Detecting remote sequence homology in disordered proteins: discovery of conserved motifs in the N-termini of Mononegavirales phosphoproteins.

Directory of Open Access Journals (Sweden)

David Karlin

Full Text Available Paramyxovirinae are a large group of viruses that includes measles virus and parainfluenza viruses. The viral Phosphoprotein (P plays a central role in viral replication. It is composed of a highly variable, disordered N-terminus and a conserved C-terminus. A second viral protein alternatively expressed, the V protein, also contains the N-terminus of P, fused to a zinc finger. We suspected that, despite their high variability, the N-termini of P/V might all be homologous; however, using standard approaches, we could previously identify sequence conservation only in some Paramyxovirinae. We now compared the N-termini using sensitive sequence similarity search programs, able to detect residual similarities unnoticeable by conventional approaches. We discovered that all Paramyxovirinae share a short sequence motif in their first 40 amino acids, which we called soyuz1. Despite its short length (11-16aa, several arguments allow us to conclude that soyuz1 probably evolved by homologous descent, unlike linear motifs. Conservation across such evolutionary distances suggests that soyuz1 plays a crucial role and experimental data suggest that it binds the viral nucleoprotein to prevent its illegitimate self-assembly. In some Paramyxovirinae, the N-terminus of P/V contains a second motif, soyuz2, which might play a role in blocking interferon signaling. Finally, we discovered that the P of related Mononegavirales contain similarly overlooked motifs in their N-termini, and that their C-termini share a previously unnoticed structural similarity suggesting a common origin. Our results suggest several testable hypotheses regarding the replication of Mononegavirales and suggest that disordered regions with little overall sequence similarity, common in viral and eukaryotic proteins, might contain currently overlooked motifs (intermediate in length between linear motifs and disordered domains that could be detected simply by comparing orthologous proteins.

Regulation of homologous recombination at telomeres in budding yeast

DEFF Research Database (Denmark)

Eckert-Boulet, Nadine; Lisby, Michael

2010-01-01

Homologous recombination is suppressed at normal length telomere sequences. In contrast, telomere recombination is allowed when telomeres erode in the absence of telomerase activity or as a consequence of nucleolytic degradation or incomplete replication. Here, we review the mechanisms that contr...... that contribute to regulating mitotic homologous recombination at telomeres and the role of these mechanisms in signalling short telomeres in the budding yeast Saccharomyces cerevisiae....

Short sequence motifs, overrepresented in mammalian conservednon-coding sequences

Energy Technology Data Exchange (ETDEWEB)

Minovitsky, Simon; Stegmaier, Philip; Kel, Alexander; Kondrashov,Alexey S.; Dubchak, Inna

2007-02-21

Background: A substantial fraction of non-coding DNAsequences of multicellular eukaryotes is under selective constraint. Inparticular, ~;5 percent of the human genome consists of conservednon-coding sequences (CNSs). CNSs differ from other genomic sequences intheir nucleotide composition and must play important functional roles,which mostly remain obscure.Results: We investigated relative abundancesof short sequence motifs in all human CNSs present in the human/mousewhole-genome alignments vs. three background sets of sequences: (i)weakly conserved or unconserved non-coding sequences (non-CNSs); (ii)near-promoter sequences (located between nucleotides -500 and -1500,relative to a start of transcription); and (iii) random sequences withthe same nucleotide composition as that of CNSs. When compared tonon-CNSs and near-promoter sequences, CNSs possess an excess of AT-richmotifs, often containing runs of identical nucleotides. In contrast, whencompared to random sequences, CNSs contain an excess of GC-rich motifswhich, however, lack CpG dinucleotides. Thus, abundance of short sequencemotifs in human CNSs, taken as a whole, is mostly determined by theiroverall compositional properties and not by overrepresentation of anyspecific short motifs. These properties are: (i) high AT-content of CNSs,(ii) a tendency, probably due to context-dependent mutation, of A's andT's to clump, (iii) presence of short GC-rich regions, and (iv) avoidanceof CpG contexts, due to their hypermutability. Only a small number ofshort motifs, overrepresented in all human CNSs are similar to bindingsites of transcription factors from the FOX family.Conclusion: Human CNSsas a whole appear to be too broad a class of sequences to possess strongfootprints of any short sequence-specific functions. Such footprintsshould be studied at the level of functional subclasses of CNSs, such asthose which flank genes with a particular pattern of expression. Overallproperties of CNSs are affected by

Isolation and amino acid sequence of a short-chain neurotoxin from an Australian elapid snake, Pseudechis australis.

OpenAIRE

Takasaki, C; Tamiya, N

1985-01-01

A short-chain neurotoxin Pseudechis australis a (toxin Pa a) was isolated from the venom of an Australian elapid snake Pseudechis australis (king brown snake) by sequential chromatography on CM-cellulose, Sephadex G-50 and CM-cellulose columns. Toxin Pa a has an LD50 (intravenous) value of 76 micrograms/kg body wt. in mice and consists of 62 amino acid residues. The amino acid sequence of Pa a shows considerable homology with those of short-chain neurotoxins of elapid snakes, especially of tr...

Structural organization of glycophorin A and B genes: Glycophorin B gene evolved by homologous recombination at Alu repeat sequences

International Nuclear Information System (INIS)

Kudo, Shinichi; Fukuda, Minoru

1989-01-01

Glycophorins A (GPA) and B (GPB) are two major sialoglycoproteins of the human erythrocyte membrane. Here the authors present a comparison of the genomic structures of GPA and GPB developed by analyzing DNA clones isolated from a K562 genomic library. Nucleotide sequences of exon-intron junctions and 5' and 3' flanking sequences revealed that the GPA and GPB genes consist of 7 and 5 exons, respectively, and both genes have >95% identical sequence from the 5' flanking region to the region ∼ 1 kilobase downstream from the exon encoding the transmembrane regions. In this homologous part of the genes, GPB lacks one exon due to a point mutation at the 5' splicing site of the third intron, which inactivates the 5' cleavage event of splicing and leads to ligation of the second to the fourth exon. Following these very homologous sequences, the genomic sequences for GPA and GPB diverge significantly and no homology can be detected in their 3' end sequences. The analysis of the Alu sequences and their flanking direct repeat sequences suggest that an ancestral genomic structure has been maintained in the GPA gene, whereas the GPB gene has arisen from the acquisition of 3' sequences different from those of the GPA gene by homologous recombination at the Alu repeats during or after gene duplication

Chemical shift homology in proteins

International Nuclear Information System (INIS)

Potts, Barbara C.M.; Chazin, Walter J.

1998-01-01

The degree of chemical shift similarity for homologous proteins has been determined from a chemical shift database of over 50 proteins representing a variety of families and folds, and spanning a wide range of sequence homologies. After sequence alignment, the similarity of the secondary chemical shifts of C α protons was examined as a function of amino acid sequence identity for 37 pairs of structurally homologous proteins. A correlation between sequence identity and secondary chemical shift rmsd was observed. Important insights are provided by examining the sequence identity of homologous proteins versus percentage of secondary chemical shifts that fall within 0.1 and 0.3 ppm thresholds. These results begin to establish practical guidelines for the extent of chemical shift similarity to expect among structurally homologous proteins

WeederH: an algorithm for finding conserved regulatory motifs and regions in homologous sequences

Directory of Open Access Journals (Sweden)

Pesole Graziano

2007-02-01

Full Text Available Abstract Background This work addresses the problem of detecting conserved transcription factor binding sites and in general regulatory regions through the analysis of sequences from homologous genes, an approach that is becoming more and more widely used given the ever increasing amount of genomic data available. Results We present an algorithm that identifies conserved transcription factor binding sites in a given sequence by comparing it to one or more homologs, adapting a framework we previously introduced for the discovery of sites in sequences from co-regulated genes. Differently from the most commonly used methods, the approach we present does not need or compute an alignment of the sequences investigated, nor resorts to descriptors of the binding specificity of known transcription factors. The main novel idea we introduce is a relative measure of conservation, assuming that true functional elements should present a higher level of conservation with respect to the rest of the sequence surrounding them. We present tests where we applied the algorithm to the identification of conserved annotated sites in homologous promoters, as well as in distal regions like enhancers. Conclusion Results of the tests show how the algorithm can provide fast and reliable predictions of conserved transcription factor binding sites regulating the transcription of a gene, with better performances than other available methods for the same task. We also show examples on how the algorithm can be successfully employed when promoter annotations of the genes investigated are missing, or when regulatory sites and regions are located far away from the genes.

Homology analyses of the protein sequences of fatty acid synthases from chicken liver, rat mammary gland, and yeast

International Nuclear Information System (INIS)

Chang, Soo-Ik; Hammes, G.G.

1989-01-01

Homology analyses of the protein sequences of chicken liver and rat mammary gland fatty acid synthases were carried out. The amino acid sequences of the chicken and rat enzymes are 67% identical. If conservative substitutions are allowed, 78% of the amino acids are matched. A region of low homologies exists between the functional domains, in particular around amino acid residues 1059-1264 of the chicken enzyme. Homologies between the active sites of chicken and rat and of chicken and yeast enzymes have been analyzed by an alignment method. A high degree of homology exists between the active sites of the chicken and rat enzymes. However, the chicken and yeast enzymes show a lower degree of homology. The DADPH-binding dinucleotide folds of the β-ketoacyl reductase and the enoyl reductase sites were identified by comparison with a known consensus sequence for the DADP- and FAD-binding dinucleotide folds. The active sites of all of the enzymes are primarily in hydrophobic regions of the protein. This study suggests that the genes for the functional domains of fatty acid synthase were originally separated, and these genes were connected to each other by using different connecting nucleotide sequences in different species. An alternative explanation for the differences in rat and chicken is a common ancestry and mutations in the joining regions during evolution

Cluster based on sequence comparison of homologous proteins of 95 organism species - Gclust Server | LSDB Archive [Life Science Database Archive metadata

Lifescience Database Archive (English)

Full Text Available List Contact us Gclust Server Cluster based on sequence comparison of homologous proteins of 95 organism spe...cies Data detail Data name Cluster based on sequence comparison of homologous proteins of 95 organism specie...istory of This Database Site Policy | Contact Us Cluster based on sequence compariso

CPHmodels-3.0--remote homology modeling using structure-guided sequence profiles.

Science.gov (United States)

Nielsen, Morten; Lundegaard, Claus; Lund, Ole; Petersen, Thomas Nordahl

2010-07-01

CPHmodels-3.0 is a web server predicting protein 3D structure by use of single template homology modeling. The server employs a hybrid of the scoring functions of CPHmodels-2.0 and a novel remote homology-modeling algorithm. A query sequence is first attempted modeled using the fast CPHmodels-2.0 profile-profile scoring function suitable for close homology modeling. The new computational costly remote homology-modeling algorithm is only engaged provided that no suitable PDB template is identified in the initial search. CPHmodels-3.0 was benchmarked in the CASP8 competition and produced models for 94% of the targets (117 out of 128), 74% were predicted as high reliability models (87 out of 117). These achieved an average RMSD of 4.6 A when superimposed to the 3D structure. The remaining 26% low reliably models (30 out of 117) could superimpose to the true 3D structure with an average RMSD of 9.3 A. These performance values place the CPHmodels-3.0 method in the group of high performing 3D prediction tools. Beside its accuracy, one of the important features of the method is its speed. For most queries, the response time of the server is web server is available at http://www.cbs.dtu.dk/services/CPHmodels/.

CMsearch: simultaneous exploration of protein sequence space and structure space improves not only protein homology detection but also protein structure prediction

KAUST Repository

Cui, Xuefeng

2016-06-15

Motivation: Protein homology detection, a fundamental problem in computational biology, is an indispensable step toward predicting protein structures and understanding protein functions. Despite the advances in recent decades on sequence alignment, threading and alignment-free methods, protein homology detection remains a challenging open problem. Recently, network methods that try to find transitive paths in the protein structure space demonstrate the importance of incorporating network information of the structure space. Yet, current methods merge the sequence space and the structure space into a single space, and thus introduce inconsistency in combining different sources of information. Method: We present a novel network-based protein homology detection method, CMsearch, based on cross-modal learning. Instead of exploring a single network built from the mixture of sequence and structure space information, CMsearch builds two separate networks to represent the sequence space and the structure space. It then learns sequence–structure correlation by simultaneously taking sequence information, structure information, sequence space information and structure space information into consideration. Results: We tested CMsearch on two challenging tasks, protein homology detection and protein structure prediction, by querying all 8332 PDB40 proteins. Our results demonstrate that CMsearch is insensitive to the similarity metrics used to define the sequence and the structure spaces. By using HMM–HMM alignment as the sequence similarity metric, CMsearch clearly outperforms state-of-the-art homology detection methods and the CASP-winning template-based protein structure prediction methods.

Amino acid sequences mediating vascular cell adhesion molecule 1 binding to integrin alpha 4: homologous DSP sequence found for JC polyoma VP1 coat protein

Directory of Open Access Journals (Sweden)

Michael Andrew Meyer

2013-07-01

Full Text Available The JC polyoma viral coat protein VP1 was analyzed for amino acid sequences homologies to the IDSP sequence which mediates binding of VLA-4 (integrin alpha 4 to vascular cell adhesion molecule 1. Although the full sequence was not found, a DSP sequence was located near the critical arginine residue linked to infectivity of the virus and binding to sialic acid containing molecules such as integrins (3. For the JC polyoma virus, a DSP sequence was found at residues 70, 71 and 72 with homology also noted for the mouse polyoma virus and SV40 virus. Three dimensional modeling of the VP1 molecule suggests that the DSP loop has an accessible site for interaction from the external side of the assembled viral capsid pentamer.

Bidirectional gene sequences with similar homology to functional proteins of alkane degrading bacterium pseudomonas fredriksbergensis DNA

International Nuclear Information System (INIS)

Megeed, A.A.

2011-01-01

The potential for two overlapping fragments of DNA from a clone of newly isolated alkanes degrading bacterium Pseudomonas frederiksbergensis encoding sequences with similar homology to two parts of functional proteins is described. One strand contains a sequence with high homology to alkanes monooxygenase (alkB), a member of the alkanes hydroxylase family, and the other strand contains a sequence with some homology to alcohol dehydrogenase gene (alkJ). Overlapping of the genes on opposite strands has been reported in eukaryotic species, and is now reported in a bacterial species. The sequence comparisons and ORFS results revealed that the regulation and the genes organization involved in alkane oxidation represented in Pseudomonas frederiksberghensis varies among the different known alkane degrading bacteria. The alk gene cluster containing homologues to the known alkane monooxygenase (alkB), and rubredoxin (alkG) are oriented in the same direction, whereas alcohol dehydrogenase (alkJ) is oriented in the opposite direction. Such genomes encode messages on both strands of the DNA, or in an overlapping but different reading frames, of the same strand of DNA. The possibility of creating novel genes from pre-existing sequences, known as overprinting, which is a widespread phenomenon in small viruses. Here, the origin and evolution of the gene overlap to bacteriophages belonging to the family Microviridae have been investigated. Such a phenomenon is most widely described in extremely small genomes such as those of viruses or small plasmids, yet here is a unique phenomenon. (author)

Single-cell template strand sequencing by Strand-seq enables the characterization of individual homologs

NARCIS (Netherlands)

Sanders, Ashley D; Falconer, Ester; Hills, Mark; Spierings, Diana C J; Lansdorp, Peter M.

The ability to distinguish between genome sequences of homologous chromosomes in single cells is important for studies of copy-neutral genomic rearrangements (such as inversions and translocations), building chromosome-length haplotypes, refining genome assemblies, mapping sister chromatid exchange

Short read sequence typing (SRST: multi-locus sequence types from short reads

Directory of Open Access Journals (Sweden)

Inouye Michael

2012-07-01

Full Text Available Abstract Background Multi-locus sequence typing (MLST has become the gold standard for population analyses of bacterial pathogens. This method focuses on the sequences of a small number of loci (usually seven to divide the population and is simple, robust and facilitates comparison of results between laboratories and over time. Over the last decade, researchers and population health specialists have invested substantial effort in building up public MLST databases for nearly 100 different bacterial species, and these databases contain a wealth of important information linked to MLST sequence types such as time and place of isolation, host or niche, serotype and even clinical or drug resistance profiles. Recent advances in sequencing technology mean it is increasingly feasible to perform bacterial population analysis at the whole genome level. This offers massive gains in resolving power and genetic profiling compared to MLST, and will eventually replace MLST for bacterial typing and population analysis. However given the wealth of data currently available in MLST databases, it is crucial to maintain backwards compatibility with MLST schemes so that new genome analyses can be understood in their proper historical context. Results We present a software tool, SRST, for quick and accurate retrieval of sequence types from short read sets, using inputs easily downloaded from public databases. SRST uses read mapping and an allele assignment score incorporating sequence coverage and variability, to determine the most likely allele at each MLST locus. Analysis of over 3,500 loci in more than 500 publicly accessible Illumina read sets showed SRST to be highly accurate at allele assignment. SRST output is compatible with common analysis tools such as eBURST, Clonal Frame or PhyloViz, allowing easy comparison between novel genome data and MLST data. Alignment, fastq and pileup files can also be generated for novel alleles. Conclusions SRST is a novel

Protein backbone angle restraints from searching a database for chemical shift and sequence homology

Energy Technology Data Exchange (ETDEWEB)

Cornilescu, Gabriel; Delaglio, Frank; Bax, Ad [National Institutes of Health, Laboratory of Chemical Physics, National Institute of Diabetes and Digestive and Kidney Diseases (United States)

1999-03-15

Chemical shifts of backbone atoms in proteins are exquisitely sensitive to local conformation, and homologous proteins show quite similar patterns of secondary chemical shifts. The inverse of this relation is used to search a database for triplets of adjacent residues with secondary chemical shifts and sequence similarity which provide the best match to the query triplet of interest. The database contains 13C{alpha}, 13C{beta}, 13C', 1H{alpha} and 15N chemical shifts for 20 proteins for which a high resolution X-ray structure is available. The computer program TALOS was developed to search this database for strings of residues with chemical shift and residue type homology. The relative importance of the weighting factors attached to the secondary chemical shifts of the five types of resonances relative to that of sequence similarity was optimized empirically. TALOS yields the 10 triplets which have the closest similarity in secondary chemical shift and amino acid sequence to those of the query sequence. If the central residues in these 10 triplets exhibit similar {phi} and {psi} backbone angles, their averages can reliably be used as angular restraints for the protein whose structure is being studied. Tests carried out for proteins of known structure indicate that the root-mean-square difference (rmsd) between the output of TALOS and the X-ray derived backbone angles is about 15 deg. Approximately 3% of the predictions made by TALOS are found to be in error.

Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.

Science.gov (United States)

Wyszyńska-Koko, J; Kurył, J

2004-01-01

MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.

MIPS: a database for protein sequences, homology data and yeast genome information.

Science.gov (United States)

Mewes, H W; Albermann, K; Heumann, K; Liebl, S; Pfeiffer, F

1997-01-01

The MIPS group (Martinsried Institute for Protein Sequences) at the Max-Planck-Institute for Biochemistry, Martinsried near Munich, Germany, collects, processes and distributes protein sequence data within the framework of the tripartite association of the PIR-International Protein Sequence Database (,). MIPS contributes nearly 50% of the data input to the PIR-International Protein Sequence Database. The database is distributed on CD-ROM together with PATCHX, an exhaustive supplement of unique, unverified protein sequences from external sources compiled by MIPS. Through its WWW server (http://www.mips.biochem.mpg.de/ ) MIPS permits internet access to sequence databases, homology data and to yeast genome information. (i) Sequence similarity results from the FASTA program () are stored in the FASTA database for all proteins from PIR-International and PATCHX. The database is dynamically maintained and permits instant access to FASTA results. (ii) Starting with FASTA database queries, proteins have been classified into families and superfamilies (PROT-FAM). (iii) The HPT (hashed position tree) data structure () developed at MIPS is a new approach for rapid sequence and pattern searching. (iv) MIPS provides access to the sequence and annotation of the complete yeast genome (), the functional classification of yeast genes (FunCat) and its graphical display, the 'Genome Browser' (). A CD-ROM based on the JAVA programming language providing dynamic interactive access to the yeast genome and the related protein sequences has been compiled and is available on request. PMID:9016498

Relative K-homology and normal operators

DEFF Research Database (Denmark)

Manuilov, Vladimir; Thomsen, Klaus

2009-01-01

-term exact sequence which generalizes the excision six-term exact sequence in the first variable of KK-theory. Subsequently we investigate the relative K-homology which arises from the group of relative extensions by specializing to abelian $C^*$-algebras. It turns out that this relative K-homology carries...

Two RNAs or DNAs May Artificially Fuse Together at a Short Homologous Sequence (SHS) during Reverse Transcription or Polymerase Chain Reactions, and Thus Reporting an SHS-Containing Chimeric RNA Requires Extra Caution

Science.gov (United States)

Xie, Bingkun; Yang, Wei; Ouyang, Yongchang; Chen, Lichan; Jiang, Hesheng; Liao, Yuying; Liao, D. Joshua

2016-01-01

Tens of thousands of chimeric RNAs have been reported. Most of them contain a short homologous sequence (SHS) at the joining site of the two partner genes but are not associated with a fusion gene. We hypothesize that many of these chimeras may be technical artifacts derived from SHS-caused mis-priming in reverse transcription (RT) or polymerase chain reactions (PCR). We cloned six chimeric complementary DNAs (cDNAs) formed by human mitochondrial (mt) 16S rRNA sequences at an SHS, which were similar to several expression sequence tags (ESTs).These chimeras, which could not be detected with cDNA protection assay, were likely formed because some regions of the 16S rRNA are reversely complementary to another region to form an SHS, which allows the downstream sequence to loop back and anneal at the SHS to prime the synthesis of its complementary strand, yielding a palindromic sequence that can form a hairpin-like structure.We identified a 16S rRNA that ended at the 4th nucleotide(nt) of the mt-tRNA-leu was dominant and thus should be the wild type. We also cloned a mouse Bcl2-Nek9 chimeric cDNA that contained a 5-nt unmatchable sequence between the two partners, contained two copies of the reverse primer in the same direction but did not contain the forward primer, making it unclear how this Bcl2-Nek9 was formed and amplified. Moreover, a cDNA was amplified because one primer has 4 nts matched to the template, suggesting that there may be many more artificial cDNAs than we have realized, because the nuclear and mt genomes have many more 4-nt than 5-nt or longer homologues. Altogether, the chimeric cDNAs we cloned are good examples suggesting that many cDNAs may be artifacts due to SHS-caused mis-priming and thus greater caution should be taken when new sequence is obtained from a technique involving DNA polymerization. PMID:27148738

Comparative genomic survey, exon-intron annotation and phylogenetic analysis of NAT-homologous sequences in archaea, protists, fungi, viruses, and invertebrates

Science.gov (United States)

We have previously published extensive genomic surveys [1-3], reporting NAT-homologous sequences in hundreds of sequenced bacterial, fungal and vertebrate genomes. We present here the results of our latest search of 2445 genomes, representing 1532 (70 archaeal, 1210 bacterial, 43 protist, 97 fungal,...

Top-Down-Assisted Bottom-Up Method for Homologous Protein Sequencing: Hemoglobin from 33 Bird Species

Science.gov (United States)

Song, Yang; Laskay, Ünige A.; Vilcins, Inger-Marie E.; Barbour, Alan G.; Wysocki, Vicki H.

2015-11-01

Ticks are vectors for disease transmission because they are indiscriminant in their feeding on multiple vertebrate hosts, transmitting pathogens between their hosts. Identifying the hosts on which ticks have fed is important for disease prevention and intervention. We have previously shown that hemoglobin (Hb) remnants from a host on which a tick fed can be used to reveal the host's identity. For the present research, blood was collected from 33 bird species that are common in the U.S. as hosts for ticks but that have unknown Hb sequences. A top-down-assisted bottom-up mass spectrometry approach with a customized searching database, based on variability in known bird hemoglobin sequences, has been devised to facilitate fast and complete sequencing of hemoglobin from birds with unknown sequences. These hemoglobin sequences will be added to a hemoglobin database and used for tick host identification. The general approach has the potential to sequence any set of homologous proteins completely in a rapid manner.

Establishment of screening technique for mutant cell and analysis of base sequence in the mutation

International Nuclear Information System (INIS)

Sofuni, Toshio; Nomi, Takehiko; Yamada, Masami; Masumura, Kenichi

2000-01-01

This research project aimed to establish an easy and quick detection method for radiation-induced mutation using molecular-biological techniques and an effective analyzing method for the molecular changes in base sequence. In this year, Spi mutants derived from γ-radiation exposed mouse were analyzed by PCR method and DNA sequence method. Male transgenic mice were exposed to γ-ray at 5,10, 50 Gy and the transgene was taken out from the genome DNA from the spleen in vivo packaging method. Spi mutant plaques were obtained by infecting the recovered phage to E. coli. Sequence analysis for the mutants was made using ALFred DNA sequencer and SequiTherm TM Long-Red Cycle sequencing kit. Sequence analysis was carried out for 41 of 50 independent Spi mutants obtained. The deletions were classified into 4 groups; Group 1 included 15 mutants that were characterized with a large deletion (43 bp-10 kb) with a short homologous sequence. Group 2 included 11 mutants of a large deletion having no homologous sequence at the connecting region. Group 3 included 11 mutants having a short deletion of less than 20 bp, which occurred in the non-repetitive sequence of gam gene and possibly caused by oxidative breakage of DNA or recombination of DNA fragment produced by the breakage. Group 4 included 4 mutants having deletions as short as 20 bp or less in the repetitive sequence of gam gene, resulting in an alteration of the reading frame. Thus, the synthesis of Gam protein was terminated by the appearance of TGA between code 13 and 14 of redB gene, leading to inactivation of gam gene and redBA gene. These results indicated that most of Spi mutants had a deletion in red/gam region and the deletions in more than half mutants occurred in homologous sequences as short as 8 bp. (M.N.)

The OGCleaner: filtering false-positive homology clusters.

Science.gov (United States)

Fujimoto, M Stanley; Suvorov, Anton; Jensen, Nicholas O; Clement, Mark J; Snell, Quinn; Bybee, Seth M

2017-01-01

Detecting homologous sequences in organisms is an essential step in protein structure and function prediction, gene annotation and phylogenetic tree construction. Heuristic methods are often employed for quality control of putative homology clusters. These heuristics, however, usually only apply to pairwise sequence comparison and do not examine clusters as a whole. We present the Orthology Group Cleaner (the OGCleaner), a tool designed for filtering putative orthology groups as homology or non-homology clusters by considering all sequences in a cluster. The OGCleaner relies on high-quality orthologous groups identified in OrthoDB to train machine learning algorithms that are able to distinguish between true-positive and false-positive homology groups. This package aims to improve the quality of phylogenetic tree construction especially in instances of lower-quality transcriptome assemblies. https://github.com/byucsl/ogcleaner CONTACT: sfujimoto@gmail.comSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Sequence homology and expression profile of genes associated with DNA repair pathways in Mycobacterium leprae.

Science.gov (United States)

Sharma, Mukul; Vedithi, Sundeep Chaitanya; Das, Madhusmita; Roy, Anindya; Ebenezer, Mannam

2017-01-01

Survival of Mycobacterium leprae, the causative bacteria for leprosy, in the human host is dependent to an extent on the ways in which its genome integrity is retained. DNA repair mechanisms protect bacterial DNA from damage induced by various stress factors. The current study is aimed at understanding the sequence and functional annotation of DNA repair genes in M. leprae. T he genome of M. leprae was annotated using sequence alignment tools to identify DNA repair genes that have homologs in Mycobacterium tuberculosis and Escherichia coli. A set of 96 genes known to be involved in DNA repair mechanisms in E. coli and Mycobacteriaceae were chosen as a reference. Among these, 61 were identified in M. leprae based on sequence similarity and domain architecture. The 61 were classified into 36 characterized gene products (59%), 11 hypothetical proteins (18%), and 14 pseudogenes (23%). All these genes have homologs in M. tuberculosis and 49 (80.32%) in E. coli. A set of 12 genes which are absent in E. coli were present in M. leprae and in Mycobacteriaceae. These 61 genes were further investigated for their expression profiles in the whole transcriptome microarray data of M. leprae which was obtained from the signal intensities of 60bp probes, tiling the entire genome with 10bp overlaps. It was noted that transcripts corresponding to all the 61 genes were identified in the transcriptome data with varying expression levels ranging from 0.18 to 2.47 fold (normalized with 16SrRNA). The mRNA expression levels of a representative set of seven genes ( four annotated and three hypothetical protein coding genes) were analyzed using quantitative Polymerase Chain Reaction (qPCR) assays with RNA extracted from skin biopsies of 10 newly diagnosed, untreated leprosy cases. It was noted that RNA expression levels were higher for genes involved in homologous recombination whereas the genes with a low level of expression are involved in the direct repair pathway. This study provided

Prediction and phylogenetic analysis of mammalian short interspersed elements (SINEs).

Science.gov (United States)

Rogozin, I B; Mayorov, V I; Lavrentieva, M V; Milanesi, L; Adkison, L R

2000-09-01

The presence of repetitive elements can create serious problems for sequence analysis, especially in the case of homology searches in nucleotide sequence databases. Repetitive elements should be treated carefully by using special programs and databases. In this paper, various aspects of SINE (short interspersed repetitive element) identification, analysis and evolution are discussed.

BLAST and FASTA similarity searching for multiple sequence alignment.

Science.gov (United States)

Pearson, William R

2014-01-01

BLAST, FASTA, and other similarity searching programs seek to identify homologous proteins and DNA sequences based on excess sequence similarity. If two sequences share much more similarity than expected by chance, the simplest explanation for the excess similarity is common ancestry-homology. The most effective similarity searches compare protein sequences, rather than DNA sequences, for sequences that encode proteins, and use expectation values, rather than percent identity, to infer homology. The BLAST and FASTA packages of sequence comparison programs provide programs for comparing protein and DNA sequences to protein databases (the most sensitive searches). Protein and translated-DNA comparisons to protein databases routinely allow evolutionary look back times from 1 to 2 billion years; DNA:DNA searches are 5-10-fold less sensitive. BLAST and FASTA can be run on popular web sites, but can also be downloaded and installed on local computers. With local installation, target databases can be customized for the sequence data being characterized. With today's very large protein databases, search sensitivity can also be improved by searching smaller comprehensive databases, for example, a complete protein set from an evolutionarily neighboring model organism. By default, BLAST and FASTA use scoring strategies target for distant evolutionary relationships; for comparisons involving short domains or queries, or searches that seek relatively close homologs (e.g. mouse-human), shallower scoring matrices will be more effective. Both BLAST and FASTA provide very accurate statistical estimates, which can be used to reliably identify protein sequences that diverged more than 2 billion years ago.

Scarless and sequential gene modification in Pseudomonas using PCR product flanked by short homology regions

Directory of Open Access Journals (Sweden)

Liang Rubing

2010-08-01

Full Text Available Abstract Background The lambda Red recombination system has been used to inactivate chromosomal genes in various bacteria and fungi. The procedure consists of electroporating a polymerase chain reaction (PCR fragment containing antibiotic cassette flanked by homology regions to the target locus into a strain that can express the lambda Red proteins (Gam, Bet, Exo. Results Here a scarless gene modification strategy based on the Red recombination system has been developed to modify Pseudomonas genome DNA via sequential deletion of multiple targets. This process was mediated by plasmid pRKaraRed encoding the Red proteins regulated by PBAD promoter, which was functional in P. aeruginosa as well as in other bacteria. First the target gene was substituted for the sacB-bla cassette flanked by short homology regions (50 bp, and then this marker gene cassette could be replaced by the PCR fragment flanking itself, generating target-deleted genome without any remnants and no change happened to the surrounding region. Twenty genes involved in the synthesis and regulation pathways of the phenazine derivate, pyocyanin, were modified, including one single-point mutation and deletion of two large operons. The recombination efficiencies ranged from 88% to 98%. Multiple-gene modification was also achieved, generating a triple-gene deletion strain PCA (PAO1, ΔphzHΔphzMΔphzS, which could produce another phenazine derivate, phenazine-1-carboxylic acid (PCA, efficiently and exclusively. Conclusions This lambda Red-based technique can be used to generate scarless and sequential gene modification mutants of P. aeruginosa efficiently, using one-step PCR product flanked by short homology regions. Single-point mutation, scarless deletion of genes can be achieved easily in less than three days. This method may give a new way to construct genetically modified P. aeruginosa strains more efficiently and advance the regulatory network study of this organism.

Lectures on functor homology

CERN Document Server

Touzé, Antoine

2015-01-01

This book features a series of lectures that explores three different fields in which functor homology (short for homological algebra in functor categories) has recently played a significant role. For each of these applications, the functor viewpoint provides both essential insights and new methods for tackling difficult mathematical problems. In the lectures by Aurélien Djament, polynomial functors appear as coefficients in the homology of infinite families of classical groups, e.g. general linear groups or symplectic groups, and their stabilization. Djament’s theorem states that this stable homology can be computed using only the homology with trivial coefficients and the manageable functor homology. The series includes an intriguing development of Scorichenko’s unpublished results. The lectures by Wilberd van der Kallen lead to the solution of the general cohomological finite generation problem, extending Hilbert’s fourteenth problem and its solution to the context of cohomology. The focus here is o...

Sequence homology and expression profile of genes associated with dna repair pathways in Mycobacterium leprae

Directory of Open Access Journals (Sweden)

Mukul Sharma

2017-01-01

Full Text Available Background: Survival of Mycobacterium leprae, the causative bacteria for leprosy, in the human host is dependent to an extent on the ways in which its genome integrity is retained. DNA repair mechanisms protect bacterial DNA from damage induced by various stress factors. The current study is aimed at understanding the sequence and functional annotation of DNA repair genes in M. leprae. Methods: T he genome of M. leprae was annotated using sequence alignment tools to identify DNA repair genes that have homologs in Mycobacterium tuberculosis and Escherichia coli. A set of 96 genes known to be involved in DNA repair mechanisms in E. coli and Mycobacteriaceae were chosen as a reference. Among these, 61 were identified in M. leprae based on sequence similarity and domain architecture. The 61 were classified into 36 characterized gene products (59%, 11 hypothetical proteins (18%, and 14 pseudogenes (23%. All these genes have homologs in M. tuberculosis and 49 (80.32% in E. coli. A set of 12 genes which are absent in E. coli were present in M. leprae and in Mycobacteriaceae. These 61 genes were further investigated for their expression profiles in the whole transcriptome microarray data of M. leprae which was obtained from the signal intensities of 60bp probes, tiling the entire genome with 10bp overlaps. Results: It was noted that transcripts corresponding to all the 61 genes were identified in the transcriptome data with varying expression levels ranging from 0.18 to 2.47 fold (normalized with 16SrRNA. The mRNA expression levels of a representative set of seven genes ( four annotated and three hypothetical protein coding genes were analyzed using quantitative Polymerase Chain Reaction (qPCR assays with RNA extracted from skin biopsies of 10 newly diagnosed, untreated leprosy cases. It was noted that RNA expression levels were higher for genes involved in homologous recombination whereas the genes with a low level of expression are involved in the

Molecular cloning, sequence analysis and homology modeling of the first caudata amphibian antifreeze-like protein in axolotl (Ambystoma mexicanum).

Science.gov (United States)

Zhang, Songyan; Gao, Jiuxiang; Lu, Yiling; Cai, Shasha; Qiao, Xue; Wang, Yipeng; Yu, Haining

2013-08-01

Antifreeze proteins (AFPs) refer to a class of polypeptides that are produced by certain vertebrates, plants, fungi, and bacteria and which permit their survival in subzero environments. In this study, we report the molecular cloning, sequence analysis and three-dimensional structure of the axolotl antifreeze-like protein (AFLP) by homology modeling of the first caudate amphibian AFLP. We constructed a full-length spleen cDNA library of axolotl (Ambystoma mexicanum). An EST having highest similarity (∼42%) with freeze-responsive liver protein Li16 from Rana sylvatica was identified, and the full-length cDNA was subsequently obtained by RACE-PCR. The axolotl antifreeze-like protein sequence represents an open reading frame for a putative signal peptide and the mature protein composed of 93 amino acids. The calculated molecular mass and the theoretical isoelectric point (pl) of this mature protein were 10128.6 Da and 8.97, respectively. The molecular characterization of this gene and its deduced protein were further performed by detailed bioinformatics analysis. The three-dimensional structure of current AFLP was predicted by homology modeling, and the conserved residues required for functionality were identified. The homology model constructed could be of use for effective drug design. This is the first report of an antifreeze-like protein identified from a caudate amphibian.

CMsearch: simultaneous exploration of protein sequence space and structure space improves not only protein homology detection but also protein structure prediction

KAUST Repository

Cui, Xuefeng; Lu, Zhiwu; Wang, Sheng; Jing-Yan Wang, Jim; Gao, Xin

2016-01-01

Motivation: Protein homology detection, a fundamental problem in computational biology, is an indispensable step toward predicting protein structures and understanding protein functions. Despite the advances in recent decades on sequence alignment

Targeted assembly of short sequence reads.

Directory of Open Access Journals (Sweden)

René L Warren

Full Text Available As next-generation sequence (NGS production continues to increase, analysis is becoming a significant bottleneck. However, in situations where information is required only for specific sequence variants, it is not necessary to assemble or align whole genome data sets in their entirety. Rather, NGS data sets can be mined for the presence of sequence variants of interest by localized assembly, which is a faster, easier, and more accurate approach. We present TASR, a streamlined assembler that interrogates very large NGS data sets for the presence of specific variants by only considering reads within the sequence space of input target sequences provided by the user. The NGS data set is searched for reads with an exact match to all possible short words within the target sequence, and these reads are then assembled stringently to generate a consensus of the target and flanking sequence. Typically, variants of a particular locus are provided as different target sequences, and the presence of the variant in the data set being interrogated is revealed by a successful assembly outcome. However, TASR can also be used to find unknown sequences that flank a given target. We demonstrate that TASR has utility in finding or confirming genomic mutations, polymorphisms, fusions and integration events. Targeted assembly is a powerful method for interrogating large data sets for the presence of sequence variants of interest. TASR is a fast, flexible and easy to use tool for targeted assembly.

Adhesive proteins of stalked and acorn barnacles display homology with low sequence similarities.

Directory of Open Access Journals (Sweden)

Jaimie-Leigh Jonker

Full Text Available Barnacle adhesion underwater is an important phenomenon to understand for the prevention of biofouling and potential biotechnological innovations, yet so far, identifying what makes barnacle glue proteins 'sticky' has proved elusive. Examination of a broad range of species within the barnacles may be instructive to identify conserved adhesive domains. We add to extensive information from the acorn barnacles (order Sessilia by providing the first protein analysis of a stalked barnacle adhesive, Lepas anatifera (order Lepadiformes. It was possible to separate the L. anatifera adhesive into at least 10 protein bands using SDS-PAGE. Intense bands were present at approximately 30, 70, 90 and 110 kilodaltons (kDa. Mass spectrometry for protein identification was followed by de novo sequencing which detected 52 peptides of 7-16 amino acids in length. None of the peptides matched published or unpublished transcriptome sequences, but some amino acid sequence similarity was apparent between L. anatifera and closely-related Dosima fascicularis. Antibodies against two acorn barnacle proteins (ab-cp-52k and ab-cp-68k showed cross-reactivity in the adhesive glands of L. anatifera. We also analysed the similarity of adhesive proteins across several barnacle taxa, including Pollicipes pollicipes (a stalked barnacle in the order Scalpelliformes. Sequence alignment of published expressed sequence tags clearly indicated that P. pollicipes possesses homologues for the 19 kDa and 100 kDa proteins in acorn barnacles. Homology aside, sequence similarity in amino acid and gene sequences tended to decline as taxonomic distance increased, with minimum similarities of 18-26%, depending on the gene. The results indicate that some adhesive proteins (e.g. 100 kDa are more conserved within barnacles than others (20 kDa.

Nucleotide and amino acid sequences of a coat protein of an Ukrainian isolate of Potato virus Y: comparison with homologous sequences of other isolates and phylogenetic analysis

Directory of Open Access Journals (Sweden)

Budzanivska I. G.

2014-03-01

Full Text Available Aim. Identification of the widespread Ukrainian isolate(s of PVY (Potato virus Y in different potato cultivars and subsequent phylogenetic analysis of detected PVY isolates based on NA and AA sequences of coat protein. Methods. ELISA, RT-PCR, DNA sequencing and phylogenetic analysis. Results. PVY has been identified serologically in potato cultivars of Ukrainian selection. In this work we have optimized a method for total RNA extraction from potato samples and offered a sensitive and specific PCR-based test system of own design for diagnostics of the Ukrainian PVY isolates. Part of the CP gene of the Ukrainian PVY isolate has been sequenced and analyzed phylogenetically. It is demonstrated that the Ukrainian isolate of Potato virus Y (CP gene has a higher percentage of homology with the recombinant isolates (strains of this pathogen (approx. 98.8– 99.8 % of homology for both nucleotide and translated amino acid sequences of the CP gene. The Ukrainian isolate of PVY is positioned in the separate cluster together with the isolates found in Syria, Japan and Iran; these isolates possibly have common origin. The Ukrainian PVY isolate is confirmed to be recombinant. Conclusions. This work underlines the need and provides the means for accurate monitoring of Potato virus Y in the agroecosystems of Ukraine. Most importantly, the phylogenetic analysis demonstrated the recombinant nature of this PVY isolate which has been attributed to the strain group O, subclade N:O.

A short TE gradient-echo sequence using asymmetric sampling

International Nuclear Information System (INIS)

Fujita, Norihiko; Harada, Kohshi; Sakurai, Kosuke; Nakanishi, Katsuyuki; Kim, Shyogen; Kozuka, Takahiro

1990-01-01

We have developed a gradient-echo pulse sequence with a short TE less than 4 msec using a data set of asymmetric off-center sampling with a broad bandwidth. The use of such a short TE significantly reduces T 2 * dephasing effect even in a two-dimensional mode, and by collecting an off-center echo, motion-induced phase dispersion is also considerably decreased. High immunity of this sequence to these dephasing effects permits clear visualization of anatomical details near the skull base where large local field inhomogeneities and rapid blood flow such as in the internal carotid artery are present. (author)

Dualities in persistent (co)homology

International Nuclear Information System (INIS)

De Silva, Vin; Morozov, Dmitriy; Vejdemo-Johansson, Mikael

2011-01-01

We consider sequences of absolute and relative homology and cohomology groups that arise naturally for a filtered cell complex. We establish algebraic relationships between their persistence modules, and show that they contain equivalent information. We explain how one can use the existing algorithm for persistent homology to process any of the four modules, and relate it to a recently introduced persistent cohomology algorithm. We present experimental evidence for the practical efficiency of the latter algorithm

Neural network and SVM classifiers accurately predict lipid binding proteins, irrespective of sequence homology.

Science.gov (United States)

Bakhtiarizadeh, Mohammad Reza; Moradi-Shahrbabak, Mohammad; Ebrahimi, Mansour; Ebrahimie, Esmaeil

2014-09-07

Due to the central roles of lipid binding proteins (LBPs) in many biological processes, sequence based identification of LBPs is of great interest. The major challenge is that LBPs are diverse in sequence, structure, and function which results in low accuracy of sequence homology based methods. Therefore, there is a need for developing alternative functional prediction methods irrespective of sequence similarity. To identify LBPs from non-LBPs, the performances of support vector machine (SVM) and neural network were compared in this study. Comprehensive protein features and various techniques were employed to create datasets. Five-fold cross-validation (CV) and independent evaluation (IE) tests were used to assess the validity of the two methods. The results indicated that SVM outperforms neural network. SVM achieved 89.28% (CV) and 89.55% (IE) overall accuracy in identification of LBPs from non-LBPs and 92.06% (CV) and 92.90% (IE) (in average) for classification of different LBPs classes. Increasing the number and the range of extracted protein features as well as optimization of the SVM parameters significantly increased the efficiency of LBPs class prediction in comparison to the only previous report in this field. Altogether, the results showed that the SVM algorithm can be run on broad, computationally calculated protein features and offers a promising tool in detection of LBPs classes. The proposed approach has the potential to integrate and improve the common sequence alignment based methods. Copyright © 2014 Elsevier Ltd. All rights reserved.

Insights into early extracellular matrix evolution: spongin short chain collagen-related proteins are homologous to basement membrane type IV collagens and form a novel family widely distributed in invertebrates.

Science.gov (United States)

Aouacheria, Abdel; Geourjon, Christophe; Aghajari, Nushin; Navratil, Vincent; Deléage, Gilbert; Lethias, Claire; Exposito, Jean-Yves

2006-12-01

Collagens are thought to represent one of the most important molecular innovations in the metazoan line. Basement membrane type IV collagen is present in all Eumetazoa and was found in Homoscleromorpha, a sponge group with a well-organized epithelium, which may represent the first stage of tissue differentiation during animal evolution. In contrast, spongin seems to be a demosponge-specific collagenous protein, which can totally substitute an inorganic skeleton, such as in the well-known bath sponge. In the freshwater sponge Ephydatia mülleri, we previously characterized a family of short-chain collagens that are likely to be main components of spongins. Using a combination of sequence- and structure-based methods, we present evidence of remote homology between the carboxyl-terminal noncollagenous NC1 domain of spongin short-chain collagens and type IV collagen. Unexpectedly, spongin short-chain collagen-related proteins were retrieved in nonsponge animals, suggesting that a family related to spongin constitutes an evolutionary sister to the type IV collagen family. Formation of the ancestral NC1 domain and divergence of the spongin short-chain collagen-related and type IV collagen families may have occurred before the parazoan-eumetazoan split, the earliest divergence among extant animal phyla. Molecular phylogenetics based on NC1 domain sequences suggest distinct evolutionary histories for spongin short-chain collagen-related and type IV collagen families that include spongin short-chain collagen-related gene loss in the ancestors of Ecdyzosoa and of vertebrates. The fact that a majority of invertebrates encodes spongin short-chain collagen-related proteins raises the important question to the possible function of its members. Considering the importance of collagens for animal structure and substratum attachment, both families may have played crucial roles in animal diversification.

De novo assembly of human genomes with massively parallel short read sequencing

DEFF Research Database (Denmark)

Li, Ruiqiang; Zhu, Hongmei; Ruan, Jue

2010-01-01

genomes from short read sequences. We successfully assembled both the Asian and African human genome sequences, achieving an N50 contig size of 7.4 and 5.9 kilobases (kb) and scaffold of 446.3 and 61.9 kb, respectively. The development of this de novo short read assembly method creates new opportunities...... for building reference sequences and carrying out accurate analyses of unexplored genomes in a cost-effective way....

ISRNA: an integrative online toolkit for short reads from high-throughput sequencing data.

Science.gov (United States)

Luo, Guan-Zheng; Yang, Wei; Ma, Ying-Ke; Wang, Xiu-Jie

2014-02-01

Integrative Short Reads NAvigator (ISRNA) is an online toolkit for analyzing high-throughput small RNA sequencing data. Besides the high-speed genome mapping function, ISRNA provides statistics for genomic location, length distribution and nucleotide composition bias analysis of sequence reads. Number of reads mapped to known microRNAs and other classes of short non-coding RNAs, coverage of short reads on genes, expression abundance of sequence reads as well as some other analysis functions are also supported. The versatile search functions enable users to select sequence reads according to their sub-sequences, expression abundance, genomic location, relationship to genes, etc. A specialized genome browser is integrated to visualize the genomic distribution of short reads. ISRNA also supports management and comparison among multiple datasets. ISRNA is implemented in Java/C++/Perl/MySQL and can be freely accessed at http://omicslab.genetics.ac.cn/ISRNA/.

FastBLAST: homology relationships for millions of proteins.

Directory of Open Access Journals (Sweden)

Morgan N Price

Full Text Available BACKGROUND: All-versus-all BLAST, which searches for homologous pairs of sequences in a database of proteins, is used to identify potential orthologs, to find new protein families, and to provide rapid access to these homology relationships. As DNA sequencing accelerates and data sets grow, all-versus-all BLAST has become computationally demanding. METHODOLOGY/PRINCIPAL FINDINGS: We present FastBLAST, a heuristic replacement for all-versus-all BLAST that relies on alignments of proteins to known families, obtained from tools such as PSI-BLAST and HMMer. FastBLAST avoids most of the work of all-versus-all BLAST by taking advantage of these alignments and by clustering similar sequences. FastBLAST runs in two stages: the first stage identifies additional families and aligns them, and the second stage quickly identifies the homologs of a query sequence, based on the alignments of the families, before generating pairwise alignments. On 6.53 million proteins from the non-redundant Genbank database ("NR", FastBLAST identifies new families 25 times faster than all-versus-all BLAST. Once the first stage is completed, FastBLAST identifies homologs for the average query in less than 5 seconds (8.6 times faster than BLAST and gives nearly identical results. For hits above 70 bits, FastBLAST identifies 98% of the top 3,250 hits per query. CONCLUSIONS/SIGNIFICANCE: FastBLAST enables research groups that do not have supercomputers to analyze large protein sequence data sets. FastBLAST is open source software and is available at http://microbesonline.org/fastblast.

Electron microscopic comparison of the sequences of single-stranded genomes of mammalian parvoviruses by heteroduplex mapping

Energy Technology Data Exchange (ETDEWEB)

Banerjee, P.T.; Olson, W.H.; Allison, D.P.; Bates, R.C.; Snyder, C.E.; Mitra, S.

1983-01-01

The sequence homologies among the linear single-stranded genomes of several mammalian parvoviruses have been studied by electron microscopic analysis of tthe heteroduplexes produced by reannealing the complementary strands of their DNAs. The genomes of Kilham rat virus, H-1, minute virus of ice and LuIII, which are antigenically distinct non-defective parvoviruses, have considerable homology: about 70% of their sequences are conserved. The homologous regions map at similar locations in the left halves (from the 3' ends) of the genomes. No sequence homology, however, is observed between the DNAs of these nondefective parvoviruses and that of bovine parvovirus, another non-defective virus, or that of defective adenoassociated virus, nor between the genomes of bovine parvovirus and adenoassociated virus. This suggests that only very short, if any, homologous regions are present. From these results, an evolutionary relationship among Kilham rat virus, H-1, minute virus of mice and LuIII is predicted. It is interesting to note that, although LuIII was originally isolated from a human cell line and is specific for human cells in vitro, its genome has sequences in common only with the rodent viruses Kilham rat virus, minute virus of mice and H-1, and not with the other two mammalian parvoviruses tested.

OCCURRENCE OF SMALL HOMOLOGOUS AND COMPLEMENTARY FRAGMENTS IN HUMAN VIRUS GENOMES AND THEIR POSSIBLE ROLE

Directory of Open Access Journals (Sweden)

E. P. Kharchenko

2017-01-01

Full Text Available With computer analysis occurrence of small homologous and complementary fragments (21 nucleotides in length has been studied in genomes of 14 human viruses causing most dangerous infections. The sample includes viruses with (+ and (– single stranded RNA and DNA-containing hepatitis A virus. Analysis of occurrence of homologous sequences has shown the existence two extreme situations. On the one hand, the same virus contains homologous sequences to almost all other viruses (for example, Ebola virus, severe acute respiratory syndrome-related coronavirus, and mumps virus, and numerous homologous sequences to the same other virus (especially in severe acute respiratory syndrome-related coronavirus to Dengue virus and in Ebola virus to poliovirus. On the other hand, there are rare occurrence and not numerous homologous sequences in genomes of other viruses (rubella virus, hepatitis A virus, and hepatitis B virus. Similar situation exists for occurrence of complementary sequences. Rubella virus, the genome of which has the high content of guanine and cytosine, has no complementary sequences to almost all other viruses. Most viruses have moderate level of occurrence for homologous and complementary sequences. Autocomplementary sequences are numerous in most viruses and one may suggest that the genome of single stranded RNA viruses has branched secondary structure. In addition to possible role in recombination among strains autocomplementary sequences could be regulators of translation rate of virus proteins and determine its optimal proportion in virion assembly with genome and mRNA folding. Occurrence of small homologous and complementary sequences in RNA- and DNA-containing viruses may be the result of multiple recombinations in the past and the present and determine their adaptation and variability. Recombination may take place in coinfection of human and/or common hosts. Inclusion of homologous and complementary sequences into genome could not

Productive Homologous and Non-homologous Recombination of Hepatitis C Virus in Cell Culture

Science.gov (United States)

Li, Yi-Ping; Mikkelsen, Lotte S.; Gottwein, Judith M.; Bukh, Jens

2013-01-01

Genetic recombination is an important mechanism for increasing diversity of RNA viruses, and constitutes a viral escape mechanism to host immune responses and to treatment with antiviral compounds. Although rare, epidemiologically important hepatitis C virus (HCV) recombinants have been reported. In addition, recombination is an important regulatory mechanism of cytopathogenicity for the related pestiviruses. Here we describe recombination of HCV RNA in cell culture leading to production of infectious virus. Initially, hepatoma cells were co-transfected with a replicating JFH1ΔE1E2 genome (genotype 2a) lacking functional envelope genes and strain J6 (2a), which has functional envelope genes but does not replicate in culture. After an initial decrease in the number of HCV positive cells, infection spread after 13–36 days. Sequencing of recovered viruses revealed non-homologous recombinants with J6 sequence from the 5′ end to the NS2–NS3 region followed by JFH1 sequence from Core to the 3′ end. These recombinants carried duplicated sequence of up to 2400 nucleotides. HCV replication was not required for recombination, as recombinants were observed in most experiments even when two replication incompetent genomes were co-transfected. Reverse genetic studies verified the viability of representative recombinants. After serial passage, subsequent recombination events reducing or eliminating the duplicated region were observed for some but not all recombinants. Furthermore, we found that inter-genotypic recombination could occur, but at a lower frequency than intra-genotypic recombination. Productive recombination of attenuated HCV genomes depended on expression of all HCV proteins and tolerated duplicated sequence. In general, no strong site specificity was observed. Non-homologous recombination was observed in most cases, while few homologous events were identified. A better understanding of HCV recombination could help identification of natural recombinants

Prefiltering Model for Homology Detection Algorithms on GPU.

Science.gov (United States)

Retamosa, Germán; de Pedro, Luis; González, Ivan; Tamames, Javier

2016-01-01

Homology detection has evolved over the time from heavy algorithms based on dynamic programming approaches to lightweight alternatives based on different heuristic models. However, the main problem with these algorithms is that they use complex statistical models, which makes it difficult to achieve a relevant speedup and find exact matches with the original results. Thus, their acceleration is essential. The aim of this article was to prefilter a sequence database. To make this work, we have implemented a groundbreaking heuristic model based on NVIDIA's graphics processing units (GPUs) and multicore processors. Depending on the sensitivity settings, this makes it possible to quickly reduce the sequence database by factors between 50% and 95%, while rejecting no significant sequences. Furthermore, this prefiltering application can be used together with multiple homology detection algorithms as a part of a next-generation sequencing system. Extensive performance and accuracy tests have been carried out in the Spanish National Centre for Biotechnology (NCB). The results show that GPU hardware can accelerate the execution times of former homology detection applications, such as National Centre for Biotechnology Information (NCBI), Basic Local Alignment Search Tool for Proteins (BLASTP), up to a factor of 4.

BLEACHING EUCALYPTUS PULPS WITH SHORT SEQUENCES

Directory of Open Access Journals (Sweden)

Flaviana Reis Milagres

2011-03-01

Full Text Available Eucalyptus spp kraft pulp, due to its high content of hexenuronic acids, is quite easy to bleach. Therefore, investigations have been made attempting to decrease the number of stages in the bleaching process in order to minimize capital costs. This study focused on the evaluation of short ECF (Elemental Chlorine Free and TCF (Totally Chlorine Free sequences for bleaching oxygen delignified Eucalyptus spp kraft pulp to 90% ISO brightness: PMoDP (Molybdenum catalyzed acid peroxide, chlorine dioxide and hydrogen peroxide, PMoD/P (Molybdenum catalyzed acid peroxide, chlorine dioxide and hydrogen peroxide, without washing PMoD(PO (Molybdenum catalyzed acid peroxide, chlorine dioxide and pressurized peroxide, D(EPODP (chlorine dioxide, extraction oxidative with oxygen and peroxide, chlorine dioxide and hydrogen peroxide, PMoQ(PO (Molybdenum catalyzed acid peroxide, DTPA and pressurized peroxide, and XPMoQ(PO (Enzyme, molybdenum catalyzed acid peroxide, DTPA and pressurized peroxide. Uncommon pulp treatments, such as molybdenum catalyzed acid peroxide (PMo and xylanase (X bleaching stages, were used. Among the ECF alternatives, the two-stage PMoD/P sequence proved highly cost-effective without affecting pulp quality in relation to the traditional D(EPODP sequence and produced better quality effluent in relation to the reference. However, a four stage sequence, XPMoQ(PO, was required to achieve full brightness using the TCF technology. This sequence was highly cost-effective although it only produced pulp of acceptable quality.

Persistent homology of complex networks

International Nuclear Information System (INIS)

Horak, Danijela; Maletić, Slobodan; Rajković, Milan

2009-01-01

Long-lived topological features are distinguished from short-lived ones (considered as topological noise) in simplicial complexes constructed from complex networks. A new topological invariant, persistent homology, is determined and presented as a parameterized version of a Betti number. Complex networks with distinct degree distributions exhibit distinct persistent topological features. Persistent topological attributes, shown to be related to the robust quality of networks, also reflect the deficiency in certain connectivity properties of networks. Random networks, networks with exponential connectivity distribution and scale-free networks were considered for homological persistency analysis

Systematic analysis of short internal indels and their impact on protein folding

Directory of Open Access Journals (Sweden)

Guo Jun-tao

2010-08-01

Full Text Available Abstract Background Protein sequence insertions/deletions (indels can be introduced during evolution or through alternative splicing (AS. Alternative splicing is an important biological phenomenon and is considered as the major means of expanding structural and functional diversity in eukaryotes. Knowledge of the structural changes due to indels is critical to our understanding of the evolution of protein structure and function. In addition, it can help us probe the evolution of alternative splicing and the diversity of functional isoforms. However, little is known about the effects of indels, in particular the ones involving core secondary structures, on the folding of protein structures. The long term goal of our study is to accurately predict the protein AS isoform structures. As a first step towards this goal, we performed a systematic analysis on the structural changes caused by short internal indels through mining highly homologous proteins in Protein Data Bank (PDB. Results We compiled a non-redundant dataset of short internal indels (2-40 amino acids from highly homologous protein pairs and analyzed the sequence and structural features of the indels. We found that about one third of indel residues are in disordered state and majority of the residues are exposed to solvent, suggesting that these indels are generally located on the surface of proteins. Though naturally occurring indels are fewer than engineered ones in the dataset, there are no statistically significant differences in terms of amino acid frequencies and secondary structure types between the "Natural" indels and "All" indels in the dataset. Structural comparisons show that all the protein pairs with short internal indels in the dataset preserve the structural folds and about 85% of protein pairs have global RMSDs (root mean square deviations of 2Å or less, suggesting that protein structures tend to be conserved and can tolerate short insertions and deletions. A few pairs

PSI/TM-Coffee: a web server for fast and accurate multiple sequence alignments of regular and transmembrane proteins using homology extension on reduced databases.

Science.gov (United States)

Floden, Evan W; Tommaso, Paolo D; Chatzou, Maria; Magis, Cedrik; Notredame, Cedric; Chang, Jia-Ming

2016-07-08

The PSI/TM-Coffee web server performs multiple sequence alignment (MSA) of proteins by combining homology extension with a consistency based alignment approach. Homology extension is performed with Position Specific Iterative (PSI) BLAST searches against a choice of redundant and non-redundant databases. The main novelty of this server is to allow databases of reduced complexity to rapidly perform homology extension. This server also gives the possibility to use transmembrane proteins (TMPs) reference databases to allow even faster homology extension on this important category of proteins. Aside from an MSA, the server also outputs topological prediction of TMPs using the HMMTOP algorithm. Previous benchmarking of the method has shown this approach outperforms the most accurate alignment methods such as MSAProbs, Kalign, PROMALS, MAFFT, ProbCons and PRALINE™. The web server is available at http://tcoffee.crg.cat/tmcoffee. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Salt-bridging effects on short amphiphilic helical structure and introducing sequence-based short beta-turn motifs.

Science.gov (United States)

Guarracino, Danielle A; Gentile, Kayla; Grossman, Alec; Li, Evan; Refai, Nader; Mohnot, Joy; King, Daniel

2018-02-01

Determining the minimal sequence necessary to induce protein folding is beneficial in understanding the role of protein-protein interactions in biological systems, as their three-dimensional structures often dictate their activity. Proteins are generally comprised of discrete secondary structures, from α-helices to β-turns and larger β-sheets, each of which is influenced by its primary structure. Manipulating the sequence of short, moderately helical peptides can help elucidate the influences on folding. We created two new scaffolds based on a modestly helical eight-residue peptide, PT3, we previously published. Using circular dichroism (CD) spectroscopy and changing the possible salt-bridging residues to new combinations of Lys, Arg, Glu, and Asp, we found that our most helical improvements came from the Arg-Glu combination, whereas the Lys-Asp was not significantly different from the Lys-Glu of the parent scaffold, PT3. The marked 3 10 -helical contributions in PT3 were lessened in the Arg-Glu-containing peptide with the beginning of cooperative unfolding seen through a thermal denaturation. However, a unique and unexpected signature was seen for the denaturation of the Lys-Asp peptide which could help elucidate the stages of folding between the 3 10 and α-helix. In addition, we developed a short six-residue peptide with β-turn/sheet CD signature, again to help study minimal sequences needed for folding. Overall, the results indicate that improvements made to short peptide scaffolds by fine-tuning the salt-bridging residues can enhance scaffold structure. Likewise, with the results from the new, short β-turn motif, these can help impact future peptidomimetic designs in creating biologically useful, short, structured β-sheet-forming peptides.

Sequence homolog-based molecular engineering for shifting the enzymatic pH optimum

Directory of Open Access Journals (Sweden)

Fuqiang Ma

2016-09-01

Full Text Available Cell-free synthetic biology system organizes multiple enzymes (parts from different sources to implement unnatural catalytic functions. Highly adaption between the catalytic parts is crucial for building up efficient artificial biosynthetic systems. Protein engineering is a powerful technology to tailor various enzymatic properties including catalytic efficiency, substrate specificity, temperature adaptation and even achieve new catalytic functions. However, altering enzymatic pH optimum still remains a challenging task. In this study, we proposed a novel sequence homolog-based protein engineering strategy for shifting the enzymatic pH optimum based on statistical analyses of sequence-function relationship data of enzyme family. By two statistical procedures, artificial neural networks (ANNs and least absolute shrinkage and selection operator (Lasso, five amino acids in GH11 xylanase family were identified to be related to the evolution of enzymatic pH optimum. Site-directed mutagenesis of a thermophilic xylanase from Caldicellulosiruptor bescii revealed that four out of five mutations could alter the enzymatic pH optima toward acidic condition without compromising the catalytic activity and thermostability. Combination of the positive mutants resulted in the best mutant M31 that decreased its pH optimum for 1.5 units and showed increased catalytic activity at pH < 5.0 compared to the wild-type enzyme. Structure analysis revealed that all the mutations are distant from the active center, which may be difficult to be identified by conventional rational design strategy. Interestingly, the four mutation sites are clustered at a certain region of the enzyme, suggesting a potential “hot zone” for regulating the pH optima of xylanases. This study provides an efficient method of modulating enzymatic pH optima based on statistical sequence analyses, which can facilitate the design and optimization of suitable catalytic parts for the construction

Direct Single-Molecule Observation of Mode and Geometry of RecA-Mediated Homology Search.

Science.gov (United States)

Lee, Andrew J; Endo, Masayuki; Hobbs, Jamie K; Wälti, Christoph

2018-01-23

Genomic integrity, when compromised by accrued DNA lesions, is maintained through efficient repair via homologous recombination. For this process the ubiquitous recombinase A (RecA), and its homologues such as the human Rad51, are of central importance, able to align and exchange homologous sequences within single-stranded and double-stranded DNA in order to swap out defective regions. Here, we directly observe the widely debated mechanism of RecA homology searching at a single-molecule level using high-speed atomic force microscopy (HS-AFM) in combination with tailored DNA origami frames to present the reaction targets in a way suitable for AFM-imaging. We show that RecA nucleoprotein filaments move along DNA substrates via short-distance facilitated diffusions, or slides, interspersed with longer-distance random moves, or hops. Importantly, from the specific interaction geometry, we find that the double-stranded substrate DNA resides in the secondary DNA binding-site within the RecA nucleoprotein filament helical groove during the homology search. This work demonstrates that tailored DNA origami, in conjunction with HS-AFM, can be employed to reveal directly conformational and geometrical information on dynamic protein-DNA interactions which was previously inaccessible at an individual single-molecule level.

CBH1 homologs and varian CBH1 cellulase

Energy Technology Data Exchange (ETDEWEB)

Goedegebuur, Frits; Gualfetti, Peter; Mitchinson, Colin; Neefe, Paulien

2014-07-01

Disclosed are a number of homologs and variants of Hypocrea jecorina Cel7A (formerly Trichoderma reesei cellobiohydrolase I or CBH1), nucleic acids encoding the same and methods for producing the same. The homologs and variant cellulases have the amino acid sequence of a glycosyl hydrolase of family 7A wherein one or more amino acid residues are substituted and/or deleted.

External and semi-internal controls for PCR amplification of homologous sequences in mixed templates

DEFF Research Database (Denmark)

Kalle, Elena; Gulevich, Alexander; Rensing, Christopher Günther T

2013-01-01

as an acceptable alternative. In order to evaluate the effects of inhibitors, a model multi-template mix was amplified in a mixture with DNAse-treated sample. Semi-internal control allowed establishment of intervals for robust PCR performance for different samples, thus enabling correct comparison of the samples......In a mixed template, the presence of homologous target DNA sequences creates environments that almost inevitably give rise to artifacts and biases during PCR. Heteroduplexes, chimeras, and skewed template-to-product ratios are the exclusive attributes of mixed template PCR and never occur....... This study demonstrated the efficiency of a model mixed template as an adequate external amplification control for a particular PCR application. The conditions of multi-template PCR do not allow implementation of a classic internal control; therefore we developed a convenient semi-internal control...

Rapid Acquisition of Linezolid Resistance in Methicillin-Resistant Staphylococcus aureus: Role of Hypermutation and Homologous Recombination.

Science.gov (United States)

Iguchi, Shigekazu; Mizutani, Tomonori; Hiramatsu, Keiichi; Kikuchi, Ken

2016-01-01

We previously reported the case of a 64-year-old man with mediastinitis caused by Staphylococcus aureus in which the infecting bacterium acquired linezolid resistance after only 14 days treatment with linezolid. We therefore investigated relevant clinical isolates for possible mechanisms of this rapid acquisition of linezolid resistance. Using clinical S. aureus isolates, we assessed the in vitro mutation rate and performed stepwise selection for linezolid resistance. To investigate homologous recombination, sequences were determined for each of the 23S ribosomal RNA (23S rRNA) loci; analyzed sequences spanned the entirety of each 23S rRNA gene, including domain V, as well as the 16S-23S intergenic spacer regions. We additionally performed next-generation sequencing on clinical strains to identify single-nucleotide polymorphisms compared to the N315 genome. Strains isolated from the patient prior to linezolid exposure (M5-M7) showed higher-level linezolid resistance than N315, and the pre-exposure strain (M2) exhibited more rapid acquisition of linezolid resistance than did N315. However, the mutation rates of these and contemporaneous clinical isolates were similar to those of N315, and the isolates did not exhibit any mutations in hypermutation-related genes. Sequences of the 23S rRNA genes and 16S-23S intergenic spacer regions were identical among the pre- and post-exposure clinical strains. Notably, all of the pre-exposure isolates harbored a recQ missense mutation (Glu69Asp) with respect to N315; such a lesion may have affected short sequence recombination (facilitating, for example, recombination among rrn loci). We hypothesize that this mechanism contributed to rapid acquisition of linezolid resistance. Hypermutation and homologous recombination of the ribosomal RNA genes, including 23S rRNA genes, appear not to have been sources of the accelerated acquisition of linezolid resistance observed in our clinical case. Increased frequency of short sequence

Structural and Sequence Similarities of Hydra Xeroderma Pigmentosum A Protein to Human Homolog Suggest Early Evolution and Conservation

Directory of Open Access Journals (Sweden)

Apurva Barve

2013-01-01

Full Text Available Xeroderma pigmentosum group A (XPA is a protein that binds to damaged DNA, verifies presence of a lesion, and recruits other proteins of the nucleotide excision repair (NER pathway to the site. Though its homologs from yeast, Drosophila, humans, and so forth are well studied, XPA has not so far been reported from protozoa and lower animal phyla. Hydra is a fresh-water cnidarian with a remarkable capacity for regeneration and apparent lack of organismal ageing. Cnidarians are among the first metazoa with a defined body axis, tissue grade organisation, and nervous system. We report here for the first time presence of XPA gene in hydra. Putative protein sequence of hydra XPA contains nuclear localization signal and bears the zinc-finger motif. It contains two conserved Pfam domains and various characterized features of XPA proteins like regions for binding to excision repair cross-complementing protein-1 (ERCC1 and replication protein A 70 kDa subunit (RPA70 proteins. Hydra XPA shows a high degree of similarity with vertebrate homologs and clusters with deuterostomes in phylogenetic analysis. Homology modelling corroborates the very close similarity between hydra and human XPA. The protein thus most likely functions in hydra in the same manner as in other animals, indicating that it arose early in evolution and has been conserved across animal phyla.

SeqEntropy: genome-wide assessment of repeats for short read sequencing.

Directory of Open Access Journals (Sweden)

Hsueh-Ting Chu

Full Text Available BACKGROUND: Recent studies on genome assembly from short-read sequencing data reported the limitation of this technology to reconstruct the entire genome even at very high depth coverage. We investigated the limitation from the perspective of information theory to evaluate the effect of repeats on short-read genome assembly using idealized (error-free reads at different lengths. METHODOLOGY/PRINCIPAL FINDINGS: We define a metric H(k to be the entropy of sequencing reads at a read length k and use the relative loss of entropy ΔH(k to measure the impact of repeats for the reconstruction of whole-genome from sequences of length k. In our experiments, we found that entropy loss correlates well with de-novo assembly coverage of a genome, and a score of ΔH(k>1% indicates a severe loss in genome reconstruction fidelity. The minimal read lengths to achieve ΔH(k<1% are different for various organisms and are independent of the genome size. For example, in order to meet the threshold of ΔH(k<1%, a read length of 60 bp is needed for the sequencing of human genome (3.2 10(9 bp and 320 bp for the sequencing of fruit fly (1.8×10(8 bp. We also calculated the ΔH(k scores for 2725 prokaryotic chromosomes and plasmids at several read lengths. Our results indicate that the levels of repeats in different genomes are diverse and the entropy of sequencing reads provides a measurement for the repeat structures. CONCLUSIONS/SIGNIFICANCE: The proposed entropy-based measurement, which can be calculated in seconds to minutes in most cases, provides a rapid quantitative evaluation on the limitation of idealized short-read genome sequencing. Moreover, the calculation can be parallelized to scale up to large euakryotic genomes. This approach may be useful to tune the sequencing parameters to achieve better genome assemblies when a closely related genome is already available.

A family of cell-adhering peptides homologous to fibrinogen C-termini

International Nuclear Information System (INIS)

Levy-Beladev, Liron; Levdansky, Lilia; Gaberman, Elena; Friedler, Assaf; Gorodetsky, Raphael

2010-01-01

Research highlights: → Cell-adhesive sequences homologous to fibrinogen C-termini exist in other proteins. → The extended homologous cell-adhesive C-termini peptides family is termed Haptides. → In membrane-like environment random coiled Haptides adopt a helical conformation. → Replacing positively charged residues with alanine reduces Haptides activity. -- Abstract: A family of cell-adhesive peptides homologous to sequences on different chains of fibrinogen was investigated. These homologous peptides, termed Haptides, include the peptides Cβ, preCγ, and CαE, corresponding to sequences on the C-termini of fibrinogen chains β, γ, and αE, respectively. Haptides do not affect cell survival and rate of proliferation of the normal cell types tested. The use of new sensitive assays of cell adhesion clearly demonstrated the ability of Haptides, bound to inert matrices, to mediate attachment of different matrix-dependent cell types including normal fibroblasts, endothelial, and smooth muscle cells. Here we present new active Haptides bearing homologous sequences derived from the C-termini of other proteins, such as angiopoietin 1 and 2, tenascins C and X, and microfibril-associated glycoprotein-4. The cell adhesion properties of all the Haptides were found to be associated mainly with their 11 N-terminal residues. Mutated preCγ peptides revealed that positively charged residues account for their attachment effect. These results suggest a mechanism of direct electrostatic interaction of Haptides with the cell membrane. The extended Haptides family may be applied in modulating adhesion of cells to scaffolds for tissue regeneration and for enhancement of nanoparticulate transfection into cells.

Accurate typing of short tandem repeats from genome-wide sequencing data and its applications.

Science.gov (United States)

Fungtammasan, Arkarachai; Ananda, Guruprasad; Hile, Suzanne E; Su, Marcia Shu-Wei; Sun, Chen; Harris, Robert; Medvedev, Paul; Eckert, Kristin; Makova, Kateryna D

2015-05-01

Short tandem repeats (STRs) are implicated in dozens of human genetic diseases and contribute significantly to genome variation and instability. Yet profiling STRs from short-read sequencing data is challenging because of their high sequencing error rates. Here, we developed STR-FM, short tandem repeat profiling using flank-based mapping, a computational pipeline that can detect the full spectrum of STR alleles from short-read data, can adapt to emerging read-mapping algorithms, and can be applied to heterogeneous genetic samples (e.g., tumors, viruses, and genomes of organelles). We used STR-FM to study STR error rates and patterns in publicly available human and in-house generated ultradeep plasmid sequencing data sets. We discovered that STRs sequenced with a PCR-free protocol have up to ninefold fewer errors than those sequenced with a PCR-containing protocol. We constructed an error correction model for genotyping STRs that can distinguish heterozygous alleles containing STRs with consecutive repeat numbers. Applying our model and pipeline to Illumina sequencing data with 100-bp reads, we could confidently genotype several disease-related long trinucleotide STRs. Utilizing this pipeline, for the first time we determined the genome-wide STR germline mutation rate from a deeply sequenced human pedigree. Additionally, we built a tool that recommends minimal sequencing depth for accurate STR genotyping, depending on repeat length and sequencing read length. The required read depth increases with STR length and is lower for a PCR-free protocol. This suite of tools addresses the pressing challenges surrounding STR genotyping, and thus is of wide interest to researchers investigating disease-related STRs and STR evolution. © 2015 Fungtammasan et al.; Published by Cold Spring Harbor Laboratory Press.

Induction of homologous recombination in Saccharomyces cerevisiae.

Science.gov (United States)

Simon, J R; Moore, P D

1988-09-01

We have investigated the effects of UV irradiation of Saccharomyces cerevisiae in order to distinguish whether UV-induced recombination results from the induction of enzymes required for homologous recombination, or the production of substrate sites for recombination containing regions of DNA damage. We utilized split-dose experiments to investigate the induction of proteins required for survival, gene conversion, and mutation in a diploid strain of S. cerevisiae. We demonstrate that inducing doses of UV irradiation followed by a 6 h period of incubation render the cells resistant to challenge doses of UV irradiation. The effects of inducing and challenge doses of UV irradiation upon interchromosomal gene conversion and mutation are strictly additive. Using the yeast URA3 gene cloned in non-replicating single- and double-stranded plasmid vectors that integrate into chromosomal genes upon transformation, we show that UV irradiation of haploid yeast cells and homologous plasmid DNA sequences each stimulate homologous recombination approximately two-fold, and that these effects are additive. Non-specific DNA damage has little effect on the stimulation of homologous recombination, as shown by studies in which UV-irradiated heterologous DNA was included in transformation/recombination experiments. We further demonstrate that the effect of competing single- and double-stranded heterologous DNA sequences differs in UV-irradiated and unirradiated cells, suggesting an induction of recombinational machinery in UV-irradiated S. cerevisiae cells.

Homologous Recombination and Xylella fastidiosa Host-Pathogen Associations in South America.

Science.gov (United States)

Coletta-Filho, Helvécio D; Francisco, Carolina S; Lopes, João R S; Muller, Christiane; Almeida, Rodrigo P P

2017-03-01

Homologous recombination affects the evolution of bacteria such as Xylella fastidiosa, a naturally competent plant pathogen that requires insect vectors for dispersal. This bacterial species is taxonomically divided into subspecies, with phylogenetic clusters within subspecies that are host specific. One subspecies, pauca, is primarily limited to South America, with the exception of recently reported strains in Europe and Costa Rica. Despite the economic importance of X. fastidiosa subsp. pauca in South America, little is known about its genetic diversity. Multilocus sequence typing (MLST) has previously identified six sequence types (ST) among plant samples collected in Brazil (both subsp. pauca and multiplex). Here, we report on a survey of X. fastidiosa genetic diversity (MLST based) performed in six regions in Brazil and two in Argentina, by sampling five different plant species. In addition to the six previously reported ST, seven new subsp. pauca and two new subsp. multiplex ST were identified. The presence of subsp. multiplex in South America is considered to be the consequence of a single introduction from its native range in North America more than 80 years ago. Different phylogenetic approaches clustered the South American ST into four groups, with strains infecting citrus (subsp. pauca); coffee and olive (subsp. pauca); coffee, hibiscus, and plum (subsp. pauca); and plum (subsp. multiplex). In areas where these different genetic clusters occurred sympatrically, we found evidence of homologous recombination in the form of bidirectional allelic exchange between subspp. pauca and multiplex. In fact, the only strain of subsp. pauca isolated from a plum host had an allele that originated from subsp. multiplex. These signatures of bidirectional homologous recombination between endemic and introduced ST indicate that gene flow occurs in short evolutionary time frames in X. fastidiosa, despite the ecological isolation (i.e., host plant species) of genotypes.

A recurrent translocation is mediated by homologous recombination between HERV-H elements

Directory of Open Access Journals (Sweden)

Hermetz Karen E

2012-01-01

Full Text Available Abstract Background Chromosome rearrangements are caused by many mutational mechanisms; of these, recurrent rearrangements can be particularly informative for teasing apart DNA sequence-specific factors. Some recurrent translocations are mediated by homologous recombination between large blocks of segmental duplications on different chromosomes. Here we describe a recurrent unbalanced translocation casued by recombination between shorter homologous regions on chromosomes 4 and 18 in two unrelated children with intellectual disability. Results Array CGH resolved the breakpoints of the 6.97-Megabase (Mb loss of 18q and the 7.30-Mb gain of 4q. Sequencing across the translocation breakpoints revealed that both translocations occurred between 92%-identical human endogenous retrovirus (HERV elements in the same orientation on chromosomes 4 and 18. In addition, we find sequence variation in the chromosome 4 HERV that makes one allele more like the chromosome 18 HERV. Conclusions Homologous recombination between HERVs on the same chromosome is known to cause chromosome deletions, but this is the first report of interchromosomal HERV-HERV recombination leading to a translocation. It is possible that normal sequence variation in substrates of non-allelic homologous recombination (NAHR affects the alignment of recombining segments and influences the propensity to chromosome rearrangement.

FASTERp: A Feature Array Search Tool for Estimating Resemblance of Protein Sequences

Energy Technology Data Exchange (ETDEWEB)

Macklin, Derek; Egan, Rob; Wang, Zhong

2014-03-14

Metagenome sequencing efforts have provided a large pool of billions of genes for identifying enzymes with desirable biochemical traits. However, homology search with billions of genes in a rapidly growing database has become increasingly computationally impractical. Here we present our pilot efforts to develop a novel alignment-free algorithm for homology search. Specifically, we represent individual proteins as feature vectors that denote the presence or absence of short kmers in the protein sequence. Similarity between feature vectors is then computed using the Tanimoto score, a distance metric that can be rapidly computed on bit string representations of feature vectors. Preliminary results indicate good correlation with optimal alignment algorithms (Spearman r of 0.87, ~;;1,000,000 proteins from Pfam), as well as with heuristic algorithms such as BLAST (Spearman r of 0.86, ~;;1,000,000 proteins). Furthermore, a prototype of FASTERp implemented in Python runs approximately four times faster than BLAST on a small scale dataset (~;;1000 proteins). We are optimizing and scaling to improve FASTERp to enable rapid homology searches against billion-protein databases, thereby enabling more comprehensive gene annotation efforts.

SANSparallel: interactive homology search against Uniprot.

Science.gov (United States)

Somervuo, Panu; Holm, Liisa

2015-07-01

Proteins evolve by mutations and natural selection. The network of sequence similarities is a rich source for mining homologous relationships that inform on protein structure and function. There are many servers available to browse the network of homology relationships but one has to wait up to a minute for results. The SANSparallel webserver provides protein sequence database searches with immediate response and professional alignment visualization by third-party software. The output is a list, pairwise alignment or stacked alignment of sequence-similar proteins from Uniprot, UniRef90/50, Swissprot or Protein Data Bank. The stacked alignments are viewed in Jalview or as sequence logos. The database search uses the suffix array neighborhood search (SANS) method, which has been re-implemented as a client-server, improved and parallelized. The method is extremely fast and as sensitive as BLAST above 50% sequence identity. Benchmarks show that the method is highly competitive compared to previously published fast database search programs: UBLAST, DIAMOND, LAST, LAMBDA, RAPSEARCH2 and BLAT. The web server can be accessed interactively or programmatically at http://ekhidna2.biocenter.helsinki.fi/cgi-bin/sans/sans.cgi. It can be used to make protein functional annotation pipelines more efficient, and it is useful in interactive exploration of the detailed evidence supporting the annotation of particular proteins of interest. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Evaluating the efficacy of a structure-derived amino acid substitution matrix in detecting protein homologs by BLAST and PSI-BLAST.

Science.gov (United States)

Goonesekere, Nalin Cw

2009-01-01

The large numbers of protein sequences generated by whole genome sequencing projects require rapid and accurate methods of annotation. The detection of homology through computational sequence analysis is a powerful tool in determining the complex evolutionary and functional relationships that exist between proteins. Homology search algorithms employ amino acid substitution matrices to detect similarity between proteins sequences. The substitution matrices in common use today are constructed using sequences aligned without reference to protein structure. Here we present amino acid substitution matrices constructed from the alignment of a large number of protein domain structures from the structural classification of proteins (SCOP) database. We show that when incorporated into the homology search algorithms BLAST and PSI-blast, the structure-based substitution matrices enhance the efficacy of detecting remote homologs.

Evaluating the efficacy of a structure-derived amino acid substitution matrix in detecting protein homologs by BLAST and PSI-BLAST

Directory of Open Access Journals (Sweden)

Nalin CW Goonesekere

2009-06-01

Full Text Available Nalin CW GoonesekereDepartment of Chemistry and Biochemistry, University of Northern iowa, Cedar Falls, IA, USAAbstract: The large numbers of protein sequences generated by whole genome sequencing projects require rapid and accurate methods of annotation. The detection of homology through computational sequence analysis is a powerful tool in determining the complex evolutionary and functional relationships that exist between proteins. Homology search algorithms employ amino acid substitution matrices to detect similarity between proteins sequences. The substitution matrices in common use today are constructed using sequences aligned without reference to protein structure. Here we present amino acid substitution matrices constructed from the alignment of a large number of protein domain structures from the structural classification of proteins (SCOP database. We show that when incorporated into the homology search algorithms BLAST and PSI-blaST, the structure-based substitution matrices enhance the efficacy of detecting remote homologs. Keywords: computational biology, protein homology, amino acid substitution matrix, protein structure

TMS Over the Cerebellum Interferes with Short-term Memory of Visual Sequences.

Science.gov (United States)

Ferrari, C; Cattaneo, Z; Oldrati, V; Casiraghi, L; Castelli, F; D'Angelo, E; Vecchi, T

2018-04-30

Growing evidence suggests that the cerebellum is not only involved in motor functions, but it significantly contributes to sensory and cognitive processing as well. In particular, it has been hypothesized that the cerebellum identifies recurrent serial events and recognizes their violations. Here we used transcranial magnetic stimulation (TMS) to shed light on the role of the cerebellum in short-term memory of visual sequences. In two experiments, we found that TMS over the right cerebellar hemisphere impaired participants' ability to recognize the correct order of appearance of geometrical stimuli varying in shape and/or size. In turn, cerebellar TMS did not affect recognition of highly familiar short sequences of letters or numbers. Overall, our data suggest that the cerebellum is involved in memorizing the order in which (concatenated) stimuli appear, this process being important for sequence learning.

Studying a free fall experiment using short sequences of images

International Nuclear Information System (INIS)

Vera, Francisco; Romanque, Cristian

2008-01-01

We discuss a new alternative for obtaining position and time coordinates from a video of a free fall experiment. In our approach, after converting the video to a short sequence of images, the images are analyzed using a web page application developed by the author. The main advantage of the setup explained in this work, is that it is simple to use, no software license fees are necessary, and can be scaled-up to be used by a big number of students in introductory physics courses. The steps involved in the full analysis of a falling object are: we grab a short digital video of the experiment and convert it to a sequence of images, then, using a web page that includes all the necessary javascript, the student can easily click on the object of interest to obtain the (x,y,t) coordinates, finally, the student analyze motion using a spreadsheet.

Homology groups for particles on one-connected graphs

Science.gov (United States)

MaciÄ Żek, Tomasz; Sawicki, Adam

2017-06-01

We present a mathematical framework for describing the topology of configuration spaces for particles on one-connected graphs. In particular, we compute the homology groups over integers for different classes of one-connected graphs. Our approach is based on some fundamental combinatorial properties of the configuration spaces, Mayer-Vietoris sequences for different parts of configuration spaces, and some limited use of discrete Morse theory. As one of the results, we derive the closed-form formulae for ranks of the homology groups for indistinguishable particles on tree graphs. We also give a detailed discussion of the second homology group of the configuration space of both distinguishable and indistinguishable particles. Our motivation is the search for new kinds of quantum statistics.

Characterizing novel endogenous retroviruses from genetic variation inferred from short sequence reads

DEFF Research Database (Denmark)

Mourier, Tobias; Mollerup, Sarah; Vinner, Lasse

2015-01-01

From Illumina sequencing of DNA from brain and liver tissue from the lion, Panthera leo, and tumor samples from the pike-perch, Sander lucioperca, we obtained two assembled sequence contigs with similarity to known retroviruses. Phylogenetic analyses suggest that the pike-perch retrovirus belongs...... to the epsilonretroviruses, and the lion retrovirus to the gammaretroviruses. To determine if these novel retroviral sequences originate from an endogenous retrovirus or from a recently integrated exogenous retrovirus, we assessed the genetic diversity of the parental sequences from which the short Illumina reads...

SRComp: short read sequence compression using burstsort and Elias omega coding.

Directory of Open Access Journals (Sweden)

Jeremy John Selva

Full Text Available Next-generation sequencing (NGS technologies permit the rapid production of vast amounts of data at low cost. Economical data storage and transmission hence becomes an increasingly important challenge for NGS experiments. In this paper, we introduce a new non-reference based read sequence compression tool called SRComp. It works by first employing a fast string-sorting algorithm called burstsort to sort read sequences in lexicographical order and then Elias omega-based integer coding to encode the sorted read sequences. SRComp has been benchmarked on four large NGS datasets, where experimental results show that it can run 5-35 times faster than current state-of-the-art read sequence compression tools such as BEETL and SCALCE, while retaining comparable compression efficiency for large collections of short read sequences. SRComp is a read sequence compression tool that is particularly valuable in certain applications where compression time is of major concern.

Optimization of short amino acid sequences classifier

Science.gov (United States)

Barcz, Aleksy; Szymański, Zbigniew

This article describes processing methods used for short amino acid sequences classification. The data processed are 9-symbols string representations of amino acid sequences, divided into 49 data sets - each one containing samples labeled as reacting or not with given enzyme. The goal of the classification is to determine for a single enzyme, whether an amino acid sequence would react with it or not. Each data set is processed separately. Feature selection is performed to reduce the number of dimensions for each data set. The method used for feature selection consists of two phases. During the first phase, significant positions are selected using Classification and Regression Trees. Afterwards, symbols appearing at the selected positions are substituted with numeric values of amino acid properties taken from the AAindex database. In the second phase the new set of features is reduced using a correlation-based ranking formula and Gram-Schmidt orthogonalization. Finally, the preprocessed data is used for training LS-SVM classifiers. SPDE, an evolutionary algorithm, is used to obtain optimal hyperparameters for the LS-SVM classifier, such as error penalty parameter C and kernel-specific hyperparameters. A simple score penalty is used to adapt the SPDE algorithm to the task of selecting classifiers with best performance measures values.

PEST sequences in the malaria parasite Plasmodium falciparum: a genomic study

Directory of Open Access Journals (Sweden)

Bell Angus

2003-06-01

Full Text Available Abstract Background Inhibitors of the protease calpain are known to have selectively toxic effects on Plasmodium falciparum. The enzyme has a natural inhibitor calpastatin and in eukaryotes is responsible for turnover of proteins containing short sequences enriched in certain amino acids (PEST sequences. The genome of P. falciparum was searched for this protease, its natural inhibitor and putative substrates. Methods The publicly available P. falciparum genome was found to have too many errors to permit reliable analysis. An earlier annotation of chromosome 2 was instead examined. PEST scores were determined for all annotated proteins. The published genome was searched for calpain and calpastatin homologs. Results Typical PEST sequences were found in 13% of the proteins on chromosome 2, including a surprising number of cell-surface proteins. The annotated calpain gene has a non-biological "intron" that appears to have been created to avoid an unrecognized frameshift. Only the catalytic domain has significant similarity with the vertebrate calpains. No calpastatin homologs were found in the published annotation. Conclusion A calpain gene is present in the genome and many putative substrates of this enzyme have been found. Calpastatin homologs may be found once the re-annotation is completed. Given the selective toxicity of calpain inhibitors, this enzyme may be worth exploring further as a potential drug target.

Clustering evolving proteins into homologous families.

Science.gov (United States)

Chan, Cheong Xin; Mahbob, Maisarah; Ragan, Mark A

2013-04-08

Clustering sequences into groups of putative homologs (families) is a critical first step in many areas of comparative biology and bioinformatics. The performance of clustering approaches in delineating biologically meaningful families depends strongly on characteristics of the data, including content bias and degree of divergence. New, highly scalable methods have recently been introduced to cluster the very large datasets being generated by next-generation sequencing technologies. However, there has been little systematic investigation of how characteristics of the data impact the performance of these approaches. Using clusters from a manually curated dataset as reference, we examined the performance of a widely used graph-based Markov clustering algorithm (MCL) and a greedy heuristic approach (UCLUST) in delineating protein families coded by three sets of bacterial genomes of different G+C content. Both MCL and UCLUST generated clusters that are comparable to the reference sets at specific parameter settings, although UCLUST tends to under-cluster compositionally biased sequences (G+C content 33% and 66%). Using simulated data, we sought to assess the individual effects of sequence divergence, rate heterogeneity, and underlying G+C content. Performance decreased with increasing sequence divergence, decreasing among-site rate variation, and increasing G+C bias. Two MCL-based methods recovered the simulated families more accurately than did UCLUST. MCL using local alignment distances is more robust across the investigated range of sequence features than are greedy heuristics using distances based on global alignment. Our results demonstrate that sequence divergence, rate heterogeneity and content bias can individually and in combination affect the accuracy with which MCL and UCLUST can recover homologous protein families. For application to data that are more divergent, and exhibit higher among-site rate variation and/or content bias, MCL may often be the better

p53 regulates the repair of DNA double-strand breaks by both homologous and non-homologous recombination

International Nuclear Information System (INIS)

Willers, H.; Powell, S.N.; Dahm-Daphi, J.

2003-01-01

Full text: p53 is known to suppress spontaneous homologous recombination (HR), while its role in non-homologous recombination (NHR) remains to be clarified. Here, we sought to determine the influence of p53 on the repair of chromosomal double-strand breaks (DSBs) by HR or NHR using specially designed recombination substrates that integrate into the genome. Isogenic mouse fibroblast pairs with or without expression of exogenous p53 protein were utilized. A reporter plasmid carrying a mutated XGPRT gene was chromosomally integrated and DSBs were generated within the plasmid by the I-SceI endonuclease. Subsequent homology-mediated repair from an episomal donor resulted in XGPRT reconstitution and cellular resistance to a selection antibiotic. Analogously, the repair of chromosomal I-SceI breaks by NHR using another novel reporter plasmid restored XGPRT translation. For p53-null cells, the mean frequency of I-SceI break repair via HR was 5.5 x 10 -4 . The p53-Val135 mutant, which previously has been shown to suppress spontaneous HR by 14-fold employing the same cell system and reporter gene, only caused a 2- to 3-fold suppression of break-induced HR. In contrast, a dramatic effect of p53 on repair via NHR was found. Preliminary sequence analysis indicated that there was at least a 1000-fold reduction of illegitimate repair events resulting in loss of sequence at the break sites. The observed effects were mediated by p53 mutants defective in regulation of the cell-cycle and apoptosis. The main findings were: (1) p53 virtually blocked illegitimate rejoining of chromosomal ends. (2) The suppression of homologous DSB repair was less pronounced than the inhibition of spontaneous HR. We hypothesize that p53 allows to a certain extent error-free homology-dependent repair to proceed, while blocking error-prone NHR. The data support and extent a previous model, in which p53 maintains genomic stability by regulating recombination independently of its transactivation function

Fast and accurate taxonomic assignments of metagenomic sequences using MetaBin.

Directory of Open Access Journals (Sweden)

Vineet K Sharma

Full Text Available Taxonomic assignment of sequence reads is a challenging task in metagenomic data analysis, for which the present methods mainly use either composition- or homology-based approaches. Though the homology-based methods are more sensitive and accurate, they suffer primarily due to the time needed to generate the Blast alignments. We developed the MetaBin program and web server for better homology-based taxonomic assignments using an ORF-based approach. By implementing Blat as the faster alignment method in place of Blastx, the analysis time has been reduced by severalfold. It is benchmarked using both simulated and real metagenomic datasets, and can be used for both single and paired-end sequence reads of varying lengths (≥45 bp. To our knowledge, MetaBin is the only available program that can be used for the taxonomic binning of short reads (<100 bp with high accuracy and high sensitivity using a homology-based approach. The MetaBin web server can be used to carry out the taxonomic analysis, by either submitting reads or Blastx output. It provides several options including construction of taxonomic trees, creation of a composition chart, functional analysis using COGs, and comparative analysis of multiple metagenomic datasets. MetaBin web server and a standalone version for high-throughput analysis are available freely at http://metabin.riken.jp/.

Comparison of the degree of homology of DNA and quantity of repeated sequences in an intact plant and cell structure

International Nuclear Information System (INIS)

Solov'yan, V.T.; Kunaleh, V.A.; Shumnyl, V.K.; Vershinin, A.V.

1986-01-01

This paper attempts to assess the quantity of repeated sequences and degree of homology of DNA in the intact plant and two lines of callus tissue of Rauwolfia serpentina Benth maintained for 20 years, which differ among themselves in the level of biosynthesis of the pharmacologically valuable alkaloid ajmaline. The tritium-labeled repeats of plants and calli were used in direct and reverse hybridization on nitrocellulose filters. Hybridization of H 3-labeled repeats with phage 17 DNA was used as control. The radioactivity of filters after washing was measured in a liquid scintillation counter

Homology-integrated CRISPR-Cas (HI-CRISPR) system for one-step multigene disruption in Saccharomyces cerevisiae.

Science.gov (United States)

Bao, Zehua; Xiao, Han; Liang, Jing; Zhang, Lu; Xiong, Xiong; Sun, Ning; Si, Tong; Zhao, Huimin

2015-05-15

One-step multiple gene disruption in the model organism Saccharomyces cerevisiae is a highly useful tool for both basic and applied research, but it remains a challenge. Here, we report a rapid, efficient, and potentially scalable strategy based on the type II Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR associated proteins (Cas) system to generate multiple gene disruptions simultaneously in S. cerevisiae. A 100 bp dsDNA mutagenizing homologous recombination donor is inserted between two direct repeats for each target gene in a CRISPR array consisting of multiple donor and guide sequence pairs. An ultrahigh copy number plasmid carrying iCas9, a variant of wild-type Cas9, trans-encoded RNA (tracrRNA), and a homology-integrated crRNA cassette is designed to greatly increase the gene disruption efficiency. As proof of concept, three genes, CAN1, ADE2, and LYP1, were simultaneously disrupted in 4 days with an efficiency ranging from 27 to 87%. Another three genes involved in an artificial hydrocortisone biosynthetic pathway, ATF2, GCY1, and YPR1, were simultaneously disrupted in 6 days with 100% efficiency. This homology-integrated CRISPR (HI-CRISPR) strategy represents a powerful tool for creating yeast strains with multiple gene knockouts.

Whole genome analysis of CRISPR Cas9 sgRNA off-target homologies via an efficient computational algorithm.

Science.gov (United States)

Zhou, Hong; Zhou, Michael; Li, Daisy; Manthey, Joseph; Lioutikova, Ekaterina; Wang, Hong; Zeng, Xiao

2017-11-17

The beauty and power of the genome editing mechanism, CRISPR Cas9 endonuclease system, lies in the fact that it is RNA-programmable such that Cas9 can be guided to any genomic loci complementary to a 20-nt RNA, single guide RNA (sgRNA), to cleave double stranded DNA, allowing the introduction of wanted mutations. Unfortunately, it has been reported repeatedly that the sgRNA can also guide Cas9 to off-target sites where the DNA sequence is homologous to sgRNA. Using human genome and Streptococcus pyogenes Cas9 (SpCas9) as an example, this article mathematically analyzed the probabilities of off-target homologies of sgRNAs and discovered that for large genome size such as human genome, potential off-target homologies are inevitable for sgRNA selection. A highly efficient computationl algorithm was developed for whole genome sgRNA design and off-target homology searches. By means of a dynamically constructed sequence-indexed database and a simplified sequence alignment method, this algorithm achieves very high efficiency while guaranteeing the identification of all existing potential off-target homologies. Via this algorithm, 1,876,775 sgRNAs were designed for the 19,153 human mRNA genes and only two sgRNAs were found to be free of off-target homology. By means of the novel and efficient sgRNA homology search algorithm introduced in this article, genome wide sgRNA design and off-target analysis were conducted and the results confirmed the mathematical analysis that for a sgRNA sequence, it is almost impossible to escape potential off-target homologies. Future innovations on the CRISPR Cas9 gene editing technology need to focus on how to eliminate the Cas9 off-target activity.

MollDE: a homology modeling framework you can click with.

Science.gov (United States)

Canutescu, Adrian A; Dunbrack, Roland L

2005-06-15

Molecular Integrated Development Environment (MolIDE) is an integrated application designed to provide homology modeling tools and protocols under a uniform, user-friendly graphical interface. Its main purpose is to combine the most frequent modeling steps in a semi-automatic, interactive way, guiding the user from the target protein sequence to the final three-dimensional protein structure. The typical basic homology modeling process is composed of building sequence profiles of the target sequence family, secondary structure prediction, sequence alignment with PDB structures, assisted alignment editing, side-chain prediction and loop building. All of these steps are available through a graphical user interface. MolIDE's user-friendly and streamlined interactive modeling protocol allows the user to focus on the important modeling questions, hiding from the user the raw data generation and conversion steps. MolIDE was designed from the ground up as an open-source, cross-platform, extensible framework. This allows developers to integrate additional third-party programs to MolIDE. http://dunbrack.fccc.edu/molide/molide.php rl_dunbrack@fccc.edu.

Investigating homology between proteins using energetic profiles.

Science.gov (United States)

Wrabl, James O; Hilser, Vincent J

2010-03-26

Accumulated experimental observations demonstrate that protein stability is often preserved upon conservative point mutation. In contrast, less is known about the effects of large sequence or structure changes on the stability of a particular fold. Almost completely unknown is the degree to which stability of different regions of a protein is generally preserved throughout evolution. In this work, these questions are addressed through thermodynamic analysis of a large representative sample of protein fold space based on remote, yet accepted, homology. More than 3,000 proteins were computationally analyzed using the structural-thermodynamic algorithm COREX/BEST. Estimated position-specific stability (i.e., local Gibbs free energy of folding) and its component enthalpy and entropy were quantitatively compared between all proteins in the sample according to all-vs.-all pairwise structural alignment. It was discovered that the local stabilities of homologous pairs were significantly more correlated than those of non-homologous pairs, indicating that local stability was indeed generally conserved throughout evolution. However, the position-specific enthalpy and entropy underlying stability were less correlated, suggesting that the overall regional stability of a protein was more important than the thermodynamic mechanism utilized to achieve that stability. Finally, two different types of statistically exceptional evolutionary structure-thermodynamic relationships were noted. First, many homologous proteins contained regions of similar thermodynamics despite localized structure change, suggesting a thermodynamic mechanism enabling evolutionary fold change. Second, some homologous proteins with extremely similar structures nonetheless exhibited different local stabilities, a phenomenon previously observed experimentally in this laboratory. These two observations, in conjunction with the principal conclusion that homologous proteins generally conserved local stability, may

Investigating homology between proteins using energetic profiles.

Directory of Open Access Journals (Sweden)

James O Wrabl

2010-03-01

Full Text Available Accumulated experimental observations demonstrate that protein stability is often preserved upon conservative point mutation. In contrast, less is known about the effects of large sequence or structure changes on the stability of a particular fold. Almost completely unknown is the degree to which stability of different regions of a protein is generally preserved throughout evolution. In this work, these questions are addressed through thermodynamic analysis of a large representative sample of protein fold space based on remote, yet accepted, homology. More than 3,000 proteins were computationally analyzed using the structural-thermodynamic algorithm COREX/BEST. Estimated position-specific stability (i.e., local Gibbs free energy of folding and its component enthalpy and entropy were quantitatively compared between all proteins in the sample according to all-vs.-all pairwise structural alignment. It was discovered that the local stabilities of homologous pairs were significantly more correlated than those of non-homologous pairs, indicating that local stability was indeed generally conserved throughout evolution. However, the position-specific enthalpy and entropy underlying stability were less correlated, suggesting that the overall regional stability of a protein was more important than the thermodynamic mechanism utilized to achieve that stability. Finally, two different types of statistically exceptional evolutionary structure-thermodynamic relationships were noted. First, many homologous proteins contained regions of similar thermodynamics despite localized structure change, suggesting a thermodynamic mechanism enabling evolutionary fold change. Second, some homologous proteins with extremely similar structures nonetheless exhibited different local stabilities, a phenomenon previously observed experimentally in this laboratory. These two observations, in conjunction with the principal conclusion that homologous proteins generally conserved

De novo sequencing of two novel peptides homologous to calcitonin-like peptides, from skin secretion of the Chinese Frog, Odorrana schmackeri

Directory of Open Access Journals (Sweden)

Geisa P.C. Evaristo

2015-09-01

Full Text Available An MS/MS based analytical strategy was followed to solve the complete sequence of two new peptides from frog (Odorrana schmackeri skin secretion. This involved reduction and alkylation with two different alkylating agents followed by high resolution tandem mass spectrometry. De novo sequencing was achieved by complementary CID and ETD fragmentations of full-length peptides and of selected tryptic fragments. Heavy and light isotope dimethyl labeling assisted with annotation of sequence ion series. The identified primary structures are GCD[I/L]STCATHN[I/L]VNE[I/L]NKFDKSKPSSGGVGPESP-NH2 and SCNLSTCATHNLVNELNKFDKSKPSSGGVGPESF-NH2, i.e. two carboxyamidated 34 residue peptides with an aminoterminal intramolecular ring structure formed by a disulfide bridge between Cys2 and Cys7. Edman degradation analysis of the second peptide positively confirmed the exact sequence, resolving I/L discriminations. Both peptide sequences are novel and share homology with calcitonin, calcitonin gene related peptide (CGRP and adrenomedullin from other vertebrates. Detailed sequence analysis as well as the 34 residue length of both O. schmackeri peptides, suggest they do not fully qualify as either calcitonins (32 residues or CGRPs (37 amino acids and may justify their classification in a novel peptide family within the calcitonin gene related peptide superfamily. Smooth muscle contractility assays with synthetic replicas of the S–S linked peptides on rat tail artery, uterus, bladder and ileum did not reveal myotropic activity.

Interference by clustered regularly interspaced short palindromic repeat (CRISPR) RNA is governed by a seed sequence

NARCIS (Netherlands)

Semenova, E.V.; Jore, M.M.; Westra, E.R.; Oost, van der J.; Brouns, S.J.J.

2011-01-01

Prokaryotic clustered regularly interspaced short palindromic repeat (CRISPR)/Cas (CRISPR-associated sequences) systems provide adaptive immunity against viruses when a spacer sequence of small CRISPR RNA (crRNA) matches a protospacer sequence in the viral genome. Viruses that escape CRISPR/Cas

GPCR-SSFE: A comprehensive database of G-protein-coupled receptor template predictions and homology models

Directory of Open Access Journals (Sweden)

Kreuchwig Annika

2011-05-01

Full Text Available Abstract Background G protein-coupled receptors (GPCRs transduce a wide variety of extracellular signals to within the cell and therefore have a key role in regulating cell activity and physiological function. GPCR malfunction is responsible for a wide range of diseases including cancer, diabetes and hyperthyroidism and a large proportion of drugs on the market target these receptors. The three dimensional structure of GPCRs is important for elucidating the molecular mechanisms underlying these diseases and for performing structure-based drug design. Although structural data are restricted to only a handful of GPCRs, homology models can be used as a proxy for those receptors not having crystal structures. However, many researchers working on GPCRs are not experienced homology modellers and are therefore unable to benefit from the information that can be gleaned from such three-dimensional models. Here, we present a comprehensive database called the GPCR-SSFE, which provides initial homology models of the transmembrane helices for a large variety of family A GPCRs. Description Extending on our previous theoretical work, we have developed an automated pipeline for GPCR homology modelling and applied it to a large set of family A GPCR sequences. Our pipeline is a fragment-based approach that exploits available family A crystal structures. The GPCR-SSFE database stores the template predictions, sequence alignments, identified sequence and structure motifs and homology models for 5025 family A GPCRs. Users are able to browse the GPCR dataset according to their pharmacological classification or search for results using a UniProt entry name. It is also possible for a user to submit a GPCR sequence that is not contained in the database for analysis and homology model building. The models can be viewed using a Jmol applet and are also available for download along with the alignments. Conclusions The data provided by GPCR-SSFE are useful for investigating

GPCR-SSFE: a comprehensive database of G-protein-coupled receptor template predictions and homology models.

Science.gov (United States)

Worth, Catherine L; Kreuchwig, Annika; Kleinau, Gunnar; Krause, Gerd

2011-05-23

G protein-coupled receptors (GPCRs) transduce a wide variety of extracellular signals to within the cell and therefore have a key role in regulating cell activity and physiological function. GPCR malfunction is responsible for a wide range of diseases including cancer, diabetes and hyperthyroidism and a large proportion of drugs on the market target these receptors. The three dimensional structure of GPCRs is important for elucidating the molecular mechanisms underlying these diseases and for performing structure-based drug design. Although structural data are restricted to only a handful of GPCRs, homology models can be used as a proxy for those receptors not having crystal structures. However, many researchers working on GPCRs are not experienced homology modellers and are therefore unable to benefit from the information that can be gleaned from such three-dimensional models. Here, we present a comprehensive database called the GPCR-SSFE, which provides initial homology models of the transmembrane helices for a large variety of family A GPCRs. Extending on our previous theoretical work, we have developed an automated pipeline for GPCR homology modelling and applied it to a large set of family A GPCR sequences. Our pipeline is a fragment-based approach that exploits available family A crystal structures. The GPCR-SSFE database stores the template predictions, sequence alignments, identified sequence and structure motifs and homology models for 5025 family A GPCRs. Users are able to browse the GPCR dataset according to their pharmacological classification or search for results using a UniProt entry name. It is also possible for a user to submit a GPCR sequence that is not contained in the database for analysis and homology model building. The models can be viewed using a Jmol applet and are also available for download along with the alignments. The data provided by GPCR-SSFE are useful for investigating general and detailed sequence-structure-function relationships

Complete Unique Genome Sequence, Expression Profile, and Salivary Gland Tissue Tropism of the Herpesvirus 7 Homolog in Pigtailed Macaques.

Science.gov (United States)

Staheli, Jeannette P; Dyen, Michael R; Deutsch, Gail H; Basom, Ryan S; Fitzgibbon, Matthew P; Lewis, Patrick; Barcy, Serge

2016-08-01

Human herpesvirus 6A (HHV-6A), HHV-6B, and HHV-7 are classified as roseoloviruses and are highly prevalent in the human population. Roseolovirus reactivation in an immunocompromised host can cause severe pathologies. While the pathogenic potential of HHV-7 is unclear, it can reactivate HHV-6 from latency and thus contributes to severe pathological conditions associated with HHV-6. Because of the ubiquitous nature of roseoloviruses, their roles in such interactions and the resulting pathological consequences have been difficult to study. Furthermore, the lack of a relevant animal model for HHV-7 infection has hindered a better understanding of its contribution to roseolovirus-associated diseases. Using next-generation sequencing analysis, we characterized the unique genome of an uncultured novel pigtailed macaque roseolovirus. Detailed genomic analysis revealed the presence of gene homologs to all 84 known HHV-7 open reading frames. Phylogenetic analysis confirmed that the virus is a macaque homolog of HHV-7, which we have provisionally named Macaca nemestrina herpesvirus 7 (MneHV7). Using high-throughput RNA sequencing, we observed that the salivary gland tissue samples from nine different macaques had distinct MneHV7 gene expression patterns and that the overall number of viral transcripts correlated with viral loads in parotid gland tissue and saliva. Immunohistochemistry staining confirmed that, like HHV-7, MneHV7 exhibits a natural tropism for salivary gland ductal cells. We also observed staining for MneHV7 in peripheral nerve ganglia present in salivary gland tissues, suggesting that HHV-7 may also have a tropism for the peripheral nervous system. Our data demonstrate that MneHV7-infected macaques represent a relevant animal model that may help clarify the causality between roseolovirus reactivation and diseases. Human herpesvirus 6A (HHV-6A), HHV-6B, and HHV-7 are classified as roseoloviruses. We have recently discovered that pigtailed macaques are naturally

Resonant magnetoelectric response of composite cantilevers: Theory of short vs. open circuit operation and layer sequence effects

Directory of Open Access Journals (Sweden)

Matthias C. Krantz

2015-11-01

Full Text Available The magnetoelectric effect in layered composite cantilevers consisting of strain coupled layers of magnetostrictive (MS, piezoelectric (PE, and substrate materials is investigated for magnetic field excitation at bending resonance. Analytic theories are derived for the transverse magnetoelectric (ME response in short and open circuit operation for three different layer sequences and results presented and discussed for the FeCoBSi-AlN-Si and the FeCoBSi-PZT-Si composite systems. Response optimized PE-MS layer thickness ratios are found to greatly change with operation mode shifting from near equal MS and PE layer thicknesses in the open circuit mode to near vanishing PE layer thicknesses in short circuit operation for all layer sequences. In addition the substrate layer thickness is found to differently affect the open and short circuit ME response producing shifts and reversal between ME response maxima depending on layer sequence. The observed rich ME response behavior for different layer thicknesses, sequences, operating modes, and PE materials can be explained by common neutral plane effects and different elastic compliance effects in short and open circuit operation.

Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 with improved proof-reading enhances homology-directed repair.

Science.gov (United States)

Kato-Inui, Tomoko; Takahashi, Gou; Hsu, Szuyin; Miyaoka, Yuichiro

2018-05-18

Genome editing using clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) predominantly induces non-homologous end joining (NHEJ), which generates random insertions or deletions, whereas homology-directed repair (HDR), which generates precise recombination products, is useful for wider applications. However, the factors that determine the ratio of HDR to NHEJ products after CRISPR/Cas9 editing remain unclear, and methods by which the proportion of HDR products can be increased have not yet been fully established. We systematically analyzed the HDR and NHEJ products after genome editing using various modified guide RNAs (gRNAs) and Cas9 variants with an enhanced conformational checkpoint to improve the fidelity at endogenous gene loci in HEK293T cells and HeLa cells. We found that these modified gRNAs and Cas9 variants were able to enhance HDR in both single-nucleotide substitutions and a multi-kb DNA fragment insertion. Our results suggest that the original CRISPR/Cas9 system from the bacterial immune system is not necessarily the best option for the induction of HDR in genome editing and indicate that the modulation of the kinetics of conformational checkpoints of Cas9 can optimize the HDR/NHEJ ratio.

Universal sequence map (USM of arbitrary discrete sequences

Directory of Open Access Journals (Sweden)

Almeida Jonas S

2002-02-01

Full Text Available Abstract Background For over a decade the idea of representing biological sequences in a continuous coordinate space has maintained its appeal but not been fully realized. The basic idea is that any sequence of symbols may define trajectories in the continuous space conserving all its statistical properties. Ideally, such a representation would allow scale independent sequence analysis – without the context of fixed memory length. A simple example would consist on being able to infer the homology between two sequences solely by comparing the coordinates of any two homologous units. Results We have successfully identified such an iterative function for bijective mappingψ of discrete sequences into objects of continuous state space that enable scale-independent sequence analysis. The technique, named Universal Sequence Mapping (USM, is applicable to sequences with an arbitrary length and arbitrary number of unique units and generates a representation where map distance estimates sequence similarity. The novel USM procedure is based on earlier work by these and other authors on the properties of Chaos Game Representation (CGR. The latter enables the representation of 4 unit type sequences (like DNA as an order free Markov Chain transition table. The properties of USM are illustrated with test data and can be verified for other data by using the accompanying web-based tool:http://bioinformatics.musc.edu/~jonas/usm/. Conclusions USM is shown to enable a statistical mechanics approach to sequence analysis. The scale independent representation frees sequence analysis from the need to assume a memory length in the investigation of syntactic rules.

Characterization of Campylobacter jejuni applying flaA short variable region sequencing, multilocus sequencing and Fourier transform infrared spectroscopy

DEFF Research Database (Denmark)

Josefsen, Mathilde Hartmann; Bonnichsen, Lise; Larsson, Jonas

flaA short variable region sequencing and phenetic Fourier transform infrared (FTIR) spectroscopy was applied on a collection of 102 Campylobacter jejuni isolated from continuous sampling of organic, free range geese and chickens. FTIR has been shown to serve as a valuable tool in typing...

SEQUENCING AND SEQUENCE ANALYSIS OF MYOSTATIN GENE IN THE EXON 1 OF THE CAMEL (CAMELUS DROMEDARIUS

Directory of Open Access Journals (Sweden)

M. G. SHAH, A. S. QURESHI1, M. REISSMANN2 AND H. J. SCHWARTZ3

2006-10-01

Full Text Available Myostatin, also called growth differentiation factor-8 (GDF-8, is a member of the mammalian growth transforming family (TGF-beta superfamily, which is expressed specifically in developing an adult skeletal muscle. Muscular hypertrophy allele (mh allele in the double muscle breeds involved mutation within the myostatin gene. Genomic DNA was isolated from the camel hair using NucleoSpin Tissue kit. Two animals of each of the six breeds namely, Marecha, Dhatti, Larri, Kohi, Sakrai and Cambelpuri were used for sequencing. For PCR amplification of the gene, a primer pair was designed from homolog regions of already published sequences of farm animals from GenBank. Results showed that camel myostatin possessed more than 90% homology with that of cattle, sheep and pig. Camel formed separate cluster from the pig in spite of having high homology (98% and showed 94% homology with cattle and sheep as reported in literature. Sequence analysis of the PCR amplified part of exon 1 (256 bp of the camel myostatin was identical among six camel breeds.

Fast subcellular localization by cascaded fusion of signal-based and homology-based methods

Directory of Open Access Journals (Sweden)

Wang Wei

2011-10-01

Full Text Available Abstract Background The functions of proteins are closely related to their subcellular locations. In the post-genomics era, the amount of gene and protein data grows exponentially, which necessitates the prediction of subcellular localization by computational means. Results This paper proposes mitigating the computation burden of alignment-based approaches to subcellular localization prediction by a cascaded fusion of cleavage site prediction and profile alignment. Specifically, the informative segments of protein sequences are identified by a cleavage site predictor using the information in their N-terminal shorting signals. Then, the sequences are truncated at the cleavage site positions, and the shortened sequences are passed to PSI-BLAST for computing their profiles. Subcellular localization are subsequently predicted by a profile-to-profile alignment support-vector-machine (SVM classifier. To further reduce the training and recognition time of the classifier, the SVM classifier is replaced by a new kernel method based on the perturbational discriminant analysis (PDA. Conclusions Experimental results on a new dataset based on Swiss-Prot Release 57.5 show that the method can make use of the best property of signal- and homology-based approaches and can attain an accuracy comparable to that achieved by using full-length sequences. Analysis of profile-alignment score matrices suggest that both profile creation time and profile alignment time can be reduced without significant reduction in subcellular localization accuracy. It was found that PDA enjoys a short training time as compared to the conventional SVM. We advocate that the method will be important for biologists to conduct large-scale protein annotation or for bioinformaticians to perform preliminary investigations on new algorithms that involve pairwise alignments.

Evolutionary distance from human homologs reflects allergenicity of animal food proteins.

Science.gov (United States)

Jenkins, John A; Breiteneder, Heimo; Mills, E N Clare

2007-12-01

In silico analysis of allergens can identify putative relationships among protein sequence, structure, and allergenic properties. Such systematic analysis reveals that most plant food allergens belong to a restricted number of protein superfamilies, with pollen allergens behaving similarly. We have investigated the structural relationships of animal food allergens and their evolutionary relatedness to human homologs to define how closely a protein must resemble a human counterpart to lose its allergenic potential. Profile-based sequence homology methods were used to classify animal food allergens into Pfam families, and in silico analyses of their evolutionary and structural relationships were performed. Animal food allergens could be classified into 3 main families--tropomyosins, EF-hand proteins, and caseins--along with 14 minor families each composed of 1 to 3 allergens. The evolutionary relationships of each of these allergen superfamilies showed that in general, proteins with a sequence identity to a human homolog above approximately 62% were rarely allergenic. Single substitutions in otherwise highly conserved regions containing IgE epitopes in EF-hand parvalbumins may modulate allergenicity. These data support the premise that certain protein structures are more allergenic than others. Contrasting with plant food allergens, animal allergens, such as the highly conserved tropomyosins, challenge the capability of the human immune system to discriminate between foreign and self-proteins. Such immune responses run close to becoming autoimmune responses. Exploiting the closeness between animal allergens and their human homologs in the development of recombinant allergens for immunotherapy will need to consider the potential for developing unanticipated autoimmune responses.

MetaGO: Predicting Gene Ontology of Non-homologous Proteins Through Low-Resolution Protein Structure Prediction and Protein-Protein Network Mapping.

Science.gov (United States)

Zhang, Chengxin; Zheng, Wei; Freddolino, Peter L; Zhang, Yang

2018-03-10

Homology-based transferal remains the major approach to computational protein function annotations, but it becomes increasingly unreliable when the sequence identity between query and template decreases below 30%. We propose a novel pipeline, MetaGO, to deduce Gene Ontology attributes of proteins by combining sequence homology-based annotation with low-resolution structure prediction and comparison, and partner's homology-based protein-protein network mapping. The pipeline was tested on a large-scale set of 1000 non-redundant proteins from the CAFA3 experiment. Under the stringent benchmark conditions where templates with >30% sequence identity to the query are excluded, MetaGO achieves average F-measures of 0.487, 0.408, and 0.598, for Molecular Function, Biological Process, and Cellular Component, respectively, which are significantly higher than those achieved by other state-of-the-art function annotations methods. Detailed data analysis shows that the major advantage of the MetaGO lies in the new functional homolog detections from partner's homology-based network mapping and structure-based local and global structure alignments, the confidence scores of which can be optimally combined through logistic regression. These data demonstrate the power of using a hybrid model incorporating protein structure and interaction networks to deduce new functional insights beyond traditional sequence homology-based referrals, especially for proteins that lack homologous function templates. The MetaGO pipeline is available at http://zhanglab.ccmb.med.umich.edu/MetaGO/. Copyright © 2018. Published by Elsevier Ltd.

Evaluating the efficacy of a structure-derived amino acid substitution matrix in detecting protein homologs by BLAST and PSI-BLAST

OpenAIRE

Goonesekere, Nalin CW

2009-01-01

Nalin CW GoonesekereDepartment of Chemistry and Biochemistry, University of Northern iowa, Cedar Falls, IA, USAAbstract: The large numbers of protein sequences generated by whole genome sequencing projects require rapid and accurate methods of annotation. The detection of homology through computational sequence analysis is a powerful tool in determining the complex evolutionary and functional relationships that exist between proteins. Homology search algorithms employ amino acid substitution ...

Double Strand Break Repair, one mechanism can hide another: Alternative non-homologous end joining

International Nuclear Information System (INIS)

Rass, E.; Grabarz, A.; Bertrand, P.; Lopez, B.S.

2012-01-01

DNA double strand breaks are major cytotoxic lesions encountered by the cells. They can be induced by ionizing radiation or endogenous stress and can lead to genetic instability. Two mechanisms compete for the repair of DNA double strand breaks: homologous recombination and non-homologous end joining (NHEJ). Homologous recombination requires DNA sequences homology and is initiated by single strand resection. Recently, advances have been made concerning the major steps and proteins involved in resection. NHEJ, in contrast, does not require sequence homology. The existence of a DNA double strand break repair mechanism, independent of KU and ligase IV, the key proteins of the canonical non homologous end joining pathway, has been revealed lately and named alternative non homologous end joining. The hallmarks of this highly mutagenic pathway are deletions at repair junctions and frequent use of distal micro-homologies. This mechanism is also initiated by a single strand resection of the break. The aim of this review is firstly to present recent data on single strand resection, and secondly the alternative NHEJ pathway, including a discussion on the fidelity of NHEJ. Based on current knowledge, canonical NHEJ does not appear as an intrinsically mutagenic mechanism, but in contrast, as a conservative one. The structure of broken DNA ends actually dictates the quality repair of the alternative NHEJ and seems the actual responsible for the mutagenesis attributed beforehand to the canonical NHEJ. The existence of this novel DNA double strand breaks repair mechanism needs to be taken into account in the development of radiosensitizing strategies in order to optimise the efficiency of radiotherapy. (authors)

MATAM: reconstruction of phylogenetic marker genes from short sequencing reads in metagenomes.

Science.gov (United States)

Pericard, Pierre; Dufresne, Yoann; Couderc, Loïc; Blanquart, Samuel; Touzet, Hélène

2018-02-15

Advances in the sequencing of uncultured environmental samples, dubbed metagenomics, raise a growing need for accurate taxonomic assignment. Accurate identification of organisms present within a community is essential to understanding even the most elementary ecosystems. However, current high-throughput sequencing technologies generate short reads which partially cover full-length marker genes and this poses difficult bioinformatic challenges for taxonomy identification at high resolution. We designed MATAM, a software dedicated to the fast and accurate targeted assembly of short reads sequenced from a genomic marker of interest. The method implements a stepwise process based on construction and analysis of a read overlap graph. It is applied to the assembly of 16S rRNA markers and is validated on simulated, synthetic and genuine metagenomes. We show that MATAM outperforms other available methods in terms of low error rates and recovered fractions and is suitable to provide improved assemblies for precise taxonomic assignments. https://github.com/bonsai-team/matam. pierre.pericard@gmail.com or helene.touzet@univ-lille1.fr. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

Mutagenic Organized Recombination Process by Homologous IN vivo Grouping (MORPHING) for directed enzyme evolution.

Science.gov (United States)

Gonzalez-Perez, David; Molina-Espeja, Patricia; Garcia-Ruiz, Eva; Alcalde, Miguel

2014-01-01

Approaches that depend on directed evolution require reliable methods to generate DNA diversity so that mutant libraries can focus on specific target regions. We took advantage of the high frequency of homologous DNA recombination in Saccharomyces cerevisiae to develop a strategy for domain mutagenesis aimed at introducing and in vivo recombining random mutations in defined segments of DNA. Mutagenic Organized Recombination Process by Homologous IN vivo Grouping (MORPHING) is a one-pot random mutagenic method for short protein regions that harnesses the in vivo recombination apparatus of yeast. Using this approach, libraries can be prepared with different mutational loads in DNA segments of less than 30 amino acids so that they can be assembled into the remaining unaltered DNA regions in vivo with high fidelity. As a proof of concept, we present two eukaryotic-ligninolytic enzyme case studies: i) the enhancement of the oxidative stability of a H2O2-sensitive versatile peroxidase by independent evolution of three distinct protein segments (Leu28-Gly57, Leu149-Ala174 and Ile199-Leu268); and ii) the heterologous functional expression of an unspecific peroxygenase by exclusive evolution of its native 43-residue signal sequence.

A Comprehensive Strategy for Accurate Mutation Detection of the Highly Homologous PMS2.

Science.gov (United States)

Li, Jianli; Dai, Hongzheng; Feng, Yanming; Tang, Jia; Chen, Stella; Tian, Xia; Gorman, Elizabeth; Schmitt, Eric S; Hansen, Terah A A; Wang, Jing; Plon, Sharon E; Zhang, Victor Wei; Wong, Lee-Jun C

2015-09-01

Germline mutations in the DNA mismatch repair gene PMS2 underlie the cancer susceptibility syndrome, Lynch syndrome. However, accurate molecular testing of PMS2 is complicated by a large number of highly homologous sequences. To establish a comprehensive approach for mutation detection of PMS2, we have designed a strategy combining targeted capture next-generation sequencing (NGS), multiplex ligation-dependent probe amplification, and long-range PCR followed by NGS to simultaneously detect point mutations and copy number changes of PMS2. Exonic deletions (E2 to E9, E5 to E9, E8, E10, E14, and E1 to E15), duplications (E11 to E12), and a nonsense mutation, p.S22*, were identified. Traditional multiplex ligation-dependent probe amplification and Sanger sequencing approaches cannot differentiate the origin of the exonic deletions in the 3' region when PMS2 and PMS2CL share identical sequences as a result of gene conversion. Our approach allows unambiguous identification of mutations in the active gene with a straightforward long-range-PCR/NGS method. Breakpoint analysis of multiple samples revealed that recurrent exon 14 deletions are mediated by homologous Alu sequences. Our comprehensive approach provides a reliable tool for accurate molecular analysis of genes containing multiple copies of highly homologous sequences and should improve PMS2 molecular analysis for patients with Lynch syndrome. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

A unique genomic sequence in the Wolf-Hirschhorn syndrome [WHS] region of humans is conserved in the great apes.

Science.gov (United States)

Tarzami, S T; Kringstein, A M; Conte, R A; Verma, R S

1996-10-01

The Wolf-Hirschhorn syndrome (WHS) is caused by a partial deletion in the short arm of chromosome 4 band 16.3 (4p 16.3). A unique-sequence human DNA probe (39 kb) localized within this region has been used to search for sequence homology in the apes' equivalent chromosome 3 by FISH-technique. The WHS loci are conserved in higher primates at the expected position. Nevertheless, a control probe, which detects alphoid sequences of the pericentromeric region of humans, is diverged in chimpanzee, gorilla, and orangutan. The conservation of WHS loci and divergence of DNA alphoid sequences have further added to the controversy concerning human descent.

Nucleotide sequence of the hexA gene for DNA mismatch repair in Streptococcus pneumoniae and homology of hexA to mutS of Escherichia coli and Salmonella typhimurium

International Nuclear Information System (INIS)

Priebe, S.D.; Hadi, S.M.; Greenberg, B.; Lacks, S.A.

1988-01-01

The Hex system of heteroduplex DNA base mismatch repair operates in Streptococcus pneumoniae after transformation and replication to correct donor and nascent DNA strands, respectively. A functionally similar system, called Mut, operates in Escherichia coli and Salmonella typhimurium. The nucleotide sequence of a 3.8-kilobase segment from the S. pneumoniae chromosome that includes the 2.7-kilobase hexA gene was determined. Chromosomal DNA used as donor to measure Hex phenotype was irradiated with UV light. An open reading frame that could encode a 17-kilodalton polypeptide (OrfC) was located just upstream of the gene encoding a polypeptide of 95 kilodaltons corresponding to HexA. Shine-Dalgarno sequences and putative promoters were identified upstream of each protein start site. Insertion mutations showed that only HexA functioned in mismatch repair and that the promoter for hexA transcription was located within the OrfC-coding region. The HexA polypeptide contains a consensus sequence for ATP- or GTP-binding sites in proteins. Comparison of the entire HexA protein sequence to that of MutS of S. typhimurium, showed the proteins to be homologous, inasmuch as 36% of their amino acid residues were identical. This homology indicates that the Hex and Mut systems of mismatch repair evolved from an ancestor common to the gram-positive streptococci and the gram-negative enterobacteria. It is the first direct evidence linking the two systems

Study of the fast inversion recovery pulse sequence. With reference to fast fluid attenuated inversion recovery and fast short TI inversion recovery pulse sequence

International Nuclear Information System (INIS)

Tsuchihashi, Toshio; Maki, Toshio; Suzuki, Takeshi

1997-01-01

The fast inversion recovery (fast IR) pulse sequence was evaluated. We compared the fast fluid attenuated inversion recovery (fast FLAIR) pulse sequence in which inversion time (TI) was established as equal to the water null point for the purpose of the water-suppressed T 2 -weighted image, with the fast short TI inversion recovery (fast STIR) pulse sequence in which TI was established as equal to the fat null point for purpose of fat suppression. In the fast FLAIR pulse sequence, the water null point was increased by making TR longer. In the FLAIR pulse sequence, the longitudinal magnetization contrast is determined by TI. If TI is increased, T 2 -weighted contrast improves in the same way as increasing TR for the SE pulse sequence. Therefore, images should be taken with long TR and long TI, which are longer than TR and longer than the water null point. On the other hand, the fat null point is not affected by TR in the fast STIR pulse sequence. However, effective TE was affected by variation of the null point. This increased in proportion to the increase in effective TE. Our evaluation indicated that the fast STIR pulse sequence can control the extensive signals from fat in a short time. (author)

High-Specificity Targeted Functional Profiling in Microbial Communities with ShortBRED.

Directory of Open Access Journals (Sweden)

James Kaminski

2015-12-01

Full Text Available Profiling microbial community function from metagenomic sequencing data remains a computationally challenging problem. Mapping millions of DNA reads from such samples to reference protein databases requires long run-times, and short read lengths can result in spurious hits to unrelated proteins (loss of specificity. We developed ShortBRED (Short, Better Representative Extract Dataset to address these challenges, facilitating fast, accurate functional profiling of metagenomic samples. ShortBRED consists of two components: (i a method that reduces reference proteins of interest to short, highly representative amino acid sequences ("markers" and (ii a search step that maps reads to these markers to quantify the relative abundance of their associated proteins. After evaluating ShortBRED on synthetic data, we applied it to profile antibiotic resistance protein families in the gut microbiomes of individuals from the United States, China, Malawi, and Venezuela. Our results support antibiotic resistance as a core function in the human gut microbiome, with tetracycline-resistant ribosomal protection proteins and Class A beta-lactamases being the most widely distributed resistance mechanisms worldwide. ShortBRED markers are applicable to other homology-based search tasks, which we demonstrate here by identifying phylogenetic signatures of antibiotic resistance across more than 3,000 microbial isolate genomes. ShortBRED can be applied to profile a wide variety of protein families of interest; the software, source code, and documentation are available for download at http://huttenhower.sph.harvard.edu/shortbred.

Statistical alignment: computational properties, homology testing and goodness-of-fit

DEFF Research Database (Denmark)

Hein, J; Wiuf, Carsten; Møller, Martin

2000-01-01

The model of insertions and deletions in biological sequences, first formulated by Thorne, Kishino, and Felsenstein in 1991 (the TKF91 model), provides a basis for performing alignment within a statistical framework. Here we investigate this model.Firstly, we show how to accelerate the statistical...... alignment algorithms several orders of magnitude. The main innovations are to confine likelihood calculations to a band close to the similarity based alignment, to get good initial guesses of the evolutionary parameters and to apply an efficient numerical optimisation algorithm for finding the maximum...... analysis.Secondly, we propose a new homology test based on this model, where homology means that an ancestor to a sequence pair can be found finitely far back in time. This test has statistical advantages relative to the traditional shuffle test for proteins.Finally, we describe a goodness-of-fit test...

Short branches lead to systematic artifacts when BLAST searches are used as surrogate for phylogenetic reconstruction.

Science.gov (United States)

Dick, Amanda A; Harlow, Timothy J; Gogarten, J Peter

2017-02-01

Long Branch Attraction (LBA) is a well-known artifact in phylogenetic reconstruction when dealing with branch length heterogeneity. Here we show another phenomenon, Short Branch Attraction (SBA), which occurs when BLAST searches, a phenetic analysis, are used as a surrogate method for phylogenetic analysis. This error also results from branch length heterogeneity, but this time it is the short branches that are attracting. The SBA artifact is reciprocal and can be returned 100% of the time when multiple branches differ in length by a factor of more than two. SBA is an intended feature of BLAST searches, but becomes an issue, when top scoring BLAST hit analyses are used to infer Horizontal Gene Transfers (HGTs), assign taxonomic category with environmental sequence data in phylotyping, or gather homologous sequences for building gene families. SBA can lead researchers to believe that there has been a HGT event when only vertical descent has occurred, cause slowly evolving taxa to be over-represented and quickly evolving taxa to be under-represented in phylotyping, or systematically exclude quickly evolving taxa from analyses. SBA also contributes to the changing results of top scoring BLAST hit analyses as the database grows, because more slowly evolving taxa, or short branches, are added over time, introducing more potential for SBA. SBA can be detected by examining reciprocal best BLAST hits among a larger group of taxa, including the known closest phylogenetic neighbors. Therefore, one should look for this phenomenon when conducting best BLAST hit analyses as a surrogate method to identify HGTs, in phylotyping, or when using BLAST to gather homologous sequences. Copyright © 2016 Elsevier Inc. All rights reserved.

Identification of the porcine homologous of human disease causing trinucleotide repeat sequences

DEFF Research Database (Denmark)

Madsen, Lone Bruhn; Thomsen, Bo; Sølvsten, Christina Ane Elisabeth

2007-01-01

in this paper the identification of porcine noncoding and polyglutamine-encoding TNR regions and the comparison to the homologous TNRs from human, chimpanzee, dog, opossum, rat, and mouse. Several of the porcine TNR regions are highly polymorphic both within and between different breeds. The TNR regions...

Keeping it together: Semantic coherence stabilizes phonological sequences in short-term memory.

Science.gov (United States)

Savill, Nicola; Ellis, Rachel; Brooke, Emma; Koa, Tiffany; Ferguson, Suzie; Rojas-Rodriguez, Elena; Arnold, Dominic; Smallwood, Jonathan; Jefferies, Elizabeth

2018-04-01

Our ability to hold a sequence of speech sounds in mind, in the correct configuration, supports many aspects of communication, but the contribution of conceptual information to this basic phonological capacity remains controversial. Previous research has shown modest and inconsistent benefits of meaning on phonological stability in short-term memory, but these studies were based on sets of unrelated words. Using a novel design, we examined the immediate recall of sentence-like sequences with coherent meaning, alongside both standard word lists and mixed lists containing words and nonwords. We found, and replicated, substantial effects of coherent meaning on phoneme-level accuracy: The phonemes of both words and nonwords within conceptually coherent sequences were more likely to be produced together and in the correct order. Since nonwords do not exist as items in long-term memory, the semantic enhancement of phoneme-level recall for both item types cannot be explained by a lexically based item reconstruction process employed at the point of retrieval ("redintegration"). Instead, our data show, for naturalistic input, that when meaning emerges from the combination of words, the phonological traces that support language are reinforced by a semantic-binding process that has been largely overlooked by past short-term memory research.

Tools for analyzing genetic variants from sequencing data Case study: short tandem repeats

OpenAIRE

Gymrek, Melissa

2016-01-01

This was presented as a BitesizeBio Webinar entitled "Tools for analyzing genetic variants from sequencing data Case study: short tandem repeats"Accompanying scripts can be accessed on github:https://github.com/mgymrek/mgymrek-bitesizebio-webinar 

[Bioinformatics Analysis of Clustered Regularly Interspaced Short Palindromic Repeats in the Genomes of Shigella].

Science.gov (United States)

Wang, Pengfei; Wang, Yingfang; Duan, Guangcai; Xue, Zerun; Wang, Linlin; Guo, Xiangjiao; Yang, Haiyan; Xi, Yuanlin

2015-04-01

This study was aimed to explore the features of clustered regularly interspaced short palindromic repeats (CRISPR) structures in Shigella by using bioinformatics. We used bioinformatics methods, including BLAST, alignment and RNA structure prediction, to analyze the CRISPR structures of Shigella genomes. The results showed that the CRISPRs existed in the four groups of Shigella, and the flanking sequences of upstream CRISPRs could be classified into the same group with those of the downstream. We also found some relatively conserved palindromic motifs in the leader sequences. Repeat sequences had the same group with corresponding flanking sequences, and could be classified into two different types by their RNA secondary structures, which contain "stem" and "ring". Some spacers were found to homologize with part sequences of plasmids or phages. The study indicated that there were correlations between repeat sequences and flanking sequences, and the repeats might act as a kind of recognition mechanism to mediate the interaction between foreign genetic elements and Cas proteins.

Productive homologous and non-homologous recombination of hepatitis C virus in cell culture

DEFF Research Database (Denmark)

Scheel, Troels K H; Galli, Andrea; Li, Yi-Ping

2013-01-01

. In addition, recombination is an important regulatory mechanism of cytopathogenicity for the related pestiviruses. Here we describe recombination of HCV RNA in cell culture leading to production of infectious virus. Initially, hepatoma cells were co-transfected with a replicating JFH1ΔE1E2 genome (genotype 2a......) lacking functional envelope genes and strain J6 (2a), which has functional envelope genes but does not replicate in culture. After an initial decrease in the number of HCV positive cells, infection spread after 13-36 days. Sequencing of recovered viruses revealed non-homologous recombinants with J6...

Sequencing BPS spectra

Energy Technology Data Exchange (ETDEWEB)

Gukov, Sergei [Walter Burke Institute for Theoretical Physics, California Institute of Technology,1200 E California Blvd, Pasadena, CA 91125 (United States); Max-Planck-Institut für Mathematik,Vivatsgasse 7, D-53111 Bonn (Germany); Nawata, Satoshi [Walter Burke Institute for Theoretical Physics, California Institute of Technology,1200 E California Blvd, Pasadena, CA 91125 (United States); Centre for Quantum Geometry of Moduli Spaces, University of Aarhus,Nordre Ringgade 1, DK-8000 (Denmark); Saberi, Ingmar [Walter Burke Institute for Theoretical Physics, California Institute of Technology,1200 E California Blvd, Pasadena, CA 91125 (United States); Stošić, Marko [CAMGSD, Departamento de Matemática, Instituto Superior Técnico,Av. Rovisco Pais, 1049-001 Lisbon (Portugal); Mathematical Institute SANU,Knez Mihajlova 36, 11000 Belgrade (Serbia); Sułkowski, Piotr [Walter Burke Institute for Theoretical Physics, California Institute of Technology,1200 E California Blvd, Pasadena, CA 91125 (United States); Faculty of Physics, University of Warsaw,ul. Pasteura 5, 02-093 Warsaw (Poland)

2016-03-02

This paper provides both a detailed study of color-dependence of link homologies, as realized in physics as certain spaces of BPS states, and a broad study of the behavior of BPS states in general. We consider how the spectrum of BPS states varies as continuous parameters of a theory are perturbed. This question can be posed in a wide variety of physical contexts, and we answer it by proposing that the relationship between unperturbed and perturbed BPS spectra is described by a spectral sequence. These general considerations unify previous applications of spectral sequence techniques to physics, and explain from a physical standpoint the appearance of many spectral sequences relating various link homology theories to one another. We also study structural properties of colored HOMFLY homology for links and evaluate Poincaré polynomials in numerous examples. Among these structural properties is a novel “sliding” property, which can be explained by using (refined) modular S-matrix. This leads to the identification of modular transformations in Chern-Simons theory and 3d N=2 theory via the 3d/3d correspondence. Lastly, we introduce the notion of associated varieties as classical limits of recursion relations of colored superpolynomials of links, and study their properties.

Sequencing BPS spectra

International Nuclear Information System (INIS)

Gukov, Sergei; Nawata, Satoshi; Saberi, Ingmar; Stošić, Marko; Sułkowski, Piotr

2016-01-01

This paper provides both a detailed study of color-dependence of link homologies, as realized in physics as certain spaces of BPS states, and a broad study of the behavior of BPS states in general. We consider how the spectrum of BPS states varies as continuous parameters of a theory are perturbed. This question can be posed in a wide variety of physical contexts, and we answer it by proposing that the relationship between unperturbed and perturbed BPS spectra is described by a spectral sequence. These general considerations unify previous applications of spectral sequence techniques to physics, and explain from a physical standpoint the appearance of many spectral sequences relating various link homology theories to one another. We also study structural properties of colored HOMFLY homology for links and evaluate Poincaré polynomials in numerous examples. Among these structural properties is a novel “sliding” property, which can be explained by using (refined) modular S-matrix. This leads to the identification of modular transformations in Chern-Simons theory and 3d N=2 theory via the 3d/3d correspondence. Lastly, we introduce the notion of associated varieties as classical limits of recursion relations of colored superpolynomials of links, and study their properties.

Homotopic Chain Maps Have Equal s-Homology and d-Homology

Directory of Open Access Journals (Sweden)

M. Z. Kazemi-Baneh

2016-01-01

Full Text Available The homotopy of chain maps on preabelian categories is investigated and the equality of standard homologies and d-homologies of homotopic chain maps is established. As a special case, if X and Y are the same homotopy type, then their nth d-homology R-modules are isomorphic, and if X is a contractible space, then its nth d-homology R-modules for n≠0 are trivial.

CORE-SINEs: eukaryotic short interspersed retroposing elements with common sequence motifs.

Science.gov (United States)

Gilbert, N; Labuda, D

1999-03-16

A 65-bp "core" sequence is dispersed in hundreds of thousands copies in the human genome. This sequence was found to constitute the central segment of a group of short interspersed elements (SINEs), referred to as mammalian-wide interspersed repeats, that proliferated before the radiation of placental mammals. Here, we propose that the core identifies an ancient tRNA-like SINE element, which survived in different lineages such as mammals, reptiles, birds, and fish, as well as mollusks, presumably for >550 million years. This element gave rise to a number of sequence families (CORE-SINEs), including mammalian-wide interspersed repeats, whose distinct 3' ends are shared with different families of long interspersed elements (LINEs). The evolutionary success of the generic CORE-SINE element can be related to the recruitment of the internal promoter from highly transcribed host RNA as well as to its capacity to adapt to changing retropositional opportunities by sequence exchange with actively amplifying LINEs. It reinforces the notion that the very existence of SINEs depends on the cohabitation with both LINEs and the host genome.

Sequence and transcription analysis of the human cytomegalovirus DNA polymerase gene

International Nuclear Information System (INIS)

Kouzarides, T.; Bankier, A.T.; Satchwell, S.C.; Weston, K.; Tomlinson, P.; Barrell, B.G.

1987-01-01

DNA sequence analysis has revealed that the gene coding for the human cytomegalovirus (HCMV) DNA polymerase is present within the long unique region of the virus genome. Identification is based on extensive amino acid homology between the predicted HCMV open reading frame HFLF2 and the DNA polymerase of herpes simplex virus type 1. The authors present here a 5280 base-pair DNA sequence containing the HCMV pol gene, along with the analysis of transcripts encoded within this region. Since HCMV pol also shows homology to the predicted Epstein-Barr virus pol, they were able to analyze the extent of homology between the DNA polymerases of three distantly related herpes viruses, HCMV, Epstein-Barr virus, and herpes simplex virus. The comparison shows that these DNA polymerases exhibit considerable amino acid homology and highlights a number of highly conserved regions; two such regions show homology to sequences within the adenovirus type 2 DNA polymerase. The HCMV pol gene is flanked by open reading frames with homology to those of other herpes viruses; upstream, there is a reading frame homologous to the glycoprotein B gene of herpes simplex virus type I and Epstein-Barr virus, and downstream there is a reading frame homologous to BFLF2 of Epstein-Barr virus

Choice of reference sequence and assembler for alignment of Listeria monocytogenes short-read sequence data greatly influences rates of error in SNP analyses.

Directory of Open Access Journals (Sweden)

Arthur W Pightling

Full Text Available The wide availability of whole-genome sequencing (WGS and an abundance of open-source software have made detection of single-nucleotide polymorphisms (SNPs in bacterial genomes an increasingly accessible and effective tool for comparative analyses. Thus, ensuring that real nucleotide differences between genomes (i.e., true SNPs are detected at high rates and that the influences of errors (such as false positive SNPs, ambiguously called sites, and gaps are mitigated is of utmost importance. The choices researchers make regarding the generation and analysis of WGS data can greatly influence the accuracy of short-read sequence alignments and, therefore, the efficacy of such experiments. We studied the effects of some of these choices, including: i depth of sequencing coverage, ii choice of reference-guided short-read sequence assembler, iii choice of reference genome, and iv whether to perform read-quality filtering and trimming, on our ability to detect true SNPs and on the frequencies of errors. We performed benchmarking experiments, during which we assembled simulated and real Listeria monocytogenes strain 08-5578 short-read sequence datasets of varying quality with four commonly used assemblers (BWA, MOSAIK, Novoalign, and SMALT, using reference genomes of varying genetic distances, and with or without read pre-processing (i.e., quality filtering and trimming. We found that assemblies of at least 50-fold coverage provided the most accurate results. In addition, MOSAIK yielded the fewest errors when reads were aligned to a nearly identical reference genome, while using SMALT to align reads against a reference sequence that is ∼0.82% distant from 08-5578 at the nucleotide level resulted in the detection of the greatest numbers of true SNPs and the fewest errors. Finally, we show that whether read pre-processing improves SNP detection depends upon the choice of reference sequence and assembler. In total, this study demonstrates that researchers

A multidimensional strategy to detect polypharmacological targets in the absence of structural and sequence homology.

Science.gov (United States)

Durrant, Jacob D; Amaro, Rommie E; Xie, Lei; Urbaniak, Michael D; Ferguson, Michael A J; Haapalainen, Antti; Chen, Zhijun; Di Guilmi, Anne Marie; Wunder, Frank; Bourne, Philip E; McCammon, J Andrew

2010-01-22

Conventional drug design embraces the "one gene, one drug, one disease" philosophy. Polypharmacology, which focuses on multi-target drugs, has emerged as a new paradigm in drug discovery. The rational design of drugs that act via polypharmacological mechanisms can produce compounds that exhibit increased therapeutic potency and against which resistance is less likely to develop. Additionally, identifying multiple protein targets is also critical for side-effect prediction. One third of potential therapeutic compounds fail in clinical trials or are later removed from the market due to unacceptable side effects often caused by off-target binding. In the current work, we introduce a multidimensional strategy for the identification of secondary targets of known small-molecule inhibitors in the absence of global structural and sequence homology with the primary target protein. To demonstrate the utility of the strategy, we identify several targets of 4,5-dihydroxy-3-(1-naphthyldiazenyl)-2,7-naphthalenedisulfonic acid, a known micromolar inhibitor of Trypanosoma brucei RNA editing ligase 1. As it is capable of identifying potential secondary targets, the strategy described here may play a useful role in future efforts to reduce drug side effects and/or to increase polypharmacology.

Cloning, Expression, Sequence Analysis and Homology Modeling of the Prolyl Endoprotease from Eurygaster integriceps Puton

Directory of Open Access Journals (Sweden)

Ravi Chandra Yandamuri

2014-10-01

Full Text Available eurygaster integriceps Puton, commonly known as sunn pest, is a major pest of wheat in Northern Africa, the Middle East and Eastern Europe. This insect injects a prolyl endoprotease into the wheat, destroying the gluten. The purpose of this study was to clone the full length cDNA of the sunn pest prolyl endoprotease (spPEP for expression in E. coli and to compare the amino acid sequence of the enzyme to other known PEPs in both phylogeny and potential tertiary structure. Sequence analysis shows that the 5ꞌ UTR contains several putative transcription factor binding sites for transcription factors known to be expressed in Drosophila that might be useful targets for inhibition of the enzyme. The spPEP was first identified as a prolyl endoprotease by Darkoh et al., 2010. The enzyme is a unique serine protease of the S9A family by way of its substrate recognition of the gluten proteins, which are greater than 30 kD in size. At 51% maximum identity to known PEPs, homology modeling using SWISS-MODEL, the porcine brain PEP (PDB: 2XWD was selected in the database of known PEP structures, resulting in a predicted tertiary structure 99% identical to the porcine brain PEP structure. A Km for the recombinant spPEP was determined to be 210 ± 53 µM for the zGly-Pro-pNA substrate in 0.025 M ethanolamine, pH 8.5, containing 0.1 M NaCl at 37 °C with a turnover rate of 172 ± 47 µM Gly-Pro-pNA/s/µM of enzyme.

Correction of echo shift in reconstruction processing for ultra-short TE pulse sequence

International Nuclear Information System (INIS)

Takizawa, Masahiro; Ootsuka, Takehiro; Abe, Takayuki; Takahashi, Tetsuhiko

2010-01-01

An ultra-short echo time (TE) pulse sequence is composed of a radial sampling that acquires echo signals radially in the K-space and a half-echo acquisition that acquires only half of the echo signal. The shift in the position of the echo signal (echo shift) caused by the timing errors in the gradient magnetic field pulses affects the image quality in the radial sampling with the half-echo acquisition. To improve image quality, we have developed a signal correction algorithm that detects and eliminates this echo shift during reconstruction by performing a pre-scan within 10 seconds. The results showed that image quality is improved under oblique and/or off-centering conditions that frequently cause image distortion due to hardware error. In conclusion, we have developed a robust ultra-short TE pulse sequence that allows wide latitude in the scan parameters, including oblique and off-centering conditions. (author)

Recovery of arrested replication forks by homologous recombination is error-prone.

Directory of Open Access Journals (Sweden)

Ismail Iraqui

Full Text Available Homologous recombination is a universal mechanism that allows repair of DNA and provides support for DNA replication. Homologous recombination is therefore a major pathway that suppresses non-homology-mediated genome instability. Here, we report that recovery of impeded replication forks by homologous recombination is error-prone. Using a fork-arrest-based assay in fission yeast, we demonstrate that a single collapsed fork can cause mutations and large-scale genomic changes, including deletions and translocations. Fork-arrest-induced gross chromosomal rearrangements are mediated by inappropriate ectopic recombination events at the site of collapsed forks. Inverted repeats near the site of fork collapse stimulate large-scale genomic changes up to 1,500 times over spontaneous events. We also show that the high accuracy of DNA replication during S-phase is impaired by impediments to fork progression, since fork-arrest-induced mutation is due to erroneous DNA synthesis during recovery of replication forks. The mutations caused are small insertions/duplications between short tandem repeats (micro-homology indicative of replication slippage. Our data establish that collapsed forks, but not stalled forks, recovered by homologous recombination are prone to replication slippage. The inaccuracy of DNA synthesis does not rely on PCNA ubiquitination or trans-lesion-synthesis DNA polymerases, and it is not counteracted by mismatch repair. We propose that deletions/insertions, mediated by micro-homology, leading to copy number variations during replication stress may arise by progression of error-prone replication forks restarted by homologous recombination.

Genes homologous to glycopeptide resistance vanA are widespread in soil microbial communities

DEFF Research Database (Denmark)

Guardabassi, L.; Agersø, Yvonne

2006-01-01

-Ala : D-Ala ligase genes unrelated to vanA. In order to enhance detection of vanA-homologous genes, a third PCR step was added using primers targeting vanA in soil Paenibacillus. Sequencing of 25 clones obtained by this method allowed recovery of 23 novel sequences having 86-100% identity with van...

Accurate estimation of short read mapping quality for next-generation genome sequencing

Science.gov (United States)

Ruffalo, Matthew; Koyutürk, Mehmet; Ray, Soumya; LaFramboise, Thomas

2012-01-01

Motivation: Several software tools specialize in the alignment of short next-generation sequencing reads to a reference sequence. Some of these tools report a mapping quality score for each alignment—in principle, this quality score tells researchers the likelihood that the alignment is correct. However, the reported mapping quality often correlates weakly with actual accuracy and the qualities of many mappings are underestimated, encouraging the researchers to discard correct mappings. Further, these low-quality mappings tend to correlate with variations in the genome (both single nucleotide and structural), and such mappings are important in accurately identifying genomic variants. Approach: We develop a machine learning tool, LoQuM (LOgistic regression tool for calibrating the Quality of short read mappings, to assign reliable mapping quality scores to mappings of Illumina reads returned by any alignment tool. LoQuM uses statistics on the read (base quality scores reported by the sequencer) and the alignment (number of matches, mismatches and deletions, mapping quality score returned by the alignment tool, if available, and number of mappings) as features for classification and uses simulated reads to learn a logistic regression model that relates these features to actual mapping quality. Results: We test the predictions of LoQuM on an independent dataset generated by the ART short read simulation software and observe that LoQuM can ‘resurrect’ many mappings that are assigned zero quality scores by the alignment tools and are therefore likely to be discarded by researchers. We also observe that the recalibration of mapping quality scores greatly enhances the precision of called single nucleotide polymorphisms. Availability: LoQuM is available as open source at http://compbio.case.edu/loqum/. Contact: matthew.ruffalo@case.edu. PMID:22962451

The Complete Genome Sequence of Herpesvirus Papio 2 (Cercopithecine Herpesvirus 16) Shows Evidence of Recombination Events among Various Progenitor Herpesviruses†

Science.gov (United States)

Tyler, Shaun D.; Severini, Alberto

2006-01-01

We have sequenced the entire genome of herpesvirus papio 2 (HVP-2; Cercopithecine herpesvirus 16) strain X313, a baboon herpesvirus with close homology to other primate alphaherpesviruses, such as SA8, monkey B virus, and herpes simplex virus (HSV) type 1 and type 2. The genome of HVP-2 is 156,487 bp in length, with an overall GC content of 76.5%. The genome organization is identical to that of the other members of the genus Simplexvirus, with a long and a short unique region, each bordered by inverted repeats which end with an “a” sequence. All of the open reading frames detected in this genome were homologous and colinear with those of SA8 and B virus. The HSV gene RL1 (γ134.5; neurovirulence factor) is not present in HVP-2, as is the case for SA8 and B virus. The HVP-2 genome is 85% homologous to its closest relative, SA8. However, segment-by-segment bootstrap analysis of the genome revealed at least two regions that display closer homology to the corresponding sequences of B virus. The first region comprises the UL41 to UL44 genes, and the second region is located within the UL36 gene. We hypothesize that this localized and defined shift in homology is due to recombination events between an SA8-like progenitor of HVP-2 and a herpesvirus species more closely related to the B virus. Since some of the genes involved in these putative recombination events are determinants of virulence, a comparative analysis of their function may provide insight into the pathogenic mechanism of simplexviruses. PMID:16414998

The complete genome sequence of herpesvirus papio 2 (Cercopithecine herpesvirus 16) shows evidence of recombination events among various progenitor herpesviruses.

Science.gov (United States)

Tyler, Shaun D; Severini, Alberto

2006-02-01

We have sequenced the entire genome of herpesvirus papio 2 (HVP-2; Cercopithecine herpesvirus 16) strain X313, a baboon herpesvirus with close homology to other primate alphaherpesviruses, such as SA8, monkey B virus, and herpes simplex virus (HSV) type 1 and type 2. The genome of HVP-2 is 156,487 bp in length, with an overall GC content of 76.5%. The genome organization is identical to that of the other members of the genus Simplexvirus, with a long and a short unique region, each bordered by inverted repeats which end with an "a" sequence. All of the open reading frames detected in this genome were homologous and colinear with those of SA8 and B virus. The HSV gene RL1 (gamma(1)34.5; neurovirulence factor) is not present in HVP-2, as is the case for SA8 and B virus. The HVP-2 genome is 85% homologous to its closest relative, SA8. However, segment-by-segment bootstrap analysis of the genome revealed at least two regions that display closer homology to the corresponding sequences of B virus. The first region comprises the UL41 to UL44 genes, and the second region is located within the UL36 gene. We hypothesize that this localized and defined shift in homology is due to recombination events between an SA8-like progenitor of HVP-2 and a herpesvirus species more closely related to the B virus. Since some of the genes involved in these putative recombination events are determinants of virulence, a comparative analysis of their function may provide insight into the pathogenic mechanism of simplexviruses.

The genome BLASTatlas - a GeneWiz extension for visualization of whole-genome homology

DEFF Research Database (Denmark)

Hallin, Peter Fischer; Binnewies, Tim Terence; Ussery, David

2008-01-01

://www.cbs.dtu.dk/ws/BLASTatlas), where programming examples are available in Perl. By providing an interoperable method to carry out whole genome visualization of homology, this service offers bioinformaticians as well as biologists an easy-to-adopt workflow that can be directly called from the programming language of the user, hence......The development of fast and inexpensive methods for sequencing bacterial genomes has led to a wealth of data, often with many genomes being sequenced of the same species or closely related organisms. Thus, there is a need for visualization methods that will allow easy comparison of many sequenced...... genomes to a defined reference strain. The BLASTatlas is one such tool that is useful for mapping and visualizing whole genome homology of genes and proteins within a reference strain compared to other strains or species of one or more prokaryotic organisms. We provide examples of BLASTatlases, including...

Non-homologous isofunctional enzymes: a systematic analysis of alternative solutions in enzyme evolution.

Science.gov (United States)

Omelchenko, Marina V; Galperin, Michael Y; Wolf, Yuri I; Koonin, Eugene V

2010-04-30

Evolutionarily unrelated proteins that catalyze the same biochemical reactions are often referred to as analogous - as opposed to homologous - enzymes. The existence of numerous alternative, non-homologous enzyme isoforms presents an interesting evolutionary problem; it also complicates genome-based reconstruction of the metabolic pathways in a variety of organisms. In 1998, a systematic search for analogous enzymes resulted in the identification of 105 Enzyme Commission (EC) numbers that included two or more proteins without detectable sequence similarity to each other, including 34 EC nodes where proteins were known (or predicted) to have distinct structural folds, indicating independent evolutionary origins. In the past 12 years, many putative non-homologous isofunctional enzymes were identified in newly sequenced genomes. In addition, efforts in structural genomics resulted in a vastly improved structural coverage of proteomes, providing for definitive assessment of (non)homologous relationships between proteins. We report the results of a comprehensive search for non-homologous isofunctional enzymes (NISE) that yielded 185 EC nodes with two or more experimentally characterized - or predicted - structurally unrelated proteins. Of these NISE sets, only 74 were from the original 1998 list. Structural assignments of the NISE show over-representation of proteins with the TIM barrel fold and the nucleotide-binding Rossmann fold. From the functional perspective, the set of NISE is enriched in hydrolases, particularly carbohydrate hydrolases, and in enzymes involved in defense against oxidative stress. These results indicate that at least some of the non-homologous isofunctional enzymes were recruited relatively recently from enzyme families that are active against related substrates and are sufficiently flexible to accommodate changes in substrate specificity.

Homological stabilizer codes

Energy Technology Data Exchange (ETDEWEB)

Anderson, Jonas T., E-mail: jonastyleranderson@gmail.com

2013-03-15

In this paper we define homological stabilizer codes on qubits which encompass codes such as Kitaev's toric code and the topological color codes. These codes are defined solely by the graphs they reside on. This feature allows us to use properties of topological graph theory to determine the graphs which are suitable as homological stabilizer codes. We then show that all toric codes are equivalent to homological stabilizer codes on 4-valent graphs. We show that the topological color codes and toric codes correspond to two distinct classes of graphs. We define the notion of label set equivalencies and show that under a small set of constraints the only homological stabilizer codes without local logical operators are equivalent to Kitaev's toric code or to the topological color codes. - Highlights: Black-Right-Pointing-Pointer We show that Kitaev's toric codes are equivalent to homological stabilizer codes on 4-valent graphs. Black-Right-Pointing-Pointer We show that toric codes and color codes correspond to homological stabilizer codes on distinct graphs. Black-Right-Pointing-Pointer We find and classify all 2D homological stabilizer codes. Black-Right-Pointing-Pointer We find optimal codes among the homological stabilizer codes.

A complete mitochondrial genome sequence of Ogura-type male-sterile cytoplasm and its comparative analysis with that of normal cytoplasm in radish (Raphanus sativus L.

Directory of Open Access Journals (Sweden)

Tanaka Yoshiyuki

2012-07-01

Full Text Available Abstract Background Plant mitochondrial genome has unique features such as large size, frequent recombination and incorporation of foreign DNA. Cytoplasmic male sterility (CMS is caused by rearrangement of the mitochondrial genome, and a novel chimeric open reading frame (ORF created by shuffling of endogenous sequences is often responsible for CMS. The Ogura-type male-sterile cytoplasm is one of the most extensively studied cytoplasms in Brassicaceae. Although the gene orf138 has been isolated as a determinant of Ogura-type CMS, no homologous sequence to orf138 has been found in public databases. Therefore, how orf138 sequence was created is a mystery. In this study, we determined the complete nucleotide sequence of two radish mitochondrial genomes, namely, Ogura- and normal-type genomes, and analyzed them to reveal the origin of the gene orf138. Results Ogura- and normal-type mitochondrial genomes were assembled to 258,426-bp and 244,036-bp circular sequences, respectively. Normal-type mitochondrial genome contained 33 protein-coding and three rRNA genes, which are well conserved with the reported mitochondrial genome of rapeseed. Ogura-type genomes contained same genes and additional atp9. As for tRNA, normal-type contained 17 tRNAs, while Ogura-type contained 17 tRNAs and one additional trnfM. The gene orf138 was specific to Ogura-type mitochondrial genome, and no sequence homologous to it was found in normal-type genome. Comparative analysis of the two genomes revealed that radish mitochondrial genome consists of 11 syntenic regions (length >3 kb, similarity >99.9%. It was shown that short repeats and overlapped repeats present in the edge of syntenic regions were involved in recombination events during evolution to interconvert two types of mitochondrial genome. Ogura-type mitochondrial genome has four unique regions (2,803 bp, 1,601 bp, 451 bp and 15,255 bp in size that are non-syntenic to normal-type genome, and the gene orf138

Gene Discovery through Genomic Sequencing of Brucella abortus

Science.gov (United States)

Sánchez, Daniel O.; Zandomeni, Ruben O.; Cravero, Silvio; Verdún, Ramiro E.; Pierrou, Ester; Faccio, Paula; Diaz, Gabriela; Lanzavecchia, Silvia; Agüero, Fernán; Frasch, Alberto C. C.; Andersson, Siv G. E.; Rossetti, Osvaldo L.; Grau, Oscar; Ugalde, Rodolfo A.

2001-01-01

Brucella abortus is the etiological agent of brucellosis, a disease that affects bovines and human. We generated DNA random sequences from the genome of B. abortus strain 2308 in order to characterize molecular targets that might be useful for developing immunological or chemotherapeutic strategies against this pathogen. The partial sequencing of 1,899 clones allowed the identification of 1,199 genomic sequence surveys (GSSs) with high homology (BLAST expect value < 10−5) to sequences deposited in the GenBank databases. Among them, 925 represent putative novel genes for the Brucella genus. Out of 925 nonredundant GSSs, 470 were classified in 15 categories based on cellular function. Seven hundred GSSs showed no significant database matches and remain available for further studies in order to identify their function. A high number of GSSs with homology to Agrobacterium tumefaciens and Rhizobium meliloti proteins were observed, thus confirming their close phylogenetic relationship. Among them, several GSSs showed high similarity with genes related to nodule nitrogen fixation, synthesis of nod factors, nodulation protein symbiotic plasmid, and nodule bacteroid differentiation. We have also identified several B. abortus homologs of virulence and pathogenesis genes from other pathogens, including a homolog to both the Shda gene from Salmonella enterica serovar Typhimurium and the AidA-1 gene from Escherichia coli. Other GSSs displayed significant homologies to genes encoding components of the type III and type IV secretion machineries, suggesting that Brucella might also have an active type III secretion machinery. PMID:11159979

Phylogenomics of Phrynosomatid Lizards: Conflicting Signals from Sequence Capture versus Restriction Site Associated DNA Sequencing

Science.gov (United States)

Leaché, Adam D.; Chavez, Andreas S.; Jones, Leonard N.; Grummer, Jared A.; Gottscho, Andrew D.; Linkem, Charles W.

2015-01-01

Sequence capture and restriction site associated DNA sequencing (RADseq) are popular methods for obtaining large numbers of loci for phylogenetic analysis. These methods are typically used to collect data at different evolutionary timescales; sequence capture is primarily used for obtaining conserved loci, whereas RADseq is designed for discovering single nucleotide polymorphisms (SNPs) suitable for population genetic or phylogeographic analyses. Phylogenetic questions that span both “recent” and “deep” timescales could benefit from either type of data, but studies that directly compare the two approaches are lacking. We compared phylogenies estimated from sequence capture and double digest RADseq (ddRADseq) data for North American phrynosomatid lizards, a species-rich and diverse group containing nine genera that began diversifying approximately 55 Ma. Sequence capture resulted in 584 loci that provided a consistent and strong phylogeny using concatenation and species tree inference. However, the phylogeny estimated from the ddRADseq data was sensitive to the bioinformatics steps used for determining homology, detecting paralogs, and filtering missing data. The topological conflicts among the SNP trees were not restricted to any particular timescale, but instead were associated with short internal branches. Species tree analysis of the largest SNP assembly, which also included the most missing data, supported a topology that matched the sequence capture tree. This preferred phylogeny provides strong support for the paraphyly of the earless lizard genera Holbrookia and Cophosaurus, suggesting that the earless morphology either evolved twice or evolved once and was subsequently lost in Callisaurus. PMID:25663487

The genome of flax (Linum usitatissimum) assembled de novo from short shotgun sequence reads.

Science.gov (United States)

Wang, Zhiwen; Hobson, Neil; Galindo, Leonardo; Zhu, Shilin; Shi, Daihu; McDill, Joshua; Yang, Linfeng; Hawkins, Simon; Neutelings, Godfrey; Datla, Raju; Lambert, Georgina; Galbraith, David W; Grassa, Christopher J; Geraldes, Armando; Cronk, Quentin C; Cullis, Christopher; Dash, Prasanta K; Kumar, Polumetla A; Cloutier, Sylvie; Sharpe, Andrew G; Wong, Gane K-S; Wang, Jun; Deyholos, Michael K

2012-11-01

Flax (Linum usitatissimum) is an ancient crop that is widely cultivated as a source of fiber, oil and medicinally relevant compounds. To accelerate crop improvement, we performed whole-genome shotgun sequencing of the nuclear genome of flax. Seven paired-end libraries ranging in size from 300 bp to 10 kb were sequenced using an Illumina genome analyzer. A de novo assembly, comprised exclusively of deep-coverage (approximately 94× raw, approximately 69× filtered) short-sequence reads (44-100 bp), produced a set of scaffolds with N(50) =694 kb, including contigs with N(50)=20.1 kb. The contig assembly contained 302 Mb of non-redundant sequence representing an estimated 81% genome coverage. Up to 96% of published flax ESTs aligned to the whole-genome shotgun scaffolds. However, comparisons with independently sequenced BACs and fosmids showed some mis-assembly of regions at the genome scale. A total of 43384 protein-coding genes were predicted in the whole-genome shotgun assembly, and up to 93% of published flax ESTs, and 86% of A. thaliana genes aligned to these predicted genes, indicating excellent coverage and accuracy at the gene level. Analysis of the synonymous substitution rates (K(s) ) observed within duplicate gene pairs was consistent with a recent (5-9 MYA) whole-genome duplication in flax. Within the predicted proteome, we observed enrichment of many conserved domains (Pfam-A) that may contribute to the unique properties of this crop, including agglutinin proteins. Together these results show that de novo assembly, based solely on whole-genome shotgun short-sequence reads, is an efficient means of obtaining nearly complete genome sequence information for some plant species. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

Sequence composition and gene content of the short arm of rye (Secale cereale chromosome 1.

Directory of Open Access Journals (Sweden)

Silvia Fluch

Full Text Available BACKGROUND: The purpose of the study is to elucidate the sequence composition of the short arm of rye chromosome 1 (Secale cereale with special focus on its gene content, because this portion of the rye genome is an integrated part of several hundreds of bread wheat varieties worldwide. METHODOLOGY/PRINCIPAL FINDINGS: Multiple Displacement Amplification of 1RS DNA, obtained from flow sorted 1RS chromosomes, using 1RS ditelosomic wheat-rye addition line, and subsequent Roche 454FLX sequencing of this DNA yielded 195,313,589 bp sequence information. This quantity of sequence information resulted in 0.43× sequence coverage of the 1RS chromosome arm, permitting the identification of genes with estimated probability of 95%. A detailed analysis revealed that more than 5% of the 1RS sequence consisted of gene space, identifying at least 3,121 gene loci representing 1,882 different gene functions. Repetitive elements comprised about 72% of the 1RS sequence, Gypsy/Sabrina (13.3% being the most abundant. More than four thousand simple sequence repeat (SSR sites mostly located in gene related sequence reads were identified for possible marker development. The existence of chloroplast insertions in 1RS has been verified by identifying chimeric chloroplast-genomic sequence reads. Synteny analysis of 1RS to the full genomes of Oryza sativa and Brachypodium distachyon revealed that about half of the genes of 1RS correspond to the distal end of the short arm of rice chromosome 5 and the proximal region of the long arm of Brachypodium distachyon chromosome 2. Comparison of the gene content of 1RS to 1HS barley chromosome arm revealed high conservation of genes related to chromosome 5 of rice. CONCLUSIONS: The present study revealed the gene content and potential gene functions on this chromosome arm and demonstrated numerous sequence elements like SSRs and gene-related sequences, which can be utilised for future research as well as in breeding of wheat and rye.

A homology sound-based algorithm for speech signal interference

Science.gov (United States)

Jiang, Yi-jiao; Chen, Hou-jin; Li, Ju-peng; Zhang, Zhan-song

2015-12-01

Aiming at secure analog speech communication, a homology sound-based algorithm for speech signal interference is proposed in this paper. We first split speech signal into phonetic fragments by a short-term energy method and establish an interference noise cache library with the phonetic fragments. Then we implement the homology sound interference by mixing the randomly selected interferential fragments and the original speech in real time. The computer simulation results indicated that the interference produced by this algorithm has advantages of real time, randomness, and high correlation with the original signal, comparing with the traditional noise interference methods such as white noise interference. After further studies, the proposed algorithm may be readily used in secure speech communication.

Bioinformatic approach in the identification of arabidopsis gene homologous in amaranthus

Directory of Open Access Journals (Sweden)

Jana Žiarovská

2015-05-01

Full Text Available Bioinfomatics offers an efficient tool for molecular genetics applications and sequence homology search algorithms became an inevitable part for many different research strategies. Appropriate managing of known data that are stored in public available databases can be used in many ways in the research. Here, we report the identification of RmlC-like cupins superfamily protein DNA sequence than is known in Arabidopsis genome for the Amaranthus - plant specie where this sequence was still not sequenced. A BLAST based approach was used to identify the homologous sequences in the nucleotide database and to find suitable parts of the Arabidopsis sequence were primers can be designed. In total, 64 hits were found in nucleotide database for Arabidopsis RmlC-like cupins sequence. A query cover ranged from 10% up to the 100% among RmlC-like cupins nucleotides and its homologues that are actually stored in public nucleotide databases. The most conserved region was identified for matches that posses nucleotides in the range of 1506 up to the 1925 bp of RmlC-like cupins DNA sequence stored in the database. The in silico approach was subsequently used in PCR analysis where the specifity of designed primers was approved. A unique, 250 bp long fragment was obtained for Amaranthus cruentus and a hybride Amaranthus hypochondriacus x hybridus in our analysis. Bioinformatic based analysis of unknown parts of the plant genomes as showed in this study is a very good additional tool in PCR based analysis of plant variability. This approach is suitable in the case for plants, where concrete genomic data are still missing for the appropriate genes, as was demonstrated for Amaranthus. 

The genome of flax (Linum usitatissimum) assembled de novo from short shotgun sequence reads

DEFF Research Database (Denmark)

Wang, Zhiwen; Hobson, Neil; Galindo, Leonardo

2012-01-01

Flax (Linum usitatissimum) is an ancient crop that is widely cultivated as a source of fiber, oil and medicinally relevant compounds. To accelerate crop improvement, we performed whole-genome shotgun sequencing of the nuclear genome of flax. Seven paired-end libraries ranging in size from 300 bp...... these results show that de novo assembly, based solely on whole-genome shotgun short-sequence reads, is an efficient means of obtaining nearly complete genome sequence information for some plant species....

Searching remote homology with spectral clustering with symmetry in neighborhood cluster kernels.

Directory of Open Access Journals (Sweden)

Ujjwal Maulik

Full Text Available Remote homology detection among proteins utilizing only the unlabelled sequences is a central problem in comparative genomics. The existing cluster kernel methods based on neighborhoods and profiles and the Markov clustering algorithms are currently the most popular methods for protein family recognition. The deviation from random walks with inflation or dependency on hard threshold in similarity measure in those methods requires an enhancement for homology detection among multi-domain proteins. We propose to combine spectral clustering with neighborhood kernels in Markov similarity for enhancing sensitivity in detecting homology independent of "recent" paralogs. The spectral clustering approach with new combined local alignment kernels more effectively exploits the unsupervised protein sequences globally reducing inter-cluster walks. When combined with the corrections based on modified symmetry based proximity norm deemphasizing outliers, the technique proposed in this article outperforms other state-of-the-art cluster kernels among all twelve implemented kernels. The comparison with the state-of-the-art string and mismatch kernels also show the superior performance scores provided by the proposed kernels. Similar performance improvement also is found over an existing large dataset. Therefore the proposed spectral clustering framework over combined local alignment kernels with modified symmetry based correction achieves superior performance for unsupervised remote homolog detection even in multi-domain and promiscuous domain proteins from Genolevures database families with better biological relevance. Source code available upon request.sarkar@labri.fr.

In silico sequence analysis and homology modeling of predicted beta-amylase 7-like protein in Brachypodium distachyon L.

Directory of Open Access Journals (Sweden)

ERTUĞRUL FILIZ

2014-04-01

Full Text Available Beta-amylase (β-amylase, EC 3.2.1.2 is an enzyme that catalyses hydrolysis of glucosidic bonds in polysaccharides. In this study, we analyzed protein sequence of predicted beta-amylase 7-like protein in Brachypodium distachyon. pI (isoelectric point value was found as 5.23 in acidic character, while the instability index (II was found as 50.28 with accepted unstable protein. The prediction of subcellular localization was revealed that the protein may reside in chloroplast by using CELLO v.2.5. The 3D structure of protein was performed using comparative homology modeling with SWISS-MODEL. The accuracy of the predicted 3D structure was checked using Ramachandran plot analysis showed that 95.4% in favored region. The results of our study contribute to understanding of β-amylase protein structure in grass species and will be scientific base for 3D modeling of beta-amylase proteins in further studies.

Molecular Cloning And Sequencing Of Disintegrin Like Domain ...

African Journals Online (AJOL)

Disintegrin-like domain was cloned and sequenced from Cerastes cerastes venom gland tissue. Nested RT-PCR was performed using initial primers designed based on the homology of disintegrins from Trimeresurus flavoviridis, Glodius halys , Agkistrodon halys and Trimeresurus macrosquamatus. The homology was ...

Isolation and sequence of complementary DNA encoding human extracellular superoxide dismutase

International Nuclear Information System (INIS)

Hjalmarsson, K.; Marklund, S.L.; Engstroem, A.; Edlund, T.

1987-01-01

A complementary DNA (cDNA) clone from a human placenta cDNA library encoding extracellular superoxide dismutase has been isolated and the nucleotide sequence determined. The cDNA has a very high G + C content. EC-SOD is synthesized with a putative 18-amino acid signal peptide, preceding the 222 amino acids in the mature enzyme, indicating that the enzyme is a secretory protein. The first 95 amino acids of the mature enzyme show no sequence homology with other sequenced proteins and there is one possible N-glycosylation site (Asn-89). The amino acid sequence from residues 96-193 shows strong homology (∼ 50%) with the final two-thirds of the sequences of all know eukaryotic CuZn SODs, whereas the homology with the P. leiognathi CuZn SOD is clearly lower. The ligands to Cu and Zn, the cysteines forming the intrasubunit disulfide bridge in the CuZn SODs, and the arginine found in all CuZn SODs in the entrance to the active site can all be identified in EC-SOD. A comparison with bovine CuZn SOD, the three-dimensional structure of which is known, reveals that the homologies occur in the active site and the divergencies are in the part constituting the subunit contact area in CuZn SOD. Amino acid sequence 194-222 in the carboxyl-terminal end of EC-SOD is strongly hydrophilic and contains nine amino acids with a positive charge. This sequence probably confers the affinity of EC-SOD for heparin and heparan sulfate. An analysis of the amino acid sequence homologies with CuZn SODs from various species indicates that the EC-SODs may have evolved form the CuZn SODs before the evolution of fungi and plants

FBH1 helicase disrupts RAD51 filaments in vitro and modulates homologous recombination in mammalian cells

DEFF Research Database (Denmark)

Simandlova, Jitka; Zagelbaum, Jennifer; Payne, Miranda J

2013-01-01

Efficient repair of DNA double strand breaks and interstrand cross-links requires the homologous recombination (HR) pathway, a potentially error-free process that utilizes a homologous sequence as a repair template. A key player in HR is RAD51, the eukaryotic ortholog of bacterial RecA protein. RAD......51 can polymerize on DNA to form a nucleoprotein filament that facilitates both the search for the homologous DNA sequences and the subsequent DNA strand invasion required to initiate HR. Because of its pivotal role in HR, RAD51 is subject to numerous positive and negative regulatory influences...... filaments on DNA through its ssDNA translocase function. Consistent with this, a mutant mouse embryonic stem cell line with a deletion in the FBH1 helicase domain fails to limit RAD51 chromatin association and shows hyper-recombination. Our data are consistent with FBH1 restraining RAD51 DNA binding under...

Assembly and dynamics of the bacteriophage T4 homologous recombination machinery

Directory of Open Access Journals (Sweden)

Morrical Scott W

2010-12-01

Full Text Available Abstract Homologous recombination (HR, a process involving the physical exchange of strands between homologous or nearly homologous DNA molecules, is critical for maintaining the genetic diversity and genome stability of species. Bacteriophage T4 is one of the classic systems for studies of homologous recombination. T4 uses HR for high-frequency genetic exchanges, for homology-directed DNA repair (HDR processes including DNA double-strand break repair, and for the initiation of DNA replication (RDR. T4 recombination proteins are expressed at high levels during T4 infection in E. coli, and share strong sequence, structural, and/or functional conservation with their counterparts in cellular organisms. Biochemical studies of T4 recombination have provided key insights on DNA strand exchange mechanisms, on the structure and function of recombination proteins, and on the coordination of recombination and DNA synthesis activities during RDR and HDR. Recent years have seen the development of detailed biochemical models for the assembly and dynamics of presynaptic filaments in the T4 recombination system, for the atomic structure of T4 UvsX recombinase, and for the roles of DNA helicases in T4 recombination. The goal of this chapter is to review these recent advances and their implications for HR and HDR mechanisms in all organisms.

An RNA secondary structure bias for non-homologous reverse transcriptase-mediated deletions in vivo

DEFF Research Database (Denmark)

Duch, Mogens; Carrasco, Maria L; Jespersen, Thomas

2004-01-01

Murine leukemia viruses harboring an internal ribosome entry site (IRES)-directed translational cassette are able to replicate, but undergo loss of heterologous sequences upon continued passage. While complete loss of heterologous sequences is favored when these are flanked by a direct repeat......, deletion mutants with junction sites within the heterologous cassette may also be retrieved, in particular from vectors without flanking repeats. Such deletion mutants were here used to investigate determinants of reverse transcriptase-mediated non-homologous recombination. Based upon previous structural...... result from template switching during first-strand cDNA synthesis and that the choice of acceptor sites for non-homologous recombination are guided by non-paired regions. Our results may have implications for recombination events taking place within structured regions of retroviral RNA genomes...

The primary structures of two yeast enolase genes. Homology between the 5' noncoding flanking regions of yeast enolase and glyceraldehyde-3-phosphate dehydrogenase genes.

Science.gov (United States)

Holland, M J; Holland, J P; Thill, G P; Jackson, K A

1981-02-10

Segments of yeast genomic DNA containing two enolase structural genes have been isolated by subculture cloning procedures using a cDNA hybridization probe synthesized from purified yeast enolase mRNA. Based on restriction endonuclease and transcriptional maps of these two segments of yeast DNA, each hybrid plasmid contains a region of extensive nucleotide sequence homology which forms hybrids with the cDNA probe. The DNA sequences which flank this homologous region in the two hybrid plasmids are nonhomologous indicating that these sequences are nontandemly repeated in the yeast genome. The complete nucleotide sequence of the coding as well as the flanking noncoding regions of these genes has been determined. The amino acid sequence predicted from one reading frame of both structural genes is extremely similar to that determined for yeast enolase (Chin, C. C. Q., Brewer, J. M., Eckard, E., and Wold, F. (1981) J. Biol. Chem. 256, 1370-1376), confirming that these isolated structural genes encode yeast enolase. The nucleotide sequences of the coding regions of the genes are approximately 95% homologous, and neither gene contains an intervening sequence. Codon utilization in the enolase genes follows the same biased pattern previously described for two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes (Holland, J. P., and Holland, M. J. (1980) J. Biol. Chem. 255, 2596-2605). DNA blotting analysis confirmed that the isolated segments of yeast DNA are colinear with yeast genomic DNA and that there are two nontandemly repeated enolase genes per haploid yeast genome. The noncoding portions of the two enolase genes adjacent to the initiation and termination codons are approximately 70% homologous and contain sequences thought to be involved in the synthesis and processing messenger RNA. Finally there are regions of extensive homology between the two enolase structural genes and two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes within the 5

Molecular characterization of DnaJ 5 homologs in silkworm Bombyx mori and its expression during egg diapause.

Science.gov (United States)

Sirigineedi, Sasibhushan; Vijayagowri, Esvaran; Murthy, Geetha N; Rao, Guruprasada; Ponnuvel, Kangayam M

2014-12-01

A comparison of the cDNA sequences (1 056 bp) of Bombyx mori DnaJ 5 homolog with B. mori genome revealed that unlike in other Hsps, it has an intron of 234 bp. The DnaJ 5 homolog contains 351 amino acids, of which 70 contain the conserved DnaJ domain at the N-terminal end. This homolog of B. mori has all desirable functional domains similar to other insects, and the 13 different DnaJ homologs identified in B. mori genome were distributed on different chromosomes. The expressed sequence tag database analysis of Hsp40 gene expression revealed higher expression in wing disc followed by diapause-induced eggs. Microarray analysis revealed higher expression of DnaJ 5 homolog at 18th h after oviposition in diapause-induced eggs. Further validation of DnaJ 5 expression through qPCR in diapause-induced and nondiapause eggs at different time intervals revealed higher expression in diapause eggs at 18 and 24 h after oviposition, which coincided with the expression of Hsp70 as the Hsp 40 is its co-chaperone. This study thus provides an outline of the genome organization of Hsp40 gene, and its role in egg diapause induction in B. mori. © 2013 Institute of Zoology, Chinese Academy of Sciences.

Use of short tandem repeat sequences to study Mycobacterium leprae in leprosy patients in Malawi and India.

Directory of Open Access Journals (Sweden)

Saroj K Young

2008-04-01

Full Text Available Inadequate understanding of the transmission of Mycobacterium leprae makes it difficult to predict the impact of leprosy control interventions. Genotypic tests that allow tracking of individual bacterial strains would strengthen epidemiological studies and contribute to our understanding of the disease.Genotyping assays based on variation in the copy number of short tandem repeat sequences were applied to biopsies collected in population-based epidemiological studies of leprosy in northern Malawi, and from members of multi-case households in Hyderabad, India. In the Malawi series, considerable genotypic variability was observed between patients, and also within patients, when isolates were collected at different times or from different tissues. Less within-patient variability was observed when isolates were collected from similar tissues at the same time. Less genotypic variability was noted amongst the closely related Indian patients than in the Malawi series.Lineages of M. leprae undergo changes in their pattern of short tandem repeat sequences over time. Genetic divergence is particularly likely between bacilli inhabiting different (e.g., skin and nerve tissues. Such variability makes short tandem repeat sequences unsuitable as a general tool for population-based strain typing of M. leprae, or for distinguishing relapse from reinfection. Careful use of these markers may provide insights into the development of disease within individuals and for tracking of short transmission chains.

Annotating Protein Functional Residues by Coupling High-Throughput Fitness Profile and Homologous-Structure Analysis.

Science.gov (United States)

Du, Yushen; Wu, Nicholas C; Jiang, Lin; Zhang, Tianhao; Gong, Danyang; Shu, Sara; Wu, Ting-Ting; Sun, Ren

2016-11-01

Identification and annotation of functional residues are fundamental questions in protein sequence analysis. Sequence and structure conservation provides valuable information to tackle these questions. It is, however, limited by the incomplete sampling of sequence space in natural evolution. Moreover, proteins often have multiple functions, with overlapping sequences that present challenges to accurate annotation of the exact functions of individual residues by conservation-based methods. Using the influenza A virus PB1 protein as an example, we developed a method to systematically identify and annotate functional residues. We used saturation mutagenesis and high-throughput sequencing to measure the replication capacity of single nucleotide mutations across the entire PB1 protein. After predicting protein stability upon mutations, we identified functional PB1 residues that are essential for viral replication. To further annotate the functional residues important to the canonical or noncanonical functions of viral RNA-dependent RNA polymerase (vRdRp), we performed a homologous-structure analysis with 16 different vRdRp structures. We achieved high sensitivity in annotating the known canonical polymerase functional residues. Moreover, we identified a cluster of noncanonical functional residues located in the loop region of the PB1 β-ribbon. We further demonstrated that these residues were important for PB1 protein nuclear import through the interaction with Ran-binding protein 5. In summary, we developed a systematic and sensitive method to identify and annotate functional residues that are not restrained by sequence conservation. Importantly, this method is generally applicable to other proteins about which homologous-structure information is available. To fully comprehend the diverse functions of a protein, it is essential to understand the functionality of individual residues. Current methods are highly dependent on evolutionary sequence conservation, which is

Murine mammary tumor virus pol-related sequences in human DNA: characterization and sequence comparison with the complete murine mammary tumor virus pol gene

International Nuclear Information System (INIS)

Deen, K.C.; Sweet, R.W.

1986-01-01

Sequences in the human genome with homology to the murine mammary tumor virus (MMTV) pol gene were isolated from a human phage library. Ten clones with extensive pol homology were shown to define five separate loci. These loci share common sequences immediately adjacent to the pol-like segments and, in addition, contain a related repeat element which bounds this region. This organization is suggestive of a proviral structure. The authors estimate that the human genome contains 30 to 40 copies of these pol-related sequences. The pol region of one of the cloned segments (HM16) and the complete MMTV pol gene were sequenced and compared. The nucleotide homology between these pol sequences is 52% and is concentrated in the terminal regions. The MMTV pol gene contains a single long open reading frame encoding 899 amino acids and is demarcated from the partially overlapping putative gag gene by termination codons and a shift in translational reading frame. The pol sequence of HM16 is multiply terminated but does contain open reading frames which encode 370, 105, and 112 amino acids residues in separate reading frames. The authors deduced a composite pol protein sequence for HM16 by aligning it to the MMTV pol gene and then compared these sequences with other retroviral pol protein sequences. Conserved sequences occur in both the amino and carboxyl regions which lie within the polymerase and endonuclease domains of pol, respectively

Fine de novo sequencing of a fungal genome using only SOLiD short read data: verification on Aspergillus oryzae RIB40.

Directory of Open Access Journals (Sweden)

Myco Umemura

Full Text Available The development of next-generation sequencing (NGS technologies has dramatically increased the throughput, speed, and efficiency of genome sequencing. The short read data generated from NGS platforms, such as SOLiD and Illumina, are quite useful for mapping analysis. However, the SOLiD read data with lengths of <60 bp have been considered to be too short for de novo genome sequencing. Here, to investigate whether de novo sequencing of fungal genomes is possible using only SOLiD short read sequence data, we performed de novo assembly of the Aspergillus oryzae RIB40 genome using only SOLiD read data of 50 bp generated from mate-paired libraries with 2.8- or 1.9-kb insert sizes. The assembled scaffolds showed an N50 value of 1.6 Mb, a 22-fold increase than those obtained using only SOLiD short read in other published reports. In addition, almost 99% of the reference genome was accurately aligned by the assembled scaffold fragments in long lengths. The sequences of secondary metabolite biosynthetic genes and clusters, whose products are of considerable interest in fungal studies due to their potential medicinal, agricultural, and cosmetic properties, were also highly reconstructed in the assembled scaffolds. Based on these findings, we concluded that de novo genome sequencing using only SOLiD short reads is feasible and practical for molecular biological study of fungi. We also investigated the effect of filtering low quality data, library insert size, and k-mer size on the assembly performance, and recommend for the assembly use of mild filtered read data where the N50 was not so degraded and the library has an insert size of ∼2.0 kb, and k-mer size 33.

A novel mutation in TFL1 homolog affecting determinacy in cowpea (Vigna unguiculata).

Science.gov (United States)

Dhanasekar, P; Reddy, K S

2015-02-01

Mutations in the widely conserved Arabidopsis Terminal Flower 1 (TFL1) gene and its homologs have been demonstrated to result in determinacy across genera, the knowledge of which is lacking in cowpea. Understanding the molecular events leading to determinacy of apical meristems could hasten development of cowpea varieties with suitable ideotypes. Isolation and characterization of a novel mutation in cowpea TFL1 homolog (VuTFL1) affecting determinacy is reported here for the first time. Cowpea TFL1 homolog was amplified using primers designed based on conserved sequences in related genera and sequence variation was analysed in three gamma ray-induced determinate mutants, their indeterminate parent "EC394763" and two indeterminate varieties. The analyses of sequence variation exposed a novel SNP distinguishing the determinate mutants from the indeterminate types. The non-synonymous point mutation in exon 4 at position 1,176 resulted from transversion of cytosine (C) to adenine (A) leading to an amino acid change (Pro-136 to His) in determinate mutants. The effect of the mutation on protein function and stability was predicted to be detrimental using different bioinformatics/computational tools. The functionally significant novel substitution mutation is hypothesized to affect determinacy in the cowpea mutants. Development of suitable regeneration protocols in this hitherto recalcitrant crop and subsequent complementation assay in mutants or over-expressing assay in parents could decisively conclude the role of the SNP in regulating determinacy in these cowpea mutants.

Competitive repair by naturally dispersed repetitive DNA during non-allelic homologous recombination

Energy Technology Data Exchange (ETDEWEB)

Hoang, Margaret L.; Tan, Frederick J.; Lai, David C.; Celniker, Sue E.; Hoskins, Roger A.; Dunham, Maitreya J.; Zheng, Yixian; Koshland, Douglas

2010-08-27

Genome rearrangements often result from non-allelic homologous recombination (NAHR) between repetitive DNA elements dispersed throughout the genome. Here we systematically analyze NAHR between Ty retrotransposons using a genome-wide approach that exploits unique features of Saccharomyces cerevisiae purebred and Saccharomyces cerevisiae/Saccharomyces bayanus hybrid diploids. We find that DNA double-strand breaks (DSBs) induce NAHR-dependent rearrangements using Ty elements located 12 to 48 kilobases distal to the break site. This break-distal recombination (BDR) occurs frequently, even when allelic recombination can repair the break using the homolog. Robust BDR-dependent NAHR demonstrates that sequences very distal to DSBs can effectively compete with proximal sequences for repair of the break. In addition, our analysis of NAHR partner choice between Ty repeats shows that intrachromosomal Ty partners are preferred despite the abundance of potential interchromosomal Ty partners that share higher sequence identity. This competitive advantage of intrachromosomal Tys results from the relative efficiencies of different NAHR repair pathways. Finally, NAHR generates deleterious rearrangements more frequently when DSBs occur outside rather than within a Ty repeat. These findings yield insights into mechanisms of repeat-mediated genome rearrangements associated with evolution and cancer.

Allergenic characterization of a novel allergen, homologous to chymotrypsin, from german cockroach.

Science.gov (United States)

Jeong, Kyoung Yong; Son, Mina; Lee, Jae Hyun; Hong, Chein Soo; Park, Jung Won

2015-05-01

Cockroach feces are known to be rich in IgE-reactive components. Various protease allergens were identified by proteomic analysis of German cockroach fecal extract in a previous study. In this study, we characterized a novel allergen, a chymotrypsin-like serine protease. A cDNA sequence homologous to chymotrypsin was obtained by analysis of German cockroach expressed sequence tag (EST) clones. The recombinant chymotrypsins from the German cockroach and house dust mite (Der f 6) were expressed in Escherichia coli using the pEXP5NT/TOPO vector system, and their allergenicity was investigated by ELISA. The deduced amino acid sequence of German cockroach chymotrypsin showed 32.7 to 43.1% identity with mite group 3 (trypsin) and group 6 (chymotrypsin) allergens. Sera from 8 of 28 German cockroach allergy subjects (28.6%) showed IgE binding to the recombinant protein. IgE binding to the recombinant cockroach chymotrypsin was inhibited by house dust mite chymotrypsin Der f 6, while it minimally inhibited the German cockroach whole body extract. A novel allergen homologous to chymotrypsin was identified from the German cockroach and was cross-reactive with Der f 6.

Competitive repair by naturally dispersed repetitive DNA during non-allelic homologous recombination.

Directory of Open Access Journals (Sweden)

Margaret L Hoang

2010-12-01

Full Text Available Genome rearrangements often result from non-allelic homologous recombination (NAHR between repetitive DNA elements dispersed throughout the genome. Here we systematically analyze NAHR between Ty retrotransposons using a genome-wide approach that exploits unique features of Saccharomyces cerevisiae purebred and Saccharomyces cerevisiae/Saccharomyces bayanus hybrid diploids. We find that DNA double-strand breaks (DSBs induce NAHR-dependent rearrangements using Ty elements located 12 to 48 kilobases distal to the break site. This break-distal recombination (BDR occurs frequently, even when allelic recombination can repair the break using the homolog. Robust BDR-dependent NAHR demonstrates that sequences very distal to DSBs can effectively compete with proximal sequences for repair of the break. In addition, our analysis of NAHR partner choice between Ty repeats shows that intrachromosomal Ty partners are preferred despite the abundance of potential interchromosomal Ty partners that share higher sequence identity. This competitive advantage of intrachromosomal Tys results from the relative efficiencies of different NAHR repair pathways. Finally, NAHR generates deleterious rearrangements more frequently when DSBs occur outside rather than within a Ty repeat. These findings yield insights into mechanisms of repeat-mediated genome rearrangements associated with evolution and cancer.

Pure homology of algebraic varieties

OpenAIRE

Weber, Andrzej

2003-01-01

We show that for a complete complex algebraic variety the pure component of homology coincides with the image of intersection homology. Therefore pure homology is topologically invariant. To obtain slightly more general results we introduce "image homology" for noncomplete varieties.

Easy and accurate reconstruction of whole HIV genomes from short-read sequence data with shiver

Science.gov (United States)

Blanquart, François; Golubchik, Tanya; Gall, Astrid; Bakker, Margreet; Bezemer, Daniela; Croucher, Nicholas J; Hall, Matthew; Hillebregt, Mariska; Ratmann, Oliver; Albert, Jan; Bannert, Norbert; Fellay, Jacques; Fransen, Katrien; Gourlay, Annabelle; Grabowski, M Kate; Gunsenheimer-Bartmeyer, Barbara; Günthard, Huldrych F; Kivelä, Pia; Kouyos, Roger; Laeyendecker, Oliver; Liitsola, Kirsi; Meyer, Laurence; Porter, Kholoud; Ristola, Matti; van Sighem, Ard; Cornelissen, Marion; Kellam, Paul; Reiss, Peter

2018-01-01

Abstract Studying the evolution of viruses and their molecular epidemiology relies on accurate viral sequence data, so that small differences between similar viruses can be meaningfully interpreted. Despite its higher throughput and more detailed minority variant data, next-generation sequencing has yet to be widely adopted for HIV. The difficulty of accurately reconstructing the consensus sequence of a quasispecies from reads (short fragments of DNA) in the presence of large between- and within-host diversity, including frequent indels, may have presented a barrier. In particular, mapping (aligning) reads to a reference sequence leads to biased loss of information; this bias can distort epidemiological and evolutionary conclusions. De novo assembly avoids this bias by aligning the reads to themselves, producing a set of sequences called contigs. However contigs provide only a partial summary of the reads, misassembly may result in their having an incorrect structure, and no information is available at parts of the genome where contigs could not be assembled. To address these problems we developed the tool shiver to pre-process reads for quality and contamination, then map them to a reference tailored to the sample using corrected contigs supplemented with the user’s choice of existing reference sequences. Run with two commands per sample, it can easily be used for large heterogeneous data sets. We used shiver to reconstruct the consensus sequence and minority variant information from paired-end short-read whole-genome data produced with the Illumina platform, for sixty-five existing publicly available samples and fifty new samples. We show the systematic superiority of mapping to shiver’s constructed reference compared with mapping the same reads to the closest of 3,249 real references: median values of 13 bases called differently and more accurately, 0 bases called differently and less accurately, and 205 bases of missing sequence recovered. We also

Short-read reading-frame predictors are not created equal: sequence error causes loss of signal

Directory of Open Access Journals (Sweden)

Trimble William L

2012-07-01

Full Text Available Abstract Background Gene prediction algorithms (or gene callers are an essential tool for analyzing shotgun nucleic acid sequence data. Gene prediction is a ubiquitous step in sequence analysis pipelines; it reduces the volume of data by identifying the most likely reading frame for a fragment, permitting the out-of-frame translations to be ignored. In this study we evaluate five widely used ab initio gene-calling algorithms—FragGeneScan, MetaGeneAnnotator, MetaGeneMark, Orphelia, and Prodigal—for accuracy on short (75–1000 bp fragments containing sequence error from previously published artificial data and “real” metagenomic datasets. Results While gene prediction tools have similar accuracies predicting genes on error-free fragments, in the presence of sequencing errors considerable differences between tools become evident. For error-containing short reads, FragGeneScan finds more prokaryotic coding regions than does MetaGeneAnnotator, MetaGeneMark, Orphelia, or Prodigal. This improved detection of genes in error-containing fragments, however, comes at the cost of much lower (50% specificity and overprediction of genes in noncoding regions. Conclusions Ab initio gene callers offer a significant reduction in the computational burden of annotating individual nucleic acid reads and are used in many metagenomic annotation systems. For predicting reading frames on raw reads, we find the hidden Markov model approach in FragGeneScan is more sensitive than other gene prediction tools, while Prodigal, MGA, and MGM are better suited for higher-quality sequences such as assembled contigs.

Epitopes of human testis-specific lactate dehydrogenase deduced from a cDNA sequence

International Nuclear Information System (INIS)

Millan, J.L.; Driscoll, C.E.; LeVan, K.M.; Goldberg, E.

1987-01-01

The sequence and structure of human testis-specific L-lactate dehydrogenase [LDHC 4 , LDHX; (L)-lactate:NAD + oxidoreductase, EC 1.1.1.27] has been derived from analysis of a complementary DNA (cDNA) clone comprising the complete protein coding region of the enzyme. From the deduced amino acid sequence, human LDHC 4 is as different from rodent LDHC 4 (73% homology) as it is from human LDHA 4 (76% homology) and porcine LDHB 4 (68% homology). Subunit homologies are consistent with the conclusion that the LDHC gene arose by at least two independent duplication events. Furthermore, the lower degree of homology between mouse and human LDHC 4 and the appearance of this isozyme late in evolution suggests a higher rate of mutation in the mammalian LDHC genes than in the LDHA and -B genes. Comparison of exposed amino acid residues of discrete anti-genic determinants of mouse and human LDHC 4 reveals significant differences. Knowledge of the human LDHC 4 sequence will help design human-specific peptides useful in the development of a contraceptive vaccine

Identification and Partial Characterization of Potential FtsL and FtsQ Homologs of Chlamydia

Directory of Open Access Journals (Sweden)

Scot P Ouellette

2015-11-01

Full Text Available Chlamydia is amongst the rare bacteria that lack the critical cell division protein FtsZ. By annotation, Chlamydia also lacks several other essential cell division proteins including the FtsLBQ complex that links the early (e.g. FtsZ and late (e.g. FtsI/Pbp3 components of the division machinery. Here, we report chlamydial FtsL and FtsQ homologs. Ct271 aligned well with E. coli FtsL and shared sequence homology with it, including a predicted leucine-zipper like motif. Based on in silico modeling, we show that Ct764 has structural homology to FtsQ in spite of little sequence similarity. Importantly, ct271/ftsL and ct764/ftsQ are present within all sequenced chlamydial genomes and are expressed during the replicative phase of the chlamydial developmental cycle, two key characteristics for a chlamydial cell division gene. GFP-Ct764 localized to the division septum of dividing transformed chlamydiae, and, importantly, over-expression inhibited chlamydial development. Using a bacterial two-hybrid approach, we show that Ct764 interacted with other components of the chlamydial division apparatus. However, Ct764 was not capable of complementing an E. coli FtsQ depletion strain in spite of its ability to interact with many of the same division proteins as E. coli FtsQ, suggesting that chlamydial FtsQ may function differently. We previously proposed that Chlamydia uses MreB and other rod-shape determining proteins as an alternative system for organizing the division site and its apparatus. Chlamydial FtsL and FtsQ homologs expand the number of identified chlamydial cell division proteins and suggest that Chlamydia has likely kept the late components of the division machinery while substituting the Mre system for the early components.

In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration

KAUST Repository

Suzuki, Keiichiro; Tsunekawa, Yuji; Herná ndez-Bení tez, Reyna; Wu, Jun; Zhu, Jie; Kim, Euiseok J.; Hatanaka, Fumiyuki; Yamamoto, Mako; Araoka, Toshikazu; Li, Zhe; Kurita, Masakazu; Hishida, Tomoaki; Li, Mo; Aizawa, Emi; Guo, Shicheng; Chen, Song; Goebl, April; Soligalla, Rupa Devi; Qu, Jing; Jiang, Tingshuai; Fu, Xin; Jafari, Maryam; Esteban, Concepcion Rodriguez; Berggren, W. Travis; Lajara, Jeronimo; Nuñ ez-Delicado, Estrella; Guillen, Pedro; Campistol, Josep M.; Matsuzaki, Fumio; Liu, Guang-Hui; Magistretti, Pierre J.; Zhang, Kun; Callaway, Edward M.; Zhang, Kang; Belmonte, Juan Carlos Izpisua

2016-01-01

regularly interspaced short palindromic repeat/Cas9 (CRISPR/Cas9)3, 4 technology, here we devise a homology-independent targeted integration (HITI) strategy, which allows for robust DNA knock-in in both dividing and non-dividing cells in vitro and, more

Phylogenetic incongruence in E. coli O104: understanding the evolutionary relationships of emerging pathogens in the face of homologous recombination.

Directory of Open Access Journals (Sweden)

Weilong Hao

Full Text Available Escherichia coli O104:H4 was identified as an emerging pathogen during the spring and summer of 2011 and was responsible for a widespread outbreak that resulted in the deaths of 50 people and sickened over 4075. Traditional phenotypic and genotypic assays, such as serotyping, pulsed field gel electrophoresis (PFGE, and multilocus sequence typing (MLST, permit identification and classification of bacterial pathogens, but cannot accurately resolve relationships among genotypically similar but pathotypically different isolates. To understand the evolutionary origins of E. coli O104:H4, we sequenced two strains isolated in Ontario, Canada. One was epidemiologically linked to the 2011 outbreak, and the second, unrelated isolate, was obtained in 2010. MLST analysis indicated that both isolates are of the same sequence type (ST678, but whole-genome sequencing revealed differences in chromosomal and plasmid content. Through comprehensive phylogenetic analysis of five O104:H4 ST678 genomes, we identified 167 genes in three gene clusters that have undergone homologous recombination with distantly related E. coli strains. These recombination events have resulted in unexpectedly high sequence diversity within the same sequence type. Failure to recognize or adjust for homologous recombination can result in phylogenetic incongruence. Understanding the extent of homologous recombination among different strains of the same sequence type may explain the pathotypic differences between the ON2010 and ON2011 strains and help shed new light on the emergence of this new pathogen.

GenHtr: a tool for comparative assessment of genetic heterogeneity in microbial genomes generated by massive short-read sequencing

Directory of Open Access Journals (Sweden)

Yu GongXin

2010-10-01

Full Text Available Abstract Background Microevolution is the study of short-term changes of alleles within a population and their effects on the phenotype of organisms. The result of the below-species-level evolution is heterogeneity, where populations consist of subpopulations with a large number of structural variations. Heterogeneity analysis is thus essential to our understanding of how selective and neutral forces shape bacterial populations over a short period of time. The Solexa Genome Analyzer, a next-generation sequencing platform, allows millions of short sequencing reads to be obtained with great accuracy, allowing for the ability to study the dynamics of the bacterial population at the whole genome level. The tool referred to as GenHtr was developed for genome-wide heterogeneity analysis. Results For particular bacterial strains, GenHtr relies on a set of Solexa short reads on given bacteria pathogens and their isogenic reference genome to identify heterogeneity sites, the chromosomal positions with multiple variants of genes in the bacterial population, and variations that occur in large gene families. GenHtr accomplishes this by building and comparatively analyzing genome-wide heterogeneity genotypes for both the newly sequenced genomes (using massive short-read sequencing and their isogenic reference (using simulated data. As proof of the concept, this approach was applied to SRX007711, the Solexa sequencing data for a newly sequenced Staphylococcus aureus subsp. USA300 cell line, and demonstrated that it could predict such multiple variants. They include multiple variants of genes critical in pathogenesis, e.g. genes encoding a LysR family transcriptional regulator, 23 S ribosomal RNA, and DNA mismatch repair protein MutS. The heterogeneity results in non-synonymous and nonsense mutations, leading to truncated proteins for both LysR and MutS. Conclusion GenHtr was developed for genome-wide heterogeneity analysis. Although it is much more time

Homology modelling and docking analysis of L-lactate dehydrogenase from Streptococcus thermopilus

Directory of Open Access Journals (Sweden)

Vukić Vladimir R.

2016-01-01

Full Text Available The aim of this research was to create a three-dimensional model of L-lactate dehydrogenase from the main yoghurt starter culture - Streptococcus thermopilus, to analyse its structural features and investigate substrate binding in the active site. NCBI BlastP was used against the Protein Data Bank database in order to identify the template for construction of homology models. Multiple sequence alignment was performed using the program MUSCULE within the UGENE 1.11.3 program. Homology models were constructed using the program Modeller v. 9.17. The obtained 3D model was verified by Ramachandran plots. Molecular docking simulations were performed using the program Surflex-Dock. The highest sequence similarity was observed with L-lactate dehydrogenase from Lactobacillus casei subsp. casei, with 69% identity. Therefore, its structure (PDB ID: 2ZQY:A was selected as a modelling template for homology modelling. Active residues are by sequence similarity predicted: S. thermophilus - HIS181 and S. aureus - HIS179. Binding energy of pyruvate to L-lactate dehydrogenase of S. thermopilus was - 7.874 kcal/mol. Pyruvate in L-lactate dehydrogenase of S. thermopilus makes H bonds with catalytic HIS181 (1.9 Å, as well as with THR235 (3.6 Å. Although our results indicate similar position of substrates between L-lactate dehydrogenase of S. thermopilus and S. aureus, differences in substrate distances and binding energy values could influence the reaction rate. Based on these results, the L-lactate dehydrogenase model proposed here could be used as a guide for further research, such as transition states of the reaction through molecular dynamics. [Projekat Ministarstva nauke Republike Srbije, br. III 46009

MODexplorer: an integrated tool for exploring protein sequence, structure and function relationships.

KAUST Repository

Kosinski, Jan; Barbato, Alessandro; Tramontano, Anna

2013-01-01

SUMMARY: MODexplorer is an integrated tool aimed at exploring the sequence, structural and functional diversity in protein families useful in homology modeling and in analyzing protein families in general. It takes as input either the sequence or the structure of a protein and provides alignments with its homologs along with a variety of structural and functional annotations through an interactive interface. The annotations include sequence conservation, similarity scores, ligand-, DNA- and RNA-binding sites, secondary structure, disorder, crystallographic structure resolution and quality scores of models implied by the alignments to the homologs of known structure. MODexplorer can be used to analyze sequence and structural conservation among the structures of similar proteins, to find structures of homologs solved in different conformational state or with different ligands and to transfer functional annotations. Furthermore, if the structure of the query is not known, MODexplorer can be used to select the modeling templates taking all this information into account and to build a comparative model. AVAILABILITY AND IMPLEMENTATION: Freely available on the web at http://modorama.biocomputing.it/modexplorer. Website implemented in HTML and JavaScript with all major browsers supported. SUPPLEMENTARY INFORMATION: Supplementary data are available at Bioinformatics online.

MODexplorer: an integrated tool for exploring protein sequence, structure and function relationships.

KAUST Repository

Kosinski, Jan

2013-02-08

SUMMARY: MODexplorer is an integrated tool aimed at exploring the sequence, structural and functional diversity in protein families useful in homology modeling and in analyzing protein families in general. It takes as input either the sequence or the structure of a protein and provides alignments with its homologs along with a variety of structural and functional annotations through an interactive interface. The annotations include sequence conservation, similarity scores, ligand-, DNA- and RNA-binding sites, secondary structure, disorder, crystallographic structure resolution and quality scores of models implied by the alignments to the homologs of known structure. MODexplorer can be used to analyze sequence and structural conservation among the structures of similar proteins, to find structures of homologs solved in different conformational state or with different ligands and to transfer functional annotations. Furthermore, if the structure of the query is not known, MODexplorer can be used to select the modeling templates taking all this information into account and to build a comparative model. AVAILABILITY AND IMPLEMENTATION: Freely available on the web at http://modorama.biocomputing.it/modexplorer. Website implemented in HTML and JavaScript with all major browsers supported. SUPPLEMENTARY INFORMATION: Supplementary data are available at Bioinformatics online.

Sequence and expression pattern of a novel human orphan G-protein-coupled receptor, GPRC5B, a family C receptor with a short amino-terminal domain

DEFF Research Database (Denmark)

Bräuner-Osborne, Hans; Krogsgaard-Larsen, P

2000-01-01

Query of GenBank with the amino acid sequence of human metabotropic glutamate receptor subtype 2 (mGluR2) identified a predicted gene product of unknown function on BAC clone CIT987SK-A-69G12 (located on chromosome band 16p12) as a homologous protein. The transcript, entitled GPRC5B, was cloned f...... from an expressed sequence tag clone that contained the entire open reading frame of the transcript encoding a protein of 395 amino acids. Analysis of the protein sequence reveal that GPRC5B contains a signal peptide and seven transmembrane alpha-helices, which is a hallmark of G...

Computational complexity of algorithms for sequence comparison, short-read assembly and genome alignment.

Science.gov (United States)

Baichoo, Shakuntala; Ouzounis, Christos A

A multitude of algorithms for sequence comparison, short-read assembly and whole-genome alignment have been developed in the general context of molecular biology, to support technology development for high-throughput sequencing, numerous applications in genome biology and fundamental research on comparative genomics. The computational complexity of these algorithms has been previously reported in original research papers, yet this often neglected property has not been reviewed previously in a systematic manner and for a wider audience. We provide a review of space and time complexity of key sequence analysis algorithms and highlight their properties in a comprehensive manner, in order to identify potential opportunities for further research in algorithm or data structure optimization. The complexity aspect is poised to become pivotal as we will be facing challenges related to the continuous increase of genomic data on unprecedented scales and complexity in the foreseeable future, when robust biological simulation at the cell level and above becomes a reality. Copyright © 2017 Elsevier B.V. All rights reserved.

Isolation, sequence identification and tissue expression profile of a ...

African Journals Online (AJOL)

The complete expressed sequence tag (CDS) sequence of Banna mini-pig inbred line (BMI) ribokinase gene (RBKS) was amplified using the reverse transcription-polymerase chain reaction (RT-PCR) based on the conserved sequence information of the cattle or other mammals and known highly homologous swine ESTs.

Somatic association of telocentric chromosomes carrying homologous centromeres in common wheat.

Science.gov (United States)

Mello-Sampayo, T

1973-01-01

Measurements of distances between telocentric chromosomes, either homologous or representing the opposite arms of a metacentric chromosome (complementary telocentrics), were made at metaphase in root tip cells of common wheat carrying two homologous pairs of complementary telocentrics of chromosome 1 B or 6 B (double ditelosomic 1 B or 6 B). The aim was to elucidate the relative locations of the telocentric chromosomes within the cell. The data obtained strongly suggest that all four telocentrics of chromosome 1 B or 6 B are spacially and simultaneously co-associated. In plants carrying two complementary (6 B (S) and 6 B (L)) and a non-related (5 B (L)) telocentric, only the complementary chromosomes were found to be somatically associated. It is thought, therefore, that the somatic association of chromosomes may involve more than two chromosomes in the same association and, since complementary telocentrics are as much associated as homologous, that the homology between centromeres (probably the only homologous region that exists between complementary telocentrics) is a very important condition for somatic association of chromosomes. The spacial arrangement of chromosomes was studied at anaphase and prophase and the polar orientation of chromosomes at prophase was found to resemble anaphase orientation. This was taken as good evidence for the maintenance of the chromosome arrangement - the Rabl orientation - and of the peripheral location of the centromere and its association with the nuclear membrane. Within this general arrangement homologous telocentric chromosomes were frequently seen to have their centromeres associated or directed towards each other. The role of the centromere in somatic association as a spindle fibre attachment and chromosome binder is discussed. It is suggested that for non-homologous chromosomes to become associated in root tips, the only requirement needed should be the homology of centromeres such as exists between complementary

The HMMER Web Server for Protein Sequence Similarity Search.

Science.gov (United States)

Prakash, Ananth; Jeffryes, Matt; Bateman, Alex; Finn, Robert D

2017-12-08

Protein sequence similarity search is one of the most commonly used bioinformatics methods for identifying evolutionarily related proteins. In general, sequences that are evolutionarily related share some degree of similarity, and sequence-search algorithms use this principle to identify homologs. The requirement for a fast and sensitive sequence search method led to the development of the HMMER software, which in the latest version (v3.1) uses a combination of sophisticated acceleration heuristics and mathematical and computational optimizations to enable the use of profile hidden Markov models (HMMs) for sequence analysis. The HMMER Web server provides a common platform by linking the HMMER algorithms to databases, thereby enabling the search for homologs, as well as providing sequence and functional annotation by linking external databases. This unit describes three basic protocols and two alternate protocols that explain how to use the HMMER Web server using various input formats and user defined parameters. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

A discriminative method for family-based protein remote homology detection that combines inductive logic programming and propositional models.

Science.gov (United States)

Bernardes, Juliana S; Carbone, Alessandra; Zaverucha, Gerson

2011-03-23

Remote homology detection is a hard computational problem. Most approaches have trained computational models by using either full protein sequences or multiple sequence alignments (MSA), including all positions. However, when we deal with proteins in the "twilight zone" we can observe that only some segments of sequences (motifs) are conserved. We introduce a novel logical representation that allows us to represent physico-chemical properties of sequences, conserved amino acid positions and conserved physico-chemical positions in the MSA. From this, Inductive Logic Programming (ILP) finds the most frequent patterns (motifs) and uses them to train propositional models, such as decision trees and support vector machines (SVM). We use the SCOP database to perform our experiments by evaluating protein recognition within the same superfamily. Our results show that our methodology when using SVM performs significantly better than some of the state of the art methods, and comparable to other. However, our method provides a comprehensible set of logical rules that can help to understand what determines a protein function. The strategy of selecting only the most frequent patterns is effective for the remote homology detection. This is possible through a suitable first-order logical representation of homologous properties, and through a set of frequent patterns, found by an ILP system, that summarizes essential features of protein functions.

Gene Unprediction with Spurio: A tool to identify spurious protein sequences.

Science.gov (United States)

Höps, Wolfram; Jeffryes, Matt; Bateman, Alex

2018-01-01

We now have access to the sequences of tens of millions of proteins. These protein sequences are essential for modern molecular biology and computational biology. The vast majority of protein sequences are derived from gene prediction tools and have no experimental supporting evidence for their translation.  Despite the increasing accuracy of gene prediction tools there likely exists a large number of spurious protein predictions in the sequence databases.  We have developed the Spurio tool to help identify spurious protein predictions in prokaryotes.  Spurio searches the query protein sequence against a prokaryotic nucleotide database using tblastn and identifies homologous sequences. The tblastn matches are used to score the query sequence's likelihood of being a spurious protein prediction using a Gaussian process model. The most informative feature is the appearance of stop codons within the presumed translation of homologous DNA sequences. Benchmarking shows that the Spurio tool is able to distinguish spurious from true proteins. However, transposon proteins are prone to be predicted as spurious because of the frequency of degraded homologs found in the DNA sequence databases. Our initial experiments suggest that less than 1% of the proteins in the UniProtKB sequence database are likely to be spurious and that Spurio is able to identify over 60 times more spurious proteins than the AntiFam resource. The Spurio software and source code is available under an MIT license at the following URL: https://bitbucket.org/bateman-group/spurio.

Mod two homology and cohomology

CERN Document Server

Hausmann, Jean-Claude

2014-01-01

Cohomology and homology modulo 2 helps the reader grasp more readily the basics of a major tool in algebraic topology. Compared to a more general approach to (co)homology this refreshing approach has many pedagogical advantages: It leads more quickly to the essentials of the subject, An absence of signs and orientation considerations simplifies the theory, Computations and advanced applications can be presented at an earlier stage, Simple geometrical interpretations of (co)chains. Mod 2 (co)homology was developed in the first quarter of the twentieth century as an alternative to integral homology, before both became particular cases of (co)homology with arbitrary coefficients. The first chapters of this book may serve as a basis for a graduate-level introductory course to (co)homology. Simplicial and singular mod 2 (co)homology are introduced, with their products and Steenrod squares, as well as equivariant cohomology. Classical applications include Brouwer's fixed point theorem, Poincaré duality, Borsuk-Ula...

Short Interspersed Nuclear Element (SINE) Sequences in the Genome of the Human Pathogenic Fungus Aspergillus fumigatus Af293.

Science.gov (United States)

Kanhayuwa, Lakkhana; Coutts, Robert H A

2016-01-01

Novel families of short interspersed nuclear element (SINE) sequences in the human pathogenic fungus Aspergillus fumigatus, clinical isolate Af293, were identified and categorised into tRNA-related and 5S rRNA-related SINEs. Eight predicted tRNA-related SINE families originating from different tRNAs, and nominated as AfuSINE2 sequences, contained target site duplications of short direct repeat sequences (4-14 bp) flanking the elements, an extended tRNA-unrelated region and typical features of RNA polymerase III promoter sequences. The elements ranged in size from 140-493 bp and were present in low copy number in the genome and five out of eight were actively transcribed. One putative tRNAArg-derived sequence, AfuSINE2-1a possessed a unique feature of repeated trinucleotide ACT residues at its 3'-terminus. This element was similar in sequence to the I-4_AO element found in A. oryzae and an I-1_AF long nuclear interspersed element-like sequence identified in A. fumigatus Af293. Families of 5S rRNA-related SINE sequences, nominated as AfuSINE3, were also identified and their 5'-5S rRNA-related regions show 50-65% and 60-75% similarity to respectively A. fumigatus 5S rRNAs and SINE3-1_AO found in A. oryzae. A. fumigatus Af293 contains five copies of AfuSINE3 sequences ranging in size from 259-343 bp and two out of five AfuSINE3 sequences were actively transcribed. Investigations on AfuSINE distribution in the fungal genome revealed that the elements are enriched in pericentromeric and subtelomeric regions and inserted within gene-rich regions. We also demonstrated that some, but not all, AfuSINE sequences are targeted by host RNA silencing mechanisms. Finally, we demonstrated that infection of the fungus with mycoviruses had no apparent effects on SINE activity.

HOMOLOGY BETWEEN SEGMENTS OF HUMAN HEMOSTATIC PROTEINS AND PROTEINS OF VIRUSES WHICH CAUSE ACUTE RESPIRATORY INFECTIONS OR DISEASES WITH SIMILAR SYMPTOMS

Directory of Open Access Journals (Sweden)

I. N. Zhilinskaya

2017-01-01

Full Text Available Objectives: To identify homologous segments of human hemostatic and viral proteins and to assess the role of human hemostatic proteins in viral replication. Materials and Methods: The following viruses were chosen for comparison: influenza B (B/Astrakhan/2/2017, coronaviruses (Hcov229E and SARS-Co, type 1 adenovirus (adenoid 71, measles (ICHINOSE-BA and rubella (Therien. The primary structures of viral proteins and 41 human hemostatic proteins were obtained from open–access www.ncbi.nlm.nih. gov and www.nextprot.org databases, respectively. Sequence homology was determined by comparing 12-amino-acid segments. Those sequences identical in ≥ 8 positions were considered homologous. Results: The analysis shows that viral proteins contain segments which mimic a number of human hemostatic proteins. Most of these segments, except those of adenovirus proteins, are homologous with coagulation factors. The increase in viral virulence, as in case of SARS-Co, correlates with an increased number of segments homologous with hemostatic proteins. Conclusion: Hemostasis plays an important role in viral replication and pathogenesis. The conclusion is consistent with the literature data about the relationship of hemostasis and inflammatory response to viral infections.

Rapid Multiplex Small DNA Sequencing on the MinION Nanopore Sequencing Platform

Directory of Open Access Journals (Sweden)

Shan Wei

2018-05-01

Full Text Available Real-time sequencing of short DNA reads has a wide variety of clinical and research applications including screening for mutations, target sequences and aneuploidy. We recently demonstrated that MinION, a nanopore-based DNA sequencing device the size of a USB drive, could be used for short-read DNA sequencing. In this study, an ultra-rapid multiplex library preparation and sequencing method for the MinION is presented and applied to accurately test normal diploid and aneuploidy samples’ genomic DNA in under three hours, including library preparation and sequencing. This novel method shows great promise as a clinical diagnostic test for applications requiring rapid short-read DNA sequencing.

Cloning and characterization of the ddc homolog encoding L-2,4-diaminobutyrate decarboxylase in Enterobacter aerogenes.

Science.gov (United States)

Yamamoto, S; Mutoh, N; Tsuzuki, D; Ikai, H; Nakao, H; Shinoda, S; Narimatsu, S; Miyoshi, S I

2000-05-01

L-2,4-diaminobutyrate decarboxylase (DABA DC) catalyzes the formation of 1,3-diaminopropane (DAP) from DABA. In the present study, the ddc gene encoding DABA DC from Enterobacter aerogenes ATCC 13048 was cloned and characterized. Determination of the nucleotide sequence revealed an open reading frame of 1470 bp encoding a 53659-Da protein of 490 amino acids, whose deduced NH2-terminal sequence was identical to that of purified DABA DC from E. aerogenes. The deduced amino acid sequence was highly similar to those of Acinetobacter baumannii and Haemophilus influenzae DABA DCs encoded by the ddc genes. The lysine-307 of the E. aerogenes DABA DC was identified as the pyridoxal 5'-phosphate binding residue by site-directed mutagenesis. Furthermore, PCR analysis revealed the distribution of E. aerogenes ddc homologs in some other species of Enterobacteriaceae. Such a relatively wide occurrence of the ddc homologs implies biological significance of DABA DC and its product DAP.

External and semi-internal controls for PCR amplification of homologous sequences in mixed templates.

Science.gov (United States)

Kalle, Elena; Gulevich, Alexander; Rensing, Christopher

2013-11-01

In a mixed template, the presence of homologous target DNA sequences creates environments that almost inevitably give rise to artifacts and biases during PCR. Heteroduplexes, chimeras, and skewed template-to-product ratios are the exclusive attributes of mixed template PCR and never occur in a single template assay. Yet, multi-template PCR has been used without appropriate attention to quality control and assay validation, in spite of the fact that such practice diminishes the reliability of results. External and internal amplification controls became obligatory elements of good laboratory practice in different PCR assays. We propose the inclusion of an analogous approach as a quality control system for multi-template PCR applications. The amplification controls must take into account the characteristics of multi-template PCR and be able to effectively monitor particular assay performance. This study demonstrated the efficiency of a model mixed template as an adequate external amplification control for a particular PCR application. The conditions of multi-template PCR do not allow implementation of a classic internal control; therefore we developed a convenient semi-internal control as an acceptable alternative. In order to evaluate the effects of inhibitors, a model multi-template mix was amplified in a mixture with DNAse-treated sample. Semi-internal control allowed establishment of intervals for robust PCR performance for different samples, thus enabling correct comparison of the samples. The complexity of the external and semi-internal amplification controls must be comparable with the assumed complexity of the samples. We also emphasize that amplification controls should be applied in multi-template PCR regardless of the post-assay method used to analyze products. © 2013 Elsevier B.V. All rights reserved.

Genomic DNA sequence and cytosine methylation changes of adult rice leaves after seeds space flight

Science.gov (United States)

Shi, Jinming

In this study, cytosine methylation on CCGG site and genomic DNA sequence changes of adult leaves of rice after seeds space flight were detected by methylation-sensitive amplification polymorphism (MSAP) and Amplified fragment length polymorphism (AFLP) technique respectively. Rice seeds were planted in the trial field after 4 days space flight on the shenzhou-6 Spaceship of China. Adult leaves of space-treated rice including 8 plants chosen randomly and 2 plants with phenotypic mutation were used for AFLP and MSAP analysis. Polymorphism of both DNA sequence and cytosine methylation were detected. For MSAP analysis, the average polymorphic frequency of the on-ground controls, space-treated plants and mutants are 1.3%, 3.1% and 11% respectively. For AFLP analysis, the average polymorphic frequencies are 1.4%, 2.9%and 8%respectively. Total 27 and 22 polymorphic fragments were cloned sequenced from MSAP and AFLP analysis respectively. Nine of the 27 fragments from MSAP analysis show homology to coding sequence. For the 22 polymorphic fragments from AFLP analysis, no one shows homology to mRNA sequence and eight fragments show homology to repeat region or retrotransposon sequence. These results suggest that although both genomic DNA sequence and cytosine methylation status can be effected by space flight, the genomic region homology to the fragments from genome DNA and cytosine methylation analysis were different.

Efficient Detection of Copy Number Mutations in PMS2 Exons with a Close Homolog.

Science.gov (United States)

Herman, Daniel S; Smith, Christina; Liu, Chang; Vaughn, Cecily P; Palaniappan, Selvi; Pritchard, Colin C; Shirts, Brian H

2018-07-01

Detection of 3' PMS2 copy-number mutations that cause Lynch syndrome is difficult because of highly homologous pseudogenes. To improve the accuracy and efficiency of clinical screening for these mutations, we developed a new method to analyze standard capture-based, next-generation sequencing data to identify deletions and duplications in PMS2 exons 9 to 15. The approach captures sequences using PMS2 targets, maps sequences randomly among regions with equal mapping quality, counts reads aligned to homologous exons and introns, and flags read count ratios outside of empirically derived reference ranges. The method was trained on 1352 samples, including 8 known positives, and tested on 719 samples, including 17 known positives. Clinical implementation of the first version of this method detected new mutations in the training (N = 7) and test (N = 2) sets that had not been identified by our initial clinical testing pipeline. The described final method showed complete sensitivity in both sample sets and false-positive rates of 5% (training) and 7% (test), dramatically decreasing the number of cases needing additional mutation evaluation. This approach leveraged the differences between gene and pseudogene to distinguish between PMS2 and PMS2CL copy-number mutations. These methods enable efficient and sensitive Lynch syndrome screening for 3' PMS2 copy-number mutations and may be applied similarly to other genomic regions with highly homologous pseudogenes. Copyright © 2018 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

Science.gov (United States)

Szymanski, Maciej; Karlowski, Wojciech M

2016-01-01

In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

DSAP: deep-sequencing small RNA analysis pipeline.

Science.gov (United States)

Huang, Po-Jung; Liu, Yi-Chung; Lee, Chi-Ching; Lin, Wei-Chen; Gan, Richie Ruei-Chi; Lyu, Ping-Chiang; Tang, Petrus

2010-07-01

DSAP is an automated multiple-task web service designed to provide a total solution to analyzing deep-sequencing small RNA datasets generated by next-generation sequencing technology. DSAP uses a tab-delimited file as an input format, which holds the unique sequence reads (tags) and their corresponding number of copies generated by the Solexa sequencing platform. The input data will go through four analysis steps in DSAP: (i) cleanup: removal of adaptors and poly-A/T/C/G/N nucleotides; (ii) clustering: grouping of cleaned sequence tags into unique sequence clusters; (iii) non-coding RNA (ncRNA) matching: sequence homology mapping against a transcribed sequence library from the ncRNA database Rfam (http://rfam.sanger.ac.uk/); and (iv) known miRNA matching: detection of known miRNAs in miRBase (http://www.mirbase.org/) based on sequence homology. The expression levels corresponding to matched ncRNAs and miRNAs are summarized in multi-color clickable bar charts linked to external databases. DSAP is also capable of displaying miRNA expression levels from different jobs using a log(2)-scaled color matrix. Furthermore, a cross-species comparative function is also provided to show the distribution of identified miRNAs in different species as deposited in miRBase. DSAP is available at http://dsap.cgu.edu.tw.

Prokaryotic caspase homologs: phylogenetic patterns and functional characteristics reveal considerable diversity.

Directory of Open Access Journals (Sweden)

Johannes Asplund-Samuelsson

Full Text Available Caspases accomplish initiation and execution of apoptosis, a programmed cell death process specific to metazoans. The existence of prokaryotic caspase homologs, termed metacaspases, has been known for slightly more than a decade. Despite their potential connection to the evolution of programmed cell death in eukaryotes, the phylogenetic distribution and functions of these prokaryotic metacaspase sequences are largely uncharted, while a few experiments imply involvement in programmed cell death. Aiming at providing a more detailed picture of prokaryotic caspase homologs, we applied a computational approach based on Hidden Markov Model search profiles to identify and functionally characterize putative metacaspases in bacterial and archaeal genomes. Out of the total of 1463 analyzed genomes, merely 267 (18% were identified to contain putative metacaspases, but their taxonomic distribution included most prokaryotic phyla and a few archaea (Euryarchaeota. Metacaspases were particularly abundant in Alphaproteobacteria, Deltaproteobacteria and Cyanobacteria, which harbor many morphologically and developmentally complex organisms, and a distinct correlation was found between abundance and phenotypic complexity in Cyanobacteria. Notably, Bacillus subtilis and Escherichia coli, known to undergo genetically regulated autolysis, lacked metacaspases. Pfam domain architecture analysis combined with operon identification revealed rich and varied configurations among the metacaspase sequences. These imply roles in programmed cell death, but also e.g. in signaling, various enzymatic activities and protein modification. Together our data show a wide and scattered distribution of caspase homologs in prokaryotes with structurally and functionally diverse sub-groups, and with a potentially intriguing evolutionary role. These features will help delineate future characterizations of death pathways in prokaryotes.

De novo transcriptome sequencing and sequence analysis of the malaria vector Anopheles sinensis (Diptera: Culicidae)

Science.gov (United States)

2014-01-01

Background Anopheles sinensis is the major malaria vector in China and Southeast Asia. Vector control is one of the most effective measures to prevent malaria transmission. However, there is little transcriptome information available for the malaria vector. To better understand the biological basis of malaria transmission and to develop novel and effective means of vector control, there is a need to build a transcriptome dataset for functional genomics analysis by large-scale RNA sequencing (RNA-seq). Methods To provide a more comprehensive and complete transcriptome of An. sinensis, eggs, larvae, pupae, male adults and female adults RNA were pooled together for cDNA preparation, sequenced using the Illumina paired-end sequencing technology and assembled into unigenes. These unigenes were then analyzed in their genome mapping, functional annotation, homology, codon usage bias and simple sequence repeats (SSRs). Results Approximately 51.6 million clean reads were obtained, trimmed, and assembled into 38,504 unigenes with an average length of 571 bp, an N50 of 711 bp, and an average GC content 51.26%. Among them, 98.4% of unigenes could be mapped onto the reference genome, and 69% of unigenes could be annotated with known biological functions. Homology analysis identified certain numbers of An. sinensis unigenes that showed homology or being putative 1:1 orthologues with genomes of other Dipteran species. Codon usage bias was analyzed and 1,904 SSRs were detected, which will provide effective molecular markers for the population genetics of this species. Conclusions Our data and analysis provide the most comprehensive transcriptomic resource and characteristics currently available for An. sinensis, and will facilitate genetic, genomic studies, and further vector control of An. sinensis. PMID:25000941

Protein Function Prediction Based on Sequence and Structure Information

KAUST Repository

Smaili, Fatima Z.

2016-05-25

The number of available protein sequences in public databases is increasing exponentially. However, a significant fraction of these sequences lack functional annotation which is essential to our understanding of how biological systems and processes operate. In this master thesis project, we worked on inferring protein functions based on the primary protein sequence. In the approach we follow, 3D models are first constructed using I-TASSER. Functions are then deduced by structurally matching these predicted models, using global and local similarities, through three independent enzyme commission (EC) and gene ontology (GO) function libraries. The method was tested on 250 “hard” proteins, which lack homologous templates in both structure and function libraries. The results show that this method outperforms the conventional prediction methods based on sequence similarity or threading. Additionally, our method could be improved even further by incorporating protein-protein interaction information. Overall, the method we use provides an efficient approach for automated functional annotation of non-homologous proteins, starting from their sequence.

The colocalization transition of homologous chromosomes at meiosis

Science.gov (United States)

Nicodemi, Mario; Panning, Barbara; Prisco, Antonella

2008-06-01

Meiosis is the specialized cell division required in sexual reproduction. During its early stages, in the mother cell nucleus, homologous chromosomes recognize each other and colocalize in a crucial step that remains one of the most mysterious of meiosis. Starting from recent discoveries on the system molecular components and interactions, we discuss a statistical mechanics model of chromosome early pairing. Binding molecules mediate long-distance interaction of special DNA recognition sequences and, if their concentration exceeds a critical threshold, they induce a spontaneous colocalization transition of chromosomes, otherwise independently diffusing.

Effects of High Intensity White Noise on Short-Term Memory for Position in a List and Sequence

Science.gov (United States)

Daee, Safar; Wilding, J. M.

1977-01-01

Seven experiments are described investigating the effecy of high intensity white noise during the visual presentation of words on a number of short-term memory tasks. Examines results relative to position learning and sequence learning. (Editor/RK)

Interspecies hybridization on DNA resequencing microarrays: efficiency of sequence recovery and accuracy of SNP detection in human, ape, and codfish mitochondrial DNA genomes sequenced on a human-specific MitoChip

Directory of Open Access Journals (Sweden)

Carr Steven M

2007-09-01

Full Text Available Abstract Background Iterative DNA "resequencing" on oligonucleotide microarrays offers a high-throughput method to measure intraspecific biodiversity, one that is especially suited to SNP-dense gene regions such as vertebrate mitochondrial (mtDNA genomes. However, costs of single-species design and microarray fabrication are prohibitive. A cost-effective, multi-species strategy is to hybridize experimental DNAs from diverse species to a common microarray that is tiled with oligonucleotide sets from multiple, homologous reference genomes. Such a strategy requires that cross-hybridization between the experimental DNAs and reference oligos from the different species not interfere with the accurate recovery of species-specific data. To determine the pattern and limits of such interspecific hybridization, we compared the efficiency of sequence recovery and accuracy of SNP identification by a 15,452-base human-specific microarray challenged with human, chimpanzee, gorilla, and codfish mtDNA genomes. Results In the human genome, 99.67% of the sequence was recovered with 100.0% accuracy. Accuracy of SNP identification declines log-linearly with sequence divergence from the reference, from 0.067 to 0.247 errors per SNP in the chimpanzee and gorilla genomes, respectively. Efficiency of sequence recovery declines with the increase of the number of interspecific SNPs in the 25b interval tiled by the reference oligonucleotides. In the gorilla genome, which differs from the human reference by 10%, and in which 46% of these 25b regions contain 3 or more SNP differences from the reference, only 88% of the sequence is recoverable. In the codfish genome, which differs from the reference by > 30%, less than 4% of the sequence is recoverable, in short islands ≥ 12b that are conserved between primates and fish. Conclusion Experimental DNAs bind inefficiently to homologous reference oligonucleotide sets on a re-sequencing microarray when their sequences differ by

Annotating Protein Functional Residues by Coupling High-Throughput Fitness Profile and Homologous-Structure Analysis

Directory of Open Access Journals (Sweden)

Yushen Du

2016-11-01

Full Text Available Identification and annotation of functional residues are fundamental questions in protein sequence analysis. Sequence and structure conservation provides valuable information to tackle these questions. It is, however, limited by the incomplete sampling of sequence space in natural evolution. Moreover, proteins often have multiple functions, with overlapping sequences that present challenges to accurate annotation of the exact functions of individual residues by conservation-based methods. Using the influenza A virus PB1 protein as an example, we developed a method to systematically identify and annotate functional residues. We used saturation mutagenesis and high-throughput sequencing to measure the replication capacity of single nucleotide mutations across the entire PB1 protein. After predicting protein stability upon mutations, we identified functional PB1 residues that are essential for viral replication. To further annotate the functional residues important to the canonical or noncanonical functions of viral RNA-dependent RNA polymerase (vRdRp, we performed a homologous-structure analysis with 16 different vRdRp structures. We achieved high sensitivity in annotating the known canonical polymerase functional residues. Moreover, we identified a cluster of noncanonical functional residues located in the loop region of the PB1 β-ribbon. We further demonstrated that these residues were important for PB1 protein nuclear import through the interaction with Ran-binding protein 5. In summary, we developed a systematic and sensitive method to identify and annotate functional residues that are not restrained by sequence conservation. Importantly, this method is generally applicable to other proteins about which homologous-structure information is available.

Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

Science.gov (United States)

Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

1987-06-01

The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

Short Interspersed Nuclear Element (SINE Sequences in the Genome of the Human Pathogenic Fungus Aspergillus fumigatus Af293.

Directory of Open Access Journals (Sweden)

Lakkhana Kanhayuwa

Full Text Available Novel families of short interspersed nuclear element (SINE sequences in the human pathogenic fungus Aspergillus fumigatus, clinical isolate Af293, were identified and categorised into tRNA-related and 5S rRNA-related SINEs. Eight predicted tRNA-related SINE families originating from different tRNAs, and nominated as AfuSINE2 sequences, contained target site duplications of short direct repeat sequences (4-14 bp flanking the elements, an extended tRNA-unrelated region and typical features of RNA polymerase III promoter sequences. The elements ranged in size from 140-493 bp and were present in low copy number in the genome and five out of eight were actively transcribed. One putative tRNAArg-derived sequence, AfuSINE2-1a possessed a unique feature of repeated trinucleotide ACT residues at its 3'-terminus. This element was similar in sequence to the I-4_AO element found in A. oryzae and an I-1_AF long nuclear interspersed element-like sequence identified in A. fumigatus Af293. Families of 5S rRNA-related SINE sequences, nominated as AfuSINE3, were also identified and their 5'-5S rRNA-related regions show 50-65% and 60-75% similarity to respectively A. fumigatus 5S rRNAs and SINE3-1_AO found in A. oryzae. A. fumigatus Af293 contains five copies of AfuSINE3 sequences ranging in size from 259-343 bp and two out of five AfuSINE3 sequences were actively transcribed. Investigations on AfuSINE distribution in the fungal genome revealed that the elements are enriched in pericentromeric and subtelomeric regions and inserted within gene-rich regions. We also demonstrated that some, but not all, AfuSINE sequences are targeted by host RNA silencing mechanisms. Finally, we demonstrated that infection of the fungus with mycoviruses had no apparent effects on SINE activity.

Origin and spread of photosynthesis based upon conserved sequence features in key bacteriochlorophyll biosynthesis proteins.

Science.gov (United States)

Gupta, Radhey S

2012-11-01

The origin of photosynthesis and how this capability has spread to other bacterial phyla remain important unresolved questions. I describe here a number of conserved signature indels (CSIs) in key proteins involved in bacteriochlorophyll (Bchl) biosynthesis that provide important insights in these regards. The proteins BchL and BchX, which are essential for Bchl biosynthesis, are derived by gene duplication in a common ancestor of all phototrophs. More ancient gene duplication gave rise to the BchX-BchL proteins and the NifH protein of the nitrogenase complex. The sequence alignment of NifH-BchX-BchL proteins contain two CSIs that are uniquely shared by all NifH and BchX homologs, but not by any BchL homologs. These CSIs and phylogenetic analysis of NifH-BchX-BchL protein sequences strongly suggest that the BchX homologs are ancestral to BchL and that the Bchl-based anoxygenic photosynthesis originated prior to the chlorophyll (Chl)-based photosynthesis in cyanobacteria. Another CSI in the BchX-BchL sequence alignment that is uniquely shared by all BchX homologs and the BchL sequences from Heliobacteriaceae, but absent in all other BchL homologs, suggests that the BchL homologs from Heliobacteriaceae are primitive in comparison to all other photosynthetic lineages. Several other identified CSIs in the BchN homologs are commonly shared by all proteobacterial homologs and a clade consisting of the marine unicellular Cyanobacteria (Clade C). These CSIs in conjunction with the results of phylogenetic analyses and pair-wise sequence similarity on the BchL, BchN, and BchB proteins, where the homologs from Clade C Cyanobacteria and Proteobacteria exhibited close relationship, provide strong evidence that these two groups have incurred lateral gene transfers. Additionally, phylogenetic analyses and several CSIs in the BchL-N-B proteins that are uniquely shared by all Chlorobi and Chloroflexi homologs provide evidence that the genes for these proteins have also been

High frequency of phylogenetically diverse reductive dehalogenase-homologous genes in deep subseafloor sedimentary metagenomes

Directory of Open Access Journals (Sweden)

Mikihiko eKawai

2014-03-01

Full Text Available Marine subsurface sediments on the Pacific margin harbor diverse microbial communities even at depths of several hundreds meters below the seafloor (mbsf or more. Previous PCR-based molecular analysis showed the presence of diverse reductive dehalogenase gene (rdhA homologs in marine subsurface sediment, suggesting that anaerobic respiration of organohalides is one of the possible energy-yielding pathways in the organic-rich sedimentary habitat. However, primer-independent molecular characterization of rdhA has remained to be demonstrated. Here, we studied the diversity and frequency of rdhA homologs by metagenomic analysis of five different depth horizons (0.8, 5.1, 18.6, 48.5 and 107.0 mbsf at Site C9001 off the Shimokita Peninsula of Japan. From all metagenomic pools, remarkably diverse rdhA-homologous sequences, some of which are affiliated with novel clusters, were observed with high frequency. As a comparison, we also examined frequency of dissimilatory sulfite reductase genes (dsrAB, key functional genes for microbial sulfate reduction. The dsrAB were also widely observed in the metagenomic pools whereas the frequency of dsrAB genes was generally smaller than that of rdhA-homologous genes. The phylogenetic composition of rdhA-homologous genes was similar among the five depth horizons. Our metagenomic data revealed that subseafloor rdhA homologs are more diverse than previously identified from PCR-based molecular studies. Spatial distribution of similar rdhA homologs across wide depositional ages indicates that the heterotrophic metabolic processes mediated by the genes can be ecologically important, functioning in the organic-rich subseafloor sedimentary biosphere.

Gene mining a marama bean expressed sequence tags (ESTs ...

African Journals Online (AJOL)

The authors reported the identification of genes associated with embryonic development and microsatellite sequences. The future direction will entail characterization of these genes using gene over-expression and mutant assays. Key words: Namibia, simple sequence repeats (SSR), data mining, homology searches, ...

The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing

DEFF Research Database (Denmark)

Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P

2007-01-01

BACKGROUND: The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine...... primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution...

Analysis of quality raw data of second generation sequencers with Quality Assessment Software.

Science.gov (United States)

Ramos, Rommel Tj; Carneiro, Adriana R; Baumbach, Jan; Azevedo, Vasco; Schneider, Maria Pc; Silva, Artur

2011-04-18

Second generation technologies have advantages over Sanger; however, they have resulted in new challenges for the genome construction process, especially because of the small size of the reads, despite the high degree of coverage. Independent of the program chosen for the construction process, DNA sequences are superimposed, based on identity, to extend the reads, generating contigs; mismatches indicate a lack of homology and are not included. This process improves our confidence in the sequences that are generated. We developed Quality Assessment Software, with which one can review graphs showing the distribution of quality values from the sequencing reads. This software allow us to adopt more stringent quality standards for sequence data, based on quality-graph analysis and estimated coverage after applying the quality filter, providing acceptable sequence coverage for genome construction from short reads. Quality filtering is a fundamental step in the process of constructing genomes, as it reduces the frequency of incorrect alignments that are caused by measuring errors, which can occur during the construction process due to the size of the reads, provoking misassemblies. Application of quality filters to sequence data, using the software Quality Assessment, along with graphing analyses, provided greater precision in the definition of cutoff parameters, which increased the accuracy of genome construction.

Genome dynamics of short oligonucleotides: the example of bacterial DNA uptake enhancing sequences.

Directory of Open Access Journals (Sweden)

Mohammed Bakkali

Full Text Available Among the many bacteria naturally competent for transformation by DNA uptake-a phenomenon with significant clinical and financial implications- Pasteurellaceae and Neisseriaceae species preferentially take up DNA containing specific short sequences. The genomic overrepresentation of these DNA uptake enhancing sequences (DUES causes preferential uptake of conspecific DNA, but the function(s behind this overrepresentation and its evolution are still a matter for discovery. Here I analyze DUES genome dynamics and evolution and test the validity of the results to other selectively constrained oligonucleotides. I use statistical methods and computer simulations to examine DUESs accumulation in Haemophilus influenzae and Neisseria gonorrhoeae genomes. I analyze DUESs sequence and nucleotide frequencies, as well as those of all their mismatched forms, and prove the dependence of DUESs genomic overrepresentation on their preferential uptake by quantifying and correlating both characteristics. I then argue that mutation, uptake bias, and weak selection against DUESs in less constrained parts of the genome combined are sufficient enough to cause DUESs accumulation in susceptible parts of the genome with no need for other DUES function. The distribution of overrepresentation values across sequences with different mismatch loads compared to the DUES suggests a gradual yet not linear molecular drive of DNA sequences depending on their similarity to the DUES. Other genomically overrepresented sequences, both pro- and eukaryotic, show similar distribution of frequencies suggesting that the molecular drive reported above applies to other frequent oligonucleotides. Rare oligonucleotides, however, seem to be gradually drawn to genomic underrepresentation, thus, suggesting a molecular drag. To my knowledge this work provides the first clear evidence of the gradual evolution of selectively constrained oligonucleotides, including repeated, palindromic and protein

Chlamydomonas chloroplasts can use short dispersed repeats and multiple pathways to repair a double-strand break in the genome.

Science.gov (United States)

Odom, Obed W; Baek, Kwang-Hyun; Dani, Radhika N; Herrin, David L

2008-03-01

Certain group I introns insert into intronless DNA via an endonuclease that creates a double-strand break (DSB). There are two models for intron homing in phage: synthesis-dependent strand annealing (SDSA) and double-strand break repair (DSBR). The Cr.psbA4 intron homes efficiently from a plasmid into the chloroplast psbA gene in Chlamydomonas, but little is known about the mechanism. Analysis of co-transformants selected using a spectinomycin-resistant 16S gene (16S(spec)) provided evidence for both pathways. We also examined the consequences of the donor DNA having only one-sided or no homology with the psbA gene. When there was no homology with the donor DNA, deletions of up to 5 kb involving direct repeats that flank the psbA gene were obtained. Remarkably, repeats as short as 15 bp were used for this repair, which is consistent with the single-strand annealing (SSA) pathway. When the donor had one-sided homology, the DSB in most co-transformants was repaired using two DNAs, the donor and the 16S(spec) plasmid, which, coincidentally, contained a region that is repeated upstream of psbA. DSB repair using two separate DNAs provides further evidence for the SDSA pathway. These data show that the chloroplast can repair a DSB using short dispersed repeats located proximally, distally, or even on separate molecules relative to the DSB. They also provide a rationale for the extensive repertoire of repeated sequences in this genome.

Draft genome sequence of Cicer reticulatum L., the wild progenitor of chickpea provides a resource for agronomic trait improvement.

Science.gov (United States)

Gupta, Sonal; Nawaz, Kashif; Parween, Sabiha; Roy, Riti; Sahu, Kamlesh; Kumar Pole, Anil; Khandal, Hitaishi; Srivastava, Rishi; Kumar Parida, Swarup; Chattopadhyay, Debasis

2017-02-01

Cicer reticulatum L. is the wild progenitor of the fourth most important legume crop chickpea (C. arietinum L.). We assembled short-read sequences into 416 Mb draft genome of C. reticulatum and anchored 78% (327 Mb) of this assembly to eight linkage groups. Genome annotation predicted 25,680 protein-coding genes covering more than 90% of predicted gene space. The genome assembly shared a substantial synteny and conservation of gene orders with the genome of the model legume Medicago truncatula. Resistance gene homologs of wild and domesticated chickpeas showed high sequence homology and conserved synteny. Comparison of gene sequences and nucleotide diversity using 66 wild and domesticated chickpea accessions suggested that the desi type chickpea was genetically closer to the wild species than the kabuli type. Comparative analyses predicted gene flow between the wild and the cultivated species during domestication. Molecular diversity and population genetic structure determination using 15,096 genome-wide single nucleotide polymorphisms revealed an admixed domestication pattern among cultivated (desi and kabuli) and wild chickpea accessions belonging to three population groups reflecting significant influence of parentage or geographical origin for their cultivar-specific population classification. The assembly and the polymorphic sequence resources presented here would facilitate the study of chickpea domestication and targeted use of wild Cicer germplasms for agronomic trait improvement in chickpea. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Analysis of the role of homology arms in gene-targeting vectors in human cells.

Directory of Open Access Journals (Sweden)

Ayako Ishii

Full Text Available Random integration of targeting vectors into the genome is the primary obstacle in human somatic cell gene targeting. Non-homologous end-joining (NHEJ, a major pathway for repairing DNA double-strand breaks, is thought to be responsible for most random integration events; however, absence of DNA ligase IV (LIG4, the critical NHEJ ligase, does not significantly reduce random integration frequency of targeting vector in human cells, indicating robust integration events occurring via a LIG4-independent mechanism. To gain insights into the mechanism and robustness of LIG4-independent random integration, we employed various types of targeting vectors to examine their integration frequencies in LIG4-proficient and deficient human cell lines. We find that the integration frequency of targeting vector correlates well with the length of homology arms and with the amount of repetitive DNA sequences, especially SINEs, present in the arms. This correlation was prominent in LIG4-deficient cells, but was also seen in LIG4-proficient cells, thus providing evidence that LIG4-independent random integration occurs frequently even when NHEJ is functionally normal. Our results collectively suggest that random integration frequency of conventional targeting vectors is substantially influenced by homology arms, which typically harbor repetitive DNA sequences that serve to facilitate LIG4-independent random integration in human cells, regardless of the presence or absence of functional NHEJ.

Genome sequence determination and metagenomic characterization of a Dehalococcoides mixed culture grown on cis-1,2-dichloroethene.

Science.gov (United States)

Yohda, Masafumi; Yagi, Osami; Takechi, Ayane; Kitajima, Mizuki; Matsuda, Hisashi; Miyamura, Naoaki; Aizawa, Tomoko; Nakajima, Mutsuyasu; Sunairi, Michio; Daiba, Akito; Miyajima, Takashi; Teruya, Morimi; Teruya, Kuniko; Shiroma, Akino; Shimoji, Makiko; Tamotsu, Hinako; Juan, Ayaka; Nakano, Kazuma; Aoyama, Misako; Terabayashi, Yasunobu; Satou, Kazuhito; Hirano, Takashi

2015-07-01

A Dehalococcoides-containing bacterial consortium that performed dechlorination of 0.20 mM cis-1,2-dichloroethene to ethene in 14 days was obtained from the sediment mud of the lotus field. To obtain detailed information of the consortium, the metagenome was analyzed using the short-read next-generation sequencer SOLiD 3. Matching the obtained sequence tags with the reference genome sequences indicated that the Dehalococcoides sp. in the consortium was highly homologous to Dehalococcoides mccartyi CBDB1 and BAV1. Sequence comparison with the reference sequence constructed from 16S rRNA gene sequences in a public database showed the presence of Sedimentibacter, Sulfurospirillum, Clostridium, Desulfovibrio, Parabacteroides, Alistipes, Eubacterium, Peptostreptococcus and Proteocatella in addition to Dehalococcoides sp. After further enrichment, the members of the consortium were narrowed down to almost three species. Finally, the full-length circular genome sequence of the Dehalococcoides sp. in the consortium, D. mccartyi IBARAKI, was determined by analyzing the metagenome with the single-molecule DNA sequencer PacBio RS. The accuracy of the sequence was confirmed by matching it to the tag sequences obtained by SOLiD 3. The genome is 1,451,062 nt and the number of CDS is 1566, which includes 3 rRNA genes and 47 tRNA genes. There exist twenty-eight RDase genes that are accompanied by the genes for anchor proteins. The genome exhibits significant sequence identity with other Dehalococcoides spp. throughout the genome, but there exists significant difference in the distribution RDase genes. The combination of a short-read next-generation DNA sequencer and a long-read single-molecule DNA sequencer gives detailed information of a bacterial consortium. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Sequence of human protamine 2 cDNA

Energy Technology Data Exchange (ETDEWEB)

Domenjoud, L; Fronia, C; Uhde, F; Engel, W [Universitaet Goettingen (West Germany)

1988-08-11

The authors report the cloning and sequencing of a cDNA clone for human protamine 2 (hp2), isolated from a human testis cDNA library cloned in the vector {lambda}-gt11. A 66mer oligonucleotide, that corresponds to an amino acid sequence which is highly conserved between hp2 and mouse protamine 2 (mp2) served as hybridization probe. The homology between the amino acid sequence deduced from our cDNA and the published amino acid sequence for hp2 is 100%.

Gene Discovery through Genomic Sequencing of Brucella abortus

OpenAIRE

Sánchez, Daniel O.; Zandomeni, Ruben O.; Cravero, Silvio; Verdún, Ramiro E.; Pierrou, Ester; Faccio, Paula; Diaz, Gabriela; Lanzavecchia, Silvia; Agüero, Fernán; Frasch, Alberto C. C.; Andersson, Siv G. E.; Rossetti, Osvaldo L.; Grau, Oscar; Ugalde, Rodolfo A.

2001-01-01

Brucella abortus is the etiological agent of brucellosis, a disease that affects bovines and human. We generated DNA random sequences from the genome of B. abortus strain 2308 in order to characterize molecular targets that might be useful for developing immunological or chemotherapeutic strategies against this pathogen. The partial sequencing of 1,899 clones allowed the identification of 1,199 genomic sequence surveys (GSSs) with high homology (BLAST expect value < 10−5) to sequences deposit...

Membrane and Protein Interactions of the Pleckstrin Homology Domain Superfamily

Directory of Open Access Journals (Sweden)

Marc Lenoir

2015-10-01

Full Text Available The human genome encodes about 285 proteins that contain at least one annotated pleckstrin homology (PH domain. As the first phosphoinositide binding module domain to be discovered, the PH domain recruits diverse protein architectures to cellular membranes. PH domains constitute one of the largest protein superfamilies, and have diverged to regulate many different signaling proteins and modules such as Dbl homology (DH and Tec homology (TH domains. The ligands of approximately 70 PH domains have been validated by binding assays and complexed structures, allowing meaningful extrapolation across the entire superfamily. Here the Membrane Optimal Docking Area (MODA program is used at a genome-wide level to identify all membrane docking PH structures and map their lipid-binding determinants. In addition to the linear sequence motifs which are employed for phosphoinositide recognition, the three dimensional structural features that allow peripheral membrane domains to approach and insert into the bilayer are pinpointed and can be predicted ab initio. The analysis shows that conserved structural surfaces distinguish which PH domains associate with membrane from those that do not. Moreover, the results indicate that lipid-binding PH domains can be classified into different functional subgroups based on the type of membrane insertion elements they project towards the bilayer.

Membrane and Protein Interactions of the Pleckstrin Homology Domain Superfamily.

Science.gov (United States)

Lenoir, Marc; Kufareva, Irina; Abagyan, Ruben; Overduin, Michael

2015-10-23

The human genome encodes about 285 proteins that contain at least one annotated pleckstrin homology (PH) domain. As the first phosphoinositide binding module domain to be discovered, the PH domain recruits diverse protein architectures to cellular membranes. PH domains constitute one of the largest protein superfamilies, and have diverged to regulate many different signaling proteins and modules such as Dbl homology (DH) and Tec homology (TH) domains. The ligands of approximately 70 PH domains have been validated by binding assays and complexed structures, allowing meaningful extrapolation across the entire superfamily. Here the Membrane Optimal Docking Area (MODA) program is used at a genome-wide level to identify all membrane docking PH structures and map their lipid-binding determinants. In addition to the linear sequence motifs which are employed for phosphoinositide recognition, the three dimensional structural features that allow peripheral membrane domains to approach and insert into the bilayer are pinpointed and can be predicted ab initio. The analysis shows that conserved structural surfaces distinguish which PH domains associate with membrane from those that do not. Moreover, the results indicate that lipid-binding PH domains can be classified into different functional subgroups based on the type of membrane insertion elements they project towards the bilayer.

Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity.

Science.gov (United States)

Mulligan, M E; Hawley, D K; Entriken, R; McClure, W R

1984-01-11

We describe a simple algorithm for computing a homology score for Escherichia coli promoters based on DNA sequence alone. The homology score was related to 31 values, measured in vitro, of RNA polymerase selectivity, which we define as the product KBk2, the apparent second order rate constant for open complex formation. We found that promoter strength could be predicted to within a factor of +/-4.1 in KBk2 over a range of 10(4) in the same parameter. The quantitative evaluation was linked to an automated (Apple II) procedure for searching and evaluating possible promoters in DNA sequence files.

Conservation of the glycoprotein B homologs of the Kaposi’s sarcoma-associated herpesvirus (KSHV/HHV8) and Old World primate rhadinoviruses of chimpanzees and macaques

Science.gov (United States)

Bruce, A. Gregory; Horst, Jeremy A.; Rose, Timothy M.

2016-01-01

The envelope-associated glycoprotein B (gB) is highly conserved within the Herpesviridae and plays a critical role in viral entry. We analyzed the evolutionary conservation of sequence and structural motifs within the Kaposi’s sarcoma-associated herpesvirus (KSHV) gB and homologs of Old World primate rhadinoviruses belonging to the distinct RV1 and RV2 rhadinovirus lineages. In addition to gB homologs of rhadinoviruses infecting the pig-tailed and rhesus macaques, we cloned and sequenced gB homologs of RV1 and RV2 rhadinoviruses infecting chimpanzees. A structural model of the KSHV gB was determined, and functional motifs and sequence variants were mapped to the model structure. Conserved domains and motifs were identified, including an “RGD” motif that plays a critical role in KSHV binding and entry through the cellular integrin αVβ3. The RGD motif was only detected in RV1 rhadinoviruses suggesting an important difference in cell tropism between the two rhadinovirus lineages. PMID:27070755

Screening of SHOX gene sequence variants in Saudi Arabian children with idiopathic short stature.

Science.gov (United States)

Alharthi, Abdulla A; El-Hallous, Ehab I; Talaat, Iman M; Alghamdi, Hamed A; Almalki, Matar I; Gaber, Ahmed

2017-10-01

Short stature affects approximately 2%-3% of children, representing one of the most frequent disorders for which clinical attention is sought during childhood. Despite assumed genetic heterogeneity, mutations or deletions in the short stature homeobox-containing gene ( SHOX ) are frequently detected in subjects with short stature. Idiopathic short stature (ISS) refers to patients with short stature for various unknown reasons. The goal of this study was to screen all the exons of SHOX to identify related mutations. We screened all the exons of SHOX for mutations analysis in 105 ISS children patients (57 girls and 48 boys) living in Taif governorate, KSA using a direct DNA sequencing method. Height, arm span, and sitting height were recorded, and subischial leg length was calculated. A total of 30 of 105 ISS patients (28%) contained six polymorphic variants in exons 1, 2, 4, and 6. One mutation was found in the DNA domain binding region of exon 4. Three of these polymorphic variants were novel, while the others were reported previously. There were no significant differences in anthropometric measures in ISS patients with and without identifiable polymorphic variants in SHOX . In Saudi Arabia ISS patients, rather than SHOX , it is possible that new genes are involved in longitudinal growth. Additional molecular analysis is required to diagnose and understand the etiology of this disease.

In Silico Characterization of Pectate Lyase Protein Sequences from Different Source Organisms

Directory of Open Access Journals (Sweden)

Amit Kumar Dubey

2010-01-01

Full Text Available A total of 121 protein sequences of pectate lyases were subjected to homology search, multiple sequence alignment, phylogenetic tree construction, and motif analysis. The phylogenetic tree constructed revealed different clusters based on different source organisms representing bacterial, fungal, plant, and nematode pectate lyases. The multiple accessions of bacterial, fungal, nematode, and plant pectate lyase protein sequences were placed closely revealing a sequence level similarity. The multiple sequence alignment of these pectate lyase protein sequences from different source organisms showed conserved regions at different stretches with maximum homology from amino acid residues 439–467, 715–816, and 829–910 which could be used for designing degenerate primers or probes specific for pectate lyases. The motif analysis revealed a conserved Pec_Lyase_C domain uniformly observed in all pectate lyases irrespective of variable sources suggesting its possible role in structural and enzymatic functions.

Therapeutic Potential of a Scorpion Venom-Derived Antimicrobial Peptide and Its Homologs Against Antibiotic-Resistant Gram-Positive Bacteria

Directory of Open Access Journals (Sweden)

Gaomin Liu

2018-05-01

Full Text Available The alarming rise in the prevalence of antibiotic resistance among pathogenic bacteria poses a unique challenge for the development of effective therapeutic agents. Antimicrobial peptides (AMPs have attracted a great deal of attention as a possible solution to the increasing problem of antibiotic-resistant bacteria. Marcin-18 was identified from the scorpion Mesobuthus martensii at both DNA and protein levels. The genomic sequence revealed that the marcin-18 coding gene contains a phase-I intron with a GT-AG splice junction located in the DNA region encoding the N-terminal part of signal peptide. The peptide marcin-18 was also isolated from scorpion venom. A protein sequence homology search revealed that marcin-18 shares extremely high sequence identity to the AMPs meucin-18 and megicin-18. In vitro, chemically synthetic marcin-18 and its homologs (meucin-18 and megicin-18 showed highly potent inhibitory activity against Gram-positive bacteria, including some clinical antibiotic-resistant strains. Importantly, in a mouse acute peritonitis model, these peptides significantly decreased the bacterial load in ascites and rescued nearly all mice heavily infected with clinical methicillin-resistant Staphylococcus aureus from lethal bacteremia. Peptides exerted antimicrobial activity via a bactericidal mechanism and killed bacteria through membrane disruption. Taken together, marcin-18 and its homologs have potential for development as therapeutic agents for treating antibiotic-resistant, Gram-positive bacterial infections.

Acetylcholine Receptor: Complex of Homologous Subunits

Science.gov (United States)

Raftery, Michael A.; Hunkapiller, Michael W.; Strader, Catherine D.; Hood, Leroy E.

1980-06-01

The acetylcholine receptor from the electric ray Torpedo californica is composed of five subunits; two are identical and the other three are structurally related to them. Microsequence analysis of the four polypeptides demonstrates amino acid homology among the subunits. Further sequence analysis of both membrane-bound and Triton-solubilized, chromatographically purified receptor gave the stoichiometry of the four subunits (40,000:50,000:60,000:65,000 daltons) as 2:1:1:1, indicating that this protein is a pentameric complex with a molecular weight of 255,000 daltons. Genealogical analysis suggests that divergence from a common ancestral gene occurred early in the evolution of the receptor. This shared ancestry argues that each of the four subunits plays a functional role in the receptor's physiological action.

Cloning and cDNA sequence of the dihydrolipoamide dehydrogenase component of human α-ketoacid dehydrogenase complexes

International Nuclear Information System (INIS)

Pons, G.; Raefsky-Estrin, C.; Carothers, D.J.; Pepin, R.A.; Javed, A.A.; Jesse, B.W.; Ganapathi, M.K.; Samols, D.; Patel, M.S.

1988-01-01

cDNA clones comprising the entire coding region for human dihydrolipoamide dehydrogenase have been isolated from a human liver cDNA library. The cDNA sequence of the largest clone consisted of 2082 base pairs and contained a 1527-base open reading frame that encodes a precursor dihydrolipoamide dehydrogenase of 509 amino acid residues. The first 35-amino acid residues of the open reading frame probably correspond to a typical mitochondrial import leader sequence. The predicted amino acid sequence of the mature protein, starting at the residue number 36 of the open reading frame, is almost identical (>98% homology) with the known partial amino acid sequence of the pig heart dihydrolipoamide dehydrogenase. The cDNA clone also contains a 3' untranslated region of 505 bases with an unusual polyadenylylation signal (TATAAA) and a short poly(A) track. By blot-hybridization analysis with the cDNA as probe, two mRNAs, 2.2 and 2.4 kilobases in size, have been detected in human tissues and fibroblasts, whereas only one mRNA (2.4 kilobases) was detected in rat tissues

Amino acid sequences of ribosomal proteins S11 from Bacillus stearothermophilus and S19 from Halobacterium marismortui. Comparison of the ribosomal protein S11 family.

Science.gov (United States)

Kimura, M; Kimura, J; Hatakeyama, T

1988-11-21

The complete amino acid sequences of ribosomal proteins S11 from the Gram-positive eubacterium Bacillus stearothermophilus and of S19 from the archaebacterium Halobacterium marismortui have been determined. A search for homologous sequences of these proteins revealed that they belong to the ribosomal protein S11 family. Homologous proteins have previously been sequenced from Escherichia coli as well as from chloroplast, yeast and mammalian ribosomes. A pairwise comparison of the amino acid sequences showed that Bacillus protein S11 shares 68% identical residues with S11 from Escherichia coli and a slightly lower homology (52%) with the homologous chloroplast protein. The halophilic protein S19 is more related to the eukaryotic (45-49%) than to the eubacterial counterparts (35%).

454 sequencing of pooled BAC clones on chromosome 3H of barley

Directory of Open Access Journals (Sweden)

Yamaji Nami

2011-05-01

Full Text Available Abstract Background Genome sequencing of barley has been delayed due to its large genome size (ca. 5,000Mbp. Among the fast sequencing systems, 454 liquid phase pyrosequencing provides the longest reads and is the most promising method for BAC clones. Here we report the results of pooled sequencing of BAC clones selected with ESTs genetically mapped to chromosome 3H. Results We sequenced pooled barley BAC clones using a 454 parallel genome sequencer. A PCR screening system based on primer sets derived from genetically mapped ESTs on chromosome 3H was used for clone selection in a BAC library developed from cultivar "Haruna Nijo". The DNA samples of 10 or 20 BAC clones were pooled and used for shotgun library development. The homology between contig sequences generated in each pooled library and mapped EST sequences was studied. The number of contigs assigned on chromosome 3H was 372. Their lengths ranged from 1,230 bp to 58,322 bp with an average 14,891 bp. Of these contigs, 240 showed homology and colinearity with the genome sequence of rice chromosome 1. A contig annotation browser supplemented with query search by unique sequence or genetic map position was developed. The identified contigs can be annotated with barley cDNAs and reference sequences on the browser. Homology analysis of these contigs with rice genes indicated that 1,239 rice genes can be assigned to barley contigs by the simple comparison of sequence lengths in both species. Of these genes, 492 are assigned to rice chromosome 1. Conclusions We demonstrate the efficiency of sequencing gene rich regions from barley chromosome 3H, with special reference to syntenic relationships with rice chromosome 1.

Sequence homology: A poor predictive value for profilins cross-reactivity

Directory of Open Access Journals (Sweden)

Pazouki Nazanin

2005-09-01

Full Text Available Summary Background Profilins are highly cross-reactive allergens which bind IgE antibodies of almost 20% of plant-allergic patients. This study is aimed at investigating cross-reactivity of melon profilin with other plant profilins and the role of the linear and conformational epitopes in human IgE cross-reactivity. Methods Seventeen patients with melon allergy were selected based on clinical history and a positive skin prick test to melon extract. Melon profilin has been cloned and expressed in E. coli. The IgE binding and cross-reactivity of the recombinant profilin were measured by ELISA and inhibition ELISA. The amino acid sequence of melon profilin was compared with other profilin sequences. A combination of chemical cleavage and immunoblotting techniques were used to define the role of conformational and linear epitopes in IgE binding. Comparative modeling was used to construct three-dimensional models of profilins and to assess theoretical impact of amino acid differences on conformational structure. Results Profilin was identified as a major IgE-binding component of melon. Alignment of amino acid sequences of melon profilin with other profilins showed the most identity with watermelon profilin. This melon profilin showed substantial cross-reactivity with the tomato, peach, grape and Cynodon dactylon (Bermuda grass pollen profilins. Cantaloupe, watermelon, banana and Poa pratensis (Kentucky blue grass displayed no notable inhibition. Our experiments also indicated human IgE only react with complete melon profilin. Immunoblotting analysis with rabbit polyclonal antibody shows the reaction of the antibody to the fragmented and complete melon profilin. Although, the well-known linear epitope of profilins were identical in melon and watermelon, comparison of three-dimensional models of watermelon and melon profilins indicated amino acid differences influence the electric potential and accessibility of the solvent-accessible surface of

Protein 3D structure computed from evolutionary sequence variation.

Directory of Open Access Journals (Sweden)

Debora S Marks

Full Text Available The evolutionary trajectory of a protein through sequence space is constrained by its function. Collections of sequence homologs record the outcomes of millions of evolutionary experiments in which the protein evolves according to these constraints. Deciphering the evolutionary record held in these sequences and exploiting it for predictive and engineering purposes presents a formidable challenge. The potential benefit of solving this challenge is amplified by the advent of inexpensive high-throughput genomic sequencing.In this paper we ask whether we can infer evolutionary constraints from a set of sequence homologs of a protein. The challenge is to distinguish true co-evolution couplings from the noisy set of observed correlations. We address this challenge using a maximum entropy model of the protein sequence, constrained by the statistics of the multiple sequence alignment, to infer residue pair couplings. Surprisingly, we find that the strength of these inferred couplings is an excellent predictor of residue-residue proximity in folded structures. Indeed, the top-scoring residue couplings are sufficiently accurate and well-distributed to define the 3D protein fold with remarkable accuracy.We quantify this observation by computing, from sequence alone, all-atom 3D structures of fifteen test proteins from different fold classes, ranging in size from 50 to 260 residues, including a G-protein coupled receptor. These blinded inferences are de novo, i.e., they do not use homology modeling or sequence-similar fragments from known structures. The co-evolution signals provide sufficient information to determine accurate 3D protein structure to 2.7-4.8 Å C(α-RMSD error relative to the observed structure, over at least two-thirds of the protein (method called EVfold, details at http://EVfold.org. This discovery provides insight into essential interactions constraining protein evolution and will facilitate a comprehensive survey of the universe of

Abundant and diverse clustered regularly interspaced short palindromic repeat spacers in Clostridium difficile strains and prophages target multiple phage types within this pathogen.

Science.gov (United States)

Hargreaves, Katherine R; Flores, Cesar O; Lawley, Trevor D; Clokie, Martha R J

2014-08-26

Clostridium difficile is an important human-pathogenic bacterium causing antibiotic-associated nosocomial infections worldwide. Mobile genetic elements and bacteriophages have helped shape C. difficile genome evolution. In many bacteria, phage infection may be controlled by a form of bacterial immunity called the clustered regularly interspaced short palindromic repeats/CRISPR-associated (CRISPR/Cas) system. This uses acquired short nucleotide sequences (spacers) to target homologous sequences (protospacers) in phage genomes. C. difficile carries multiple CRISPR arrays, and in this paper we examine the relationships between the host- and phage-carried elements of the system. We detected multiple matches between spacers and regions in 31 C. difficile phage and prophage genomes. A subset of the spacers was located in prophage-carried CRISPR arrays. The CRISPR spacer profiles generated suggest that related phages would have similar host ranges. Furthermore, we show that C. difficile strains of the same ribotype could either have similar or divergent CRISPR contents. Both synonymous and nonsynonymous mutations in the protospacer sequences were identified, as well as differences in the protospacer adjacent motif (PAM), which could explain how phages escape this system. This paper illustrates how the distribution and diversity of CRISPR spacers in C. difficile, and its prophages, could modulate phage predation for this pathogen and impact upon its evolution and pathogenicity. Clostridium difficile is a significant bacterial human pathogen which undergoes continual genome evolution, resulting in the emergence of new virulent strains. Phages are major facilitators of genome evolution in other bacterial species, and we use sequence analysis-based approaches in order to examine whether the CRISPR/Cas system could control these interactions across divergent C. difficile strains. The presence of spacer sequences in prophages that are homologous to phage genomes raises an

Geometric homology revisited

OpenAIRE

Ruffino, Fabio Ferrari

2013-01-01

Given a cohomology theory, there is a well-known abstract way to define the dual homology theory using the theory of spectra. In [4] the author provides a more geometric construction of the homology theory, using a generalization of the bordism groups. Such a generalization involves in its definition the vector bundle modification, which is a particular case of the Gysin map. In this paper we provide a more natural variant of that construction, which replaces the vector bundle modification wi...

Sequence requirement of the ade6-4095 meiotic recombination hotspot in Schizosaccharomyces pombe.

Science.gov (United States)

Foulis, Steven J; Fowler, Kyle R; Steiner, Walter W

2018-02-01

Homologous recombination occurs at a greatly elevated frequency in meiosis compared to mitosis and is initiated by programmed double-strand DNA breaks (DSBs). DSBs do not occur at uniform frequency throughout the genome in most organisms, but occur preferentially at a limited number of sites referred to as hotspots. The location of hotspots have been determined at nucleotide-level resolution in both the budding and fission yeasts, and while several patterns have emerged regarding preferred locations for DSB hotspots, it remains unclear why particular sites experience DSBs at much higher frequency than other sites with seemingly similar properties. Short sequence motifs, which are often sites for binding of transcription factors, are known to be responsible for a number of hotspots. In this study we identified the minimum sequence required for activity of one of such motif identified in a screen of random sequences capable of producing recombination hotspots. The experimentally determined sequence, GGTCTRGACC, closely matches the previously inferred sequence. Full hotspot activity requires an effective sequence length of 9.5 bp, whereas moderate activity requires an effective sequence length of approximately 8.2 bp and shows significant association with DSB hotspots. In combination with our previous work, this result is consistent with a large number of different sequence motifs capable of producing recombination hotspots, and supports a model in which hotspots can be rapidly regenerated by mutation as they are lost through recombination.

Feature Selection and the Class Imbalance Problem in Predicting Protein Function from Sequence

NARCIS (Netherlands)

Al-Shahib, A.; Breitling, R.; Gilbert, D.

2005-01-01

Abstract: When the standard approach to predict protein function by sequence homology fails, other alternative methods can be used that require only the amino acid sequence for predicting function. One such approach uses machine learning to predict protein function directly from amino acid sequence

Homologous Recombination—Experimental Systems, Analysis and Significance

Science.gov (United States)

Kuzminov, Andrei

2014-01-01

Homologous recombination is the most complex of all recombination events that shape genomes and produce material for evolution. Homologous recombination events are exchanges between DNA molecules in the lengthy regions of shared identity, catalyzed by a group of dedicated enzymes. There is a variety of experimental systems in E. coli and Salmonella to detect homologous recombination events of several different kinds. Genetic analysis of homologous recombination reveals three separate phases of this process: pre-synapsis (the early phase), synapsis (homologous strand exchange) and post-synapsis (the late phase). In E. coli, there are at least two independent pathway of the early phase and at least two independent pathways of the late phase. All this complexity is incongruent with the originally ascribed role of homologous recombination as accelerator of genome evolution: there is simply not enough duplication and repetition in enterobacterial genomes for homologous recombination to have a detectable evolutionary role, and therefore not enough selection to maintain such a complexity. At the same time, the mechanisms of homologous recombination are uniquely suited for repair of complex DNA lesions called chromosomal lesions. In fact, the two major classes of chromosomal lesions are recognized and processed by the two individual pathways at the early phase of homologous recombination. It follows, therefore, that homologous recombination events are occasional reflections of the continual recombinational repair, made possible in cases of natural or artificial genome redundancy. PMID:26442506

Comparative analysis of the prion protein gene sequences in African lion.

Science.gov (United States)

Wu, Chang-De; Pang, Wan-Yong; Zhao, De-Ming

2006-10-01

The prion protein gene of African lion (Panthera Leo) was first cloned and polymorphisms screened. The results suggest that the prion protein gene of eight African lions is highly homogenous. The amino acid sequences of the prion protein (PrP) of all samples tested were identical. Four single nucleotide polymorphisms (C42T, C81A, C420T, T600C) in the prion protein gene (Prnp) of African lion were found, but no amino acid substitutions. Sequence analysis showed that the higher homology is observed to felis catus AF003087 (96.7%) and to sheep number M31313.1 (96.2%) Genbank accessed. With respect to all the mammalian prion protein sequences compared, the African lion prion protein sequence has three amino acid substitutions. The homology might in turn affect the potential intermolecular interactions critical for cross species transmission of prion disease.

A PHF8 homolog in C. elegans promotes DNA repair via homologous recombination.

Directory of Open Access Journals (Sweden)

Changrim Lee

Full Text Available PHF8 is a JmjC domain-containing histone demethylase, defects in which are associated with X-linked mental retardation. In this study, we examined the roles of two PHF8 homologs, JMJD-1.1 and JMJD-1.2, in the model organism C. elegans in response to DNA damage. A deletion mutation in either of the genes led to hypersensitivity to interstrand DNA crosslinks (ICLs, while only mutation of jmjd-1.1 resulted in hypersensitivity to double-strand DNA breaks (DSBs. In response to ICLs, JMJD-1.1 did not affect the focus formation of FCD-2, a homolog of FANCD2, a key protein in the Fanconi anemia pathway. However, the dynamic behavior of RPA-1 and RAD-51 was affected by the mutation: the accumulations of both proteins at ICLs appeared normal, but their subsequent disappearance was retarded, suggesting that later steps of homologous recombination were defective. Similar changes in the dynamic behavior of RPA-1 and RAD-51 were seen in response to DSBs, supporting a role of JMJD-1.1 in homologous recombination. Such a role was also supported by our finding that the hypersensitivity of jmjd-1.1 worms to ICLs was rescued by knockdown of lig-4, a homolog of Ligase 4 active in nonhomologous end-joining. The hypersensitivity of jmjd-1.1 worms to ICLs was increased by rad-54 knockdown, suggesting that JMJD-1.1 acts in parallel with RAD-54 in modulating chromatin structure. Indeed, the level of histone H3 Lys9 tri-methylation, a marker of heterochromatin, was higher in jmjd-1.1 cells than in wild-type cells. We conclude that the histone demethylase JMJD-1.1 influences homologous recombination either by relaxing heterochromatin structure or by indirectly regulating the expression of multiple genes affecting DNA repair.

Using SQL Databases for Sequence Similarity Searching and Analysis.

Science.gov (United States)

Pearson, William R; Mackey, Aaron J

2017-09-13

Relational databases can integrate diverse types of information and manage large sets of similarity search results, greatly simplifying genome-scale analyses. By focusing on taxonomic subsets of sequences, relational databases can reduce the size and redundancy of sequence libraries and improve the statistical significance of homologs. In addition, by loading similarity search results into a relational database, it becomes possible to explore and summarize the relationships between all of the proteins in an organism and those in other biological kingdoms. This unit describes how to use relational databases to improve the efficiency of sequence similarity searching and demonstrates various large-scale genomic analyses of homology-related data. It also describes the installation and use of a simple protein sequence database, seqdb_demo, which is used as a basis for the other protocols. The unit also introduces search_demo, a database that stores sequence similarity search results. The search_demo database is then used to explore the evolutionary relationships between E. coli proteins and proteins in other organisms in a large-scale comparative genomic analysis. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

Phylo-mLogo: an interactive and hierarchical multiple-logo visualization tool for alignment of many sequences

Directory of Open Access Journals (Sweden)

Lee DT

2007-02-01

Full Text Available Abstract Background When aligning several hundreds or thousands of sequences, such as epidemic virus sequences or homologous/orthologous sequences of some big gene families, to reconstruct the epidemiological history or their phylogenies, how to analyze and visualize the alignment results of many sequences has become a new challenge for computational biologists. Although there are several tools available for visualization of very long sequence alignments, few of them are applicable to the alignments of many sequences. Results A multiple-logo alignment visualization tool, called Phylo-mLogo, is presented in this paper. Phylo-mLogo calculates the variabilities and homogeneities of alignment sequences by base frequencies or entropies. Different from the traditional representations of sequence logos, Phylo-mLogo not only displays the global logo patterns of the whole alignment of multiple sequences, but also demonstrates their local homologous logos for each clade hierarchically. In addition, Phylo-mLogo also allows the user to focus only on the analysis of some important, structurally or functionally constrained sites in the alignment selected by the user or by built-in automatic calculation. Conclusion With Phylo-mLogo, the user can symbolically and hierarchically visualize hundreds of aligned sequences simultaneously and easily check the changes of their amino acid sites when analyzing many homologous/orthologous or influenza virus sequences. More information of Phylo-mLogo can be found at URL http://biocomp.iis.sinica.edu.tw/phylomlogo.

Complete cDNA sequence of human complement C1s and close physical linkage of the homologous genes C1s and C1r

International Nuclear Information System (INIS)

Tosi, M.; Duponchel, C.; Meo, T.; Julier, C.

1987-01-01

Overlapping molecular clones encoding the complement subcomponent C1s were isolated from a human liver cDNA library. The nucleotide sequence reconstructed from these clones spans about 85% of the length of the liver C1s messenger RNAs, which occur in three distinct size classes around 3 kilobases in length. Comparisons with the sequence of C1r, the other enzymatic subcomponent of C1, reveal 40% amino acid identity and conservation of all the cysteine residues. Beside the serine protease domain, the following sequence motifs, previously described in C1r, were also found in C1s: (a) two repeats of the type found in the Ba fragment of complement factor B and in several other complement but also noncomplement proteins, (b) a cysteine-rich segment homologous to the repeats of epidermal growth factor precursor, and (c) a duplicated segment found only in C1r and C1s. Differences in each of these structural motifs provide significant clues for the interpretation of the functional divergence of these interacting serine protease zymogens. Hybridizations of C1r and C1s probes to restriction endonuclease fragments of genomic DNA demonstrate close physical linkage of the corresponding genes. The implications of this finding are discussed with respect to the evolution of C1r and C1s after their origin by tandem gene duplication and to the previously observed combined hereditary deficiencies of Clr and Cls

Using relational databases for improved sequence similarity searching and large-scale genomic analyses.

Science.gov (United States)

Mackey, Aaron J; Pearson, William R

2004-10-01

Relational databases are designed to integrate diverse types of information and manage large sets of search results, greatly simplifying genome-scale analyses. Relational databases are essential for management and analysis of large-scale sequence analyses, and can also be used to improve the statistical significance of similarity searches by focusing on subsets of sequence libraries most likely to contain homologs. This unit describes using relational databases to improve the efficiency of sequence similarity searching and to demonstrate various large-scale genomic analyses of homology-related data. This unit describes the installation and use of a simple protein sequence database, seqdb_demo, which is used as a basis for the other protocols. These include basic use of the database to generate a novel sequence library subset, how to extend and use seqdb_demo for the storage of sequence similarity search results and making use of various kinds of stored search results to address aspects of comparative genomic analysis.

Lectures on homology with internal symmetries

International Nuclear Information System (INIS)

Solovyov, Yu.

1993-09-01

Homology with internal symmetries is a natural generalization of cyclic homology introduced, independently, by Connes and Tsygan, which has turned out to be a very useful tool in a number of problems of algebra, geometry topology, analysis and mathematical physics. It suffices to say cycling homology and cohomology are successfully applied in the index theory of elliptic operators on foliations, in the description of the homotopy type of pseudoisotopy spaces, in the theory of characteristic classes in algebraic K-theory. They are also applied in noncommutative differential geometry and in the cohomology of Lie algebras, the branches of mathematics which brought them to life in the first place. Essentially, we consider dihedral homology, which was successfully applied for the description of the homology type of groups of homeomorphisms and diffeomorphisms of simply connected manifolds. (author). 27 refs

Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

Science.gov (United States)

Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

1991-02-15

The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

Improving model construction of profile HMMs for remote homology detection through structural alignment

Directory of Open Access Journals (Sweden)

Zaverucha Gerson

2007-11-01

Full Text Available Abstract Background Remote homology detection is a challenging problem in Bioinformatics. Arguably, profile Hidden Markov Models (pHMMs are one of the most successful approaches in addressing this important problem. pHMM packages present a relatively small computational cost, and perform particularly well at recognizing remote homologies. This raises the question of whether structural alignments could impact the performance of pHMMs trained from proteins in the Twilight Zone, as structural alignments are often more accurate than sequence alignments at identifying motifs and functional residues. Next, we assess the impact of using structural alignments in pHMM performance. Results We used the SCOP database to perform our experiments. Structural alignments were obtained using the 3DCOFFEE and MAMMOTH-mult tools; sequence alignments were obtained using CLUSTALW, TCOFFEE, MAFFT and PROBCONS. We performed leave-one-family-out cross-validation over super-families. Performance was evaluated through ROC curves and paired two tailed t-test. Conclusion We observed that pHMMs derived from structural alignments performed significantly better than pHMMs derived from sequence alignment in low-identity regions, mainly below 20%. We believe this is because structural alignment tools are better at focusing on the important patterns that are more often conserved through evolution, resulting in higher quality pHMMs. On the other hand, sensitivity of these tools is still quite low for these low-identity regions. Our results suggest a number of possible directions for improvements in this area.

Improving model construction of profile HMMs for remote homology detection through structural alignment.

Science.gov (United States)

Bernardes, Juliana S; Dávila, Alberto M R; Costa, Vítor S; Zaverucha, Gerson

2007-11-09

Remote homology detection is a challenging problem in Bioinformatics. Arguably, profile Hidden Markov Models (pHMMs) are one of the most successful approaches in addressing this important problem. pHMM packages present a relatively small computational cost, and perform particularly well at recognizing remote homologies. This raises the question of whether structural alignments could impact the performance of pHMMs trained from proteins in the Twilight Zone, as structural alignments are often more accurate than sequence alignments at identifying motifs and functional residues. Next, we assess the impact of using structural alignments in pHMM performance. We used the SCOP database to perform our experiments. Structural alignments were obtained using the 3DCOFFEE and MAMMOTH-mult tools; sequence alignments were obtained using CLUSTALW, TCOFFEE, MAFFT and PROBCONS. We performed leave-one-family-out cross-validation over super-families. Performance was evaluated through ROC curves and paired two tailed t-test. We observed that pHMMs derived from structural alignments performed significantly better than pHMMs derived from sequence alignment in low-identity regions, mainly below 20%. We believe this is because structural alignment tools are better at focusing on the important patterns that are more often conserved through evolution, resulting in higher quality pHMMs. On the other hand, sensitivity of these tools is still quite low for these low-identity regions. Our results suggest a number of possible directions for improvements in this area.

Compositional Homology and Creative Thinking

Directory of Open Access Journals (Sweden)

Salvatore Tedesco

2015-05-01

Full Text Available The concept of homology is the most solid theoretical basis elaborated by the morphological thinking during its history. The enucleation of some general criteria for the interpretation of homology is today a fundamental tool for life sciences, and for restoring their own opening to the question of qualitative innovation that arose so powerfully in the original Darwinian project. The aim of this paper is to verify the possible uses of the concept of compositional homology in order to provide of an adequate understanding of the dynamics of creative thinking.

Rational Homological Stability for Automorphisms of Manifolds

DEFF Research Database (Denmark)

Grey, Matthias

In this thesis we prove rational homological stability for the classifying spaces of the homotopy automorphisms and block di↵eomorphisms of iterated connected sums of products of spheres of a certain connectivity.The results in particular apply to the manifolds       Npg,q  = (#g(Sp x Sq)) - int...... with coefficients in the homology of the universal covering, which is studied using rational homology theory. The result for the block di↵eomorphisms is deduced from the homological stability for the homotopy automorphisms upon using Surgery theory. Themain theorems of this thesis extend the homological stability...

Homologous gene targeting of a carotenoids biosynthetic gene in Rhodosporidium toruloides by Agrobacterium-mediated transformation.

Science.gov (United States)

Sun, Wenyi; Yang, Xiaobing; Wang, Xueying; Lin, Xinping; Wang, Yanan; Zhang, Sufang; Luan, Yushi; Zhao, Zongbao K

2017-07-01

To target a carotenoid biosynthetic gene in the oleaginous yeast Rhodosporidium toruloides by using the Agrobacterium-mediated transformation (AMT) method. The RHTO_04602 locus of R. toruloides NP11, previously assigned to code the carotenoid biosynthetic gene CRTI, was amplified from genomic DNA and cloned into the binary plasmid pZPK-mcs, resulting in pZPK-CRT. A HYG-expression cassette was inserted into the CRTI sequence of pZPK-CRT by utilizing the restriction-free clone strategy. The resulted plasmid was used to transform R. toruloides cells according to the AMT method, leading to a few white transformants. Sequencing analysis of those transformants confirmed homologous recombination and insertional inactivation of CRTI. When the white variants were transformed with a CRTI-expression cassette, cells became red and produced carotenoids as did the wild-type strain NP11. Successful homologous targeting of the CrtI locus confirmed the function of RHTO_04602 in carotenoids biosynthesis in R. toruloides. It provided valuable information for metabolic engineering of this non-model yeast species.

De novo assembly of a 40 Mb eukaryotic genome from short sequence reads: Sordaria macrospora, a model organism for fungal morphogenesis.

Science.gov (United States)

Nowrousian, Minou; Stajich, Jason E; Chu, Meiling; Engh, Ines; Espagne, Eric; Halliday, Karen; Kamerewerd, Jens; Kempken, Frank; Knab, Birgit; Kuo, Hsiao-Che; Osiewacz, Heinz D; Pöggeler, Stefanie; Read, Nick D; Seiler, Stephan; Smith, Kristina M; Zickler, Denise; Kück, Ulrich; Freitag, Michael

2010-04-08

Filamentous fungi are of great importance in ecology, agriculture, medicine, and biotechnology. Thus, it is not surprising that genomes for more than 100 filamentous fungi have been sequenced, most of them by Sanger sequencing. While next-generation sequencing techniques have revolutionized genome resequencing, e.g. for strain comparisons, genetic mapping, or transcriptome and ChIP analyses, de novo assembly of eukaryotic genomes still presents significant hurdles, because of their large size and stretches of repetitive sequences. Filamentous fungi contain few repetitive regions in their 30-90 Mb genomes and thus are suitable candidates to test de novo genome assembly from short sequence reads. Here, we present a high-quality draft sequence of the Sordaria macrospora genome that was obtained by a combination of Illumina/Solexa and Roche/454 sequencing. Paired-end Solexa sequencing of genomic DNA to 85-fold coverage and an additional 10-fold coverage by single-end 454 sequencing resulted in approximately 4 Gb of DNA sequence. Reads were assembled to a 40 Mb draft version (N50 of 117 kb) with the Velvet assembler. Comparative analysis with Neurospora genomes increased the N50 to 498 kb. The S. macrospora genome contains even fewer repeat regions than its closest sequenced relative, Neurospora crassa. Comparison with genomes of other fungi showed that S. macrospora, a model organism for morphogenesis and meiosis, harbors duplications of several genes involved in self/nonself-recognition. Furthermore, S. macrospora contains more polyketide biosynthesis genes than N. crassa. Phylogenetic analyses suggest that some of these genes may have been acquired by horizontal gene transfer from a distantly related ascomycete group. Our study shows that, for typical filamentous fungi, de novo assembly of genomes from short sequence reads alone is feasible, that a mixture of Solexa and 454 sequencing substantially improves the assembly, and that the resulting data can be used for

De novo assembly of a 40 Mb eukaryotic genome from short sequence reads: Sordaria macrospora, a model organism for fungal morphogenesis.

Directory of Open Access Journals (Sweden)

Minou Nowrousian

2010-04-01

Full Text Available Filamentous fungi are of great importance in ecology, agriculture, medicine, and biotechnology. Thus, it is not surprising that genomes for more than 100 filamentous fungi have been sequenced, most of them by Sanger sequencing. While next-generation sequencing techniques have revolutionized genome resequencing, e.g. for strain comparisons, genetic mapping, or transcriptome and ChIP analyses, de novo assembly of eukaryotic genomes still presents significant hurdles, because of their large size and stretches of repetitive sequences. Filamentous fungi contain few repetitive regions in their 30-90 Mb genomes and thus are suitable candidates to test de novo genome assembly from short sequence reads. Here, we present a high-quality draft sequence of the Sordaria macrospora genome that was obtained by a combination of Illumina/Solexa and Roche/454 sequencing. Paired-end Solexa sequencing of genomic DNA to 85-fold coverage and an additional 10-fold coverage by single-end 454 sequencing resulted in approximately 4 Gb of DNA sequence. Reads were assembled to a 40 Mb draft version (N50 of 117 kb with the Velvet assembler. Comparative analysis with Neurospora genomes increased the N50 to 498 kb. The S. macrospora genome contains even fewer repeat regions than its closest sequenced relative, Neurospora crassa. Comparison with genomes of other fungi showed that S. macrospora, a model organism for morphogenesis and meiosis, harbors duplications of several genes involved in self/nonself-recognition. Furthermore, S. macrospora contains more polyketide biosynthesis genes than N. crassa. Phylogenetic analyses suggest that some of these genes may have been acquired by horizontal gene transfer from a distantly related ascomycete group. Our study shows that, for typical filamentous fungi, de novo assembly of genomes from short sequence reads alone is feasible, that a mixture of Solexa and 454 sequencing substantially improves the assembly, and that the resulting data

Isolation of Specific Clones from Nonarrayed BAC Libraries through Homologous Recombination

Directory of Open Access Journals (Sweden)

Mikhail Nefedov

2011-01-01

Full Text Available We have developed a new approach to screen bacterial artificial chromosome (BAC libraries by recombination selection. To test this method, we constructed an orangutan BAC library using an E. coli strain (DY380 with temperature inducible homologous recombination (HR capability. We amplified one library segment, induced HR at 42∘C to make it recombination proficient, and prepared electrocompetent cells for transformation with a kanamycin cassette to target sequences in the orangutan genome through terminal recombineering homologies. Kanamycin-resistant colonies were tested for the presence of BACs containing the targeted genes by the use of a PCR-assay to confirm the presence of the kanamycin insertion. The results indicate that this is an effective approach for screening clones. The advantage of recombination screening is that it avoids the high costs associated with the preparation, screening, and archival storage of arrayed BAC libraries. In addition, the screening can be conceivably combined with genetic engineering to create knockout and reporter constructs for functional studies.

In vivo blunt-end cloning through CRISPR/Cas9-facilitated non-homologous end-joining

Science.gov (United States)

Geisinger, Jonathan M.; Turan, Sören; Hernandez, Sophia; Spector, Laura P.; Calos, Michele P.

2016-01-01

The CRISPR/Cas9 system facilitates precise DNA modifications by generating RNA-guided blunt-ended double-strand breaks. We demonstrate that guide RNA pairs generate deletions that are repaired with a high level of precision by non-homologous end-joining in mammalian cells. We present a method called knock-in blunt ligation for exploiting these breaks to insert exogenous PCR-generated sequences in a homology-independent manner without loss of additional nucleotides. This method is useful for making precise additions to the genome such as insertions of marker gene cassettes or functional elements, without the need for homology arms. We successfully utilized this method in human and mouse cells to insert fluorescent protein cassettes into various loci, with efficiencies up to 36% in HEK293 cells without selection. We also created versions of Cas9 fused to the FKBP12-L106P destabilization domain in an effort to improve Cas9 performance. Our in vivo blunt-end cloning method and destabilization-domain-fused Cas9 variant increase the repertoire of precision genome engineering approaches. PMID:26762978

Discovery of Escherichia coli CRISPR sequences in an undergraduate laboratory.

Science.gov (United States)

Militello, Kevin T; Lazatin, Justine C

2017-05-01

Clustered regularly interspaced short palindromic repeats (CRISPRs) represent a novel type of adaptive immune system found in eubacteria and archaebacteria. CRISPRs have recently generated a lot of attention due to their unique ability to catalog foreign nucleic acids, their ability to destroy foreign nucleic acids in a mechanism that shares some similarity to RNA interference, and the ability to utilize reconstituted CRISPR systems for genome editing in numerous organisms. In order to introduce CRISPR biology into an undergraduate upper-level laboratory, a five-week set of exercises was designed to allow students to examine the CRISPR status of uncharacterized Escherichia coli strains and to allow the discovery of new repeats and spacers. Students started the project by isolating genomic DNA from E. coli and amplifying the iap CRISPR locus using the polymerase chain reaction (PCR). The PCR products were analyzed by Sanger DNA sequencing, and the sequences were examined for the presence of CRISPR repeat sequences. The regions between the repeats, the spacers, were extracted and analyzed with BLASTN searches. Overall, CRISPR loci were sequenced from several previously uncharacterized E. coli strains and one E. coli K-12 strain. Sanger DNA sequencing resulted in the discovery of 36 spacer sequences and their corresponding surrounding repeat sequences. Five of the spacers were homologous to foreign (non-E. coli) DNA. Assessment of the laboratory indicates that improvements were made in the ability of students to answer questions relating to the structure and function of CRISPRs. Future directions of the laboratory are presented and discussed. © 2016 by The International Union of Biochemistry and Molecular Biology, 45(3):262-269, 2017. © 2016 The International Union of Biochemistry and Molecular Biology.

The polymorphic integumentary mucin B.1 from Xenopus laevis contains the short consensus repeat.

Science.gov (United States)

Probst, J C; Hauser, F; Joba, W; Hoffmann, W

1992-03-25

The frog integumentary mucin B.1 (FIM-B.1), discovered by molecular cloning, contains a cysteine-rich C-terminal domain which is homologous with von Willebrand factor. With the help of the polymerase chain reaction, we now characterize a contiguous region 5' to the von Willebrand factor domain containing the short consensus repeat typical of many proteins from the complement system. Multiple transcripts have been cloned, which originate from a single animal and differ by a variable number of tandem repeats (rep-33 sequences). These different transcripts probably originate solely from two genes and are generated presumably by alternative splicing of an huge array of functional cassettes. This model is supported by analysis of genomic FIM-B.1 sequences from Xenopus laevis. Here, rep-33 sequences are arranged in an interrupted array of individual units. Additionally, results of Southern analysis revealed genetic polymorphism between different animals which is predicted to be within the tandem repeats. A first investigation of the predicted mucins with the help of a specific antibody against a synthetic peptide determined the molecular mass of FIM-B.1 to greater than 200 kDa. Here again, genetic polymorphism between different animals is detected.

Evolution of pH buffers and water homeostasis in eukaryotes: homology between humans and Acanthamoeba proteins.

Science.gov (United States)

Baig, Abdul M; Zohaib, R; Tariq, S; Ahmad, H R

2018-02-01

This study intended to trace the evolution of acid-base buffers and water homeostasis in eukaryotes. Acanthamoeba castellanii  was selected as a model unicellular eukaryote for this purpose. Homologies of proteins involved in pH and water regulatory mechanisms at cellular levels were compared between humans and A. castellanii. Amino acid sequence homology, structural homology, 3D modeling and docking prediction were done to show the extent of similarities between carbonic anhydrase 1 (CA1), aquaporin (AQP), band-3 protein and H + pump. Experimental assays were done with acetazolamide (AZM), brinzolamide and mannitol to observe their effects on the trophozoites of  A. castellanii.  The human CA1, AQP, band-3 protein and H + -transport proteins revealed similar proteins in Acanthamoeba. Docking showed the binding of AZM on amoebal AQP-like proteins.  Acanthamoeba showed transient shape changes and encystation at differential doses of brinzolamide, mannitol and AZM.  Conclusion: Water and pH regulating adapter proteins in Acanthamoeba and humans show significant homology, these mechanisms evolved early in the primitive unicellular eukaryotes and have remained conserved in multicellular eukaryotes.

Principles of Long Noncoding RNA Evolution Derived from Direct Comparison of Transcriptomes in 17 Species

Directory of Open Access Journals (Sweden)

Hadas Hezroni

2015-05-01

Full Text Available The inability to predict long noncoding RNAs from genomic sequence has impeded the use of comparative genomics for studying their biology. Here, we develop methods that use RNA sequencing (RNA-seq data to annotate the transcriptomes of 16 vertebrates and the echinoid sea urchin, uncovering thousands of previously unannotated genes, most of which produce long intervening noncoding RNAs (lincRNAs. Although in each species, >70% of lincRNAs cannot be traced to homologs in species that diverged >50 million years ago, thousands of human lincRNAs have homologs with similar expression patterns in other species. These homologs share short, 5′-biased patches of sequence conservation nested in exonic architectures that have been extensively rewired, in part by transposable element exonization. Thus, over a thousand human lincRNAs are likely to have conserved functions in mammals, and hundreds beyond mammals, but those functions require only short patches of specific sequences and can tolerate major changes in gene architecture.

Homology in Electromagnetic Boundary Value Problems

Directory of Open Access Journals (Sweden)

Pellikka Matti

2010-01-01

Full Text Available We discuss how homology computation can be exploited in computational electromagnetism. We represent various cellular mesh reduction techniques, which enable the computation of generators of homology spaces in an acceptable time. Furthermore, we show how the generators can be used for setting up and analysis of an electromagnetic boundary value problem. The aim is to provide a rationale for homology computation in electromagnetic modeling software.

The complete genome sequence and proteomics of Yersinia pestis phage Yep-phi.

Science.gov (United States)

Zhao, Xiangna; Wu, Weili; Qi, Zhizhen; Cui, Yujun; Yan, Yanfeng; Guo, Zhaobiao; Wang, Zuyun; Wang, Hu; Deng, Haijun; Xue, Yan; Chen, Weijun; Wang, Xiaoyi; Yang, Ruifu

2011-01-01

Yep-phi, a lytic phage of Yersinia pestis, was isolated in China and is routinely used as a diagnostic phage for the identification of the plague pathogen. Yep-phi has an isometric hexagonal head containing dsDNA and a short non-contractile conical tail. In this study, we sequenced the Yep-phi genome (GenBank accession no. HQ333270) and performed proteomics analysis. The genome consists of 38 ,616 bp of DNA, including direct terminal repeats of 222 bp, and is predicted to contain 45 ORFs. Most structural proteins were identified by proteomics analysis. Compared with the three available genome sequences of lytic phages for Y. pestis, the phages could be divided into two subgroups. Yep-phi displays marked homology to the bacteriophages Berlin (GenBank accession no. AM183667) and Yepe2 (GenBank accession no. EU734170), and these comprise one subgroup. The other subgroup is represented by bacteriophage ΦA1122 (GenBank accession no. AY247822). Potential recombination was detected among the Yep-phi subgroup.

[Cloning and sequencing of the papA gene from uropathogenic Escherichia coli 4030 strain].

Science.gov (United States)

Wu, Qinggang; Zhang, Jingping; Zhao, Chuncheng; Zhu, Jianguo

2008-09-01

Cloning and sequencing of the papA gene from uropathogenic Escherichia coli 4030 strain to investigate the differences of the sequences of the papA of UPEC4030 strain and the ones of related genes, in order to make whether or not it was a new genotype. Cloning and sequencing methods were used to analyze the sequence of the papA of UPEC4030 strain in comparison with related sequences. The sequence analysis of papA revealed a 722 bp gene and encode 192 amino acid polypeptide. The overall homology of the papA genes between UPEC4030 and the standard strains of ten F types were 36.11%-77.95% and 22.20%-78.34% at nucleotide and deduced amino acid levels. The homology between the sequence of the reverse primers and the corresponding sequence of UPEC4030 papA was 10%-66.67%. The results confirmed that UPEC4030 strain contained a novel papA variant. UPEC4030 strain could contain an unknown papA variant or the novel genotype. The pathogenic mechanism and epidemiology related need to be further studied.

Third-Generation Sequencing and Analysis of Four Complete Pig Liver Esterase Gene Sequences in Clones Identified by Screening BAC Library.

Science.gov (United States)

Zhou, Qiongqiong; Sun, Wenjuan; Liu, Xiyan; Wang, Xiliang; Xiao, Yuncai; Bi, Dingren; Yin, Jingdong; Shi, Deshi

2016-01-01

Pig liver carboxylesterase (PLE) gene sequences in GenBank are incomplete, which has led to difficulties in studying the genetic structure and regulation mechanisms of gene expression of PLE family genes. The aim of this study was to obtain and analysis of complete gene sequences of PLE family by screening from a Rongchang pig BAC library and third-generation PacBio gene sequencing. After a number of existing incomplete PLE isoform gene sequences were analysed, primers were designed based on conserved regions in PLE exons, and the whole pig genome used as a template for Polymerase chain reaction (PCR) amplification. Specific primers were then selected based on the PCR amplification results. A three-step PCR screening method was used to identify PLE-positive clones by screening a Rongchang pig BAC library and PacBio third-generation sequencing was performed. BLAST comparisons and other bioinformatics methods were applied for sequence analysis. Five PLE-positive BAC clones, designated BAC-10, BAC-70, BAC-75, BAC-119 and BAC-206, were identified. Sequence analysis yielded the complete sequences of four PLE genes, PLE1, PLE-B9, PLE-C4, and PLE-G2. Complete PLE gene sequences were defined as those containing regulatory sequences, exons, and introns. It was found that, not only did the PLE exon sequences of the four genes show a high degree of homology, but also that the intron sequences were highly similar. Additionally, the regulatory region of the genes contained two 720bps reverse complement sequences that may have an important function in the regulation of PLE gene expression. This is the first report to confirm the complete sequences of four PLE genes. In addition, the study demonstrates that each PLE isoform is encoded by a single gene and that the various genes exhibit a high degree of sequence homology, suggesting that the PLE family evolved from a single ancestral gene. Obtaining the complete sequences of these PLE genes provides the necessary foundation for

The genomic sequence of the Chinese hamster ovary (CHO)-K1 cell line

DEFF Research Database (Denmark)

Xu, Xun; Pan, Shengkai; Liu, Xin

2011-01-01

Chinese hamster ovary (CHO)-derived cell lines are the preferred host cells for the production of therapeutic proteins. Here we present a draft genomic sequence of the CHO-K1 ancestral cell line. The assembly comprises 2.45 Gb of genomic sequence, with 24,383 predicted genes. We associate most....... Homologs of most human glycosylation-associated genes are present in the CHO-K1 genome, although 141 of these homologs are not expressed under exponential growth conditions. Many important viral entry genes are also present in the genome but not expressed, which may explain the unusual viral resistance...... property of CHO cell lines. We discuss how the availability of this genome sequence may facilitate genome-scale science for the optimization of biopharmaceutical protein production....

An aureobasidin A resistance gene isolated from Aspergillus is a homolog of yeast AUR1, a gene responsible for inositol phosphorylceramide (IPC) synthase activity.

Science.gov (United States)

Kuroda, M; Hashida-Okado, T; Yasumoto, R; Gomi, K; Kato, I; Takesako, K

1999-03-01

The AUR1 gene of Saccharomyces cerevisiae, mutations in which confer resistance to the antibiotic aureobasidin A, is necessary for inositol phosphorylceramide (IPC) synthase activity. We report the molecular cloning and characterization of the Aspergillus nidulans aurA gene, which is homologous to AUR1. A single point mutation in the aurA gene of A. nidulans confers a high level of resistance to aureobasidin A. The A. nidulans aurA gene was used to identify its homologs in other Aspergillus species, including A. fumigatus, A. niger, and A. oryzae. The deduced amino acid sequence of an aurA homolog from the pathogenic fungus A. fumigatus showed 87% identity to that of A. nidulans. The AurA proteins of A. nidulans and A. fumigatus shared common characteristics in primary structure, including sequence, hydropathy profile, and N-glycosylation sites, with their S. cerevisiae, Schizosaccharomyces pombe, and Candida albicans counterparts. These results suggest that the aureobasidin resistance gene is conserved evolutionarily in various fungi.

Homologous series of induced early mutants in indican rice. Pt.1. The production of homologous series of early mutants

International Nuclear Information System (INIS)

Chen Xiulan; Yang Hefeng; He Zhentian; Han Yuepeng; Liu Xueyu

1999-01-01

The percentage of homologous series of early mutants induced from the same Indican rice variety were almost the same (1.37%∼1.64%) in 1983∼1993, but the ones from the different eco-typical varieties were different. The early variety was 0.73%, the mid variety was 1.51%, and the late variety was 1.97%. The percentage of homologous series of early mutants from the varieties with the same pedigree and relationship were similar, but the one from the cog nation were lower than those from distant varieties. There are basic laws and characters in the homologous series of early mutants: 1. The inhibited phenotype is the basic of the homologous series of early mutants; 2. The production of the homologous series of early mutants is closely related with the growing period of the parent; 3. The parallel mutation of the stem and leaves are simultaneously happened with the variation of early or late maturing; 4. The occurrence of the homologous series of early mutants is in a state of imbalance. According to the law of parallel variability, the production of homologous series of early mutants can be predicted as long as the parents' classification of plant, pedigree and ecological type are identified. Therefore, the early breeding can be guided by the law of homologous series of early mutants

Two tandemly repeated telomere-associated sequences in Nicotiana plumbaginifolia.

Science.gov (United States)

Chen, C M; Wang, C T; Wang, C J; Ho, C H; Kao, Y Y; Chen, C C

1997-12-01

Two tandemly repeated telomere-associated sequences, NP3R and NP4R, have been isolated from Nicotiana plumbaginifolia. The length of a repeating unit for NP3R and NP4R is 165 and 180 nucleotides respectively. The abundance of NP3R, NP4R and telomeric repeats is, respectively, 8.4 x 10(4), 6 x 10(3) and 1.5 x 10(6) copies per haploid genome of N. plumbaginifolia. Fluorescence in situ hybridization revealed that NP3R is located at the ends and/or in interstitial regions of all 10 chromosomes and NP4R on the terminal regions of three chromosomes in the haploid genome of N. plumbaginifolia. Sequence homology search revealed that not only are NP3R and NP4R homologous to HRS60 and GRS, respectively, two tandem repeats isolated from N. tabacum, but that NP3R and NP4R are also related to each other, suggesting that they originated from a common ancestral sequence. The role of these repeated sequences in chromosome healing is discussed based on the observation that two to three copies of a telomere-similar sequence were present in each repeating unit of NP3R and NP4R.

DNA Barcoding: Amplification and sequence analysis of rbcl and matK genome regions in three divergent plant species

Directory of Open Access Journals (Sweden)

Javed Iqbal Wattoo

2016-11-01

Full Text Available Background: DNA barcoding is a novel method of species identification based on nucleotide diversity of conserved sequences. The establishment and refining of plant DNA barcoding systems is more challenging due to high genetic diversity among different species. Therefore, targeting the conserved nuclear transcribed regions would be more reliable for plant scientists to reveal genetic diversity, species discrimination and phylogeny. Methods: In this study, we amplified and sequenced the chloroplast DNA regions (matk+rbcl of Solanum nigrum, Euphorbia helioscopia and Dalbergia sissoo to study the functional annotation, homology modeling and sequence analysis to allow a more efficient utilization of these sequences among different plant species. These three species represent three families; Solanaceae, Euphorbiaceae and Fabaceae respectively. Biological sequence homology and divergence of amplified sequences was studied using Basic Local Alignment Tool (BLAST. Results: Both primers (matk+rbcl showed good amplification in three species. The sequenced regions reveled conserved genome information for future identification of different medicinal plants belonging to these species. The amplified conserved barcodes revealed different levels of biological homology after sequence analysis. The results clearly showed that the use of these conserved DNA sequences as barcode primers would be an accurate way for species identification and discrimination. Conclusion: The amplification and sequencing of conserved genome regions identified a novel sequence of matK in native species of Solanum nigrum. The findings of the study would be applicable in medicinal industry to establish DNA based identification of different medicinal plant species to monitor adulteration.

Tracing the Evolutionary History of the CAP Superfamily of Proteins Using Amino Acid Sequence Homology and Conservation of Splice Sites.

Science.gov (United States)

Abraham, Anup; Chandler, Douglas E

2017-10-01

Proteins of the CAP superfamily play numerous roles in reproduction, innate immune responses, cancer biology, and venom toxicology. Here we document the breadth of the CAP (Cysteine-RIch Secretory Protein (CRISP), Antigen 5, and Pathogenesis-Related) protein superfamily and trace the major events in its evolution using amino acid sequence homology and the positions of exon/intron borders within their genes. Seldom acknowledged in the literature, we find that many of the CAP subfamilies present in mammals, where they were originally characterized, have distinct homologues in the invertebrate phyla. Early eukaryotic CAP genes contained only one exon inherited from prokaryotic predecessors and as evolution progressed an increasing number of introns were inserted, reaching 2-5 in the invertebrate world and 5-15 in the vertebrate world. Focusing on the CRISP subfamily, we propose that these proteins evolved in three major steps: (1) origination of the CAP/PR/SCP domain in bacteria, (2) addition of a small Hinge domain to produce the two-domain SCP-like proteins found in roundworms and anthropoids, and (3) addition of an Ion Channel Regulatory domain, borrowed from invertebrate peptide toxins, to produce full length, three-domain CRISP proteins, first seen in insects and later to diversify into multiple subtypes in the vertebrate world.

Two human cDNA molecules coding for the Duchenne muscular dystrophy (DMD) locus are highly homologous

Energy Technology Data Exchange (ETDEWEB)

Rosenthal, A.; Speer, A.; Billwitz, H. (Zentralinstitut fuer Molekularbiologie, Berlin-Buch (Germany Democratic Republic)); Cross, G.S.; Forrest, S.M.; Davies, K.E. (Univ. of Oxford (England))

1989-07-11

Recently the complete sequence of the human fetal cDNA coding for the Duchenne muscular dystrophy (DMD) locus was reported and a 3,685 amino acid long, rod-shaped cytoskeletal protein (dystrophin) was predicted as the protein product. Independently, the authors have isolated and sequenced different DMD cDNA molecules from human adult and fetal muscle. The complete 12.5 kb long sequence of all their cDNA clones has now been determined and they report here the nucleotide (nt) and amino acid (aa) differences between the sequences of both groups. The cDNA sequence comprises the whole coding region but lacks the first 110 nt from the 5{prime}-untranslated region and the last 1,417 nt of the 3{prime}-untranslated region. They have found 11 nt differences (approximately 99.9% homology) from which 7 occurred at the aa level.

Sequence Exchange between Homologous NB-LRR Genes Converts Virus Resistance into Nematode Resistance, and Vice Versa.

Science.gov (United States)

Slootweg, Erik; Koropacka, Kamila; Roosien, Jan; Dees, Robert; Overmars, Hein; Lankhorst, Rene Klein; van Schaik, Casper; Pomp, Rikus; Bouwman, Liesbeth; Helder, Johannes; Schots, Arjen; Bakker, Jaap; Smant, Geert; Goverse, Aska

2017-09-01

Plants have evolved a limited repertoire of NB-LRR disease resistance ( R ) genes to protect themselves against myriad pathogens. This limitation is thought to be counterbalanced by the rapid evolution of NB-LRR proteins, as only a few sequence changes have been shown to be sufficient to alter resistance specificities toward novel strains of a pathogen. However, little is known about the flexibility of NB-LRR R genes to switch resistance specificities between phylogenetically unrelated pathogens. To investigate this, we created domain swaps between the close homologs Gpa2 and Rx1 , which confer resistance in potato ( Solanum tuberosum ) to the cyst nematode Globodera pallida and Potato virus X , respectively. The genetic fusion of the CC-NB-ARC of Gpa2 with the LRR of Rx1 (Gpa2 CN /Rx1 L ) results in autoactivity, but lowering the protein levels restored its specific activation response, including extreme resistance to Potato virus X in potato shoots. The reciprocal chimera (Rx1 CN /Gpa2 L ) shows a loss-of-function phenotype, but exchange of the first three LRRs of Gpa2 by the corresponding region of Rx1 was sufficient to regain a wild-type resistance response to G. pallida in the roots. These data demonstrate that exchanging the recognition moiety in the LRR is sufficient to convert extreme virus resistance in the leaves into mild nematode resistance in the roots, and vice versa. In addition, we show that the CC-NB-ARC can operate independently of the recognition specificities defined by the LRR domain, either aboveground or belowground. These data show the versatility of NB-LRR genes to generate resistance to unrelated pathogens with completely different lifestyles and routes of invasion. © 2017 American Society of Plant Biologists. All Rights Reserved.

In vitro site selection of a consensus binding site for the Drosophila melanogaster Tbx20 homolog midline.

Directory of Open Access Journals (Sweden)

Nima Najand

Full Text Available We employed in vitro site selection to identify a consensus binding sequence for the Drosophila melanogaster Tbx20 T-box transcription factor homolog Midline. We purified a bacterially expressed T-box DNA binding domain of Midline, and used it in four rounds of precipitation and polymerase-chain-reaction based amplification. We cloned and sequenced 54 random oligonucleotides selected by Midline. Electromobility shift-assays confirmed that 27 of these could bind the Midline T-box. Sequence alignment of these 27 clones suggests that Midline binds as a monomer to a consensus sequence that contains an AGGTGT core. Thus, the Midline consensus binding site we define in this study is similar to that defined for vertebrate Tbx20, but differs from a previously reported Midline binding sequence derived through site selection.

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

Science.gov (United States)

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

Science.gov (United States)

Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

1987-01-01

Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

Site-specific integration in CHO cells mediated by CRISPR/Cas9 and homology-directed DNA repair pathway

DEFF Research Database (Denmark)

Lee, Jae Seong; Beuchert Kallehauge, Thomas; Pedersen, Lasse Ebdrup

2015-01-01

gene integration into site-specific loci in CHO cells using CRISPR/Cas9 genome editing system and compatible donor plasmid harboring a gene of interest (GOI) and short homology arms. This strategy has enabled precise insertion of a 3.7-kb gene expression cassette at defined loci in CHO cells following...

Selective anticancer activity of a hexapeptide with sequence homology to a non-kinase domain of Cyclin Dependent Kinase 4

Directory of Open Access Journals (Sweden)

Agarwala Usha

2011-06-01

Full Text Available Abstract Background Cyclin-dependent kinases 2, 4 and 6 (Cdk2, Cdk4, Cdk6 are closely structurally homologous proteins which are classically understood to control the transition from the G1 to the S-phases of the cell cycle by combining with their appropriate cyclin D or cyclin E partners to form kinase-active holoenzymes. Deregulation of Cdk4 is widespread in human cancer, CDK4 gene knockout is highly protective against chemical and oncogene-mediated epithelial carcinogenesis, despite the continued presence of CDK2 and CDK6; and overexpresssion of Cdk4 promotes skin carcinogenesis. Surprisingly, however, Cdk4 kinase inhibitors have not yet fulfilled their expectation as 'blockbuster' anticancer agents. Resistance to inhibition of Cdk4 kinase in some cases could potentially be due to a non-kinase activity, as recently reported with epidermal growth factor receptor. Results A search for a potential functional site of non-kinase activity present in Cdk4 but not Cdk2 or Cdk6 revealed a previously-unidentified loop on the outside of the C'-terminal non-kinase domain of Cdk4, containing a central amino-acid sequence, Pro-Arg-Gly-Pro-Arg-Pro (PRGPRP. An isolated hexapeptide with this sequence and its cyclic amphiphilic congeners are selectively lethal at high doses to a wide range of human cancer cell lines whilst sparing normal diploid keratinocytes and fibroblasts. Treated cancer cells do not exhibit the wide variability of dose response typically seen with other anticancer agents. Cancer cell killing by PRGPRP, in a cyclic amphiphilic cassette, requires cells to be in cycle but does not perturb cell cycle distribution and is accompanied by altered relative Cdk4/Cdk1 expression and selective decrease in ATP levels. Morphological features of apoptosis are absent and cancer cell death does not appear to involve autophagy. Conclusion These findings suggest a potential new paradigm for the development of broad-spectrum cancer specific therapeutics with

Homologous SV40 RNA trans-splicing: Special case or prime example of viral RNA trans-splicing?

Directory of Open Access Journals (Sweden)

Sushmita Poddar

2014-06-01

Full Text Available To date the Simian Virus 40 (SV40 is the only proven example of a virus that recruits the mechanism of RNA trans-splicing to diversify its sequences and gene products. Thereby, two identical viral transcripts are efficiently joined by homologous trans-splicing triggering the formation of a highly transforming 100 kDa super T antigen. Sequences of other viruses including HIV-1 and the human adenovirus type 5 were reported to be involved in heterologous trans-splicing towards cellular or viral sequences but the meaning of these events remains unclear. We computationally and experimentally investigated molecular features associated with viral RNA trans-splicing and identified a common pattern: Viral RNA trans-splicing occurs between strong cryptic or regular viral splice sites and strong regular or cryptic splice sites of the trans-splice partner sequences. The majority of these splice sites are supported by exonic splice enhancers. Splice sites that could compete with the trans-splicing sites for cis-splice reactions are weaker or inexistent. Finally, all but one of the trans-splice reactions seem to be facilitated by one or more complementary binding domains of 11 to 16 nucleotides in length which, however occur with a statistical probability close to one for the given length of the involved sequences. The chimeric RNAs generated via heterologous viral RNA trans-splicing either did not lead to fusion proteins or led to proteins of unknown function. Our data suggest that distinct viral RNAs are highly susceptible to trans-splicing and that heterologous viral trans-splicing, unlike homologous SV40 trans-splicing, represents a chance event.

Coding sequence of human rho cDNAs clone 6 and clone 9

Energy Technology Data Exchange (ETDEWEB)

Chardin, P; Madaule, P; Tavitian, A

1988-03-25

The authors have isolated human cDNAs including the complete coding sequence for two rho proteins corresponding to the incomplete isolates previously described as clone 6 and clone 9. The deduced a.a. sequences, when compared to the a.a. sequence deduced from clone 12 cDNA, show that there are in human at least three highly homologous rho genes. They suggest that clone 12 be named rhoA, clone 6 : rhoB and clone 9 : rhoC. RhoA, B and C proteins display approx. 30% a.a. identity with ras proteins,. mainly clustered in four highly homologous internal regions corresponding to the GTP binding site; however at least one significant difference is found; the 3 rho proteins have an Alanine in position corresponding to ras Glycine 13, suggesting that rho and ras proteins might have slightly different biochemical properties.

Cloning of human and mouse genes homologous to RAD52, a yeast gene involved in DNA repair and recombination.

NARCIS (Netherlands)

D.F.R. Muris; O.Y. Bezzubova (Olga); J-M. Buerstedde; K. Vreeken; A.S. Balajee; C.J. Osgood; C. Troelstra (Christine); J.H.J. Hoeijmakers (Jan); K. Ostermann; H. Schmidt (Henning); A.T. Natarajan; J.C.J. Eeken; P.H.M. Lohmann (Paul); A. Pastink (Albert)

1994-01-01

textabstractThe RAD52 gene of Saccharomyces cerevisiae is required for recombinational repair of double-strand breaks. Using degenerate oligonucleotides based on conserved amino acid sequences of RAD52 and rad22, its counterpart from Schizosaccharomyces pombe, RAD52 homologs from man and mouse were

FASH: A web application for nucleotides sequence search

Directory of Open Access Journals (Sweden)

Chew Paul

2008-05-01

Full Text Available Abstract FASH (Fourier Alignment Sequence Heuristics is a web application, based on the Fast Fourier Transform, for finding remote homologs within a long nucleic acid sequence. Given a query sequence and a long text-sequence (e.g, the human genome, FASH detects subsequences within the text that are remotely-similar to the query. FASH offers an alternative approach to Blast/Fasta for querying long RNA/DNA sequences. FASH differs from these other approaches in that it does not depend on the existence of contiguous seed-sequences in its initial detection phase. The FASH web server is user friendly and very easy to operate. Availability FASH can be accessed at https://fash.bgu.ac.il:8443/fash/default.jsp (secured website

Colored Kauffman homology and super-A-polynomials

International Nuclear Information System (INIS)

Nawata, Satoshi; Ramadevi, P.; Zodinmawia

2014-01-01

We study the structural properties of colored Kauffman homologies of knots. Quadruple-gradings play an essential role in revealing the differential structure of colored Kauffman homology. Using the differential structure, the Kauffman homologies carrying the symmetric tensor products of the vector representation for the trefoil and the figure-eight are determined. In addition, making use of relations from representation theory, we also obtain the HOMFLY homologies colored by rectangular Young tableaux with two rows for these knots. Furthermore, the notion of super-A-polynomials is extended in order to encompass two-parameter deformations of PSL(2,ℂ) character varieties

Improvement of methods for large scale sequencing; application to human Xq28

Energy Technology Data Exchange (ETDEWEB)

Gibbs, R.A.; Andersson, B.; Wentland, M.A. [Baylor College of Medicine, Houston, TX (United States)] [and others

1994-09-01

Sequencing of a one-metabase region of Xq28, spanning the FRAXA and IDS loci has been undertaken in order to investigate the practicality of the shotgun approach for large scale sequencing and as a platform to develop improved methods. The efficiency of several steps in the shotgun sequencing strategy has been increased using PCR-based approaches. An improved method for preparation of M13 libraries has been developed. This protocol combines a previously described adaptor-based protocol with the uracil DNA glycosylase (UDG)-cloning procedure. The efficiency of this procedure has been found to be up to 100-fold higher than that of previously used protocols. In addition the novel protocol is more reliable and thus easy to establish in a laboratory. The method has also been adapted for the simultaneous shotgun sequencing of multiple short fragments by concentrating them before library construction is presented. This protocol is suitable for rapid characterization of cDNA clones. A library was constructed from 15 PCR-amplified and concentrated human cDNA inserts, and the insert sequences could easily be identified as separate contigs during the assembly process and the sequence coverage was even along each fragment. Using this strategy, the fine structures of the FraxA and IDS loci have been revealed and several EST homologies indicating novel expressed sequences have been identified. Use of PCR to close repetitive regions that are difficult to clone was tested by determination of the sequence of a cosmid mapping DXS455 in Xq28, containing a polymorphic VNTR. The region containing the VNTR was not represented in the shotgun library, but by designing PCR primers in the sequences flanking the gap and by cloning and sequencing the PCR product, the fine structure of the VNTR has been determined. It was found to be an AT-rich VNTR with a repeated 25-mer at the center.

Protein secondary structure prediction for a single-sequence using hidden semi-Markov models

Directory of Open Access Journals (Sweden)

Borodovsky Mark

2006-03-01

Full Text Available Abstract Background The accuracy of protein secondary structure prediction has been improving steadily towards the 88% estimated theoretical limit. There are two types of prediction algorithms: Single-sequence prediction algorithms imply that information about other (homologous proteins is not available, while algorithms of the second type imply that information about homologous proteins is available, and use it intensively. The single-sequence algorithms could make an important contribution to studies of proteins with no detected homologs, however the accuracy of protein secondary structure prediction from a single-sequence is not as high as when the additional evolutionary information is present. Results In this paper, we further refine and extend the hidden semi-Markov model (HSMM initially considered in the BSPSS algorithm. We introduce an improved residue dependency model by considering the patterns of statistically significant amino acid correlation at structural segment borders. We also derive models that specialize on different sections of the dependency structure and incorporate them into HSMM. In addition, we implement an iterative training method to refine estimates of HSMM parameters. The three-state-per-residue accuracy and other accuracy measures of the new method, IPSSP, are shown to be comparable or better than ones for BSPSS as well as for PSIPRED, tested under the single-sequence condition. Conclusions We have shown that new dependency models and training methods bring further improvements to single-sequence protein secondary structure prediction. The results are obtained under cross-validation conditions using a dataset with no pair of sequences having significant sequence similarity. As new sequences are added to the database it is possible to augment the dependency structure and obtain even higher accuracy. Current and future advances should contribute to the improvement of function prediction for orphan proteins inscrutable

Draft Genome Sequence of Lactobacillus delbrueckii Strain #22 Isolated from a Patient with Short Bowel Syndrome and Previous d-Lactic Acidosis and Encephalopathy.

Science.gov (United States)

Domann, Eugen; Fischer, Florence; Glowatzki, Fabian; Fritzenwanker, Moritz; Hain, Torsten; Zechel-Gran, Silke; Giffhorn-Katz, Susanne; Neubauer, Bernd A

2016-07-28

d-Lactic acidosis with associated encephalopathy caused by overgrowth of intestinal lactic acid bacteria is a rarely diagnosed neurological complication of patients with short bowel syndrome. Here, we report the draft genome sequence of Lactobacillus delbrueckii strain #22 isolated from a patient with short bowel syndrome and previous d-lactic acidosis/encephalopathy. Copyright © 2016 Domann et al.

Frequent gene conversion events between the X and Y homologous chromosomal regions in primates

Directory of Open Access Journals (Sweden)

Hirai Hirohisa

2010-07-01

Full Text Available Abstract Background Mammalian sex-chromosomes originated from a pair of autosomes. A step-wise cessation of recombination is necessary for the proper maintenance of sex-determination and, consequently, generates a four strata structure on the X chromosome. Each stratum shows a specific per-site nucleotide sequence difference (p-distance between the X and Y chromosomes, depending on the time of recombination arrest. Stratum 4 covers the distal half of the human X chromosome short arm and the p-distance of the stratum is ~10%, on average. However, a 100-kb region, which includes KALX and VCX, in the middle of stratum 4 shows a significantly lower p-distance (1-5%, suggesting frequent sequence exchanges or gene conversions between the X and Y chromosomes in humans. To examine the evolutionary mechanism for this low p-distance region, sequences of a corresponding region including KALX/Y from seven species of non-human primates were analyzed. Results Phylogenetic analysis of this low p-distance region in humans and non-human primate species revealed that gene conversion like events have taken place at least ten times after the divergence of New World monkeys and Catarrhini (i.e., Old World monkeys and hominoids. A KALY-converted KALX allele in white-handed gibbons also suggests a possible recent gene conversion between the X and Y chromosomes. In these primate sequences, the proximal boundary of this low p-distance region is located in a LINE element shared between the X and Y chromosomes, suggesting the involvement of this element in frequent gene conversions. Together with a palindrome on the Y chromosome, a segmental palindrome structure on the X chromosome at the distal boundary near VCX, in humans and chimpanzees, may mediate frequent sequence exchanges between X and Y chromosomes. Conclusion Gene conversion events between the X and Y homologous regions have been suggested, mainly in humans. Here, we found frequent gene conversions in the

Musicians' and nonmusicians' short-term memory for verbal and musical sequences: comparing phonological similarity and pitch proximity.

Science.gov (United States)

Williamson, Victoria J; Baddeley, Alan D; Hitch, Graham J

2010-03-01

Language-music comparative studies have highlighted the potential for shared resources or neural overlap in auditory short-term memory. However, there is a lack of behavioral methodologies for comparing verbal and musical serial recall. We developed a visual grid response that allowed both musicians and nonmusicians to perform serial recall of letter and tone sequences. The new method was used to compare the phonological similarity effect with the impact of an operationalized musical equivalent-pitch proximity. Over the course of three experiments, we found that short-term memory for tones had several similarities to verbal memory, including limited capacity and a significant effect of pitch proximity in nonmusicians. Despite being vulnerable to phonological similarity when recalling letters, however, musicians showed no effect of pitch proximity, a result that we suggest might reflect strategy differences. Overall, the findings support a limited degree of correspondence in the way that verbal and musical sounds are processed in auditory short-term memory.

Induction of human immunodeficiency virus (HIV-1 envelope specific cell-mediated immunity by a non-homologous synthetic peptide.

Directory of Open Access Journals (Sweden)

Ammar Achour

2007-11-01

Full Text Available Cell mediated immunity, including efficient CTL response, is required to prevent HIV-1 from cell-to-cell transmission. In previous investigations, we have shown that B1 peptide derived by Fourier transformation of HIV-1 primary structures and sharing no sequence homology with the parent proteins was able to generate antiserum which recognizes envelope and Tat proteins. Here we have investigated cellular immune response towards a novel non-homologous peptide, referred to as cA1 peptide.The 20 amino acid sequence of cA1 peptide was predicted using the notion of peptide hydropathic properties; the peptide is encoded by the complementary anti-sense DNA strand to the sense strand of previously described non-homologous A1 peptide. In this report we demonstrate that the cA1 peptide can be a target for major histocompatibility complex (MHC class I-restricted cytotoxic T lymphocytes in HIV-1-infected or envelope-immunized individuals. The cA1 peptide is recognized in association with different MHC class I allotypes and could prime in vitro CTLs, derived from gp160-immunized individuals capable to recognize virus variants.For the first time a theoretically designed immunogen involved in broad-based cell-immune memory activation is described. Our findings may thus contribute to the advance in vaccine research by describing a novel strategy to develop a synthetic AIDS vaccine.

No allelic variation in genes with high gliadin homology in patients with celiac disease and type 1 diabetes

DEFF Research Database (Denmark)

Nielsen, Christian; Hansen, Dorte; Husby, Steffen

2004-01-01

recognize gluten-derived peptides in which specific glutamine residues are deamidated to glutamic acid by tissue transglutaminase. Recently, intestinally expressed human genes with high homology to DQ2-gliadin celiac T-cell epitopes have been identified. Single or double point mutations which would increase...... the celiac T-cell epitope homology, and mutation in these genes, leading to the expression of glutamic acid at particular positions, could hypothetically be involved in the initiation of CD in HLA-DQ2-positive children. Six gene regions with high celiac T-cell epitope homology were investigated for single......-nucleotide polymorphisms using direct sequencing of DNA from 20 CD patients, 27 type 1 diabetes mellitus (T1DM) patients with associated CD, 24 patients with T1DM without CD and 110 healthy controls, all of Caucasian origin. No variants in any of these genes in any of the investigated groups were found. We conclude...

Statistical distributions of optimal global alignment scores of random protein sequences

Directory of Open Access Journals (Sweden)

Tang Jiaowei

2005-10-01

Full Text Available Abstract Background The inference of homology from statistically significant sequence similarity is a central issue in sequence alignments. So far the statistical distribution function underlying the optimal global alignments has not been completely determined. Results In this study, random and real but unrelated sequences prepared in six different ways were selected as reference datasets to obtain their respective statistical distributions of global alignment scores. All alignments were carried out with the Needleman-Wunsch algorithm and optimal scores were fitted to the Gumbel, normal and gamma distributions respectively. The three-parameter gamma distribution performs the best as the theoretical distribution function of global alignment scores, as it agrees perfectly well with the distribution of alignment scores. The normal distribution also agrees well with the score distribution frequencies when the shape parameter of the gamma distribution is sufficiently large, for this is the scenario when the normal distribution can be viewed as an approximation of the gamma distribution. Conclusion We have shown that the optimal global alignment scores of random protein sequences fit the three-parameter gamma distribution function. This would be useful for the inference of homology between sequences whose relationship is unknown, through the evaluation of gamma distribution significance between sequences.

A computational approach to discovering the functions of bacterial phytochromes by analysis of homolog distributions

Directory of Open Access Journals (Sweden)

Lamparter Tilman

2006-03-01

Full Text Available Abstract Background Phytochromes are photoreceptors, discovered in plants, that control a wide variety of developmental processes. They have also been found in bacteria and fungi, but for many species their biological role remains obscure. This work concentrates on the phytochrome system of Agrobacterium tumefaciens, a non-photosynthetic soil bacterium with two phytochromes. To identify proteins that might share common functions with phytochromes, a co-distribution analysis was performed on the basis of protein sequences from 138 bacteria. Results A database of protein sequences from 138 bacteria was generated. Each sequence was BLASTed against the entire database. The homolog distribution of each query protein was then compared with the homolog distribution of every other protein (target protein of the same species, and the target proteins were sorted according to their probability of co-distribution under random conditions. As query proteins, phytochromes from Agrobacterium tumefaciens, Pseudomonas aeruginosa, Deinococcus radiodurans and Synechocystis PCC 6803 were chosen along with several phytochrome-related proteins from A. tumefaciens. The Synechocystis photosynthesis protein D1 was selected as a control. In the D1 analyses, the ratio between photosynthesis-related proteins and those not related to photosynthesis among the top 150 in the co-distribution tables was > 3:1, showing that the method is appropriate for finding partner proteins with common functions. The co-distribution of phytochromes with other histidine kinases was remarkably high, although most co-distributed histidine kinases were not direct BLAST homologs of the query protein. This finding implies that phytochromes and other histidine kinases share common functions as parts of signalling networks. All phytochromes tested, with one exception, also revealed a remarkably high co-distribution with glutamate synthase and methionine synthase. This result implies a general role of

How to Choose the Suitable Template for Homology Modelling of GPCRs: 5-HT7 Receptor as a Test Case.

Science.gov (United States)

Shahaf, Nir; Pappalardo, Matteo; Basile, Livia; Guccione, Salvatore; Rayan, Anwar

2016-09-01

G protein-coupled receptors (GPCRs) are a super-family of membrane proteins that attract great pharmaceutical interest due to their involvement in almost every physiological activity, including extracellular stimuli, neurotransmission, and hormone regulation. Currently, structural information on many GPCRs is mainly obtained by the techniques of computer modelling in general and by homology modelling in particular. Based on a quantitative analysis of eighteen antagonist-bound, resolved structures of rhodopsin family "A" receptors - also used as templates to build 153 homology models - it was concluded that a higher sequence identity between two receptors does not guarantee a lower RMSD between their structures, especially when their pair-wise sequence identity (within trans-membrane domain and/or in binding pocket) lies between 25 % and 40 %. This study suggests that we should consider all template receptors having a sequence identity ≤50 % with the query receptor. In fact, most of the GPCRs, compared to the currently available resolved structures of GPCRs, fall within this range and lack a correlation between structure and sequence. When testing suitability for structure-based drug design, it was found that choosing as a template the most similar resolved protein, based on sequence resemblance only, led to unsound results in many cases. Molecular docking analyses were carried out, and enrichment factors as well as attrition rates were utilized as criteria for assessing suitability for structure-based drug design. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

[Preparation of monoclonal antibody against 4-amylphenol and homology modeling of its Fv fragment].

Science.gov (United States)

Cheng, Lei; Wu, Haizhen; Fei, Jing; Zhang, Lujia; Ye, Jiang; Zhang, Huizhan

2017-03-01

Objective To prepare and characterize a monoclonal antibody (mAb) against 4-amylphenol (4-AP), clone its cDNA sequence and make homology modeling for its Fv fragment. Methods A high-affinity anti-4-AP mAb was generated from a hybridoma cell line F10 using electrofusion between splenocytes from APA-BSA-immunized mouse and Sp2/0 myeloma cells. Then we extracted the mRNA of F10 cells and cloned the cDNA of mAb. The homology modeling and molecular docking of its Fv fragment was conducted with biological software. Results Under the optimum conditions, the ic-ELISA equation was y=A 2 +(A 1 -A 2 )/(1+(x/x 0 ) p ) (A 1 =1.28; A 2 =-0.066; x 0 =12560.75; p=0.74) with a correlation coefficient (R 2 ) of 0.997. The lowest detectable limit was 0.65 μg/mL. The heavy and light chains of mAb respectively belonged to IgG1 and Kappa. The homology modeling and molecular docking studies revealed that the binding of 4-Ap and mAb was attributed to the hydrogen bond and hydrophobic interactions. Conclusion The study successfully established a stable 4-AP mAb-secreting hybridoma cell line. The study on spatial structure of Fv fragment using homology modeling provided a reference for the development and design of single chain variable fragments.

Nature and distribution of feline sarcoma virus nucleotide sequences.

Science.gov (United States)

Frankel, A E; Gilbert, J H; Porzig, K J; Scolnick, E M; Aaronson, S A

1979-01-01

The genomes of three independent isolates of feline sarcoma virus (FeSV) were compared by molecular hybridization techniques. Using complementary DNAs prepared from two strains, SM- and ST-FeSV, common complementary DNA'S were selected by sequential hybridization to FeSV and feline leukemia virus RNAs. These DNAs were shown to be highly related among the three independent sarcoma virus isolates. FeSV-specific complementary DNAs were prepared by selection for hybridization by the homologous FeSV RNA and against hybridization by fline leukemia virus RNA. Sarcoma virus-specific sequences of SM-FeSV were shown to differ from those of either ST- or GA-FeSV strains, whereas ST-FeSV-specific DNA shared extensive sequence homology with GA-FeSV. By molecular hybridization, each set of FeSV-specific sequences was demonstrated to be present in normal cat cellular DNA in approximately one copy per haploid genome and was conserved throughout Felidae. In contrast, FeSV-common sequences were present in multiple DNA copies and were found only in Mediterranean cats. The present results are consistent with the concept that each FeSV strain has arisen by a mechanism involving recombination between feline leukemia virus and cat cellular DNA sequences, the latter represented within the cat genome in a manner analogous to that of a cellular gene. PMID:225544

The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.

Science.gov (United States)

Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L

1989-04-01

The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.

Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity.

OpenAIRE

Mulligan, M E; Hawley, D K; Entriken, R; McClure, W R

1984-01-01

We describe a simple algorithm for computing a homology score for Escherichia coli promoters based on DNA sequence alone. The homology score was related to 31 values, measured in vitro, of RNA polymerase selectivity, which we define as the product KBk2, the apparent second order rate constant for open complex formation. We found that promoter strength could be predicted to within a factor of +/-4.1 in KBk2 over a range of 10(4) in the same parameter. The quantitative evaluation was linked to ...

Rfam: annotating families of non-coding RNA sequences.

Science.gov (United States)

Daub, Jennifer; Eberhardt, Ruth Y; Tate, John G; Burge, Sarah W

2015-01-01

The primary task of the Rfam database is to collate experimentally validated noncoding RNA (ncRNA) sequences from the published literature and facilitate the prediction and annotation of new homologues in novel nucleotide sequences. We group homologous ncRNA sequences into "families" and related families are further grouped into "clans." We collate and manually curate data cross-references for these families from other databases and external resources. Our Web site offers researchers a simple interface to Rfam and provides tools with which to annotate their own sequences using our covariance models (CMs), through our tools for searching, browsing, and downloading information on Rfam families. In this chapter, we will work through examples of annotating a query sequence, collating family information, and searching for data.

Nucleotide sequence analysis of the Legionella micdadei mip gene, encoding a 30-kilodalton analog of the Legionella pneumophila Mip protein

DEFF Research Database (Denmark)

Bangsborg, Jette Marie; Cianciotto, N P; Hindersson, P

1991-01-01

After the demonstration of analogs of the Legionella pneumophila macrophage infectivity potentiator (Mip) protein in other Legionella species, the Legionella micdadei mip gene was cloned and expressed in Escherichia coli. DNA sequence analysis of the L. micdadei mip gene contained in the plasmid p...... homology with the mip-like genes of several Legionella species. Furthermore, amino acid sequence comparisons revealed significant homology to two eukaryotic proteins with isomerase activity (FK506-binding proteins)....

Chromhome: a rich internet application for accessing comparative chromosome homology maps.

Science.gov (United States)

Nagarajan, Sridevi; Rens, Willem; Stalker, James; Cox, Tony; Ferguson-Smith, Malcolm A

2008-03-26

Comparative genomics has become a significant research area in recent years, following the availability of a number of sequenced genomes. The comparison of genomes is of great importance in the analysis of functionally important genome regions. It can also be used to understand the phylogenetic relationships of species and the mechanisms leading to rearrangement of karyotypes during evolution. Many species have been studied at the cytogenetic level by cross species chromosome painting. With the large amount of such information, it has become vital to computerize the data and make them accessible worldwide. Chromhome http://www.chromhome.org is a comprehensive web application that is designed to provide cytogenetic comparisons among species and to fulfil this need. The Chromhome application architecture is multi-tiered with an interactive client layer, business logic and database layers. Enterprise java platform with open source framework OpenLaszlo is used to implement the Rich Internet Chromhome Application. Cross species comparative mapping raw data are collected and the processed information is stored into MySQL Chromhome database. Chromhome Release 1.0 contains 109 homology maps from 51 species. The data cover species from 14 orders and 30 families. The homology map displays all the chromosomes of the compared species as one image, making comparisons among species easier. Inferred data also provides maps of homologous regions that could serve as a guideline for researchers involved in phylogenetic or evolution based studies. Chromhome provides a useful resource for comparative genomics, holding graphical homology maps of a wide range of species. It brings together cytogenetic data of many genomes under one roof. Inferred painting can often determine the chromosomal homologous regions between two species, if each has been compared with a common third species. Inferred painting greatly reduces the need to map entire genomes and helps focus only on relevant

Chromhome: A rich internet application for accessing comparative chromosome homology maps

Directory of Open Access Journals (Sweden)

Cox Tony

2008-03-01

Full Text Available Abstract Background Comparative genomics has become a significant research area in recent years, following the availability of a number of sequenced genomes. The comparison of genomes is of great importance in the analysis of functionally important genome regions. It can also be used to understand the phylogenetic relationships of species and the mechanisms leading to rearrangement of karyotypes during evolution. Many species have been studied at the cytogenetic level by cross species chromosome painting. With the large amount of such information, it has become vital to computerize the data and make them accessible worldwide. Chromhome http://www.chromhome.org is a comprehensive web application that is designed to provide cytogenetic comparisons among species and to fulfil this need. Results The Chromhome application architecture is multi-tiered with an interactive client layer, business logic and database layers. Enterprise java platform with open source framework OpenLaszlo is used to implement the Rich Internet Chromhome Application. Cross species comparative mapping raw data are collected and the processed information is stored into MySQL Chromhome database. Chromhome Release 1.0 contains 109 homology maps from 51 species. The data cover species from 14 orders and 30 families. The homology map displays all the chromosomes of the compared species as one image, making comparisons among species easier. Inferred data also provides maps of homologous regions that could serve as a guideline for researchers involved in phylogenetic or evolution based studies. Conclusion Chromhome provides a useful resource for comparative genomics, holding graphical homology maps of a wide range of species. It brings together cytogenetic data of many genomes under one roof. Inferred painting can often determine the chromosomal homologous regions between two species, if each has been compared with a common third species. Inferred painting greatly reduces the need to

[Possibilities in the differential diagnosis of brain neoplasms using the long and short time sequences of proton magnetic resonance spectroscopy

NARCIS (Netherlands)

Gajewicz, W.; Goraj, B.M.

2004-01-01

Currently to perform proton magnetic resonance spectroscopy (1H MRS) with single voxel spectroscopy (SVS) technique long and/or short echo time sequences are used in order to provide complementary information. PURPOSE: The aim of the study was to compare the usefulness of STEAM (time echo, TE, 20

On (co)homology of Frobenius Poisson algebras

OpenAIRE

Zhu, Can; Van Oystaeyen, Fred; ZHANG, Yinhuo

2014-01-01

In this paper, we study Poisson (co)homology of a Frobenius Poisson algebra. More precisely, we show that there exists a duality between Poisson homology and Poisson cohomology of Frobenius Poisson algebras, similar to that between Hochschild homology and Hochschild cohomology of Frobenius algebras. Then we use the non-degenerate bilinear form on a unimodular Frobenius Poisson algebra to construct a Batalin-Vilkovisky structure on the Poisson cohomology ring making it into a Batalin-Vilkovisk...

N-terminal sequence of human leukocyte glycoprotein Mo1: conservation across species and homology to platelet IIb/IIIa.

Science.gov (United States)

Pierce, M W; Remold-O'Donnell, E; Todd, R F; Arnaout, M A

1986-12-12

Mo1 and gp160-gp93 are two surface membrane glycoprotein heterodimers present on granulocytes and monocytes derived from humans and guinea pigs, respectively. We purified both antigens and found that their alpha subunits had identical N-termini which were significantly homologous to the alpha subunit of the human adhesion platelet glycoprotein IIb/IIIa.

Compilation and analysis of Escherichia coli promoter DNA sequences.

OpenAIRE

Hawley, D K; McClure, W R

1983-01-01

The DNA sequence of 168 promoter regions (-50 to +10) for Escherichia coli RNA polymerase were compiled. The complete listing was divided into two groups depending upon whether or not the promoter had been defined by genetic (promoter mutations) or biochemical (5' end determination) criteria. A consensus promoter sequence based on homologies among 112 well-defined promoters was determined that was in substantial agreement with previous compilations. In addition, we have tabulated 98 promoter ...

The Coding and Effector Transfer of Movement Sequences

Science.gov (United States)

Kovacs, Attila J.; Muhlbauer, Thomas; Shea, Charles H.

2009-01-01

Three experiments utilizing a 14-element arm movement sequence were designed to determine if reinstating the visual-spatial coordinates, which require movements to the same spatial locations utilized during acquisition, results in better effector transfer than reinstating the motor coordinates, which require the same pattern of homologous muscle…

Ecological genomics in Xanthomonas: the nature of genetic adaptation with homologous recombination and host shifts

KAUST Repository

Huang, Chao-Li; Pu, Pei-Hua; Huang, Hao-Jen; Sung, Huang-Mo; Liaw, Hung-Jiun; Chen, Yi-Min; Chen, Chien-Ming; Huang, Ming-Ban; Osada, Naoki; Gojobori, Takashi; Pai, Tun-Wen; Chen, Yu-Tin; Hwang, Chi-Chuan; Chiang, Tzen-Yuh

2015-01-01

Background: Comparative genomics provides insights into the diversification of bacterial species. Bacterial speciation usually takes place with lasting homologous recombination, which not only acts as a cohering force between diverging lineages but brings advantageous alleles favored by natural selection, and results in ecologically distinct species, e.g., frequent host shift in Xanthomonas pathogenic to various plants. Results: Using whole-genome sequences, we examined the genetic divergence in Xanthomonas campestris that infected Brassicaceae, and X. citri, pathogenic to a wider host range. Genetic differentiation between two incipient races of X. citri pv. mangiferaeindicae was attributable to a DNA fragment introduced by phages. In contrast to most portions of the genome that had nearly equivalent levels of genetic divergence between subspecies as a result of the accumulation of point mutations, 10% of the core genome involving with homologous recombination contributed to the diversification in Xanthomonas, as revealed by the correlation between homologous recombination and genomic divergence. Interestingly, 179 genes were under positive selection; 98 (54.7%) of these genes were involved in homologous recombination, indicating that foreign genetic fragments may have caused the adaptive diversification, especially in lineages with nutritional transitions. Homologous recombination may have provided genetic materials for the natural selection, and host shifts likely triggered ecological adaptation in Xanthomonas. To a certain extent, we observed positive selection nevertheless contributed to ecological divergence beyond host shifting. Conclusion: Altogether, mediated with lasting gene flow, species formation in Xanthomonas was likely governed by natural selection that played a key role in helping the deviating populations to explore novel niches (hosts) or respond to environmental cues, subsequently triggering species diversification. © Huang et al.

Ecological genomics in Xanthomonas: the nature of genetic adaptation with homologous recombination and host shifts

KAUST Repository

Huang, Chao-Li

2015-03-15

Background: Comparative genomics provides insights into the diversification of bacterial species. Bacterial speciation usually takes place with lasting homologous recombination, which not only acts as a cohering force between diverging lineages but brings advantageous alleles favored by natural selection, and results in ecologically distinct species, e.g., frequent host shift in Xanthomonas pathogenic to various plants. Results: Using whole-genome sequences, we examined the genetic divergence in Xanthomonas campestris that infected Brassicaceae, and X. citri, pathogenic to a wider host range. Genetic differentiation between two incipient races of X. citri pv. mangiferaeindicae was attributable to a DNA fragment introduced by phages. In contrast to most portions of the genome that had nearly equivalent levels of genetic divergence between subspecies as a result of the accumulation of point mutations, 10% of the core genome involving with homologous recombination contributed to the diversification in Xanthomonas, as revealed by the correlation between homologous recombination and genomic divergence. Interestingly, 179 genes were under positive selection; 98 (54.7%) of these genes were involved in homologous recombination, indicating that foreign genetic fragments may have caused the adaptive diversification, especially in lineages with nutritional transitions. Homologous recombination may have provided genetic materials for the natural selection, and host shifts likely triggered ecological adaptation in Xanthomonas. To a certain extent, we observed positive selection nevertheless contributed to ecological divergence beyond host shifting. Conclusion: Altogether, mediated with lasting gene flow, species formation in Xanthomonas was likely governed by natural selection that played a key role in helping the deviating populations to explore novel niches (hosts) or respond to environmental cues, subsequently triggering species diversification. © Huang et al.

The Porcelain Crab Transcriptome and PCAD, the Porcelain Crab Microarray and Sequence Database

Energy Technology Data Exchange (ETDEWEB)

Tagmount, Abderrahmane; Wang, Mei; Lindquist, Erika; Tanaka, Yoshihiro; Teranishi, Kristen S.; Sunagawa, Shinichi; Wong, Mike; Stillman, Jonathon H.

2010-01-27

Background: With the emergence of a completed genome sequence of the freshwater crustacean Daphnia pulex, construction of genomic-scale sequence databases for additional crustacean sequences are important for comparative genomics and annotation. Porcelain crabs, genus Petrolisthes, have been powerful crustacean models for environmental and evolutionary physiology with respect to thermal adaptation and understanding responses of marine organisms to climate change. Here, we present a large-scale EST sequencing and cDNA microarray database project for the porcelain crab Petrolisthes cinctipes. Methodology/Principal Findings: A set of ~;;30K unique sequences (UniSeqs) representing ~;;19K clusters were generated from ~;;98K high quality ESTs from a set of tissue specific non-normalized and mixed-tissue normalized cDNA libraries from the porcelain crab Petrolisthes cinctipes. Homology for each UniSeq was assessed using BLAST, InterProScan, GO and KEGG database searches. Approximately 66percent of the UniSeqs had homology in at least one of the databases. All EST and UniSeq sequences along with annotation results and coordinated cDNA microarray datasets have been made publicly accessible at the Porcelain Crab Array Database (PCAD), a feature-enriched version of the Stanford and Longhorn Array Databases.Conclusions/Significance: The EST project presented here represents the third largest sequencing effort for any crustacean, and the largest effort for any crab species. Our assembly and clustering results suggest that our porcelain crab EST data set is equally diverse to the much larger EST set generated in the Daphnia pulex genome sequencing project, and thus will be an important resource to the Daphnia research community. Our homology results support the pancrustacea hypothesis and suggest that Malacostraca may be ancestral to Branchiopoda and Hexapoda. Our results also suggest that our cDNA microarrays cover as much of the transcriptome as can reasonably be captured in

Human papilloma viruses and cervical tumours: mapping of integration sites and analysis of adjacent cellular sequences

International Nuclear Information System (INIS)

Klimov, Eugene; Vinokourova, Svetlana; Moisjak, Elena; Rakhmanaliev, Elian; Kobseva, Vera; Laimins, Laimonis; Kisseljov, Fjodor; Sulimova, Galina

2002-01-01

In cervical tumours the integration of human papilloma viruses (HPV) transcripts often results in the generation of transcripts that consist of hybrids of viral and cellular sequences. Mapping data using a variety of techniques has demonstrated that HPV integration occurred without obvious specificity into human genome. However, these techniques could not demonstrate whether integration resulted in the generation of transcripts encoding viral or viral-cellular sequences. The aim of this work was to map the integration sites of HPV DNA and to analyse the adjacent cellular sequences. Amplification of the INTs was done by the APOT technique. The APOT products were sequenced according to standard protocols. The analysis of the sequences was performed using BLASTN program and public databases. To localise the INTs PCR-based screening of GeneBridge4-RH-panel was used. Twelve cellular sequences adjacent to integrated HPV16 (INT markers) expressed in squamous cell cervical carcinomas were isolated. For 11 INT markers homologous human genomic sequences were readily identified and 9 of these showed significant homologies to known genes/ESTs. Using the known locations of homologous cDNAs and the RH-mapping techniques, mapping studies showed that the INTs are distributed among different human chromosomes for each tumour sample and are located in regions with the high levels of expression. Integration of HPV genomes occurs into the different human chromosomes but into regions that contain highly transcribed genes. One interpretation of these studies is that integration of HPV occurs into decondensed regions, which are more accessible for integration of foreign DNA

A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities

OpenAIRE

Maréchal Eric; Ortet Philippe; Roy Sylvaine; Bastien Olivier

2005-01-01

Abstract Background Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic recon...

Isolation and characterization of a FLOWERING LOCUS T homolog from pineapple (Ananas comosus (L.) Merr).

Science.gov (United States)

Lv, LingLing; Duan, Jun; Xie, JiangHui; Wei, ChangBin; Liu, YuGe; Liu, ShengHui; Sun, GuangMing

2012-09-01

FLOWERING LOCUS T (FT)-like genes are crucial regulators of flowering in angiosperms. A homolog of FT, designated as AcFT (GenBank ID: HQ343233), was isolated from pineapple cultivar Comte de Paris by reverse transcriptase polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). The cDNA sequence of AcFT is 915 bp in length and contains an ORF of 534 bp, which encodes a protein of 177 aa. Molecular weight was 19.9 kDa and isoelectric point was 6.96. The deduced protein sequence of AcFT was 84% and 82% identical to homologs encoded by CgFT in Cymbidium goeringii and OgFT in Oncidium Gower Ramsey respectively. Quantitative real-time PCR (qRT-PCR) analyses showed that the expression of AcFT was high in flesh and none in leaves. qRT-PCR analyses in different stages indicated that the expression of AcFT reached the highest level on 40 d after flower inducing, when the multiple fruit and floral organs were forming. The 35S::AcFT transgenic Arabidopsis plants flowered earlier and had more inflorescences or branches than wild type plants. Copyright © 2012 Elsevier B.V. All rights reserved.

Efficient and controllable thermal ablation induced by short-pulsed HIFU sequence assisted with perfluorohexane nanodroplets.

Science.gov (United States)

Chang, Nan; Lu, Shukuan; Qin, Dui; Xu, Tianqi; Han, Meng; Wang, Supin; Wan, Mingxi

2018-07-01

A HIFU sequence with extremely short pulse duration and high pulse repetition frequency can achieve thermal ablation at a low acoustic power using inertial cavitation. Because of its cavitation-dependent property, the therapeutic outcome is unreliable when the treatment zone lacks cavitation nuclei. To overcome this intrinsic limitation, we introduced perfluorocarbon nanodroplets as extra cavitation nuclei into short-pulsed HIFU-mediated thermal ablation. Two types of nanodroplets were used with perfluorohexane (PFH) as the core material coated with bovine serum albumin (BSA) or an anionic fluorosurfactant (FS) to demonstrate the feasibility of this study. The thermal ablation process was recorded by high-speed photography. The inertial cavitation activity during the ablation was revealed by sonoluminescence (SL). The high-speed photography results show that the thermal ablation volume increased by ∼643% and 596% with BSA-PFH and FS-PFH, respectively, than the short-pulsed HIFU alone at an acoustic power of 19.5 W. Using nanodroplets, much larger ablation volumes were created even at a much lower acoustic power. Meanwhile, the treatment time for ablating a desired volume significantly reduced in the presence of nanodroplets. Moreover, by adjusting the treatment time, lesion migration towards the HIFU transducer could also be avoided. The SL results show that the thermal lesion shape was significantly dependent on the inertial cavitation in this short-pulsed HIFU-mediated thermal ablation. The inertial cavitation activity became more predictable by using nanodroplets. Therefore, the introduction of PFH nanodroplets as extra cavitation nuclei made the short-pulsed HIFU thermal ablation more efficient by increasing the ablation volume and speed, and more controllable by reducing the acoustic power and preventing lesion migration. Copyright © 2018. Published by Elsevier B.V.

Accurate protein structure modeling using sparse NMR data and homologous structure information.

Science.gov (United States)

Thompson, James M; Sgourakis, Nikolaos G; Liu, Gaohua; Rossi, Paolo; Tang, Yuefeng; Mills, Jeffrey L; Szyperski, Thomas; Montelione, Gaetano T; Baker, David

2012-06-19

While information from homologous structures plays a central role in X-ray structure determination by molecular replacement, such information is rarely used in NMR structure determination because it can be incorrect, both locally and globally, when evolutionary relationships are inferred incorrectly or there has been considerable evolutionary structural divergence. Here we describe a method that allows robust modeling of protein structures of up to 225 residues by combining (1)H(N), (13)C, and (15)N backbone and (13)Cβ chemical shift data, distance restraints derived from homologous structures, and a physically realistic all-atom energy function. Accurate models are distinguished from inaccurate models generated using incorrect sequence alignments by requiring that (i) the all-atom energies of models generated using the restraints are lower than models generated in unrestrained calculations and (ii) the low-energy structures converge to within 2.0 Å backbone rmsd over 75% of the protein. Benchmark calculations on known structures and blind targets show that the method can accurately model protein structures, even with very remote homology information, to a backbone rmsd of 1.2-1.9 Å relative to the conventional determined NMR ensembles and of 0.9-1.6 Å relative to X-ray structures for well-defined regions of the protein structures. This approach facilitates the accurate modeling of protein structures using backbone chemical shift data without need for side-chain resonance assignments and extensive analysis of NOESY cross-peak assignments.

Salmon louse (Lepeophtheirus salmonis transcriptomes during post molting maturation and egg production, revealed using EST-sequencing and microarray analysis

Directory of Open Access Journals (Sweden)

Jonassen Inge

2008-03-01

Full Text Available Abstract Background Lepeophtheirus salmonis is an ectoparasitic copepod feeding on skin, mucus and blood from salmonid hosts. Initial analysis of EST sequences from pre adult and adult stages of L. salmonis revealed a large proportion of novel transcripts. In order to link unknown transcripts to biological functions we have combined EST sequencing and microarray analysis to characterize female salmon louse transcriptomes during post molting maturation and egg production. Results EST sequence analysis shows that 43% of the ESTs have no significant hits in GenBank. Sequenced ESTs assembled into 556 contigs and 1614 singletons and whenever homologous genes were identified no clear correlation with homologous genes from any specific animal group was evident. Sequence comparison of 27 L. salmonis proteins with homologous proteins in humans, zebrafish, insects and crustaceans revealed an almost identical sequence identity with all species. Microarray analysis of maturing female adult salmon lice revealed two major transcription patterns; up-regulation during the final molting followed by down regulation and female specific up regulation during post molting growth and egg production. For a third minor group of ESTs transcription decreased during molting from pre-adult II to immature adults. Genes regulated during molting typically gave hits with cuticula proteins whilst transcripts up regulated during post molting growth were female specific, including two vitellogenins. Conclusion The copepod L.salmonis contains high a level of novel genes. Among analyzed L.salmonis proteins, sequence identities with homologous proteins in crustaceans are no higher than to homologous proteins in humans. Three distinct processes, molting, post molting growth and egg production correlate with transcriptional regulation of three groups of transcripts; two including genes related to growth, one including genes related to egg production. The function of the regulated

Homologous expression of a mutated beta-tubulin gene does not confer benomyl resistance on Trichoderma virens.

Science.gov (United States)

Mukherjee, M; Hadar, R; Mukherjee, P K; Horwitz, B A

2003-01-01

To clone the beta-tubulins and to induce resistance to benzimidazoles in the biocontrol fungus Trichoderma virens through site-directed mutagenesis. Two beta-tubulin genes have been cloned using PCR amplification followed by the screening of a T. virens cDNA library. The full-length cDNA clones, coding for 445 and 446 amino acids, have been designated as T. virens tub1 and T. virens tub2. A sequence alignment of these two tubulins with tubulins from other filamentous fungi has shown the presence of some unique amino acid sequences not found in those positions in other beta-tubulins. Constitutive expression of the tub2 gene with a histidine to tyrosine substitution at position 6 (known to impart benomyl/methyl benzimadazol-2-yl carbamate resistance in other fungi), under the Pgpd promoter of Aspergillus nidulans, did not impart resistance to benomyl. The homologous expression of tub2 gene with a histidine to tyrosine mutation at position +6, which is known to impart benomyl tolerance in other fungi, does not impart resistance in T. virens. Unlike other Trichoderma spp., T. virens, has been difficult to mutate for benomyl tolerance. The present study, through site-directed mutagenesis, shows that a mutation known to impart benomyl tolerance in T. viride and other fungi does not impart resistance in this fungus. Understanding the mechanisms of this phenomenon will have a profound impact in plant-disease management, as many plant pathogenic fungi develop resistance to this group of fungicides forcing its withdrawal after a short period of use.

A local homology theory for linearly compact modules

International Nuclear Information System (INIS)

Nguyen Tu Cuong; Tran Tuan Nam

2004-11-01

We introduce a local homology theory for linearly modules which is in some sense dual to the local cohomology theory of A. Grothendieck. Some basic properties of local homology modules are shown such as: the vanishing and non-vanishing, the noetherianness of local homology modules. By using duality, we extend some well-known results in theory of local cohomology of A. Grothendieck. (author)

Stringent homology-based prediction of H. sapiens-M. tuberculosis H37Rv protein-protein interactions.

Science.gov (United States)

Zhou, Hufeng; Gao, Shangzhi; Nguyen, Nam Ninh; Fan, Mengyuan; Jin, Jingjing; Liu, Bing; Zhao, Liang; Xiong, Geng; Tan, Min; Li, Shijun; Wong, Limsoon

2014-04-08

H. sapiens-M. tuberculosis H37Rv protein-protein interaction (PPI) data are essential for understanding the infection mechanism of the formidable pathogen M. tuberculosis H37Rv. Computational prediction is an important strategy to fill the gap in experimental H. sapiens-M. tuberculosis H37Rv PPI data. Homology-based prediction is frequently used in predicting both intra-species and inter-species PPIs. However, some limitations are not properly resolved in several published works that predict eukaryote-prokaryote inter-species PPIs using intra-species template PPIs. We develop a stringent homology-based prediction approach by taking into account (i) differences between eukaryotic and prokaryotic proteins and (ii) differences between inter-species and intra-species PPI interfaces. We compare our stringent homology-based approach to a conventional homology-based approach for predicting host-pathogen PPIs, based on cellular compartment distribution analysis, disease gene list enrichment analysis, pathway enrichment analysis and functional category enrichment analysis. These analyses support the validity of our prediction result, and clearly show that our approach has better performance in predicting H. sapiens-M. tuberculosis H37Rv PPIs. Using our stringent homology-based approach, we have predicted a set of highly plausible H. sapiens-M. tuberculosis H37Rv PPIs which might be useful for many of related studies. Based on our analysis of the H. sapiens-M. tuberculosis H37Rv PPI network predicted by our stringent homology-based approach, we have discovered several interesting properties which are reported here for the first time. We find that both host proteins and pathogen proteins involved in the host-pathogen PPIs tend to be hubs in their own intra-species PPI network. Also, both host and pathogen proteins involved in host-pathogen PPIs tend to have longer primary sequence, tend to have more domains, tend to be more hydrophilic, etc. And the protein domains from both

Using sequence similarity networks for visualization of relationships across diverse protein superfamilies.

Directory of Open Access Journals (Sweden)

Holly J Atkinson

Full Text Available The dramatic increase in heterogeneous types of biological data--in particular, the abundance of new protein sequences--requires fast and user-friendly methods for organizing this information in a way that enables functional inference. The most widely used strategy to link sequence or structure to function, homology-based function prediction, relies on the fundamental assumption that sequence or structural similarity implies functional similarity. New tools that extend this approach are still urgently needed to associate sequence data with biological information in ways that accommodate the real complexity of the problem, while being accessible to experimental as well as computational biologists. To address this, we have examined the application of sequence similarity networks for visualizing functional trends across protein superfamilies from the context of sequence similarity. Using three large groups of homologous proteins of varying types of structural and functional diversity--GPCRs and kinases from humans, and the crotonase superfamily of enzymes--we show that overlaying networks with orthogonal information is a powerful approach for observing functional themes and revealing outliers. In comparison to other primary methods, networks provide both a good representation of group-wise sequence similarity relationships and a strong visual and quantitative correlation with phylogenetic trees, while enabling analysis and visualization of much larger sets of sequences than trees or multiple sequence alignments can easily accommodate. We also define important limitations and caveats in the application of these networks. As a broadly accessible and effective tool for the exploration of protein superfamilies, sequence similarity networks show great potential for generating testable hypotheses about protein structure-function relationships.

Using sequence similarity networks for visualization of relationships across diverse protein superfamilies.

Science.gov (United States)

Atkinson, Holly J; Morris, John H; Ferrin, Thomas E; Babbitt, Patricia C

2009-01-01

The dramatic increase in heterogeneous types of biological data--in particular, the abundance of new protein sequences--requires fast and user-friendly methods for organizing this information in a way that enables functional inference. The most widely used strategy to link sequence or structure to function, homology-based function prediction, relies on the fundamental assumption that sequence or structural similarity implies functional similarity. New tools that extend this approach are still urgently needed to associate sequence data with biological information in ways that accommodate the real complexity of the problem, while being accessible to experimental as well as computational biologists. To address this, we have examined the application of sequence similarity networks for visualizing functional trends across protein superfamilies from the context of sequence similarity. Using three large groups of homologous proteins of varying types of structural and functional diversity--GPCRs and kinases from humans, and the crotonase superfamily of enzymes--we show that overlaying networks with orthogonal information is a powerful approach for observing functional themes and revealing outliers. In comparison to other primary methods, networks provide both a good representation of group-wise sequence similarity relationships and a strong visual and quantitative correlation with phylogenetic trees, while enabling analysis and visualization of much larger sets of sequences than trees or multiple sequence alignments can easily accommodate. We also define important limitations and caveats in the application of these networks. As a broadly accessible and effective tool for the exploration of protein superfamilies, sequence similarity networks show great potential for generating testable hypotheses about protein structure-function relationships.

[Sequencing and analysis of the complete genome of a rabies virus isolate from Sika deer].

Science.gov (United States)

Zhao, Yun-Jiao; Guo, Li; Huang, Ying; Zhang, Li-Shi; Qian, Ai-Dong

2008-05-01

One DRV strain was isolated from Sika Deer brain and sequenced. Nine overlapped gene fragments were amplified by RT-PCR through 3'-RACE and 5'-RACE method, and the complete DRV genome sequence was assembled. The length of the complete genome is 11863bp. The DRV genome organization was similar to other rabies viruses which were composed of five genes and the initiation sites and termination sites were highly conservative. There were mutated amino acids in important antigen sites of nucleoprotein and glycoprotein. The nucleotide and amino acid homologies of gene N, P, M, G, L in strains with completed genomie sequencing were compared. Compared with N gene sequence of other typical rabies viruses, a phylogenetic tree was established . These results indicated that DRV belonged to gene type 1. The highest homology compared with Chinese vaccine strain 3aG was 94%, and the lowest was 71% compared with WCBV. These findings provided theoretical reference for further research in rabies virus.

The concept of homology as a basis for evaluating developmental mechanisms: exploring selective attention across the life-span.

Science.gov (United States)

Lickliter, Robert; Bahrick, Lorraine E

2013-01-01

Research with human infants as well as non-human animal embryos and infants has consistently demonstrated the benefits of intersensory redundancy for perceptual learning and memory for redundantly specified information during early development. Studies of infant affect discrimination, face discrimination, numerical discrimination, sequence detection, abstract rule learning, and word comprehension and segmentation have all shown that intersensory redundancy promotes earlier detection of these properties when compared to unimodal exposure to the same properties. Here we explore the idea that such intersensory facilitation is evident across the life-span and that this continuity is an example of a developmental behavioral homology. We present evidence that intersensory facilitation is most apparent during early phases of learning for a variety of tasks, regardless of developmental level, including domains that are novel or tasks that require discrimination of fine detail or speeded responses. Under these conditions, infants, children, and adults all show intersensory facilitation, suggesting a developmental homology. We discuss the challenge and propose strategies for establishing appropriate guidelines for identifying developmental behavioral homologies. We conclude that evaluating the extent to which continuities observed across development are homologous can contribute to a better understanding of the processes of development. Copyright © 2012 Wiley Periodicals, Inc.

Functional Coverage of the Human Genome by Existing Structures, Structural Genomics Targets, and Homology Models.

Directory of Open Access Journals (Sweden)

2005-08-01

Full Text Available The bias in protein structure and function space resulting from experimental limitations and targeting of particular functional classes of proteins by structural biologists has long been recognized, but never continuously quantified. Using the Enzyme Commission and the Gene Ontology classifications as a reference frame, and integrating structure data from the Protein Data Bank (PDB, target sequences from the structural genomics projects, structure homology derived from the SUPERFAMILY database, and genome annotations from Ensembl and NCBI, we provide a quantified view, both at the domain and whole-protein levels, of the current and projected coverage of protein structure and function space relative to the human genome. Protein structures currently provide at least one domain that covers 37% of the functional classes identified in the genome; whole structure coverage exists for 25% of the genome. If all the structural genomics targets were solved (twice the current number of structures in the PDB, it is estimated that structures of one domain would cover 69% of the functional classes identified and complete structure coverage would be 44%. Homology models from existing experimental structures extend the 37% coverage to 56% of the genome as single domains and 25% to 31% for complete structures. Coverage from homology models is not evenly distributed by protein family, reflecting differing degrees of sequence and structure divergence within families. While these data provide coverage, conversely, they also systematically highlight functional classes of proteins for which structures should be determined. Current key functional families without structure representation are highlighted here; updated information on the "most wanted list" that should be solved is available on a weekly basis from http://function.rcsb.org:8080/pdb/function_distribution/index.html.

Lactobacillus buchneri genotyping on the basis of clustered regularly interspaced short palindromic repeat (CRISPR) locus diversity.

Science.gov (United States)

Briner, Alexandra E; Barrangou, Rodolphe

2014-02-01

Clustered regularly interspaced short palindromic repeats (CRISPR) in combination with associated sequences (cas) constitute the CRISPR-Cas immune system, which uptakes DNA from invasive genetic elements as novel "spacers" that provide a genetic record of immunization events. We investigated the potential of CRISPR-based genotyping of Lactobacillus buchneri, a species relevant for commercial silage, bioethanol, and vegetable fermentations. Upon investigating the occurrence and diversity of CRISPR-Cas systems in Lactobacillus buchneri genomes, we observed a ubiquitous occurrence of CRISPR arrays containing a 36-nucleotide (nt) type II-A CRISPR locus adjacent to four cas genes, including the universal cas1 and cas2 genes and the type II signature gene cas9. Comparative analysis of CRISPR spacer content in 26 L. buchneri pickle fermentation isolates associated with spoilage revealed 10 unique locus genotypes that contained between 9 and 29 variable spacers. We observed a set of conserved spacers at the ancestral end, reflecting a common origin, as well as leader-end polymorphisms, reflecting recent divergence. Some of these spacers showed perfect identity with phage sequences, and many spacers showed homology to Lactobacillus plasmid sequences. Following a comparative analysis of sequences immediately flanking protospacers that matched CRISPR spacers, we identified a novel putative protospacer-adjacent motif (PAM), 5'-AAAA-3'. Overall, these findings suggest that type II-A CRISPR-Cas systems are valuable for genotyping of L. buchneri.

Protein sequence comparison and protein evolution

Energy Technology Data Exchange (ETDEWEB)

Pearson, W.R. [Univ. of Virginia, Charlottesville, VA (United States). Dept. of Biochemistry

1995-12-31

This tutorial was one of eight tutorials selected to be presented at the Third International Conference on Intelligent Systems for Molecular Biology which was held in the United Kingdom from July 16 to 19, 1995. This tutorial examines how the information conserved during the evolution of a protein molecule can be used to infer reliably homology, and thus a shared proteinfold and possibly a shared active site or function. The authors start by reviewing a geological/evolutionary time scale. Next they look at the evolution of several protein families. During the tutorial, these families will be used to demonstrate that homologous protein ancestry can be inferred with confidence. They also examine different modes of protein evolution and consider some hypotheses that have been presented to explain the very earliest events in protein evolution. The next part of the tutorial will examine the technical aspects of protein sequence comparison. Both optimal and heuristic algorithms and their associated parameters that are used to characterize protein sequence similarities are discussed. Perhaps more importantly, they survey the statistics of local similarity scores, and how these statistics can both be used to improve the selectivity of a search and to evaluate the significance of a match. They them examine distantly related members of three protein families, the serine proteases, the glutathione transferases, and the G-protein-coupled receptors (GCRs). Finally, the discuss how sequence similarity can be used to examine internal repeated or mosaic structures in proteins.

Statistical Inference for Porous Materials using Persistent Homology.

Energy Technology Data Exchange (ETDEWEB)

Moon, Chul [Univ. of Georgia, Athens, GA (United States); Heath, Jason E. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Mitchell, Scott A. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

2017-12-01

We propose a porous materials analysis pipeline using persistent homology. We rst compute persistent homology of binarized 3D images of sampled material subvolumes. For each image we compute sets of homology intervals, which are represented as summary graphics called persistence diagrams. We convert persistence diagrams into image vectors in order to analyze the similarity of the homology of the material images using the mature tools for image analysis. Each image is treated as a vector and we compute its principal components to extract features. We t a statistical model using the loadings of principal components to estimate material porosity, permeability, anisotropy, and tortuosity. We also propose an adaptive version of the structural similarity index (SSIM), a similarity metric for images, as a measure to determine the statistical representative elementary volumes (sREV) for persistence homology. Thus we provide a capability for making a statistical inference of the uid ow and transport properties of porous materials based on their geometry and connectivity.

K-homology and K-cohomology constructions of relations

International Nuclear Information System (INIS)

Abd El-Sattar, A. Dabbour; Bayoumy, F.M.

1990-08-01

One of the important homology (cohomology) theories, based on systems of covering of the space, is the homology (cohomology) theory of relations. In the present work, by using the idea of K-homology and K-cohomology groups different varieties of the Dowker's theory are introduced and studied. These constructions are defined on the category of pairs of topological spaces and over a pair of coefficient groups. (author). 14 refs

The sequence of the Helicoverpa armigera single nucleocapsid nucleopolyhedrovirus genome

NARCIS (Netherlands)

Chen, X.; IJkel, W.F.J.; Tarchini, R.; Sun, X.; Sandbrink, H.; Wang, H.; Peters, S.; Zuidema, D.; Klein Lankhorst, R.; Vlak, J.M.; Hu, Z.

2001-01-01

The nucleotide sequence of the Helicoverpa armigera single-nucleocapsid nucleopolyhedrovirus (HaSNPV) DNA genome was determined and analysed. The circular genome encompasses 131 403 bp, has a G C content of 39.1 molnd contains five homologous regions with a unique pattern of repeats.

Isolation and characterization of rhamnose-binding lectins from eggs of steelhead trout (Oncorhynchus mykiss) homologous to low density lipoprotein receptor superfamily.

Science.gov (United States)

Tateno, H; Saneyoshi, A; Ogawa, T; Muramoto, K; Kamiya, H; Saneyoshi, M

1998-07-24

Two L-rhamnose-binding lectins named STL1 and STL2 were isolated from eggs of steelhead trout (Oncorhynchus mykiss) by affinity chromatography and ion exchange chromatography. The apparent molecular masses of purified STL1 and STL2 were estimated to be 84 and 68 kDa, respectively, by gel filtration chromatography. Sodium dodecyl sulfate polyacrylamide gel electrophoresis and matrix-assisted laser desorption ionization time of flight mass spectrometry of these lectins revealed that STL1 was composed of noncovalently linked trimer of 31.4-kDa subunits, and STL2 was noncovalently linked trimer of 21.5-kDa subunits. The minimum concentrations of STL1, a major component, and STL2, a minor component, needed to agglutinate rabbit erythrocytes were 9 and 0.2 microg/ml, respectively. The most effective saccharide in the hemagglutination inhibition assay for both STL1 and STL2 was L-rhamnose. Saccharides possessing the same configuration of hydroxyl groups at C2 and C4 as that in L-rhamnose, such as L-arabinose and D-galactose, also inhibited. The amino acid sequence of STL2 was determined by analysis of peptides generated by digestion of the S-carboxamidomethylated protein with Achromobacter protease I or Staphylococcus aureus V8 protease. The STL2 subunit of 195 amino acid residues proved to have a unique polypeptide architecture; that is, it was composed of two tandemly repeated homologous domains (STL2-N and STL2-C) with 52% internal homology. These two domains showed a sequence homology to the subunit (105 amino acid residues) of D-galactoside-specific sea urchin (Anthocidaris crassispina) egg lectin (37% for STL2-N and 46% for STL2-C, respectively). The N terminus of the STL1 subunit was blocked with an acetyl group. However, a partial amino acid sequence of the subunit showed a sequence similarity to STL2. Moreover, STL2 also showed a sequence homology to the ligand binding domain of the vitellogenin receptor. We have also employed surface plasmon resonance biosensor

Some homological properties of skew PBW extensions arising in non-commutative algebraic geometry

Directory of Open Access Journals (Sweden)

Lezama Oswaldo

2017-06-01

Full Text Available In this short paper we study for the skew PBW (Poincar-Birkhoff-Witt extensions some homological properties arising in non-commutative algebraic geometry, namely, Auslander-Gorenstein regularity, Cohen-Macaulayness and strongly noetherianity. Skew PBW extensions include a considerable number of non-commutative rings of polynomial type such that classical PBW extensions, quantum polynomial rings, multiplicative analogue of the Weyl algebra, some Sklyanin algebras, operator algebras, diffusion algebras, quadratic algebras in 3 variables, among many others. Parametrization of the point modules of some examples is also presented.

Multiscale analysis of nonlinear systems using computational homology

Energy Technology Data Exchange (ETDEWEB)

Konstantin Mischaikow; Michael Schatz; William Kalies; Thomas Wanner

2010-05-24

This is a collaborative project between the principal investigators. However, as is to be expected, different PIs have greater focus on different aspects of the project. This report lists these major directions of research which were pursued during the funding period: (1) Computational Homology in Fluids - For the computational homology effort in thermal convection, the focus of the work during the first two years of the funding period included: (1) A clear demonstration that homology can sensitively detect the presence or absence of an important flow symmetry, (2) An investigation of homology as a probe for flow dynamics, and (3) The construction of a new convection apparatus for probing the effects of large-aspect-ratio. (2) Computational Homology in Cardiac Dynamics - We have initiated an effort to test the use of homology in characterizing data from both laboratory experiments and numerical simulations of arrhythmia in the heart. Recently, the use of high speed, high sensitivity digital imaging in conjunction with voltage sensitive fluorescent dyes has enabled researchers to visualize electrical activity on the surface of cardiac tissue, both in vitro and in vivo. (3) Magnetohydrodynamics - A new research direction is to use computational homology to analyze results of large scale simulations of 2D turbulence in the presence of magnetic fields. Such simulations are relevant to the dynamics of black hole accretion disks. The complex flow patterns from simulations exhibit strong qualitative changes as a function of magnetic field strength. Efforts to characterize the pattern changes using Fourier methods and wavelet analysis have been unsuccessful. (4) Granular Flow - two experts in the area of granular media are studying 2D model experiments of earthquake dynamics where the stress fields can be measured; these stress fields from complex patterns of 'force chains' that may be amenable to analysis using computational homology. (5) Microstructure

Multiscale analysis of nonlinear systems using computational homology

Energy Technology Data Exchange (ETDEWEB)

Konstantin Mischaikow, Rutgers University/Georgia Institute of Technology, Michael Schatz, Georgia Institute of Technology, William Kalies, Florida Atlantic University, Thomas Wanner,George Mason University

2010-05-19

This is a collaborative project between the principal investigators. However, as is to be expected, different PIs have greater focus on different aspects of the project. This report lists these major directions of research which were pursued during the funding period: (1) Computational Homology in Fluids - For the computational homology effort in thermal convection, the focus of the work during the first two years of the funding period included: (1) A clear demonstration that homology can sensitively detect the presence or absence of an important flow symmetry, (2) An investigation of homology as a probe for flow dynamics, and (3) The construction of a new convection apparatus for probing the effects of large-aspect-ratio. (2) Computational Homology in Cardiac Dynamics - We have initiated an effort to test the use of homology in characterizing data from both laboratory experiments and numerical simulations of arrhythmia in the heart. Recently, the use of high speed, high sensitivity digital imaging in conjunction with voltage sensitive fluorescent dyes has enabled researchers to visualize electrical activity on the surface of cardiac tissue, both in vitro and in vivo. (3) Magnetohydrodynamics - A new research direction is to use computational homology to analyze results of large scale simulations of 2D turbulence in the presence of magnetic fields. Such simulations are relevant to the dynamics of black hole accretion disks. The complex flow patterns from simulations exhibit strong qualitative changes as a function of magnetic field strength. Efforts to characterize the pattern changes using Fourier methods and wavelet analysis have been unsuccessful. (4) Granular Flow - two experts in the area of granular media are studying 2D model experiments of earthquake dynamics where the stress fields can be measured; these stress fields from complex patterns of 'force chains' that may be amenable to analysis using computational homology. (5) Microstructure

TurboFold: Iterative probabilistic estimation of secondary structures for multiple RNA sequences

Directory of Open Access Journals (Sweden)

Sharma Gaurav

2011-04-01

Full Text Available Abstract Background The prediction of secondary structure, i.e. the set of canonical base pairs between nucleotides, is a first step in developing an understanding of the function of an RNA sequence. The most accurate computational methods predict conserved structures for a set of homologous RNA sequences. These methods usually suffer from high computational complexity. In this paper, TurboFold, a novel and efficient method for secondary structure prediction for multiple RNA sequences, is presented. Results TurboFold takes, as input, a set of homologous RNA sequences and outputs estimates of the base pairing probabilities for each sequence. The base pairing probabilities for a sequence are estimated by combining intrinsic information, derived from the sequence itself via the nearest neighbor thermodynamic model, with extrinsic information, derived from the other sequences in the input set. For a given sequence, the extrinsic information is computed by using pairwise-sequence-alignment-based probabilities for co-incidence with each of the other sequences, along with estimated base pairing probabilities, from the previous iteration, for the other sequences. The extrinsic information is introduced as free energy modifications for base pairing in a partition function computation based on the nearest neighbor thermodynamic model. This process yields updated estimates of base pairing probability. The updated base pairing probabilities in turn are used to recompute extrinsic information, resulting in the overall iterative estimation procedure that defines TurboFold. TurboFold is benchmarked on a number of ncRNA datasets and compared against alternative secondary structure prediction methods. The iterative procedure in TurboFold is shown to improve estimates of base pairing probability with each iteration, though only small gains are obtained beyond three iterations. Secondary structures composed of base pairs with estimated probabilities higher than a

Micropathogen Community Analysis in Hyalomma rufipes via High-Throughput Sequencing of Small RNAs

Science.gov (United States)

Luo, Jin; Liu, Min-Xuan; Ren, Qiao-Yun; Chen, Ze; Tian, Zhan-Cheng; Hao, Jia-Wei; Wu, Feng; Liu, Xiao-Cui; Luo, Jian-Xun; Yin, Hong; Wang, Hui; Liu, Guang-Yuan

2017-01-01

Ticks are important vectors in the transmission of a broad range of micropathogens to vertebrates, including humans. Because of the role of ticks in disease transmission, identifying and characterizing the micropathogen profiles of tick populations have become increasingly important. The objective of this study was to survey the micropathogens of Hyalomma rufipes ticks. Illumina HiSeq2000 technology was utilized to perform deep sequencing of small RNAs (sRNAs) extracted from field-collected H. rufipes ticks in Gansu Province, China. The resultant sRNA library data revealed that the surveyed tick populations produced reads that were homologous to St. Croix River Virus (SCRV) sequences. We also observed many reads that were homologous to microbial and/or pathogenic isolates, including bacteria, protozoa, and fungi. As part of this analysis, a phylogenetic tree was constructed to display the relationships among the homologous sequences that were identified. The study offered a unique opportunity to gain insight into the micropathogens of H. rufipes ticks. The effective control of arthropod vectors in the future will require knowledge of the micropathogen composition of vectors harboring infectious agents. Understanding the ecological factors that regulate vector propagation in association with the prevalence and persistence of micropathogen lineages is also imperative. These interactions may affect the evolution of micropathogen lineages, especially if the micropathogens rely on the vector or host for dispersal. The sRNA deep-sequencing approach used in this analysis provides an intuitive method to survey micropathogen prevalence in ticks and other vector species. PMID:28861401

Survey of transposable elements in sugarcane expressed sequence tags (ESTs

Directory of Open Access Journals (Sweden)

Rossi Magdalena

2001-01-01

Full Text Available The sugarcane expressed sequence tag (SUCEST project has produced a large number of cDNA sequences from several plant tissues submitted or not to different conditions of stress. In this paper we report the result of a search for transposable elements (TEs revealing a surprising amount of expressed TEs homologues. Of the 260,781 sequences grouped in 81,223 fragment assembly program (Phrap clusters, a total of 276 clones showed homology to previously reported TEs using a stringent cut-off value of e-50 or better. Homologous clones to Copia/Ty1 and Gypsy/Ty3 groups of long terminal repeat (LTR retrotransposons were found but no non-LTR retroelements were identified. All major transposon families were represented in sugarcane including Activator (Ac, Mutator (MuDR, Suppressor-mutator (En/Spm and Mariner. In order to compare the TE diversity in grasses genomes, we carried out a search for TEs described in sugarcane related species O.sativa, Z. mays and S. bicolor. We also present preliminary results showing the potential use of TEs insertion pattern polymorphism as molecular markers for cultivar identification.

Molecular characterization, sequence analysis and tissue expression of a porcine gene – MOSPD2

Directory of Open Access Journals (Sweden)

Yang Jie

2017-01-01

Full Text Available The full-length cDNA sequence of a porcine gene, MOSPD2, was amplified using the rapid amplification of cDNA ends method based on a pig expressed sequence tag sequence which was highly homologous to the coding sequence of the human MOSPD2 gene. Sequence prediction analysis revealed that the open reading frame of this gene encodes a protein of 491 amino acids that has high homology with the motile sperm domain-containing protein 2 (MOSPD2 of five species: horse (89%, human (90%, chimpanzee (89%, rhesus monkey (89% and mouse (85%; thus, it could be defined as a porcine MOSPD2 gene. This novel porcine gene was assigned GeneID: 100153601. This gene is structured in 15 exons and 14 introns as revealed by computer-assisted analysis. The phylogenetic analysis revealed that the porcine MOSPD2 gene has a closer genetic relationship with the MOSPD2 gene of horse. Tissue expression analysis indicated that the porcine MOSPD2 gene is generally and differentially expressed in the spleen, muscle, skin, kidney, lung, liver, fat and heart. Our experiment is the first to establish the primary foundation for further research on the porcine MOSPD2 gene.

Exploring sequence characteristics related to high-level production of secreted proteins in Aspergillus niger.

Directory of Open Access Journals (Sweden)

Bastiaan A van den Berg

Full Text Available Protein sequence features are explored in relation to the production of over-expressed extracellular proteins by fungi. Knowledge on features influencing protein production and secretion could be employed to improve enzyme production levels in industrial bioprocesses via protein engineering. A large set, over 600 homologous and nearly 2,000 heterologous fungal genes, were overexpressed in Aspergillus niger using a standardized expression cassette and scored for high versus no production. Subsequently, sequence-based machine learning techniques were applied for identifying relevant DNA and protein sequence features. The amino-acid composition of the protein sequence was found to be most predictive and interpretation revealed that, for both homologous and heterologous gene expression, the same features are important: tyrosine and asparagine composition was found to have a positive correlation with high-level production, whereas for unsuccessful production, contributions were found for methionine and lysine composition. The predictor is available online at http://bioinformatics.tudelft.nl/hipsec. Subsequent work aims at validating these findings by protein engineering as a method for increasing expression levels per gene copy.

Transcriptome characterization of the South African abalone Haliotis midae using sequencing-by-synthesis

Directory of Open Access Journals (Sweden)

Roodt-Wilding Rouvay

2011-03-01

Full Text Available Abstract Background Worldwide, the genus Haliotis is represented by 56 extant species and several of these are commercially cultured. Among the six abalone species found in South Africa, Haliotis midae is the only aquacultured species. Despite its economic importance, genomic sequence resources for H. midae, and for abalone in general, are still scarce. Next generation sequencing technologies provide a fast and efficient tool to generate large sequence collections that can be used to characterize the transcriptome and identify expressed genes associated with economically important traits like growth and disease resistance. Results More than 25 million short reads generated by the Illumina Genome Analyzer were de novo assembled in 22,761 contigs with an average size of 260 bp. With a stringent E-value threshold of 10-10, 3,841 contigs (16.8% had a BLAST homologous match against the Genbank non-redundant (NR protein database. Most of these sequences were annotated using the gene ontology (GO and eukaryotic orthologous groups of proteins (KOG databases and assigned to various functional categories. According to annotation results, many gene families involved in immune response were identified. Thousands of simple sequence repeats (SSR and single nucleotide polymorphisms (SNP were detected. Setting stringent parameters to ensure a high probability of amplification, 420 primer pairs in 181 contigs containing SSR loci were designed. Conclusion This data represents the most comprehensive genomic resource for the South African abalone H. midae to date. The amount of assembled sequences demonstrated the utility of the Illumina sequencing technology in the transcriptome characterization of a non-model species. It allowed the development of several markers and the identification of promising candidate genes for future studies on population and functional genomics in H. midae and in other abalone species.

Identification of a Flavivirus Sequence in a Marine Arthropod.

Directory of Open Access Journals (Sweden)

Michael J Conway

Full Text Available Phylogenetic analysis has yet to uncover the early origins of flaviviruses. In this study, I mined a database of expressed sequence tags in order to discover novel flavivirus sequences. Flavivirus sequences were identified in a pool of mRNA extracted from the sea spider Endeis spinosa (Pycnogonida, Pantopoda. Reconstruction of the translated sequences and BLAST analysis matched the sequence to the flavivirus NS5 gene. Additional sequences corresponding to envelope and the NS5 MTase domain were also identified. Phylogenetic analysis of homologous NS5 sequences revealed that Endeis spinosa NS5 (ESNS5 is likely related to classical insect-specific flaviviruses. It is unclear if ESNS5 represents genetic material from an active viral infection or an integrated viral genome. These data raise the possibility that classical insect-specific flaviviruses and perhaps medically relevant flaviviruses, evolved from progenitors that infected marine arthropods.

Conservation and co-option in developmental programmes: the importance of homology relationships

Directory of Open Access Journals (Sweden)

Becker May-Britt

2005-10-01

Full Text Available Abstract One of the surprising insights gained from research in evolutionary developmental biology (evo-devo is that increasing diversity in body plans and morphology in organisms across animal phyla are not reflected in similarly dramatic changes at the level of gene composition of their genomes. For instance, simplicity at the tissue level of organization often contrasts with a high degree of genetic complexity. Also intriguing is the observation that the coding regions of several genes of invertebrates show high sequence similarity to those in humans. This lack of change (conservation indicates that evolutionary novelties may arise more frequently through combinatorial processes, such as changes in gene regulation and the recruitment of novel genes into existing regulatory gene networks (co-option, and less often through adaptive evolutionary processes in the coding portions of a gene. As a consequence, it is of great interest to examine whether the widespread conservation of the genetic machinery implies the same developmental function in a last common ancestor, or whether homologous genes acquired new developmental roles in structures of independent phylogenetic origin. To distinguish between these two possibilities one must refer to current concepts of phylogeny reconstruction and carefully investigate homology relationships. Particularly problematic in terms of homology decisions is the use of gene expression patterns of a given structure. In the future, research on more organisms other than the typical model systems will be required since these can provide insights that are not easily obtained from comparisons among only a few distantly related model species.

Identification of human microRNA-like sequences embedded within the protein-encoding genes of the human immunodeficiency virus.

Directory of Open Access Journals (Sweden)

Bryan Holland

Full Text Available BACKGROUND: MicroRNAs (miRNAs are highly conserved, short (18-22 nts, non-coding RNA molecules that regulate gene expression by binding to the 3' untranslated regions (3'UTRs of mRNAs. While numerous cellular microRNAs have been associated with the progression of various diseases including cancer, miRNAs associated with retroviruses have not been well characterized. Herein we report identification of microRNA-like sequences in coding regions of several HIV-1 genomes. RESULTS: Based on our earlier proteomics and bioinformatics studies, we have identified 8 cellular miRNAs that are predicted to bind to the mRNAs of multiple proteins that are dysregulated during HIV-infection of CD4+ T-cells in vitro. In silico analysis of the full length and mature sequences of these 8 miRNAs and comparisons with all the genomic and subgenomic sequences of HIV-1 strains in global databases revealed that the first 18/18 sequences of the mature hsa-miR-195 sequence (including the short seed sequence, matched perfectly (100%, or with one nucleotide mismatch, within the envelope (env genes of five HIV-1 genomes from Africa. In addition, we have identified 4 other miRNA-like sequences (hsa-miR-30d, hsa-miR-30e, hsa-miR-374a and hsa-miR-424 within the env and the gag-pol encoding regions of several HIV-1 strains, albeit with reduced homology. Mapping of the miRNA-homologues of env within HIV-1 genomes localized these sequence to the functionally significant variable regions of the env glycoprotein gp120 designated V1, V2, V4 and V5. CONCLUSIONS: We conclude that microRNA-like sequences are embedded within the protein-encoding regions of several HIV-1 genomes. Given that the V1 to V5 regions of HIV-1 envelopes contain specific, well-characterized domains that are critical for immune responses, virus neutralization and disease progression, we propose that the newly discovered miRNA-like sequences within the HIV-1 genomes may have evolved to self-regulate survival of the

Dependence of Subduction Zone seismicity on Strain-Rate-Dependent Critical Homologous Temperature

Science.gov (United States)

Davis, P. M.

2016-12-01

Earthquakes mainly occur in crust or mantle that is below a critical temperature for the tectonic strain-rate, such that stress builds up to the breaking point before it can relax due to creep. Then long-range stress correlation gives rise to power law seismicity with large events. The limiting temperature depends on pressure, which is taken into account by finding a critical homologous temperature THc=T/TM above which earthquakes are rarely observed. We find that THc for ocean plates is ˜0.55. For California earthquakes, it is also close to 0.55. The uppermost mantle layer of oceanic plates of thickness ˜50 km is composed of harzburgite and depleted peridotite from which basalt has been removed to form ocean crust. Thus it has a higher melting temperature than the peridotite of the surrounding mantle, or the lower halves of plates. Thicknesses of seismicity in deep subduction zones, determined from 2D polynomial fits to a relocated catalog, are ˜50 km, which suggests that the earthquake channel is confined to this layer. We construct models to find homologous temperatures in slabs, and find that seismicity thicknesses are also, on average, confined to TH ≤ 0.55 ± 0.05. The associated rheology is compared with that obtained from flexure models of ocean lithosphere. The brittle-ductile transition occurs where viscosity drops from high values in the cold cores of slabs to values of 1022 to $1023 Pa s, i.e., where creep strain-rates become comparable to tectonic rates. The cutoff for deep earthquakes is not sharp. However they appear unlikely to occur if homologous temperature is high TH>0.55. Exceptions to the rule are anomalously deep earthquakes such as those beneath the Iceland and the Hawaiian hotspots, and the Newport Inglewood Fault. These are smaller events with short-range stress correlation, and can be explained if strain-rates are 2 to 3 orders of magnitude higher than those associated with earthquakes located where TH ≤0.55. We conclude that the

Multiple Evolutionary Events Involved in Maintaining Homologs of Resistance to Powdery Mildew 8 in Brassica napus.

Science.gov (United States)

Li, Qin; Li, Jing; Sun, Jin-Long; Ma, Xian-Feng; Wang, Ting-Ting; Berkey, Robert; Yang, Hui; Niu, Ying-Ze; Fan, Jing; Li, Yan; Xiao, Shunyuan; Wang, Wen-Ming

2016-01-01

The Resistance to Powdery Mildew 8 (RPW8) locus confers broad-spectrum resistance to powdery mildew in Arabidopsis thaliana. There are four Homologous to RPW8s (BrHRs) in Brassica rapa and three in Brassica oleracea (BoHRs). Brassica napus (Bn) is derived from diploidization of a hybrid between B. rapa and B. oleracea, thus should have seven homologs of RPW8 (BnHRs). It is unclear whether these genes are still maintained or lost in B. napus after diploidization and how they might have been evolved. Here, we reported the identification and sequence polymorphisms of BnHRs from a set of B. napus accessions. Our data indicated that while the BoHR copy from B. oleracea is highly conserved, the BrHR copy from B. rapa is relatively variable in the B. napus genome owing to multiple evolutionary events, such as gene loss, point mutation, insertion, deletion, and intragenic recombination. Given the overall high sequence homology of BnHR genes, it is not surprising that both intragenic recombination between two orthologs and two paralogs were detected in B. napus, which may explain the loss of BoHR genes in some B. napus accessions. When ectopically expressed in Arabidopsis, a C-terminally truncated version of BnHRa and BnHRb, as well as the full length BnHRd fused with YFP at their C-termini could trigger cell death in the absence of pathogens and enhanced resistance to powdery mildew disease. Moreover, subcellular localization analysis showed that both BnHRa-YFP and BnHRb-YFP were mainly localized to the extra-haustorial membrane encasing the haustorium of powdery mildew. Taken together, our data suggest that the duplicated BnHR genes might have been subjected to differential selection and at least some may play a role in defense and could serve as resistance resource in engineering disease-resistant plants.

Transformation of Aspergillus parasiticus with a homologous gene (pyrG) involved in pyrimidine biosynthesis

International Nuclear Information System (INIS)

Skory, C.D.; Horng, J.S.; Pestka, J.J.; Linz, J.E.

1990-01-01

The lack of efficient transformation methods for aflatoxigenic Aspergillus parasiticus has been a major constraint for the study of aflatoxin biosynthesis at the genetic level. A transformation system with efficiencies of 30 to 50 stable transformants per μg of DNA was developed for A. parasiticus by using homologous pyrG gene. The pyrG gene from A. parasiticus was isolated by in situ plaque hybridization of a lambda genomic DNA library. Uridine auxotrophs of A. parasiticus ATCC 36537, a mutant blocked in aflatoxin biosynthesis, were isolated by selection on 5-fluoroorotic acid following nitrosoguanidine mutagenesis. Isolates with mutations in the pyrG gene resulting in elimination of orotidine monophosphate (OMP) decarboxylase activity were detected by assaying cell extracts for their ability to convert [ 14 C]OMP to [ 14 C]UMP. Transformation of A. parasiticus pyrG protoplasts with the homologous pyrG gene restored the fungal cells to prototrophy. Enzymatic analysis of cell extracts of transformant clones demonstrated that these extracts had the ability to convert [ 14 C]OMP to [ 14 C]UMP. Southern analysis of DNA purified from transformant clones indicated that both pUC19 vector sequences and pyrG sequences were integrated into the genome. The development of this pyrG transformation system should allow cloning of the aflatoxin-biosynthetic genes, which will be useful in studying the regulation of aflatoxin biosynthesis and may ultimately provide a means for controlling aflatoxin production in the field

A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities.

Science.gov (United States)

Bastien, Olivier; Ortet, Philippe; Roy, Sylvaine; Maréchal, Eric

2005-03-10

Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic reconstruction. We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space) and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP) allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.

A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities

Directory of Open Access Journals (Sweden)

Maréchal Eric

2005-03-01

Full Text Available Abstract Background Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons and be the basis for a novel method of consistent and stable phylogenetic reconstruction. Results We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. Conclusion The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.

Method and apparatus for biological sequence comparison

Science.gov (United States)

Marr, T.G.; Chang, W.I.

1997-12-23

A method and apparatus are disclosed for comparing biological sequences from a known source of sequences, with a subject (query) sequence. The apparatus takes as input a set of target similarity levels (such as evolutionary distances in units of PAM), and finds all fragments of known sequences that are similar to the subject sequence at each target similarity level, and are long enough to be statistically significant. The invention device filters out fragments from the known sequences that are too short, or have a lower average similarity to the subject sequence than is required by each target similarity level. The subject sequence is then compared only to the remaining known sequences to find the best matches. The filtering member divides the subject sequence into overlapping blocks, each block being sufficiently large to contain a minimum-length alignment from a known sequence. For each block, the filter member compares the block with every possible short fragment in the known sequences and determines a best match for each comparison. The determined set of short fragment best matches for the block provide an upper threshold on alignment values. Regions of a certain length from the known sequences that have a mean alignment value upper threshold greater than a target unit score are concatenated to form a union. The current block is compared to the union and provides an indication of best local alignment with the subject sequence. 5 figs.

Detection of short repeated genomic sequences on metaphase chromosomes using padlock probes and target primed rolling circle DNA synthesis

Directory of Open Access Journals (Sweden)

Stougaard Magnus

2007-11-01

Full Text Available Abstract Background In situ detection of short sequence elements in genomic DNA requires short probes with high molecular resolution and powerful specific signal amplification. Padlock probes can differentiate single base variations. Ligated padlock probes can be amplified in situ by rolling circle DNA synthesis and detected by fluorescence microscopy, thus enhancing PRINS type reactions, where localized DNA synthesis reports on the position of hybridization targets, to potentially reveal the binding of single oligonucleotide-size probe molecules. Such a system has been presented for the detection of mitochondrial DNA in fixed cells, whereas attempts to apply rolling circle detection to metaphase chromosomes have previously failed, according to the literature. Methods Synchronized cultured cells were fixed with methanol/acetic acid to prepare chromosome spreads in teflon-coated diagnostic well-slides. Apart from the slide format and the chromosome spreading everything was done essentially according to standard protocols. Hybridization targets were detected in situ with padlock probes, which were ligated and amplified using target primed rolling circle DNA synthesis, and detected by fluorescence labeling. Results An optimized protocol for the spreading of condensed metaphase chromosomes in teflon-coated diagnostic well-slides was developed. Applying this protocol we generated specimens for target primed rolling circle DNA synthesis of padlock probes recognizing a 40 nucleotide sequence in the male specific repetitive satellite I sequence (DYZ1 on the Y-chromosome and a 32 nucleotide sequence in the repetitive kringle IV domain in the apolipoprotein(a gene positioned on the long arm of chromosome 6. These targets were detected with good efficiency, but the efficiency on other target sites was unsatisfactory. Conclusion Our aim was to test the applicability of the method used on mitochondrial DNA to the analysis of nuclear genomes, in particular as

Generation and analysis of expressed sequence tags from Botrytis cinerea

Directory of Open Access Journals (Sweden)

EVELYN SILVA

2006-01-01

Full Text Available Botrytis cinerea is a filamentous plant pathogen of a wide range of plant species, and its infection may cause enormous damage both during plant growth and in the post-harvest phase. We have constructed a cDNA library from an isolate of B. cinerea and have sequenced 11,482 expressed sequence tags that were assembled into 1,003 contigs sequences and 3,032 singletons. Approximately 81% of the unigenes showed significant similarity to genes coding for proteins with known functions: more than 50% of the sequences code for genes involved in cellular metabolism, 12% for transport of metabolites, and approximately 10% for cellular organization. Other functional categories include responses to biotic and abiotic stimuli, cell communication, cell homeostasis, and cell development. We carried out pair-wise comparisons with fungal databases to determine the B. cinerea unisequence set with relevant similarity to genes in other fungal pathogenic counterparts. Among the 4,035 non-redundant B. cinerea unigenes, 1,338 (23% have significant homology with Fusarium verticillioides unigenes. Similar values were obtained for Saccharomyces cerevisiae and Aspergillus nidulans (22% and 24%, respectively. The lower percentages of homology were with Magnaporthe grisae and Neurospora crassa (13% and 19%, respectively. Several genes involved in putative and known fungal virulence and general pathogenicity were identified. The results provide important information for future research on this fungal pathogen

A 1,681-locus consensus genetic map of cultivated cucumber including 67 NB-LRR resistance gene homolog and ten gene loci.

Science.gov (United States)

Yang, Luming; Li, Dawei; Li, Yuhong; Gu, Xingfang; Huang, Sanwen; Garcia-Mas, Jordi; Weng, Yiqun

2013-03-25

Cucumber is an important vegetable crop that is susceptible to many pathogens, but no disease resistance (R) genes have been cloned. The availability of whole genome sequences provides an excellent opportunity for systematic identification and characterization of the nucleotide binding and leucine-rich repeat (NB-LRR) type R gene homolog (RGH) sequences in the genome. Cucumber has a very narrow genetic base making it difficult to construct high-density genetic maps. Development of a consensus map by synthesizing information from multiple segregating populations is a method of choice to increase marker density. As such, the objectives of the present study were to identify and characterize NB-LRR type RGHs, and to develop a high-density, integrated cucumber genetic-physical map anchored with RGH loci. From the Gy14 draft genome, 70 NB-containing RGHs were identified and characterized. Most RGHs were in clusters with uneven distribution across seven chromosomes. In silico analysis indicated that all 70 RGHs had EST support for gene expression. Phylogenetic analysis classified 58 RGHs into two clades: CNL and TNL. Comparative analysis revealed high-degree sequence homology and synteny in chromosomal locations of these RGH members between the cucumber and melon genomes. Fifty-four molecular markers were developed to delimit 67 of the 70 RGHs, which were integrated into a genetic map through linkage analysis. A 1,681-locus cucumber consensus map including 10 gene loci and spanning 730.0 cM in seven linkage groups was developed by integrating three component maps with a bin-mapping strategy. Physically, 308 scaffolds with 193.2 Mbp total DNA sequences were anchored onto this consensus map that covered 52.6% of the 367 Mbp cucumber genome. Cucumber contains relatively few NB-LRR RGHs that are clustered and unevenly distributed in the genome. All RGHs seem to be transcribed and shared significant sequence homology and synteny with the melon genome suggesting conservation of

The K-homology of nets of C∗-algebras

Science.gov (United States)

Ruzzi, Giuseppe; Vasselli, Ezio

2014-12-01

Let X be a space, intended as a possibly curved space-time, and A a precosheaf of C∗-algebras on X. Motivated by algebraic quantum field theory, we study the Kasparov and Θ-summable K-homology of A interpreting them in terms of the holonomy equivariant K-homology of the associated C∗-dynamical system. This yields a characteristic class for K-homology cycles of A with values in the odd cohomology of X, that we interpret as a generalized statistical dimension.

Molecular cloning and sequencing analysis of the interferon receptor (IFNAR-1) from Columba livia.

Science.gov (United States)

Li, Chao; Chang, Wei Shan

2014-01-01

Partial sequence cloning of interferon receptor (IFNAR-1) of Columba livia. In order to obtain a certain length (630 bp) of gene, a pair of primers was designed according to the conserved nucleotide sequence of Gallus (EU477527.1) and Taeniopygia guttata (XM_002189232.1) IFNAR-1 gene fragment that was published by GenBank. Special primers were designed by the Race method to amplify the 3'terminal cDNA. The Columba livia IFNAR-1 displayed 88.5%, 80.5% and 73.8% nucleotide identity to Falco peregrinus, Gallus and Taeniopygia guttata, respectively. Phylogenetic analysis of the IFNAR1 gene showed that the relationship of Columba livia, Falco peregrinus and chicken had high homology. We successfully obtained a Columba livia IFNAR-1 gene partial sequence. Analysis of the genetic tree showed that the relationship of Columba livia and Falco peregrinus IFNAR-1 had high homology. This result can be used as reference for further research and practical application.

New Insight Into the Diversity of SemiSWEET Sugar Transporters and the Homologs in Prokaryotes

Directory of Open Access Journals (Sweden)

Baolei Jia

2018-05-01

Full Text Available Sugars will eventually be exported transporters (SWEETs and SemiSWEETs represent a family of sugar transporters in eukaryotes and prokaryotes, respectively. SWEETs contain seven transmembrane helices (TMHs, while SemiSWEETs contain three. The functions of SemiSWEETs are less studied. In this perspective article, we analyzed the diversity and conservation of SemiSWEETs and further proposed the possible functions. 1,922 SemiSWEET homologs were retrieved from the UniProt database, which is not proportional to the sequenced prokaryotic genomes. However, these proteins are very diverse in sequences and can be classified into 19 clusters when >50% sequence identity is required. Moreover, a gene context analysis indicated that several SemiSWEETs are located in the operons that are related to diverse carbohydrate metabolism. Several proteins with seven TMHs can be found in bacteria, and sequence alignment suggested that these proteins in bacteria may be formed by the duplication and fusion. Multiple sequence alignments showed that the amino acids for sugar translocation are still conserved and coevolved, although the sequences show diversity. Among them, the functions of a few amino acids are still not clear. These findings highlight the challenges that exist in SemiSWEETs and provide future researchers the foundation to explore these uncharted areas.

Mouse tetranectin: cDNA sequence, tissue-specific expression, and chromosomal mapping

DEFF Research Database (Denmark)

Ibaraki, K; Kozak, C A; Wewer, U M

1995-01-01

regulation, mouse tetranectin cDNA was cloned from a 16-day-old mouse embryo library. Sequence analysis revealed a 992-bp cDNA with an open reading frame of 606 bp, which is identical in length to the human tetranectin cDNA. The deduced amino acid sequence showed high homology to the human cDNA with 76......(s) of tetranectin. The sequence analysis revealed a difference in both sequence and size of the noncoding regions between mouse and human cDNAs. Northern analysis of the various tissues from mouse, rat, and cow showed the major transcript(s) to be approximately 1 kb, which is similar in size to that observed...

QUASAR--scoring and ranking of sequence-structure alignments.

Science.gov (United States)

Birzele, Fabian; Gewehr, Jan E; Zimmer, Ralf

2005-12-15

Sequence-structure alignments are a common means for protein structure prediction in the fields of fold recognition and homology modeling, and there is a broad variety of programs that provide such alignments based on sequence similarity, secondary structure or contact potentials. Nevertheless, finding the best sequence-structure alignment in a pool of alignments remains a difficult problem. QUASAR (quality of sequence-structure alignments ranking) provides a unifying framework for scoring sequence-structure alignments that aids finding well-performing combinations of well-known and custom-made scoring schemes. Those scoring functions can be benchmarked against widely accepted quality scores like MaxSub, TMScore, Touch and APDB, thus enabling users to test their own alignment scores against 'standard-of-truth' structure-based scores. Furthermore, individual score combinations can be optimized with respect to benchmark sets based on known structural relationships using QUASAR's in-built optimization routines.

Natural Homologous Triploidization and DNA Methylation in SARII-628, a Twin-seedling Line of Rice (Oryza sativa

Directory of Open Access Journals (Sweden)

Hai PENG

2007-12-01

Full Text Available A total of five pairs of diploid-triploid twin-seedlings (a diploid seedling and a triploid seedling emerged from a grain were selected out from 4500 pairs of seedlings from SARII-628, a twin-seedling rice line. SSR analysis indicated that no difference between the diploid seedling and corresponding triploid seedling in a twin-seedling was found at the 310 loci, indicating that there was no obvious change in DNA primary structure. A modified AFLP technique ‘MSAP (methylation-sensitive AFLP’ was used to analyze methylation mutation. Although no methylation mutation was noted among the five diploids, 29 methylation mutation loci were found from the corresponding triploids. This suggested that methylation mutation happened rapidly on M0 generation after natural homologous triploidization. The mutations were classified into 10 types, including 3 increased types, 3 decreased types and 4 undecided types of methylation-degrees. The bands of 22 loci were sequenced and then those sequences were searched through website. The result showed that the methylation mutation involved into the whole rice genome and the 12 pairs of chromosomes. The mutation trend was site-related and there were different mutation loci for different triploids, which foretold that SARII-628 would have different evolution fates after natural homologous triploidization.

[Topographic mapping of retinal function with a scanning laser ophthalmoscope and multifocal electroretinography using short M-sequences].

Science.gov (United States)

Rudolph, G; Bechmann, M; Berninger, T; Kutschbach, E; Held, U; Tornow, R P; Kalpadakis, P; Zol'nikova, I V; Shamshinova, A M

2001-01-01

A new method of multifocal electroretinography making use of scanning laser ophthalmoscope with a wavelength of 630 nm (SLO-m-ERG), evoking short spatial visual stimuli on the retina, is proposed. Algorithm of presenting the visual stimuli and analysis of distribution of local electroretinograms on the surface of the retina is based on short m-sequences. Mathematical cross correlation analysis shows a three-dimensional distribution of bioelectrical activity of the retina in the central visual field. In normal subjects the cone bioelectrical activity is the maximum in the macular area (corresponding to the density of cone distribution) and absent in the blind spot. The method detects the slightest pathological changes in the retina under control of the site of stimulation and ophthalmoscopic picture of the fundus oculi. The site of the pathological process correlates with the topography of changes in bioelectrical activity of the examined retinal area in diseases of the macular area and pigmented retinitis detectable by ophthalmoscopy.

Draft genome sequence of the Coccolithovirus Emiliania huxleyi virus 203.

Science.gov (United States)

Nissimov, Jozef I; Worthy, Charlotte A; Rooks, Paul; Napier, Johnathan A; Kimmance, Susan A; Henn, Matthew R; Ogata, Hiroyuki; Allen, Michael J

2011-12-01

The Coccolithoviridae are a recently discovered group of viruses that infect the marine coccolithophorid Emiliania huxleyi. Emiliania huxleyi virus 203 (EhV-203) has a 160- to 180-nm-diameter icosahedral structure and a genome of approximately 400 kbp, consisting of 464 coding sequences (CDSs). Here we describe the genomic features of EhV-203 together with a draft genome sequence and its annotation, highlighting the homology and heterogeneity of this genome in comparison with the EhV-86 reference genome.

The novel as short story

Directory of Open Access Journals (Sweden)

Kirk Schlueter

2013-06-01

Full Text Available In recent history, the novel has been thought of and defined primarily as a long prose narrative. However, this has not been the case historically, as the original meaning of "novel" was for "a piece of news" or "a short story or novella." Returning to this original definition, I propose a new way of viewing the work known contemporarily as the novel as a collection, or sequence, of united short stories rather than a single indivisible work, with the component short stories or novellas comprising the sequence renamed as "novels." A brief examination of several classic works traditionally considered novels serves to illustrate how this change in definition will affect reading.

Complete Genome Sequences of Four Isolates of Plutella xylostella Granulovirus

OpenAIRE

Spence, Robert J.; Noune, Christopher; Hauxwell, Caroline

2016-01-01

Granuloviruses are widespread pathogens of Plutella xylostella L. (diamondback moth) and potential biopesticides for control of this global insect pest. We report the complete genomes of four Plutella xylostella granulovirus isolates from China, Malaysia, and Taiwan exhibiting pairs of noncoding, homologous repeat regions with significant sequence variation but equivalent length.

Zea mI, the maize homolog of the allergen-encoding Lol pI gene of rye grass.

Science.gov (United States)

Broadwater, A H; Rubinstein, A L; Chay, C H; Klapper, D G; Bedinger, P A

1993-09-15

Sequence analysis of a pollen-specific cDNA from maize has identified a homolog (Zea mI) of the gene (Lol pI) encoding the major allergen of rye-grass pollen. The protein encoded by the partial cDNA sequence is 59.3% identical and 72.7% similar to the comparable region of the reported amino acid sequence of Lol pIA. Southern analysis indicates that this cDNA represents a member of a small multigene family in maize. Northern analysis shows expression only in pollen, not in vegetative or female floral tissues. The timing of expression is developmentally regulated, occurring at a low level prior to the first pollen mitosis and at a high level after this postmeiotic division. Western analysis detects a protein in maize pollen lysates using polyclonal antiserum and monoclonal antibodies directed against purified Lolium perenne allergen.

MRI in multiple sclerosis of the spinal cord: evaluation of fast short-tan inversion-recovery and spin-echo sequences

International Nuclear Information System (INIS)

Dietemann, J.L.; Thibaut-Menard, A.; Neugroschl, C.; Gillis, C.; Abu Eid, M.; Bogorin, A.; Warter, J.M.; Tranchant, C.

2000-01-01

We compared the sensitivity of T2-weighted spin-echo (FSE) and fast short-tau inversion-recovery (fSTIR) sequences in detection of multiple sclerosis of the spinal cord in 100 consecutive patients with clinically confirmed multiple sclerosis (MS); 86 patients underwent also brain MRI. In all, 310 focal lesions were detected on fSTIR and 212 on T2-weighted FSE, spinal cord lesions were seen better on fSTIR images, with a higher contrast between the lesion and the normal spinal cord. In 24 patients in whom cord plaques were shown with both sequences, the cranial study was normal or inconclusive. Assessment of spinal plaques can be particularly important when MRI of the brain is inconclusive, and in there situations fSTIR can be helpful. (orig.)

Whole Genome Sequencing Identifies a Missense Mutation in HES7 Associated with Short Tails in Asian Domestic Cats.

Science.gov (United States)

Xu, Xiao; Sun, Xin; Hu, Xue-Song; Zhuang, Yan; Liu, Yue-Chen; Meng, Hao; Miao, Lin; Yu, He; Luo, Shu-Jin

2016-08-25

Domestic cats exhibit abundant variations in tail morphology and serve as an excellent model to study the development and evolution of vertebrate tails. Cats with shortened and kinked tails were first recorded in the Malayan archipelago by Charles Darwin in 1868 and remain quite common today in Southeast and East Asia. To elucidate the genetic basis of short tails in Asian cats, we built a pedigree of 13 cats segregating at the trait with a founder from southern China and performed linkage mapping based on whole genome sequencing data from the pedigree. The short-tailed trait was mapped to a 5.6 Mb region of Chr E1, within which the substitution c. 5T > C in the somite segmentation-related gene HES7 was identified as the causal mutation resulting in a missense change (p.V2A). Validation in 245 unrelated cats confirmed the correlation between HES7-c. 5T > C and Chinese short-tailed feral cats as well as the Japanese Bobtail breed, indicating a common genetic basis of the two. In addition, some of our sampled kinked-tailed cats could not be explained by either HES7 or the Manx-related T-box, suggesting at least three independent events in the evolution of domestic cats giving rise to short-tailed traits.

cDNA, genomic sequence cloning and overexpression of ribosomal ...

African Journals Online (AJOL)

RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

Computing Homology Group Generators of Images Using Irregular Graph Pyramids

OpenAIRE

Peltier , Samuel; Ion , Adrian; Haxhimusa , Yll; Kropatsch , Walter; Damiand , Guillaume

2007-01-01

International audience; We introduce a method for computing homology groups and their generators of a 2D image, using a hierarchical structure i.e. irregular graph pyramid. Starting from an image, a hierarchy of the image is built, by two operations that preserve homology of each region. Instead of computing homology generators in the base where the number of entities (cells) is large, we first reduce the number of cells by a graph pyramid. Then homology generators are computed efficiently on...

Homologs of the Acinetobacter baumannii AceI transporter represent a new family of bacterial multidrug efflux systems.

Science.gov (United States)

Hassan, Karl A; Liu, Qi; Henderson, Peter J F; Paulsen, Ian T

2015-02-10

Multidrug efflux systems are a major cause of resistance to antimicrobials in bacteria, including those pathogenic to humans, animals, and plants. These proteins are ubiquitous in these pathogens, and five families of bacterial multidrug efflux systems have been identified to date. By using transcriptomic and biochemical analyses, we recently identified the novel AceI (Acinetobacter chlorhexidine efflux) protein from Acinetobacter baumannii that conferred resistance to the biocide chlorhexidine, via an active efflux mechanism. Proteins homologous to AceI are encoded in the genomes of many other bacterial species and are particularly prominent within proteobacterial lineages. In this study, we expressed 23 homologs of AceI and examined their resistance and/or transport profiles. MIC analyses demonstrated that, like AceI, many of the homologs conferred resistance to chlorhexidine. Many of the AceI homologs conferred resistance to additional biocides, including benzalkonium, dequalinium, proflavine, and acriflavine. We conducted fluorimetric transport assays using the AceI homolog from Vibrio parahaemolyticus and confirmed that resistance to both proflavine and acriflavine was mediated by an active efflux mechanism. These results show that this group of AceI homologs represent a new family of bacterial multidrug efflux pumps, which we have designated the proteobacterial antimicrobial compound efflux (PACE) family of transport proteins. Bacterial multidrug efflux pumps are an important class of resistance determinants that can be found in every bacterial genome sequenced to date. These transport proteins have important protective functions for the bacterial cell but are a significant problem in the clinical setting, since a single efflux system can mediate resistance to many structurally and mechanistically diverse antibiotics and biocides. In this study, we demonstrate that proteins related to the Acinetobacter baumannii AceI transporter are a new class of multidrug

New acute transforming feline retovirus with fms homology specifies a C-terminally truncated version of the c-fms protein that is different from SM-feline sarcoma virus v-fms protein

International Nuclear Information System (INIS)

Besmer, P.; Lader, E.; George, P.C.; Bergold, P.J.; Qui, F.; Zuckerman, E.E.; Hardy, W.D.

1986-01-01

The HZ5-feline sarcoma virus (FeSV) is a new acute transforming feline retrovirus which was isolated from a multicentric fibrosarcoma of a domestic cat. The HZ5-FeSV transforms fibroblasts in vitro and is replication defective. A biologically active integrated HZ5-FeSV provirus was molecularly cloned from cellular DNA of HZ5-FeSV-infected FRE-3A rat cells. The HZ5-FeSV has oncogene homology with the fms sequences of the SM-FeSV. The genome organization of the 8.6-kilobase HZ5-FeSV provirus is 5' Δgag-fms-Δpol-Δenv 3'. The HZ5- and SM-FeSVs display indistinguishable in vitro transformation characteristics, and the structures of the gag-fms transforming genes in the two viruses are very similar. In the HZ5-FeSV and the SM-FeSV, identical c-fms and feline leukemia virus p10 sequences form the 5' gag-fms junction. With regard to v-fms the two viruses are homologous up to 11 amino acids before the C terminus of the SM-FeSV v-fms protein. In HZ5-FeSV a segment of 362 nucleotides then follows before the 3' recombination site with feline leukemia virus pol. The new 3' v-fms sequence encodes 27 amino acids before reaching a TGA termination signal. The relationship of this sequence with the recently characterized human c-fms sequence has been examined. The 3' HZ5-FeSV v-fms sequence is homologous with 3' c-fms sequences. A frameshift mutation (11-base-pair deletion) was found in the C-terminal fms coding sequence of the HZ5-FeSV. As a result, the HZ5-FeSV v-fms protein is predicted to be a C-terminally truncated version of c-fms. This frameshift mutation may determine the oncogenic properties of v-fms in the HZ5-FeSV

New acute transforming feline retovirus with fms homology specifies a C-terminally truncated version of the c-fms protein that is different from SM-feline sarcoma virus v-fms protein

Energy Technology Data Exchange (ETDEWEB)

Besmer, P.; Lader, E.; George, P.C.; Bergold, P.J.; Qui, F.; Zuckerman, E.E.; Hardy, W.D.

1986-10-01

The HZ5-feline sarcoma virus (FeSV) is a new acute transforming feline retrovirus which was isolated from a multicentric fibrosarcoma of a domestic cat. The HZ5-FeSV transforms fibroblasts in vitro and is replication defective. A biologically active integrated HZ5-FeSV provirus was molecularly cloned from cellular DNA of HZ5-FeSV-infected FRE-3A rat cells. The HZ5-FeSV has oncogene homology with the fms sequences of the SM-FeSV. The genome organization of the 8.6-kilobase HZ5-FeSV provirus is 5' ..delta..gag-fms-..delta..pol-..delta..env 3'. The HZ5- and SM-FeSVs display indistinguishable in vitro transformation characteristics, and the structures of the gag-fms transforming genes in the two viruses are very similar. In the HZ5-FeSV and the SM-FeSV, identical c-fms and feline leukemia virus p10 sequences form the 5' gag-fms junction. With regard to v-fms the two viruses are homologous up to 11 amino acids before the C terminus of the SM-FeSV v-fms protein. In HZ5-FeSV a segment of 362 nucleotides then follows before the 3' recombination site with feline leukemia virus pol. The new 3' v-fms sequence encodes 27 amino acids before reaching a TGA termination signal. The relationship of this sequence with the recently characterized human c-fms sequence has been examined. The 3' HZ5-FeSV v-fms sequence is homologous with 3' c-fms sequences. A frameshift mutation (11-base-pair deletion) was found in the C-terminal fms coding sequence of the HZ5-FeSV. As a result, the HZ5-FeSV v-fms protein is predicted to be a C-terminally truncated version of c-fms. This frameshift mutation may determine the oncogenic properties of v-fms in the HZ5-FeSV.

Inverse statistical physics of protein sequences: a key issues review.

Science.gov (United States)

Cocco, Simona; Feinauer, Christoph; Figliuzzi, Matteo; Monasson, Rémi; Weigt, Martin

2018-03-01

In the course of evolution, proteins undergo important changes in their amino acid sequences, while their three-dimensional folded structure and their biological function remain remarkably conserved. Thanks to modern sequencing techniques, sequence data accumulate at unprecedented pace. This provides large sets of so-called homologous, i.e. evolutionarily related protein sequences, to which methods of inverse statistical physics can be applied. Using sequence data as the basis for the inference of Boltzmann distributions from samples of microscopic configurations or observables, it is possible to extract information about evolutionary constraints and thus protein function and structure. Here we give an overview over some biologically important questions, and how statistical-mechanics inspired modeling approaches can help to answer them. Finally, we discuss some open questions, which we expect to be addressed over the next years.

Silencing the lettuce homologs of small rubber particle protein does not influence natural rubber biosynthesis in lettuce (Lactuca sativa).

Science.gov (United States)

Chakrabarty, Romit; Qu, Yang; Ro, Dae-Kyun

2015-05-01

Natural rubber, cis-1,4-polyisoprene, is an important raw material in chemical industries, but its biosynthetic mechanism remains elusive. Natural rubber is known to be synthesized in rubber particles suspended in laticifer cells in the Brazilian rubber tree (Hevea brasiliensis). In the rubber tree, rubber elongation factor (REF) and its homolog, small rubber particle protein (SRPP), were found to be the most abundant proteins in rubber particles, and they have been implicated in natural rubber biosynthesis. As lettuce (Lactuca sativa) can synthesize natural rubber, we utilized this annual, transformable plant to examine in planta roles of the lettuce REF/SRPP homologs by RNA interference. Among eight lettuce REF/SRPP homologs identified, transcripts of two genes (LsSRPP4 and LsSRPP8) accounted for more than 90% of total transcripts of REF/SRPP homologs in lettuce latex. LsSRPP4 displays a typical primary protein sequence as other REF/SRPP, while LsSRPP8 is twice as long as LsSRPP4. These two major LsSRPP transcripts were individually and simultaneously silenced by RNA interference, and relative abundance, polymer molecular weight, and polydispersity of natural rubber were analyzed from the LsSRPP4- and LsSRPP8-silenced transgenic lettuce. Despite previous data suggesting the implications of REF/SRPP in natural rubber biosynthesis, qualitative and quantitative alterations of natural rubber could not be observed in transgenic lettuce lines. It is concluded that lettuce REF/SRPP homologs are not critically important proteins in natural rubber biosynthesis in lettuce. Copyright © 2014 Elsevier Ltd. All rights reserved.

Down-regulation of the strawberry Bet v 1-homologous allergen in concert with the flavonoid biosynthesis pathway in colorless strawberry mutant

DEFF Research Database (Denmark)

Hjernø, Karin; Alm, Rikard; Canbäck, Björn

2006-01-01

Proteomic screening of strawberry (Fragaria ananassa) yielded a 58% success rate in protein identification in spite of the fact that no genomic sequence is available for this species. This was achieved by a combination of MALDI-MS/MS de novo sequencing of double-derivatized peptides and indel......-tolerant searching against local protein databases built on both EST and full-length nucleotide sequences. The amino acid sequence of a strawberry allergen, homologous to the well-known major birch pollen allergen Bet v 1, was partially determined. This strawberry allergen, named Fra a 1 according...... to the nomenclature for allergen proteins, showed sequence identity of 54 and 77%, respectively, with corresponding allergens from birch and apple. Differential expression, as evaluated by 2-D DIGE, occurred in 10% of protein spots when red strawberries were compared to a colorless (white) strawberry mutant. White...

A decline in transcript abundance for Heterodera glycines homologs of Caenorhabditis elegans uncoordinated genes accompanies its sedentary parasitic phase

Directory of Open Access Journals (Sweden)

Overall Christopher C

2007-04-01

Full Text Available Abstract Background Heterodera glycines (soybean cyst nematode [SCN], the major pathogen of Glycine max (soybean, undergoes muscle degradation (sarcopenia as it becomes sedentary inside the root. Many genes encoding muscular and neuromuscular components belong to the uncoordinated (unc family of genes originally identified in Caenorhabditis elegans. Previously, we reported a substantial decrease in transcript abundance for Hg-unc-87, the H. glycines homolog of unc-87 (calponin during the adult sedentary phase of SCN. These observations implied that changes in the expression of specific muscle genes occurred during sarcopenia. Results We developed a bioinformatics database that compares expressed sequence tag (est and genomic data of C. elegans and H. glycines (CeHg database. We identify H. glycines homologs of C. elegans unc genes whose protein products are involved in muscle composition and regulation. RT-PCR reveals the transcript abundance of H. glycines unc homologs at mobile and sedentary stages of its lifecycle. A prominent reduction in transcript abundance occurs in samples from sedentary nematodes for homologs of actin, unc-60B (cofilin, unc-89, unc-15 (paromyosin, unc-27 (troponin I, unc-54 (myosin, and the potassium channel unc-110 (twk-18. Less reduction is observed for the focal adhesion complex gene Hg-unc-97. Conclusion The CeHg bioinformatics database is shown to be useful in identifying homologs of genes whose protein products perform roles in specific aspects of H. glycines muscle biology. Our bioinformatics comparison of C. elegans and H. glycines genomic data and our Hg-unc-87 expression experiments demonstrate that the transcript abundance of specific H. glycines homologs of muscle gene decreases as the nematode becomes sedentary inside the root during its parasitic feeding stages.

CDNA encoding a polypeptide including a hevein sequence

Science.gov (United States)

Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

1995-03-21

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

I-SceI-mediated double-strand break does not increase the frequency of homologous recombination at the Dct locus in mouse embryonic stem cells.

Science.gov (United States)

Fenina, Myriam; Simon-Chazottes, Dominique; Vandormael-Pournin, Sandrine; Soueid, Jihane; Langa, Francina; Cohen-Tannoudji, Michel; Bernard, Bruno A; Panthier, Jean-Jacques

2012-01-01

Targeted induction of double-strand breaks (DSBs) at natural endogenous loci was shown to increase the rate of gene replacement by homologous recombination in mouse embryonic stem cells. The gene encoding dopachrome tautomerase (Dct) is specifically expressed in melanocytes and their precursors. To construct a genetic tool allowing the replacement of Dct gene by any gene of interest, we generated an embryonic stem cell line carrying the recognition site for the yeast I-SceI meganuclease embedded in the Dct genomic segment. The embryonic stem cell line was electroporated with an I-SceI expression plasmid, and a template for the DSB-repair process that carried sequence homologies to the Dct target. The I-SceI meganuclease was indeed able to introduce a DSB at the Dct locus in live embryonic stem cells. However, the level of gene targeting was not improved by the DSB induction, indicating a limited capacity of I-SceI to mediate homologous recombination at the Dct locus. These data suggest that homologous recombination by meganuclease-induced DSB may be locus dependent in mammalian cells.

Heteromorphic Sex Chromosomes: Navigating Meiosis without a Homologous Partner

OpenAIRE

Checchi, Paula M.; Engebrecht, JoAnne

2011-01-01

Accurate chromosome segregation during meiosis relies on homology between the maternal and paternal chromosomes. Yet by definition, sex chromosomes of the heterogametic sex lack a homologous partner. Recent studies in a number of systems have shed light on the unique meiotic behavior of heteromorphic sex chromosomes, and highlight both the commonalities and differences in divergent species. During meiotic prophase, the homology-dependent processes of pairing, synapsis, and recombination have ...

Induction and repair of DNA double strand breaks: The increasing spectrum of non-homologous end joining pathways

International Nuclear Information System (INIS)

Mladenov, Emil; Iliakis, George

2011-01-01

A defining characteristic of damage induced in the DNA by ionizing radiation (IR) is its clustered character that leads to the formation of complex lesions challenging the cellular repair mechanisms. The most widely investigated such complex lesion is the DNA double strand break (DSB). DSBs undermine chromatin stability and challenge the repair machinery because an intact template strand is lacking to assist restoration of integrity and sequence in the DNA molecule. Therefore, cells have evolved a sophisticated machinery to detect DSBs and coordinate a response on the basis of inputs from various sources. A central function of cellular responses to DSBs is the coordination of DSB repair. Two conceptually different mechanisms can in principle remove DSBs from the genome of cells of higher eukaryotes. Homologous recombination repair (HRR) uses as template a homologous DNA molecule and is therefore error-free; it functions preferentially in the S and G2 phases. Non-homologous end joining (NHEJ), on the other hand, simply restores DNA integrity by joining the two ends, is error prone as sequence is only fortuitously preserved and active throughout the cell cycle. The basis of DSB repair pathway choice remains unknown, but cells of higher eukaryotes appear programmed to utilize preferentially NHEJ. Recent work suggests that when the canonical DNA-PK dependent pathway of NHEJ (D-NHEJ), becomes compromised an alternative NHEJ pathway and not HRR substitutes in a quasi-backup function (B-NHEJ). Here, we outline aspects of DSB induction by IR and review the mechanisms of their processing in cells of higher eukaryotes. We place particular emphasis on backup pathways of NHEJ and summarize their increasing significance in various cellular processes, as well as their potential contribution to carcinogenesis.

Homologous Recombination between Genetically Divergent Campylobacter fetus Lineages Supports Host-Associated Speciation

Science.gov (United States)

Duim, Birgitta; van der Graaf-van Bloois, Linda; Wagenaar, Jaap A; Zomer, Aldert L

2018-01-01

Abstract Homologous recombination is a major driver of bacterial speciation. Genetic divergence and host association are important factors influencing homologous recombination. Here, we study these factors for Campylobacter fetus, which shows a distinct intraspecific host dichotomy. Campylobacter fetus subspecies fetus (Cff) and venerealis are associated with mammals, whereas C. fetus subsp. testudinum (Cft) is associated with reptiles. Recombination between these genetically divergent C. fetus lineages is extremely rare. Previously it was impossible to show whether this barrier to recombination was determined by the differential host preferences, by the genetic divergence between both lineages or by other factors influencing recombination, such as restriction-modification, CRISPR/Cas, and transformation systems. Fortuitously, a distinct C. fetus lineage (ST69) was found, which was highly related to mammal-associated C. fetus, yet isolated from a chelonian. The whole genome sequences of two C. fetus ST69 isolates were compared with those of mammal- and reptile-associated C. fetus strains for phylogenetic and recombination analysis. In total, 5.1–5.5% of the core genome of both ST69 isolates showed signs of recombination. Of the predicted recombination regions, 80.4% were most closely related to Cft, 14.3% to Cff, and 5.6% to C. iguaniorum. Recombination from C. fetus ST69 to Cft was also detected, but to a lesser extent and only in chelonian-associated Cft strains. This study shows that despite substantial genetic divergence no absolute barrier to homologous recombination exists between two distinct C. fetus lineages when occurring in the same host type, which provides valuable insights in bacterial speciation and evolution. PMID:29608720

ChickVD: a sequence variation database for the chicken genome

DEFF Research Database (Denmark)

Wang, Jing; He, Ximiao; Ruan, Jue

2005-01-01

Working in parallel with the efforts to sequence the chicken (Gallus gallus) genome, the Beijing Genomics Institute led an international team of scientists from China, USA, UK, Sweden, The Netherlands and Germany to map extensive DNA sequence variation throughout the chicken genome by sampling DN...... on quantitative trait loci using data from collaborating institutions and public resources. Our data can be queried by search engine and homology-based BLAST searches. ChickVD is publicly accessible at http://chicken.genomics.org.cn. Udgivelsesdato: 2005-Jan-1...

Draft genome sequence of the coccolithovirus Emiliania huxleyi virus 202.

Science.gov (United States)

Nissimov, Jozef I; Worthy, Charlotte A; Rooks, Paul; Napier, Johnathan A; Kimmance, Susan A; Henn, Matthew R; Ogata, Hiroyuki; Allen, Michael J

2012-02-01

Emiliania huxleyi virus 202 (EhV-202) is a member of the Coccolithoviridae, a group of viruses that infect the marine coccolithophorid Emiliania huxleyi. EhV-202 has a 160- to 180-nm-diameter icosahedral structure and a genome of approximately 407 kbp, consisting of 485 coding sequences (CDSs). Here we describe the genomic features of EhV-202, together with a draft genome sequence and its annotation, highlighting the homology and heterogeneity of this genome in comparison with the EhV-86 reference genome.

Design of Long Period Pseudo-Random Sequences from the Addition of -Sequences over

Directory of Open Access Journals (Sweden)

Ren Jian

2004-01-01

Full Text Available Pseudo-random sequence with good correlation property and large linear span is widely used in code division multiple access (CDMA communication systems and cryptology for reliable and secure information transmission. In this paper, sequences with long period, large complexity, balance statistics, and low cross-correlation property are constructed from the addition of -sequences with pairwise-prime linear spans (AMPLS. Using -sequences as building blocks, the proposed method proved to be an efficient and flexible approach to construct long period pseudo-random sequences with desirable properties from short period sequences. Applying the proposed method to , a signal set is constructed.

Dependence of the brittle ductile transition on strain-rate-dependent critical homologous temperature

Science.gov (United States)

Davis, Paul M.

2017-05-01

Earthquakes mainly occur in crust or mantle that is below a critical temperature for the tectonic strain-rate, \\dot{e}_t, such that stress builds up to the breaking point before it can relax due to creep. Then long-range stress correlation gives rise to power law seismicity including large events. The limiting temperature depends on pressure, which is taken into account by finding a critical homologous temperature THc = T/TM above which earthquakes are rarely observed (where T, TM are temperature and average melting temperature of constituent minerals). We find that THc for ocean plates is ∼0.55. For California earthquakes, it is also close to 0.55. The uppermost mantle layer of oceanic plates of thickness ∼50 km is composed of harzburgite and depleted peridotite from which basalt has been removed to form ocean crust. Thus it has a higher melting temperature than the peridotite of the surrounding mantle, or the lower halves of plates. Thicknesses of seismicity in deep subduction zones, determined from 2-D polynomial fits to a relocated catalogue, are ∼50 km, which suggests that the earthquake channel is confined to this layer. We construct models to find homologous temperatures in slabs, and find that seismicity thicknesses are also, on average, confined to TH ≤ 0.55 ± 0.05. The associated rheology is compared with that obtained from flexure models of ocean lithosphere. The brittle-ductile transition occurs where viscosity drops from high values in the cold cores of slabs to values of 1022-1023 Pa s, that is, where creep strain-rates become comparable to tectonic rates. The cut-off for deep earthquakes is not sharp. However they appear unlikely to occur if homologous temperature is high TH > 0.55. Exceptions to the rule are anomalously deep earthquakes such as those beneath the Iceland and the Hawaiian hotspots, and the Newport Inglewood Fault. These are smaller events with short-range stress correlation, and can be explained if strain-rates are two to

Comparative anatomy of the human APRT gene and enzyme: nucleotide sequence divergence and conservation of a nonrandom CpG dinucleotide arrangement

International Nuclear Information System (INIS)

Broderick, T.P.; Schaff, D.A.; Bertino, A.M.; Dush, M.K.; Tischfield, J.A.; Stambrook, P.J.

1987-01-01

The functional human adenine phosphoribosyltransferase (APRT) gene is <2.6 kilobases in length and contains five exons. The amino acid sequences of APRTs have been highly conserved throughout evolution. The human enzyme is 82%, 90%, and 40% identical to the mouse, hamster, and Escherichia coli enzymes, respectively. The promoter region of the human APRT gene, like that of several other housekeeping genes, lacks TATA and CCAAT boxes but contains five GC boxes that are potential binding sites for the Sp1 transcription factor. The distal three, however, are dispensable for gene expression. Comparison between human and mouse APRT gene nucleotide sequences reveals a high degree of homology within protein coding regions but an absence of significant homology in 5' flanking, 3' untranslated, and intron sequences, except for similarly positioned GC boxes in the promoter region and a 26-base-pair region in intron 3. This 26-base-pair sequence is 92% identical with a similarly positioned sequence in the mouse gene and is also found in intron 3 of the hamster gene, suggesting that its retention may be a consequence of stringent selection. The positions of all introns have been precisely retained in the human and both rodent genes. Retention of an elevated CpG dinucleotide content, despite loss of sequence homology, suggests that there may be selection for CpG dinucleotides in these regions and that their maintenance may be important for APRT gene function

Homologous Recombination as a Replication Fork Escort: Fork-Protection and Recovery

Directory of Open Access Journals (Sweden)

Audrey Costes

2012-12-01

Full Text Available Homologous recombination is a universal mechanism that allows DNA repair and ensures the efficiency of DNA replication. The substrate initiating the process of homologous recombination is a single-stranded DNA that promotes a strand exchange reaction resulting in a genetic exchange that promotes genetic diversity and DNA repair. The molecular mechanisms by which homologous recombination repairs a double-strand break have been extensively studied and are now well characterized. However, the mechanisms by which homologous recombination contribute to DNA replication in eukaryotes remains poorly understood. Studies in bacteria have identified multiple roles for the machinery of homologous recombination at replication forks. Here, we review our understanding of the molecular pathways involving the homologous recombination machinery to support the robustness of DNA replication. In addition to its role in fork-recovery and in rebuilding a functional replication fork apparatus, homologous recombination may also act as a fork-protection mechanism. We discuss that some of the fork-escort functions of homologous recombination might be achieved by loading of the recombination machinery at inactivated forks without a need for a strand exchange step; as well as the consequence of such a model for the stability of eukaryotic genomes.

Cloning Should Be Simple: Escherichia coli DH5α-Mediated Assembly of Multiple DNA Fragments with Short End Homologies

Science.gov (United States)

Richardson, Ruth E.; Suzuki, Yo

2015-01-01

Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six double-stranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processes associated with most common applications of DNA assembly. We demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work. PMID:26348330

A geometric model for Hochschild homology of Soergel bimodules

DEFF Research Database (Denmark)

Webster, Ben; Williamson, Geordie

2008-01-01

An important step in the calculation of the triply graded link homology of Khovanov and Rozansky is the determination of the Hochschild homology of Soergel bimodules for SL(n). We present a geometric model for this Hochschild homology for any simple group G, as B–equivariant intersection cohomology...... on generators whose degree is explicitly determined by the geometry of the orbit closure, and to describe its Hilbert series, proving a conjecture of Jacob Rasmussen....

Nicotiana small RNA sequences support a host genome origin of cucumber mosaic virus satellite RNA.

Directory of Open Access Journals (Sweden)

Kiran Zahid

2015-01-01

Full Text Available Satellite RNAs (satRNAs are small noncoding subviral RNA pathogens in plants that depend on helper viruses for replication and spread. Despite many decades of research, the origin of satRNAs remains unknown. In this study we show that a β-glucuronidase (GUS transgene fused with a Cucumber mosaic virus (CMV Y satellite RNA (Y-Sat sequence (35S-GUS:Sat was transcriptionally repressed in N. tabacum in comparison to a 35S-GUS transgene that did not contain the Y-Sat sequence. This repression was not due to DNA methylation at the 35S promoter, but was associated with specific DNA methylation at the Y-Sat sequence. Both northern blot hybridization and small RNA deep sequencing detected 24-nt siRNAs in wild-type Nicotiana plants with sequence homology to Y-Sat, suggesting that the N. tabacum genome contains Y-Sat-like sequences that give rise to 24-nt sRNAs capable of guiding RNA-directed DNA methylation (RdDM to the Y-Sat sequence in the 35S-GUS:Sat transgene. Consistent with this, Southern blot hybridization detected multiple DNA bands in Nicotiana plants that had sequence homology to Y-Sat, suggesting that Y-Sat-like sequences exist in the Nicotiana genome as repetitive DNA, a DNA feature associated with 24-nt sRNAs. Our results point to a host genome origin for CMV satRNAs, and suggest novel approach of using small RNA sequences for finding the origin of other satRNAs.

Molecular cloning of a human glycophorin B cDNA: nucleotide sequence and genomic relationship to glycophorin A

International Nuclear Information System (INIS)

Siebert, P.D.; Fukuda, M.

1987-01-01

The authors describe the isolation and nucleotide sequence of a human glycophorin B cDNA. The cDNA was identified by differential hybridization of synthetic oligonucleotide probes to a human erythroleukemic cell line (K562) cDNA library constructed in phage vector λgt10. The nucleotide sequence of the glycophorin B cDNA was compared with that of a previously cloned glycophorin A cDNA. The nucleotide sequences encoding the NH 2 -terminal leader peptide and first 26 amino acids of the two proteins are nearly identical. This homologous region is followed by areas specific to either glycophorin A or B and a number of small regions of homology, which in turn are followed by a very homologous region encoding the presumed membrane-spanning portion of the proteins. They used RNA blot hybridization with both cDNA and synthetic oligonucleotide probes to prove our previous hypothesis that glycophorin B is encoded by a single 0.5- to 0.6-kb mRNA and to show that glycophorins A and B are negatively and coordinately regulated by a tumor-promoting phorbol ester, phorbol 12-myristate 13-acetate. They established the intron/exon structure of the glycophorin A and B genes by oligonucleotide mapping; the results suggest a complex evolution of the glycophorin genes

VITAL NMR: using chemical shift derived secondary structure information for a limited set of amino acids to assess homology model accuracy

Energy Technology Data Exchange (ETDEWEB)

Brothers, Michael C.; Nesbitt, Anna E.; Hallock, Michael J. [University of Illinois at Urbana-Champaign, Department of Chemistry (United States); Rupasinghe, Sanjeewa G. [University of Illinois at Urbana-Champaign, Department of Cell and Developmental Biology (United States); Tang Ming [University of Illinois at Urbana-Champaign, Department of Chemistry (United States); Harris, Jason; Baudry, Jerome [University of Tennessee, Department of Biochemistry, Cellular and Molecular Biology (United States); Schuler, Mary A. [University of Illinois at Urbana-Champaign, Department of Cell and Developmental Biology (United States); Rienstra, Chad M., E-mail: rienstra@illinois.edu [University of Illinois at Urbana-Champaign, Department of Chemistry (United States)

2012-01-15

Homology modeling is a powerful tool for predicting protein structures, whose success depends on obtaining a reasonable alignment between a given structural template and the protein sequence being analyzed. In order to leverage greater predictive power for proteins with few structural templates, we have developed a method to rank homology models based upon their compliance to secondary structure derived from experimental solid-state NMR (SSNMR) data. Such data is obtainable in a rapid manner by simple SSNMR experiments (e.g., {sup 13}C-{sup 13}C 2D correlation spectra). To test our homology model scoring procedure for various amino acid labeling schemes, we generated a library of 7,474 homology models for 22 protein targets culled from the TALOS+/SPARTA+ training set of protein structures. Using subsets of amino acids that are plausibly assigned by SSNMR, we discovered that pairs of the residues Val, Ile, Thr, Ala and Leu (VITAL) emulate an ideal dataset where all residues are site specifically assigned. Scoring the models with a predicted VITAL site-specific dataset and calculating secondary structure with the Chemical Shift Index resulted in a Pearson correlation coefficient (-0.75) commensurate to the control (-0.77), where secondary structure was scored site specifically for all amino acids (ALL 20) using STRIDE. This method promises to accelerate structure procurement by SSNMR for proteins with unknown folds through guiding the selection of remotely homologous protein templates and assessing model quality.

VITAL NMR: Using Chemical Shift Derived Secondary Structure Information for a Limited Set of Amino Acids to Assess Homology Model Accuracy

Energy Technology Data Exchange (ETDEWEB)

Brothers, Michael C [University of Illinois, Urbana-Champaign; Nesbitt, Anna E [University of Illinois, Urbana-Champaign; Hallock, Michael J [University of Illinois, Urbana-Champaign; Rupasinghe, Sanjeewa [University of Illinois, Urbana-Champaign; Tang, Ming [University of Illinois, Urbana-Champaign; Harris, Jason B [ORNL; Baudry, Jerome Y [ORNL; Schuler, Mary A [University of Illinois, Urbana-Champaign; Rienstra, Chad M [University of Illinois, Urbana-Champaign

2011-01-01

Homology modeling is a powerful tool for predicting protein structures, whose success depends on obtaining a reasonable alignment between a given structural template and the protein sequence being analyzed. In order to leverage greater predictive power for proteins with few structural templates, we have developed a method to rank homology models based upon their compliance to secondary structure derived from experimental solid-state NMR (SSNMR) data. Such data is obtainable in a rapid manner by simple SSNMR experiments (e.g., (13)C-(13)C 2D correlation spectra). To test our homology model scoring procedure for various amino acid labeling schemes, we generated a library of 7,474 homology models for 22 protein targets culled from the TALOS+/SPARTA+ training set of protein structures. Using subsets of amino acids that are plausibly assigned by SSNMR, we discovered that pairs of the residues Val, Ile, Thr, Ala and Leu (VITAL) emulate an ideal dataset where all residues are site specifically assigned. Scoring the models with a predicted VITAL site-specific dataset and calculating secondary structure with the Chemical Shift Index resulted in a Pearson correlation coefficient (-0.75) commensurate to the control (-0.77), where secondary structure was scored site specifically for all amino acids (ALL 20) using STRIDE. This method promises to accelerate structure procurement by SSNMR for proteins with unknown folds through guiding the selection of remotely homologous protein templates and assessing model quality.

Homology of normal chains and cohomology of charges

CERN Document Server

Pauw, Th De; Pfeffer, W F

2017-01-01

The authors consider a category of pairs of compact metric spaces and Lipschitz maps where the pairs satisfy a linearly isoperimetric condition related to the solvability of the Plateau problem with partially free boundary. It includes properly all pairs of compact Lipschitz neighborhood retracts of a large class of Banach spaces. On this category the authors define homology and cohomology functors with real coefficients which satisfy the Eilenberg-Steenrod axioms, but reflect the metric properties of the underlying spaces. As an example they show that the zero-dimensional homology of a space in our category is trivial if and only if the space is path connected by arcs of finite length. The homology and cohomology of a pair are, respectively, locally convex and Banach spaces that are in duality. Ignoring the topological structures, the homology and cohomology extend to all pairs of compact metric spaces. For locally acyclic spaces, the authors establish a natural isomorphism between their cohomology and the �...

The N-terminal sequence of ribosomal protein L10 from the archaebacterium Halobacterium marismortui and its relationship to eubacterial protein L6 and other ribosomal proteins.

Science.gov (United States)

Dijk, J; van den Broek, R; Nasiulas, G; Beck, A; Reinhardt, R; Wittmann-Liebold, B

1987-08-01

The amino-terminal sequence of ribosomal protein L10 from Halobacterium marismortui has been determined up to residue 54, using both a liquid- and a gas-phase sequenator. The two sequences are in good agreement. The protein is clearly homologous to protein HcuL10 from the related strain Halobacterium cutirubrum. Furthermore, a weaker but distinct homology to ribosomal protein L6 from Escherichia coli and Bacillus stearothermophilus can be detected. In addition to 7 identical amino acids in the first 36 residues in all four sequences a number of conservative replacements occurs, of mainly hydrophobic amino acids. In this common region the pattern of conserved amino acids suggests the presence of a beta-alpha fold as it occurs in ribosomal proteins L12 and L30. Furthermore, several potential cases of homology to other ribosomal components of the three ur-kingdoms have been found.

Development and Testing of New Gene-Homologous EST-SSRs for Eucalyptus gomphocephala (Myrtaceae

Directory of Open Access Journals (Sweden)

Donna Bradbury

2013-07-01

Full Text Available Premise of the study: New microsatellite (simple sequence repeat [SSR] primers were developed from Eucalyptus expressed sequence tags (ESTs and optimized for genetic studies of the southwestern Australian tree E. gomphocephala, which is severely impacted by tree health decline and habitat fragmentation. Methods and Results: A total of 133 gene-homologous EST-SSR primer pairs were designed for Eucalyptus, and 44 were screened in E. gomphocephala. Of these, 17 produced reliable amplification products and 11 were polymorphic. Between two and 13 alleles were observed per locus, and observed heterozygosities ranged from 0.172 to 0.867. All 17 EST-SSRs that amplified E. gomphocephala cross-amplified to at least one of E. marginata, E. camaldulensis, and E. victrix. Conclusions: This set of EST-SSR primer pairs will be valuable tools for future population genetic studies of E. gomphocephala and other eucalypts, particularly for studying gene-linked variation and informing seed-sourcing strategies for ecological restoration.

Alignment of Short Reads: A Crucial Step for Application of Next-Generation Sequencing Data in Precision Medicine

Directory of Open Access Journals (Sweden)

Hao Ye

2015-11-01

Full Text Available Precision medicine or personalized medicine has been proposed as a modernized and promising medical strategy. Genetic variants of patients are the key information for implementation of precision medicine. Next-generation sequencing (NGS is an emerging technology for deciphering genetic variants. Alignment of raw reads to a reference genome is one of the key steps in NGS data analysis. Many algorithms have been developed for alignment of short read sequences since 2008. Users have to make a decision on which alignment algorithm to use in their studies. Selection of the right alignment algorithm determines not only the alignment algorithm but also the set of suitable parameters to be used by the algorithm. Understanding these algorithms helps in selecting the appropriate alignment algorithm for different applications in precision medicine. Here, we review current available algorithms and their major strategies such as seed-and-extend and q-gram filter. We also discuss the challenges in current alignment algorithms, including alignment in multiple repeated regions, long reads alignment and alignment facilitated with known genetic variants.

The nucleotide sequence of human transition protein 1 cDNA

Energy Technology Data Exchange (ETDEWEB)

Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)

1988-08-11

The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.

Lion (Panthera leo) and cheetah (Acinonyx jubatus) IFN-gamma sequences.

Science.gov (United States)

Maas, Miriam; Van Rhijn, Ildiko; Allsopp, Maria T E P; Rutten, Victor P M G

2010-04-15

Cloning and sequencing of the full length lion and cheetah interferon-gamma (IFN-gamma) transcript will enable the expression of the recombinant cytokine, to be used for production of monoclonal antibodies and to set up lion and cheetah-specific IFN-gamma ELISAs. These are relevant in blood-based diagnosis of bovine tuberculosis, an important threat to lions in the Kruger National Park. Alignment of nucleotide and amino acid sequences of lion and cheetah and that of domestic cats showed homologies of 97-100%. Copyright 2009 Elsevier B.V. All rights reserved.

Identification of three homologous latex-clearing protein (lcp) genes from the genome of Streptomyces sp. strain CFMR 7.

Science.gov (United States)

Nanthini, Jayaram; Ong, Su Yean; Sudesh, Kumar

2017-09-10

Rubber materials have greatly contributed to human civilization. However, being a polymeric material does not decompose easily, it has caused huge environmental problems. On the other hand, only few bacteria are known to degrade rubber, with studies pertaining them being intensively focusing on the mechanism involved in microbial rubber degradation. The Streptomyces sp. strain CFMR 7, which was previously confirmed to possess rubber-degrading ability, was subjected to whole genome sequencing using the single molecule sequencing technology of the PacBio® RS II system. The genome was further analyzed and compared with previously reported rubber-degrading bacteria in order to identify the potential genes involved in rubber degradation. This led to the interesting discovery of three homologues of latex-clearing protein (Lcp) on the chromosome of this strain, which are probably responsible for rubber degrading activities. Genes encoding oxidoreductase α-subunit (oxiA) and oxidoreductase β-subunit (oxiB) were also found downstream of two lcp genes which are located adjacent to each other. In silico analysis reveals genes that have been identified to be involved in the microbial degradation of rubber in the Streptomyces sp. strain CFMR 7. This is the first whole genome sequence of a clear-zone-forming natural rubber- degrading Streptomyces sp., which harbours three Lcp homologous genes with the presence of oxiA and oxiB genes compared to the previously reported Gordonia polyisoprenivorans strain VH2 (with two Lcp homologous genes) and Nocardia nova SH22a (with only one Lcp gene). Copyright © 2017 Elsevier B.V. All rights reserved.

Antibodies against homologous microbial caseinolytic proteases P characterise primary biliary cirrhosis.

Science.gov (United States)

Bogdanos, Dimitrios-Petrou; Baum, Harold; Sharma, Umesh C; Grasso, Alessandro; Ma, Yun; Burroughs, Andrew K; Vergani, Diego

2002-01-01

Antibodies to caseinolytic protease P(177-194) (ClpP(177-194)) of the proteolytic subunit of the Clp complex of Escherichia coli (E. coli) are uniquely present in primary biliary cirrhosis (PBC). Molecular mimicry between the regulatory subunit ClpX and the principal T-cell epitope of pyruvate dehydrogenase complex (PDC-E2) in PBC, has been proposed to account for this. Since ClpP is highly conserved among bacteria we investigated whether the micro-organisms triggering these antibodies may be other than E. coli. E. coli ClpP(177-194) is homologous with ClpP peptides of Yersinia enterocolitica (YEREN) and Haemophilus influenzae (HAEIN). Enzyme linked immunosorbent assay (ELISA) reactivity to these peptides was tested in 45 patients with PBC, 44 pathological and 32 healthy controls. Reactivity to at least one of the ClpP peptides was observed in 21 (47%) PBC patients, 5.8% pathological and 3.1% healthy controls (PECOLI ClpP(177-194), alone or in association with YEREN and/or HAEIN peptides, compared to three (14.2%) reactive with YEREN, two (9.5%) with YEREN/HAEIN and one (4.7%) with HAEIN peptide. Simultaneous reactivity to homologous sequences was due to cross-reactivity as confirmed by competition ELISAs. The PBC-specificity of anti-microbial ClpP reactivity is confirmed: the questions as to primary trigger(s) and relevance to PBC pathogenesis remain open.

(D,A)∞-modules over (D,A)∞-algebras and spectral sequences

International Nuclear Information System (INIS)

Lapin, S V

2002-01-01

We introduce the construction of a (D,A) ∞ -(co)module over a (D,A) ∞ -(co) algebra and study its main homotopy properties. We establish a connection between (D,A) ∞ -(co)modules over (D,A) ∞ -(co)algebras and spectral sequences, and thus obtain the structure of an A ∞ -comodule over the Milnor A ∞ -coalgebra on the homology of any spectrum directly from the differentials of the Adams spectral sequence of this spectrum

Complete Genome Sequences of Four Isolates of Plutella xylostella Granulovirus.

Science.gov (United States)

Spence, Robert J; Noune, Christopher; Hauxwell, Caroline

2016-06-30

Granuloviruses are widespread pathogens of Plutella xylostella L. (diamondback moth) and potential biopesticides for control of this global insect pest. We report the complete genomes of four Plutella xylostella granulovirus isolates from China, Malaysia, and Taiwan exhibiting pairs of noncoding, homologous repeat regions with significant sequence variation but equivalent length. Copyright © 2016 Spence et al.

The K Domain Mediates Homologous and Heterologous Interactions Between FLC and SVP Proteins of Brassica juncea

Directory of Open Access Journals (Sweden)

Ma Guanpeng

2015-07-01

Full Text Available The transcription factors FLOWERING LOCUS C (FLC and SHORT VEGETATIVE PHASE (SVP can interact to form homologous and heterologous protein complexes that regulate flowering time in Brassica juncea Coss. (Mustard.Previous studies showed that protein interactions were mediated by the K domain, which contains the subdomains K1, K2 and K3. However, it remains unknown how the subdomains mediate the interactions between FLC and SVP. In the present study, we constructed several mutants of subdomains K1–K3 and investigated the mechanisms involved in the heterologous interaction of BjFLC/BjSVP and in the homologous interaction of BjFLC/BjFLC or BjSVP/BjSVP. Yeast two-hybrid and β-Galactosidase activity assays showed that the 19 amino acids of the K1 subdomain in BjSVP and the 17 amino acids of the K1 subdomain in BjFLC were functional subdomains that interact with each other to mediate hetero-dimerization. The heterologous interaction was enhanced by the K2 subdomain of BjSVP protein, but weakened by its interhelical domain L2. The heterologous interaction was also enhanced by the K2 subdomain of BjFLC protein, but weakened by its K3 subdomain. The homologous interaction of BjSVP was mediated by the full K-domain. However, the homologous interaction of BjFLC was regulated only by its K1 and weakened by its K2 and K3 subdomains. The results provided new insights into the interactions between FLC and SVP, which will be valuable for further studies on the molecular regulation mechanisms of the regulation of flowering time in B. juncea and other Brassicaceae.

The complete nucleotide sequence, genome organization, and origin of human adenovirus type 11

International Nuclear Information System (INIS)

Stone, Daniel; Furthmann, Anne; Sandig, Volker; Lieber, Andre

2003-01-01

The complete DNA sequence and transcription map of human adenovirus type 11 are reported here. This is the first published sequence for a subgenera B human adenovirus and demonstrates a genome organization highly similar to those of other human adenoviruses. All of the genes from the early, intermediate, and late regions are present in the expected locations of the genome for a human adenovirus. The genome size is 34,794 bp in length and has a GC content of 48.9%. Sequence alignment with genomes of groups A (Ad12), C (Ad5), D (Ad17), E (Simian adenovirus 25), and F (Ad40) revealed homologies of 64, 54, 68, 75, and 52%, respectively. Detailed genomic analysis demonstrated that Ads 11 and 35 are highly conserved in all areas except the hexon hypervariable regions and fiber. Similarly, comparison of Ad11 with subgroup E SAV25 revealed poor homology between fibers but high homology in proteins encoded by all other areas of the genome. We propose an evolutionary model in which functional viruses can be reconstituted following fiber substitution from one serotype to another. According to this model either the Ad11 genome is a derivative of Ad35, from which the fiber was substituted with Ad7, or the Ad35 genome is the product of a fiber substitution from Ad21 into the Ad11 genome. This model also provides a possible explanation for the origin of group E Ads, which are evolutionarily derived from a group C fiber substitution into a group B genome

Several aspects of some techniques avoiding homologous blood transfusions

NARCIS (Netherlands)

E.C.S.M. van Woerkens (Liesbeth)

1998-01-01

textabstractThe use of homologous blood products during anesthesia and surgery is not without risks. Complications due to homologous blood transfusions include transfusion reactions, isosensitization, transmission of infections (including HIV, hepatitis, CMV) and immunosuppression (resuiting in

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

2000-07-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

1999-05-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

1999-05-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

1995-03-21

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

Nucleotide sequences of two cellulase genes from alkalophilic Bacillus sp. strain N-4 and their strong homology.

OpenAIRE

Fukumori, F; Sashihara, N; Kudo, T; Horikoshi, K

1986-01-01

Two genes for cellulases of alkalophilic Bacillus sp. strain N-4 (ATCC 21833) have been sequenced. From the DNA sequences the cellulases encoded in the plasmids pNK1 and pNK2 consist of 488 and 409 amino acids, respectively. The DNA and protein sequences of the pNK1-encoded cellulase are related to those of the pNK2-encoded cellulase. The pNK2-encoded cellulase lacks the direct repeat sequence of a stretch of 60 amino acids near the C-terminal end of the pNK1-encoded cellulase. The duplicatio...

Multiple evolutionary events involved in maintaining homologs of Resistance to Powdery Mildew 8 in Brassica napus

Directory of Open Access Journals (Sweden)

Qin Li

2016-07-01

Full Text Available The Resistance to Powdery Mildew 8 (RPW8 locus confers broad-spectrum resistance to powdery mildew in Arabidopsis thaliana. There are four Homologous to RPW8s (BrHRs in Brassica rapa and three in B. oleracea (BoHRs. B. napus (Bn is derived from diploidization of a hybrid between B. rapa and B. oleracea, thus should have seven homologs of RPW8 (BnHRs. It is unclear whether these genes are still maintained or lost in B. napus after diploidization and how they might have been evolved. Here we reported the identification and sequence polymorphisms of BnHRs from a set of B. napus accessions. Our data indicated that while the BoHR copy from B. oleracea is highly conserved, the BrHR copy from B. rapa is relatively variable in the B. napus genome owing to multiple evolutionary events, such as gene loss, point mutation, insertion, deletion and intragenic recombination. Given the overall high sequence homology of BnHR genes, it is not surprising that both intragenic recombination between two orthologs and two paralogs were detected in B. napus, which may explain the loss of BoHR genes in some B. napus accessions. When ectopically expressed in Arabidopsis, a C-terminally truncated version of BnHRa and BnHRb, as well as the full length BnHRd fused with YFP at their C-termini could trigger cell death in the absence of pathogens and enhanced resistance to powdery mildew disease. Moreover, subcellular localization analysis showed that both BnHRa-YFP and BnHRb-YFP were mainly localized to the extra-haustorial membrane (EHM encasing the haustorium of powdery mildew. Taken together, our data suggest that the duplicated BnHR genes might have been subjected to differential selection and at least some may play a role in defense and could serve as resistance resource in engineering disease-resistant plants.

SPOT-ligand 2: improving structure-based virtual screening by binding-homology search on an expanded structural template library.

Science.gov (United States)

Litfin, Thomas; Zhou, Yaoqi; Yang, Yuedong

2017-04-15

The high cost of drug discovery motivates the development of accurate virtual screening tools. Binding-homology, which takes advantage of known protein-ligand binding pairs, has emerged as a powerful discrimination technique. In order to exploit all available binding data, modelled structures of ligand-binding sequences may be used to create an expanded structural binding template library. SPOT-Ligand 2 has demonstrated significantly improved screening performance over its previous version by expanding the template library 15 times over the previous one. It also performed better than or similar to other binding-homology approaches on the DUD and DUD-E benchmarks. The server is available online at http://sparks-lab.org . yaoqi.zhou@griffith.edu.au or yuedong.yang@griffith.edu.au. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Khovanov homology for virtual knots with arbitrary coefficients

International Nuclear Information System (INIS)

Manturov, Vassily O

2007-01-01

The Khovanov homology theory over an arbitrary coefficient ring is extended to the case of virtual knots. We introduce a complex which is well-defined in the virtual case and is homotopy equivalent to the original Khovanov complex in the classical case. Unlike Khovanov's original construction, our definition of the complex does not use any additional prescription of signs to the edges of a cube. Moreover, our method enables us to construct a Khovanov homology theory for 'twisted virtual knots' in the sense of Bourgoin and Viro (including knots in three-dimensional projective space). We generalize a number of results of Khovanov homology theory (the Wehrli complex, minimality problems, Frobenius extensions) to virtual knots with non-orientable atoms

DNA damage, homology-directed repair, and DNA methylation.

Directory of Open Access Journals (Sweden)

Concetta Cuozzo

2007-07-01

Full Text Available To explore the link between DNA damage and gene silencing, we induced a DNA double-strand break in the genome of Hela or mouse embryonic stem (ES cells using I-SceI restriction endonuclease. The I-SceI site lies within one copy of two inactivated tandem repeated green fluorescent protein (GFP genes (DR-GFP. A total of 2%-4% of the cells generated a functional GFP by homology-directed repair (HR and gene conversion. However, approximately 50% of these recombinants expressed GFP poorly. Silencing was rapid and associated with HR and DNA methylation of the recombinant gene, since it was prevented in Hela cells by 5-aza-2'-deoxycytidine. ES cells deficient in DNA methyl transferase 1 yielded as many recombinants as wild-type cells, but most of these recombinants expressed GFP robustly. Half of the HR DNA molecules were de novo methylated, principally downstream to the double-strand break, and half were undermethylated relative to the uncut DNA. Methylation of the repaired gene was independent of the methylation status of the converting template. The methylation pattern of recombinant molecules derived from pools of cells carrying DR-GFP at different loci, or from an individual clone carrying DR-GFP at a single locus, was comparable. ClustalW analysis of the sequenced GFP molecules in Hela and ES cells distinguished recombinant and nonrecombinant DNA solely on the basis of their methylation profile and indicated that HR superimposed novel methylation profiles on top of the old patterns. Chromatin immunoprecipitation and RNA analysis revealed that DNA methyl transferase 1 was bound specifically to HR GFP DNA and that methylation of the repaired segment contributed to the silencing of GFP expression. Taken together, our data support a mechanistic link between HR and DNA methylation and suggest that DNA methylation in eukaryotes marks homologous recombined segments.

Comparative Analysis of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) of Streptococcus thermophilus St-I and its Bacteriophage-Insensitive Mutants (BIM) Derivatives.

Science.gov (United States)

Li, Wan; Bian, Xin; Evivie, Smith Etareri; Huo, Gui-Cheng

2016-09-01

The CRISPR-Cas (CRISPR together with CRISPR-associated proteins) modules are the adaptive immune system, acting as an adaptive and heritable immune system in bacteria and archaea. CRISPR-based immunity acts by integrating short virus sequences in the cell's CRISPR locus, allowing the cell to remember, recognize, and clear infections. In this study, the homology of CRISPRs sequence in BIMs (bacteriophage-insensitive mutants) of Streptococcus thermophilus St-I were analyzed. Secondary structures of the repeats and the PAMs (protospacer-associated motif) of each CRISPR locus were also predicted. Results showed that CRISPR1 has 27 repeat-spacer units, 5 of them had duplicates; CRISPR2 has one repeat-spacer unit; CRISPR3 has 28 repeat-spacer units. Only BIM1 had a new spacer acquisition in CRISPR3, while BIM2 and BIM3 had no new spacers' insertion, thus indicating that while most CRISPR1 were more active than CRISPR3, new spacer acquisition occurred just in CRSPR3 in some situations. These findings will help establish the foundation for the study of CRSPR-Cas systems in lactic acid bacteria.

Activation of the polyomavirus enhancer by a murine activator protein 1 (AP1) homolog and two contiguous proteins.

OpenAIRE

Martin, M E; Piette, J; Yaniv, M; Tang, W J; Folk, W R

1988-01-01

The polyomavirus enhancer is composed of multiple DNA sequence elements serving as binding sites for proteins present in mouse nuclear extracts that activate transcription and DNA replication. We have identified three such proteins and their binding sites and correlate them with enhancer function. Mutation of nucleotide (nt) 5140 in the enhancer alters the binding site (TGACTAA, nt 5139-5145) for polyomavirus enhancer A binding protein 1 (PEA1), a murine homolog of the human transcription fac...

Homology analysis and cross-immunogenicity of OmpA from pathogenic Yersinia enterocolitica, Yersinia pseudotuberculosis and Yersinia pestis.

Science.gov (United States)

Chen, Yuhuang; Duan, Ran; Li, Xu; Li, Kewei; Liang, Junrong; Liu, Chang; Qiu, Haiyan; Xiao, Yuchun; Jing, Huaiqi; Wang, Xin

2015-12-01

The outer membrane protein A (OmpA) is one of the intra-species conserved proteins with immunogenicity widely found in the family of Enterobacteriaceae. Here we first confirmed OmpA is conserved in the three pathogenic Yersinia: Yersinia pestis, Yersinia pseudotuberculosis and pathogenic Yersinia enterocolitica, with high homology at the nucleotide level and at the amino acid sequence level. The identity of ompA sequences for 262 Y. pestis strains, 134 Y. pseudotuberculosis strains and 219 pathogenic Y. enterocolitica strains are 100%, 98.8% and 97.7% similar. The main pattern of OmpA of pathogenic Yersinia are 86.2% and 88.8% identical at the nucleotide and amino acid sequence levels, respectively. Immunological analysis showed the immunogenicity of each OmpA and cross-immunogenicity of OmpA for pathogenic Yersinia where OmpA may be a vaccine candidate for Y. pestis and other pathogenic Yersinia. Copyright © 2015 Elsevier Ltd. All rights reserved.

Parametric representation of centrifugal pump homologous curves

International Nuclear Information System (INIS)

Veloso, Marcelo A.; Mattos, Joao R.L. de

2015-01-01

Essential for any mathematical model designed to simulate flow transient events caused by pump operations is the pump performance data. The performance of a centrifugal pump is characterized by four basic quantities: the rotational speed, the volumetric flow rate, the dynamic head, and the hydraulic torque. The curves showing the relationships between these four variables are called the pump characteristic curves. The characteristic curves are empirically developed by the pump manufacturer and uniquely describe head and torque as functions of volumetric flow rate and rotation speed. Because of comprising a large amount of points, this configuration is not suitable for computational purposes. However, it can be converted to a simpler form by the development of the homologous curves, in which dynamic head and hydraulic torque ratios are expressed as functions of volumetric flow and rotation speed ratios. The numerical use of the complete set of homologous curves requires specification of sixteen partial curves, being eight for the dynamic head and eight for the hydraulic torque. As a consequence, the handling of homologous curves is still somewhat complicated. In solving flow transient problems that require the pump characteristic data for all the operation zones, the parametric form appears as the simplest way to deal with the homologous curves. In this approach, the complete characteristics of a pump can be described by only two closed curves, one for the dynamic head and other for the hydraulic torque, both in function of a single angular coordinate defined adequately in terms of the quotient between volumetric flow ratio and rotation speed ratio. The usefulness and advantages of this alternative method are demonstrated through a practical example in which the homologous curves for a pump of the type used in the main coolant loops of a pressurized water reactor (PWR) are transformed to the parametric form. (author)

Gene repair of an Usher syndrome causing mutation by zinc-finger nuclease mediated homologous recombination.

Science.gov (United States)

Overlack, Nora; Goldmann, Tobias; Wolfrum, Uwe; Nagel-Wolfrum, Kerstin

2012-06-26

Human Usher syndrome (USH) is the most frequent cause of inherited deaf-blindness. It is clinically and genetically heterogeneous, assigned to three clinical types of which the most severe type is USH1. No effective treatment for the ophthalmic component of USH exists. Gene augmentation is an attractive strategy for hereditary retinal diseases. However, several USH genes, like USH1C, are expressed in various isoforms, hampering gene augmentation. As an alternative treatment strategy, we applied the zinc-finger nuclease (ZFN) technology for targeted gene repair of an USH1C, causing mutation by homologous recombination. We designed ZFNs customized for the p.R31X nonsense mutation in Ush1c. We evaluated ZFNs for DNA cleavage capability and analyzed ZFNs biocompatibilities by XTT assays. We demonstrated ZFNs mediated gene repair on genomic level by digestion assays and DNA sequencing, and on protein level by indirect immunofluorescence and Western blot analyses. The specifically designed ZFNs did not show cytotoxic effects in a p.R31X cell line. We demonstrated that ZFN induced cleavage of their target sequence. We showed that simultaneous application of ZFN and rescue DNA induced gene repair of the disease-causing mutation on the genomic level, resulting in recovery of protein expression. In our present study, we analyzed for the first time ZFN-activated gene repair of an USH gene. The data highlight the ability of ZFNs to induce targeted homologous recombination and mediate gene repair in USH. We provide further evidence that the ZFN technology holds great potential to recover disease-causing mutations in inherited retinal disorders.

Primary homologies of the circumorbital bones of snakes.

Science.gov (United States)

Palci, Alessandro; Caldwell, Michael W

2013-09-01

Some snakes have two circumorbital ossifications that in the current literature are usually referred to as the postorbital and supraorbital. We review the arguments that have been proposed to justify this interpretation and provide counter-arguments that reject those conjectures of primary homology based on the observation of 32 species of lizards and 81 species of snakes (both extant and fossil). We present similarity arguments, both topological and structural, for reinterpretation of the primary homologies of the dorsal and posterior orbital ossifications of snakes. Applying the test of similarity, we conclude that the posterior orbital ossification of snakes is topologically consistent as the homolog of the lacertilian jugal, and that the dorsal orbital ossification present in some snakes (e.g., pythons, Loxocemus, and Calabaria) is the homolog of the lacertilian postfrontal. We therefore propose that the terms postorbital and supraorbital should be abandoned as reference language for the circumorbital bones of snakes, and be replaced with the terms jugal and postfrontal, respectively. The primary homology claim for the snake "postorbital" fails the test of similarity, while the term "supraorbital" is an unnecessary and inaccurate application of the concept of a neomorphic ossification, for an element that passes the test of similarity as a postfrontal. This reinterpretation of the circumorbital bones of snakes is bound to have important repercussions for future phylogenetic analyses and consequently for our understanding of the origin and evolution of snakes. Copyright © 2013 Wiley Periodicals, Inc.

Nucleotide sequence of the coat protein gene of the Skierniewice isolate of plum pox virus (PPV)

International Nuclear Information System (INIS)

Wypijewski, K.; Musial, W.; Augustyniak, J.; Malinowski, T.

1994-01-01

The coat protein (CP) gene of the Skierniewice isolate of plum pox virus (PPV-S) has been amplified using the reverse transcription - polymerase chain reaction (RT-PCR), cloned and sequenced. The nucleotide sequence of the gene and the deduced amino-acid sequences of PPV-S CP were compared with those of other PPV strains. The nucleotide sequence showed very high homology to most of the published sequences. The motif: Asp-Ala-Gly (DAG), important for the aphid transmissibility, was present in the amino-acid sequence. Our isolate did not react in ELISA with monoclonal antibodies MAb06 supposed to be specific for PPV-D. (author). 32 refs, 1 fig., 2 tabs

HOMOLOGY MODELING AND MOLECULAR DYNAMICS STUDY OF MYCOBACTERIUM TUBERCULOSIS UREASE

Directory of Open Access Journals (Sweden)

Lisnyak Yu. V.

2017-10-01

Full Text Available Introduction. M. tuberculosis urease (MTU is an attractive target for chemotherapeutic intervention in tuberculosis by designing new safe and efficient enzyme inhibitors. A prerequisite for designing such inhibitors is an understanding of urease's three-dimensional (3D structure organization. 3D structure of M. tuberculosis urease is unknown. When experimental three-dimensional structure of a protein is not known, homology modeling, the most commonly used computational structure prediction method, is the technique of choice. This paper aimed to build a 3D-structure of M. tuberculosis urease by homology modeling and to study its stability by molecular dynamics simulations. Materials and methods. To build MTU model, five high-resolution X-ray structures of bacterial ureases with three-subunit composition (2KAU, 5G4H, 4UBP, 4СEU, and 4EPB have been selected as templates. For each template five stochastic alignments were created and for each alignment, a three-dimensional model was built. Then, each model was energy minimized and the models were ranked by quality Z-score. The MTU model with highest quality estimation amongst 25 potential models was selected. To further improve structure quality the model was refined by short molecular dynamics simulation that resulted in 20 snapshots which were rated according to their energy and the quality Z-score. The best scoring model having minimum energy was chosen as a final homology model of 3D structure for M. tuberculosis. The final model of MTU was also validated by using PDBsum and QMEAN servers. These checks confirmed good quality of MTU homology model. Results and discussion. Homology model of MTU is a nonamer (homotrimer of heterotrimers, (αβγ3 consisting of 2349 residues. In MTU heterotrimer, sub-units α, β, and γ tightly interact with each other at a surface of approximately 3000 Å2. Sub-unit α contains the enzyme active site with two Ni atoms coordinated by amino acid residues His347, His

MetaVelvet: An Extension of Velvet Assembler to de novo Metagenome Assembly from Short Sequence Reads (Metagenomics Informatics Challenges Workshop: 10K Genomes at a Time)

Energy Technology Data Exchange (ETDEWEB)

Sakakibara, Yasumbumi

2011-10-13

Keio University's Yasumbumi Sakakibara on "MetaVelvet: An Extension of Velvet Assembler to de novo Metagenome Assembly from Short Sequence Reads" at the Metagenomics Informatics Challenges Workshop held at the DOE JGI on October 12-13, 2011.

Evolutionary conservation of nuclear and nucleolar targeting sequences in yeast ribosomal protein S6A

International Nuclear Information System (INIS)

Lipsius, Edgar; Walter, Korden; Leicher, Torsten; Phlippen, Wolfgang; Bisotti, Marc-Angelo; Kruppa, Joachim

2005-01-01