Enhancer elements upstream of the SHOX gene are active in the developing limb.

Science.gov (United States)

Durand, Claudia; Bangs, Fiona; Signolet, Jason; Decker, Eva; Tickle, Cheryll; Rappold, Gudrun

2010-05-01

Léri-Weill Dyschondrosteosis (LWD) is a dominant skeletal disorder characterized by short stature and distinct bone anomalies. SHOX gene mutations and deletions of regulatory elements downstream of SHOX resulting in haploinsufficiency have been found in patients with LWD. SHOX encodes a homeodomain transcription factor and is known to be expressed in the developing limb. We have now analyzed the regulatory significance of the region upstream of the SHOX gene. By comparative genomic analyses, we identified several conserved non-coding elements, which subsequently were tested in an in ovo enhancer assay in both chicken limb bud and cornea, where SHOX is also expressed. In this assay, we found three enhancers to be active in the developing chicken limb, but none were functional in the developing cornea. A screening of 60 LWD patients with an intact SHOX coding and downstream region did not yield any deletion of the upstream enhancer region. Thus, we speculate that SHOX upstream deletions occur at a lower frequency because of the structural organization of this genomic region and/or that SHOX upstream deletions may cause a phenotype that differs from the one observed in LWD.

Upstream-Downstream Joint Carbon Reduction Strategies Based on Low-Carbon Promotion

Directory of Open Access Journals (Sweden)

Xiqiang Xia

2018-06-01

Full Text Available A differential game model is established to analyze the impact of emissions reduction efforts and low-carbon product promotion on the reduction strategies of low-carbon product manufacturers (subsequently referred to as manufacturers and the retailers of such products in a dynamic environment. Based on this model, changes in emissions reduction efforts and promotional efforts are comparatively analyzed under three scenarios (retailers bearing the promotional cost, manufacturers bearing the promotional cost, and centralized decision-making. The results are as follows: (1 the trajectory of carbon emissions reduction per product unit is the highest when the supply chain is under centralized decision-making, followed by when manufacturers bear the promotional cost, and lastly when retailers bear the cost; (2 when manufacturers bear the promotional cost, the market demand, emissions reduction effort, and promotional effort are higher, although the unit retail price is higher than when retailers bear the promotional cost; and (3 under centralized decision-making, the unit retail price is the lowest; however, sales volume, the emissions reduction effort, and the promotional effort are all higher than those in the other scenarios.

Analysis of upstream promoter region and corresponding 5’ UTR of glucokinase (GCK gene in horse breeds

Directory of Open Access Journals (Sweden)

L. Minieri

2010-04-01

Full Text Available A region of glucokinase (GCK gene was sequenced in 14 horses of 14 different breeds. The resulting GCK nucleotide sequence (GenBank number EF136885 showed 77% homology with human GCK gene portion containing the upstream promoter region and the corresponding 5’ UTR of the exon 1. Conserved regulatory sequences near the putative transcriptional start site were identified. The obtained sequences were aligned to detect polymorphism. A new C>T transition within the 5’ UTR of exon 1 was found. Allele frequencies of this polymorphism were studied by PCR-RFLP in 193 horses of 14 breeds (Bardigiano, 21; Esperia Pony, 5; Haflinger, 10; Italian Heavy Draught Horse, 28; Italian Saddle, 25; Italian Trotter, 16; Lipizzan, 12; Maremmano, 15; Murgese, 14; Norico, 10; Salernitano, 12; Thoroughbred, 10; Tolfetano, 7 and Ventasso Horse, 8. The polymorphism was found in all breeds and differences in allelic frequencies among the breeds were observed. The new SNP identified within a regulative region of GCK gene, which plays an important role in insulin secretion and feeding behaviour, could be used for association studies with performance traits of the horses.

Characterization of sediment transport upstream and downstream from Lake Emory on the Little Tennessee River near Franklin, North Carolina, 2014–15

Science.gov (United States)

Huffman, Brad A.; Hazell, William F.; Oblinger, Carolyn J.

2017-09-06

Federal, State, and local agencies and organizations have expressed concerns regarding the detrimental effects of excessive sediment transport on aquatic resources and endangered species populations in the upper Little Tennessee River and some of its tributaries. In addition, the storage volume of Lake Emory, which is necessary for flood control and power generation, has been depleted by sediment deposition. To help address these concerns, a 2-year study was conducted in the upper Little Tennessee River Basin to characterize the ambient suspended-sediment concentrations and suspended-sediment loads upstream and downstream from Lake Emory in Franklin, North Carolina. The study was conducted by the U.S. Geological Survey in cooperation with Duke Energy. Suspended-sediment samples were collected periodically, and time series of stage and turbidity data were measured from December 2013 to January 2016 upstream and downstream from Lake Emory. The stage data were used to compute time-series streamflow. Suspended-sediment samples, along with time-series streamflow and turbidity data, were used to develop regression models that were used to estimate time-series suspended-sediment concentrations for the 2014 and 2015 calendar years. These concentrations, along with streamflow data, were used to compute suspended-sediment loads. Selected suspended-sediment samples were collected for analysis of particle-size distribution, with emphasis on high-flow events. Bed-load samples were also collected upstream from Lake Emory.The estimated annual suspended-sediment loads (yields) for the upstream site for the 2014 and 2015 calendar years were 27,000 short tons (92 short tons per square mile) and 63,300 short tons (215 short tons per square mile), respectively. The annual suspended-sediment loads (yields) for the downstream site for 2014 and 2015 were 24,200 short tons (75 short tons per square mile) and 94,300 short tons (292 short tons per square mile), respectively. Overall, the

Characterization of wind velocities in the upstream induction zone of a wind turbine using scanning continuous-wave lidars

DEFF Research Database (Denmark)

Simley, Eric; Angelou, Nikolas; Mikkelsen, Torben Krogh

2016-01-01

As a wind turbine generates power, induced velocities, lower than the freestream velocity, will be present upstream of the turbine due to perturbation of the flow by the rotor. In this study, the upstream induction zone of a 225kW horizontal axis Vestas V27 wind turbine located at the Danish...... Technical University’s Risø campus is investigated using a scanning Light Detection and Ranging (lidar) system. Three short-range continuous-wave “WindScanner” lidars are positioned in the field around the V27 turbine allowing detection of all three components of the wind velocity vectors within...... the induction zone. The time-averaged mean wind speeds at different locations in the upstream induction zone are measured by scanning a horizontal plane at hub height and a vertical plane centered at the middle of the rotor extending roughly 1.5 rotor diameters (D) upstream of the rotor. Turbulence statistics...

NMDA receptor activation upstream of methyl farnesoate signaling for short day-induced male offspring production in the water flea, Daphnia pulex.

Science.gov (United States)

Toyota, Kenji; Miyakawa, Hitoshi; Yamaguchi, Katsushi; Shigenobu, Shuji; Ogino, Yukiko; Tatarazako, Norihisa; Miyagawa, Shinichi; Iguchi, Taisen

2015-03-14

The cladoceran crustacean Daphnia pulex produces female offspring by parthenogenesis under favorable conditions, but in response to various unfavorable external stimuli, it produces male offspring (environmental sex determination: ESD). We recently established an innovative system for ESD studies using D. pulex WTN6 strain, in which the sex of the offspring can be controlled simply by changes in the photoperiod: the long-day and short-day conditions can induce female and male offspring, respectively. Taking advantage of this system, we demonstrated that de novo methyl farnesoate (MF) synthesis is necessary for male offspring production. These results indicate the key role of innate MF signaling as a conductor between external environmental stimuli and the endogenous male developmental pathway. Despite these findings, the molecular mechanisms underlying up- and downstream signaling of MF have not yet been well elucidated in D. pulex. To elucidate up- and downstream events of MF signaling during sex determination processes, we compared the transcriptomes of daphnids reared under the long-day (female) condition with short-day (male) and MF-treated (male) conditions. We found that genes involved in ionotropic glutamate receptors, known to mediate the vast majority of excitatory neurotransmitting processes in various organisms, were significantly activated in daphnids by the short-day condition but not by MF treatment. Administration of specific agonists and antagonists, especially for the N-methyl-D-aspartic acid (NMDA) receptor, strongly increased or decreased, respectively, the proportion of male-producing mothers. Moreover, we also identified genes responsible for male production (e.g., protein kinase C pathway-related genes). Such genes were generally shared between the short-day reared and MF-treated daphnids. We identified several candidate genes regulating ESD which strongly suggests that these genes may be essential factors for male offspring production as an

Principles for RNA metabolism and alternative transcription initiation within closely spaced promoters

DEFF Research Database (Denmark)

Chen, Yun; Pai, Athma A; Herudek, Jan

2016-01-01

Mammalian transcriptomes are complex and formed by extensive promoter activity. In addition, gene promoters are largely divergent and initiate transcription of reverse-oriented promoter upstream transcripts (PROMPTs). Although PROMPTs are commonly terminated early, influenced by polyadenylation s...... suggest that basic building blocks of divergently transcribed core promoter pairs, in combination with the wealth of TSSs in mammalian genomes, provide a framework with which evolution shapes transcriptomes.......Mammalian transcriptomes are complex and formed by extensive promoter activity. In addition, gene promoters are largely divergent and initiate transcription of reverse-oriented promoter upstream transcripts (PROMPTs). Although PROMPTs are commonly terminated early, influenced by polyadenylation...

Monitoring upstream sinkhole development by detailed sonar profiling

Energy Technology Data Exchange (ETDEWEB)

Rigbey, S. [Acres International Ltd., Niagara Falls, ON (Canada)

2004-09-01

This paper describes the development and use of a simple sonar system that has been used by engineers for routine monitoring of small sinkholes on the upstream face of a distressed earth dam. Improper construction of the dam led to the development of several sinkholes measuring 10 to 20 m in diameter upstream from the dam which is founded on deep alluvial sands and gravels. The dam has a central core of silt and leakage varies between 200 and 500 l/s, depending on the water level of the reservoir. The main issues with the upstream blanket are: improper fill placement due to the inability to dewater the area properly; omission of a filter material between the blanket and the alluvium foundation; thin placement of fill and runnelling of the blanket prior to impoundment; and, short upstream extent of the blanket. A downstream weighting toe of material was placed to address the seepage and piping that developed immediately following impounding. Other incidents continued over the years, such as downstream sinkholes, slumping of the crest and repairs about 12 years after construction. An inverter filter was also constructed to better control the seepage. Simple bathymetric surveys conducted by sounding the bottom of the reservoir from the ice surface each winter revealed the presence of several large sinkholes. Although infilling programs were conducted, sinkholes redeveloped after each program. The bathymetric surveys were found to be limited in accuracy and repeatability. Therefore, it was not possible to monitor small developments on a yearly basis. A 3-dimensional seepage model was developed to reconcile some of the unexplained piezometric patterns and to better understand the seepage patterns. However, this was also unsuccessful on its own. A trial sonar survey was then undertaken in 2002 by a Vancouver-based sonar company using an Imagenix profiling sonar head. It was successful in locating a small, previously unknown sinkhole measuring a few metres in diameter at

Upstream Disaster Management to Support People Experiencing Homelessness.

Science.gov (United States)

Sundareswaran, Madura; Ghazzawi, Andrea; O'Sullivan, Tracey L

2015-08-18

The unique context of day-to-day living for people who are chronically homeless or living with housing insecurity puts them at high risk during community disasters. The impacts of extreme events, such as flooding, storms, riots, and other sources of community disruption, underscore the importance of preparedness efforts and fostering community resilience. This study is part of larger initiative focused on enhancing resilience and preparedness among high risk populations. The purpose of this study was to explore critical issues and strategies to promote resilience and disaster preparedness among people who are homeless in Canada. A sample of interviews (n=21) from key informants across Canada was analyzed to explore existing programs and supports for homeless populations. The data was selected from a larger sample of (n=43) interviews focused on programs and supports for people who are at heightened risk for negative impacts during disasters. Qualitative content analysis was used to extract emergent themes and develop a model of multi-level collaboration to support disaster resilience among people who are homeless. The results indicate there is a need for more upstream continuity planning, collaboration and communication between the emergency management sector and community service organizations that support people who are homeless. Prioritization and investment in the social determinants of health and community supports is necessary to promote resilience among this high-risk population. The findings from this study highlight the importance of acknowledging community support organizations as assets in disaster preparedness. Day-to-day resilience is an ongoing theme for people who are chronically homeless or living with housing insecurity. Upstream investment to build adaptive capacity and collaborate with community organizations is an important strategy to enhance community resilience.

Isolation and functional characterization of Lycopene β-cyclase (CYC-B promoter from Solanum habrochaites

Directory of Open Access Journals (Sweden)

Chinnusamy Viswanathan

2010-04-01

Full Text Available Abstract Background Carotenoids are a group of C40 isoprenoid molecules that play diverse biological and ecological roles in plants. Tomato is an important vegetable in human diet and provides the vitamin A precursor β-carotene. Genes encoding enzymes involved in carotenoid biosynthetic pathway have been cloned. However, regulation of genes involved in carotenoid biosynthetic pathway and accumulation of specific carotenoid in chromoplasts are not well understood. One of the approaches to understand regulation of carotenoid metabolism is to characterize the promoters of genes encoding proteins involved in carotenoid metabolism. Lycopene β-cyclase is one of the crucial enzymes in carotenoid biosynthesis pathway in plants. Its activity is required for synthesis of both α-and β-carotenes that are further converted into other carotenoids such as lutein, zeaxanthin, etc. This study describes the isolation and characterization of chromoplast-specific Lycopene β-cyclase (CYC-B promoter from a green fruited S. habrochaites genotype EC520061. Results A 908 bp region upstream to the initiation codon of the Lycopene β-cyclase gene was cloned and identified as full-length promoter. To identify promoter region necessary for regulating developmental expression of the ShCYC-B gene, the full-length promoter and its three different 5' truncated fragments were cloned upstream to the initiation codon of GUS reporter cDNA in binary vectors. These four plant transformation vectors were separately transformed in to Agrobacterium. Agrobacterium-mediated transient and stable expression systems were used to study the GUS expression driven by the full-length promoter and its 5' deletion fragments in tomato. The full-length promoter showed a basal level activity in leaves, and its expression was upregulated > 5-fold in flowers and fruits in transgenic tomato plants. Deletion of -908 to -577 bp 5' to ATG decreases the ShCYC-B promoter strength, while deletion of -908

Short-term azithromycin treatment promotes cornea allograft survival in the rat.

Science.gov (United States)

Wacker, Katrin; Denker, Sophy; Hildebrand, Antonia; Eberwein, Philipp; Reinhard, Thomas; Schwartzkopff, Johannes

2013-01-01

Any inflammatory response following corneal transplantation may induce rejection and irreversible graft failure. The purpose of this study is to analyze the anti-inflammatory effect of azithromycin (AZM) following experimental keratoplasty in rats. Corneal transplants were performed between Fisher-donor and Lewis-recipient rats. Recipients were postoperatively treated three times daily with AZM, miglyol, ofloxacin or dexamethasone eye drops. As an additional control, AZM was applied following syngeneic keratoplasty. Furthermore, short-term treatments with AZM for seven days perioperatively or with AZM only three days prior to the transplantation were compared to appropriate controls. All transplants were monitored clinically for opacity, edema, and vascularization. Infiltrating CD45(+), CD4(+), CD8(+), CD25(+), CD161(+) and CD163(+) cells were quantified via immunohistochemistry. AZM significantly promoted corneal graft survival compared with miglyol or ofloxacin treatment. This effect was comparable to topical dexamethasone. No adverse AZM effect was observed. Histology confirmed a significant reduction of infiltrating leukocytes. The short-term application of AZM for three days prior to transplantation or for seven days perioperatively reduced corneal graft rejection significantly compared with the controls. Along with antibiotic properties, topical AZM has a strong anti-inflammatory effect. Following keratoplasty, this effect is comparable to topical dexamethasone without the risk of steroid-induced adverse effects. Short-term treatment with AZM three days prior to the transplantation was sufficient to promote graft survival in the rat keratoplasty model. We therefore suggest further assessing the anti-inflammatory function of topical AZM following keratoplasty in humans.

Short-term azithromycin treatment promotes cornea allograft survival in the rat.

Directory of Open Access Journals (Sweden)

Katrin Wacker

Full Text Available Any inflammatory response following corneal transplantation may induce rejection and irreversible graft failure. The purpose of this study is to analyze the anti-inflammatory effect of azithromycin (AZM following experimental keratoplasty in rats.Corneal transplants were performed between Fisher-donor and Lewis-recipient rats. Recipients were postoperatively treated three times daily with AZM, miglyol, ofloxacin or dexamethasone eye drops. As an additional control, AZM was applied following syngeneic keratoplasty. Furthermore, short-term treatments with AZM for seven days perioperatively or with AZM only three days prior to the transplantation were compared to appropriate controls. All transplants were monitored clinically for opacity, edema, and vascularization. Infiltrating CD45(+, CD4(+, CD8(+, CD25(+, CD161(+ and CD163(+ cells were quantified via immunohistochemistry.AZM significantly promoted corneal graft survival compared with miglyol or ofloxacin treatment. This effect was comparable to topical dexamethasone. No adverse AZM effect was observed. Histology confirmed a significant reduction of infiltrating leukocytes. The short-term application of AZM for three days prior to transplantation or for seven days perioperatively reduced corneal graft rejection significantly compared with the controls.Along with antibiotic properties, topical AZM has a strong anti-inflammatory effect. Following keratoplasty, this effect is comparable to topical dexamethasone without the risk of steroid-induced adverse effects. Short-term treatment with AZM three days prior to the transplantation was sufficient to promote graft survival in the rat keratoplasty model. We therefore suggest further assessing the anti-inflammatory function of topical AZM following keratoplasty in humans.

Upstream CREs participate in the basal activity of minute virus of mice promoter P4 and in its stimulation in ras-transformed cells.

Science.gov (United States)

Perros, M; Deleu, L; Vanacker, J M; Kherrouche, Z; Spruyt, N; Faisst, S; Rommelaere, J

1995-01-01

The activity of the P4 promoter of the parvovirus minute virus of mice (prototype strain MVMp) is stimulated in ras-transformed FREJ4 cells compared with the parental FR3T3 line. This activation may participate in the oncolytic effect of parvoviruses, given that P4 drives a transcriptional unit encoding cytotoxic nonstructural proteins. Our results suggest that the higher transcriptional activity of promoter P4 in FREJ4 cells is mediated at least in part by upstream CRE elements. Accordingly, mutations in the CRE motifs impair P4 function more strongly in the FREJ4 derivative than in its FR3T3 parent. Further evidence that these elements contribute to hyperactivity of the P4 promoter in the ras transformant is the fact that they form distinct complexes with proteins from FREJ4 and FR3T3 cell extracts. This difference can be abolished by treating the FREJ4 cell extracts with cyclic AMP-dependent protein kinase (PKA) or treating original cultures with a PKA activator. These findings can be linked with two previously reported features of ras-transformed cells: the activation of a PKA-inhibited protein kinase cascade and the reduction of PKA-induced protein phosphorylation. In keeping with these facts, P4-directed gene expression can be up- or downmodulated in vivo by exposing cells to known inhibitors or activators of PKA, respectively. PMID:7636996

MESSENGER Magnetic Field Observations of Upstream Ultra-Low Frequency Waves at Mercury

Science.gov (United States)

Le, G.; Chi, P. J.; Boardsen, S.; Blanco-Cano, X.; Anderosn, B. J.; Korth, H.

2012-01-01

The region upstream from a planetary bow shock is a natural plasma laboratory containing a variety of wave particle phenomena. The study of foreshocks other than the Earth's is important for extending our understanding of collisionless shocks and foreshock physics since the bow shock strength varies with heliocentric distance from the Sun, and the sizes of the bow shocks are different at different planets. The Mercury's bow shock is unique in our solar system as it is produced by low Mach number solar wind blowing over a small magnetized body with a predominately radial interplanetary magnetic field. Previous observations of Mercury upstream ultra-low frequency (ULF) waves came exclusively from two Mercury flybys of Mariner 10. The MESSENGER orbiter data enable us to study of upstream waves in the Mercury's foreshock in depth. This paper reports an overview of upstream ULF waves in the Mercury's foreshock using high-time resolution magnetic field data, 20 samples per second, from the MESSENGER spacecraft. The most common foreshock waves have frequencies near 2 Hz, with properties similar to the I-Hz waves in the Earth's foreshock. They are present in both the flyby data and in every orbit of the orbital data we have surveyed. The most common wave phenomenon in the Earth's foreshock is the large-amplitude 30-s waves, but similar waves at Mercury have frequencies at near 0.1 Hz and occur only sporadically with short durations (a few wave cycles). Superposed on the "30-s" waves, there are spectral peaks at near 0.6 Hz, not reported previously in Mariner 10 data. We will discuss wave properties and their occurrence characteristics in this paper.

Detailed study of electron plasma waves upstream of the earth's bow shock

International Nuclear Information System (INIS)

Etcheto, J.; Faucheux, M.

1984-01-01

A detailed study of electron plasma waves observed upstream of the earth's bow shock and of their relationships to the position of the satellite in the foreshock and to the electron measurements has been carried out. The wave characteristics depend on the position in the electron foreshock: a narrow-bnd (a few percent) and intense (a few millivolts per meter) noise is observed at the plasma frequency at the edge of the foreshock while the spectrum widens (Δf/fapprox. =0.3) at the same time as the power decreases (hundreds of microvolts per meter) deeper (a few earth radii) inside the foreshock. Signals below the plasma frequency are also observed. These waves are polarized along the magnetic field, with long wavelengths below and at the plasma frequency and short wavelengths above it. They appear as short bursts, the duration of which depends on the frequency: longer close to the plasma frequency (50 ms), they shorten with increasing separation from the plasma frequency, the usual duration being 15 ms. While the correlation of the wave characteristics with the reflected electrons is good as the satellite moves inside the foreshock, no evolution is found with the distance to the bow shock, neither for the noise nor for the particles. These results are discussed in the frame of various mechanisms which have been proposed to explain these upstream waves but no satisfactory agreement is found with any of them

Viral Vector-Based Dissection of Marmoset GFAP Promoter in Mouse and Marmoset Brains.

Directory of Open Access Journals (Sweden)

Yoichiro Shinohara

Full Text Available Adeno-associated virus (AAV vectors are small in diameter, diffuse easily in the brain, and represent a highly efficient means by which to transfer a transgene to the brain of a large animal. A major demerit of AAV vectors is their limited accommodation capacity for transgenes. Thus, a compact promoter is useful when delivering large transgenes via AAV vectors. In the present study, we aimed to identify the shortest astrocyte-specific GFAP promoter region that could be used for AAV-vector-mediated transgene expression in the marmoset brain. The 2.0-kb promoter region upstream of the GFAP gene was cloned from the marmoset genome, and short promoters (1.6 kb, 1.4 kb, 0.6 kb, 0.3 kb and 0.2 kb were obtained by progressively deleting the original 2.0-kb promoter from the 5' end. The short promoters were screened in the mouse cerebellum in terms of their strength and astrocyte specificity. We found that the 0.3-kb promoter maintained 40% of the strength of the original 2.0-kb promoter, and approximately 90% of its astrocyte specificity. These properties were superior to those of the 1.4-kb, 0.6-kb (20% promoter strength and 0.2-kb (70% astrocyte specificity promoters. Then, we verified whether the 0.3-kb GFAP promoter retained astrocyte specificity in the marmoset cerebral cortex. Injection of viral vectors carrying the 0.3-kb marmoset GFAP promoter specifically transduced astrocytes in both the cerebral cortex and cerebellar cortex of the marmoset. These results suggest that the compact 0.3-kb promoter region serves as an astrocyte-specific promoter in the marmoset brain, which permits us to express a large gene by AAV vectors that have a limited accommodation capacity.

Interaction of a nodule specific, trans-acting factor with distinct DNA elements in the soybean leghaemoglobin Ibc(3) 5' upstream region

DEFF Research Database (Denmark)

Jensen, Erik Østergaard; Marcker, Kjeld A; Schell, J

1988-01-01

Nuclear extracts from soybean nodules, leaves and roots were used to investigate protein-DNA interactions in the 5' upstream (promoter) region of the soybean leghaemoglobin lbc(3) gene. Two distinct regions were identified which strongly bind a nodule specific factor. A Bal31 deletion analysis......, but with different affinities. Elements 1 and 2 share a common motif, although their AT-rich DNA sequences differ. Element 2 is highly conserved at an analogous position in other soybean lb gene 5' upstream regions. Udgivelsesdato: 1988-May...

Distribution of CpG Motifs in Upstream Gene Domains in a Reef Coral and Sea Anemone: Implications for Epigenetics in Cnidarians.

Science.gov (United States)

Marsh, Adam G; Hoadley, Kenneth D; Warner, Mark E

2016-01-01

Coral reefs are under assault from stressors including global warming, ocean acidification, and urbanization. Knowing how these factors impact the future fate of reefs requires delineating stress responses across ecological, organismal and cellular scales. Recent advances in coral reef biology have integrated molecular processes with ecological fitness and have identified putative suites of temperature acclimation genes in a Scleractinian coral Acropora hyacinthus. We wondered what unique characteristics of these genes determined their coordinate expression in response to temperature acclimation, and whether or not other corals and cnidarians would likewise possess these features. Here, we focus on cytosine methylation as an epigenetic DNA modification that is responsive to environmental stressors. We identify common conserved patterns of cytosine-guanosine dinucleotide (CpG) motif frequencies in upstream promoter domains of different functional gene groups in two cnidarian genomes: a coral (Acropora digitifera) and an anemone (Nematostella vectensis). Our analyses show that CpG motif frequencies are prominent in the promoter domains of functional genes associated with environmental adaptation, particularly those identified in A. hyacinthus. Densities of CpG sites in upstream promoter domains near the transcriptional start site (TSS) are 1.38x higher than genomic background levels upstream of -2000 bp from the TSS. The increase in CpG usage suggests selection to allow for DNA methylation events to occur more frequently within 1 kb of the TSS. In addition, observed shifts in CpG densities among functional groups of genes suggests a potential role for epigenetic DNA methylation within promoter domains to impact functional gene expression responses in A. digitifera and N. vectensis. Identifying promoter epigenetic sequence motifs among genes within specific functional groups establishes an approach to describe integrated cellular responses to environmental stress in

Distribution of CpG Motifs in Upstream Gene Domains in a Reef Coral and Sea Anemone: Implications for Epigenetics in Cnidarians.

Directory of Open Access Journals (Sweden)

Adam G Marsh

Full Text Available Coral reefs are under assault from stressors including global warming, ocean acidification, and urbanization. Knowing how these factors impact the future fate of reefs requires delineating stress responses across ecological, organismal and cellular scales. Recent advances in coral reef biology have integrated molecular processes with ecological fitness and have identified putative suites of temperature acclimation genes in a Scleractinian coral Acropora hyacinthus. We wondered what unique characteristics of these genes determined their coordinate expression in response to temperature acclimation, and whether or not other corals and cnidarians would likewise possess these features. Here, we focus on cytosine methylation as an epigenetic DNA modification that is responsive to environmental stressors. We identify common conserved patterns of cytosine-guanosine dinucleotide (CpG motif frequencies in upstream promoter domains of different functional gene groups in two cnidarian genomes: a coral (Acropora digitifera and an anemone (Nematostella vectensis. Our analyses show that CpG motif frequencies are prominent in the promoter domains of functional genes associated with environmental adaptation, particularly those identified in A. hyacinthus. Densities of CpG sites in upstream promoter domains near the transcriptional start site (TSS are 1.38x higher than genomic background levels upstream of -2000 bp from the TSS. The increase in CpG usage suggests selection to allow for DNA methylation events to occur more frequently within 1 kb of the TSS. In addition, observed shifts in CpG densities among functional groups of genes suggests a potential role for epigenetic DNA methylation within promoter domains to impact functional gene expression responses in A. digitifera and N. vectensis. Identifying promoter epigenetic sequence motifs among genes within specific functional groups establishes an approach to describe integrated cellular responses to

Force control tasks with pure haptic feedback promote short-term focused attention.

Science.gov (United States)

Wang, Dangxiao; Zhang, Yuru; Yang, Xiaoxiao; Yang, Gaofeng; Yang, Yi

2014-01-01

Focused attention has great impact on our quality of life. Our learning, social skills and even happiness are closely intertwined with our capacity for focused attention. Attention promotion is replete with examples of training-induced increases in attention capability, most of which rely on visual and auditory stimulation. Pure haptic stimulation to increase attention capability is rarely found. We show that accurate force control tasks with pure haptic feedback enhance short-term focused attention. Participants were trained by a force control task in which information from visual and auditory channels was blocked, and only haptic feedback was provided. The trainees were asked to exert a target force within a pre-defined force tolerance for a specific duration. The tolerance was adaptively modified to different levels of difficulty to elicit full participant engagement. Three attention tests showed significant changes in different aspects of focused attention in participants who had been trained as compared with those who had not, thereby illustrating the role of haptic-based sensory-motor tasks in the promotion of short-term focused attention. The findings highlight the potential value of haptic stimuli in brain plasticity and serve as a new tool to extend existing computer games for cognitive enhancement.

Upstream cash cloud

International Nuclear Information System (INIS)

Shepherd, R.

1998-01-01

This paper focuses on the effects of the slowdown in budgetary growth on the upstream business and offshore services. The dangers facing investors, the strong growth in energy demand, oil company priorities, the dip in profits of the oil companies, new field economics, the budgets for exploration and production, and the rig market outlook are discussed. (UK)

Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes

International Nuclear Information System (INIS)

Nalcacioglu, Remziye; Marks, Hendrik; Vlak, Just M.; Demirbag, Zihni; Oers, Monique M. van

2003-01-01

The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an immediate-early gene and confirmed that the major capsid protein (MCP) is a late gene. Transcription of DNApol initiated 35 nt upstream and that of MCP 14 nt upstream of the translational start site. In a luciferase reporter gene assay both promoters were active only when cells were infected with CIV. For DNApol sequences between position -27 and -6, relative to the transcriptional start site, were essential for promoter activity. Furthermore, mutation of a G within the sequence TTGTTTT located just upstream of the DNApol transcription initiation site reduced the promoter activity by 25%. Sequences crucial for MCP promoter activity are located between positions -53 and -29

Short-term biomarkers of tumor promotion in mouse skin treated with petroleum middle distillates.

Science.gov (United States)

Walborg, E F; DiGiovanni, J; Conti, C J; Slaga, T J; Freeman, J J; Steup, D R; Skisak, C M

1998-10-01

Topical application of certain petroleum middle distillates (PMD) to mice produces skin tumors after long latency, and initiation/promotion protocols indicate that this effect is associated with their tumor promoting activity. Since induction of sustained, potentiated epidermal hyperplasia is predictive of promoting activity, five compositionally distinct PMD [hydrodesulfurized kerosene (API 81-07); hydrodesulfurized PMD (API 81-10); odorless light petroleum hydrocarbons; severely hydrotreated light vacuum distillate (LVD); and lightly refined paraffinic oil (LRPO)] were assessed for their effects on epidermal hyperplasia. PMD were administered (2 x/week for 2 weeks) to skin of CD-1 mice. Four quantitative biomarkers of epidermal hyperplasia were evaluated: epidermal thickness, number of nucleated epidermal cells per unit length of basement membrane, labeling (BrdUrd) index of epidermal cells, and induction of epidermal ornithine decarboxylase (ODC) activity. As positive controls, 12-O-tetradecanoylphorbol-13-acetate (TPA) and n-dodecane were utilized. PMD-induced skin irritation was evaluated visually and/or histopathologically. All five PMD produced dose-dependent, skin irritation and epidermal hyperplasia. On a weight basis the magnitude of the maximal PMD-induced effects was similar to that produced by n-dodecane, but > 1000-fold less than that produced by TPA. Epidermal hyperplasia and subacute skin irritancy produced by the five PMD were similar. Of the four short-term markers of tumor promotion assessed, labeling index and epidermal ODC activity were predictive of the relative promoting activities of those PMD for which tumorigenicity bioassay data are available, i.e., API 81-07 > API 81-10 > LRPO. An apparent discrepancy to the predictability of epidermal ODC activity occurred with LRPO:toluene [1:1 (v/v)]. This mixture is nontumorigenic, yet significantly induced epidermal ODC activity. This mixture, however, produced severe epidermal toxicity that

Cloning and functional analysis of 5'-upstream region of the Pokemon gene.

Science.gov (United States)

Yang, Yutao; Zhou, Xiaowei; Zhu, Xudong; Zhang, Chuanfu; Yang, Zhixin; Xu, Long; Huang, Peitang

2008-04-01

Pokemon, the POK erythroid myeloid ontogenic factor, not only regulates the expression of many genes, but also plays an important role in cell tumorigenesis. To investigate the molecular mechanism regulating expression of the Pokemon gene in humans, its 5'-upstream region was cloned and analyzed. Transient analysis revealed that the Pokemon promoter is constitutive. Deletion analysis and a DNA decoy assay indicated that the NEG-U and NEG-D elements were involved in negative regulation of the Pokemon promoter, whereas the POS-D element was mainly responsible for its strong activity. Electrophoretic mobility shift assays suggested that the NEG-U, NEG-D and POS-D elements were specifically bound by the nuclear extract from A549 cells in vitro. Mutation analysis demonstrated that cooperation of the NEG-U and NEG-D elements led to negative regulation of the Pokemon promoter. Moreover, the NEG-U and NEG-D elements needed to be an appropriate distance apart in the Pokemon promoter in order to cooperate. Taken together, our results elucidate the mechanism underlying the regulation of Pokemon gene transcription, and also define a novel regulatory sequence that may be used to decrease expression of the Pokemon gene in cancer gene therapy.

Kin28 regulates the transient association of Mediator with core promoters.

Science.gov (United States)

Jeronimo, Célia; Robert, François

2014-05-01

Mediator is an essential, broadly used eukaryotic transcriptional coactivator. How and what Mediator communicates from activators to RNA polymerase II (RNAPII) remains an open question. Here we performed genome-wide location profiling of Saccharomyces cerevisiae Mediator subunits. Mediator is not found at core promoters but rather occupies the upstream activating sequence, upstream of the pre-initiation complex. In the absence of Kin28 (CDK7) kinase activity or in cells in which the RNAPII C-terminal domain is mutated to replace Ser5 with alanine, however, Mediator accumulates at core promoters together with RNAPII. We propose that Mediator is released quickly from promoters after phosphorylation of Ser5 by Kin28 (CDK7), which also allows for RNAPII to escape from the promoter.

Comparative Analysis of Chloroplast psbD Promoters in Terrestrial Plants

Directory of Open Access Journals (Sweden)

Shuichi Shimmura

2017-07-01

Full Text Available The transcription of photosynthesis genes encoded by the plastid genome is mainly mediated by a prokaryotic-type RNA polymerase called plastid-encoded plastid RNA polymerase (PEP. Standard PEP-dependent promoters resemble bacterial sigma-70-type promoters containing the so-called -10 and -35 elements. On the other hand, an unusual light- and stress-responsive promoter (psbD LRP that is regulated by a 19-bp AAG-box immediately upstream of the -35 element has been mapped upstream of the psbD-psbC operon in some angiosperms. However, the occurrence of the AAG-box containing psbD LRP in plant evolution remains elusive. We have mapped the psbD promoters in eleven embryophytes at different evolutionary stages from liverworts to angiosperms. The psbD promoters were mostly mapped around 500–900 bp upstream of the psbD translational start sites, indicating that the psbD mRNAs have unusually long 5′-UTR extensions in common. The -10 elements of the psbD promoter are well-conserved in all embryophytes, but not the -35 elements. We found that the AAG-box sequences are highly conserved in angiosperms and gymnosperms except for gnetaceae plants. Furthermore, partial AAG-box-like sequences have been identified in the psbD promoters of some basal embryophytes such as moss, hornwort, and lycophyte, whereas liverwort has the standard PEP promoter without the AAG-box. These results suggest that the AAG-box sequences of the psbD LRP may have evolved from a primitive type of AAG-box of basal embryophytes. On the other hand, monilophytes (ferns use another type of psbD promoter composed of a distinct cis-element upstream of the potential -35 element. Furthermore, we found that psbD expression is not regulated by light in gymnosperms or basal angiosperms, although they have the well-conserved AAG-box sequences. Thus, it is unlikely that acquisition of the AAG-box containing psbD promoter is directly associated with light-induced transcription of the psb

Sequence motif upstream of the Hendra virus fusion protein cleavage site is not sufficient to promote efficient proteolytic processing

International Nuclear Information System (INIS)

Craft, Willie Warren; Dutch, Rebecca Ellis

2005-01-01

The Hendra virus fusion (HeV F) protein is synthesized as a precursor, F 0 , and proteolytically cleaved into the mature F 1 and F 2 heterodimer, following an HDLVDGVK 109 motif. This cleavage event is required for fusogenic activity. To determine the amino acid requirements for processing of the HeV F protein, we constructed multiple mutants. Individual and simultaneous alanine substitutions of the eight residues immediately upstream of the cleavage site did not eliminate processing. A chimeric SV5 F protein in which the furin site was substituted for the VDGVK 109 motif of the HeV F protein was not processed but was expressed on the cell surface. Another chimeric SV5 F protein containing the HDLVDGVK 109 motif of the HeV F protein underwent partial cleavage. These data indicate that the upstream region can play a role in protease recognition, but is neither absolutely required nor sufficient for efficient processing of the HeV F protein

Upstream Atlantic salmon (Salmo salar) passage

International Nuclear Information System (INIS)

Clay, C.H.

1993-01-01

Upstream salmon passage though a dam is discussed with respect to three main components: the fishway entrance, the fishway, and the exit. Design considerations and alternative types of components are presented. For fishway entrances, an important consideration is the positioning of the entrance as far upstream as the fish can swim with respect to obstacles. For powerhouses using water diverted from a river, the problem of leading fish past the powerhouse may be overcome by either installing a tailrace barrier or increasing the flow until the home stream odor is sufficient to attract fish. Swimming ability should be the first consideration in fishway design. Fishways with 50 cm drops per pool would be satisfactory in most cases. The problem of headwater fluctuation is overcome through careful fishway selection. Fish locks, hoists, and elevators are other alternatives to pool/weir fishways. The location for a fish exit must be decided on the basis of whether the fishway will be used only for upstream migrations. 5 refs., 1 fig., 1 tab

Development and validation of the short-form Adolescent Health Promotion Scale.

Science.gov (United States)

Chen, Mei-Yen; Lai, Li-Ju; Chen, Hsiu-Chih; Gaete, Jorge

2014-10-26

Health-promoting lifestyle choices of adolescents are closely related to current and subsequent health status. However, parsimonious yet reliable and valid screening tools are scarce. The original 40-item adolescent health promotion (AHP) scale was developed by our research team and has been applied to measure adolescent health-promoting behaviors worldwide. The aim of our study was to examine the psychometric properties of a newly developed short-form version of the AHP (AHP-SF) including tests of its reliability and validity. The study was conducted in nine middle and high schools in southern Taiwan. Participants were 814 adolescents randomly divided into two subgroups with equal size and homogeneity of baseline characteristics. The first subsample (calibration sample) was used to modify and shorten the factorial model while the second subsample (validation sample) was utilized to validate the result obtained from the first one. The psychometric testing of the AHP-SF included internal reliability of McDonald's omega and Cronbach's alpha, convergent validity, discriminant validity, and construct validity with confirmatory factor analysis (CFA). The results of the CFA supported a six-factor model and 21 items were retained in the AHP-SF with acceptable model fit. For the discriminant validity test, results indicated that adolescents with lower AHP-SF scores were more likely to be overweight or obese, skip breakfast, and spend more time watching TV and playing computer games. The AHP-SF also showed excellent internal consistency with a McDonald's omega of 0.904 (Cronbach's alpha 0.905) in the calibration group. The current findings suggest that the AHP-SF is a valid and reliable instrument for the evaluation of adolescent health-promoting behaviors. Primary health care providers and clinicians can use the AHP-SF to assess these behaviors and evaluate the outcome of health promotion programs in the adolescent population.

Interaction of Energetic Particles with Discontinuities Upstream of Strong Shocks

Science.gov (United States)

Malkov, Mikhail; Diamond, Patrick

2008-11-01

Acceleration of particles in strong astrophysical shocks is known to be accompanied and promoted by a number of instabilities which are driven by the particles themselves. One of them is an acoustic (also known as Drury's) instability driven by the pressure gradient of accelerated particles upstream. The generated sound waves naturally steepen into shocks thus forming a shocktrain. Similar magnetoacoustic or Alfven type structures may be driven by pick-up ions, for example. We consider the solutions of kinetic equation for accelerated particles within the shocktrain. The accelerated particles are assumed to be coupled to the flow by an intensive pitch-angle scattering on the self-generated Alfven waves. The implications for acceleration and confinement of cosmic rays in this shock environment will be discussed.

Upstream health law.

Science.gov (United States)

Sage, William M; McIlhattan, Kelley

2014-01-01

For the first time, entrepreneurs are aggressively developing new technologies and business models designed to improve individual and population health, not just to deliver specialized medical care. Consumers of these goods and services are not yet "patients"; they are simply people. As this sector of the health care industry expands, it is likely to require new forms of legal governance, which we term "upstream health law." © 2014 American Society of Law, Medicine & Ethics, Inc.

Suspended-sediment loads, reservoir sediment trap efficiency, and upstream and downstream channel stability for Kanopolis and Tuttle Creek Lakes, Kansas, 2008-10

Science.gov (United States)

Juracek, Kyle E.

2011-01-01

Continuous streamflow and turbidity data collected from October 1, 2008, to September 30, 2010, at streamgage sites upstream and downstream from Kanopolis and Tuttle Creek Lakes, Kansas, were used to compute the total suspended-sediment load delivered to and released from each reservoir as well as the sediment trap efficiency for each reservoir. Ongoing sedimentation is decreasing the ability of the reservoirs to serve several purposes including flood control, water supply, and recreation. River channel stability upstream and downstream from the reservoirs was assessed using historical streamgage information. For Kanopolis Lake, the total 2-year inflow suspended-sediment load was computed to be 600 million pounds. Most of the suspended-sediment load was delivered during short-term, high-discharge periods. The total 2-year outflow suspended-sediment load was computed to be 31 million pounds. Sediment trap efficiency for the reservoir was estimated to be 95 percent. The mean annual suspended-sediment yield from the upstream basin was estimated to be 129,000 pounds per square mile per year. No pronounced changes in channel width were evident at five streamgage sites located upstream from the reservoir. At the Ellsworth streamgage site, located upstream from the reservoir, long-term channel-bed aggradation was followed by a period of stability. Current (2010) conditions at five streamgages located upstream from the reservoir were typified by channel-bed stability. At the Langley streamgage site, located immediately downstream from the reservoir, the channel bed degraded 6.15 feet from 1948 to 2010. For Tuttle Creek Lake, the total 2-year inflow suspended-sediment load was computed to be 13.3 billion pounds. Most of the suspended-sediment load was delivered during short-term, high-discharge periods. The total 2-year outflow suspended-sediment load was computed to be 327 million pounds. Sediment trap efficiency for the reservoir was estimated to be 98 percent. The mean

Analysis of the pelE promoter in Erwinia chrysanthemi EC16.

Science.gov (United States)

Gold, S; Nishio, S; Tsuyumu, S; Keen, N T

1992-01-01

The pelE gene of Erwinia chrysanthemi strain EC16 encodes an extracellular pectate lyase protein that is important in virulence on plants. Control of pelE expression is complex, because the gene is regulated by catabolite repression, substrate induction, and growth-phase inhibition. A Tn7-lux reporter gene system was employed to define DNA sequences comprising the pelE promoter. When EC16 cells were grown on medium containing sodium polypectate, pelE transcriptional start sites were observed only at 95 and 96 bases upstream of the translational start site. However, DNA sequences required for pelE expression were also shown by deletion analysis to reside between 196 and 215 base pairs upstream of the translational start site. In addition to these upstream elements, two putative operator sequences that interact with negative regulatory factors occurred downstream of the transcriptional start. Finally, deletion of three bases from a putative catabolite gene activator protein binding site in the pelE promoter eliminated activity. The data demonstrate that the pelE promoter is complex and suggest that it interacts with several regulatory proteins.

Energetic particle diffusion coefficients upstream of quasi-parallel interplanetary shocks

Science.gov (United States)

Tan, L. C.; Mason, G. M.; Gloeckler, G.; Ipavich, F. M.

1989-01-01

The properties of about 30 to 130-keV/e protons and alpha particles upstream of six quasi-parallel interplanetary shocks that passed by the ISEE 3 spacecraft during 1978-1979 were analyzed, and the values for the upstream energegic particle diffusion coefficient, kappa, in these six events were deduced for a number of energies and upstream positions. These observations were compared with predictions of Lee's (1983) theory of shock acceleration. It was found that the observations verified the prediction of the A/Q dependence (where A and Q are the particle atomic mass and ionization state, respectively) of kappa for alpha and proton particles upstream of the quasi-parallel shocks.

Human Resource Local Content in Ghana's Upstream Petroleum Industry

Science.gov (United States)

Benin, Papa

Enactment of Ghana's Petroleum (Local Content and Local Participation) Regulations, 2013 (L.I. 2204) was intended to regulate the percentage of local products, personnel, financing, and goods and services rendered within Ghana's upstream petroleum industry value chain. Five years after the inception of Ghana's upstream oil and gas industry, a gap is evident between the requirements of L.I. 2204 and professional practice. Drawing on Lewin's change theory, a cross-sectional study was conducted to examine the extent of differences between the prevailing human resource local content and the requirements of L.I. 2204 in Ghana's upstream petroleum industry. The extent to which training acquired by indigenous Ghanaians seeking jobs in Ghana's oil fields affects the prevalent local content in its upstream petroleum industry was also examined. Survey data were collected from 97 management, technical, and other staff in 2 multinational petroleum companies whose oil and gas development plans have been approved by the Petroleum Commission of Ghana. To answer the research questions and test their hypotheses, one-way ANOVA was performed with staff category (management, technical, and other) as the independent variable and prevalent local content as the dependent variable. Results indicated that prevailing local content in Ghana's upstream petroleum industry meets the requirements of L.I. 2204. Further, training acquired by indigenous Ghanaians seeking jobs in Ghana's oil fields affects the prevalent local content in its offshore petroleum industry. Findings may encourage leaders within multinational oil companies and the Petroleum Commission of Ghana to organize educational seminars that equip indigenous Ghanaians with specialized skills for working in Ghana's upstream petroleum industry.

Characterization of the promoter region of the human c-erbB-2 protooncogene

International Nuclear Information System (INIS)

Ishii, S.; Imamoto, F.; Yamanashi, Y.; Toyoshima, K.; Yamamoto, T.

1987-01-01

Three overlapping genomic clones that contain the 5'-terminal portion of the human c-erbB-2 gene (ERBB2) were isolated. The promoter region was identified by nuclease S1 mapping with c-erbB-2 mRNA. Seven transcriptional start sites were identified. DNA sequence analysis showed that the promoter region contains a TATA box and a CAAT box about 30 and 80 base pairs (bp), respectively, upstream of the most downstream RNA initiation site. Two putative binding sites for transcription factor Sp1 were identified about 50 and 110 bp upstream of the CAAT box, and six GGA repeats were found between the CAAT box and the TATA box. This region had strong promoter activity when placed upstream of the bacterial chloramphenicol acetyltransferase gene and transfected into monkey CV-1 cells. These data indicate that the promoter of the human c-erbB-2 protooncogene is different from that of the protooncogene c-erbB-1 (epidermal growth factor receptor gene), which does not contain either a TATA box or a CAAT box. Comparison of the promoter sequences and activities of the two protooncogenes should be helpful in analysis of the regulatory mechanism of expression of their gene products, which are growth-factor receptors

Interplay between chromatin modulators and histone acetylation regulates the formation of accessible chromatin in the upstream regulatory region of fission yeast fbp1.

Science.gov (United States)

Adachi, Akira; Senmatsu, Satoshi; Asada, Ryuta; Abe, Takuya; Hoffman, Charles S; Ohta, Kunihiro; Hirota, Kouji

2018-05-03

Numerous noncoding RNA transcripts are detected in eukaryotic cells. Noncoding RNAs transcribed across gene promoters are involved in the regulation of mRNA transcription via chromatin modulation. This function of noncoding RNA transcription was first demonstrated for the fission yeast fbp1 gene, where a cascade of noncoding RNA transcription events induces chromatin remodeling to facilitate transcription factor binding. We recently demonstrated that the noncoding RNAs from the fbp1 upstream region facilitate binding of the transcription activator Atf1 and thereby promote histone acetylation. Histone acetylation by histone acetyl transferases (HATs) and ATP-dependent chromatin remodelers (ADCRs) are implicated in chromatin remodeling, but the interplay between HATs and ADCRs in this process has not been fully elucidated. Here, we examine the roles played by two distinct ADCRs, Snf22 and Hrp3, and by the HAT Gcn5 in the transcriptional activation of fbp1. Snf22 and Hrp3 redundantly promote disassembly of chromatin in the fbp1 upstream region. Gcn5 critically contributes to nucleosome eviction in the absence of either Snf22 or Hrp3, presumably by recruiting Hrp3 in snf22∆ cells and Snf22 in hrp3∆ cells. Conversely, Gcn5-dependent histone H3 acetylation is impaired in snf22∆/hrp3∆ cells, suggesting that both redundant ADCRs induce recruitment of Gcn5 to the chromatin array in the fbp1 upstream region. These results reveal a previously unappreciated interplay between ADCRs and histone acetylation in which histone acetylation facilitates recruitment of ADCRs, while ADCRs are required for histone acetylation.

Analysis of clustered point mutations in the human ribosomal RNA gene promoter by transient expression in vivo

International Nuclear Information System (INIS)

Jones, M.H.; Learned, R.M.; Tjian, R.

1988-01-01

The authors have mapped the cis regulatory elements required in vivo for initiation at the human rRNA promoter by RNA polymerase I. Transient expression in COS-7 cells was used to evaluate the transcription phenotype of clustered base substitution mutations in the human rRNA promoter. The promoter consists of two major elements: a large upstream region, composed of several domains, that lies between nucleotides -234 and -107 relative to the transcription initiation site and affects transcription up to 100-fold and a core element that lies between nucleotides -45 and +20 and affects transcription up to 1000-fold. The upstream regions is able to retain partial function when positioned within 100-160 nucleotides of the transcription initiation site, but it cannot stimulate transcription from distances of ≥ 600 nucleotides. In addition, they demonstrate, using mouse-human hybrid rRNA promoters, that the sequences responsible for human species-specific transcription in vivo appear to reside in both the core and upstream elements, and sequences from the mouse rRNA promoter cannot be substituted for them

Upstream oil and gas industry options paper : report of the upstream oil and gas working group of the Industry Issues Table to the National Climate Change Secretariat

International Nuclear Information System (INIS)

1999-09-01

The Canadian Association of Petroleum Producers (CAPP) has coordinated the efforts of the upstream oil and natural gas industry to draft a foundation paper to provide data on industry greenhouse gas (GHG) emissions and actions. This paper is a technical piece targeted at government officials and stakeholders involved in the National Climate Change Secretariat process. The paper also outlines the context for considering policies aimed at reducing oil and gas industry emissions on climate change. The 6 key messages that CAPP wanted to emphasize in this paper were: (1) Canada's situation is very different from that of the U.S. and most other industrial countries, (2) GHG emissions are primarily an end-use consumption issue, (3) the climate change issue and the Kyoto Protocol present a major uncertainty that could undermine Canadian oil and natural gas development opportunities, (4) Canada should not be penalised by its growth of oil and natural gas resources, (5) the ability to reduce emissions by changing production technology is limited because large reductions in Canadian upstream emissions would only mean a shift of production to other countries which would not help to reduce global emissions, and (6) Canada should focus on promoting cost-effective action, research and development and international flexibility, and ensure that recognition is given to those companies that reduce emissions. tabs., figs

Participation costs can suppress the evolution of upstream reciprocity.

Science.gov (United States)

Peña, Jorge; Pestelacci, Enea; Berchtold, André; Tomassini, Marco

2011-03-21

Indirect reciprocity, one of the many mechanisms proposed to explain the evolution of cooperation, is the idea that altruistic actions can be rewarded by third parties. Upstream or generalized reciprocity is one type of indirect reciprocity in which individuals help someone if they have been helped by somebody else in the past. Although empirically found to be at work in humans, the evolution of upstream reciprocity is difficult to explain from a theoretical point of view. A recent model of upstream reciprocity, first proposed by Nowak and Roch (2007) and further analyzed by Iwagami and Masuda (2010), shows that while upstream reciprocity alone does not lead to the evolution of cooperation, it can act in tandem with mechanisms such as network reciprocity and increase the total level of cooperativity in the population. We argue, however, that Nowak and Roch's model systematically leads to non-uniform interaction rates, where more cooperative individuals take part in more games than less cooperative ones. As a result, the critical benefit-to-cost ratios derived under this model in previous studies are not invariant with respect to the addition of participation costs. We show that accounting for these costs can hinder and even suppress the evolution of upstream reciprocity, both for populations with non-random encounters and graph-structured populations. Copyright © 2011 Elsevier Ltd. All rights reserved.

Retroactive signaling in short signaling pathways.

Directory of Open Access Journals (Sweden)

Jacques-Alexandre Sepulchre

Full Text Available In biochemical signaling pathways without explicit feedback connections, the core signal transduction is usually described as a one-way communication, going from upstream to downstream in a feedforward chain or network of covalent modification cycles. In this paper we explore the possibility of a new type of signaling called retroactive signaling, offered by the recently demonstrated property of retroactivity in signaling cascades. The possibility of retroactive signaling is analysed in the simplest case of the stationary states of a bicyclic cascade of signaling cycles. In this case, we work out the conditions for which variables of the upstream cycle are affected by a change of the total amount of protein in the downstream cycle, or by a variation of the phosphatase deactivating the same protein. Particularly, we predict the characteristic ranges of the downstream protein, or of the downstream phosphatase, for which a retroactive effect can be observed on the upstream cycle variables. Next, we extend the possibility of retroactive signaling in short but nonlinear signaling pathways involving a few covalent modification cycles.

Unveiling Mycoplasma hyopneumoniae Promoters: Sequence Definition and Genomic Distribution

Science.gov (United States)

Weber, Shana de Souto; Sant'Anna, Fernando Hayashi; Schrank, Irene Silveira

2012-01-01

Several Mycoplasma species have had their genome completely sequenced, including four strains of the swine pathogen Mycoplasma hyopneumoniae. Nevertheless, little is known about the nucleotide sequences that control transcriptional initiation in these microorganisms. Therefore, with the objective of investigating the promoter sequences of M. hyopneumoniae, 23 transcriptional start sites (TSSs) of distinct genes were mapped. A pattern that resembles the σ70 promoter −10 element was found upstream of the TSSs. However, no −35 element was distinguished. Instead, an AT-rich periodic signal was identified. About half of the experimentally defined promoters contained the motif 5′-TRTGn-3′, which was identical to the −16 element usually found in Gram-positive bacteria. The defined promoters were utilized to build position-specific scoring matrices in order to scan putative promoters upstream of all coding sequences (CDSs) in the M. hyopneumoniae genome. Two hundred and one signals were found associated with 169 CDSs. Most of these sequences were located within 100 nucleotides of the start codons. This study has shown that the number of promoter-like sequences in the M. hyopneumoniae genome is more frequent than expected by chance, indicating that most of the sequences detected are probably biologically functional. PMID:22334569

Developmental Origins, Epigenetics, and Equity: Moving Upstream.

Science.gov (United States)

Wallack, Lawrence; Thornburg, Kent

2016-05-01

The Developmental Origins of Health and Disease and the related science of epigenetics redefines the meaning of what constitutes upstream approaches to significant social and public health problems. An increasingly frequent concept being expressed is "When it comes to your health, your zip code may be more important than your genetic code". Epigenetics explains how the environment-our zip code-literally gets under our skin, creates biological changes that increase our vulnerability for disease, and even children's prospects for social success, over their life course and into future generations. This science requires us to rethink where disease comes from and the best way to promote health. It identifies the most fundamental social equity issue in our society: that initial social and biological disadvantage, established even prior to birth, and linked to the social experience of prior generations, is made worse by adverse environments throughout the life course. But at the same time, it provides hope because it tells us that a concerted focus on using public policy to improve our social, physical, and economic environments can ultimately change our biology and the trajectory of health and social success into future generations.

Identification and annotation of promoter regions in microbial ...

Indian Academy of Sciences (India)

PRAKASH KUMAR

2007-06-15

Jun 15, 2007 ... It remains important, not only to detect rarely expressed genes but also for ... well as in identifying genes associated with rRNA, tRNA and ... DNA stability; free energy calculation; promoter; upstream and downstream region.

Analysis of key thresholds leading to upstream dependencies in global transboundary water bodies

Science.gov (United States)

Munia, Hafsa Ahmed; Guillaume, Joseph; Kummu, Matti; Mirumachi, Naho; Wada, Yoshihide

2017-04-01

Transboundary water bodies supply 60% of global fresh water flow and are home to about 1/3 of the world's population; creating hydrological, social and economic interdependencies between countries. Trade-offs between water users are delimited by certain thresholds, that, when crossed, result in changes in system behavior, often related to undesirable impacts. A wide variety of thresholds are potentially related to water availability and scarcity. Scarcity can occur because of the country's own water use, and that is potentially intensified by upstream water use. In general, increased water scarcity escalates the reliance on shared water resources, which increases interdependencies between riparian states. In this paper the upstream dependencies of global transboundary river basins are examined at the scale of sub-basin areas. We aim to assess how upstream water withdrawals cause changes in the scarcity categories, such that crossing thresholds is interpreted in terms of downstream dependency on upstream water availability. The thresholds are defined for different types of water availability on which a sub-basin relies: - reliable local runoff (available even in a dry year), - less reliable local water (available in the wet year), - reliable dry year inflows from possible upstream area, and - less reliable wet year inflows from upstream. Possible upstream withdrawals reduce available water downstream, influencing the latter two water availabilities. Upstream dependencies have then been categorized by comparing a sub-basin's scarcity category across different water availability types. When population (or water consumption) grows, the sub-basin satisfies its needs using less reliable water. Thus, the factors affecting the type of water availability being used are different not only for each type of dependency category, but also possibly for every sub- basin. Our results show that, in the case of stress (impacts from high use of water), in 104 (12%) sub- basins out of

Valuating Indonesian upstream oil management scenario through system dynamics modelling

Science.gov (United States)

Ketut Gunarta, I.; Putri, F. A.

2018-04-01

Under the existing regulation in Constitution Number 22 Year 2001 (UU No 22 Tahun 2001), Production Sharing Contract (PSC) continues to be the scenario in conducting oil and gas upstream mining activities as the previous regulation (UU No. 8 Tahun 1971). Because of the high costs and risks in upstream mining activities, the contractors are dominated by foreign companies, meanwhile National Oil Company (NOC) doesn’t act much. The domination of foreign contractor companies also warned Indonesia in several issues addressing to energy independence and energy security. Therefore, to achieve the goals of energy which is independence and security, there need to be a revision in upstream oil activities regulating scenario. The scenarios will be comparing the current scenario, which is PSC, with the “full concession” scenario for National Oil Company (NOC) in managing oil upstream mining activities. Both scenario will be modelled using System Dynamics methodology and assessed furthermore using financial valuation method of income approach. Under the 2 scenarios, the author will compare which scenario is better for upstream oil management in reaching the goals mentioned before and more profitable in financial aspect. From the simulation, it is gathered that concession scenario offers better option than PSC in reaching energy independence and energy security.

The construction of a library of synthetic promoters revealed some specific features of strong Streptomyces promoters

DEFF Research Database (Denmark)

Seghezzi, Nicolas; Amar, Patrick; Købmann, Brian

2011-01-01

Streptomyces are bacteria of industrial interest whose genome contains more than 73% of bases GC. In order to define, in these GC-rich bacteria, specific sequence features of strong promoters, a library of synthetic promoters of various sequence composition was constructed in Streptomyces. To do so...... cloned into the promoter-probe plasmid pIJ487 just upstream of the promoter-less aphII gene that confers resistance to neomycin. This synthetic promoter library was transformed into Streptomyces lividans, and the resulting transformants were screened for their ability to grow in the presence of different...... projects. Thirty-eight promoters were sequenced, and the sequences of the 14 weakest and 14 strongest promoters were compared using the WebLogo software with small sample correction. This comparison revealed that the −10 box, the −10 extended motif as well as the spacer of the strong Streptomyces promoters...

Impact of a five-day short course on integration of health promotion into practice in north Queensland.

Science.gov (United States)

Devine, Susan G; Llewellyn-Jones, Lorraine; Lloyd, Jacqui

2009-04-01

Workforce development is one element of health promotion capacity building. This paper describes the extent to which participants in a five-day short course in health promotion, delivered three times in north Queensland during 2007, reported greater adoption of health promotion within their work roles, and the factors that affected the level of adoption. Out of 54 course attendees, 39 completed a post-course survey five to nine months after completing the course (72% response rate). Additionally, 11 course attendees participated in a focus group or phone interview to explore survey findings. The courses succeeded in providing knowledge, skills, confidence and enthusiasm to undertake health promotion work. Eighty per cent of participants stated they had incorporated health promotion into their work frequently or all of the time since undertaking the course. Lack of understanding of health promotion from co-workers and managers, lack of organisational support and commitment, lack of resources, competing clinical priorities, and lack of time were cited as the main barriers for undertaking health promotion. The course met participant training needs. However, similar training across all levels of staff including management may help to develop organisational capacity, thereby building a more knowledgeable workforce that is supported to undertake health promotion as a core part of an organisation's business.

Discharge Coefficient of Rectangular Short-Crested Weir with Varying Slope Coefficients

Directory of Open Access Journals (Sweden)

Yuejun Chen

2018-02-01

Full Text Available Rectangular short-crested weirs are widely used for simple structure and high discharge capacity. As one of the most important and influential factors of discharge capacity, side slope can improve the hydraulic characteristics of weirs at special conditions. In order to systemically study the effects of upstream and downstream slope coefficients S1 and S2 on overflow discharge coefficient in a rectangular short-crested weir the Volume of Fluid (VOF method and the Renormalization Group (RNG κ-ε turbulence model are used. In this study, the slope coefficient ranges from V to 3H:1V and each model corresponds to five total energy heads of H0 ranging from 8.0 to 24.0 cm. Comparisons of discharge coefficients and free surface profiles between simulated and laboratory results display a good agreement. The simulated results show that the difference of discharge coefficients will decrease with upstream slopes and increase with downstream slopes as H0 increases. For a given H0, the discharge coefficient has a convex parabolic relation with S1 and a piecewise linearity relation with S2. The maximum discharge coefficient is always obtained at S2 = 0.8. There exists a difference between upstream and downstream slope coefficients in the influence range of free surface curvatures. Furthermore, a proposed discharge coefficient equation by nonlinear regression is a function of upstream and downstream slope coefficients.

Inlet effect induced ''upstream'' critical heat flux in smooth tubes

International Nuclear Information System (INIS)

Kitto, J.B. Jr.

1986-01-01

An unusual form of ''upstream'' critical heat flux (CHF) has been observed and directly linked to the inlet flow pattern during an experimental study of high pressure (17 - 20 MPa) water flowing through a vertical 38.1 mm ID smooth bore tube with uniform axial and nonuniform circumferential heating. These upstream CHF data were characterized by temperature excursions which initially occurred at a relatively fixed axial location in the middle of the test section while the outlet and inlet heated lengths experienced no change. A rifled tube inlet flow conditioner could be substituted for a smooth tube section to generate the desired swirling inlet flow pattern. The upstream CHF data were found to match data from a uniformly heated smooth bore tube when the comparison was made using the peak local heat flux. The mechanism proposed to account for the upstream CHF observations involves the destructive interference between the decaying swirl flow and the secondary circumferential liquid flow field resulting from the one-sided heating

The role of polymorphisms in the spliced leader addition domain in determining promoter activity in Brugia malayi.

Science.gov (United States)

Bailey, Michelle; Chauhan, Chitra; Liu, Canhui; Unnasch, Thomas R

2011-03-01

Previous studies of Brugia malayi promoters have suggested that they are unusual in that they lack the CAAT or TATAA boxes that are often emblematic of eucaryotic core promoter domains. Instead, the region surrounding the spliced leader (SL) addition site appears to function as the core promoter domain in B. malayi. To test the hypothesis that polymorphisms in this SL addition domain are important determinants of promoter activity, a series of domain swap mutants were prepared replacing the SL addition domain of the B. malayi 13kDa large subunit ribosomal protein (BmRPL13) with those of other ribosomal protein (RP) promoters exhibiting a wide range of activities. These constructs were then tested for promoter activity in a homologous transient transfection system. On average, polymorphisms in the SL addition domain were found to be responsible for 80% of the variation in promoter activity exhibited by the RP promoters tested. Essentially all of this effect could be attributable to polymorphisms in the 10nt located directly upstream of the SL addition site. A comparison of the sequence of this domain to the promoter activity exhibited by the domain swap mutants suggested that promoter activity was related to the number of T residues present in the coding strand of the upstream domain. Confirming this, mutation of the upstream domain of the promoter of the BmRPS4 gene to a homogeneous stretch of 10 T residues resulted in a significant increase in promoter activity. Copyright © 2010 Elsevier B.V. All rights reserved.

The LHCb Upstream Tracker Project

CERN Document Server

Steinkamp, Olaf

2015-01-01

The LHCb detector performs searches for New Physics in CP-violating observables and rare heavy-quark decays at the LHC. A comprehensive upgrade is planned for the long shutdown of the LHC in 2018/19. A goal of this upgrade is to abolish hardware triggers and read out the full detector at 40 MHz. This requires to replace the existing TT station upstream of the LHCb magnet by a new silicon micro-strip detector, the Upstream Tracker (UT). The UT will have a new front-end chip compatible with 40 MHz readout, silicon sensors with improved radiation hardness, finer readout granularity, and improved acceptance coverage at small polar angles. The outer region of each detection layer will be covered by p-in-n sensors with 10 cm long strips and a pitch of about 180 mum, while n-in-p sensors with half the pitch and strip length will be employed in the regions of highest particle density close to the beam pipe. The innermost sensors will have a circular cutout to optimize the forward acceptance. The front-end chip is bei...

Iron-regulated transcription of the pvdA gene in Pseudomonas aeruginosa: effect of Fur and PvdS on promoter activity.

OpenAIRE

Leoni, L; Ciervo, A; Orsi, N; Visca, P

1996-01-01

The pvdA gene, encoding the enzyme L-ornithine N5-oxygenase, catalyzes a key step of the pyoverdin biosynthetic pathway in Pseudomonas aeruginosa. Expression studies with a promoter probe vector made it possible to identify three tightly iron-regulated promoter regions in the 5.9-kb DNA fragment upstream of pvdA. The promoter governing pvdA expression was located within the 154-bp sequence upstream of the pvdA translation start site. RNA analysis showed that expression of PvdA is iron regulat...

Upstream waves simultaneously observed by ISEE and UKS

International Nuclear Information System (INIS)

Russell, C.T.; Luhmann, J.G.; Elphic, R.C.; Southwood, D.J.; Smith, M.F.; Johnstone, A.D.

1987-01-01

Measurements obtained in the solar wind by ISEE-2 and the United Kingdom Subsatellite (UKS) have been examined for observations of upstream waves. These data reveal that the waves in the foreshock region are enhanced at all frequencies from at least 0.003 Hz to 0.5 Hz. The wave spectra generally have a spectral peak, but this peak is usually broad and the peak frequency depends on the position of the spacecraft. Generally, the spectra seen at the two spacecraft are most similar at high frequencies and least similar at low frequencies. The geometry of the interaction is displayed in the plane containing the magnetic field, the solar wind velocity, and the spacecraft location. However, this coordinate system does not order all the observed wave properties. It does not clearly explain or order the handedness of the waves, or their direction of propagation. It is clear that the upstream region is inherently three-dimensional. The position-dependent nature of the upstream waves indicates that comparisons between ground-based measurements and in-situ observations must be undertaken with some caution

Mechanosensitive promoter region in the human HB-GAM gene

DEFF Research Database (Denmark)

Liedert, Astrid; Kassem, Moustapha; Claes, Lutz

2009-01-01

Mechanical loading is essential for maintaining bone mass in the adult skeleton. However, the underlying process of the transfer of the physical stimulus into a biochemical response, which is termed mechanotransduction is poorly understood. Mechanotransduction results in the modulation of gene...... cells. Analysis of the human HB-GAM gene upstream regulatory region with luciferase reporter gene assays revealed that the upregulation of HB-GAM expression occurred at the transcriptional level and was mainly dependent on the HB-GAM promoter region most upstream containing three potential AP-1 binding...

Meeting the challenge : capturing the upstream

International Nuclear Information System (INIS)

Bogle, E.W.

1998-01-01

The challenge facing the exploration and production sector of the petroleum industry to capture and hold onto the upstream was the main focus of this paper. The exploration and production (E and P) business was described as being highly complex, characterized by constant change and increasing competition. Some of the dynamic changes which have occurred in the Western Canada Basin (WCB) during the last five years and how they relate to the international playing field were reviewed. Significant changes to the production ranking profile as a result of acquisitions, and basin reserve endowment and maturity are the two major factors affecting current and future dynamics of upstream WCB E and P activity. Competitive pressures, contractor relationships, infrastructure access and controls, environmental issues are some of the other factors. Taking these factors into account, Talisman Energy Inc. has used its growth in the WCB to leverage its international activities, diversifying to less mature, but proven hydrocarbon basins. The company's international exploration strategy is designed to be adaptive and flexible and is guided by focus on a limited number of core areas with proven source rock and existing production, achievement of a set production level within a five-year time frame, ensuring strong relationships with host governments and partners, and selecting areas where a multiple of opportunity types are available. In general, for any upstream company it is important to recognize that the more predictable traditional order has given way to a market-driven environment where the rules change almost daily, and success depends on the ability to adapt to change.14 figs

Deduction of upstream sequences of Xanthomonas campestris flagellar genes responding to transcription activation by FleQ

International Nuclear Information System (INIS)

Hu, R.-M.; Yang, T.-C.; Yang, S.-H.; Tseng, Y.-H.

2005-01-01

Xanthomonas campestris pv. campestris (Xcc), a close relative to Pseudomonas aeruginosa, is the pathogen causing black rot in cruciferous plants. In P. aeruginosa, FleQ serves as a cognate activator of σ 54 in transcription from several σ 54 -dependent promoters of flagellar genes. These P. aeruginosa promoters have been analyzed for FleQ-binding sequences; however, no consensus was deduced. Xcc, although lacks fleSR, has a fleQ homologue residing among over 40 contiguously clustered flagellar genes. A fleQ mutant, Xc17fleQ, constructed by insertional mutation is deficient in FleQ protein, non-flagellated, and immobile. Transcriptional fusion assays on six putative σ 54 -dependent promoters of the flagellar genes, fliE, fliQ, fliL, flgG, flgB, and flhF, indicated that each of them is also FleQ dependent. Each of these promoters has a sequence with weak consensus to 5'-gaaacCCgccgCcgctTt-3', immediately upstream of the predicted σ 54 -binding site, with an imperfect inverted repeat containing a GC-rich center flanked by several A and T at 5'- and 3'-ends, respectively. Replacing this region in fliE promoter with a HindIII recognition sequence abolished the transcription, indicating that this region responds to transcription activation by FleQ

Evolution of the leukotoxin promoter in genus Mannheimia

DEFF Research Database (Denmark)

Larsen, Jesper; Pedersen, Anders Gorm; Davies, Robert L

2009-01-01

of the leukotoxin promoter among representatives of the five species within genus Mannheimia. We also consider how the evolution of the leukotoxin operon fits with the evolution and maintenance of virulence. Results: The alignment of the intergenic regions upstream of the leukotoxin genes showed significant...

Two distinct promoters drive transcription of the human D1A dopamine receptor gene.

Science.gov (United States)

Lee, S H; Minowa, M T; Mouradian, M M

1996-10-11

The human D1A dopamine receptor gene has a GC-rich, TATA-less promoter located upstream of a small, noncoding exon 1, which is separated from the coding exon 2 by a 116-base pair (bp)-long intron. Serial 3'-deletions of the 5'-noncoding region of this gene, including the intron and 5'-end of exon 2, resulted in 80 and 40% decrease in transcriptional activity of the upstream promoter in two D1A-expressing neuroblastoma cell lines, SK-N-MC and NS20Y, respectively. To investigate the function of this region, the intron and 245 bp at the 5'-end of exon 2 were investigated. Transient expression analyses using various chloramphenicol acetyltransferase constructs showed that the transcriptional activity of the intron is higher than that of the upstream promoter by 12-fold in SK-N-MC cells and by 5.5-fold in NS20Y cells in an orientation-dependent manner, indicating that the D1A intron is a strong promoter. Primer extension and ribonuclease protection assays revealed that transcription driven by the intron promoter is initiated at the junction of intron and exon 2 and at a cluster of nucleotides located 50 bp downstream from this junction. The same transcription start sites are utilized by the chloramphenicol acetyltransferase constructs employed in transfections as well as by the D1A gene expressed within the human caudate. The relative abundance of D1A transcripts originating from the upstream promoter compared with those transcribed from the intron promoter is 1.5-2.9 times in SK-N-MC cells and 2 times in the human caudate. Transcript stability studies in SK-N-MC cells revealed that longer D1A mRNA molecules containing exon 1 are degraded 1.8 times faster than shorter transcripts lacking exon 1. Although gel mobility shift assay could not detect DNA-protein interaction at the D1A intron, competitive co-transfection using the intron as competitor confirmed the presence of trans-acting factors at the intron. These data taken together indicate that the human D1A gene has

Spatial distribution of upstream magnetospheric ≥50 keV ions

Directory of Open Access Journals (Sweden)

G. C. Anagnostopoulos

2000-01-01

Full Text Available We present for the first time a statistical study of \\geq50 keV ion events of a magnetospheric origin upstream from Earth's bow shock. The statistical analysis of the 50-220 keV ion events observed by the IMP-8 spacecraft shows: (1 a dawn-dusk asymmetry in ion distributions, with most events and lower intensities upstream from the quasi-parallel pre-dawn side (4 LT-6 LT of the bow shock, (2 highest ion fluxes upstream from the nose/dusk side of the bow shock under an almost radial interplanetary magnetic field (IMF configuration, and (3 a positive correlation of the ion intensities with the solar wind speed and the index of geomagnetic index Kp, with an average solar wind speed as high as 620 km s-1 and values of the index Kp > 2. The statistical results are consistent with (1 preferential leakage of ~50 keV magnetospheric ions from the dusk magnetopause, (2 nearly scatter free motion of ~50 keV ions within the magnetosheath, and (3 final escape of magnetospheric ions from the quasi-parallel dawn side of the bow shock. An additional statistical analysis of higher energy (290-500 keV upstream ion events also shows a dawn-dusk asymmetry in the occurrence frequency of these events, with the occurrence frequency ranging between ~16%-~34% in the upstream region.Key words. Interplanetary physics (energetic particles; planetary bow shocks

Spatial distribution of upstream magnetospheric ≥50 keV ions

Directory of Open Access Journals (Sweden)

G. Kaliabetsos

Full Text Available We present for the first time a statistical study of geq50 keV ion events of a magnetospheric origin upstream from Earth's bow shock. The statistical analysis of the 50-220 keV ion events observed by the IMP-8 spacecraft shows: (1 a dawn-dusk asymmetry in ion distributions, with most events and lower intensities upstream from the quasi-parallel pre-dawn side (4 LT-6 LT of the bow shock, (2 highest ion fluxes upstream from the nose/dusk side of the bow shock under an almost radial interplanetary magnetic field (IMF configuration, and (3 a positive correlation of the ion intensities with the solar wind speed and the index of geomagnetic index Kp, with an average solar wind speed as high as 620 km s-1 and values of the index Kp > 2. The statistical results are consistent with (1 preferential leakage of ~50 keV magnetospheric ions from the dusk magnetopause, (2 nearly scatter free motion of ~50 keV ions within the magnetosheath, and (3 final escape of magnetospheric ions from the quasi-parallel dawn side of the bow shock. An additional statistical analysis of higher energy (290-500 keV upstream ion events also shows a dawn-dusk asymmetry in the occurrence frequency of these events, with the occurrence frequency ranging between ~16%-~34% in the upstream region.Key words. Interplanetary physics (energetic particles; planetary bow shocks

Novel strong tissue specific promoter for gene expression in human germ cells

Directory of Open Access Journals (Sweden)

Kuzmin Denis

2010-08-01

Full Text Available Abstract Background Tissue specific promoters may be utilized for a variety of applications, including programmed gene expression in cell types, tissues and organs of interest, for developing different cell culture models or for use in gene therapy. We report a novel, tissue-specific promoter that was identified and engineered from the native upstream regulatory region of the human gene NDUFV1 containing an endogenous retroviral sequence. Results Among seven established human cell lines and five primary cultures, this modified NDUFV1 upstream sequence (mNUS was active only in human undifferentiated germ-derived cells (lines Tera-1 and EP2102, where it demonstrated high promoter activity (~twice greater than that of the SV40 early promoter, and comparable to the routinely used cytomegaloviral promoter. To investigate the potential applicability of the mNUS promoter for biotechnological needs, a construct carrying a recombinant cytosine deaminase (RCD suicide gene under the control of mNUS was tested in cell lines of different tissue origin. High cytotoxic effect of RCD with a cell-death rate ~60% was observed only in germ-derived cells (Tera-1, whereas no effect was seen in a somatic, kidney-derived control cell line (HEK293. In further experiments, we tested mNUS-driven expression of a hyperactive Sleeping Beauty transposase (SB100X. The mNUS-SB100X construct mediated stable transgene insertions exclusively in germ-derived cells, thereby providing further evidence of tissue-specificity of the mNUS promoter. Conclusions We conclude that mNUS may be used as an efficient promoter for tissue-specific gene expression in human germ-derived cells in many applications. Our data also suggest that the 91 bp-long sequence located exactly upstream NDUFV1 transcriptional start site plays a crucial role in the activity of this gene promoter in vitro in the majority of tested cell types (10/12, and an important role - in the rest two cell lines.

Upstream effects of dams on alluvial channels: state-of-the-art and future challenges

Science.gov (United States)

Liro, Maciej

2017-04-01

More than 50,000 large dams (with the height above 15 m) operate all over the world and, thus, they significantly disturb water and sediment transport in river systems. These disturbances are recognized as one of the most important factors shaping river morphology in the Anthropocene. Downstream effects of dams have been well documented in numerous case studies and supported by predictions from existing models. In contrast, little is known on the upstream effects of dams on alluvial channels. This review highlights the lack of studies on sedimentological, hydromorphological and biogeomorphological adjustments of alluvial rivers in the base-level raised zones of backwater upstream of dam reservoirs where water level fluctuations occur. Up to date, it has been documented that backwater effects may facilitate fine and coarse sediment deposition, increase groundwater level, provide higher and more frequent channel and floodplain inundation and lead to significant morphological changes. But there have been no studies quantifying short- and long-term consequences of these disturbances for the hydromorphological and biogeomorphological feedbacks that control development of alluvial channels. Some recent studies carried out on gravel-bed and fine-grained bed rivers show that the above mentioned disturbances facilitate vegetation expansion on exposed channel sediments and floodplain influencing river morphology, which suggests that backwater area of alluvial rivers may be treated as the hotspot of bio-geomorphological changes in a fluvial system. To set the stage for future research on upstream effects of dams, this work presents the existing state-of-art and proposes some hypotheses which may be tested in future studies. This study was carried out within the scope of the Research Project 2015/19/N/ST10/01526 financed by the National Science Centre of Poland

LHCb upstream tracker

CERN Multimedia

Artuso, Marina

2016-01-01

The detector for the LHCb upgrade is designed for 40MHz readout, allowing the experiment to run at an instantaneous luminosity of 2x10^33 cm$^2$s$^-1$. The upgrade of the tracker subsystem in front of the dipole magnet, the Upstream Tracker, is crucial for charged track reconstruction and fast trigger decisions based on a tracking algorithm involving also vertex detector information. The detector consists of 4 planes with a total area of about 8.5m$^2$, made of single sided silicon strip sensors read-out by a novel custom-made ASIC (SALT). Details on the performance of prototype sensors, front-end electronics, near-detector electronics and mechanical components are presented.

Inventories and upstream gasoline price dynamics

NARCIS (Netherlands)

Kuper, Gerard H.

This paper sheds new light on the asymmetric dynamics in upstream U.S. gasoline prices. The model is based on Pindyck's inventory model of commodity price dynamics. We show that asymmetry in gasoline price dynamics is caused by changes in the net marginal convenience yield: higher costs of marketing

Genome-scale portrait and evolutionary significance of human-specific core promoter tri- and tetranucleotide short tandem repeats.

Science.gov (United States)

Nazaripanah, N; Adelirad, F; Delbari, A; Sahaf, R; Abbasi-Asl, T; Ohadi, M

2018-04-05

While there is an ongoing trend to identify single nucleotide substitutions (SNSs) that are linked to inter/intra-species differences and disease phenotypes, short tandem repeats (STRs)/microsatellites may be of equal (if not more) importance in the above processes. Genes that contain STRs in their promoters have higher expression divergence compared to genes with fixed or no STRs in the gene promoters. In line with the above, recent reports indicate a role of repetitive sequences in the rise of young transcription start sites (TSSs) in human evolution. Following a comparative genomics study of all human protein-coding genes annotated in the GeneCards database, here we provide a genome-scale portrait of human-specific short- and medium-size (≥ 3-repeats) tri- and tetranucleotide STRs and STR motifs in the critical core promoter region between - 120 and + 1 to the TSS and evidence of skewing of this compartment in reference to the STRs that are not human-specific (Levene's test p human-specific transcripts was detected in the tri and tetra human-specific compartments (mid-p genome-scale skewing of STRs at a specific region of the human genome and a link between a number of these STRs and TSS selection/transcript specificity. The STRs and genes listed here may have a role in the evolution and development of characteristics and phenotypes that are unique to the human species.

Promoter trans-activation of protooncogenes c-fos and c-myc, but not c-Ha-ras, by products of adenovirus early region 1A

International Nuclear Information System (INIS)

Sassone-Corsi, P.; Borrelli, E.

1987-01-01

The E1A (early region 1A) oncogene products of adenovirus type 2 trans-activate the other early viral transcription units, as well as some cellular promoters. Using a short-term cotransfection assay in murine NIH 3T3 fibroblasts, we show that c-fos and c-myc promoter activities are stimulated by the E1A proteins, whereas c-Ha-ras transcription is not affected. The product of E1A 13S mRNA is responsible for the trans-activation, whereas the 12S mRNA product has no effect. Analysis of the c-fos promoter sequences required for the E1A stimulation shows that responsive sequences are located between positions -402 and -240 upstream of the transcription initiation site. This same region also contains the c-fos serum-responsive element. Furthermore, transcription of the endogenous c-fos gene in HeLa cells is increased after E1A transfection

Upstream-downstream cooperation approach in Guanting Reservoir watershed.

Science.gov (United States)

Yang, Zhi-Feng; Zhang, Wen-Guo

2005-01-01

A case study is introduced and discussed concerning water dispute of misuse and pollution between up- and down-stream parts. The relations between water usage and local industrial structures are analyzed. Results show it is important to change industrial structures of the target region along with controlling water pollution by technical and engineering methods. Three manners of upstream-downstream cooperation are presented and discussed based on the actual conditions of Guangting Reservoir watershed. Two typical scenarios are supposed and studied along with the local plan on water resources development. The best solution for this cooperation presents a good way to help the upstream developing in a new pattern of eco-economy.

The architecture of mammalian ribosomal protein promoters

Directory of Open Access Journals (Sweden)

Perry Robert P

2005-02-01

Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.

Oral health promotion reduces plaque and gingival bleeding in the short term.

Science.gov (United States)

Hausen, Hannu

2005-01-01

Cochrane Database of Systematic Reviews, Database of Abstracts of Reviews of Effects, Health Technology Assessment Database, UK National Health Service Economic Evaluation Database, Cochrane Central Register of Controlled Trials and Medline. There were no date limits or language restriction. Systematic reviews and controlled trials (randomised or quasi-randomised) assessing reductions in dental plaque levels and/or gingival bleeding (gingivitis) and comparing health education/health promotion interventions that did not involve clinical professional input or the use of pharmacological interventions, such as antiplaque agents were included. Studies involving only special groups, such as orthodontic or medically compromised patients or assessing only denture plaque, were excluded. A range of data were extracted from systematic reviews and trials, quality assessment was undertaken, and a qualitative overview of the findings was provided. Twenty-six potentially relevant studies were identified. Six reports of five systematic reviews and 13 trials were discussed: four studies were not assessed as one was published in Polish and three could not be located.A wide range of educational and behavioural interventions were considered. These did not generally include clinical interventions and social or environmental approaches. The reviews have a number of limitations so their conclusions should be viewed with a degree of caution. However, the majority of studies achieved short-term reductions in plaque and gingival bleeding. Precise estimates of the improvement are difficult to assess because of the range and diversity of outcome measures used. The results of two meta-analyses indicate a reduction in plaque levels of 32-37%. Of 13 recently published trials evaluating educational interventions, five were set in schools, four focused on adults either in a clinical or workplace setting, three targeted older people, and one, infants. The design quality of the trials was variable

Russian upstream joint ventures logging progress

International Nuclear Information System (INIS)

Anon.

1992-01-01

This paper reports that Occidental Petroleum Corp. has begun exporting oil from Russia as part of an enhanced recovery joint venture in western Siberia. Oxy holds a 50% interest in the joint venture company, Vanyoganneft, and will market the oil. In other activity, two Canadian companies are marking progress with Russian upstream joint ventures

Regulation of CCL2 expression by an upstream TALE homeodomain protein-binding site that synergizes with the site created by the A-2578G SNP.

Science.gov (United States)

Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E

2011-01-01

CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.

An in situ Comparison of Electron Acceleration at Collisionless Shocks under Differing Upstream Magnetic Field Orientations

Energy Technology Data Exchange (ETDEWEB)

Masters, A.; Dougherty, M. K. [The Blackett Laboratory, Imperial College London, Prince Consort Road, London, SW7 2AZ (United Kingdom); Sulaiman, A. H. [Department of Physics and Astronomy, University of Iowa, Iowa City, IA 52242 (United States); Stawarz, Ł. [Astronomical Observatory, Jagiellonian University, ul. Orla 171, 30-244 Krakow (Poland); Reville, B. [School of Mathematics and Physics, Queens University Belfast, Belfast BT7 1NN (United Kingdom); Sergis, N. [Office of Space Research and Technology, Academy of Athens, Soranou Efesiou 4, 11527 Athens (Greece); Fujimoto, M. [Institute of Space and Astronautical Science, Japan Aerospace Exploration Agency, 3-1-1 Yoshinodai, Chuo-ku, Sagamihara, Kanagawa 252-5210 (Japan); Burgess, D. [School of Physics and Astronomy, Queen Mary University of London, London E1 4NS (United Kingdom); Coates, A. J., E-mail: a.masters@imperial.ac.uk [Mullard Space Science Laboratory, Department of Space and Climate Physics, University College London, Holmbury St. Mary, Dorking RH5 6NT (United Kingdom)

2017-07-10

A leading explanation for the origin of Galactic cosmic rays is acceleration at high-Mach number shock waves in the collisionless plasma surrounding young supernova remnants. Evidence for this is provided by multi-wavelength non-thermal emission thought to be associated with ultrarelativistic electrons at these shocks. However, the dependence of the electron acceleration process on the orientation of the upstream magnetic field with respect to the local normal to the shock front (quasi-parallel/quasi-perpendicular) is debated. Cassini spacecraft observations at Saturn’s bow shock have revealed examples of electron acceleration under quasi-perpendicular conditions, and the first in situ evidence of electron acceleration at a quasi-parallel shock. Here we use Cassini data to make the first comparison between energy spectra of locally accelerated electrons under these differing upstream magnetic field regimes. We present data taken during a quasi-perpendicular shock crossing on 2008 March 8 and during a quasi-parallel shock crossing on 2007 February 3, highlighting that both were associated with electron acceleration to at least MeV energies. The magnetic signature of the quasi-perpendicular crossing has a relatively sharp upstream–downstream transition, and energetic electrons were detected close to the transition and immediately downstream. The magnetic transition at the quasi-parallel crossing is less clear, energetic electrons were encountered upstream and downstream, and the electron energy spectrum is harder above ∼100 keV. We discuss whether the acceleration is consistent with diffusive shock acceleration theory in each case, and suggest that the quasi-parallel spectral break is due to an energy-dependent interaction between the electrons and short, large-amplitude magnetic structures.

On-line soft sensing in upstream bioprocessing.

Science.gov (United States)

Randek, Judit; Mandenius, Carl-Fredrik

2018-02-01

This review provides an overview and a critical discussion of novel possibilities of applying soft sensors for on-line monitoring and control of industrial bioprocesses. Focus is on bio-product formation in the upstream process but also the integration with other parts of the process is addressed. The term soft sensor is used for the combination of analytical hardware data (from sensors, analytical devices, instruments and actuators) with mathematical models that create new real-time information about the process. In particular, the review assesses these possibilities from an industrial perspective, including sensor performance, information value and production economy. The capabilities of existing analytical on-line techniques are scrutinized in view of their usefulness in soft sensor setups and in relation to typical needs in bioprocessing in general. The review concludes with specific recommendations for further development of soft sensors for the monitoring and control of upstream bioprocessing.

An upstream open reading frame represses expression of Lc, a member of the R/B family of maize transcriptional activators

Energy Technology Data Exchange (ETDEWEB)

Damiani, R.D. Jr.; Wessler, S.R. (Univ. of Georgia, Athens, GA (United States))

1993-09-01

The R/B genes of maize encode a family of basic helix-loop-helix proteins that determine where and when the anthocyanin-pigment pathway will be expressed in the plant. Previous studies showed that allelic diversity among family members reflects differences in gene expression, specifically in transcription initiation. The authors present evidence that the R gene Lc is under translational control. They demonstrate that the 235-nt transcript leader of Lc represses expression 25- to 30-fold in an in vivo assay. Repression is mediated by the presence in cis of a 38-codon upstream open reading frame. Furthermore, the coding capacity of the upstream open reading frame influences the magnitude of repression. It is proposed that translational control does not contribute to tissue specificity but prevents overexpression of the Lc protein. The diversity of promoter and 5' untranslated leader sequences among the R/B genes provides an opportunity to study the coevolution of transcriptional and translational mechanisms of gene regulation. 36 refs., 5 figs.

Tissue specific promoters improve the localization of radiation-inducible gene expression

International Nuclear Information System (INIS)

Hallahan, Dennis; Kataoka, Yasushi; Kuchibhotla, Jaya; Virudachalam, Subbu; Weichselbaum, Ralph

1996-01-01

Purpose: Site-specific activation of gene expression can be achieved by the use of a promoter that is induced by physical agents such as x-rays. The purpose of the present study was to determine whether site-specific activation of gene therapy can also be achieved within the vascular endothelium by use of radiation-inducible promoters. We studied induction of promoter-reporter gene constructs using previously identified radiation-promoters from c-jun, c-fos, Egr-1, ICAM-1, ELAM-1 after transfection into in the vascular endothelium. Methods: The following radiation-inducible genetic constructs were created: The ELAM-1 promoter fragment was cloned into pOGH to obtain the pE-sel(-587 +35)GH reporter construct. The ICAM-1 promoter fragment (-1162/+1) was cloned upstream of the CAT coding region of the pCAT-plasmid (Promega) after removal of the SV40 promoter by Bgl2/Stu1 digestion to create the pBS-CAT plasmid. The 132 to +170 bp segment of the 5' untranslated region of the c-jun promoter was cloned to the CAT reporter gene to create the -132/+170 cjun-CAT. The Egr-1 promoter fragment (-425/+75) was cloned upstream of the CAT coding region to create the pE425-CAT plasmid. Tandem repeats of the AP-1 binding site were cloned upstream of the CAT coding region (3 xTRE-CAT). Tandem repeats of the Egr binding site (EBS) were cloned upstream of the CAT coding region (EBS-CAT). Human vascular endothelial cells from both large vessel and small vessel origin (HUVEC and HMEC), as well as human tumor cell lines were transfected with plasmids -132/+170 cjun-CAT, pE425-CAT, 3 xTRE-CAT, EBS-CAT, pE-sel-GH and pBS-CAT by use of liposomes. Humor tumor cell lines included SQ20B (squamous), RIT3 (sarcoma), and HL525 (leukemia). Each plasmid was cotransfected with a plasmid containing a CMV promoter linked to the LacZ gene (1 μg). Transfected cells were treated with mock irradiation or x-rays. Cell extracts were assayed for reporter gene expression. Results: Radiation-induced gene

DENSITY FLUCTUATIONS UPSTREAM AND DOWNSTREAM OF INTERPLANETARY SHOCKS

Energy Technology Data Exchange (ETDEWEB)

Pitňa, A.; Šafránková, J.; Němeček, Z.; Goncharov, O.; Němec, F.; Přech, L. [Charles University, Faculty of Mathematics and Physics, V Holešovičkách 2, 180 00 Prague 8 (Czech Republic); Chen, C. H. K. [Department of Physics, Imperial College London, London SW7 2AZ (United Kingdom); Zastenker, G. N., E-mail: jana.safrankova@mff.cuni.cz [Space Research Institute of Russian Academy of Sciences, Moscow, Russia, Profsoyuznaya ul. 84/32, Moscow 117997 (Russian Federation)

2016-03-01

Interplanetary (IP) shocks as typical large-scale disturbances arising from processes such as stream–stream interactions or Interplanetary Coronal Mass Ejection (ICME) launching play a significant role in the energy redistribution, dissipation, particle heating, acceleration, etc. They can change the properties of the turbulent cascade on shorter scales. We focus on changes of the level and spectral properties of ion flux fluctuations upstream and downstream of fast forward oblique shocks. Although the fluctuation level increases by an order of magnitude across the shock, the spectral slope in the magnetohydrodynamic range is conserved. The frequency spectra upstream of IP shocks are the same as those in the solar wind (if not spoiled by foreshock waves). The spectral slopes downstream are roughly proportional to the corresponding slopes upstream, suggesting that the properties of the turbulent cascade are conserved across the shock; thus, the shock does not destroy the shape of the spectrum as turbulence passes through it. Frequency spectra downstream of IP shocks often exhibit “an exponential decay” in the ion kinetic range that was earlier reported at electron scales in the solar wind or at ion scales in the interstellar medium. We suggest that the exponential shape of ion flux spectra in this range is caused by stronger damping of the fluctuations in the downstream region.

Exploring Social Learning through Upstream Engagement in Science and Technology

DEFF Research Database (Denmark)

Mortensen, Jonas Egmose

This discussion paper deliberates on how the concept of social learning can be used for evaluating upstream engagement initiatives in science and technology.  The paper briefly introduces to the concept of upstream engagement and a concrete case, the UK Citizen Science for Sustainability project...... (SuScit), as an outset for discussing how the concept of social learning can be used for analysing and understanding relations between citizen participation, Science and research, and sustainability. A number of relevant research questions and methodological considerations are distilled...

Artificial promoter libraries for selected organisms and promoters derived from such libraries

DEFF Research Database (Denmark)

1998-01-01

or organisms may be selected from prokaryotes and from eukaryotes; and in prokaryotes the consensus sequences to be retained most often will comprise the -35 signal (-35 to -30): TTGACA and the -10 signal (-12 to -7): TATAAT or parts of both comprising at least 3 conserved nucleotides of each, while...... in eukaryotes said consensus sequences should comprise a TATA box and at least one upstream activation sequence (UAS). Such artificial promoter libraries can be used i.a. for optimizing the expression of specific genes in various selected organisms....

Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene

International Nuclear Information System (INIS)

Mavrothalassitis, G.J.; Watson, D.K.; Papas, T.S.

1990-01-01

The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical TATA and CAAT elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1,400 base pairs (bp) upstream from the first major transcription initiation site. A G+C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with TATA-less promoters

Moving Upstream in U.S. Hospital Care Toward Investments in Population Health.

Science.gov (United States)

Begun, James W; Potthoff, Sandra

The root causes for most health outcomes are often collectively referred to as the social determinants of health. Hospitals and health systems now must decide how much to "move upstream," or invest in programs that directly affect the social determinants of health. Moving upstream in healthcare delivery requires an acceptance of responsibility for the health of populations. We examine responses of 950 nonfederal, general hospitals in the United States to the 2015 American Hospital Association Population Health Survey to identify characteristics that distinguish those hospitals that are most aligned with population health and most engaged in addressing social determinants of health. Those "upstream" hospitals are significantly more likely to be large, not-for-profit, metropolitan, teaching-affiliated, and members of systems. Internally, the more upstream hospitals are more likely to organize their population health activities with strong executive-level involvement, full-time-equivalent support, and coordination at the system level.The characteristics differentiating hospitals strongly involved in population health and upstream activity are not unlike those characteristics associated with diffusion of many innovations in hospitals. These hospitals may be the early adopters in a diffusion process that will eventually include most hospitals or, at least, most not-for-profit hospitals. Alternatively, the population health and social determinants movements could be transient or could be limited to a small portion of hospitals such as those identified here, with distinctive patient populations, missions, and resources.

The human luteinizing hormone receptor gene promoter: activation by Sp1 and Sp3 and inhibitory regulation.

Science.gov (United States)

Geng, Y; Tsai-Morris, C H; Zhang, Y; Dufau, M L

1999-09-24

To understand the transcriptional mechanism(s) of human LH receptor (LHR) gene expression, we have identified the dominant functional cis-elements that regulate the activity of the promoter domain (-1 to -176 bp from ATG). Mutagenesis demonstrated that the promoter activity was dependent on two Sp1 domains (-79 bp, -120 bp) in a transformed normal placental cell (PLC) and the choriocarcinoma JAR cell. Both elements interacted with endogenous Sp1 and Sp3 factors but not with Sp2 or Sp4. In Drosophila SL2 cells, the promoter was activated by either Sp1 or Sp3. An ERE half-site (EREhs) at -174 bp was inhibitory (by 100%), but was unresponsive to estradiol and did not bind the estrogen receptor or orphan receptors ERR1 and SF-1. The 5' upstream sequence (-177 to -2056 bp) inhibited promoter activity in PLC by 60%, but only minimally in JAR cells. Activation of the human LHR promoter through Sp1/3 factors is negatively regulated through EREhs and upstream sequences to exert control of gene expression. Copyright 1999 Academic Press.

Expression analysis of four flower-specific promoters of Brassica spp ...

African Journals Online (AJOL)

The 5'-flanking region of ca. 1200 bp upstream of the translation start site (TSS) of a putative cell wall protein gene was cloned from Brassica campestris, B. chinensis, B. napus and B. oleracea, and transferred to tobacco via Agrobacterium-mediation after fused to promoter-less beta-glucuronidase (GUS) reporter gene.

Optical power equalization for upstream traffic with injection-locked Fabry-Perot lasers in TDM-PON

Science.gov (United States)

Huang, Ting-Tsan; Sheu, Lih-Gen; Chi, Sien

2010-10-01

An optical power equalization of upstream traffic in time-division-multiplexed passive optical network (TDM-PON) based on injection-locked Fabry-Perot lasers has been experimentally investigated. The upstream transmitters with stable spectrum are achieved by using an external injection light source in the optical line terminal (OLT). The different upstream powers can be equalized by injection locking a Fabry-Perot laser diode (FP-LD) biased below threshold current in OLT. The dynamic upstream power range from - 8.5 to - 19.5 db m is reduced to a 1.6 dB maximal power variation, when the uplink signal is directly modulated at 1.25 Gb/s.

Anatomy of top 100 upstream players

International Nuclear Information System (INIS)

Burk, V.A.

1992-01-01

A brief review is given of a recent survey of the top one hundred upstream oil and gas companies which file financial data with the US Securities and Exchange Commission. The analysis indicates the increasing globalisation of the industry with exploration and development spending increasing dramatically outside the US. To survive, companies must operate as efficient low cost finders and producers of oil and gas and anticipate and meet changing market demands quickly. (UK)

Multiple upstream modules regulate zebrafish myf5 expression

Directory of Open Access Journals (Sweden)

Weng Chih-Wei

2007-01-01

Full Text Available Abstract Background Myf5 is one member of the basic helix-loop-helix family of transcription factors, and it functions as a myogenic factor that is important for the specification and differentiation of muscle cells. The expression of myf5 is somite- and stage-dependent during embryogenesis through a delicate regulation. However, this complex regulatory mechanism of myf5 is not clearly understood. Results We isolated a 156-kb bacterial artificial chromosome clone that includes an upstream 80-kb region and a downstream 70-kb region of zebrafish myf5 and generated a transgenic line carrying this 156-kb segment fused to a green fluorescent protein (GFP reporter gene. We find strong GFP expression in the most rostral somite and in the presomitic mesoderm during segmentation stages, similar to endogenous myf5 expression. Later, the GFP signals persist in caudal somites near the tail bud but are down-regulated in the older, rostral somites. During the pharyngula period, we detect GFP signals in pectoral fin buds, dorsal rostral myotomes, hypaxial myotomes, and inferior oblique and superior oblique muscles, a pattern that also corresponds well with endogenous myf5 transcripts. To characterize the specific upstream cis-elements that regulate this complex and dynamic expression pattern, we also generated several transgenic lines that harbor various lengths within the upstream 80-kb segment. We find that (1 the -80 kb/-9977 segment contains a fin and cranial muscle element and a notochord repressor; (2 the -9977/-6213 segment contains a strong repressive element that does not include the notochord-specific repressor; (3 the -6212/-2938 segment contains tissue-specific elements for bone and spinal cord; (4 the -2937/-291 segment contains an eye enhancer, and the -2937/-2457 segment is required for notochord and myocyte expression; and (5 the -290/-1 segment is responsible for basal transcription in somites and the presomitic mesoderm. Conclusion We suggest

Multispacecraft observations of energetic ions upstream and downstream of the bow shock

International Nuclear Information System (INIS)

Scholer, M.; Mobius, E.; Kistler, L.M.; Klecker, B.; Ipavich, F.M.; Department of Physics and Astronomy, University of Maryland, College Park)

1989-01-01

We present simultaneous measurements of energetic protons and alpha particles inside and outside of the magnetopause, immediately upstream, and downstream as well as further upstream of the bow shock. A comparison between the intensity at the bow shock and further upstream results in an e-folding distance at 30 keV of similar to 6.2 R/sub E/. After transformation of the angular distribution into the solar wind frame a diffusion coefficeint of κ/sub parallel/similar to 3 R/sub E/ is obtained from the anisotropy and the intensity gradient. Immediately downstream of the bow shock the anisotropy in the shock frame is directed toward the magnetopause. After transformation into the plasma rest frame the distribution is isotropic. The intensity in the magnetosheath just outside the magnetopause is smaller than the intensity behind the bow shock. Thus, in the magnetosheath there is no gradient or streaming in the upstream direction. The spectra, intensities, and relative abundances in the magnetosheath and inside the magnetosphere are totally different. These observations are consistent with first order Fermi acceleration at the bow shock and subsequent downstream convection, and exclude a magnetospheric source for these particles. Copyright American Geophysical Union 1989

Influence of Upstream and Downstream Compressor Stators on Rotor Exit Flow Field

Directory of Open Access Journals (Sweden)

Nicole L. Key

2014-01-01

Full Text Available Measurements acquired at the rotor exit plane illuminate the interaction of the rotor with the upstream vane row and the downstream vane row. The relative phase of the upstream and downstream vane rows is adjusted using vane clocking so that the effect of the upstream propagating potential field from the downstream stator can be distinguished from the effects associated with the wakes shed from the upstream stator. Unsteady absolute flow angle information shows that the downstream potential field causes the absolute flow angle to increase in the vicinity of the downstream stator leading edge. The presence of Stator 1 wake is also detected at this measurement plane using unsteady total pressure data. The rotor wakes are measured at different circumferential locations across the vane passage, and the influence of Stator 1 wake on the suction side of the rotor wake is evident. Also, the influence of the downstream stator is detected on the pressure side of the rotor wake for a particular clocking configuration. Understanding the role of the surrounding vane rows on rotor wake development will lead to improved comparison between experimental data and results from computational models.

Upstream ORF affects MYCN translation depending on exon 1b alternative splicing

International Nuclear Information System (INIS)

Besançon, Roger; Puisieux, Alain; Valsesia-Wittmann, Sandrine; Locher, Clara; Delloye-Bourgeois, Céline; Furhman, Lydie; Tutrone, Giovani; Bertrand, Christophe; Jallas, Anne-Catherine; Garin, Elisabeth

2009-01-01

The MYCN gene is transcribed into two major mRNAs: one full-length (MYCN) and one exon 1b-spliced (MYCN Δ1b ) mRNA. But nothing is known about their respective ability to translate the MYCN protein. Plasmids were prepared to enable translation from the upstream (uORF) and major ORF of the two MYCN transcripts. Translation was studied after transfection in neuroblastoma SH-EP cell line. Impact of the upstream AUG on translation was evaluated after directed mutagenesis. Functional study with the two MYCN mRNAs was conducted by a cell viability assay. Existence of a new protein encoded by the MYCN Δ1b uORF was explored by designing a rabbit polyclonal antibody against a specific epitope of this protein. Both are translated, but higher levels of protein were seen with MYCN Δ1b mRNA. An upstream ORF was shown to have positive cis-regulatory activity on translation from MYCN but not from MYCN Δ1b mRNA. In transfected SH-EP neuroblastoma cells, high MYCN dosage obtained with MYCN Δ1b mRNA translation induces an antiapoptotic effect after serum deprivation that was not observed with low MYCN expression obtained with MYCN mRNA. Here, we showed that MYCNOT: MYCN Overlap Transcript, a new protein of unknown function is translated from the upstream AUG of MYCN Δ1b mRNA. Existence of upstream ORF in MYCN transcripts leads to a new level of MYCN regulation. The resulting MYCN dosage has a weak but significant anti-apoptotic activity after intrinsic apoptosis induction

Characterization of the promoter and upstream activating sequence from the Pseudomonas alcaligenes lipase gene

NARCIS (Netherlands)

Cox, M; Gerritse, G; Dankmeyer, L; Quax, W.J.

2001-01-01

Pseudomonas alcaligenes secretes a lipase with a high pH optimum, which has interesting properties for application in detergents. The expression of the lipase is strongly dependent on the presence of lipids in the growth medium such as soybean oil. The promoter of the gene was characterized and

Upstream waves in Saturn's foreshock

Science.gov (United States)

Bavassano Cattaneo, M. B.; Cattaneo, P.; Moreno, G.; Lepping, R. P.

1991-01-01

An analysis based on plasma and magnetic-field data obtained from Voyager 1 during its Saturn encounter is reported. The plasma data provided every 96 sec and magnetic-field data averaged over 48 sec are utilized. The evidence of upstream waves at Saturn are detected. The waves have a period, in the spacecraft frame, of about 550 sec and a relative amplitude larger than 0.3, are left- and right-hand elliptically polarized, and propagate at about 30 deg with respect to the average magnetic field. The appearance of the waves is correlated with the spacecraft being magnetically connected to the bow shock.

Molecular Evolution of Two Distinct dmrt1 Promoters for Germ and Somatic Cells in Vertebrate Gonads.

Science.gov (United States)

Mawaribuchi, Shuuji; Musashijima, Masato; Wada, Mikako; Izutsu, Yumi; Kurakata, Erina; Park, Min Kyun; Takamatsu, Nobuhiko; Ito, Michihiko

2017-03-01

The transcription factor DMRT1 has important functions in two distinct processes, somatic-cell masculinization and germ-cell development in mammals. However, it is unknown whether the functions are conserved during evolution, and what mechanism underlies its expression in the two cell lineages. Our analysis of the Xenopus laevis and Silurana tropicalis dmrt1 genes indicated the presence of two distinct promoters: one upstream of the noncoding first exon (ncEx1), and one within the first intron. In contrast, only the ncEx1-upstream promoter was detected in the dmrt1 gene of the agnathan sand lamprey, which expressed dmrt1 exclusively in the germ cells. In X. laevis, the ncEx1- and exon 2-upstream promoters were predominantly used for germ-cell and somatic-cell transcription, respectively. Importantly, knockdown of the ncEx1-containing transcript led to reduced germ-cell numbers in X. laevis gonads. Intriguingly, two genetically female individuals carrying the knockdown construct developed testicles. Analysis of the reptilian leopard gecko dmrt1 revealed the absence of ncEx1. We propose that dmrt1 regulated germ-cell development in the vertebrate ancestor, then acquired another promoter in its first intron to regulate somatic-cell masculinization during gnathostome evolution. In the common ancestor of reptiles and mammals, only one promoter got function for both the two cell lineages, accompanied with the loss of ncEx1. In addition, we found a conserved noncoding sequence (CNS) in the dmrt1 5'-flanking regions only among amniote species, and two CNSs in the introns among most vertebrates except for agnathans. Finally, we discuss relationships between these CNSs and the promoters of dmrt1 during vertebrate evolution. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Insulators form gene loops by interacting with promoters in Drosophila.

Science.gov (United States)

Erokhin, Maksim; Davydova, Anna; Kyrchanova, Olga; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya

2011-09-01

Chromatin insulators are regulatory elements involved in the modulation of enhancer-promoter communication. The 1A2 and Wari insulators are located immediately downstream of the Drosophila yellow and white genes, respectively. Using an assay based on the yeast GAL4 activator, we have found that both insulators are able to interact with their target promoters in transgenic lines, forming gene loops. The existence of an insulator-promoter loop is confirmed by the fact that insulator proteins could be detected on the promoter only in the presence of an insulator in the transgene. The upstream promoter regions, which are required for long-distance stimulation by enhancers, are not essential for promoter-insulator interactions. Both insulators support basal activity of the yellow and white promoters in eyes. Thus, the ability of insulators to interact with promoters might play an important role in the regulation of basal gene transcription.

Analysis of an upstream weighted collocation approximation to the transport equation

International Nuclear Information System (INIS)

Shapiro, A.; Pinder, G.F.

1981-01-01

The numerical behavior of a modified orthogonal collocation method, as applied to the transport equations, can be examined through the use of a Fourier series analysis. The necessity of such a study becomes apparent in the analysis of several techniques which emulate classical upstream weighting schemes. These techniques are employed in orthogonal collocation and other numerical methods as a means of handling parabolic partial differential equations with significant first-order terms. Divergent behavior can be shown to exist in one upstream weighting method applied to orthogonal collocation

Differences in sedge fen vegetation upstream and downstream from a managed impoundment

Science.gov (United States)

Kowalski, Kurt P.; Wilcox, Douglas A.

2003-01-01

The U.S. Fish and Wildlife Service proposed the restoration of wetlands impacted by a series of drainage ditches and pools located in an extensive undeveloped peatland in the Seney National Wildlife Refuge, Michigan. This study examined the nature and extent of degradation to the Marsh Creek wetlands caused by alteration of natural hydrology by a water-storage pool (C-3 Pool) that intersects the Marsh Creek channel. We tested the hypothesis that a reduction in moderate-intensity disturbance associated with natural water-level fluctuations below the C-3 dike contributed to lower species richness, reduced floristic quality and a larger tree and shrub component than vegetation upstream from the pool. Wetland plant communities were sampled quantitatively and analyzed for species richness, floristic quality and physiognomy. Aerial photographs, GIS databases and GPS data contributed to the characterization and analysis of the Marsh Creek wetlands. Results showed that there was lower species richness in vegetated areas downstream from the pool, but not the anticipated growth in shrubs. Wetland vegetation upstream and downstream from the pool had similar floristic quality, except for a greater number of weedy taxa above the pool. Seepage through the pool dike and localized ground-water discharge created conditions very similar to those observed around beaver dams in Marsh Creek. In essence, the dike containing the C-3 Pool affected hydrology and wetland plant communities in a manner similar to an enormous beaver dam, except that it did not allow seasonal flooding episodes to occur. Management actions to release water from the pool into the original Marsh Creek channel at certain times and in certain amounts that mimic the natural flow regime would be expected to promote greater plant species richness and minimize the negative impacts of the dike.

Identification of functional DNA variants in the constitutive promoter region of MDM2

Directory of Open Access Journals (Sweden)

Lalonde Marie-Eve

2012-09-01

Full Text Available Abstract Although mutations in the oncoprotein murine double minute 2 (MDM2 are rare, MDM2 gene overexpression has been observed in several human tumors. Given that even modest changes in MDM2 levels might influence the p53 tumor suppressor signaling pathway, we postulated that sequence variation in the promoter region of MDM2 could lead to disregulated expression and variation in gene dosage. Two promoters have been reported for MDM2; an internal promoter (P2, which is located near the end of intron 1 and is p53-responsive, and an upstream constitutive promoter (P1, which is p53-independent. Both promoter regions contain DNA variants that could influence the expression levels of MDM2, including the well-studied single nucleotide polymorphism (SNP SNP309, which is located in the promoter P2; i.e., upstream of exon 2. In this report, we screened the promoter P1 for DNA variants and assessed the functional impact of the corresponding SNPs. Using the dbSNP database and genotyping validation in individuals of European descent, we identified three common SNPs (−1494 G > A; indel 40 bp; and −182 C > G. Three major promoter haplotypes were inferred by using these three promoter SNPs together with rs2279744 (SNP309. Following subcloning into a gene reporter system, we found that two of the haplotypes significantly influenced MDM2 promoter activity in a haplotype-specific manner. Site-directed mutagenesis experiments indicated that the 40 bp insertion/deletion variation is causing the observed allelic promoter activity. This study suggests that part of the variability in the MDM2 expression levels could be explained by allelic p53-independent P1 promoter activity.

Identiifcation and validation of root-speciifc promoters in rice

Institute of Scientific and Technical Information of China (English)

HUANG Li-yu; ZHANG Fan; QIN Qiao; WANG Wen-sheng; ZHANG Ting; FU Bin-ying

2015-01-01

Novel promoters that confer root-speciifc expression would be useful for engineering resistance against problems of nutrient and water absorption by roots. In this study, the reverse transcriptase polymerase chain reaction was used to identify seven genes with root-speciifc expression in rice. The isolation and characterization of upstream promoter regions of ifve selected genes rice root-speciifc promoter (rRSP) 1 to 5 (rRSP1-rRSP5) and A2P (the promoter ofOsAct2) revealed that rRSP1, rRSP3, and rRSP5 are particularly important with respect to root-speciifc activities. Furthermore, rRSP1, rRSP3, and rRSP5 were observed to make different contributions to root activities in various species. These three promoters could be used for root-speciifc enhancement of target gene(s).

Characterization of the human UDP-galactose:ceramide galactosyltransferase gene promoter.

Science.gov (United States)

Tencomnao, T; Yu, R K; Kapitonov, D

2001-02-16

UDP-galactose:ceramide galactosyltransferase (CGT, EC 2.4.1.45) is a key enzyme in the biosynthesis of galactocerebroside, the most abundant glycosphingolipid in the myelin sheath. An 8 kb fragment upstream from the transcription initiation site of CGT gene was isolated from a human genomic DNA library. Primer extension analysis revealed a single transcription initiation site 329 bp upstream from the ATG start codon. Neither a consensus TATA nor a CCAAT box was identified in the proximity to the transcription start site; however, this region contains a high GC content and multiple putative regulatory elements. To investigate the transcriptional regulation of CGT, a series of 5' deletion constructs of the 5'-flanking region were generated and cloned upstream from the luciferase reporter gene. By comparing promoter activity in the human oligodendroglioma (HOG) and human neuroblastoma (LAN-5) cell lines, we found that the CGT promoter functions in a cell type-specific manner. Three positive cis-acting regulatory regions were identified, including a proximal region at -292/-256 which contains the potential binding sites for known transcription factors (TFs) such as Ets and SP1 (GC box), a distal region at -747/-688 comprising a number of binding sites such as the ERE half-site, NF1-like, TGGCA-BP, and CRE, and a third positive cis-acting region distally localized at -1325/-1083 consisting of binding sites for TFs such as nitrogen regulatory, TCF-1, TGGCA-BP, NF-IL6, CF1, bHLH, NF1-like, GATA, and gamma-IRE. A negative cis-acting domain localized in a far distal region at -1594/-1326 was also identified. Our results suggest the presence of both positive and negative cis-regulatory regions essential for the cell-specific expression in the TATA-less promoter of the human CGT gene.

ENHANCING THE ROLE OF STAKEHOLDERS IN THE MANAGEMENT OF UPSTREAM CILIWUNG WATERSHED

Directory of Open Access Journals (Sweden)

Iis Alviya

2016-08-01

Full Text Available Stakeholders have a ver y important role interm of the management of upstream watershed. Thus, the common understanding on the existence and role of stakeholders is an important factor in order to achieve good governance of watershed management, leading to the attainment of environmental, social and economic benefits. This paper aims to analyse the role, interests, and cooperation among stakeholders and its relationship with the condition of upper Ciliwung watershed. Stakeholder analysis was used in this study to identify stakeholders, to categorize them, and to investigate the relationship between stakeholders. The analysis showed the lack of cooperation among stakeholders both between key stakeholders with primar y stakeholders. This resulted in lack of communities' understanding on the benefits and the importance of conservation activities in the upstream Ciliwung watershed. Meanwhile, the cooperation between key stakeholders and supporting stakeholders, especially the providers of funds, was relatively better/stronger. This can be seen from a better management of inter-agency cooperation in the upstream Ciliwung watershed, although the effort was tend to be project-oriented. Therefore, communication forum need to be established, to taking role for synchronizing , collaborating and coordinating stakeholders' efforts, so that the management programs of upstream Ciliwung watershed can be integrated.

DOWNSTREAM ECOCIDE FROM UPSTREAM WATER PIRACY

OpenAIRE

Miah Muhammad Adel

2012-01-01

Upstream India and downstream Bangladesh share more than 50 international rivers. India has set up water diversion constructions in more than 50% of these rivers, the largest one being on the Bangladeshâs northwest upon the Ganges River, puts Bangladeshâs Gangetic ecosystem at stake. In some border rivers, India has set up groins on her side of river banks. Also, Indian side pumps Bangladesh river water stealthily from border-rivers. Further, India is constructing another dam and reservoir up...

The WW domain protein Kibra acts upstream of Hippo in Drosophila

DEFF Research Database (Denmark)

Baumgartner, Roland; Poernbacher, Ingrid; Buser, Nathalie

2010-01-01

inactivating the transcriptional coactivator Yorkie is well established, much less is known about the upstream events that regulate Hippo signaling activity. The FERM domain proteins Expanded and Merlin appear to represent two different signaling branches that feed into the Hippo pathway. Signaling...... by the atypical cadherin Fat may act via Expanded, but how Merlin is regulated has remained elusive. Here, we show that the WW domain protein Kibra is a Hippo signaling component upstream of Hippo and Merlin. Kibra acts synergistically with Expanded, and it physically interacts with Merlin. Thus, Kibra...

Impact of upstream industrial effluents on irrigation water quality ...

African Journals Online (AJOL)

Impact of upstream industrial effluents on irrigation water quality, soils and ... Knowledge of irrigation water quality is critical to predicting, managing and reducing salt ... Presence of heavy metals in concentration higher than the recommended ...

Water Stress in Global Transboundary River Basins: Significance of Upstream Water Use on Downstream Stress

Science.gov (United States)

Munia, H.; Guillaume, J. H. A.; Mirumachi, N.; Porkka,M.; Wada, Yoshihide; Kummu, M.

2016-01-01

Growing population and water demand have increased pressure on water resources in various parts of the globe, including many transboundary river basins. While the impacts of upstream water use on downstream water availability have been analyzed in many of these international river basins, this has not been systematically done at the global scale using coherent and comparable datasets. In this study, we aim to assess the change in downstream water stress due to upstream water use in the world's transboundary river basins. Water stress was first calculated considering only local water use of each sub-basin based on country-basin mesh, then compared with the situation when upstream water use was subtracted from downstream water availability. Wefound that water stress was generally already high when considering only local water use, affecting 0.95-1.44 billion people or 33%-51% of the population in transboundary river basins. After accounting for upstream water use, stress level increased by at least 1 percentage-point for 30-65 sub-basins, affecting 0.29-1.13 billion people. Altogether 288 out of 298 middle-stream and downstream sub-basin areas experienced some change in stress level. Further, we assessed whether there is a link between increased water stress due to upstream water use and the number of conflictive and cooperative events in the transboundary river basins, as captured by two prominent databases. No direct relationship was found. This supports the argument that conflicts and cooperation events originate from a combination of different drivers, among which upstream-induced water stress may play a role. Our findings contribute to better understanding of upstream-downstream dynamics in water stress to help address water allocation problems.

Sector report: Malaysia. Upstream oil and gas industry

International Nuclear Information System (INIS)

1997-01-01

This report is one of a series designed to introduce British exporters to the opportunities offered by the Malaysian market in oil and natural gas. The report includes Malaysia's oil and gas reserves, production, exploration, major profits upstream, production sharing contracts, pipeline construction, operators in production, service sector, and Petronas. (UK)

Interferon-induced transcription of a gene encoding a 15-kDA protein depends on an upstream enhancer element

International Nuclear Information System (INIS)

Reich, N.; Evans, B.; Levy, D.; Fahey, D.; Knight, E. Jr.; Darnell, J.E. Jr.

1987-01-01

A human gene encoding an interferon-induced 15-kDa protein has been isolated from a genomic library. The gene appears to be single-copy and is composed of two exons, the first of which contains the ATG translation initiation codon. In vitro nuclear run-on assays showed that the transcription rate of the gene is stimulated after interferon treatment. To analyze transcriptional regulatory sequences, the authors constructed recombinant plasmids for use in transient transfection assays of HeLa cells. Constructs containing 115 nucleotides 5' to the transcription initiation site were found to be fully inducible by interferon. Assays of deletion mutants identified a critical element for interferon induction located between -115 and -96, just upstream of the CCAAT box. Moreover, a DNA fragment including this region can confer interferon inducibility on a heterologous promoter (thymidine kinase) when cloned in either orientation upstream of the gene or downstream of the gene. These are properties characteristic of an enhancer element that is active only after treatment with interferon. This regulatory sequence may be shared by a group of interferon-induced genes, since a very similar sequence is present within the functional region near the RNA start site of another interferon-induced gene

Strategic human resources study of the upstream petroleum industry : the decade ahead

International Nuclear Information System (INIS)

2003-10-01

This report presents the results of a 10 month study of the human resources issues in Canada's upstream petroleum industry. The study identifies workforce demographics, skills, and supply and demand. It also discusses the impact of technology and other key challenges facing human resources issues. The upstream petroleum industry includes exploration and production, service industries, pipeline transmission, natural gas processing, and heavy oil and bitumen extracting and upgrading. The study defined four regions in Canada: Western Canada Sedimentary Basin, the oil sands, the north, and the east coast. The main influences on the management practices within the upstream petroleum industry are: globalization; cyclical economic conditions; operational excellence business models; government regulatory requirements; stakeholder expectations for involvement; technological advances; changing demographics, and workplace skills. The study also presented suggestions for changes in best practices to improve the efficiency and effectiveness of product and service delivery. refs., tabs., figs

Insulated hsp70B' promoter: stringent heat-inducible activity in replication-deficient, but not replication-competent adenoviruses.

Science.gov (United States)

Rohmer, Stanimira; Mainka, Astrid; Knippertz, Ilka; Hesse, Andrea; Nettelbeck, Dirk M

2008-04-01

Key to the realization of gene therapy is the development of efficient and targeted gene transfer vectors. Therapeutic gene transfer by replication-deficient or more recently by conditionally replication-competent/oncolytic adenoviruses has shown much promise. For specific applications, however, it will be advantageous to provide vectors that allow for external control of gene expression. The efficient cellular heat shock system in combination with available technology for focused and controlled hyperthermia suggests heat-regulated transcription control as a promising tool for this purpose. We investigated the feasibility of a short fragment of the human hsp70B' promoter, with and without upstream insulator elements, for the regulation of transgene expression by replication-deficient or oncolytic adenoviruses. Two novel adenoviral vectors with an insulated hsp70B' promoter were developed and showed stringent heat-inducible gene expression with induction ratios up to 8000-fold. In contrast, regulation of gene expression from the hsp70B' promoter without insulation was suboptimal. In replication-competent/oncolytic adenoviruses regulation of the hsp70B' promoter was lost specifically during late replication in permissive cells and could not be restored by the insulators. We developed novel adenovirus gene transfer vectors that feature improved and stringent regulation of transgene expression from the hsp70B' promoter using promoter insulation. These vectors have potential for gene therapy applications that benefit from external modulation of therapeutic gene expression or for combination therapy with hyperthermia. Furthermore, our study reveals that vector replication can deregulate inserted cellular promoters, an observation which is of relevance for the development of replication-competent/oncolytic gene transfer vectors. (c) 2008 John Wiley & Sons, Ltd.

Does eIF3 promote reinitiation after translation of short upstream ORFs also in mammalian cells?

Czech Academy of Sciences Publication Activity Database

Hronová, Vladislava; Mohammad, Mahabub Pasha; Wagner, Susan; Pánek, Josef; Gunišová, Stanislava; Zeman, Jakub; Poncová, Kristýna; Valášek, Leoš Shivaya

2017-01-01

Roč. 14, č. 12 (2017), s. 1660-1667 ISSN 1547-6286 R&D Projects: GA ČR GA15-10116S Institutional support: RVO:61388971 Keywords : ATF4 * eIF3 * GCN4 Subject RIV: EE - Microbiology, Virology OBOR OECD: Developmental biology Impact factor: 3.900, year: 2016

Restructuring: new relationships between the oil companies and the upstream oil firms

International Nuclear Information System (INIS)

Barreau, S.

2001-11-01

Since the 1986 oil shock, international oil companies have focused on their base competencies, concentrating on activities viewed as their core businesses and steadily increasing the number of tasks to be subcontracted to the upstream oil and gas service sector. The upstream oil and gas service companies had to be restructured to face this new challenge. The strategies they launched at the end of the 80's were varied. Some firms became largely integrated (Schlumberger, Baker Hughes, Halliburton) whereas other firms chose to broaden their range of services. However generally, they opted for external investment which led to an important wave of mergers and acquisitions. The first part characterizes the upstream oil and gas sector by introducing the main oil and gas service firms and their recent strategic evolution. This concludes with both an economic valuation and a typology of attempted growth strategies. To illustrate this, a matrix has been created to characterise the dynamic paths of the oil and gas service firms. The purpose of the second part is to consider the economic theories related to industrial strategies. The strategies of innovation, market protection, vertical integration and diversification have been studied to illustrate the main conclusion which is that the aim of all these strategies was to change the relationships between the oil companies and the upstream oil and gas service firms. (author)

The upstream escape of energized solar wind protons from the bow shock

International Nuclear Information System (INIS)

Greenstadt, E.W.

1975-01-01

Recently, there have been some systematic observations of backstreaming protons at the Earth's bow shock with parallel velocity components and total energies much too high to be associated with the usual long-period upstream waves or to be produced by Sonnerup's simple reflection process (Lin et al., 1974), and these protons (30-100keV) were attributed to some unknown acceleration mechanism in the upstream region. The observations of Lof et al. involved protons in high pitch angle, and, although their reasons for favoring an upstream acceleration were quite different, it may seem intuitive that high pitch angle particles would have difficulty escaping the shock, especially at large field-normal angles. Such an inference would superficially support the notion of energization outside the bow shock. It seems worthwhile therefore to examine the extent to which the geometry of individual particle motion alone might select among reflected particles those that can escape upstream and those that cannot. In this paper the geometry of escape is described and some simple numerical examples are worked out for a few special cases. It is found that protons with rather high energies and pitch angles can escape the shock at only marginally quasi-parallel field orientations (i.e., thetasub(nB) approximately 50 0 ), even if they have quite moderate speeds parallel to B. (Auth.)

Identification of a functional element in the promoter of the silkworm (Bombyx mori) fat body-specific gene Bmlp3.

Science.gov (United States)

Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou

2014-08-01

30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.

In silico Analysis of osr40c1 Promoter Sequence Isolated from Indica Variety Pokkali

OpenAIRE

W.S.I. de Silva; M.M.N. Perera; K.L.N.S. Perera; A.M. Wickramasuriya; G.A.U. Jayasekera

2017-01-01

The promoter region of a drought and abscisic acid (ABA) inducible gene, osr40c1, was isolated from a salt-tolerant indica rice variety Pokkali, which is 670 bp upstream of the putative translation start codon. In silico promoter analysis of resulted sequence showed that at least 15 types of putative motifs were distributed within the sequence, including two types of common promoter elements, TATA and CAAT boxes. Additionally, several putative cis-acing regulatory elements which may be involv...

Upstream pressure variations associated with the bow shock and their effects on the magnetosphere

International Nuclear Information System (INIS)

Fairfield, D.H.; Baumjohann, W.; Paschmann, G.; Luehr, H.; Sibeck, D.G.

1990-01-01

Magnetic field enhancements and depressions on the time scales of minutes were frequently observed simultaneously by the AMPTE CCE, GOES 5, and GOES 6 spacecraft in the subsolar magnetosphere. The source of these perturbations has been detected in the high time resolution AMPTE IRM measurements of the kinetic pressure of the solar wind upstream of the bow shock. It is argued that these upstream pressure variations are not inherent in the solar wind but rather are associated with the bow shock. This conclusion follows from the facts that (1) the upstream field strength and the density associated with the perturbations are highly correlated with each other whereas these quantities tend to be anticorrelated in the undisturbed solar wind, and (2) the upstream perturbations occur within the foreshock or at its boundary. The results imply a mode of interaction between the solar wind and the magnetosphere whereby density changes produced in the foreshock subsequently convect through the bow shock and impinge on the magnetosphere. Also velocity decreases deep within the foreshock sometimes reach many tens of kilometers per second and may be associated with further pressure variations as a changing interplanetary field direction changes the foreshock geometry. Upstream pressure perturbations should create significant effects on the magnetopause and at the foot of nearby field lines that lead to the polar cusp ionosphere

Synthetic promoter libraries for Corynebacterium glutamicum

DEFF Research Database (Denmark)

Rytter, Jakob Vang; Helmark, Søren; Chen, Jun

2014-01-01

The ability to modulate gene expression is an important genetic tool in systems biology and biotechnology. Here, we demonstrate that a previously published easy and fast PCR-based method for modulating gene expression in lactic acid bacteria is also applicable to Corynebacterium glutamicum. We co...... promoter library (SPL) technology is convenient for modulating gene expression in C. glutamicum and should have many future applications, within basic research as well as for optimizing industrial production organisms....... constructed constitutive promoter libraries based on various combinations of a previously reported C. glutamicum -10 consensus sequence (gngnTA(c/t)aaTgg) and the Escherichia coli -35 consensus, either with or without an AT-rich region upstream. A promoter library based on consensus sequences frequently found...... in low-GC Gram-positive microorganisms was also included. The strongest promoters were found in the library with a -35 region and a C. glutamicum -10 consensus, and this library also represents the largest activity span. Using the alternative -10 consensus TATAAT, which can be found in many other...

Multiple spacecraft observations of interplanetary shocks: characteristics of the upstream ulf turbulence

International Nuclear Information System (INIS)

Russell, C.T.; Smith, E.J.; Tsurutani, B.T.; Gosling, J.T.; Bame, S.J.

1982-01-01

All interplanetary shocks observed by ISEE-3 and either ISEE-1 or ISEE-2 or both in 1978 and 1979 are examined for evidence of upstream waves. In order to characterize the properties of these shocks it is necessary to determine accurate shock normals. We invert an overdetermined set of equations to obtain shock normals, velocities and error estimates for all these shocks. Tests of the method indicate it is quite reliable. Using these normals we then calculate the Mach number and angle between the interplanetary magnetic field and the shock normal for each shock. These parameters allow us to separate the upstream waves into two classes: whistler-mode precursors which occur at low Mach numbers and upstream turbulence whose amplitude at Mach numbers greater than 1.5 is controlled by the angle of the field to the shock normal. The former waves are right-hand circularly polarized and quite monochromatic. The latter waves are more linearly polarized and have a broadband featureless spectrum

Biodiesel byproduct bioconversion to rhamnolipids: Upstream aspects.

Science.gov (United States)

Salazar-Bryam, Ana Maria; Lovaglio, Roberta Barros; Contiero, Jonas

2017-06-01

This study focused on two important aspects of the upstream process: the appropriate use of crude glycerol as a low-cost carbon source, and strain selection. The effect of different crude glycerol concentrations on rhamnolipid biosynthesis by two Pseudomonas aeruginosa strains (wild type LBI and mutant LBI 2A1) was studied. Finally, the synthesized rhamnolipids were characterized by mass spectrometry. When both strains were compared, 50 g/L was the most favorable concentration for both, but P. aeruginosa LBI 2A1 showed an increase in rhamnolipid production (2.55 g/L) of 192% over wild type (1.3 g/L). The higher rhamnolipid production could be related to a possible mechanism developed after the mutation process at high antibiotic concentrations. Mass spectrometry confirmed the glycolipid nature of the produced biosurfactant, and the homologue composition showed a wide mixture of mono and di-rhamnolipids. These results show that high glycerol concentrations can inhibit microbial metabolism, due to osmotic stress, leading to a better understanding of glycerol metabolism towards its optimization in fermentation media. Since P. aeruginosa LBI 2A1 showed higher conversion yields than P. aeruginosa LBI, the use of a mutant strain associated with a low cost carbon source might improve biosurfactant biosynthesis, therefore yielding an important upstream improvement.

Torque fluctuations caused by upstream mean flow and turbulence

Science.gov (United States)

Farr, T. D.; Hancock, P. E.

2014-12-01

A series of studies are in progress investigating the effects of turbine-array-wake interactions for a range of atmospheric boundary layer states by means of the EnFlo meteorological wind tunnel. The small, three-blade model wind turbines drive 4-quadrant motor-generators. Only a single turbine in neutral flow is considered here. The motor-generator current can be measured with adequate sensitivity by means of a current sensor allowing the mean and fluctuating torque to be inferred. Spectra of torque fluctuations and streamwise velocity fluctuations ahead of the rotor, between 0.1 and 2 diameters, show that only the large-scale turbulent motions contribute significantly to the torque fluctuations. Time-lagged cross-correlation between upstream velocity and torque fluctuations are largest over the inner part of the blade. They also show the turbulence to be frozen in behaviour over the 2 diameters upstream of the turbine.

CLICs-dependent chloride efflux is an essential and proximal upstream event for NLRP3 inflammasome activation.

Science.gov (United States)

Tang, Tiantian; Lang, Xueting; Xu, Congfei; Wang, Xiaqiong; Gong, Tao; Yang, Yanqing; Cui, Jun; Bai, Li; Wang, Jun; Jiang, Wei; Zhou, Rongbin

2017-08-04

The NLRP3 inflammasome can sense different pathogens or danger signals, and has been reported to be involved in the development of many human diseases. Potassium efflux and mitochondrial damage are both reported to mediate NLRP3 inflammasome activation, but the underlying, orchestrating signaling events are still unclear. Here we show that chloride intracellular channels (CLIC) act downstream of the potassium efflux-mitochondrial reactive oxygen species (ROS) axis to promote NLRP3 inflammasome activation. NLRP3 agonists induce potassium efflux, which causes mitochondrial damage and ROS production. Mitochondrial ROS then induces the translocation of CLICs to the plasma membrane for the induction of chloride efflux to promote NEK7-NLRP3 interaction, inflammasome assembly, caspase-1 activation, and IL-1β secretion. Thus, our results identify CLICs-dependent chloride efflux as an essential and proximal upstream event for NLRP3 activation.The NLRP3 inflammasome is key to the regulation of innate immunity against pathogens or stress, but the underlying signaling regulation is still unclear. Here the authors show that chloride intracellular channels (CLIC) interface between mitochondria stress and inflammasome activation to modulate inflammatory responses.

The role of chicken ovalbumin upstream promoter transcription factor II in the regulation of hepatic fatty acid oxidation and gluconeogenesis in newborn mice.

Science.gov (United States)

Planchais, Julien; Boutant, Marie; Fauveau, Véronique; Qing, Lou Dan; Sabra-Makke, Lina; Bossard, Pascale; Vasseur-Cognet, Mireille; Pégorier, Jean-Paul

2015-05-15

Chicken ovalbumin upstream promoter transcription factor II (COUP-TFII) is an orphan nuclear receptor involved in the control of numerous functions in various organs (organogenesis, differentiation, metabolic homeostasis, etc.). The aim of the present work was to characterize the regulation and contribution of COUP-TFII in the control of hepatic fatty acid and glucose metabolisms in newborn mice. Our data show that postnatal increase in COUP-TFII mRNA levels is enhanced by glucagon (via cAMP) and PPARα. To characterize COUP-TFII function in the liver of suckling mice, we used a functional (dominant negative form; COUP-TFII-DN) and a genetic (shRNA) approach. Adenoviral COUP-TFII-DN injection induces a profound hypoglycemia due to the inhibition of gluconeogenesis and fatty acid oxidation secondarily to reduced PEPCK, Gl-6-Pase, CPT I, and mHMG-CoA synthase gene expression. Using the crossover plot technique, we show that gluconeogenesis is inhibited at two different levels: 1) pyruvate carboxylation and 2) trioses phosphate synthesis. This could result from a decreased availability in fatty acid oxidation arising cofactors such as acetyl-CoA and reduced equivalents. Similar results are observed using the shRNA approach. Indeed, when fatty acid oxidation is rescued in response to Wy-14643-induced PPARα target genes (CPT I and mHMG-CoA synthase), blood glucose is normalized in COUP-TFII-DN mice. In conclusion, this work demonstrates that postnatal increase in hepatic COUP-TFII gene expression is involved in the regulation of liver fatty acid oxidation, which in turn sustains an active hepatic gluconeogenesis that is essential to maintain an appropriate blood glucose level required for newborn mice survival. Copyright © 2015 the American Physiological Society.

Knockdown of a HIF-2α promoter upstream long noncoding RNA impairs colorectal cancer stem cell properties in vitro through HIF-2α downregulation

Directory of Open Access Journals (Sweden)

Yao J

2015-11-01

Full Text Available Jie Yao,1,* Jianxiong Li,2,* Peiliang Geng,2,* Yi Li,3,* Hong Chen,3 Yunfeng Zhu2 1Department of Oncology, People’s Liberation Army No 161 Hospital, Wuhan, 2Cancer Center, Division of Internal Medicine, Chinese PLA General Hospital, Beijing, 3Department of Oncology, Kunming General Hospital of Chendu Military Command, Kunming, People’s Republic of China *These authors contributed equally to this work Abstract: Currently, various long noncoding RNAs (lncRNAs have been identified as key regulators of multiple cancers. However, cancer stem cell (CSC-related lncRNAs have rarely been reported. In this study, we found an lncRNA that is a promoter upstream transcript of hypoxia-inducible factor-2α (HIF-2α, and we named it “lncRNA-HIF2PUT”. The function of HIF-2α is closely connected with “stem cell-like” properties, and the function of PROMPTs is often associated with the adjacent protein-coding transcripts. Herein, we showed that the expression of lncRNA-HIF2PUT was significantly correlated with HIF-2α in colorectal cancer (CRC tissues. Knockdown of lncRNA-HIF2PUT blocked the HIF-2α expression and inhibited the CSC properties in CRC cell lines DLD-1 and HT29. LncRNA-HIF2PUTsmall interfering RNA transfection resulted in decreased stemness genes expression, impaired colony formation, and spheroid formation ability, retarded migration, and invasion of the cells. These data suggest that lncRNA-HIF2PUT may be a regulator of HIF-2α and a mediator of CSCs in CRC. Keywords: HIF-2α, long noncoding RNA, colorectal cancer, stem cell properties

Sectoral approaches establishment for climate change mitigation in Thailand upstream oil and gas industry

International Nuclear Information System (INIS)

Chaiyapa, Warathida; Esteban, Miguel; Kameyama, Yasuko

2016-01-01

Understanding the upstream oil and gas (O&G) industry's responses to climate change and what factors can be influential to trigger their mitigation strategies is crucial for policy-makers to harness the huge resources that this industry can mobilize towards environmental protection. Considering that individual climate change efforts are unlikely to affect global mitigation paths, the study investigates the possibility that sectoral approaches can help in the reduction of greenhouse gas emissions, using Thailand as a case study. It conducted online questionnaire surveys and semi-structured interviews to acquire primary data from companies and key informants from the government, NGOs, NPOs and academics. The results suggested that, among three possible groups of factors that could affect company decisions on whether to promote sectoral approaches, domestic politics (particularly the Thai government) is the most important, though other factors also play important and interrelated roles. The most welcomed type of scheme that could be envisaged would appear to be a sectoral agreement between government and industry. Finally, the authors provide two main policy recommendations, namely the establishment of an industrial association of O&G companies and for it to target how to start looking at measures to reduce greenhouse gas emissions amongst large companies in the sector. - Highlights: •Examining the possibility of establishing a sectoral approach Thailand's upstream O&G industry. •Analytical framework was constructed to ascertain most influential factors. •Questionnaires and interviews were employed with companies, government, NGOs and academic. •Domestic politics is the most determining factor, but other factors have strong interrelation. •Sectoral agreement between government and industry is the most likely scheme to be established.

Collisionless shocks and upstream waves and particles: Introductory remarks

International Nuclear Information System (INIS)

Kennel, C.F.

1981-01-01

We discuss more aspects of collisionless shock theory that might be pertinent to the problem of upstream waves and particles. It is hoped that our qualititive remarks may be a useful guide for the general reader as he goes through the detailed papers to come

Research on performance of upstream pumping mechanical seal with different deep spiral groove

International Nuclear Information System (INIS)

Wang, Q; Chen, H L; Liu, T; Liu, Y H; Liu, Z B; Liu, D H

2012-01-01

As one new type of mechanical seal, Upstream Pumping Mechanical Seal has been widely used in fluid machinery. In this paper, structure of spiral groove is innovatively optimized to improve performance of Upstream Pumping Mechanical Seal with Spiral Groove: keeping the dam zone and the weir zone not changed, changing the bottom shape of spiral groove only, substituting different deep spiral groove for equal deep spiral groove. The simulation on Upstream Pumping Mechanical Seal with different deep spiral grooves is done using FVM method. According to calculation, the performances of opening force and pressure distribution on seals face are obtained. Five types of spiral grooves are analyzed, namely equal deep spiral groove, circumferential convergent ladder-like different deep spiral groove, circumferential divergent ladder-like different deep spiral groove, radial convergent ladder-like different deep spiral groove and radial divergent ladder-like different deep spiral groove. This paper works on twenty-five working conditions. The results indicate the performances of circumferential divergent 2-ladder different deep spiral groove are better than the others, with more opening force and better stabilization, while with the same leakage. The outcome provides theoretical support for application of Upstream Pumping Mechanical Seal with circumferential convergent ladder-like different deep spiral groove.

Research on performance of upstream pumping mechanical seal with different deep spiral groove

Science.gov (United States)

Wang, Q.; Chen, H. L.; Liu, T.; Liu, Y. H.; Liu, Z. B.; Liu, D. H.

2012-11-01

As one new type of mechanical seal, Upstream Pumping Mechanical Seal has been widely used in fluid machinery. In this paper, structure of spiral groove is innovatively optimized to improve performance of Upstream Pumping Mechanical Seal with Spiral Groove: keeping the dam zone and the weir zone not changed, changing the bottom shape of spiral groove only, substituting different deep spiral groove for equal deep spiral groove. The simulation on Upstream Pumping Mechanical Seal with different deep spiral grooves is done using FVM method. According to calculation, the performances of opening force and pressure distribution on seals face are obtained. Five types of spiral grooves are analyzed, namely equal deep spiral groove, circumferential convergent ladder-like different deep spiral groove, circumferential divergent ladder-like different deep spiral groove, radial convergent ladder-like different deep spiral groove and radial divergent ladder-like different deep spiral groove. This paper works on twenty-five working conditions. The results indicate the performances of circumferential divergent 2-ladder different deep spiral groove are better than the others, with more opening force and better stabilization, while with the same leakage. The outcome provides theoretical support for application of Upstream Pumping Mechanical Seal with circumferential convergent ladder-like different deep spiral groove.

Loss of proteostatic control as a substrate for Atrial Fibrillation; a novel target for upstream therapy by Heat Shock Proteins

Directory of Open Access Journals (Sweden)

Roelien Amanda Marjolein Meijering

2012-02-01

Full Text Available Atrial Fibrillation (AF is the most common, sustained clinical tachyarrhythmia associated with significant morbidity and mortality. AF is a persistent condition with progressive structural remodeling of the atrial cardiomyocytes due to the AF itself, resulting in cellular changes commonly observed in ageing and in other heart diseases. While rhythm control by electrocardioversion or drug treatment is the treatment of choice in symptomatic AF patients, its effectiveness is still limited. Current research is directed at preventing new-onset AF by limiting the development of substrates underlying AF promotion and resembles mechanism-based therapy. Upstream therapy refers to the use of non-ion channel anti-arrhythmic drugs that modify the atrial substrate- or target-specific mechanisms of AF, with the ultimate aim to prevent the occurrence (primary prevention or recurrence of the arrhythmia following (spontaneous conversion (secondary prevention.Heat shock proteins (HSPs are molecular chaperones and comprise a large family of proteins involved in the protection against various forms of cellular stress. Their classical function is the conservation of proteostasis via prevention of toxic protein aggregation by binding to (partially unfolded proteins. Our recent data reveal that HSPs prevent electrical, contractile and structural remodeling of cardiomyocytes, thus attenuating the AF substrate in cellular, Drosophila melanogaster and animal experimental models. Furthermore, studies in humans suggest a protective role for HSPs against the progression from paroxysmal AF to persistent AF and in recurrence of AF. In this review, we discuss upregulation of the heat shock response system as a novel target for upstream therapy to prevent derailment of proteostasis and consequently promotion and recurrence of AF.

Biodiesel byproduct bioconversion to rhamnolipids: Upstream aspects

OpenAIRE

Salazar-Bryam, Ana Maria; Lovaglio, Roberta Barros; Contiero, Jonas

2017-01-01

This study focused on two important aspects of the upstream process: the appropriate use of crude glycerol as a low-cost carbon source, and strain selection. The effect of different crude glycerol concentrations on rhamnolipid biosynthesis by two Pseudomonas aeruginosa strains (wild type LBI and mutant LBI 2A1) was studied. Finally, the synthesized rhamnolipids were characterized by mass spectrometry. When both strains were compared, 50 g/L was the most favorable concentration for both, but P...

Identification of cis-acting regulatory elements in the human oxytocin gene promoter.

Science.gov (United States)

Richard, S; Zingg, H H

1991-12-01

The expression of hormone-inducible genes is determined by the interaction of trans-acting factors with hormone-inducible elements and elements mediating basal and cell-specific expression. We have shown earlier that the gene encoding the hypothalamic nonapeptide oxytocin (OT) is under the control of an estrogen response element (ERE). The present study was aimed at identifying cis-acting elements mediating basal expression of the OT gene. A construct containing sequences -381 to +36 of the human OT gene was linked to a reporter gene and transiently transfected into a series of neuronal and nonneuronal cell lines. Expression of this construct was cell specific: it was highest in the neuroblastoma-derived cell line, Neuro-2a, and lowest in NIH 3T3 and JEG-3 cells. By 5' deletion analysis, we determined that a segment from -49 to +36 was capable of mediating cells-pecific promoter activity. Within this segment, we identified three proximal promoter elements (PPE-1, PPE-2, and PPE-3) that are each required for promoter activity. Most notably, mutation of a conserved purine-rich element (GAGAGA) contained within PPE-2 leads to a 10-fold decrease in promoter strength. Gel mobility shift analysis with three different double-stranded oligonucleotides demonstrated that each proximal promoter element binds distinct nuclear factors. In each case, only the homologous oligonucleotide, but neither of the oligonucleotides corresponding to adjacent elements, was able to act as a competitor. Thus, a different set of factors appears to bind independently to each element. By reinserting the homologous ERE or a heterologous glucocorticoid response element upstream of intact or altered proximal promoter segments we determined that removal or mutation of proximal promoter elements decreases basal expression, but does not abrogate the hormone responsiveness of the promoter. In conclusion, these results indicate that an important component of the transcriptional activity of the OT

Proteomic identification of an embryo-specific 1Cys-Prx promoter and analysis of its activity in transgenic rice.

Science.gov (United States)

Kim, Je Hein; Jung, In Jung; Kim, Dool Yi; Fanata, Wahyu Indra; Son, Bo Hwa; Yoo, Jae Yong; Harmoko, Rikno; Ko, Ki Seong; Moon, Jeong Chan; Jang, Ho Hee; Kim, Woe Yeon; Kim, Jae-Yean; Lim, Chae Oh; Lee, Sang Yeol; Lee, Kyun Oh

2011-04-29

Proteomic analysis of a rice callus led to the identification of 10 abscisic acid (ABA)-induced proteins as putative products of the embryo-specific promoter candidates. 5'-flanking sequence of 1 Cys-Prx, a highly-induced protein gene, was cloned and analyzed. The transcription initiation site of 1 Cys-Prx maps 96 nucleotides upstream of the translation initiation codon and a TATA-box and putative seed-specific cis-acting elements, RYE and ABRE, are located 26, 115 and 124 bp upstream of the transcription site, respectively. β-glucuronidase (GUS) expression driven by the 1 Cys-Prx promoters was strong in the embryo and aleurone layer and the activity reached up to 24.9 ± 3.3 and 40.5 ± 2.1 pmol (4 MU/min/μg protein) in transgenic rice seeds and calluses, respectively. The activity of the 1 Cys-Prx promoters is much higher than that of the previously-identified embryo-specific promoters, and comparable to that of strong endosperm-specific promoters in rice. GUS expression driven by the 1 Cys-Prx promoters has been increased by ABA treatment and rapidly induced by wounding in callus and at the leaf of the transgenic plants, respectively. Furthermore, ectopic expression of the GUS construct in Arabidopsis suggested that the 1 Cys-Prx promoter also has strong activity in seeds of dicot plants. Copyright © 2011 Elsevier Inc. All rights reserved.

Employee assistance programs in the upstream petroleum industry

International Nuclear Information System (INIS)

Crutcher, R.A.; Yip, R.Y.; Young, M.R.

1991-01-01

This paper is a descriptive overview of Employee Assistance Programs (EAPs) in the upstream Canadian petroleum industry. The authors review current EAP models within the occupational health setting and the Canadian health care context. This article also explores the challenging issues of EAP's emergent functions in workplace substance abuse programs, its changing role in organizational effectiveness and its professional identity

In silico Analysis of osr40c1 Promoter Sequence Isolated from Indica Variety Pokkali

Directory of Open Access Journals (Sweden)

W.S.I. de Silva

2017-07-01

Full Text Available The promoter region of a drought and abscisic acid (ABA inducible gene, osr40c1, was isolated from a salt-tolerant indica rice variety Pokkali, which is 670 bp upstream of the putative translation start codon. In silico promoter analysis of resulted sequence showed that at least 15 types of putative motifs were distributed within the sequence, including two types of common promoter elements, TATA and CAAT boxes. Additionally, several putative cis-acing regulatory elements which may be involved in regulation of osr40c1 expression under different conditions were found in the 5′-upstream region of osr40c1. These are ABA-responsive element, light-responsive elements (ATCT-motif, Box I, G-box, GT1-motif, Gap-box and Sp1, myeloblastosis oncogene response element (CCAAT-box, auxin responsive element (TGA-element, gibberellin-responsive element (GARE-motif and fungal-elicitor responsive elements (Box E and Box-W1. A putative regulatory element, required for endosperm-specific pattern of gene expression designated as Skn-1 motif, was also detected in the Pokkali osr40c1 promoter region. In conclusion, the bioinformatic analysis of osr40c1 promoter region isolated from indica rice variety Pokkali led to the identification of several important stress-responsive cis-acting regulatory elements, and therefore, the isolated promoter sequence could be employed in rice genetic transformation to mediate expression of abiotic stress induced genes.

LuFLA1PRO and LuBGAL1PRO promote gene expression in the phloem fibres of flax (Linum usitatissimum).

Science.gov (United States)

Hobson, Neil; Deyholos, Michael K

2013-04-01

Cell type-specific promoters were identified that drive gene expression in an industrially important product. To identify flax (Linum usitatissimum) gene promoters, we analyzed the genomic regions upstream of a fasciclin-like arabinogalactan protein (LuFLA1) and a beta-galactosidase (LuBGAL1). Both of these genes encode transcripts that have been found to be highly enriched in tissues bearing phloem fibres. Using a beta-glucuronidase (GUS) reporter construct, we found that a 908-bp genomic sequence upstream of LuFLA1 (LuFLA1PRO) directed GUS expression with high specificity to phloem fibres undergoing secondary cell wall development. The DNA sequence upstream of LuBGAL1 (LuBGAL1PRO) likewise produced GUS staining in phloem fibres with developing secondary walls, as well as in tissues of developing flowers and seed bolls. These data provide further evidence of a specific role for LuFLA1 in phloem fibre development, and demonstrate the utility of LuFLA1PRO and LuBGAL1PRO as tools for biotechnology and further investigations of phloem fibre development.

Biodiesel byproduct bioconversion to rhamnolipids: Upstream aspects

Directory of Open Access Journals (Sweden)

Ana Maria Salazar-Bryam

2017-06-01

Full Text Available This study focused on two important aspects of the upstream process: the appropriate use of crude glycerol as a low-cost carbon source, and strain selection. The effect of different crude glycerol concentrations on rhamnolipid biosynthesis by two Pseudomonas aeruginosa strains (wild type LBI and mutant LBI 2A1 was studied. Finally, the synthesized rhamnolipids were characterized by mass spectrometry. When both strains were compared, 50 g/L was the most favorable concentration for both, but P. aeruginosa LBI 2A1 showed an increase in rhamnolipid production (2.55 g/L of 192% over wild type (1.3 g/L. The higher rhamnolipid production could be related to a possible mechanism developed after the mutation process at high antibiotic concentrations. Mass spectrometry confirmed the glycolipid nature of the produced biosurfactant, and the homologue composition showed a wide mixture of mono and di-rhamnolipids. These results show that high glycerol concentrations can inhibit microbial metabolism, due to osmotic stress, leading to a better understanding of glycerol metabolism towards its optimization in fermentation media. Since P. aeruginosa LBI 2A1 showed higher conversion yields than P. aeruginosa LBI, the use of a mutant strain associated with a low cost carbon source might improve biosurfactant biosynthesis, therefore yielding an important upstream improvement. Keywords: Biotechnology, Microbiology

Increased risk of oesophageal adenocarcinoma among upstream petroleum workers

Science.gov (United States)

Kirkeleit, Jorunn; Riise, Trond; Bjørge, Tone; Moen, Bente E; Bråtveit, Magne; Christiani, David C

2013-01-01

Objectives To investigate cancer risk, particularly oesophageal cancer, among male upstream petroleum workers offshore potentially exposed to various carcinogenic agents. Methods Using the Norwegian Registry of Employers and Employees, 24 765 male offshore workers registered from 1981 to 2003 was compared with 283 002 male referents from the general working population matched by age and community of residence. The historical cohort was linked to the Cancer Registry of Norway and the Norwegian Cause of Death Registry. Results Male offshore workers had excess risk of oesophageal cancer (RR 2.6, 95% CI 1.4 to 4.8) compared with the reference population. Only the adenocarcinoma type had a significantly increased risk (RR 2.7, 95% CI 1.0 to 7.0), mainly because of an increased risk among upstream operators (RR 4.3, 95% CI 1.3 to 14.5). Upstream operators did not have significant excess of respiratory system or colon cancer or mortality from any other lifestyle-related diseases investigated. Conclusion We found a fourfold excess risk of oesophageal adenocarcinoma among male workers assumed to have had the most extensive contact with crude oil. Due to the small number of cases, and a lack of detailed data on occupational exposure and lifestyle factors associated with oesophageal adenocarcinoma, the results must be interpreted with caution. Nevertheless, given the low risk of lifestyle-related cancers and causes of death in this working group, the results add to the observations in other low-powered studies on oesophageal cancer, further suggesting that factors related to the petroleum stream or carcinogenic agents used in the production process might be associated with risk of oesophageal adenocarcinoma. PMID:19858535

The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

Science.gov (United States)

Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

1987-01-01

Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

Evaluation of synthetic promoters in Physcomitrella patens

DEFF Research Database (Denmark)

Peramuna, Anantha; Bae, Hansol; Rasmussen, Erling Koch

2018-01-01

Securing a molecular toolbox including diverse promoters is essential for genome engineering. However, native promoters have limitations such as the available number or the length of the promoter. In this work, three short synthetic promoters were characterized by using the yellow fluorescent...

How will climate change policy affect upstream oil and gas

International Nuclear Information System (INIS)

Hyndman, R.

2003-01-01

This presentation outlined the status of climate change policies in Canada and Alberta for large industry with particular reference to the effect that the policies may have on upstream oil and gas. Global climate change and energy use was outlined along with what actions that should be taken to secure energy supplies and stabilize greenhouse gas (GHG) emissions. An economic model projection of global carbon dioxide emissions without the Kyoto agreement was presented. Global action on climate change will likely include greater efforts in energy efficiency to slow the growth in demand for energy. However, demand for oil and gas is still likely to increase in the next few decades due to a growing population worldwide. The author emphasized that developing countries should not forgo economic growth to avoid higher energy use. It was argued that Canadian climate change policies are out of line with the global climate change effort because they focus on short-term reductions rather than developing technologies. The policies also divert investment to competing suppliers that do not impose GHG costs, with no global GHG benefit. The author described why Alberta climate change policy rejects the Kyoto target. Natural Resource Canada's approach to large industrial emitters was also discussed along with a proposed policy framework by the Canadian Association of Petroleum Producers (CAPP) for long term certainty. 2 tabs., 12 figs

Characterization of upstream sequences of the LIM2 gene that bind developmentally regulated and lens-specific proteins

Institute of Scientific and Technical Information of China (English)

HSU Heng; Robert L. CHURCH

2004-01-01

During lens development, lens epithelial cells differentiate into fiber cells. To date, four major lens fiber cell intrinsic membrane proteins (MIP) ranging in size from 70 kD to 19 kD have been characterized. The second most abundant lens fiber cell intrinsic membrane protein is MP19. This protein probably is involved with lens cell communication and relates with cataractogenesis. The aim of this research is to characterize upstream sequences of the MP19 (also called LIM2) gene that bind developmentally regulated and lens-specific proteins. We have used the gel mobility assays and corresponding competition experiments to identify and characterize cis elements within approximately 500 bases of LIM2 upstream sequences. Our studies locate the positions of some cis elements, including a "CA" repeat, a methylation Hha I island, an FnuD II site, an Ap1 and an Ap2 consensus sequences, and identify some specific cis elements which relate to lens-specific transcription of LIM2. Our experiments also preliminarily identify trans factors which bind to specific cis elements of the LIM2 promoter and/or regulate transcription of LIM2. We conclude that developmental regulation and coordination of the MP 19 gene in ocular lens fiber cells is controlled by the presence of specific cis elements that bind regulatory trans factors that affect LIM2 gene expression. DNA methylation is one mechanism of controlling LIM2 gene expression during lens development.

Wind Predictions Upstream Wind Turbines from a LiDAR Database

Directory of Open Access Journals (Sweden)

Soledad Le Clainche

2018-03-01

Full Text Available This article presents a new method to predict the wind velocity upstream a horizontal axis wind turbine from a set of light detection and ranging (LiDAR measurements. The method uses higher order dynamic mode decomposition (HODMD to construct a reduced order model (ROM that can be extrapolated in space. LiDAR measurements have been carried out upstream a wind turbine at six different planes perpendicular to the wind turbine axis. This new HODMD-based ROM predicts with high accuracy the wind velocity during a timespan of 24 h in a plane of measurements that is more than 225 m far away from the wind turbine. Moreover, the technique introduced is general and obtained with an almost negligible computational cost. This fact makes it possible to extend its application to both vertical axis wind turbines and real-time operation.

Meta-analysis of Arabidopsis KANADI1 direct target genes identifies basic growth-promoting module acting upstream of hormonal signaling pathways

DEFF Research Database (Denmark)

Xie, Yakun; Straub, Daniel; Eguen, Teinai Ebimienere

2015-01-01

An intricate network of antagonistically acting transcription factors mediates formation of a flat leaf lamina of Arabidopsis thaliana plants. In this context, members of the class III homeodomain leucine zipper (HD-ZIPIII) transcription factor family specify the adaxial domain (future upper side......) of the leaf, while antagonistically acting KANADI transcription factors determine the abaxial domain (future lower side). Here we used an mRNA-seq approach to identify genes regulated by KANADI1 (KAN1) and subsequently performed a meta-analysis approach combining our datasets with published genome......-wide datasets. Our analysis revealed that KAN1 acts upstream of several genes encoding auxin biosynthetic enzymes. When exposed to shade, we find three YUCCA genes, YUC2, YUC5 and YUC8 to be transcriptionally upregulated, which correlates with an increase in the levels of free auxin. When ectopically expressed...

SPORT PROMOTION STRATEGIES

Directory of Open Access Journals (Sweden)

Alexandru Lucian MIHAI

2013-10-01

Full Text Available In sport marketing, the word promotion covers a range of interrelated activities. All of these activities are designed to attract attention, stimulate the interest and awareness of consumers, and of course, encourage them to purchase a sport product. Promotion is about communicating with and educating consumers. The purpose of a sport promotional strategy is to build brand loyalty and product credibility, develop image, and position the brand. A promotional strategy is similar to a marketing strategy, but the promotional strategy seeks short-term objectives, both direct and indirect. Promotional objectives usually include increased sales, stimulate impulse buying, raise customer traffic, and present and reinforce image. It also provides information about products and services, publicizes new stores or websites, and creates and enhances customer satisfaction.

Willingness of upstream and downstream resource managers to engage in compensation schemes for environmental services

Directory of Open Access Journals (Sweden)

Chapika Sangkapitux

2009-04-01

Full Text Available Providing compensation for agricultural conservation practices adopted by upstream farmers is still an alien concept in the Thai political context. The governance of common-pool natural resources, such as forest and water, has traditionally been under the control of powerful government line agencies, while the contribution of local communities to natural resource conservation have been hardly recognized by policy-makers. Drawing on a case study in Mae Sa watershed, Chiang Mai province, northern Thailand, this paper discusses the potential of developing compensation schemes in a socio-political context where upland farmers – mostly belonging to ethnic minority groups – tend to be considered a threat to the natural resource base rather than providers of environmental services. Based on data obtained from 371 households in the upstream communities and 151 households in the downstream communities of the watershed, upstream resource managers’ willingness to accept compensation for the conservation measures and downstream resource managers’ willingness to pay for water resource improvements were estimated through the use of choice experiments. Results from the study suggest that downstream resource managers would be willing to provide on average nearly 1% of their annual income for a substantial improvement of the quantity and quality of water resources, which could be achieved by compensating upstream farmers’ change of their agricultural systems towards more environment-friendly practices. Both willingness to pay of downstream respondents and willingness of upstream resource managers to accept compensation were positively correlated with age, education, participation in environmental conservation activities and previous experiences with droughts and/or erosion. The paper concludes that there is a clear potential for establishing compensation schemes for provision of environmental services in northern Thai watersheds. The important policy

Identification of a type 1 diabetes-associated CD4 promoter haplotype with high constitutive activity

DEFF Research Database (Denmark)

Kristiansen, O P; Karlsen, A E; Larsen, Z M

2004-01-01

screened the human CD4 promoter for mutations and identified three frequent single nucleotide polymorphisms (SNPs): CD4-181C/G, CD4-521C/G and CD4-1050T/C. The SNPs are in strong linkage disequilibrium (LD) and association with the CD4-1188(TTTTC)(5-14) alleles, and we observed nine CD4 promoter haplotypes...... promoter activity and (2) the CD4-181G variant encodes higher stimulated promoter activity than the CD4-181C variant. This difference is in part neutralized in the frequently occurring CD4 promoter haplotypes by the more upstream genetic variants. Thus, we report functional impact of a novel CD4-181C/G SNP...

Canada's upstream petroleum industry : 1997 perspective

International Nuclear Information System (INIS)

1997-06-01

A review of the trends and activities in the upstream petroleum industry during 1996 were presented, emphasizing the significance of the industry' contribution to Canada's economy. Among the areas included were highlights of Canada's hydrocarbon reserves, conventional production, frontier production, and non-conventional (oil sands) production. New market opportunities and activities in the pipeline transportation sector were also discussed. Environmental issues including health and safety received due attention. In this regard, the industry's efforts to work with government and other stakeholders to ensure that requirements for land use are balanced with the need to protect wilderness and wildlife habitat, received special mention. 16 figs

Properties of promoters cloned randomly from the Saccharomyces cerevisiae genome.

Science.gov (United States)

Santangelo, G M; Tornow, J; McLaughlin, C S; Moldave, K

1988-01-01

Promoters were isolated at random from the genome of Saccharomyces cerevisiae by using a plasmid that contains a divergently arrayed pair of promoterless reporter genes. A comprehensive library was constructed by inserting random (DNase I-generated) fragments into the intergenic region upstream from the reporter genes. Simple in vivo assays for either reporter gene product (alcohol dehydrogenase or beta-galactosidase) allowed the rapid identification of promoters from among these random fragments. Poly(dA-dT) homopolymer tracts were present in three of five randomly cloned promoters. With two exceptions, each RNA start site detected was 40 to 100 base pairs downstream from a TATA element. All of the randomly cloned promoters were capable of activating reporter gene transcription bidirectionally. Interestingly, one of the promoter fragments originated in a region of the S. cerevisiae rDNA spacer; regulated divergent transcription (presumably by RNA polymerase II) initiated in the same region. Images PMID:2847031

How downstream sub-basins depend on upstream inflows to avoid scarcity: typology and global analysis of transboundary rivers

Science.gov (United States)

Munia, Hafsa Ahmed; Guillaume, Joseph H. A.; Mirumachi, Naho; Wada, Yoshihide; Kummu, Matti

2018-05-01

Countries sharing river basins are often dependent upon water originating outside their boundaries; meaning that without that upstream water, water scarcity may occur with flow-on implications for water use and management. We develop a formalisation of this concept drawing on ideas about the transition between regimes from resilience literature, using water stress and water shortage as indicators of water scarcity. In our analytical framework, dependency occurs if water from upstream is needed to avoid scarcity. This can be diagnosed by comparing different types of water availability on which a sub-basin relies, in particular local runoff and upstream inflows. At the same time, possible upstream water withdrawals reduce available water downstream, influencing the latter water availability. By developing a framework of scarcity and dependency, we contribute to the understanding of transitions between system regimes. We apply our analytical framework to global transboundary river basins at the scale of sub-basin areas (SBAs). Our results show that 1175 million people live under water stress (42 % of the total transboundary population). Surprisingly, the majority (1150 million) of these currently suffer from stress only due to their own excessive water use and possible water from upstream does not have impact on the stress status - i.e. they are not yet dependent on upstream water to avoid stress - but could still impact on the intensity of the stress. At the same time, 386 million people (14 %) live in SBAs that can avoid stress owing to available water from upstream and have thus upstream dependency. In the case of water shortage, 306 million people (11 %) live in SBAs dependent on upstream water to avoid possible shortage. The identification of transitions between system regimes sheds light on how SBAs may be affected in the future, potentially contributing to further refined analysis of inter- and intrabasin hydro-political power relations and strategic planning

Nuclear factor ETF specifically stimulates transcription from promoters without a TATA box.

Science.gov (United States)

Kageyama, R; Merlino, G T; Pastan, I

1989-09-15

Transcription factor ETF stimulates the expression of the epidermal growth factor receptor (EGFR) gene which does not have a TATA box in the promoter region. Here, we show that ETF recognizes various GC-rich sequences including stretches of deoxycytidine or deoxyguanosine residues and GC boxes with similar affinities. ETF also binds to TATA boxes but with a lower affinity. ETF stimulated in vitro transcription from several promoters without TATA boxes but had little or no effect on TATA box-containing promoters even though they had strong ETF-binding sites. These inactive ETF-binding sites became functional when placed upstream of the EGFR promoter whose own ETF-binding sites were removed. Furthermore, when a TATA box was introduced into the EGFR promoter, the responsiveness to ETF was abolished. These results indicate that ETF is a specific transcription factor for promoters which do not contain TATA elements.

Environmental regulatory framework for the upstream petroleum industry

International Nuclear Information System (INIS)

1996-01-01

In order to provide its member companies with a useful reference document in environmental analysis and compliance, CAPP compiled a list of Canadian legislation, regulations and guidelines which relate to the upstream petroleum industry. Text of all federal, Alberta, British Columbia and Saskatchewan legislation, regulations, guidelines and related documents were provided. Pending legislation, regulations and government policy have been identified. Annual updates will be provided to all subscribers

An assessment of the parameters and experimental data of the continuous water activity monitors operating in the upstream and downstream channels of the Paks nuclear power plant

International Nuclear Information System (INIS)

Nagy, Gy.; Feher, I.

1986-03-01

A NaI(Tl) scintillator was placed into a measuring vessel of 8 msup(3) volume for monitoring the effluents in the upstream and downstream channels of the Paks nuclear power plant. The effects of radioactivity, meteorological parameters, and the atmospheric pressure on the counting rates, and their daily and monthly average values in both channels were analyzed. The short-term increases of the monitor signals could be attributed to rainy weather. The sup(222)Rn countent of water was also evaluated. (author)

Effects on the upstream flood inundation caused from the operation of Chao Phraya Dam

Directory of Open Access Journals (Sweden)

Sutham Visutimeteegorn

2007-11-01

Full Text Available During the flooding events, the operation of Chao Phraya Dam to control downstream water discharge is one of the causes of the inundation occuring over the upstream area. The purposes of this research are to study the effects of the operation of Chao Phraya Dam upon the upstream flood inundation and to find out the new measures of the flood mitigation in the upstream areas of Chao Phraya Dam by using a hydrodynamic model. The results show that Manning's n in the Chao Phraya River and its tributaries is 0.030-0.035 in the main channels and 0.050-0.070 in the flood plain areas. The backwater due to the operation of the Chao Praya dam affects as far as 110 kilometers upstream. New methods of water diversion can mitigate the flood inundation without the effect on the floating rice fields. The construction of reservoirs in the Upper Sakaekang River Basin and the Upper Yom River Basin will mitigate the flood not only in their own basins but also in the Lower Chao Phraya River Basin. The coordinated operation of the Chao Phraya Dam, the regulators and the upper basin reservoirs will efficiently mitigate the flood inundation.

Kinetic modeling of the purging of activated carbon after short term methyl iodide loading

International Nuclear Information System (INIS)

Friedrich, V.; Lux, I.

1991-01-01

A bimolecular reaction model containing the physico-chemical parameters of the adsorption and desorption was developed earlier to describe the kinetics of methyl iodide retention by activated carbon adsorber. Both theoretical model and experimental investigations postulated constant upstream methyl iodide concentration till the maximum break-through. The work reported here includes the extension of the theoretical model to the general case when the concentration of the challenging gas may change in time. The effect of short term loading followed by purging with air, and an impulse-like increase in upstream gas concentration has been simulated. The case of short term loading and subsequent purging has been experimentally studied to validate the model. The investigations were carried out on non-impregnated activated carbon. A 4 cm deep carbon bed had been challenged by methyl iodide for 30, 90, 120 and 180 min and then purged with air, downstream methyl iodide concentration had been measured continuously. The main characteristics of the observed downstream concentration curves (time and slope of break-through, time and amplitude of maximum values) showed acceptable agreement with those predicted by the model

Observations of two distinct populations of bow shock ions in the upstream solar wind

International Nuclear Information System (INIS)

Gosling, J.T.; Asbridge, J.; Bame, S.J.; Paschmann, G.; Sckopke, N.

1978-01-01

Observations upstream of the earth's bow shock with the LASL/MPI fast plasma experiments on ISEE 1 and 2 reveal the presence of two distinct and mutually exclusive populations of low energy (< or approx. =40keV) ions apparently accelerated at the bow shock. The first of these, the ''reflected'' population, is characterized by 1) sharply peaked spectra seldom extending much above approx. 10 keV/ion and 2) relatively collimated flow coming from the direction of the shock. On the other hand, the ''diffuse'' ions are distinguished by relatively flat energy spectra above approx. 10 keV and broad angular distributions. They are by far the most commonly observed upstream ion event. A close causal association is suggested between the diffuse ion population in the upstream solar wind and energetic plasma ions observed within the magnetosheath

EMMPRIN, an upstream regulator of MMPs, in CNS biology.

Science.gov (United States)

Kaushik, Deepak Kumar; Hahn, Jennifer Nancy; Yong, V Wee

2015-01-01

Matrix metalloproteinases (MMPs) are engaged in pathologies associated with infections, tumors, autoimmune disorders and neurological dysfunctions. With the identification of an upstream regulator of MMPs, EMMPRIN (Extracellular matrix metalloproteinase inducer, CD147), it is relevant to address if EMMPRIN plays a role in the pathology of central nervous system (CNS) diseases. This would enable the possibility of a more upstream and effective therapeutic target. Indeed, conditions including gliomas, Alzheimer's disease (AD), multiple sclerosis (MS), and other insults such as hypoxia/ischemia show elevated levels of EMMPRIN which correlate with MMP production. In contrast, given EMMPRIN's role in CNS homeostasis with respect to regulation of monocarboxylate transporters (MCTs) and interactions with adhesion molecules including integrins, we need to consider that EMMPRIN may also serve important regulatory or protective functions. This review summarizes the current understanding of EMMPRIN's involvement in CNS homeostasis, its possible roles in escalating or reducing neural injury, and the mechanisms of EMMPRIN including and apart from MMP induction. Copyright © 2015 International Society of Matrix Biology. Published by Elsevier B.V. All rights reserved.

par genes in Mycobacterium bovis and Mycobacterium smegmatis are arranged in an operon transcribed from "SigGC" promoters

Directory of Open Access Journals (Sweden)

Casart Yveth

2008-03-01

Full Text Available Abstract Background The ParA/Soj and ParB/Spo0J proteins, and the cis-acting parS site, participate actively in chromosome segregation and cell cycle progression. Genes homologous to parA and parB, and two putative parS copies, have been identified in the Mycobacterium bovis BCG and Mycobacterium smegmatis chromosomes. As in Mycobacterium tuberculosis, the parA and parB genes in these two non-pathogenic mycobacteria are located near the chromosomal origin of replication. The present work focused on the determination of the transcriptional organisation of the ~6 Kb orf60K-parB region of M. bovis BCG and M. smegmatis by primer extension, transcriptional fusions to the green fluorescence protein (GFP and quantitative RT-PCR. Results The parAB genes were arranged in an operon. However, we also found promoters upstream of each one of these genes. Seven putative promoter sequences were identified in the orf60K-parB region of M. bovis BCG, whilst four were identified in the homologous region of M. smegmatis, one upstream of each open reading frame (ORF. Real-time PCR assays showed that in M. smegmatis, mRNA-parA and mRNA-parB levels decreased between the exponential and stationary phases. In M. bovis BCG, mRNA-parA levels also decreased between the exponential and stationary phases. However, parB expression was higher than parA expression and remained almost unchanged along the growth curve. Conclusion The majority of the proposed promoter regions had features characteristic of Mycobacterium promoters previously denoted as Group D. The -10 hexamer of a strong E. coli σ70-like promoter, located upstream of gidB of M. bovis BCG, overlapped with a putative parS sequence, suggesting that the transcription from this promoter might be regulated by the binding of ParB to parS.

Upstream Tracking and the Decay $B^{0} \\to K^{+}\\pi^{-}\\mu^{+}\\mu^{-}$ at the LHCb Experiment

CERN Document Server

AUTHOR|(INSPIRE)INSPIRE-00388407; Serra, Nicola; Steinkamp, Olaf; Storaci, Barbara

The LHCb detector is a single-arm forward spectrometer covering the pseudorapidity range $2 < \\eta < 5$, designed to search for indirect evidence of New Physics in $C\\!P$ violation and rare decays of beauty and charm hadrons. The unique geometry takes advantage of the large $b$ and $c$ quark production in the forward region at the LHC. The detector includes a high granularity silicon-strip vertex detector, a silicon-strip detector upstream of the magnet and three stations of silicon-strip detectors and straw drift tubes downstream of the magnet. This thesis is divided into two main parts. The first part details the development of improved algorithms to perform track reconstruction using the sub-detectors upstream of the LHCb magnet. A novel idea to perform upstream tracking as an intermediate step of the track reconstruction sequence was investigated. The vast gains in tracking performance obtained when using upstream tracks led to the algorithm being adopted into the default reconstruction sequence for...

A CUSUM analysis of discharge patterns by a hydroelectric dam and discussion of potential effects on the upstream migration of American eel elvers

International Nuclear Information System (INIS)

Jessop, B.M.; Harvie, C.J.

2003-01-01

American eel elvers are among the diadromous fishes native to the Saint John River in New Brunswick that have been affected by the construction of hydroelectric dams. Before 1980, large numbers of elvers were observed entering the fishway of the Mactaquac Dam in May and June for upstream migration, but their presence abruptly ceased after 1980. A study was conducted to determine why they disappeared at the Mactaquac Dam. A cumulative sum (CUSUM) analysis was performed to determine the variability in magnitude, duration, timing, frequency, and rate of change in the daily and seasonal average level of water discharge associated with the installation of the last two of six turbines in late 1979 and early 1980. It is believed that the rapid, short-term fluctuations in water discharge which is characteristic of peaking hydroelectric dam operations, could seriously affect life cycle transitions of diadromous fishes. Upstream and downstream migration of the elvers may be affected along with their abundance, diversity and productivity. Young fish in particular are at higher risk of mortality during high flows, depending on the species. 40 refs., 3 tabs., 10 figs

Characterization of upstream sequences from the 8S globulin gene ...

African Journals Online (AJOL)

Administrator

2011-09-21

Sep 21, 2011 ... added recombinant proteins and enzymes for industries. The upstream region ... cost, eukaryotic expression and no endogenous patho- gen pollution, thus it ... developmental process (Santino et al., 1997) which may deplete nutrient ... ideal bioreactors for economic production and storage of value-added ...

Characterization of a Lactococcus lactis promoter for heterologous protein production

Directory of Open Access Journals (Sweden)

Christian E. Ogaugwu

2018-03-01

Full Text Available Constitutively active promoter elements for heterologous protein production in Lactococcus lactis are scarce. Here, the promoter of the PTS-IIC gene cluster from L. lactis NZ3900 is described. This promoter was cloned upstream of an enhanced green fluorescent protein, GFPmut3a, and transformed into L. lactis. Transformants produced up to 13.5 μg of GFPmut3a per milliliter of log phase cells. Addition of cellobiose further increased the production of GFPmut3a by up to two-fold when compared to glucose. Analysis of mutations at two specific positions in the PTS-IIC promoter showed that a ‘T’ to ‘G’ mutation within the −35 element resulted in constitutive expression in glucose, while a ‘C’ at nucleotide 7 in the putative cre site enhanced promoter activity in cellobiose. Finally, this PTS-IIC promoter is capable of mediating protein expression in Bacillus subtilis and Escherichia coli Nissle 1917, suggesting the potential for future biotechnological applications of this element and its derivatives.

Entrepreneurial Leadership in Upstream Oil and Gas Industry

OpenAIRE

Kalu, Mona Ukpai

2015-01-01

The study examined Entrepreneurial leadership in Upstream Oil and Gas industry and its ability to accelerate innovative energy technology development. The declining deliverability from existing reservoirs and ever increasing demand for energy to fuel growth in many parts of the world is driving oil and gas exploration into more difficult to access reservoirs like bituminous sands and shale gas. Accelerating new innovative technology development to access these new streams of profitable oil an...

Genetic variation in the proximal promoter of ABC and SLC superfamilies: liver and kidney specific expression and promoter activity predict variation.

Directory of Open Access Journals (Sweden)

Stephanie E Hesselson

2009-09-01

Full Text Available Membrane transporters play crucial roles in the cellular uptake and efflux of an array of small molecules including nutrients, environmental toxins, and many clinically used drugs. We hypothesized that common genetic variation in the proximal promoter regions of transporter genes contribute to observed variation in drug response. A total of 579 polymorphisms were identified in the proximal promoters (-250 to +50 bp and flanking 5' sequence of 107 transporters in the ATP Binding Cassette (ABC and Solute Carrier (SLC superfamilies in 272 DNA samples from ethnically diverse populations. Many transporter promoters contained multiple common polymorphisms. Using a sliding window analysis, we observed that, on average, nucleotide diversity (pi was lowest at approximately 300 bp upstream of the transcription start site, suggesting that this region may harbor important functional elements. The proximal promoters of transporters that were highly expressed in the liver had greater nucleotide diversity than those that were highly expressed in the kidney consistent with greater negative selective pressure on the promoters of kidney transporters. Twenty-one promoters were evaluated for activity using reporter assays. Greater nucleotide diversity was observed in promoters with strong activity compared to promoters with weak activity, suggesting that weak promoters are under more negative selective pressure than promoters with high activity. Collectively, these results suggest that the proximal promoter region of membrane transporters is rich in variation and that variants in these regions may play a role in interindividual variation in drug disposition and response.

Induction of short-term biomarkers of tumor promotion in skin of CD-1 mice by petroleum middle distillates: preliminary observations.

Science.gov (United States)

Skisak, C; DiGiovanni, J; Conti, C J; Slaga, T J; Sharma, S; Sagartz, J W; Walborg, E F

1995-01-01

The induction of sustained epidermal hyperplasia in mouse skin has been shown to be a reliable predictor of tumor promoting activity for chemicals as diverse as phorbol esters, anthralins, n-dodecane and organic peroxides (DiGiovanni, 1992). The results contained herein demonstrate that API 81-07 and API 81-10, petroleum middle distillates that exhibit tumor promoting activity in mouse skin, induce epidermal hyperplasia and ODC activity. Other petroleum middle distillates (odorless light petroleum hydrocarbons, a light vacuum distillate, and a mineral seal oil) were also shown to share these activities. It should be emphasized that the relevance of these observations to human skin remains unresolved; however, the availability of these short-term biomarkers offers the opportunity to address the issue by performing comparative investigations on the effects of petroleum middle distillates on human skin xenografted to athymic (nude) mice. Such studies are being initiated.

Technological acceleration and organizational transformations in the upstream oil and gas industry

International Nuclear Information System (INIS)

Isabelle, M.

2000-12-01

The upstream oil and gas industry experienced a dramatic technological acceleration in the early 1970's. The relationships between the agents in this industry have themselves undergone deep changes since that date. This thesis shows that a tight link exists between the technological acceleration and the organizational transformations in the upstream oil and gas industry. In a first part, it focuses on the economic theory's developments concerning industrial organization. In a second part, it applies these developments to three types of relations: those between the owner-states of hydrocarbon resources and the international petroleum companies; those between the international petroleum companies and their subcontractors; and finally those between the international petroleum companies themselves. (author)

The economic benefits of vegetation in the upstream area of Ciliwung watershed

Science.gov (United States)

Saridewi, T. R.; Nazaruddin

2018-04-01

Ciliwung watershed has strategic values since its entire downstream area is located in the Special Administrative Region of Jakarta (DKI Jakarta), the capital of Indonesia. This causes forest and farmland areas are converted into open areas or built-up areas. The existence of these areas provides enormous environmental and economic benefits. Economic benefit values are very important to be considered in developing a policy development plan, but they have not been calculated yet. This study aims to determine the economic benefits provided by trees and other vegetation anddevelops a development policy that takes into account simultaneously ecological and economic aspects. The study is conducted in the upstream Ciliwung watershed, by using land cover patterns in 1989, 2000, 2010 and 2014, and employs GIS and CITY green analysis. The results show that conversion of forest and farmland areas reduces the ability of Ciliwung upstream watershed to store water. Therefore, its ability to reduce the flow of surface has been decreased. This creates a decrease in the cost savings of annual stormwater, from US 15,175,721 in 1989 to US 13,317,469 in 2014. The Environmental Services Payment Policy (PES) for upstream community groups managing the watershed has been considered as a fairly effective policy.

Localization and regulation of bacteriophage Mu promoters

International Nuclear Information System (INIS)

Stoddard, S.F.; Howe, M.M.

1989-01-01

Mu promoters active during the lytic cycle were located by isolating RNA at various times after induction of Mu prophages, radiolabeling it by capping in vitro, and hybridizing it to Mu DNA fragments on Southern blots. Signals were detected from four new promoters in addition to the previously characterized P e (early), P cM (repressor), and P mom (late) promoters. A major signal upstream of C was first observed at 12 min and intensified thereafter with RNA from cts and C amber but not replication-defective prophages; these characteristics indicate that this signal arises from a middle promoter, which we designate P m . With 20- and 40-min RNA, four additional major signals originated in the C-lys, F-G-I, N-P, and com-mom regions. These signals were missing with RNA from C amber and replication-defective prophages and therefore reflected the activity of late promoters, one of which we presume was P mom . Uninduced lysogens showed weak signals from five regions, one from the early regulatory region, three between genes B and lys, and one near the late genes K, L, and M. The first of these probably resulted from P cM activity; the others remain to be identified

CTCF Prevents the Epigenetic Drift of EBV Latency Promoter Qp

Science.gov (United States)

Tempera, Italo; Wiedmer, Andreas; Dheekollu, Jayaraju; Lieberman, Paul M.

2010-01-01

The establishment and maintenance of Epstein-Barr Virus (EBV) latent infection requires distinct viral gene expression programs. These gene expression programs, termed latency types, are determined largely by promoter selection, and controlled through the interplay between cell-type specific transcription factors, chromatin structure, and epigenetic modifications. We used a genome-wide chromatin-immunoprecipitation (ChIP) assay to identify epigenetic modifications that correlate with different latency types. We found that the chromatin insulator protein CTCF binds at several key regulatory nodes in the EBV genome and may compartmentalize epigenetic modifications across the viral genome. Highly enriched CTCF binding sites were identified at the promoter regions upstream of Cp, Wp, EBERs, and Qp. Since Qp is essential for long-term maintenance of viral genomes in type I latency and epithelial cell infections, we focused on the role of CTCF in regulating Qp. Purified CTCF bound ∼40 bp upstream of the EBNA1 binding sites located at +10 bp relative to the transcriptional initiation site at Qp. Mutagenesis of the CTCF binding site in EBV bacmids resulted in a decrease in the recovery of stable hygromycin-resistant episomes in 293 cells. EBV lacking the Qp CTCF site showed a decrease in Qp transcription initiation and a corresponding increase in Cp and Fp promoter utilization at 8 weeks post-transfection. However, by 16 weeks post-transfection, bacmids lacking CTCF sites had no detectable Qp transcription and showed high levels of histone H3 K9 methylation and CpG DNA methylation at the Qp initiation site. These findings provide direct genetic evidence that CTCF functions as a chromatin insulator that prevents the promiscuous transcription of surrounding genes and blocks the epigenetic silencing of an essential promoter, Qp, during EBV latent infection. PMID:20730088

ISEE/IMP Observations of simultaneous upstream ion events

International Nuclear Information System (INIS)

Mitchel, D.G.; Roelof, E.C.; Sanderson, T.R.; Reinhard, R.; Wenzel, K.

1983-01-01

Propagation of upstream energetic (50--200 keV) ions is analyzed in sixteen events observed simulataneously by solid state detectors on ISEE 3 at approx.200 R/sub E/ and on IMP 8 at approx.35 R/sub E/ from the earth. Conclusions are based on comparisons of the pitch angle distributions observed at the two spacecraft and transformed into the solar wind frame. They are beamlike at ISEE 3 and are confined to the outward hemisphere. When IMP 8 is furtherest from the bow shock, they are also usually beamlike, or hemispheric. However, when IMP 8 is closer to the bow shock, pancakelike distributions are observed. This systematic variation in the IMP 8 pitch angle distributions delimits a scattering region l< or approx. =14 R/sub E/ upstream of the earth's bow shock (l measured along the interplanetary magnetic field) that dominates ion propagation, influences the global distribution of fluxes in the foreshock, and may play a role in acceleration of the ions. When IMP 8 is beyond lapprox.15 R/sub E/, the propagation appears to be essentially scatter-free between IMP 8 and ISEE 3; this is deduced from the absence of earthward fluxes at IMP 8 as well as the tendency for the spin-averaged fluxes to be comparable at the two spacecraft

Ion acceleration at the earth's bow shock: A review of observations in the upstream region

International Nuclear Information System (INIS)

Gosling, J.T.; Asbridge, J.R.; Bame, S.J.; Feldman, W.C.

1979-01-01

Positive ions are accelerated at or near the earth's bow shock and propagate into the upstream region. Two distinctly different population of these ions, distinguished by their greatly different spectral and angular widths, can be identified there. The type of ion population observed in the upstream region is strongly correlated with the presence or absence of long-period compresive waves in the solar wind. Very few ions are accelerated in the vicinity of the shock to energies much above about 100 keV. It is not yet clear whether the most energetic ions (i.e. those near 100 keV) are accelerated at the shock or in the broad disturbed region upstream from the shock. In either case stochastic acceleration by turbulent electrostatic fields seems to be the most viable candidate for the acceleration of the most energetic particles

Ion acceleration at the earth's bow shock: a review of observations in the upstream region

International Nuclear Information System (INIS)

Gosling, J.T.; Asbridge, J.R.; Bame, S.J.; Feldman, W.C.

1979-01-01

Positive ions are accelerated at or near the earth's bow shock and propagate into the upstream region. Two distinctly different populations of these ions, distinguished by their greatly different spectral and angular widths, can be identified there. The type of ion population observed in the upstream region is strongly correlated with the presence or absence of long-period compressive waves in the solar wind. Very few ions are accelerated in the vicinity of the shock to energies much above about 100 keV. It is not yet clear whether the most energetic ions (i.e., those near 100 keV) are accelerated at the shock or in broad disturbed region upstream from the shock. In either case stochastic acceleration by turbulent electrostatic fields seems to be the most viable candidate for the acceleration of the most energetic particles

Genome-wide mapping of autonomous promoter activity in human cells.

Science.gov (United States)

van Arensbergen, Joris; FitzPatrick, Vincent D; de Haas, Marcel; Pagie, Ludo; Sluimer, Jasper; Bussemaker, Harmen J; van Steensel, Bas

2017-02-01

Previous methods to systematically characterize sequence-intrinsic activity of promoters have been limited by relatively low throughput and the length of the sequences that could be tested. Here we present 'survey of regulatory elements' (SuRE), a method that assays more than 10 8 DNA fragments, each 0.2-2 kb in size, for their ability to drive transcription autonomously. In SuRE, a plasmid library of random genomic fragments upstream of a 20-bp barcode is constructed, and decoded by paired-end sequencing. This library is used to transfect cells, and barcodes in transcribed RNA are quantified by high-throughput sequencing. When applied to the human genome, we achieve 55-fold genome coverage, allowing us to map autonomous promoter activity genome-wide in K562 cells. By computational modeling we delineate subregions within promoters that are relevant for their activity. We show that antisense promoter transcription is generally dependent on the sense core promoter sequences, and that most enhancers and several families of repetitive elements act as autonomous transcription initiation sites.

A scheme for regulating toxic substances to water quality of Chamsil upstream water system

Energy Technology Data Exchange (ETDEWEB)

Kim, Kang Suk; Kim, Jee Hoon [Korea Environment Institute, Seoul (Korea)

1998-12-01

This study asserts to reflect a concept of toxicity thoroughly in the present water quality concept. It presents an appropriate solution to control toxic substances flowing into the Chamsil upstream water system. Although a regulation of toxic substances into major rivers in Korea other than Han river is also required urgently, it will be studied in future. It is expected that this study on Chamsil upstream would be a cornerstone for establishing a national regulation policy of toxic substances into water system. 28 refs., 1 fig., 36 tabs.

Thyroid hormone receptor binds to a site in the rat growth hormone promoter required for induction by thyroid hormone

International Nuclear Information System (INIS)

Koenig, R.J.; Brent, G.A.; Warne, R.L.; Larsen, P.R.; Moore, D.D.

1987-01-01

Transcription of the rat growth hormone (rGH) gene in pituitary cells is increased by addition of thyroid hormone (T3). This induction is dependent on the presence of specific sequences just upstream of the rGH promoter. The authors have partially purified T3 receptor from rat liver and examined its interaction with these rGH sequences. They show here that T3 receptor binds specifically to a site just upstream of the basal rGH promoter. This binding site includes two copies of a 7-base-pair direct repeat, the centers of which are separated by 10 base pairs. Deletions that specifically remove the T3 receptor binding site drastically reduce response to T3 in transient transfection experiments. These results demonstrate that T3 receptor can recognize specific DNA sequences and suggest that it can act directly as a positive transcriptional regulatory factor

Ultra-short silicon MMI duplexer

Science.gov (United States)

Yi, Huaxiang; Huang, Yawen; Wang, Xingjun; Zhou, Zhiping

2012-11-01

The fiber-to-the-home (FTTH) systems are growing fast these days, where two different wavelengths are used for upstream and downstream traffic, typically 1310nm and 1490nm. The duplexers are the key elements to separate these wavelengths into different path in central offices (CO) and optical network unit (ONU) in passive optical network (PON). Multimode interference (MMI) has some benefits to be a duplexer including large fabrication tolerance, low-temperature dependence, and low-polarization dependence, but its size is too large to integrate in conventional case. Based on the silicon photonics platform, ultra-short silicon MMI duplexer was demonstrated to separate the 1310nm and 1490nm lights. By studying the theory of self-image phenomena in MMI, the first order images are adopted in order to keep the device short. A cascaded MMI structure was investigated to implement the wavelength splitting, where both the light of 1310nm and 1490nm was input from the same port, and the 1490nm light was coupling cross the first MMI and output at the cross-port in the device while the 1310nm light was coupling through the first and second MMI and output at the bar-port in the device. The experiment was carried on with the SOI wafer of 340nm top silicon. The cascaded MMI was investigated to fold the length of the duplexer as short as 117μm with the extinct ratio over 10dB.

Experimental Branch Retinal Vein Occlusion Induces Upstream Pericyte Loss and Vascular Destabilization.

Directory of Open Access Journals (Sweden)

Elisa Dominguez

Full Text Available Branch retinal vein occlusion (BRVO leads to extensive vascular remodeling and is important cause of visual impairment. Although the vascular morphological changes following experimental vein occlusion have been described in a variety of models using angiography, the underlying cellular events are ill defined.We here show that laser-induced experimental BRVO in mice leads to a wave of TUNEL-positive endothelial cell (EC apoptosis in the upstream vascular network associated with a transient edema and hemorrhages. Subsequently, we observe an induction of EC proliferation within the dilated vein and capillaries, detected by EdU incorporation, and the edema resolves. However, the pericytes of the upstream capillaries are severely reduced, which was associated with continuing EC apoptosis and proliferation. The vascular remodeling was associated with increased expression of TGFβ, TSP-1, but also FGF2 expression. Exposure of the experimental animals to hypoxia, when pericyte (PC dropout had occurred, led to a dramatic increase in endothelial cell proliferation, confirming the vascular instability induced by the experimental BRVO.Experimental BRVO leads to acute endothelial cells apoptosis and increased permeability. Subsequently the upstream vascular network remains destabilized, characterized by pericyte dropout, un-physiologically high endothelial cells turnover and sensitivity to hypoxia. These early changes might pave the way for capillary loss and subsequent chronic ischemia and edema that characterize the late stage disease.

Decomposing the sales promotion bump with store data

NARCIS (Netherlands)

van Heerde, H.J.; Leeflang, P.S.H.; Wittink, D.R.

2004-01-01

Sales promotions generate substantial short-term sales increases. To determine whether the sales promotion bump is truly beneficial from a managerial perspective, we propose a system of store-level regression models that decomposes the sales promotion bump into three parts: cross-brand effects

Maternal variant in the upstream of FOXP3 gene on the X chromosome is associated with recurrent infertility in Japanese Black cattle.

Science.gov (United States)

Arishima, Taichi; Sasaki, Shinji; Isobe, Tomohiro; Ikebata, Yoshihisa; Shimbara, Shinichi; Ikeda, Shogo; Kawashima, Keisuke; Suzuki, Yutaka; Watanabe, Manabu; Sugano, Sumio; Mizoshita, Kazunori; Sugimoto, Yoshikazu

2017-12-06

Repeat breeding, which is defined as cattle failure to conceive after three or more inseminations in the absence of clinical abnormalities, is a substantial problem in cattle breeding. To identify maternal genetic variants of repeat breeding in Japanese Black cattle, we selected 29 repeat-breeding heifers that failed to conceive following embryo transfer (ET) and conducted a genome-wide association study (GWAS) using the traits. We found that a single-nucleotide polymorphism (SNP; g.92,377,635A > G) in the upstream region of the FOXP3 gene on the X chromosome was highly associated with repeat breeding and failure to conceive following ET (P = 1.51 × 10 -14 ). FOXP3 is a master gene for differentiation of regulatory T (T reg ) cells that function in pregnancy maintenance. Reporter assay results revealed that the activity of the FOXP3 promoter was lower in reporter constructs with the risk-allele than in those with the non-risk-allele by approximately 0.68 fold. These findings suggest that the variant in the upstream region of FOXP3 with the risk-allele decreased FOXP3 transcription, which in turn, could reduce the number of maternal T reg cells and lead to infertility. The frequency of the risk-allele in repeat-breeding heifers is more than that in cows, suggesting that the risk-allele could be associated with infertility in repeat-breeding heifers. This GWAS identified a maternal variant in the upstream region of FOXP3 that was associated with infertility in repeat-breeding Japanese Black cattle that failed to conceive using ET. The variant affected the level of FOXP3 mRNA expression. Thus, the results suggest that the risk-allele could serve as a useful marker to reduce and eliminate animals with inferior fertility in Japanese Black cattle.

Essential roles of caspases and their upstream regulators in rotenone-induced apoptosis

International Nuclear Information System (INIS)

Lee Jihjong; Huang, M.-S.; Yang, I-C.; Lai, T.-C.; Wang, J.-L.; Pang, V.F.; Hsiao, M.; Kuo, M.Y.P.

2008-01-01

In the present study, we examined whether caspases and their upstream regulators are involved in rotenone-induced cytotoxicity. Rotenone significantly inhibited the proliferation of oral cancer cell lines in a dose-dependent manner compared to normal oral mucosal fibroblasts. Flow cytometric analysis of DNA content showed that rotenone treatment induced apoptosis following G2/M arrest. Western blotting showed activation of both the caspase-8 and caspase-9 pathways, which differed from previous studies conducted in other cell types. Furthermore, p53 protein and its downstream pro-apoptotic target, Bax, were induced in SAS cells after treatment with rotenone. Rotenone-induced apoptosis was inhibited by antioxidants (glutathione, N-acetylcysteine, and tiron). In conclusion, our results demonstrate significant involvement of caspases and their upstream regulators in rotenone-induced cytotoxicity

Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori

Energy Technology Data Exchange (ETDEWEB)

Yan, Liu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Lian, Yu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Zhejiang Province Key Laboratory of Preventive Veterinary Medicine, Institute of Preventive Veterinary Medicine, Zhejiang University, Hangzhou 310029 (China); Xiuyang, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Tingqing, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Shengpeng, Wang [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Changde, Lu [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China)

2006-03-31

The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.

Experience of molecular monitoring techniques in upstream oil and gas operations

Energy Technology Data Exchange (ETDEWEB)

Mitchell, Anthony F.; Anfindsen, Hilde; Liengen, Turid; Molid, Solfrid [Statoil ASA (Denmark)

2011-07-01

For a numbers of years, molecular monitoring tools have been used in upstream oil and gas operations but the results have given only limited added value. This paper discusses the various techniques available for upstream molecular monitoring which provides scope for identification of microbial influenced problems. The methodology, which consists of analyzing solid samples using traditional as well as molecular techniques, is detailed. Two cases were studied with the objective of determining if microbial contamination was contributing to the problem. The first case was a study of amorphous deposits in production wells and mainly iron sulphide was found. The second study was of amorphous deposits in water injection wells and the analysis showed typical components of drilling and completion fluids with some organic material. Two more cases, corrosion of tubing in a water injection well and flow line corrosion, are discussed and the results are given. From the study, it can be concluded that failure can be due to several factors, chemical and biological.

Exploring health promotion practitioners' experiences of moral distress in Canada and Australia.

Science.gov (United States)

Sunderland, Naomi; Harris, Paul; Johnstone, Kylie; Del Fabbro, Letitia; Kendall, Elizabeth

2015-03-01

This article introduces moral distress - the experience of painful feelings due to institutional constraints on personal moral action - as a significant issue for the international health promotion workforce. Our exploratory study of practitioners' experiences of health promotion in Australia and Canada during 2009-2010 indicated that practitioners who work in upstream policy- and systems-level health promotion are affected by experiences of moral distress. Health promotion practitioners at all levels of the health promotion continuum also described themselves as being engaged in a minority practice within a larger dominant system that does not always value health promotion. We argue that health promotion practitioners are vulnerable to moral distress due to the values-driven and political nature of the practice, the emphasis on systems change and the inherent complexity and diversity of the practice. This vulnerability to moral distress poses significant challenges to both workers and organisations and the communities they seek to benefit. We propose that further research should be undertaken to fully identify the causes and symptoms of moral distress in health promotion. Extensive existing research on moral distress in nursing provides ample resources to conduct such research. © The Author(s) 2014.

Role of nitric oxide in vasodilation in upstream muscle during intermittent pneumatic compression.

Science.gov (United States)

Chen, Long-En; Liu, Kang; Qi, Wen-Ning; Joneschild, Elizabeth; Tan, Xiangling; Seaber, Anthony V; Stamler, Jonathan S; Urbaniak, James R

2002-02-01

This study investigated the dosage effects of nitric oxide synthase (NOS) inhibitor N(G)-monomethyl-L-arginine (L-NMMA) on intermittent pneumatic compression (IPC)-induced vasodilation in uncompressed upstream muscle and the effects of IPC on endothelial NOS (eNOS) expression in upstream muscle. After L-NMMA infusion, mean arterial pressure increased by 5% from baseline (99.5 +/- 18.7 mmHg; P < 0.05). Heart rate and respiratory rate were not significantly affected. One-hour IPC application on legs induced a 10% dilation from baseline in 10- to 20-microm arterioles and a 10-20% dilation in 21- to 40 microm arterioles and 41- to 70-microm arteries in uncompressed cremaster muscle. IPC-induced vasodilation was dose dependently reduced, abolished, or even reversed by concurrently infused L-NMMA. Moreover, expression of eNOS mRNA in uncompressed cremaster muscle was upregulated to 2 and 2.5 times normal at the end of 1- and 5-h IPC on legs, respectively, and the expression of eNOS protein was upregulated to 1.8 times normal. These increases returned to baseline level after cessation of IPC. The results suggest that eNOS plays an important role in regulating the microcirculation in upstream muscle during IPC.

Loss of the NKX3.1 tumorsuppressor promotes the TMPRSS2-ERG fusion gene expression in prostate cancer

International Nuclear Information System (INIS)

Thangapazham, Rajesh; Saenz, Francisco; Katta, Shilpa; Mohamed, Ahmed A; Tan, Shyh-Han; Petrovics, Gyorgy; Srivastava, Shiv; Dobi, Albert

2014-01-01

In normal prostate epithelium the TMPRSS2 gene encoding a type II serine protease is directly regulated by male hormones through the androgen receptor. In prostate cancer ERG protooncogene frequently gains hormonal control by seizing gene regulatory elements of TMPRSS2 through genomic fusion events. Although, the androgenic activation of TMPRSS2 gene has been established, little is known about other elements that may interact with TMPRSS2 promoter sequences to modulate ERG expression in TMPRSS2-ERG gene fusion context. Comparative genomic analyses of the TMPRSS2 promoter upstream sequences and pathway analyses were performed by the Genomatix Software. NKX3.1 and ERG genes expressions were evaluated by immunoblot or by quantitative Real-Time PCR (qRT-PCR) assays in response to siRNA knockdown or heterologous expression. QRT-PCR assay was used for monitoring the gene expression levels of NKX3.1-regulated genes. Transcriptional regulatory function of NKX3.1 was assessed by luciferase assay. Recruitment of NKX3.1 to its cognate elements was monitored by Chromatin Immunoprecipitation assay. Comparative analysis of the TMPRSS2 promoter upstream sequences among different species revealed the conservation of binding sites for the androgen inducible NKX3.1 tumor suppressor. Defects of NKX3.1, such as, allelic loss, haploinsufficiency, attenuated expression or decreased protein stability represent established pathways in prostate tumorigenesis. We found that NKX3.1 directly binds to TMPRSS2 upstream sequences and negatively regulates the expression of the ERG protooncogene through the TMPRSS2-ERG gene fusion. These observations imply that the frequently noted loss-of-function of NKX3.1 cooperates with the activation of TMPRSS2-ERG fusions in prostate tumorigenesis

Identification of a p53-response element in the promoter of the proline oxidase gene

International Nuclear Information System (INIS)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-01-01

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

Foreshock density holes in the context of known upstream plasma structures

Directory of Open Access Journals (Sweden)

M. Wilber

2008-11-01

Full Text Available We present case examples of foreshock density holes and results from a statistical survey, which provide additional characterizations of these recently-described structures. Specific effort is made to place these objects into context with well-studied foreshock phenomena, such as hot flow anomalies (HFAs and large-amplitude magnetic pulsations (SLAMS. Density holes are observed during higher-than-average solar wind speeds (~620 km s−1, have well-correlated density and magnetic field intensities, and anti-correlated density and temperature variations. Like HFAs, these structures occur over a wide range of foreshock geometries, suggesting that this is not a determining factor. They are embedded within IMF current sheets, but their cross-structure magnetic shears are considerably lower than for HFAs. When the Cluster spacecraft are widely separated, they are able to measure structure time development, with substantial changes occurring over 10s of seconds, confirming an earlier case study, and possibly indicating short lifetimes as well. We find that density holes can occur in the absence of strong upstream magnetic pulsations and/or density enhancements, which rules out a "wake effect" as the sole explanation for their formation. Most important is the observation that the observed solar wind motional electric fields tend to have components pointing away from the embedding IMF current sheets. Density holes have no connection with magnetic holes and foreshock cavities, and appear not to be early-stage or weakly-formed HFAs.

Foreshock density holes in the context of known upstream plasma structures

Directory of Open Access Journals (Sweden)

M. Wilber

2008-11-01

Full Text Available We present case examples of foreshock density holes and results from a statistical survey, which provide additional characterizations of these recently-described structures. Specific effort is made to place these objects into context with well-studied foreshock phenomena, such as hot flow anomalies (HFAs and large-amplitude magnetic pulsations (SLAMS. Density holes are observed during higher-than-average solar wind speeds (~620 km s⁻¹, have well-correlated density and magnetic field intensities, and anti-correlated density and temperature variations. Like HFAs, these structures occur over a wide range of foreshock geometries, suggesting that this is not a determining factor. They are embedded within IMF current sheets, but their cross-structure magnetic shears are considerably lower than for HFAs. When the Cluster spacecraft are widely separated, they are able to measure structure time development, with substantial changes occurring over 10s of seconds, confirming an earlier case study, and possibly indicating short lifetimes as well. We find that density holes can occur in the absence of strong upstream magnetic pulsations and/or density enhancements, which rules out a "wake effect" as the sole explanation for their formation. Most important is the observation that the observed solar wind motional electric fields tend to have components pointing away from the embedding IMF current sheets. Density holes have no connection with magnetic holes and foreshock cavities, and appear not to be early-stage or weakly-formed HFAs.

Sodium Pick-Up Ion Observations in the Solar Wind Upstream of Mercury

Science.gov (United States)

Jasinski, J. M.; Raines, J. M.; Slavin, J. A.; Regoli, L. R.; Murphy, N.

2018-05-01

We present the first observations of sodium pick-up ions upstream of Mercury’s magnetosphere. From these observations we infer properties of Mercury’s sodium exosphere and implications for the solar wind interaction with Mercury’s magnetosphere.

Short Intervention, Sustained Effects: Promoting Students’ Math Competence Beliefs, Effort, and Achievement

NARCIS (Netherlands)

Brisson, Brigitte Maria; Dicke, Anna Lena; Gaspard, Hanna; Häfner, Isabelle; Flunger, Barbara|info:eu-repo/dai/nl/412516322; Nagengast, Benjamin; Trautwein, Ulrich

2017-01-01

The present study investigated the effectiveness of two short relevance interventions (writing a text or evaluating quotations about the utility of mathematics) using a sample of 1,916 students in 82 math classrooms in a cluster randomized controlled experiment. Short-term and sustained effects (6

Promotional Strategy of Advent Himalaya Trekks Private Limited

OpenAIRE

Gurung, Sabin

2017-01-01

The purpose of conducting this thesis was to study on the promotional strategy of a trekking company. The aim of this thesis was to study on current promotional strategy and suggest the case company with new and effective ideas and tools for promotion. The theoretical part of this thesis includes basic knowledge of marketing, promotion, promotional mix and promotional strategy. Also, a short overview of tourism business of Nepal and promotional strengths of the case company is also done. H...

Short-term water-based aerobic training promotes improvements in aerobic conditioning parameters of mature women.

Science.gov (United States)

Costa, Rochelle Rocha; Reichert, Thais; Coconcelli, Leandro; Simmer, Nicole Monticelli; Bagatini, Natália Carvalho; Buttelli, Adriana Cristine Koch; Bracht, Cláudia Gomes; Stein, Ricardo; Kruel, Luiz Fernando Martins

2017-08-01

Aging is accompanied by a decrease in aerobic capacity. Therefore, physical training has been recommended to soften the effects of advancement age. The aim of this study was to assess the effects of a short-term water-based aerobic training on resting heart rate (HR rest ), heart rate corresponding to anaerobic threshold (HR AT ), peak heart rate (HR peak ), percentage value of HR AT in relation to HR peak and test duration (TD) of mature women. Twenty-two women (65.91 ± 4.83 years) were submitted to a five-week water-based interval aerobic training. Aerobic capacity parameters were evaluated through an aquatic incremental test. After training, there was an increase in TD (16%) and HR AT percentage in relation to HR peak (4.68%), and a reduction of HR rest (9%). It is concluded that a water-based aerobic interval training prescribed through HR AT of only five weeks is able to promote improvements in aerobic capacity of mature women. Copyright © 2017 Elsevier Ltd. All rights reserved.

Canadian upstream oil and gas industry profitability: Historical review and future perspectives [with executive summary

International Nuclear Information System (INIS)

1991-09-01

The profitability of the Canadian upstream oil and gas industry is examined by analyzing return on equity and return on capital invested. By all measures and interpretations, the upstream industry has been unprofitable since the mid-1980s; returns generated are far below the industry's own historical cost of capital, and are inadequate relative to other sectors of the Canadian economy and to international oil and gas companies. This poor profitability is attributed to such factors as: overly optimistic price forecasts and healthy cash flows generated in the early 1980s, which led to excess capital spending; poor returns on capital reflective of the physical limitations of the Western Canadian Sedimentary Basin; high capital and operating costs; and a high royalty burden imposed by provincial governments. The consequences of low profitability include inadequate returns to equity investors, a drop in spending on upstream services such as drilling and exploration, a reduced ability of the industry to generate employment, and an adverse effect on the economy of Alberta. Forecasts indicate that the upstream sector is extremely vulnerable to a scenario of relatively flat prices due to high and increasing operating costs and depletion charges, and the significant royalty payments that still are in effect. Little scope is foreseen for industry profitability to return to acceptable levels over the first half of the 1990s. Reduced royalties have the potential to make a significant contribution to improved profitability. 52 figs., 40 tabs

The human oxytocin gene promoter is regulated by estrogens.

Science.gov (United States)

Richard, S; Zingg, H H

1990-04-15

Gonadal steroids affect brain function primarily by altering the expression of specific genes, yet the specific mechanisms by which neuronal target genes undergo such regulation are unknown. Recent evidence suggests that the expression of the neuropeptide gene for oxytocin (OT) is modulated by estrogens. We therefore examined the possibility that this regulation occurred via a direct interaction of the estrogen-receptor complex with cis-acting elements flanking the OT gene. DNA-mediated gene transfer experiments were performed using Neuro-2a neuroblastoma cells and chimeric plasmids containing portions of the human OT gene 5'-glanking region linked to the chloramphenicol acetyltransferase gene. We identified a 19-base pair region located at -164 to -146 upstream of the transcription start site which is capable of conferring estrogen responsiveness to the homologous as well as to a heterologous promoter. The hormonal response is strictly dependent on the presence of intracellular estrogen receptors, since estrogen induced stimulation occurred only in Neuro-2a cells co-transfected with an expression vector for the human estrogen receptor. The identified region contains a novel imperfect palindrome (GGTGACCTTGACC) with sequence similarity to other estrogen response elements (EREs). To define cis-acting elements that function in synergism with the ERE, sequences 3' to the ERE were deleted, including the CCAAT box, two additional motifs corresponding to the right half of the ERE palindrome (TGACC), as well as a CTGCTAA heptamer similar to the "elegans box" found in Caenorhabditis elegans. Interestingly, optimal function of the identified ERE was fully independent of these elements and only required a short promoter region (-49 to +36). Our studies define a molecular mechanism by which estrogens can directly modulate OT gene expression. However, only a subset of OT neurons are capable of binding estrogens, therefore, direct action of estrogens on the OT gene may be

The giant mottled eel, Anguilla marmorata, uses blue-shifted rod photoreceptors during upstream migration.

Science.gov (United States)

Wang, Feng-Yu; Fu, Wen-Chun; Wang, I-Li; Yan, Hong Young; Wang, Tzi-Yuan

2014-01-01

Catadromous fishes migrate between ocean and freshwater during particular phases of their life cycle. The dramatic environmental changes shape their physiological features, e.g. visual sensitivity, olfactory ability, and salinity tolerance. Anguilla marmorata, a catadromous eel, migrates upstream on dark nights, following the lunar cycle. Such behavior may be correlated with ontogenetic changes in sensory systems. Therefore, this study was designed to identify changes in spectral sensitivity and opsin gene expression of A. marmorata during upstream migration. Microspectrophotometry analysis revealed that the tropical eel possesses a duplex retina with rod and cone photoreceptors. The λmax of rod cells are 493, 489, and 489 nm in glass, yellow, and wild eels, while those of cone cells are 508, and 517 nm in yellow, and wild eels, respectively. Unlike European and American eels, Asian eels exhibited a blue-shifted pattern of rod photoreceptors during upstream migration. Quantitative gene expression analyses of four cloned opsin genes (Rh1f, Rh1d, Rh2, and SWS2) revealed that Rh1f expression is dominant at all three stages, while Rh1d is expressed only in older yellow eel. Furthermore, sequence comparison and protein modeling studies implied that a blue shift in Rh1d opsin may be induced by two known (N83, S292) and four putative (S124, V189, V286, I290) tuning sites adjacent to the retinal binding sites. Finally, expression of blue-shifted Rh1d opsin resulted in a spectral shift in rod photoreceptors. Our observations indicate that the giant mottled eel is color-blind, and its blue-shifted scotopic vision may influence its upstream migration behavior and habitat choice.

Frequency effects of upstream wake and blade interaction on the unsteady boundary layer flow

International Nuclear Information System (INIS)

Kang, Dong Jin; Bae, Sang Su

2002-01-01

Effects of the reduced frequency of upstream wake on downstream unsteady boundary layer flow were simulated by using a Navier-Stokes code. The Navier-Stokes code is based on an unstructured finite volume method and uses a low Reynolds number turbulence model to close the momentum equations. The geometry used in this paper is the MIT flapping foil experimental set-up and the reduced frequency of the upstream wake is varied in the range of 0.91 to 10.86 to study its effect on the unsteady boundary layer flow. Numerical solutions show that they can be divided into two categories. One is so called the low frequency solution, and behaves quite similar to a Stokes layer. Its characteristics is found to be quite similar to those due to either a temporal or spatial wave. The low frequency solutions are observed clearly when reduced frequency is smaller than 3.26. The other one is the high frequency solution. It is observed for the reduced frequency larger than 7.24. It shows a sudden shift of the phase angle of the unsteady velocity around the edge of the boundary layer. The shift of phase angle is about 180 degree, and leads to separation of the boundary layer flow from corresponding outer flow. The high frequency solution shows the characteristics of a temporal wave whose wave length is half of the upstream frequency. This characteristics of the high frequency solution is found to be caused by the strong interaction between unsteady vortices. This strong interaction also leads to destroy of the upstream wake stripe inside the viscous sublayer as well as the buffer layer

Identification of a single-nucleotide insertion in the promoter region affecting the sodC promoter activity in Brucella neotomae.

Directory of Open Access Journals (Sweden)

Dina A Moustafa

Full Text Available Brucella neotomae is not known to be associated with clinical disease in any host species. Previous research suggested that B. neotomae might not express detectable levels of Cu/Zn superoxide dismutase (SOD, a periplasmic enzyme known to be involved in protecting Brucella from oxidative bactericidal effects of host phagocytes. This study was undertaken to investigate the genetic basis for the disparity in SOD expression in B. neotomae. Our Western blot and SOD enzyme assay analyses indicated that B. neotomae does express SOD, but at a substantially reduced level. Nucleotide sequence analysis of region upstream to the sodC gene identified a single-nucleotide insertion in the potential promoter region. The same single-nucleotide insertion was also detected in the sodC promoter of B. suis strain Thomsen, belonging to biovar 2 in which SOD expression was undetectable previously. Examination of the sodC promoter activities using translational fusion constructs with E. coli β-galactosidase demonstrated that the B. neotomae and B. suis biovar 2 promoters were very weak in driving gene expression. Site-directed mutation studies indicated that the insertion of A in the B. neotomae sodC promoter reduced the promoter activity. Increasing the level of SOD expression in B. neotomae through complementation with B. abortus sodC gene did not alter the bacterial survival in J774A.1 macrophage-like cells and in tissues of BALB/c and C57BL/6 mice. These results for the first time demonstrate the occurrence of a single-nucleotide polymorphism affecting promoter function and gene expression in Brucella.

Wake flow behaviour behind a smaller cylinder oscillating in the wake of an upstream stationary cylinder

Energy Technology Data Exchange (ETDEWEB)

Gao, Yangyang; Sun, Zhilin [Ocean College, Zhejiang University, Hangzhou 310058 (China); Tan, Danielle S [Maritime Research Centre, Nanyang Technological University, Singapore 639798 (Singapore); Yu, Dingyong [College of Engineering, Ocean University of China, 266100 (China); Tan, Soon Keat, E-mail: yygao@zju.edu.cn [Nanyang Environment and Water Research Institute, Nanyang Technological University, Singapore 639798 (Singapore)

2014-04-01

The flow patterns around a cylinder oscillating freely in the wake of a larger cylinder upstream were investigated using the particle image velocimetry technique. The upstream cylinder was fixed at both ends while the downstream smaller cylinder was held by springs such that it was free to oscillate in the transverse direction. The flow patterns, amplitudes of oscillation and vortex shedding frequencies were compared with those of a single cylinder. In the presence of the upstream cylinder, the three parameters characterizing the oscillation response of the smaller cylinder—amplitude of oscillation, vortex shedding frequency and Reynolds stresses—were greatly reduced. While their magnitude increased with gap ratio, these three parameters were still smaller than the corresponding magnitudes for a single oscillating cylinder. The peak values of turbulence statistics such as Reynolds shear stress and normal stress behind the oscillating downstream cylinder were similarly reduced, and increased with gap ratios. (paper)

Interaction between the thyroid hormone receptor and co-factors on the promoter of the gene encoding phospho enol pyruvate carboxykinase

NARCIS (Netherlands)

Schmidt, E. D.; van Beeren, M.; Glass, C. K.; Wiersinga, W. M.; Lamers, W. H.

1993-01-01

Using transient transfection studies we localized a thyroid hormone-responsive element on the promoter of the rat phospho-enol pyruvate carboxykinase gene between 355 and 174 bp upstream of the transcription start site. DNAse 1 footprinting analysis within this region showed that a 28 bp fragment at

POSTRANSLATIONAL MODIFICATIONS OF P53: UPSTREAM SIGNALING PATHWAYS.

Energy Technology Data Exchange (ETDEWEB)

ANDERSON,C.W.APPELLA,E.

2003-10-23

The p53 tumor suppressor is a tetrameric transcription factor that is posttranslational modified at >20 different sites by phosphorylation, acetylation, or sumoylation in response to various cellular stress conditions. Specific posttranslational modifications, or groups of modifications, that result from the activation of different stress-induced signaling pathways are thought to modulate p53 activity to regulate cell fate by inducing cell cycle arrest, apoptosis, or cellular senescence. Here we review recent progress in characterizing the upstream signaling pathways whose activation in response to various genotoxic and non-genotoxic stresses result in p53 posttranslational modifications.

HOX Gene Promoter Prediction and Inter-genomic Comparison: An Evo-Devo Study

Directory of Open Access Journals (Sweden)

Marla A. Endriga

2010-10-01

Full Text Available Homeobox genes direct the anterior-posterior axis of the body plan in eukaryotic organisms. Promoter regions upstream of the Hox genes jumpstart the transcription process. CpG islands found within the promoter regions can cause silencing of these promoters. The locations of the promoter regions and the CpG islands of Homeo sapiens sapiens (human, Pan troglodytes (chimpanzee, Mus musculus (mouse, and Rattus norvegicus (brown rat are compared and related to the possible influence on the specification of the mammalian body plan. The sequence of each gene in Hox clusters A-D of the mammals considered were retrieved from Ensembl and locations of promoter regions and CpG islands predicted using Exon Finder. The predicted promoter sequences were confirmed via BLAST and verified against the Eukaryotic Promoter Database. The significance of the locations was determined using the Kruskal-Wallis test. Among the four clusters, only promoter locations in cluster B showed significant difference. HOX B genes have been linked with the control of genes that direct the development of axial morphology, particularly of the vertebral column bones. The magnitude of variation among the body plans of closely-related species can thus be partially attributed to the promoter kind, location and number, and gene inactivation via CpG methylation.

Impacts of shape and height of upstream roof on airflow and pollutant dispersion inside an urban street canyon.

Science.gov (United States)

Huang, Yuan-Dong; He, Wen-Rong; Kim, Chang-Nyung

2015-02-01

A two-dimensional numerical model for simulating flow and pollutant dispersion in an urban street canyon is firstly developed using the FLUENT code and then validated against the wind tunnel results. After this, the flow field and pollutant dispersion inside an urban street canyon with aspect ratio W/H = 1 are examined numerically considering five different shapes (vaulted, trapezoidal, slanted, upward wedged, and downward wedged roofs) as well as three different roof height to building height ratios (Z H /H = 1/6, 1/3, and 1/2) for the upstream building roof. The results obtained reveal that the shape and height of an upstream roof have significant influences on flow pattern and pollutant distribution in an urban canyon. A large single clockwise vortex is generated in the canyon for the vaulted upstream roof at Z H /H = 1/6, 1/3, and 1/2, the trapezoidal and downward wedged roofs at Z H /H = 1/6 and 1/3, and the slanted and upward wedged roofs at Z H /H = 1/6, while a main clockwise vortex and a secondary counterclockwise vortex are established for the trapezoidal and downward wedged roofs at Z H /H = 1/2 and the slanted and upward wedged roofs at Z H /H = 1/3 and 1/2. In the one-vortex flow regime, the clockwise vortex moves upward and grows in size with increasing upstream roof height for the vaulted, trapezoidal, and downward wedged roofs. In the two-vortex flow regime, the size and rotational velocity of both upper clockwise and lower counterclockwise vortices increase with the upstream roof height for the slanted and upward wedged roofs. At Z H /H = 1/6, the pollution levels in the canyon are close among all the upstream roof shapes studied. At Z H /H = 1/3, the pollution levels in the canyon for the upward wedged roof and slanted roof are much higher than those for the vaulted, trapezoidal, and downward wedged roofs. At Z H /H = 1/2, the lowest pollution level appears in the canyon for the vaulted upstream roof, while

How to use Big Data technologies to optimize operations in Upstream Petroleum Industry

Directory of Open Access Journals (Sweden)

Abdelkader Baaziz

2013-12-01

Full Text Available “Big Data is the oil of the new economy” is the most famous citation during the three last years. It has even been adopted by the World Economic Forum in 2011. In fact, Big Data is like crude! It’s valuable, but if unrefined it cannot be used. It must be broken down, analyzed for it to have value. But what about Big Data generated by the Petroleum Industry and particularly its upstream segment? Upstream is no stranger to Big Data. Understanding and leveraging data in the upstream segment enables firms to remain competitive throughout planning, exploration, delineation, and field development.Oil & Gas Companies conduct advanced geophysics modeling and simulation to support operations where 2D, 3D & 4D Seismic generate significant data during exploration phases. They closely monitor the performance of their operational assets. To do this, they use tens of thousands of data-collecting sensors in subsurface wells and surface facilities to provide continuous and real-time monitoring of assets and environmental conditions. Unfortunately, this information comes in various and increasingly complex forms, making it a challenge to collect, interpret, and leverage the disparate data. As an example, Chevron’s internal IT traffic alone exceeds 1.5 terabytes a day.Big Data technologies integrate common and disparate data sets to deliver the right information at the appropriate time to the correct decision-maker. These capabilities help firms act on large volumes of data, transforming decision-making from reactive to proactive and optimizing all phases of exploration, development and production. Furthermore, Big Data offers multiple opportunities to ensure safer, more responsible operations. Another invaluable effect of that would be shared learning.The aim of this paper is to explain how to use Big Data technologies to optimize operations. How can Big Data help experts to decision-making leading the desired outcomes?Keywords:Big Data; Analytics

Investigating the Applicability of Upstream Detection Strategy at Pedestrian Signalised Crossings

Directory of Open Access Journals (Sweden)

Sitti A Hassan

2017-10-01

Full Text Available In the UK, the Puffin crossing has provision to extend pedestrian green time for those who take longer to cross. However, even at such a pedestrian friendly facility, the traffic signal control is usually designed to minimise vehicle delay while providing the crossing facility. This situation is rather contrary to the current policies to encourage walking. It is this inequity that has prompted the need to re-examine the traffic control of signalised crossings to provide more benefit to both pedestrians and vehicles. In this context, this paper explores the possibility of implementing an Upstream Detection strategy at a Puffin crossing to provide a user friendly crossing. The study has been carried out by simulating a mid-block Puffin crossing for various detector distances and a number of combinations of pedestrian and traffic flows. This paper presents the simulation results and recommends the situations at which Upstream Detection would be suitable.

The giant mottled eel, Anguilla marmorata, uses blue-shifted rod photoreceptors during upstream migration.

Directory of Open Access Journals (Sweden)

Feng-Yu Wang

Full Text Available Catadromous fishes migrate between ocean and freshwater during particular phases of their life cycle. The dramatic environmental changes shape their physiological features, e.g. visual sensitivity, olfactory ability, and salinity tolerance. Anguilla marmorata, a catadromous eel, migrates upstream on dark nights, following the lunar cycle. Such behavior may be correlated with ontogenetic changes in sensory systems. Therefore, this study was designed to identify changes in spectral sensitivity and opsin gene expression of A. marmorata during upstream migration. Microspectrophotometry analysis revealed that the tropical eel possesses a duplex retina with rod and cone photoreceptors. The λmax of rod cells are 493, 489, and 489 nm in glass, yellow, and wild eels, while those of cone cells are 508, and 517 nm in yellow, and wild eels, respectively. Unlike European and American eels, Asian eels exhibited a blue-shifted pattern of rod photoreceptors during upstream migration. Quantitative gene expression analyses of four cloned opsin genes (Rh1f, Rh1d, Rh2, and SWS2 revealed that Rh1f expression is dominant at all three stages, while Rh1d is expressed only in older yellow eel. Furthermore, sequence comparison and protein modeling studies implied that a blue shift in Rh1d opsin may be induced by two known (N83, S292 and four putative (S124, V189, V286, I290 tuning sites adjacent to the retinal binding sites. Finally, expression of blue-shifted Rh1d opsin resulted in a spectral shift in rod photoreceptors. Our observations indicate that the giant mottled eel is color-blind, and its blue-shifted scotopic vision may influence its upstream migration behavior and habitat choice.

Upstream pumping of radial lip seals by tangentially deforming, rough seal surfaces

NARCIS (Netherlands)

Bavel, van P.G.M.; Ruijl, T.A.M.; Leeuwen, van H.J.; Muijderman, E.A.

1996-01-01

This paper aims at a theoretical explanation of the following two experimental observations of radial lip seals: fluid film formation and upstream pumping action. The origins of these observations are still poorly understood. A hydrodynamic analysis is presented for the fully flooded contact zone of

Open science initiatives: challenges for public health promotion.

Science.gov (United States)

Holzmeyer, Cheryl

2018-03-07

While academic open access, open data and open science initiatives have proliferated in recent years, facilitating new research resources for health promotion, open initiatives are not one-size-fits-all. Health research particularly illustrates how open initiatives may serve various interests and ends. Open initiatives not only foster new pathways of research access; they also discipline research in new ways, especially when associated with new regimes of research use and peer review, while participating in innovation ecosystems that often perpetuate existing systemic biases toward commercial biomedicine. Currently, many open initiatives are more oriented toward biomedical research paradigms than paradigms associated with public health promotion, such as social determinants of health research. Moreover, open initiatives too often dovetail with, rather than challenge, neoliberal policy paradigms. Such initiatives are unlikely to transform existing health research landscapes and redress health inequities. In this context, attunement to social determinants of health research and community-based local knowledge is vital to orient open initiatives toward public health promotion and health equity. Such an approach calls for discourses, norms and innovation ecosystems that contest neoliberal policy frameworks and foster upstream interventions to promote health, beyond biomedical paradigms. This analysis highlights challenges and possibilities for leveraging open initiatives on behalf of a wider range of health research stakeholders, while emphasizing public health promotion, health equity and social justice as benchmarks of transformation.

The retinoid X receptor response element in the human aldehyde dehydrogenase 2 promoter is antagonized by the chicken ovalbumin upstream promoter family of orphan receptors

NARCIS (Netherlands)

Pinaire, J; Hasanadka, R; Fang, M; Chou, WY; Stewart, MJ; Kruijer, W; Crabb, D

2000-01-01

Two tandem sites in the aldehyde dehydrogenase 2 promoter (designated FP330-5' and FP330-3') that bind members of the nuclear receptor superfamily mere recently identified. Antibodies against apolipoprotein regulatory protein (ARP-1) altered DNA-protein interactions in electrophoretic mobility shift

ERalpha and AP-1 interact in vivo with a specific sequence of the F promoter of the human ERalpha gene in osteoblasts.

Science.gov (United States)

Lambertini, Elisabetta; Tavanti, Elisa; Torreggiani, Elena; Penolazzi, Letizia; Gambari, Roberto; Piva, Roberta

2008-07-01

Estrogen-responsive genes often have an estrogen response element (ERE) positioned next to activator protein-1 (AP-1) binding sites. Considering that the interaction between ERE and AP-1 elements has been described for the modulation of bone-specific genes, we investigated the 17-beta-estradiol responsiveness and the role of these cis-elements present in the F promoter of the human estrogen receptor alpha (ERalpha) gene. The F promoter, containing the sequence analyzed here, is one of the multiple promoters of the human ERalpha gene and is the only active promoter in bone tissue. Through electrophoretic mobility shift (EMSA), chromatin immunoprecipitation (ChIP), and re-ChIP assays, we investigated the binding of ERalpha and four members of the AP-1 family (c-Jun, c-fos, Fra-2, and ATF2) to a region located approximately 800 bp upstream of the transcriptional start site of exon F of the human ERalpha gene in SaOS-2 osteoblast-like cells. Reporter gene assay experiments in combination with DNA binding assays demonstrated that F promoter activity is under the control of upstream cis-acting elements which are recognized by specific combinations of ERalpha, c-Jun, c-fos, and ATF2 homo- and heterodimers. Moreover, ChIP and re-ChIP experiments showed that these nuclear factors bind the F promoter in vivo with a simultaneous occupancy stimulated by 17-beta-estradiol. Taken together, our findings support a model in which ERalpha/AP-1 complexes modulate F promoter activity under conditions of 17-beta-estradiol stimulation. (c) 2008 Wiley-Liss, Inc.

(LBA-and-WRM)-based DBA scheme for multi-wavelength upstream transmission supporting 10 Gbps and 1 Gbps in MAN

Science.gov (United States)

Zhang, Yuchao; Gan, Chaoqin; Gou, Kaiyu; Xu, Anni; Ma, Jiamin

2018-01-01

DBA scheme based on Load balance algorithm (LBA) and wavelength recycle mechanism (WRM) for multi-wavelength upstream transmission is proposed in this paper. According to 1 Gbps and 10 Gbps line rates, ONUs are grouped into different VPONs. To facilitate wavelength management, resource pool is proposed to record wavelength state. To realize quantitative analysis, a mathematical model describing metro-access network (MAN) environment is presented. To 10G-EPON upstream, load balance algorithm is designed to ensure load distribution fairness for 10G-OLTs. To 1G-EPON upstream, wavelength recycle mechanism is designed to share remained wavelengths. Finally, the effectiveness of the proposed scheme is demonstrated by simulation and analysis.

Low power consumption O-band VCSEL sources for upstream channels in PON systems

DEFF Research Database (Denmark)

Vegas Olmos, Juan José; Rodes Lopez, Roberto; Tafur Monroy, Idelfonso

2012-01-01

This paper presents an experimental validation of a low power optical network unit employing vertical-cavity surface-emitting lasers as upstream sources for passive optical networks with an increased power budget, enabling even larger splitting ratios....

Explosion Clad for Upstream Oil and Gas Equipment

Science.gov (United States)

Banker, John G.; Massarello, Jack; Pauly, Stephane

2011-01-01

Today's upstream oil and gas facilities frequently involve the combination of high pressures, high temperatures, and highly corrosive environments, requiring equipment that is thick wall, corrosion resistant, and cost effective. When significant concentrations of CO2 and/or H2S and/or chlorides are present, corrosion resistant alloys (CRA) can become the material of choice for separator equipment, piping, related components, and line pipe. They can provide reliable resistance to both corrosion and hydrogen embrittlement. For these applications, the more commonly used CRA's are 316L, 317L and duplex stainless steels, alloy 825 and alloy 625, dependent upon the application and the severity of the environment. Titanium is also an exceptional choice from the technical perspective, but is less commonly used except for heat exchangers. Explosion clad offers significant savings by providing a relatively thin corrosion resistant alloy on the surface metallurgically bonded to a thick, lower cost, steel substrate for the pressure containment. Developed and industrialized in the 1960's the explosion cladding technology can be used for cladding the more commonly used nickel based and stainless steel CRA's as well as titanium. It has many years of proven experience as a reliable and highly robust clad manufacturing process. The unique cold welding characteristics of explosion cladding reduce problems of alloy sensitization and dissimilar metal incompatibility. Explosion clad materials have been used extensively in both upstream and downstream oil, gas and petrochemical facilities for well over 40 years. The explosion clad equipment has demonstrated excellent resistance to corrosion, embrittlement and disbonding. Factors critical to insure reliable clad manufacture and equipment design and fabrication are addressed.

Explosion Clad for Upstream Oil and Gas Equipment

International Nuclear Information System (INIS)

Banker, John G.; Massarello, Jack; Pauly, Stephane

2011-01-01

Today's upstream oil and gas facilities frequently involve the combination of high pressures, high temperatures, and highly corrosive environments, requiring equipment that is thick wall, corrosion resistant, and cost effective. When significant concentrations of CO 2 and/or H 2 S and/or chlorides are present, corrosion resistant alloys (CRA) can become the material of choice for separator equipment, piping, related components, and line pipe. They can provide reliable resistance to both corrosion and hydrogen embrittlement. For these applications, the more commonly used CRA's are 316L, 317L and duplex stainless steels, alloy 825 and alloy 625, dependent upon the application and the severity of the environment. Titanium is also an exceptional choice from the technical perspective, but is less commonly used except for heat exchangers. Explosion clad offers significant savings by providing a relatively thin corrosion resistant alloy on the surface metallurgically bonded to a thick, lower cost, steel substrate for the pressure containment. Developed and industrialized in the 1960's the explosion cladding technology can be used for cladding the more commonly used nickel based and stainless steel CRA's as well as titanium. It has many years of proven experience as a reliable and highly robust clad manufacturing process. The unique cold welding characteristics of explosion cladding reduce problems of alloy sensitization and dissimilar metal incompatibility. Explosion clad materials have been used extensively in both upstream and downstream oil, gas and petrochemical facilities for well over 40 years. The explosion clad equipment has demonstrated excellent resistance to corrosion, embrittlement and disbonding. Factors critical to insure reliable clad manufacture and equipment design and fabrication are addressed.

Exploring Patterns of Upstream Internationalization: The Role of Home-region ‘Stickiness’

NARCIS (Netherlands)

A.R. Muller (Allan); R.J.M. van Tulder (Rob)

2005-01-01

textabstractRecent work has emphasized the importance of regional strategies downstream, adding new depth to the debate on ‘globalization’. This paper adds to the debate by exploring the regional dimension upstream for a sample of Triad-based Fortune 500 firms. We find support for our hypothesis

Effect of longitudinal and transverse vibrations of an upstream square cylinder on vortex shedding behind two inline square cylinders

International Nuclear Information System (INIS)

Patil, Pratish P; Tiwari, Shaligram

2009-01-01

The characteristics of unsteady wakes behind a stationary square cylinder and another upstream vibrating square cylinder have been investigated numerically with the help of a developed computational code. The effect of longitudinal as well as transverse vibrations of the upstream cylinder is studied on the coupled wake between the two cylinders, which is found to control the vortex shedding behavior behind the downstream stationary cylinder. Computations are carried out for a fixed value of Reynolds number (Re = 200) and three different values of excitation frequencies of the upstream cylinder, namely less than, equal to and greater than the natural frequency of vortex shedding corresponding to flow past a stationary square cylinder. The vortex shedding characteristics of the unsteady wakes behind the vibrating and stationary cylinders are found to differ significantly for longitudinal and transverse modes of vibration of the upstream cylinder. The wake of the downstream stationary cylinder is found to depict a synchronization behavior with the upstream cylinder vibration. The spacing between the two cylinders has been identified to be the key parameter influencing the synchronization phenomenon. The effect of cylinder spacing on the wake synchronization and the hydrodynamic forces has been examined. In addition, a comparison of the drag forces for flow past transversely vibrating square and circular cylinders for similar amplitudes and frequencies of cylinder vibration has been presented while employing the tested computational code.

Study on effects of turbulence promoter on fluid mixing in T-junction piping system

International Nuclear Information System (INIS)

Nagao, Akihiro; Hibara, Hideki; Ochi, Junji; Muramatsu, Toshiharu

2004-07-01

Flows in T-junction piping system with turbulence promoter have been investigated experimentally using flow visualization techniques (the dye injection method) and velocity measurement by LDV. Effects of turbulent promoter on characteristics of fluid mixing and thermal-striping phenomena are examined. From the experiment, following results are obtained. (1) Arch vortex is formed further than the case without promoter in the upstream station and is rapidly transported to the downstream direction. (2) Secondary flow induced in the cross section become stronger and the diffusion of axial momentum is promoted, as the height of turbulence promoter is higher. (3) Main flow deflects towards to the opposite side of branch pipe at the T-junction, as the height of turbulence promoter is higher, and as velocity ratio becomes smaller, and the flow continues to deflect to a considerably downstream station. (4) Velocity fluctuation is observed in the position where the vortex is formed, and it becomes a maximum at z/Dm=2. In the further downstream, velocity fluctuation decreases with the vortex breakdown, and it considerably remains to the downstream. (author)

The role of the ionosphere in coupling upstream ULF wave power into the dayside magnetosphere

International Nuclear Information System (INIS)

Engebretson, M.J.; Cahill, L.J. Jr.; Arnoldy, R.L.; Anderson, B.J.; Rosenberg, T.J.; Carpenter, D.L.; Inan, U.S.; Eather, R.H.

1991-01-01

A series of recent studies of Pc 3 magnetic pulsations in the dayside outer magnetosphere has given new insights into the possible mechanisms of entry of ULF wave power into the magnetosphere from a bow shock related upstream source. In this paper, the authors first review many of these new observational results by presenting a comparison of data from two 10-hour intervals on successive days in April 1986 and then present a possible model for transmission of pulsation signals from the magnetosheath into the dayside magnetosphere. Simultaneous multi-instrument observations at South Pole Station, located below the cusp/cleft ionosphere near local noon, magnetic field observations by the AMPTE CCE satellite in the dayside outer magnetosphere, and upstream magnetic field observations by the IMP 8 satellite show clear interplanetary magnetic field field magnitude control of dayside resonant harmonic pulsations and band-limited very high latitude pulsations, as well as pulsation-modulated precipitation of what appear to be magnetosheath/boundary layer electrons. They believe that this modulated precipitation may be responsible for the propagation of upstream wave power in the Pc 3 frequency band into the high-latitude ionosphere, from whence it may be transported throughout the dayside outer magnetosphere by means of an ionospheric transistor. In this model, modulations in ionospheric conductivity caused by cusp/cleft precipitation cause varying ionospheric currents with frequency spectra determined by the upstream waves; these modulations will be superimposed on the Birkeland currents, which close via these ionospheric currents. Modulated region 2 Birkeland currents will in turn provide a narrow-band source of wave energy to a wide range of dayside local times in the outer magnetosphere

Radiation degradation of short-cotton linters

International Nuclear Information System (INIS)

Ma Zue Teh; Zhou Rui Min

1984-01-01

Radiation degradation of short-cotton linters has been studied by using X-ray diffraction, an infrared spectrometer and a viscosimeter. Average molecular weight and crystallinity of short-cotton linters and the change of reducing sugar in γ-radiation degradation were examined. It was found that cellulosic saccharification in hydrolysis was enhanced with preirradiation of linter. This probably resulted from the radiation induced change of cellulosic structure. Sensitizers to promote radiation degradation effect were investigated. Carbon tetrachloride has been found to be effective. (author)

Upstream passage, spawning, and stock identification of fall chinook in the Snake River, 1992 and 1993. Final report

International Nuclear Information System (INIS)

Blankenship, H.L.; Mendel, G.W.

1997-05-01

This final report of the 3-year study summarizes activities and results for 1993. Study objectives were to: (1) determine the source of losses (or accounting errors) for adult chinook salmon between Ice Harbor Dam (IHR) and Lower Granite Dam (LGR), and upstream of LGR in the Snake River; (2) identify spawning locations upstream of LGR for calibration of aerial redd surveys, redd habitat mapping, carcass recovery for genetic stock profile analysis, and correction of estimated adult/redd ratios; and (3) estimate passage and migration times at Snake River. 200 fall chinook salmon were radio tagged and tracked with aerial, fixed-site, and ground mobile tracking. Fish were released upstream of IHR at Charbonneau Park (CHAR). 190 of the fish were tracked or relocated away from CHAR. 59 fish descended to below IHR without crossing Lower Monumental Dam (LMO). Another 128 salmon passed upstream of LMO without falling back at IHR. Only 80 salmon passed Little Goose Dam (LGO) without falling back at a downstream dam; 66 of these fish passed LGR. Many fish that fell back reascended the dams. A total of 72 salmon released at CHAR passed upstream of LGR, including fish that had fallen back and reascended a dam. Over 80 percent of the salmon that entered Lyons Ferry Hatchery each year had reached LGO before descending to the hatchery. Extensive wandering was documented between LMO and upstream of LGR before salmon entered Lyons Ferry Hatchery or the Tucannon River. In 1993, 41 salmon were found to be of hatchery origin when recovered. These fish entered Lyons Ferry Hatchery with similar movements to unmarked salmon. Each year a few salmon have remained near the hatchery without entering, which suggests the hatchery may have inadequate attraction flows. Fall chinook passed lower Snake River dams in 2-5 days each on average. Median travel times through LMO and LGO were 1.0-1.3 days each, which was slower than for spring chinook or steelhead in 1993. 5 refs., 21 figs., 20 tabs

Investigations of Escherichia coli promoter sequences with artificial neural networks: new signals discovered upstream of the transcriptional startpoint

DEFF Research Database (Denmark)

Pedersen, Anders Gorm; Engelbrecht, Jacob

1995-01-01

We present a novel method for using the learning ability of a neural network as a measure of information in local regions of input data. Using the method to analyze Escherichia coli promoters, we discover all previously described signals, and furthermore find new signals that are regularly spaced...

The promoter of the Arabidopsis thaliana plastocyanin gene contains a far upstream enhancer-like element involved in chloroplast-dependent expression.

Science.gov (United States)

Vorst, O; Kock, P; Lever, A; Weterings, B; Weisbeek, P; Smeekens, S

1993-12-01

Plastocyanin is part of the photosynthetic electron transport chain in the chloroplast and is encoded in the nucleus. Expression of the Arabidopsis thaliana plastocyanin gene is organ specific: high mRNA levels are observed in young green parts of the plant. Furthermore, expression is dependent on the presence of light and functional chloroplasts. When grown in the presence of norflurazon under white light conditions, resulting in the photo-oxidative destruction of the chloroplast, plastocyanin mRNA levels are strongly reduced. A -1579 to -9 promoter fragment confers light-regulated and chloroplast-dependent expression to the beta-glucuronidase reporter gene in transgenic tobacco plants. This suggests that regulation takes place at the level of transcription. A plastocyanin promoter deletion series ranging from -1579 to -121 which was also tested in tobacco, revealed the presence of a strong positive regulating element (PRE) in the -1579 to -705 region. Deletion of this part of the promoter resulted in a approximately 100-fold reduction of GUS expression as measured in mature leaves. Surprisingly, this enhancer-like element was capable of stimulating transcription from a position downstream of its reporter. Moreover, it could also activate a truncated CaMV 35S promoter. Deletion of this element coincides with the loss of chloroplast-dependency of reporter gene expression, as judged by norflurazon treatment of transgenic seedlings. So, the activity of the PRE itself might depend on the presence of functional chloroplasts.

A semelparous fish continues upstream migration when exposed to alarm cue, but adjusts movement speed and timing

Science.gov (United States)

Luhring, Thomas M; Meckley, Trevor D.; Johnson, Nicholas S.; Siefkes, Michael J.; Hume, John B.; Wagner, C. Michael

2016-01-01

Animals make trade-offs between predation risk and pursuit of opportunities such as foraging and reproduction. Trade-offs between antipredator behaviours and foraging are well suited to manipulation in laboratory and field settings and have generated a vast compendium of knowledge. However, much less is known about how animals manage trade-offs between predation risk and pursuit of reproductive opportunities in the absence of the confounding effects of foraging. In the present study, we investigated how the nonfeeding migratory life stage of sea lamprey, Petromyzon marinus, responds to odour from dead conspecifics (a cue that induces avoidance behaviours in laboratory and field studies). We released groups of PIT-tagged sea lamprey 65 m from the shore of Lake Michigan or 287 m upstream in Carp Lake River and used antennas to detect their movements in the river. As the breeding season progressed, sea lamprey initiated upstream movement earlier and were more likely to enter the river. Sea lamprey that began the night in Lake Michigan entered Carp Lake River at higher rates and accelerated upstream when exposed to high concentrations of alarm cue, consistent with animals attempting to minimize time spent in risky areas. Sea lampreys that began the night in the river delayed upstream movement when exposed to alarm cue, consistent with animals sheltering and gathering information about a source of risk. We attribute this context-specific reaction to alarm cue to differences in perceived vulnerability to predation in sheltered positions in the river versus exposed positions in the lake. Once in the river, the vast majority of sea lamprey moved upstream independent of alarm cue or Julian date. Although life-history-induced time and energy budgets place rigid constraints on the direction of migration, sea lamprey attend to predation risk by modifying movement timing and speed.

A cost-effective structure of a centralized-light-source WDM-PON utilizing inverse-duobinary-RZ downstream and DPSK upstream

International Nuclear Information System (INIS)

Chen Long-Quan; Qiao Yao-Jun; Ji Yue-Feng

2013-01-01

In this paper, we propose a new structure of a centralized-light-source wavelength division multiplexed passive optical network (WDM-PON) utilizing inverse-duobinary-return-to-zero (inverse-duobinary-RZ) downstream and DPSK upstream. It reuses downstream light for the upstream modulation, which retrenches lasers assembled at each optical network unit (ONU), and ultimately cuts down the cost of ONUs a great deal. Meanwhile, a 50-km-reach WDM-PON experiment with 10-Gb/s inverse-duobinary-RZ downstream and 6-Gb/s DPSK upstream is demonstrated here. It is revealed to be a novel cost-effective alternative for the next generation access network. (electromagnetism, optics, acoustics, heat transfer, classical mechanics, and fluid dynamics)

Negative effect of the 5'-untranslated leader sequence on Ac transposon promoter expression.

Science.gov (United States)

Scortecci, K C; Raina, R; Fedoroff, N V; Van Sluys, M A

1999-08-01

Transposable elements are used in heterologous plant hosts to clone genes by insertional mutagenesis. The Activator (Ac) transposable element has been cloned from maize, and introduced into a variety of plants. However, differences in regulation and transposition frequency have been observed between different host plants. The cause of this variability is still unknown. To better understand the activity of the Ac element, we analyzed the Ac promoter region and its 5'-untranslated leader sequence (5' UTL). Transient assays in tobacco NT1 suspension cells showed that the Ac promoter is a weak promoter and its activity was localized by deletion analyses. The data presented here indicate that the core of the Ac promoter is contained within 153 bp fragment upstream to transcription start sites. An important inhibitory effect (80%) due to the presence of the 5' UTL was found on the expression of LUC reporter gene. Here we demonstrate that the presence of the 5' UTL in the constructs reduces the expression driven by either strong or weak promoters.

Short repeats in the heme oxygenase 1 gene promoter is associated with increased levels of inflammation, ferritin and higher risk of type-2 diabetes mellitus.

Science.gov (United States)

Andrews, Mónica; Leiva, Elba; Arredondo-Olguín, Miguel

2016-09-01

We evaluated the relationship between the HO1 genotype, ferritin levels and the risk of type-2 diabetes and inflammation. Eight hundred thirty-five individuals were evaluated and classified according to their nutritional status and the presence of type-2 diabetes: 153 overweight (OW); 62 obese (OB); 55 type-2 diabetes mellitus (DM); 202 OWDM; 239 OBDM and 124 controls (C). We studied biochemical (glycemia, insulin, lipid profile, liver enzyme, creatinine, hsCRP), hematological (hemoglobin, free erythrocyte protoporphyrin, transferrin receptor and serum Fe and ferritin) and oxidative stress (SOD, GHS and TBARS) parameters. We determined heme oxygenase activity and the (GT)n polymorphism in its gene promoter. Individuals with diabetes, independent of nutritional status, showed high levels of ferritin and HO activity compared to control subjects. Allelic frequency was not different between the groups (Chi(2), NS) however, genotypes were different (Chi(2), P1). The SS (short-short) genotype was higher in all DM individuals compared to controls and MM was higher in controls. SM (short-medium) genotype was an independent risk factor for DM in logistic regression analysis. We observed high risk for type-2 diabetes mellitus in the presence of SM genotype and high levels of ferritin (OR adjusted: 2.7; 1.9-3.6; p1; compared to control group). It was also significantly related to inflammation. The SM genotype in HO1 gene promoter and ferritin levels were associated with higher risk for type-2 diabetes and for having a higher marker of inflammation, which is the main risk factor for the development of chronic diseases. Copyright © 2016 Elsevier GmbH. All rights reserved.

Novel Strategies for Upstream and Downstream Processing of Tannin Acyl Hydrolase

Directory of Open Access Journals (Sweden)

Luis V. Rodríguez-Durán

2011-01-01

Full Text Available Tannin acyl hydrolase also referred as tannase is an enzyme with important applications in several science and technology fields. Due to its hydrolytic and synthetic properties, tannase could be used to reduce the negative effects of tannins in beverages, food, feed, and tannery effluents, for the production of gallic acid from tannin-rich materials, the elucidation of tannin structure, and the synthesis of gallic acid esters in nonaqueous media. However, industrial applications of tannase are still very limited due to its high production cost. Thus, there is a growing interest in the production, recovery, and purification of this enzyme. Recently, there have been published a number of papers on the improvement of upstream and downstream processing of the enzyme. These papers dealt with the search for new tannase producing microorganisms, the application of novel fermentation systems, optimization of culture conditions, the production of the enzyme by recombinant microorganism, and the design of efficient protocols for tannase recovery and purification. The present work reviews the state of the art of basic and biotechnological aspects of tannin acyl hydrolase, focusing on the recent advances in the upstream and downstream processing of the enzyme.

Novel strategies for upstream and downstream processing of tannin acyl hydrolase.

Science.gov (United States)

Rodríguez-Durán, Luis V; Valdivia-Urdiales, Blanca; Contreras-Esquivel, Juan C; Rodríguez-Herrera, Raúl; Aguilar, Cristóbal N

2011-01-01

Tannin acyl hydrolase also referred as tannase is an enzyme with important applications in several science and technology fields. Due to its hydrolytic and synthetic properties, tannase could be used to reduce the negative effects of tannins in beverages, food, feed, and tannery effluents, for the production of gallic acid from tannin-rich materials, the elucidation of tannin structure, and the synthesis of gallic acid esters in nonaqueous media. However, industrial applications of tannase are still very limited due to its high production cost. Thus, there is a growing interest in the production, recovery, and purification of this enzyme. Recently, there have been published a number of papers on the improvement of upstream and downstream processing of the enzyme. These papers dealt with the search for new tannase producing microorganisms, the application of novel fermentation systems, optimization of culture conditions, the production of the enzyme by recombinant microorganism, and the design of efficient protocols for tannase recovery and purification. The present work reviews the state of the art of basic and biotechnological aspects of tannin acyl hydrolase, focusing on the recent advances in the upstream and downstream processing of the enzyme.

Moving upstream in health promoting policies for older people with early frailty in England? A policy analysis.

OpenAIRE

Drennan, V; Walters, K; Avgerinou, C; Gardner, B; Goodman, C; Frost, R; Kharicha, K; Iliffe, S; Manthorpe, J

2018-01-01

Objectives Globally, populations are rapidly ageing and countries have developed health promotion and wellbeing strategies to address increasing demand for health care and old-age support. The older population is not homogeneous however, and includes a large group in transition between being active and healthy to being frail, i.e. with early frailty. This review explores the extent to which policy in England has addressed this group with a view to supporting independence and preventing furthe...

Upstream particles observed in the earth's foreshock region

International Nuclear Information System (INIS)

Eastman, T.E.; Anderson, R.R.; Frank, L.A.; Parks, G.K.

1981-01-01

On the basis of primarily an extensive study of fully three-dimensional plasma data, we describe the interrelationships of the upstream particles and plasma waves observed in the earth's foreshock region. The University of Iowa LEPEDEAs detect ions and electrons from 1 eV to 45 keV over all except approx.2% of the unit sphere. Comparisons are made with high time resolution particle data obtained by the University of California (Berkeley) instruments and plasma wave data collected by the University of Iowa plasma wave instruments on the two ISEE spacecraft. The presence of ion beams or dispersed ion distributions is found to be a sufficient condition for the presence of electrostatic and electromagnetic wave emissions. Detailed correlations of ions with plasma waves down to a tenth of an ion gyroperiod indicate that ion acoustic emission is enhanced when increased anisotropies and gyrophase organization are observed. Time aliasing effects limit the interpretation of velocity distributions taken within the foreshock region. High time resolution correlations between the different instruments, however, demonstrate that time variations of a single isotropic or anisotropic distribution cannot produce the dispersed ion distributions. Detailed analysis of high time resolution data reveals that the upstream particles undergo significant spatial and temporal variations including gyrophase organization. Gyrophase organization comprises groups of ion clusters each one of which includes ions with similar pitch angles that gyrate together about a common guiding center. On the basis of our high time resolution analysis of three-dimensional plasma data combined with magnetic field and plasma wave data, we conclude that (1) ions observed in the foreshock region display gyrophase organization produced by ion clusters with a spatial scale <1 R/sub g/, and (2) dispersed ion distributions are produced primarily by direct sources at or near the bow shock

Differential methylation at the RELN gene promoter in temporal cortex from autistic and typically developing post-puberal subjects.

Science.gov (United States)

Lintas, Carla; Sacco, Roberto; Persico, Antonio M

2016-01-01

Reelin plays a pivotal role in neurodevelopment and in post-natal synaptic plasticity and has been implicated in the pathogenesis of autism spectrum disorder (ASD). The reelin (RELN) gene expression is significantly decreased in ASD, both in the brain and peripherally. Methylation at the RELN gene promoter is largely triggered at puberty, and hypermethylation has been found in post-mortem brains of schizophrenic and bipolar patients. In this study, we assessed RELN gene methylation status in post-mortem temporocortical tissue samples (BA41/42 or 22) of six pairs of post-puberal individuals with ASD and typically developing subjects, matched for sex (male:female, M:F = 5:1), age, and post-mortem interval. ASD patients display a significantly higher number of methylated CpG islands and heavier methylation in the 5' region of the RELN gene promoter, spanning from -458 to -223 bp, whereas controls have more methylated CpG positions and greater extent of methylation at the 3' promoter region, spanning from -222 to +1 bp. The most upstream promoter region (-458 to -364 bp) is methylated only in ASD brains, while the most downstream region (-131 to +1 bp) is methylated exclusively in control brains. Within this general framework, three different methylation patterns are discernible, each correlated with different extents of reduction in reelin gene expression among ASD individuals compared to controls. The methylation pattern is different in ASD and control post-mortem brains. ASD-specific CpG positions, located in the most upstream gene promoter region, may exert a functional role potentially conferring ASD risk by blunting RELN gene expression.

Functional analysis of the promoter of the molt-inhibiting hormone (mih) gene in mud crab Scylla paramamosain.

Science.gov (United States)

Zhang, Xin; Huang, Danping; Jia, Xiwei; Zou, Zhihua; Wang, Yilei; Zhang, Ziping

2018-04-01

In this study, the 5'-flanking region of molt-inhibiting hormone (MIH) gene was cloned by Tail-PCR. It is 2024 bp starting from the translation initiation site, and 1818 bp starting from the predicted transcription start site. Forecast analysis results by the bioinformatics software showed that the transcription start site is located at 207 bp upstream of the start codon ATG, and TATA box is located at 240 bp upstream of the start codon ATG. Potential transcription factor binding sites include Sp1, NF-1, Oct-1, Sox-2, RAP1, and so on. There are two CpG islands, located at -25- +183 bp and -1451- -1316 bp respectively. The transfection results of luciferase reporter constructs showed that the core promoter region was located in the fragment -308 bp to -26 bp. NF-kappaB and RAP1 were essential for mih basal transcriptional activity. There are three kinds of polymorphism CA in the 5'-flanking sequence, and they can influence mih promoter activity. These findings provide a genetic foundation of the further research of mih transcription regulation. Copyright © 2017 Elsevier Inc. All rights reserved.

Method and system for control of upstream flowfields of vehicle in supersonic or hypersonic atmospheric flight

Science.gov (United States)

Daso, Endwell O. (Inventor); Pritchett, II, Victor E. (Inventor); Wang, Ten-See (Inventor); Farr, Rebecca Ann (Inventor)

2012-01-01

The upstream flowfield of a vehicle traveling in supersonic or hypersonic atmospheric flight is actively controlled using attribute(s) experienced by the vehicle. Sensed attribute(s) include pressure along the vehicle's outer mold line, temperature along the vehicle's outer mold line, heat flux along the vehicle's outer mold line, and/or local acceleration response of the vehicle. A non-heated, non-plasma-producing gas is injected into an upstream flowfield of the vehicle from at least one surface location along the vehicle's outer mold line. The pressure of the gas so-injected is adjusted based on the attribute(s) so-sensed.

DEVELOPMENT OF A VIRTUAL INTELLIGENCE TECHNIQUE FOR THE UPSTREAM OIL INDUSTRY

Energy Technology Data Exchange (ETDEWEB)

Iraj A. Salehi; Shahab D. Mohaghegh; Samuel Ameri

2004-09-01

The objective of the research and development work reported in this document was to develop a Virtual Intelligence Technique for optimization of the Preferred Upstream Management Practices (PUMP) for the upstream oil industry. The work included the development of a software tool for identification and optimization of the most influential parameters in upstream common practices as well as geological, geophysical and reservoir engineering studies. The work was performed in cooperation with three independent producing companies--Newfield Exploration, Chesapeake Energy, and Triad Energy--operating in the Golden Trend, Oklahoma. In order to protect data confidentiality, these companies are referred to as Company One, Two, Three in a randomly selected order. These producing companies provided geological, completion, and production data on 320 wells and participated in frequent technical discussions throughout the project. Research and development work was performed by Gas Technology Institute (GTI), West Virginia University (WVU), and Intelligent Solutions Inc. (ISI). Oklahoma Independent Petroleum Association (OIPA) participated in technology transfer and data acquisition efforts. Deliverables from the project are the present final report and a user-friendly software package (Appendix D) with two distinct functions: a characterization tool that identifies the most influential parameters in the upstream operations, and an optimization tool that seeks optimization by varying a number of influential parameters and investigating the coupled effects of these variations. The electronic version of this report is also included in Appendix D. The Golden Trend data were used for the first cut optimization of completion procedures. In the subsequent step, results from soft computing runs were used as the guide for detailed geophysical and reservoir engineering studies that characterize the cause-and-effect relationships between various parameters. The general workflow and the main

Independents in European Gas Markets after liberalisation - downstream integration of upstream oil and gas companies

International Nuclear Information System (INIS)

Eikeland, Per Ove

2005-01-01

A central objective of gas market liberalisation in Europe in the 1990s was to increase competition by opening end-use markets for independent suppliers. Upstream oil and gas companies in Europe reacted to this opportunity by announcing strategies to integrate forward in European gas markets. By late 2004, however, upstream companies still recorded generally weak downstream strategy implementation in Europe. The article concludes that this general implementation gap should be explained by political failure in EU member states to abolish gas market barriers to entry for independents. Variation between companies in degree of implementation should be explained by variation in conditions in the companies' home markets / wider business spheres and internal company factors. (Author)

Performance of upstream interaction region detectors for the FIRST experiment at GSI

CERN Document Server

Abou-Haidar, Z; Alvarez, M A G; Anelli, M; Aumann, T; Battistoni, G; Bocci, A; Bohlen, T T; Boudard, A; Brunetti, A; Carpinelli, M; Cirrone, G A P; Cortes-Giraldo, M A; Cuttone, G; De Napoli, M; Durante, M; Fernandez-Garcia, J P; Finck, C; Gallardo, M I; Golosio, B; Iarocci, E; Iazzi, F; Ickert, G; Introzzi, R; Juliani, D; Krimmer, J; Kurz, N; Labalme, M; Leifels, Y; Le Fevre, A; Leray, S; Marchetto, F; Monaco, V; Morone, M C; Oliva, P; Paoloni, A; Patera, V; Piersanti, L; Pleskac, R; Quesada, J M; Randazzo, N; Romano, F; Rossi, D; Rosso, V; Rousseau, M; Sacchi, R; Sala, P; Sarti, A; Schuy, C; Sciubba, A; Sfienti, C; Simon, H; Sipala, V; Spiriti, E; Stuttge, L; Tropea, S; Younis, H

2012-01-01

The FIRST (Fragmentation of Ions Relevant for Space and Therapy) experiment at GSI has been designed to study carbon fragmentation, measuring (12)C double differential cross sections (- (2)I /- - E) for different beam energies between 100 and 1000 MeV/u. The experimental setup integrates newly designed detectors in the, so called, Interaction Region around the graphite target. The Interaction Region upstream detectors are a 250 mum thick scintillator and a drift chamber optimized for a precise measurement of the ions interaction time and position on the target. In this article we review the design of the upstream detectors along with the preliminary results of the data taking performed on August 2011 with 400 MeV/u fully stripped carbon ion beam at GSI. Detectors performances will be reviewed and compared to those obtained during preliminary tests, performed with 500 MeV electrons (at the BTF facility in the INFN Frascati Laboratories) and 80 MeV/u protons and carbon ions (at the INFN LNS Laboratories in Cata...

Influence of upstream stator on rotor flutter stability in a low pressure steam turbine stage

Energy Technology Data Exchange (ETDEWEB)

Huang, X.; He, L. [University of Durham (United Kingdom). School of Engineering; Bell, D. [ALSTOM Power Ltd., Rugby (United Kingdom)

2006-07-01

Conventional blade flutter prediction is normally based on an isolated blade row model, however, little is known about the influence of adjacent blade rows. In this article, an investigation is presented into the influence of the upstream stator row on the aero-elastic stability of rotor blades in the last stage of a low pressure (LP) steam turbine. The influence of the upstream blade row is computed directly by a time-marching, unsteady, Navier-Stokes flow solver in a stator-rotor coupled computational domain. The three-dimensional flutter solution is obtained, with adequate mesh resolution, in a single passage domain through application of the Fourier-Transform based Shape-Correction method. The capability of this single-passage method is examined through comparison with predictions obtained from a complete annulus model, and the results demonstrate a good level of accuracy, while achieving a speed up factor of 25. The present work shows that the upstream stator blade row can significantly change the aero-elastic behaviour of an LP steam turbine rotor. Caution is, therefore, advised when using an isolated blade row model for blade flutter prediction. The results presented also indicated that the intra-row interaction is of a strong three-dimensional nature. (author)

Analysis of Microbe-Associated Molecular Pattern-Responsive Synthetic Promoters with the Parsley Protoplast System.

Science.gov (United States)

Kanofsky, Konstantin; Lehmeyer, Mona; Schulze, Jutta; Hehl, Reinhard

2016-01-01

Plants recognize pathogens by microbe-associated molecular patterns (MAMPs) and subsequently induce an immune response. The regulation of gene expression during the immune response depends largely on cis-sequences conserved in promoters of MAMP-responsive genes. These cis-sequences can be analyzed by constructing synthetic promoters linked to a reporter gene and by testing these constructs in transient expression systems. Here, the use of the parsley (Petroselinum crispum) protoplast system for analyzing MAMP-responsive synthetic promoters is described. The synthetic promoter consists of four copies of a potential MAMP-responsive cis-sequence cloned upstream of a minimal promoter and the uidA reporter gene. The reporter plasmid contains a second reporter gene, which is constitutively expressed and hence eliminates the requirement of a second plasmid used as a transformation control. The reporter plasmid is transformed into parsley protoplasts that are elicited by the MAMP Pep25. The MAMP responsiveness is validated by comparing the reporter gene activity from MAMP-treated and untreated cells and by normalizing reporter gene activity using the constitutively expressed reporter gene.

Promoter characterization and genomic organization of the human X11β gene APBA2.

LENUS (Irish Health Repository)

Hao, Yan

2012-02-15

Overexpression of neuronal adaptor protein X11β has been shown to decrease the production of amyloid-β, a toxic peptide deposited in Alzheimer\\'s disease brains. Therefore, manipulation of the X11β level may represent a potential therapeutic strategy for Alzheimer\\'s disease. As X11β expression can be regulated at the transcription level, we determined the genomic organization and the promoter of the human X11β gene, amyloid β A4 precursor protein-binding family A member 2 (APBA2). By RNA ligase-mediated rapid amplification of cDNA ends, a single APBA2 transcription start site and the complete sequence of exon 1 were identified. The APBA2 promoter was located upstream of exon 1 and was more active in neurons. The core promoter contains several CpG dinucleotides, and was strongly suppressed by DNA methylation. In addition, mutagenesis analysis revealed a putative Pax5-binding site within the promoter. Together, APBA2 contains a potent neuronal promoter whose activity may be regulated by DNA methylation and Pax5.

Upstream Structural Management Measures for an Urban Area Flooding in Turkey and their Consequences on Flood Risk Management

Science.gov (United States)

Akyurek, Z.; Bozoglu, B.; Girayhan, T.

2015-12-01

Flooding has the potential to cause significant impacts to economic activities as well as to disrupt or displace populations. Changing climate regimes such as extreme precipitation events increase flood vulnerability and put additional stresses on infrastructure. In this study the flood modelling in an urbanized area, namely Samsun-Terme in Blacksea region of Turkey is done. MIKE21 with flexible grid is used in 2- dimensional shallow water flow modelling. 1/1000 scaled maps with the buildings for the urbanized area and 1/5000 scaled maps for the rural parts are used to obtain DTM needed in the flood modelling. The bathymetry of the river is obtained from additional surveys. The main river passing through the urbanized area has a capacity of Q5 according to the design discharge obtained by simple ungauged discharge estimation depending on catchment area only. The effects of the available structures like bridges across the river on the flooding are presented. The upstream structural measures are studied on scenario basis. Four sub-catchments of Terme River are considered as contributing the downstream flooding. The existing circumstance of the Terme River states that the meanders of the river have a major effect on the flood situation and lead to approximately 35% reduction in the peak discharge between upstream and downstream of the river. It is observed that if the flow from the upstream catchments can be retarded through a detention pond constructed in at least two of the upstream catchments, estimated Q100 flood can be conveyed by the river without overtopping from the river channel. The operation of the upstream detention ponds and the scenarios to convey Q500 without causing flooding are also presented. Structural management measures to address changes in flood characteristics in water management planning are discussed. Flood risk is obtained by using the flood hazard maps and water depth-damage functions plotted for a variety of building types and occupancies

Upstream migration of Pacific lampreys in the John Day River, Oregon: Behavior, timing, and habitat use

Science.gov (United States)

Robinson, T. Craig; Bayer, J.M.

2005-01-01

Adult Pacific lamprey migration and habitat preferences for over-winter holding and spawning, and larval rearing in tributaries to the Columbia River are not well understood. The John Day River is one such tributary where larval and adult stages of this species have been documented, and its free-flowing character provided the opportunity to study migration of Pacific lampreys unimpeded by passage constraints. Forty-two adult Pacific lampreys were captured in the John Day River near its mouth during their upstream migration. Pacific lampreys were surgically implanted with radio transmitters and released onsite, and tracked by fixed-site, aerial, and terrestrial telemetry methods for nearly one year. Adults moved upstream exclusively at night, with a mean rate of 11.1 ?? 6.3 km/day. They halted upstream migration by September, and held a single position for approximately six months in the lateral margins of riffles and glides, using boulders for cover. More than half of Pacific lampreys resumed migration in March before ending movement in early May. Pacific lampreys that resumed migration in spring completed a median of 87% of their upstream migration before over-winter holding. Upon completing migration. Pacific lampreys briefly held position before beginning downstream movement at the end of May. Though not directly observed, halting migration and movement downstream were likely the result of spawning and death. Gains in adult Pacific lamprey passage through the Columbia River hydrosystem and tributaries may be made by improvements that would expedite migration during spring and summer and increase the quantity and variety of cover and refuge opportunities. ?? 2005 by the Northwest Scientific Association. All rights reserved.

Analysis of an osmotically regulated pathogenesis-related osmotin gene promoter.

Science.gov (United States)

Raghothama, K G; Liu, D; Nelson, D E; Hasegawa, P M; Bressan, R A

1993-12-01

Osmotin is a small (24 kDa), basic, pathogenesis-related protein, that accumulates during adaptation of tobacco (Nicotiana tabacum) cells to osmotic stress. There are more than 10 inducers that activate the osmotin gene in various plant tissues. The osmotin promoter contains several sequences bearing a high degree of similarity to ABRE, as-1 and E-8 cis element sequences. Gel retardation studies indicated the presence of at least two regions in the osmotin promoter that show specific interactions with nuclear factors isolated from cultured cells or leaves. The abundance of these binding factors increased in response to salt, ABA and ethylene. Nuclear factors protected a 35 bp sequence of the promoter from DNase I digestion. Different 5' deletions of the osmotin promoter cloned into a promoter-less GUSNOS plasmid (pBI 201) were used in transient expression studies with a Biolistic gun. The transient expression studies revealed the presence of three distinct regions in the osmotin promoter. The promoter sequence from -108 to -248 bp is absolutely required for reporter gene activity, followed by a long stretch (up to -1052) of enhancer-like sequence and then a sequence upstream of -1052, which appears to contain negative elements. The responses to ABA, ethylene, salt, desiccation and wounding appear to be associated with the -248 bp sequence of the promoter. This region also contains a putative ABRE (CACTGTG) core element. Activation of the osmotin gene by various inducers is discussed in view of antifungal activity of the osmotin protein.

Influence of upstream disturbance on the draft-tube flow of Francis turbine under part-load conditions

Science.gov (United States)

Chen, Ting; Zheng, Xianghao; Zhang, Yu-ning; Li, Shengcai

2018-02-01

Owing to the part-load operations for the enhancement of grid flexibility, the Francis turbine often suffers from severe low-frequency and large-amplitude hydraulic instability, which is mostly pertinent to the highly unsteady swirling vortex rope in the draft tube. The influence of disturbances in the upstream (e.g., large-scale vortex structures in the spiral casing) on the draft-tube vortex flow is not well understood yet. In the present paper, the influence of the upstream disturbances on the vortical flow in the draft tube is studied based on the vortex identification method and the analysis of several important parameters (e.g., the swirl number and the velocity profile). For a small guide vane opening (representing the part-load condition), the vortices triggered in the spiral casing propagate downstream and significantly affect the swirling vortex-rope precession in the draft tube, leading to the changes of the intensity and the processional frequency of the swirling vortex rope. When the guide vane opening approaches the optimum one (representing the full-load condition), the upstream disturbance becomes weaker and thus its influences on the downstream flow are very limited.

Isolation of the endosperm-specific LPAAT gene promoter from coconut (Cocos nucifera L.) and its functional analysis in transgenic rice plants.

Science.gov (United States)

Xu, Li; Ye, Rongjian; Zheng, Yusheng; Wang, Zhekui; Zhou, Peng; Lin, Yongjun; Li, Dongdong

2010-09-01

As one of the key tropical crops, coconut (Cocos nucifera L.) is a member of the monocotyledonous family Aracaceae (Palmaceae). In this study, we amplified the upstream region of an endosperm-specific expression gene, Lysophosphatidyl acyltransferase (LPAAT), from the coconut genomic DNA by chromosome walking. In this sequence, we found several types of promoter-related elements including TATA-box, CAAT-box and Skn1-motif. In order to further examine its function, three different 5'-deletion fragments were inserted into pBI101.3, a plant expression vector harboring the LPAAT upstream sequence, leading to pBI101.3-L1, pBI101.3-L2 and pBI101.3-L3, respectively. We obtained transgenic plants of rice by Agrobacterium-mediated callus transformation and plant regeneration and detected the expression of gus gene by histochemical staining and fluorometric determination. We found that gus gene driven by the three deletion fragments was specifically expressed in the endosperm of rice seeds, but not in the empty vector of pBI101.3 and other tissues. The highest expression level of GUS was at 15 DAF in pBI101.3-L3 and pBI101.3-L2 transgenic lines, while the same level was detected at 10 DAF in pBI101.3-L1. The expression driven by the whole fragment was up to 1.76- and 2.8-fold higher than those driven by the -817 bp and -453 bp upstream fragments, and 10.7-fold higher than that driven by the vector without the promoter. Taken together, our results strongly suggest that these promoter fragments from coconut have a significant potential in genetically improving endosperm in main crops.

SAP and life-cycle management in the upstream

International Nuclear Information System (INIS)

Davis, B.

1997-01-01

Business relationships today depend more than ever on changing alliances and partnerships to leverage risk in a commodity market. SAP is a fully integrated, enterprise-wide software system that uses business processes tightly integrated around a common data model to facilitate these business relationships across the oil and gas supply chain. The SAP modules contain the business processes that are needed to handle the logistics and operations maintenance for operating an oil or gas field. Each industry has unique business-process requirements that the core SAP application set may not cover. In the oil and gas business, there are unique financial requirements in the upstream for working in joint ventures. In the downstream business segment, handling bulk hydrocarbons requires additional functionality

BORC Functions Upstream of Kinesins 1 and 3 to Coordinate Regional Movement of Lysosomes along Different Microtubule Tracks.

Science.gov (United States)

Guardia, Carlos M; Farías, Ginny G; Jia, Rui; Pu, Jing; Bonifacino, Juan S

2016-11-15

The multiple functions of lysosomes are critically dependent on their ability to undergo bidirectional movement along microtubules between the center and the periphery of the cell. Centrifugal and centripetal movement of lysosomes is mediated by kinesin and dynein motors, respectively. We recently described a multi-subunit complex named BORC that recruits the small GTPase Arl8 to lysosomes to promote their kinesin-dependent movement toward the cell periphery. Here, we show that BORC and Arl8 function upstream of two structurally distinct kinesin types: kinesin-1 (KIF5B) and kinesin-3 (KIF1Bβ and KIF1A). Remarkably, KIF5B preferentially moves lysosomes on perinuclear tracks enriched in acetylated α-tubulin, whereas KIF1Bβ and KIF1A drive lysosome movement on more rectilinear, peripheral tracks enriched in tyrosinated α-tubulin. These findings establish BORC as a master regulator of lysosome positioning through coupling to different kinesins and microtubule tracks. Common regulation by BORC enables coordinate control of lysosome movement in different regions of the cell. Published by Elsevier Inc.

Promotion and resignation in employee networks

Science.gov (United States)

Yuan, Jia; Zhang, Qian-Ming; Gao, Jian; Zhang, Linyan; Wan, Xue-Song; Yu, Xiao-Jun; Zhou, Tao

2016-02-01

Enterprises have put more and more emphasis on data analysis so as to obtain effective management advices. Managers and researchers are trying to dig out the major factors that lead to employees' promotion and resignation. Most previous analyses are based on questionnaire survey, which usually consists of a small fraction of samples and contains biases caused by psychological defense. In this paper, we successfully collect a data set consisting of all the employees' work-related interactions (action network, AN for short) and online social connections (social network, SN for short) of a company, which inspires us to reveal the correlations between structural features and employees' career development, namely promotion and resignation. Through statistical analysis, we show that the structural features of both AN and SN are correlated and predictive to employees' promotion and resignation, and the AN has higher correlation and predictability. More specifically, the in-degree in AN is the most relevant indicator for promotion, while the k-shell index in AN and in-degree in SN are both very predictive to resignation. Our results provide a novel and actionable understanding of enterprise management and suggest that to enhance the interplays among employees, no matter work-related or social interplays, can be helpful to reduce staffs' turnover risk.

Libraries of Synthetic TALE-Activated Promoters: Methods and Applications.

Science.gov (United States)

Schreiber, T; Tissier, A

2016-01-01

The discovery of proteins with programmable DNA-binding specificities triggered a whole array of applications in synthetic biology, including genome editing, regulation of transcription, and epigenetic modifications. Among those, transcription activator-like effectors (TALEs) due to their natural function as transcription regulators, are especially well-suited for the development of orthogonal systems for the control of gene expression. We describe here the construction and testing of libraries of synthetic TALE-activated promoters which are under the control of a single TALE with a given DNA-binding specificity. These libraries consist of a fixed DNA-binding element for the TALE, a TATA box, and variable sequences of 19 bases upstream and 43 bases downstream of the DNA-binding element. These libraries were cloned using a Golden Gate cloning strategy making them usable as standard parts in a modular cloning system. The broad range of promoter activities detected and the versatility of these promoter libraries make them valuable tools for applications in the fine-tuning of expression in metabolic engineering projects or in the design and implementation of regulatory circuits. © 2016 Elsevier Inc. All rights reserved.

GTPase ROP2 binds and promotes activation of target of rapamycin, TOR, in response to auxin.

Science.gov (United States)

Schepetilnikov, Mikhail; Makarian, Joelle; Srour, Ola; Geldreich, Angèle; Yang, Zhenbiao; Chicher, Johana; Hammann, Philippe; Ryabova, Lyubov A

2017-04-03

Target of rapamycin (TOR) promotes reinitiation at upstream ORFs (uORFs) in genes that play important roles in stem cell regulation and organogenesis in plants. Here, we report that the small GTPase ROP2, if activated by the phytohormone auxin, promotes activation of TOR, and thus translation reinitiation of uORF-containing mRNAs. Plants with high levels of active ROP2, including those expressing constitutively active ROP2 (CA-ROP2), contain high levels of active TOR ROP2 physically interacts with and, when GTP-bound, activates TOR in vitro TOR activation in response to auxin is abolished in ROP-deficient rop2 rop6 ROP4 RNAi plants. GFP-TOR can associate with endosome-like structures in ROP2-overexpressing plants, indicating that endosomes mediate ROP2 effects on TOR activation. CA-ROP2 is efficient in loading uORF-containing mRNAs onto polysomes and stimulates translation in protoplasts, and both processes are sensitive to TOR inhibitor AZD-8055. TOR inactivation abolishes ROP2 regulation of translation reinitiation, but not its effects on cytoskeleton or intracellular trafficking. These findings imply a mode of translation control whereby, as an upstream effector of TOR, ROP2 coordinates TOR function in translation reinitiation pathways in response to auxin. © 2017 The Authors.

A barrier to upstream migration in the fish passage of Itaipu Dam (Canal da Piracema), Paraná River basin

Science.gov (United States)

,; Fontes Júnior, Hélio Martins; Makrakis, Sergio; Gomes, Luiz Carlos; Latini, João Dirço

2012-01-01

The majority of the fish passages built in the Neotropical region are characterised by low efficiency and high selectivity; in many cases, the benefits to fish populations are uncertain. Studies conducted in the Canal da Piracema at Itaipu dam on the Parana River indicate that the system component designated as the Discharge channel in the Bela Vista River (herein named Canal de deságue no rio Bela Vista or CABV), a 200 m long technical section, was the main barrier to the upstream migration. The aim of this study was to evaluate the degree of restriction imposed by the CABV on upstream movements of Prochilodus lineatus and Leporinus elongatus, Characiformes. Fish were tagged with passive integrated transponders (PIT tags) and released both downstream and upstream of this critical section. Individuals of both species released downstream of the CABV took much more time to reach the upper end of the system (43.6 days vs. 15.9 days), and passed in much lower proportions (18% vs. 60.8%) than those tagged upstream of this component. Although more work is needed to differentiate between fishway effects and natural variation in migratory motivation, the results clearly demonstrate passage problems at the CABV.

Three-dimensional vortex flow near the endwall of a short cylinder in crossflow: Uniform-diameter circular cylinder

International Nuclear Information System (INIS)

Chen, S.B.; Sanitjai, S.; Ghosh, K.; Goldstein, R.J.

2012-01-01

Flow characteristics, around a short uniform-diameter circular cylinder in crossflow, are investigated experimentally. Extensive flow visualization using oil-lampblack and smoke-wire methods have been performed. Near-wake velocity measurements have been performed using a hotwire anemometer. Complex secondary flows are observed on and around the cylinder in crossflow. Multiple vortices are observed in the horseshoe vortex system near the cylinder–endwall junction. Based on this flow visualization and local mass transfer measurement results, a six-vortex secondary flow model has been proposed. - Highlights: ► Flow visualizations and velocity measurements for a short circular cylinder. ► Six vortices in the horseshoe vortex system upstream of the base of the cylinder. ► Cross-stream turbulence intensity profiles show a similarity in their shape.

Compressor Stator Time-Variant Aerodynamic Response to Upstream Rotor Wakes.

Science.gov (United States)

1976-11-01

periodic varia t i ons in pressure , velocity and flow direction in the exit field of an upstream element , wh i ch appea r as temporall y vary ing in a...compressor features blad i ng (42 rotor blades and 40 stator vanes , NACA 65 F Series ) that is aerodynamicall y l oaded to levels that are typical of...measurements were accom- — p lished by instrumenting a pair of the NACA Series 65 stator — vanes with flush mounted Ku lite thin -line des i gn dynamic

A nuclear factor I-like activity and a liver-specific repressor govern estrogen-regulated in vitro transcription from the Xenopus laevis vitellogenin B1 promoter.

OpenAIRE

Corthésy, B; Cardinaux, J R; Claret, F X; Wahli, W

1989-01-01

A hormone-controlled in vitro transcription system derived from Xenopus liver nuclear extracts was exploited to identify novel cis-acting elements within the vitellogenin gene B1 promoter region. In addition to the already well-documented estrogen-responsive element (ERE), two elements were found within the 140 base pairs upstream of the transcription initiation site. One of them, a negative regulatory element, is responsible for the lack of promoter activity in the absence of the hormone and...

Functional Characterization of TaSnRK2.8 Promoter in Response to Abiotic Stresses by Deletion Analysis in Transgenic Arabidopsis

Directory of Open Access Journals (Sweden)

Hongying Zhang

2017-07-01

Full Text Available Drought, salinity, and cold are the major factors limiting wheat quality and productivity; it is thus highly desirable to characterize the abiotic-stress-inducible promoters suitable for the genetic improvement of plant resistance. The sucrose non-fermenting 1-related protein kinase 2 (SnRK2 family genes show distinct regulatory properties in response to abiotic stresses. The present study characterized the approximately 3000-bp upstream sequence (the 313 bp upstream of the ATG was the transcription start site of the Triticum aestivum TaSnRK2.8 promoter under abscisic acid (ABA and abiotic stresses. Four different-length 5′ deletion fragments of TaSnRK2.8 promoter were fused with the GUS reporter gene and transformed into Arabidopsis. Tissue expression analysis showed that the TaSnRK2.8 promoter region from position -1481 to -821 contained the stalk-specific elements, and the region from position -2631 to -1481 contained the leaf- and root-specific elements. In the ABA-treated seedlings, the deletion analysis showed that the TaSnRK2.8 promoter region from position -821 to -2631 contained ABA response elements. The abiotic stress responses of the TaSnRK2.8 promoter derivatives demonstrated that they harbored abiotic-stress response elements: the region from position -821 to -408 harbored the osmotic-stress response elements, whereas the region from position -2631 to -1481 contained the positive regulatory motifs and the region from position -1481 to -821 contained the leaf- and stalk-specific enhancers. Further deletion analysis of the promoter region from position -821 to -408 indicated that a 125-bp region from position -693 to -568 was required to induce an osmotic-stress response. These results contribute to a better understanding of the molecular mechanisms of TaSnRK2.8 in response to abiotic stresses, and the TaSnRK2.8 promoter seems to be a candidate for regulating the expression of abiotic stress response genes in transgenic plants.

Duplication of an upstream silencer of FZP increases grain yield in rice.

Science.gov (United States)

Bai, Xufeng; Huang, Yong; Hu, Yong; Liu, Haiyang; Zhang, Bo; Smaczniak, Cezary; Hu, Gang; Han, Zhongmin; Xing, Yongzhong

2017-11-01

Transcriptional silencer and copy number variants (CNVs) are associated with gene expression. However, their roles in generating phenotypes have not been well studied. Here we identified a rice quantitative trait locus, SGDP7 (Small Grain and Dense Panicle 7). SGDP7 is identical to FZP (FRIZZY PANICLE), which represses the formation of axillary meristems. The causal mutation of SGDP7 is an 18-bp fragment, named CNV-18bp, which was inserted ~5.3 kb upstream of FZP and resulted in a tandem duplication in the cultivar Chuan 7. The CNV-18bp duplication repressed FZP expression, prolonged the panicle branching period and increased grain yield by more than 15% through substantially increasing the number of spikelets per panicle (SPP) and slightly decreasing the 1,000-grain weight (TGW). The transcription repressor OsBZR1 binds the CGTG motifs in CNV-18bp and thereby represses FZP expression, indicating that CNV-18bp is the upstream silencer of FZP. These findings showed that the silencer CNVs coordinate a trade-off between SPP and TGW by fine-tuning FZP expression, and balancing the trade-off could enhance yield potential.

MAVEN Observation of an Obliquely Propagating Low-Frequency Wave Upstream of Mars

Science.gov (United States)

Ruhunusiri, Suranga; Halekas, J. S.; Connerney, J. E. P.; Espley, J. R.; McFadden, J. P.; Mazelle, C.; Brain, D.; Collinson, G.; Harada, Y.; Larson, D. E.;

Coordination in the upstream supply chain of the Dutch railway sector : a research agenda

NARCIS (Netherlands)

Schlicher, L.P.J.; Slikker, M.; van Houtum, G.J.J.A.N.; Pombo, J.

2016-01-01

In this paper, we present a research agenda which identifies three research directions for the upstream supply chain of the Dutch railway sector. The first research direction focusses on coordination of spare parts with criticality differences and related allocations of potential cost savings

22 CFR 62.21 - Short-term scholars.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Short-term scholars. 62.21 Section 62.21 Foreign Relations DEPARTMENT OF STATE PUBLIC DIPLOMACY AND EXCHANGES EXCHANGE VISITOR PROGRAM Specific... programs, confer on common problems and projects, and promote professional relationships and communications...

ULF Waves Upstream from Planetary Bow Shocks: Application to the Interball-Tail Observations at the Earth

International Nuclear Information System (INIS)

Trotignon, J.G.; Rauch, J.L.; Klimov, S.; Nozdrachev, M.; Romanov, S.; Savin, S.; Skalsky, A.; Blecki, J.; Juchniewicz, J.; Amata, E.

1999-01-01

One of the outstanding problems in solar system plasma physics is the morphology of planetary and cometary foreshocks. A large variety of electron and ion velocity distribution functions, as well as electrostatic and electromagnetic waves phenomena, are indeed currently observed in these regions located upstream from, and magnetically connected to, bow shocks. Foreshocks being complex and highly dynamic, it is not easy to get a comprehensive description of them. Nevertheless, simple geometrical considerations can be of help to order foreshock structures. In light of the great number of results obtained in planetary foreshocks, which are briefly reviewed, we present an ongoing study of the upstream waves observed by the INTERBALL-TAIL magnetometers in the Ultra Low Frequency range. (author)

Upstream from OPERA: extreme attention to detail

CERN Multimedia

CERN Bulletin

2011-01-01

Two weeks ago, at a seminar held at CERN, the OPERA collaboration revealed their astonishing observation: neutrinos might move faster than light. The finding is currently under scrutiny in the scientific community. While the result downstream at Gran Sasso speaks for itself, upstream at CERN things are no less intriguing, with high-tech GPS systems, novel techniques for accurately measuring the time, and unique ways keeping the initial particle beam stable. Take away one ingredient and the accuracy needed for the final measurement is spoiled.   Underground installations of the CERN Neutrinos to Gran Sasso (CNGS) project. First ingredient: a stable beam CERN produces neutrinos by sending a beam of protons to hit a target. The collisions produce a secondary beam, which mostly consists of pions and kaons that decay in flight within an evacuated tunnel. Their decay products are muons and muon-neutrinos. An absorber stops the pions and kaons that do not decay, while the resulting muons are absorb...

From Worker Health To Citizen Health: Moving Upstream

Science.gov (United States)

Sepulveda, Martin-Jose

2014-01-01

New rapid growth economies, urbanization, health systems crises and “big data” are causing fundamental changes in social structures and systems including health. These forces for change have significant consequences for occupational and environmental medicine and will challenge the specialty to think beyond workers and workplaces as the principal locus of innovation for health and performance. These trends are placing great emphasis on upstream strategies for addressing the complex systems dynamics of the social determinants of health. The need to engage systems in communities for healthier workforces is a shift in orientation from worker and workplace centric to citizen and community centric. This change for occupational and environmental medicine requires extending systems approaches in the workplace to communities which are systems of systems and which require different skills, data, tools and partnerships. PMID:24284749

Ions upstream of the earth's bow shock: a theoretical comparison of alternative source populations

International Nuclear Information System (INIS)

Schwartz, S.J.; Thomsen, M.F.; Gosling, J.T.

1983-01-01

A theoretical framework is developed for studying trajectories of ions reflected or leaked upstream from the earth's bow shock and subject solely to the Lorentz force in a steady interplanetary magnetic field B and the V x B electric field. We include the effects of a sharp shock potential rise. Expressions are derived for the guiding center motion and gyromotion in a frame (the Hoffman-Teller frame) moving parallel to the shock surface with sufficient speed to transform the incident solar wind velocity into motion entirely along the interplanetary magnetic field: the appropriate equations are also provided to transform these motions back to the observer's frame. The utility of these expressions is illustrated by comparing the predicted upstream motions for four different source models for upstream ions: magnetic moment-conserving reflection of the solar wind ions, specular reflection of solar wind ions, magnetic moment-conserving leakage of magnetosheath ions, and leakage of magnetosheath ions parallel to the shock normal. This comparison reveals that, for identical geometries, the reflection models produce higher energies and/or gyromotion than do the leakage models. We further argue that in a single simple encounter with the shock, an ion should behave in an unmagnetized manner and hence should not conserve its magnetic moment. Conservation of magnetic moment, if it is to occur, would seem to require multiple encounters with the shock. We investigate the conditions under which such multiple encounters can occur and find that under most quasi-parallel geometries neither leaked nor reflected ions should probably conserve their magnetic moments

Bidirectional 3.125 Gbps downstream / 2 Gbps upstream impulse radio ultrawide-band (UWB) over combined fiber and wireless link

DEFF Research Database (Denmark)

Jensen, Jesper Bevensee; Gibbon, Timothy Braidwood; Yu, Xianbin

2010-01-01

We demonstrate bidirectional fiber and wireless transmission of impulse radio ultra-wideband at 3.125 Gbps downstream and 2 Gbps upstream. After transmission over 50 km fiber and 1.85 m wireless link both signals are recovered without errors.......We demonstrate bidirectional fiber and wireless transmission of impulse radio ultra-wideband at 3.125 Gbps downstream and 2 Gbps upstream. After transmission over 50 km fiber and 1.85 m wireless link both signals are recovered without errors....

Is it a must to add upstream devices for high GVF multiphase

Energy Technology Data Exchange (ETDEWEB)

Dou, Jianwen; Guo, Jason; Gokulnath, R.

2005-07-01

High accuracies in measurement of the gross liquid and net oil flow rates at high GVF levels in the multiphase flow is identified as one of the most demanding needs of the industry, especially in high water cut environments. The underlying factor that decides the accuracy of the net oil flow rate measurement is the accuracy at which the gross liquid and water cut are measured and the prevailing water cut in the flow. It is an established fact that accuracies falter with increasing GVF in the multiphase flow. The purpose of this paper is to present the performance results of a newly developed Compact High GVF Haimo multiphase meter that addresses the above needs, without having to use an Upstream Separation Device for high GVF application while retaining the accuracies within +2% absolute for water cut and 10% relative for liquid and gas flow rates at 90% confidence level. while also optimising the footprint, the cost, the weight of the solution Further developmental work and trials are in progress to achieve the targeted accuracy levels under very high GVF conditions as well. Contents of the Paper:1) Definitions. 2) MFM 2000 + Upstream Separation Device. 3) Haimo's experience with upstream devices. 4) Motivation to develop the new Compact meter solution. 5) Description of the Compact solution. 6) Performance testing of the Compact solution in a third party test facility. 7) Conclusion and Benefit which are: The objective of working out a new solution for high GVF without having to use a Upstream Separation Device seem to have been achieved with excellent test results; The new configuration of Compact High GVF meter successfully met and exceeded its Acceptance criteria. The main objective was to asses its performance, confirm the quality of the measurements and check its compliance with the Accuracy specifications. The consistency of the absolute error on water cut much lower than 2% for the full range of the GVF and liquid flow rates re-establishes the

Coral-inferred Variability of Upstream Kuroshio Current from 1953-2004 AD

Science.gov (United States)

Li, X.; Yi, L.; Shen, C. C.; Hsin, Y. C.

2016-12-01

The Kuroshio Current (KC), one of the most important western boundary currents in the North Pacific Ocean, strongly impacts regional climate in East Asia and upper-ocean thermal structure. However, the responses of KC to regional and remote climate forcing are poorly understood owing to lacking of long-term KC observations. Here, we present a sea surface temperature (SST) record from 1953 to 2004 AD derived from monthly skeletal δ18O data of a living coral Porites core, drilled in Nanwan, southern Taiwan (22°N, 121°E), located on the western front of the Upstream KC. The increased/reduced Kuroshio transport would generate stronger/weaker upwelling in Southern Taiwan, which can cause lower/higher SST. Agreement between dynamics of interannual coral δ18O and modern KC data shows that the regional coral δ18O can be used as a promising proxy for Upstream KC intensity. The KC-induced SST anomaly record reveals prominent interannual and decadal variability predominantly controlled by the bifurcation latitude of North Equatorial Current. We also find that the reconstructed KC intensity at east of Taiwan and south of Japan have nearly simultaneous interannual changes, suggesting the same dominant forcing(s) for the entire KC system. Additional work is needed to understand the KC system with respect to the interannual to decadal climate variability and the influences of global warming.

Polycyclic aromatic hydrocarbons in upstream riverine runoff of the Pearl River Delta, China: An assessment of regional input sources

International Nuclear Information System (INIS)

Zhang Kai; Liang Bo; Wang Jizhong; Guan Yufeng; Zeng, Eddy Y.

2012-01-01

Water samples collected from upstream tributaries of the Pearl River Delta (PRD) and from locations within the PRD (South China) were analyzed for 27 polycyclic aromatic hydrocarbons (PAHs). Average concentrations (aqueous plus particulate) of total 27 PAHs (Σ 27 PAH), 16 priority PAHs designated by the United States Environmental Protection Agency (USEPA) except naphthalene (Σ 15 PAH), and the seven carcinogenic PAHs (Σ 7 PAH) classified by the USEPA were 260 ± 410, 130 ± 310, and 15 ± 12 ng/L, respectively. Riverine PAHs were predominantly generated from coal and vegetation combustion, coke production, vehicle exhausts, and petroleum residues, accounting for 28%, 25%, 22% and 21%, respectively, on average. Upstream riverine fluxes of Σ 27 PAH and Σ 15 PAH amounted to 38.9 and 12.9 tons/year, respectively. The net contributions of Σ 27 PAH and Σ 15 PAH from sources within the PRD were estimated at 21.4 and 21.0 tons/year, respectively. - Highlights: ► Upstream PAH levels were lower than downstream PAHs and pose low ecological risk. ► Riverine PAHs are predominantly pyrogenic. ► Parent PAHs in Pearl River are mainly derived from within the PRD. ► The 15 priority PAHs were mainly generated within the Pearl River Delta. - The 15 priority PAHs are mainly generated within the PRD while the other 12 PAHs from upstream areas.

Combined effect of upstream surge chamber and sloping ceiling tailrace tunnel on dynamic performance of turbine regulating system of hydroelectric power plant

International Nuclear Information System (INIS)

Guo, Wencheng; Yang, Jiandong

2017-01-01

Highlights: • Nonlinear mathematical model and Hopf bifurcation analysis of turbine regulating system are presented. • Dynamic performance of turbine regulating system under 0.5 times Thoma sectional area is analyzed and a novel dynamic performance is revealed. • Relationship between two bifurcation lines and wave superposition is studied. • Combined effect mechanisms of upstream surge chamber and sloping ceiling tailrace tunnel on stability are revealed and optimization methods are proposed. - Abstract: Based on the nonlinear mathematical model of the turbine regulating system of hydroelectric power plant with upstream surge chamber and sloping ceiling tailrace tunnel and the Hopf bifurcation theory, this paper firstly studies the dynamic performance of the turbine regulating system under 0.5 times Thoma sectional area of surge chamber, and reveals a novel dynamic performance. Then, the relationship between the two bifurcation lines and the wave superposition of upstream surge chamber and sloping ceiling tailrace tunnel is analyzed. Finally, the effect mechanisms of the wave superposition on the system stability are investigated, and the methods to improve the system stability are proposed. The results indicate that: Under the combined effect of upstream surge chamber and sloping ceiling tailrace tunnel, the dynamic performance of the turbine regulating system of hydroelectric power plant shows an obvious difference on the two sides of the critical sectional area of surge chamber. There are two bifurcation lines for the condition of 0.5 times Thoma sectional area, i.e. Bifurcation line 1 and Bifurcation line 2, which represent the stability characteristics of the flow oscillation of “penstock-sloping ceiling tailrace tunnel” and the water-level fluctuation in upstream surge chamber, respectively. The stable domain of the system is determined by Bifurcation line 2. The effect of upstream surge chamber mainly depends on its sectional area, while the

INDIRECT UPSTREAM EFFECTS OF DAMS: CONSEQUENCES OF MIGRATORY CONSUMER EXTIRPATION IN PUERTO RICO

Science.gov (United States)

EFFIE A. GREATHOUSE; CATHERINE M. PRINGLE; WILLIAM H. MCDOWELL; JEFF G. HOLMQUIST

2006-01-01

Large dams degrade the integrity of a wide variety of ecosystems, yet direct downstream effects of dams have received the most attention from ecosystem managers and researchers. We investigated indirect upstream effects of dams resulting from decimation of migratory freshwater shrimp and fish populations in Puerto Rico, USA, in both high- and low-gradient streams. In...

A Tourist-like MITE insertion in the upstream region of the BnFLC.A10 gene is associated with vernalization requirement in rapeseed (Brassica napus L.).

Science.gov (United States)

Hou, Jinna; Long, Yan; Raman, Harsh; Zou, Xiaoxiao; Wang, Jing; Dai, Shutao; Xiao, Qinqin; Li, Cong; Fan, Longjiang; Liu, Bin; Meng, Jinling

2012-12-15

Rapeseed (Brassica napus L.) has spring and winter genotypes adapted to different growing seasons. Winter genotypes do not flower before the onset of winter, thus leading to a longer vegetative growth period that promotes the accumulation and allocation of more resources to seed production. The development of winter genotypes enabled the rapeseed to spread rapidly from southern to northern Europe and other temperate regions of the world. The molecular basis underlying the evolutionary transition from spring- to winter- type rapeseed is not known, however, and needs to be elucidated. We fine-mapped the spring environment specific quantitative trait locus (QTL) for flowering time, qFT10-4,in a doubled haploid (DH) mapping population of rapeseed derived from a cross between Tapidor (winter-type) and Ningyou7 (semi-winter) and delimited the qFT10-4 to an 80-kb region on chromosome A10 of B. napus. The BnFLC.A10 gene, an ortholog of FLOWERING LOCUS C (FLC) in Arabidopsis, was cloned from the QTL. We identified 12 polymorphic sites between BnFLC.A10 parental alleles of the TN-DH population in the upstream region and in intron 1. Expression of both BnFLC.A10 alleles decreased during vernalization, but decreased more slowly in the winter parent Tapidor. Haplotyping and association analysis showed that one of the polymorphic sites upstream of BnFLC.A10 is strongly associated with the vernalization requirement of rapeseed (r2 = 0.93, χ2 = 0.50). This polymorphic site is derived from a Tourist-like miniature inverted-repeat transposable element (MITE) insertion/deletion in the upstream region of BnFLC.A10. The MITE sequence was not present in the BnFLC.A10 gene in spring-type rapeseed, nor in ancestral 'A' genome species B. rapa genotypes. Our results suggest that the insertion may have occurred in winter rapeseed after B. napus speciation. Our findings strongly suggest that (i) BnFLC.A10 is the gene underlying qFT10-4, the QTL for phenotypic diversity of flowering time in

Enhancement of axial momentum lost to the radial wall by the upstream magnetic field in a helicon source

Science.gov (United States)

Takahashi, Kazunori; Ando, Akira

2017-05-01

Individual measurements of forces exerted to an upstream back wall, a radial source wall, and a magnetic field of a helicon plasma thruster, which has two solenoids upstream and downstream of a radiofrequency antenna, are precisely measured. Two different structures of magnetic field lines in the source are tested, where the solenoid current is supplied to either only the downstream solenoid or to both the solenoids. It is observed that the high density plasma exists upstream of the rf antenna when both the solenoids are powered, while the maximum density exists near the rf antenna when only the downstream solenoid is powered. Although the force exerted to the back wall is increased for the two solenoids case, the axial momentum lost to the radial wall is simultaneously enhanced; then the total force exerted to the whole structure of the thruster is found to be very similar for the two magnetic field configurations. It is shown that the individual force measurement provides useful information on the plasma momentum interacting with the physical boundaries and the magnetic fields.

Identification and functional characterisation of the promoter of the calcium sensor gene CBL1 from the xerophyte Ammopiptanthus mongolicus

Directory of Open Access Journals (Sweden)

Yin Weilun

2010-01-01

Full Text Available Abstract Background CBL1 is a calcium sensor that regulates drought, cold and salt signals in Arabidopsis. Overexpression of CBL1 gene in Arabidopsis and in Ammopiptanthus mongolicus showed different tolerant activities. We are interested in understanding the molecular mechanism of the upstream region of the CBL1 gene of A. mongolicus (AmCBL1. We investigated and characterized the promoter of the AmCBL1 gene, for promoters play a very important role in regulating gene expression in eukaryotes. Results A 1683-bp 5' flanking region was isolated from A. mongolicus. The sequence was identified as AmCBL1 promoter. Analysis of the promoter sequence indicated a 690-bp intron and some basic cis-acting elements were related to various environmental stresses and plant hormones. To identify the functional region of the AmCBL1 promoter, five plant expression vectors fused with the GUS (β-glucuronidase gene, driven by series deleted fragments of AmCBL1 promoter at different lengths from -1659, -1414, -1048, -296 to -167 bp relative to the transcriptional start site were constructed and transformed into Nicotiana tabacum L. cv. 89. Functional properties of each promoter segment were examined by GUS staining and fluorescence quantitative analyses using at least three single-copy PCR-positive plants of transgenic tobacco, treated with various environmental stresses and plant hormones for different times. We demonstrated that the AmCBL1 promoter was a vascular-specific and multiple-stress-inducible promoter. Our results further imply that the promoter fragment B1S3 possessed sufficient essential cis-acting elements, accounting for vascular-specific and stress-induced expression patterns. It may also indicate that for response to some stresses certain cis-elements are required in tissues outside the region of the B1S3 construct. Conclusions To help resolve uncertainties about the upstream regulatory mechanism of the CBL1 gene in desert plants, we suggest that

Downstream Antisense Transcription Predicts Genomic Features That Define the Specific Chromatin Environment at Mammalian Promoters.

Directory of Open Access Journals (Sweden)

Christopher A Lavender

2016-08-01

Full Text Available Antisense transcription is a prevalent feature at mammalian promoters. Previous studies have primarily focused on antisense transcription initiating upstream of genes. Here, we characterize promoter-proximal antisense transcription downstream of gene transcription starts sites in human breast cancer cells, investigating the genomic context of downstream antisense transcription. We find extensive correlations between antisense transcription and features associated with the chromatin environment at gene promoters. Antisense transcription downstream of promoters is widespread, with antisense transcription initiation observed within 2 kb of 28% of gene transcription start sites. Antisense transcription initiates between nucleosomes regularly positioned downstream of these promoters. The nucleosomes between gene and downstream antisense transcription start sites carry histone modifications associated with active promoters, such as H3K4me3 and H3K27ac. This region is bound by chromatin remodeling and histone modifying complexes including SWI/SNF subunits and HDACs, suggesting that antisense transcription or resulting RNA transcripts contribute to the creation and maintenance of a promoter-associated chromatin environment. Downstream antisense transcription overlays additional regulatory features, such as transcription factor binding, DNA accessibility, and the downstream edge of promoter-associated CpG islands. These features suggest an important role for antisense transcription in the regulation of gene expression and the maintenance of a promoter-associated chromatin environment.

Genomic organization and identification of promoter regions for the BDNF gene in the pond turtle Trachemys scripta elegans.

Science.gov (United States)

Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce

2014-08-01

Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.

Cloning and characterization of the human integrin β6 gene promoter.

Directory of Open Access Journals (Sweden)

Mingyan Xu

Full Text Available The integrin β6 (ITGB6 gene, which encodes the limiting subunit of the integrin αvβ6 heterodimer, plays an important role in wound healing and carcinogenesis. The mechanism underlying ITGB6 regulation, including the identification of DNA elements and cognate transcription factors responsible for basic transcription of human ITGB6 gene, remains unknown. This report describes the cloning and characterization of the human ITGB6 promoter. Using 5'-RACE (rapid amplification of cDNA ends analysis, the transcriptional initiation site was identified. Promoter deletion analysis identified and functionally validated a TATA box located in the region -24 to -18 base pairs upstream of the ITGB6 promoter. The regulatory elements for transcription of the ITGB6 gene were predominantly located -289 to -150 from the ITGB6 promoter and contained putative binding sites for transcription factors such as STAT3 and C/EBPα. Using chromatin immunoprecipitation assays, this study has demonstrated, for the first time, that transcription factors STAT3 and C/EBPα are involved in the positive regulation of ITGB6 transcription in oral squamous cell carcinoma cells. These findings have important implications for unraveling the mechanism of abnormal ITGB6 activation in tissue remodeling and tumorigenesis.

Teduglutide for the treatment of short bowel syndrome

DEFF Research Database (Denmark)

Jeppesen, P B

2013-01-01

Glucagon-like peptide 2 (GLP-2) decreases gastric and intestinal motility, reduces gastric secretions, promotes intestinal growth and improves post-resection structural and functional adaptation in short bowel syndrome (SBS). Teduglutide, an analogue of GLP-2, has a prolonged half-life and provides...

Multiple regulatory mechanisms of hepatocyte growth factor expression in malignant cells with a short poly(dA) sequence in the HGF gene promoter.

Science.gov (United States)

Sakai, Kazuko; Takeda, Masayuki; Okamoto, Isamu; Nakagawa, Kazuhiko; Nishio, Kazuto

2015-01-01

Hepatocyte growth factor (HGF) expression is a poor prognostic factor in various types of cancer. Expression levels of HGF have been reported to be regulated by shorter poly(dA) sequences in the promoter region. In the present study, the poly(dA) mononucleotide tract in various types of human cancer cell lines was examined and compared with the HGF expression levels in those cells. Short deoxyadenosine repeat sequences were detected in five of the 55 cell lines used in the present study. The H69, IM95, CCK-81, Sui73 and H28 cells exhibited a truncated poly(dA) sequence in which the number of poly(dA) repeats was reduced by ≥5 bp. Two of the cell lines exhibited high HGF expression, determined by reverse transcription quantitative polymerase chain reaction and enzyme-linked immunosorbent assay. The CCK-81, Sui73 and H28 cells with shorter poly(dA) sequences exhibited low HGF expression. The cause of the suppression of HGF expression in the CCK-81, Sui73 and H28 cells was clarified by two approaches, suppression by methylation and single nucleotide polymorphisms in the HGF gene. Exposure to 5-Aza-dC, an inhibitor of DNA methyltransferase 1, induced an increased expression of HGF in the CCK-81 cells, but not in the other cells. Single-nucleotide polymorphism (SNP) rs72525097 in intron 1 was detected in the Sui73 and H28 cells. Taken together, it was found that the defect of poly(dA) in the HGF promoter was present in various types of cancer, including lung, stomach, colorectal, pancreas and mesothelioma. The present study proposes the negative regulation mechanisms by methylation and SNP in intron 1 of HGF for HGF expression in cancer cells with short poly(dA).

Routine versus aggressive upstream rhythm control for prevention of early atrial fibrillation in heart failure : background, aims and design of the RACE 3 study

NARCIS (Netherlands)

Alings, M.; Smit, M. D.; Moes, M. L.; Crijns, H. J. G. M.; Tijssen, J. G. P.; Brugemann, J.; Hillege, H. L.; Lane, D. A.; Lip, G. Y. H.; Smeets, J. R. L. M.; Tieleman, R. G.; Tukkie, R.; Willems, F. F.; Vermond, R. A.; Van Veldhuisen, D. J.; Van Gelder, I. C.

Rhythm control for atrial fibrillation (AF) is cumbersome because of its progressive nature caused by structural remodelling. Upstream therapy refers to therapeutic interventions aiming to modify the atrial substrate, leading to prevention of AF. The Routine versus Aggressive upstream rhythm Control

Routine versus aggressive upstream rhythm control for prevention of early atrial fibrillation in heart failure: background, aims and design of the RACE 3 study

NARCIS (Netherlands)

Alings, M.; Smit, M. D.; Moes, M. L.; Crijns, H. J. G. M.; Tijssen, J. G. P.; Brügemann, J.; Hillege, H. L.; Lane, D. A.; Lip, G. Y. H.; Smeets, J. R. L. M.; Tieleman, R. G.; Tukkie, R.; Willems, F. F.; Vermond, R. A.; van Veldhuisen, D. J.; van Gelder, I. C.

2013-01-01

Rhythm control for atrial fibrillation (AF) is cumbersome because of its progressive nature caused by structural remodelling. Upstream therapy refers to therapeutic interventions aiming to modify the atrial substrate, leading to prevention of AF. The Routine versus Aggressive upstream rhythm Control

The X-linked 1.688 Satellite in Drosophila melanogaster Promotes Specific Targeting by Painting of Fourth.

Science.gov (United States)

Kim, Maria; Ekhteraei-Tousi, Samaneh; Lewerentz, Jacob; Larsson, Jan

2018-02-01

Repetitive DNA, represented by transposons and satellite DNA, constitutes a large portion of eukaryotic genomes, being the major component of constitutive heterochromatin. There is a growing body of evidence that it regulates several nuclear functions including chromatin state and the proper functioning of centromeres and telomeres. The 1.688 satellite is one of the most abundant repetitive sequences in Drosophila melanogaster , with the longest array being located in the pericentromeric region of the X-chromosome. Short arrays of 1.688 repeats are widespread within the euchromatic part of the X-chromosome, and these arrays were recently suggested to assist in recognition of the X-chromosome by the dosage compensation male-specific lethal complex. We discovered that a short array of 1.688 satellite repeats is essential for recruitment of the protein POF to a previously described site on the X-chromosome ( PoX2 ) and to various transgenic constructs. On an isolated target, i.e. , an autosomic transgene consisting of a gene upstream of 1.688 satellite repeats, POF is recruited to the transgene in both males and females. The sequence of the satellite, as well as its length and position within the recruitment element, are the major determinants of targeting. Moreover, the 1.688 array promotes POF targeting to the roX1 -proximal PoX1 site in trans Finally, binding of POF to the 1.688-related satellite-enriched sequences is conserved in evolution. We hypothesize that the 1.688 satellite functioned in an ancient dosage compensation system involving POF targeting to the X-chromosome. Copyright © 2018 by the Genetics Society of America.

Assessment of whether upstream passage for Lake Sturgeon is needed at the Pointe du Bois Generating Station (Winnipeg River)

International Nuclear Information System (INIS)

Pratt, T.

2010-01-01

This document reviewed Manitoba Hydro's proposal to modernize the Pointe du Bois Generating Station (GS) on the Winnipeg River, with particular reference to the potential impacts on Lake Sturgeon in Management Unit 5 (MU5) where large numbers of the fish spawn at the base of the falls. The modernization will involve replacing the spillway, dam segments and replacing or repairing the powerhouse. The pros and cons of providing upstream fish passage for Lake Sturgeon and the generating station were outlined. The only spawning area in the MU5 area may be altered considerably due to changes in water flow, depending on the design chosen for modernization. A potential benefit of providing upstream fish passage for Lake Sturgeon would be to increase genetic diversity within the Winnipeg River. Another potential benefit would be to allow Lake Sturgeon, from the relatively dense population below the GS, to move upstream into MU4 where unfilled habitat may be available and Lake Sturgeon abundance is lower. A potential disadvantage of providing fish passage would be the loss of individual Lake Sturgeon from the healthy population in MU5 with no accompanying benefit to MU4. There would be no net gain to MU4 or MU5 if migrating Lake Sturgeon returned to MU5 rather than proceeding upstream. It was concluded that these current gaps in knowledge must be filled in order to fully assess the environmental impacts. 2 figs.

Real-time mobile customer short message system design and implementation

Science.gov (United States)

Han, Qirui; Sun, Fang

To expand the current mobile phone short message service, and to make the contact between schools, teachers, parents and feedback of the modern school office system more timely and conveniently, designed and developed the Short Message System based on the Linux platform. The state-of-the-art principles and designed proposals in the Short Message System based on the Linux platform are introduced. Finally we propose an optimized secure access authentication method. At present, many schools,vbusinesses and research institutions ratify the promotion and application the messaging system gradually, which has shown benign market prospects.

Upstream oil and gas. Subsector no. 7: Oil and gas exploration and development 1995 to 1999

Energy Technology Data Exchange (ETDEWEB)

NONE

2000-08-01

Prepared by the Alberta Human Resources and Employment, this report provides a summary of the lost-time injuries and disease descriptions of workers injured while employed in the upstream oil and gas industries in Alberta during the period 1995 to 1999. The report includes the characteristics of the injured worker and the risk of injury to workers in the industries in Alberta, as well as the cost of injuries and revenue by means of total premiums paid by the employers. The occupational fatalities that were accepted by the Workers Compensation Board and investigated by the Occupational Health and Safety were summarized in the report along with a brief description of the injuries. The aim was to provide information concerning health and safety issues to government, employers, workers, and health and safety officers in the industries in Alberta about health and safety issues. The focus was placed on the oil and gas exploration and development sub-sector. Defined as all upstream oil field activities of employers which generate revenue from the production and sale of crude oil and/or natural gas, the sub-sector comprises major integrated oil and gas companies and small independent producers. In those cases where the owner/producer operates its own upstream production/processing facilities, they form an integral part of this sub-section. In addition, oil and gas marketing firms are included. Oil/gas well, well head equipment; flow lines/gathering systems tied into field processing facilities; battery sites/compressors stations; crude oil separators and natural gas dehydrators/treaters; natural gas/sulfur processing plants; heavy oil projects including steam generation; and other enhanced recovery methods are all included in the sub-sector. The other sub-sectors in the upstream oil and gas industries are: exploration, oilfield maintenance and construction, well servicing with service rigs and power swivels, drilling of oil and gas wells, oilfield downhole and other

Chandra's Observations of Jupiter's X-Ray Aurora During Juno Upstream and Apojove Intervals

Science.gov (United States)

Jackman, C.M.; Dunn, W.; Kraft, R.; Gladstone, R.; Branduardi-Raymont, G.; Knigge, C.; Altamirano, D.; Elsner, R.

2017-01-01

The Chandra space telescope has recently conducted a number of campaigns to observe Jupiter's X-ray aurora. The first set of campaigns took place in summer 2016 while the Juno spacecraft was upstream of the planet sampling the solar wind. The second set of campaigns took place in February, June and August 2017 at times when the Juno spacecraft was at apojove (expected close to the magnetopause). We report on these upstream and apojove campaigns including intensities and periodicities of auroral X-ray emissions. This new era of jovian X-ray astronomy means we have more data than ever before, long observing windows (up to 72 kiloseconds for this Chandra set), and successive observations relatively closely spaced in time. These features combine to allow us to pursue novel methods for examining periodicities in the X-ray emission. Our work will explore significance testing of emerging periodicities, and the search for coherence in X-ray pulsing over weeks and months, seeking to understand the robustness and regularity of previously reported hot spot X-ray emissions. The periods that emerge from our analysis will be compared against those which emerge from radio and UV wavelengths.

Ecological risk assessment of microcystin-LR in the upstream section of the Haihe River based on a species sensitivity distribution model.

Science.gov (United States)

Niu, Zhiguang; Du, Lei; Li, Jiafu; Zhang, Ying; Lv, Zhiwei

2018-02-01

The eutrophication of surface water has been the main problem of water quality management in recent decades, and the ecological risk of microcystin-LR (MC-LR), which is the by-product of eutrophication, has drawn more attention worldwide. The aims of our study were to determine the predicted no effect concentration (PNEC) of MC-LR and to assess the ecological risk of MC-LR in the upstream section of the Haihe River. HC 5 (hazardous concentration for 5% of biological species) and PNEC were obtained from a species sensitivity distribution (SSD) model, which was constructed with the acute toxicity data of MC-LR on aquatic organisms. The concentrations of MC-LR in the upstream section of the Haihe River from April to August of 2015 were analysed, and the ecological risk characteristics of MC-LR were evaluated based on the SSD model. The results showed that the HC 5 of MC-LR in freshwater was 17.18 μg/L and PNEC was 5.73 μg/L. The concentrations of MC-LR ranged from 0.68 μg/L to 32.21 μg/L and were obviously higher in summer than in spring. The values of the risk quotient (RQ) ranged from 0.12 to 5.62, suggesting that the risk of MC-LR for aquatic organisms in the river was at a medium or high level during the study period. Compared with other waterbodies in the world, the pollution level of MC-LR in the Haihe River was at a moderate level. This research could promote the study of the ecological risk of MC-LR at the ecosystem level. Copyright © 2017 Elsevier Ltd. All rights reserved.

On the upstream boundary of electron foreshocks in the solar wind

International Nuclear Information System (INIS)

Zimbardo, G.; Veltri, P.

1996-01-01

The backstreaming of electrons from planetary and interplanetary shocks creates foreshocks of fast particles propagating along the magnetic field. The effect of low frequency magnetic fluctuations is to create both a broadening and a fine structure of the foreshock upstream boundary. This is studied by means of a newly developed 3-D numerical simulation of turbulent magnetic fields. Applications to the Earth and to the termination shock electron foreshocks are done, and some implications on the observations of the spreading and of the bursty structure of the foreshocks are discussed

Electromagnetic ion beam instability upstream of the earth's bow shock

International Nuclear Information System (INIS)

Gary, S.P.; Gosling, J.T.; Forslund, D.W.

1981-01-01

The linear theory of the electromagnetic ion beam instability for arbitrary angles of propagation has been studied. The parameters considered in the theory are typical of the solar wind upstream of the earth's bow shock when a 'reflected' proton beam is present. Maximum growth occurs for propagation parallel to the ambient field B, but this instability also displays significant growth at wave-vectors oblique to B, Oblique, unstable modes seem to be the likely source of the compressive magnetic fluctuations recently observed in conjunction with 'diffuse' ion population. An energetic ion beam does not directly give rise to linear growth of either ion acoustic or whistler mode instabilities

FOXA1 promotes tumor cell proliferation through AR involving the Notch pathway in endometrial cancer

International Nuclear Information System (INIS)

Qiu, Meiting; Bao, Wei; Wang, Jingyun; Yang, Tingting; He, Xiaoying; Liao, Yun; Wan, Xiaoping

2014-01-01

Increasing evidence suggests that forkhead box A1 (FOXA1) is frequently dysregulated in many types of human cancers. However, the exact function and mechanism of FOXA1 in human endometrial cancer (EC) remains unclear. FOXA1 expression, androgen receptor (AR) expression, and the relationships of these two markers with clinicopathological factors were determined by immunohistochemistry analysis. FOXA1 and AR were up-regulated by transient transfection with plasmids, and were down-regulated by transfection with siRNA or short hairpin RNA (shRNA). The effects of FOXA1 depletion and FOXA1 overexpression on AR-mediated transcription as well as Notch pathway and their impact on EC cell proliferation were examined by qRT-PCR, western blotting, co-immunoprecipitation, ChIP-PCR, MTT, colony-formation, and xenograft tumor–formation assays. We found that the expression of FOXA1 and AR in ECs was significantly higher than that in a typical hyperplasia and normal tissues. FOXA1 expression was significantly correlated with AR expression in clinical tissues. High FOXA1 levels positively correlated with pathological grade and depth of myometrial invasion in EC. High AR levels also positively correlated with pathological grade in EC. Moreover, the expression of XBP1, MYC, ZBTB16, and UHRF1, which are downstream targets of AR, was promoted by FOXA1 up-regulation or inhibited by FOXA1 down-regulation. Co-immunoprecipitation showed that FOXA1 interacted with AR in EC cells. ChIP-PCR assays showed that FOXA1 and AR could directly bind to the promoter and enhancer regions upstream of MYC. Mechanistic investigation revealed that over-expression of Notch1 and Hes1 proteins by FOXA1 could be reversed by AR depletion. In addition, we showed that down-regulation of AR attenuated FOXA1-up-regulated cell proliferation. However, AR didn’t influence the promotion effect of FOXA1 on cell migration and invasion. In vivo xenograft model, FOXA1 knockdown reduced the rate of tumor growth. These

Engineered Promoters for Potent Transient Overexpression.

Directory of Open Access Journals (Sweden)

Dan Y Even

Full Text Available The core promoter, which is generally defined as the region to which RNA Polymerase II is recruited to initiate transcription, plays a pivotal role in the regulation of gene expression. The core promoter consists of different combinations of several short DNA sequences, termed core promoter elements or motifs, which confer specific functional properties to each promoter. Earlier studies that examined the ability to modulate gene expression levels via the core promoter, led to the design of strong synthetic core promoters, which combine different core elements into a single core promoter. Here, we designed a new core promoter, termed super core promoter 3 (SCP3, which combines four core promoter elements (the TATA box, Inr, MTE and DPE into a single promoter that drives prolonged and potent gene expression. We analyzed the effect of core promoter architecture on the temporal dynamics of reporter gene expression by engineering EGFP expression vectors that are driven by distinct core promoters. We used live cell imaging and flow cytometric analyses in different human cell lines to demonstrate that SCPs, particularly the novel SCP3, drive unusually strong long-term EGFP expression. Importantly, this is the first demonstration of long-term expression in transiently transfected mammalian cells, indicating that engineered core promoters can provide a novel non-viral strategy for biotechnological as well as gene-therapy-related applications that require potent expression for extended time periods.

Water stress in global transboundary river basins : Significance of upstream water use on downstream stress

NARCIS (Netherlands)

Munia, H.; Guillaume, J. H A; Mirumachi, N.; Porkka, M.; Wada, Y.|info:eu-repo/dai/nl/341387819; Kummu, M.

2016-01-01

Growing population and water demand have increased pressure on water resources in various parts of the globe, including many transboundary river basins. While the impacts of upstream water use on downstream water availability have been analysed in many of these international river basins, this has

Routine versus aggressive upstream rhythm control for prevention of early atrial fibrillation in heart failure: background, aims and design of the RACE 3 study.

Science.gov (United States)

Alings, M; Smit, M D; Moes, M L; Crijns, H J G M; Tijssen, J G P; Brügemann, J; Hillege, H L; Lane, D A; Lip, G Y H; Smeets, J R L M; Tieleman, R G; Tukkie, R; Willems, F F; Vermond, R A; Van Veldhuisen, D J; Van Gelder, I C

2013-07-01

Rhythm control for atrial fibrillation (AF) is cumbersome because of its progressive nature caused by structural remodelling. Upstream therapy refers to therapeutic interventions aiming to modify the atrial substrate, leading to prevention of AF. The Routine versus Aggressive upstream rhythm Control for prevention of Early AF in heart failure (RACE 3) study hypothesises that aggressive upstream rhythm control increases persistence of sinus rhythm compared with conventional rhythm control in patients with early AF and mild-to-moderate early systolic or diastolic heart failure undergoing electrical cardioversion. RACE 3 is a prospective, randomised, open, multinational, multicenter trial. Upstream rhythm control consists of angiotensin converting enzyme inhibitors and/or angiotensin receptor blockers, mineralocorticoid receptor antagonists, statins, cardiac rehabilitation therapy, and intensive counselling on dietary restrictions, exercise maintenance, and drug adherence. Conventional rhythm control consists of routine rhythm control therapy without cardiac rehabilitation therapy and intensive counselling. In both arms, every effort is made to keep patients in the rhythm control strategy, and ion channel antiarrhythmic drugs or pulmonary vein ablation may be instituted if AF relapses. Total inclusion will be 250 patients. If upstream therapy proves to be effective in improving maintenance of sinus rhythm, it could become a new approach to rhythm control supporting conventional pharmacological and non-pharmacological rhythm control.

Hydrodynamic response of fuel rod with longitudinal fins to upstream generated vortices

International Nuclear Information System (INIS)

Naot, D.; Oron, A.; Technion-Israel Inst. of Tech., Haifa. Dept. of Mechanical Engineering)

1984-01-01

The hydrodynamic response of turbulent channel flow to upstream generated vortices was numerically simulated for fuel element with longitudinal cooling fins. Turbulence is modelled by an algebraic stress model and an energy-dissipation model. The developing flow is solved using a parabolic pressure correction algorithm. The decay of the initial vortices in non-circular sub-channel in the presence of geometry driven secondary currents is described and the uncertainty in the local turbulent shear stresses is discussed. (orig.)

The bZIP transcription factor HY5 interacts with the promoter of the monoterpene synthase gene QH6 in modulating its rhythmic expression.

Science.gov (United States)

Zhou, Fei; Sun, Tian-Hu; Zhao, Lei; Pan, Xi-Wu; Lu, Shan

2015-01-01

The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site) which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA), we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS) transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD) and constant dark (DD) conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC) driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.

Flow control in s-shaped air intake diffuser of gas turbine using proposed energy promoters

Directory of Open Access Journals (Sweden)

Jessam Raed A.

2017-01-01

Full Text Available This paper presents an experimental and numerical investigation of the flow control in an air intake S-shaped diffuser with and without energy promoters. The S-shaped diffuser had an area ratio 3.1and turning angle of 45°/45°. The proposed energy promoter was named as stream line sheet energy promoter. Computational Fluid Dynamics simulation was performed through commercial ANSYS-FLUENT 16.2 software. The measurements were made inside annular subsection, 45° from 360° of the complete annular shape of the diffuser, at Reynolds number 5.8×104 and turbulence intensity 4.1%. Results for the bare S-shaped diffuser (without energy promoters showed the flow structures within the S-shaped diffuser were dominated by counter-rotating vortices and boundary layer separation especially in the outer surface. The combination of the adverse pressure gradient at the first bend of outer surface and upstream low momentum wakes caused the boundary layer to separate early. The combinations of proposed energy promoters were installed on the inner and outer surfaces at three installation planes. The use of energy promoters resulting in significantly decreased the outer surface boundary layer separation with consequential improving the static pressure coefficient and reduction of total pressure losses

The role of upstream sequences in selecting the reading frame on tmRNA

Directory of Open Access Journals (Sweden)

Dewey Jonathan D

2008-06-01

Full Text Available Abstract Background tmRNA acts first as a tRNA and then as an mRNA to rescue stalled ribosomes in eubacteria. Two unanswered questions about tmRNA function remain: how does tmRNA, lacking an anticodon, bypass the decoding machinery and enter the ribosome? Secondly, how does the ribosome choose the proper codon to resume translation on tmRNA? According to the -1 triplet hypothesis, the answer to both questions lies in the unique properties of the three nucleotides upstream of the first tmRNA codon. These nucleotides assume an A-form conformation that mimics the codon-anticodon interaction, leading to recognition by the decoding center and choice of the reading frame. The -1 triplet hypothesis is important because it is the most credible model in which direct binding and recognition by the ribosome sets the reading frame on tmRNA. Results Conformational analysis predicts that 18 triplets cannot form the correct structure to function as the -1 triplet of tmRNA. We tested the tmRNA activity of all possible -1 triplet mutants using a genetic assay in Escherichia coli. While many mutants displayed reduced activity, our findings do not match the predictions of this model. Additional mutagenesis identified sequences further upstream that are required for tmRNA function. An immunoblot assay for translation of the tmRNA tag revealed that certain mutations in U85, A86, and the -1 triplet sequence result in improper selection of the first codon and translation in the wrong frame (-1 or +1 in vivo. Conclusion Our findings disprove the -1 triplet hypothesis. The -1 triplet is not required for accommodation of tmRNA into the ribosome, although it plays a minor role in frame selection. Our results strongly disfavor direct ribosomal recognition of the upstream sequence, instead supporting a model in which the binding of a separate ligand to A86 is primarily responsible for frame selection.

PENGUASAAN KERAJAAN TARUMANEGARA TERHADAP KAWASAN HULU CI SADANE THE CONTROL OF TARUMANEGARA KINGDOM TO THE CI SADANE UPSTREAM AREA

Directory of Open Access Journals (Sweden)

Endang Widyastuti

2016-06-01

Full Text Available ABSTRACT As we know that the oldest kingdom in West Java is the Kingdom Tarumanegara. Authentic evidence of the existence of such is the kingdom of seven inscriptions, of which five were found in the upstream region is now administratively Cisadane including Bogor regency. Three of the five inscriptions indicate the possession of territory by Tarumanegara kingdom. This indicates that the upstream region Cisadane is an area that is quite important and has the potential to be controlled by Tarumanegara.   Key words:upstream of Ci Sadane, Tarumanegara kingdom, control area   ABSTRAK Sebagaimana diketahui bahwa kerajaan tertua di Jawa Barat adalah Kerajaan Tarumanegara. Bukti otentik mengenai keberadaan kerajaan tersebut adalah adanya tujuh prasasti, yang lima diantaranya ditemukan di kawasan Hulu Cisadane yang sekarang secara administratif termasuk wilayah Kabupaten Bogor. Tiga diantara kelima prasasti tersebut menunjukkan penguasaan wilayah tersebut oleh Kerajaan Tarumanegara. Hal ini mengindikasikan bahwa kawasan hulu cisadane merupakan kawasan yang cukup penting dan mempunyai potensi yang harus dikuasai oleh Tarumanegara.   Kata Kunci:hulu Ci Sadane, Kerajaan Tarumanegara, penguasaan wilayah.

Peripheral kisspeptin reverses short photoperiod-induced gonadal regression in Syrian hamsters by promoting GNRH release

DEFF Research Database (Denmark)

Ansel, L; Bentsen, A H; Ancel, C

2011-01-01

In seasonal breeders, reproduction is synchronised by day length via the pineal hormone melatonin. In short winter days (short day, SD), the Syrian hamster displays a complete gonadal atrophy together with a marked reduction in expression of kisspeptins (Kp), a family of potent hypothalamic stimu...

Buzz words in the upstream

International Nuclear Information System (INIS)

Knoll, B.

1998-01-01

Examples of misleading or misunderstood 'buzz' words that are prevalent in modern upstream technology are illustrated. The terms underbalanced drilling, horizontal wells, and geo-steering, which were unheard of in the early 1980s, have become key 'buzz' words in modern exploitation terminology. The terms are not only misused, but the technologies themselves are frequently mis-applied as shown by the frequency of economic failures, or less than optimal technical successes which have occurred when these technologies have been employed. Two examples, 'horizontal drilling' and 'geosteering', are used to illustrate the point. With regard to horizontal drilling, many oil field professionals consider it as merely a more advanced method of directional drilling. This represents a serious, yet common, misconception. In truth, horizontal wells are not just an altered drilling process, but a fundamental change in exploitation technology. A more appropriate definition would be that a horizontal well is an enhanced oil recovery process, clearly implying a relationship to the exploitation benefit potential of horizontal wells. The other term, 'geo-steering' refers to defining, generating and monitoring a wellpath on geology rather than geometry. It, too, is frequently misused in the technical media. The term is also misrepresented by implying that it is applicable only to the horizontal section of a well, which in fact is far from the truth. To counter these misconceptions, the paper provides appropriate definitions for each of these terms, and defines the conditions under which the techniques themselves are most appropriately used. 7 figs

Evaluation of synthetic rainfall application with respect to the flow volume at upstream Brantas watershed, East Java Province of Indonesia

Directory of Open Access Journals (Sweden)

Limantara Lily Montarcih

2017-12-01

Full Text Available Indonesian Technical Implementation Unit (UPT of Synthetic Rainfall has modified climate by generating synthetic rainfall from 9th May until 4th June 2013. This unit has cooperated with the Department of Technological Study and Application (BPPT of Indonesia and Perum Jasa Tirta I and TNI AU Lanud Abdulrachman Saleh. This study intended to increase reservoirs water level in upstream Brantas watershed, one of them is Sutami reservoir. Successive grade evaluation of synthetic rainfall used the method of Double Ratio and Flow Discharge. The target area is upstream Brantas watershed that is represented by 12 rainfall stations and the control area is in the distance of ±30 km from the boundary of upstream Brantas watershed and is represented by 5 rainfall stations. Results show rainfall increasing by 152.05% according to the Double Ratio method and the increase of flow discharge from Sutami reservoir by 74.19% according to the Flow Discharge method.

Investigation of the Impact of the Upstream Induction Zone on LIDAR Measurement Accuracy for Wind Turbine Control Applications using Large-Eddy Simulation

International Nuclear Information System (INIS)

Simley, Eric; Pao, Lucy Y; Gebraad, Pieter; Churchfield, Matthew

2014-01-01

Several sources of error exist in lidar measurements for feedforward control of wind turbines including the ability to detect only radial velocities, spatial averaging, and wind evolution. This paper investigates another potential source of error: the upstream induction zone. The induction zone can directly affect lidar measurements and presents an opportunity for further decorrelation between upstream wind and the wind that interacts with the rotor. The impact of the induction zone is investigated using the combined CFD and aeroelastic code SOWFA. Lidar measurements are simulated upstream of a 5 MW turbine rotor and the true wind disturbances are found using a wind speed estimator and turbine outputs. Lidar performance in the absence of an induction zone is determined by simulating lidar measurements and the turbine response using the aeroelastic code FAST with wind inputs taken far upstream of the original turbine location in the SOWFA wind field. Results indicate that while measurement quality strongly depends on the amount of wind evolution, the induction zone has little effect. However, the optimal lidar preview distance and circular scan radius change slightly due to the presence of the induction zone

Promoters of Escherichia coli versus promoter islands: function and structure comparison.

Directory of Open Access Journals (Sweden)

Valeriy V Panyukov

Full Text Available Expression of bacterial genes takes place under the control of RNA polymerase with exchangeable σ-subunits and multiple transcription factors. A typical promoter region contains one or several overlapping promoters. In the latter case promoters have the same or different σ-specificity and are often subjected to different regulatory stimuli. Genes, transcribed from multiple promoters, have on average higher expression levels. However, recently in the genome of Escherichia coli we found 78 regions with an extremely large number of potential transcription start points (promoter islands, PIs. It was shown that all PIs interact with RNA polymerase in vivo and are able to form transcriptionally competent open complexes both in vitro and in vivo but their transcriptional activity measured by oligonucleotide microarrays was very low, if any. Here we confirmed transcriptional defectiveness of PIs by analyzing the 5'-end specific RNA-seq data, but showed their ability to produce short oligos (9-14 bases. This combination of functional properties indicated a deliberate suppression of transcriptional activity within PIs. According to our data this suppression may be due to a specific conformation of the DNA double helix, which provides an ideal platform for interaction with both RNA polymerase and the histone-like nucleoid protein H-NS. The genomic DNA of E.coli contains therefore several dozen sites optimized by evolution for staying in a heterochromatin-like state. Since almost all promoter islands are associated with horizontally acquired genes, we offer them as specific components of bacterial evolution involved in acquisition of foreign genetic material by turning off the expression of toxic or useless aliens or by providing optimal promoter for beneficial genes. The putative molecular mechanism underlying the appearance of promoter islands within recipient genomes is discussed.

Competitive Reactions and the Cross-Sales Effects of Advertising and Promotion

NARCIS (Netherlands)

J-B.E.M. Steenkamp (Jan-Benedict); V.R. Nijs; D.M. Hanssens (Dominique); M.G. Dekimpe (Marnik)

2002-01-01

textabstractHow do competitors react to each other's price-promotion and advertising actions? How do these reactions influence the net sales impact we observe? We answer these questions by performing a large-scale empirical study of the short-run and long-run reactions to promotion and advertising

Identification of putative regulatory motifs in the upstream regions of co-expressed functional groups of genes in Plasmodium falciparum

Directory of Open Access Journals (Sweden)

Joshi NV

2009-01-01

Full Text Available Abstract Background Regulation of gene expression in Plasmodium falciparum (Pf remains poorly understood. While over half the genes are estimated to be regulated at the transcriptional level, few regulatory motifs and transcription regulators have been found. Results The study seeks to identify putative regulatory motifs in the upstream regions of 13 functional groups of genes expressed in the intraerythrocytic developmental cycle of Pf. Three motif-discovery programs were used for the purpose, and motifs were searched for only on the gene coding strand. Four motifs – the 'G-rich', the 'C-rich', the 'TGTG' and the 'CACA' motifs – were identified, and zero to all four of these occur in the 13 sets of upstream regions. The 'CACA motif' was absent in functional groups expressed during the ring to early trophozoite transition. For functional groups expressed in each transition, the motifs tended to be similar. Upstream motifs in some functional groups showed 'positional conservation' by occurring at similar positions relative to the translational start site (TLS; this increases their significance as regulatory motifs. In the ribonucleotide synthesis, mitochondrial, proteasome and organellar translation machinery genes, G-rich, C-rich, CACA and TGTG motifs, respectively, occur with striking positional conservation. In the organellar translation machinery group, G-rich motifs occur close to the TLS. The same motifs were sometimes identified for multiple functional groups; differences in location and abundance of the motifs appear to ensure different modes of action. Conclusion The identification of positionally conserved over-represented upstream motifs throws light on putative regulatory elements for transcription in Pf.

Sales promotions and food consumption.

Science.gov (United States)

Hawkes, Corinna

2009-06-01

Sales promotions are widely used to market food to adults, children, and youth. Yet, in contrast to advertising, practically no attention has been paid to their impacts on dietary behaviors, or to how they may be used more effectively to promote healthy eating. This review explores the available literature on the subject. The objective is to identify if and what literature exists, examine the nature of this literature, and analyze what can be learned from it about the effects of sales promotions on food consumption. The review finds that while sales promotions lead to significant sales increases over the short-term, this does not necessarily lead to changes in food-consumption patterns. Nevertheless, there is evidence from econometric modeling studies indicating that sales promotions can influence consumption patterns by influencing the purchasing choices of consumers and encouraging them to eat more. These effects depend on the characteristics of the food product, sales promotion, and consumer. The complexity of the effects means that sales promotions aiming to encourage consumption of nutritious foods need to be carefully designed. These conclusions are based on studies that use mainly sales data as a proxy for dietary intake. The nutrition (and economics) research communities should add to this existing body of research to provide evidence on the impact of sales promotions on dietary intake and related behaviors. This would help support the development of a sales promotion environment conducive to healthy eating.

Statistical handbook for Canada's upstream petroleum industry: '96 updates

International Nuclear Information System (INIS)

1997-01-01

The Statistical Handbook of CAPP is an annual compilation of useful information about the Canadian petroleum and natural gas industry. It has been published since 1955, and is a key source of upstream petroleum statistics. It presents a historical summary of the petroleum industry''s progress and provides detailed statistical information on the production and consumption of petroleum, petroleum products, natural gas and natural gas liquids, imports and exports, land sales, pipelines, reserves, drilling and refinery activities, and prices in Canada. The information, mostly in tabular form, is based on the latest available data (generally up to and including 1996). For the first time in 1997, the Handbook is also made available in CD-ROM format (EXCEL 5.0). Plans are also underway to publish the Handbook on a secure site on the Internet

Competitive Reactions to Advertising and Promotion Attacks

OpenAIRE

Jan-Benedict E. M. Steenkamp; Vincent R. Nijs; Dominique M. Hanssens; Marnik G. Dekimpe

2005-01-01

How do competitors react to each other's price-promotion and advertising attacks? What are the reasons for the observed reaction behavior? We answer these questions by performing a large-scale empirical study on the short-run and long-run reactions to promotion and advertising shocks in over 400 consumer product categories over a four-year time span. Our results clearly show that the most predominant form of competitive response is passive in nature. When a reaction does occur, it is usually ...

In vivo identification of promoter elements and transcription factors mediating activation of hepatic HMG-CoA reductase by T{sub 3}

Energy Technology Data Exchange (ETDEWEB)

Boone, Lindsey R.; Niesen, Melissa I. [Department of Molecular Medicine, College of Medicine, University of South Florida, Tampa, FL (United States); Jaroszeski, Mark [Department of Chemical and Biomedical Engineering, College of Engineering, University of South Florida, Tampa, FL (United States); Ness, Gene C., E-mail: gness@hsc.usf.edu [Department of Molecular Medicine, College of Medicine, University of South Florida, Tampa, FL (United States)

2009-07-31

The promoter elements and transcription factors necessary for triiodothyronine (T{sub 3}) induction of hepatic HMG-CoA reductase (HMGR) were investigated by transfecting rat livers with wild type and mutant HMGR promoter-luciferase constructs using in vivo electroporation. Mutations in the sterol response element (SRE), nuclear factor-y (NF-Y) site, and the newly identified upstream transcription factor-2 (USF-2) site essentially abolished the T{sub 3} response. Chromatin immunoprecipitation (ChIP) analysis demonstrated that T{sub 3} treatment caused a 4-fold increase in in vivo binding of USF-2 to the HMGR promoter. Co-transfection of the wild type HMGR promoter with siRNAs to USF-2, SREBP-2, or NF-Y nearly abolished the T{sub 3} induction, as measured by promoter activity. These data provide in vivo evidence for functional roles for USF-2, SREBP-2, and NF-Y in mediating the T{sub 3}-induction of hepatic HMGR transcription.

Short bowel syndrome.

LENUS (Irish Health Repository)

Donohoe, Claire L

2012-02-01

The short bowel syndrome (SBS) is a state of malabsorption following intestinal resection where there is less than 200 cm of intestinal length. The management of short bowel syndrome can be challenging and is best managed by a specialised multidisciplinary team. A good understanding of the pathophysiological consequences of resection of different portions of the small intestine is necessary to anticipate and prevent, where possible, consequences of SBS. Nutrient absorption and fluid and electrolyte management in the initial stages are critical to stabilisation of the patient and to facilitate the process of adaptation. Pharmacological adjuncts to promote adaptation are in the early stages of development. Primary restoration of bowel continuity, if possible, is the principle mode of surgical treatment. Surgical procedures to increase the surface area of the small intestine or improve its function may be of benefit in experienced hands, particularly in the paediatric population. Intestinal transplant is indicated at present for patients who have failed to tolerate long-term parenteral nutrition but with increasing experience, there may be a potentially expanded role for its use in the future.

Conserved upstream open reading frames in higher plants

Directory of Open Access Journals (Sweden)

Schultz Carolyn J

2008-07-01

Full Text Available Abstract Background Upstream open reading frames (uORFs can down-regulate the translation of the main open reading frame (mORF through two broad mechanisms: ribosomal stalling and reducing reinitiation efficiency. In distantly related plants, such as rice and Arabidopsis, it has been found that conserved uORFs are rare in these transcriptomes with approximately 100 loci. It is unclear how prevalent conserved uORFs are in closely related plants. Results We used a homology-based approach to identify conserved uORFs in five cereals (monocots that could potentially regulate translation. Our approach used a modified reciprocal best hit method to identify putative orthologous sequences that were then analysed by a comparative R-nomics program called uORFSCAN to find conserved uORFs. Conclusion This research identified new genes that may be controlled at the level of translation by conserved uORFs. We report that conserved uORFs are rare (

Shape and shear guide sperm cells spiraling upstream

Science.gov (United States)

Kantsler, Vasily; Dunkel, Jorn; Goldstein, Raymond E.

2014-11-01

A major puzzle in biology is how mammalian sperm determine and maintain the correct swimming direction during the various phases of the sexual reproduction process. Currently debated mechanisms for sperm long range travel vary from peristaltic pumping to temperature sensing (thermotaxis) and direct response to fluid flow (rheotaxis), but little is known quantitatively about their relative importance. Here, we report the first quantitative experimental study of mammalian sperm rheotaxis. Using microfluidic devices, we investigate systematically the swimming behavior of human and bull sperm over a wide range of physiologically relevant shear rates and viscosities. Our measurements show that the interplay of fluid shear, steric surface-interactions and chirality of the flagellar beat leads to a stable upstream spiraling motion of sperm cells, thus providing a generic and robust rectification mechanism to support mammalian fertilization. To rationalize these findings, we identify a minimal mathematical model that is capable of describing quantitatively the experimental observations.

Identification of a novel temperature sensitive promoter in cho cells

Directory of Open Access Journals (Sweden)

Hesse Friedemann

2011-05-01

Full Text Available Abstract Background The Chinese hamster ovary (CHO expression system is the leading production platform for manufacturing biopharmaceuticals for the treatment of numerous human diseases. Efforts to optimize the production process also include the genetic construct encoding the therapeutic gene. Here we report about the successful identification of an endogenous highly active gene promoter obtained from CHO cells which shows conditionally inducible gene expression at reduced temperature. Results Based on CHO microarray expression data abundantly transcribed genes were selected as potential promoter candidates. The S100a6 (calcyclin and its flanking regions were identified from a genomic CHO-K1 lambda-phage library. Computational analyses showed a predicted TSS, a TATA-box and several TFBSs within the 1.5 kb region upstream the ATG start signal. Various constructs were investigated for promoter activity at 37°C and 33°C in transient luciferase reporter gene assays. Most constructs showed expression levels even higher than the SV40 control and on average a more than two-fold increase at lower temperature. We identified the core promoter sequence (222 bp comprising two SP1 sites and could show a further increase in activity by duplication of this minimal sequence. Conclusions This novel CHO promoter permits conditionally high-level gene expression. Upon a shift to 33°C, a two to three-fold increase of basal productivity (already higher than SV40 promoter is achieved. This property is of particular advantage for a process with reduced expression during initial cell growth followed by the production phase at low temperature with a boost in expression. Additionally, production of toxic proteins becomes feasible, since cell metabolism and gene expression do not directly interfere. The CHO S100a6 promoter can be characterized as cold-shock responsive with the potential for improving process performance of mammalian expression systems.

A Tourist-like MITE insertion in the upstream region of the BnFLC.A10 gene is associated with vernalization requirement in rapeseed (Brassica napus L.

Directory of Open Access Journals (Sweden)

Hou Jinna

2012-12-01

Full Text Available Abstract Background Rapeseed (Brassica napus L. has spring and winter genotypes adapted to different growing seasons. Winter genotypes do not flower before the onset of winter, thus leading to a longer vegetative growth period that promotes the accumulation and allocation of more resources to seed production. The development of winter genotypes enabled the rapeseed to spread rapidly from southern to northern Europe and other temperate regions of the world. The molecular basis underlying the evolutionary transition from spring- to winter- type rapeseed is not known, however, and needs to be elucidated. Results We fine-mapped the spring environment specific quantitative trait locus (QTL for flowering time, qFT10-4,in a doubled haploid (DH mapping population of rapeseed derived from a cross between Tapidor (winter-type and Ningyou7 (semi-winter and delimited the qFT10-4 to an 80-kb region on chromosome A10 of B. napus. The BnFLC.A10 gene, an ortholog of FLOWERING LOCUS C (FLC in Arabidopsis, was cloned from the QTL. We identified 12 polymorphic sites between BnFLC.A10 parental alleles of the TN-DH population in the upstream region and in intron 1. Expression of both BnFLC.A10 alleles decreased during vernalization, but decreased more slowly in the winter parent Tapidor. Haplotyping and association analysis showed that one of the polymorphic sites upstream of BnFLC.A10 is strongly associated with the vernalization requirement of rapeseed (r2 = 0.93, χ2 = 0.50. This polymorphic site is derived from a Tourist-like miniature inverted-repeat transposable element (MITE insertion/deletion in the upstream region of BnFLC.A10. The MITE sequence was not present in the BnFLC.A10 gene in spring-type rapeseed, nor in ancestral ‘A’ genome species B. rapa genotypes. Our results suggest that the insertion may have occurred in winter rapeseed after B. napus speciation. Conclusions Our findings strongly suggest that (i BnFLC.A10 is the gene underlying qFT10

PATTERNS AND TOURIST ACTIVITIES INDUCED BY THE UNDERGROUND RIVERS AND LAKES IN THE ARIEŞ BASIN UPSTREAM OF BURU

Directory of Open Access Journals (Sweden)

Marius CIGHER

2011-11-01

Full Text Available Patterns and tourist activities induced by the underground rivers and lakes in the Arieş basin upstream of Buru – The presence of carbonate deposits in the Arieş basin, upstream of Buru induced certain organization of groundwater resources. Depending on local genetic factors – geological, climatic, biotic, temporal, etc – the extension and characteristics of karst aquifers engenders exploitable hydro units in terms of tourism: underground rivers and lakes. Identification and analysis of morphometrical, morphological, quantitative, qualitative, dynamic and biotic characteristics have provided the approach to ranking the hydro entities. Forms and tourism activities are subsumed to the established typological categories: recreational and pleasure tourism and multipurpose tourism.

THE ACTUAL CONDITIONS OF WETLANDS FROM THE UPSTREAM OF HĂRPĂŞEŞETI RIVER (BAHLUI HYDROGRAPHICAL BASIN

Directory of Open Access Journals (Sweden)

Gheorghe Romanescu

2005-10-01

Full Text Available The Hărpăşeşti river is a right side affluent of the Bahluieţ river. It junctions with the latter in the river-collecting “market” from near Podu Iloaiei. The physico-chemical analysis conducted in the waters and the marshes of the creek relieve an increase of the content of dissolved salts and of the water chemical content as we advance upstream, as a consequence of the fact that these salts are transported from the upstream hydrographical basin. The temperature is higher in the low waters, and the dissolved oxygen has a higher importance in the waters with high depths, lower temperatures and rare aquatic vegetation.

Alternative promoter usage generates novel shorter MAPT mRNA transcripts in Alzheimer's disease and progressive supranuclear palsy brains.

Science.gov (United States)

Huin, Vincent; Buée, Luc; Behal, Hélène; Labreuche, Julien; Sablonnière, Bernard; Dhaenens, Claire-Marie

2017-10-03

Alternative promoter usage is an important mechanism for transcriptome diversity and the regulation of gene expression. Indeed, this alternative usage may influence tissue/subcellular specificity, protein translation and function of the proteins. The existence of an alternative promoter for MAPT gene was considered for a long time to explain differential tissue specificity and differential response to transcription and growth factors between mRNA transcripts. The alternative promoter usage could explain partly the different tau proteins expression patterns observed in tauopathies. Here, we report on our discovery of a functional alternative promoter for MAPT, located upstream of the gene's second exon (exon 1). By analyzing genome databases and brain tissue from control individuals and patients with Alzheimer's disease or progressive supranuclear palsy, we identified novel shorter transcripts derived from this alternative promoter. These transcripts are increased in patients' brain tissue as assessed by 5'RACE-PCR and qPCR. We suggest that these new MAPT isoforms can be translated into normal or amino-terminal-truncated tau proteins. We further suggest that activation of MAPT's alternative promoter under pathological conditions leads to the production of truncated proteins, changes in protein localization and function, and thus neurodegeneration.

Defective distal regulatory element at the 5' upstream of rat prolactin gene of steroid-nonresponsive GH-subclone.

Science.gov (United States)

Kumar, V; Wong, D T; Pasion, S G; Biswas, D K

1987-12-08

The prolactin-nonproducing (PRL-) GH cell strains (rat pituitary tumor cells in culture). GH12C1 and F1BGH12C1, do not respond to steroid hormones estradiol or hydrocortisone (HC). However, the stimulatory effect of estradiol and the inhibitory effect of hydrocortisone on prolactin synthesis can be demonstrated in the prolactin-producing GH cell strain, GH4C1. In this investigation we have examined the 5' end flanking region of rat prolactin (rat PRL) gene of steroid-responsive, GH4C1 cells to identify the positive and negative regulatory elements and to verify the status of these elements in steroid-nonresponsive F1BGH12C1 cells. Results presented in this report demonstrate that the basel level expression of the co-transferred Neo gene (neomycin phosphoribosyl transferase) is modulated by the distal upstream regulatory elements of rat PRL gene in response to steroid hormones. The expression of adjacent Neo gene is inhibited by dexamethasone and is stimulated by estradiol in transfectants carrying distal regulatory elements (SRE) of steroid-responsive cells. These responses are not observed in transfectants with the rat PRL upstream sequences derived from steroid-nonresponsive cells. The basal level expression of the host cell alpha-2 tubulin gene is not affected by dexamethasone. We report here the identification of the distal steroid regulatory element (SRE) located between 3.8 and 7.8 kb upstream of the transcription initiation site of rat PRL gene. Both the positive and the negative effects of steroid hormones can be identified within this upstream sequence. This distal SRE appears to be nonfunctional in steroid-nonresponsive cells. Though the proximal SRE is functional, the defect in the distal SRE makes the GH substrain nonresponsive to steroid hormones. These results suggest that both the proximal and the distal SREs are essential for the mediation of action of steroid hormones in GH cells.

Promoter activity of polypyrimidine tract-binding protein genes of potato responds to environmental cues.

Science.gov (United States)

Butler, Nathaniel M; Hannapel, David J

2012-12-01

Polypyrimidine tract-binding (PTB) proteins are RNA-binding proteins that target specific RNAs for post-transcriptional processing by binding cytosine/uracil motifs. PTBs have established functions in a range of RNA processes including splicing, translation, stability and long-distance transport. Six PTB-like genes identified in potato have been grouped into two clades based on homology to other known plant PTBs. StPTB1 and StPTB6 are closely related to a PTB protein discovered in pumpkin, designated CmRBP50, and contain four canonical RNA-recognition motifs. CmRBP50 is expressed in phloem tissues and functions as the core protein of a phloem-mobile RNA/protein complex. Sequence from the potato genome database was used to clone the upstream sequence of these two PTB genes and analyzed to identify conserved cis-elements. The promoter of StPTB6 was enriched for regulatory elements for light and sucrose induction and defense. Upstream sequence of both PTB genes was fused to β-glucuronidase and monitored in transgenic potato lines. In whole plants, the StPTB1 promoter was most active in leaf veins and petioles, whereas StPTB6 was most active in leaf mesophyll. Both genes are active in new tubers and tuber sprouts. StPTB6 expression was induced in stems and stolon sections in response to sucrose and in leaves or petioles in response to light, heat, drought and mechanical wounding. These results show that CmRBP50-like genes of potato exhibit distinct expression patterns and respond to both developmental and environmental cues.

Deletion of SNURF/SNRPN U1B and U1B* upstream exons in a ...

Indian Academy of Sciences (India)

RESEARCH ARTICLE. Deletion of SNURF/SNRPN U1B and U1B* upstream exons in a child ... whereby genes are expressed in a parent-of-origin dependent manner. One of the ... lity, neurodevelopmental delay, features of attention deficit hyperactivity .... Received 16 December 2015; accepted 8 January 2016. Unedited ...

Suspension, abandonment, decontamination, and surface land reclamation of upstream oil and gas facilities : informational letter IL 98-2

International Nuclear Information System (INIS)

1998-01-01

This release of the Alberta Energy and Utilities Board (EUB) is intended to clarify the jurisdictional roles of Alberta Environmental Protection (AEP) and the EUB with regard to their respective responsibilities for the regulation of the suspension, abandonment, decontamination and surface land reclamation of active and inactive upstream oil and gas facilities. The EUB, AEP and industrial operators all have separate roles and responsibilities when active and inactive upstream facilities are suspended or reclaimed. In the future, industry operators will have more interaction with the AEP during the decontamination of a site, while the EUB will concentrate on pollution prevention and abandonment of non-economic facilities. All oilfield waste generated from suspension, abandonment, decontamination, and surface land reclamation of an active or inactive upstream oil and gas facility will fall under the jurisdiction of the EUB. Contaminated soils, sludges, and waters that are physically removed as a result of decontamination activities are considered to be oilfield wastes. The regulatory responsibility between the AEP and the EUB remains unchanged for the reclamation process of on-lease and off-lease spills, releases or pipeline breaks. Industry operators are no longer allowed to discharge any produced liquid to earthen pits or ponds and are encouraged to reclaim existing ones. 3 figs

A numerical study on the flow upstream of a wind turbine on complex terran

DEFF Research Database (Denmark)

Meyer Forsting, Alexander Raul; Bechmann, Andreas; Troldborg, Niels

2016-01-01

The interaction of a wind turbine with the upstream flow-field in complex and flat terrain is studied using Reynolds-averaged Navier-Stokes (RANS) simulations with a two equation turbulence closure. The complex site modelled is Perdigao (Portugal), where a turbine is located on one of two parallel...... the wind turbine wake trajectory which in turn governs the orientation of the induction zone...

Expression in Arabidopsis of a nucellus-specific promoter from watermelon (Citrullus lanatus).

Science.gov (United States)

Dwivedi, Krishna K; Roche, Dominique; Carman, John G

2010-11-01

Though many tissue-specific promoters have been identified, few have been associated specifically with the angiospermous megasporangium (nucellus). In the present study the 2000-bp regulatory region upstream to the watermelon, Citrullus lanatus (Thunb.) Matsum & Nakai, gene WM403 (GenBank accession no. AF008925), which shows nucellus-specific expression, was cloned from watermelon gDNA and fused to the β-glucuronidase reporter gene (GUS). The resulting plasmid, WM403 Prom::GUS(+), which also contained NPTII, was transformed into Arabidopsis thaliana ecotype Co1-0. Seedlings were selected on kanamycin-containing medium, and transformants were confirmed by PCR. GUS assays of T(3) transformants revealed weak promoter activation in epidermal layers of the placenta and locule septum during premeiotic ovule development but strong activation in the nucellus, embryo sac and early embryo, from early embryo sac formation to early globular embryo formation. Expression in seeds was absent thereafter. These results indicate that the WM403 promoter may be useful in driving nucellus-specific gene expression in plants including candidate genes for important nucellus-specific traits such as apospory or adventitious embryony. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

Exploiting nucleotide composition to engineer promoters.

Directory of Open Access Journals (Sweden)

Manfred G Grabherr

Full Text Available The choice of promoter is a critical step in optimizing the efficiency and stability of recombinant protein production in mammalian cell lines. Artificial promoters that provide stable expression across cell lines and can be designed to the desired strength constitute an alternative to the use of viral promoters. Here, we show how the nucleotide characteristics of highly active human promoters can be modelled via the genome-wide frequency distribution of short motifs: by overlapping motifs that occur infrequently in the genome, we constructed contiguous sequence that is rich in GC and CpGs, both features of known promoters, but lacking homology to real promoters. We show that snippets from this sequence, at 100 base pairs or longer, drive gene expression in vitro in a number of mammalian cells, and are thus candidates for use in protein production. We further show that expression is driven by the general transcription factors TFIIB and TFIID, both being ubiquitously present across cell types, which results in less tissue- and species-specific regulation compared to the viral promoter SV40. We lastly found that the strength of a promoter can be tuned up and down by modulating the counts of GC and CpGs in localized regions. These results constitute a "proof-of-concept" for custom-designing promoters that are suitable for biotechnological and medical applications.

Measurements of energy spectra of fast electrons from PF-1000 in the upstream and downstream directions

Energy Technology Data Exchange (ETDEWEB)

Kwiatkowski, R.; Czaus, K.; Skladnik-Sadowska, E.; Malinowski, K.; Zebrowski, J. [The Andrzej Soltan Institute for Nuclear Studies (IPJ), 05-400 Otwock-Swierk (Poland); Sadowski, M.J. [The Andrzej Soltan Institute for Nuclear Studies (IPJ), 05-400 Otwock-Swierk (Poland); Karpinski, L.; Paduch, M.; Scholz, M. [Institute of Plasma Physics and Laser Microfusion (IPPLM), 01-497 Warsaw (Poland); Kubes, P. [Czech Technical University (CVUT), 166-27 Prague, (Czech Republic)

2011-07-01

The paper describes measurements of energy spectra of electrons emitted in the upstream direction along the symmetry-axis of the PF-1000 facility, operated with the deuterium filling at 21 kV, 290 kJ. The measurements were performed with a magnetic analyzer. The same analyzer was used to measure also electron beams emitted in along the symmetry-axis in the downstream direction. The recorded spectra showed that the electron-beams emitted in the upstream direction have energies in the range from about 40 keV to about 800 keV, while those in the downstream direction have energies in the range from about 60 keV to about 200 keV. These spectra confirm that in the PF (Plasma Focus) plasma column there appear strong local fields accelerating charged particles in different directions. This document is composed of a paper and a poster. (authors)

A novel polymorphic repeat in the upstream regulatory region of the estrogen-induced gene EIG121 is not associated with the risk of developing breast or endometrial cancer.

Science.gov (United States)

Bolton, Katherine A; Holliday, Elizabeth G; Attia, John; Bowden, Nikola A; Avery-Kiejda, Kelly A; Scott, Rodney J

2016-05-26

The estrogen-induced gene 121 (EIG121) has been associated with breast and endometrial cancers, but its mechanism of action remains unknown. In a genome-wide search for tandem repeats, we found that EIG121 contains a short tandem repeat (STR) in its upstream regulatory region which has the potential to alter gene expression. The presence of this STR has not previously been analysed in relation to breast or endometrial cancer risk. In this study, the lengths of this STR were determined by PCR, fragment analysis and sequencing using DNA from 223 breast cancer patients, 204 endometrial cancer patients and 220 healthy controls to determine if they were associated with the risk of developing breast or endometrial cancer. We found this repeat to be highly variable with the number of copies of the AG motif ranging from 27 to 72 and having a bimodal distribution. No statistically significant association was identified between the length of this STR and the risk of developing breast or endometrial cancer or age at diagnosis. The STR in the upstream regulatory region of EIG121 is highly polymorphic, but is not associated with the risk of developing breast or endometrial cancer in the cohorts analysed here. While this polymorphic STR in the regulatory region of EIG121 appears to have no impact on the risk of developing breast or endometrial cancer, its association with disease recurrence or overall survival remains to be determined.

Promoter proximal polyadenylation sites reduce transcription activity

DEFF Research Database (Denmark)

Andersen, Pia Kjølhede; Lykke-Andersen, Søren; Jensen, Torben Heick

2012-01-01

Gene expression relies on the functional communication between mRNA processing and transcription. We previously described the negative impact of a point-mutated splice donor (SD) site on transcription. Here we demonstrate that this mutation activates an upstream cryptic polyadenylation (CpA) site......, which in turn causes reduced transcription. Functional depletion of U1 snRNP in the context of the wild-type SD triggers the same CpA event accompanied by decreased RNA levels. Thus, in accordance with recent findings, U1 snRNP can shield premature pA sites. The negative impact of unshielded pA sites...... on transcription requires promoter proximity, as demonstrated using artificial constructs and supported by a genome-wide data set. Importantly, transcription down-regulation can be recapitulated in a gene context devoid of splice sites by placing a functional bona fide pA site/transcription terminator within ∼500...

Improving creativity performance by short-term meditation

Science.gov (United States)

2014-01-01

Background One form of meditation intervention, the integrative body-mind training (IBMT) has been shown to improve attention, reduce stress and change self-reports of mood. In this paper we examine whether short-term IBMT can improve performance related to creativity and determine the role that mood may play in such improvement. Methods Forty Chinese undergraduates were randomly assigned to short-term IBMT group or a relaxation training (RT) control group. Mood and creativity performance were assessed by the Positive and Negative Affect Schedule (PANAS) and Torrance Tests of Creative Thinking (TTCT) questionnaire respectively. Results As predicted, the results indicated that short-term (30 min per day for 7 days) IBMT improved creativity performance on the divergent thinking task, and yielded better emotional regulation than RT. In addition, cross-lagged analysis indicated that both positive and negative affect may influence creativity in IBMT group (not RT group). Conclusions Our results suggested that emotion-related creativity-promoting mechanism may be attributed to short-term meditation. PMID:24645871

Analysis of the 227 bp short interspersed nuclear element (SINE insertion of the promoter of the myostatin (MSTN gene in different horse breeds

Directory of Open Access Journals (Sweden)

Stefania Dall'Olio

2014-09-01

Full Text Available The myostatin (MSTN gene encodes a protein known to be a negative regulator of muscle mass in mammalian species. Different polymorphisms of the horse (Equus caballus MSTN gene have been identified, including single nucleotide polymorphisms and a short interspersed nuclear element (SINE insertion of 227 bp within the promoter of the gene. The SINE insertion has been associated with performance traits in Thoroughbred racehorses and it was proposed as a predictor of optimum racing distance. The aims of this study were to perform in silico analysis to identify putative gains or abrogation of transcription-factor binding sites (TFBSs generated by the SINE allele of the promoter and to analyse the frequency of the SINE insertion in horses used for racing (gallop and trot and other purposes. The SINE insertion was genotyped in 227 horses from 10 breeds belonging to different morphological types (brachimorphic, mesomorphic, meso-dolichomorphic and dolichomorphic. The presence of the insertion was confirmed in the Quarter Horse (SINE allele frequency of 0.81 and in the Thoroughbred (0.51, whereas the SINE allele did not segregate in any of the other analysed breeds. As the SINE MSTN gene polymorphism may be population or breed specific, it is not a useful marker for association studies in all breeds.

Analysis of the 227 bp short interspersed nuclear element (SINE) insertion of the promoter of the myostatin (MSTN) gene in different horse breeds.

Science.gov (United States)

Dall'Olio, Stefania; Scotti, Emilio; Fontanesi, Luca; Tassinari, Marco

2014-01-01

The myostatin (MSTN) gene encodes a protein known to be a negative regulator of muscle mass in mammalian species. Different polymorphisms of the horse (Equus caballus) MSTN gene have been identified, including single nucleotide polymorphisms and a short interspersed nuclear element (SINE) insertion of 227 bp within the promoter of the gene. The SINE insertion has been associated with performance traits in Thoroughbred racehorses and it was proposed as a predictor of optimum racing distance. The aims of this study were to perform in silico analysis to identify putative gains or abrogation of transcription-factor binding sites (TFBSs) generated by the SINE allele of the promoter and to analyse the frequency of the SINE insertion in horses used for racing (gallop and trot) and other purposes. The SINE insertion was genotyped in 227 horses from 10 breeds belonging to different morphological types (brachimorphic, mesomorphic, meso-dolichomorphic and dolichomorphic). The presence of the insertion was confirmed in the Quarter Horse (SINE allele frequency of 0.81) and in the Thoroughbred (0.51), whereas the SINE allele did not segregate in any of the other analysed breeds. As the SINE MSTN gene polymorphism may be population or breed specific, it is not a useful marker for association studies in all breeds.

Research on Cavitation Regions of Upstream Pumping Mechanical Seal Based on Dynamic Mesh Technique

Directory of Open Access Journals (Sweden)

Huilong Chen

2014-08-01

Full Text Available In order to study the cavitation area of the Upstream Pumping Mechanical Seal, three-dimensional microgap inner flow field of the Upstream Pumping Mechanical Seal was simulated with multiphase flow cavitation model and dynamic mesh technique based on hydrodynamic lubrication theory. Furthermore, the simulated result was compared with the experimental data. The results show that the simulated result with the Zwart-Gerber-Belamri cavitation model was much closer to the experimental data. The area of cavitation inception mainly occurred at the concave side of the spiral groove and surrounding region without spiral grooves, which was nearly covered by the inner diameter to roots of grooves; in addition, the region near the surface of the stationary ring was primary cavitation location. The area of cavitation has little relationship with the medium pressure; however, it became larger following increasing rotating speed in the range of researched operating conditions. Moreover the boundary of cavitated area was transformed from smooth to rough, which occurred in similar film thickness. When cavitation number was decreasing, which was conducive to improving the lubrication performance of sealed auxiliary, it made the sealing stability decline.

Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing.

Science.gov (United States)

Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L

Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1 , an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from -938 to -337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1 . We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34 + selected hematopoietic stem and progenitor cells.

Intersystem Implications of the Developmental Origins of Health and Disease: Advancing Health Promotion in the 21st Century.

Science.gov (United States)

Barnes, Michael D; Heaton, Thomas L; Goates, Michael C; Packer, Justin M

2016-07-15

The developmental origins of health and disease (DOHaD) theory and life course theory (LCT) are emerging fields of research that have significant implications for the public health and health promotion professions. Using a DOHaD/LCT perspective, social determinants of health (SDH) take on new critical meaning by which health promotion professionals can implement DOHaD/LCT guided interventions, including recommended policies. Through these interventions, public health could further address the sources of worldwide chronic disease epidemics and reduce such disease rates substantially if related policy, programs, and interdisciplinary and multi-sector collaboration are emphasized. Additional characteristics of the most effective interventions involve context-specific adaptation and societal structures that impact upstream, early life environments on a broad scale, influencing multiple locations and/or diseases.

The Giant Mottled Eel, Anguilla marmorata, Uses Blue-Shifted Rod Photoreceptors during Upstream Migration

OpenAIRE

Wang, Feng-Yu; Fu, Wen-Chun; Wang, I-Li; Yan, Hong Young; Wang, Tzi-Yuan

2014-01-01

Catadromous fishes migrate between ocean and freshwater during particular phases of their life cycle. The dramatic environmental changes shape their physiological features, e.g. visual sensitivity, olfactory ability, and salinity tolerance. Anguilla marmorata, a catadromous eel, migrates upstream on dark nights, following the lunar cycle. Such behavior may be correlated with ontogenetic changes in sensory systems. Therefore, this study was designed to identify changes in spectral sensitivity ...

The bZIP transcription factor HY5 interacts with the promoter of the monoterpene synthase gene QH6 in modulating its rhythmic expression

Directory of Open Access Journals (Sweden)

Fei eZhou

2015-04-01

Full Text Available The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA, we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD and constant dark (DD conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.

A comparative analysis of constitutive promoters located in adeno-associated viral vectors.

Directory of Open Access Journals (Sweden)

Lkhagvasuren Damdindorj

Full Text Available The properties of constitutive promoters within adeno-associated viral (AAV vectors have not yet been fully characterized. In this study, AAV vectors, in which enhanced GFP expression was directed by one of the six constitutive promoters (human β-actin, human elongation factor-1α, chicken β-actin combined with cytomegalovirus early enhancer, cytomegalovirus (CMV, simian virus 40, and herpes simplex virus thymidine kinase, were constructed and introduced into the HCT116, DLD-1, HT-1080, and MCF-10A cell lines. Quantification of GFP signals in infected cells demonstrated that the CMV promoter produced the highest GFP expression in the six promoters and maintained relatively high GFP expression for up to eight weeks after infection of HCT116, DLD-1, and HT-1080. Exogenous human CDKN2A gene expression was also introduced into DLD-1 and MCF-10A in a similar pattern by using AAV vectors bearing the human β-actin and the CMV promoters. The six constitutive promoters were subsequently placed upstream of the neomycin resistance gene within AAV vectors, and HCT116, DLD-1, and HT-1080 were infected with the resulting vectors. Of the six promoters, the CMV promoter produced the largest number of G418-resistant colonies in all three cell lines. Because AAV vectors have been frequently used as a platform to construct targeting vectors that permit gene editing in human cell lines, we lastly infected the three cell lines with AAV-based targeting vectors against the human PIGA gene in which one of the six promoters regulate the neomycin resistance gene. This assay revealed that the CMV promoter led to the lowest PIGA gene targeting efficiency in the investigated promoters. These results provide a clue to the identification of constitutive promoters suitable to express exogenous genes with AAV vectors, as well as those helpful to conduct efficient gene targeting using AAV-based targeting vectors in human cell lines.

Implications of Upstream Flow Availability for Watershed Surface Water Supply Across the Conterminous United States

Science.gov (United States)

Kai Duan; Ge Sun; Peter V. Caldwell; Steven G. McNulty; Yang Zhang

2018-01-01

Although it is well established that the availability of upstream flow (AUF) affects downstream water supply, its significance has not been rigorously categorized and quantified at fine resolutions. This study aims to fill this gap by providing a nationwide inventory of AUF and local water resource, and assessing their roles in securing water supply across the 2,099 8-...

Origin of 30 approximately 100 keV protons observed in the upstream region of the earth's bow shock

International Nuclear Information System (INIS)

Terasawa, T.

1979-01-01

A Fermi-type acceleration model is constructed to explain the origin of energetic protons (30 approximately 100 keV) which have been observed upstream of the bow shock. It is shown that the suprathermal protons (with energy of several keV) can be accelerated up to several tens of keV through the Fermi-type process in which the reflection at the shock front and the scattering in the upstream region are coupled. The efficiency of the scattering process is estimated by using the results of Barnes' quasilinear treatment of the wave excitation. The resultant energy spectrum and flux intensity (10 3 approximately 10 4 protons/(cm 2 s ster keV) in 32 approximately 45.3 keV) are consistent with the observation, and the softening of the energy spectrum observed in the dawn region can be explained by the decrease in the efficiency of the acceleration process in the dawn region due to the curvature of the bow shock and the reduction of shock strength. The spatial distribution of the flux predicted by the model is also consistent with the observation. In view of these consistencies of the Fermi-type acceleration process is suggested as a possible candidate mechanism to explain the upstream protons although it is not intended to exclude other possibilities. (author)

Large eddy simulation of a T-Junction with upstream elbow: The role of Dean vortices in thermal fatigue

International Nuclear Information System (INIS)

Tunstall, R.; Laurence, D.; Prosser, R.; Skillen, A.

2016-01-01

Highlights: • A T-Junction with an upstream bend is studied using wall-resolved LES and POD. • The bend generates Dean vortices which remain prominent downstream of the junction. • Dean vortex swirl-switching results in an unsteady secondary flow about the pipe axis. • This provides a further mechanism for near-wall temperature fluctuations. • Upstream bends can have a crucial role in T-Junction thermal fatigue problems. - Abstract: Turbulent mixing of fluids in a T-Junction can generate oscillating thermal stresses in pipe walls, which may lead to high cycle thermal fatigue. This thermal stripping problem is an important safety issue in nuclear plant thermal-hydraulic systems, since it can lead to unexpected failure of the pipe material. Here, we carry out a large eddy simulation (LES) of a T-Junction with an upstream bend and use proper orthogonal decomposition (POD) to identify the dominant structures in the flow. The bend generates an unsteady secondary flow about the pipe axis, known as Dean vortex swirl-switching. This provides an additional mechanism for low-frequency near-wall temperature fluctuations downstream of the T-Junction, over those that would be produced by mixing in the same T-Junction with straight inlets. The paper highlights the important role of neighbouring pipe bends in T-Junction thermal fatigue problems and the need to include them when using CFD as a predictive tool.

Mutations that alter a conserved element upstream of the potato virus X triple block and coat protein genes affect subgenomic RNA accumulation.

Science.gov (United States)

Kim, K H; Hemenway, C

1997-05-26

The putative subgenomic RNA (sgRNA) promoter regions upstream of the potato virus X (PVX) triple block and coat protein (CP) genes contain sequences common to other potexviruses. The importance of these sequences to PVX sgRNA accumulation was determined by inoculation of Nicotiana tabacum NT1 cell suspension protoplasts with transcripts derived from wild-type and modified PVX cDNA clones. Analyses of RNA accumulation by S1 nuclease digestion and primer extension indicated that a conserved octanucleotide sequence element and the spacing between this element and the start-site for sgRNA synthesis are critical for accumulation of the two major sgRNA species. The impact of mutations on CP sgRNA levels was also reflected in the accumulation of CP. In contrast, genomic minus- and plus-strand RNA accumulation were not significantly affected by mutations in these regions. Studies involving inoculation of tobacco plants with the modified transcripts suggested that the conserved octanucleotide element functions in sgRNA accumulation and some other aspect of the infection process.

Aberrant GSTP1 promoter methylation predicts short-term prognosis in acute-on-chronic hepatitis B liver failure.

Science.gov (United States)

Gao, S; Sun, F-K; Fan, Y-C; Shi, C-H; Zhang, Z-H; Wang, L-Y; Wang, K

2015-08-01

Glutathione-S-transferase P1 (GSTP1) methylation has been demonstrated to be associated with oxidative stress induced liver damage in acute-on-chronic hepatitis B liver failure (ACHBLF). To evaluate the methylation level of GSTP1 promoter in acute-on-chronic hepatitis B liver failure and determine its predictive value for prognosis. One hundred and five patients with acute-on-chronic hepatitis B liver failure, 86 with chronic hepatitis B (CHB) and 30 healthy controls (HC) were retrospectively enrolled. GSTP1 methylation level in peripheral mononuclear cells (PBMC) was detected by MethyLight. Clinical and laboratory parameters were obtained. GSTP1 methylation levels were significantly higher in patients with acute-on-chronic hepatitis B liver failure (median 16.84%, interquartile range 1.83-59.05%) than those with CHB (median 1.25%, interquartile range 0.48-2.47%; P chronic hepatitis B liver failure group, nonsurvivors showed significantly higher GSTP1 methylation levels (P chronic hepatitis B liver failure, GSTP1 methylation showed significantly better predictive value than MELD score [area under the receiver operating characteristic curve (AUC) 0.89 vs. 0.72, P chronic hepatitis B liver failure and shows high predictive value for short-term mortality. It might serve as a potential prognostic marker for acute-on-chronic hepatitis B liver failure. © 2015 John Wiley & Sons Ltd.

Interactions between the cyclic AMP receptor protein and the alpha subunit of RNA polymerase at the Escherichia coli galactose operon P1 promoter.

Science.gov (United States)

Attey, A; Belyaeva, T; Savery, N; Hoggett, J; Fujita, N; Ishihama, A; Busby, S

1994-10-25

DNAase I footprinting has been used to study open complexes between Escherichia coli RNA polymerase and the galactose operon P1 promoter, both in the absence and the presence of CRP (the cyclic AMP receptor protein, a transcription activator). From the effects of deletion of the C-terminal part of the RNA polymerase alpha subunit, we deduce that alpha binds at the upstream end of both the binary RNA polymerase-galP1 and ternary RNA polymerase-CRP-galP1 complexes. Disruption of the alpha-upstream contact suppresses open complex formation at galP1 at lower temperatures. In ternary RNA polymerase-CRP-galP1 complexes, alpha appears to make direct contact with Activating Region 1 in CRP. DNAase I footprinting has been used to detect and quantify interactions between purified alpha and CRP bound at galP1.

Influence of seasonal, diel, lunar, and other environmental factors on upstream fish passage in the igarapava fish ladder, Brazil

Science.gov (United States)

Bizzotto, P.M.; Godinho, Alexandre L.; Vono, V.; Kynard, B.; Godinho, Hugo P.

2009-01-01

Upstream fish passage was evaluated during 12 months in the vertical-slot Igarapava Fish Ladder constructed around Igarapava Dam, in the heavily dammed Grande River, Southeast Brazil. A video monitoring system was used to observe 61,621 fish that passed the ladder, of which 93.5% were identified to 15 taxa. Among the migratory species, the most abundant were Pimelodus maculatus (33.6% of all fish), Leporinus octofasciatus (31.4%), Leporinus friderici (4.5%), and Prochilodus lineatus (3.1%). Seven taxa were classified as nonmigratory, and of these taxa, the small Bryconamericus stramineus was the most abundant (12.7%) of all fishes. Passage of the 'nonmigratory' taxa upstream in the ladder shows they are migratory in this system and have a strong behavioural drive to move to upstream habitat. Passage of most taxa had a strong seasonal pattern. While some species passed primarily during the day, others showed a distinct nocturnal pattern. Lunar phase and water temperature also strongly affected passage of some taxa. Rainfall and dam discharge had a small or null influence on most taxa; perhaps due to the fairly small catchment area of the reservoir and the highly regulated discharge at Igarapava Dam. ?? 2009 John Wiley & Sons A/S.

Short-term fasting promotes insulin expression in rat hypothalamus.

Science.gov (United States)

Dakic, Tamara B; Jevdjovic, Tanja V; Peric, Mina I; Bjelobaba, Ivana M; Markelic, Milica B; Milutinovic, Bojana S; Lakic, Iva V; Jasnic, Nebojsa I; Djordjevic, Jelena D; Vujovic, Predrag Z

2017-07-01

In the hypothalamus, insulin takes on many roles involved in energy homoeostasis. Therefore, the aim of this study was to examine hypothalamic insulin expression during the initial phase of the metabolic response to fasting. Hypothalamic insulin content was assessed by both radioimmunoassay and Western blot. The relative expression of insulin mRNA was examined by qPCR. Immunofluorescence and immunohistochemistry were used to determine the distribution of insulin immunopositivity in the hypothalamus. After 6-h fasting, both glucose and insulin levels were decreased in serum but not in the cerebrospinal fluid. Our study showed for the first time that, while the concentration of circulating glucose and insulin decreased, both insulin mRNA expression and insulin content in the hypothalamic parenchyma were increased after short-term fasting. Increased insulin immunopositivity was detected specifically in the neurons of the hypothalamic periventricular nucleus and in the ependymal cells of fasting animals. These novel findings point to the complexity of mechanisms regulating insulin expression in the CNS in general and in the hypothalamus in particular. © 2017 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

Large-eddy simulations of velocity and temperature fluctuations in hot and cold fluids mixing in a tee junction with an upstream straight or elbow main pipe

International Nuclear Information System (INIS)

Lu, T.; Attinger, D.; Liu, S.M.

2013-01-01

Highlights: • Temperature and velocity fluctuations in a tee junction are predicted using LES. • The numerical results are in good agreement with the experimental data. • Upstream elbow pipe has significant influence on those fluctuations. -- Abstract: Thermal striping resulting in thermal fatigue is an important safety issue for nuclear power plants. In this work, temperature and velocity fluctuations in hot and cold fluids mixing in a tee junction with the main pipe connected either to an upstream straight or elbow pipe have been numerically predicted using large-eddy simulations (LES) on the FLUENT platform with the assumption of fully-developed velocity at both main and branch pipe inlets. The numerical results for the case with an upstream straight pipe were found to be in reasonable agreement with the available experimental data. The reason for the small discrepancy between the numerical results and experimental data can be attributed to the turbulence velocity being 10% of the fully-developed velocity at the main and branch pipe inlets in the LES calculations, while in the experiments the turbulence velocity was about 10% of the average velocity upstream of the tee junction. The simulated normalized mean and root-mean square (RMS) temperatures and the velocities at both straight and elbow tees were then compared, as well as the power spectrum densities (PSD) of the temperature fluctuations. The elbow pipe upstream of the main pipe has a significant influence on the mixing, resulting in increased temperature and velocity fluctuations. The flow pattern of the elbow tee deviates from the wall jet due to the secondary flow in the upstream elbow pipe

In vivo evidence that eIF3 stays bound to ribosomes elongating and terminating on short upstream ORFs to promote reinitiation

Czech Academy of Sciences Publication Activity Database

Mohammad, Mahabub Pasha; Munzarová Pondělíčková, Vanda; Zeman, Jakub; Gunišová, Stanislava; Valášek, Leoš Shivaya

2017-01-01

Roč. 45, č. 5 (2017), s. 2658-2674 ISSN 0305-1048 R&D Projects: GA ČR GA15-10116S EU Projects: Wellcome Trust(GB) 090812/B/09/A Institutional support: RVO:61388971 Keywords : OPEN READING FRAMES * MESSENGER-RNA RECRUITMENT * EUKARYOTIC TRANSLATION INITIATION Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 10.162, year: 2016

A rare case of 46, XX SRY-negative male with approximately 74-kb duplication in a region upstream of SOX9.

Science.gov (United States)

Xiao, Bing; Ji, Xing; Xing, Ya; Chen, Ying-Wei; Tao, Jiong

2013-12-01

The 46, XX male disorder of sex development (DSD) is a rare genetic condition. Here, we report the case of a 46, XX SRY-negative male with complete masculinization. The coding region and exon/intron boundaries of the DAX1, SOX9 and RSPO1 genes were sequenced, and no mutations were detected. Using whole genome array analysis and real-time PCR, we identified a approximately 74-kb duplication in a region approximately 510-584 kb upstream of SOX9 (chr17:69,533,305-69,606,825, hg19). Combined with the results of previous studies, the minimum critical region associated with gonadal development is a 67-kb region located 584-517 kb upstream of SOX9. The amplification of this region might lead to SOX9 overexpression, causing female-to-male sex reversal. Gonadal-specific enhancers in the region upstream of SOX9 may activate the SOX9 expression through long-range regulation, thus triggering testicular differentiation. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Analysis and Modeling of Time-Correlated Characteristics of Rainfall-Runoff Similarity in the Upstream Red River Basin

Directory of Open Access Journals (Sweden)

Xiuli Sang

2012-01-01

Full Text Available We constructed a similarity model (based on Euclidean distance between rainfall and runoff to study time-correlated characteristics of rainfall-runoff similar patterns in the upstream Red River Basin and presented a detailed evaluation of the time correlation of rainfall-runoff similarity. The rainfall-runoff similarity was used to determine the optimum similarity. The results showed that a time-correlated model was found to be capable of predicting the rainfall-runoff similarity in the upstream Red River Basin in a satisfactory way. Both noised and denoised time series by thresholding the wavelet coefficients were applied to verify the accuracy of model. And the corresponding optimum similar sets obtained as the equation solution conditions showed an interesting and stable trend. On the whole, the annual mean similarity presented a gradually rising trend, for quantitatively estimating comprehensive influence of climate change and of human activities on rainfall-runoff similarity.

Energy-Saving Mechanism in WDM/TDM-PON Based on Upstream Network Traffic

Directory of Open Access Journals (Sweden)

Paola Garfias

2014-08-01

Full Text Available One of the main challenges of Passive Optical Networks (PONs is the resource (bandwidth and wavelength management. Since it has been shown that access networks consume a significant part of the overall energy of the telecom networks, the resource management schemes should also consider energy minimization strategies. To sustain the increased bandwidth demand of emerging applications in the access section of the network, it is expected that next generation optical access networks will adopt the wavelength division/time division multiplexing (WDM/TDM technique to increase PONs capacity. Compared with traditional PONs, the architecture of a WDM/TDM-PON requires more transceivers/receivers, hence they are expected to consume more energy. In this paper, we focus on the energy minimization in WDM/TDM-PONs and we propose an energy-efficient Dynamic Bandwidth and Wavelength Allocation mechanism whose objective is to turn off, whenever possible, the unnecessary upstream traffic receivers at the Optical Line Terminal (OLT. We evaluate our mechanism in different scenarios and show that the proper use of upstream channels leads to relevant energy savings. Our proposed energy-saving mechanism is able to save energy at the OLT while maintaining the introduced penalties in terms of packet delay and cycle time within an acceptable range. We might highlight the benefits of our proposal as a mechanism that maximizes the channel utilization. Detailed implementation of the proposed algorithm is presented, and simulation results are reported to quantify energy savings and effects on network performance on different network scenarios.

Short sequence motifs, overrepresented in mammalian conservednon-coding sequences

Energy Technology Data Exchange (ETDEWEB)

Minovitsky, Simon; Stegmaier, Philip; Kel, Alexander; Kondrashov,Alexey S.; Dubchak, Inna

2007-02-21

Background: A substantial fraction of non-coding DNAsequences of multicellular eukaryotes is under selective constraint. Inparticular, ~;5 percent of the human genome consists of conservednon-coding sequences (CNSs). CNSs differ from other genomic sequences intheir nucleotide composition and must play important functional roles,which mostly remain obscure.Results: We investigated relative abundancesof short sequence motifs in all human CNSs present in the human/mousewhole-genome alignments vs. three background sets of sequences: (i)weakly conserved or unconserved non-coding sequences (non-CNSs); (ii)near-promoter sequences (located between nucleotides -500 and -1500,relative to a start of transcription); and (iii) random sequences withthe same nucleotide composition as that of CNSs. When compared tonon-CNSs and near-promoter sequences, CNSs possess an excess of AT-richmotifs, often containing runs of identical nucleotides. In contrast, whencompared to random sequences, CNSs contain an excess of GC-rich motifswhich, however, lack CpG dinucleotides. Thus, abundance of short sequencemotifs in human CNSs, taken as a whole, is mostly determined by theiroverall compositional properties and not by overrepresentation of anyspecific short motifs. These properties are: (i) high AT-content of CNSs,(ii) a tendency, probably due to context-dependent mutation, of A's andT's to clump, (iii) presence of short GC-rich regions, and (iv) avoidanceof CpG contexts, due to their hypermutability. Only a small number ofshort motifs, overrepresented in all human CNSs are similar to bindingsites of transcription factors from the FOX family.Conclusion: Human CNSsas a whole appear to be too broad a class of sequences to possess strongfootprints of any short sequence-specific functions. Such footprintsshould be studied at the level of functional subclasses of CNSs, such asthose which flank genes with a particular pattern of expression. Overallproperties of CNSs are affected by

Education Improves Public Health and Promotes Health Equity.

Science.gov (United States)

Hahn, Robert A; Truman, Benedict I

2015-01-01

This article describes a framework and empirical evidence to support the argument that educational programs and policies are crucial public health interventions. Concepts of education and health are developed and linked, and we review a wide range of empirical studies to clarify pathways of linkage and explore implications. Basic educational expertise and skills, including fundamental knowledge, reasoning ability, emotional self-regulation, and interactional abilities, are critical components of health. Moreover, education is a fundamental social determinant of health - an upstream cause of health. Programs that close gaps in educational outcomes between low-income or racial and ethnic minority populations and higher-income or majority populations are needed to promote health equity. Public health policy makers, health practitioners and educators, and departments of health and education can collaborate to implement educational programs and policies for which systematic evidence indicates clear public health benefits. © The Author(s) 2015.

Impact of sales promotion on purchase decision of consumers: An application in tourism sector

OpenAIRE

Hülya Bakırtaş

2013-01-01

Sales promotion is generally used to increase sales in the short term by businesses and especially used widely to influence consumers by businesses and agents of the consumer good markets. To identify and select the appropriate sales promotion techniques for businesses is an important decision. In the context businesses should well know target customers and decide to appropriate sales promotion techniques. This research evaluates impact on purchase decision of consumers of sales promotional t...

Murine homeobox-containing gene, Msx-1: analysis of genomic organization, promoter structure, and potential autoregulatory cis-acting elements.

Science.gov (United States)

Kuzuoka, M; Takahashi, T; Guron, C; Raghow, R

1994-05-01

Detailed molecular organization of the coding and upstream regulatory regions of the murine homeodomain-containing gene, Msx-1, is reported. The protein-encoding portion of the gene is contained in two exons, 590 and 1214 bp in length, separated by a 2107-bp intron; the homeodomain is located in the second exon. The two-exon organization of the murine Msx-1 gene resembles a number of other homeodomain-containing genes. The 5'-(GTAAGT) and 3'-(CCCTAG) splicing junctions and the mRNA polyadenylation signal (UAUAA) of the murine Msx-1 gene are also characteristic of other vertebrate genes. By nuclease protection and primer extension assays, the start of transcription of the Msx-1 gene was located 256 bp upstream of the first AUG. Computer analysis of the promoter proximal 1280-bp sequence revealed a number of potentially important cis-regulatory sequences; these include the recognition elements for Ap-1, Ap-2, Ap-3, Sp-1, a possible binding site for RAR:RXR, and a number of TCF-1 consensus motifs. Importantly, a perfect reverse complement of (C/G)TTAATTG, which was recently shown to be an optimal binding sequence for the homeodomain of Msx-1 protein (K.M. Catron, N. Iler, and C. Abate (1993) Mol. Cell. Biol. 13:2354-2365), was also located in the murine Msx-1 promoter. Binding of bacterially expressed Msx-1 homeodomain polypeptide to Msx-1-specific oligonucleotide was experimentally demonstrated, raising a distinct possibility of autoregulation of this developmentally regulated gene.

An upstream open reading frame controls translation of var2csa, a gene implicated in placental malaria

DEFF Research Database (Denmark)

Amulic, Borko; Salanti, Ali; Lavstsen, Thomas

2009-01-01

contains a small upstream open reading frame that acts to repress translation of the resulting mRNA, revealing a novel form of gene regulation in malaria parasites. The mechanism underlying this translational repression is reversible, allowing high levels of protein translation upon selection, thus...

Copy number variation of two separate regulatory regions upstream of SOX9 causes isolated 46,XY or 46,XX disorder of sex development.

Science.gov (United States)

Kim, Gwang-Jin; Sock, Elisabeth; Buchberger, Astrid; Just, Walter; Denzer, Friederike; Hoepffner, Wolfgang; German, James; Cole, Trevor; Mann, Jillian; Seguin, John H; Zipf, William; Costigan, Colm; Schmiady, Hardi; Rostásy, Moritz; Kramer, Mildred; Kaltenbach, Simon; Rösler, Bernd; Georg, Ina; Troppmann, Elke; Teichmann, Anne-Christin; Salfelder, Anika; Widholz, Sebastian A; Wieacker, Peter; Hiort, Olaf; Camerino, Giovanna; Radi, Orietta; Wegner, Michael; Arnold, Hans-Henning; Scherer, Gerd

2015-04-01

SOX9 mutations cause the skeletal malformation syndrome campomelic dysplasia in combination with XY sex reversal. Studies in mice indicate that SOX9 acts as a testis-inducing transcription factor downstream of SRY, triggering Sertoli cell and testis differentiation. An SRY-dependent testis-specific enhancer for Sox9 has been identified only in mice. A previous study has implicated copy number variations (CNVs) of a 78 kb region 517-595 kb upstream of SOX9 in the aetiology of both 46,XY and 46,XX disorders of sex development (DSD). We wanted to better define this region for both disorders. By CNV analysis, we identified SOX9 upstream duplications in three cases of SRY-negative 46,XX DSD, which together with previously reported duplications define a 68 kb region, 516-584 kb upstream of SOX9, designated XXSR (XX sex reversal region). More importantly, we identified heterozygous deletions in four families with SRY-positive 46,XY DSD without skeletal phenotype, which define a 32.5 kb interval 607.1-639.6 kb upstream of SOX9, designated XY sex reversal region (XYSR). To localise the suspected testis-specific enhancer, XYSR subfragments were tested in cell transfection and transgenic experiments. While transgenic experiments remained inconclusive, a 1.9 kb SRY-responsive subfragment drove expression specifically in Sertoli-like cells. Our results indicate that isolated 46,XY and 46,XX DSD can be assigned to two separate regulatory regions, XYSR and XXSR, far upstream of SOX9. The 1.9 kb SRY-responsive subfragment from the XYSR might constitute the core of the Sertoli-cell enhancer of human SOX9, representing the so far missing link in the genetic cascade of male sex determination. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Recombinational micro-evolution of functionally different metallothionein promoter alleles from Orchesella cincta

Directory of Open Access Journals (Sweden)

van Straalen Nico M

2007-06-01

Full Text Available Abstract Background Metallothionein (mt transcription is elevated in heavy metal tolerant field populations of Orchesella cincta (Collembola. This suggests that natural selection acts on transcriptional regulation of mt in springtails at sites where cadmium (Cd levels in soil reach toxic values This study investigates the nature and the evolutionary origin of polymorphisms in the metallothionein promoter (pmt and their functional significance for mt expression. Results We sequenced approximately 1600 bp upstream the mt coding region by genome walking. Nine pmt alleles were discovered in NW-European populations. They differ in the number of some indels, consensus transcription factor binding sites and core promoter elements. Extensive recombination events between some of the alleles can be inferred from the alignment. A deviation from neutral expectations was detected in a cadmium tolerant population, pointing towards balancing selection on some promoter stretches. Luciferase constructs were made from the most abundant alleles, and responses to Cd, paraquat (oxidative stress inducer and moulting hormone were studied in cell lines. By using paraquat we were able to dissect the effect of oxidative stress from the Cd specific effect, and extensive differences in mt induction levels between these two stressors were observed. Conclusion The pmt alleles evolved by a number of recombination events, and exhibited differential inducibilities by Cd, paraquat and molting hormone. In a tolerant population from a metal contaminated site, promoter allele frequencies differed significantly from a reference site and nucleotide polymorphisms in some promoter stretches deviated from neutral expectations, revealing a signature of balancing selection. Our results suggest that the structural differences in the Orchesella cincta metallothionein promoter alleles contribute to the metallothionein -over-expresser phenotype in cadmium tolerant populations.

Generation of an efficient artificial promoter of bovine skeletal muscle α-actin gene (ACTA1) through addition of cis-acting element.

Science.gov (United States)

Hu, Qian; Tong, Huili; Zhao, Dandan; Cao, Yunkao; Zhang, Weiwei; Chang, Shuwei; Yang, Yu; Yan, Yunqin

2015-03-01

The promoter of skeletal muscle α-actin gene (ACTA1) is highly muscle specific. The core of the bovine ACTA1 promoter extends from +29 to -233, about 262 base pairs (bp), which is sufficient to activate transcription in bovine muscle satellite cells. In this study, analysis by PCR site-specific mutagenesis showed that the cis-acting element SRE (serum response element binding factor) was processed as a transcriptional activator. In order to enhance the bovine ACTA1 promoter's activity, we used a strategy to modify it. We cloned a fragment containing three SREs from the promoter of ACTA1, and then one or two clones were linked upstream of the core promoter (262 bp) of ACTA1. One and two clones increased the activity of the ACTA1 promoter 3-fold and 10-fold, respectively, and maintained muscle tissue specificity. The modified promoter with two clones could increase the level of ACTA1 mRNA and protein 4-fold and 1.1-fold, respectively. Immunofluorescence results showed that green fluorescence of ACTA1 increased. Additionally, the number of total muscle microfilaments increased. These genetically engineered promoters might be useful for regulating gene expression in muscle cells and improving muscle mass in livestock.

Deletion of P2 promoter of GJB1 gene a cause of Charcot-Marie-Tooth disease.

Science.gov (United States)

Kulshrestha, R; Burton-Jones, S; Antoniadi, T; Rogers, M; Jaunmuktane, Z; Brandner, S; Kiely, N; Manuel, R; Willis, T

2017-08-01

X-linked Charcot-Marie-Tooth disease (CMT) is the second most common cause of CMT, and is usually caused by mutations in the gap junction protein beta 1 (GJB1) gene. This gene has nerve specific P2 promoter that work synergistically with SOX10 and EGR2 genes to initiate transcription. Mutation in this region is known to cause Schwann cell dysfunction. A single large family of X linked peripheral neuropathy was identified in our practice. Next generation sequencing for targeted panel assay identified an upstream exon-splicing deletion identified extending from nucleotide c.-5413 to approximately - c.-49. This matches the sequence of 32 nucleotides at positions c.*218-*249 in the 3'UTR downstream of the GJB1 gene. The deleted fragment included the entire P2 promoter region. The deletion segregated with the disease. To our knowledge a deletion of the P2 promoter alone as a cause of CMT has not been reported previously. Copyright © 2017 Elsevier B.V. All rights reserved.

Restructuring: new relationships between the oil companies and the upstream oil firms; Alliances et restructurations: nouvelles relations entre maitres d'oeuvre et parapetrolier

Energy Technology Data Exchange (ETDEWEB)

Barreau, S

2001-11-01

Since the 1986 oil shock, international oil companies have focused on their base competencies, concentrating on activities viewed as their core businesses and steadily increasing the number of tasks to be subcontracted to the upstream oil and gas service sector. The upstream oil and gas service companies had to be restructured to face this new challenge. The strategies they launched at the end of the 80's were varied. Some firms became largely integrated (Schlumberger, Baker Hughes, Halliburton) whereas other firms chose to broaden their range of services. However generally, they opted for external investment which led to an important wave of mergers and acquisitions. The first part characterizes the upstream oil and gas sector by introducing the main oil and gas service firms and their recent strategic evolution. This concludes with both an economic valuation and a typology of attempted growth strategies. To illustrate this, a matrix has been created to characterise the dynamic paths of the oil and gas service firms. The purpose of the second part is to consider the economic theories related to industrial strategies. The strategies of innovation, market protection, vertical integration and diversification have been studied to illustrate the main conclusion which is that the aim of all these strategies was to change the relationships between the oil companies and the upstream oil and gas service firms. (author)

Promoter binding, initiation, and elongation by bacteriophage T7 RNA polymerase. A single-molecule view of the transcription cycle.

Science.gov (United States)

Skinner, Gary M; Baumann, Christoph G; Quinn, Diana M; Molloy, Justin E; Hoggett, James G

2004-01-30

A single-molecule transcription assay has been developed that allows, for the first time, the direct observation of promoter binding, initiation, and elongation by a single RNA polymerase (RNAP) molecule in real-time. To promote DNA binding and transcription initiation, a DNA molecule tethered between two optically trapped beads was held near a third immobile surface bead sparsely coated with RNAP. By driving the optical trap holding the upstream bead with a triangular oscillation while measuring the position of both trapped beads, we observed the onset of promoter binding, promoter escape (productive initiation), and processive elongation by individual RNAP molecules. After DNA template release, transcription re-initiation on the same DNA template is possible; thus, multiple enzymatic turnovers by an individual RNAP molecule can be observed. Using bacteriophage T7 RNAP, a commonly used RNAP paradigm, we observed the association and dissociation (k(off)= 2.9 s(-1)) of T7 RNAP and promoter DNA, the transition to the elongation mode (k(for) = 0.36 s(-1)), and the processive synthesis (k(pol) = 43 nt s(-1)) and release of a gene-length RNA transcript ( approximately 1200 nt). The transition from initiation to elongation is much longer than the mean lifetime of the binary T7 RNAP-promoter DNA complex (k(off) > k(for)), identifying a rate-limiting step between promoter DNA binding and promoter escape.

Effect of food-related stress conditions and loss of agr and sigB on seb promoter activity in S. aureus.

Science.gov (United States)

Sihto, Henna-Maria; Stephan, Roger; Engl, Christoph; Chen, John; Johler, Sophia

2017-08-01

Staphylococcal enterotoxin B (SEB) causes staphylococcal food poisoning and is produced in up to ten times higher quantities than other major enterotoxins. While Staphylococcus aureus growth is often repressed by competing flora, the organism exhibits a decisive growth advantage under some stress conditions. So far, data on the influence of food-related stressors and regulatory mutations on seb expression is limited and largely based on laboratory strains, which were later reported to harbor mutations. Therefore, the aim of this study was to investigate the influence of stress and regulatory mutations on seb promoter activity. To this end, transcriptional fusions were created in two strains, USA300 and HG003, carrying different seb upstream sequences fused to a blaZ reporter. NaCl, nitrite, and glucose stress led to significantly decreased seb promoter activity, while lactic acid stress resulted in significantly increased seb promoter activity. Loss of agr decreased seb promoter activity and loss of sigB increased promoter activity, with the magnitude of change depending on the strain. These results demonstrate that mild stress conditions encountered during food production and preservation can induce significant changes in seb promoter activity. Copyright © 2017 Elsevier Ltd. All rights reserved.

Short hairpin RNA-mediated knockdown of protein expression in Entamoeba histolytica

Directory of Open Access Journals (Sweden)

Singh Upinder

2009-02-01

Full Text Available Abstract Background Entamoeba histolytica is an intestinal protozoan parasite of humans. The genome has been sequenced, but the study of individual gene products has been hampered by the lack of the ability to generate gene knockouts. We chose to test the use of RNA interference to knock down gene expression in Entamoeba histolytica. Results An episomal vector-based system, using the E. histolytica U6 promoter to drive expression of 29-basepair short hairpin RNAs, was developed to target protein-encoding genes in E. histolytica. The short hairpin RNAs successfully knocked down protein levels of all three unrelated genes tested with this system: Igl, the intermediate subunit of the galactose- and N-acetyl-D-galactosamine-inhibitable lectin; the transcription factor URE3-BP; and the membrane binding protein EhC2A. Igl levels were reduced by 72%, URE3-BP by 89%, and EhC2A by 97%. Conclusion Use of the U6 promoter to drive expression of 29-basepair short hairpin RNAs is effective at knocking down protein expression for unrelated genes in Entamoeba histolytica, providing a useful tool for the study of this parasite.

Short hairpin RNA-mediated knockdown of protein expression in Entamoeba histolytica.

Science.gov (United States)

Linford, Alicia S; Moreno, Heriberto; Good, Katelyn R; Zhang, Hanbang; Singh, Upinder; Petri, William A

2009-02-17

Entamoeba histolytica is an intestinal protozoan parasite of humans. The genome has been sequenced, but the study of individual gene products has been hampered by the lack of the ability to generate gene knockouts. We chose to test the use of RNA interference to knock down gene expression in Entamoeba histolytica. An episomal vector-based system, using the E. histolytica U6 promoter to drive expression of 29-basepair short hairpin RNAs, was developed to target protein-encoding genes in E. histolytica. The short hairpin RNAs successfully knocked down protein levels of all three unrelated genes tested with this system: Igl, the intermediate subunit of the galactose- and N-acetyl-D-galactosamine-inhibitable lectin; the transcription factor URE3-BP; and the membrane binding protein EhC2A. Igl levels were reduced by 72%, URE3-BP by 89%, and EhC2A by 97%. Use of the U6 promoter to drive expression of 29-basepair short hairpin RNAs is effective at knocking down protein expression for unrelated genes in Entamoeba histolytica, providing a useful tool for the study of this parasite.

Power from renewable sources of energy should be promoted

International Nuclear Information System (INIS)

Wartburg, L. von

2005-01-01

This short article presents the views of five experts concerning a model for the promotion of the use of solar energy that was developed by the Swiss Association of Electricity Utilities VSE. The model is based on a tendering system for promotion of solar installations. Also, various points of view are presented on the questions concerning the opening of the electricity market in Switzerland, the effect of the introduction of a CO 2 levy and the status of the promotion of renewable forms of energy in the future. Opinions on the VSE's model and the competitiveness of Swiss electricity utilities in comparison with those in the European Union are stated

Mental health promotion initiatives for children and youth in contexts of poverty: the case of South Africa.

Science.gov (United States)

Petersen, Inge; Swartz, Leslie; Bhana, Arvin; Flisher, Alan J

2010-09-01

In order to achieve sustainable development and a consequent reduction in levels of poverty, a multisectoral response to development incorporating pro-poor economic policies in low- to middle-income countries (LMICs) is required. An important aspect is strengthening the human capital asset base of vulnerable populations. This should include the promotion of mental health, which can play an important role in breaking the intergenerational cycle of poverty and mental ill-health through promoting positive mental health outcomes within the context of risk. For each developmental phase of early childhood, middle childhood and adolescence, this article provides: (i) an overview of the critical risk influences and evidence of the role of mental health promotion initiatives in mediating these influences; (ii) a background to these risk influences in South Africa; and (iii) a review of mental health promotion initiatives addressing distal upstream influences at a macro-policy level in South Africa, as well as evidence-based micro- and community-level interventions that have the potential to be scaled up. From this review, strengths and gaps in existing micro- and community-level evidence-based mental health promotion interventions as well as macro-policy-level initiatives are identified, and recommendations made for South Africa that may also have applicability for other LMICs.

The mitochondrial fusion-promoting factor mitofusin is a substrate of the PINK1/parkin pathway.

Directory of Open Access Journals (Sweden)

Angela C Poole

2010-04-01

Full Text Available Loss-of-function mutations in the PINK1 or parkin genes result in recessive heritable forms of parkinsonism. Genetic studies of Drosophila orthologs of PINK1 and parkin indicate that PINK1, a mitochondrially targeted serine/threonine kinase, acts upstream of Parkin, a cytosolic ubiquitin-protein ligase, to promote mitochondrial fragmentation, although the molecular mechanisms by which the PINK1/Parkin pathway promotes mitochondrial fragmentation are unknown. We tested the hypothesis that PINK1 and Parkin promote mitochondrial fragmentation by targeting core components of the mitochondrial morphogenesis machinery for ubiquitination. We report that the steady-state abundance of the mitochondrial fusion-promoting factor Mitofusin (dMfn is inversely correlated with the activity of PINK1 and Parkin in Drosophila. We further report that dMfn is ubiquitinated in a PINK1- and Parkin-dependent fashion and that dMfn co-immunoprecipitates with Parkin. By contrast, perturbations of PINK1 or Parkin did not influence the steady-state abundance of the mitochondrial fission-promoting factor Drp1 or the mitochondrial fusion-promoting factor Opa1, or the subcellular distribution of Drp1. Our findings suggest that dMfn is a direct substrate of the PINK1/Parkin pathway and that the mitochondrial morphological alterations and tissue degeneration phenotypes that derive from mutations in PINK1 and parkin result at least in part from reduced ubiquitin-mediated turnover of dMfn.

Upstream vertical cavity surface-emitting lasers for fault monitoring and localization in WDM passive optical networks

Science.gov (United States)

Wong, Elaine; Zhao, Xiaoxue; Chang-Hasnain, Connie J.

2008-04-01

As wavelength division multiplexed passive optical networks (WDM-PONs) are expected to be first deployed to transport high capacity services to business customers, real-time knowledge of fiber/device faults and the location of such faults will be a necessity to guarantee reliability. Nonetheless, the added benefit of implementing fault monitoring capability should only incur minimal cost associated with upgrades to the network. In this work, we propose and experimentally demonstrate a fault monitoring and localization scheme based on a highly-sensitive and potentially low-cost monitor in conjunction with vertical cavity surface-emitting lasers (VCSELs). The VCSELs are used as upstream transmitters in the WDM-PON. The proposed scheme benefits from the high reflectivity of the top distributed Bragg reflector (DBR) mirror of optical injection-locked (OIL) VCSELs to reflect monitoring channels back to the central office for monitoring. Characterization of the fault monitor demonstrates high sensitivity, low bandwidth requirements, and potentially low output power. The added advantage of the proposed fault monitoring scheme incurs only a 0.5 dB penalty on the upstream transmissions on the existing infrastructure.

Developing world perspective: the importance of growth for short-term health.

Science.gov (United States)

Adair, Linda S

2010-01-01

Recently, concern has been raised about the potential adverse long-term consequences of rapid child growth. Rapid early childhood weight gain is associated with increased likelihood of being overweight or obese later in childhood and of having risk factors for the development of chronic disease such insulin resistance and elevated blood pressure. This has led to concerns about the wisdom of promoting catch-up growth in infants born small for gestational age or in children with poor growth after birth. In considering the costs and benefits of promoting catch-up growth, we must not lose sight of the immediate health threats to children in resource-poor environments in developing countries where child morbidity and mortality remain high. The literature on short-term consequences of growth is limited by its focus on attained size as an indicator of prior nutritional status, but generally shows that children with evidence of poor prior growth are at greater risk of morbidity and mortality from common infectious diseases, including lower respiratory infections and diarrhea. In these settings, failure to promote compensatory growth may have devastating short-term consequences. Copyright (c) 2010 S. Karger AG, Basel.

Improvement in Product Development: Use of back-end data to support upstream efforts of Robust Design Methodology

Directory of Open Access Journals (Sweden)

Vanajah Siva

2012-12-01

Full Text Available In the area of Robust Design Methodology (RDM less is done on how to use and work with data from the back-end of the product development process to support upstream improvement. The purpose of this paper is to suggest RDM practices for the use of customer claims data in early design phases as a basis for improvements. The back-end data, when systematically analyzed and fed back into the product development process, aids in closing the product development loop from claims to improvement in the design phase. This is proposed through a flow of claims data analysis tied to an existing tool, namely Failure Mode and Effects Analysis (FMEA. The systematic and integrated analysis of back-end data is suggested as an upstream effort of RDM to increase understanding of noise factors during product usage based on the feedback of claims data to FMEA and to address continuous improvement in product development.

Pooled genome wide association detects association upstream of FCRL3 with Graves' disease.

Science.gov (United States)

Khong, Jwu Jin; Burdon, Kathryn P; Lu, Yi; Laurie, Kate; Leonardos, Lefta; Baird, Paul N; Sahebjada, Srujana; Walsh, John P; Gajdatsy, Adam; Ebeling, Peter R; Hamblin, Peter Shane; Wong, Rosemary; Forehan, Simon P; Fourlanos, Spiros; Roberts, Anthony P; Doogue, Matthew; Selva, Dinesh; Montgomery, Grant W; Macgregor, Stuart; Craig, Jamie E

2016-11-18

Graves' disease is an autoimmune thyroid disease of complex inheritance. Multiple genetic susceptibility loci are thought to be involved in Graves' disease and it is therefore likely that these can be identified by genome wide association studies. This study aimed to determine if a genome wide association study, using a pooling methodology, could detect genomic loci associated with Graves' disease. Nineteen of the top ranking single nucleotide polymorphisms including HLA-DQA1 and C6orf10, were clustered within the Major Histo-compatibility Complex region on chromosome 6p21, with rs1613056 reaching genome wide significance (p = 5 × 10 -8 ). Technical validation of top ranking non-Major Histo-compatablity complex single nucleotide polymorphisms with individual genotyping in the discovery cohort revealed four single nucleotide polymorphisms with p ≤ 10 -4 . Rs17676303 on chromosome 1q23.1, located upstream of FCRL3, showed evidence of association with Graves' disease across the discovery, replication and combined cohorts. A second single nucleotide polymorphism rs9644119 downstream of DPYSL2 showed some evidence of association supported by finding in the replication cohort that warrants further study. Pooled genome wide association study identified a genetic variant upstream of FCRL3 as a susceptibility locus for Graves' disease in addition to those identified in the Major Histo-compatibility Complex. A second locus downstream of DPYSL2 is potentially a novel genetic variant in Graves' disease that requires further confirmation.

HIV-1 Promoter Single Nucleotide Polymorphisms Are Associated with Clinical Disease Severity.

Directory of Open Access Journals (Sweden)

Michael R Nonnemacher

Full Text Available The large majority of human immunodeficiency virus type 1 (HIV-1 markers of disease progression/severity previously identified have been associated with alterations in host genetic and immune responses, with few studies focused on viral genetic markers correlate with changes in disease severity. This study presents a cross-sectional/longitudinal study of HIV-1 single nucleotide polymorphisms (SNPs contained within the viral promoter or long terminal repeat (LTR in patients within the Drexel Medicine CNS AIDS Research and Eradication Study (CARES Cohort. HIV-1 LTR SNPs were found to associate with the classical clinical disease parameters CD4+ T-cell count and log viral load. They were found in both defined and undefined transcription factor binding sites of the LTR. A novel SNP identified at position 108 in a known COUP (chicken ovalbumin upstream promoter/AP1 transcription factor binding site was significantly correlated with binding phenotypes that are potentially the underlying cause of the associated clinical outcome (increase in viral load and decrease in CD4+ T-cell count.

Characterization of a putative cis-regulatory element that controls transcriptional activity of the pig uroplakin II gene promoter

International Nuclear Information System (INIS)

Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi

2011-01-01

Highlights: → The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. → The core promoter was located in the 5F-1. → Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. → These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.

Search for short-lived particles produced on nuclei with a heavy liquid mini bubble chamber

CERN Multimedia

2002-01-01

The aim of this experiment is to search for short-lived particles produced in hadronic interactions on nuclei with our high resolution heavy liquid mini bubble chamber BIBC, aiming to establish the cross-section for associated production in hadron-nucleus collisions, its $A$-dependence and an approximate value of the lifetime. The chamber will be operated at a bubble density of 290 bubbles/cm and with an apparent bubble size of 30 $\\mu$m in real space. In test runs at CERN we measured detection efficiencies which, together with simulations of $D\\bar{D}$ production and decay, lead to a sensitivity of 0.25 events/($\\mu$b/N) per day if the lifetime is of the order of $5\\times10^{-13}$s. A null result after 10 days running time would set an upper limit on the production cross section to $3 \\mu$b. \\\\ \\\\ In order to measure the momenta of charged decay products of short-lived particles, the bubble chamber will be placed 1.80 m upstream of the streamer chamber of the NA5 experiment (MPI). The geometrical acceptance ...

Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes

Directory of Open Access Journals (Sweden)

Rowe J

2009-08-01

Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.

Beyond police crisis intervention: moving "upstream" to manage cases and places of behavioral health vulnerability.

Science.gov (United States)

Wood, Jennifer D; Beierschmitt, Laura

2014-01-01

Law enforcement officers continue to serve on the front lines as mental health interventionists, and as such have been subject to a wave of "first generation" reform designed to enhance their crisis response capabilities. Yet, this focus on crisis intervention has not answered recent calls to move "upstream" and bolster early intervention in the name of long-term recovery. This paper reports on findings from an action research project in Philadelphia aimed at exploring opportunities for enhanced upstream engagement. Study methods include spatial analyses of police mental health transportations from an eight year period (2004-2011) and qualitative data from twenty-three "framing conversations" with partners and other stakeholders, seven focus groups with police and outreach workers, five key informant interviews as well as document reviews of the service delivery system in Philadelphia. Recommendations include the need to move beyond a focus on what police can do to a wider conception of city agencies and business stakeholders who can influence vulnerable people and vulnerable spaces of the city. We argue for the need to develop shared principles and rules of engagement that clarify roles and stipulate how best to enlist city resources in a range of circumstances. Since issues of mental health, substance use and disorder are so tightly coupled, we stress the importance of establishing a data-driven approach to crime and disorder reduction in areas of the city we term "hotspots of vulnerability". In line with a recovery philosophy, such an approach should reduce opportunities for anti-social behavior among the "dually labeled" in ways consistent with "procedural justice". Furthermore, crime and disorder data flowing from police and security to behavioral health analysts could contribute to a more focused case management of "repeat utilizers" across the two systems. Our central argument is that a twin emphasis on "case management" and "place management" may provide

ECONOMIC PROMOTION OF A SMALL COUNTRY – THE CASE OF SLOVENIA

Directory of Open Access Journals (Sweden)

Dejan ROMIH

2014-06-01

Full Text Available This paper examines the economic promotion of a small country in the case of Slovenia, which is facing certain economic and social problems. One reason for this is the current financial and economic crisis, which is continuing to affect the country’s economy. Economic promotion is therefore very important for Slovenia and its economic performance in both the short and long run.

Upstream transcription factor 1 (USF1) in risk of type 2 diabetes: association study in 2000 Dutch Caucasians

NARCIS (Netherlands)

Meex, S.J.; Vliet-Ostaptchouk, J.V.; Kallen, van der C.J.H.; Greevenbroek, M.M.; Schalkwijk, C.G.; Feskens, E.J.M.; Blaak, E.E.; Wijmenga, C.; Hofker, M.H.; Stehouwer, C.D.; Bruin, T.W.

2008-01-01

Type 2 diabetes shares substantial genetic and phenotypic overlap with familial combined hyperlipidemia. Upstream stimulatory factor 1 (USF1), a well-established susceptibility gene for familial combined hyperlipidemia, is postulated to be such a shared genetic determinant. We evaluated two

Key concerns of U.K. oil and gas company directors for upstream oil developments

International Nuclear Information System (INIS)

Anon.

1996-01-01

Energy 2006 is a survey published by Ernst and Young presenting the main concerns over the past decade of the UK company directors. The upstream conclusions are presented here. In the medium term (3 years) and long term (10 years), the main concerns were with replacing reserves and with oil price changes. Company re-organisation etc., de-regulation of the gas market, maximising production, return of Iraq to the oil market, and environmental issues were also of concern. (author)

Upstream petroleum industry flaring guide : review draft

International Nuclear Information System (INIS)

1999-03-01

The Alberta requirements and expectations for upstream petroleum flaring are presented. Flaring is associated with a wide range of energy activities including oil and gas well drilling and well completion operations. The guide incorporates the recommendations made to the Alberta Energy and Utilities Board (EUB) in June 1998 by the multi-stakeholder Clean Air Strategic Alliance (CASA) on associated or solution gas flaring. Additional requirements which address flaring issues not covered in the CASA report are also included in this guide. The Guide requires a 15 per cent reduction in solution gas flare volume by the end of year 2000 from the 1996 baseline, and a 25 per cent reduction by the end of 2001. The Guide prescribes new flare performance requirements for all flares, within three years for existing solution gas flares, five years for flares at other existing permanent facilities. It sets personal consultation and public notification requirements for new and existing solution gas batteries, and new sulphur recovery requirements for facilities not covered by existing EUB regulations. The Guide also addresses the question of conflict resolution to deal with flaring concerns, the release of flaring and venting data, the proposed reduction of flare limits, progress towards minimizing requirements for electricity generators using otherwise flared gas, annual reporting to the EUB, and management framework review in 2001

Deep brine recognition upstream the EBE syndicate. Geochemical and isotopic investigations. Final report

International Nuclear Information System (INIS)

2009-01-01

The authors report and discuss the results obtained after performing a drilling upstream the drinkable water harnessing field of a water supply syndicate in Alsace (Ensisheim, Bollwiller and surroundings), in order to confirm the existence of a deep brine source. This brine is diluted by recent waters. The first isotopic investigations do not allow the origin of this brine to be identified, but fractures due to some seismic events are suspected. The report presents the drilling and the various aspects of the chemical and isotopic studies (sampling, physico-chemical analysis, dating, identification of various isotopes)

OGJ group weathered tough times upstream and downstream in 1991

International Nuclear Information System (INIS)

Biggs, J.B.; Price, R.B.

1992-01-01

With an upstream sector hit by low oil and gas prices and downstream operations squeezed by weak petroleum demand, 1991, was a tough year for the group of 22 major integrated U.S. companies Oil and Gas Journal tracks. This paper reports that the brief respite caused by the oil price spike in second half 1990 ended abruptly early in first half 1991, and it turned into a year of buckling down for most companies. They shed non-core assets, implemented strategic restructuring moves, and reduced staff. Although low prices slowed overall drilling activity for the group, oil and gas production increased slightly, and most companies reported reserves gains. Recession in the U.S. and Europe depressed demand for the group's fined products enough to pinch downstream earnings even as buoyant Asia-Pacific demand helped jack up world product sales

Factors Affecting the Survival of Upstream Migrant Adult Salmonids in the Columbia River Basin : Recovery Issues for Threatened and Endangered Snake River Salmon : Technical Report 9 of 11.

Energy Technology Data Exchange (ETDEWEB)

Dauble, Dennis D.; Mueller, Robert P.

1993-06-01

The Bonneville Power Administration (BPA) is developing conservation planning documentation to support the National Marine Fisheries Service`s (NMFS) recovery plan for Columbia Basin salmonid stocks that are currently listed under the Endangered Species Act (ESA). Information from the conservation planning documentation will be used as a partial scientific basis for identifying alternative conservation strategies and to make recommendations toward conserving, rebuilding, and ultimately removing these salmon stocks from the list of endangered species. This report describes the adult upstream survival study, a synthesis of biological analyses related to conditions affecting the survival of adult upstream migrant salmonids in the Columbia River system. The objective of the adult upstream survival study was to analyze existing data related to increasing the survival of adult migrant salmonids returning to the Snake River system. The fate and accountability of each stock during its upstream migration period and the uncertainties associated with measurements of escapement and survival were evaluated. Operational measures that affected the survival of adult salmon were evaluated including existing conditions, augmented flows from upstream storage release, and drawdown of mainstem reservoirs. The potential impacts and benefits of these measures to each ESA stock were, also described based on considerations of species behavior and run timing.

Expression of the nifA gene of Herbaspirillum seropedicae: role of the NtrC and NifA binding sites and of the -24/-12 promoter element.

Science.gov (United States)

Souza, E M; Pedrosa, F O; Rigo, L U; Machado, H B; Yates, M G

2000-06-01

The nifA promoter of Herbaspirillum seropedicae contains potential NtrC, NifA and IHF binding sites together with a -12/-24 sigma(N)-dependent promoter. This region has now been investigated by deletion mutagenesis for the effect of NtrC and NifA on the expression of a nifA::lacZ fusion. A 5' end to the RNA was identified at position 641, 12 bp downstream from the -12/-24 promoter. Footprinting experiments showed that the G residues at positions -26 and -9 are hypermethylated, and that the region from -10 to +10 is partially melted under nitrogen-fixing conditions, confirming that this is the active nifA promoter. In H. seropedicae nifA expression from the sigma(N)-dependent promoter is repressed by fixed nitrogen but not by oxygen and is probably activated by the NtrC protein. NifA protein is apparently not essential for nifA expression but it can still bind the NifA upstream activating sequence.

Genomic organization and promoter cloning of the human X11α gene APBA1.

LENUS (Irish Health Repository)

Chai, Ka-Ho

2012-05-01

X11α is a brain specific multi-modular protein that interacts with the Alzheimer\\'s disease amyloid precursor protein (APP). Aggregation of amyloid-β peptide (Aβ), an APP cleavage product, is believed to be central to the pathogenesis of Alzheimer\\'s disease. Recently, overexpression of X11α has been shown to reduce Aβ generation and to ameliorate memory deficit in a transgenic mouse model of Alzheimer\\'s disease. Therefore, manipulating the expression level of X11α may provide a novel route for the treatment of Alzheimer\\'s disease. Human X11α is encoded by the gene APBA1. As evidence suggests that X11α expression can be regulated at transcription level, we have determined the gene structure and cloned the promoter of APBA1. APBA1 spans over 244 kb on chromosome 9 and is composed of 13 exons and has multiple transcription start sites. A putative APBA1 promoter has been identified upstream of exon 1 and functional analysis revealed that this is highly active in neurons. By deletion analysis, the minimal promoter was found to be located between -224 and +14, a GC-rich region that contains a functional Sp3 binding site. In neurons, overexpression of Sp3 stimulates the APBA1 promoter while an Sp3 inhibitor suppresses the promoter activity. Moreover, inhibition of Sp3 reduces endogenous X11α expression and promotes the generation of Aβ. Our findings reveal that Sp3 play an essential role in APBA1 transcription.

Moving Upstream and Going Local: The Responsibility to Protect Ten Years Later

Directory of Open Access Journals (Sweden)

Bridget Moix

2015-10-01

Full Text Available Ten years ago the international community pledged to protect civilians from genocide, ethnic cleansing, war crimes, and crimes against humanity by endorsing the responsibility to protect (R2P doctrine. Yet today, horrific violence against civilians continues in places like Syria, Iraq, and South Sudan. This article examines some of the progress and gaps in the international community’s efforts to better protect civilians against mass violence over the past decade. It proposes two emerging directions for advancing the R2P agenda in the coming years: 1 greater focus on upstream prevention, and 2 increased support for locally-led peacebuilding and prevention actors and capacities.

Salinity Trends in the Upper Colorado River Basin Upstream From the Grand Valley Salinity Control Unit, Colorado, 1986-2003

Science.gov (United States)

Leib, Kenneth J.; Bauch, Nancy J.

2008-01-01

In 1974, the Colorado River Basin Salinity Control Act was passed into law. This law was enacted to address concerns regarding the salinity content of the Colorado River. The law authorized various construction projects in selected areas or 'units' of the Colorado River Basin intended to reduce the salinity load in the Colorado River. One such area was the Grand Valley Salinity Control Unit in western Colorado. The U. S. Geological Survey has done extensive studies and research in the Grand Valley Salinity Control Unit that provide information to aid the U.S. Bureau of Reclamation and the Natural Resources Conservation Service in determining where salinity-control work may provide the best results, and to what extent salinity-control work was effective in reducing salinity concentrations and loads in the Colorado River. Previous studies have indicated that salinity concentrations and loads have been decreasing downstream from the Grand Valley Salinity Control Unit, and that the decreases are likely the result of salinity control work in these areas. Several of these reports; however, also document decreasing salinity loads upstream from the Grand Valley Salinity Control Unit. This finding was important because only a small amount of salinity-control work was being done in areas upstream from the Grand Valley Salinity Control Unit at the time the findings were reported (late 1990?s). As a result of those previous findings, the U.S. Bureau of Reclamation entered into a cooperative agreement with the U.S. Geological Survey to investigate salinity trends in selected areas bracketing the Grand Valley Salinity Control Unit and regions upstream from the Grand Valley Salinity Control Unit. The results of the study indicate that salinity loads were decreasing upstream from the Grand Valley Salinity Control Unit from 1986 through 2003, but the rates of decrease have slowed during the last 10 years. The average rate of decrease in salinity load upstream from the Grand Valley

Rehabilitation of the short pelvic floor. II: Treatment of the patient with the short pelvic floor.

Science.gov (United States)

FitzGerald, M P; Kotarinos, R

2003-10-01

Several urogynecologic syndromes are associated with the clinical finding of a short, painful, tender and weak pelvic floor and a variety of connective tissue abnormalities. Techniques for rehabilitation include the avoidance of perpetuating factors, rehabilitation of extrapelvic musculoskeletal abnormalities, the use of manual techniques and needling to promote resolution of connective tissue problems, closure of any diastasis recti, and transvaginal/transrectal manual release of muscular trigger points and contractures. Therapy can be facilitated by pudendal or epidural nerve block. Patients contribute to their success through home maintenance programs.

When is vertical integration profitable? Focus on a large upstream company in the gas market

International Nuclear Information System (INIS)

Hatlebakk, Magnus

2001-12-01

This note discusses basic economic mechanisms that may affect the profitability of vertical integration in the European gas industry. It concentrates on reasonable strategies for a large upstream company which considers a stronger engagement downstream. The note warns against the effect of simplified conclusions with regard to the impact of vertical integration. It applies a simple model of successive oligopolies to discuss double mark-ups, exclusions, barriers to entry, etc

Plutella xylostella granulovirus late gene promoter activity in the context of the Autographa californica multiple nucleopolyhedrovirus genome.

Science.gov (United States)

Ren, He-Lin; Hu, Yuan; Guo, Ya-Jun; Li, Lu-Lin

2016-06-01

Within Baculoviridae, little is known about the molecular mechanisms of replication in betabaculoviruses, despite extensive studies in alphabaculoviruses. In this study, the promoters of nine late genes of the betabaculovirus Plutella xylostella granulovirus (PlxyGV) were cloned into a transient expression vector and the alphabaculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV) genome, and compared with homologous late gene promoters of AcMNPV in Sf9 cells. In transient expression assays, all PlxyGV late promoters were activated in cells transfected with the individual reporter plasmids together with an AcMNPV bacmid. In infected cells, reporter gene expression levels with the promoters of PlxyGV e18 and AcMNPV vp39 and gp41 were significantly higher than those of the corresponding AcMNPV or PlxyGV promoters, which had fewer late promoter motifs. Observed expression levels were lower for the PlxyGV p6.9, pk1, gran, p10a, and p10b promoters than for the corresponding AcMNPV promoters, despite equal numbers of late promoter motifs, indicating that species-specific elements contained in some late promoters were favored by the native viral RNA polymerases for optimal transcription. The 8-nt sequence TAAATAAG encompassing the ATAAG motif was conserved in the AcMNPV polh, p10, and pk1 promoters. The 5-nt sequence CAATT located 4 or 5 nt upstream of the T/ATAAG motif was conserved in the promoters of PlxyGV gran, p10c, and pk1. The results of this study demonstrated that PlxyGV late gene promoters could be effectively activated by the RNA polymerase from AcMNPV, implying that late gene expression systems are regulated by similar mechanisms in alphabaculoviruses and betabaculoviruses.

Improving AVSWAT Stream Flow Simulation by Incorporating Groundwater Recharge Prediction in the Upstream Lesti Watershed, East Java, Indonesia

Directory of Open Access Journals (Sweden)

Christina Rahayuningtyas

2014-01-01

Full Text Available The upstream Lesti watershed is one of the major watersheds of East Java in Indonesia, covering about 38093 hectares. Although there are enough water resources to meet current demands in the basin, many challenges including high spatial and temporal variability in precipitation from year to year exist. It is essential to understand how the climatic condition affects Lesti River stream flow in each sub basin. This study investigated the applicability of using the Soil and Water Assessment Tool (SWAT with the incorporation of groundwater recharge prediction in stream flow simulation in the upstream Lesti watershed. Four observation wells in the upstream Lesti watershed were used to evaluate the seasonal and annual variations in the water level and estimate the groundwater recharge in the deep aquifer. The results show that annual water level rise was within the 2800 - 5700 mm range in 2007, 3900 - 4700 mm in 2008, 3200 - 5100 mm in 2009, and 2800 - 4600 mm in 2010. Based on the specific yield and the measured water level rise, the area-weighted groundwater predictions at the watershed outlet are 736, 820.9, 786.7, 306.4 mm in 2007, 2008, 2009, and 2010, respectively. The consistency test reveals that the R-square statistical value is greater than 0.7, and the DV (% ranged from 32 - 55.3% in 2007 - 2010. Overall, the SWAT model performs better in the wet season flow simulation than the dry season. It is suggested that the SWAT model needs to be improved for stream flow simulation in tropical regions.

Restructuring: new relationships between the oil companies and the upstream oil firms; Alliances et restructurations: nouvelles relations entre maitres d'oeuvre et parapetrolier

Energy Technology Data Exchange (ETDEWEB)

Barreau, S

2001-11-01

Since the 1986 oil shock, international oil companies have focused on their base competencies, concentrating on activities viewed as their core businesses and steadily increasing the number of tasks to be subcontracted to the upstream oil and gas service sector. The upstream oil and gas service companies had to be restructured to face this new challenge. The strategies they launched at the end of the 80's were varied. Some firms became largely integrated (Schlumberger, Baker Hughes, Halliburton) whereas other firms chose to broaden their range of services. However generally, they opted for external investment which led to an important wave of mergers and acquisitions. The first part characterizes the upstream oil and gas sector by introducing the main oil and gas service firms and their recent strategic evolution. This concludes with both an economic valuation and a typology of attempted growth strategies. To illustrate this, a matrix has been created to characterise the dynamic paths of the oil and gas service firms. The purpose of the second part is to consider the economic theories related to industrial strategies. The strategies of innovation, market protection, vertical integration and diversification have been studied to illustrate the main conclusion which is that the aim of all these strategies was to change the relationships between the oil companies and the upstream oil and gas service firms. (author)

Upregulation of DARS2 by HBV promotes hepatocarcinogenesis through the miR-30e-5p/MAPK/NFAT5 pathway.

Science.gov (United States)

Qin, Xian; Li, Changsheng; Guo, Tao; Chen, Jing; Wang, Hai-Tao; Wang, Yi-Tao; Xiao, Yu-Sha; Li, Jun; Liu, Pengpeng; Liu, Zhi-Su; Liu, Quan-Yan

2017-10-19

Infection with the hepatitis B virus (HBV) is closely associated with the development of hepatocellular carcinoma (HCC). The osmoregulatory transcription factor nuclear factor of activated T-cells 5 (NFAT5) has been shown to play an important role in the development of many types of human cancers. The role of NFAT5 in HBV-associated HCC has never previously been investigated. We compared expression profiles of NFAT5, DARS2 and miR-30e-5p in HCC samples, adjacent nontumor tissues and different hepatoma cell lines by quantitative real-time polymerase chain reaction and /or Western blot. Clinical data of HCC patients for up to 80 months were analyzed. The regulatory mechanisms upstream and convergent downstream pathways of NFAT5 in HBV-associated HCC were investigated by ChIP-seq, MSP, luciferase report assay and bioinformation anaylsis. We first found that higher levels of NFAT5 expression predict a good prognosis, suggesting that NFAT5 is a potential tumor-suppressing gene, and verified that NFAT5 promotes hepatoma cell apoptosis and inhibits cell growth in vitro. Second, our results showed that HBV could suppress NFAT5 expression by inducing hypermethylation of the AP1-binding site in the NFAT5 promoter in hepatoma cells. In addition, HBV also inhibited NFAT5 through miR-30e-5p targeted MAP4K4, and miR-30e-5p in turn inhibited HBV replication. Finally, we demonstrated that NFAT5 suppressed DARS2 by directly binding to its promoter. DARS2 was identified as an HCC oncogene that promotes HCC cell cycle progression and inhibits HCC cell apoptosis. HBV suppresses NFAT5 through the miR-30e-5p/mitogen-activated protein kinase (MAPK) signaling pathway upstream of NFAT5 and inhibits the NFAT5 to enhance HCC tumorigenesis via the downstream target genes of DARS2.

New Approaches for Moving Upstream: How State and Local Health Departments Can Transform Practice to Reduce Health Inequalities

Science.gov (United States)

Freudenberg, Nicholas; Franzosa, Emily; Chisholm, Janice; Libman, Kimberly

2015-01-01

Growing evidence shows that unequal distribution of wealth and power across race, class, and gender produces the differences in living conditions that are "upstream" drivers of health inequalities. Health educators and other public health professionals, however, still develop interventions that focus mainly on "downstream"…

Impact of Environmental Factors on Bacteriocin Promoter Activity in Gut-Derived Lactobacillus salivarius.

Science.gov (United States)

Guinane, Caitriona M; Piper, Clare; Draper, Lorraine A; O'Connor, Paula M; Hill, Colin; Ross, R Paul; Cotter, Paul D

2015-11-01

Bacteriocin production is regarded as a desirable probiotic trait that aids in colonization and persistence in the gastrointestinal tract (GIT). Strains of Lactobacillus salivarius, a species associated with the GIT, are regarded as promising probiotic candidates and have a number of associated bacteriocins documented to date. These include multiple class IIb bacteriocins (salivaricin T, salivaricin P, and ABP-118) and the class IId bacteriocin bactofencin A, which show activity against medically important pathogens. However, the production of a bacteriocin in laboratory media does not ensure production under stressful environmental conditions, such as those encountered within the GIT. To allow this issue to be addressed, the promoter regions located upstream of the structural genes encoding the L. salivarius bacteriocins mentioned above were fused to a number of reporter proteins (green fluorescent protein [GFP], red fluorescent protein [RFP], and luciferase [Lux]). Of these, only transcriptional fusions to GFP generated signals of sufficient strength to enable the study of promoter activity in L. salivarius. While analysis of the class IIb bacteriocin promoter regions indicated relatively weak GFP expression, assessment of the promoter of the antistaphylococcal bacteriocin bactofencin A revealed a strong promoter that is most active in the absence of the antimicrobial peptide and is positively induced in the presence of mild environmental stresses, including simulated gastric fluid. Taken together, these data provide information on factors that influence bacteriocin production, which will assist in the development of strategies to optimize in vivo and in vitro production of these antimicrobials. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

WRNIP1 functions upstream of DNA polymerase η in the UV-induced DNA damage response

Energy Technology Data Exchange (ETDEWEB)

Yoshimura, Akari, E-mail: akari_yo@stu.musashino-u.ac.jp [Molecular Cell Biology Laboratory, Research Institute of Pharmaceutical Sciences, Faculty of Pharmacy, Musashino University, 1-1-20 Shinmachi, Nishitokyo-shi, Tokyo 202-8585 (Japan); Kobayashi, Yume [Molecular Cell Biology Laboratory, Research Institute of Pharmaceutical Sciences, Faculty of Pharmacy, Musashino University, 1-1-20 Shinmachi, Nishitokyo-shi, Tokyo 202-8585 (Japan); Tada, Shusuke [Department of Medical Biochemistry, Faculty of Pharmaceutical Sciences, Toho University, 2-2-1 Miyama, Funabashi-shi, Chiba 274-8510 (Japan); Seki, Masayuki [Department of Biochemistry, Tohoku Pharmaceutical University, 4-4-1 Komatsushima, Aoba-ku, Sendai-shi, Miyagi 981-8558 (Japan); Enomoto, Takemi [Molecular Cell Biology Laboratory, Research Institute of Pharmaceutical Sciences, Faculty of Pharmacy, Musashino University, 1-1-20 Shinmachi, Nishitokyo-shi, Tokyo 202-8585 (Japan)

2014-09-12

Highlights: • The UV sensitivity of POLH{sup −/−} cells was suppressed by disruption of WRNIP1. • In WRNIP1{sup −/−/−}/POLH{sup −/−} cells, mutation frequencies and SCE after irradiation reduced. • WRNIP1 defect recovered rate of fork progression after irradiation in POLH{sup −/−} cells. • WRNIP1 functions upstream of Polη in the translesion DNA synthesis pathway. - Abstract: WRNIP1 (WRN-interacting protein 1) was first identified as a factor that interacts with WRN, the protein that is defective in Werner syndrome (WS). WRNIP1 associates with DNA polymerase η (Polη), but the biological significance of this interaction remains unknown. In this study, we analyzed the functional interaction between WRNIP1 and Polη by generating knockouts of both genes in DT40 chicken cells. Disruption of WRNIP1 in Polη-disrupted (POLH{sup −/−}) cells suppressed the phenotypes associated with the loss of Polη: sensitivity to ultraviolet light (UV), delayed repair of cyclobutane pyrimidine dimers (CPD), elevated frequency of mutation, elevated levels of UV-induced sister chromatid exchange (SCE), and reduced rate of fork progression after UV irradiation. These results suggest that WRNIP1 functions upstream of Polη in the response to UV irradiation.

Atmospheric emissions from the upstream oil and gas industry

International Nuclear Information System (INIS)

Taylor, B.G.S.

1994-01-01

The results are presented of a study set up to determine the nature and levels of atmospheric emissions resulting from United Kingdom oil and gas exploration and production activities. The study was commissioned by the UK Offshore Operators Association. Emissions by the upstream oil and gas industry of common pollutants, such as carbon monoxide, sulphur dioxide and nitrous oxide, and ozone depletion chemicals were shown in each case to be less than 1% of total UK emissions. Greenhouse gas emissions in the industry arise mainly from production operations with a small but significant contribution from onshore activities. Carbon dioxide is the major component followed in descending order by nitrogen oxides, methane and volatile organic compounds. In 1991, these emissions formed 3.2%, 4.6%, 2.9% and 2.8% of the UK totals respectively; overall this represented only about 3% of UK global warming emissions. The evidence of this study illustrates that the industry, which produces 67% of the UK's primary energy, is successfully managing its operations in an environmentally responsible way. (3 figures, 3 tables) (UK)

An integrated expression atlas of miRNAs and their promoters in human and mouse

DEFF Research Database (Denmark)

de Rie, Derek; Abugessaisa, Imad; Alam, Tanvir

2017-01-01

MicroRNAs (miRNAs) are short non-coding RNAs with key roles in cellular regulation. As part of the fifth edition of the Functional Annotation of Mammalian Genome (FANTOM5) project, we created an integrated expression atlas of miRNAs and their promoters by deep-sequencing 492 short RNA (sRNA) libr...

A fast wind-farm boundary-layer model to investigate gravity wave effects and upstream flow deceleration

Science.gov (United States)

Allaerts, Dries; Meyers, Johan

2017-11-01

Wind farm design and control often relies on fast analytical wake models to predict turbine wake interactions and associated power losses. Essential input to these models are the inflow velocity and turbulent intensity at hub height, which come from prior measurement campaigns or wind-atlas data. Recent LES studies showed that in some situations large wind farms excite atmospheric gravity waves, which in turn affect the upstream wind conditions. In the current study, we develop a fast boundary-layer model that computes the excitation of gravity waves and the perturbation of the boundary-layer flow in response to an applied force. The core of the model is constituted by height-averaged, linearised Navier-Stokes equations for the inner and outer layer, and the effect of atmospheric gravity waves (excited by the boundary-layer displacement) is included via the pressure gradient. Coupling with analytical wake models allows us to study wind-farm wakes and upstream flow deceleration in various atmospheric conditions. Comparison with wind-farm LES results shows excellent agreement in terms of pressure and boundary-layer displacement levels. The authors acknowledge support from the European Research Council (FP7-Ideas, Grant No. 306471).

NO formation in the burnout region of a partially premixed methane-air flame with upstream heat loss

Energy Technology Data Exchange (ETDEWEB)

Mokhov, A.V.; Levinsky, H.B.

1999-09-01

Measurements of temperature and NO concentration in laminar, partially premixed methane-air flames stabilized on a ceramic burner in coflow are reported. The NO concentration and temperature were determined by laser-induced fluorescence (LIF) and coherent anti-Stokes Raman scattering (CARS), respectively. Upstream heat loss to the burner was varied by changing the exit velocity of the fuel-air mixture at a constant equivalence ratio of 1,3; this alters the structure of the flame from an axisymmetric Bunsen-type to a strongly stabilized flat flame. To facilitate analysis of the results, a method is derived for separating the effects of dilution from those of chemical reaction based on the relation between the measured temperature and the local mixture fraction, including the effects of upstream heat loss. Using this method, the amount of NO formed during burnout of the hot, fuel-rich combustion products can be ascertained. In the Bunsen-type flame, it is seen that {approximately}40 ppm of NO are produced in this burnout region, at temperatures between {approximately}2,100 K and {approximately}1,900 K, probably via the Zeldovich mechanism. Reducing the exit velocity of 12 cm/s reduces the flame temperature substantially, and effectively eliminates this contribution. At velocities of 12 and 8 cm/s, {approximately}10 ppm of NO are formed in the burnout region, even though the gas temperatures are too low for Zeldovich NO to be significant. Although the mechanism responsible for these observations is as yet unclear, the results are consistent with the idea that the low temperatures in the fuel-rich gases caused by upstream heat loss retard the conversion of HCN (formed via the Fenimore mechanism) to NO, with this residual HCN then being converted to NO during burnout.

Landscape-based upstream-downstream prevalence of land-use/cover change drivers in southeastern rift escarpment of Ethiopia.

Science.gov (United States)

Temesgen, Habtamu; Wu, Wei; Legesse, Abiyot; Yirsaw, Eshetu; Bekele, Belew

2018-02-23

Characterized by high population density on a rugged topography, the Gedeo-Abaya landscape dominantly contains a multi-strata traditional agroforests showing the insight of Gedeo farmers on natural resource management practices. Currently, this area has been losing its resilience and is becoming unable to sustain its inhabitants. Based on both RS-derived and GIS-computed land-use/cover changes (LUCC) as well as socioeconomic validations, this article explored the LUCC and agroecological-based driver patterns in Gedeo-Abaya landscape from 1986 to 2015. A combination of geo-spatial technology and cross-sectional survey design were employed to detect the drivers behind these changes. The article discussed that LUCC and the prevalence of drivers are highly diverse and vary throughout agroecological zones. Except for the population, most downstream top drivers are perceived as insignificant in the upstream region and vice versa. In the downstream, land-use/cover (LUC) classes are more dynamic, diverse, and challenged by nearly all anticipated drivers than are upstream ones. Agroforestry LUC has been increasing (by 25% of its initial cover) and is becoming the predominant cover type, although socioeconomic analysis and related findings show its rapid LUC modification. A rapid reduction of woodland/shrubland (63%) occurred in the downstream, while wetland/marshy land increased threefold (158%), from 1986 to 2015 with annual change rates of - 3.7 and + 6%, respectively. Land degradation induced by changes in land use is a serious problem in Africa, especially in the densely populated sub-Saharan regions such as Ethiopia (FAO 2015). Throughout the landscape, LUCC is prominently affecting land-use system of the study landscape due to population pressure in the upstream region and drought/rainfall variability, agribusiness investment, and charcoaling in the downstream that necessitate urgent action.

Suspended sediments from upstream tributaries as the source of downstream river sites

Science.gov (United States)

Haddadchi, Arman; Olley, Jon

2014-05-01

Understanding the efficiency with which sediment eroded from different sources is transported to the catchment outlet is a key knowledge gap that is critical to our ability to accurately target and prioritise management actions to reduce sediment delivery. Sediment fingerprinting has proven to be an efficient approach to determine the sources of sediment. This study examines the suspended sediment sources from Emu Creek catchment, south eastern Queensland, Australia. In addition to collect suspended sediments from different sites of the streams after the confluence of tributaries and outlet of the catchment, time integrated suspended samples from upper tributaries were used as the source of sediment, instead of using hillslope and channel bank samples. Totally, 35 time-integrated samplers were used to compute the contribution of suspended sediments from different upstream waterways to the downstream sediment sites. Three size fractions of materials including fine sand (63-210 μm), silt (10-63 μm) and fine silt and clay (<10 μm) were used to find the effect of particle size on the contribution of upper sediments as the sources of sediment after river confluences. And then samples were analysed by ICP-MS and -OES to find 41 sediment fingerprints. According to the results of Student's T-distribution mixing model, small creeks in the middle and lower part of the catchment were major source in different size fractions, especially in silt (10-63 μm) samples. Gowrie Creek as covers southern-upstream part of the catchment was a major contributor at the outlet of the catchment in finest size fraction (<10 μm) Large differences between the contributions of suspended sediments from upper tributaries in different size fractions necessitate the selection of appropriate size fraction on sediment tracing in the catchment and also major effect of particle size on the movement and deposition of sediments.

Permitted water pollution discharges and population cancer and non-cancer mortality: toxicity weights and upstream discharge effects in US rural-urban areas.

Science.gov (United States)

Hendryx, Michael; Conley, Jamison; Fedorko, Evan; Luo, Juhua; Armistead, Matthew

2012-04-02

The study conducts statistical and spatial analyses to investigate amounts and types of permitted surface water pollution discharges in relation to population mortality rates for cancer and non-cancer causes nationwide and by urban-rural setting. Data from the Environmental Protection Agency's (EPA) Discharge Monitoring Report (DMR) were used to measure the location, type, and quantity of a selected set of 38 discharge chemicals for 10,395 facilities across the contiguous US. Exposures were refined by weighting amounts of chemical discharges by their estimated toxicity to human health, and by estimating the discharges that occur not only in a local county, but area-weighted discharges occurring upstream in the same watershed. Centers for Disease Control and Prevention (CDC) mortality files were used to measure age-adjusted population mortality rates for cancer, kidney disease, and total non-cancer causes. Analysis included multiple linear regressions to adjust for population health risk covariates. Spatial analyses were conducted by applying geographically weighted regression to examine the geographic relationships between releases and mortality. Greater non-carcinogenic chemical discharge quantities were associated with significantly higher non-cancer mortality rates, regardless of toxicity weighting or upstream discharge weighting. Cancer mortality was higher in association with carcinogenic discharges only after applying toxicity weights. Kidney disease mortality was related to higher non-carcinogenic discharges only when both applying toxicity weights and including upstream discharges. Effects for kidney mortality and total non-cancer mortality were stronger in rural areas than urban areas. Spatial results show correlations between non-carcinogenic discharges and cancer mortality for much of the contiguous United States, suggesting that chemicals not currently recognized as carcinogens may contribute to cancer mortality risk. The geographically weighted

Permitted water pollution discharges and population cancer and non-cancer mortality: toxicity weights and upstream discharge effects in US rural-urban areas

Directory of Open Access Journals (Sweden)

Hendryx Michael

2012-04-01

Full Text Available Abstract Background The study conducts statistical and spatial analyses to investigate amounts and types of permitted surface water pollution discharges in relation to population mortality rates for cancer and non-cancer causes nationwide and by urban-rural setting. Data from the Environmental Protection Agency's (EPA Discharge Monitoring Report (DMR were used to measure the location, type, and quantity of a selected set of 38 discharge chemicals for 10,395 facilities across the contiguous US. Exposures were refined by weighting amounts of chemical discharges by their estimated toxicity to human health, and by estimating the discharges that occur not only in a local county, but area-weighted discharges occurring upstream in the same watershed. Centers for Disease Control and Prevention (CDC mortality files were used to measure age-adjusted population mortality rates for cancer, kidney disease, and total non-cancer causes. Analysis included multiple linear regressions to adjust for population health risk covariates. Spatial analyses were conducted by applying geographically weighted regression to examine the geographic relationships between releases and mortality. Results Greater non-carcinogenic chemical discharge quantities were associated with significantly higher non-cancer mortality rates, regardless of toxicity weighting or upstream discharge weighting. Cancer mortality was higher in association with carcinogenic discharges only after applying toxicity weights. Kidney disease mortality was related to higher non-carcinogenic discharges only when both applying toxicity weights and including upstream discharges. Effects for kidney mortality and total non-cancer mortality were stronger in rural areas than urban areas. Spatial results show correlations between non-carcinogenic discharges and cancer mortality for much of the contiguous United States, suggesting that chemicals not currently recognized as carcinogens may contribute to cancer

Ion distributions in the Earth's foreshock upstream from the bow shock

Science.gov (United States)

Fuselier, S. A.

1995-01-01

A variety of suprathermal and energetic ion distributions are found upstream from shocks. Some distributions, such as field-aligned beams, are generated directly at the shock either through reflection processes or through leakage from the hotter downstream region. Other distributions, such as intermediate distributions, evolve from these parent distributions through wave-particle interactions. This paper reviews our current understanding of the creation and evolution of suprathermal distributions at shocks. Examples of suprathermal ion distributions are taken from observations at the Earth's bow shock. Particular emphasis is placed on the creation of field-aligned beams and specularly reflected ion distributions and on the evolution of these distributions in the Earth's ion foreshock. However, the results from this heavily studied region are applicable to interplanetary shocks, bow shocks at other planets, and comets.

Upstream magnetospheric ion flux tube within a magnetic cloud: Wind/STICS

Science.gov (United States)

Posner, Arik; Liemohn, Michael W.; Zurbuchen, Thomas H.

2003-03-01

We present a case study of a remarkable upstream O+ and N+ ion outflow event. We present observational evidence for spatially structured outflow of these Low Charge State Heavy Ions (LCSHIs) of magnetospheric origin along a small reconnected field line region within the framework of a magnetic cloud of an ICME. From the particles' in situ 3D distribution function we conclude that in this case the interaction of the outflow with the bow shock is small. We conclude further that the gyrophases of outflowing ions at the reconnection point are randomly distributed. This leads to the formation of a flux tube with a specific geometry. In particular, the outflow reveals spatial dispersion and non-gyrotropy. This result has implications for the size of the dayside reconnection site.

Designing a HER2/neu promoter to drive α1,3galactosyltransferase expression for targeted anti-αGal antibody-mediated tumor cell killing

International Nuclear Information System (INIS)

Lanteri, Marion; Ollier, Laurence; Giordanengo, Valérie; Lefebvre, Jean-Claude

2005-01-01

Our goal was to specifically render tumor cells susceptible to natural cytolytic anti-αGal antibodies by using a murine α1,3galactosyltransferase (mαGalT) transgene driven by a designed form of HER2/neu promoter (pNeu), the transcription of which is frequently observed to be above basal in breast tumors. Indeed, the αGalT activity that promotes Galα1,3Galβ1,4GlcNAc-R (αGal) epitope expression has been mutationally disrupted during the course of evolution, starting from Old World primates, and this has led to the counter-production of large amounts of cytotoxic anti-αGal antibodies in recent primates, including man. Expression of the endogenous c-erbB-2 gene was investigated in various cell lines by northern blotting. A mαGalT cDNA was constructed into pcDNA3 vector downstream of the original CMV promoter (pCMV/mαGalT) and various forms of pNeu were prepared by PCR amplification and inserted in the pCMV/mαGalT construct upstream of the mαGalT cDNA, in the place of the CMV promoter. These constructs were transferred into HEK-293 control and breast tumor cell lines. Stably transfected cells were analyzed by northern blotting for their expression of αGalT and c-erbB-2, and by flow cytometry for their binding with fluorescein isothiocyanate-conjugated Griffonia simplicifolia/isolectin B4. We show that expression of the mαGalT was up- or down-modulated according to the level of endogenous pNeu activity and the particular form of constructed pNeu. Among several constructs, two particular forms of the promoter, pNeu250 containing the CCAAT box and the PEA3 motif adjacent to the TATAA box, and pNeu664, which has three additional PEA3 motifs upstream of the CCAAT box, were found to promote differential αGalT expression. Our results strengthen current concepts about the crucial role played by the proximal PEA3 motif of pNeu, and may represent a novel therapeutic approach for the development of targeted transgene expression

Distribution Pattern of Fe, Sr, Zr and Ca Elements as Particle Size Function in the Code River Sediments from Upstream to Downstream

International Nuclear Information System (INIS)

Sri Murniasih; Muzakky

2007-01-01

The analysis of Fe, Sr, Zr and Ca elements concentration of granular sediment from upstream to downstream of Code river has been done. The aim of this research is to know the influence of particle size on the concentration of Fe, Sr, Zr and Ca elements in the Code river sediments from upstream to downstream and its distribution pattern. The instrument used was x-ray fluorescence with Si(Li) detector. Analysis results show that more Fe and Sr elements are very much found in 150 - 90 μm particle size, while Zr and Ca elements are very much found in < 90 μm particle size. Distribution pattern of Fe, Sr, Zr and Ca elements distribution in Code river sediments tends to increase relatively from upstream to downstream following its conductivity. The concentration of Fe, Sr, Zr and Ca elements are 1.49 ± 0.03 % - 5.93 ± 0.02 % ; 118.20 ± 10.73 ppm - 468.21 ± 20.36 ppm; 19.81 ppm ± 0.86 ppm - 76.36 ± 3.02 ppm and 3.22 ± 0.25 % - 11.40 ± 0.31 % successively. (author)

MicroRNA genes preferentially expressed in dendritic cells contain sites for conserved transcription factor binding motifs in their promoters

Directory of Open Access Journals (Sweden)

Huynen Martijn A

2011-06-01

Full Text Available Abstract Background MicroRNAs (miRNAs play a fundamental role in the regulation of gene expression by translational repression or target mRNA degradation. Regulatory elements in miRNA promoters are less well studied, but may reveal a link between their expression and a specific cell type. Results To explore this link in myeloid cells, miRNA expression profiles were generated from monocytes and dendritic cells (DCs. Differences in miRNA expression among monocytes, DCs and their stimulated progeny were observed. Furthermore, putative promoter regions of miRNAs that are significantly up-regulated in DCs were screened for Transcription Factor Binding Sites (TFBSs based on TFBS motif matching score, the degree to which those TFBSs are over-represented in the promoters of the up-regulated miRNAs, and the extent of conservation of the TFBSs in mammals. Conclusions Analysis of evolutionarily conserved TFBSs in DC promoters revealed preferential clustering of sites within 500 bp upstream of the precursor miRNAs and that many mRNAs of cognate TFs of the conserved TFBSs were indeed expressed in the DCs. Taken together, our data provide evidence that selected miRNAs expressed in DCs have evolutionarily conserved TFBSs relevant to DC biology in their promoters.

A nuclear factor I-like activity and a liver-specific repressor govern estrogen-regulated in vitro transcription from the Xenopus laevis vitellogenin B1 promoter.

Science.gov (United States)

Corthésy, B; Cardinaux, J R; Claret, F X; Wahli, W

1989-12-01

A hormone-controlled in vitro transcription system derived from Xenopus liver nuclear extracts was exploited to identify novel cis-acting elements within the vitellogenin gene B1 promoter region. In addition to the already well-documented estrogen-responsive element (ERE), two elements were found within the 140 base pairs upstream of the transcription initiation site. One of them, a negative regulatory element, is responsible for the lack of promoter activity in the absence of the hormone and, as demonstrated by DNA-binding assays, interacts with a liver-specific transcription factor. The second is required in association with the estrogen-responsive element to mediate hormonal induction and is recognized by the Xenopus liver homolog of nuclear factor I.

Effect of an upstream bulge configuration on film cooling with and without mist injection.

Science.gov (United States)

Wang, Jin; Li, Qianqian; Sundén, Bengt; Ma, Ting; Cui, Pei

2017-12-01

To meet the economic requirements of power output, the increased inlet temperature of modern gas turbines is above the melting point of the material. Therefore, high-efficient cooling technology is needed to protect the blades from the hot mainstream. In this study, film cooling was investigated in a simplified channel. A bulge located upstream of the film hole was numerically investigated by analysis of the film cooling effectiveness distribution downstream of the wall. The flow distribution in the plate channel is first presented. Comparing with a case without bulge, different cases with bulge heights of 0.1d, 0.3d and 0.5d were examined with blowing ratios of 0.5 and 1.0. Cases with 1% mist injection were also included in order to obtain better cooling performance. Results show that the bulge configuration located upstream the film hole makes the cooling film more uniform, and enhanceslateral cooling effectiveness. Unlike other cases, the configuration with a 0.3d-height bulge shows a good balance in improving the downstream and lateral cooling effectiveness. Compared with the case without mist at M = 0.5, the 0.3d-height bulge with 1% mist injection increases lateral average effectiveness by 559% at x/d = 55. In addition, a reduction of the thermal stress concentration can be obtained by increasing the height of the bulge configuration. Copyright © 2017 Elsevier Ltd. All rights reserved.

Comparison of accelerated ion populations observed upstream of the bow shocks at Venus and Mars

Directory of Open Access Journals (Sweden)

M. Yamauchi

2011-03-01

Full Text Available Foreshock ions are compared between Venus and Mars at energies of 0.6~20 keV using the same ion instrument, the Ion Mass Analyser, on board both Venus Express and Mars Express. Venus Express often observes accelerated protons (2~6 times the solar wind energy that travel away from the Venus bow shock when the spacecraft location is magnetically connected to the bow shock. The observed ions have a large field-aligned velocity compared to the perpendicular velocity in the solar wind frame, and are similar to the field-aligned beams and intermediate gyrating component of the foreshock ions in the terrestrial upstream region. Mars Express does not observe similar foreshock ions as does Venus Express, indicating that the Martian foreshock does not possess the intermediate gyrating component in the upstream region on the dayside of the planet. Instead, two types of gyrating protons in the solar wind frame are observed very close to the Martian quasi-perpendicular bow shock within a proton gyroradius distance. The first type is observed only within the region which is about 400 km from the bow shock and flows tailward nearly along the bow shock with a similar velocity as the solar wind. The second type is observed up to about 700 km from the bow shock and has a bundled structure in the energy domain. A traversal on 12 July 2005, in which the energy-bunching came from bundling in the magnetic field direction, is further examined. The observed velocities of the latter population are consistent with multiple specular reflections of the solar wind at the bow shock, and the ions after the second reflection have a field-aligned velocity larger than that of the de Hoffman-Teller velocity frame, i.e., their guiding center has moved toward interplanetary space out from the bow shock. To account for the observed peculiarity of the Martian upstream region, finite gyroradius effects of the solar wind protons compared to the radius of the bow shock curvature and

Folate deficiency facilitates recruitment of upstream binding factor to hot spots of DNA double-strand breaks of rRNA genes and promotes its transcription.

Science.gov (United States)

Xie, Qiu; Li, Caihua; Song, Xiaozhen; Wu, Lihua; Jiang, Qian; Qiu, Zhiyong; Cao, Haiyan; Yu, Kaihui; Wan, Chunlei; Li, Jianting; Yang, Feng; Huang, Zebing; Niu, Bo; Jiang, Zhengwen; Zhang, Ting

2017-03-17

The biogenesis of ribosomes in vivo is an essential process for cellular functions. Transcription of ribosomal RNA (rRNA) genes is the rate-limiting step in ribosome biogenesis controlled by environmental conditions. Here, we investigated the role of folate antagonist on changes of DNA double-strand breaks (DSBs) landscape in mouse embryonic stem cells. A significant DSB enhancement was detected in the genome of these cells and a large majority of these DSBs were found in rRNA genes. Furthermore, spontaneous DSBs in cells under folate deficiency conditions were located exclusively within the rRNA gene units, representing a H3K4me1 hallmark. Enrichment H3K4me1 at the hot spots of DSB regions enhanced the recruitment of upstream binding factor (UBF) to rRNA genes, resulting in the increment of rRNA genes transcription. Supplement of folate resulted in a restored UBF binding across DNA breakage sites of rRNA genes, and normal rRNA gene transcription. In samples from neural tube defects (NTDs) with low folate level, up-regulation of rRNA gene transcription was observed, along with aberrant UBF level. Our results present a new view by which alterations in folate levels affects DNA breakage through epigenetic control leading to the regulation of rRNA gene transcription during the early stage of development. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

The heptanucleotide motif GAGACGC is a key component of a cis-acting promoter element that is critical for SnSAG1 expression in Sarcocystis neurona.

Science.gov (United States)

Gaji, Rajshekhar Y; Howe, Daniel K

2009-07-01

The apicomplexan parasite Sarcocystis neurona undergoes a complex process of intracellular development, during which many genes are temporally regulated. The described study was undertaken to begin identifying the basic promoter elements that control gene expression in S. neurona. Sequence analysis of the 5'-flanking region of five S. neurona genes revealed a conserved heptanucleotide motif GAGACGC that is similar to the WGAGACG motif described upstream of multiple genes in Toxoplasma gondii. The promoter region for the major surface antigen gene SnSAG1, which contains three heptanucleotide motifs within 135 bases of the transcription start site, was dissected by functional analysis using a dual luciferase reporter assay. These analyses revealed that a minimal promoter fragment containing all three motifs was sufficient to drive reporter molecule expression, with the presence and orientation of the 5'-most heptanucleotide motif being absolutely critical for promoter function. Further studies should help to identify additional sequence elements important for promoter function and for controlling gene expression during intracellular development by this apicomplexan pathogen.

Promotion of Viral IRES-Mediated Translation Initiation under Mild Hypothermia.

Directory of Open Access Journals (Sweden)

Maria Licursi

Full Text Available Internal ribosome entry site (IRES-mediated translation is an essential replication step for certain viruses. As IRES-mediated translation is regulated differently from cap-dependent translation under various cellular conditions, we sought to investigate whether temperature influences efficiency of viral IRES-mediated translation initiation by using bicistronic reporter constructs containing an IRES element of encephalomyocarditis virus (EMCV, foot-and-mouth disease virus (FMDV, hepatitis C virus (HCV, human rhinovirus (HRV or poliovirus (PV. Under mild hypothermic conditions (30 and 35°C, we observed increases in the efficiency of translation initiation by HCV and HRV IRES elements compared to translation initiation at 37°C. The promotion of HRV IRES activity was observed as early as 2 hours after exposure to mild hypothermia. We also confirmed the promotion of translation initiation by HRV IRES under mild hypothermia in multiple cell lines. The expression levels and locations of polypyrimidine tract-binding protein (PTB and upstream of N-Ras (unr, the IRES trans-acting factors (ITAFs of HCV and HRV IRES elements, were not modulated by the temperature shift from 37°C to 30°C. Taken together, this study demonstrates that efficiency of translation initiation by some viral IRES elements is temperature dependent.

Downstream natural gas in Europe - high hopes dashed for upstream oil and gas companies

International Nuclear Information System (INIS)

Eikeland, P.O.

2007-01-01

Access for independents to retail gas markets was a central concern in European policy reform efforts in the 1990s. Upstream oil and gas companies reacted with strategic intentions of forward integration. By late 2004, forward integration was still weak, however. An important explanation of the gap between announced strategic re-orientation and actual strategy implementation lies in the political failure of EU member states to dismantle market barriers to entry for independents. Variations between companies in downstream strategy implementation are explained by variations in business opportunities and internal company factors. [Author

Downstream natural gas in Europe-High hopes dashed for upstream oil and gas companies

International Nuclear Information System (INIS)

Eikeland, Per Ove

2007-01-01

Access for independents to retail gas markets was a central concern in European policy reform efforts in the 1990s. Upstream oil and gas companies reacted with strategic intentions of forward integration. By late 2004, forward integration was still weak, however. An important explanation of the gap between announced strategic re-orientation and actual strategy implementation lies in the political failure of EU member states to dismantle market barriers to entry for independents. Variations between companies in downstream strategy implementation are explained by variations in business opportunities and internal company factors

Xylem specific activation of 5’ upstream regulatory region of two NAC transcription factors (MusaVND6 and MusaVND7) in banana is regulated by SNBE-like sites

Science.gov (United States)

2018-01-01

Deposition of secondary cell wall in the xylem elements is controlled by a subgroup of NAC (NAM, ATAF, CUC) family, known as vascular-related NAC transcription factors (VNDs). In the present study, we analyzed the 5’ upstream regulatory region of two banana NAC transcription factors (MusaVND6 and MusaVND7) for tissue specific expression and presence of 19-bp secondary-wall NAC binding element (SNBE)-like motifs. Transgenic banana plants of Musa cultivar Rasthali harboring either PMusaVND7::GUS or PMusaVND6::GUS showed specific GUS (β-D-Glucuronidase) activity in cells of the xylem tissue. Approximately 1.2kb promoter region of either MusaVND6 or MusaVND7 showed presence of at least two SNBE-like motifs. This 1.2kb promoter region was retarded in a gel shift assay by three banana VND protein (VND1,VND2 and VND3). The banana VND1-VND3 could also retard the mobility of isolated SNBE-like motifs of MusaVND6 or MusaVND7 in a gel shift assay. Transcript levels of MusaVND6 and MusaVND7 were elevated in transgenic banana overexpressing either banana VND1, VND2 or VND3. Present study suggested a probable regulation of banana VND6 and VND7 expression through direct interaction of banana VND1- VND3 with SNBE-like motifs. Our study also indicated two promoter elements for possible utilization in cell wall modifications in plants especially banana, which is being recently considered as a potential biofuel crop. PMID:29438404

Cloning and Functional Analysis of Phosphoethanolamine Methyltransferase Promoter from Maize (Zea mays L.

Directory of Open Access Journals (Sweden)

Gai-Li Niu

2018-01-01

Full Text Available Betaine, a non-toxic osmoprotectant, is believed to accumulate considerably in plants under stress conditions to maintain the osmotic pressure and promote a variety of processes involved in growth and development. Phosphoethanolamine N-methyltransferase (PEAMT, a key enzyme for betaine synthesis, is reported to be regulated by its upstream promoter. In the present investigation, by using the transgenic approach, a 1048 bp long promoter region of ZmPEAMT gene from Zea mays was cloned and functionally characterized in tobacco. Computational analysis affirmed the existence of abiotic stress responsive cis-elements like ABRE, MYC, HST, LST etc., as well as pathogen, wound and phytohormone responsive motifs. For transformation in tobacco, four 5′-deletion constructs of 826 bp (P2, 642 bp (P3, 428 bp (P4 and 245 bp (P5 were constructed from the 1048 bp (P1 promoter fragment. The transgenic plants generated through a single event exhibited a promising expression of GUS reporter protein in the leaf tissues of treated with salt, drought, oxidative and cold stress as well as control plants. The GUS expression level progressively reduced from P1 to P5 in the leaf tissues, whereas a maximal expression was observed with the P3 construct in the leaves of control plants. The expression of GUS was noted to be higher in the leaves of osmotically- or salt-treated transgenic plants than that in the untreated (control plants. An effective expression of GUS in the transgenic plants manifests that this promoter can be employed for both stress-inducible and constitutive expression of gene(s. Due to this characteristic, this potential promoter can be effectively used for genetic engineering of several crops.

Single-step generation of gene knockout-rescue system in pluripotent stem cells by promoter insertion with CRISPR/Cas9.

Science.gov (United States)

Matsunaga, Taichi; Yamashita, Jun K

2014-02-07

Specific gene knockout and rescue experiments are powerful tools in developmental and stem cell biology. Nevertheless, the experiments require multiple steps of molecular manipulation for gene knockout and subsequent rescue procedures. Here we report an efficient and single step strategy to generate gene knockout-rescue system in pluripotent stem cells by promoter insertion with CRISPR/Cas9 genome editing technology. We inserted a tetracycline-regulated inducible gene promoter (tet-OFF/TRE-CMV) upstream of the endogenous promoter region of vascular endothelial growth factor receptor 2 (VEGFR2/Flk1) gene, an essential gene for endothelial cell (EC) differentiation, in mouse embryonic stem cells (ESCs) with homologous recombination. Both homo- and hetero-inserted clones were efficiently obtained through a simple selection with a drug-resistant gene. The insertion of TRE-CMV promoter disrupted endogenous Flk1 expression, resulting in null mutation in homo-inserted clones. When the inserted TRE-CMV promoter was activated with doxycycline (Dox) depletion, Flk1 expression was sufficiently recovered from the downstream genomic Flk1 gene. Whereas EC differentiation was almost completely perturbed in homo-inserted clones, Flk1 rescue with TRE-CMV promoter activation restored EC appearance, indicating that phenotypic changes in EC differentiation can be successfully reproduced with this knockout-rescue system. Thus, this promoter insertion strategy with CRISPR/Cas9 would be a novel attractive method for knockout-rescue experiments. Copyright © 2014 Elsevier Inc. All rights reserved.

Developing a set of strong intronic promoters for robust metabolic engineering in oleaginous Rhodotorula (Rhodosporidium) yeast species.

Science.gov (United States)

Liu, Yanbin; Yap, Sihui Amy; Koh, Chong Mei John; Ji, Lianghui

2016-11-25

Red yeast species in the Rhodotorula/Rhodosporidium genus are outstanding producers of triacylglyceride and cell biomass. Metabolic engineering is expected to further enhance the productivity and versatility of these hosts for the production of biobased chemicals and fuels. Promoters with strong activity during oil-accumulation stage are critical tools for metabolic engineering of these oleaginous yeasts. The upstream DNA sequences of 6 genes involved in lipid biosynthesis or accumulation in Rhodotorula toruloides were studied by luciferase reporter assay. The promoter of perilipin/lipid droplet protein 1 gene (LDP1) displayed much stronger activity (4-11 folds) than that of glyceraldehyde-3-phosphate dehydrogenase gene (GPD1), one of the strongest promoters known in yeasts. Depending on the stage of cultivation, promoter of acetyl-CoA carboxylase gene (ACC1) and fatty acid synthase β subunit gene (FAS1) exhibited intermediate strength, displaying 50-160 and 20-90% levels of GPD1 promoter, respectively. Interestingly, introns significantly modulated promoter strength at high frequency. The incorporation of intron 1 and 2 of LDP1 (LDP1in promoter) enhanced its promoter activity by 1.6-3.0 folds. Similarly, the strength of ACC1 promoter was enhanced by 1.5-3.2 folds if containing intron 1. The intron 1 sequences of ACL1 and FAS1 also played significant regulatory roles. When driven by the intronic promoters of ACC1 and LDP1 (ACC1in and LDP1in promoter, respectively), the reporter gene expression were up-regulated by nitrogen starvation, independent of de novo oil biosynthesis and accumulation. As a proof of principle, overexpression of the endogenous acyl-CoA-dependent diacylglycerol acyltransferase 1 gene (DGA1) by LDP1in promoter was significantly more efficient than GPD1 promoter in enhancing lipid accumulation. Intronic sequences play an important role in regulating gene expression in R. toruloides. Three intronic promoters, LDP1in, ACC1in and FAS1in, are

Erythroid Kruppel-like factor (EKLF) is recruited to the γ-globin gene promoter as a co-activator and is required for γ-globin gene induction by short-chain fatty acid derivatives

Science.gov (United States)

Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.

2011-01-01

Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418

The Short- and Long-Run Marginal Cost Curve: A Pedagogical Note.

Science.gov (United States)

Sexton, Robert L.; And Others

1993-01-01

Contends that the standard description of the relationship between the long-run marginal cost curve and the short-run marginal cost curve is often misleading and imprecise. Asserts that a sampling of college-level textbooks confirms this confusion. Provides a definition and instructional strategy that can be used to promote student understanding…

Measuring and Promoting Acceptance of Young Children with Disabilities.

Science.gov (United States)

Favazza, Paddy C.; Phillipsen, Leslie; Kumar, Poonam

2000-01-01

Results of two studies indicate the Acceptance Scale for Kindergartners was reliable with a sample of minority, low socioeconomic status children and that children exposed to all of the components of an intervention designed to promote acceptance of young children with disabilities had short-term and long-term gains in acceptance. (Contains…

A minimal murine Msx-1 gene promoter. Organization of its cis-regulatory motifs and their role in transcriptional activation in cells in culture and in transgenic mice.

Science.gov (United States)

Takahashi, T; Guron, C; Shetty, S; Matsui, H; Raghow, R

1997-09-05

To dissect the cis-regulatory elements of the murine Msx-1 promoter, which lacks a conventional TATA element, a putative Msx-1 promoter DNA fragment (from -1282 to +106 base pairs (bp)) or its congeners containing site-specific alterations were fused to luciferase reporter and introduced into NIH3T3 and C2C12 cells, and the expression of luciferase was assessed in transient expression assays. The functional consequences of the sequential 5' deletions of the promotor revealed that multiple positive and negative regulatory elements participate in regulating transcription of the Msx-1 gene. Surprisingly, however, the optimal expression of Msx-1 promoter in either NIH3T3 or C2C12 cells required only 165 bp of the upstream sequence to warrant detailed examination of its structure. Therefore, the functional consequences of site-specific deletions and point mutations of the cis-acting elements of the minimal Msx-1 promoter were systematically examined. Concomitantly, potential transcriptional factor(s) interacting with the cis-acting elements of the minimal promoter were also studied by gel electrophoretic mobility shift assays and DNase I footprinting. Combined analyses of the minimal promoter by DNase I footprinting, electrophoretic mobility shift assays, and super shift assays with specific antibodies revealed that 5'-flanking regions from -161 to -154 and from -26 to -13 of the Msx-1 promoter contains an authentic E box (proximal E box), capable of binding a protein immunologically related to the upstream stimulating factor 1 (USF-1) and a GC-rich sequence motif which can bind to Sp1 (proximal Sp1), respectively. Additionally, we observed that the promoter activation was seriously hampered if the proximal E box was removed or mutated, and the promoter activity was eliminated completely if the proximal Sp1 site was similarly altered. Absolute dependence of the Msx-1 minimal promoter on Sp1 could be demonstrated by transient expression assays in the Sp1-deficient

MECP2 promoter methylation and X chromosome inactivation in autism.

Science.gov (United States)

Nagarajan, Raman P; Patzel, Katherine A; Martin, Michelle; Yasui, Dag H; Swanberg, Susan E; Hertz-Picciotto, Irva; Hansen, Robin L; Van de Water, Judy; Pessah, Isaac N; Jiang, Ruby; Robinson, Wendy P; LaSalle, Janine M

2008-06-01

Epigenetic mechanisms have been proposed to play a role in the etiology of autism. This hypothesis is supported by the discovery of increased MECP2 promoter methylation associated with decreased MeCP2 protein expression in autism male brain. To further understand the influence of female X chromosome inactivation (XCI) and neighboring methylation patterns on aberrant MECP2 promoter methylation in autism, multiple methylation analyses were peformed on brain and blood samples from individuals with autism. Bisulfite sequencing analyses of a region 0.6 kb upstream of MECP2 in brain DNA samples revealed an abrupt transition from a highly methylated region in both sexes to a region unmethylated in males and subject to XCI in females. Chromatin immunoprecipitation analysis demonstrated that the CCTC-binding factor (CTCF) bound to this transition region in neuronal cells, consistent with a chromatin boundary at the methylation transition. Male autism brain DNA samples displayed a slight increase in methylation in this transition region, suggesting a possible aberrant spreading of methylation into the MECP2 promoter in autism males across this boundary element. In addition, autistic female brain DNA samples showed evidence for aberrant MECP2 promoter methylation as an increase in the number of bisulfite sequenced clones with undefined XCI status for MECP2 but not androgen receptor (AR). To further investigate the specificity of MECP2 methylation alterations in autism, blood DNA samples from females and mothers of males with autism were also examined for XCI skewing at AR, but no significant increase in XCI skewing was observed compared to controls. These results suggest that the aberrant MECP2 methylation in autism brain DNA samples is due to locus-specific rather than global X chromosome methylation changes.

A Microarray-Based Analysis Reveals that a Short Photoperiod Promotes Hair Growth in the Arbas Cashmere Goat.

Directory of Open Access Journals (Sweden)

Bin Liu

Full Text Available Many animals exhibit different behaviors in different seasons. The photoperiod can have effects on migration, breeding, fur growth, and other processes. The cyclic growth of the fur and feathers of some species of mammals and birds, respectively, is stimulated by the photoperiod as a result of hormone-dependent regulation of the nervous system. To further examine this phenomenon, we evaluated the Arbas Cashmere goat (Capra hircus, a species that is often used in this type of research. The goats were exposed to an experimentally controlled short photoperiod to study the regulation of cyclic cashmere growth. Exposure to a short photoperiod extended the anagen phase of the Cashmere goat hair follicle to increase cashmere production. Assessments of tissue sections indicated that the short photoperiod significantly induced cashmere growth. This conclusion was supported by a comparison of the differences in gene expression between the short photoperiod and natural conditions using gene chip technology. Using the gene chip data, we identified genes that showed altered expression under the short photoperiod compared to natural conditions, and these genes were found to be involved in the biological processes of hair follicle growth, structural composition of the hair follicle, and the morphogenesis of the surrounding skin appendages. Knowledge about differences in the expression of these genes as well as their functions and periodic regulation patterns increases our understanding of Cashmere goat hair follicle growth. This study also provides preliminary data that may be useful for the development of an artificial method to improve cashmere production by controlling the light cycle, which has practical significance for livestock breeding.

Adaptive upstream rate adjustment by RSOA-ONU depending on different injection power of seeding light in standard-reach and long-reach PON systems

Science.gov (United States)

Yeh, C. H.; Chow, C. W.; Shih, F. Y.; Pan, C. L.

2012-08-01

The wavelength division multiplexing-time division multiplexing (WDM-TDM) passive optical network (PON) using reflective semiconductor optical amplifier (RSOA)-based colorless optical networking units (ONUs) is considered as a promising candidate for the realization of fiber-to-the-home (FTTH). And this architecture is actively considered by Industrial Technology Research Institute (ITRI) for the realization of FTTH in Taiwan. However, different fiber distances and optical components would introduce different power budgets to different ONUs in the PON. Besides, due to the aging of optical transmitter (Tx), the power decay of the distributed optical carrier from the central office (CO) could also reduce the injection power into each ONU. The situation will be more severe in the long-reach (LR) PON, which is considered as an option for the future access. In this work, we investigate a WDM-TDM PON using RSOA-based ONU for upstream data rate adjustment depending on different continuous wave (CW) injection powers. Both standard-reach (25 km) and LR (100 km) transmissions are evaluated. Moreover, a detail analysis of the upstream signal bit-error rate (BER) performances at different injection powers, upstream data rates, PON split-ratios under stand-reach and long-reach is presented.

Zebrafish hoxd4a acts upstream of meis1.1 to direct vasculogenesis, angiogenesis and hematopoiesis.

Directory of Open Access Journals (Sweden)

Aseervatham Anusha Amali

Full Text Available Mice lacking the 4th-group paralog Hoxd4 display malformations of the anterior vertebral column, but are viable and fertile. Here, we report that zebrafish embryos having decreased function of the orthologous hoxd4a gene manifest striking perturbations in vasculogenesis, angiogenesis and primitive and definitive hematopoiesis. These defects are preceded by reduced expression of the hemangioblast markers scl1, lmo2 and fli1 within the posterior lateral plate mesoderm (PLM at 13 hours post fertilization (hpf. Epistasis analysis revealed that hoxd4a acts upstream of meis1.1 but downstream of cdx4 as early as the shield stage in ventral-most mesoderm fated to give rise to hemangioblasts, leading us to propose that loss of hoxd4a function disrupts hemangioblast specification. These findings place hoxd4a high in a genetic hierarchy directing hemangioblast formation downstream of cdx1/cdx4 and upstream of meis1.1. An additional consequence of impaired hoxd4a and meis1.1 expression is the deregulation of multiple Hox genes implicated in vasculogenesis and hematopoiesis which may further contribute to the defects described here. Our results add to evidence implicating key roles for Hox genes in their initial phase of expression early in gastrulation.

Multiple distinct stimuli increase measured nucleosome occupancy around human promoters.

Directory of Open Access Journals (Sweden)

Chuong D Pham

Full Text Available Nucleosomes can block access to transcription factors. Thus the precise localization of nucleosomes relative to transcription start sites and other factor binding sites is expected to be a critical component of transcriptional regulation. Recently developed microarray approaches have allowed the rapid mapping of nucleosome positions over hundreds of kilobases (kb of human genomic DNA, although these approaches have not yet been widely used to measure chromatin changes associated with changes in transcription. Here, we use custom tiling microarrays to reveal changes in nucleosome positions and abundance that occur when hormone-bound glucocorticoid receptor (GR binds to sites near target gene promoters in human osteosarcoma cells. The most striking change is an increase in measured nucleosome occupancy at sites spanning ∼1 kb upstream and downstream of transcription start sites, which occurs one hour after addition of hormone, but is lost at 4 hours. Unexpectedly, this increase was seen both on GR-regulated and GR-non-regulated genes. In addition, the human SWI/SNF chromatin remodeling factor (a GR co-activator was found to be important for increased occupancy upon hormone treatment and also for low nucleosome occupancy without hormone. Most surprisingly, similar increases in nucleosome occupancy were also seen on both regulated and non-regulated promoters during differentiation of human myeloid leukemia cells and upon activation of human CD4+ T-cells. These results indicate that dramatic changes in chromatin structure over ∼2 kb of human promoters may occur genomewide and in response to a variety of stimuli, and suggest novel models for transcriptional regulation.

The economic impacts of the upstream activities after the reform of the Brazilian oil industry; Impactos economicos da exploracao e producao apos a abertura da industria petrolifera brasileira

Energy Technology Data Exchange (ETDEWEB)

Canelas, Andre [Universidade Federal, Rio de Janeiro, RJ (Brazil). Coordenacao dos Programas de Pos-graduacao de Engenharia. Programa de Planejamento Energetico

2004-07-01

This paper analyzes the macroeconomic impacts of the investments in the oil and gas upstream, which took place after the reform of the Brazilian oil industry. The reason why I chose to analyze such a period of time was the institutional change which took place in the Brazilian oil industry after the Brazilian Parliament approved Law n. 9.478 in 1997. The law represented the new regulation of the activities related to the oil industry in Brazil. Since then, there has been a very large amount of capital spending in the oil and gas upstream, not only by PETROBRAS, the state-owned oil company, but also by the oil companies which entered the Brazilian oil industry after it was opened to foreign and private upstream investments. This paper analyses the economic impacts of these upstream investments by PETROBRAS and by the new players in Brazil, addressing the impacts of these investments on the generation of aggregate value and yield and the economic activity of other industries. This paper is dedicated, in its entirety, to Prof. Carmen Alveal, whose knowledge, support, encouragement and friendship were, for me, the most important of all, professionally and morally. (author)

Upstream technology - onshore

International Nuclear Information System (INIS)

Wind, H.

1998-01-01

Ways in which the onshore petroleum industry can meet the challenges of technological development in the new century to allow the industry to operate in a sustainable fashion were discussed. Advances in the areas of emissions control, environment protection, production, process automation and in situ heavy oil production have been mentioned as the most important guarantors of sustainable development. Ongoing work to combat emissions includes: (1) electricity from flare gas, (2) flare performance, (3) waste gas injection, (4) zero gas emissions equipment for wells, and (5) enhanced coalbed methane recovery. From the vantage point of improving environmental performance, efforts to minimize surface disturbance, to treat drilling wastes, and to remediate sites with native plants have shown good results. Technology developments in production include: (1) downhole gas/water separation and downhole oil/water separation, (2) water coning control, and (3) pipelines. The most significant advances in automation are the increased use of SCADA monitoring systems and pump off controllers. The two most notable developments in the in situ heavy oil exploitation area are the Steam Assisted Gravity Drainage (SAGD) process and its variant, the Vapex process. The most successful pilot to date has been the AOSTRA Underground Test Facility project in Athabasca. Cooperative research in numerical simulations, tomographic imaging, carbon dioxide, solvent and steam experiments and methane injection work have been cited as the most promising among the collaborative projects promoted by the Canadian Oilsands Network for Research and Development (CONRAD)

The Promoter of AtUSP Is Co-regulated by Phytohormones and Abiotic Stresses in Arabidopsis thaliana.

Science.gov (United States)

Bhuria, Monika; Goel, Parul; Kumar, Sanjay; Singh, Anil K

2016-01-01

Universal stress proteins (USPs) are known to be expressed in response to various abiotic stresses in a wide variety of organisms, such as bacteria, archaebacteria, protists, algae, fungi, plants, and animals. However, in plants, biological function of most of the USPs still remains obscure. In the present study, Arabidopsis USP gene ( AtUSP ) showed induction in response to abscisic acid (ABA) and various abiotic stresses viz . heat, dehydration, salt, osmotic, and cold stresses. Additionally, in silico analysis of AtUSP promoter identified several cis -elements responsive to phytohormones and abiotic stresses such as ABRE, ERE, DRE, and HSE, etc. To functionally validate the AtUSP promoter, the 1115 bp region of promoter was characterized under phytohormone and abiotic stress treatments. Deletion analysis of promoter was carried out by cloning the full length promoter (D0) and its three 5' deletion derivatives, D1 (964 bp), D2 (660 bp), and D3 (503 bp) upstream of the β-glucuronidase (GUS) reporter gene, which were then stably transformed in Arabidopsis plants. The AtUSP promoter (D0) showed minimal activity under non-stress conditions which was enhanced in response to phytohormone treatments (ABA and ACC) and abiotic stresses such as dehydration, heat, cold, salt, and osmotic stresses. The seedlings harboring D1 and D2 deletion fragments showed constitutive GUS expression even under control condition with increased activity almost under all the treatments. However, D3 seedlings exhibited complete loss of activity under control condition with induction under ACC treatment, dehydration, heat, oxidative, salt, and osmotic stresses. Thus, present study clearly showed that AtUSP promoter is highly inducible by phytohormones and multiple abiotic stresses and it can be exploited as stress inducible promoter to generate multi-stress tolerant crops with minimal effects on their other important traits.

Using high-level construal and perceptions of changeability to promote self-change over self-protection motives in response to negative feedback.

Science.gov (United States)

Belding, Jennifer N; Naufel, Karen Z; Fujita, Kentaro

2015-06-01

Diagnostic negative information presents people with a motivational dilemma. Although negative feedback can provide useful information with which to guide future self-improvement efforts, it also presents short-term affective costs. We propose that construal level, jointly with the perceived changeability of the feedback domain, determines whether people choose to accept or dismiss such information. Whereas low-level construal promotes short-term self-protection motivation (promoting dismissal), high-level construal promotes long-term self-change motivation (promoting acceptance)--to the extent that change is perceived as possible. Four studies support this hypothesis and examine underlying cognitive and motivational mechanisms. The present work may provide an integrative theoretical framework for understanding when people will be open to and accept negative diagnostic information, and has important practical implications for promoting self-change efforts. © 2015 by the Society for Personality and Social Psychology, Inc.

Development of useful recombinant promoter and its expression analysis in different plant cells using confocal laser scanning microscopy.

Directory of Open Access Journals (Sweden)

Deepak Kumar

Full Text Available BACKGROUND: Designing functionally efficient recombinant promoters having reduced sequence homology and enhanced promoter activity will be an important step toward successful stacking or pyramiding of genes in a plant cell for developing transgenic plants expressing desired traits(s. Also basic knowledge regarding plant cell specific expression of a transgene under control of a promoter is crucial to assess the promoter's efficacy. METHODOLOGY/PRINCIPAL FINDINGS: We have constructed a set of 10 recombinant promoters incorporating different up-stream activation sequences (UAS of Mirabilis mosaic virus sub-genomic transcript (MS8, -306 to +27 and TATA containing core domains of Figwort mosaic virus sub-genomic transcript promoter (FS3, -271 to +31. Efficacies of recombinant promoters coupled to GUS and GFP reporter genes were tested in tobacco protoplasts. Among these, a 369-bp long hybrid sub-genomic transcript promoter (MSgt-FSgt showed the highest activity in both transient and transgenic systems. In a transient system, MSgt-FSgt was 10.31, 2.86 and 2.18 times more active compared to the CaMV35S, MS8 and FS3 promoters, respectively. In transgenic tobacco (Nicotiana tabaccum, var. Samsun NN and Arabidopsis plants, the MSgt-FSgt hybrid promoter showed 14.22 and 7.16 times stronger activity compared to CaMV35S promoter respectively. The correlation between GUS activity and uidA-mRNA levels in transgenic tobacco plants were identified by qRT-PCR. Both CaMV35S and MSgt-FSgt promoters caused gene silencing but the degree of silencing are less in the case of the MSgt-FSgt promoter compared to CaMV35S. Quantification of GUS activity in individual plant cells driven by the MSgt-FSgt and the CaMV35S promoter were estimated using confocal laser scanning microscopy and compared. CONCLUSION AND SIGNIFICANCE: We propose strong recombinant promoter MSgt-FSgt, developed in this study, could be very useful for high-level constitutive expression of transgenes in

FGF‐2 promotes osteocyte differentiation through increased E11/podoplanin expression

Science.gov (United States)

Ikpegbu, Ekele; Basta, Lena; Clements, Dylan N.; Fleming, Robert; Vincent, Tonia L.; Buttle, David J.; Pitsillides, Andrew A.; Farquharson, Colin

2018-01-01

E11/podoplanin is critical in the early stages of osteoblast‐to‐osteocyte transitions (osteocytogenesis), however, the upstream events which regulate E11 expression are unknown. The aim of this study was to examine the effects of FGF‐2 on E11‐mediated osteocytogenesis and to reveal the nature of the underlying signaling pathways regulating this process. Exposure of MC3T3 osteoblast‐like cells and murine primary osteoblasts to FGF‐2 (10 ng/ml) increased E11 mRNA and protein expression (p 70% reduction of basal E11 mRNA expression (p < 0.05) and effectively abrogated FGF‐2‐related changes in E11 expression and dendrite formation. FGF‐2 strongly activated the ERK signaling pathway in osteoblast‐like cells but inhibition of this pathway did not block the ability of FGF‐2 to enhance E11 expression or to promote acquisition of the osteocyte phenotype. The results of this study highlight a novel mechanism by which FGF‐2 can regulate osteoblast differentiation and osteocyte formation. Specifically, the data suggests that FGF‐2 promotes osteocytogenesis through increased E11 expression and further studies will identify if this regulatory pathway is essential for bone development and maintenance in health and disease. PMID:29215722

Identification of a novel promoter from banana aquaporin family gene (MaTIP1;2) which responses to drought and salt-stress in transgenic Arabidopsis thaliana.

Science.gov (United States)

Song, Shun; Xu, Yi; Huang, Dongmei; Miao, Hongxia; Liu, Juhua; Jia, Caihong; Hu, Wei; Valarezo, Ana Valeria; Xu, Biyu; Jin, Zhiqiang

2018-07-01

Drought and salt stresses often affect plant growth and crop yields. Identification of promoters involved in drought and salt stress responses is of great significance for genetic improvement of crop resistance. Our previous studies showed that aquaporin can respond to drought and salt stresses, but its promoter has not yet been reported in plants. In the present study, cis-acting elements of MaAQP family member promoters were systematically analyzed in banana. Expression of MaTIP1; 2 was induced by drought and salt stresses but not sensitive to cold stress, waterlogging stress, or mechanical damage, and its promoter contained five stress-related cis-acting elements. The MaTIP1; 2 promoter (841 bp upstream of translation initiation site) from banana (Musa acuminata L. AAA group cv. Brazilian) was isolated through genome walking polymerase chain reaction, and found to contain a TATA Box, CAAT box, ABRE element, CCGTCC box, CGTCA motif, and TCA element. Transformation of the MaTIP1; 2 promoter into Arabidopsis to assess its function indicated that it responds to both drought and salt stress treatments. These results suggest that MaTIP1; 2 utilization may improve drought and salt stresses resistance of the transgenic plants by promoting banana aquaporin expression. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

Colonic infusions of short-chain fatty acid mixtures promote energy metabolism in overweight/obese men

DEFF Research Database (Denmark)

Canfora, Emanuel E; van der Beek, Christina M; Jocken, Johan W E

2017-01-01

Short-chain fatty acids (SCFA), formed by microbial fermentation, are believed to be involved in the aetiology of obesity and diabetes. This study investigated the effects of colonic administration of physiologically relevant SCFA mixtures on human substrate and energy metabolism...

Automation and control trends in the upstream sector of the oil industry

Energy Technology Data Exchange (ETDEWEB)

Plucenio, Agustinho; Pagano, Daniel J. [Universidade Federal de Santa Catarina (UFSC), Florianopolis, SC (Brazil). Programa de Recursos Humanos da ANP em Automacao, Controle e Instrumentacao para a Industria do Petroleo e Gas, PRH-34

2004-07-01

The need to continuously improve the aspects of Health, Safety and Environment to operators, installation's security, optimization of oil reservoir recovery in wells operating with different artificial lift methods, subject to different secondary recovery techniques, has motivated the development of technologies in the automation and control for the upstream sector of the oil industry. While the application of control and automation techniques is well established in the downstream sector of the oil industry that is not the case in the downstream sector. One tendency in this sector is the utilization of control via Field bus Networks. This technology uses equipment that communicate with each other in a two wire digital network and can be programmed to execute function blocks algorithms designed to perform a designed control strategy. The most noticeable benefits are the improvements in the process performance and the equipment reusability and interoperability. Proprietary solutions can be replaced by systems composed of equipment supplied by different manufacturers connected in the same network. These equipment operate according to a strategy designed by automation and control engineers under the supervision of professionals working in computer terminals located in different company departments. Other gains are a better understanding about the industry processes, application of optimization techniques, fault detection, equipment maintenance follow-up, and improved operators working conditions and workers qualification. Other tendencies are: permanent well monitoring. Either with installation of down hole sensors based on fiber grating sensors or surface sensors using embedded electronic processors. Developments of instrumentation technology for low cost multiphase flow measurements. Application of control techniques for flow regime control and optimization of reservoir recovery through better identification, optimization and Model Based Predictive Control

Short-term Canadian natural gas deliverability 2008-2010 : an energy market assessment

International Nuclear Information System (INIS)

2008-10-01

This document examined the factors that affect gas supply in the short term and presented an outlook for deliverability through 2010. Its primary purpose was to advance public understanding of the short-term gas supply situation in Canada. For the past several years, Canadian natural gas has provided about 25 per cent of combined Canadian and U.S. production. Canadian gas deliverability remained within a narrow range from 2000 to mid-2007 at around 483 million cubic metres and has since begun to decline. About 98 per cent of the Canadian volume comes from the Western Canada Sedimentary Basin (WCSB), with most of the rest coming from Atlantic Canada. Although drilling and development activity in the WCSB has depended on the price of natural gas relative to costs, that price was influenced by uncertainties such as weather-driven market demand, changes in natural gas supply, cost, attractiveness of other basins, availability of imported liquefied natural gas and possible supply disruptions in the Gulf of Mexico. Shale gas and tight gas prospects in the Horn River and Montney plays of northeast British Columbia have attracted considerable interest from Canada's upstream industry. Early stages of shale gas development are also underway in Quebec and the Maritimes. However, the viability of large scale commercial development of shale gas in Canada has yet to be proven. In order to reflect the short-term uncertainty of the North American natural gas market, this report project deliverability under 3 cases that reflect different levels of drilling investment, namely reference case, high case and low case scenarios. 4 tabs., 12 figs

Short-term Canadian natural gas deliverability 2008-2010 : an energy market assessment

Energy Technology Data Exchange (ETDEWEB)

NONE

2008-10-15

This document examined the factors that affect gas supply in the short term and presented an outlook for deliverability through 2010. Its primary purpose was to advance public understanding of the short-term gas supply situation in Canada. For the past several years, Canadian natural gas has provided about 25 per cent of combined Canadian and U.S. production. Canadian gas deliverability remained within a narrow range from 2000 to mid-2007 at around 483 million cubic metres and has since begun to decline. About 98 per cent of the Canadian volume comes from the Western Canada Sedimentary Basin (WCSB), with most of the rest coming from Atlantic Canada. Although drilling and development activity in the WCSB has depended on the price of natural gas relative to costs, that price was influenced by uncertainties such as weather-driven market demand, changes in natural gas supply, cost, attractiveness of other basins, availability of imported liquefied natural gas and possible supply disruptions in the Gulf of Mexico. Shale gas and tight gas prospects in the Horn River and Montney plays of northeast British Columbia have attracted considerable interest from Canada's upstream industry. Early stages of shale gas development are also underway in Quebec and the Maritimes. However, the viability of large scale commercial development of shale gas in Canada has yet to be proven. In order to reflect the short-term uncertainty of the North American natural gas market, this report project deliverability under 3 cases that reflect different levels of drilling investment, namely reference case, high case and low case scenarios. 4 tabs., 12 figs.

Short-Chain Fatty Acids from Periodontal Pathogens Suppress Histone Deacetylases, EZH2, and SUV39H1 To Promote Kaposi's Sarcoma-Associated Herpesvirus Replication

Science.gov (United States)

Yu, Xiaolan; Shahir, Abdel-Malek; Sha, Jingfeng; Feng, Zhimin; Eapen, Betty; Nithianantham, Stanley; Das, Biswajit; Karn, Jonathan; Weinberg, Aaron; Bissada, Nabil F.

2014-01-01

ABSTRACT Periodontal pathogens such as Porphyromonas gingivalis and Fusobacterium nucleatum produce five different short-chain fatty acids (SCFAs) as metabolic by-products. We detect significantly higher levels of SCFAs in the saliva of patients with severe periodontal disease. The different SCFAs stimulate lytic gene expression of Kaposi's sarcoma-associated herpesvirus (KSHV) dose dependently and synergistically. SCFAs inhibit class-1/2 histone deacetylases (HDACs) and downregulate expression of silent information regulator-1 (SIRT1). SCFAs also downregulate expression of enhancer of zeste homolog2 (EZH2) and suppressor of variegation 3-9 homolog1 (SUV39H1), which are two histone N-lysine methyltransferases (HLMTs). By suppressing the different components of host epigenetic regulatory machinery, SCFAs increase histone acetylation and decrease repressive histone trimethylations to transactivate the viral chromatin. These new findings provide mechanistic support that SCFAs from periodontal pathogens stimulate KSHV replication and infection in the oral cavity and are potential risk factors for development of oral Kaposi's sarcoma (KS). IMPORTANCE About 20% of KS patients develop KS lesions first in the oral cavity, while other patients never develop oral KS. It is not known if the oral microenvironment plays a role in oral KS tumor development. In this work, we demonstrate that a group of metabolic by-products, namely, short-chain fatty acids, from bacteria that cause periodontal disease promote lytic replication of KSHV, the etiological agent associated with KS. These new findings provide mechanistic support that periodontal pathogens create a unique microenvironment in the oral cavity that contributes to KSHV replication and development of oral KS. PMID:24501407

Critical interactionism: an upstream-downstream approach to health care reform.

Science.gov (United States)

Martins, Diane Cocozza; Burbank, Patricia M

2011-01-01

Currently, per capita health care expenditures in the United States are more than 20% higher than any other country in the world and more than twice the average expenditure for European countries, yet the United States ranks 37th in life expectancy. Clearly, the health care system is not succeeding in improving the health of the US population with its focus on illness care for individuals. A new theoretical approach, critical interactionism, combines symbolic interactionism and critical social theory to provide a guide for addressing health care problems from both an upstream and downstream approach. Concepts of meaning from symbolic interactionism and emancipation from critical perspective move across system levels to inform and reform health care for individuals, organizations, and societies. This provides a powerful approach for health care reform, moving back and forth between the micro and macro levels. Areas of application to nursing practice with several examples (patients with obesity; patients who are lesbian, gay, bisexual, and transgender; workplace bullying and errors), nursing education, and research are also discussed.

Characterization and functional analyses of the human G protein-coupled receptor kinase 4 gene promoter.

Science.gov (United States)

Hasenkamp, Sandra; Telgmann, Ralph; Staessen, Jan A; Hagedorn, Claudia; Dördelmann, Corinna; Bek, Martin; Brand-Herrmann, Stefan-Martin; Brand, Eva

2008-10-01

The G protein-coupled receptor kinase 4 is involved in renal sodium handling and blood pressure regulation. Missense variants have already been tested functionally and are associated with hypertension, but no data on promoter analyses are yet available. We scanned 94 hypertensive white subjects for genetic variation and performed promoter reporter gene analyses in HEK293T, COS7, and SaOs-2 cells. Transient transfections with various full lengths and wild-type deletion constructs revealed that 1851 bp of the flanking region and 275 bp of the 5'-untranslated region were sufficient for transcriptional activities and composed a powerful cis-active element in the distal 293 bp. The -1702T and +2T alleles resulted in drastic general reductions of promoter function, whereas an activity increasing effect of +268C was cell type specific. Electrophoretic mobility-shift assay, supershift, and cotransfection analyses of transcription factor binding sites predicted in silico (Alibaba2.1/Transfac7) resulted in allele-specific binding patterns of nuclear proteins and identified the participation of CCAAT/enhancer-binding protein transcription factor family members. The G protein-coupled receptor kinase 4 core promoter resides in the first 1851 bp upstream of its transcription start site. The 4 identified genetic variants within this region exert allele-specific impact on both cell type- and stimulation-dependent transcription and may affect the expression balance of renal G protein-coupled receptor kinase 4.

What's in a message? Delivering sexual health promotion to young people in Australia via text messaging

Directory of Open Access Journals (Sweden)

Hellard Margaret E

2010-12-01

Full Text Available Abstract Background Advances in communication technologies have dramatically changed how individuals access information and communicate. Recent studies have found that mobile phone text messages (SMS can be used successfully for short-term behaviour change. However there is no published information examining the acceptability, utility and efficacy of different characteristics of health promotion SMS. This paper presents the results of evaluation focus groups among participants who received twelve sexual health related SMS as part of a study examining the impact of text messaging for sexual health promotion to on young people in Victoria, Australia. Methods Eight gender-segregated focus groups were held with 21 males and 22 females in August 2008. Transcripts of audio recordings were analysed using thematic analysis. Data were coded under one or more themes. Results Text messages were viewed as an acceptable and 'personal' means of health promotion, with participants particularly valuing the informal language. There was a preference for messages that were positive, relevant and short and for messages to cover a variety of topics. Participants were more likely to remember and share messages that were funny, rhymed and/or tied into particular annual events. The message broadcasting, generally fortnightly on Friday afternoons, was viewed as appropriate. Participants said the messages provided new information, a reminder of existing information and reduced apprehension about testing for sexually transmitted infections. Conclusions Mobile phones, in particular SMS, offer health promoters an exciting opportunity to engage personally with a huge number of individuals for low cost. The key elements emerging from this evaluation, such as message style, language and broadcast schedule are directly relevant to future studies using SMS for health promotion, as well as for future health promotion interventions in other mediums that require short formats, such

Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

Energy Technology Data Exchange (ETDEWEB)

Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

2015-07-28

Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

Synergistic activation of the CMV promoter by NF-κB P50 and PKG

International Nuclear Information System (INIS)

He Bin; Weber, Georg F.

2004-01-01

Several DNA binding NF-κB subunits are substrates for cGMP-dependent kinase (PKG) and their transactivation from cognate sites is induced by phosphorylation. This includes p50, which does not have a transcriptional activation domain and therefore needs to bind to other proteins to mediate gene expression. Here, we describe the synergistic transactivation by p50 and PKG from the CMV promoter. This is caused not only by phosphorylation of p50, leading to increased DNA binding, but also by PKG-dependent activation of CRE sites in the promoter. One of the CRE sites is located directly adjacent to a NF-κB site and is essential for p50-mediated induction of transcription. According to the binding of CREB to p50 in pull-down assays and according to the inhibition of p50-dependent transactivation by dominant-negative CREB, this reflects the formation of a transcription factor complex containing CREB and p50. The nuclear translocation of NF-κB is insufficient to distinguish among the multitude of promoters that harbor cognate recognition sites. The phosphorylation of multiple transcription factors by an upstream kinase, such as PKG, can lead to the formation of transcription factor complexes and differential transactivation from a subset of NF-κB sites. These interactions may be relevant for the activation of viral gene expression

Two rare deletions upstream of the NRXN1 gene (2p16.3) affecting the non-coding mRNA AK127244 segregate with diverse psychopathological phenotypes in a family

DEFF Research Database (Denmark)

Duong, L. T. T.; Hoeffding, L. K.; Petersen, K. B.

2015-01-01

127244 in addition to the pathogenic 15q11.2 deletion in distinct family members. The two deletions upstream of the NRXN1 gene were found to segregate with psychiatric disorders in the family and further similar deletions have been observed in patients diagnosed with autism spectrum disorder. Thus, we...... susceptibility. In this study, we describe a family affected by a wide range of psychiatric disorders including early onset schizophrenia, schizophreniform disorder, and affective disorders. Microarray analysis identified two rare deletions immediately upstream of the NRXN1 gene affecting the non-coding mRNA AK...... suggest that non-coding regions upstream of the NRXN1 gene affecting AK127244 might (as NRXN1) contain susceptibility regions for a wide spectrum of neuropsychiatric disorders. (C) 2015 Elsevier Masson SAS. All rights reserved....

Energy optimization for upstream data transfer in 802.15.4 beacon-enabled star formulation

Science.gov (United States)

Liu, Hua; Krishnamachari, Bhaskar

2008-08-01

Energy saving is one of the major concerns for low rate personal area networks. This paper models energy consumption for beacon-enabled time-slotted media accessing control cooperated with sleeping scheduling in a star network formulation for IEEE 802.15.4 standard. We investigate two different upstream (data transfer from devices to a network coordinator) strategies: a) tracking strategy: the devices wake up and check status (track the beacon) in each time slot; b) non-tracking strategy: nodes only wake-up upon data arriving and stay awake till data transmitted to the coordinator. We consider the tradeoff between energy cost and average data transmission delay for both strategies. Both scenarios are formulated as optimization problems and the optimal solutions are discussed. Our results show that different data arrival rate and system parameters (such as contention access period interval, upstream speed etc.) result in different strategies in terms of energy optimization with maximum delay constraints. Hence, according to different applications and system settings, different strategies might be chosen by each node to achieve energy optimization for both self-interested view and system view. We give the relation among the tunable parameters by formulas and plots to illustrate which strategy is better under corresponding parameters. There are two main points emphasized in our results with delay constraints: on one hand, when the system setting is fixed by coordinator, nodes in the network can intelligently change their strategies according to corresponding application data arrival rate; on the other hand, when the nodes' applications are known by the coordinator, the coordinator can tune the system parameters to achieve optimal system energy consumption.

On the upstream boundary of electron foreshocks in the solar wind

Science.gov (United States)

Zimbardo, G.; Veltri, P.

1995-01-01

The upstream boundary of electron foreshocks is defined as the path of the fastest electrons reflected by collisionless shocks and moving along the magnetic field in the solar wind. Considerable levels of magnetic fluctuations are found in these regions of the solar wind, and their effect is to create both a broadening and a fine structure of the electron foreshock boundary. The magnetic structure is studied by means of a 3-D numerical simulation of a turbulent magnetic field. Enhanced, anomalous diffusion is found, (Delta x(exp 2)) varies as s(sup alpha), where alpha is greater than 1 for typical values of the parameters (here, Delta x(exp 2) is the mean square width of the tangent magnetic surface and s is the field line length). This corresponds to a Levy flight regime for the magnetic field line random walk, and allows very efficient electron propagation perpendicular to the magnetic field. Implications on the observations of planetary foreshocks and of the termination shock foreshock are considered.

Polychlorinated Biphenyls (PCBs) in Catfish and Carp Collected from the Rio Grande Upstream and Downstream of Los Alamos National Laboratory: Revision 1

Energy Technology Data Exchange (ETDEWEB)

Gilbert J. Gonzales

2008-05-12

Concern has existed for years that the Los Alamos National Laboratory (LANL), a complex of nuclear weapons research and support facilities, has released polychlorinated biphenyls (PCBs) to the environment that may have reached adjacent bodies of water through canyons that connect them. In 1997, LANL's Ecology Group began measuring PCBs in fish in the Rio Grande upstream and downstream of ephemeral streams that cross LANL and later began sampling fish in Abiquiu and Cochiti reservoirs, which are situated on the Rio Chama and Rio Grande upstream and downstream of LANL, respectively. In 2002, we electroshocked channel catfish (Ictalurus punctatus) and common carp (Carpiodes carpio) in the Rio Grande upstream and downstream of LANL and analyzed fillets for PCB congeners. We also sampled soils along the Rio Chama and Rio Grande drainages to discern whether a background atmospheric source of PCBs that could impact surface water adjacent to LANL might exist. Trace concentrations of PCBs measured in soil (mean = 4.7E-05 {micro}g/g-ww) appear to be from background global atmospheric sources, at least in part, because the bimodal distribution of low-chlorinated PCB congeners and mid-chlorinated PCB congeners in the soil samples is interpreted to be typical of volatilized PCB congeners that are found in the atmosphere and dust from global fallout. Upstream catfish (n = 5) contained statistically (P = 0.047) higher concentrations of total PCBs (mean = 2.80E-02 {micro}g/g-ww) than downstream catfish (n = 10) (mean = 1.50E-02 {micro}g/g-ww). Similarly, upstream carp (n = 4) contained higher concentrations of total PCBs (mean = 7.98E-02 {micro}g/g-ww) than downstream carp (n = 4) (3.07E-02 {micro}g/g-ww); however, the difference was not statistically significant (P = 0.42). The dominant PCB homologue in all fish samples was hexachlorobiphenyls. Total PCB concentrations in fish in 2002 are lower than 1997; however, differences in analytical methods and other uncertainties

Health technology assessment demonstrates efficient health promotion bu Transcendental Meditation (TM)

DEFF Research Database (Denmark)

Larsen, Torben

2002-01-01

-actualisation; (3) Independence of stimulantia including tobacco and alcohol; (4) Cardiologic health. RESULTS: This health promotion is explained by a cybernetic model based on 'The Limbic System'. A sample of records collected by the Internet shows significant compliance between the self-reports of TM......-practitioners and controls without specific health promotion. The TM-group has a relative high level of education. TM is organized as a private, standardised dissemination of the original, Indoeuropean mantrameditation. This standardisation creates economies-of-scale 1) using local instructors with a short education, 2...

Upstream movements of Atlantic Salmon in the Lower Penobscot River, Maine following two dam removals and fish passage modifications

Science.gov (United States)

Izzo, Lisa K.; Maynard, George A.; Zydlewski, Joseph D.

2016-01-01

The Penobscot River Restoration Project (PRRP), to be completed in 2016, involved an extensive plan of dam removal, increases in hydroelectric capacity, and fish passage modifications to increase habitat access for diadromous species. As part of the PRRP, Great Works and Veazie dams were removed, making Milford Dam the first impediment to federally endangered Atlantic Salmon Salmo salar. Upstream habitat access for Atlantic Salmon is dependent upon successful and timely passage at Milford Dam because nearly all suitable spawning habitat is located upstream. In 2014 and 2015, a total of 73 adult salmon were radio-tagged to track their upstream movements through the Penobscot River to assess potential delays at (1) the dam remnants, (2) the confluence of the Stillwater Branch and the main stem of the Penobscot River below the impassable Orono Dam, and (3) the Milford Dam fish lift (installed in 2014). Movement rates through the dam remnants and the Stillwater confluence were comparable to open river reaches. Passage efficiency of the fish lift was high in both years (95% and 100%). However, fish experienced long delays at Milford Dam, with approximately one-third of fish taking more than a week to pass in each year, well below the Federal Energy Regulatory Commission passage standard of 95% within 48 h. Telemetry indicates most fish locate the fishway entrance within 5 h of arrival and were observed at the entrance at all hours of the day. These data indicate that overall transit times through the lower river were comparable to reported movement rates prior to changes to the Penobscot River due to the substantial delays seen at Milford Dam. The results of this study show that while adult Atlantic Salmon locate the new fish lift entrance quickly, passage of these fish was significantly delayed under 2014–2015 operations.

Heterologous and endogenous U6 snRNA promoters enable CRISPR/Cas9 mediated genome editing in Aspergillus niger.

Science.gov (United States)

Zheng, Xiaomei; Zheng, Ping; Sun, Jibin; Kun, Zhang; Ma, Yanhe

2018-01-01

U6 promoters have been used for single guide RNA (sgRNA) transcription in the clustered regularly interspaced short palindromic repeats/CRISPR-associated protein (CRISPR/Cas9) genome editing system. However, no available U6 promoters have been identified in Aspergillus niger, which is an important industrial platform for organic acid and protein production. Two CRISPR/Cas9 systems established in A. niger have recourse to the RNA polymerase II promoter or in vitro transcription for sgRNA synthesis, but these approaches generally increase cloning efforts and genetic manipulation. The validation of functional RNA polymerase II promoters is therefore an urgent need for A. niger . Here, we developed a novel CRISPR/Cas9 system in A. niger for sgRNA expression, based on one endogenous U6 promoter and two heterologous U6 promoters. The three tested U6 promoters enabled sgRNA transcription and the disruption of the polyketide synthase albA gene in A. niger . Furthermore, this system enabled highly efficient gene insertion at the targeted genome loci in A. niger using donor DNAs with homologous arms as short as 40-bp. This study demonstrated that both heterologous and endogenous U6 promoters were functional for sgRNA expression in A. niger . Based on this result, a novel and simple CRISPR/Cas9 toolbox was established in A. niger, that will benefit future gene functional analysis and genome editing.

Dehydrins from wheat x Thinopyrum ponticum amphiploid increase salinity and drought tolerance under their own inducible promoters without growth retardation.

Science.gov (United States)

Qin, Yu-Xiang; Qin, Fangyuan

2016-02-01

Dehydrins confer abiotic stress tolerance in seedlings, but few dehydrins have been studied by transgenic analysis under their own promoters in relation to abiotic stress tolerance. Also the inducible promoters for transgenic engineering are limited. In this study, we isolated from wheat three salt-induced YSK2 dehydrin genes and their promoters. The cDNA sequences were 711, 785, and 932 bp in length, encoding proteins containing 133, 166 and 231 amino acids, respectively, and were named TaDHN1, TaDHN2, and TaDHN3. TaDHN2 doesn't contain introns, while the other two genes each contain one. Semi-quantitative reverse transcription PCR analysis revealed all three dehydrin genes are substantially induced by ABA and NaCl, but only TaDHN2 is induced in seedlings by PEG and by cold (4 °C). Regulatory sequences upstream of the first translation codon (775, 1615 and 889 bp) of the three dehydrin genes were also cloned. Cis-element prediction indicated the presence of ABRE and other abiotic-stress-related elements. Histochemical analysis using GUS expression demonstrated that all three promoters were induced by ABA, cold or NaCl. Ectopic over-expression of TaDHN1 or TaDHN3 in Arabidopsis under their own inducible promoters enhanced NaCl- and drought-stress tolerance without growth retardation. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Understanding physical activity promotion in physiotherapy practice: A qualitative study.

Science.gov (United States)

Lowe, Anna; Littlewood, Chris; McLean, Sionnadh

2018-06-01

Physical inactivity is a major public health issue and healthcare professionals are encouraged to promote physical activity during routine patient contacts in order to reduce non-communicable diseases and enhance individuals' quality of life. Little is known about physical activity promotion in physiotherapy practice in the UK. The aim of this study was to better understand physiotherapists' experience of physical activity promotion in clinical practice. A qualitative study was undertaken comprising 12 telephone interviews with participants using a quota sampling approach. The qualitative data was analysed using a thematic analysis approach and written up according to COREQ guidelines. Four themes were identified (1) Current physiotherapy practice (2) Barriers to, and facilitators of physical activity promotion, (3) Exercise or physical activity? and (4) Functional restoration versus general wellbeing. Physiotherapists use routine clinical contacts to discuss physical activity. However, brief interventions are not consistently used and no common framework to guide physical activity promotion was identified. Approaches appear to be inconsistent and informal and focus largely on short-term restoration of function rather than health promotion. There is scope to improve practice in line with current guidance to maximise potential impact on inactivity. Copyright © 2018 Elsevier Ltd. All rights reserved.

JV Task 125-Mercury Measurement in Combustion Flue Gases Short Course

Energy Technology Data Exchange (ETDEWEB)

Dennis Laudal

2008-09-30

The short course, designed to train personnel who have an interest in measuring mercury in combustion flue gases, was held twice at the Drury Inn in Marion, Illinois. The short course helped to provide attendees with the knowledge necessary to avoid the many pitfalls that can and do occur when measuring mercury in combustion flue gases. The first short course, May 5-8, 2008, included both a classroom-type session and hands-on demonstration of mercury-sampling equipment. The hands-on demonstration of equipment was staged at Southern Illinois Power Cooperative. Not including the Illinois Clean Coal Institute and the U.S. Department of Energy project managers, there were 12 attendees. The second short course was conducted September 16-17, 2008, but only included the classroom portion of the course; 14 people attended. In both cases, lectures were provided on the various mercury measurement methods, and interaction between attendees and EERC research personnel to discuss specific mercury measurement problems was promoted. Overall, the response to the course was excellent.

Mutational studies reveal a complex set of positive and negative control elements within the chicken vitellogenin II promoter.

Science.gov (United States)

Seal, S N; Davis, D L; Burch, J B

1991-05-01

The endogenous chicken vitellogenin II (VTGII) gene is transcribed exclusively in hepatocytes in response to estrogen. We previously identified two estrogen response elements (EREs) upstream of this gene. We now present an analysis of the VTGII promoter activated by these EREs in response to estrogen. Chimeric VTGII-CAT genes were cotransfected into LMH chicken hepatoma cells along with an estrogen receptor expression vector, and transient CAT expression was assayed after culturing the cells in the absence or presence of estrogen. An analysis of constructs bearing deletions downstream of the more proximal ERE indicated that promoter elements relevant to transcription in LMH cells extend to between -113 and -96. The relative importance of sequences within the VTGII promoter was examined by using 10 contiguous linker scanner mutations spanning the region from -117 to -24. Although most of these mutations compromised VTGII promoter function, one dramatically increased expression in LMH cells and also rendered the VTGII promoter capable of being activated by cis-linked EREs in fibroblasts cotransfected with an estrogen receptor expression vector. Gel retardation and DNase I footprinting assays revealed four factor-binding sites within this promoter. We demonstrate that three of these sites bind C/EBP, SP1, and USF (or related factors), respectively; the fourth site binds a factor that we denote TF-V beta. The biological relevance of these findings is suggested by the fact that three of these binding sites map to sites previously shown to be occupied in vivo in response to estrogen.

Radionuclide concentrations in game and nongame fish upstream and downstream of Los Alamos National Laboratory: 1981 to 1993

International Nuclear Information System (INIS)

Fresquez, P.R.; Armstrong, D.R.; Salazar, J.G.

1994-08-01

Radionuclide concentrations were determined in game (surface-feeding) and nongame (bottom-feeding) fish collected from reservoirs upstream (Abiquiu, Heron, and El Vado) and downstream (Cochiti) of Los Alamos National Laboratory from 1981 to 1993. The average levels of 90 Sr, 137 Cs, 238 Pu, and 239 Pu in game and nongame fish collected from Cochiti reservoir were not significantly different in fish collected from reservoirs upstream of the Laboratory. Total uranium was the only radionuclide that was found to be significantly higher n both game and nongame fish from Cochiti as compared to fish from Abiquiu, Heron, and El Vado. Uranium concentrations in fish collected from Cochiti, however, significantly decreased from 1981 to 1993, and no evidence of depleted uranium was found in fish samples collected from Cochiti in 1993. Based on the average concentration of radionuclides over the year the effective (radiation) dose equivalent from consuming 46 lb of game fish and nongame fish from Cochiti reservoir after natural background has been subtracted was 0.005 and 0.009 mrem/yr, respectively. The highest dose was <0.01% of the International Commission on Radiological Protection (ICRP) permissible dose limit for protecting members of the public

Plasma and energetic particle structure upstream of a quasi-parallel interplanetary shock

Science.gov (United States)

Kennel, C. F.; Scarf, F. L.; Coroniti, F. V.; Russell, C. T.; Wenzel, K.-P.; Sanderson, T. R.; Van Nes, P.; Smith, E. J.; Tsurutani, B. T.; Scudder, J. D.

1984-01-01

ISEE 1, 2 and 3 data from 1978 on interplanetary magnetic fields, shock waves and particle energetics are examined to characterize a quasi-parallel shock. The intense shock studied exhibited a 640 km/sec velocity. The data covered 1-147 keV protons and electrons and ions with energies exceeding 30 keV in regions both upstream and downstream of the shock, and also the magnitudes of ion-acoustic and MHD waves. The energetic particles and MHD waves began being detected 5 hr before the shock. Intense halo electron fluxes appeared ahead of the shock. A closed magnetic field structure was produced with a front end 700 earth radii from the shock. The energetic protons were cut off from the interior of the magnetic bubble, which contained a markedly increased density of 2-6 keV protons as well as the shock itself.

Impact of upstream and downstream constraints on a signaling module’s ultrasensitivity

International Nuclear Information System (INIS)

Altszyler, Edgar; Chernomoretz, Ariel; Ventura, Alejandra; Colman-Lerner, Alejandro

2014-01-01

Much work has been done on the study of the biochemical mechanisms that result in ultrasensitive behavior of simple biochemical modules. However, in a living cell, such modules are embedded in a bigger network that constrains the range of inputs that the module will receive as well as the range of the module’s outputs that network will be able to detect. Here, we studied how the effective ultrasensitivity of a modular system is affected by these restrictions. We use a simple setup to explore to what extent the dynamic range spanned by upstream and downstream components of an ultrasensitive module impact on the effective sensitivity of the system. Interestingly, we found for some ultrasensitive motifs that dynamic range limitations imposed by downstream components can produce effective sensitivities much larger than that of the original module when considered in isolation. (paper)

Human Fanconi anemia monoubiquitination pathway promotes homologous DNA repair.

Science.gov (United States)

Nakanishi, Koji; Yang, Yun-Gui; Pierce, Andrew J; Taniguchi, Toshiyasu; Digweed, Martin; D'Andrea, Alan D; Wang, Zhao-Qi; Jasin, Maria

2005-01-25

Fanconi anemia (FA) is a recessive disorder characterized by congenital abnormalities, progressive bone-marrow failure, and cancer susceptibility. Cells from FA patients are hypersensitive to agents that produce DNA crosslinks and, after treatment with these agents, have pronounced chromosome breakage and other cytogenetic abnormalities. Eight FANC genes have been cloned, and the encoded proteins interact in a common cellular pathway. DNA-damaging agents activate the monoubiquitination of FANCD2, resulting in its targeting to nuclear foci that also contain BRCA1 and BRCA2/FANCD1, proteins involved in homology-directed DNA repair. Given the interaction of the FANC proteins with BRCA1 and BRCA2, we tested whether cells from FA patients (groups A, G, and D2) and mouse Fanca-/- cells with a targeted mutation are impaired for this repair pathway. We find that both the upstream (FANCA and FANCG) and downstream (FANCD2) FA pathway components promote homology-directed repair of chromosomal double-strand breaks (DSBs). The FANCD2 monoubiquitination site is critical for normal levels of repair, whereas the ATM phosphorylation site is not. The defect in these cells, however, is mild, differentiating them from BRCA1 and BRCA2 mutant cells. Surprisingly, we provide evidence that these proteins, like BRCA1 but unlike BRCA2, promote a second DSB repair pathway involving homology, i.e., single-strand annealing. These results suggest an early role for the FANC proteins in homologous DSB repair pathway choice.

A functional SNP upstream of the ADRB2 gene is associated with COPD

Directory of Open Access Journals (Sweden)

Li JX

2018-03-01

Full Text Available Jin-Xiu Li,1,2,* Wei-Ping Fu,3,* Jing Zhang,4 Xiao-Hua Zhang,1,2 Chang Sun,1,5 Lu-Ming Dai,3 Li Zhong,1,5,6 Li Yu,1,2 Ya-Ping Zhang1,7 1State Key Laboratory for Conservation and Utilization of Bio-Resource in Yunnan, 2Key Laboratory for Animal Genetic Diversity and Evolution of High Education in Yunnan Province, School of Life Sciences, Yunnan University, 3Department of Respiratory Critical Care Medicine, 4Department of Thoracic Surgery, The First Affiliated Hospital of Kunming Medical University, Kunming, 5College of Life Sciences, 6Provincial Demonstration Center for Experimental Biology Education, Shaanxi Normal University, Xi’an, 7State Key Laboratory of Genetic Resources and Evolution, and Yunnan Laboratory of Molecular Biology of Domestic Animals, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, China *These authors contributed equally to this work Background: Previous studies have suggested that β2-adrenergic receptor (ADRB2 is associated with COPD. However, the role of genetic polymorphisms in ADRB2 on COPD has not been evaluated yet. Methods: In this study, SNaPshot genotyping, luciferase assay, chromatin immunoprecipitation and real-time polymerase chain reaction were adopted to investigate the association between ADRB2 genetic polymorphisms and COPD, comprehensively. Results: One single nucleotide polymorphism (rs12654778, located upstream of ADRB2, showed a significant association with COPD by the logistic regression analysis after adjusting for age, sex and smoking history (p=0.04 in 200 COPD patients and 222 controls from southwest Chinese population. Furthermore, the luciferase assay indicated that rs12654778-A allele reduced the relative promoter activity by ~26% compared with rs12654778-G allele (p=0.0034. The chromatin immunoprecipitation analysis demonstrated that rs12654778 modulated the binding affinity of transcription factor neurofibromin 1. In addition, a significantly reduced expression of ADRB

White Sturgeon Mitigation and Restoration in the Columbia and Snake Rivers Upstream from Bonneville Dam; 2002-2003 Annual Report.

Energy Technology Data Exchange (ETDEWEB)

Ward, David L.; Kern, J. Chris; Hughes, Michele L. (Oregon Department of Fish and Wildlife)

2004-02-01

We report on our progress from April 2002 through March 2003 on determining the effects of mitigative measures on productivity of white sturgeon populations in the Columbia River downstream from McNary Dam, and on determining the status and habitat requirements of white sturgeon populations in the Columbia and Snake rivers upstream from McNary Dam.

White Sturgeon Mitigation and Restoration in the Columbia and Snake Rivers Upstream from Bonneville Dam; 2001-2002 Annual Report.

Energy Technology Data Exchange (ETDEWEB)

Ward, David L.; Kern, J. Chris; Hughes, Michele L.

2003-12-01

We report on our progress from April 2001 through March 2002 on determining the effects of mitigative measures on productivity of white sturgeon populations in the Columbia River downstream from McNary Dam, and on determining the status and habitat requirements of white sturgeon populations in the Columbia and Snake rivers upstream from McNary Dam.

ManA is regulated by RssAB signaling and promotes motility in Serratia marcescens.

Science.gov (United States)

Soo, Po-Chi; Horng, Yu-Tze; Chang, Yung-Lin; Tsai, Wei-Wen; Jeng, Wen-Yih; Lu, Chia-Chen; Lai, Hsin-Chih

2014-01-01

Serratia marcescens swarms on 0.8% LB agar at 30 °C but not at 37 °C. To understand the molecular mechanism regulating Serratia swarming, transposon mutagenesis was performed to screen for mutants that swarmed at 37 °C. In one mutant, S. marcescens WW100, the transposon was inserted in the upstream region of manA, which encodes mannose-6-phosphate isomerase, a type I phosphomannose isomerase. The transcriptional and translational levels of manA were higher in S. marcescens WW100 than in the wild-type strain. S. marcescens WW100 produced more serrawettin W1 (biosurfactant) than the wild-type, as detected by thin-layer chromatography, to promote surface motility by reducing surface tension. Serratia swarming was previously shown to be negatively regulated by the RssA-RssB two-component system. An electrophoretic mobility shift assay (EMSA) indicated that phosphorylated RssB (the response regulator) binds upstream of the transposon insertion site and manA in S. marcescens WW100. Analysis by real-time RT-PCR (qRT-PCR) revealed that, compared to the wild-type level, manA mRNA was increased in the rssA deletion mutant. The results indicated that RssA-RssB signaling directly represses the expression of manA and that overexpression of manA increases the production of serrawettin for Serratia swarming at 37 °C. Copyright © 2013 Institut Pasteur. All rights reserved.

Transactivation of a cellular promoter by the NS1 protein of the parvovirus minute virus of mice through a putative hormone-responsive element.

Science.gov (United States)

Vanacker, J M; Corbau, R; Adelmant, G; Perros, M; Laudet, V; Rommelaere, J

1996-01-01

The promoter of the thyroid hormone receptor alpha gene (c-erbA-1) is activated by the nonstructural protein 1 (NS1) of parvovirus minute virus of mice (prototype strain [MVMp]) in ras-transformed FREJ4 cells that are permissive for lytic MVMp replication. This stimulation may be related to the sensitivity of host cells to MVMp, as it does not take place in parental FR3T3 cells, which are resistant to the parvovirus killing effect. The analysis of a series of deletion and point mutants of the c-erbA-1 promoter led to the identification of an upstream region that is necessary for NS1-driven transactivation. This sequence harbors a putative hormone-responsive element and is sufficient to render a minimal promoter NS1 inducible in FREJ4 but not in FR3T3 cells, and it is involved in distinct interactions with proteins from the respective cell lines. The NS1-responsive element of the c-erbA-1 promoter bears no homology with sequences that were previously reported to be necessary for NS1 DNA binding and transactivation. Altogether, our data point to a novel, cell-specific mechanism of promoter activation by NS1. PMID:8642664

Genomic sequences of murine gamma B- and gamma C-crystallin-encoding genes: promoter analysis and complete evolutionary pattern of mouse, rat and human gamma-crystallins.

Science.gov (United States)

Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T

1993-12-22

The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.

The clinical impact of chromosomal rearrangements with breakpoints upstream of the SOX9 gene: two novel de novo balanced translocations associated with acampomelic campomelic dysplasia.

Science.gov (United States)

Fonseca, Ana Carolina S; Bonaldi, Adriano; Bertola, Débora R; Kim, Chong A; Otto, Paulo A; Vianna-Morgante, Angela M

2013-05-07

The association of balanced rearrangements with breakpoints near SOX9 [SRY (sex determining region Y)-box 9] with skeletal abnormalities has been ascribed to the presumptive altering of SOX9 expression by the direct disruption of regulatory elements, their separation from SOX9 or the effect of juxtaposed sequences. We report on two sporadic apparently balanced translocations, t(7;17)(p13;q24) and t(17;20)(q24.3;q11.2), whose carriers have skeletal abnormalities that led to the diagnosis of acampomelic campomelic dysplasia (ACD; MIM 114290). No pathogenic chromosomal imbalances were detected by a-CGH. The chromosome 17 breakpoints were mapped, respectively, 917-855 kb and 601-585 kb upstream of the SOX9 gene. A distal cluster of balanced rearrangements breakpoints on chromosome 17 associated with SOX9-related skeletal disorders has been mapped to a segment 932-789 kb upstream of SOX9. In this cluster, the breakpoint of the herein described t(17;20) is the most telomeric to SOX9, thus allowing the redefining of the telomeric boundary of the distal breakpoint cluster region related to skeletal disorders to 601-585 kb upstream of SOX9. Although both patients have skeletal abnormalities, the t(7;17) carrier presents with relatively mild clinical features, whereas the t(17;20) was detected in a boy with severe broncheomalacia, depending on mechanical ventilation. Balanced and unbalanced rearrangements associated with disorders of sex determination led to the mapping of a regulatory region of SOX9 function on testicular differentiation to a 517-595 kb interval upstream of SOX9, in addition to TESCO (Testis-specific enhancer of SOX9 core). As the carrier of t(17;20) has an XY sex-chromosome constitution and normal male development for his age, the segment of chromosome 17 distal to the translocation breakpoint should contain the regulatory elements for normal testis development. These two novel translocations illustrate the clinical variability in carriers of balanced

The serine protease inhibitor TLCK attenuates intrinsic death pathways in neurons upstream of mitochondrial demise.

Science.gov (United States)

Reuther, C; Ganjam, G K; Dolga, A M; Culmsee, C

2014-11-01

It is well-established that activation of proteases, such as caspases, calpains and cathepsins are essential components in signaling pathways of programmed cell death (PCD). Although these proteases have also been linked to mechanisms of neuronal cell death, they are dispensable in paradigms of intrinsic death pathways, e.g. induced by oxidative stress. However, emerging evidence implicated a particular role for serine proteases in mechanisms of PCD in neurons. Here, we investigated the role of trypsin-like serine proteases in a model of glutamate toxicity in HT-22 cells. In these cells glutamate induces oxytosis, a form of caspase-independent cell death that involves activation of the pro-apoptotic protein BH3 interacting-domain death agonist (Bid), leading to mitochondrial demise and ensuing cell death. In this model system, the trypsin-like serine protease inhibitor Nα-tosyl-l-lysine chloromethyl ketone hydrochloride (TLCK) inhibited mitochondrial damage and cell death. Mitochondrial morphology alterations, the impairment of the mitochondrial membrane potential and ATP depletion were prevented and, moreover, lipid peroxidation induced by glutamate was completely abolished. Strikingly, truncated Bid-induced cell death was not affected by TLCK, suggesting a detrimental activity of serine proteases upstream of Bid activation and mitochondrial demise. In summary, this study demonstrates the protective effect of serine protease inhibition by TLCK against oxytosis-induced mitochondrial damage and cell death. These findings indicate that TLCK-sensitive serine proteases play a crucial role in cell death mechanisms upstream of mitochondrial demise and thus, may serve as therapeutic targets in diseases, where oxidative stress and intrinsic pathways of PCD mediate neuronal cell death.

Multiple 5' ends of human cytomegalovirus UL57 transcripts identify a complex, cycloheximide-resistant promoter region that activates oriLyt

International Nuclear Information System (INIS)

Kiehl, Anita; Huang, Lili; Franchi, David; Anders, David G.

2003-01-01

The human cytomegalovirus (HCMV) UL57 gene lies adjacent to HCMV oriLyt, from which it is separated by an organizationally conserved, mostly noncoding region that is thought to both regulate UL57 expression and activate oriLyt function. However, the UL57 promoter has not been studied. We determined the 5' ends of UL57 transcripts toward an understanding of the potential relationship between UL57 expression and oriLyt activation. The results presented here identified three distinct 5' ends spread over 800 bp, at nt 90302, 90530, and 91138; use of these sites exhibited differential sensitivity to phosphonoformic acid treatment. Interestingly, a 10-kb UL57 transcript accumulated in cycloheximide-treated infected cells, even though other early transcripts were not detectable. However, the 10-kb transcript did not accumulate in cells treated with the more stringent translation inhibitor anisomycin. Consistent with the notion that the identified 5' ends arise from distinct transcription start sites, the sequences upstream of sites I and II functioned as promoters responsive to HCMV infection in transient assays. However, the origin-proximal promoter region III required downstream sequences for transcriptional activity. Mutation of candidate core promoter elements suggested that promoter III is regulated by an initiator region (Inr) and a downstream promoter element. Finally, a 42-bp sequence containing the candidate Inr activated a minimal oriLyt core construct in transient replication assays. Thus, these studies showed that a large, complex promoter region with novel features controls UL57 expression, and identified a sequence that regulates both UL57 transcription and oriLyt activation

Getting Ready for BepiColombo: A Modeling Approach to Infer the Solar Wind Plasma Parameters Upstream of Mercury from Magnetic Field Observations

Science.gov (United States)

Fatemi, S.; Poirier, N.; Holmström, M.; Wieser, M.; Barabash, S.

2018-05-01

We have developed a model to infer the solar wind plasma parameters upstream of Mercury from magnetic field observations in Mercury's magnetosphere. This is important for observations by MESSENGER and the future mission to Mercury, BepiColombo.

Functional groups of macro-benthos of selected sites of upstream of Hron River and Hnilec River

International Nuclear Information System (INIS)

Rufusova, A.

2011-01-01

The author used six functional groups of macro-benthos based on 'species traits', which are indicated with the Greek letters α to ζ. In the work authors applied this method to the macroinvertebrate communities of selected sites of upstream of the Hron River and the Hnilec River. The method appropriately captured increasing gradient of anthropogenic changes in the direction of the river continuum. Although the method was used for Slovak rivers for the first time, it seems to be promising for use in the future. (author)

Characterization of a transcriptional promoter of human papillomavirus 18 and modulation of its expression by simian virus 40 and adenovirus early antigens

International Nuclear Information System (INIS)

Thierry, F.; Heard, J.M.; Dartmann, K.; Yaniv, M.

1987-01-01

RNA present in cells derived from cervical carcinoma that contained human papillomavirus 18 genomes was initiated in the 1.053-kilobase BamHI fragment that covered the complete noncoding region of this virus. When cloned upstream of the chloramphenicol acetyltransferase gene, this viral fragment directed the expression of the bacterial enzyme only in the sense orientation. Initiation sites were mapped around the ATG of open reading frame E6. This promoter was active in some human and simian cell lines, and its expression was modulated positively by simian virus 40 large T antigen and negatively by adenovirus type 5 E1a antigen

A shared promoter region suggests a common ancestor for the human VCX/Y, SPANX, and CSAG gene families and the murine CYPT family

DEFF Research Database (Denmark)

Hansen, Martin A; Nielsen, John E; Retelska, Dorota

2008-01-01

, sequences corresponding to the shared promoter region of the CYPT family were identified at 39 loci. Most loci were located immediately upstream of genes belonging to the VCX/Y, SPANX, or CSAG gene families. Sequence comparison of the loci revealed a conserved CYPT promoter-like (CPL) element featuring TATA...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together......Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...

The ygaVP Genes of Escherichia coli Form a Tributyltin-Inducible Operon▿ †

OpenAIRE

Gueuné, Hervé; Durand, Marie-José; Thouand, Gérald; DuBow, Michael S.

2008-01-01

A tributyltin (TBT) luxAB transcriptional fusion in Escherichia coli revealed that a TBT-activated promoter is located upstream of two cotranscribed orphan genes, ygaV and ygaP. We demonstrate that transcription from the promoter upstream of ygaVP is constitutive in a ygaVP mutant, suggesting that YgaV is an autoregulated, TBT-inducible repressor.

The role of upstream distal electrodes in mitigating electrochemical degradation of ionic liquid ion sources

Science.gov (United States)

Brikner, Natalya; Lozano, Paulo C.

2012-11-01

Ionic liquid ion sources produce molecular ions from micro-tip emitters wetted with room-temperature molten salts. When a single ion polarity is extracted, counterions accumulate and generate electrochemical reactions that limit the source lifetime. The dynamics of double layer formation are reviewed and distal electrode contacts are introduced to resolve detrimental electrochemical decomposition effects at the micro-tip apex. By having the emitter follow the ionic liquid potential, operation can be achieved for an extended period of time with no apparent degradation of the material, indicating that electrochemistry can be curtailed and isolated to the upstream distal electrode.