssRNA bound to a protein, based on only the protein structure, the RNA sequence and conserved contacts. The conformational diversity of each RNA fragment is sampled by an exhaustive library of trinucleotides extracted from all known experimental protein–RNA complexes. The method was applied to ssRNA with up to 12 nucleotides which bind to dimers of the RNA recognition motifs (RRMs), a highly abundant eukaryotic RNA-binding domain. The fragment based docking allows a precise de novo atomic modeling of protein-bound ssRNA chains. On a benchmark of seven experimental ssRNA–RRM complexes, near-native models (with a mean heavy-atom deviation of <3 Å from experiment) were generated for six out of seven bound RNA chains, and even more precise models (deviation < 2 Å) were obtained for five out of seven cases, a significant improvement compared to the state of the art. The method is not restricted to RRMs but was also successfully applied to Pumilio RNA binding proteins. PMID:27131381

  9. The use of 125iodine-labeled RNA for detection of the RNA binding to ribosomes

    International Nuclear Information System (INIS)

    Mori, Tomohiko; Fukuda, Mitsuru

    1975-01-01

    The in vitro labeling of RNA with radioactive iodine is the efficient method to obtain the RNA with high specific activity. The present paper reports on the application of this technique to the production of iodine-labeled RNA for use in the experiment of binding RNA to ribosomes. Tobacco mosaic virus (TMV) RNA was used as natural mRNA, and E. coli S-30 preparation was used as a source of ribosomes. The TMV-RNA was prepared by bentonite-phenol extraction from TMV, and the method used for the iodation of RNA was based on the procedure described by Getz et al. The iodine-labeled RNA was incubated in a cell-free protein synthesizing system (S-30) prepared from E. coli K-12. After the incubation, the reaction mixture was layered onto sucrose gradient, centrifuged, and fractionated into 18 fractions. Optical density at 260 nm was measured, and radioactivity was counted, for each fraction. The binding of mRNA to ribosomes occurred even at 0 deg C, and the occurrence of the nonspecific binding was also shown. Consequently, the specific binding, i.e. the formation of the initiation complex being involved in amino acid incorporation, may be estimated by subtracting the radioactivity associated with monosomes in the presence of both rRNA and ATA from that in the presence of rRNA only. It was shown that the iodine-labeled RNA can be used for the studies of binding RNA to ribosomes. (Kako, I.)

  10. Disruption of Specific RNA-RNA Interactions in a Double-Stranded RNA Virus Inhibits Genome Packaging and Virus Infectivity.

    Science.gov (United States)

    Fajardo, Teodoro; Sung, Po-Yu; Roy, Polly

    2015-12-01

    Bluetongue virus (BTV) causes hemorrhagic disease in economically important livestock. The BTV genome is organized into ten discrete double-stranded RNA molecules (S1-S10) which have been suggested to follow a sequential packaging pathway from smallest to largest segment during virus capsid assembly. To substantiate and extend these studies, we have investigated the RNA sorting and packaging mechanisms with a new experimental approach using inhibitory oligonucleotides. Putative packaging signals present in the 3'untranslated regions of BTV segments were targeted by a number of nuclease resistant oligoribonucleotides (ORNs) and their effects on virus replication in cell culture were assessed. ORNs complementary to the 3' UTR of BTV RNAs significantly inhibited virus replication without affecting protein synthesis. Same ORNs were found to inhibit complex formation when added to a novel RNA-RNA interaction assay which measured the formation of supramolecular complexes between and among different RNA segments. ORNs targeting the 3'UTR of BTV segment 10, the smallest RNA segment, were shown to be the most potent and deletions or substitution mutations of the targeted sequences diminished the RNA complexes and abolished the recovery of viable viruses using reverse genetics. Cell-free capsid assembly/RNA packaging assay also confirmed that the inhibitory ORNs could interfere with RNA packaging and further substitution mutations within the putative RNA packaging sequence have identified the recognition sequence concerned. Exchange of 3'UTR between segments have further demonstrated that RNA recognition was segment specific, most likely acting as part of the secondary structure of the entire genomic segment. Our data confirm that genome packaging in this segmented dsRNA virus occurs via the formation of supramolecular complexes formed by the interaction of specific sequences located in the 3' UTRs. Additionally, the inhibition of packaging in-trans with inhibitory ORNs

  11. Nuclear Protein Sam68 Interacts with the Enterovirus 71 Internal Ribosome Entry Site and Positively Regulates Viral Protein Translation.

    Science.gov (United States)

    Zhang, Hua; Song, Lei; Cong, Haolong; Tien, Po

    2015-10-01

    Enterovirus 71 (EV71) recruits various cellular factors to assist in the replication and translation of its genome. Identification of the host factors involved in the EV71 life cycle not only will enable a better understanding of the infection mechanism but also has the potential to be of use in the development of antiviral therapeutics. In this study, we demonstrated that the cellular factor 68-kDa Src-associated protein in mitosis (Sam68) acts as an internal ribosome entry site (IRES) trans-acting factor (ITAF) that binds specifically to the EV71 5' untranslated region (5'UTR). Interaction sites in both the viral IRES (stem-loops IV and V) and the heterogeneous nuclear ribonucleoprotein K homology (KH) domain of Sam68 protein were further mapped using an electrophoretic mobility shift assay (EMSA) and biotin RNA pulldown assay. More importantly, dual-luciferase (firefly) reporter analysis suggested that overexpression of Sam68 positively regulated IRES-dependent translation of virus proteins. In contrast, both IRES activity and viral protein translation significantly decreased in Sam68 knockdown cells compared with the negative-control cells treated with short hairpin RNA (shRNA). However, downregulation of Sam68 did not have a significant inhibitory effect on the accumulation of the EV71 genome. Moreover, Sam68 was redistributed from the nucleus to the cytoplasm and interacts with cellular factors, such as poly(rC)-binding protein 2 (PCBP2) and poly(A)-binding protein (PABP), during EV71 infection. The cytoplasmic relocalization of Sam68 in EV71-infected cells may be involved in the enhancement of EV71 IRES-mediated translation. Since Sam68 is known to be a RNA-binding protein, these results provide direct evidence that Sam68 is a novel ITAF that interacts with EV71 IRES and positively regulates viral protein translation. The nuclear protein Sam68 is found as an additional new host factor that interacts with the EV71 IRES during infection and could potentially

  12. Neuronal RING finger protein 11 (RNF11 regulates canonical NF-κB signaling

    Directory of Open Access Journals (Sweden)

    Pranski Elaine L

    2012-04-01

    Full Text Available Abstract Background The RING domain-containing protein RING finger protein 11 (RNF11 is a member of the A20 ubiquitin-editing protein complex and modulates peripheral NF-κB signaling. RNF11 is robustly expressed in neurons and colocalizes with a population of α-synuclein-positive Lewy bodies and neurites in Parkinson disease patients. The NF-κB pathway has an important role in the vertebrate nervous system, where the absence of NF-κB activity during development can result in learning and memory deficits, whereas chronic NF-κB activation is associated with persistent neuroinflammation. We examined the functional role of RNF11 with respect to canonical NF-κB signaling in neurons to gain understanding of the tight association of inflammatory pathways, including NF-κB, with the pathogenesis of neurodegenerative diseases. Methods and results Luciferase assays were employed to assess NF-κB activity under targeted short hairpin RNA (shRNA knockdown of RNF11 in human neuroblastoma cells and murine primary neurons, which suggested that RNF11 acts as a negative regulator of canonical neuronal NF-κB signaling. These results were further supported by analyses of p65 translocation to the nucleus following depletion of RNF11. Coimmunoprecipitation experiments indicated that RNF11 associates with members of the A20 ubiquitin-editing protein complex in neurons. Site-directed mutagenesis of the myristoylation domain, which is necessary for endosomal targeting of RNF11, altered the impact of RNF11 on NF-κB signaling and abrogated RNF11’s association with the A20 ubiquitin-editing protein complex. A partial effect on canonical NF-κB signaling and an association with the A20 ubiquitin-editing protein complex was observed with mutagenesis of the PPxY motif, a proline-rich region involved in Nedd4-like protein interactions. Last, shRNA-mediated reduction of RNF11 in neurons and neuronal cell lines elevated levels of monocyte chemoattractant protein 1 and

  13. Argonaute: The executor of small RNA function.

    Science.gov (United States)

    Azlan, Azali; Dzaki, Najat; Azzam, Ghows

    2016-08-20

    The discovery of small non-coding RNAs - microRNA (miRNA), short interfering RNA (siRNA) and PIWI-interacting RNA (piRNA) - represents one of the most exciting frontiers in biology specifically on the mechanism of gene regulation. In order to execute their functions, these small RNAs require physical interactions with their protein partners, the Argonaute (AGO) family proteins. Over the years, numerous studies have made tremendous progress on understanding the roles of AGO in gene silencing in various organisms. In this review, we summarize recent progress of AGO-mediated gene silencing and other cellular processes in which AGO proteins have been implicated with a particular focus on progress made in flies, humans and other model organisms as compliment. Copyright © 2016 Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and Genetics Society of China. Published by Elsevier Ltd. All rights reserved.

  14. Designing synthetic RNA for delivery by nanoparticles

    International Nuclear Information System (INIS)

    Jedrzejczyk, Dominika; Pawlowska, Roza; Chworos, Arkadiusz; Gendaszewska-Darmach, Edyta

    2017-01-01

    The rapid development of synthetic biology and nanobiotechnology has led to the construction of various synthetic RNA nanoparticles of different functionalities and potential applications. As they occur naturally, nucleic acids are an attractive construction material for biocompatible nanoscaffold and nanomachine design. In this review, we provide an overview of the types of RNA and nucleic acid’s nanoparticle design, with the focus on relevant nanostructures utilized for gene-expression regulation in cellular models. Structural analysis and modeling is addressed along with the tools available for RNA structural prediction. The functionalization of RNA-based nanoparticles leading to prospective applications of such constructs in potential therapies is shown. The route from the nanoparticle design and modeling through synthesis and functionalization to cellular application is also described. For a better understanding of the fate of targeted RNA after delivery, an overview of RNA processing inside the cell is also provided. (topical review)

  15. Predicting RNA Structure Using Mutual Information

    DEFF Research Database (Denmark)

    Freyhult, E.; Moulton, V.; Gardner, P. P.

    2005-01-01

    , to display and predict conserved RNA secondary structure (including pseudoknots) from an alignment. Results: We show that MIfold can be used to predict simple pseudoknots, and that the performance can be adjusted to make it either more sensitive or more selective. We also demonstrate that the overall...... package. Conclusion: MIfold provides a useful supplementary tool to programs such as RNA Structure Logo, RNAalifold and COVE, and should be useful for automatically generating structural predictions for databases such as Rfam. Availability: MIfold is freely available from http......Background: With the ever-increasing number of sequenced RNAs and the establishment of new RNA databases, such as the Comparative RNA Web Site and Rfam, there is a growing need for accurately and automatically predicting RNA structures from multiple alignments. Since RNA secondary structure...

  16. Preparation of Total RNA from Fission Yeast.

    Science.gov (United States)

    Bähler, Jürg; Wise, Jo Ann

    2017-04-03

    Treatment with hot phenol breaks open fission yeast cells and begins to strip away bound proteins from RNA. Deproteinization is completed by multiple extractions with chloroform/isoamyl alcohol and separation of the aqueous and organic phases using MaXtract gel, an inert material that acts as a physical barrier between the phases. The final step is concentration of the RNA by ethanol precipitation. The protocol can be used to prepare RNA from several cultures grown in parallel, but it is important not to process too many samples at once because delays can be detrimental to RNA quality. A reasonable number of samples to process at once would be three to four for microarray or RNA sequencing analyses and six for preliminary investigations of mutants implicated in RNA metabolism. © 2017 Cold Spring Harbor Laboratory Press.

  17. A probabilistic model of RNA conformational space

    DEFF Research Database (Denmark)

    Frellsen, Jes; Moltke, Ida; Thiim, Martin

    2009-01-01

    efficient sampling of RNA conformations in continuous space, and with associated probabilities. We show that the model captures several key features of RNA structure, such as its rotameric nature and the distribution of the helix lengths. Furthermore, the model readily generates native-like 3-D......, the discrete nature of the fragments necessitates the use of carefully tuned, unphysical energy functions, and their non-probabilistic nature impairs unbiased sampling. We offer a solution to the sampling problem that removes these important limitations: a probabilistic model of RNA structure that allows......The increasing importance of non-coding RNA in biology and medicine has led to a growing interest in the problem of RNA 3-D structure prediction. As is the case for proteins, RNA 3-D structure prediction methods require two key ingredients: an accurate energy function and a conformational sampling...

  18. RNA-Binding Proteins in Plant Immunity

    Directory of Open Access Journals (Sweden)

    Virginia Woloshen

    2011-01-01

    Full Text Available Plant defence responses against pathogen infection are crucial to plant survival. The high degree of regulation of plant immunity occurs both transcriptionally and posttranscriptionally. Once transcribed, target gene RNA must be processed prior to translation. This includes polyadenylation, 5′capping, editing, splicing, and mRNA export. RNA-binding proteins (RBPs have been implicated at each level of RNA processing. Previous research has primarily focused on structural RNA-binding proteins of yeast and mammals; however, more recent work has characterized a number of plant RBPs and revealed their roles in plant immune responses. This paper provides an update on the known functions of RBPs in plant immune response regulation. Future in-depth analysis of RBPs and other related players will unveil the sophisticated regulatory mechanisms of RNA processing during plant immune responses.

  19. The Old and New RNA World

    Directory of Open Access Journals (Sweden)

    Zofia Szweykowska-Kulińska

    2014-12-01

    Full Text Available Among the numerous hypotheses offering a scenario for the origin of life on Earth, the one called “The RNA World” has gained the most attention. According to this hypothesis RNA acted as a genetic information storage material, as a catalyst of all metabolic reactions, and as a regulator of all processes in the primordial world. Various experiments show that RNA molecules could have been synthesized abiotically, with the potential to mediate a whole repertoire of metabolic reactions. Ribozymes carrying out aminoacyl-tRNA reactions have been found in SELEX (systematic evolution of ligands by exponential enrichment approaches and the development of a ribosome from a RNA-built protoribosome is easy to imagine. Transfer RNA aminoacylation, protoribosome origin, and the availability of amino acids on early Earth allowed the genetic code to evolve. Encoded proteins most likely stabilized RNA molecules and were able to create channels across membranes. In the modern cell, DNA replaced RNA as the main depositor of genetic information and proteins carry out almost all metabolic reactions. However, RNA is still playing versatile, crucial roles in the cell. Apart from its classical functions in the cell, a huge small RNA world is controlling gene expression, chromatin condensation, response to environmental cues, and protecting the cell against the invasion of various nucleic acids forms. Long non-coding RNAs act as crucial gene expression regulators. Riboswitches act at the level of transcription, splicing or translation and mediate feedback regulation on biosynthesis and transport of the ligand they sense. Alternative splicing generates genetic variability and increases the protein repertoire in response to developmental or environmental changes. All these regulatory functions are essential in shaping cell plasticity in the changing milieu. Recent discoveries of new, unexpected and important functions of RNA molecules support the hypothesis that we

  20. Small catalytic RNA: Structure, function and application

    Energy Technology Data Exchange (ETDEWEB)

    Monforte, J.A.

    1991-04-01

    We have utilized a combination of photochemical cross-linking techniques and site-directed mutagenesis to obtain secondary and tertiary structure information for the self-cleaving, self-ligating subsequence of RNA from the negative strand of Satellite Tobacco Ringspot Virus. We have found that the helical regions fold about a hinge to promoting four different possible tertiary interactions, creating a molecular of similar shape to a paperclip. A model suggesting that the paperclip'' and hammerhead'' RNAs share a similar three dimensional structure is proposed. We have used a self-cleaving RNA molecule related to a subsequence of plant viroids, a hammerhead,'' to study the length-dependent folding of RNA produced during transcription by RNA polymerase. We have used this method to determine the length of RNA sequestered within elongating E. coli and T7 RNA polymerase complexes. The data show that for E. coli RNA polymerase 12{plus minus}1 nucleotides are sequestered within the ternary complex, which is consistent with the presence of an RNA-DNA hybrid within the transcription bubble, as proposed by others. The result for T7 RNA polymerase differs from E. coli RNA polymerase, with only 10{plus minus}1 nucleotides sequestered within the ternary complex, setting a new upper limit for the minimum RNA-DNA required for a stable elongating complex. Comparisons between E. coli and T7 RNA polymerase are made. The relevance of the results to models or transcription termination, abortive initiation, and initiation to elongation mode transitions are discussed.

  1. Inverse folding of RNA pseudoknot structures

    Directory of Open Access Journals (Sweden)

    Li Linda YM

    2010-06-01

    Full Text Available Abstract Background RNA exhibits a variety of structural configurations. Here we consider a structure to be tantamount to the noncrossing Watson-Crick and G-U-base pairings (secondary structure and additional cross-serial base pairs. These interactions are called pseudoknots and are observed across the whole spectrum of RNA functionalities. In the context of studying natural RNA structures, searching for new ribozymes and designing artificial RNA, it is of interest to find RNA sequences folding into a specific structure and to analyze their induced neutral networks. Since the established inverse folding algorithms, RNAinverse, RNA-SSD as well as INFO-RNA are limited to RNA secondary structures, we present in this paper the inverse folding algorithm Inv which can deal with 3-noncrossing, canonical pseudoknot structures. Results In this paper we present the inverse folding algorithm Inv. We give a detailed analysis of Inv, including pseudocodes. We show that Inv allows to design in particular 3-noncrossing nonplanar RNA pseudoknot 3-noncrossing RNA structures-a class which is difficult to construct via dynamic programming routines. Inv is freely available at http://www.combinatorics.cn/cbpc/inv.html. Conclusions The algorithm Inv extends inverse folding capabilities to RNA pseudoknot structures. In comparison with RNAinverse it uses new ideas, for instance by considering sets of competing structures. As a result, Inv is not only able to find novel sequences even for RNA secondary structures, it does so in the context of competing structures that potentially exhibit cross-serial interactions.

  2. Functional characterization of the Drosophila MRP (mitochondrial RNA processing) RNA gene.

    Science.gov (United States)

    Schneider, Mary D; Bains, Anupinder K; Rajendra, T K; Dominski, Zbigniew; Matera, A Gregory; Simmonds, Andrew J

    2010-11-01

    MRP RNA is a noncoding RNA component of RNase mitochondrial RNA processing (MRP), a multi-protein eukaryotic endoribonuclease reported to function in multiple cellular processes, including ribosomal RNA processing, mitochondrial DNA replication, and cell cycle regulation. A recent study predicted a potential Drosop