WorldWideScience

Sample records for short hairpin sh

  1. Short Hairpin RNA (shRNA): Design, Delivery, and Assessment of Gene Knockdown

    Science.gov (United States)

    Moore, Chris B.; Guthrie, Elizabeth H.; Huang, Max Tze-Han; Taxman, Debra J.

    2013-01-01

    Shortly after the cellular mechanism of RNA interference (RNAi) was first described, scientists began using this powerful technique to study gene function. This included designing better methods for the successful delivery of small interfering RNAs (siRNAs) and short hairpin RNAs (shRNAs) into mammalian cells. While the simplest method for RNAi is the cytosolic delivery of siRNA oligonucleotides, this technique is limited to cells capable of transfection and is primarily utilized during transient in vitro studies. The introduction of shRNA into mammalian cells through infection with viral vectors allows for stable integration of shRNA and long-term knockdown of the targeted gene; however, several challenges exist with the implementation of this technology. Here we describe some well-tested protocols which should increase the chances of successful design, delivery, and assessment of gene knockdown by shRNA. We provide suggestions for designing shRNA targets and controls, a protocol for sequencing through the secondary structure of the shRNA hairpin structure, and protocols for packaging and delivery of shRNA lentiviral particles. Using real-time PCR and functional assays we demonstrate the successful knockdown of ASC, an inflammatory adaptor molecule. These studies demonstrate the practicality of including two shRNAs with different efficacies of knockdown to provide an additional level of control and to verify dose dependency of functional effects. Along with the methods described here, as new techniques and algorithms are designed in the future, shRNA is likely to include further promising application and continue to be a critical component of gene discovery. PMID:20387148

  2. Is TNF-a-targeted short hairpin RNA (shRNA) a novel potential therapeutic tool in psoriasis treatment?

    DEFF Research Database (Denmark)

    Stenderup, Karin; Jakobsen, Maria; Rosada, Cecilia

    2008-01-01

      TNF-α is a well known target in psoriasis treatment and biological treatments targeting TNF-a are already clinically used against psoriasis and psoriasis arthritis. Attention is however given to a novel therapeutic tool: RNA interference that controls gene silencing. This study investigates...... the efficiency of targeting TNF-a with specific short hairpin RNA (shRNA) and explores its potential in treating psoriasis. ShRNAs targeting human TNF-α mRNA were generated. Their efficiency in down-regulating TNF-a protein expression was evaluated using a Renilla luciferase screening-assay and a transient co...... TNF-a shRNA was used to transduce HEK293 cells and verify vector-derived TNF-a knockdown in vitro. In vivo, psoriasis skin was exposed to lentiviral TNF-a shRNAs by a single intra-dermal injection. Psoriasis skin for the in vivo study was obtained from psoriatic plaque skin biopsies that were...

  3. Dicer-independent processing of short hairpin RNAs

    NARCIS (Netherlands)

    Liu, Ying Poi; Schopman, Nick C. T.; Berkhout, Ben

    2013-01-01

    Short hairpin RNAs (shRNAs) are widely used to induce RNA interference (RNAi). We tested a variety of shRNAs that differed in stem length and terminal loop size and revealed strikingly different RNAi activities and shRNA-processing patterns. Interestingly, we identified a specific shRNA design that

  4. Short hairpin RNA interference therapy for ischemic heart disease

    Science.gov (United States)

    Huang, Mei; Chan, Denise; Jia, Fangjun; Xie, Xiaoyan; Li, Zongjin; Hoyt, Grant; Robbins, Robert C.; Chen, Xiaoyuan; Giaccia, Amato; Wu, Joseph C.

    2013-01-01

    Background During hypoxia, upregulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Here we hypothesize that short hairpin RNA (shRNA) interference therapy targeting PHD2 can be used for treatment of myocardial ischemia and this process can be followed noninvasively by molecular imaging. Methods and Results PHD2 was cloned from mouse embryonic stem (ES) cells by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted into the pSuper vector driven by the H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct was used to transfect mouse C2C12 myoblast cell line for in vitro confirmation. Compared to the control short hairpin scramble (shScramble) as control, inhibition of PHD2 increased levels of HIF-1α protein and several downstream angiogenic genes by >30% (P<0.01). Afterwards, shRNA targeting PHD2 (shPHD2) plasmid was injected intramyocardially following ligation of left anterior descending (LAD) artery in mice. Animals were randomized into shPHD2 group (n=20) versus shScramble sequence as control (n=20). Bioluminescence imaging detected transgene expression for 4–5 weeks. Echocardiographic study showed the shPHD2 group had improved fractional shortening compared with the shScramble group at week 4 (33.7%±1.9% vs. 28.4%±2.8%; P<0.05). Postmortem analysis showed increased presence of small capillaries and venules in the infarcted zones by CD31 staining. Finally, Western blot anlaysis of explanted hearts also confirm that animals treated with shPHD2 had significantly higher levels of HIF-1α protein. Conclusions This is the first study to image the biological role of shRNA therapy for improving cardiac function. Inhibition of PHD2 by shRNA led to

  5. Lentiviral Delivery of a Vesicular Glutamate Transporter 1 (VGLUT1)-Targeting Short Hairpin RNA Vector Into the Mouse Hippocampus Impairs Cognition

    NARCIS (Netherlands)

    King, Madeleine V.; Kurian, Nisha; Qin, Si; Papadopoulou, Nektaria; Westerink, Ben H. C.; Cremers, Thomas I.; Epping-Jordan, Mark P.; Le Poul, Emmanuel; Ray, David E.; Fone, Kevin C. F.; Kendall, David A.; Marsden, Charles A.; Sharp, Tyson V.

    Glutamate is the principle excitatory neurotransmitter in the mammalian brain, and dysregulation of glutamatergic neurotransmission is implicated in the pathophysiology of several psychiatric and neurological diseases. This study utilized novel lentiviral short hairpin RNA (shRNA) vectors to target

  6. Multi-resistance strategy for viral diseases and short hairpin RNA verification method in pigs

    Directory of Open Access Journals (Sweden)

    Jong-nam Oh

    2018-04-01

    Full Text Available Objective Foot and mouth disease (FMD and porcine reproductive and respiratory syndrome (PRRS are major diseases that interrupt porcine production. Because they are viral diseases, vaccinations are of only limited effectiveness in preventing outbreaks. To establish an alternative multi-resistant strategy against FMD virus (FMDV and PRRS virus (PRRSV, the present study introduced two genetic modification techniques to porcine cells. Methods First, cluster of differentiation 163 (CD163, the PRRSV viral receptor, was edited with the clustered regularly interspaced short palindromic repeats-CRISPR-associated protein 9 technique. The CD163 gene sequences of edited cells and control cells differed. Second, short hairpin RNA (shRNAs were integrated into the cells. The shRNAs, targeting the 3D gene of FMDV and the open reading frame 7 (ORF7 gene of PRRSV, were transferred into fibroblasts. We also developed an in vitro shRNA verification method with a target gene expression vector. Results shRNA activity was confirmed in vitro with vectors that expressed the 3D and ORF7 genes in the cells. Cells containing shRNAs showed lower transcript levels than cells with only the expression vectors. The shRNAs were integrated into CD163-edited cells to combine the two techniques, and the viral genes were suppressed in these cells. Conclusion We established a multi-resistant strategy against viral diseases and an in vitro shRNA verification method.

  7. Short-hairpin RNA-mediated stable silencing of Grb2 impairs cell growth and DNA synthesis

    International Nuclear Information System (INIS)

    Di Fulvio, Mauricio; Henkels, Karen M.; Gomez-Cambronero, Julian

    2007-01-01

    Grb2 is an SH2-SH3 protein adaptor responsible for linking growth factor receptors with intracellular signaling cascades. To study the role of Grb2 in cell growth, we have generated a new COS7 cell line (COS7 shGrb2 ), based on RNAi technology, as null mutations in mammalian Grb2 genes are lethal in early development. This novel cell line continuously expresses a short hairpin RNA that targets endogenous Grb2. Stable COS7 shGrb2 cells had the shGrb2 integrated into the genomic DNA and carried on SiL construct (made refractory to the shRNA-mediated interference), but not with an SH2-deficient mutant (R86K). Thus, a viable knock-down and rescue protocol has demonstrated that Grb2 is crucial for cell proliferation

  8. RNA polymerase II mediated transcription from the polymerase III promoters in short hairpin RNA expression vector

    International Nuclear Information System (INIS)

    Rumi, Mohammad; Ishihara, Shunji; Aziz, Monowar; Kazumori, Hideaki; Ishimura, Norihisa; Yuki, Takafumi; Kadota, Chikara; Kadowaki, Yasunori; Kinoshita, Yoshikazu

    2006-01-01

    RNA polymerase III promoters of human ribonuclease P RNA component H1, human U6, and mouse U6 small nuclear RNA genes are commonly used in short hairpin RNA (shRNA) expression vectors due their precise initiation and termination sites. During transient transfection of shRNA vectors, we observed that H1 or U6 promoters also express longer transcripts enough to express several reporter genes including firefly luciferase, green fluorescent protein EGFP, and red fluorescent protein JRed. Expression of such longer transcripts was augmented by upstream RNA polymerase II enhancers and completely inhibited by downstream polyA signal sequences. Moreover, the transcription of firefly luciferase from human H1 promoter was sensitive to RNA polymerase II inhibitor α-amanitin. Our findings suggest that commonly used polymerase III promoters in shRNA vectors are also prone to RNA polymerase II mediated transcription, which may have negative impacts on their targeted use

  9. Miniature short hairpin RNA screens to characterize antiproliferative drugs.

    Science.gov (United States)

    Kittanakom, Saranya; Arnoldo, Anthony; Brown, Kevin R; Wallace, Iain; Kunavisarut, Tada; Torti, Dax; Heisler, Lawrence E; Surendra, Anuradha; Moffat, Jason; Giaever, Guri; Nislow, Corey

    2013-08-07

    The application of new proteomics and genomics technologies support a view in which few drugs act solely by inhibiting a single cellular target. Indeed, drug activity is modulated by complex, often incompletely understood cellular mechanisms. Therefore, efforts to decipher mode of action through genetic perturbation such as RNAi typically yields "hits" that fall into several categories. Of particular interest to the present study, we aimed to characterize secondary activities of drugs on cells. Inhibiting a known target can result in clinically relevant synthetic phenotypes. In one scenario, drug perturbation could, for example, improperly activate a protein that normally inhibits a particular kinase. In other cases, additional, lower affinity targets can be inhibited as in the example of inhibition of c-Kit observed in Bcr-Abl-positive cells treated with Gleevec. Drug transport and metabolism also play an important role in the way any chemicals act within the cells. Finally, RNAi per se can also affect cell fitness by more general off-target effects, e.g., via the modulation of apoptosis or DNA damage repair. Regardless of the root cause of these unwanted effects, understanding the scope of a drug's activity and polypharmacology is essential for better understanding its mechanism(s) of action, and such information can guide development of improved therapies. We describe a rapid, cost-effective approach to characterize primary and secondary effects of small-molecules by using small-scale libraries of virally integrated short hairpin RNAs. We demonstrate this principle using a "minipool" composed of shRNAs that target the genes encoding the reported protein targets of approved drugs. Among the 28 known reported drug-target pairs, we successfully identify 40% of the targets described in the literature and uncover several unanticipated drug-target interactions based on drug-induced synthetic lethality. We provide a detailed protocol for performing such screens and for

  10. Adenoviral short hairpin RNA therapy targeting phosphodiesterase 5a relieves cardiac remodeling and dysfunction following myocardial infarction

    Science.gov (United States)

    Li, Longhu; Haider, Husnain Kh.; Wang, Linlin; Lu, Gang

    2012-01-01

    We previously showed that treatment with tadalafil, a long-acting phosphodiesterase-5a (PDE5a) inhibitor, effectively prevented adverse left ventricular (LV) remodeling of the infarcted heart. We hypothesized that short-hairpin RNA (shRNA) therapy targeting PDE5a would simulate the effects of pharmacological intervention for treatment of postinfarction LV remodeling and dysfunction. Experimental model of myocardial infarction was developed in female mice by permanent ligation of left coronary artery. Immediately after that, an adenoviral vector encoding for shRNA sequence targeting PDE5a (Ad-shPDE5a) was injected intramyocardially, which specifically inhibited PDE5a in the heart. Four weeks later, Ad-shPDE5a treated mice showed significant mitigation of the left ventricle (LV) dilatation and dysfunction as indicated by smaller LV cavity and more preserved ejection fraction and fractional shortening. Infarction size and fibrosis were significantly reduced in Ad-shPDE5a-treated mice. Additionally, more salvaged cardiomyocytes, significantly reduced collagen contents, and higher blood vessel density were observed in Ad-shPDE5a-treated mice. The cytoprotective effects of Ad-shPDE5a were demonstrated in vitro in Ad-shPDE5a transfected cardiomyocytes cultured under oxygen glucose deprivation. Among downstream mediators of PDE5a signaling, cyclic GMP (cGMP) and cGMP-dependent protein kinase G (PKG) were activated with concomitant reduction in caspase-3 activity. However, no significant change in PKA and cAMP activities were observed in Ad-shPDE5a-treated hearts. Inhibition with shRNA improved cardiac remodeling and dysfunction by reducing infarction size and cardiac fibrosis and increased cGMP and PKG activity. These findings suggest that PDE5 inhibition with Ad-shPDE5a is a novel approach for treatment of myocardial infarction. PMID:22447941

  11. An optimized lentiviral vector system for conditional RNAi and efficient cloning of microRNA embedded short hairpin RNA libraries.

    Science.gov (United States)

    Adams, Felix F; Heckl, Dirk; Hoffmann, Thomas; Talbot, Steven R; Kloos, Arnold; Thol, Felicitas; Heuser, Michael; Zuber, Johannes; Schambach, Axel; Schwarzer, Adrian

    2017-09-01

    RNA interference (RNAi) and CRISPR-Cas9-based screening systems have emerged as powerful and complementary tools to unravel genetic dependencies through systematic gain- and loss-of-function studies. In recent years, a series of technical advances helped to enhance the performance of virally delivered RNAi. For instance, the incorporation of short hairpin RNAs (shRNAs) into endogenous microRNA contexts (shRNAmiRs) allows the use of Tet-regulated promoters for synchronous onset of gene knockdown and precise interrogation of gene dosage effects. However, remaining challenges include lack of efficient cloning strategies, inconsistent knockdown potencies and leaky expression. Here, we present a simple, one-step cloning approach for rapid and efficient cloning of miR-30 shRNAmiR libraries. We combined a human miR-30 backbone retaining native flanking sequences with an optimized all-in-one lentiviral vector system for conditional RNAi to generate a versatile toolbox characterized by higher doxycycline sensitivity, reduced leakiness and enhanced titer. Furthermore, refinement of existing shRNA design rules resulted in substantially improved prediction of powerful shRNAs. Our approach was validated by accurate quantification of the knockdown potency of over 250 single shRNAmiRs. To facilitate access and use by the scientific community, an online tool was developed for the automated design of refined shRNA-coding oligonucleotides ready for cloning into our system. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Short hairpin-loop-structured oligodeoxynucleotides reduce HSV-1 replication

    Directory of Open Access Journals (Sweden)

    Heinrich Jochen

    2009-04-01

    Full Text Available Abstract The Herpes simplex virus (HSV is known as an infectious agent and widespread in the human population. The symptoms of HSV infections can range from mild to life threatening, especially in immune-compromised individuals. HSV infections are commonly treated with the guanosine analogue Aciclovir, but reports of resistance are increasing. Efforts are made to establish single-stranded antisense oligodeoxynucleotides (as and small interfering ribonucleic acids (siRNAs for antiviral treatment. Recently, another class of short interfering nucleic acids, partially double-stranded hairpin loop-structured 54 mer oligodeoxynucleotides (ODNs, was shown to allow hydrolysis of HIV RNA by binding to the viral RNA. This leads to a substrate for the viral RNase H. To assess the potential of such ODNs for inhibition of HSV-1 replication, five partially double-stranded ODNs were designed based on the sequences of known siRNAs against HSV-1 with antiviral activity. Three of them are directed against early and two against leaky late genes. Primary human lung fibroblasts, MRC-5, and African green monkey kidney cells, Vero, were transfected with ODNs and subsequently infected. The effect on HSV-1 replication was determined by analyzing the virus titer in cell culture supernatants by quantitative PCR and plaque assays. An inhibitory effect was observed with all five selected ODNs, with two cases showing statistical significance in both cell types. The observed effect was sequence-specific and dose dependent. In one case the ODN was more efficient than a previously described siRNA directed against the same target site in the mRNA of UL5, a component of the helicase/primase complex. HSV-1 virions and ODNs can be applied simultaneously without transfection reagent, but at a 50-fold higher concentration to Vero cells with similar efficiencies. The results underline the potential of partially double-stranded hairpin loop-structured ODNs as antiviral agents.

  13. Novel guanidinylated bioresponsive poly(amidoamines designed for short hairpin RNA delivery

    Directory of Open Access Journals (Sweden)

    Yu J

    2016-12-01

    Full Text Available Jiankun Yu,1 Jinmin Zhang,1 Haonan Xing,1 Yanping Sun,1 Zhen Yang,1 Tianzhi Yang,2 Cuifang Cai,1 Xiaoyun Zhao,3 Li Yang,1 Pingtian Ding1 1School of Pharmacy, Shenyang Pharmaceutical University, Shenyang, China; 2Department of Basic Pharmaceutical Sciences, School of Pharmacy, Husson University, Bangor, ME, USA; 3Department of Microbiology and Cell Biology, School of Life Science and Biopharmaceutics, Shenyang Pharmaceutical University, Shenyang, China Abstract: Two different disulfide (SS-containing poly(amidoamine (PAA polymers were constructed using guanidino (Gua-containing monomers (ie, arginine [Arg] and agmatine [Agm] and N,N'-cystamine bisacrylamide (CBA by Michael-addition polymerization. In order to characterize these two Gua-SS-PAA polymers and investigate their potentials as short hairpin RNA (shRNA-delivery carriers, pSilencer 4.1-CMV FANCF shRNA was chosen as a model plasmid DNA to form complexes with these two polymers. The Gua-SS-PAAs and plasmid DNA complexes were determined with particle sizes less than 90 nm and positive ζ-potentials under 20 mV at nucleic acid:polymer weight ratios lower than 1:24. Bioresponsive release of plasmid DNA was observed from both newly constructed complexes. Significantly lower cytotoxicity was observed for both polymer complexes compared with polyethylenimine and Lipofectamine 2000, two widely used transfection reagents as reference carriers. Arg-CBA showed higher transfection efficiency and gene-silencing efficiency in MCF7 cells than Agm-CBA and the reference carriers. In addition, the cellular uptake of Arg-CBA in MCF7 cells was found to be higher and faster than Agm-CBA and the reference carriers. Similarly, plasmid DNA transport into the nucleus mediated by Arg-CBA was more than that by Agm-CBA and the reference carriers. The study suggested that guanidine and carboxyl introduced into Gua-SS-PAAs polymers resulted in a better nuclear localization effect, which played a key role in the

  14. Pathogenic effects of Rift Valley fever virus NSs gene are alleviated in cultured cells by expressed antiviral short hairpin RNAs.

    Science.gov (United States)

    Scott, Tristan; Paweska, Janusz T; Arbuthnot, Patrick; Weinberg, Marc S

    2012-01-01

    Rift Valley fever virus (RVFV), a member of the Bunyaviridae family, may cause severe hepatitis, encephalitis and haemorrhagic fever in humans. There are currently no available licensed vaccines or therapies to treat the viral infection in humans. RNA interference (RNAi)-based viral gene silencing offers a promising approach to inhibiting replication of this highly pathogenic virus. The small (S) segment of the RVFV tripartite genome carries the genetic determinates for pathogenicity during infection. This segment encodes the non-structural S (NSs) and essential nucleocapsid (N) genes. To advance RNAi-based inhibition of RVFV replication, we designed several Pol III short hairpin RNA (shRNA) expression cassettes against the NSs and N genes, including a multimerized plasmid vector that included four shRNA expression cassettes. Effective target silencing was demonstrated using full- and partial-length target reporter assays, and confirmed by western blot analysis of exogenous N and NSs expression. Small RNA northern blots showed detectable RNAi guide strand formation from single and multimerized shRNA constructs. Using a cell culture model of RVFV replication, shRNAs targeting the N gene decreased intracellular nucleocapsid protein concentration and viral replication. The shRNAs directed against the NSs gene reduced NSs protein concentrations and alleviated NSs-mediated cytotoxicity, which may be caused by host transcription suppression. These data are the first demonstration that RNAi activators have a potential therapeutic benefit for countering RVFV infection.

  15. Short Hairpin RNA Silencing of PHD-2 Improves Neovascularization and Functional Outcomes in Diabetic Wounds and Ischemic Limbs.

    Directory of Open Access Journals (Sweden)

    Kevin J Paik

    Full Text Available The transcription factor hypoxia-inducible factor 1-alpha (HIF-1α is responsible for the downstream expression of over 60 genes that regulate cell survival and metabolism in hypoxic conditions as well as those that enhance angiogenesis to alleviate hypoxia. However, under normoxic conditions, HIF-1α is hydroxylated by prolyl hydroxylase 2, and subsequently degraded, with a biological half-life of less than five minutes. Here we investigated the therapeutic potential of inhibiting HIF-1α degradation through short hairpin RNA silencing of PHD-2 in the setting of diabetic wounds and limb ischemia. Treatment of diabetic mouse fibroblasts with shPHD-2 in vitro resulted in decreased levels of PHD-2 transcript demonstrated by qRT-PCR, higher levels of HIF-1α as measured by western blot, and higher expression of the downstream angiogenic genes SDF-1 and VEGFα, as measured by qRT-PCR. In vivo, shPHD-2 accelerated healing of full thickness excisional wounds in diabetic mice compared to shScr control, (14.33 ± 0.45 days vs. 19 ± 0.33 days and was associated with an increased vascular density. Delivery of shPHD-2 also resulted in improved perfusion of ischemic hind limbs compared to shScr, prevention of distal digit tip necrosis, and increased survival of muscle tissue. Knockdown of PHD-2 through shRNA treatment has the potential to stimulate angiogenesis through overexpression of HIF-1α and upregulation of pro-angiogenic genes downstream of HIF-1α, and may represent a viable, non-viral approach to gene therapy for ischemia related applications.

  16. Adeno-Associated Viral Vector-Mediated mTOR Inhibition by Short Hairpin RNA Suppresses Laser-Induced Choroidal Neovascularization

    Directory of Open Access Journals (Sweden)

    Tae Kwann Park

    2017-09-01

    Full Text Available Choroidal neovascularization (CNV is the defining characteristic feature of the wet subtype of age-related macular degeneration (AMD and may result in irreversible blindness. Based on anti-vascular endothelial growth factor (anti-VEGF, the current therapeutic approaches to CNV are fraught with difficulties, and mammalian target of rapamycin (mTOR has recently been proposed as a possible therapeutic target, although few studies have been conducted. Here, we show that a recombinant adeno-associated virus-delivered mTOR-inhibiting short hairpin RNA (rAAV-mTOR shRNA, which blocks the activity of both mTOR complex 1 and 2, represents a promising therapeutic approach for the treatment of CNV. Eight-week-old male C57/B6 mice were treated with the short hairpin RNA (shRNA after generating CNV lesions in the eyes via laser photocoagulation. The recombinant adeno-associated virus (rAAV delivery vehicle was able to effectively transduce cells in the inner retina, and significantly fewer inflammatory cells and less extensive CNV were observed in the animals treated with rAAV-mTOR shRNA when compared with control- and rAAV-scrambled shRNA-treated groups. Presumably related to the reduction of CNV, increased autophagy was detected in CNV lesions treated with rAAV-mTOR shRNA, whereas significantly fewer apoptotic cells detected in the outer nuclear layer around the CNV indicate that mTOR inhibition may also have neuroprotective effects. Taken together, these results demonstrate the therapeutic potential of mTOR inhibition, resulting from rAAV-mTOR shRNA activity, in the treatment of AMD-related CNV. Keywords: retinal neovascularization, choroidal neovascularization, adeno-associated virus, mTOR, RNA interference, mTOR shRNA, autophagy

  17. Short hairpin RNA-mediated knockdown of protein expression in Entamoeba histolytica

    Directory of Open Access Journals (Sweden)

    Singh Upinder

    2009-02-01

    Full Text Available Abstract Background Entamoeba histolytica is an intestinal protozoan parasite of humans. The genome has been sequenced, but the study of individual gene products has been hampered by the lack of the ability to generate gene knockouts. We chose to test the use of RNA interference to knock down gene expression in Entamoeba histolytica. Results An episomal vector-based system, using the E. histolytica U6 promoter to drive expression of 29-basepair short hairpin RNAs, was developed to target protein-encoding genes in E. histolytica. The short hairpin RNAs successfully knocked down protein levels of all three unrelated genes tested with this system: Igl, the intermediate subunit of the galactose- and N-acetyl-D-galactosamine-inhibitable lectin; the transcription factor URE3-BP; and the membrane binding protein EhC2A. Igl levels were reduced by 72%, URE3-BP by 89%, and EhC2A by 97%. Conclusion Use of the U6 promoter to drive expression of 29-basepair short hairpin RNAs is effective at knocking down protein expression for unrelated genes in Entamoeba histolytica, providing a useful tool for the study of this parasite.

  18. Short hairpin RNA-mediated knockdown of protein expression in Entamoeba histolytica.

    Science.gov (United States)

    Linford, Alicia S; Moreno, Heriberto; Good, Katelyn R; Zhang, Hanbang; Singh, Upinder; Petri, William A

    2009-02-17

    Entamoeba histolytica is an intestinal protozoan parasite of humans. The genome has been sequenced, but the study of individual gene products has been hampered by the lack of the ability to generate gene knockouts. We chose to test the use of RNA interference to knock down gene expression in Entamoeba histolytica. An episomal vector-based system, using the E. histolytica U6 promoter to drive expression of 29-basepair short hairpin RNAs, was developed to target protein-encoding genes in E. histolytica. The short hairpin RNAs successfully knocked down protein levels of all three unrelated genes tested with this system: Igl, the intermediate subunit of the galactose- and N-acetyl-D-galactosamine-inhibitable lectin; the transcription factor URE3-BP; and the membrane binding protein EhC2A. Igl levels were reduced by 72%, URE3-BP by 89%, and EhC2A by 97%. Use of the U6 promoter to drive expression of 29-basepair short hairpin RNAs is effective at knocking down protein expression for unrelated genes in Entamoeba histolytica, providing a useful tool for the study of this parasite.

  19. Short hairpin RNA targeting 2B gene of coxsackievirus B3 exhibits potential antiviral effects both in vitro and in vivo

    Directory of Open Access Journals (Sweden)

    Yao Hailan

    2012-08-01

    Full Text Available Abstract Background Coxsackievirus B3 is an important infectious agent of viral myocarditis, pancreatitis and aseptic meningitis, but there are no specific antiviral therapeutic reagents in clinical use. RNA interference-based technology has been developed to prevent the viral infection. Methods To evaluate the impact of RNA interference on viral replication, cytopathogenicity and animal survival, short hairpin RNAs targeting the viral 2B region (shRNA-2B expressed by a recombinant vector (pGCL-2B or a recombinant lentivirus (Lenti-2B were tansfected in HeLa cells or transduced in mice infected with CVB3. Results ShRNA-2B exhibited a significant effect on inhibition of viral production in HeLa cells. Furthermore, shRNA-2B improved mouse survival rate, reduced the viral tissues titers and attenuated tissue damage compared with those of the shRNA-NC treated control group. Lenti-2B displayed more effective role in inhibition of viral replication than pGCL-2B in vivo. Conclusions Coxsackievirus B3 2B is an effective target of gene silencing against coxsackievirus B3 infection, suggesting that shRNA-2B is a potential agent for further development into a treatment for enterviral diseases.

  20. Preclinical safety and efficacy of an anti–HIV-1 lentiviral vector containing a short hairpin RNA to CCR5 and the C46 fusion inhibitor

    Directory of Open Access Journals (Sweden)

    Orit Wolstein

    2014-01-01

    Full Text Available Gene transfer has therapeutic potential for treating HIV-1 infection by generating cells that are resistant to the virus. We have engineered a novel self-inactivating lentiviral vector, LVsh5/C46, using two viral-entry inhibitors to block early steps of HIV-1 cycle. The LVsh5/C46 vector encodes a short hairpin RNA (shRNA for downregulation of CCR5, in combination with the HIV-1 fusion inhibitor, C46. We demonstrate here the effective delivery of LVsh5/C46 to human T cell lines, peripheral blood mononuclear cells, primary CD4+ T lymphocytes, and CD34+ hematopoietic stem/progenitor cells (HSPC. CCR5-targeted shRNA (sh5 and C46 peptide were stably expressed in the target cells and were able to effectively protect gene-modified cells against infection with CCR5- and CXCR4-tropic strains of HIV-1. LVsh5/C46 treatment was nontoxic as assessed by cell growth and viability, was noninflammatory, and had no adverse effect on HSPC differentiation. LVsh5/C46 could be produced at a scale sufficient for clinical development and resulted in active viral particles with very low mutagenic potential and the absence of replication-competent lentivirus. Based on these in vitro results, plus additional in vivo safety and efficacy data, LVsh5/C46 is now being tested in a phase 1/2 clinical trial for the treatment of HIV-1 disease.

  1. Short, multiple-stranded β-hairpin peptides have antimicrobial potency with high selectivity and salt resistance.

    Science.gov (United States)

    Chou, Shuli; Shao, Changxuan; Wang, Jiajun; Shan, Anshan; Xu, Lin; Dong, Na; Li, Zhongyu

    2016-01-01

    The β-hairpin structure has been proposed to exhibit potent antimicrobial properties with low cytotoxicity, thus, multiple β-hairpin structures have been proved to be highly stable in structures containing tightly packed hydrophobic cores. The aim of this study was to develop peptide-based synthetic strategies for generating short, but effective AMPs as inexpensive antimicrobial agents. Multiple-stranded β-hairpin peptides with the same β-hairpin unit, (WRXxRW)n where n=1, 2, 3, or 4 and Xx represent the turn sequence, were synthesized, and their potential as antimicrobial agents was evaluated. Owning to the tightly packed hydrophobic core and paired Trp of this multiple-stranded β-hairpin structure, all the 12-residues peptides exhibited high cell selectivity towards bacterial cells over human red blood cells (hRBCs), and the peptide W2 exhibited stronger antimicrobial activities with the MIC values of 2-8μM against various tested bacteria. Not only that, but W2 also showed obvious synergy with streptomycin and chloramphenicol against Escherichia coli, and displayed synergy with ciprofloxacin against Staphylococcus aureus with the FICI values ⩽0.5. Fluorescence spectroscopy and electron microscopy analyses indicated that W2 kills microbial cells by permeabilizing the cell membrane and damaging membrane integrity. Collectively, based on the multiple β-hairpin peptides, the ability to develop libraries of short and effective peptides will be a powerful approach to the discovery of novel antimicrobial agents. We successfully screened a peptide W2 ((WRPGRW)2) from a series of multiple-stranded β-hairpin antimicrobial peptides based on the "S-shaped" motif that induced the formation of a globular structure, and Trp zipper was used to replace the disulfide bonds to reduce the cost of production. This novel structure applied to AMPs improved cell selectivity and salt stability. The findings of this study will promote the development of peptide

  2. Adenovirus delivered short hairpin RNA targeting a conserved site in the 5' non-translated region inhibits all four serotypes of dengue viruses.

    Directory of Open Access Journals (Sweden)

    Anil Babu Korrapati

    Full Text Available BACKGROUND: Dengue is a mosquito-borne viral disease caused by four closely related serotypes of Dengue viruses (DENVs. This disease whose symptoms range from mild fever to potentially fatal haemorrhagic fever and hypovolemic shock, threatens nearly half the global population. There is neither a preventive vaccine nor an effective antiviral therapy against dengue disease. The difference between severe and mild disease appears to be dependent on the viral load. Early diagnosis may enable timely therapeutic intervention to blunt disease severity by reducing the viral load. Harnessing the therapeutic potential of RNA interference (RNAi to attenuate DENV replication may offer one approach to dengue therapy. METHODOLOGY/PRINCIPAL FINDINGS: We screened the non-translated regions (NTRs of the RNA genomes of representative members of the four DENV serotypes for putative siRNA targets mapping to known transcription/translation regulatory elements. We identified a target site in the 5' NTR that maps to the 5' upstream AUG region, a highly conserved cis-acting element essential for viral replication. We used a replication-defective human adenovirus type 5 (AdV5 vector to deliver a short-hairpin RNA (shRNA targeting this site into cells. We show that this shRNA matures to the cognate siRNA and is able to inhibit effectively antigen secretion, viral RNA replication and infectious virus production by all four DENV serotypes. CONCLUSION/SIGNIFICANCE: The data demonstrate the feasibility of using AdV5-mediated delivery of shRNAs targeting conserved sites in the viral genome to achieve inhibition of all four DENV serotypes. This paves the way towards exploration of RNAi as a possible therapeutic strategy to curtail DENV infection.

  3. Engineering HIV-1-resistant T-cells from short-hairpin RNA-expressing hematopoietic stem/progenitor cells in humanized BLT mice.

    Directory of Open Access Journals (Sweden)

    Gene-Errol E Ringpis

    Full Text Available Down-regulation of the HIV-1 coreceptor CCR5 holds significant potential for long-term protection against HIV-1 in patients. Using the humanized bone marrow/liver/thymus (hu-BLT mouse model which allows investigation of human hematopoietic stem/progenitor cell (HSPC transplant and immune system reconstitution as well as HIV-1 infection, we previously demonstrated stable inhibition of CCR5 expression in systemic lymphoid tissues via transplantation of HSPCs genetically modified by lentiviral vector transduction to express short hairpin RNA (shRNA. However, CCR5 down-regulation will not be effective against existing CXCR4-tropic HIV-1 and emergence of resistant viral strains. As such, combination approaches targeting additional steps in the virus lifecycle are required. We screened a panel of previously published shRNAs targeting highly conserved regions and identified a potent shRNA targeting the R-region of the HIV-1 long terminal repeat (LTR. Here, we report that human CD4(+ T-cells derived from transplanted HSPC engineered to co-express shRNAs targeting CCR5 and HIV-1 LTR are resistant to CCR5- and CXCR4- tropic HIV-1-mediated depletion in vivo. Transduction with the combination vector suppressed CXCR4- and CCR5- tropic viral replication in cell lines and peripheral blood mononuclear cells in vitro. No obvious cytotoxicity or interferon response was observed. Transplantation of combination vector-transduced HSPC into hu-BLT mice resulted in efficient engraftment and subsequent stable gene marking and CCR5 down-regulation in human CD4(+ T-cells within peripheral blood and systemic lymphoid tissues, including gut-associated lymphoid tissue, a major site of robust viral replication, for over twelve weeks. CXCR4- and CCR5- tropic HIV-1 infection was effectively inhibited in hu-BLT mouse spleen-derived human CD4(+ T-cells ex vivo. Furthermore, levels of gene-marked CD4(+ T-cells in peripheral blood increased despite systemic infection with either

  4. Shortcomings of short hairpin RNA-based transgenic RNA interference in mouse oocytes

    Czech Academy of Sciences Publication Activity Database

    Sarnová, Lenka; Malík, Radek; Sedláček, Radislav; Svoboda, Petr

    2010-01-01

    Roč. 9, č. 8 (2010), s. 1-10 ISSN 1477-5751 R&D Project s: GA MŠk ME09039 Grant - others:EMBO SDIG(DE) project 1483 Institutional research plan: CEZ:AV0Z50520514 Keywords : transgenic RNAi * shRNA * oocyte Subject RIV: EB - Genetics ; Molecular Biology http://www.jnrbm.com/content/9/1/8

  5. Shortcomings of short hairpin RNA-based transgenic RNA interference in mouse oocytes

    Czech Academy of Sciences Publication Activity Database

    Sarnová, Lenka; Malík, Radek; Sedláček, Radislav; Svoboda, Petr

    2010-01-01

    Roč. 9, č. 8 (2010), s. 1-10 ISSN 1477-5751 R&D Projects: GA MŠk ME09039 Grant - others:EMBO SDIG(DE) project 1483 Institutional research plan: CEZ:AV0Z50520514 Keywords : transgenic RNAi * shRNA * oocyte Subject RIV: EB - Genetics ; Molecular Biology http://www.jnrbm.com/content/9/1/8

  6. A novel bidirectional expression system for simultaneous expression of both the protein-coding genes and short hairpin RNAs in mammalian cells

    International Nuclear Information System (INIS)

    Hung, C.-F.; Cheng, T.-L.; Wu, R.-H.; Teng, C.-F.; Chang, W.-T.

    2006-01-01

    RNA interference (RNAi) is an extremely powerful and widely used gene silencing approach for reverse functional genomics and molecular therapeutics. In mammals, the conserved poly(ADP-ribose) polymerase 2 (PARP-2)/RNase P bidirectional control promoter simultaneously expresses both the PARP-2 protein and RNase P RNA by RNA polymerase II- and III-dependent mechanisms, respectively. To explore this unique bidirectional control system in RNAi-mediated gene silencing strategy, we have constructed two novel bidirectional expression vectors, pbiHsH1 and pbiMmH1, which contained the PARP-2/RNase P bidirectional control promoters from human and mouse, for simultaneous expression of both the protein-coding genes and short hairpin RNAs. Analyses of the dual transcriptional activities indicated that these two bidirectional expression vectors could not only express enhanced green fluorescent protein as a functional reporter but also simultaneously transcribe shLuc for inhibiting the firefly luciferase expression. In addition, to extend its utility for the establishment of inherited stable clones, we have also reconstructed this bidirectional expression system with the blasticidin S deaminase gene, an effective dominant drug resistance selectable marker, and examined both the selection and inhibition efficiencies in drug resistance and gene expression. Moreover, we have further demonstrated that this bidirectional expression system could efficiently co-regulate the functionally important genes, such as overexpression of tumor suppressor protein p53 and inhibition of anti-apoptotic protein Bcl-2 at the same time. In summary, the bidirectional expression vectors, pbiHsH1 and pbiMmH1, should provide a simple, convenient, and efficient novel tool for manipulating the gene function in mammalian cells

  7. A Conserved Target Site in HIV-1 Gag RNA is Accessible to Inhibition by Both an HDV Ribozyme and a Short Hairpin RNA

    Directory of Open Access Journals (Sweden)

    Robert J Scarborough

    2014-01-01

    Full Text Available Antisense-based molecules targeting HIV-1 RNA have the potential to be used as part of gene or drug therapy to treat HIV-1 infection. In this study, HIV-1 RNA was screened to identify more conserved and accessible target sites for ribozymes based on the hepatitis delta virus motif. Using a quantitative screen for effects on HIV-1 production, we identified a ribozyme targeting a highly conserved site in the Gag coding sequence with improved inhibitory potential compared to our previously described candidates targeting the overlapping Tat/Rev coding sequence. We also demonstrate that this target site is highly accessible to short hairpin directed RNA interference, suggesting that it may be available for the binding of antisense RNAs with different modes of action. We provide evidence that this target site is structurally conserved in diverse viral strains and that it is sufficiently different from the human transcriptome to limit off-target effects from antisense therapies. We also show that the modified hepatitis delta virus ribozyme is more sensitive to a mismatch in its target site compared to the short hairpin RNA. Overall, our results validate the potential of a new target site in HIV-1 RNA to be used for the development of antisense therapies.

  8. Identification of short hairpin RNA targeting foot-and-mouth disease virus with transgenic bovine fetal epithelium cells.

    Directory of Open Access Journals (Sweden)

    Hongmei Wang

    Full Text Available BACKGROUND: Although it is known that RNA interference (RNAi targeting viral genes protects experimental animals, such as mice, from the challenge of Foot-and-mouth disease virus (FMDV, it has not been previously investigated whether shRNAs targeting FMDV in transgenic dairy cattle or primary transgenic bovine epithelium cells will confer resistance against FMDV challenge. PRINCIPAL FINDING: Here we constructed three recombinant lentiviral vectors containing shRNA against VP2 (RNAi-VP2, VP3 (RNAi-VP3, or VP4 (RNAi-VP4 of FMDV, and found that all of them strongly suppressed the transient expression of a FLAG-tagged viral gene fusion protein in 293T cells. In BHK-21 cells, RNAi-VP4 was found to be more potent in inhibition of viral replication than the others with over 98% inhibition of viral replication. Therefore, recombinant lentiviral vector RNAi-VP4 was transfected into bovine fetal fibroblast cells to generate transgenic nuclear donor cells. With subsequent somatic cell cloning, we generated forty transgenic blastocysts, and then transferred them to 20 synchronized recipient cows. Three transgenic bovine fetuses were obtained after pregnant period of 4 months, and integration into chromosome in cloned fetuses was confirmed by Southern hybridization. The primary tongue epithelium cells of transgenic fetuses were isolated and inoculated with 100 TCID(50 of FMDV, and it was observed that shRNA significantly suppressed viral RNA synthesis and inhibited over 91% of viral replication after inoculation of FMDV for 48 h. CONCLUSION: RNAi-VP4 targeting viral VP4 gene appears to prevent primary epithelium cells of transgenic bovine fetus from FMDV infection, and it could be a candidate shRNA used for cultivation of transgenic cattle against FMDV.

  9. Hairpin vortices in turbulent boundary layers

    International Nuclear Information System (INIS)

    Eitel-Amor, G; Schlatter, P; Flores, O

    2014-01-01

    The present work addresses the question whether hairpin vortices are a dominant feature of near-wall turbulence and which role they play during transition. First, the parent-offspring mechanism is investigated in temporal simulations of a single hairpin vortex introduced in a mean shear flow corresponding to turbulent channels and boundary layers up to Re τ = 590. Using an eddy viscosity computed from resolved simulations, the effect of a turbulent background is also considered. Tracking the vortical structure downstream, it is found that secondary hairpins are created shortly after initialization. Thereafter, all rotational structures decay, whereas this effect is enforced in the presence of an eddy viscosity. In a second approach, a laminar boundary layer is tripped to transition by insertion of a regular pattern of hairpins by means of defined volumetric forces representing an ejection event. The idea is to create a synthetic turbulent boundary layer dominated by hairpin-like vortices. The flow for Re τ < 250 is analysed with respect to the lifetime of individual hairpin-like vortices. Both the temporal and spatial simulations demonstrate that the regeneration process is rather short-lived and may not sustain once a turbulent background has formed. From the transitional flow simulations, it is conjectured that the forest of hairpins reported in former DNS studies is an outer layer phenomenon not being connected to the onset of near-wall turbulence.

  10. Efficient immortalization of primary human cells by p16INK4a-specific short hairpin RNA or Bmi-1, combined with introduction of hTERT.

    Science.gov (United States)

    Haga, Kei; Ohno, Shin-ichi; Yugawa, Takashi; Narisawa-Saito, Mako; Fujita, Masatoshi; Sakamoto, Michiie; Galloway, Denise A; Kiyono, Tohru

    2007-02-01

    Activation of telomerase is sufficient for immortalization of some types of human cells but additional factors may also be essential. It has been proposed that stress imposed by inadequate culture conditions induces senescence due to accumulation of p16(INK4a). Here, we present evidence that many human cell types undergo senescence by activation of the p16(INK4a)/Rb pathway, and that introduction of Bmi-1 can inhibit p16(INK4a) expression and extend the life span of human epithelial cells derived from skin, mammary gland and lung. Introduction of p16(INK4a)-specific short hairpin RNA, as well as Bmi-1, suppressed p16(INK4a) expression in human mammary epithelial cells without promoter methylation, and extended their life span. Subsequent introduction of hTERT, the telomerase catalytic subunit, into cells with low p16(INK4a) levels resulted in efficient immortalization of three cell types without crisis or growth arrest. The majority of the human mammary epithelial cells thus immortalized showed almost normal ploidy as judged by G-banding and spectral karyotyping analysis. Our data suggest that inhibition of p16(INK4a) and introduction of hTERT can immortalize many human cell types with little chromosomal instability.

  11. SH2/SH3 signaling proteins.

    Science.gov (United States)

    Schlessinger, J

    1994-02-01

    SH2 and SH3 domains are small protein modules that mediate protein-protein interactions in signal transduction pathways that are activated by protein tyrosine kinases. SH2 domains bind to short phosphotyrosine-containing sequences in growth factor receptors and other phosphoproteins. SH3 domains bind to target proteins through sequences containing proline and hydrophobic amino acids. SH2 and SH3 domain containing proteins, such as Grb2 and phospholipase C gamma, utilize these modules in order to link receptor and cytoplasmic protein tyrosine kinases to the Ras signaling pathway and to phosphatidylinositol hydrolysis, respectively. The three-dimensional structures of several SH2 and SH3 domains have been determined by NMR and X-ray crystallography, and the molecular basis of their specificity is beginning to be unveiled.

  12. A simple and robust vector-based shRNA expression system used for RNA interference.

    Science.gov (United States)

    Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi

    2013-01-01

    RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

  13. A simple and robust vector-based shRNA expression system used for RNA interference.

    Directory of Open Access Journals (Sweden)

    Xue-jun Wang

    Full Text Available BACKGROUND: RNA interference (RNAi mediated by small interfering RNAs (siRNAs or short hairpin RNAs (shRNAs has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. RESULTS: In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. CONCLUSION: This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

  14. Effects of short-hairpin RNA-inhibited {beta}-catenin expression on the growth of human multiple myeloma cells in vitro and in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Liang, Wenqing, E-mail: liangwenqing_1234@126.com [Department of Orthopaedics, Shaoxing People' s Hospital, 568 Zhongxing North Road, Shaoxing 312000 (China); Yang, Chengwei [Department of Spinal Surgery, Lanzhou General Hospital, Lanzhou Military Area Command, 333 Nanbinhe Road, Lanzhou 730050 (China); Qian, Yu [Department of Orthopaedics, Shaoxing People' s Hospital, 568 Zhongxing North Road, Shaoxing 312000 (China); Fu, Qiang, E-mail: chyygklwq@hotmail.com [Department of Orthopaedics, Changhai Hospital, Second Military Medical University, 168 Changhai Road, Shanghai 200433 (China)

    2012-06-15

    Highlights: Black-Right-Pointing-Pointer {beta}-Catenin expression were markedly down-regulated by CTNNB1 shRNA. Black-Right-Pointing-Pointer CTNNB1 shRNA could inhibit the proliferation of RPMI8226 cells. Black-Right-Pointing-Pointer Significantly profound apoptotic cell death in CTNNB1 shRNA cells. Black-Right-Pointing-Pointer In vivo, CTNNB1 silence led to a growth inhibition of myeloma growth. Black-Right-Pointing-Pointer c-myc and {beta}-catenin in the expression cells of cleaved caspase-3 were increased. -- Abstract: Multiple myeloma (MM) is thrombogenic as a consequence of multiple hemostatic effects. Overexpression of {beta}-catenin has been observed in several types of malignant tumors, including MM. However, the relationship between {beta}-catenin expression and MM remains unclear. In the present study, RNA interference was used to inhibit {beta}-catenin expression in RPMI8226 cells. RT-PCR and Western blotting analyses showed that {beta}-catenin mRNA and protein expression were markedly down-regulated by CTNNB1 shRNA. Western blotting showed that the protein levels of cyclin D1 and glutamine synthetase were downregulated and supported the transcriptional regulatory function of {beta}-catenin. The MTT assay showed that CTNNB1 shRNA could have significant inhibitory effects on the proliferation of RPMI8226 cells. The TOPflash reporter assay demonstrated significant downregulation after CTNNB1 shRNA transfection in RPMI8226 cells. Flow cytometric analyses also showed significantly profound apoptosis in CTNNB1 shRNA cells. We found CTNNB1 silence led to growth inhibition of MM growth in vivo. Immunohistochemical analyses showed that c-myc and {beta}-catenin were reduced in CTNNB1 shRNA tumor tissues, but that expression of cleaved caspase-3 was increased. These results show that {beta}-catenin could be a new therapeutic agent that targets the biology of MM cells.

  15. Short-hairpin RNA-mediated Heat shock protein 90 gene silencing inhibits human breast cancer cell growth in vitro and in vivo

    International Nuclear Information System (INIS)

    Zuo, Keqiang; Li, Dan; Pulli, Benjamin; Yu, Fei; Cai, Haidong; Yuan, Xueyu; Zhang, Xiaoping; Lv, Zhongwei

    2012-01-01

    Highlights: ► Hsp90 is over-expressed in human breast cancer. ► The shRNA-mediated gene silencing of Hsp90 resulted in inhibition of cell growth. ► Akt and NF-kB were down-regulation after transfection due to Hsp90 silencing. ► The tumor growth ratio was decline due to Hsp90 silencing. ► The PCNA expression was down-regulation due to Hsp90 silencing. -- Abstract: Hsp90 interacts with proteins that mediate signaling pathways involved in the regulation of essential processes such as proliferation, cell cycle control, angiogenesis and apoptosis. Hsp90 inhibition is therefore an attractive strategy for blocking abnormal pathways that are crucial for cancer cell growth. In the present study, the role of Hsp90 in human breast cancer MCF-7 cells was examined by stably silencing Hsp90 gene expression with an Hsp90-silencing vector (Hsp90-shRNA). RT-PCR and Western blot analyses showed that Hsp90-shRNA specifically and markedly down-regulated Hsp90 mRNA and protein expression. NF-kB and Akt protein levels were down-regulated in Hsp90-shRNA transfected cells, indicating that Hsp90 knockout caused a reduction of survival factors and induced apoptosis. Treatment with Hsp90-shRNA significantly increased apoptotic cell death and caused cell cycle arrest in the G1/S phase in MCF-7 cells, as shown by flow cytometry. Silencing of Hsp90 also reduced cell viability, as determined by MTT assay. In vivo experiments showed that MCF-7 cells stably transfected with Hsp90-shRNA grew slowly in nude mice as compared with control groups. In summary, the Hsp90-shRNA specifically silenced the Hsp90 gene, and inhibited MCF-7 cell growth in vitro and in vivo. Possible molecular mechanisms underlying the effects of Hsp90-shRNA include the degradation of Hsp90 breast cancer-related client proteins, the inhibition of survival signals and the upregulation of apoptotic pathways. shRNA-mediated interference may have potential therapeutic utility in human breast cancer.

  16. Effect of a Dual Charge on the DNA-Conjugated Redox Probe on DNA Sensing by Short Hairpin Beacons Tethered to Gold Electrodes.

    Science.gov (United States)

    Kékedy-Nagy, László; Shipovskov, Stepan; Ferapontova, Elena E

    2016-08-16

    Charges of redox species can critically affect both the interfacial state of DNA and electrochemistry of DNA-conjugated redox labels and, as a result, the electroanalytical performance of those systems. Here, we show that the kinetics of electron transfer (ET) between the gold electrode and methylene blue (MB) label conjugated to a double-stranded (ds) DNA tethered to gold strongly depend on the charge of the MB molecule, and that affects the performance of genosensors exploiting MB-labeled hairpin DNA beacons. Positively charged MB binds to dsDNA via electrostatic and intercalative/groove binding, and this binding allows the DNA-mediated electrochemistry of MB intercalated into the duplex and, as a result, a complex mode of the electrochemical signal change upon hairpin hybridization to the target DNA, dominated by the "on-off" signal change mode at nanomolar levels of the analyzed DNA. When MB bears an additional carboxylic group, the negative charge provided by this group prevents intimate interactions between MB and DNA, and then the ET in duplexes is limited by the diffusion of the MB-conjugated dsDNA (the phenomenon first shown in Farjami , E. ; Clima , L. ; Gothelf , K. ; Ferapontova , E. E. Anal. Chem. 2011 , 83 , 1594 ) providing the robust "off-on" nanomolar DNA sensing. Those results can be extended to other intercalating redox probes and are of strategic importance for design and development of electrochemical hybridization sensors exploiting DNA nanoswitchable architectures.

  17. Towards Antiviral shRNAs Based on the AgoshRNA Design.

    Directory of Open Access Journals (Sweden)

    Ying Poi Liu

    Full Text Available RNA interference (RNAi can be induced by intracellular expression of a short hairpin RNA (shRNA. Processing of the shRNA requires the RNaseIII-like Dicer enzyme to remove the loop and to release the biologically active small interfering RNA (siRNA. Dicer is also involved in microRNA (miRNA processing to liberate the mature miRNA duplex, but recent studies indicate that miR-451 is not processed by Dicer. Instead, this miRNA is processed by the Argonaute 2 (Ago2 protein, which also executes the subsequent cleavage of a complementary mRNA target. Interestingly, shRNAs that structurally resemble miR-451 can also be processed by Ago2 instead of Dicer. The key determinant of these "AgoshRNA" molecules is a relatively short basepaired stem, which avoids Dicer recognition and consequently allows alternative processing by Ago2. AgoshRNA processing yields a single active RNA strand, whereas standard shRNAs produce a duplex with guide and passenger strands and the latter may cause adverse off-target effects. In this study, we converted previously tested active anti-HIV-1 shRNA molecules into AgoshRNA. We tested several designs that could potentially improve AgoshRNA activity, including extension of the complementarity between the guide strand and the mRNA target and reduction of the thermodynamic stability of the hairpins. We demonstrate that active AgoshRNAs can be generated. However, the RNAi activity is reduced compared to the matching shRNAs. Despite reduced RNAi activity, comparison of an active AgoshRNA and the matching shRNA in a sensitive cell toxicity assay revealed that the AgoshRNA is much less toxic.

  18. Tumor-targeting magnetic lipoplex delivery of short hairpin RNA suppresses IGF-1R overexpression of lung adenocarcinoma A549 cells in vitro and in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Chunmao; Ding, Chao; Kong, Minjian [Department of Cardiothoracic Surgery, Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou 310009 (China); Dong, Aiqiang, E-mail: dr_dongaiqiang@sina.com [Department of Cardiothoracic Surgery, Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou 310009 (China); Qian, Jianfang; Jiang, Daming; Shen, Zhonghua [Department of Cardiothoracic Surgery, Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou 310009 (China)

    2011-07-08

    Highlights: {yields} We compared lipofection with magnetofection about difference of transfection efficiency on delivery a therapeutic gene in vitro and in vivo. {yields} We investigated the difference of shRNA induced by magnetofection and lipofection into A549 cell and subcutaneous tumor to knockdown IGF-1R overexpressed in A549 cell and A549 tumor. {yields} We investigated in vivo shRNA silenced IGF-1R overexpression 24, 48, and 72 h after shRNA intravenous injection into tumor-bearing mice by way of magnetofection and lipofection. {yields} Our results showed that magnetofection could achieve therapeutic gene targeted delivery into special site, which contributed to targeted gene therapy of lung cancers. -- Abstract: Liposomal magnetofection potentiates gene transfection by applying a magnetic field to concentrate magnetic lipoplexes onto target cells. Magnetic lipoplexes are self-assembling ternary complexes of cationic lipids with plasmid DNA associated with superparamagnetic iron oxide nanoparticles (SPIONs). Type1insulin-like growth factor receptor (IGF-1R), an important oncogene, is frequently overexpressed in lung cancer and mediates cancer cell proliferation and tumor growth. In this study, we evaluated the transfection efficiency (percentage of transfected cells) and therapeutic potential (potency of IGF-1R knockdown) of liposomal magnetofection of plasmids expressing GFP and shRNAs targeting IGF-1R (pGFPshIGF-1Rs) in A549 cells and in tumor-bearing mice as compared to lipofection using Lipofectamine 2000. Liposomal magnetofection provided a threefold improvement in transgene expression over lipofection and transfected up to 64.1% of A549 cells in vitro. In vitro, IGF-1R specific-shRNA transfected by lipofection inhibited IGF-1R protein by 56.1 {+-} 6% and by liposomal magnetofection by 85.1 {+-} 3%. In vivo delivery efficiency of the pGFPshIGF-1R plasmid into the tumor was significantly higher in the liposomal magnetofection group than in the

  19. Tumor-targeting magnetic lipoplex delivery of short hairpin RNA suppresses IGF-1R overexpression of lung adenocarcinoma A549 cells in vitro and in vivo

    International Nuclear Information System (INIS)

    Wang, Chunmao; Ding, Chao; Kong, Minjian; Dong, Aiqiang; Qian, Jianfang; Jiang, Daming; Shen, Zhonghua

    2011-01-01

    Highlights: → We compared lipofection with magnetofection about difference of transfection efficiency on delivery a therapeutic gene in vitro and in vivo. → We investigated the difference of shRNA induced by magnetofection and lipofection into A549 cell and subcutaneous tumor to knockdown IGF-1R overexpressed in A549 cell and A549 tumor. → We investigated in vivo shRNA silenced IGF-1R overexpression 24, 48, and 72 h after shRNA intravenous injection into tumor-bearing mice by way of magnetofection and lipofection. → Our results showed that magnetofection could achieve therapeutic gene targeted delivery into special site, which contributed to targeted gene therapy of lung cancers. -- Abstract: Liposomal magnetofection potentiates gene transfection by applying a magnetic field to concentrate magnetic lipoplexes onto target cells. Magnetic lipoplexes are self-assembling ternary complexes of cationic lipids with plasmid DNA associated with superparamagnetic iron oxide nanoparticles (SPIONs). Type1insulin-like growth factor receptor (IGF-1R), an important oncogene, is frequently overexpressed in lung cancer and mediates cancer cell proliferation and tumor growth. In this study, we evaluated the transfection efficiency (percentage of transfected cells) and therapeutic potential (potency of IGF-1R knockdown) of liposomal magnetofection of plasmids expressing GFP and shRNAs targeting IGF-1R (pGFPshIGF-1Rs) in A549 cells and in tumor-bearing mice as compared to lipofection using Lipofectamine 2000. Liposomal magnetofection provided a threefold improvement in transgene expression over lipofection and transfected up to 64.1% of A549 cells in vitro. In vitro, IGF-1R specific-shRNA transfected by lipofection inhibited IGF-1R protein by 56.1 ± 6% and by liposomal magnetofection by 85.1 ± 3%. In vivo delivery efficiency of the pGFPshIGF-1R plasmid into the tumor was significantly higher in the liposomal magnetofection group than in the lipofection group. In vivo IGF-1R

  20. Tumor-targeting magnetic lipoplex delivery of short hairpin RNA suppresses IGF-1R overexpression of lung adenocarcinoma A549 cells in vitro and in vivo.

    Science.gov (United States)

    Wang, Chunmao; Ding, Chao; Kong, Minjian; Dong, Aiqiang; Qian, Jianfang; Jiang, Daming; Shen, Zhonghua

    2011-07-08

    Liposomal magnetofection potentiates gene transfection by applying a magnetic field to concentrate magnetic lipoplexes onto target cells. Magnetic lipoplexes are self-assembling ternary complexes of cationic lipids with plasmid DNA associated with superparamagnetic iron oxide nanoparticles (SPIONs). Type1 insulin-like growth factor receptor (IGF-1R), an important oncogene, is frequently overexpressed in lung cancer and mediates cancer cell proliferation and tumor growth. In this study, we evaluated the transfection efficiency (percentage of transfected cells) and therapeutic potential (potency of IGF-1R knockdown) of liposomal magnetofection of plasmids expressing GFP and shRNAs targeting IGF-1R (pGFPshIGF-1Rs) in A549 cells and in tumor-bearing mice as compared to lipofection using Lipofectamine 2000. Liposomal magnetofection provided a threefold improvement in transgene expression over lipofection and transfected up to 64.1% of A549 cells in vitro. In vitro, IGF-1R specific-shRNA transfected by lipofection inhibited IGF-1R protein by 56.1±6% and by liposomal magnetofection by 85.1±3%. In vivo delivery efficiency of the pGFPshIGF-1R plasmid into the tumor was significantly higher in the liposomal magnetofection group than in the lipofection group. In vivo IGF-1R specific-shRNA by lipofection inhibited IGF-1R protein by an average of 43.8±5.3%; that by liposomal magnetofection inhibited IGF-1R protein by 43.4±5.7%, 56.3±9.6%, and 72.2±6.8%, at 24, 48, and 72 h, respectively, after pGFPshIGF-1R injection. Our findings indicate that liposomal magnetofection may be a promising method that allows the targeting of gene therapy to lung cancer. Copyright © 2011 Elsevier Inc. All rights reserved.

  1. Short-hairpin Mediated Myostatin Knockdown Resulted in Altered Expression of Myogenic Regulatory Factors with Enhanced Myoblast Proliferation in Fetal Myoblast Cells of Goats.

    Science.gov (United States)

    Kumar, Rohit; Singh, Satyendra Pal; Mitra, Abhijit

    2018-01-02

    Myostatin (MSTN) is a well-known negative regulator of skeletal muscle development. Reduced expression due to natural mutations in the coding region and knockout as well as knockdown of MSTN results in an increase in the muscle mass. In the present study, we demonstrated as high as 60 and 52% downregulation (p < 0.01) of MSTN mRNA and protein in the primary fetal myoblast cells of goats using synthetic shRNAs (n = 3), without any interferon response. We, for the first time, evaluated the effect of MSTN knockdown on the expression of MRFs (namely, MyoD, Myf5), follistatin (FST), and IGFs (IGF-1 & IGF-2) in goat myoblast cells. MSTN knockdown caused an upregulation (p < 0.05) of MyoD and downregulation (p < 0.01) of MYf5 and FST expression. Moreover, we report up to ∼four fold (p < 0.001) enhanced proliferation in myoblasts after four days of culture. The anti-MSTN shRNA demonstrated in the present study could be used for the production of transgenic goats to increase the muscle mass.

  2. shRNA-seq data analysis with edgeR [v1; ref status: indexed, http://f1000r.es/38s

    Directory of Open Access Journals (Sweden)

    Zhiyin Dai

    2014-04-01

    Full Text Available Pooled short hairpin RNA sequencing (shRNA-seq screens are becoming increasingly popular in functional genomics research, and there is a need to establish optimal analysis tools to handle such data. Our open-source shRNA processing pipeline in edgeR provides a complete analysis solution for shRNA-seq screen data, that begins with the raw sequence reads and ends with a ranked lists of candidate shRNAs for downstream biological validation. We first summarize the raw data contained in a fastq file into a matrix of counts (samples in the columns, hairpins in the rows with options for allowing mismatches and small shifts in hairpin position. Diagnostic plots, normalization and differential representation analysis can then be performed using established methods to prioritize results in a statistically rigorous way, with the choice of either the classic exact testing methodology or a generalized linear modelling that can handle complex experimental designs. A detailed users’ guide that demonstrates how to analyze screen data in edgeR along with a point-and-click implementation of this workflow in Galaxy are also provided. The edgeR package is freely available from http://www.bioconductor.org.

  3. Role of solution conformation and flexibility of short peptide ligands that bind to the p56(lck) SH2 domain

    NARCIS (Netherlands)

    Dekker, Frank J; de Mol, Nico J; Bultinck, Patrick; Kemmink, Johan; Hilbers, Hans W; Liskamp, Rob M J; Dekker, Frank

    2003-01-01

    A general approach in drug design is making ligands more rigid in order to avoid loss in conformational entropy (deltaS(conf)) upon receptor binding. We hypothesized that in the high affinity binding of pYEEI peptide ligands to the p56(lck) SH2 domain this loss in deltaS(conf) might be diminished

  4. Three new shRNA expression vectors targeting the CYP3A4 coding sequence to inhibit its expression

    Directory of Open Access Journals (Sweden)

    Siyun Xu

    2014-10-01

    Full Text Available RNA interference (RNAi is useful for selective gene silencing. Cytochrome P450 3A4 (CYP3A4, which metabolizes approximately 50% of drugs in clinical use, plays an important role in drug metabolism. In this study, we aimed to develop a short hairpin RNA (shRNA to modulate CYP3A4 expression. Three new shRNAs (S1, S2 and S3 were designed to target the coding sequence (CDS of CYP3A4, cloned into a shRNA expression vector, and tested in different cells. The mixture of three shRNAs produced optimal reduction (55% in CYP3A4 CDS-luciferase activity in both CHL and HEK293 cells. Endogenous CYP3A4 expression in HepG2 cells was decreased about 50% at both mRNA and protein level after transfection of the mixture of three shRNAs. In contrast, CYP3A5 gene expression was not altered by the shRNAs, supporting the selectivity of CYP3A4 shRNAs. In addition, HepG2 cells transfected with CYP3A4 shRNAs were less sensitive to Ginkgolic acids, whose toxic metabolites are produced by CYP3A4. These results demonstrate that vector-based shRNAs could modulate CYP3A4 expression in cells through their actions on CYP3A4 CDS, and CYP3A4 shRNAs may be utilized to define the role of CYP3A4 in drug metabolism and toxicity.

  5. Deep Sequencing Insights in Therapeutic shRNA Processing and siRNA Target Cleavage Precision.

    Science.gov (United States)

    Denise, Hubert; Moschos, Sterghios A; Sidders, Benjamin; Burden, Frances; Perkins, Hannah; Carter, Nikki; Stroud, Tim; Kennedy, Michael; Fancy, Sally-Ann; Lapthorn, Cris; Lavender, Helen; Kinloch, Ross; Suhy, David; Corbau, Romu

    2014-02-04

    TT-034 (PF-05095808) is a recombinant adeno-associated virus serotype 8 (AAV8) agent expressing three short hairpin RNA (shRNA) pro-drugs that target the hepatitis C virus (HCV) RNA genome. The cytosolic enzyme Dicer cleaves each shRNA into multiple, potentially active small interfering RNA (siRNA) drugs. Using next-generation sequencing (NGS) to identify and characterize active shRNAs maturation products, we observed that each TT-034-encoded shRNA could be processed into as many as 95 separate siRNA strands. Few of these appeared active as determined by Sanger 5' RNA Ligase-Mediated Rapid Amplification of cDNA Ends (5-RACE) and through synthetic shRNA and siRNA analogue studies. Moreover, NGS scrutiny applied on 5-RACE products (RACE-seq) suggested that synthetic siRNAs could direct cleavage in not one, but up to five separate positions on targeted RNA, in a sequence-dependent manner. These data support an on-target mechanism of action for TT-034 without cytotoxicity and question the accepted precision of substrate processing by the key RNA interference (RNAi) enzymes Dicer and siRNA-induced silencing complex (siRISC).Molecular Therapy-Nucleic Acids (2014) 3, e145; doi:10.1038/mtna.2013.73; published online 4 February 2014.

  6. Oxidative stress response in SH-SY5Y cells exposed to short-term 1800 MHz radiofrequency radiation.

    Science.gov (United States)

    Marjanovic Cermak, Ana Marija; Pavicic, Ivan; Trosic, Ivancica

    2018-01-28

    The exact mechanism that could explain the effects of radiofrequency (RF) radiation exposure at non-thermal level is still unknown. Increasing evidence suggests a possible involvement of reactive oxygen species (ROS) and development of oxidative stress. To test the proposed hypothesis, human neuroblastoma cells (SH-SY5Y) were exposed to 1800 MHz short-term RF exposure for 10, 30 and 60 minutes. Electric field strength within Gigahertz Transverse Electromagnetic cell (GTEM) was 30 V m -1 and specific absorption rate (SAR) was calculated to be 1.6 W kg -1 . Cellular viability was measured by MTT assay and level of ROS was determined by fluorescent probe 2',7'-dichlorofluorescin diacetate. Concentrations of malondialdehyde and protein carbonyls were used to assess lipid and protein oxidative damage and antioxidant activity was evaluated by measuring concentrations of total glutathione (GSH). After radiation exposure, viability of irradiated cells remained within normal physiological values. Significantly higher ROS level was observed for every radiation exposure time. After 60 min of exposure, the applied radiation caused significant lipid and protein damage. The highest GSH concentration was detected after 10 minute-exposure. The results of our study showed enhanced susceptibility of SH-SY5Y cells for development of oxidative stress even after short-term RF exposure.

  7. Incorporation of a cationic aminopropyl chain in DNA hairpins: thermodynamics and hydration

    Science.gov (United States)

    Soto, Ana Maria; Kankia, Besik I.; Dande, Prasad; Gold, Barry; Marky, Luis A.

    2001-01-01

    We report on the physicochemical effects resulting from incorporating a 5-(3-aminopropyl) side chain onto a 2′-deoxyuridine (dU) residue in a short DNA hairpin. A combination of spectroscopy, calorimetry, density and ultrasound techniques were used to investigate both the helix–coil transition of a set of  hairpins with the following sequence: d(GCGACTTTTTGNCGC) [N = dU, deoxythymidine (dT) or 5-(3-aminopropyl)-2′-deoxyuridine (dU*)], and the interaction of each hairpin with Mg2+. All three molecules undergo two-state transitions with melting temperatures (TM) independent of strand concentration that indicates their intramolecular hairpin formation. The unfolding of each hairpin takes place with similar TM values of 64–66°C and similar thermodynamic profiles. The unfavorable unfolding free energies of 6.4–6.9 kcal/mol result from the typical compensation of unfavorable enthalpies, 36–39 kcal/mol, and favorable entropies of ∼110 cal/mol. Furthermore, the stability of each hairpin increases as the salt concentration increases, the TM-dependence on salt yielded slopes of 2.3–2.9°C, which correspond to counterion releases of 0.53 (dU and dT) and 0.44 (dU*) moles of Na+ per mole of hairpin. Absolute volumetric and compressibility measurements reveal that all three hairpins have similar hydration levels. The electrostatic interaction of Mg2+ with each hairpin yielded binding affinities in the order: dU > dT > dU*, and a similar release of 2–4 electrostricted water molecules. The main result is that the incorporation of the cationic 3-aminopropyl side chain in the major groove of the hairpin stem neutralizes some local negative charges yielding a hairpin molecule with lower charge density. PMID:11522834

  8. Creating Transgenic shRNA Mice by Recombinase-Mediated Cassette Exchange

    Science.gov (United States)

    Premsrirut, Prem K.; Dow, Lukas E.; Park, Youngkyu; Hannon, Gregory J.; Lowe, Scott W.

    2014-01-01

    RNA interference (RNAi) enables sequence-specific, experimentally induced silencing of virtually any gene by tapping into innate regulatory mechanisms that are conserved among most eukaryotes. The principles that enable transgenic RNAi in cell lines can also be used to create transgenic animals, which express short-hairpin RNAs (shRNAs) in a regulated or tissue-specific fashion. However, RNAi in transgenic animals is somewhat more challenging than RNAi in cultured cells. The activities of promoters that are commonly used for shRNA expression in cell culture can vary enormously in different tissues, and founder lines also typically vary in transgene expression due to the effects of their single integration sites. There are many ways to produce mice carrying shRNA transgenes and the method described here uses recombinase-mediated cassette exchange (RMCE). RMCE permits insertion of the shRNA transgene into a well-characterized locus that gives reproducible and predictable expression in each founder and enhances the probability of potent expression in many cell types. This procedure is more involved and complex than simple pronuclear injection, but if even a few shRNA mice are envisioned, for example, to probe the functions of several genes, the effort of setting up the processes outlined below are well worthwhile. Note that when creating a transgenic mouse, one should take care to use the most potent shRNA possible. As a rule of thumb, the sequence chosen should provide >90% knockdown when introduced into cultured cells at single copy (e.g., on retroviral infection at a multiplicity of ≤0.3). PMID:24003198

  9. Comparison of SH3 and SH2 domain dynamics when expressed alone or in an SH(3+2) construct: the role of protein dynamics in functional regulation.

    Science.gov (United States)

    Engen, J R; Smithgall, T E; Gmeiner, W H; Smith, D L

    1999-04-02

    Protein dynamics play an important role in protein function and regulation of enzymatic activity. To determine how additional interactions with surrounding structure affects local protein dynamics, we have used hydrogen exchange and mass spectrometry to investigate the SH2 and SH3 domains of the protein tyrosine kinase Hck. Exchange rates of isolated Hck SH3 and SH2 domains were compared with rates for the same domains when part of a larger SH(3+2) construct. Increased deuterium incorporation was observed for the SH3 domain in the joint construct, particularly near the SH2 interface and the short sequence that connects SH3 to SH2, implying greater flexibility of SH3 when it is part of SH(3+2). Slow cooperative unfolding of the SH3 domain occurred at the same rate in isolated SH3 as in the SH(3+2) construct, suggesting a functional significance for this unfolding. The SH2 domain displayed relatively smaller changes in flexibility when part of the SH(3+2) construct. These results suggest that the domains influence each other. Further, our results imply a link between functional regulation and structural dynamics of SH3 and SH2 domains. Copyright 1999 Academic Press.

  10. Doppler-Guided Transanal Hemorrhoidal Dearterialization (DG-THD) Versus Stapled Hemorrhoidopexy (SH) in the Treatment of Third-Degree Hemorrhoids: Clinical Results at Short and Long-Term Follow-Up.

    Science.gov (United States)

    Leardi, S; Pessia, B; Mascio, M; Piccione, F; Schietroma, M; Pietroletti, R

    2016-11-01

    The stapled hemorrhoidopexy (SH) and the Doppler-guided transanal hemorrhoidal dearterialization (DG-THD) are minimally invasive procedures for the surgical treatment of hemorrhoids. This study aims to verify the efficacy of the DG-THD versus the SH in the treatment of third-degree hemorrhoids. One hundred consecutive patients were causally allocated to either procedure, obtaining two groups of 50 pts. A clinical examination was performed at 3, 7, 15, and 30 days after the operation. Quality of life, anal symptoms, recurrence of hemorrhoids, and reoperation were assessed by means of a questionnaire and of a clinical examination at long-term follow-up (7.0 year average). At short-term follow-up, the median postoperative pain score was significantly lower in DG-THD group compared to SH group, (V.A.S 2 vs 6; t = 2.65, p hemorrhoids.

  11. AAV-based shRNA silencing of NF-κB ameliorates muscle pathologies in mdx mice.

    Science.gov (United States)

    Yang, Q; Tang, Y; Imbrogno, K; Lu, A; Proto, J D; Chen, A; Guo, F; Fu, F H; Huard, J; Wang, B

    2012-12-01

    Chronic inflammation, promoted by an upregulated NF-kappa B (NF-κB) pathway, has a key role in Duchenne muscular dystrophy (DMD) patients' pathogenesis. Blocking the NF-κB pathway has been shown to be a viable approach to diminish chronic inflammation and necrosis in the dystrophin-defective mdx mouse, a murine DMD model. In this study, we used the recombinant adeno-associated virus serotype 9 (AAV9) carrying an short hairpin RNA (shRNA) specifically targeting the messenger RNA of NF-κB/p65 (p65-shRNA), the major subunit of NF-κB associated with chronic inflammation in mdx mice. We examined whether i.m. AAV9-mediated delivery of p65-shRNA could decrease NF-κB activation, allowing for amelioration of muscle pathologies in 1- and 4-month-old mdx mice. At 1 month after treatment, NF-κB/p65 levels were significantly decreased by AAV gene transfer of p65-shRNA in the two ages of treatment groups, with necrosis significantly decreased compared with controls. Quantitative analysis revealed that central nucleation (CN) of the myofibers of p65-shRNA-treated 1-month-old mdx muscles was reduced from 67 to 34%, but the level of CN was not significantly decreased in treated 4-month-old mdx mice. Moreover, delivery of the p65-shRNA enhanced the capacity of myofiber regeneration in old mdx mice treated at 4 months of age when the dystrophic myofibers were most exhausted; however, such p65 silencing diminished the myofiber regeneration in young mdx mice treated at 1 month of age. Taken together, these findings demonstrate that the AAV-mediated delivery of p65-shRNA has the capacity to ameliorate muscle pathologies in mdx mice by selectively reducing NF-κB/p65 activity.

  12. [Lentivirus-mediated shRNA silencing of LAMP2A inhibits the proliferation of multiple myeloma cells].

    Science.gov (United States)

    Li, Lixuan; Li, Jia

    2015-05-01

    To study the effects of lentivirus-mediated short hairpin RNA (shRNA) silencing of lysosome-associated membrane protein type 2A (LAMP2A) expression on the proliferation of multiple myeloma cells. The constructed shRNA lentiviral vector was applied to infect human multiple myeloma cell line MM.1S, and stable expression cell line was obtained by puromycin screening. Western blotting was used to verify the inhibitory effect on LAMP2A protein expression. MTT assay was conducted to detect the effect of knocked-down LAMP2A on MM.1S cell proliferation, and the anti-tumor potency of suberoylanilide hydroxamic acid (SAHA) against the obtained MM.1S LAMP2A(shRNA) stable cell line. Lactate assay was performed to observe the impact of low LAMP2A expression on cell glycolysis. The stable cell line with low LAMP2A expression were obtained with the constructed human LAMP2A-shRNA lentiviral vector. Down-regulation of LAMP2A expression significantly inhibited MM.1S cell proliferation and enhanced the anti-tumor activity of SAHA. Interestingly, decreased LAMP2A expression also inhibited MM.1S cell lactic acid secretion. Down-regulation of LAMP2A expression could inhibit cell proliferation in multiple myeloma cells.

  13. A hairpin within YAP mRNA 3′UTR functions in regulation at post-transcription level

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Yuen; Wang, Yuan; Feng, Jinyan; Feng, Guoxing; Zheng, Minying; Yang, Zhe; Xiao, Zelin; Lu, Zhanping [State Key Laboratory of Medicinal Chemical Biology, Department of Cancer Research, College of Life Sciences, Nankai University, Tianjin 300071 (China); Ye, Lihong [State Key Laboratory of Medicinal Chemical Biology, Department of Biochemistry, College of Life Sciences, Nankai University, Tianjin 300071 (China); Zhang, Xiaodong, E-mail: zhangxd@nankai.edu.cn [State Key Laboratory of Medicinal Chemical Biology, Department of Cancer Research, College of Life Sciences, Nankai University, Tianjin 300071 (China)

    2015-04-03

    The central dogma of gene expression is that DNA is transcribed into messenger RNAs, which in turn serve as the template for protein synthesis. Recently, it has been reported that mRNAs display regulatory roles that rely on their ability to compete for microRNA binding, independent of their protein-coding function. However, the regulatory mechanism of mRNAs remains poorly understood. Here, we report that a hairpin within YAP mRNA 3′untranslated region (3′UTR) functions in regulation at post-transcription level through generating endogenous siRNAs (esiRNAs). Bioinformatics analysis for secondary structure showed that YAP mRNA displayed a hairpin structure (termed standard hairpin, S-hairpin) within its 3′UTR. Surprisingly, we observed that the overexpression of S-hairpin derived from YAP 3′UTR (YAP-sh) increased the luciferase reporter activities of transcriptional factor NF-κB and AP-1 in 293T cells. Moreover, we identified that a fragment from YAP-sh, an esiRNA, was able to target mRNA 3′UTR of NF2 (a member of Hippo-signaling pathway) and YAP mRNA 3′UTR itself in hepatoma cells. Thus, we conclude that the YAP-sh within YAP mRNA 3′UTR may serve as a novel regulatory element, which functions in regulation at post-transcription level. Our finding provides new insights into the mechanism of mRNAs in regulatory function. - Highlights: • An S-hairpin within YAP mRNA 3′UTR possesses regulatory function. • YAP-sh acts as a regulatory element for YAP at post-transcription level. • YAP-sh-3p20, an esiRNA derived from YAP-sh, targets mRNAs of YAP and NF2. • YAP-sh-3p20 depresses the proliferation of HepG2 cells in vitro.

  14. A hairpin within YAP mRNA 3′UTR functions in regulation at post-transcription level

    International Nuclear Information System (INIS)

    Gao, Yuen; Wang, Yuan; Feng, Jinyan; Feng, Guoxing; Zheng, Minying; Yang, Zhe; Xiao, Zelin; Lu, Zhanping; Ye, Lihong; Zhang, Xiaodong

    2015-01-01

    The central dogma of gene expression is that DNA is transcribed into messenger RNAs, which in turn serve as the template for protein synthesis. Recently, it has been reported that mRNAs display regulatory roles that rely on their ability to compete for microRNA binding, independent of their protein-coding function. However, the regulatory mechanism of mRNAs remains poorly understood. Here, we report that a hairpin within YAP mRNA 3′untranslated region (3′UTR) functions in regulation at post-transcription level through generating endogenous siRNAs (esiRNAs). Bioinformatics analysis for secondary structure showed that YAP mRNA displayed a hairpin structure (termed standard hairpin, S-hairpin) within its 3′UTR. Surprisingly, we observed that the overexpression of S-hairpin derived from YAP 3′UTR (YAP-sh) increased the luciferase reporter activities of transcriptional factor NF-κB and AP-1 in 293T cells. Moreover, we identified that a fragment from YAP-sh, an esiRNA, was able to target mRNA 3′UTR of NF2 (a member of Hippo-signaling pathway) and YAP mRNA 3′UTR itself in hepatoma cells. Thus, we conclude that the YAP-sh within YAP mRNA 3′UTR may serve as a novel regulatory element, which functions in regulation at post-transcription level. Our finding provides new insights into the mechanism of mRNAs in regulatory function. - Highlights: • An S-hairpin within YAP mRNA 3′UTR possesses regulatory function. • YAP-sh acts as a regulatory element for YAP at post-transcription level. • YAP-sh-3p20, an esiRNA derived from YAP-sh, targets mRNAs of YAP and NF2. • YAP-sh-3p20 depresses the proliferation of HepG2 cells in vitro

  15. Short Chemical Ischemia Triggers Phosphorylation of eIF2α and Death of SH-SY5Y Cells but not Proteasome Stress and Heat Shock Protein Response in both SH-SY5Y and T98G Cells.

    Science.gov (United States)

    Klacanova, Katarina; Pilchova, Ivana; Klikova, Katarina; Racay, Peter

    2016-04-01

    Both translation arrest and proteasome stress associated with accumulation of ubiquitin-conjugated protein aggregates were considered as a cause of delayed neuronal death after transient global brain ischemia; however, exact mechanisms as well as possible relationships are not fully understood. The aim of this study was to compare the effect of chemical ischemia and proteasome stress on cellular stress responses and viability of neuroblastoma SH-SY5Y and glioblastoma T98G cells. Chemical ischemia was induced by transient treatment of the cells with sodium azide in combination with 2-deoxyglucose. Proteasome stress was induced by treatment of the cells with bortezomib. Treatment of SH-SY5Y cells with sodium azide/2-deoxyglucose for 15 min was associated with cell death observed 24 h after treatment, while glioblastoma T98G cells were resistant to the same treatment. Treatment of both SH-SY5Y and T98G cells with bortezomib was associated with cell death, accumulation of ubiquitin-conjugated proteins, and increased expression of Hsp70. These typical cellular responses to proteasome stress, observed also after transient global brain ischemia, were not observed after chemical ischemia. Finally, chemical ischemia, but not proteasome stress, was in SH-SY5Y cells associated with increased phosphorylation of eIF2α, another typical cellular response triggered after transient global brain ischemia. Our results showed that short chemical ischemia of SH-SY5Y cells is not sufficient to induce both proteasome stress associated with accumulation of ubiquitin-conjugated proteins and stress response at the level of heat shock proteins despite induction of cell death and eIF2α phosphorylation.

  16. Crystal structure of Src-like adaptor protein 2 reveals close association of SH3 and SH2 domains through β-sheet formation.

    Science.gov (United States)

    Wybenga-Groot, Leanne E; McGlade, C Jane

    2013-12-01

    The Src-like adaptor proteins (SLAP/SLAP2) are key components of Cbl-dependent downregulation of antigen receptor, cytokine receptor, and receptor tyrosine kinase signaling in hematopoietic cells. SLAP and SLAP2 consist of adjacent SH3 and SH2 domains that are most similar in sequence to Src family kinases (SFKs). Notably, the SH3-SH2 connector sequence is significantly shorter in SLAP/SLAP2 than in SFKs. To understand the structural implication of a short SH3-SH2 connector sequence, we solved the crystal structure of a protein encompassing the SH3 domain, SH3-SH2 connector, and SH2 domain of SLAP2 (SLAP2-32). While both domains adopt typical folds, the short SH3-SH2 connector places them in close association. Strand βe of the SH3 domain interacts with strand βA of the SH2 domain, resulting in the formation of a continuous β sheet that spans the length of the protein. Disruption of the SH3/SH2 interface through mutagenesis decreases SLAP-32 stability in vitro, consistent with inter-domain binding being an important component of SLAP2 structure and function. The canonical peptide binding pockets of the SH3 and SH2 domains are fully accessible, in contrast to other protein structures that display direct interaction between SH3 and SH2 domains, in which either peptide binding surface is obstructed by the interaction. Our results reveal potential sites of novel interaction for SH3 and SH2 domains, and illustrate the adaptability of SH2 and SH3 domains in mediating interactions. As well, our results suggest that the SH3 and SH2 domains of SLAP2 function interdependently, with implications on their mode of substrate binding. © 2013.

  17. Effects and mechanism of integrin-β1 gene expression inhibited by shRNA in invasion of pancreatic carcinoma PANC-1 cells.

    Science.gov (United States)

    Yu, Feng; Li, Hua; Bu, Xuefeng; Zhang, Yongjun

    2012-01-01

    To investigate the effects of integrin-β1 gene expression inhibited by shRNA on invasion of pancreatic carcinoma PANC-1 cells in vitro. The eukaryotic expression plasmid of short hairpin RNA (shRNA) targeting integrin-β1 gene (integrin-β1-shRNA) was constructed and transfected into PANC-1 cells. The expressions of integrin-β1 mRNA and protein were detected by real-time quantitative polymerase chain reaction (PCR) and western blot assay, respectively. The invasive ability of PANC-1 cells was observed with a transwell cell culture chamber and the expressions of MMP-2 and MMP-9 were assayed. Compared to the untransfected group, recombinant expression plasmid integrin-β1-shRNA resulted in reduction of integrin-β1 mRNA and protein by 78.58%±7.24% and 92.88%±3.18%, respectively and the average number of invading PANC-1 cells were decreased from 52±5 to 21±4 (pPANC-1 cells in vitro significantly.

  18. The influence of survivin shRNA on the cell cycle and the invasion of SW480 cells of colorectal carcinoma

    Directory of Open Access Journals (Sweden)

    Yu Jin

    2008-07-01

    Full Text Available Abstract Background The objective was to understand the influence of Survivin plasmid with short hairpin RNA (shRNA on the cell cycle, invasion, and the silencing effect of Survivin gene in the SW480 cell of colorectal carcinoma. Methods A eukaryotic expression vector, PGCH1/Survivin shRNA, a segment sequence of Survivin as target, was created and transfected into colorectal carcinoma cell line SW480 by the non-lipid method. The influence on the Survivin protein was analyzed by Western blotting, while the cell cycle, cell apoptosis were analyzed by flow cytometry, and invasion of the cell was analyzed by Transwell's chamber method. Results After the transfection of PGCH1/Survivin shRNA, the expression of Survivin protein in SW480 cells was dramatically decreased by 60.68%, in which the cells were stopped at G2/M phase, even though no apoptosis was detected. The number of transmembranous cells of the experimental group, negative control group, and blank control group were 14.46 ± 2.11, 25.12 ± 8.37, and 25.86 ± 7.45, respectively (P 0.05. Conclusion Survivin shRNA could significantly reduce the expression of Survivin protein and invasion of SW480 cells. Changes in cell cycle were observed, but no apoptosis was induced.

  19. A dynamical mechanism for the hairpin diagram

    International Nuclear Information System (INIS)

    Chang Chaohsi; Guo Xinheng; Li Xueqian.

    1989-09-01

    Based on the non-valence quark-antiquark and gluon constituent structure of mesons we give a reasonable dynamical mechanism which can induce the hairpin diagram without violating the well-observed OZI rule. We calculate the hairpin amplitudes of D deg. → K-bar deg.η and K-bar deg.η' normalized by D deg. → K-bar deg.π deg. and have found that the hairpin diagram can give rise to substantial contribution to the decays where a meson with a SU(3) flavor singlet component is involved in the final state. In this scenario, we also obtain the branching ratio of D deg. → K-bar deg. φ as 0.55% in comparison with the experimental data of 0.83%. (autor). 33 refs, 3 figs

  20. Life extension of MAPS-2 by replacement of boiler hairpin type heat exchangers

    International Nuclear Information System (INIS)

    Tripathi, J.C.; Rastogi, S.K.; Rastogi, A.K.

    2006-01-01

    The steam generating equipment in MAPS-1 and 2 are Hairpin type comprises of eight boiler assemblies arranged in two banks of four boilers each. Each hairpin type heat exchangers consist of 195 Monel-400 tubes of 12.7 mm OD x 1.24 mm WT. One boiler assembly consists of eleven inverted U type heat exchangers (called hairpin type heat exchangers) mounted in parallel on inlet and outlet heavy water manifolds and connected to steam drum through individual short riser. Heavy water flows through these tubes where as feed water enters the shell at the bottom of one leg called pre-heat leg. After commissioning of MAPS-2 in 1985, five hairpins of MAPS-2 developed leak during the course of operation by the year 1999. Absence of physical access for health assessment of steam generator tube and lack of provision for tube sheet cleaning to remove the deposits on feed water side had caused pile and resulted in tube failures by under deposit pitting corrosion. All the 88 hairpins of MAPS-2 were replaced to extend the plant life when MAPS-2 was taken out of grid for En-masse Coolant Channel Replacement job (EMCCR) in the year 2001 - 03. The long shutdown of MAPS units for EMCCR was considered to be cost effective since unscheduled plant shut downs on account of tube leaks could be avoided. (author)

  1. An infinitely expandable cloning strategy plus repeat-proof PCR for working with multiple shRNA.

    Directory of Open Access Journals (Sweden)

    Glen John McIntyre

    Full Text Available Vector construction with restriction enzymes (REs typically involves the ligation of a digested donor fragment (insert to a reciprocally digested recipient fragment (vector backbone. Creating a suitable cloning plan becomes increasingly difficult for complex strategies requiring repeated insertions such as constructing multiple short hairpin RNA (shRNA expression vectors for RNA interference (RNAi studies. The problem lies in the reduced availability of suitable RE recognition sites with an increasing number of cloning events and or vector size. This report details a technically simple, directional cloning solution using REs with compatible cohesive ends that are repeatedly destroyed and simultaneously re-introduced with each round of cloning. Donor fragments can be made by PCR or sub-cloned from pre-existing vectors and inserted ad infinitum in any combination. The design incorporates several cloning cores in order to be compatible with as many donor sequences as possible. We show that joining sub-combinations made in parallel is more time-efficient than sequential construction (of one cassette at a time for any combination of 4 or more insertions. Screening for the successful construction of combinations using Taq polymerase based PCR became increasingly difficult with increasing number of repeated sequence elements. A Pfu polymerase based PCR was developed and successfully used to amplify combinations of up to eleven consecutive hairpin expression cassettes. The identified PCR conditions can be beneficial to others working with multiple shRNA or other repeated sequences, and the infinitely expandable cloning strategy serves as a general solution applicable to many cloning scenarios.

  2. An approach to the construction of tailor-made amphiphilic peptides that strongly and selectively bind to hairpin RNA targets.

    Science.gov (United States)

    Lee, Su Jin; Hyun, Soonsil; Kieft, Jeffrey S; Yu, Jaehoon

    2009-02-18

    The hairpin RNA motif is one of the most frequently observed secondary structures and is often targeted by therapeutic agents. An amphiphilic peptide with seven lysine and eight leucine residues and its derivatives were designed for use as ligands against RNA hairpin motifs. We hypothesized that variations in both the hydrophobic leucine-rich and hydrophilic lysine-rich spheres of these amphiphilic peptides would create extra attractive interactions with hairpin RNA targets. A series of alanine-scanned peptides were probed to identify the most influential lysine residues in the hydrophilic sphere. The binding affinities of these modified peptides with several hairpins, such as RRE, TAR from HIV, a short hairpin from IRES of HCV, and a hairpin from the 16S A-site stem from rRNA, were determined. Since the hairpin from IRES of HCV was the most susceptible to the initial series of alanine-scanned peptides, studies investigating how further variations in the peptides effect binding employed the IRES hairpin. Next, the important Lys residues were substituted by shorter chain amines, such as ornithine, to place the peptide deeper into the hairpin groove. In a few cases, a 70-fold improved binding was observed for peptides that contained the specifically located shorter amine side chains. To further explore changes in binding affinities brought about by alterations in the hydrophobic sphere, tryptophan residues were introduced in place of leucine. A few peptides with tryptophan in specific positions also displayed 70-fold improved binding affinities. Finally, double mutant peptides incorporating both specifically located shorter amine side chains in the hydrophilic region and tryptophan residues in the hydrophobic region were synthesized. The binding affinities of peptides containing the simple double modification were observed to be 80 times lower, and their binding specificities were increased 40-fold. The results of this effort provide important information about

  3. Virus-mediated shRNA knockdown of prodynorphin in the rat nucleus accumbens attenuates depression-like behavior and cocaine locomotor sensitization.

    Science.gov (United States)

    Cohen, Ami; Whitfield, Timothy W; Kreifeldt, Max; Koebel, Pascale; Kieffer, Brigitte L; Contet, Candice; George, Olivier; Koob, George F

    2014-01-01

    Dynorphins, endogenous opioid peptides that arise from the precursor protein prodynorphin (Pdyn), are hypothesized to be involved in the regulation of mood states and the neuroplasticity associated with addiction. The current study tested the hypothesis that dynorphin in the nucleus accumbens (NAcc) mediates such effects. More specifically, we examined whether knockdown of Pdyn within the NAcc in rats would alter the expression of depressive-like and anxiety-like behavior, as well as cocaine locomotor sensitization. Wistar rats were injected with adeno-associated viral (AAV) vectors encoding either a Pdyn-specific short hairpin RNA (AAV-shPdyn) or a scrambled shRNA (AAV-shScr) as control. Four weeks later, rats were tested for anxiety-like behavior in the elevated plus maze test and depressive-like behavior in the forced swim test (FST). Finally, rats received one daily injection of saline or cocaine (20 mg/kg, i.p.), followed by assessment of locomotion for 4 consecutive days. Following 3 days of abstinence, the rats completed 2 additional daily cocaine/saline locomotor trials. Pdyn knockdown in the NAcc led to a significant reduction in depressive-like behavior in the FST, but had no effect on anxiety-like behavior in the elevated plus maze. Pdyn knockdown did not alter baseline locomotor behavior, the locomotor response to acute cocaine, or the initial sensitization of the locomotor response to cocaine over the first 4 cocaine treatment days. However, following 3 days abstinence the locomotor response to the cocaine challenge returned to their original levels in the AAV-shPdyn rats while remaining heightened in the AAV-shScr rats. These results suggest that dynorphin in a very specific area of the nucleus accumbens contributes to depressive-like states and may be involved in neuroadaptations in the NAcc that contribute to the development of cocaine addiction as a persistent and lasting condition.

  4. Virus-mediated shRNA knockdown of prodynorphin in the rat nucleus accumbens attenuates depression-like behavior and cocaine locomotor sensitization.

    Directory of Open Access Journals (Sweden)

    Ami Cohen

    Full Text Available Dynorphins, endogenous opioid peptides that arise from the precursor protein prodynorphin (Pdyn, are hypothesized to be involved in the regulation of mood states and the neuroplasticity associated with addiction. The current study tested the hypothesis that dynorphin in the nucleus accumbens (NAcc mediates such effects. More specifically, we examined whether knockdown of Pdyn within the NAcc in rats would alter the expression of depressive-like and anxiety-like behavior, as well as cocaine locomotor sensitization. Wistar rats were injected with adeno-associated viral (AAV vectors encoding either a Pdyn-specific short hairpin RNA (AAV-shPdyn or a scrambled shRNA (AAV-shScr as control. Four weeks later, rats were tested for anxiety-like behavior in the elevated plus maze test and depressive-like behavior in the forced swim test (FST. Finally, rats received one daily injection of saline or cocaine (20 mg/kg, i.p., followed by assessment of locomotion for 4 consecutive days. Following 3 days of abstinence, the rats completed 2 additional daily cocaine/saline locomotor trials. Pdyn knockdown in the NAcc led to a significant reduction in depressive-like behavior in the FST, but had no effect on anxiety-like behavior in the elevated plus maze. Pdyn knockdown did not alter baseline locomotor behavior, the locomotor response to acute cocaine, or the initial sensitization of the locomotor response to cocaine over the first 4 cocaine treatment days. However, following 3 days abstinence the locomotor response to the cocaine challenge returned to their original levels in the AAV-shPdyn rats while remaining heightened in the AAV-shScr rats. These results suggest that dynorphin in a very specific area of the nucleus accumbens contributes to depressive-like states and may be involved in neuroadaptations in the NAcc that contribute to the development of cocaine addiction as a persistent and lasting condition.

  5. Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

    Science.gov (United States)

    Caetano-Anollés, G; Gresshoff, P M

    1996-06-01

    DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

  6. Targeting of human interleukin-12B by small hairpin RNAs in xenografted psoriatic skin

    Directory of Open Access Journals (Sweden)

    Jakobsen Maria

    2011-02-01

    Full Text Available Abstract Background Psoriasis is a chronic inflammatory skin disorder that shows as erythematous and scaly lesions. The pathogenesis of psoriasis is driven by a dysregulation of the immune system which leads to an altered cytokine production. Proinflammatory cytokines that are up-regulated in psoriasis include tumor necrosis factor alpha (TNFα, interleukin-12 (IL-12, and IL-23 for which monoclonal antibodies have already been approved for clinical use. We have previously documented the therapeutic applicability of targeting TNFα mRNA for RNA interference-mediated down-regulation by anti-TNFα small hairpin RNAs (shRNAs delivered by lentiviral vectors to xenografted psoriatic skin. The present report aims at targeting mRNA encoding the shared p40 subunit (IL-12B of IL-12 and IL-23 by cellular transduction with lentiviral vectors encoding anti-IL12B shRNAs. Methods Effective anti-IL12B shRNAs are identified among a panel of shRNAs by potency measurements in cultured cells. The efficiency and persistency of lentiviral gene delivery to xenografted human skin are investigated by bioluminescence analysis of skin treated with lentiviral vectors encoding the luciferase gene. shRNA-expressing lentiviral vectors are intradermally injected in xenografted psoriatic skin and the effects of the treatment evaluated by clinical psoriasis scoring, by measurements of epidermal thickness, and IL-12B mRNA levels. Results Potent and persistent transgene expression following a single intradermal injection of lentiviral vectors in xenografted human skin is reported. Stable IL-12B mRNA knockdown and reduced epidermal thickness are achieved three weeks after treatment of xenografted psoriatic skin with lentivirus-encoded anti-IL12B shRNAs. These findings mimick the results obtained with anti-TNFα shRNAs but, in contrast to anti-TNFα treatment, anti-IL12B shRNAs do not ameliorate the psoriatic phenotype as evaluated by semi-quantitative clinical scoring and by

  7. The SH2 domain interaction landscape.

    Science.gov (United States)

    Tinti, Michele; Kiemer, Lars; Costa, Stefano; Miller, Martin L; Sacco, Francesca; Olsen, Jesper V; Carducci, Martina; Paoluzi, Serena; Langone, Francesca; Workman, Christopher T; Blom, Nikolaj; Machida, Kazuya; Thompson, Christopher M; Schutkowski, Mike; Brunak, Søren; Mann, Matthias; Mayer, Bruce J; Castagnoli, Luisa; Cesareni, Gianni

    2013-04-25

    Members of the SH2 domain family modulate signal transduction by binding to short peptides containing phosphorylated tyrosines. Each domain displays a distinct preference for the sequence context of the phosphorylated residue. We have developed a high-density peptide chip technology that allows for probing of the affinity of most SH2 domains for a large fraction of the entire complement of tyrosine phosphopeptides in the human proteome. Using this technique, we have experimentally identified thousands of putative SH2-peptide interactions for more than 70 different SH2 domains. By integrating this rich data set with orthogonal context-specific information, we have assembled an SH2-mediated probabilistic interaction network, which we make available as a community resource in the PepspotDB database. A predicted dynamic interaction between the SH2 domains of the tyrosine phosphatase SHP2 and the phosphorylated tyrosine in the extracellular signal-regulated kinase activation loop was validated by experiments in living cells. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  8. The SH2 Domain Interaction Landscape

    Directory of Open Access Journals (Sweden)

    Michele Tinti

    2013-04-01

    Full Text Available Members of the SH2 domain family modulate signal transduction by binding to short peptides containing phosphorylated tyrosines. Each domain displays a distinct preference for the sequence context of the phosphorylated residue. We have developed a high-density peptide chip technology that allows for probing of the affinity of most SH2 domains for a large fraction of the entire complement of tyrosine phosphopeptides in the human proteome. Using this technique, we have experimentally identified thousands of putative SH2-peptide interactions for more than 70 different SH2 domains. By integrating this rich data set with orthogonal context-specific information, we have assembled an SH2-mediated probabilistic interaction network, which we make available as a community resource in the PepspotDB database. A predicted dynamic interaction between the SH2 domains of the tyrosine phosphatase SHP2 and the phosphorylated tyrosine in the extracellular signal-regulated kinase activation loop was validated by experiments in living cells.

  9. On hairpin vortices in a transitional boundary layer

    Directory of Open Access Journals (Sweden)

    Uruba Václav

    2012-04-01

    Full Text Available In the presented paper the results of experiments on transitional boundary layer are presented. The boundary layer was generated on smooth flat wall with zero pressure gradient forming one side of the channel of rectangular cross section. The hairpin vortices, packets of hairpin vortices, turbulent spots and calmed regions were experimentally investigated using time-resolved PIV technique.

  10. Hypoxia-response plasmid vector producing bcl-2 shRNA enhances the apoptotic cell death of mouse rectum carcinoma.

    Science.gov (United States)

    Fujioka, Takashi; Matsunaga, Naoya; Okazaki, Hiroyuki; Koyanagi, Satoru; Ohdo, Shigehiro

    2010-01-01

    Hypoxia-induced gene expression frequently occurs in malignant solid tumors because they often have hypoxic areas in which circulation is compromised due to structurally disorganized blood vessels. Hypoxia-response elements (HREs) are responsible for activating gene transcription in response to hypoxia. In this study, we constructed a hypoxia-response plasmid vector producing short hairpin RNA (shRNA) against B-cell leukemia/lymphoma-2 (bcl-2), an anti-apoptotic factor. The hypoxia-response promoter was made by inserting tandem repeats of HREs upstream of cytomegalovirus (CMV) promoter (HRE-CMV). HRE-CMV shbcl-2 vector consisted of bcl-2 shRNA under the control of HRE-CMV promoter. In hypoxic mouse rectum carcinoma cells (colon-26), the production of bcl-2 shRNA driven by HRE-CMV promoter was approximately 2-fold greater than that driven by CMV promoter. A single intratumoral (i.t.) injection of 40 microg HRE-CMV shbcl-2 to colon-26 tumor-bearing mice caused apoptotic cell death, and repetitive treatment with HRE-CMV shbcl-2 (40 microg/mouse, i.t.) also significantly suppressed the growth of colon-26 tumor cells implanted in mice. Apoptotic and anti-tumor effects were not observed in tumor-bearing mice treated with CMV shbcl-2. These results reveal the ability of HRE-CMV shbcl-2 vector to suppress the expression of bcl-2 in hypoxic tumor cells and suggest the usefulness of our constructed hypoxia-response plasmid vector to treat malignant tumors. [Supplementary Figures: available only at http://dx.doi.org/10.1254/jphs.10054FP].

  11. Linker length dependent binding of a focal adhesion kinase derived peptide to the Src SH3-SH2 domains.

    Science.gov (United States)

    Lindfors, Hanna E; Venkata, Bharat Somireddy; Drijfhout, Jan W; Ubbink, Marcellus

    2011-02-18

    The interaction between a peptide encompassing the SH3 and SH2 binding motifs of focal adhesion kinase (FAK) and the Src SH3-SH2 domains has been investigated with NMR spectroscopy and calorimetry. The binding to both motifs is anti-cooperative. Reduction of the long linker connecting the motifs does not lead to cooperativity. Short linkers that do not allow simultaneous intramolecular binding of the peptide to both motifs cause peptide-mediated dimerisation, even with a linker of only three amino acids. The role of the SH3 binding motif is discussed in view of the independent nature of the SH interactions. Copyright © 2011 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  12. Survivin knockdown increased anti-cancer effects of (-)-epigallocatechin-3-gallate in human malignant neuroblastoma SK-N-BE2 and SH-SY5Y cells

    Energy Technology Data Exchange (ETDEWEB)

    Hossain, Md. Motarab [Department of Pathology, Microbiology, and Immunology, University of South Carolina School of Medicine, Columbia, SC (United States); Banik, Naren L. [Department of Neurosciences, Medical University of South Carolina, Charleston, SC (United States); Ray, Swapan K., E-mail: swapan.ray@uscmed.sc.edu [Department of Pathology, Microbiology, and Immunology, University of South Carolina School of Medicine, Columbia, SC (United States)

    2012-08-01

    Neuroblastoma is a solid tumor that mostly occurs in children. Malignant neuroblastomas have poor prognosis because conventional chemotherapeutic agents are hardly effective. Survivin, which is highly expressed in some malignant neuroblastomas, plays a significant role in inhibiting differentiation and apoptosis and promoting cell proliferation, invasion, and angiogenesis. We examined consequences of survivin knockdown by survivin short hairpin RNA (shRNA) plasmid and then treatment with (-)-epigallocatechin-3-gallate (EGCG), a green tea flavonoid, in malignant neuroblastoma cells. Our Western blotting and laser scanning confocal immunofluorescence microscopy showed that survivin was highly expressed in malignant neuroblastoma SK-N-BE2 and SH-SY5Y cell lines and slightly in SK-N-DZ cell line. Expression of survivin was very faint in malignant neuroblastoma IMR32 cell line. We transfected SK-N-BE2 and SH-SY-5Y cells with survivin shRNA, treated with EGCG, and confirmed knockdown of survivin at mRNA and protein levels. Survivin knockdown induced morphological features of neuronal differentiation, as we observed following in situ methylene blue staining. Combination of survivin shRNA and EGCG promoted neuronal differentiation biochemically by increases in the expression of NFP, NSE, and e-cadherin and also decreases in the expression of Notch-1, ID2, hTERT, and PCNA. Our in situ Wright staining and Annexin V-FITC/PI staining showed that combination therapy was highly effective in inducing, respectively, morphological and biochemical features of apoptosis. Apoptosis occurred with activation of caspase-8 and cleavage of Bid to tBid, increase in Bax:Bcl-2 ratio, mitochondrial release of cytochrome c, and increases in the expression and activity of calpain and caspase-3. Combination therapy decreased migration of cells through matrigel and inhibited proliferative (p-Akt and NF-{kappa}B), invasive (MMP-2 and MMP-9), and angiogenic (VEGF and b-FGF) factors. Also, in vitro

  13. Hypoxia-inducible bidirectional shRNA expression vector delivery using PEI/chitosan-TBA copolymers for colorectal Cancer gene therapy.

    Science.gov (United States)

    Javan, Bita; Atyabi, Fatemeh; Shahbazi, Majid

    2018-04-12

    This investigation was conducted to construct a hypoxia/colorectal dual-specific bidirectional short hairpin RNA (shRNA) expression vector and to transfect it into the colon cancer cell line HT-29 with PEI/chitosan-TBA nanoparticles for the simultaneous knock down of β-catenin and Bcl-2 under hypoxia. To construct a pRNA-bipHRE-CEA vector, the carcinoma embryonic antigen (CEA) promoter designed in two directions and the vascular endothelial growth factor (VEGF) enhancer were inserted between two promoters for hypoxic cancer specific gene expression. To confirm the therapeutic effect of the dual-specific vector, β-catenin and Bcl-2 shRNAs were inserted downstream of each promoter. The physicochemical properties, the cytotoxicity, and the transfection efficiency of these PEI/chitosan-TBA nanoparticles were investigated. In addition, the antitumor effects of the designed vector on the expression of β-catenin and Bcl-2, cell cycle distribution, and apoptosis were investigated in vitro. The silencing effect of the hypoxia-response shRNA expression vector was relatively low (18%-25%) under normoxia, whereas it was significantly increased to approximately 50%-60% in the HT-29 cell line. Moreover, the cancer cells showed significant G0/G1 arrest and increased apoptosis due to gene silencing under hypoxia. Furthermore, MTS assay, fluorescence microscopy images, and flow cytometry analyses confirmed that the PEI/chitosan-TBA blend system provided effective transfection with low cytotoxicity. This novel hypoxia-responsive shRNA expression vector may be useful for RNA interference (RNAi)-based cancer gene therapy in hypoxic colorectal tumors. Moreover, the PEI/chitosan-TBA copolymer might be a promising gene carrier for use in gene transfer in vivo. Copyright © 2017. Published by Elsevier Inc.

  14. SH2 Domain Histochemistry.

    Science.gov (United States)

    Buhs, Sophia; Nollau, Peter

    2017-01-01

    Among posttranslational modifications, the phosphorylation of tyrosine residues is a key modification in cell signaling. Because of its biological importance, characterization of the cellular state of tyrosine phosphorylation is of great interest. Based on the unique properties of endogenously expressed SH2 domains recognizing tyrosine phosphorylated signaling proteins with high specificity we have developed an alternative approach, coined SH2 profiling, enabling us to decipher complex patterns of tyrosine phosphorylation in various normal and cancerous tissues. So far, SH2 profiling has largely been applied for the analysis of protein extracts with the limitation that information on spatial distribution and intensity of tyrosine phosphorylation within a tissue is lost. Here, we describe a novel SH2 domain based strategy for differential characterization of the state of tyrosine phosphorylation in formaldehyde-fixed and paraffin-embedded tissues. This approach demonstrates that SH2 domains may serve as very valuable tools for the analysis of the differential state of tyrosine phosphorylation in primary tissues fixed and processed under conditions frequently applied by routine pathology laboratories.

  15. Metamorphosis of a Hairpin Vortex into a Young Turbulent Spot

    Science.gov (United States)

    Singer, Bart A.; Joslin, Ronald D.

    1995-01-01

    Direct numerical simulation was used to study the formation and growth of a hairpin vortex in a flat-plate boundary layer and its later development into a young turbulent spot. Fluid injection through a slit in the wall triggered the initial vortex. The legs of the vortex were stretched into a hairpin shape as it traveled downstream. Multiple hairpin vortex heads developed between the stretched legs. New vortices formed beneath the streamwise-elongated vortex legs. The continued development of additional vortices resulted in the formation of a traveling region of highly disturbed ow with an arrowhead shape similar to that of a turbulent spot.

  16. Short-term cytotoxic effects and long-term instability of RNAi delivered using lentiviral vectors

    Directory of Open Access Journals (Sweden)

    Kruithof Egbert KO

    2004-08-01

    Full Text Available Abstract Background RNA interference (RNAi can potently reduce target gene expression in mammalian cells and is in wide use for loss-of-function studies. Several recent reports have demonstrated that short double-stranded RNAs (dsRNAs, used to mediate RNAi, can also induce an interferon-based response resulting in changes in the expression of many interferon-responsive genes. Off-target gene silencing has also been described, bringing into question the validity of certain RNAi-based approaches for studying gene function. We have targeted the plasminogen activator inhibitor-2 (PAI-2 or SERPINB2 mRNA using lentiviral vectors for delivery of U6 promoter-driven PAI-2-targeted short hairpin RNA (shRNA expression. PAI-2 is reported to have anti-apoptotic activity, thus reduction of endogenous expression may be expected to make cells more sensitive to programmed cell death. Results As expected, we encountered a cytotoxic phenotype when targeting the PAI-2 mRNA with vector-derived shRNA. However, this predicted phenotype was a potent non-specific effect of shRNA expression, as functional overexpression of the target protein failed to rescue the phenotype. By decreasing the shRNA length or modifying its sequence we maintained PAI-2 silencing and reduced, but did not eliminate, cytotoxicity. ShRNA of 21 complementary nucleotides (21 mers or more increased expression of the oligoadenylate synthase-1 (OAS1 interferon-responsive gene. 19 mer shRNA had no effect on OAS1 expression but long-term selective pressure on cell growth was observed. By lowering lentiviral vector titre we were able to reduce both expression of shRNA and induction of OAS1, without a major impact on the efficacy of gene silencing. Conclusions Our data demonstrate a rapid cytotoxic effect of shRNAs expressed in human tumor cell lines. There appears to be a cut-off of 21 complementary nucleotides below which there is no interferon response while target gene silencing is maintained

  17. Transient β-hairpin formation in α-synuclein monomer revealed by coarse-grained molecular dynamics simulation

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Hang; Ma, Wen [Beckman Institute for Advanced Science and Technology, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States); Center for Biophysics and Computational Biology, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States); Han, Wei [Beckman Institute for Advanced Science and Technology, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States); Department of Physics, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States); Schulten, Klaus, E-mail: kschulte@ks.uiuc.edu [Beckman Institute for Advanced Science and Technology, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States); Center for Biophysics and Computational Biology, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States); Department of Physics, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States)

    2015-12-28

    Parkinson’s disease, originating from the intrinsically disordered peptide α-synuclein, is a common neurodegenerative disorder that affects more than 5% of the population above age 85. It remains unclear how α-synuclein monomers undergo conformational changes leading to aggregation and formation of fibrils characteristic for the disease. In the present study, we perform molecular dynamics simulations (over 180 μs in aggregated time) using a hybrid-resolution model, Proteins with Atomic details in Coarse-grained Environment (PACE), to characterize in atomic detail structural ensembles of wild type and mutant monomeric α-synuclein in aqueous solution. The simulations reproduce structural properties of α-synuclein characterized in experiments, such as secondary structure content, long-range contacts, chemical shifts, and {sup 3}J(H{sub N}H{sub C{sub α}})-coupling constants. Most notably, the simulations reveal that a short fragment encompassing region 38-53, adjacent to the non-amyloid-β component region, exhibits a high probability of forming a β-hairpin; this fragment, when isolated from the remainder of α-synuclein, fluctuates frequently into its β-hairpin conformation. Two disease-prone mutations, namely, A30P and A53T, significantly accelerate the formation of a β-hairpin in the stated fragment. We conclude that the formation of a β-hairpin in region 38-53 is a key event during α-synuclein aggregation. We predict further that the G47V mutation impedes the formation of a turn in the β-hairpin and slows down β-hairpin formation, thereby retarding α-synuclein aggregation.

  18. "Off-on" electrochemical hairpin-DNA-based genosensor for cancer diagnostics.

    Science.gov (United States)

    Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt; Ferapontova, Elena E

    2011-03-01

    A simple and robust "off-on" signaling genosensor platform with improved selectivity for single-nucleotide polymorphism (SNP) detection based on the electronic DNA hairpin molecular beacons has been developed. The DNA beacons were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 3'-end, while the 5'-end was labeled with a methylene blue (MB) redox probe. A typical "on-off" change of the electrochemical signal was observed upon hybridization of the 27-33 nucleotide (nt) long hairpin DNA to the target DNA, in agreement with all the hitherto published data. Truncation of the DNA hairpin beacons down to 20 nts provided improved genosensor selectivity for SNP and allowed switching of the electrochemical genosensor response from the on-off to the off-on mode. Switching was consistent with the variation in the mechanism of the electron transfer reaction between the electrode and the MB redox label, for the folded beacon being characteristic of the electrochemistry of adsorbed species, while for the "open" duplex structure being formally controlled by the diffusion of the redox label within the adsorbate layer. The relative current intensities of both processes were governed by the length of the formed DNA duplex, potential scan rate, and apparent diffusion coefficient of the redox species. The off-on genosensor design used for detection of a cancer biomarker TP53 gene sequence favored discrimination between the healthy and SNP-containing DNA sequences, which was particularly pronounced at short hybridization times.

  19. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    Directory of Open Access Journals (Sweden)

    Gayani N. P. Dedduwa-Mudalige

    2015-09-01

    Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

  20. RNA interference-based therapeutics for human immunodeficiency virus HIV-1 treatment: synthetic siRNA or vector-based shRNA?

    Science.gov (United States)

    Subramanya, Sandesh; Kim, Sang-Soo; Manjunath, N; Shankar, Premlata

    2010-02-01

    Despite the clinical benefits of highly active antiretroviral therapy (HAART), the prospect of life-long antiretroviral treatment poses significant problems, which has spurred interest in developing new drugs and strategies to treat HIV infection and eliminate persistent viral reservoirs. RNAi has emerged as a therapeutic possibility for HIV. We discuss progress in overcoming hurdles to translating transient and stable RNAi enabling technologies to clinical application for HIV; covering the past 2 - 3 years. HIV inhibition can be achieved by transfection of chemically or enzymatically synthesized siRNAs or by DNA-based vector systems expressing short hairpin RNAs (shRNAs) that are processed intracellularly into siRNA. We compare these approaches, focusing on technical and safety issues that will guide the choice of strategy for clinical use. Introduction of synthetic siRNA into cells or its stable endogenous production using vector-driven shRNA have been shown to suppress HIV replication in vitro and, in some instances, in vivo. Each method has advantages and limitations in terms of ease of delivery, duration of silencing, emergence of escape mutants and potential toxicity. Both appear to have potential as future therapeutics for HIV, once the technical and safety issues of each approach are overcome.

  1. Short (

    NARCIS (Netherlands)

    Telleman, Gerdien; den Hartog, Laurens

    2013-01-01

    Aim: This systematic review assessed the implant survival rate of short (<10 mm) dental implants installed in partially edentulous patients. A case report of a short implant in the posterior region have been added. Materials and methods: A search was conducted in the electronic databases of MEDLINE

  2. Downregulation of mouse CCR3 by lentiviral shRNA inhibits proliferation and induces apoptosis of mouse eosinophils.

    Science.gov (United States)

    Zhu, Xin-Hua; Liao, Bing; Xu, Yi; Liu, Ke; Huang, Yun; Huang, Quan-Long; Liu, Yue-Hui

    2017-02-01

    RNA interference has been considered as an effective gene silencing method in basic and preclinical investigations. The aims of the present study were to construct a lentiviral vector expressing a short hairpin RNA (shRNA) targeting the murine CC chemokine receptor 3 (mCCR3), and to investigate its effects on the proliferation and apoptosis of mouse eosinophils. A recombinant lentiviral vector expressing four fragments of mouse CCR3 shRNA (pLVX‑mCCR3‑1+2+3+4‑shRNA) was constructed using subcloning techniques. This novel lentivirus was then packaged into 293T cells by co‑transduction with plasmids, including Baculo p35, pCMV R8.2 and VSV. The interference effects of the vector were verified using polymerase chain reaction (PCR) and western blot analyses. The effects of the interference on the proliferation and apoptosis of mouse eosinophils were investigated using 3‑(4,5‑dimethylthiazol‑2‑yl)‑5‑(3‑carboxymethoxyphenyl)‑2‑(4‑sulfophenyl)‑2H‑tetrazolium and terminal deoxynucleotidyl transferase dUTP nick end labeling methods, respectively. The results of the PCR and western blot analyses confirmed that the novel recombinant vector, pLVX‑mCCR3‑1+2+3+4‑shRNA, had high efficiency in inhibiting the mRNA and protein expression levels of mCCR3 in mouse eosinophils. The downregulation of mCCR3 significantly inhibited proliferation of the eosinophils. Furthermore, the present study found that the downregulation of mCCR3 significantly promoted apoptosis of the eosinophils. Therefore, the downregulation of mCCR3 led to the inhibition of proliferation and induction of apoptosis in mouse eosinophils. The predominant characteristics of allergic rhinitis are eosinophil infiltration and release of inflammatory mediators, which appear in a variety of clinical manifestations. The results of the present study indicate that mCCR3 silencing may serve as a putative approach for the treatment of allergic rhinitis.

  3. Structural studies on an internal loop from a hairpin ribozyme

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Z.; SantaLucia, J. Jr.; Tinoco, I. Jr. [Univ. of California, Berkeley, CA (United States)

    1994-12-01

    Ribozymes, RNA enzymes, catalyze site-specific RNA cleavage and ligation reactions. We are studying the three-dimensional structure of a hairpin ribozyme derived from the minus strand of tobacco ring spot virus satellite RNA ((-)sTRSV), which has been engineering to specifically cleave the HIV-1 RNA. The minimum structure for the catalytic reaction involves a 50-nucleotide ribozyme and a 14-nucleotide substrate. The proposed secondary structure of the ribozyme-substrate complex consists of four short helices separated by two internal loops. The relatively large size (64-nucleotide) of the ribozyme-substrate complex presents formidable problems in solving the structure using NMR. Therefore we are studying smaller structural subunits of the complex. We are determining the high resolution structure of the symmetric internal loop involving the cleavage site and the flanking helices. One strand of the internal loop was selectively {sup 13}C-labeled at C8 of each purine and C6 of each pyrimidine. By using {sup 13}C-edited two-dimensional NMR, the proton NOESY spectrum was greatly simplified. This allowed unambiguous sequential proton resonance assignments along each strand. Three-dimensional {sup 1}-{sup 13}C HMQC-NOESY was used to further facilitate resonance assignments. We are also enzymatically synthesizing the entire 50-nucleotide ribozyme and will combine it with the {sup 13}C-labeled substrate. Through comparison of the NOE connectivities of the labeled nucleotides from the internal loop alone with those from the entire complex, the differences between the two structures can be elucidated.

  4. Permanent, lowered HLA class I expression using lentivirus vectors with shRNA constructs: Averting cytotoxicity by alloreactive T lymphocytes.

    Science.gov (United States)

    Haga, K; Lemp, N A; Logg, C R; Nagashima, J; Faure-Kumar, E; Gomez, G G; Kruse, C A; Mendez, R; Stripecke, R; Kasahara, N; Kasahara, N A; Cicciarelli, J C

    2006-12-01

    Transplantation of many tissues requires histocompatibility matching of human leukocyte antigens (HLA) to prevent graft rejection, to reduce the level of immunosuppression needed to maintain graft survival, and to minimize the risk of graft-versus-host disease, particularly in the case of bone marrow transplantation. However, recent advances in fields of gene delivery and genetic regulation technologies have opened the possibility of engineering grafts that display reduced levels of HLA expression. Suppression of HLA expression could help to overcome the limitations imposed by extensive HLA polymorphisms that restrict the availability of suitable donors, necessitate the maintenance of large donor registries, and complicate the logistics of procuring and delivering matched tissues and organs to the recipient. Accordingly, we investigated whether knockdown of HLA by RNA interference (RNAi), a ubiquitous regulatory system that can efficiently and selectively inhibit the expression of specific gene products, would enable allogeneic cells to evade immune recognition. For efficient and stable delivery of short hairpin-type RNAi constructs (shRNA), we employed lentivirus-based gene transfer vectors, which provide a delivery system that can achieve integration into genomic DNA, thereby permanently modifying transduced graft cells. Our results show that lentivirus-mediated delivery of shRNA targeting pan-Class I and allele-specific HLA can achieve efficient and dose-dependent reduction in surface expression of HLA in human cells, associated with enhanced resistance to alloreactive T lymphocyte-mediated cytotoxicity, while avoiding MHC-non-restricted killing. We hypothesize that RNAi-induced silencing of HLA expression has the potential to create histocompatibility-enhanced, and, eventually, perhaps "universally" compatible cellular grafts.

  5. Survivin knockdown increased anti-cancer effects of (−)-epigallocatechin-3-gallate in human malignant neuroblastoma SK-N-BE2 and SH-SY5Y cells

    International Nuclear Information System (INIS)

    Hossain, Md. Motarab; Banik, Naren L.; Ray, Swapan K.

    2012-01-01

    Neuroblastoma is a solid tumor that mostly occurs in children. Malignant neuroblastomas have poor prognosis because conventional chemotherapeutic agents are hardly effective. Survivin, which is highly expressed in some malignant neuroblastomas, plays a significant role in inhibiting differentiation and apoptosis and promoting cell proliferation, invasion, and angiogenesis. We examined consequences of survivin knockdown by survivin short hairpin RNA (shRNA) plasmid and then treatment with (−)-epigallocatechin-3-gallate (EGCG), a green tea flavonoid, in malignant neuroblastoma cells. Our Western blotting and laser scanning confocal immunofluorescence microscopy showed that survivin was highly expressed in malignant neuroblastoma SK-N-BE2 and SH-SY5Y cell lines and slightly in SK-N-DZ cell line. Expression of survivin was very faint in malignant neuroblastoma IMR32 cell line. We transfected SK-N-BE2 and SH-SY-5Y cells with survivin shRNA, treated with EGCG, and confirmed knockdown of survivin at mRNA and protein levels. Survivin knockdown induced morphological features of neuronal differentiation, as we observed following in situ methylene blue staining. Combination of survivin shRNA and EGCG promoted neuronal differentiation biochemically by increases in the expression of NFP, NSE, and e-cadherin and also decreases in the expression of Notch-1, ID2, hTERT, and PCNA. Our in situ Wright staining and Annexin V-FITC/PI staining showed that combination therapy was highly effective in inducing, respectively, morphological and biochemical features of apoptosis. Apoptosis occurred with activation of caspase-8 and cleavage of Bid to tBid, increase in Bax:Bcl-2 ratio, mitochondrial release of cytochrome c, and increases in the expression and activity of calpain and caspase-3. Combination therapy decreased migration of cells through matrigel and inhibited proliferative (p-Akt and NF-κB), invasive (MMP-2 and MMP-9), and angiogenic (VEGF and b-FGF) factors. Also, in vitro

  6. Hybridization-based biosensor containing hairpin probes and use thereof

    Science.gov (United States)

    Miller, Benjamin L.; Strohsahl, Christopher M.

    2010-10-12

    A sensor chip that includes: a fluorescence quenching surface; a nucleic acid probe that contains first and second ends with the first end bound to the fluorescence quenching surface, and is characterized by being able to self-anneal into a hairpin conformation; and a first fluorophore bound to the second end of the first nucleic acid molecule. When the first nucleic acid molecule is in the hairpin conformation, the fluorescence quenching surface substantially quenches fluorescent emissions by the first fluorophore; and when the first nucleic acid molecule is in a non-hairpin conformation, fluorescent emissions by the fluorophore are substantially free of quenching by the fluorescence quenching surface. Various nucleic acid probes, methods of making the sensor chip, biological sensor devices that contain the sensor chip, and their methods of use are also disclosed.

  7. Characterization of a parallel-stranded DNA hairpin

    International Nuclear Information System (INIS)

    Germann, M.W.; Vogel, H.J.; Pon, R.T.; van de Sande, J.H.

    1989-01-01

    Recently, the authors have shown that synthetic DNA containing homooligomeric A-T base pairs can form a parallel-stranded intramolecular hairpin structure. In the present study, they have employed NMR and optical spectroscopy to investigate the structure of the parallel-stranded (PS) DNA hairpin 3'-d(T) 8 C 4 (A) 8 -3' and the related antiparallel (APS) hair 5'-d(T) 8 C 4 (A) 8 -3'. The parallel orientation of the strands in the PS oligonucleotide is achieved by introducing a 5'-5' phosphodiester linkage in the hairpin loop. Ultraviolet spectroscopic and fluorescence data of drug binding are consistent with the formation of PS and APS structures, respectively, in these two hairpins. Vacuum circular dichroism measurements in combination with theoretical CD calculations indicate that the PS structure forms a right-handed helix. 31 P NMR measurements indicate that the conformation of the phosphodiester backbone of the PS structure is not drastically different from that of the APS control. The presence of slowly exchanging imino protons at 14 ppm and the observation of nuclear Overhauser enhancement between imino protons and the AH-2 protons demonstrate that similar base pairing and base stacking between T and A residues occur in both hairpins. On the basis of NOESY measurements, they find that the orientation of the bases is in the anti region and that the sugar puckering is in the 2'-endo range. The results indicate a B-like conformation for each of the strands in the stem part of the PS hairpin and reverse Watson-Crick base pairing between the T and A residues. These data are consistent with a previously calculated structure for parallel-stranded DNA

  8. Hybridization chain reaction-based colorimetric aptasensor of adenosine 5'-triphosphate on unmodified gold nanoparticles and two label-free hairpin probes.

    Science.gov (United States)

    Gao, Zhuangqiang; Qiu, Zhenli; Lu, Minghua; Shu, Jian; Tang, Dianping

    2017-03-15

    This work designs a new label-free aptasensor for the colorimetric determination of small molecules (adenosine 5'-triphosphate, ATP) by using visible gold nanoparticles as the signal-generation tags, based on target-triggered hybridization chain reaction (HCR) between two hairpin DNA probes. The assay is carried out referring to the change in the color/absorbance by salt-induced aggregation of gold nanoparticles after the interaction with hairpins, gold nanoparticles and ATP. To construct such an assay system, two hairpin DNA probes with a short single-stranded DNA at the sticky end are utilized for interaction with gold nanoparticles. In the absence of target ATP, the hairpin DNA probes can prevent gold nanoparticles from the salt-induced aggregation through the interaction of the single-stranded DNA at the sticky end with gold nanoparticles. Upon target ATP introduction, the aptamer-based hairpin probe is opened to expose a new sticky end for the strand-displacement reaction with another complementary hairpin, thus resulting in the decreasing single-stranded DNA because of the consumption of hairpins. In this case, gold nanoparticles are uncovered owing to the formation of double-stranded DNA, which causes their aggregation upon addition of the salt, thereby leading to the change in the red-to-blue color. Under the optimal conditions, the HCR-based colorimetric assay presents good visible color or absorbance responses for the determination of target ATP at a concentration as low as 1.0nM. Importantly, the methodology can be further extended to quantitatively or qualitatively monitor other small molecules or biotoxins by changing the sequence of the corresponding aptamer. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Survivin knockdown increased anti-cancer effects of (-)-epigallocatechin-3-gallate in human malignant neuroblastoma SK-N-BE2 and SH-SY5Y cells.

    Science.gov (United States)

    Hossain, Md Motarab; Banik, Naren L; Ray, Swapan K

    2012-08-01

    Neuroblastoma is a solid tumor that mostly occurs in children. Malignant neuroblastomas have poor prognosis because conventional chemotherapeutic agents are hardly effective. Survivin, which is highly expressed in some malignant neuroblastomas, plays a significant role in inhibiting differentiation and apoptosis and promoting cell proliferation, invasion, and angiogenesis. We examined consequences of survivin knockdown by survivin short hairpin RNA (shRNA) plasmid and then treatment with (-)-epigallocatechin-3-gallate (EGCG), a green tea flavonoid, in malignant neuroblastoma cells. Our Western blotting and laser scanning confocal immunofluorescence microscopy showed that survivin was highly expressed in malignant neuroblastoma SK-N-BE2 and SH-SY5Y cell lines and slightly in SK-N-DZ cell line. Expression of survivin was very faint in malignant neuroblastoma IMR32 cell line. We transfected SK-N-BE2 and SH-SY-5Y cells with survivin shRNA, treated with EGCG, and confirmed knockdown of survivin at mRNA and protein levels. Survivin knockdown induced morphological features of neuronal differentiation, as we observed following in situ methylene blue staining. Combination of survivin shRNA and EGCG promoted neuronal differentiation biochemically by increases in the expression of NFP, NSE, and e-cadherin and also decreases in the expression of Notch-1, ID2, hTERT, and PCNA. Our in situ Wright staining and Annexin V-FITC/PI staining showed that combination therapy was highly effective in inducing, respectively, morphological and biochemical features of apoptosis. Apoptosis occurred with activation of caspase-8 and cleavage of Bid to tBid, increase in Bax:Bcl-2 ratio, mitochondrial release of cytochrome c, and increases in the expression and activity of calpain and caspase-3. Combination therapy decreased migration of cells through matrigel and inhibited proliferative (p-Akt and NF-κB), invasive (MMP-2 and MMP-9), and angiogenic (VEGF and b-FGF) factors. Also, in vitro

  10. Whirlwinds and hairpins in the atmospheric surface layer

    NARCIS (Netherlands)

    Oncley, Steven P.; Hartogensis, O.K.; Tong, Chenning

    2016-01-01

    Vortices in the atmospheric surface layer are characterized using observations at unprecedented resolution from a fixed array of 31 turbulence sensors. During the day, these vortices likely are dust devils, though no visual observations are available for confirmation. At night, hairpin vortices

  11. Modeling the mechanism of CLN025 beta-hairpin formation

    Science.gov (United States)

    McKiernan, Keri A.; Husic, Brooke E.; Pande, Vijay S.

    2017-09-01

    Beta-hairpins are substructures found in proteins that can lend insight into more complex systems. Furthermore, the folding of beta-hairpins is a valuable test case for benchmarking experimental and theoretical methods. Here, we simulate the folding of CLN025, a miniprotein with a beta-hairpin structure, at its experimental melting temperature using a range of state-of-the-art protein force fields. We construct Markov state models in order to examine the thermodynamics, kinetics, mechanism, and rate-determining step of folding. Mechanistically, we find the folding process is rate-limited by the formation of the turn region hydrogen bonds, which occurs following the downhill hydrophobic collapse of the extended denatured protein. These results are presented in the context of established and contradictory theories of the beta-hairpin folding process. Furthermore, our analysis suggests that the AMBER-FB15 force field, at this temperature, best describes the characteristics of the full experimental CLN025 conformational ensemble, while the AMBER ff99SB-ILDN and CHARMM22* force fields display a tendency to overstabilize the native state.

  12. The Drosophila Helicase MLE Targets Hairpin Structures in Genomic Transcripts.

    Directory of Open Access Journals (Sweden)

    Simona Cugusi

    2016-01-01

    Full Text Available RNA hairpins are a common type of secondary structures that play a role in every aspect of RNA biochemistry including RNA editing, mRNA stability, localization and translation of transcripts, and in the activation of the RNA interference (RNAi and microRNA (miRNA pathways. Participation in these functions often requires restructuring the RNA molecules by the association of single-strand (ss RNA-binding proteins or by the action of helicases. The Drosophila MLE helicase has long been identified as a member of the MSL complex responsible for dosage compensation. The complex includes one of two long non-coding RNAs and MLE was shown to remodel the roX RNA hairpin structures in order to initiate assembly of the complex. Here we report that this function of MLE may apply to the hairpins present in the primary RNA transcripts that generate the small molecules responsible for RNA interference. Using stocks from the Transgenic RNAi Project and the Vienna Drosophila Research Center, we show that MLE specifically targets hairpin RNAs at their site of transcription. The association of MLE at these sites is independent of sequence and chromosome location. We use two functional assays to test the biological relevance of this association and determine that MLE participates in the RNAi pathway.

  13. Hairpin-Hairpin Molecular Beacon Interactions for Detection of Survivin mRNA in Malignant SW480 Cells.

    Science.gov (United States)

    Ratajczak, Katarzyna; Krazinski, Bartlomiej E; Kowalczyk, Anna E; Dworakowska, Beata; Jakiela, Slawomir; Stobiecka, Magdalena

    2018-05-07

    Cancer biomarkers offer unique prospects for the development of cancer diagnostics and therapy. One of such biomarkers, protein survivin (Sur), exhibits strong antiapoptotic and proliferation-enhancing properties and is heavily expressed in multiple cancers. Thus, it can be utilized to provide new modalities for modulating the cell-growth rate, essential for effective cancer treatment. Herein, we have focused on the development of a new survivin-based cancer detection platform for colorectal cancer cells SW480 using a turn-on fluorescence oligonucleotide molecular beacon (MB) probe, encoded to recognize Sur messenger RNA (mRNA). Contrary to the expectations, we have found that both the complementary target oligonucleotide strands as well as the single- and double-mismatch targets, instead of exhibiting the anticipated simple random conformations, preferentially formed secondary structure motifs by folding into small-loop hairpin structures. Such a conformation may interfere with, or even undermine, the biorecognition process. To gain better understanding of the interactions involved, we have replaced the classical Tyagi-Kramer model of interactions between a straight target oligonucleotide strand and a hairpin MB with a new model to account for the hairpin-hairpin interactions as the biorecognition principle. A detailed mechanism of these interactions has been proposed. Furthermore, in experimental work, we have demonstrated an efficient transfection of malignant SW480 cells with SurMB probes containing a fluorophore Joe (SurMB-Joe) using liposomal nanocarriers. The green emission from SurMB-Joe in transfected cancer cells, due to the hybridization of the SurMB-Joe loop with Sur mRNA hairpin target, corroborates Sur overexpression. On the other hand, healthy human-colon epithelial cells CCD 841 CoN show only negligible expression of survivin mRNA. These experiments provide the proof-of-concept for distinguishing between the cancer and normal cells by the proposed

  14. The haloarchaeal MCM proteins: bioinformatic analysis and targeted mutagenesis of the β7-β8 and β9-β10 hairpin loops and conserved zinc binding domain cysteines.

    Science.gov (United States)

    Kristensen, Tatjana P; Maria Cherian, Reeja; Gray, Fiona C; MacNeill, Stuart A

    2014-01-01

    The hexameric MCM complex is the catalytic core of the replicative helicase in eukaryotic and archaeal cells. Here we describe the first in vivo analysis of archaeal MCM protein structure and function relationships using the genetically tractable haloarchaeon Haloferax volcanii as a model system. Hfx. volcanii encodes a single MCM protein that is part of the previously identified core group of haloarchaeal MCM proteins. Three structural features of the N-terminal domain of the Hfx. volcanii MCM protein were targeted for mutagenesis: the β7-β8 and β9-β10 β-hairpin loops and putative zinc binding domain. Five strains carrying single point mutations in the β7-β8 β-hairpin loop were constructed, none of which displayed impaired cell growth under normal conditions or when treated with the DNA damaging agent mitomycin C. However, short sequence deletions within the β7-β8 β-hairpin were not tolerated and neither was replacement of the highly conserved residue glutamate 187 with alanine. Six strains carrying paired alanine substitutions within the β9-β10 β-hairpin loop were constructed, leading to the conclusion that no individual amino acid within that hairpin loop is absolutely required for MCM function, although one of the mutant strains displays greatly enhanced sensitivity to mitomycin C. Deletions of two or four amino acids from the β9-β10 β-hairpin were tolerated but mutants carrying larger deletions were inviable. Similarly, it was not possible to construct mutants in which any of the conserved zinc binding cysteines was replaced with alanine, underlining the likely importance of zinc binding for MCM function. The results of these studies demonstrate the feasibility of using Hfx. volcanii as a model system for reverse genetic analysis of archaeal MCM protein function and provide important confirmation of the in vivo importance of conserved structural features identified by previous bioinformatic, biochemical and structural studies.

  15. The haloarchaeal MCM proteins: bioinformatic analysis and targeted mutagenesis of the β7-β8 and β9-β10 hairpin loops and conserved zinc binding domain cysteines

    Directory of Open Access Journals (Sweden)

    Tatjana P Kristensen

    2014-03-01

    Full Text Available The hexameric MCM complex is the catalytic core of the replicative helicase in eukaryotic and archaeal cells. Here we describe the first in vivo analysis of archaeal MCM protein structure and function relationships using the genetically tractable haloarchaeon Haloferax volcanii as a model system. Hfx. volcanii encodes a single MCM protein that is part of the previously identified core group of haloarchaeal MCM proteins. Three structural features of the N-terminal domain of the Hfx. volcanii MCM protein were targeted for mutagenesis: the β7-β8 and β9-β10 β-hairpin loops and putative zinc binding domain. Five strains carrying single point mutations in the β7-β8 β-hairpin loop were constructed, none of which displayed impaired cell growth under normal conditions or when treated with the DNA damaging agent mitomycin C. However, short sequence deletions within the β7-β8 β-hairpin were not tolerated and neither was replacement of the highly conserved residue glutamate 187 with alanine. Six strains carrying paired alanine substitutions within the β9-β10 β-hairpin loop were constructed, leading to the conclusion that no individual amino acid within that hairpin loop is absolutely required for MCM function, although one of the mutant strains displays greatly enhanced sensitivity to mitomycin C. Deletions of two or four amino acids from the β9-β10 β-hairpin were tolerated but mutants carrying larger deletions were inviable. Similarly, it was not possible to construct mutants in which any of the conserved zinc binding cysteines was replaced with alanine, underlining the likely importance of zinc binding for MCM function. The results of these studies demonstrate the feasibility of using Hfx. volcanii as a model system for reverse genetic analysis of archaeal MCM protein function and provide important confirmation of the in vivo importance of conserved structural features identified by previous bioinformatic, biochemical and structural

  16. A Therapeutic Potential of Animal β-hairpin Antimicrobial Peptides.

    Science.gov (United States)

    Panteleev, Pavel V; Balandin, Sergey V; Ivanov, Vadim T; Ovchinnikova, Tatiana V

    2017-01-01

    Endogenous antimicrobial peptides (AMPs) are evolutionary ancient molecular factors of innate immunity that play the key role in host defense. Because of the low resistance rate, AMPs have caught extensive attention as possible alternatives to conventional antibiotics. Over the last years, it has become evident that biological functions of AMPs are beyond direct killing of microbial cells. This review focuses on a relatively small family of animal host defense peptides with the β-hairpin structure stabilized by disulfide bridges. Their small size, rigid structure, stability to proteases, and plethora of biological functions, including antibacterial, antifungal, antiviral, anticancer, endotoxin-binding, metabolism- and immune- modulating activities, make natural β-hairpin AMPs an attractive molecular basis for drug design. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  17. [Selection and construction of cell line stably expressing survivin gene in lower level through eukaryotic plasmid vector of shRNA].

    Science.gov (United States)

    Wang, Wen-Xia; Sun, Shan-Zhen; Song, Ying

    2008-06-01

    To construct a short hairpin RNA(shRNA) interference expression plasmid vector of survivin gene, transfect tongue squamous cell carcinoma line Tca8113 which expressed survivin gene in a high level, and choose the cells whose survivin gene were suppressed significantly. Two pairs of oligonucleotide sequences specific for survivin gene were designed and synthesized, and cloned into pSilencer-2.1U6-neo plasmid. The recombinant plasmids (named PS1 and PS2) were amplified in Ecoli. DH5alpha was identified by restriction digestion, PCR and sequencing. The vectors were transfected into Tca8113 cells with lipofectamine 2000. After selection with G418, the stable cell clones were attained. Survivn expression was assayed with real-time quantitative PCR and Western blotting. SAS8.0 software package was used for Student t test. Two vectors were constructed successfully and stable cell clones with PS1 or PS2 plasmid were obtained. As compared with those of control, survivin expression of transfected cell with PS1 or PS2 in mRNA level was significantly suppressed (P<0.05). In protein level, only those of transfected cell with PS2 was significantly suppressed (P<0.01). The shRNA interference expression plasmid vectors of survivin gene are successfully constructed, and Tca8113 cells which express survivin gene in a stable lower level are attained, which enable us to carry out further research on gene therapy of oral squamous cell carcinoma. Supported by National Natural Science Foundation of China (Grant No.30572056).

  18. Intravitreal Injection of Ranibizumab and CTGF shRNA Improves Retinal Gene Expression and Microvessel Ultrastructure in a Rodent Model of Diabetes

    Directory of Open Access Journals (Sweden)

    Bojie Hu

    2014-01-01

    Full Text Available Therapeutic modalities targeting vascular endothelial growth factor (VEGF have been used to treat neovascularization and macular edema. However, anti-VEGF treatment alone may cause up-regulation of connective tissue growth factor (CTGF in the retina, increasing the risk of fibrosis and tractional retinal detachment. Therefore, in this study, we employ a novel dual-target intervention that involves intravitreal injection of the VEGF inhibitor ranibizumab and a transfection reagent-treated non-viral vector carrying anti-CTGF short hairpin RNA (shRNA driven by human RNA polymerase III promoter U6. The effects of the dual-target intervention on the expression of VEGF and CTGF and on microvessel ultrastructure were examined in retina of streptozocin-induced diabetic rats. CTGF was significantly up-regulated at week 8 after diabetic induction, whereas VEGF was not up-regulated until week 10. The high expression of both genes was maintained at week 12. Transmission electron microscopy also revealed progressive exacerbation of microvessel ultrastructure during the same period. In addition, ranibizumab significantly lowered VEGF but elevated CTGF mRNA, whereas CTGF shRNA significantly reduced the mRNA levels of both CTGF and VEGF in diabetic retinas. Importantly, dual-target intervention normalized the transcript levels of both target genes and ameliorated retinal microvessel ultrastructural damage better than either single-target intervention. These results suggest the advantages of dual-target over single-target interventions in diabetic retina and reveal a novel therapeutic modality for diabetic retinopathy.

  19. Kinome-wide shRNA Screen Identifies the Receptor Tyrosine Kinase AXL as a Key Regulator for Mesenchymal Glioblastoma Stem-like Cells

    Directory of Open Access Journals (Sweden)

    Peng Cheng

    2015-05-01

    Full Text Available Glioblastoma is a highly lethal cancer for which novel therapeutics are urgently needed. Two distinct subtypes of glioblastoma stem-like cells (GSCs were recently identified: mesenchymal (MES and proneural (PN. To identify mechanisms to target the more aggressive MES GSCs, we combined transcriptomic expression analysis and kinome-wide short hairpin RNA screening of MES and PN GSCs. In comparison to PN GSCs, we found significant upregulation and phosphorylation of the receptor tyrosine kinase AXL in MES GSCs. Knockdown of AXL significantly decreased MES GSC self-renewal capacity in vitro and inhibited the growth of glioblastoma patient-derived xenografts. Moreover, inhibition of AXL with shRNA or pharmacologic inhibitors also increased cell death significantly more in MES GSCs. Clinically, AXL expression was elevated in the MES GBM subtype and significantly correlated with poor prognosis in multiple cancers. In conclusion, we identified AXL as a potential molecular target for novel approaches to treat glioblastoma and other solid cancers.

  20. Novel HIV-1 knockdown targets identified by an enriched kinases/phosphatases shRNA library using a long-term iterative screen in Jurkat T-cells.

    Directory of Open Access Journals (Sweden)

    Sylvie Rato

    2010-02-01

    Full Text Available HIV-1 is a complex retrovirus that uses host machinery to promote its replication. Understanding cellular proteins involved in the multistep process of HIV-1 infection may result in the discovery of more adapted and effective therapeutic targets. Kinases and phosphatases are a druggable class of proteins critically involved in regulation of signal pathways of eukaryotic cells. Here, we focused on the discovery of kinases and phosphatases that are essential for HIV-1 replication but dispensable for cell viability. We performed an iterative screen in Jurkat T-cells with a short-hairpin-RNA (shRNA library highly enriched for human kinases and phosphatases. We identified 14 new proteins essential for HIV-1 replication that do not affect cell viability. These proteins are described to be involved in MAPK, JNK and ERK pathways, vesicular traffic and DNA repair. Moreover, we show that the proteins under study are important in an early step of HIV-1 infection before viral integration, whereas some of them affect viral transcription/translation. This study brings new insights for the complex interplay of HIV-1/host cell and opens new possibilities for antiviral strategies.

  1. Anti-Proliferation and Anti-Invasion Effects of Diosgenin on Gastric Cancer BGC-823 Cells with HIF-1α shRNAs

    Directory of Open Access Journals (Sweden)

    Yuan-Neng Chou

    2012-05-01

    Full Text Available Drug resistance is a major factor for the limited efficacy of chemotherapy in gastric cancer treatment. Hypoxia-inducible factor-1α (HIF-1α, a central transcriptional factor in hypoxia, is suggested to participate in the resistance. Here, we identified a hypoxia-mimic (cobalt chloride sensitive gastric cell line BGC-823 to explore whether diosgenin, an aglycone of steroidal saponins, can inhibit cancer cell invasion and survival of solid tumor in a hypoxic mimic microenvironment. We have shown that diosgenin is a potent candidate for decreasing the ability of invasion and survival in cobalt chloride treated BGC-823 cells. In addition, when combined with HIF-1α specific short hairpin RNA (shRNA, diosgenin can inhibit BGC-823 cells more effectively. The anti-invasion role of diosgenin may be related to E-cadherin, integrinα5 and integrinβ6. These results suggest that diosgenin may be a useful compound in controlling gastric cancer cells in hypoxia condition, especially when combined with down-regulated HIF-1α.

  2. shRNA-Mediated XRCC2 Gene Knockdown Efficiently Sensitizes Colon Tumor Cells to X-ray Irradiation in Vitro and in Vivo

    Directory of Open Access Journals (Sweden)

    Qin Wang

    2014-01-01

    Full Text Available Colon cancer is one of the most common tumors of the digestive tract. Resistance to ionizing radiation (IR decreased therapeutic efficiency in these patients’ radiotherapy. XRCC2 is the key protein of DNA homologous recombination repair, and its high expression is associated with enhanced resistance to DNA damage induced by IR. Here, we investigated the effect of XRCC2 silencing on colon tumor cells’ growth and sensitivity to X-radiation in vitro and in vivo. Colon tumor cells (T84 cell line were cultivated in vitro and tumors originated from the cell line were propagated as xenografts in nude mice. The suppression of XRCC2 expression was achieved by using vector-based short hairpin RNA (shRNA in T84 cells. We found that the knockdown of XRCC2 expression effectively decreased T84 cellular proliferation and colony formation, and led to cell apoptosis and cell cycle arrested in G2/M phase induced by X-radiation in vitro. In addition, tumor xenograft studies suggested that XRCC2 silencing inhibited tumorigenicity after radiation treatment in vivo. Our data suggest that the suppression of XRCC2 expression rendered colon tumor cells more sensitive to radiation therapy in vitro and in vivo, implying XRCC2 as a promising therapeutic target for the treatment of radioresistant human colon cancer.

  3. Survivin knockdown increased anti-cancer effects of (−)-epigallocatechin-3-gallate in human malignant neuroblastoma SK-N- BE2 and SH-SY5Y cells

    Science.gov (United States)

    Hossain, Md. Motarab; Banik, Naren L.; Ray, Swapan K.

    2012-01-01

    Neuroblastoma is a solid tumor that mostly occurs in children. Malignant neuroblastomas have poor prognosis because conventional chemotherapeutic agents are hardly effective. Survivin, which is highly expressed in some malignant neuroblastomas, plays a significant role in inhibiting differentiation and apoptosis and promoting cell proliferation, invasion, and angiogenesis. We examined consequences of survivin knockdown by survivin short hairpin RNA (shRNA) plasmid and then treatment with (−)-epigallocatechin-3-gallate (EGCG), a green tea flavonoid, in malignant neuroblastoma cells. Our Western blotting and laser scanning confocal immunofluorescence microscopy showed that survivin was highly expressed in malignant neuroblastoma SK-N-BE2 and SH-SY5Y cell lines and slightly in SK-N-DZ cell line. Expression of survivin was very faint in malignant neuroblastoma IMR32 cell line. We transfected SK-N-BE2 and SH-SY-5Y cells with survivin shRNA, treated with EGCG, and confirmed knockdown of survivin at mRNA and protein levels. Survivin knockdown induced morphological features of neuronal differentiation, as we observed following in situ methylene blue staining. Combination of survivin shRNA and EGCG promoted neuronal differentiation biochemically by increases in expression of NFP, NSE, and e-cadherin and also decreases in expression of Notch-1, ID2, hTERT, and PCNA. Our in situ Wright staining and Annexin V-FITC/PI staining showed that combination therapy was highly effective in inducing, respectively, morphological and biochemical features of apoptosis. Apoptosis occurred with activation of caspase-8 and cleavage of Bid to tBid, increase in Bax:Bcl-2 ratio, mitochondrial release of cytochrome c, and increases in expression and activity of calpain and caspase-3. Combination therapy decreased migration of cells through matrigel and inhibited proliferative (p-Akt and NF-κB), invasive (MMP-2 and MMP-9), and angiogenic (VEGF and b-FGF) factors. Also, in vitro network

  4. Identify Beta-Hairpin Motifs with Quadratic Discriminant Algorithm Based on the Chemical Shifts.

    Directory of Open Access Journals (Sweden)

    Feng YongE

    Full Text Available Successful prediction of the beta-hairpin motif will be helpful for understanding the of the fold recognition. Some algorithms have been proposed for the prediction of beta-hairpin motifs. However, the parameters used by these methods were primarily based on the amino acid sequences. Here, we proposed a novel model for predicting beta-hairpin structure based on the chemical shift. Firstly, we analyzed the statistical distribution of chemical shifts of six nuclei in not beta-hairpin and beta-hairpin motifs. Secondly, we used these chemical shifts as features combined with three algorithms to predict beta-hairpin structure. Finally, we achieved the best prediction, namely sensitivity of 92%, the specificity of 94% with 0.85 of Mathew's correlation coefficient using quadratic discriminant analysis algorithm, which is clearly superior to the same method for the prediction of beta-hairpin structure from 20 amino acid compositions in the three-fold cross-validation. Our finding showed that the chemical shift is an effective parameter for beta-hairpin prediction, suggesting the quadratic discriminant analysis is a powerful algorithm for the prediction of beta-hairpin.

  5. Interaction between human BAP31 and respiratory syncytial virus small hydrophobic (SH) protein

    International Nuclear Information System (INIS)

    Li, Yan; Jain, Neeraj; Limpanawat, Suweeraya; To, Janet; Quistgaard, Esben M.; Nordlund, Par; Thanabalu, Thirumaran; Torres, Jaume

    2015-01-01

    The small hydrophobic (SH) protein is a short channel-forming polypeptide encoded by the human respiratory syncytial virus (hRSV). Deletion of SH protein leads to the viral attenuation in mice and primates, and delayed apoptosis in infected cells. We have used a membrane-based yeast two-hybrid system (MbY2H) and a library from human lung cDNA to detect proteins that bind SH protein. This led to the identification of a membrane protein, B-cell associated protein 31 (BAP31). Transfected SH protein co-localizes with transfected BAP31 in cells, and pulls down endogenous BAP31. Titration of purified C-terminal endodomain of BAP31 against isotopically labeled SH protein in detergent micelles suggests direct interaction between the two proteins. Given the key role of BAP31 in protein trafficking and its critical involvement in pro- and anti-apoptotic pathways, this novel interaction may constitute a potential drug target. - Highlights: • A yeast two-hybrid system (MbY2H) detected BAP31 as a binder of RSV SH protein. • Transfected SH and BAP31 co-localize in lung epithelial cells. • Endogenous BAP31 is pulled down by RSV SH protein. • BAP31 endodomain interacts with the N-terminal α-helix of SH protein in micelles. • This interaction is proposed to be a potential drug target

  6. Interaction between human BAP31 and respiratory syncytial virus small hydrophobic (SH) protein

    Energy Technology Data Exchange (ETDEWEB)

    Li, Yan; Jain, Neeraj; Limpanawat, Suweeraya; To, Janet [School of Biological Sciences, Nanyang Technological University, 637551 (Singapore); Quistgaard, Esben M. [Department of Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm (Sweden); Nordlund, Par [School of Biological Sciences, Nanyang Technological University, 637551 (Singapore); Department of Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm (Sweden); Thanabalu, Thirumaran [School of Biological Sciences, Nanyang Technological University, 637551 (Singapore); Torres, Jaume, E-mail: jtorres@ntu.edu.sg [School of Biological Sciences, Nanyang Technological University, 637551 (Singapore)

    2015-08-15

    The small hydrophobic (SH) protein is a short channel-forming polypeptide encoded by the human respiratory syncytial virus (hRSV). Deletion of SH protein leads to the viral attenuation in mice and primates, and delayed apoptosis in infected cells. We have used a membrane-based yeast two-hybrid system (MbY2H) and a library from human lung cDNA to detect proteins that bind SH protein. This led to the identification of a membrane protein, B-cell associated protein 31 (BAP31). Transfected SH protein co-localizes with transfected BAP31 in cells, and pulls down endogenous BAP31. Titration of purified C-terminal endodomain of BAP31 against isotopically labeled SH protein in detergent micelles suggests direct interaction between the two proteins. Given the key role of BAP31 in protein trafficking and its critical involvement in pro- and anti-apoptotic pathways, this novel interaction may constitute a potential drug target. - Highlights: • A yeast two-hybrid system (MbY2H) detected BAP31 as a binder of RSV SH protein. • Transfected SH and BAP31 co-localize in lung epithelial cells. • Endogenous BAP31 is pulled down by RSV SH protein. • BAP31 endodomain interacts with the N-terminal α-helix of SH protein in micelles. • This interaction is proposed to be a potential drug target.

  7. Insights into the folding and unfolding processes of wild-type and mutated SH3 domain by molecular dynamics and replica exchange molecular dynamics simulations.

    Directory of Open Access Journals (Sweden)

    Wen-Ting Chu

    Full Text Available Src-homology regions 3 (SH3 domain is essential for the down-regulation of tyrosine kinase activity. Mutation A39V/N53P/V55L of SH3 is found to be relative to the urgent misfolding diseases. To gain insight, the human and gallus SH3 domains (PDB ID: 1NYG and 2LP5, including 58 amino acids in each protein, were selected for MD simulations (Amber11, ff99SB force field and cluster analysis to investigate the influence of mutations on the spatial structure of the SH3 domain. It is found that the large conformational change of mutations mainly exists in three areas in the vicinity of protein core: RT loop, N-src loop, distal β-hairpin to 310 helix. The C-terminus of the mutated gallus SH3 is disordered after simulation, which represents the intermediate state of aggregation. The disappeared strong Hbond net in the mutated human and gallus systems will make these mutated proteins looser than the wild-type proteins. Additionally, by performing the REMD simulations on the gallus SH3 domain, the mutated domain is found to have an obvious effect on the unfolding process. These studies will be helpful for further aggregation mechanisms investigations on SH3 family.

  8. The Role of XPG in Processing (CAGn/(CTGn DNA Hairpins

    Directory of Open Access Journals (Sweden)

    Hou Caixia

    2011-03-01

    Full Text Available Abstract Background During DNA replication or repair, disease-associated (CAGn/(CTGn expansion can result from formation of hairpin structures in the repeat tract of the newly synthesized or nicked DNA strand. Recent studies identified a nick-directed (CAGn/(CTGn hairpin repair (HPR system that removes (CAGn/(CTGn hairpins from human cells via endonucleolytic incisions. Because the process is highly similar to the mechanism by which XPG and XPF endonucleases remove bulky DNA lesions during nucleotide excision repair, we assessed the potential role of XPG in conducting (CAGn/(CTGn HPR. Results To determine if the XPG endonuclease is involved in (CAGn/(CTGn hairpin removal, two XPG-deficient cell lines (GM16024 and AG08802 were examined for their ability to process (CAGn/(CTGn hairpins in vitro. We demonstrated that the GM16024 cell line processes all hairpin substrates as efficiently as HeLa cells, and that the AG08802 cell line is partially defective in HPR. Analysis of repair intermediates revealed that nuclear extracts from both XPG-deficient lines remove CAG/CTG hairpins via incisions, but the incision products are distinct from those generated in HeLa extracts. We also show that purified recombinant XPG protein greatly stimulates HPR in XPG-deficient extracts by promoting an incision 5' to the hairpin. Conclusions Our results strongly suggest that 1 human cells possess multiple pathways to remove (CAGn/(CTGn hairpins located in newly synthesized (or nicked DNA strand; and 2 XPG, although not essential for (CAGn/(CTGn hairpin removal, stimulates HPR by facilitating a 5' incision to the hairpin. This study reveals a novel role for XPG in genome-maintenance and implicates XPG in diseases caused by trinucleotide repeat expansion.

  9. Expression of plasmid-based shRNA against the E1 and nsP1 genes effectively silenced Chikungunya virus replication.

    Directory of Open Access Journals (Sweden)

    Shirley Lam

    Full Text Available BACKGROUND: Chikungunya virus (CHIKV is a re-emerging alphavirus that causes chikungunya fever and persistent arthralgia in humans. Currently, there is no effective vaccine or antiviral against CHIKV infection. Therefore, this study evaluates whether RNA interference which targets at viral genomic level may be a novel antiviral strategy to inhibit the medically important CHIKV infection. METHODS: Plasmid-based small hairpin RNA (shRNA was investigated for its efficacy in inhibiting CHIKV replication. Three shRNAs designed against CHIKV Capsid, E1 and nsP1 genes were transfected to establish stable shRNA-expressing cell clones. Following infection of stable shRNA cells clones with CHIKV at M.O.I. 1, viral plaque assay, Western blotting and transmission electron microscopy were performed. The in vivo efficacy of shRNA against CHIKV replication was also evaluated in a suckling murine model of CHIKV infection. RESULTS: Cell clones expressing shRNAs against CHIKV E1 and nsP1 genes displayed significant inhibition of infectious CHIKV production, while shRNA Capsid demonstrated a modest inhibitory effect as compared to scrambled shRNA cell clones and non-transfected cell controls. Western blot analysis of CHIKV E2 protein expression and transmission electron microscopy of shRNA E1 and nsP1 cell clones collectively demonstrated similar inhibitory trends against CHIKV replication. shRNA E1 showed non cell-type specific anti-CHIKV effects and broad-spectrum silencing against different geographical strains of CHIKV. Furthermore, shRNA E1 clones did not exert any inhibition against Dengue virus and Sindbis virus replication, thus indicating the high specificity of shRNA against CHIKV replication. Moreover, no shRNA-resistant CHIKV mutant was generated after 50 passages of CHIKV in the stable cell clones. More importantly, strong and sustained anti-CHIKV protection was conferred in suckling mice pre-treated with shRNA E1. CONCLUSION: Taken together, these

  10. Effects of a mutation on the folding mechanism of a β-hairpin

    NARCIS (Netherlands)

    Juraszek, J.; Bolhuis, P.G.

    2009-01-01

    The folding mechanism of a protein is determined by its primary sequence. Yet, how the mechanism is changed by a mutation is still poorly understood, even for basic secondary structures such as β-hairpins. We perform an extensive simulation study of the effects of mutating the GB1 β-hairpin into

  11. Influence of Expression Plasmid of Connective Tissue Growth Factor and Tissue Inhibitor of Metalloproteinase-1 shRNA on Hepatic Precancerous Fibrosis in Rats.

    Science.gov (United States)

    Zhang, Qun; Shu, Fu-Li; Jiang, Yu-Feng; Huang, Xin-En

    2015-01-01

    In this study, influence caused by expression plasmids of connective tissue growth factor (CTGF) and tissue inhibitor of metalloproteinase-1 (TIMP-1) short hairpin RNA (shRNA) on mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII in hepatic tissue with hepatic fibrosis, a precancerous condition, in rats is analyzed. To screen and construct shRNA expression plasimid which effectively interferes RNA targets of CTGF and TIMP-1 in rats. 50 cleaning Wistar male rats are allocated randomly at 5 different groups after precancerous fibrosis models and then injection of shRNA expression plasimids. Plasmid psiRNA-GFP-Com (CTGF and TIMP-1 included), psiRNA-GFP-CTGF, psiRNA-GFP-TIMP-1 and psiRNA- DUO-GFPzeo of blank plasmid are injected at group A, B, C and D, respectively, and as model control group that none plasimid is injected at group E. In 2 weeks after last injection, to hepatic tissue at different groups, protein expression of CTGF, TIMP-1, procol-α1and PC III is tested by immunohistochemical method and,mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII is measured by real-time PCR. One-way ANOVA is used to comparison between-groups. Compared with model group, there is no obvious difference of mRNA expression among CTGF,TIMP-1,procol-α1,PC III and of protein expression among CTGF, TIMP-1, procol-α1, PC III in hepatic tissue at group injected with blank plasmid. Expression quantity of mRNA of CTGF, TIMP-1, procol-α1 and PCIII at group A, B and C decreases, protein expression of CTGF, TIMP-1, procol-α1, PC III in hepatic tissue is lower, where the inhibition of combination RNA interference group (group A) on procol-α1 mRNA transcription and procol-α1 protein expression is superior to that of single interference group (group B and C) (P<0.01 or P<0.05). RNA interference on CTGF and/or TIMP-1 is obviously a inhibiting factor for mRNA and protein expression of CTGF, TIMP-1, procol-α1 and PCIII. Combination RNA interference on genes of CTGF and TIMP-1 is superior

  12. Effective relief of neuropathic pain by adeno-associated virus-mediated expression of a small hairpin RNA against GTP cyclohydrolase 1

    Directory of Open Access Journals (Sweden)

    Chang Jin

    2009-11-01

    Full Text Available Abstract Background Recent studies show that transcriptional activation of GTP cyclohydrolase I (GCH1 in dorsal root ganglia (DRG is significantly involved in the development and persistency of pain symptoms. We thus hypothesize that neuropathic pain may be attenuated by down-regulation of GCH1 expression, and propose a gene silencing system for this purpose. Results To interrupt GCH1 synthesis, we designed a bidirectional recombinant adeno-associated virus encoding both a small hairpin RNA against GCH1 and a GFP reporter gene (rAAV-shGCH1. After rAAV-shGCH1 was introduced into the sciatic nerve prior to or following pain-inducing surgery, therapeutic efficacy and the underlying mechanisms were subsequently validated in animal models. The GFP expression data indicates that rAAV effectively delivered transgenes to DRG. Subsequently reduced GCH1 expression was evident from immunohistochemistry and western-blotting analysis. Along with the down-regulation of GCH1, the von Frey test correspondingly indicated a sharp decline in pain symptoms upon both pre- and post-treatment with rAAV-shGCH1. Interestingly, GCH1 down-regulation additionally led to decreased microglial activation in the dorsal horn, implying an association between pain attenuation and reduced inflammation. Conclusion Therefore, the data suggests that GCH1 levels can be reduced by introducing rAAV-shGCH1, leading to pain relief. Based on the results, we propose that GCH1 modulation may be developed as a clinically applicable gene therapy strategy to treat neuropathic pain.

  13. Sequence-dependent unfolding kinetics of DNA hairpins studied by nanopore force spectroscopy

    International Nuclear Information System (INIS)

    Renner, Stephan; Bessonov, Andrey; Simmel, Friedrich C; Gerland, Ulrich

    2010-01-01

    Nanopore force spectroscopy is used to study the unzipping kinetics of two DNA hairpin molecules with a 12 base pair long stem containing two contiguous stretches of six GC and six AT base pairs in interchanged order. Even though the thermodynamic stabilities of the two structures are nearly the same, they differ greatly in their unzipping kinetics. When the GC segment has to be broken before the AT segment, the unfolding rate is orders of magnitude smaller than in the opposite case. We also investigated hairpins with stem regions consisting only of AT or GC base pairs. The pure AT hairpins translocate much faster than the other hairpins, whereas the pure GC hairpins translocate on similar timescales to the hairpins with only an initial GC segment. For each hairpin, nanopore force spectroscopy is performed for different loading rates and the resulting unzipping distributions are mathematically transformed to a master curve that yields the unfolding rate as a function of applied voltage. This is compared with a stochastic model of the unfolding process for the two sequences for different voltages. The results can be rationalized in terms of the different natures of the free energy landscapes for the unfolding process.

  14. Structural and biophysical investigation of the interaction of a mutant Grb2 SH2 domain (W121G) with its cognate phosphopeptide.

    Science.gov (United States)

    Papaioannou, Danai; Geibel, Sebastian; Kunze, Micha B A; Kay, Christopher W M; Waksman, Gabriel

    2016-03-01

    The adaptor protein Grb2 is a key element of mitogenetically important signaling pathways. With its SH2 domain it binds to upstream targets while its SH3 domains bind to downstream proteins thereby relaying signals from the cell membranes to the nucleus. The Grb2 SH2 domain binds to its targets by recognizing a phosphotyrosine (pY) in a pYxNx peptide motif, requiring an Asn at the +2 position C-terminal to the pY with the residue either side of this Asn being hydrophobic. Structural analysis of the Grb2 SH2 domain in complex with its cognate peptide has shown that the peptide adopts a unique β-turn conformation, unlike the extended conformation that phosphopeptides adopt when bound to other SH2 domains. TrpEF1 (W121) is believed to force the peptide into this unusual conformation conferring this unique specificity to the Grb2 SH2 domain. Using X-ray crystallography, electron paramagnetic resonance (EPR) spectroscopy, and isothermal titration calorimetry (ITC), we describe here a series of experiments that explore the role of TrpEF1 in determining the specificity of the Grb2 SH2 domain. Our results demonstrate that the ligand does not adopt a pre-organized structure before binding to the SH2 domain, rather it is the interaction between the two that imposes the hairpin loop to the peptide. Furthermore, we find that the peptide adopts a similar structure when bound to both the wild-type Grb2 SH2 domain and a TrpEF1Gly mutant. This suggests that TrpEF1 is not the determining factor for the conformation of the phosphopeptide. © 2015 The Protein Society.

  15. The Abl SH2-kinase linker naturally adopts a conformation competent for SH3 domain binding.

    Science.gov (United States)

    Chen, Shugui; Brier, Sébastien; Smithgall, Thomas E; Engen, John R

    2007-04-01

    The core of the Abelson tyrosine kinase (c-Abl) is structurally similar to Src-family kinases where SH3 and SH2 domains pack against the backside of the kinase domain in the down-regulated conformation. Both kinase families depend upon intramolecular association of SH3 with the linker joining the SH2 and kinase domains for suppression of kinase activity. Hydrogen deuterium exchange (HX) and mass spectrometry (MS) were used to probe intramolecular interaction of the c-Abl SH3 domain with the linker in recombinant constructs lacking the kinase domain. Under physiological conditions, the c-Abl SH3 domain undergoes partial unfolding, which is stabilized by ligand binding, providing a unique assay for SH3:linker interaction in solution. Using this approach, we observed dynamic association of the SH3 domain with the linker in the absence of the kinase domain. Truncation of the linker before W254 completely prevented cis-interaction with SH3, while constructs containing amino acids past this point showed SH3:linker interactions. The observation that the Abl linker sequence exhibits SH3-binding activity in the absence of the kinase domain is unique to Abl and was not observed with Src-family kinases. These results suggest that SH3:linker interactions may have a more prominent role in Abl regulation than in Src kinases, where the down-regulated conformation is further stabilized by a second intramolecular interaction between the C-terminal tail and the SH2 domain.

  16. RPA coordinates DNA end resection and prevents formation of DNA hairpins.

    Science.gov (United States)

    Chen, Huan; Lisby, Michael; Symington, Lorraine S

    2013-05-23

    Replication protein A (RPA) is an essential eukaryotic single-stranded DNA binding protein with a central role in DNA metabolism. RPA directly participates in DNA double-strand break repair by stimulating 5'-3' end resection by the Sgs1/BLM helicase and Dna2 endonuclease in vitro. Here we investigated the role of RPA in end resection in vivo, using a heat-inducible degron system that allows rapid conditional depletion of RPA in Saccharomyces cerevisiae. We found that RPA depletion eliminated both the Sgs1-Dna2- and Exo1-dependent extensive resection pathways and synergized with mre11Δ to prevent end resection. The short single-stranded DNA tails formed in the absence of RPA were unstable due to 3' strand loss and the formation of fold-back hairpin structures that required resection initiation and Pol32-dependent DNA synthesis. Thus, RPA is required to generate ssDNA, and also to protect ssDNA from degradation and inappropriate annealing that could lead to genome rearrangements. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. Effects of secondary structure on pre-mRNA splicing: hairpins sequestering the 5' but not the 3' splice site inhibit intron processing in Nicotiana plumbaginifolia.

    Science.gov (United States)

    Liu, H X; Goodall, G J; Kole, R; Filipowicz, W

    1995-01-16

    We have performed a systematic study of the effect of artificial hairpins on pre-mRNA splicing in protoplasts of a dicot plant, Nicotiana plumbaginifolia. Hairpins with a potential to form 18 or 24 bp stems strongly inhibit splicing when they sequester the 5' splice site or are placed in the middle of short introns. However, similar 24 bp hairpins sequestering the 3' splice site do not prevent this site from being used as an acceptor. Utilization of the stem-located 3' site requires that the base of the stem is separated from the upstream 5' splice site by a minimum of approximately 45 nucleotides and that another 'helper' 3' splice site is present downstream of the stem. The results indicate that the spliceosome or factors associated with it may have a potential to unfold secondary structure present in the downstream portion of the intron, prior to or at the step of the 3' splice site selection. The finding that the helper 3' site is required for utilization of the stem-located acceptor confirms and extends previous observations, obtained with HeLa cell in vitro splicing systems, indicating that the 3' splice site may be recognized at least twice during spliceosome assembly.

  18. Structural and sequence features of two residue turns in beta-hairpins.

    Science.gov (United States)

    Madan, Bharat; Seo, Sung Yong; Lee, Sun-Gu

    2014-09-01

    Beta-turns in beta-hairpins have been implicated as important sites in protein folding. In particular, two residue β-turns, the most abundant connecting elements in beta-hairpins, have been a major target for engineering protein stability and folding. In this study, we attempted to investigate and update the structural and sequence properties of two residue turns in beta-hairpins with a large data set. For this, 3977 beta-turns were extracted from 2394 nonhomologous protein chains and analyzed. First, the distribution, dihedral angles and twists of two residue turn types were determined, and compared with previous data. The trend of turn type occurrence and most structural features of the turn types were similar to previous results, but for the first time Type II turns in beta-hairpins were identified. Second, sequence motifs for the turn types were devised based on amino acid positional potentials of two-residue turns, and their distributions were examined. From this study, we could identify code-like sequence motifs for the two residue beta-turn types. Finally, structural and sequence properties of beta-strands in the beta-hairpins were analyzed, which revealed that the beta-strands showed no specific sequence and structural patterns for turn types. The analytical results in this study are expected to be a reference in the engineering or design of beta-hairpin turn structures and sequences. © 2014 Wiley Periodicals, Inc.

  19. Application of the biosurfactants produced by Bacillus spp. (SH 20 ...

    African Journals Online (AJOL)

    Application of the biosurfactants produced by Bacillus spp. (SH 20 and SH 26) and P. aeruginosa SH 29 isolated from the rhizosphere soil of an Egyptian salt marsh plant for the cleaning of oil - contaminataed vessels and enhancing the biodegradat.

  20. Wind rotor power station BONI-ShHV

    International Nuclear Information System (INIS)

    Bolotov, A.V.

    1999-01-01

    Wind rotor power station (WRPS) BONI-ShHV has following advantages : the increase of installation stability by rise of wind velocity and rotation speed of rotor due to gyroscopic effect; the absence noise and vibration; the safety for birds and animals; ability of compact installation and creation of series of wind power dams with higher capacity; the simplicity and fast assembling and putting into operation. The price of 1 k W of installing capacity is lower about 2.5-3 times compare to usual WRPS due to simple kinematic scheme. WRPS has high specific output of electrical energy due to use of low and long existing wind velocity and due to short storms, giving greater power. It has ability to be replayed when average annual wind velocity is above 5.5 m/s in comparison with propeller WRPS, which are never repaying. WRPS BONI-ShHV are made on the plants of Republic of Kazakhstan, and tested in wind velocity range up 45 m/s, have experience of 3 years of operation, showing their reliability and effectiveness. The repayment period of individual WRPS BONI-0.5/6 ShHV is from 10 month to 1 year depending on average annual velocity

  1. Adventitial delivery of lentivirus-shRNA-ADAMTS-1 reduces venous stenosis formation in arteriovenous fistula.

    Science.gov (United States)

    Nieves Torres, Evelyn C; Yang, Binxia; Roy, Bhaskar; Janardhanan, Rajiv; Brahmbhatt, Akshaar; Leof, Ed; Mukhopadhyay, Debabrata; Misra, Sanjay

    2014-01-01

    Hemodialysis vascular access can develop venous neointimal hyperplasia (VNH) causing stenosis. Recent clinical and experimental data has demonstrated that there is increased expression of a disintegrin and metalloproteinase thrombospondin motifs-1 (ADAMTS-1) at site of VNH. The experiments outlined in the present paper were designed to test the hypothesis that targeting of the adventitia of the outflow vein of murine arteriovenous fistula (AVF) using a small hairpin RNA that inhibits ADAMTS-1 expression (LV-shRNA-ADAMTS-1) at the time of fistula creation will decrease VNH. At early time points, ADAMTS-1 expression was significantly decreased associated with a reduction in vascular endothelial growth factor-A (VEGF-A) and matrix metalloproteinase-9 (MMP-9) (LV-shRNA-ADAMTS-1 transduced vessels vs. controls). These changes in gene and protein expression resulted in favorable vascular remodeling with a significant increase in mean lumen vessel area, decrease in media/adventitia area, with a significant increase in TUNEL staining accompanied with a decrease in cellular proliferation accompanied with a reduction in CD68 staining. Collectively, these results demonstrate that ADAMTS-1 transduced vessels of the outflow vein of AVF have positive vascular remodeling.

  2. Adventitial delivery of lentivirus-shRNA-ADAMTS-1 reduces venous stenosis formation in arteriovenous fistula.

    Directory of Open Access Journals (Sweden)

    Evelyn C Nieves Torres

    Full Text Available Hemodialysis vascular access can develop venous neointimal hyperplasia (VNH causing stenosis. Recent clinical and experimental data has demonstrated that there is increased expression of a disintegrin and metalloproteinase thrombospondin motifs-1 (ADAMTS-1 at site of VNH. The experiments outlined in the present paper were designed to test the hypothesis that targeting of the adventitia of the outflow vein of murine arteriovenous fistula (AVF using a small hairpin RNA that inhibits ADAMTS-1 expression (LV-shRNA-ADAMTS-1 at the time of fistula creation will decrease VNH. At early time points, ADAMTS-1 expression was significantly decreased associated with a reduction in vascular endothelial growth factor-A (VEGF-A and matrix metalloproteinase-9 (MMP-9 (LV-shRNA-ADAMTS-1 transduced vessels vs. controls. These changes in gene and protein expression resulted in favorable vascular remodeling with a significant increase in mean lumen vessel area, decrease in media/adventitia area, with a significant increase in TUNEL staining accompanied with a decrease in cellular proliferation accompanied with a reduction in CD68 staining. Collectively, these results demonstrate that ADAMTS-1 transduced vessels of the outflow vein of AVF have positive vascular remodeling.

  3. An enzyme-catalyzed multistep DNA refolding mechanism in hairpin telomere formation.

    Directory of Open Access Journals (Sweden)

    Ke Shi

    Full Text Available Hairpin telomeres of bacterial linear chromosomes are generated by a DNA cutting-rejoining enzyme protelomerase. Protelomerase resolves a concatenated dimer of chromosomes as the last step of chromosome replication, converting a palindromic DNA sequence at the junctions between chromosomes into covalently closed hairpins. The mechanism by which protelomerase transforms a duplex DNA substrate into the hairpin telomeres remains largely unknown. We report here a series of crystal structures of the protelomerase TelA bound to DNA that represent distinct stages along the reaction pathway. The structures suggest that TelA converts a linear duplex substrate into hairpin turns via a transient strand-refolding intermediate that involves DNA-base flipping and wobble base-pairs. The extremely compact di-nucleotide hairpin structure of the product is fully stabilized by TelA prior to strand ligation, which drives the reaction to completion. The enzyme-catalyzed, multistep strand refolding is a novel mechanism in DNA rearrangement reactions.

  4. Rosette Assay: Highly Customizable Dot-Blot for SH2 Domain Screening.

    Science.gov (United States)

    Ng, Khong Y; Machida, Kazuya

    2017-01-01

    With a growing number of high-throughput studies, structural analyses, and availability of protein-protein interaction databases, it is now possible to apply web-based prediction tools to SH2 domain-interactions. However, in silico prediction is not always reliable and requires experimental validation. Rosette assay is a dot blot-based reverse-phase assay developed for the assessment of binding between SH2 domains and their ligands. It is conveniently customizable, allowing for low- to high-throughput analysis of interactions between various numbers of SH2 domains and their ligands, e.g., short peptides, purified proteins, and cell lysates. The binding assay is performed in a 96-well plate (MBA or MWA apparatus) in which a sample spotted membrane is incubated with up to 96 labeled SH2 domains. Bound domains are detected and quantified using a chemiluminescence or near-infrared fluorescence (IR) imaging system. In this chapter, we describe a practical protocol for rosette assay to assess interactions between synthesized tyrosine phosphorylated peptides and a library of GST-tagged SH2 domains. Since the methodology is not confined to assessment of SH2-pTyr interactions, rosette assay can be broadly utilized for ligand and drug screening using different protein interaction domains or antibodies.

  5. Chemical shift assignments of the partially deuterated Fyn SH2-SH3 domain.

    Science.gov (United States)

    Kieken, Fabien; Loth, Karine; van Nuland, Nico; Tompa, Peter; Lenaerts, Tom

    2018-04-01

    Src Homology 2 and 3 (SH2 and SH3) are two key protein interaction modules involved in regulating the activity of many proteins such as tyrosine kinases and phosphatases by respective recognition of phosphotyrosine and proline-rich regions. In the Src family kinases, the inactive state of the protein is the direct result of the interaction of the SH2 and the SH3 domain with intra-molecular regions, leading to a closed structure incompetent with substrate modification. Here, we report the 1 H, 15 N and 13 C backbone- and side-chain chemical shift assignments of the partially deuterated Fyn SH3-SH2 domain and structural differences between tandem and single domains. The BMRB accession number is 27165.

  6. Model SH intelligent instrument for thickness measuring

    International Nuclear Information System (INIS)

    Liu Juntao; Jia Weizhuang; Zhao Yunlong

    1995-01-01

    The authors introduce Model SH Intelligent Instrument for thickness measuring by using principle of beta back-scattering and its application range, features, principle of operation, system design, calibration and specifications

  7. Diversity in peptide recognition by the SH2 domain of SH2B1.

    Science.gov (United States)

    McKercher, Marissa A; Guan, Xiaoyang; Tan, Zhongping; Wuttke, Deborah S

    2018-02-01

    SH2B1 is a multidomain protein that serves as a key adaptor to regulate numerous cellular events, such as insulin, leptin, and growth hormone signaling pathways. Many of these protein-protein interactions are mediated by the SH2 domain of SH2B1, which recognizes ligands containing a phosphorylated tyrosine (pY), including peptides derived from janus kinase 2, insulin receptor, and insulin receptor substrate-1 and -2. Specificity for the SH2 domain of SH2B1 is conferred in these ligands either by a hydrophobic or an acidic side chain at the +3 position C-terminal to the pY. This specificity for chemically disparate species suggests that SH2B1 relies on distinct thermodynamic or structural mechanisms to bind to peptides. Using binding and structural strategies, we have identified unique thermodynamic signatures for each peptide binding mode, and several SH2B1 residues, including K575 and R578, that play distinct roles in peptide binding. The high-resolution structure of the SH2 domain of SH2B1 further reveals conformationally plastic protein loops that may contribute to the ability of the protein to recognize dissimilar ligands. Together, numerous hydrophobic and electrostatic interactions, in addition to backbone conformational flexibility, permit the recognition of diverse peptides by SH2B1. An understanding of this expanded peptide recognition will allow for the identification of novel physiologically relevant SH2B1/peptide interactions, which can contribute to the design of obesity and diabetes pharmaceuticals to target the ligand-binding interface of SH2B1 with high specificity. © 2017 Wiley Periodicals, Inc.

  8. Enzyme-free electrochemical detection of microRNA-21 using immobilized hairpin probes and a target-triggered hybridization chain reaction amplification strategy

    International Nuclear Information System (INIS)

    Liu, Hongying; Bei, Xiaoqiong; Xia, Qiuting; Fu, Yan; Zhang, Shi; Liu, Maochuan; Fan, Kai; Zhang, Mingzhen; Yang, Yong

    2016-01-01

    We describe a sensitive enzyme-free bioassay for the determination of microRNA-21. It is based on a combination of target-triggered hybridization chain reaction, tagging with CdTe quantum dots (QDs), and anodic stripping voltammetry. Firstly, a thiolated capture hairpin probe SH-HP1 was immobilized on the surface of a gold electrode. HP1 unfolds in the presence of microRNA-21. If hairpin probe 2 (HP2) is present, a HP1-HP2 complex will be formed which possesses an exposed stem of HP2, and microRNA is released in parallel. The released microRNA-21 triggers a hybridization chain reaction and this leads to form an exposed DNA segment of HP2 and cycle use microRNA-21. With the aid of assistant DNA A1 and A2, the exposed DNA segment of HP2 progressed to a long double strand. The strand is rich in CdTe QDs with the help of QDs-A1. Then, the attached QDs were dissolved with HNO 3 to give dissolved Cd(II) ions. Finally, the corresponding electrochemical current response of Cd(II) is monitored by anodic stripping voltammetry and used to quantify the concentration of microRNA-21. More microRNA-21 participated in this reaction increases the number of CdTe QDs, which results in increased electrochemical current. Thus, an ultrasensitive detection of microRNA-21 is accomplished by anodic stripping voltammetry. This gene assay displays a detection limit as low as 33 aM. It can discriminate between complementary DNA sequence and single-base mismatched DNA, indicating its high specificity. (author)

  9. Optical and millimeter wavelength study of the complex Sh2-147/Sh2-153

    International Nuclear Information System (INIS)

    Heydari-Malayeri, M.; Testor, G.; Kahane, C.; Lucas, R.

    1982-01-01

    Sh2-147/Sh2-153 is a vast HII region-molecular cloud complex of dimension 1 0 .5 located in the Perseus arm at l approximately 109 0 . This cloud embodies the HII regions Sh2-147, 148, 149, 152 and 153. In this direction were detected several H 2 O and OH masers, a number of infrared sources, and a supernova remnant. The authors present the 13 CO map and also optical results on two of the HII regions: Sh2-152 and 148. (Auth.)

  10. SH2 and SH3 domains: elements that control interactions of cytoplasmic signaling proteins.

    Science.gov (United States)

    Koch, C A; Anderson, D; Moran, M F; Ellis, C; Pawson, T

    1991-05-03

    Src homology (SH) regions 2 and 3 are noncatalytic domains that are conserved among a series of cytoplasmic signaling proteins regulated by receptor protein-tyrosine kinases, including phospholipase C-gamma, Ras GTPase (guanosine triphosphatase)-activating protein, and Src-like tyrosine kinases. The SH2 domains of these signaling proteins bind tyrosine phosphorylated polypeptides, implicated in normal signaling and cellular transformation. Tyrosine phosphorylation acts as a switch to induce the binding of SH2 domains, thereby mediating the formation of heteromeric protein complexes at or near the plasma membrane. The formation of these complexes is likely to control the activation of signal transduction pathways by tyrosine kinases. The SH3 domain is a distinct motif that, together with SH2, may modulate interactions with the cytoskeleton and membrane. Some signaling and transforming proteins contain SH2 and SH3 domains unattached to any known catalytic element. These noncatalytic proteins may serve as adaptors to link tyrosine kinases to specific target proteins. These observations suggest that SH2 and SH3 domains participate in the control of intracellular responses to growth factor stimulation.

  11. H-alpha observations of Sh2-190, Sh2-222, Sh2-229, Sh2-236 HII regions

    Science.gov (United States)

    Sahan, Muhittin

    2018-02-01

    Hα spectral line (6563Å) profiles of four northern HII regions in the our galaxy (Sh2-190, Sh2-222, Sh2-229, Sh2-236) have been obtained using DEFPOS spectrometer, located at coude focus of 150 cm RTT150 telescope at TUBITAK National Observatory (TUG, Antalya, Turkey). Observations were carried out at nights of 2015 December 24-27 with long exposure times ranging from 900s to 3600s. The LSR velocities and the linewidths (Full Width Half Maximum: FWHM) of the Hα emission lines were found to be in the range of -45.46 kms-1 to +3.57 kms-1 and 38.50 kms-1 to 44.10 kms-1, respectively. The Sh2-229 HII region is the faintest one (211.16 R), while the Sh2-236 HII region (IC410) is brightest source (535.75 R). The LSR velocity and the line width (FWHM) results of the DEFPOS/RTT150 system were compared with the data by several authors given in literature and results of DEFPOS data were found to be in good agreement with data given in literature.

  12. Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

    Science.gov (United States)

    Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

    2003-01-01

    Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

  13. Hairpin formation within the enhancer region of the human enkephalin gene

    International Nuclear Information System (INIS)

    McMurray, C.T.; Douglass, J.O.; Wilson, W.D.

    1991-01-01

    The 3',5'-cyclic adenosine monophosphate (cAMP)-inducible enhancer of the human enkephaline gene is located within an imperfect palindrom of 23 base pairs. The authors have found that a 23-base-pair oligonucleotide duplex containing the enhancer undergoes a reversible conformational transition from the duplex to two individual hairpin structures each formed from one strand of the duplex. Each individual hairpin forms with mismatched base pairs, one containing two GT pairs and the other containing two AC pairs. The conformational transition is stabilized by proton transfer to the hairpin containing AC mismatched pairs. The unique physical and thermodynamic properties of the enkephalin enhancer DNA suggest a model in which DNA secondary structure within the enhancer region plays and active role incAMP-inducible activation of the human enkephalin gene via formation of cruciform structures

  14. Hairpin formation within the enhancer region of the human enkephalin gene

    Energy Technology Data Exchange (ETDEWEB)

    McMurray, C.T.; Douglass, J.O. (Oregon Health Sciences Univ., Portland (United States)); Wilson, W.D. (Georgia State Univ., Atlanta (United States))

    1991-01-15

    The 3{prime},5{prime}-cyclic adenosine monophosphate (cAMP)-inducible enhancer of the human enkephaline gene is located within an imperfect palindrom of 23 base pairs. The authors have found that a 23-base-pair oligonucleotide duplex containing the enhancer undergoes a reversible conformational transition from the duplex to two individual hairpin structures each formed from one strand of the duplex. Each individual hairpin forms with mismatched base pairs, one containing two GT pairs and the other containing two AC pairs. The conformational transition is stabilized by proton transfer to the hairpin containing AC mismatched pairs. The unique physical and thermodynamic properties of the enkephalin enhancer DNA suggest a model in which DNA secondary structure within the enhancer region plays and active role incAMP-inducible activation of the human enkephalin gene via formation of cruciform structures.

  15. Linear Chromosome-generating System of Agrobacterium tumefaciens C58: Protelomerase Generates and Protects Hairpin Ends

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Wai Mun; DaGloria, Jeanne; Fox, Heather; Ruan, Qiurong; Tillou, John; Shi, Ke; Aihara, Hideki; Aron, John; Casjens, Sherwood (Utah); (UMM)

    2012-09-05

    Agrobacterium tumefaciens C58, the pathogenic bacteria that causes crown gall disease in plants, harbors one circular and one linear chromosome and two circular plasmids. The telomeres of its unusual linear chromosome are covalently closed hairpins. The circular and linear chromosomes co-segregate and are stably maintained in the organism. We have determined the sequence of the two ends of the linear chromosome thus completing the previously published genome sequence of A. tumefaciens C58. We found that the telomeres carry nearly identical 25-bp sequences at the hairpin ends that are related by dyad symmetry. We further showed that its Atu2523 gene encodes a protelomerase (resolvase) and that the purified enzyme can generate the linear chromosomal closed hairpin ends in a sequence-specific manner. Agrobacterium protelomerase, whose presence is apparently limited to biovar 1 strains, acts via a cleavage-and-religation mechanism by making a pair of transient staggered nicks invariably at 6-bp spacing as the reaction intermediate. The enzyme can be significantly shortened at both the N and C termini and still maintain its enzymatic activity. Although the full-length enzyme can uniquely bind to its product telomeres, the N-terminal truncations cannot. The target site can also be shortened from the native 50-bp inverted repeat to 26 bp; thus, the Agrobacterium hairpin-generating system represents the most compact activity of all hairpin linear chromosome- and plasmid-generating systems to date. The biochemical analyses of the protelomerase reactions further revealed that the tip of the hairpin telomere may be unusually polymorphically capable of accommodating any nucleotide.

  16. Energetic particles in the heliosphere and GCR modulation: Reviewing of SH-posters

    International Nuclear Information System (INIS)

    Struminsky, Alexei

    2013-01-01

    This rapporteur paper addresses the SH poster session titled 'Energetic particles in the heliosphere (solar and anomalous CRs, GCR modulation)' of the 23rd European Cosmic Ray Symposium (ECRS) and the 32nd Russian Cosmic Ray Conference (RCRC). The 65 posters presented are tentatively divided into five sections: Instruments and Methods; Solar Energetic Particles; Short Term Variations; Long Term Variations; Heliosphere.

  17. Functional analysis of SH3 domain containing ring finger 2 during the myogenic differentiation of quail myoblast cells

    Directory of Open Access Journals (Sweden)

    Si Won Kim

    2017-08-01

    Full Text Available Objective Owing to the public availability of complete genome sequences, including avian species, massive bioinformatics analyses may be conducted for computational gene prediction and the identification of gene regulatory networks through various informatics tools. However, to evaluate the biofunctional activity of a predicted target gene, in vivo and in vitro functional genomic analyses should be a prerequisite. Methods Due to a lack of quail genomic sequence information, we first identified the partial genomic structure and sequences of the quail SH3 domain containing ring finger 2 (SH3RF2 gene. Subsequently, SH3RF2 was knocked out using clustered regularly interspaced short palindromic repeat/Cas9 technology and single cell-derived SH3RF2 mutant sublines were established to study the biofunctional activity of SH3RF2 in quail myoblast (QM7 cells during muscle differentiation. Results Through a T7 endonuclease I assay and genotyping analysis, we established an SH3RF2 knockout (KO QM7#4 subline with 61 and 155 nucleotide deletion mutations in SH3RF2. After the induction of myotube differentiation, the expression profiles were analyzed and compared between regular QM7 and SH3RF2 KO QM7#4 cells by global RNA sequencing and bioinformatics analysis. Conclusion We did not detect any statistically significant role of SH3RF2 during myotube differentiation in QM7 myoblast cells. However, additional experiments are necessary to examine the biofunctional activity of SH3RF2 in cell proliferation and muscle growth.

  18. (CAG)(n)-hairpin DNA binds to Msh2-Msh3 and changes properties of mismatch recognition.

    Science.gov (United States)

    Owen, Barbara A L; Yang, Zungyoon; Lai, Maoyi; Gajec, Maciej; Gajek, Maciez; Badger, John D; Hayes, Jeffrey J; Edelmann, Winfried; Kucherlapati, Raju; Wilson, Teresa M; McMurray, Cynthia T

    2005-08-01

    Cells have evolved sophisticated DNA repair systems to correct damaged DNA. However, the human DNA mismatch repair protein Msh2-Msh3 is involved in the process of trinucleotide (CNG) DNA expansion rather than repair. Using purified protein and synthetic DNA substrates, we show that Msh2-Msh3 binds to CAG-hairpin DNA, a prime candidate for an expansion intermediate. CAG-hairpin binding inhibits the ATPase activity of Msh2-Msh3 and alters both nucleotide (ADP and ATP) affinity and binding interfaces between protein and DNA. These changes in Msh2-Msh3 function depend on the presence of A.A mispaired bases in the stem of the hairpin and on the hairpin DNA structure per se. These studies identify critical functional defects in the Msh2-Msh3-CAG hairpin complex that could misdirect the DNA repair process.

  19. Preclinical Biodistribution and Safety Evaluation of a pbi-shRNA STMN1 Lipoplex after Subcutaneous Delivery.

    Science.gov (United States)

    Wang, Zhaohui; Jay, Christopher M; Evans, Courtney; Kumar, Padmasini; Phalon, Connor; Rao, Donald D; Senzer, Neil; Nemunaitis, John

    2017-02-01

    Stathmin-1 (STMN1) is a microtubule-destabilizing protein which is overexpressed in cancer. Its overexpression is associated with poor prognosis and also serves as a predictive marker to taxane therapy. We have developed a proprietary bi-functional shRNA (bi-shRNA) platform to execute RNA interference (RNAi)-mediated gene silencing and a liposome-carrier complex to systemically deliver the pbi-shRNA plasmids. In vitro and in vivo testing demonstrated efficacy and specificity of pbi-shRNA plasmid in targeting STMN1 (Phadke, A. P., Jay, C. M., Wang, Z., Chen, S., Liu, S., Haddock, C., Kumar, P., Pappen, B. O., Rao, D. D., Templeton, N. S., et al. (2011). In vivo safety and antitumor efficacy of bifunctional small hairpin RNAs specific for the human Stathmin 1 oncoprotein. DNA Cell Biol. 30, 715-726.). Biodistribution and toxicology studies in bio-relevant Sprague Dawley rats with pbi-shRNA STMN1 lipoplex revealed that the plasmid DNA was delivered to a broad distribution of organs after a single subcutaneous injection. Specifically, plasmid was detected within the first week using QPCR (threshold 50 copies plasmid/1 µg genomic DNA) at the injection site, lung, spleen, blood, skin, ovary (limited), lymph nodes, and liver. It was not detected in the heart, testis or bone marrow. No plasmid was detected from any organ 30 days after injection. Treatment was well tolerated. Minimal inflammation/erythema was observed at the injection site. Circulating cytokine response was also examined by ELISA. The IL-6 levels were induced within 6 h then declined to the vehicle control level 72 h after the injection. TNFα induction was transiently observed 4 days after the DNA lipoplex treatment. In summary, the pbi-shRNA STMN1 lipoplex was well tolerated and displayed broad distribution after a single subcutaneous injection. The pre-clinical data has been filed to FDA and the pbi-shRNA STMN1 lipoplex is being investigated in a phase I clinical study. © The Author 2016. Published

  20. Strange temperature dependence of the folding rate of a 16-residue β-hairpin

    International Nuclear Information System (INIS)

    Xu Yao; Wang Ting; Gai Feng

    2006-01-01

    The folding/unfolding kinetics of a 16-residue β-hairpin that undergoes cold denaturation at ambient temperatures were investigated by time-resolved infrared spectroscopy coupled with the laser-induced temperature jump (T-jump) initiation method. We found that the relaxation kinetics of this β-hairpin following a T-jump, obtained by probing the amide I' band of the peptide backbone, show strange temperature dependence. At temperatures below approximately 35 deg. C where this β-hairpin mainly exhibits cold denaturation, the T-jump induced relaxation rate is ∼5 μs -1 , whereas at temperatures where heat denaturation takes place, the relaxation rate increases to ∼1 μs -1 . These results cannot be readily explained by a two-state folding model that has been used to describe the folding thermodynamics of this β-hairpin. In addition, these results suggest that the folding free energy barrier separating the cold-denatured state from the folded state is different from that separating the heat-denatured state from the folded state, coinciding with the idea that the mechanism leading to cold denaturation is different from that leading to heat denaturation

  1. Design of a new hairpin DNAzyme: The activity controlled by TMPyP4

    African Journals Online (AJOL)

    Jane

    2011-08-01

    Aug 1, 2011 ... activity and increase cell toxicity (Abdelgany et al., 2007). The hairpin DNAzyme is a ... fixed concentration of 5×10-4M in 50 mM Tris-HCl buffer (pH= 7.5,. 25°C) with 10 mM ..... Functional nucleic acid sensors. Chem. Rev.

  2. Role of the DIS hairpin in replication of human immunodeficiency virus type 1

    NARCIS (Netherlands)

    Berkhout, B.; van Wamel, J. L.

    1996-01-01

    The virion-associated genome of human immunodeficiency virus type 1 consists of a noncovalently linked dimer of two identical, unspliced RNA molecules. A hairpin structure within the untranslated leader transcript is postulated to play a role in RNA dimerization through base pairing of the

  3. Inhibition of HIV Replication by Cyclic and Hairpin PNAs Targeting the HIV-1 TAR RNA Loop

    Science.gov (United States)

    Upert, Gregory; Di Giorgio, Audrey; Upadhyay, Alok; Manvar, Dinesh; Pandey, Nootan; Pandey, Virendra N.; Patino, Nadia

    2012-01-01

    Human immunodeficiency virus-1 (HIV-1) replication and gene expression entails specific interaction of the viral protein Tat with its transactivation responsive element (TAR), to form a highly stable stem-bulge-loop structure. Previously, we described triphenylphosphonium (TPP) cation-based vectors that efficiently deliver nucleotide analogs (PNAs) into the cytoplasm of cells. In particular, we showed that the TPP conjugate of a linear 16-mer PNA targeting the apical stem-loop region of TAR impedes Tat-mediated transactivation of the HIV-1 LTR in vitro and also in cell culture systems. In this communication, we conjugated TPP to cyclic and hairpin PNAs targeting the loop region of HIV-1 TAR and evaluated their antiviral efficacy in a cell culture system. We found that TPP-cyclic PNAs containing only 8 residues, showed higher antiviral potency compared to hairpin PNAs of 12 or 16 residues. We further noted that the TPP-conjugates of the 8-mer cyclic PNA as well as the 16-mer linear PNA displayed similar antiviral efficacy. However, cyclic PNAs were shown to be highly specific to their target sequences. This communication emphasizes on the importance of small constrained cyclic PNAs over both linear and hairpin structures for targeting biologically relevant RNA hairpins. PMID:23029603

  4. Inhibition of HIV Replication by Cyclic and Hairpin PNAs Targeting the HIV-1 TAR RNA Loop

    Directory of Open Access Journals (Sweden)

    Gregory Upert

    2012-01-01

    Full Text Available Human immunodeficiency virus-1 (HIV-1 replication and gene expression entails specific interaction of the viral protein Tat with its transactivation responsive element (TAR, to form a highly stable stem-bulge-loop structure. Previously, we described triphenylphosphonium (TPP cation-based vectors that efficiently deliver nucleotide analogs (PNAs into the cytoplasm of cells. In particular, we showed that the TPP conjugate of a linear 16-mer PNA targeting the apical stem-loop region of TAR impedes Tat-mediated transactivation of the HIV-1 LTR in vitro and also in cell culture systems. In this communication, we conjugated TPP to cyclic and hairpin PNAs targeting the loop region of HIV-1 TAR and evaluated their antiviral efficacy in a cell culture system. We found that TPP-cyclic PNAs containing only 8 residues, showed higher antiviral potency compared to hairpin PNAs of 12 or 16 residues. We further noted that the TPP-conjugates of the 8-mer cyclic PNA as well as the 16-mer linear PNA displayed similar antiviral efficacy. However, cyclic PNAs were shown to be highly specific to their target sequences. This communication emphasizes on the importance of small constrained cyclic PNAs over both linear and hairpin structures for targeting biologically relevant RNA hairpins.

  5. Vibrational spectral simulation for peptides of mixed secondary structure: Method comparisons with the Trpzip model hairpin

    Czech Academy of Sciences Publication Activity Database

    Bouř, Petr; Keiderling, T. A.

    2005-01-01

    Roč. 109, - (2005), 23687-23697 ISSN 1089-5647 R&D Projects: GA AV ČR(CZ) IAA4055104 Grant - others:NSF(US) CHE03-16014 Institutional research plan: CEZ:AV0Z40550506 Keywords : VCD * trpzin model hairpin * peptides Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.679, year: 2003

  6. Hairpin and duplex formation in DNA fragments CCAATTTTGG, CCAATTTTTTGG, and CCATTTTTGG: a proton NMR study

    International Nuclear Information System (INIS)

    Pramanik, P.; Kanhouwa, N.; Kan, L.

    1988-01-01

    Three DNA fragments, CCAATTTTGG (1), CCAATTTTTTGG (2), AND CCATTTTTGG (3), were studied by proton NMR spectroscopy in aqueous solution. All these oligodeoxyribonucleotides contain common sequences at the 5' and 3' ends (5'-CCA and TGG-3'). 2 as well as 3 forms only hairpin structures with four unpaired thymidylyl units, four and three base pair stems, respectively, in neutral solution under low and high NaCl concentrations. At high salt concentration the oligomer 1 forms a duplex structure with -TT- internal loop. On the other hand, the same oligomer forms a stable hairpin structure at low salt and low strand concentrations at pH 7. The hairpin structure of 1 has a stem containing only three base pairs (CCA x TGG) and a loop containing four nucleotides (-ATTT-) that includes a dissociated A x T base pair. The two secondary structures of 1 coexist in an aqueous solution containing 0.1 M NaCl, at pH 7. The equilibrium shifts to the hairpin side when the temperature is raised. The stabilities and base-stacking modes of all three oligonucleotides in tow different structures are reported

  7. Determination of low-energy structures of a small RNA hairpin using ...

    Indian Academy of Sciences (India)

    In this method, the history of the simulation is used to increase the probability of states less visited in the simulation. It has been found that using both energy and end-to-end distance as the biasing parameters in the simulation, the partially folded structure of the hairpin starting from random structures could be obtained.

  8. Theoretical Insights Reveal Novel Motions in Csk's SH3 Domain That Control Kinase Activation.

    Directory of Open Access Journals (Sweden)

    Sulyman Barkho

    Full Text Available The Src family of tyrosine kinases (SFKs regulate numerous aspects of cell growth and differentiation and are under the principal control of the C-terminal Src Kinase (Csk. Although Csk and SFKs share conserved kinase, SH2 and SH3 domains, they differ considerably in three-dimensional structure, regulatory mechanism, and the intrinsic kinase activities. Although the SH2 and SH3 domains are known to up- or down-regulate tyrosine kinase function, little is known about the global motions in the full-length kinase that govern these catalytic variations. We use a combination of accelerated Molecular Dynamics (aMD simulations and experimental methods to provide a new view of functional motions in the Csk scaffold. These computational studies suggest that high frequency vibrations in the SH2 domain are coupled through the N-terminal lobe of the kinase domain to motions in the SH3 domain. The effects of these reflexive movements on the kinase domain can be viewed using both Deuterium Exchange Mass Spectrometry (DXMS and steady-state kinetic methods. Removal of several contacts, including a crystallographically unobserved N-terminal segment, between the SH3 and kinase domains short-circuit these coupled motions leading to reduced catalytic efficiency and stability of N-lobe motifs within the kinase domain. The data expands the model of Csk's activation whereby separate domains productively interact with two diametrically opposed surfaces of the kinase domain. Such reversible transitions may organize the active structure of the tyrosine kinase domain of Csk.

  9. Identification of SH2B2β as an Inhibitor for SH2B1- and SH2B2α-Promoted Janus Kinase-2 Activation and Insulin Signaling

    OpenAIRE

    Li, Minghua; Li, Zhiqin; Morris, David L.; Rui, Liangyou

    2007-01-01

    The SH2B family has three members (SH2B1, SH2B2, and SH2B3) that contain conserved dimerization (DD), pleckstrin homology, and SH2 domains. The DD domain mediates the formation of homo- and heterodimers between members of the SH2B family. The SH2 domain of SH2B1 (previously named SH2-B) or SH2B2 (previously named APS) binds to phosphorylated tyrosines in a variety of tyrosine kinases, including Janus kinase-2 (JAK2) and the insulin receptor, thereby promoting the activation of JAK2 or the ins...

  10. Hairpin-like fluorescent probe for imaging of NF-κB transcription factor activity.

    Science.gov (United States)

    Metelev, Valeri; Zhang, Surong; Tabatadze, David; Bogdanov, Alexei

    2011-04-20

    Three oligodeoxyribonucleotides (ODN) covalently labeled with near-infrared (NIR) fluorochromes were synthesized and characterized with a goal of comparing in vitro a hairpin-based and a duplex-based FRET probe designed for the detection of human recombinant NF-κB p50/p65 heterodimer binding to DNA. Using deoxyguanosine phosphoramidite with a phosphorus-linked aminoethylene (diethylene glycol) hydrophilic linker, we synthesized ODNs with internucleoside reactive sites. The hairpin loop amino linker was modified with IRDye 800CW (FRET acceptor), and the 3'-end was modified with Cy5.5 (FRET donor) using a dithio-linker. To obtain a duplex probe, we conjugated Cy5.5 and 800CW to complementary strands at the distance of ten base pairs in the resultant duplex. No quenching of dyes was observed in either probe. The FRET efficiency was higher in the duplex (71%) than in the hairpin (56%) due to a more favorable distance between the donor and the acceptor. However, the hairpin design allowed more precise ratiometric measurement of fluorescence intensity changes as a result of NF-κB p50/p65 binding to the probe. We determined that as a result of binding there was a statistically significant increase of fluorescence intensity of Cy5.5 (donor) due to a decrease of FRET if normalized by 800CW intensity measured independently of FRET. We conclude that the hairpin based probe design allows for the synthesis of a dual fluorescence imaging probe that renders signal changes that are simple to interpret and stoichiometrically correct for detecting transcription factor-DNA interactions.

  11. Effect of the SH3-SH2 domain linker sequence on the structure of Hck kinase.

    Science.gov (United States)

    Meiselbach, Heike; Sticht, Heinrich

    2011-08-01

    The coordination of activity in biological systems requires the existence of different signal transduction pathways that interact with one another and must be precisely regulated. The Src-family tyrosine kinases, which are found in many signaling pathways, differ in their physiological function despite their high overall structural similarity. In this context, the differences in the SH3-SH2 domain linkers might play a role for differential regulation, but the structural consequences of linker sequence remain poorly understood. We have therefore performed comparative molecular dynamics simulations of wildtype Hck and of a mutant Hck in which the SH3-SH2 domain linker is replaced by the corresponding sequence from the homologous kinase Lck. These simulations reveal that linker replacement not only affects the orientation of the SH3 domain itself, but also leads to an alternative conformation of the activation segment in the Hck kinase domain. The sequence of the SH3-SH2 domain linker thus exerts a remote effect on the active site geometry and might therefore play a role in modulating the structure of the inactive kinase or in fine-tuning the activation process itself.

  12. Biochemical and genetic analysis of the Drk SH2/SH3 adaptor protein of Drosophila.

    OpenAIRE

    Raabe, T; Olivier, J P; Dickson, B J; Liu, X; Gish, G D; Pawson, T; Hafen, E

    1995-01-01

    The Drk SH3-SH2-SH3 adaptor protein has been genetically identified in a screen for rate-limiting components acting downstream of the Sevenless (Sev) receptor tyrosine kinase in the developing eye of Drosophila. It provides a link between the activated Sev receptor and Sos, a guanine nucleotide release factor that activates Ras1. We have used a combined biochemical and genetic approach to study the interactions between Sev, Drk and Sos. We show that Tyr2546 in the cytoplasmic tail of Sev is r...

  13. SH2 domains: modulators of nonreceptor tyrosine kinase activity.

    Science.gov (United States)

    Filippakopoulos, Panagis; Müller, Susanne; Knapp, Stefan

    2009-12-01

    The Src homology 2 (SH2) domain is a sequence-specific phosphotyrosine-binding module present in many signaling molecules. In cytoplasmic tyrosine kinases, the SH2 domain is located N-terminally to the catalytic kinase domain (SH1) where it mediates cellular localization, substrate recruitment, and regulation of kinase activity. Initially, structural studies established a role of the SH2 domain stabilizing the inactive state of Src family members. However, biochemical characterization showed that the presence of the SH2 domain is frequently required for catalytic activity, suggesting a crucial function stabilizing the active state of many nonreceptor tyrosine kinases. Recently, the structure of the SH2-kinase domain of Fes revealed that the SH2 domain stabilizes the active kinase conformation by direct interactions with the regulatory helix alphaC. Stabilizing interactions between the SH2 and the kinase domains have also been observed in the structures of active Csk and Abl. Interestingly, mutations in the SH2 domain found in human disease can be explained by SH2 domain destabilization or incorrect positioning of the SH2. Here we summarize our understanding of mechanisms that lead to tyrosine kinase activation by direct interactions mediated by the SH2 domain and discuss how mutations in the SH2 domain trigger kinase inactivation.

  14. Introduction: History of SH2 Domains and Their Applications.

    Science.gov (United States)

    Liu, Bernard A; Machida, Kazuya

    2017-01-01

    The Src Homology 2 (SH2) domain is the prototypical protein interaction module that lies at the heart of phosphotyrosine signaling. Since its serendipitous discovery, there has been a tremendous advancement in technologies and an array of techniques available for studying SH2 domains and phosphotyrosine signaling. In this chapter, we provide a glimpse of the history of SH2 domains and describe many of the tools and techniques that have been developed along the way and discuss future directions for SH2 domain studies. We highlight the gist of each chapter in this volume in the context of: the structural biology and phosphotyrosine binding; characterizing SH2 specificity and generating prediction models; systems biology and proteomics; SH2 domains in signal transduction; and SH2 domains in disease, diagnostics, and therapeutics. Many of the individual chapters provide an in-depth approach that will allow scientists to interrogate the function and role of SH2 domains.

  15. SH2 domains: modulators of nonreceptor tyrosine kinase activity

    OpenAIRE

    Filippakopoulos, Panagis; Müller, Susanne; Knapp, Stefan

    2009-01-01

    The Src homology 2 (SH2) domain is a sequence-specific phosphotyrosine-binding module present in many signaling molecules. In cytoplasmic tyrosine kinases, the SH2 domain is located N-terminally to the catalytic kinase domain (SH1) where it mediates cellular localization, substrate recruitment, and regulation of kinase activity. Initially, structural studies established a role of the SH2 domain stabilizing the inactive state of Src family members. However, biochemical characterization showed ...

  16. Biochemical and genetic analysis of the Drk SH2/SH3 adaptor protein of Drosophila.

    Science.gov (United States)

    Raabe, T; Olivier, J P; Dickson, B; Liu, X; Gish, G D; Pawson, T; Hafen, E

    1995-06-01

    The Drk SH3-SH2-SH3 adaptor protein has been genetically identified in a screen for rate-limiting components acting downstream of the Sevenless (Sev) receptor tyrosine kinase in the developing eye of Drosophila. It provides a link between the activated Sev receptor and Sos, a guanine nucleotide release factor that activates Ras1. We have used a combined biochemical and genetic approach to study the interactions between Sev, Drk and Sos. We show that Tyr2546 in the cytoplasmic tail of Sev is required for Drk binding, probably because it provides a recognition site for the Drk SH2 domain. Interestingly, a mutation at this site does not completely block Sev function in vivo. This may suggest that Sev can signal in a Drk-independent, parallel pathway or that Drk can also bind to an intermediate docking protein. Analysis of the Drk-Sos interaction has identified a high affinity binding site for Drk SH3 domains in the Sos tail. We show that the N-terminal Drk SH3 domain is primarily responsible for binding to the tail of Sos in vitro, and for signalling to Ras in vivo.

  17. Kinase activation through dimerization by human SH2-B.

    Science.gov (United States)

    Nishi, Masahiro; Werner, Eric D; Oh, Byung-Chul; Frantz, J Daniel; Dhe-Paganon, Sirano; Hansen, Lone; Lee, Jongsoon; Shoelson, Steven E

    2005-04-01

    The isoforms of SH2-B, APS, and Lnk form a family of signaling proteins that have been described as activators, mediators, or inhibitors of cytokine and growth factor signaling. We now show that the three alternatively spliced isoforms of human SH2-B readily homodimerize in yeast two-hybrid and cellular transfections assays, and this is mediated specifically by a unique domain in its amino terminus. Consistent with previous reports, we further show that the SH2 domains of SH2-B and APS bind JAK2 at Tyr813. These findings suggested a model in which two molecules of SH2-B or APS homodimerize with their SH2 domains bound to two JAK2 molecules, creating heterotetrameric JAK2-(SH2-B)2-JAK2 or JAK2-(APS)2-JAK2 complexes. We further show that APS and SH2-B isoforms heterodimerize. At lower levels of SH2-B or APS expression, dimerization approximates two JAK2 molecules to induce transactivation. At higher relative concentrations of SH2-B or APS, kinase activation is blocked. SH2-B or APS homodimerization and SH2-B/APS heterodimerization thus provide direct mechanisms for activating and inhibiting JAK2 and other kinases from the inside of the cell and for potentiating or attenuating cytokine and growth factor receptor signaling when ligands are present.

  18. Classification and Lineage Tracing of SH2 Domains Throughout Eukaryotes.

    Science.gov (United States)

    Liu, Bernard A

    2017-01-01

    Today there exists a rapidly expanding number of sequenced genomes. Cataloging protein interaction domains such as the Src Homology 2 (SH2) domain across these various genomes can be accomplished with ease due to existing algorithms and predictions models. An evolutionary analysis of SH2 domains provides a step towards understanding how SH2 proteins integrated with existing signaling networks to position phosphotyrosine signaling as a crucial driver of robust cellular communication networks in metazoans. However organizing and tracing SH2 domain across organisms and understanding their evolutionary trajectory remains a challenge. This chapter describes several methodologies towards analyzing the evolutionary trajectory of SH2 domains including a global SH2 domain classification system, which facilitates annotation of new SH2 sequences essential for tracing the lineage of SH2 domains throughout eukaryote evolution. This classification utilizes a combination of sequence homology, protein domain architecture and the boundary positions between introns and exons within the SH2 domain or genes encoding these domains. Discrete SH2 families can then be traced across various genomes to provide insight into its origins. Furthermore, additional methods for examining potential mechanisms for divergence of SH2 domains from structural changes to alterations in the protein domain content and genome duplication will be discussed. Therefore a better understanding of SH2 domain evolution may enhance our insight into the emergence of phosphotyrosine signaling and the expansion of protein interaction domains.

  19. Crystal structure of the Src family kinase Hck SH3-SH2 linker regulatory region supports an SH3-dominant activation mechanism.

    Science.gov (United States)

    Alvarado, John J; Betts, Laurie; Moroco, Jamie A; Smithgall, Thomas E; Yeh, Joanne I

    2010-11-12

    Most mammalian cell types depend on multiple Src family kinases (SFKs) to regulate diverse signaling pathways. Strict control of SFK activity is essential for normal cellular function, and loss of kinase regulation contributes to several forms of cancer and other diseases. Previous x-ray crystal structures of the SFKs c-Src and Hck revealed that intramolecular association of their Src homology (SH) 3 domains and SH2 kinase linker regions has a key role in down-regulation of kinase activity. However, the amino acid sequence of the Hck linker represents a suboptimal ligand for the isolated SH3 domain, suggesting that it may form the polyproline type II helical conformation required for SH3 docking only in the context of the intact structure. To test this hypothesis directly, we determined the crystal structure of a truncated Hck protein consisting of the SH2 and SH3 domains plus the linker. Despite the absence of the kinase domain, the structures and relative orientations of the SH2 and SH3 domains in this shorter protein were very similar to those observed in near full-length, down-regulated Hck. However, the SH2 kinase linker adopted a modified topology and failed to engage the SH3 domain. This new structure supports the idea that these noncatalytic regions work together as a "conformational switch" that modulates kinase activity in a manner unique to the SH3 domain and linker topologies present in the intact Hck protein. Our results also provide fresh structural insight into the facile induction of Hck activity by HIV-1 Nef and other Hck SH3 domain binding proteins and implicate the existence of innate conformational states unique to individual Src family members that "fine-tune" their sensitivities to activation by SH3-based ligands.

  20. Summary of bi-shRNA/GM-CSF augmented autologous tumor cell immunotherapy (FANG™) in advanced cancer of the liver.

    Science.gov (United States)

    Nemunaitis, John; Barve, Minal; Orr, Douglas; Kuhn, Joseph; Magee, Mitchell; Lamont, Jeffrey; Bedell, Cynthia; Wallraven, Gladice; Pappen, Beena O; Roth, Alyssa; Horvath, Staci; Nemunaitis, Derek; Kumar, Padmasini; Maples, Phillip B; Senzer, Neil

    2014-01-01

    Therapies for advanced hepatocellular carcinoma (HCC) are limited. We carried out a phase I trial of a novel autologous whole-cell tumor cell immunotherapy (FANG™), which incorporates a dual granulocyte macrophage colony-stimulating factor (GM-CSF) expressive/bifunctional small hairpin RNA interference (bi-shRNAi) vector. The bi-shRNAi DNA targets furin, which is a proconvertase of transforming growth factors beta (TGFβ) 1 and 2. Safety, mechanism, immunoeffectiveness, and suggested benefit were previously shown [Senzer et al.: Mol Ther 2012;20:679-689; Senzer et al.: J Vaccines Vaccin 2013;4:209]. We now provide further follow-up of a subset of 8 HCC patients. FANG manufacturing was successful in 7 of 8 attempts (one failure due to insufficient cell yield). Median GM-CSF expression was 144 pg/10(6) cells, TGFβ1 knockdown was 100%, and TGFβ2 knockdown was 93% of the vector-transported cells. Five patients were vaccinated (1 or 2.5×10(7) cells/intradermal injection, 6-11 vaccinations). No FANG toxicity was observed. Three of these patients demonstrated evidence of an immune response to the autologous tumor cell sample. Long-term follow-up demonstrated survival of 319, 729, 784, 931+, and 1,043+ days of the FANG-treated patients. In conclusion, evidence supports further assessment of the FANG immunotherapy in HCC. © 2014 S. Karger AG, Basel.

  1. Observation of hairpin defects in a nematic main-chain polyester

    Science.gov (United States)

    Li, M. H.; Brûlet, A.; Davidson, P.; Keller, P.; Cotton, J. P.

    1993-04-01

    The conformation of a main-chain liquid crystalline polyester in its oriented nematic phase has been determined by small-angle neutron scattering. The data are fitted by a model of rigid cylinder with orientational fluctuations. For a low degree of polymerization (~9) the chain is almost completely elongated in the direction of the nematic field. For a polymer 3 times longer, the existence of two hairpins is shown at high temperature; this number decreases with decreasing temperature.

  2. α-helix to β-hairpin transition of human amylin monomer

    Science.gov (United States)

    Singh, Sadanand; Chiu, Chi-cheng; Reddy, Allam S.; de Pablo, Juan J.

    2013-04-01

    The human islet amylin polypeptide is produced along with insulin by pancreatic islets. Under some circumstances, amylin can aggregate to form amyloid fibrils, whose presence in pancreatic cells is a common pathological feature of Type II diabetes. A growing body of evidence indicates that small, early stage aggregates of amylin are cytotoxic. A better understanding of the early stages of the amylin aggregation process and, in particular, of the nucleation events leading to fibril growth could help identify therapeutic strategies. Recent studies have shown that, in dilute solution, human amylin can adopt an α-helical conformation, a β-hairpin conformation, or an unstructured coil conformation. While such states have comparable free energies, the β-hairpin state exhibits a large propensity towards aggregation. In this work, we present a detailed computational analysis of the folding pathways that arise between the various conformational states of human amylin in water. A free energy surface for amylin in explicit water is first constructed by resorting to advanced sampling techniques. Extensive transition path sampling simulations are then employed to identify the preferred folding mechanisms between distinct minima on that surface. Our results reveal that the α-helical conformer of amylin undergoes a transformation into the β-hairpin monomer through one of two mechanisms. In the first, misfolding begins through formation of specific contacts near the turn region, and proceeds via a zipping mechanism. In the second, misfolding occurs through an unstructured coil intermediate. The transition states for these processes are identified. Taken together, the findings presented in this work suggest that the inter-conversion of amylin between an α-helix and a β-hairpin is an activated process and could constitute the nucleation event for fibril growth.

  3. Opening of the TAR hairpin in the HIV-1 genome causes aberrant RNA dimerization and packaging

    Directory of Open Access Journals (Sweden)

    Das Atze T

    2012-07-01

    Full Text Available Abstract Background The TAR hairpin is present at both the 5′ and 3′ end of the HIV-1 RNA genome. The 5′ element binds the viral Tat protein and is essential for Tat-mediated activation of transcription. We recently observed that complete TAR deletion is allowed in the context of an HIV-1 variant that does not depend on this Tat-TAR axis for transcription. Mutations that open the 5′ stem-loop structure did however affect the leader RNA conformation and resulted in a severe replication defect. In this study, we set out to analyze which step of the HIV-1 replication cycle is affected by this conformational change of the leader RNA. Results We demonstrate that opening the 5′ TAR structure through a deletion in either side of the stem region caused aberrant dimerization and reduced packaging of the unspliced viral RNA genome. In contrast, truncation of the TAR hairpin through deletions in both sides of the stem did not affect RNA dimer formation and packaging. Conclusions These results demonstrate that, although the TAR hairpin is not essential for RNA dimerization and packaging, mutations in TAR can significantly affect these processes through misfolding of the relevant RNA signals.

  4. 2-Aminopurine hairpin probes for the detection of ultraviolet-induced DNA damage

    International Nuclear Information System (INIS)

    El-Yazbi, Amira F.; Loppnow, Glen R.

    2012-01-01

    Highlights: ► Molecular beacon with 2AP bases detects DNA damage in a simple mix-and-read assay. ► Molecular beacons with 2AP bases detect damage at a 17.2 nM limit of detection. ► The 2AP molecular beacon is linear over a 0–3.5 μM concentration range for damage. - Abstract: Nucleic acid exposure to radiation and chemical insults leads to damage and disease. Thus, detection and understanding DNA damage is important for elucidating molecular mechanisms of disease. However, current methods of DNA damage detection are either time-consuming, destroy the sample, or are too specific to be used for generic detection of damage. In this paper, we develop a fluorescence sensor of 2-aminopurine (2AP), a fluorescent analogue of adenine, incorporated in the loop of a hairpin probe for the quantification of ultraviolet (UV) C-induced nucleic acid damage. Our results show that the selectivity of the 2AP hairpin probe to UV-induced nucleic acid damage is comparable to molecular beacon (MB) probes of DNA damage. The calibration curve for the 2AP hairpin probe shows good linearity (R 2 = 0.98) with a limit of detection of 17.2 nM. This probe is a simple, fast and economic fluorescence sensor for the quantification of UV-induced damage in DNA.

  5. Stabilization of a β-hairpin in monomeric Alzheimer's amyloid-β peptide inhibits amyloid formation

    Science.gov (United States)

    Hoyer, Wolfgang; Grönwall, Caroline; Jonsson, Andreas; Ståhl, Stefan; Härd, Torleif

    2008-01-01

    According to the amyloid hypothesis, the pathogenesis of Alzheimer's disease is triggered by the oligomerization and aggregation of the amyloid-β (Aβ) peptide into protein plaques. Formation of the potentially toxic oligomeric and fibrillar Aβ assemblies is accompanied by a conformational change toward a high content of β-structure. Here, we report the solution structure of Aβ(1–40) in complex with the phage-display selected affibody protein ZAβ3, a binding protein of nanomolar affinity. Bound Aβ(1–40) features a β-hairpin comprising residues 17–36, providing the first high-resolution structure of Aβ in β conformation. The positions of the secondary structure elements strongly resemble those observed for fibrillar Aβ. ZAβ3 stabilizes the β-sheet by extending it intermolecularly and by burying both of the mostly nonpolar faces of the Aβ hairpin within a large hydrophobic tunnel-like cavity. Consequently, ZAβ3 acts as a stoichiometric inhibitor of Aβ fibrillation. The selected Aβ conformation allows us to suggest a structural mechanism for amyloid formation based on soluble oligomeric hairpin intermediates. PMID:18375754

  6. A four-way junction accelerates hairpin ribozyme folding via a discrete intermediate

    Science.gov (United States)

    Tan, Elliot; Wilson, Timothy J.; Nahas, Michelle K.; Clegg, Robert M.; Lilley, David M. J.; Ha, Taekjip

    2003-01-01

    The natural form of the hairpin ribozyme comprises two major structural elements: a four-way RNA junction and two internal loops carried by adjacent arms of the junction. The ribozyme folds into its active conformation by an intimate association between the loops, and the efficiency of this process is greatly enhanced by the presence of the junction. We have used single-molecule spectroscopy to show that the natural form fluctuates among three distinct states: the folded state and two additional, rapidly interconverting states (proximal and distal) that are inherited from the junction. The proximal state juxtaposes the two loop elements, thereby increasing the probability of their interaction and thus accelerating folding by nearly three orders of magnitude and allowing the ribozyme to fold rapidly in physiological conditions. Therefore, the hairpin ribozyme exploits the dynamics of the junction to facilitate the formation of the active site from its other elements. Dynamic interplay between structural elements, as we demonstrate for the hairpin ribozyme, may be a general theme for other functional RNA molecules. PMID:12883002

  7. Hairpin structures in DNA containing arabinofuranosylcytosine. A combination of nuclear magnetic resonance and molecular dynamics

    International Nuclear Information System (INIS)

    Pieters, J.M.L.; de Vroom, E.; van der Marel, G.A.; van Boom, J.H.; Altona, C.; Koning, T.H.G.; Kaptein, R.

    1990-01-01

    Nuclear magnetic resonance (NMR) and model-building studies were carried out on the hairpin form of the octamer d(CG a CTAGCG) ( a C = arabinofuranosylcytosine), referred to as the TA compound. The nonexchangeable protons of the TA compound were assigned by means of nuclear Overhauser effect spectroscopy (NOESY) and correlated spectroscopy (COSY). Form a detailed analysis of the coupling data and of the NOESY spectra the following conclusions are reached: (i) the hairpin consists of a stem of three Watson-Crick type base pairs, and the two remaining residues, T(4) and dA(5), participate in a loop. (ii) All sugar rings show conformational flexibility although a strong preference for the S-type (C2'-endo) conformer is observed. (iii) The thymine does not stack upon the 3' side of the stem as expected, but swings into the minor groove. (iv) At the 5'-3' loop-stem junction a stacking discontinuity occurs as a consequence of a sharp turn in that part of the backbone, caused by the unusual β + and γ t torsion angles in residue dG(6). (v) The A base slides over the 5' side of the stem to stack upon the a C(3) residue at the 3' side of the stem in an antiparallel fashion. On the basis of J couplings and a set approximate proton-proton distances from NOE cross peaks, a model for the hairpin was constructed

  8. The Role of Repeat Administration of Adventitial Delivery of Lentivirus-shRNA-Vegf-A in Arteriovenous Fistula to Prevent Venous Stenosis Formation.

    Science.gov (United States)

    Janardhanan, Rajiv; Yang, Binxia; Kilari, Sreenivasulu; Leof, Edward B; Mukhopadhyay, Debabrata; Misra, Sanjay

    2016-04-01

    To determine if a second dose of a lentivirus mediated small hairpin RNA that inhibits Vegf-A gene expression (LV-shRNA-Vegf-A) can improve lumen vessel area (LVA) of the outflow vein of an arteriovenous fistula (AVF) and decrease venous neointimal hyperplasia. Chronic kidney disease was created in C57BL/6 mice; 28 days later, an AVF was created by connecting the right carotid artery to the ipsilateral jugular vein. Immediately after AVF creation, 5 × 10(6) plaque-forming units of LV-shRNA-Vegf-A or control shRNA was administered to the adventitia of the outflow vein, and a second dose of the same treatment was administered 14 days later. Animals were sacrificed at 21 days, 28 days, and 42 days after AVF creation for reverse transcription polymerase chain reaction and histomorphometric analyses. By day 21, there was a 125% increase in the average LVA (day 21, P = .11), with a decrease in cell proliferation (day 21, P = .0079; day 28, P = .28; day 42, P = .5), decrease in α-smooth muscle cell actin staining (day 21, P < .0001; day 28, P < .05; day 42, P = .59), and decrease in hypoxic stress (day 21, P < .001; day 28, P = .28; day 42, P = .46) in LV versus control shRNA vessels. A second dose of LV-shRNA-Vegf-A administration results in a moderate improvement in LVA at day 21. Copyright © 2016 SIR. Published by Elsevier Inc. All rights reserved.

  9. Temporality in Manyōshū

    Directory of Open Access Journals (Sweden)

    Yamaguchi Toshiko

    2016-12-01

    Full Text Available Using the Manyōshū corpus, the paper argues that conceptual metaphor theory imposes limitations on the diversity of linguistic facts, particularly those concerning the speaker or the poet who is communicating. The paper offers explanations of the nature of time by drawing upon the inference operating within “basic sign structure”, specifically, indexicality and iconicity, both of which are at the heart of human semiotic activity.

  10. SH3 domain tyrosine phosphorylation--sites, role and evolution.

    Directory of Open Access Journals (Sweden)

    Zuzana Tatárová

    Full Text Available BACKGROUND: SH3 domains are eukaryotic protein domains that participate in a plethora of cellular processes including signal transduction, proliferation, and cellular movement. Several studies indicate that tyrosine phosphorylation could play a significant role in the regulation of SH3 domains. RESULTS: To explore the incidence of the tyrosine phosphorylation within SH3 domains we queried the PhosphoSite Plus database of phosphorylation sites. Over 100 tyrosine phosphorylations occurring on 20 different SH3 domain positions were identified. The tyrosine corresponding to c-Src Tyr-90 was by far the most frequently identified SH3 domain phosphorylation site. A comparison of sequences around this tyrosine led to delineation of a preferred sequence motif ALYD(Y/F. This motif is present in about 15% of human SH3 domains and is structurally well conserved. We further observed that tyrosine phosphorylation is more abundant than serine or threonine phosphorylation within SH3 domains and other adaptor domains, such as SH2 or WW domains. Tyrosine phosphorylation could represent an important regulatory mechanism of adaptor domains. CONCLUSIONS: While tyrosine phosphorylation typically promotes signaling protein interactions via SH2 or PTB domains, its role in SH3 domains is the opposite - it blocks or prevents interactions. The regulatory function of tyrosine phosphorylation is most likely achieved by the phosphate moiety and its charge interfering with binding of polyproline helices of SH3 domain interacting partners.

  11. MeSH Now: automatic MeSH indexing at PubMed scale via learning to rank.

    Science.gov (United States)

    Mao, Yuqing; Lu, Zhiyong

    2017-04-17

    MeSH indexing is the task of assigning relevant MeSH terms based on a manual reading of scholarly publications by human indexers. The task is highly important for improving literature retrieval and many other scientific investigations in biomedical research. Unfortunately, given its manual nature, the process of MeSH indexing is both time-consuming (new articles are not immediately indexed until 2 or 3 months later) and costly (approximately ten dollars per article). In response, automatic indexing by computers has been previously proposed and attempted but remains challenging. In order to advance the state of the art in automatic MeSH indexing, a community-wide shared task called BioASQ was recently organized. We propose MeSH Now, an integrated approach that first uses multiple strategies to generate a combined list of candidate MeSH terms for a target article. Through a novel learning-to-rank framework, MeSH Now then ranks the list of candidate terms based on their relevance to the target article. Finally, MeSH Now selects the highest-ranked MeSH terms via a post-processing module. We assessed MeSH Now on two separate benchmarking datasets using traditional precision, recall and F 1 -score metrics. In both evaluations, MeSH Now consistently achieved over 0.60 in F-score, ranging from 0.610 to 0.612. Furthermore, additional experiments show that MeSH Now can be optimized by parallel computing in order to process MEDLINE documents on a large scale. We conclude that MeSH Now is a robust approach with state-of-the-art performance for automatic MeSH indexing and that MeSH Now is capable of processing PubMed scale documents within a reasonable time frame. http://www.ncbi.nlm.nih.gov/CBBresearch/Lu/Demo/MeSHNow/ .

  12. SH2 Binding Site Protection Assay: A Method for Identification of SH2 Domain Interaction Partners by Exploiting SH2 Mediated Phosphosite Protection.

    Science.gov (United States)

    Jadwin, Joshua A

    2017-01-01

    Over the last two decades there has been a significant effort in the field to characterize the phosphosite binding specificities of SH2 domains with the goal of deciphering the pY signaling code. Although high throughput studies in various formats using most SH2 domains have collectively provided a rich resource of in vitro SH2-pTyr site specificity maps, this data can only be used approximate what is happening in the cell where protein concentrations and localization are not homogenous, as they are for in vitro experiments. Here we describe an in vivo approach, SH2 site protection assay, which can capture the pTyr binding specificity of SH2 domains in the cell. The basis of this approach is SH2-pY site protection, the ability of SH2 domains to prevent the PTP-dependent dephosphorylation of their pY site binding partners. We overexpress a tracer SH2 domain in cells and quantify the change in abundance of tyrosine phosphorylated sites using MS. Since the method is performed in vivo, it has the advantage of identifying SH2-pY interactions as they occur within in the cell.

  13. Probing SH2-domains using Inhibitor Affinity Purification (IAP).

    Science.gov (United States)

    Höfener, Michael; Heinzlmeir, Stephanie; Kuster, Bernhard; Sewald, Norbert

    2014-01-01

    Many human diseases are correlated with the dysregulation of signal transduction processes. One of the most important protein interaction domains in the context of signal transduction is the Src homology 2 (SH2) domain that binds phosphotyrosine residues. Hence, appropriate methods for the investigation of SH2 proteins are indispensable in diagnostics and medicinal chemistry. Therefore, an affinity resin for the enrichment of all SH2 proteins in one experiment would be desirable. However, current methods are unable to address all SH2 proteins simultaneously with a single compound or a small array of compounds. In order to overcome these limitations for the investigation of this particular protein family in future experiments, a dipeptide-derived probe has been designed, synthesized and evaluated. This probe successfully enriched 22 SH2 proteins from mixed cell lysates which contained 50 SH2 proteins. Further characterization of the SH2 binding properties of the probe using depletion and competition experiments indicated its ability to enrich complexes consisting of SH2 domain bearing regulatory PI3K subunits and catalytic phosphoinositide 3-kinase (PI3K) subunits that have no SH2 domain. The results make this probe a promising starting point for the development of a mixed affinity resin with complete SH2 protein coverage. Moreover, the additional findings render it a valuable tool for the evaluation of PI3K complex interrupting inhibitors.

  14. Drosophila photoreceptor axon guidance and targeting requires the dreadlocks SH2/SH3 adapter protein.

    Science.gov (United States)

    Garrity, P A; Rao, Y; Salecker, I; McGlade, J; Pawson, T; Zipursky, S L

    1996-05-31

    Mutations in the Drosophila gene dreadlocks (dock) disrupt photoreceptor cell (R cell) axon guidance and targeting. Genetic mosaic analysis and cell-type-specific expression of dock transgenes demonstrate dock is required in R cells for proper innervation. Dock protein contains one SH2 and three SH3 domains, implicating it in tyrosine kinase signaling, and is highly related to the human proto-oncogene Nck. Dock expression is detected in R cell growth cones in the target region. We propose Dock transmits signals in the growth cone in response to guidance and targeting cues. These findings provide an important step for dissection of signaling pathways regulating growth cone motility.

  15. The PS1 hairpin of Mcm3 is essential for viability and for DNA unwinding in vitro.

    Directory of Open Access Journals (Sweden)

    Simon K W Lam

    Full Text Available The pre-sensor 1 (PS1 hairpin is found in ring-shaped helicases of the AAA+ family (ATPases associated with a variety of cellular activities of proteins and is implicated in DNA translocation during DNA unwinding of archaeal mini-chromosome maintenance (MCM and superfamily 3 viral replicative helicases. To determine whether the PS1 hairpin is required for the function of the eukaryotic replicative helicase, Mcm2-7 (also comprised of AAA+ proteins, we mutated the conserved lysine residue in the putative PS1 hairpin motif in each of the Saccharomyces cerevisiae Mcm2-7 subunits to alanine. Interestingly, only the PS1 hairpin of Mcm3 was essential for viability. While mutation of the PS1 hairpin in the remaining MCM subunits resulted in minimal phenotypes, with the exception of Mcm7 which showed slow growth under all conditions examined, the viable alleles were synthetic lethal with each other. Reconstituted Mcm2-7 containing Mcm3 with the PS1 mutation (Mcm3(K499A had severely decreased helicase activity. The lack of helicase activity provides a probable explanation for the inviability of the mcm3(K499A strain. The ATPase activity of Mcm2-7(3K499A was similar to the wild type complex, but its interaction with single-stranded DNA in an electrophoretic mobility shift assay and its associations in cells were subtly altered. Together, these findings indicate that the PS1 hairpins in the Mcm2-7 subunits have important and distinct functions, most evident by the essential nature of the Mcm3 PS1 hairpin in DNA unwinding.

  16. Fluorescence-based characterization of genetically encoded peptides that fold in live cells: progress toward a generic hairpin scaffold

    Science.gov (United States)

    Cheng, Zihao; Campbell, Robert E.

    2007-02-01

    Binding proteins suitable for expression and high affinity molecular recognition in the cytoplasm or nucleus of live cells have numerous applications in the biological sciences. In an effort to add a new minimal motif to the growing repertoire of validated non-immunoglobulin binding proteins, we have undertaken the development of a generic protein scaffold based on a single β-hairpin that can fold efficiently in the cytoplasm. We have developed a method, based on the measurement of fluorescence resonance energy transfer (FRET) between a genetically fused cyan fluorescent protein (CFP) and yellow fluorescent protein (YFP), that allows the structural stability of recombinant β-hairpin peptides to be rapidly assessed both in vitro and in vivo. We have previously reported the validation of this method when applied to a 16mer tryptophan zipper β-hairpin. We now describe the use of this method to evaluate the potential of a designed 20mer β-hairpin peptide with a 3rd Trp/Trp cross-strand pair to function as a generic protein scaffold. Quantitative analysis of the FRET efficiency, resistance to proteolysis (assayed by loss of FRET), and circular dichroism spectra revealed that the 20mer peptide is significantly more tolerant of destabilizing mutations than the 16mer peptide. Furthermore, we experimentally demonstrate that the in vitro determined β-hairpin stabilities are well correlated with in vivo β-hairpin stabilities as determined by FRET measurements of colonies of live bacteria expressing the recombinant peptides flanked by CFP and YFP. Finally, we report on our progress to develop highly folded 24mer and 28mer β-hairpin peptides through the use of fluorescence-based library screening.

  17. Cinematic diamonds : narrative storytelling strategies in short fiction film

    OpenAIRE

    Cantell, Saara (kirjoittaja); Jeremiah, Fleur (kääntäjä)

    2012-01-01

    Saara Cantell proposes and discusses alternative ways of approaching short film. This book emphasizes short film as an independent and challenging cinematic art form of its own right. The "mystery" of short film is approached by examining the aesthetics of other short forms, The structural parallels between e.g. jokes and short films, as well as narrative strategies found in poetry, offer meaningful references. The research consists of both the analysis of selected short films and the five sh...

  18. Meshable: searching PubMed abstracts by utilizing MeSH and MeSH-derived topical terms.

    Science.gov (United States)

    Kim, Sun; Yeganova, Lana; Wilbur, W John

    2016-10-01

    Medical Subject Headings (MeSH(®)) is a controlled vocabulary for indexing and searching biomedical literature. MeSH terms and subheadings are organized in a hierarchical structure and are used to indicate the topics of an article. Biologists can use either MeSH terms as queries or the MeSH interface provided in PubMed(®) for searching PubMed abstracts. However, these are rarely used, and there is no convenient way to link standardized MeSH terms to user queries. Here, we introduce a web interface which allows users to enter queries to find MeSH terms closely related to the queries. Our method relies on co-occurrence of text words and MeSH terms to find keywords that are related to each MeSH term. A query is then matched with the keywords for MeSH terms, and candidate MeSH terms are ranked based on their relatedness to the query. The experimental results show that our method achieves the best performance among several term extraction approaches in terms of topic coherence. Moreover, the interface can be effectively used to find full names of abbreviations and to disambiguate user queries. https://www.ncbi.nlm.nih.gov/IRET/MESHABLE/ CONTACT: sun.kim@nih.gov Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.

  19. Molecular dissection of the interaction between the SH3 domain and the SH2-Kinase Linker region in PTK6.

    Science.gov (United States)

    Kim, Han Ie; Jung, Jinwon; Lee, Eun-Saem; Kim, Yong-Chul; Lee, Weontae; Lee, Seung-Taek

    2007-11-03

    PTK6 (also known as Brk) is an intracellular tyrosine kinase that contains SH3, SH2, and tyrosine kinase catalytic (Kinase) domains. The SH3 domain of PTK6 interacts with the N-terminal half of the linker (Linker) region between the SH2 and Kinase domains. Site-directed mutagenesis and surface plasmon resonance studies showed that a tryptophan residue (Trp44) in the SH3 domain and proline residues in the Linker region, in the order of Pro177, Pro175, and Pro179, contribute to the interaction. The three-dimensional modeled structure of the SH3-Linker complex was in agreement with the biochemical data. Disruption of the intramolecular interaction between the SH3 domain and the Linker region by mutation of Trp44, Pro175, Pro177, and Pro179 markedly increased the catalytic activity of PTK6 in HEK 293 cells. These results demonstrate that Trp44 in the SH3 domain and Pro177, Pro175, and Pro179 in the N-terminal half of the Linker region play important roles in the SH3-Linker interaction to maintain the protein in an inactive conformation along with the phosphorylated Tyr447-SH2 interaction.

  20. Roles of the SH2 and SH3 domains in the regulation of neuronal Src kinase functions.

    Science.gov (United States)

    Groveman, Bradley R; Xue, Sheng; Marin, Vedrana; Xu, Jindong; Ali, Mohammad K; Bienkiewicz, Ewa A; Yu, Xian-Min

    2011-02-01

    Previous studies demonstrated that intra-domain interactions between Src family kinases (SFKs), stabilized by binding of the phosphorylated C-terminus to the SH2 domain and/or binding of the SH2 kinase linker to the SH3 domain, lock the molecules in a closed conformation, disrupt the kinase active site, and inactivate SFKs. Here we report that the up-regulation of N-methyl-D-aspartate receptors (NMDARs) induced by expression of constitutively active neuronal Src (n-Src), in which the C-terminus tyrosine is mutated to phenylalanine (n-Src/Y535F), is significantly reduced by dysfunctions of the SH2 and/or SH3 domains of the protein. Furthermore, we found that dysfunctions of SH2 and/or SH3 domains reduce auto-phosphorylation of the kinase activation loop, depress kinase activity, and decrease NMDAR phosphorylation. The SH2 domain plays a greater regulatory role than the SH3 domain. Our data also show that n-Src binds directly to the C-terminus of the NMDAR NR2A subunit in vitro, with a K(D) of 108.2 ± 13.3 nM. This binding is not Src kinase activity-dependent, and dysfunctions of the SH2 and/or SH3 domains do not significantly affect the binding. These data indicate that the SH2 and SH3 domains may function to promote the catalytic activity of active n-Src, which is important in the regulation of NMDAR functions. © 2010 The Authors Journal compilation © 2010 FEBS.

  1. Structural insights into the intertwined dimer of fyn SH2.

    Science.gov (United States)

    Huculeci, Radu; Garcia-Pino, Abel; Buts, Lieven; Lenaerts, Tom; van Nuland, Nico

    2015-12-01

    Src homology 2 domains are interaction modules dedicated to the recognition of phosphotyrosine sites incorporated in numerous proteins found in intracellular signaling pathways. Here we provide for the first time structural insight into the dimerization of Fyn SH2 both in solution and in crystalline conditions, providing novel crystal structures of both the dimer and peptide-bound structures of Fyn SH2. Using nuclear magnetic resonance chemical shift analysis, we show how the peptide is able to eradicate the dimerization, leading to monomeric SH2 in its bound state. Furthermore, we show that Fyn SH2's dimer form differs from other SH2 dimers reported earlier. Interestingly, the Fyn dimer can be used to construct a completed dimer model of Fyn without any steric clashes. Together these results extend our understanding of SH2 dimerization, giving structural details, on one hand, and suggesting a possible physiological relevance of such behavior, on the other hand. © 2015 The Protein Society.

  2. SH2-PLA: a sensitive in-solution approach for quantification of modular domain binding by proximity ligation and real-time PCR.

    Science.gov (United States)

    Thompson, Christopher M; Bloom, Lee R; Ogiue-Ikeda, Mari; Machida, Kazuya

    2015-06-26

    There is a great interest in studying phosphotyrosine dependent protein-protein interactions in tyrosine kinase pathways that play a critical role in many aspects of cellular function. We previously established SH2 profiling, a phosphoproteomic approach based on membrane binding assays that utilizes purified Src Homology 2 (SH2) domains as a molecular tool to profile the global tyrosine phosphorylation state of cells. However, in order to use this method to investigate SH2 binding sites on a specific target in cell lysate, additional procedures such as pull-down or immunoprecipitation which consume large amounts of sample are required. We have developed PLA-SH2, an alternative in-solution modular domain binding assay that takes advantage of Proximity Ligation Assay and real-time PCR. The SH2-PLA assay utilizes oligonucleotide-conjugated anti-GST and anti-EGFR antibodies recognizing a GST-SH2 probe and cellular EGFR, respectively. If the GST-SH2 and EGFR are in close proximity as a result of SH2-phosphotyrosine interactions, the two oligonucleotides are brought within a suitable distance for ligation to occur, allowing for efficient complex amplification via real-time PCR. The assay detected signal across at least 3 orders of magnitude of lysate input with a linear range spanning 1-2 orders and a low femtomole limit of detection for EGFR phosphotyrosine. SH2 binding kinetics determined by PLA-SH2 showed good agreement with established far-Western analyses for A431 and Cos1 cells stimulated with EGF at various times and doses. Further, we showed that PLA-SH2 can survey lung cancer tissues using 1 μl lysate without requiring phospho-enrichment. We showed for the first time that interactions between SH2 domain probes and EGFR in cell lysate can be determined in a microliter-scale assay using SH2-PLA. The obvious benefit of this method is that the low sample requirement allows detection of SH2 binding in samples which are difficult to analyze using traditional protein

  3. Liquid crystal polymers: evidence of hairpin defects in nematic main chains, comparison with side chain polymers

    Science.gov (United States)

    Li, M. H.; Brûlet, A.; Keller, P.; Cotton, J. P.

    1996-09-01

    This article describes the conformation of two species of liquid crystalline polymers as revealed by small angle neutron scattering. The results obtained with side chain polymers are recalled. The procedure used to analyze the scattering data of main chains in the nematic phase is reported in this paper. It permits a demonstration of the existence of hairpins. Comparison of both polymer species shows that in the isotropic phase, the two polymers adopt a random coil conformation. In the nematic phase, the conformations are very different; the side chains behave as a melt of penetrable random coils whereas the main chains behave as a nematic phase of non penetrable cylinders.

  4. Effect of secondary structure on the thermodynamics and kinetics of PNA hybridization to DNA hairpins

    DEFF Research Database (Denmark)

    Kushon, S A; Jordan, J P; Seifert, J L

    2001-01-01

    The binding of a series of PNA and DNA probes to a group of unusually stable DNA hairpins of the tetraloop motif has been observed using absorbance hypochromicity (ABS), circular dichroism (CD), and a colorimetric assay for PNA/DNA duplex detection. These results indicate that both stable PNA...... structures in both target and probe molecules are shown to depress the melting temperatures and free energies of the probe-target duplexes. Kinetic analysis of hybridization yields reaction rates that are up to 160-fold slower than hybridization between two unstructured strands. The thermodynamic and kinetic...

  5. Non-Covalent Fluorescent Labeling of Hairpin DNA Probe Coupled with Hybridization Chain Reaction for Sensitive DNA Detection.

    Science.gov (United States)

    Song, Luna; Zhang, Yonghua; Li, Junling; Gao, Qiang; Qi, Honglan; Zhang, Chengxiao

    2016-04-01

    An enzyme-free signal amplification-based assay for DNA detection was developed using fluorescent hairpin DNA probes coupled with hybridization chain reaction (HCR). The hairpin DNAs were designed to contain abasic sites in the stem moiety. Non-covalent labeling of the hairpin DNAs was achieved when a fluorescent ligand was bound to the abasic sites through hydrogen bonding with the orphan cytosine present on the complementary strand, accompanied by quench of ligand fluorescence. As a result, the resultant probes, the complex formed between the hairpin DNA and ligand, showed almost no fluorescence. Upon hybridization with target DNA, the probe underwent a dehybridization of the stem moiety containing an abasic site. The release of ligand from the abasic site to the solution resulted in an effective fluorescent enhancement, which can be used as a signal. Compared with a sensing system without HCR, a 20-fold increase in the sensitivity was achieved using the sensing system with HCR. The fluorescent intensity of the sensing system increased with the increase in target DNA concentration from 0.5 nM to 100 nM. A single mismatched target ss-DNA could be effectively discriminated from complementary target DNA. Genotyping of a G/C single-nucleotide polymorphism of polymerase chain reaction (PCR) products was successfully demonstrated with the sensing system. Therefore, integrating HCR strategy with non-covalent labeling of fluorescent hairpin DNA probes provides a sensitive and cost-effective DNA assay. © The Author(s) 2016.

  6. A regenerative electrochemical biosensor for mercury(II) by using the insertion approach and dual-hairpin-based amplification

    International Nuclear Information System (INIS)

    Jia, Jing; Ling, Yu; Gao, Zhong Feng; Lei, Jing Lei; Luo, Hong Qun; Li, Nian Bing

    2015-01-01

    Highlights: • The dual-hairpin structure as a signal amplifier is label-free and handy. • The strategy uses the insertion approach to improve the hybridization efficiency. • This biosensor has a low detection limit (28 pM) for detection of Hg 2+ . • This biosensor can be easily regenerated by using L-cysteine. - Abstract: A simple and effective biosensor for Hg 2+ determination was investigated. The novel biosensor was prepared by the insertion approach that the moiety-labeled DNA inserted into a loosely packed cyclic-dithiothreitol (DTT) monolayer, improving the hybridization efficiency. Electrochemical impedance spectroscopy studies of two biosensors (single-hairpin and dual-hairpin structure DNA modified electrodes) used for Hg 2+ detection indicated that the dual-hairpin modified electrode had a larger electron transfer resistance change (ΔR ct ). Consequently, the dual-hairpin structure was used as a signal amplifier for the preparation of a selective Hg 2+ biosensor. This biosensor exhibited an excellent selectivity toward Hg 2+ over Cd 2+ , Pd 2+ , Co 2+ etc. Also, a linear relation was observed between the ΔR ct and Hg 2+ concentrations in a range from 0.1 nM to 5 μM with a detection limit of 28 pM under optimum conditions. Moreover, the biosensor can be reused by using L-cysteine and successfully applied for detecting Hg 2+ in real samples

  7. SH2B1 regulation of energy balance, body weight, and glucose metabolism

    OpenAIRE

    Rui, Liangyou

    2014-01-01

    The Src homology 2B (SH2B) family members (SH2B1, SH2B2 and SH2B3) are adaptor signaling proteins containing characteristic SH2 and PH domains. SH2B1 (also called SH2-B and PSM) and SH2B2 (also called APS) are able to form homo- or hetero-dimers via their N-terminal dimerization domains. Their C-terminal SH2 domains bind to tyrosyl phosphorylated proteins, including Janus kinase 2 (JAK2), TrkA, insulin receptors, insulin-like growth factor-1 receptors, insulin receptor substrate-1 (IRS1), and...

  8. Identification of a key structural element for protein folding within beta-hairpin turns.

    Science.gov (United States)

    Kim, Jaewon; Brych, Stephen R; Lee, Jihun; Logan, Timothy M; Blaber, Michael

    2003-05-09

    Specific residues in a polypeptide may be key contributors to the stability and foldability of the unique native structure. Identification and prediction of such residues is, therefore, an important area of investigation in solving the protein folding problem. Atypical main-chain conformations can help identify strains within a folded protein, and by inference, positions where unique amino acids may have a naturally high frequency of occurrence due to favorable contributions to stability and folding. Non-Gly residues located near the left-handed alpha-helical region (L-alpha) of the Ramachandran plot are a potential indicator of structural strain. Although many investigators have studied mutations at such positions, no consistent energetic or kinetic contributions to stability or folding have been elucidated. Here we report a study of the effects of Gly, Ala and Asn substitutions found within the L-alpha region at a characteristic position in defined beta-hairpin turns within human acidic fibroblast growth factor, and demonstrate consistent effects upon stability and folding kinetics. The thermodynamic and kinetic data are compared to available data for similar mutations in other proteins, with excellent agreement. The results have identified that Gly at the i+3 position within a subset of beta-hairpin turns is a key contributor towards increasing the rate of folding to the native state of the polypeptide while leaving the rate of unfolding largely unchanged.

  9. β-Hairpin of Islet Amyloid Polypeptide Bound to an Aggregation Inhibitor

    Science.gov (United States)

    Mirecka, Ewa A.; Feuerstein, Sophie; Gremer, Lothar; Schröder, Gunnar F.; Stoldt, Matthias; Willbold, Dieter; Hoyer, Wolfgang

    2016-01-01

    In type 2 diabetes, the formation of islet amyloid consisting of islet amyloid polypeptide (IAPP) is associated with reduction in β-cell mass and contributes to the failure of islet cell transplantation. Rational design of inhibitors of IAPP amyloid formation has therapeutic potential, but is hampered by the lack of structural information on inhibitor complexes of the conformationally flexible, aggregation-prone IAPP. Here we characterize a β-hairpin conformation of IAPP in complex with the engineered binding protein β-wrapin HI18. The β-strands correspond to two amyloidogenic motifs, 12-LANFLVH-18 and 22-NFGAILS-28, which are connected by a turn established around Ser-20. Besides backbone hydrogen bonding, the IAPP:HI18 interaction surface is dominated by non-polar contacts involving hydrophobic side chains of the IAPP β-strands. Apart from monomers, HI18 binds oligomers and fibrils and inhibits IAPP aggregation and toxicity at low substoichiometric concentrations. The IAPP β-hairpin can serve as a molecular recognition motif enabling control of IAPP aggregation. PMID:27641459

  10. Purification, crystallization and preliminary crystallographic analysis of the SH2 domain of IL-2-inducible T-cell kinase

    International Nuclear Information System (INIS)

    Joseph, Raji E.; Ginder, Nathaniel D.; Hoy, Julie A.; Nix, Jay C.; Honzatko, Richard B.; Andreotti, Amy H.

    2011-01-01

    Crystallization conditions are described for the cis- and trans-imide bond-containing SH2 domain of IL-2-inducible T-cell kinase. Proline is a unique amino acid owing to the relatively small energy difference between the cis and trans conformations of its peptide bond. The X–Pro imide bond readily undergoes cis–trans isomerization in the context of short peptides as well as some proteins. However, the direct detection of cis–trans proline isomerization in folded proteins is technically challenging. NMR spectroscopy is well suited to the direct detection of proline isomerization in folded proteins. It is less clear how well X-ray crystallography can reveal this conformational exchange event in folded proteins. Conformational heterogeneity owing to cis–trans proline isomerization in the Src homology 2 (SH2) domain of the IL-2-inducible T-cell kinase (ITK) has been extensively characterized by NMR. Using the ITK SH2 domain as a test system, an attempt was made to determine whether proline isomerization could be detected in a crystal structure of the ITK SH2 domain. As a first step towards this goal, the purification, crystallization and preliminary characterization of the ITK SH2 domain are described

  11. Structural and dynamic characterization of the upper part of the HIV-1 cTAR DNA hairpin

    OpenAIRE

    Zargarian, Loussin?; Kanevsky, Igor; Bazzi, Ali; Boynard, Jonathan; Chaminade, Fran?oise; Foss?, Philippe; Mauffret, Olivier

    2009-01-01

    First strand transfer is essential for HIV-1 reverse transcription. During this step, the TAR RNA hairpin anneals to the cTAR DNA hairpin; this annealing reaction is promoted by the nucleocapsid protein and involves an initial loop?loop interaction between the apical loops of TAR and cTAR. Using NMR and probing methods, we investigated the structural and dynamic properties of the top half of the cTAR DNA (mini-cTAR). We show that the upper stem located between the apical and the internal loop...

  12. Expression and Production of SH2 Domain Proteins.

    Science.gov (United States)

    Liu, Bernard A; Ogiue-Ikeda, Mari; Machida, Kazuya

    2017-01-01

    The Src Homology 2 (SH2) domain lies at the heart of phosphotyrosine signaling, coordinating signaling events downstream of receptor tyrosine kinases (RTKs), adaptors, and scaffolds. Over a hundred SH2 domains are present in mammals, each having a unique specificity which determines its interactions with multiple binding partners. One of the essential tools necessary for studying and determining the role of SH2 domains in phosphotyrosine signaling is a set of soluble recombinant SH2 proteins. Here we describe methods, based on a broad experience with purification of all SH2 domains, for the production of SH2 domain proteins needed for proteomic and biochemical-based studies such as peptide arrays, mass-spectrometry, protein microarrays, reverse-phase microarrays, and high-throughput fluorescence polarization (HTP-FP). We describe stepwise protocols for expression and purification of SH2 domains using GST or poly His-tags, two widely adopted affinity tags. In addition, we address alternative approaches, challenges, and validation studies for assessing protein quality and provide general characteristics of purified human SH2 domains.

  13. SH2 dependent autophosphorylation within the Tec family kinase Itk

    Science.gov (United States)

    Joseph, Raji E.; Severin, Andrew; Min, Lie; Fulton, D. Bruce; Andreotti, Amy H.

    2009-01-01

    The Tec family kinase, Itk, undergoes an in cis autophosphorylation on Y180 within its SH3 domain. Autophosphorylation of the Itk SH3 domain by the Itk kinase domain is strictly dependent on the presence of the intervening SH2 domain. A direct docking interaction between the Itk kinase and SH2 domains brings the Itk SH3 domain into the active site where Y180 is then phosphorylated. We now identify the residues on the surface of the Itk SH2 domain responsible for substrate docking and show that this SH2 surface mediates autophosphorylation in the full length Itk molecule. The canonical phospholigand binding site on the SH2 domain is not involved in substrate docking, instead the docking site consists of side chains from three loop regions (AB, EF and BG) and part of the βD strand. These results are extended into Btk, a Tec family kinase linked to the B cell deficiency X-linked agammaglobulinemia (XLA). Our results suggest that some XLA causing mutations might impair Btk phosphorylation. PMID:19523959

  14. Designing a dataflow processor using CλaSH

    NARCIS (Netherlands)

    Niedermeier, A.; Wester, Rinse; Wester, Rinse; Rovers, K.C.; Baaij, C.P.R.; Kuper, Jan; Smit, Gerardus Johannes Maria

    2010-01-01

    In this paper we show how a simple dataflow processor can be fully implemented using CλaSH, a high level HDL based on the functional programming language Haskell. The processor was described using Haskell, the CλaSH compiler was then used to translate the design into a fully synthesisable VHDL code.

  15. SH2-dependent autophosphorylation within the Tec family kinase Itk.

    Science.gov (United States)

    Joseph, Raji E; Severin, Andrew; Min, Lie; Fulton, D Bruce; Andreotti, Amy H

    2009-08-07

    The Tec family kinase, Itk (interleukin-2 tyrosine kinase), undergoes an in cis autophosphorylation on Y180 within its Src homology 3 (SH3) domain. Autophosphorylation of the Itk SH3 domain by the Itk kinase domain is strictly dependent on the presence of the intervening Src homology 2 (SH2) domain. A direct docking interaction between the Itk kinase and SH2 domains brings the Itk SH3 domain into the active site where Y180 is then phosphorylated. We now identify the residues on the surface of the Itk SH2 domain responsible for substrate docking and show that this SH2 surface mediates autophosphorylation in the full-length Itk molecule. The canonical phospholigand binding site on the SH2 domain is not involved in substrate docking, instead the docking site consists of side chains from three loop regions (AB, EF and BG) and part of the betaD strand. These results are extended into Btk (Bruton's tyrosine kinase), a Tec family kinase linked to the B-cell deficiency X-linked agammaglobulinemia (XLA). Our results suggest that some XLA-causing mutations might impair Btk phosphorylation.

  16. Experimental loop for SH2 (LECS)

    International Nuclear Information System (INIS)

    Strehar, N.R.; Bruzzoni, Pablo; Moras, J.J.; Cogozzo, E.O.

    1981-01-01

    An experimental loop is described for circulation of SH 2 that operates at 2 x 10 6 Pascal and 33 deg C. It was designed and constructed with the purpose of experimentally studying the hydraulic instability phenomenon that can be detected in cold isotopic exchange columns in the Girdler-Sulfide (GS) process of heavy water production. The main features of the different components of the loop are described, as well as the materials, the measurement and control instruments and the auxiliary equipment used, and finally the measuring methods to qualify and quantify the formation of froth. Furthermore, the loop's transportable metallic container is described, which allows to transport and connect it to CNEA's experimental heavy water plant or to any other heavy water plants using the GS method. Some tests made with inert gases that intended to verify the equipment's performance and to select the most adequate sieve trays for its operation are discussed. (M.E.L.) [es

  17. Critical Role of the Src Homology 2 (SH2) Domain of Neuronal SH2B1 in the Regulation of Body Weight and Glucose Homeostasis in Mice

    OpenAIRE

    Morris, David L.; Cho, Kae Won; Rui, Liangyou

    2010-01-01

    SH2B1 is an SH2 domain-containing adaptor protein that plays a key role in the regulation of energy and glucose metabolism in both rodents and humans. Genetic deletion of SH2B1 in mice results in obesity and type 2 diabetes. Single-nucleotide polymorphisms in the SH2B1 loci and chromosomal deletions of the SH2B1 loci associate with obesity and insulin resistance in humans. In cultured cells, SH2B1 promotes leptin and insulin signaling by binding via its SH2 domain to phosphorylated tyrosines ...

  18. SH2B Regulation of Growth, Metabolism, and Longevity in Both Insects and Mammals

    OpenAIRE

    Song, Wei; Ren, Decheng; Li, Wenjun; Jiang, Lin; Cho, Kae Won; Huang, Ping; Fan, Chen; Song, Yiyun; Liu, Yong; Rui, Liangyou

    2010-01-01

    SH2B1 is a key regulator of body weight in mammals. Here we identified dSH2B as the Drosophila homolog of SH2B1. dSH2B bound to Chico and directly promoted insulin-like signaling. Disruption of dSH2B decreased insulin-like signaling and somatic growth in flies. dSH2B deficiency also increased hemolymph carbohydrate levels, whole body lipid levels, lifespan, and resistance to starvation and oxidative stress. Systemic overexpression of dSH2B resulted in opposite phenotypes. dSH2B overexpression...

  19. Melting of a beta-Hairpin Peptide Using Isotope-Edited 2D IR Spectroscopy and Simulations

    NARCIS (Netherlands)

    Smith, Adam W.; Lessing, Joshua; Ganim, Ziad; Peng, Chunte Sam; Tokmakoff, Andrei; Roy, Santanu; Jansen, Thomas L. C.; Knoester, Jasper

    2010-01-01

    Isotope-edited two-dimensional infrared spectroscopy has been used! to characterize the conformational heterogeneity of the beta-hairpin peptide TrpZip2 (17.2) across its thermal unfolding transition Four isotopologues were synthesized to probe hydrogen bonding and solvent exposure of the beta-turn

  20. Melting of a beta-hairpin peptide using isotope-edited 2D IR spectroscopy and simulations.

    NARCIS (Netherlands)

    Smith, A.W.; Lessing, J.; Ganim, Z.; Peng, C.S.; Tokmakoff, A.; Roy, S.; Jansen, T.L.Th.A.; Knoester, J.

    2010-01-01

    Isotope-edited two-dimensional infrared spectroscopy has been used to characterize the conformational heterogeneity of the beta-hairpin peptide TrpZip2 (TZ2) across its thermal unfolding transition. Four isotopologues were synthesized to probe hydrogen bonding and solvent exposure of the beta-turn

  1. One-step isothermal detection of multiple KRAS mutations by forming SNP specific hairpins on a gold nanoshell.

    Science.gov (United States)

    Chung, Chan Ho; Kim, Joong Hyun

    2018-04-24

    We developed a one-step isothermal method for typing multiple KRAS mutations using a designed set of primers to form a hairpin on a gold nanoshell upon being ligated by a SNP specific DNA ligase after binding of targets. As a result, we could detect as low as 20 attomoles of KRAS mutations within 1 h.

  2. Detection of DNA damage by using hairpin molecular beacon probes and graphene oxide.

    Science.gov (United States)

    Zhou, Jie; Lu, Qian; Tong, Ying; Wei, Wei; Liu, Songqin

    2012-09-15

    A hairpin molecular beacon tagged with carboxyfluorescein in combination with graphene oxide as a quencher reagent was used to detect the DNA damage by chemical reagents. The fluorescence of molecular beacon was quenched sharply by graphene oxide; while in the presence of its complementary DNA the quenching efficiency decreased because their hybridization prevented the strong adsorbability of molecular beacon on graphene oxide. If the complementary DNA was damaged by a chemical reagent and could not form intact duplex structure with molecular beacon, more molecular beacon would adsorb on graphene oxide increasing the quenching efficiency. Thus, damaged DNA could be detected based on different quenching efficiencies afforded by damaged and intact complementary DNA. The damage effects of chlorpyrifos-methyl and three metabolites of styrene such as mandelieaeids, phenylglyoxylieaeids and epoxystyrene on DNA were studied as models. The method for detection of DNA damage was reliable, rapid and simple compared to the biological methods. Copyright © 2012 Elsevier B.V. All rights reserved.

  3. Pressure modulates the self-cleavage step of the hairpin ribozyme

    Science.gov (United States)

    Schuabb, Caroline; Kumar, Narendra; Pataraia, Salome; Marx, Dominik; Winter, Roland

    2017-03-01

    The ability of certain RNAs, denoted as ribozymes, to not only store genetic information but also catalyse chemical reactions gave support to the RNA world hypothesis as a putative step in the development of early life on Earth. This, however, might have evolved under extreme environmental conditions, including the deep sea with pressures in the kbar regime. Here we study pressure-induced effects on the self-cleavage of hairpin ribozyme by following structural changes in real-time. Our results suggest that compression of the ribozyme leads to an accelerated transesterification reaction, being the self-cleavage step, although the overall process is retarded in the high-pressure regime. The results reveal that favourable interactions between the reaction site and neighbouring nucleobases are strengthened under pressure, resulting therefore in an accelerated self-cleavage step upon compression. These results suggest that properly engineered ribozymes may also act as piezophilic biocatalysts in addition to their hitherto known properties.

  4. Synthetic, structural mimetics of the β-hairpin flap of HIV-1 protease inhibit enzyme function.

    Science.gov (United States)

    Chauhan, Jay; Chen, Shen-En; Fenstermacher, Katherine J; Naser-Tavakolian, Aurash; Reingewertz, Tali; Salmo, Rosene; Lee, Christian; Williams, Emori; Raje, Mithun; Sundberg, Eric; DeStefano, Jeffrey J; Freire, Ernesto; Fletcher, Steven

    2015-11-01

    Small-molecule mimetics of the β-hairpin flap of HIV-1 protease (HIV-1 PR) were designed based on a 1,4-benzodiazepine scaffold as a strategy to interfere with the flap-flap protein-protein interaction, which functions as a gated mechanism to control access to the active site. Michaelis-Menten kinetics suggested our small-molecules are competitive inhibitors, which indicates the mode of inhibition is through binding the active site or sterically blocking access to the active site and preventing flap closure, as designed. More generally, a new bioactive scaffold for HIV-1PR inhibition has been discovered, with the most potent compound inhibiting the protease with a modest K(i) of 11 μM. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Progress towards the development of SH2 domain inhibitors.

    Science.gov (United States)

    Kraskouskaya, Dziyana; Duodu, Eugenia; Arpin, Carolynn C; Gunning, Patrick T

    2013-04-21

    Src homology 2 (SH2) domains are 100 amino acid modular units, which recognize and bind to tyrosyl-phosphorylated peptide sequences on their target proteins, and thereby mediate intracellular protein-protein interactions. This review summarizes the progress towards the development of synthetic agents that disrupt the function of the SH2 domains in different proteins as well as the clinical relevance of targeting a specific SH2 domain. Since 1986, SH2 domains have been identified in over 110 human proteins, including kinases, transcription factors, and adaptor proteins. A number of these proteins are over-activated in many diseases, including cancer, and their function is highly dependent on their SH2 domain. Thus, inhibition of a protein's function through disrupting that of its SH2 domain has emerged as a promising approach towards the development of novel therapeutic modalities. Although targeting the SH2 domain is a challenging task in molecular recognition, the progress reported here demonstrates the feasibility of such an approach.

  6. Combinatorial pattern discovery approach for the folding trajectory analysis of a beta-hairpin.

    Directory of Open Access Journals (Sweden)

    Laxmi Parida

    2005-06-01

    Full Text Available The study of protein folding mechanisms continues to be one of the most challenging problems in computational biology. Currently, the protein folding mechanism is often characterized by calculating the free energy landscape versus various reaction coordinates, such as the fraction of native contacts, the radius of gyration, RMSD from the native structure, and so on. In this paper, we present a combinatorial pattern discovery approach toward understanding the global state changes during the folding process. This is a first step toward an unsupervised (and perhaps eventually automated approach toward identification of global states. The approach is based on computing biclusters (or patterned clusters-each cluster is a combination of various reaction coordinates, and its signature pattern facilitates the computation of the Z-score for the cluster. For this discovery process, we present an algorithm of time complexity c in RO((N + nm log n, where N is the size of the output patterns and (n x m is the size of the input with n time frames and m reaction coordinates. To date, this is the best time complexity for this problem. We next apply this to a beta-hairpin folding trajectory and demonstrate that this approach extracts crucial information about protein folding intermediate states and mechanism. We make three observations about the approach: (1 The method recovers states previously obtained by visually analyzing free energy surfaces. (2 It also succeeds in extracting meaningful patterns and structures that had been overlooked in previous works, which provides a better understanding of the folding mechanism of the beta-hairpin. These new patterns also interconnect various states in existing free energy surfaces versus different reaction coordinates. (3 The approach does not require calculating the free energy values, yet it offers an analysis comparable to, and sometimes better than, the methods that use free energy landscapes, thus validating the

  7. Combinatorial Pattern Discovery Approach for the Folding Trajectory Analysis of a beta-Hairpin.

    Directory of Open Access Journals (Sweden)

    2005-06-01

    Full Text Available The study of protein folding mechanisms continues to be one of the most challenging problems in computational biology. Currently, the protein folding mechanism is often characterized by calculating the free energy landscape versus various reaction coordinates, such as the fraction of native contacts, the radius of gyration, RMSD from the native structure, and so on. In this paper, we present a combinatorial pattern discovery approach toward understanding the global state changes during the folding process. This is a first step toward an unsupervised (and perhaps eventually automated approach toward identification of global states. The approach is based on computing biclusters (or patterned clusters-each cluster is a combination of various reaction coordinates, and its signature pattern facilitates the computation of the Z-score for the cluster. For this discovery process, we present an algorithm of time complexity cinRO((N + nm log n, where N is the size of the output patterns and (n x m is the size of the input with n time frames and m reaction coordinates. To date, this is the best time complexity for this problem. We next apply this to a beta-hairpin folding trajectory and demonstrate that this approach extracts crucial information about protein folding intermediate states and mechanism. We make three observations about the approach: (1 The method recovers states previously obtained by visually analyzing free energy surfaces. (2 It also succeeds in extracting meaningful patterns and structures that had been overlooked in previous works, which provides a better understanding of the folding mechanism of the beta-hairpin. These new patterns also interconnect various states in existing free energy surfaces versus different reaction coordinates. (3 The approach does not require calculating the free energy values, yet it offers an analysis comparable to, and sometimes better than, the methods that use free energy landscapes, thus validating the

  8. Water isotope effect on the thermostability of a polio viral RNA hairpin: A metadynamics study

    Science.gov (United States)

    Pathak, Arup K.; Bandyopadhyay, Tusar

    2017-04-01

    Oral polio vaccine is considered to be the most thermolabile of all the common childhood vaccines. Despite heavy water (D2O) having been known for a long time to stabilise attenuated viral RNA against thermodegradation, the molecular underpinnings of its mechanism of action are still lacking. Whereas, understanding the basis of D2O action is an important step that might reform the way other thermolabile drugs are stored and could possibly minimize the cold chain problem. Here using a combination of parallel tempering and well-tempered metadynamics simulation in light water (H2O) and in D2O, we have fully described the free energy surface associated with the folding/unfolding of a RNA hairpin containing a non-canonical basepair motif, which is conserved within the 3'-untranslated region of poliovirus-like enteroviruses. Simulations reveal that in heavy water (D2O) there is a considerable increase of the stability of the folded basin as monitored through an intramolecular hydrogen bond (HB), size, shape, and flexibility of RNA structures. This translates into a higher melting temperature in D2O by 41 K when compared with light water (H2O). We have explored the hydration dynamics of the RNA, hydration shell around the RNA surface, and spatial dependence of RNA-solvent collective HB dynamics in the two water systems. Simulation in heavy water clearly showed that D2O strengthens the HB network in the solvent, lengthens inter-residue water-bridge lifetime, and weakens dynamical coupling of the hairpin to its solvation environment, which enhances the rigidity of solvent exposed sites of the native configurations. The results might suggest that like other added osmoprotectants, D2O can act as a thermostabilizer when used as a solvent.

  9. In vivo targeting of ADAM9 gene expression using lentivirus-delivered shRNA suppresses prostate cancer growth by regulating REG4 dependent cell cycle progression.

    Directory of Open Access Journals (Sweden)

    Che-Ming Liu

    Full Text Available Cancer cells respond to stress by activating a variety of survival signaling pathways. A disintegrin and metalloproteinase (ADAM 9 is upregulated during cancer progression and hormone therapy, functioning in part through an increase in reactive oxygen species. Here, we present in vitro and in vivo evidence that therapeutic targeting of ADAM9 gene expression by lentivirus-delivered small hairpin RNA (shRNA significantly inhibited proliferation of human prostate cancer cell lines and blocked tumor growth in a murine model of prostate cancer bone metastasis. Cell cycle studies confirmed an increase in the G1-phase and decrease in the S-phase population of cancer cells under starvation stress conditions, which correlated with elevated intracellular superoxide levels. Microarray data showed significantly decreased levels of regenerating islet-derived family member 4 (REG4 expression in prostate cancer cells with knockdown of ADAM9 gene expression. This REG4 downregulation also resulted in induction of expression of p21(Cip1/WAF1, which negatively regulates cyclin D1 and blocks the G1/S transition. Our data reveal a novel molecular mechanism of ADAM9 in the regulation of prostate cancer cell proliferation, and suggests a combined modality of ADAM9 shRNA gene therapy and cytotoxic agents for hormone refractory and bone metastatic prostate cancer.

  10. Turn stability in beta-hairpin peptides: Investigation of peptides containing 3:5 type I G1 bulge turns.

    Science.gov (United States)

    Blandl, Tamas; Cochran, Andrea G; Skelton, Nicholas J

    2003-02-01

    The turn-forming ability of a series of three-residue sequences was investigated by substituting them into a well-characterized beta-hairpin peptide. The starting scaffold, bhpW, is a disulfide-cyclized 10-residue peptide that folds into a stable beta-hairpin with two antiparallel strands connected by a two-residue reverse turn. Substitution of the central two residues with the three-residue test sequences leads to less stable hairpins, as judged by thiol-disulfide equilibrium measurements. However, analysis of NMR parameters indicated that each molecule retains a significant folded population, and that the type of turn adopted by the three-residue sequence is the same in all cases. The solution structure of a selected peptide with a PDG turn contained an antiparallel beta-hairpin with a 3:5 type I + G1 bulge turn. Analysis of the energetic contributions of individual turn residues in the series of peptides indicates that substitution effects have significant context dependence, limiting the predictive power of individual amino acid propensities for turn formation. The most stable and least stable sequences were also substituted into a more stable disulfide-cyclized scaffold and a linear beta-hairpin scaffold. The relative stabilities remained the same, suggesting that experimental measurements in the bhpW context are a useful way to evaluate turn stability for use in protein design projects. Moreover, these scaffolds are capable of displaying a diverse set of turns, which can be exploited for the mimicry of protein loops or for generating libraries of reverse turns.

  11. A regenerative electrochemical biosensor for mercury(II) by using the insertion approach and dual-hairpin-based amplification

    Energy Technology Data Exchange (ETDEWEB)

    Jia, Jing; Ling, Yu; Gao, Zhong Feng [Key Laboratory of Eco-Environments in Three Gorges Reservoir Region (Ministry of Education), School of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715 (China); Lei, Jing Lei [College of Chemistry and Chemical Engineering, Chongqing University, Chongqing 400044 (China); Luo, Hong Qun, E-mail: luohq@swu.edu.cn [Key Laboratory of Eco-Environments in Three Gorges Reservoir Region (Ministry of Education), School of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715 (China); Li, Nian Bing, E-mail: linb@swu.edu.cn [Key Laboratory of Eco-Environments in Three Gorges Reservoir Region (Ministry of Education), School of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715 (China)

    2015-09-15

    Highlights: • The dual-hairpin structure as a signal amplifier is label-free and handy. • The strategy uses the insertion approach to improve the hybridization efficiency. • This biosensor has a low detection limit (28 pM) for detection of Hg{sup 2+}. • This biosensor can be easily regenerated by using L-cysteine. - Abstract: A simple and effective biosensor for Hg{sup 2+} determination was investigated. The novel biosensor was prepared by the insertion approach that the moiety-labeled DNA inserted into a loosely packed cyclic-dithiothreitol (DTT) monolayer, improving the hybridization efficiency. Electrochemical impedance spectroscopy studies of two biosensors (single-hairpin and dual-hairpin structure DNA modified electrodes) used for Hg{sup 2+} detection indicated that the dual-hairpin modified electrode had a larger electron transfer resistance change (ΔR{sub ct}). Consequently, the dual-hairpin structure was used as a signal amplifier for the preparation of a selective Hg{sup 2+} biosensor. This biosensor exhibited an excellent selectivity toward Hg{sup 2+} over Cd{sup 2+}, Pd{sup 2+}, Co{sup 2+} etc. Also, a linear relation was observed between the ΔR{sub ct} and Hg{sup 2+} concentrations in a range from 0.1 nM to 5 μM with a detection limit of 28 pM under optimum conditions. Moreover, the biosensor can be reused by using L-cysteine and successfully applied for detecting Hg{sup 2+} in real samples.

  12. A unique set of SH3-SH3 interactions controls IB1 homodimerization

    DEFF Research Database (Denmark)

    Kristensen, Ole; Guenat, Sylvie; Dar, Imran

    2006-01-01

    Islet-brain 1 (IB1 or JIP-1) is a scaffold protein that interacts with components of the c-Jun N-terminal kinase (JNK) signal-transduction pathway. IB1 is expressed at high levels in neurons and in pancreatic beta-cells, where it controls expression of several insulin-secretory components...... reduces IB1-dependent basal JNK activity in 293T cells. Impaired dimerization also results in a reduction in glucose transporter type 2 expression and in glucose-dependent insulin secretion in pancreatic beta-cells. Taken together, these results indicate that IB1 homodimerization through its SH3 domain...

  13. Organizational structures and communications on the SH 130 project.

    Science.gov (United States)

    2006-03-01

    This product summarizes the findings from research analyzing SH 130 organizational structures and communication flows. A set of guidelines pertaining to team organization and communication improvement and the design-build environment is also included...

  14. Interproximal grooving in the Atapuerca-SH hominid dentitions.

    Science.gov (United States)

    Bermúdez de Castro, J M; Arsuaga, J L; Pérez, P J

    1997-03-01

    The dental sample recovered from the Sima de los Huesos (SH) Middle Pleistocene cave site of the Sierra de Atapuerca (Spain) includes 296 specimens. Interproximal wear grooves have been observed in 20 maxillary and mandibular posterior teeth belonging to at least five of the 32 individuals identified so far in the SH hypodigm. Interproximal grooving affected only the adults, and at an age between 25 and 40 years. The appearance, morphology, and location pattern of the SH wear grooves are similar to those reported in other fossil hominids and in more recent human populations. Two alternative proposals, the toothpicking and the fiber or sinew processing hypotheses, compete for explaining the formation of this anomalous wear. The characteristics observed in the wear grooves of the SH teeth are compatible only with the habitual probing of interdental spaces by means of hard and inflexible objects. Dietary grit may also have contributed to the abrasion of the root walls during the motion of the dental probes.

  15. Subclinical hyperthyroidism (Sh) in atomic-bomb survivors in Japan

    International Nuclear Information System (INIS)

    Ashizawa, K.; Imaizumi, M.; Usa, T.; Tominaga, T.; Hida, A.; Ejima, E.; Neriishi, K.; Soda, M.; Fujiwara, S.; Maeda, R.; Akahoshi, M.; Nagataki, S.; Eguchi, K.

    2005-01-01

    Full text: Purpose/Background Subclinical hyperthyroidism (Sh) is defined as a biochemical abnormality characterized by a subnormal level of TSH with otherwise normal thyroid tests (F T 3 , F T 4 ) and no clinical symptoms. There are only a small number of cross-sectional studies on the prevalence of Sh. With the improvement of the sensitivity of TSH assay, it has become possible to survey the clinical significance of Sh. With regard to both Sh and subclinical hypothyroidism, discussions are being focused on such as the necessity of treatment. In order to elucidate the clinical significance of Sh, examination data of A-bomb survivors in Hiroshima and Nagasaki were analyzed. Subjects and Method Between 2000 and 2003, of 4,090 A-bomb survivors (1,352 males and 2,738 females with average age of 70.7), 75 individuals (1.83%) with Sh were found who had normal Free T 4 (0.71∼1.51 ng/dL) and TSH<0.45 m U/L. Analysis was limited to those who had not taken antithyroid drugs or thyroxin, and the Sh group (n=35; 9 males and 26 females) was compared with a control group with TSH:0.45∼4.5 m U/L (Group C; N=3,243; 1,109 males and 2,134 females). Result: Nine individuals had TSH<0.1 m U/L. In the Sh group, six individuals were TPO antibody-positive (17%) and 14 were TG antibody-positive (40%); hence, TG antibody-positive was significantly greater in number (p=0.0096). Hematological biochemical tests showed no significant difference between the two groups. Electrocardiograms indicated that more individuals had atrial fibrillation [p=0.028; Odds ratio (OR)=3.98; 95% Confidential interval (CI)=1.2-13.7] or ventricular premature contraction [p=0.016; OR=3.29; 95% CI=1.3-8.6] in the Sh group. In terms of the presence or absence of diabetes, dyslipidemia, hypertension, and hyperuricemia, there was no difference between the two groups. One individual from the Sh group was confirmed to have Graves' disease two years later. Conclusion: Since more individuals in the Sh group were

  16. Subclinical hyperthyroidism (Sh) in atomic-bomb survivors in Japan

    Energy Technology Data Exchange (ETDEWEB)

    Ashizawa, K; Imaizumi, M; Usa, T; Tominaga, T; Hida, A; Ejima, E; Neriishi, K; Soda, M; Fujiwara, S; Maeda, R; Akahoshi, M; Nagataki, S; Eguchi, K [Radiation Effects Research Foundation, Nagasaki (Japan). Nagasaki Branch

    2005-07-01

    Full text: Purpose/Background Subclinical hyperthyroidism (Sh) is defined as a biochemical abnormality characterized by a subnormal level of TSH with otherwise normal thyroid tests (F T{sub 3}, F T{sub 4}) and no clinical symptoms. There are only a small number of cross-sectional studies on the prevalence of Sh. With the improvement of the sensitivity of TSH assay, it has become possible to survey the clinical significance of Sh. With regard to both Sh and subclinical hypothyroidism, discussions are being focused on such as the necessity of treatment. In order to elucidate the clinical significance of Sh, examination data of A-bomb survivors in Hiroshima and Nagasaki were analyzed. Subjects and Method Between 2000 and 2003, of 4,090 A-bomb survivors (1,352 males and 2,738 females with average age of 70.7), 75 individuals (1.83%) with Sh were found who had normal Free T{sub 4} (0.71{approx}1.51 ng/dL) and TSH<0.45 m U/L. Analysis was limited to those who had not taken antithyroid drugs or thyroxin, and the Sh group (n=35; 9 males and 26 females) was compared with a control group with TSH:0.45{approx}4.5 m U/L (Group C; N=3,243; 1,109 males and 2,134 females). Result: Nine individuals had TSH<0.1 m U/L. In the Sh group, six individuals were TPO antibody-positive (17%) and 14 were TG antibody-positive (40%); hence, TG antibody-positive was significantly greater in number (p=0.0096). Hematological biochemical tests showed no significant difference between the two groups. Electrocardiograms indicated that more individuals had atrial fibrillation [p=0.028; Odds ratio (OR)=3.98; 95% Confidential interval (CI)=1.2-13.7] or ventricular premature contraction [p=0.016; OR=3.29; 95% CI=1.3-8.6] in the Sh group. In terms of the presence or absence of diabetes, dyslipidemia, hypertension, and hyperuricemia, there was no difference between the two groups. One individual from the Sh group was confirmed to have Graves' disease two years later. Conclusion: Since more individuals in

  17. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  18. Evolution of SH2 domains and phosphotyrosine signalling networks

    Science.gov (United States)

    Liu, Bernard A.; Nash, Piers D.

    2012-01-01

    Src homology 2 (SH2) domains mediate selective protein–protein interactions with tyrosine phosphorylated proteins, and in doing so define specificity of phosphotyrosine (pTyr) signalling networks. SH2 domains and protein-tyrosine phosphatases expand alongside protein-tyrosine kinases (PTKs) to coordinate cellular and organismal complexity in the evolution of the unikont branch of the eukaryotes. Examination of conserved families of PTKs and SH2 domain proteins provides fiduciary marks that trace the evolutionary landscape for the development of complex cellular systems in the proto-metazoan and metazoan lineages. The evolutionary provenance of conserved SH2 and PTK families reveals the mechanisms by which diversity is achieved through adaptations in tissue-specific gene transcription, altered ligand binding, insertions of linear motifs and the gain or loss of domains following gene duplication. We discuss mechanisms by which pTyr-mediated signalling networks evolve through the development of novel and expanded families of SH2 domain proteins and the elaboration of connections between pTyr-signalling proteins. These changes underlie the variety of general and specific signalling networks that give rise to tissue-specific functions and increasingly complex developmental programmes. Examination of SH2 domains from an evolutionary perspective provides insight into the process by which evolutionary expansion and modification of molecular protein interaction domain proteins permits the development of novel protein-interaction networks and accommodates adaptation of signalling networks. PMID:22889907

  19. Purification, crystallization and preliminary crystallographic analysis of the SH2 domain of IL-2-inducible T-cell kinase.

    Science.gov (United States)

    Joseph, Raji E; Ginder, Nathaniel D; Hoy, Julie A; Nix, Jay C; Honzatko, Richard B; Andreotti, Amy H

    2011-02-01

    Proline is a unique amino acid owing to the relatively small energy difference between the cis and trans conformations of its peptide bond. The X-Pro imide bond readily undergoes cis-trans isomerization in the context of short peptides as well as some proteins. However, the direct detection of cis-trans proline isomerization in folded proteins is technically challenging. NMR spectroscopy is well suited to the direct detection of proline isomerization in folded proteins. It is less clear how well X-ray crystallography can reveal this conformational exchange event in folded proteins. Conformational heterogeneity owing to cis-trans proline isomerization in the Src homology 2 (SH2) domain of the IL-2-inducible T-cell kinase (ITK) has been extensively characterized by NMR. Using the ITK SH2 domain as a test system, an attempt was made to determine whether proline isomerization could be detected in a crystal structure of the ITK SH2 domain. As a first step towards this goal, the purification, crystallization and preliminary characterization of the ITK SH2 domain are described.

  20. Neuronal SH2B1 is essential for controlling energy and glucose homeostasis

    OpenAIRE

    Ren, Decheng; Zhou, Yingjiang; Morris, David; Li, Minghua; Li, Zhiqin; Rui, Liangyou

    2007-01-01

    SH2B1 (previously named SH2-B), a cytoplasmic adaptor protein, binds via its Src homology 2 (SH2) domain to a variety of protein tyrosine kinases, including JAK2 and the insulin receptor. SH2B1-deficient mice are obese and diabetic. Here we demonstrated that multiple isoforms of SH2B1 (α, β, γ, and/or δ) were expressed in numerous tissues, including the brain, hypothalamus, liver, muscle, adipose tissue, heart, and pancreas. Rat SH2B1β was specifically expressed in neural tissue in SH2B1-tran...

  1. 1H and 31P resonance assignments and secondary structure of hairpin conformer of IA mismatched oligonucleotide d-GGTACIAGTACC

    International Nuclear Information System (INIS)

    Chary, K.V.R.; Rastogi, V.K.; Govil, Girjesh

    1994-01-01

    Almost complete 1 H and 31 P resonance assignments of two coexisting conformers, duplex and an hairpin, of d-GGTACIAGTACC at 1.25mM concentration and 305 K have been achieved. The results demonstrate that the hairpin conformer has a structure with two purines I6 and A7 forming a two-base loop on a B-DNA stem. Stacking is continued on the 5'-side of the loop, with the I6 stacked upon C5. The base A7, on the 3'-side of the loop stacks partially with I6. The glycosidic angle for G8 is in the anti domain and it maintains normal Watson-Crick base-pairing with the opposite C5. (author). 28 refs., 7 figs., 2 tabs

  2. Critical role of the Src homology 2 (SH2) domain of neuronal SH2B1 in the regulation of body weight and glucose homeostasis in mice.

    Science.gov (United States)

    Morris, David L; Cho, Kae Won; Rui, Liangyou

    2010-08-01

    SH2B1 is an SH2 domain-containing adaptor protein that plays a key role in the regulation of energy and glucose metabolism in both rodents and humans. Genetic deletion of SH2B1 in mice results in obesity and type 2 diabetes. Single-nucleotide polymorphisms in the SH2B1 loci and chromosomal deletions of the SH2B1 loci associate with obesity and insulin resistance in humans. In cultured cells, SH2B1 promotes leptin and insulin signaling by binding via its SH2 domain to phosphorylated tyrosines in Janus kinase 2 and the insulin receptor, respectively. Here we generated three lines of mice to analyze the role of the SH2 domain of SH2B1 in the central nervous system. Transgenic mice expressing wild-type, SH2 domain-defective (R555E), or SH2 domain-alone (DeltaN503) forms of SH2B1 specifically in neurons were crossed with SH2B1 knockout mice to generate KO/SH2B1, KO/R555E, or KO/DeltaN503 compound mutant mice. R555E had a replacement of Arg(555) with Glu within the SH2 domain. DeltaN503 contained an intact SH2 domain but lacked amino acids 1-503. Neuron-specific expression of recombinant SH2B1, but not R555E or DeltaN503, corrected hyperphagia, obesity, glucose intolerance, and insulin resistance in SH2B1 null mice. Neuron-specific expression of R555E in wild-type mice promoted obesity and insulin resistance. These results indicate that in addition to the SH2 domain, N-terminal regions of neuronal SH2B1 are also required for the maintenance of normal body weight and glucose metabolism. Additionally, mutations in the SH2 domain of SH2B1 may increase the susceptibility to obesity and type 2 diabetes in a dominant-negative manner.

  3. Superbinder SH2 domains act as antagonists of cell signaling.

    Science.gov (United States)

    Kaneko, Tomonori; Huang, Haiming; Cao, Xuan; Li, Xing; Li, Chengjun; Voss, Courtney; Sidhu, Sachdev S; Li, Shawn S C

    2012-09-25

    Protein-ligand interactions mediated by modular domains, which often play important roles in regulating cellular functions, are generally of moderate affinities. We examined the Src homology 2 (SH2) domain, a modular domain that recognizes phosphorylated tyrosine (pTyr) residues, to investigate how the binding affinity of a modular domain for its ligand influences the structure and cellular function of the protein. We used the phage display method to perform directed evolution of the pTyr-binding residues in the SH2 domain of the tyrosine kinase Fyn and identified three amino acid substitutions that critically affected binding. We generated three SH2 domain triple-point mutants that were "superbinders" with much higher affinities for pTyr-containing peptides than the natural domain. Crystallographic analysis of one of these superbinders revealed that the superbinder SH2 domain recognized the pTyr moiety in a bipartite binding mode: A hydrophobic surface encompassed the phenyl ring, and a positively charged site engaged the phosphate. When expressed in mammalian cells, the superbinder SH2 domains blocked epidermal growth factor receptor signaling and inhibited anchorage-independent cell proliferation, suggesting that pTyr superbinders might be explored for therapeutic applications and useful as biological research tools. Although the SH2 domain fold can support much higher affinity for its ligand than is observed in nature, our results suggest that natural SH2 domains are not optimized for ligand binding but for specificity and flexibility, which are likely properties important for their function in signaling and regulatory processes.

  4. Mutational analysis of an archaeal minichromosome maintenance protein exterior hairpin reveals critical residues for helicase activity and DNA binding

    Directory of Open Access Journals (Sweden)

    Brewster Aaron S

    2010-08-01

    Full Text Available Abstract Background The mini-chromosome maintenance protein (MCM complex is an essential replicative helicase for DNA replication in Archaea and Eukaryotes. While the eukaryotic complex consists of six homologous proteins (MCM2-7, the archaeon Sulfolobus solfataricus has only one MCM protein (ssoMCM, six subunits of which form a homohexamer. We have recently reported a 4.35Å crystal structure of the near full-length ssoMCM. The structure reveals a total of four β-hairpins per subunit, three of which are located within the main channel or side channels of the ssoMCM hexamer model generated based on the symmetry of the N-terminal Methanothermobacter thermautotrophicus (mtMCM structure. The fourth β-hairpin, however, is located on the exterior of the hexamer, near the exit of the putative side channels and next to the ATP binding pocket. Results In order to better understand this hairpin's role in DNA binding and helicase activity, we performed a detailed mutational and biochemical analysis of nine residues on this exterior β-hairpin (EXT-hp. We examined the activities of the mutants related to their helicase function, including hexamerization, ATPase, DNA binding and helicase activities. The assays showed that some of the residues on this EXT-hp play a role for DNA binding as well as for helicase activity. Conclusions These results implicate several current theories regarding helicase activity by this critical hexameric enzyme. As the data suggest that EXT-hp is involved in DNA binding, the results reported here imply that the EXT-hp located near the exterior exit of the side channels may play a role in contacting DNA substrate in a manner that affects DNA unwinding.

  5. Biological Applications of Designed Hairpin Peptides: As Antimicrobials and as Inhibitors of Amyloidogenesis

    Science.gov (United States)

    Sivanesam, Kalkena

    More than 40 diseases have been associated with the misfolding of peptides (or proteins) that form fibrils with a very specific morphology. These peptides classified as amyloidogenic peptides have been implicated in the development of Alzheimer's Disease, Parkinson's Disease, Type II Diabetes, Hungtinton's Disease etc. To date, these diseases have no cure, only therapies that can ameliorate the symptoms to a degree. Inhibition of the amyloidogenesis of these peptides has been proposed as a possible treatment option. While small molecules have been heavily tested as inhibitors of amyloidogenesis, peptides have emerged as potential inhibitors. In this work, the ability of a set of designed hairpin peptides to inhibit the amyloidogenesis of two different systems, alpha-synuclein (implicated in Parkinson's Disease) and human amylin (implicated in Type II Diabetes) is tested. Using circular dichroism and thioflavin T fluorescence, the ability of these peptides to inhibit amyloidogenesis is tested. The binding loci of these inhibitors to alpha-synuclein are also explored. The use of peptides as antimicrobials on the other hand is not a novel concept. However, most antimicrobial peptides, both natural and designed, rely heavily on covalent stabilizations in order to maintain secondary structure. In this study, non-covalent stabilizations are applied to a couple of natural as well as designed antimicrobials in order to study the effects of secondary structure stabilization on biological activity.

  6. Hairpin RNA Targeting Multiple Viral Genes Confers Strong Resistance to Rice Black-Streaked Dwarf Virus

    Directory of Open Access Journals (Sweden)

    Fangquan Wang

    2016-05-01

    Full Text Available Rice black-streaked dwarf virus (RBSDV belongs to the genus Fijivirus in the family of Reoviridae and causes severe yield loss in rice-producing areas in Asia. RNA silencing, as a natural defence mechanism against plant viruses, has been successfully exploited for engineering virus resistance in plants, including rice. In this study, we generated transgenic rice lines harbouring a hairpin RNA (hpRNA construct targeting four RBSDV genes, S1, S2, S6 and S10, encoding the RNA-dependent RNA polymerase, the putative core protein, the RNA silencing suppressor and the outer capsid protein, respectively. Both field nursery and artificial inoculation assays of three generations of the transgenic lines showed that they had strong resistance to RBSDV infection. The RBSDV resistance in the segregating transgenic populations correlated perfectly with the presence of the hpRNA transgene. Furthermore, the hpRNA transgene was expressed in the highly resistant transgenic lines, giving rise to abundant levels of 21–24 nt small interfering RNA (siRNA. By small RNA deep sequencing, the RBSDV-resistant transgenic lines detected siRNAs from all four viral gene sequences in the hpRNA transgene, indicating that the whole chimeric fusion sequence can be efficiently processed by Dicer into siRNAs. Taken together, our results suggest that long hpRNA targeting multiple viral genes can be used to generate stable and durable virus resistance in rice, as well as other plant species.

  7. Hairpin RNA Targeting Multiple Viral Genes Confers Strong Resistance to Rice Black-Streaked Dwarf Virus.

    Science.gov (United States)

    Wang, Fangquan; Li, Wenqi; Zhu, Jinyan; Fan, Fangjun; Wang, Jun; Zhong, Weigong; Wang, Ming-Bo; Liu, Qing; Zhu, Qian-Hao; Zhou, Tong; Lan, Ying; Zhou, Yijun; Yang, Jie

    2016-05-11

    Rice black-streaked dwarf virus (RBSDV) belongs to the genus Fijivirus in the family of Reoviridae and causes severe yield loss in rice-producing areas in Asia. RNA silencing, as a natural defence mechanism against plant viruses, has been successfully exploited for engineering virus resistance in plants, including rice. In this study, we generated transgenic rice lines harbouring a hairpin RNA (hpRNA) construct targeting four RBSDV genes, S1, S2, S6 and S10, encoding the RNA-dependent RNA polymerase, the putative core protein, the RNA silencing suppressor and the outer capsid protein, respectively. Both field nursery and artificial inoculation assays of three generations of the transgenic lines showed that they had strong resistance to RBSDV infection. The RBSDV resistance in the segregating transgenic populations correlated perfectly with the presence of the hpRNA transgene. Furthermore, the hpRNA transgene was expressed in the highly resistant transgenic lines, giving rise to abundant levels of 21-24 nt small interfering RNA (siRNA). By small RNA deep sequencing, the RBSDV-resistant transgenic lines detected siRNAs from all four viral gene sequences in the hpRNA transgene, indicating that the whole chimeric fusion sequence can be efficiently processed by Dicer into siRNAs. Taken together, our results suggest that long hpRNA targeting multiple viral genes can be used to generate stable and durable virus resistance in rice, as well as other plant species.

  8. Buckwheat trypsin inhibitor with helical hairpin structure belongs to a new family of plant defence peptides.

    Science.gov (United States)

    Oparin, Peter B; Mineev, Konstantin S; Dunaevsky, Yakov E; Arseniev, Alexander S; Belozersky, Mikhail A; Grishin, Eugene V; Egorov, Tsezi A; Vassilevski, Alexander A

    2012-08-15

    A new peptide trypsin inhibitor named BWI-2c was obtained from buckwheat (Fagopyrum esculentum) seeds by sequential affinity, ion exchange and reversed-phase chromatography. The peptide was sequenced and found to contain 41 amino acid residues, with four cysteine residues involved in two intramolecular disulfide bonds. Recombinant BWI-2c identical to the natural peptide was produced in Escherichia coli in a form of a cleavable fusion with thioredoxin. The 3D (three-dimensional) structure of the peptide in solution was determined by NMR spectroscopy, revealing two antiparallel α-helices stapled by disulfide bonds. Together with VhTI, a trypsin inhibitor from veronica (Veronica hederifolia), BWI-2c represents a new family of protease inhibitors with an unusual α-helical hairpin fold. The linker sequence between the helices represents the so-called trypsin inhibitory loop responsible for direct binding to the active site of the enzyme that cleaves BWI-2c at the functionally important residue Arg(19). The inhibition constant was determined for BWI-2c against trypsin (1.7×10(-1)0 M), and the peptide was tested on other enzymes, including those from various insect digestive systems, revealing high selectivity to trypsin-like proteases. Structural similarity shared by BWI-2c, VhTI and several other plant defence peptides leads to the acknowledgement of a new widespread family of plant peptides termed α-hairpinins.

  9. Comparison of Cytotoxic Activity in Leukemic Lineages Reveals Important Features of β-Hairpin Antimicrobial Peptides.

    Science.gov (United States)

    Buri, Marcus V; Torquato, Heron F Vieira; Barros, Carlos Castilho; Ide, Jaime S; Miranda, Antonio; Paredes-Gamero, Edgar J

    2017-07-01

    Several reports described different modes of cell death triggered by antimicrobial peptides (AMPs) due to direct effects on membrane disruption, and more recently by apoptosis and necrosis-like patterns. Cytotoxic curves of four β-hairpin AMPs (gomesin, protegrin, tachyplesin, and polyphemusin) were obtained from several human leukemic lineages and normal monocytes and Two cell lines were then selected based on their cytotoxic sensitivity. One was sensitive to AMPs (K562) and the other resistant (KG-1) and their effect compared between these lineages. Thus, these lineages were chosen to further investigate biological features related with their cytotoxicities to AMPs. Stimulation with AMPs produced cell death, with activation of caspase-3, in K562 lineage. Increase on the fluidity of plasmatic membrane by reducing cholesterol potentiated cytotoxicity of AMPs in both lineages. Quantification of internal and external gomesin binding to the cellular membrane of both K562 and KG-1 cells showed that more peptide is accumulated inside of K562 cells. Additionally, evaluation of multi-drug resistant pumps activity showed that KG-1 has more activity than K562 lineage. A comparison of intrinsic gene patterns showed great differences between K562 and KG-1, but stimulation with gomesin promoted few changes in gene expression patterns. Differences in internalization process through the plasma membrane, multidrug resistance pumps activity, and gene expression pattern are important features to AMPs regulated cell death. J. Cell. Biochem. 118: 1764-1773, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  10. Covalent Bonding of Pyrrolobenzodiazepines (PBDs) to Terminal Guanine Residues within Duplex and Hairpin DNA Fragments

    Science.gov (United States)

    Mantaj, Julia; Jackson, Paul J. M.; Karu, Kersti; Rahman, Khondaker M.; Thurston, David E.

    2016-01-01

    Pyrrolobenzodiazepines (PBDs) are covalent-binding DNA-interactive agents with growing importance as payloads in Antibody Drug Conjugates (ADCs). Until now, PBDs were thought to covalently bond to C2-NH2 groups of guanines in the DNA-minor groove across a three-base-pair recognition sequence. Using HPLC/MS methodology with designed hairpin and duplex oligonucleotides, we have now demonstrated that the PBD Dimer SJG-136 and the C8-conjugated PBD Monomer GWL-78 can covalently bond to a terminal guanine of DNA, with the PBD skeleton spanning only two base pairs. Control experiments with the non-C8-conjugated anthramycin along with molecular dynamics simulations suggest that the C8-substituent of a PBD Monomer, or one-half of a PBD Dimer, may provide stability for the adduct. This observation highlights the importance of PBD C8-substituents, and also suggests that PBDs may bind to terminal guanines within stretches of DNA in cells, thus representing a potentially novel mechanism of action at the end of DNA strand breaks. PMID:27055050

  11. Thermodynamics and kinetics of RNA tertiary structure formation in the junctionless hairpin ribozyme.

    Science.gov (United States)

    White, Neil A; Hoogstraten, Charles G

    2017-09-01

    The hairpin ribozyme consists of two RNA internal loops that interact to form the catalytically active structure. This docking transition is a rare example of intermolecular formation of RNA tertiary structure without coupling to helix annealing. We have used temperature-dependent surface plasmon resonance (SPR) to characterize the thermodynamics and kinetics of RNA tertiary structure formation for the junctionless form of the ribozyme, in which loops A and B reside on separate molecules. We find docking to be strongly enthalpy-driven and to be accompanied by substantial activation barriers for association and dissociation, consistent with the structural reorganization of both internal loops upon complex formation. Comparisons with the parallel analysis of a ribozyme variant carrying a 2'-O-methyl modification at the self-cleavage site and with published data in other systems reveal a surprising diversity of thermodynamic signatures, emphasizing the delicate balance of contributions to the free energy of formation of RNA tertiary structure. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Probing the Gaseous Structure of a β-Hairpin Peptide with H/D Exchange and Electron Capture Dissociation.

    Science.gov (United States)

    Straus, Rita N; Jockusch, Rebecca A

    2017-02-01

    An improved understanding of the extent to which native protein structure is retained upon transfer to the gas phase promises to enhance biological mass spectrometry, potentially streamlining workflows and providing fundamental insights into hydration effects. Here, we investigate the gaseous conformation of a model β-hairpin peptide using gas-phase hydrogen-deuterium (H/D) exchange with subsequent electron capture dissociation (ECD). Global gas-phase H/D exchange levels, and residue-specific exchange levels derived from ECD data, are compared among the wild type 16-residue peptide GB1p and several variants. High protection from H/D exchange observed for GB1p, but not for a truncated version, is consistent with the retention of secondary structure of GB1p in the gas phase or its refolding into some other compact structure. Four alanine mutants that destabilize the hairpin in solution show levels of protection similar to that of GB1p, suggesting collapse or (re)folding of these peptides upon transfer to the gas phase. These results offer a starting point from which to understand how a key secondary structural element, the β-hairpin, is affected by transfer to the gas phase. This work also demonstrates the utility of a much-needed addition to the tool set that is currently available for the investigation of the gaseous conformation of biomolecules, which can be employed in the future to better characterize gaseous proteins and protein complexes. Graphical Abstract ᅟ.

  13. Neuronal SH2B1 is essential for controlling energy and glucose homeostasis.

    Science.gov (United States)

    Ren, Decheng; Zhou, Yingjiang; Morris, David; Li, Minghua; Li, Zhiqin; Rui, Liangyou

    2007-02-01

    SH2B1 (previously named SH2-B), a cytoplasmic adaptor protein, binds via its Src homology 2 (SH2) domain to a variety of protein tyrosine kinases, including JAK2 and the insulin receptor. SH2B1-deficient mice are obese and diabetic. Here we demonstrated that multiple isoforms of SH2B1 (alpha, beta, gamma, and/or delta) were expressed in numerous tissues, including the brain, hypothalamus, liver, muscle, adipose tissue, heart, and pancreas. Rat SH2B1beta was specifically expressed in neural tissue in SH2B1-transgenic (SH2B1(Tg)) mice. SH2B1(Tg) mice were crossed with SH2B1-knockout (SH2B1(KO)) mice to generate SH2B1(TgKO) mice expressing SH2B1 only in neural tissue but not in other tissues. Systemic deletion of the SH2B1 gene resulted in metabolic disorders in SH2B1(KO) mice, including hyperlipidemia, leptin resistance, hyperphagia, obesity, hyperglycemia, insulin resistance, and glucose intolerance. Neuron-specific restoration of SH2B1beta not only corrected the metabolic disorders in SH2B1(TgKO) mice, but also improved JAK2-mediated leptin signaling and leptin regulation of orexigenic neuropeptide expression in the hypothalamus. Moreover, neuron-specific overexpression of SH2B1 dose-dependently protected against high-fat diet-induced leptin resistance and obesity. These observations suggest that neuronal SH2B1 regulates energy balance, body weight, peripheral insulin sensitivity, and glucose homeostasis at least in part by enhancing hypothalamic leptin sensitivity.

  14. Steering elastic SH waves in an anomalous way by metasurface

    Science.gov (United States)

    Cao, Liyun; Yang, Zhichun; Xu, Yanlong

    2018-03-01

    Metasurface, which does not exist in nature, has exhibited exotic essence on the manipulation of both electromagnetic and acoustic waves. In this paper, the concept of metasurface is extended to the field of elastic SH waves, and the anomalous refractions of SH waves across the designed elastic SH wave metasurfaces (SHWMs) are demonstrated numerically. Firstly, a SHWM is designed with supercells, each supercell is composed of four subunits. It is demonstrated that this configuration has the ability of deflecting the vertical and oblique incident waves in an arbitrary desired direction. Then, a unique SHWM with supercell composed of only two subunits is designed. Numerical simulation shows its ability of splitting the vertical and oblique incident waves into two tunable transmitted wave beams, respectively. In the process of steering SH waves, it is also found that two kinds of leakages of transmitted waves across the designed SHWM will occur in some particular situations, which will affect the desired transmitted wave. The mechanisms of the leakages, which are different from that of the common high-order diffraction mentioned in existing literatures, are revealed. The current study can offer theoretical guidance not only for designing devices of directional ultrasonic detection and splitting SH waves but also for steering other kinds of classical waves.

  15. Preferred SH3 domain partners of ADAM metalloproteases include shared and ADAM-specific SH3 interactions.

    Directory of Open Access Journals (Sweden)

    Iivari Kleino

    Full Text Available A disintegrin and metalloproteinases (ADAMs constitute a protein family essential for extracellular signaling and regulation of cell adhesion. Catalytic activity of ADAMs and their predicted potential for Src-homology 3 (SH3 domain binding show a strong correlation. Here we present a comprehensive characterization of SH3 binding capacity and preferences of the catalytically active ADAMs 8, 9, 10, 12, 15, 17, and 19. Our results revealed several novel interactions, and also confirmed many previously reported ones. Many of the identified SH3 interaction partners were shared by several ADAMs, whereas some were ADAM-specific. Most of the ADAM-interacting SH3 proteins were adapter proteins or kinases, typically associated with sorting and endocytosis. Novel SH3 interactions revealed in this study include TOCA1 and CIP4 as preferred partners of ADAM8, and RIMBP1 as a partner of ADAM19. Our results suggest that common as well as distinct mechanisms are involved in regulation and execution of ADAM signaling, and provide a useful framework for addressing the pathways that connect ADAMs to normal and aberrant cell behavior.

  16. Modeling cometary photopolarimetric characteristics with Sh-matrix method

    Science.gov (United States)

    Kolokolova, L.; Petrov, D.

    2017-12-01

    Cometary dust is dominated by particles of complex shape and structure, which are often considered as fractal aggregates. Rigorous modeling of light scattering by such particles, even using parallelized codes and NASA supercomputer resources, is very computer time and memory consuming. We are presenting a new approach to modeling cometary dust that is based on the Sh-matrix technique (e.g., Petrov et al., JQSRT, 112, 2012). This method is based on the T-matrix technique (e.g., Mishchenko et al., JQSRT, 55, 1996) and was developed after it had been found that the shape-dependent factors could be separated from the size- and refractive-index-dependent factors and presented as a shape matrix, or Sh-matrix. Size and refractive index dependences are incorporated through analytical operations on the Sh-matrix to produce the elements of T-matrix. Sh-matrix method keeps all advantages of the T-matrix method, including analytical averaging over particle orientation. Moreover, the surface integrals describing the Sh-matrix elements themselves can be solvable analytically for particles of any shape. This makes Sh-matrix approach an effective technique to simulate light scattering by particles of complex shape and surface structure. In this paper, we present cometary dust as an ensemble of Gaussian random particles. The shape of these particles is described by a log-normal distribution of their radius length and direction (Muinonen, EMP, 72, 1996). Changing one of the parameters of this distribution, the correlation angle, from 0 to 90 deg., we can model a variety of particles from spheres to particles of a random complex shape. We survey the angular and spectral dependencies of intensity and polarization resulted from light scattering by such particles, studying how they depend on the particle shape, size, and composition (including porous particles to simulate aggregates) to find the best fit to the cometary observations.

  17. An image-based, dual fluorescence reporter assay to evaluate the efficacy of shRNA for gene silencing at the single-cell level [v1; ref status: indexed, http://f1000r.es/2tt

    Directory of Open Access Journals (Sweden)

    Shin-ichiro Kojima

    2014-02-01

    Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.

  18. An image-based, dual fluorescence reporter assay to evaluate the efficacy of shRNA for gene silencing at the single-cell level [v2; ref status: indexed, http://f1000r.es/39j

    Directory of Open Access Journals (Sweden)

    Shin-ichiro Kojima

    2014-05-01

    Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.

  19. Function and anatomy of plant siRNA pools derived from hairpin transgenes

    Directory of Open Access Journals (Sweden)

    Lee Kevin AW

    2007-11-01

    Full Text Available Abstract Background RNA interference results in specific gene silencing by small-interfering RNAs (siRNAs. Synthetic siRNAs provide a powerful tool for manipulating gene expression but high cost suggests that novel siRNA production methods are desirable. Strong evolutionary conservation of siRNA structure suggested that siRNAs will retain cross-species function and that transgenic plants expressing heterologous siRNAs might serve as useful siRNA bioreactors. Here we report a detailed evaluation of the above proposition and present evidence regarding structural features of siRNAs extracted from plants. Results Testing the gene silencing capacity of plant-derived siRNAs in mammalian cells proved to be very challenging and required partial siRNA purification and design of a highly sensitive assay. Using the above assay we found that plant-derived siRNAs are ineffective for gene silencing in mammalian cells. Plant-derived siRNAs are almost exclusively double-stranded and most likely comprise a mixture of bona fide siRNAs and aberrant partially complementary duplexes. We also provide indirect evidence that plant-derived siRNAs may contain a hitherto undetected physiological modification, distinct from 3' terminal 2-O-methylation. Conclusion siRNAs produced from plant hairpin transgenes and extracted from plants are ineffective for gene silencing in mammalian cells. Thus our findings establish that a previous claim that transgenic plants offer a cost-effective, scalable and sustainable source of siRNAs is unwarranted. Our results also indicate that the presence of aberrant siRNA duplexes and possibly a plant-specific siRNA modification, compromises the gene silencing capacity of plant-derived siRNAs in mammalian cells.

  20. In-Solution SH2 Domain Binding Assay Based on Proximity Ligation.

    Science.gov (United States)

    Machida, Kazuya

    2017-01-01

    Protein-protein interactions mediated by SH2 domains confer specificity in tyrosine kinase pathways. Traditional assays for assessing interactions between an SH2 domain and its interacting protein such as far-Western and pull-down are inherently low throughput. We developed SH2-PLA, an in-solution SH2 domain binding assay, that takes advantage of the speed and sensitivity of proximity ligation and real-time PCR. SH2-PLA allows for rapid assessment of SH2 domain binding to a target protein using only a few microliters of cell lysate, thereby making it an attractive new tool to study tyrosine kinase signaling.

  1. Two-state dynamics of the SH3-SH2 tandem of Abl kinase and the allosteric role of the N-cap.

    Science.gov (United States)

    Corbi-Verge, Carles; Marinelli, Fabrizio; Zafra-Ruano, Ana; Ruiz-Sanz, Javier; Luque, Irene; Faraldo-Gómez, José D

    2013-09-03

    The regulation and localization of signaling enzymes is often mediated by accessory modular domains, which frequently function in tandems. The ability of these tandems to adopt multiple conformations is as important for proper regulation as the individual domain specificity. A paradigmatic example is Abl, a ubiquitous tyrosine kinase of significant pharmacological interest. SH3 and SH2 domains inhibit Abl by assembling onto the catalytic domain, allosterically clamping it in an inactive state. We investigate the dynamics of this SH3-SH2 tandem, using microsecond all-atom simulations and differential scanning calorimetry. Our results indicate that the Abl tandem is a two-state switch, alternating between the conformation observed in the structure of the autoinhibited enzyme and another configuration that is consistent with existing scattering data for an activated form. Intriguingly, we find that the latter is the most probable when the tandem is disengaged from the catalytic domain. Nevertheless, an amino acid stretch preceding the SH3 domain, the so-called N-cap, reshapes the free-energy landscape of the tandem and favors the interaction of this domain with the SH2-kinase linker, an intermediate step necessary for assembly of the autoinhibited complex. This allosteric effect arises from interactions between N-cap and the SH2 domain and SH3-SH2 connector, which involve a phosphorylation site. We also show that the SH3-SH2 connector plays a determinant role in the assembly equilibrium of Abl, because mutations thereof hinder the engagement of the SH2-kinase linker. These results provide a thermodynamic rationale for the involvement of N-cap and SH3-SH2 connector in Abl regulation and expand our understanding of the principles of modular domain organization.

  2. Two-state dynamics of the SH3–SH2 tandem of Abl kinase and the allosteric role of the N-cap

    Science.gov (United States)

    Corbi-Verge, Carles; Marinelli, Fabrizio; Zafra-Ruano, Ana; Ruiz-Sanz, Javier; Luque, Irene; Faraldo-Gómez, José D.

    2013-01-01

    The regulation and localization of signaling enzymes is often mediated by accessory modular domains, which frequently function in tandems. The ability of these tandems to adopt multiple conformations is as important for proper regulation as the individual domain specificity. A paradigmatic example is Abl, a ubiquitous tyrosine kinase of significant pharmacological interest. SH3 and SH2 domains inhibit Abl by assembling onto the catalytic domain, allosterically clamping it in an inactive state. We investigate the dynamics of this SH3–SH2 tandem, using microsecond all-atom simulations and differential scanning calorimetry. Our results indicate that the Abl tandem is a two-state switch, alternating between the conformation observed in the structure of the autoinhibited enzyme and another configuration that is consistent with existing scattering data for an activated form. Intriguingly, we find that the latter is the most probable when the tandem is disengaged from the catalytic domain. Nevertheless, an amino acid stretch preceding the SH3 domain, the so-called N-cap, reshapes the free-energy landscape of the tandem and favors the interaction of this domain with the SH2-kinase linker, an intermediate step necessary for assembly of the autoinhibited complex. This allosteric effect arises from interactions between N-cap and the SH2 domain and SH3–SH2 connector, which involve a phosphorylation site. We also show that the SH3–SH2 connector plays a determinant role in the assembly equilibrium of Abl, because mutations thereof hinder the engagement of the SH2-kinase linker. These results provide a thermodynamic rationale for the involvement of N-cap and SH3–SH2 connector in Abl regulation and expand our understanding of the principles of modular domain organization. PMID:23959873

  3. Physiological characteristics of elite short- and long-distance triathletes.

    Science.gov (United States)

    Millet, Grégoire P; Dréano, Patrick; Bentley, David J

    2003-01-01

    The purpose of this study was to compare the physiological responses in cycling and running of elite short-distance (ShD) and long-distance (LD) triathletes. Fifteen elite male triathletes participating in the World Championships were divided into two groups (ShD and LD) and performed a laboratory trial that comprised submaximal treadmill running, maximal then submaximal ergometry cycling and then an additional submaximal run. "In situ" best ShD triathlon performances were also analysed for each athlete. ShD demonstrated a significantly faster swim time than LD whereas .VO(2max) (ml kg(-1) min(-1)), cycling economy (W l(-1) min(-1)), peak power output (.W(peak),W) and ventilatory threshold (%.VO(2max)) were all similar between ShD and LD. Moreover, there were no differences between the two groups in the change (%) in running economy from the first to the second running bout. Swimming time was correlated to .W(peak)(r=-0.76; Ptriathlon was correlated to .W(peak)(r=-0.83; P<0.05) in LD. In conclusion, ShD triathletes had a faster swimming time but did not exhibit different maximal or submaximal physiological characteristics measured in cycling and running than LD triathletes.

  4. Al-Shāṭibīs sufismekritik:

    DEFF Research Database (Denmark)

    Riexinger, Martin Thomas

    2016-01-01

    The faqīh (Islamic legal scholar) al-Shāṭibī (d. 1388) from Granada is primarily known for his innovative approach within the field of legal theory (uṣūl al-fiqh). However, he dedicated much attention to the criticism of sufism. But like other Islamic scholars who opposed Sufism he did...

  5. Hiding State in CλaSH Hardware Descriptions

    NARCIS (Netherlands)

    Gerards, Marco Egbertus Theodorus; Baaij, C.P.R.; Kuper, Jan; Kooijman, Matthijs

    Synchronous hardware can be modelled as a mapping from input and state to output and a new state, such mappings are referred to as transition functions. It is natural to use a functional language to implement transition functions. The CaSH compiler is capable of translating transition functions to

  6. Construction of lentiviral shRNA expression vector targeting ...

    African Journals Online (AJOL)

    DNA oligo was cloned into lentiviral expression vector, and then polymerase chain reaction (PCR) and sequencing analyses were conducted to verify the constructs. The verified vectors were co-transfected into 293FT cells that could produce lentiviral. shRNA lentiviruses from the selected constructs were propagated and ...

  7. Construction of lentiviral shRNA expression vector targeting ...

    African Journals Online (AJOL)

    ajl yemi

    2011-10-26

    Oct 26, 2011 ... was then selected, while the titer of lentiviral packing PLD2-shRNA was 3.47 × 104 TU/ml and the virus was successfully ... MATERIALS AND METHODS .... such as: transfecting cells not only in mitotic active phase but also in ...

  8. Calibration of the SH134-20 Standard Gain Horn

    DEFF Research Database (Denmark)

    Pivnenko, Sergey; Breinbjerg, Olav

    This report documents the measurement of the linearly polarized SH134-20 Standard Gain Horn. The measurement comprises on-axis gain, on-axis polarization characteristics, and reflection coefficient at 111 frequencies in the frequency range from 22-33 GHz. The measurement was carried out at the DTU...

  9. The mitochondrial genomes of sponges provide evidence for multiple invasions by Repetitive Hairpin-forming Elements (RHE

    Directory of Open Access Journals (Sweden)

    Lavrov Dennis V

    2009-12-01

    Full Text Available Abstract Background The mitochondrial (mt genomes of sponges possess a variety of features, which appear to be intermediate between those of Eumetazoa and non-metazoan opisthokonts. Among these features is the presence of long intergenic regions, which are common in other eukaryotes, but generally absent in Eumetazoa. Here we analyse poriferan mitochondrial intergenic regions, paying particular attention to repetitive sequences within them. In this context we introduce the mitochondrial genome of Ircinia strobilina (Lamarck, 1816; Demospongiae: Dictyoceratida and compare it with mtDNA of other sponges. Results Mt genomes of dictyoceratid sponges are identical in gene order and content but display major differences in size and organization of intergenic regions. An even higher degree of diversity in the structure of intergenic regions was found among different orders of demosponges. One interesting observation made from such comparisons was of what appears to be recurrent invasions of sponge mitochondrial genomes by repetitive hairpin-forming elements, which cause large genome size differences even among closely related taxa. These repetitive hairpin-forming elements are structurally and compositionally divergent and display a scattered distribution throughout various groups of demosponges. Conclusion Large intergenic regions of poriferan mt genomes are targets for insertions of repetitive hairpin- forming elements, similar to the ones found in non-metazoan opisthokonts. Such elements were likely present in some lineages early in animal mitochondrial genome evolution but were subsequently lost during the reduction of intergenic regions, which occurred in the Eumetazoa lineage after the split of Porifera. Porifera acquired their elements in several independent events. Patterns of their intra-genomic dispersal can be seen in the mt genome of Vaceletia sp.

  10. Hairpin stabilized fluorescent silver nanoclusters for quantitative detection of NAD+ and monitoring NAD+/NADH based enzymatic reactions.

    Science.gov (United States)

    Jain, Priyamvada; Chakma, Babina; Patra, Sanjukta; Goswami, Pranab

    2017-03-01

    A set of 90 mer long ssDNA candidates, with different degrees of cytosine (C-levels) (% and clusters) was analyzed for their function as suitable Ag-nanocluster (AgNC) nucleation scaffolds. The sequence (P4) with highest C-level (42.2%) emerged as the only candidate supporting the nucleation process as evident from its intense fluorescence peak at λ 660 nm . Shorter DNA subsets derived from P4 with only stable hairpin structures could support the AgNC formation. The secondary hairpin structures were confirmed by PAGE, and CD studies. The number of base pairs in the stem region also contributes to the stability of the hairpins. A shorter 29 mer sequence (Sub 3) (ΔG = -1.3 kcal/mol) with 3-bp in the stem of a 7-mer loop conferred highly stable AgNC. NAD + strongly quenched the fluorescence of Sub 3-AgNC in a concentration dependent manner. Time resolved photoluminescence studies revealed the quenching involves a combined static and dynamic interaction where the binding constant and number of binding sites for NAD + were 0.201 L mol -1 and 3.6, respectively. A dynamic NAD + detection range of 50-500 μM with a limit of detection of 22.3 μM was discerned. The NAD + mediated quenching of AgNC was not interfered by NADH, NADP + , monovalent and divalent ions, or serum samples. The method was also used to follow alcohol dehydrogenase and lactate dehydrogenase catalyzed physiological reactions in a turn-on and turn-off assay, respectively. The proposed method with ssDNA-AgNC could therefore be extended to monitor other NAD + /NADH based enzyme catalyzed reactions in a turn-on/turn-off approach. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Palaeodemography of the Atapuerca-SH Middle Pleistocene hominid sample.

    Science.gov (United States)

    Bermúdez de Castro, J M; Nicolás, M E

    1997-01-01

    We report here on the palaeodemographic analysis of the hominid sample recovered to date from the Sima de los Huesos (SH) Middle Pleistocene cave site in the Sierra de Atapuerca (Burgos, Spain). The analysis of the mandibular, maxillary, and dental remains has made it possible to estimate that a minimum of 32 individuals, who probably belonged to the same biological population, are represented in the current SH human hypodigm. The remains of nine-individuals are assigned to males, and nine to females, suggesting that a 1:1 sex ratio characterizes this hominid sample. The survivorship curve shows a low representation of infants and children, a high mortality among the adolescents and prime-age adults, and a low older adult mortality. Longevity was probably no greater than 40 years. This mortality pattern (adolescents and adults); which in some aspects resembles that observed in Neandertals, is quite different from those reported for recent foraging human groups. The adult age-at-death distribution of the SH hominid sample appears to be neither the consequence of underaging the older adults, nor of differential preservation or of the recognition of skeletal remains. Thus if we accept that they had a life history pattern similar to that of modern humans there would appear to be a clear contradiction between the demographic distribution and the demographic viability of the population represented by the SH hominid fossils. The possible representational bias of the SH hominid sample, as well as some aspects of the reproductive biology of the Pleistocene populations are also discussed.

  12. An O(n(5)) algorithm for MFE prediction of kissing hairpins and 4-chains in nucleic acids.

    Science.gov (United States)

    Chen, Ho-Lin; Condon, Anne; Jabbari, Hosna

    2009-06-01

    Efficient methods for prediction of minimum free energy (MFE) nucleic secondary structures are widely used, both to better understand structure and function of biological RNAs and to design novel nano-structures. Here, we present a new algorithm for MFE secondary structure prediction, which significantly expands the class of structures that can be handled in O(n(5)) time. Our algorithm can handle H-type pseudoknotted structures, kissing hairpins, and chains of four overlapping stems, as well as nested substructures of these types.

  13. Stabilization of the beta-hairpin in Mason-Pfizer monkey virus capsid protein- a critical step for infectivity

    Czech Academy of Sciences Publication Activity Database

    Obr, M.; Hadravová, Romana; Doležal, Michal; Křížová, Ivana; Papoušková, V.; Žídek, L.; Hrabal, R.; Ruml, T.; Rumlová, Michaela

    2014-01-01

    Roč. 11, Oct 30 (2014), 94/1-94/14 ISSN 1742-4690 R&D Projects: GA ČR(CZ) GA14-15326S; GA MŠk LO1302 Grant - others:GA MŠk(CZ) ED1.1.00/02.0068; Seventh Framework Programme of the European Union(XE) FP7-261863 Program:ED Institutional support: RVO:61388963 Keywords : retrovirus * assembly * M-PMV * capsid protein * maturation * beta-hairpin Subject RIV: EE - Microbiology, Virology Impact factor: 4.185, year: 2014 http://www.retrovirology.com/content/11/1/94

  14. Shear horizontal wave excitation and reception with shear horizontal piezoelectric wafer active sensor (SH-PWAS)

    International Nuclear Information System (INIS)

    Kamal, A; Giurgiutiu, V

    2014-01-01

    This article discusses shear horizontal (SH) guided-waves that can be excited with shear type piezoelectric wafer active sensor (SH-PWAS). The paper starts with a review of state of the art SH waves modelling and their importance in non-destructive evaluation (NDE) and structural health monitoring (SHM). The basic piezoelectric sensing and actuation equations for the case of shear horizontal piezoelectric wafer active sensor (SH-PWAS) with electro-mechanical coupling coefficient d 35 are reviewed. Multiphysics finite element modelling (MP-FEM) was performed on a free SH-PWAS to show its resonance modeshapes. The actuation mechanism of the SH-PWAS is predicted by MP-FEM, and modeshapes of excited structure are presented. The structural resonances are compared with experimental measurements and showed good agreement. Analytical prediction of SH waves was performed. SH wave propagation experimental study was conducted between different combinations of SH-PWAS and regular in-plane PWAS transducers. Experimental results were compared with analytical predictions for aluminium plates and showed good agreement. 2D wave propagation effects were studied by MP-FEM. An analytical model was developed for SH wave power and energy. The normal mode expansion (NME) method was used to account for superpositioning multimodal SH waves. Modal participation factors were presented to show the contribution of every mode. Power and energy transfer between SH-PWAS and the structure was analyzed. Finally, we present simulations of our developed wave power and energy analytical models. (paper)

  15. Detection and characterization of partially unfolded oligomers of the SH3 domain of α-Spectrin

    NARCIS (Netherlands)

    Casares, S.; Sadqi, M.; López-Mayorga, O.; Conejero-Lara, F.; van Nuland, N.A.J.

    2004-01-01

    For the purpose of equilibrium and kinetic folding-unfolding studies, the SH3 domain of α-spectrin (spc-SH3) has long been considered a classic two-state folding protein. In this work we have indeed observed that the thermal unfolding curves of spc-SH3 measured at pH 3.0 by differential scanning

  16. Disentangling the gamma-ray emission towards Cygnus X: Sh2-104

    Science.gov (United States)

    Gotthelf, Eric

    2015-09-01

    We have just discovered distinct X-ray emission coincident with VER J2018+363, a TeV source recently resolved from the giant gamma-ray complex MGRO J2019+37 in the Cygnus region. NuSTAR reveals a hard point source and a diffuse nebula adjacent to and possibly part of Sh2-104, a compact HII region containing several young massive stellar clusters. There is reasonable evidence that these X-rays probe the origin of the gamma-ray flux, however, unrelated extragalactic sources need to be excluded. We propose a short Chandra observation to localize the X-ray emission to identify a putative pulsar or stellar counterpart(s). This is an important step to fully understand the energetics of the MGRO J2019+37 complex and the production of gamma-rays in star formation regions, in general.

  17. The Queer Collapse of Civilization: Mariko Ōhara's “Shōjo”

    Directory of Open Access Journals (Sweden)

    Esther Andreu

    2017-10-01

    Full Text Available This article analyses Mariko Ōhara’s short story “Shōjo” (1985 and its attempt at deconstructing the sex-gender system, focusing on the three main characters: Gil and his two sexual/love interests, Kisa and Remora. By examining the story from both gender and animal studies, the aim is to reflect on how the ideas of sex, gender and performativity are inserted into a vaster social construction that also merges with class and animality. We also consider how the recurrent image of decadence and what can be considered a return to a heteronormative situation do not undermine the overall process of deconstruction and social critique offered by the story.

  18. Short philtrum

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/003302.htm Short philtrum To use the sharing features on this page, please enable JavaScript. A short philtrum is a shorter than normal distance between ...

  19. Protein-phosphotyrosine proteome profiling by superbinder-SH2 domain affinity purification mass spectrometry, sSH2-AP-MS.

    Science.gov (United States)

    Tong, Jiefei; Cao, Biyin; Martyn, Gregory D; Krieger, Jonathan R; Taylor, Paul; Yates, Bradley; Sidhu, Sachdev S; Li, Shawn S C; Mao, Xinliang; Moran, Michael F

    2017-03-01

    Recently, "superbinder" SH2 domain variants with three amino acid substitutions (sSH2) were reported to have 100-fold or greater affinity for protein-phosphotyrosine (pY) than natural SH2 domains. Here we report a protocol in which His-tagged Src sSH2 efficiently captures pY-peptides from protease-digested HeLa cell total protein extracts. Affinity purification of pY-peptides by this method shows little bias for pY-proximal amino acid sequences, comparable to that achieved by using antibodies to pY, but with equal or higher yield. Superbinder-SH2 affinity purification mass spectrometry (sSH2-AP-MS) therefore provides an efficient and economical approach for unbiased pY-directed phospho-proteome profiling without the use of antibodies. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Expanding the peptide beta-turn in alphagamma hybrid sequences: 12 atom hydrogen bonded helical and hairpin turns.

    Science.gov (United States)

    Chatterjee, Sunanda; Vasudev, Prema G; Raghothama, Srinivasarao; Ramakrishnan, Chandrasekharan; Shamala, Narayanaswamy; Balaram, Padmanabhan

    2009-04-29

    Hybrid peptide segments containing contiguous alpha and gamma amino acid residues can form C(12) hydrogen bonded turns which may be considered as backbone expanded analogues of C(10) (beta-turns) found in alphaalpha segments. Exploration of the regular hydrogen bonded conformations accessible for hybrid alphagamma sequences is facilitated by the use of a stereochemically constrained gamma amino acid residue gabapentin (1-aminomethylcyclohexaneacetic acid, Gpn), in which the two torsion angles about C(gamma)-C(beta) (theta(1)) and C(beta)-C(alpha) (theta(2)) are predominantly restricted to gauche conformations. The crystal structures of the octapeptides Boc-Gpn-Aib-Gpn-Aib-Gpn-Aib-Gpn-Aib-OMe (1) and Boc-Leu-Phe-Val-Aib-Gpn-Leu-Phe-Val-OMe (2) reveal two distinct conformations for the Aib-Gpn segment. Peptide 1 forms a continuous helix over the Aib(2)-Aib(6) segment, while the peptide 2 forms a beta-hairpin structure stabilized by four cross-strand hydrogen bonds with the Aib-Gpn segment forming a nonhelical C(12) turn. The robustness of the helix in peptide 1 in solution is demonstrated by NMR methods. Peptide 2 is conformationally fragile in solution with evidence of beta-hairpin conformations being obtained in methanol. Theoretical calculations permit delineation of the various C(12) hydrogen bonded structures which are energetically feasible in alphagamma and gammaalpha sequences.

  1. Dynamics of bleomycin interaction with a strongly bound hairpin DNA substrate, and implications for cleavage of the bound DNA.

    Science.gov (United States)

    Bozeman, Trevor C; Nanjunda, Rupesh; Tang, Chenhong; Liu, Yang; Segerman, Zachary J; Zaleski, Paul A; Wilson, W David; Hecht, Sidney M

    2012-10-31

    Recent studies involving DNAs bound strongly by bleomycins have documented that such DNAs are degraded by the antitumor antibiotic with characteristics different from those observed when studying the cleavage of randomly chosen DNAs in the presence of excess Fe·BLM. In the present study, surface plasmon resonance has been used to characterize the dynamics of BLM B(2) binding to a strongly bound hairpin DNA, to define the effects of Fe(3+), salt, and temperature on BLM-DNA interaction. One strong primary DNA binding site, and at least one much weaker site, were documented. In contrast, more than one strong cleavage site was found, an observation also made for two other hairpin DNAs. Evidence is presented for BLM equilibration between the stronger and weaker binding sites in a way that renders BLM unavailable to other, less strongly bound DNAs. Thus, enhanced binding to a given site does not necessarily result in increased DNA degradation at that site; i.e., for strongly bound DNAs, the facility of DNA cleavage must involve other parameters in addition to the intrinsic rate of C-4' H atom abstraction from DNA sugars.

  2. HTS dual-band bandpass filters using stub-loaded hair-pin resonators for mobile communication systems

    Energy Technology Data Exchange (ETDEWEB)

    Sekiya, N., E-mail: nsekiya@yamanashi.ac.jp; Sugiyama, S.

    2014-09-15

    Highlights: • We have developed a HTS five-pole dual-band bandpass filter using stub-loaded hair-pin resonators. • The proposed dual-band BPF can independently control of the center frequency. • Flexibly adjustment of the bandwidth can be achieved by the H-shaped waveguide. • The proposed BPF is evaluated by simulation and measurement with good agreement. - Abstract: A HTS dual-band bandpass filter is developed to obtain sharp-cut off characteristics for mobile communication systems. The filter is composed of five stub-loaded hair-pin resonators with H-shaped waveguides between them. The main advantage of the proposed filter is to allow independent control of the center frequency of the first and second bands. The bandwidths can be flexibly adjusted using the H-shaped waveguide. An electromagnetic simulator was used to design and analyze the filter, which have a 3.5-GHz center frequency and a 70-MHz (2%) bandwidth for the first band and a 5.0-GHz center frequency and a 100-MHz (2%) bandwidth for the second band. The filter was fabricated using YBa{sub 2}Cu{sub 3}O{sub y} thin film on an Al{sub 2}O{sub 3} substrate. Ground plane was fabricated using Au thin film. The measured frequency responses of the filter tally well with the simulated ones.

  3. Astronomical Pacing of Relative Sea Level through OAE2 from the Expanded SH#1 Core, Southern Utah

    Science.gov (United States)

    Jones, M. M.; Sageman, B. B.; Oakes, R. L.; Bralower, T. J.; Parker, A. L.; Leckie, R. M.

    2017-12-01

    Proximal marine strata of the North American Western Interior Basin (WIB) preserve a rich record of faunal turnover linked to Oceanic Anoxic Event 2 (OAE2 - 94 Ma), a pronounced Late Cretaceous carbon cycle perturbation interpreted to reflect global warming and possible ocean acidification. To develop a more robust synthesis of paleobiologic and geochemical datasets spanning this major Earth-life transition, we drilled a 131-meter core (SH#1) on the Kaiparowits Plateau of southern Utah, recovering the Cenomanian-Turonian Boundary (CTB) interval of the Tropic Shale. A 17.5-meter positive excursion in high-resolution bulk carbon isotope chemostratigraphy (δ13Corg) of SH#1 characterizes the most expanded and detailed record of OAE2 recovered from the WIB. Additionally, we detect statistically significant evidence for astronomical cycles in a companion δ13Ccarb dataset, using advanced spectral techniques (evolutive average spectral misfit). Bandpass filtering and tracing of the short eccentricity cycle (97 ka) permit development of a floating astronomical time scale (ATS) for the CTB interval. The presence of radioisotopic dates within the time series provides an independent check on astrochronologic interpretations. We attribute some depleted δ13Ccarb values in SH#1, which cyclically punctuate the OAE2 excursion, to preferential carbonate diagenesis driven by periodic sea level oscillations. Accordingly, major flooding surfaces in SH#1 correlate well to an existing sequence stratigraphic framework from shoreface facies of the Markagunt Plateau ( 100 km west). Comparing the ATS and sequence stratigraphic surfaces in SH#1, we observe that stable eccentricity cycles (405 ka) pace stratigraphic sequences and associated saw-toothed trends in sedimentation rate estimates through OAE2. Furthermore, short eccentricity cycles pace nested parasequences. These results confirm astronomical and, therefore, climatic pacing of relative sea level trends during OAE2 in the WIB. The

  4. Acyclic peptides incorporating the d-Phe-2-Abz turn motif: Investigations on antimicrobial activity and propensity to adopt β-hairpin conformations.

    Science.gov (United States)

    Cameron, Alan J; Varnava, Kyriakos G; Edwards, Patrick J B; Harjes, Elena; Sarojini, Vijayalekshmi

    2018-06-14

    Three linear peptides incorporating d-Phe-2-Abz as the turn motif are reported. Peptide 1, a hydrophobic β-hairpin, served as a proof of principle for the design strategy with both NMR and CD spectra strongly suggesting a β-hairpin conformation. Peptides 2 and 3, designed as amphipathic antimicrobials, exhibited broad spectrum antimicrobial activity, with potency in the nanomolar range against Staphylococcus aureus. Both compounds possess a high degree of selectivity, proving non-haemolytic at concentrations 500 to 800 times higher than their respective minimal inhibitory concentrations (MICs) against S. aureus. Peptide 2 induced cell membrane and cell wall disintegration in both S. aureus and Pseudomonas aeruginosa as observed by transmission electron microscopy. Peptide 2 also demonstrated moderate antifungal activity against Candida albicans with an MIC of 50 μM. Synergism was observed with sub-MIC levels of amphotericin B (AmB), leading to nanomolar MICs against C. albicans for peptide 2. Based on circular dichroism spectra, both peptides 2 and 3 appear to exist as a mixture of conformers with the β-hairpin as a minor conformer in aqueous solution, and a slight increase in hairpin population in 50% trifluoroethanol, which was more pronounced for peptide 3. NMR spectra of peptide 2 in a 1:1 CD 3 CN/H 2 O mixture and 30 mM deuterated sodium dodecyl sulfate showed evidence of an extended backbone conformation of the β-strand residues. However, inter-strand rotating frame Overhauser effects (ROE) could not be detected and a loosely defined divergent hairpin structure resulted from ROE structure calculation in CD 3 CN/H 2 O. The loosely defined hairpin conformation is most likely a result of the electrostatic repulsions between cationic strand residues which also probably contribute towards maintaining low haemolytic activity. Copyright © 2018 European Peptide Society and John Wiley & Sons, Ltd.

  5. Characterization of breakpoint cluster region kinase and SH2-binding activities.

    Science.gov (United States)

    Afar, D E; Witte, O N

    1995-01-01

    BCR is an interesting signaling protein, whose cellular function is currently unknown. Its biochemical properties include serine kinase activity, SH2-binding activity, and a GTPase-activating activity. The SH2-binding activity is particularly interesting because it may link BCR to signaling pathways involving SH2-containing molecules. Since tyrosine phosphorylation of BCR has been detected in CML-derived cell lines and since tyrosine-phosphorylated BCR shows increased affinity toward certain SH2 domains, it seems particularly important to further characterize this activity. This chapter described a simple purification scheme for partial purification of BCR, which can be used to assess in vitro kinase and SH2-binding activities.

  6. Alternative splicing, gene localization, and binding of SH2-B to the insulin receptor kinase domain

    OpenAIRE

    Nelms, Keats; O'Neill, Thomas J.; Li, Shiqing; Hubbard, Stevan R.; Gustafson, Thomas A.; Paul, William E.

    1999-01-01

    . The SH2-B protein is an SH2-domain-containing molecule that interacts with a number of phosphorylated kinase and receptor molecules including the insulin receptor. Two isoforms of the SH2-B have been identified and have been proposed to arise through alternate splicing. Here we have identified a third isoform of the SH2-B protein, SH2-Bγ, that interacts specifically with the insulin receptor. This interaction required phosphorylation of residue Y1146 in the triple tyrosine motif within the ...

  7. Fundamental modes of new dispersive SH-waves in ...

    Indian Academy of Sciences (India)

    [3] M Fiebig, V V Pavlov and R V Pisarev, J. Opt. Soc. Am. B 22(1), 96 (2005). [4] T Kimura, Ann. Rev. Condens. Matter Phys. 3(1), 93 (2012). [5] Ch-S Park and Sh Priya, Advances in condensed matter physics (Hindawi Publishing. Corporation, 2012) Vol. 2012, 12 pages. [6] R C Pullar, Prog. Mater. Sci. 57(7), 1191 (2012).

  8. Importance of specific nucleotides in the folding of the natural form of the hairpin ribozyme.

    Science.gov (United States)

    Wilson, T J; Zhao, Z Y; Maxwell, K; Kontogiannis, L; Lilley, D M

    2001-02-20

    The hairpin ribozyme in its natural context consists of two loops in RNA duplexes that are connected as arms of a four-way helical junction. Magnesium ions induce folding into the active conformation in which the two loops are in proximity. In this study, we have investigated nucleotides that are important to this folding process. We have analyzed the folding in terms of the cooperativity and apparent affinity for magnesium ions as a function of changes in base sequence and functional groups, using fluorescence resonance energy transfer. Our results suggest that the interaction between the loops is the sum of a number of component interactions. Some sequence variants such as A10U, G+1A, and C25U exhibit loss of cooperativity and reduced affinity of apparent magnesium ion binding. These variants are also very impaired in ribozyme cleavage activity. Nucleotides A10, G+1, and C25 thus appear to be essential in creating the conformational environment necessary for ion binding. The double variant G+1A/C25U exhibits a marked recovery of both folding and catalytic activity compared to either individual variant, consistent with the proposal of a triple-base interaction among A9, G+1, and C25 [Pinard, R., Lambert, D., Walter, N. G., Heckman, J. E., Major, F., and Burke, J. M. (1999) Biochemistry 38, 16035-16039]. However, substitution of A9 leads to relatively small changes in folding properties and cleavage activity, and the double variant G+1DAP/C25U (DAP is 2,6-diaminopurine), which could form an isosteric triple-base interaction, exhibits folding and cleavage activities that are both very impaired compared to those of the natural sequence. Our results indicate an important role for a Watson--Crick base pair between G+1 and C25; this may be buttressed by an interaction with A9, but the loss of this has less significant consequences for folding. 2'-Deoxyribose substitution leads to folding with reduced magnesium ion affinity in the following order: unmodified RNA > dA9

  9. Short barb: a feather structure mutation in Japanese quail.

    Science.gov (United States)

    Fulton, J E; Roberts, C W; Nichols, C R; Cheng, K M

    1982-12-01

    A type of feather structure abnormality in Japanese quail resulting in shortened barbs on contour feathers was found to be controlled by a single autosomal recessive gene, sh (short barb). The mutation was first identified in a full-sib family from the University of British Columbia wild type line. Unlike other feather structure mutations in Japanese quail reported previously in literature, the short barb mutation is not associated with poor reproduction.

  10. Coloring Jupiter's clouds: Radiolysis of ammonium hydrosulfide (NH4SH)

    Science.gov (United States)

    Loeffler, Mark J.; Hudson, Reggie L.

    2018-03-01

    Here we present our recent studies on the color and spectral reflectance changes induced by ∼0.9 MeV proton irradiation of ammonium hydrosulfide, NH4SH, a compound predicted to be an important tropospheric cloud component of Jupiter and other giant planets. Ultraviolet-visible spectroscopy was used to observe and identify reaction products in the ice sample and digital photography was used to document the corresponding color changes at 10-160 K. Our experiments clearly show that the resulting color of the sample depends not only on the irradiation dose but also the irradiation temperature. Furthermore, unlike in our most recent studies of irradiation of NH4SH at 120 K, which showed that higher irradiation doses caused the sample to appear green, the lower temperature studies now show that the sample becomes red after irradiation. However, comparison of these lower temperature spectra over the entire spectral range observed by HST shows that even though the color and spectrum resemble the color and spectrum of the GRS, there is still enough difference to suggest that another component may be needed to adequately fit spectra of the GRS and other red regions of Jupiter's clouds. Regardless, the presence of NH4SH in the atmosphere of Jupiter and other gas giants, combined with this compound's clear alteration via radiolysis, suggests that its contribution to the ultraviolet-visible spectra of any of these object's clouds is significant.

  11. Adaptor proteins intersectin 1 and 2 bind similar proline-rich ligands but are differentially recognized by SH2 domain-containing proteins.

    Directory of Open Access Journals (Sweden)

    Olga Novokhatska

    Full Text Available BACKGROUND: Scaffolding proteins of the intersectin (ITSN family, ITSN1 and ITSN2, are crucial for the initiation stage of clathrin-mediated endocytosis. These proteins are closely related but have implications in distinct pathologies. To determine how these proteins could be separated in certain cell pathways we performed a comparative study of ITSNs. METHODOLOGY/PRINCIPAL FINDINGS: We have shown that endogenous ITSN1 and ITSN2 colocalize and form a complex in cells. A structural comparison of five SH3 domains, which mediated most ITSNs protein-protein interactions, demonstrated a similarity of their ligand-binding sites. We showed that the SH3 domains of ITSN2 bound well-established interactors of ITSN1 as well as newly identified ITSNs protein partners. A search for a novel interacting interface revealed multiple tyrosines that could be phosphorylated in ITSN2. Phosphorylation of ITSN2 isoforms but not ITSN1 short isoform was observed in various cell lines. EGF stimulation of HeLa cells enhanced tyrosine phosphorylation of ITSN2 isoforms and enabled their recognition by the SH2 domains of the Fyn, Fgr and Abl1 kinases, the regulatory subunit of PI3K, the adaptor proteins Grb2 and Crk, and phospholipase C gamma. The SH2 domains mentioned were unable to bind ITSN1 short isoform. CONCLUSIONS/SIGNIFICANCE: Our results indicate that during evolution of vertebrates ITSN2 acquired a novel protein-interaction interface that allows its specific recognition by the SH2 domains of signaling proteins. We propose that these data could be important to understand the functional diversity of paralogous ITSN proteins.

  12. Abl N-terminal cap stabilization of SH3 domain dynamics.

    Science.gov (United States)

    Chen, Shugui; Dumitrescu, Teodora Pene; Smithgall, Thomas E; Engen, John R

    2008-05-27

    Crystal structures and other biochemical data indicate that the N-terminal cap (NCap) region of the Abelson tyrosine kinase (c-Abl) is important for maintaining the downregulated conformation of the kinase domain. The exact contributions that the NCap makes in stabilizing the various intramolecular interactions within c-Abl are less clear. While the NCap appears to be important for locking the SH3 and SH2 domains to the back of the kinase domain, there may be other more subtle elements of regulation. Hydrogen exchange (HX) and mass spectrometry (MS) were used to determine if the NCap contributes to intramolecular interactions involving the Abl SH3 domain. Under physiological conditions, the Abl SH3 domain underwent partial unfolding and its unfolding half-life was slowed during binding to the SH2 kinase linker, providing a unique assay for testing NCap-induced stabilization of the SH3 domain in various constructs. The results showed that the NCap stabilizes the dynamics of the SH3 domain in certain constructs but does not increase the relative affinity of the SH3 domain for the native SH2 kinase linker. The stabilization effect was absent in constructs of just the NCap and SH3 but was obvious when the SH2 domain and the SH2 kinase linker were present. These results suggest that interactions between the NCap and the SH3 domain can contribute to c-Abl stabilization in constructs that contain at least the SH2 domain, an effect that may partially compensate for the absence of the negative regulatory C-terminal tail found in the related Src family of kinases.

  13. SH2-catalytic domain linker heterogeneity influences allosteric coupling across the SFK family.

    Science.gov (United States)

    Register, A C; Leonard, Stephen E; Maly, Dustin J

    2014-11-11

    Src-family kinases (SFKs) make up a family of nine homologous multidomain tyrosine kinases whose misregulation is responsible for human disease (cancer, diabetes, inflammation, etc.). Despite overall sequence homology and identical domain architecture, differences in SH3 and SH2 regulatory domain accessibility and ability to allosterically autoinhibit the ATP-binding site have been observed for the prototypical SFKs Src and Hck. Biochemical and structural studies indicate that the SH2-catalytic domain (SH2-CD) linker, the intramolecular binding epitope for SFK SH3 domains, is responsible for allosterically coupling SH3 domain engagement to autoinhibition of the ATP-binding site through the conformation of the αC helix. As a relatively unconserved region between SFK family members, SH2-CD linker sequence variability across the SFK family is likely a source of nonredundant cellular functions between individual SFKs via its effect on the availability of SH3 and SH2 domains for intermolecular interactions and post-translational modification. Using a combination of SFKs engineered with enhanced or weakened regulatory domain intramolecular interactions and conformation-selective inhibitors that report αC helix conformation, this study explores how SH2-CD sequence heterogeneity affects allosteric coupling across the SFK family by examining Lyn, Fyn1, and Fyn2. Analyses of Fyn1 and Fyn2, isoforms that are identical but for a 50-residue sequence spanning the SH2-CD linker, demonstrate that SH2-CD linker sequence differences can have profound effects on allosteric coupling between otherwise identical kinases. Most notably, a dampened allosteric connection between the SH3 domain and αC helix leads to greater autoinhibitory phosphorylation by Csk, illustrating the complex effects of SH2-CD linker sequence on cellular function.

  14. NEAR-INFRARED IMAGING OF THE STAR-FORMING REGIONS SH2-157 AND SH2-152

    International Nuclear Information System (INIS)

    Chen Yafeng; Yang Ji; Zeng Qin; Yao Yongqiang; Sato, Shuji

    2009-01-01

    Near-infrared JHK' and H 2 v = 1-0 S (1) imaging observations of the star-forming regions Sh2-157 and Sh2-152 are presented. The data reveal a cluster of young stars associated with H 2 line emission in each region. Additionally, many IR point sources are found in the dense core of each molecular cloud. Most of these sources exhibit infrared color excesses typical of T Tauri stars, Herbig Ae/Be stars, and protostars. Several display the characteristics of massive stars. We calculate histograms of the K'-magnitude and [H - K'] color for all sources, as well as two-color and color-magnitude diagrams. The stellar populations inside and outside the clusters are similar, suggesting that these systems are rather evolved. Shock-driven H 2 emission knots are also detected, which may be related to evident subclusters in an earlier evolutionary stage.

  15. Mutation in the β-hairpin of the Bordetella pertussis adenylate cyclase toxin modulates N-lobe conformation in calmodulin

    International Nuclear Information System (INIS)

    Springer, Tzvia I.; Goebel, Erich; Hariraju, Dinesh; Finley, Natosha L.

    2014-01-01

    Highlights: • Bordetella pertussis adenylate cyclase toxin modulates bi-lobal structure of CaM. • The structure and stability of the complex rely on intermolecular associations. • A novel mode of CaM-dependent activation of the adenylate cyclase toxin is proposed. - Abstract: Bordetella pertussis, causative agent of whooping cough, produces an adenylate cyclase toxin (CyaA) that is an important virulence factor. In the host cell, the adenylate cyclase domain of CyaA (CyaA-ACD) is activated upon association with calmodulin (CaM), an EF-hand protein comprised of N- and C-lobes (N-CaM and C-CaM, respectively) connected by a flexible tether. Maximal CyaA-ACD activation is achieved through its binding to both lobes of intact CaM, but the structural mechanisms remain unclear. No high-resolution structure of the intact CaM/CyaA-ACD complex is available, but crystal structures of isolated C-CaM bound to CyaA-ACD shed light on the molecular mechanism by which this lobe activates the toxin. Previous studies using molecular modeling, biochemical, and biophysical experiments demonstrate that CyaA-ACD’s β-hairpin participates in site-specific interactions with N-CaM. In this study, we utilize nuclear magnetic resonance (NMR) spectroscopy to probe the molecular association between intact CaM and CyaA-ACD. Our results indicate binding of CyaA-ACD to CaM induces large conformational perturbations mapping to C-CaM, while substantially smaller structural changes are localized primarily to helices I, II, and IV, and the metal-binding sites in N-CaM. Site-specific mutations in CyaA-ACD’s β-hairpin structurally modulate N-CaM, resulting in conformational perturbations in metal binding sites I and II, while no significant structural modifications are observed in C-CaM. Moreover, dynamic light scattering (DLS) analysis reveals that mutation of the β-hairpin results in a decreased hydrodynamic radius (R h ) and reduced thermal stability in the mutant complex. Taken together

  16. Mutation in the β-hairpin of the Bordetella pertussis adenylate cyclase toxin modulates N-lobe conformation in calmodulin

    Energy Technology Data Exchange (ETDEWEB)

    Springer, Tzvia I.; Goebel, Erich; Hariraju, Dinesh [Department of Microbiology, Miami University, Oxford, OH 45056 (United States); Finley, Natosha L., E-mail: finleynl@miamioh.edu [Department of Microbiology, Miami University, Oxford, OH 45056 (United States); Cell, Molecular, and Structural Biology Program, Miami University, Oxford, OH 45056 (United States)

    2014-10-10

    Highlights: • Bordetella pertussis adenylate cyclase toxin modulates bi-lobal structure of CaM. • The structure and stability of the complex rely on intermolecular associations. • A novel mode of CaM-dependent activation of the adenylate cyclase toxin is proposed. - Abstract: Bordetella pertussis, causative agent of whooping cough, produces an adenylate cyclase toxin (CyaA) that is an important virulence factor. In the host cell, the adenylate cyclase domain of CyaA (CyaA-ACD) is activated upon association with calmodulin (CaM), an EF-hand protein comprised of N- and C-lobes (N-CaM and C-CaM, respectively) connected by a flexible tether. Maximal CyaA-ACD activation is achieved through its binding to both lobes of intact CaM, but the structural mechanisms remain unclear. No high-resolution structure of the intact CaM/CyaA-ACD complex is available, but crystal structures of isolated C-CaM bound to CyaA-ACD shed light on the molecular mechanism by which this lobe activates the toxin. Previous studies using molecular modeling, biochemical, and biophysical experiments demonstrate that CyaA-ACD’s β-hairpin participates in site-specific interactions with N-CaM. In this study, we utilize nuclear magnetic resonance (NMR) spectroscopy to probe the molecular association between intact CaM and CyaA-ACD. Our results indicate binding of CyaA-ACD to CaM induces large conformational perturbations mapping to C-CaM, while substantially smaller structural changes are localized primarily to helices I, II, and IV, and the metal-binding sites in N-CaM. Site-specific mutations in CyaA-ACD’s β-hairpin structurally modulate N-CaM, resulting in conformational perturbations in metal binding sites I and II, while no significant structural modifications are observed in C-CaM. Moreover, dynamic light scattering (DLS) analysis reveals that mutation of the β-hairpin results in a decreased hydrodynamic radius (R{sub h}) and reduced thermal stability in the mutant complex. Taken

  17. Physical and functional interactions between SH2 and SH3 domains of the Src family protein tyrosine kinase p59fyn

    NARCIS (Netherlands)

    Panchamoorthy, G.; Fukazawa, T.; Stolz, L.; Payne, G.; Reedquist, K.; Shoelson, S.; Songyang, Z.; Cantley, L.; Walsh, C.; Band, H.

    1994-01-01

    The Src family protein tyrosine kinases participate in signalling through cell surface receptors that lack intrinsic tyrosine kinase domains. All nine members of this family possess adjacent Src homology (SH2 and SH3) domains, both of which are essential for repression of the enzymatic activity. The

  18. An amplified graphene oxide-based fluorescence aptasensor based on target-triggered aptamer hairpin switch and strand-displacement polymerization recycling for bioassays.

    Science.gov (United States)

    Hu, Kun; Liu, Jinwen; Chen, Jia; Huang, Yong; Zhao, Shulin; Tian, Jianniao; Zhang, Guohai

    2013-04-15

    An amplified graphene oxide (GO) based fluorescence aptasensor based on target-triggered aptamer hairpin switch and strand-displacement polymerization recycling is developed for bioassays. The dye-labeled single-strand DNA (aptamer hairpin) was adsorbed on the surface of GO, which result in the fluorescence quenching of dye, and exhibiting minimal background fluorescence. Upon the target, primer and polymerase, the stem of the aptamer hairpin was opened, and binds with the primer to triggers the circular target strand-displacement polymerization reaction, which produces huge amounts of duplex helixes DNA and lead to strong fluorescence emission due to shielding of nucelobases within its double-helix structure. During the polymerization reaction, the primer was extended, and target was displaced. And the displaced target recognizes and hybridizes with another hairpin probe, triggering the next round of polymerization reaction, and the circle process induces fluorescence signal amplification for the detection of analyte. To test the feasibility of the aptasensor systems, interferon-gamma (IFN-γ) was employed as a model analyte. A detection limit as low as 1.5 fM is obtained based on the GO aptasensor with a linear range of three orders of magnitude. The present method was successfully applied for the detection of IFN-γ in human plasma. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Electronic Detection of DNA Hybridization by Coupling Organic Field-Effect Transistor-Based Sensors and Hairpin-Shaped Probes

    Directory of Open Access Journals (Sweden)

    Corrado Napoli

    2018-03-01

    Full Text Available In this paper, the electronic transduction of DNA hybridization is presented by coupling organic charge-modulated field-effect transistors (OCMFETs and hairpin-shaped probes. These probes have shown interesting properties in terms of sensitivity and selectivity in other kinds of assays, in the form of molecular beacons (MBs. Their integration with organic-transistor based sensors, never explored before, paves the way to a new class of low-cost, easy-to-use, and portable genetic sensors with enhanced performances. Thanks to the peculiar characteristics of the employed sensor, measurements can be performed at relatively high ionic strengths, thus optimizing the probes’ functionality without affecting the detection ability of the device. A complete electrical characterization of the sensor is reported, including calibration with different target concentrations in the measurement environment and selectivity evaluation. In particular, DNA hybridization detection for target concentration as low as 100 pM is demonstrated.

  20. Differentiation of the SH-SY5Y Human Neuroblastoma Cell Line.

    Science.gov (United States)

    Shipley, Mackenzie M; Mangold, Colleen A; Szpara, Moriah L

    2016-02-17

    Having appropriate in vivo and in vitro systems that provide translational models for human disease is an integral aspect of research in neurobiology and the neurosciences. Traditional in vitro experimental models used in neurobiology include primary neuronal cultures from rats and mice, neuroblastoma cell lines including rat B35 and mouse Neuro-2A cells, rat PC12 cells, and short-term slice cultures. While many researchers rely on these models, they lack a human component and observed experimental effects could be exclusive to the respective species and may not occur identically in humans. Additionally, although these cells are neurons, they may have unstable karyotypes, making their use problematic for studies of gene expression and reproducible studies of cell signaling. It is therefore important to develop more consistent models of human neurological disease. The following procedure describes an easy-to-follow, reproducible method to obtain homogenous and viable human neuronal cultures, by differentiating the chromosomally stable human neuroblastoma cell line, SH-SY5Y. This method integrates several previously described methods(1-4) and is based on sequential removal of serum from media. The timeline includes gradual serum-starvation, with introduction of extracellular matrix proteins and neurotrophic factors. This allows neurons to differentiate, while epithelial cells are selected against, resulting in a homogeneous neuronal culture. Representative results demonstrate the successful differentiation of SH-SY5Y neuroblastoma cells from an initial epithelial-like cell phenotype into a more expansive and branched neuronal phenotype. This protocol offers a reliable way to generate homogeneous populations of neuronal cultures that can be used for subsequent biochemical and molecular analyses, which provides researchers with a more accurate translational model of human infection and disease.

  1. Visual detection of STAT5B gene expression in living cell using the hairpin DNA modified gold nanoparticle beacon.

    Science.gov (United States)

    Xue, Jianpeng; Shan, Lingling; Chen, Haiyan; Li, Yang; Zhu, Hongyan; Deng, Dawei; Qian, Zhiyu; Achilefu, Samuel; Gu, Yueqing

    2013-03-15

    Signal transducer and activator of transcription 5B (STAT5B) is an important protein in JAK-STAT signaling pathway that is responsible for the metastasis and proliferation of tumor cells. Determination of the STAT5B messenger Ribonucleic Acid (mRNA) relating to the STAT5B expression provides insight into the mechanism of tumor progression. In this study, we designed and used a special hairpin deoxyribonucleic acid (DNA) for human STAT5B mRNA to functionalize gold nanoparticles, which served as a beacon for detecting human STAT5B expression. Up to 90% quenching efficiency was achieved. Upon hybridizing with the target mRNA, the hairpin DNA modified gold nanoparticle beacons (hDAuNP beacons) release the fluorophores attached at 5' end of the oligonucleotide sequence. The fluorescence properties of the beacon before and after the hybridization with the complementary DNA were confirmed in vitro. The stability of hDAuNP beacons against degradation by DNase I and GSH indicated that the prepared beacon is stable inside cells. The detected fluorescence in MCF-7 cancer cells correlates with the specific STAT5B mRNA expression, which is consistent with the result from PCR measurement. Fluorescence microscopy showed that the hDAuNP beacons internalized in cells without using transfection agents, with intracellular distribution in the cytoplasm rather than the nucleus. The results demonstrated that this beacon could directly provide quantitative measurement of the intracellular STAT5B mRNA in living cells. Compared to the previous approaches, this beacon has advantages of higher target to background ratio of detection and an increased resistance to nuclease degradation. The strategy reported in this study is a promising approach for the intracellular measurement of RNA or protein expression in living cells, and has great potential in the study of drug screening and discovery. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. Differential RNAi responses of Nicotiana benthamiana individuals transformed with a hairpin-inducing construct during Plum pox virus challenge.

    Science.gov (United States)

    Montes, Christian; Castro, Álvaro; Barba, Paola; Rubio, Julia; Sánchez, Evelyn; Carvajal, Denisse; Aguirre, Carlos; Tapia, Eduardo; DelÍ Orto, Paola; Decroocq, Veronique; Prieto, Humberto

    2014-10-01

    Gene silencing and large-scale small RNA analysis can be used to develop RNA interference (RNAi)-based resistance strategies for Plum pox virus (PPV), a high impact disease of Prunus spp. In this study, a pPPViRNA hairpin-inducing vector harboring two silencing motif-rich regions of the PPV coat protein (CP) gene was evaluated in transgenic Nicotiana benthamiana (NB) plants. Wild-type NB plants infected with a chimeric PPV virus (PPV::GFP) exhibited affected leaves with mosaic chlorosis congruent to GFP fluorescence at 21 day post-inoculation; transgenic lines depicted a range of phenotypes from fully resistant to susceptible. ELISA values and GFP fluorescence intensities were used to select transgenic-resistant (TG-R) and transgenic-susceptible (TG-S) lines for further characterization of small interfering RNAs (siRNAs) by large-scale small RNA sequencing. In infected TG-S and untransformed (WT) plants, the observed siRNAs were nearly exclusively 21- and 22-nt siRNAs that targeted the whole PPV::GFP genome; 24-nt siRNAs were absent in these individuals. Challenged TG-R plants accumulated a full set of 21- to 24-nt siRNAs that were primarily associated with the selected motif-rich regions, indicating that a trans-acting siRNAs process prevented viral multiplication. BLAST analysis identified 13 common siRNA clusters targeting the CP gene. 21-nt siRNA sequences were associated with the 22-nt siRNAs and the scarce 23- and 24-nt molecules in TG-S plants and with most of the observed 22-, 23-, and 24-nt siRNAs in TG-R individuals. These results validate the use of a multi-hot spot silencing vector against PPV and elucidate the molecules by which hairpin-inducing vectors initiate RNAi in vivo.

  3. A study of the influence of charged residues on β-hairpin formation by nuclear magnetic resonance and molecular dynamics.

    Science.gov (United States)

    Makowska, Joanna; Zmudzińska, Wioletta; Uber, Dorota; Chmurzyński, Lech

    2014-12-01

    Chain reversals are often nucleation sites in protein folding. The β-hairpins of FBP28 WW domain and IgG are stable and have been proved to initiate the folding and are, therefore, suitable for studying the influence of charged residues on β-hairpin conformation. In this paper, we carried out NMR examination of the conformations in solution of two fragments from the FPB28 protein (PDB code: 1E0L) (N-terminal part) namely KTADGKT-NH2 (1E0L 12-18, D7) and YKTADGKTY-NH2 (1E0L 11-19, D9), one from the B3 domain of the protein G (PDB code: 1IGD), namely DDATKT-NH2 (1IGD 51-56) (Dag1), and three variants of Dag1 peptide: DVATKT-NH2 (Dag2), OVATKT-NH2 (Dag3) and KVATKT-NH2 (Dag4), respectively, in which the original charged residue were replaced with non-polar residues or modified charged residues. It was found that both the D7 and D9 peptides form a large fraction bent conformations. However, no hydrophobic contacts between the terminal Tyr residues of D9 occur, which suggests that the presence of a pair of like-charged residues stabilizes chain reversal. Conversely, only the Dag1 and Dag2 peptides exhibit some chain reversal; replacing the second aspartic-acid residue with a valine and the first one with a basic residue results in a nearly extended conformation. These results suggest that basic residues farther away in sequence can result in stabilization of chain reversal owing to screening of the non-polar core. Conversely, smaller distance in sequence prohibits this screening, while the presence oppositely-charged residues can stabilize a turn because of salt-bridge formation.

  4. Curcumin stably interacts with DNA hairpin through minor groove binding and demonstrates enhanced cytotoxicity in combination with FdU nucleotides.

    Science.gov (United States)

    Ghosh, Supratim; Mallick, Sumana; Das, Upasana; Verma, Ajay; Pal, Uttam; Chatterjee, Sabyasachi; Nandy, Abhishek; Saha, Krishna D; Maiti, Nakul Chandra; Baishya, Bikash; Suresh Kumar, G; Gmeiner, William H

    2018-03-01

    We report, based on biophysical studies and molecular mechanical calculations that curcumin binds DNA hairpin in the minor groove adjacent to the loop region forming a stable complex. UV-Vis and fluorescence spectroscopy indicated interaction of curcumin with DNA hairpin. In this novel binding motif, two ɣ H of curcumin heptadiene chain are closely positioned to the A 16 -H8 and A 17 -H8, while G 12 -H8 is located in the close proximity of curcumin α H. Molecular dynamics (MD) simulations suggest, the complex is stabilized by noncovalent forces including; π-π stacking, H-bonding and hydrophobic interactions. Nuclear magnetic resonance (NMR) spectroscopy in combination with molecular dynamics simulations indicated curcumin is bound in the minor groove, while circular dichroism (CD) spectra suggested minute enhancement in base stacking and a little change in DNA helicity, without significant conformational change of DNA hairpin structure. The DNA:curcumin complex formed with FdU nucleotides rather than Thymidine, demonstrated enhanced cytotoxicity towards oral cancer cells relative to the only FdU substituted hairpin. Fluorescence co-localization demonstrated stability of the complex in biologically relevant conditions, including its cellular uptake. Acridine orange/EtBr staining further confirmed the enhanced cytotoxic effects of the complex, suggesting apoptosis as mode of cell death. Thus, curcumin can be noncovalently complexed to small DNA hairpin for cellular delivery and the complex showed increased cytotoxicity in combination with FdU nucleotides, demonstrating its potential for advanced cancer therapy. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Propagation characteristics of SH wave in an mm2 piezoelectric layer on an elastic substrate

    Directory of Open Access Journals (Sweden)

    Yanping Kong

    2015-09-01

    Full Text Available We investigate the propagation characteristics of shear horizontal (SH waves in a structure consisting of an elastic substrate and an mm2 piezoelectric layer with different cut orientations. The dispersion equations are derived for electrically open and shorted conditions on the free surface of the piezoelectric layer. The phase velocity and electromechanical coupling coefficient are calculated for a layered structure with a KNbO3 layer perfectly bonded to a diamond substrate. The dispersion curves for the electrically shorted boundary condition indicate that for a given cut orientation, the phase velocity of the first mode approaches the B-G wave velocity of the KNbO3 layer, while the phase velocities of the higher modes tend towards the limit velocity of the KNbO3 layer. For the electrically open boundary condition, the asymptotic phase velocities of all modes are the limit velocity of the KNbO3 layer. In addition, it is found that the electromechanical coupling coefficient strongly depends on the cut orientation of the KNbO3 crystal. The obtained results are useful in device applications.

  6. Genetic loss of SH2B3 in acute lymphoblastic leukemia.

    Science.gov (United States)

    Perez-Garcia, Arianne; Ambesi-Impiombato, Alberto; Hadler, Michael; Rigo, Isaura; LeDuc, Charles A; Kelly, Kara; Jalas, Chaim; Paietta, Elisabeth; Racevskis, Janis; Rowe, Jacob M; Tallman, Martin S; Paganin, Maddalena; Basso, Giuseppe; Tong, Wei; Chung, Wendy K; Ferrando, Adolfo A

    2013-10-03

    The SH2B adaptor protein 3 (SH2B3) gene encodes a negative regulator of cytokine signaling with a critical role in the homeostasis of hematopoietic stem cells and lymphoid progenitors. Here, we report the identification of germline homozygous SH2B3 mutations in 2 siblings affected with developmental delay and autoimmunity, one in whom B-precursor acute lymphoblastic leukemia (ALL) developed. Mechanistically, loss of SH2B3 increases Janus kinase-signal transducer and activator of transcription signaling, promotes lymphoid cell proliferation, and accelerates leukemia development in a mouse model of NOTCH1-induced ALL. Moreover, extended mutation analysis showed homozygous somatic mutations in SH2B3 in 2 of 167 ALLs analyzed. Overall, these results demonstrate a Knudson tumor suppressor role for SH2B3 in the pathogenesis of ALL and highlight a possible link between genetic predisposition factors in the pathogenesis of autoimmunity and leukemogenesis.

  7. Characterizing SH2 Domain Specificity and Network Interactions Using SPOT Peptide Arrays.

    Science.gov (United States)

    Liu, Bernard A

    2017-01-01

    Src Homology 2 (SH2) domains are protein interaction modules that recognize and bind tyrosine phosphorylated ligands. Their ability to distinguish binding to over thousands of potential phosphotyrosine (pTyr) ligands within the cell is critical for the fidelity of receptor tyrosine kinase (RTK) signaling. Within humans there are over a hundred SH2 domains with more than several thousand potential ligands across many cell types and cell states. Therefore, defining the specificity of individual SH2 domains is critical for predicting and identifying their physiological ligands. Here, in this chapter, I describe the broad use of SPOT peptide arrays for examining SH2 domain specificity. An orientated peptide array library (OPAL) approach can uncover both favorable and non-favorable residues, thus providing an in-depth analysis to SH2 specificity. Moreover, I discuss the application of SPOT arrays for paneling SH2 ligand binding with physiological peptides.

  8. Distinct mechanisms of a phosphotyrosyl peptide binding to two SH2 domains.

    Science.gov (United States)

    Pang, Xiaodong; Zhou, Huan-Xiang

    2014-05-01

    Protein phosphorylation is very common post-translational modification, catalyzed by kinases, for signaling and regulation. Phosphotyrosines frequently target SH2 domains. The spleen tyrosine kinase (Syk) is critical for tyrosine phosphorylation of multiple proteins and for regulation of important pathways. Phosphorylation of both Y342 and Y346 in Syk linker B is required for optimal signaling. The SH2 domains of Vav1 and PLC-γ both bind this doubly phosphorylated motif. Here we used a recently developed method to calculate the effects of Y342 and Y346 phosphorylation on the rate constants of a peptide from Syk linker B binding to the SH2 domains of Vav1 and PLC-γ. The predicted effects agree well with experimental observations. Moreover, we found that the same doubly phosphorylated peptide binds the two SH2 domains via distinct mechanisms, with apparent rigid docking for Vav1 SH2 and dock-and-coalesce for PLC-γ SH2.

  9. Short communication

    African Journals Online (AJOL)

    abp

    2017-09-04

    Sep 4, 2017 ... Face-to-face interviews were conducted using a standardized ... Short communication. Open Access ... clinic during the time of the study and were invited to participate in the study. .... consume them. This is another ...

  10. SHORT COMMUNICATION

    African Journals Online (AJOL)

    PROF P.T. KAYE

    . SHORT COMMUNICATION. Formation and Structural Analysis of Novel Dibornyl Ethers. Perry T. Kaye*, Andrew R. Duggan, Joseph M. Matjila, Warner E. Molema, and. Swarnam S. Ravindran. Department of Chemistry, Rhodes University, Grahamstown, ...

  11. Structural Characterization of Monomeric/Dimeric State of p59fyn SH2 Domain.

    Science.gov (United States)

    Huculeci, Radu; Kieken, Fabien; Garcia-Pino, Abel; Buts, Lieven; van Nuland, Nico; Lenaerts, Tom

    2017-01-01

    Src homology 2 (SH2) domains are key modulators in various signaling pathways allowing the recognition of phosphotyrosine sites of different proteins. Despite the fact that SH2 domains acquire their biological functions in a monomeric state, a multitude of reports have shown their tendency to dimerize. Here, we provide a technical description on how to isolate and characterize by gel filtration, circular dichroism (CD), and nuclear magnetic resonance (NMR) each conformational state of p59 fyn SH2 domain.

  12. The SH2D2A gene and susceptibility to multiple sclerosis

    DEFF Research Database (Denmark)

    Lorentzen, A.R.; Smestad, C.; Lie, B.A.

    2008-01-01

    We previously reported an association between the SH2D2A gene encoding TSAd and multiple sclerosis (MS). Here a total of 2128 Nordic MS patients and 2004 controls were genotyped for the SH2D2A promoter GA repeat polymorphism and rs926103 encoding a serine to asparagine substitution at amino acid...... that the SH2D2A gene may contribute to susceptibility to MS Udgivelsesdato: 2008/7/15...

  13. SH2 Ligand Prediction-Guidance for In-Silico Screening.

    Science.gov (United States)

    Li, Shawn S C; Li, Lei

    2017-01-01

    Systematic identification of binding partners for SH2 domains is important for understanding the biological function of the corresponding SH2 domain-containing proteins. Here, we describe two different web-accessible computer programs, SMALI and DomPep, for predicting binding ligands for SH2 domains. The former was developed using a Scoring Matrix method and the latter based on the Support Vector Machine model.

  14. Binding Assays Using Recombinant SH2 Domains: Far-Western, Pull-Down, and Fluorescence Polarization.

    Science.gov (United States)

    Machida, Kazuya; Liu, Bernard

    2017-01-01

    Recognition of phosphotyrosine-containing sequences by SH2 domains confers specificity in tyrosine kinase pathways. By assessing interactions between isolated SH2 domains and their binding proteins, it is possible to gain insight into otherwise inaccessible complex cellular systems. Far-Western, pull-down, and fluorescence polarization (FP) have been frequently used for characterization of phosphotyrosine signaling. Here, we outline standard protocols for these established assays using recombinant SH2 domain, emphasizing the importance of appropriate sample preparation and assay controls.

  15. Functional diversity of Csk, Chk, and Src SH2 domains due to a single residue variation.

    Science.gov (United States)

    Ayrapetov, Marina K; Nam, Nguyen Hai; Ye, Guofeng; Kumar, Anil; Parang, Keykavous; Sun, Gongqin

    2005-07-08

    The C-terminal Src kinase (Csk) family of protein tyrosine kinases contains two members: Csk and Csk homologous kinase (Chk). Both phosphorylate and inactivate Src family kinases. Recent reports suggest that the Src homology (SH) 2 domains of Csk and Chk may bind to different phosphoproteins, which provides a basis for different cellular functions for Csk and Chk. To verify and characterize such a functional divergence, we compared the binding properties of the Csk, Chk, and Src SH2 domains and investigated the structural basis for the functional divergence. First, the study demonstrated striking functional differences between the Csk and Chk SH2 domains and revealed functional similarities between the Chk and Src SH2 domains. Second, structural analysis and mutagenic studies revealed that the functional differences among the three SH2 domains were largely controlled by one residue, Glu127 in Csk, Ile167 in Chk, and Lys200 in Src. Mutating these residues in the Csk or Chk SH2 domain to the Src counterpart resulted in dramatic gain of function similar to Src SH2 domain, whereas mutating Lys200 in Src SH2 domain to Glu (the Csk counterpart) resulted in loss of Src SH2 function. Third, a single point mutation of E127K rendered Csk responsive to activation by a Src SH2 domain ligand. Finally, the optimal phosphopeptide sequence for the Chk SH2 domain was determined. These results provide a compelling explanation for the functional differences between two homologous protein tyrosine kinases and reveal a new structure-function relationship for the SH2 domains.

  16. Crystal structure of an SH2-kinase construct of c-Abl and effect of the SH2 domain on kinase activity.

    Science.gov (United States)

    Lorenz, Sonja; Deng, Patricia; Hantschel, Oliver; Superti-Furga, Giulio; Kuriyan, John

    2015-06-01

    Constitutive activation of the non-receptor tyrosine kinase c-Abl (cellular Abelson tyrosine protein kinase 1, Abl1) in the Bcr (breakpoint cluster region)-Abl1 fusion oncoprotein is the molecular cause of chronic myeloid leukaemia (CML). Recent studies have indicated that an interaction between the SH2 (Src-homology 2) domain and the N-lobe (N-terminal lobe) of the c-Abl kinase domain (KD) has a critical role in leukaemogenesis [Grebien et al. (2011) Cell 147, 306-319; Sherbenou et al. (2010) Blood 116, 3278-3285]. To dissect the structural basis of this phenomenon, we studied c-Abl constructs comprising the SH2 and KDs in vitro. We present a crystal structure of an SH2-KD construct bound to dasatinib, which contains the relevant interface between the SH2 domain and the N-lobe of the KD. We show that the presence of the SH2 domain enhances kinase activity moderately and that this effect depends on contacts in the SH2/N-lobe interface and is abrogated by specific mutations. Consistently, formation of the interface decreases slightly the association rate of imatinib with the KD. That the effects are small compared with the dramatic in vivo consequences suggests an important function of the SH2-N-lobe interaction might be to help disassemble the auto-inhibited conformation of c-Abl and promote processive phosphorylation, rather than substantially stimulate kinase activity.

  17. SH2/SH3 adaptor proteins can link tyrosine kinases to a Ste20-related protein kinase, HPK1.

    Science.gov (United States)

    Anafi, M; Kiefer, F; Gish, G D; Mbamalu, G; Iscove, N N; Pawson, T

    1997-10-31

    Ste20-related protein kinases have been implicated as regulating a range of cellular responses, including stress-activated protein kinase pathways and the control of cytoskeletal architecture. An important issue involves the identities of the upstream signals and regulators that might control the biological functions of mammalian Ste20-related protein kinases. HPK1 is a protein-serine/threonine kinase that possesses a Ste20-like kinase domain, and in transfected cells activates a protein kinase pathway leading to the stress-activated protein kinase SAPK/JNK. Here we have investigated candidate upstream regulators that might interact with HPK1. HPK1 possesses an N-terminal catalytic domain and an extended C-terminal tail with four proline-rich motifs. The SH3 domains of Grb2 bound in vitro to specific proline-rich motifs in the HPK1 tail and functioned synergistically to direct the stable binding of Grb2 to HPK1 in transfected Cos1 cells. Epidermal growth factor (EGF) stimulation did not affect the binding of Grb2 to HPK1 but induced recruitment of the Grb2.HPK1 complex to the autophosphorylated EGF receptor and to the Shc docking protein. Several activated receptor and cytoplasmic tyrosine kinases, including the EGF receptor, stimulated the tyrosine phosphorylation of the HPK1 serine/threonine kinase. These results suggest that HPK1, a mammalian Ste20-related protein-serine/threonine kinase, can potentially associate with protein-tyrosine kinases through interactions mediated by SH2/SH3 adaptors such as Grb2. Such interaction may provide a possible mechanism for cross-talk between distinct biochemical pathways following the activation of tyrosine kinases.

  18. Purification of SOCS (Suppressor of Cytokine Signaling) SH2 Domains for Structural and Functional Studies.

    Science.gov (United States)

    Liau, Nicholas P D; Laktyushin, Artem; Babon, Jeffrey J

    2017-01-01

    Src Homology 2 (SH2) domains are protein domains which have a high binding affinity for specific amino acid sequences containing a phosphorylated tyrosine residue. The Suppressors of Cytokine Signaling (SOCS) proteins use an SH2 domain to bind to components of certain cytokine signaling pathways to downregulate the signaling cascade. The recombinantly produced SH2 domains of various SOCS proteins have been used to undertake structural and functional studies elucidating the method of how such targeting occurs. Here, we describe the protocol for the recombinant production and purification of SOCS SH2 domains, with an emphasis on SOCS3.

  19. Distinct ubiquitin binding modes exhibited by SH3 domains: molecular determinants and functional implications.

    Directory of Open Access Journals (Sweden)

    Jose L Ortega Roldan

    Full Text Available SH3 domains constitute a new type of ubiquitin-binding domains. We previously showed that the third SH3 domain (SH3-C of CD2AP binds ubiquitin in an alternative orientation. We have determined the structure of the complex between first CD2AP SH3 domain and ubiquitin and performed a structural and mutational analysis to decipher the determinants of the SH3-C binding mode to ubiquitin. We found that the Phe-to-Tyr mutation in CD2AP and in the homologous CIN85 SH3-C domain does not abrogate ubiquitin binding, in contrast to previous hypothesis and our findings for the first two CD2AP SH3 domains. The similar alternative binding mode of the SH3-C domains of these related adaptor proteins is characterised by a higher affinity to C-terminal extended ubiquitin molecules. We conclude that CD2AP/CIN85 SH3-C domain interaction with ubiquitin constitutes a new ubiquitin-binding mode involved in a different cellular function and thus changes the previously established mechanism of EGF-dependent CD2AP/CIN85 mono-ubiquitination.

  20. New investigation on THz spectra of OH and SH radicals (X∏)

    Science.gov (United States)

    Martin-Drumel, M. A.; Eliet, S.; Pirali, O.; Guinet, M.; Hindle, F.; Mouret, G.; Cuisset, A.

    2012-10-01

    Pure rotational transitions of OH and SH radicals have been recorded in the THz spectral range using cw-THz and synchrotron-based FT-FIR techniques. Line lists on these radicals have been completed in the three and two lowest vibrational states for OH and SH, respectively. Furthermore, the hyperfine structure of OH and SH has been observed for the first time using infrared IR FT-spectroscopy, and at frequencies higher than 1 THz, respectively. A combined fit has been made for each of these radicals including v = 0, 1 and 2 for OH and v = 0 and 1 for SH.

  1. Bayesian modeling of the yeast SH3 domain interactome predicts spatiotemporal dynamics of endocytosis proteins.

    Directory of Open Access Journals (Sweden)

    Raffi Tonikian

    2009-10-01

    Full Text Available SH3 domains are peptide recognition modules that mediate the assembly of diverse biological complexes. We scanned billions of phage-displayed peptides to map the binding specificities of the SH3 domain family in the budding yeast, Saccharomyces cerevisiae. Although most of the SH3 domains fall into the canonical classes I and II, each domain utilizes distinct features of its cognate ligands to achieve binding selectivity. Furthermore, we uncovered several SH3 domains with specificity profiles that clearly deviate from the two canonical classes. In conjunction with phage display, we used yeast two-hybrid and peptide array screening to independently identify SH3 domain binding partners. The results from the three complementary techniques were integrated using a Bayesian algorithm to generate a high-confidence yeast SH3 domain interaction map. The interaction map was enriched for proteins involved in endocytosis, revealing a set of SH3-mediated interactions that underlie formation of protein complexes essential to this biological pathway. We used the SH3 domain interaction network to predict the dynamic localization of several previously uncharacterized endocytic proteins, and our analysis suggests a novel role for the SH3 domains of Lsb3p and Lsb4p as hubs that recruit and assemble several endocytic complexes.

  2. Differential sensitivity of Src-family kinases to activation by SH3 domain displacement.

    Directory of Open Access Journals (Sweden)

    Jamie A Moroco

    Full Text Available Src-family kinases (SFKs are non-receptor protein-tyrosine kinases involved in a variety of signaling pathways in virtually every cell type. The SFKs share a common negative regulatory mechanism that involves intramolecular interactions of the SH3 domain with the PPII helix formed by the SH2-kinase linker as well as the SH2 domain with a conserved phosphotyrosine residue in the C-terminal tail. Growing evidence suggests that individual SFKs may exhibit distinct activation mechanisms dictated by the relative strengths of these intramolecular interactions. To elucidate the role of the SH3:linker interaction in the regulation of individual SFKs, we used a synthetic SH3 domain-binding peptide (VSL12 to probe the sensitivity of downregulated c-Src, Hck, Lyn and Fyn to SH3-based activation in a kinetic kinase assay. All four SFKs responded to VSL12 binding with enhanced kinase activity, demonstrating a conserved role for SH3:linker interaction in the control of catalytic function. However, the sensitivity and extent of SH3-based activation varied over a wide range. In addition, autophosphorylation of the activation loops of c-Src and Hck did not override regulatory control by SH3:linker displacement, demonstrating that these modes of activation are independent. Our results show that despite the similarity of their downregulated conformations, individual Src-family members show diverse responses to activation by domain displacement which may reflect their adaptation to specific signaling environments in vivo.

  3. Where is the happy Ending of Shāhnāma?

    OpenAIRE

    بهروز چمن آرا

    2015-01-01

    The renowned proverb “Shāhnāma axarash xoš ast” has implicit question which its answer may change our understanding of the nature and function of Shāhnāma. The end of Shāhnāma contains numerous tragic events in Sassanid age. Also it does not seem to be normal if the Iranians have deemed the bitter adventure of the Shahs and Pahlavāns as a happy ending like what Firdausi narrates at the end of his Shāhnāma. This article tries to reply the main question using an illustration on the story platfo...

  4. A graph kernel approach for alignment-free domain-peptide interaction prediction with an application to human SH3 domains.

    Science.gov (United States)

    Kundu, Kousik; Costa, Fabrizio; Backofen, Rolf

    2013-07-01

    State-of-the-art experimental data for determining binding specificities of peptide recognition modules (PRMs) is obtained by high-throughput approaches like peptide arrays. Most prediction tools applicable to this kind of data are based on an initial multiple alignment of the peptide ligands. Building an initial alignment can be error-prone, especially in the case of the proline-rich peptides bound by the SH3 domains. Here, we present a machine-learning approach based on an efficient graph-kernel technique to predict the specificity of a large set of 70 human SH3 domains, which are an important class of PRMs. The graph-kernel strategy allows us to (i) integrate several types of physico-chemical information for each amino acid, (ii) consider high-order correlations between these features and (iii) eliminate the need for an initial peptide alignment. We build specialized models for each human SH3 domain and achieve competitive predictive performance of 0.73 area under precision-recall curve, compared with 0.27 area under precision-recall curve for state-of-the-art methods based on position weight matrices. We show that better models can be obtained when we use information on the noninteracting peptides (negative examples), which is currently not used by the state-of-the art approaches based on position weight matrices. To this end, we analyze two strategies to identify subsets of high confidence negative data. The techniques introduced here are more general and hence can also be used for any other protein domains, which interact with short peptides (i.e. other PRMs). The program with the predictive models can be found at http://www.bioinf.uni-freiburg.de/Software/SH3PepInt/SH3PepInt.tar.gz. We also provide a genome-wide prediction for all 70 human SH3 domains, which can be found under http://www.bioinf.uni-freiburg.de/Software/SH3PepInt/Genome-Wide-Predictions.tar.gz. Supplementary data are available at Bioinformatics online.

  5. A graph kernel approach for alignment-free domain–peptide interaction prediction with an application to human SH3 domains

    Science.gov (United States)

    Kundu, Kousik; Costa, Fabrizio; Backofen, Rolf

    2013-01-01

    Motivation: State-of-the-art experimental data for determining binding specificities of peptide recognition modules (PRMs) is obtained by high-throughput approaches like peptide arrays. Most prediction tools applicable to this kind of data are based on an initial multiple alignment of the peptide ligands. Building an initial alignment can be error-prone, especially in the case of the proline-rich peptides bound by the SH3 domains. Results: Here, we present a machine-learning approach based on an efficient graph-kernel technique to predict the specificity of a large set of 70 human SH3 domains, which are an important class of PRMs. The graph-kernel strategy allows us to (i) integrate several types of physico-chemical information for each amino acid, (ii) consider high-order correlations between these features and (iii) eliminate the need for an initial peptide alignment. We build specialized models for each human SH3 domain and achieve competitive predictive performance of 0.73 area under precision-recall curve, compared with 0.27 area under precision-recall curve for state-of-the-art methods based on position weight matrices. We show that better models can be obtained when we use information on the noninteracting peptides (negative examples), which is currently not used by the state-of-the art approaches based on position weight matrices. To this end, we analyze two strategies to identify subsets of high confidence negative data. The techniques introduced here are more general and hence can also be used for any other protein domains, which interact with short peptides (i.e. other PRMs). Availability: The program with the predictive models can be found at http://www.bioinf.uni-freiburg.de/Software/SH3PepInt/SH3PepInt.tar.gz. We also provide a genome-wide prediction for all 70 human SH3 domains, which can be found under http://www.bioinf.uni-freiburg.de/Software/SH3PepInt/Genome-Wide-Predictions.tar.gz. Contact: backofen@informatik.uni-freiburg.de Supplementary

  6. Short Stature

    DEFF Research Database (Denmark)

    Christesen, Henrik Boye Thybo; Pedersen, Birgitte Tønnes; Pournara, Effie

    2016-01-01

    -scale, non-interventional, multinational study. The patient cohort consisted of 5996 short pediatric patients diagnosed with growth hormone deficiency (GHD), Turner syndrome (TS) or born small for gestational age (SGA). The proportions of children with baseline height standard deviation score (SDS) below......The use of appropriate growth standards/references is of significant clinical importance in assessing the height of children with short stature as it may determine eligibility for appropriate therapy. The aim of this study was to determine the impact of using World Health Organization (WHO) instead...... of national growth standards/references on height assessment in short children. Data were collected from routine clinical practice (1998-2014) from nine European countries that have available national growth references and were enrolled in NordiNet® International Outcome Study (IOS) (NCT00960128), a large...

  7. Paralog-Specific Patterns of Structural Disorder and Phosphorylation in the Vertebrate SH3-SH2-Tyrosine Kinase Protein Family.

    Science.gov (United States)

    Dos Santos, Helena G; Siltberg-Liberles, Jessica

    2016-09-19

    One of the largest multigene families in Metazoa are the tyrosine kinases (TKs). These are important multifunctional proteins that have evolved as dynamic switches that perform tyrosine phosphorylation and other noncatalytic activities regulated by various allosteric mechanisms. TKs interact with each other and with other molecules, ultimately activating and inhibiting different signaling pathways. TKs are implicated in cancer and almost 30 FDA-approved TK inhibitors are available. However, specific binding is a challenge when targeting an active site that has been conserved in multiple protein paralogs for millions of years. A cassette domain (CD) containing SH3-SH2-Tyrosine Kinase domains reoccurs in vertebrate nonreceptor TKs. Although part of the CD function is shared between TKs, it also presents TK specific features. Here, the evolutionary dynamics of sequence, structure, and phosphorylation across the CD in 17 TK paralogs have been investigated in a large-scale study. We establish that TKs often have ortholog-specific structural disorder and phosphorylation patterns, while secondary structure elements, as expected, are highly conserved. Further, domain-specific differences are at play. Notably, we found the catalytic domain to fluctuate more in certain secondary structure elements than the regulatory domains. By elucidating how different properties evolve after gene duplications and which properties are specifically conserved within orthologs, the mechanistic understanding of protein evolution is enriched and regions supposedly critical for functional divergence across paralogs are highlighted. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  8. Selective Targeting of SH2 Domain–Phosphotyrosine Interactions of Src Family Tyrosine Kinases with Monobodies

    Energy Technology Data Exchange (ETDEWEB)

    Kükenshöner, Tim; Schmit, Nadine Eliane; Bouda, Emilie; Sha, Fern; Pojer, Florence; Koide, Akiko; Seeliger, Markus; Koide, Shohei; Hantschel, Oliver

    2017-05-01

    The binding of Src-homology 2 (SH2) domains to phosphotyrosine (pY) sites is critical for the autoinhibition and substrate recognition of the eight Src family kinases (SFKs). The high sequence conservation of the 120 human SH2 domains poses a significant challenge to selectively perturb the interactions of even the SFK SH2 family against the rest of the SH2 domains. We have developed synthetic binding proteins, termed monobodies, for six of the SFK SH2 domains with nanomolar affinity. Most of these monobodies competed with pY ligand binding and showed strong selectivity for either the SrcA (Yes, Src, Fyn, Fgr) or SrcB subgroup (Lck, Lyn, Blk, Hck). Interactome analysis of intracellularly expressed monobodies revealed that they bind SFKs but no other SH2-containing proteins. Three crystal structures of monobody–SH2 complexes unveiled different and only partly overlapping binding modes, which rationalized the observed selectivity and enabled structure-based mutagenesis to modulate inhibition mode and selectivity. In line with the critical roles of SFK SH2 domains in kinase autoinhibition and T-cell receptor signaling, monobodies binding the Src and Hck SH2 domains selectively activated respective recombinant kinases, whereas an Lck SH2-binding monobody inhibited proximal signaling events downstream of the T-cell receptor complex. Our results show that SFK SH2 domains can be targeted with unprecedented potency and selectivity using monobodies. They are excellent tools for dissecting SFK functions in normal development and signaling and to interfere with aberrant SFK signaling networks in cancer cells.

  9. Selective Targeting of SH2 Domain-Phosphotyrosine Interactions of Src Family Tyrosine Kinases with Monobodies.

    Science.gov (United States)

    Kükenshöner, Tim; Schmit, Nadine Eliane; Bouda, Emilie; Sha, Fern; Pojer, Florence; Koide, Akiko; Seeliger, Markus; Koide, Shohei; Hantschel, Oliver

    2017-05-05

    The binding of Src-homology 2 (SH2) domains to phosphotyrosine (pY) sites is critical for the autoinhibition and substrate recognition of the eight Src family kinases (SFKs). The high sequence conservation of the 120 human SH2 domains poses a significant challenge to selectively perturb the interactions of even the SFK SH2 family against the rest of the SH2 domains. We have developed synthetic binding proteins, termed monobodies, for six of the SFK SH2 domains with nanomolar affinity. Most of these monobodies competed with pY ligand binding and showed strong selectivity for either the SrcA (Yes, Src, Fyn, Fgr) or SrcB subgroup (Lck, Lyn, Blk, Hck). Interactome analysis of intracellularly expressed monobodies revealed that they bind SFKs but no other SH2-containing proteins. Three crystal structures of monobody-SH2 complexes unveiled different and only partly overlapping binding modes, which rationalized the observed selectivity and enabled structure-based mutagenesis to modulate inhibition mode and selectivity. In line with the critical roles of SFK SH2 domains in kinase autoinhibition and T-cell receptor signaling, monobodies binding the Src and Hck SH2 domains selectively activated respective recombinant kinases, whereas an Lck SH2-binding monobody inhibited proximal signaling events downstream of the T-cell receptor complex. Our results show that SFK SH2 domains can be targeted with unprecedented potency and selectivity using monobodies. They are excellent tools for dissecting SFK functions in normal development and signaling and to interfere with aberrant SFK signaling networks in cancer cells. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  10. Short Review

    DEFF Research Database (Denmark)

    Lynnerup, Niels; Rühli, Frank

    2015-01-01

    modality in ancient mummy research. The aim of this short review is to address the advantages and pitfalls of this particular technique for such unique samples. We recommend that when results of X-ray examination of mummies are presented, the specific recording data should be listed, and any given finds...

  11. Short fusion

    CERN Multimedia

    2002-01-01

    French and UK researchers are perfecting a particle accelerator technique that could aid the quest for fusion energy or make X-rays that are safer and produce higher-resolution images. Led by Dr Victor Malka from the Ecole Nationale Superieure des Techniques Avancees in Paris, the team has developed a better way of accelerating electrons over short distances (1 page).

  12. Short communication

    African Journals Online (AJOL)

    UPuser

    Short communication. Polymorphisms of the CAST gene in the Meishan and five other pig populations in China. Q.S. Wang. 1. , Y.C. Pan. 1#. , L.B. Sun. 2 and H. Meng. 1. 1 Department of Animal Science, School of Agriculture and Biology, Shanghai Jiaotong University, Shanghai. 201101, P.R. China. 2 Shanghai Institute of ...

  13. SHORT COMMUNICATION

    African Journals Online (AJOL)

    a

    ______. *Corresponding author. E-mail: vani_chem@yahoo.com. SHORT COMMUNICATION. OXIDATION OF L-CYSTINE BY CHROMIUM(VI) - A KINETIC STUDY. Kalyan Kumar Adari, Annapurna Nowduri and Vani Parvataneni*. Department of Inorganic and Analytical Chemistry, School of Chemistry, Andhra University,.

  14. Short communication

    NARCIS (Netherlands)

    Pantophlet, Andre J.; Gilbert, M.S.; Gerrits, W.J.J.; Vonk, R.J.

    2017-01-01

    Heavy veal calves (4-6 mo old) often develop problems with insulin sensitivity. This could lead to metabolic disorders and impaired animal growth performance. Studies in various animal species have shown that the supplementation of short-chain fructo-oligosaccharides (scFOS) can improve insulin

  15. Normalizing acronyms and abbreviations to aid patient understanding of clinical texts: ShARe/CLEF eHealth Challenge 2013, Task 2.

    Science.gov (United States)

    Mowery, Danielle L; South, Brett R; Christensen, Lee; Leng, Jianwei; Peltonen, Laura-Maria; Salanterä, Sanna; Suominen, Hanna; Martinez, David; Velupillai, Sumithra; Elhadad, Noémie; Savova, Guergana; Pradhan, Sameer; Chapman, Wendy W

    2016-07-01

    The ShARe/CLEF eHealth challenge lab aims to stimulate development of natural language processing and information retrieval technologies to aid patients in understanding their clinical reports. In clinical text, acronyms and abbreviations, also referenced as short forms, can be difficult for patients to understand. For one of three shared tasks in 2013 (Task 2), we generated a reference standard of clinical short forms normalized to the Unified Medical Language System. This reference standard can be used to improve patient understanding by linking to web sources with lay descriptions of annotated short forms or by substituting short forms with a more simplified, lay term. In this study, we evaluate 1) accuracy of participating systems' normalizing short forms compared to a majority sense baseline approach, 2) performance of participants' systems for short forms with variable majority sense distributions, and 3) report the accuracy of participating systems' normalizing shared normalized concepts between the test set and the Consumer Health Vocabulary, a vocabulary of lay medical terms. The best systems submitted by the five participating teams performed with accuracies ranging from 43 to 72 %. A majority sense baseline approach achieved the second best performance. The performance of participating systems for normalizing short forms with two or more senses with low ambiguity (majority sense greater than 80 %) ranged from 52 to 78 % accuracy, with two or more senses with moderate ambiguity (majority sense between 50 and 80 %) ranged from 23 to 57 % accuracy, and with two or more senses with high ambiguity (majority sense less than 50 %) ranged from 2 to 45 % accuracy. With respect to the ShARe test set, 69 % of short form annotations contained common concept unique identifiers with the Consumer Health Vocabulary. For these 2594 possible annotations, the performance of participating systems ranged from 50 to 75 % accuracy. Short form normalization continues

  16. CARMA2sh and ULK2 control pathogen-associated molecular patterns recognition in human keratinocytes: psoriasis-linked CARMA2sh mutants escape ULK2 censorship.

    Science.gov (United States)

    Scudiero, Ivan; Mazzone, Pellegrino; D'Andrea, Luca E; Ferravante, Angela; Zotti, Tiziana; Telesio, Gianluca; De Rubis, Gabriele; Reale, Carla; Pizzulo, Maddalena; Muralitharan, Shanmugakonar; Vito, Pasquale; Stilo, Romania

    2017-02-23

    The molecular complexes formed by specific members of the family of CARMA proteins, the CARD domain-containing adapter molecule BCL10 and MALT1 (CBM complex) represent a central hub in regulating activation of the pleiotropic transcription factor NF-κB. Recently, missense mutations in CARMA2sh have been shown to cause psoriasis in a dominant manner and with high penetrancy. Here, we demonstrate that in human keratinocytes CARMA2sh plays an essential role in the signal transduction pathway that connects pathogen-associated molecular patterns recognition to NF-κB activation. We also find that the serine/threonine kinase ULK2 binds to and phosphorylates CARMA2sh, thereby inhibiting its capacity to activate NF-κB by promoting lysosomal degradation of BCL10, which is essential for CARMA2sh-mediated NF-κB signaling. Remarkably, CARMA2sh mutants associated with psoriasis escape ULK2 inhibition. Finally, we show that a peptide blocking CARD-mediated BCL10 interactions reduces the capacity of psoriasis-linked CARMA2sh mutants to activate NF-κB. Our work elucidates a fundamental signaling mechanism operating in human keratinocytes and opens to novel potential tools for the therapeutical treatment of human skin disorders.

  17. Understanding the role of BAR and SH3 domain-containing proteins in fungi

    NARCIS (Netherlands)

    Gkourtsa, A.

    2017-01-01

    This thesis addresses the role of SH3 and BAR domain-containing proteins in different fungal species. SH3 domains are small modules that mediate protein-protein interactions and BAR domains are dimerization domains with membrane binding and bending properties. It is known that the ScRvs167 protein

  18. Design of potentially active ligands for SH2 domains by molecular modeling methods

    Directory of Open Access Journals (Sweden)

    Hurmach V. V.

    2014-07-01

    Full Text Available Search for new chemical structures possessing specific biological activity is a complex problem that needs the use of the latest achievements of molecular modeling technologies. It is well known that SH2 domains play a major role in ontogenesis as intermediaries of specific protein-protein interactions. Aim. Developing an algorithm to investigate the properties of SH2 domain binding, search for new potential active compounds for the whole SH2 domains class. Methods. In this paper, we utilize a complex of computer modeling methods to create a generic set of potentially active compounds targeting universally at the whole class of SH2 domains. A cluster analysis of all available three-dimensional structures of SH2 domains was performed and general pharmacophore models were formulated. The models were used for virtual screening of collection of drug-like compounds provided by Enamine Ltd. Results. The design technique for library of potentially active compounds for SH2 domains class was proposed. Conclusions. The original algorithm of SH2 domains research with molecular docking method was developed. Using our algorithm, the active compounds for SH2 domains were found.

  19. SH3 Domains Differentially Stimulate Distinct Dynamin I Assembly Modes and G Domain Activity.

    Directory of Open Access Journals (Sweden)

    Sai Krishnan

    Full Text Available Dynamin I is a highly regulated GTPase enzyme enriched in nerve terminals which mediates vesicle fission during synaptic vesicle endocytosis. One regulatory mechanism involves its interactions with proteins containing Src homology 3 (SH3 domains. At least 30 SH3 domain-containing proteins bind dynamin at its proline-rich domain (PRD. Those that stimulate dynamin activity act by promoting its oligomerisation. We undertook a systematic parallel screening of 13 glutathione-S-transferase (GST-tagged endocytosis-related SH3 domains on dynamin binding, GTPase activity and oligomerisation. No correlation was found between dynamin binding and their potency to stimulate GTPase activity. There was limited correlation between the extent of their ability to stimulate dynamin activity and the level of oligomerisation, indicating an as yet uncharacterised allosteric coupling of the PRD and G domain. We examined the two variants, dynamin Iab and Ibb, which differ in the alternately splice middle domain α2 helix. They responded differently to the panel of SH3s, with the extent of stimulation between the splice variants varying greatly between the SH3s. This study reveals that SH3 binding can act as a heterotropic allosteric regulator of the G domain via the middle domain α2 helix, suggesting an involvement of this helix in communicating the PRD-mediated allostery. This indicates that SH3 binding both stabilises multiple conformations of the tetrameric building block of dynamin, and promotes assembly of dynamin-SH3 complexes with distinct rates of GTP hydrolysis.

  20. Structural coupling of SH2-kinase domains links Fes and Abl substrate recognition and kinase activation.

    Science.gov (United States)

    Filippakopoulos, Panagis; Kofler, Michael; Hantschel, Oliver; Gish, Gerald D; Grebien, Florian; Salah, Eidarus; Neudecker, Philipp; Kay, Lewis E; Turk, Benjamin E; Superti-Furga, Giulio; Pawson, Tony; Knapp, Stefan

    2008-09-05

    The SH2 domain of cytoplasmic tyrosine kinases can enhance catalytic activity and substrate recognition, but the molecular mechanisms by which this is achieved are poorly understood. We have solved the structure of the prototypic SH2-kinase unit of the human Fes tyrosine kinase, which appears specialized for positive signaling. In its active conformation, the SH2 domain tightly interacts with the kinase N-terminal lobe and positions the kinase alphaC helix in an active configuration through essential packing and electrostatic interactions. This interaction is stabilized by ligand binding to the SH2 domain. Our data indicate that Fes kinase activation is closely coupled to substrate recognition through cooperative SH2-kinase-substrate interactions. Similarly, we find that the SH2 domain of the active Abl kinase stimulates catalytic activity and substrate phosphorylation through a distinct SH2-kinase interface. Thus, the SH2 and catalytic domains of active Fes and Abl pro-oncogenic kinases form integrated structures essential for effective tyrosine kinase signaling.

  1. Systematic characterization of the specificity of the SH2 domains of cytoplasmic tyrosine kinases.

    Science.gov (United States)

    Zhao, Bing; Tan, Pauline H; Li, Shawn S C; Pei, Dehua

    2013-04-09

    Cytoplasmic tyrosine kinases (CTK) generally contain a Src-homology 2 (SH2) domain, whose role in the CTK family is not fully understood. Here we report the determination of the specificity of 25 CTK SH2 domains by screening one-bead-one-compound (OBOC) peptide libraries. Based on the peptide sequences selected by the SH2 domains, we built Support Vector Machine (SVM) models for the prediction of binding ligands for the SH2 domains. These models yielded support for the progressive phosphorylation model for CTKs in which the overlapping specificity of the CTK SH2 and kinase domains has been proposed to facilitate targeting of the CTK substrates with at least two potential phosphotyrosine (pTyr) sites. We curated 93 CTK substrates with at least two pTyr sites catalyzed by the same CTK, and showed that 71% of these substrates had at least two pTyr sites predicted to bind a common CTK SH2 domain. More importantly, we found 34 instances where there was at least one pTyr site predicted to be recognized by the SH2 domain of the same CTK, suggesting that the SH2 and kinase domains of the CTKs may cooperate to achieve progressive phosphorylation of a protein substrate. This article is part of a Special Issue entitled: From protein structures to clinical applications. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. Structure determination of human Lck unique and SH3 domains by nuclear magnetic resonance spectroscopy

    Directory of Open Access Journals (Sweden)

    Willbold Dieter

    2003-05-01

    Full Text Available Abstract Background Protein tyrosine kinases are involved in signal transduction pathways that regulate cell growth, differentiation, activation and transformation. Human lymphocyte specific kinase (Lck is a 56 kDa protein involved in T-cell- and IL2-receptor signaling. Three-dimensional structures are known for SH3, SH2 and kinase domains of Lck as well as for other tyrosine kinases. No structure is known for the unique domain of any Src-type tyrosine kinase. Results Lck(1–120 comprising unique and SH3 domains was structurally investigated by nuclear magnetic resonance spectroscopy. We found the unique domain, in contrast to the SH3 part, to have basically no defined structural elements. The solution structure of the SH3 part could be determined with very high precision. It does not show significant differences to Lck SH3 in the absence of the unique domain. Minor differences were observed to the X-ray structure of Lck SH3. Conclusion The unique domain of Lck does not contain any defined structure elements in the absence of ligands and membranes. Presence of the unique domain is not relevant to the three-dimensional structure of the Lck SH3 domain.

  3. S.H. and others v. Austria and circumvention tourism.

    Science.gov (United States)

    Glenn Cohen, I

    2012-12-01

    This commentary discusses the decision in S.H. and Others v. Austria from a political theoretical and bioethical perspective. I focus on the opinion's discussion of what I call 'circumvention tourism', travelling abroad for the purpose of circumventing domestic prohibitions, especially as to medical services. The majority opinion in the case touts Austria's allowance of circumvention tourism for reproductive technology services that are illegal on Austrian soil as a reason to find as lawful Austria's prohibition on using those services on Austrian soil. To the contrary, I show that, in many ways, permitting circumvention tourism for these services while prohibiting them domestically is deeply problematic. Copyright © 2012 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.

  4. Linking photochemistry in the gas and solution phase: S-H bond fission in p-methylthiophenol following UV photoexcitation.

    Science.gov (United States)

    Oliver, Thomas A A; Zhang, Yuyuan; Ashfold, Michael N R; Bradforth, Stephen E

    2011-01-01

    Gas-phase H (Rydberg) atom photofragment translational spectroscopy and solution-phase femtosecond-pump dispersed-probe transient absorption techniques are applied to explore the excited state dynamics of p-methylthiophenol connecting the short time reactive dynamics in the two phases. The molecule is excited at a range of UV wavelengths from 286 to 193 nm. The experiments clearly demonstrate that photoexcitation results in S-H bond fission--both in the gas phase and in ethanol solution-and that the resulting p-methythiophenoxyl radical fragments are formed with significant vibrational excitation. In the gas phase, the recoil anisotropy of the H atom and the vibrational energy disposal in the p-MePhS radical products formed at the longer excitation wavelengths reveal the operation of two excited state dissociation mechanisms. The prompt excited state dissociation motif appears to map into the condensed phase also. In both phases, radicals are produced in both their ground and first excited electronic states; characteristic signatures for both sets of radical products are already apparent in the condensed phase studies after 50 fs. No evidence is seen for either solute ionisation or proton coupled electron transfer--two alternate mechanisms that have been proposed for similar heteroaromatics in solution. Therefore, at least for prompt S-H bond fissions, the direct observation of the dissociation process in solution confirms that the gas phase photofragmentation studies indeed provide important insights into the early time dynamics that transfer to the condensed phase.

  5. Solution structure of the Grb2 SH2 domain complexed with a high-affinity inhibitor

    International Nuclear Information System (INIS)

    Ogura, Kenji; Shiga, Takanori; Yokochi, Masashi; Yuzawa, Satoru; Burke, Terrence R.; Inagaki, Fuyuhiko

    2008-01-01

    The solution structure of the growth factor receptor-bound protein 2 (Grb2) SH2 domain complexed with a high-affinity inhibitor containing a non-phosphorus phosphate mimetic within a macrocyclic platform was determined by nuclear magnetic resonance (NMR) spectroscopy. Unambiguous assignments of the bound inhibitor and intermolecular NOEs between the Grb2 SH2 domain and the inhibitor was accomplished using perdeuterated Grb2 SH2 protein. The well-defined solution structure of the complex was obtained and compared to those by X-ray crystallography. Since the crystal structure of the Grb2 SH2 domain formed a domain-swapped dimer and several inhibitors were bound to a hinge region, there were appreciable differences between the solution and crystal structures. Based on the binding interactions between the inhibitor and the Grb2 SH2 domain in solution, we proposed a design of second-generation inhibitors that could be expected to have higher affinity

  6. In Vitro Evaluation of Beneficial Properties of Bacteriocinogenic Lactobacillus plantarum ST8Sh.

    Science.gov (United States)

    Todorov, Svetoslav Dimitrov; Holzapfel, Wilhelm; Nero, Luis Augusto

    2017-06-01

    Lactobacillus plantarum ST8Sh, isolated from Bulgarian salami "shpek" and previously characterized as bacteriocin producer, was evaluated for its beneficial properties. Based on the PCR analysis, Lb. plantarum ST8Sh was shown to host a gene related to the production of adhesion proteins such as Mab, Mub, EF, and PrgB. Genetic and physiological tests suggest Lb. plantarum ST8Sh to represent a potential probiotic candidate, including survival in the presence of low levels of pH and high levels of ox bile, production of β-galactosidase, bile salt deconjugation, high level of hydrophobicity, functional auto- and co-aggregation properties, and adhesion to cell lines. Application of semi-purified bacteriocin produced by Lb. plantarum ST8Sh in combination with ciprofloxacin presented synergistic effect on inhibition of Listeria monocytogenes Scott A. Based on observed properties, Lb. plantarum ST8Sh can be considered as a potential probiotic candidate with additional bacteriocinogenic properties.

  7. Phe783, Thr797, and Asp804 in transmembrane hairpin M5-M6 of Na+,K+-ATPase play a key role in ouabain binding.

    Science.gov (United States)

    Qiu, Li Yan; Koenderink, Jan B; Swarts, Herman G P; Willems, Peter H G M; De Pont, Jan Joep H H M

    2003-11-21

    Ouabain is a glycoside that binds to and inhibits the action of Na+,K+-ATPase. Little is known, however, about the specific requirements of the protein surface for glycoside binding. Using chimeras of gastric H+,K+-ATPase and Na+,K+-ATPase, we demonstrated previously that the combined presence of transmembrane hairpins M3-M4 and M5-M6 of Na+,K+-ATPase in a backbone of H+,K+-ATPase (HN34/56) is both required and sufficient for high affinity ouabain binding. Since replacement of transmembrane hairpin M3-M4 by the N terminus up to transmembrane segment 3 (HNN3/56) resulted in a low affinity ouabain binding, hairpin M5-M6 seems to be essential for ouabain binding. To assess which residues of M5-M6 are required for ouabain action, we divided this transmembrane hairpin in seven parts and individually replaced these parts by the corresponding sequences of H+,K+-ATPase in chimera HN34/56. Three of these chimeras failed to bind ouabain following expression in Xenopus laevis oocytes. Altogether, these three chimeras contained 7 amino acids that were specific for Na+,K+-ATPase. Individual replacement of these 7 amino acids by the corresponding amino acids in H+,K+-ATPase revealed a dramatic loss of ouabain binding for F783Y, T797C, and D804E. As a proof of principle, the Na+,K+-ATPase equivalents of these 3 amino acids were introduced in different combinations in chimera HN34. The presence of all 3 amino acids appeared to be required for ouabain action. Docking of ouabain onto a three-dimensional-model of Na+,K+-ATPase suggests that Asp804, in contrast to Phe783 and Thr797, does not actually form part of the ouabain-binding pocket. Most likely, the presence of this amino acid is required for adopting of the proper conformation for ouabain binding.

  8. Fast and quantitative differentiation of single-base mismatched DNA by initial reaction rate of catalytic hairpin assembly.

    Science.gov (United States)

    Li, Chenxi; Li, Yixin; Xu, Xiao; Wang, Xinyi; Chen, Yang; Yang, Xiaoda; Liu, Feng; Li, Na

    2014-10-15

    The widely used catalytic hairpin assembly (CHA) amplification strategy generally needs several hours to accomplish one measurement based on the prevailingly used maximum intensity detection mode, making it less practical for assays where high throughput or speed is desired. To make the best use of the kinetic specificity of toehold domain for circuit reaction initiation, we developed a mathematical model and proposed an initial reaction rate detection mode to quantitatively differentiate the single-base mismatch. Using the kinetic mode, assay time can be reduced substantially to 10 min for one measurement with the comparable sensitivity and single-base mismatch differentiating ability as were obtained by the maximum intensity detection mode. This initial reaction rate based approach not only provided a fast and quantitative differentiation of single-base mismatch, but also helped in-depth understanding of the CHA system, which will be beneficial to the design of highly sensitive and specific toehold-mediated hybridization reactions. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. The influence of junction conformation on RNA cleavage by the hairpin ribozyme in its natural junction form.

    Science.gov (United States)

    Thomson, J B; Lilley, D M

    1999-01-01

    In the natural form of the hairpin ribozyme the two loop-carrying duplexes that comprise the majority of essential bases for activity form two adjacent helical arms of a four-way RNA junction. In the present work we have manipulated the sequence around the junction in a way known to perturb the global folding properties. We find that replacement of the junction by a different sequence that has the same conformational properties as the natural sequence gives closely similar reaction rate and Arrhenius activation energy for the substrate cleavage reaction. By comparison, rotation of the natural sequence in order to alter the three-dimensional folding of the ribozyme leads to a tenfold reduction in the kinetics of cleavage. Replacement with the U1 four-way junction that is resistant to rotation into the antiparallel structure required to allow interaction between the loops also gives a tenfold reduction in cleavage rate. The results indicate that the conformation of the junction has a major influence on the catalytic activity of the ribozyme. The results are all consistent with a role for the junction in the provision of a framework by which the loops are presented for interaction in order to create the active form of the ribozyme. PMID:10024170

  10. Modeling and validating HL7 FHIR profiles using semantic web Shape Expressions (ShEx).

    Science.gov (United States)

    Solbrig, Harold R; Prud'hommeaux, Eric; Grieve, Grahame; McKenzie, Lloyd; Mandel, Joshua C; Sharma, Deepak K; Jiang, Guoqian

    2017-03-01

    HL7 Fast Healthcare Interoperability Resources (FHIR) is an emerging open standard for the exchange of electronic healthcare information. FHIR resources are defined in a specialized modeling language. FHIR instances can currently be represented in either XML or JSON. The FHIR and Semantic Web communities are developing a third FHIR instance representation format in Resource Description Framework (RDF). Shape Expressions (ShEx), a formal RDF data constraint language, is a candidate for describing and validating the FHIR RDF representation. Create a FHIR to ShEx model transformation and assess its ability to describe and validate FHIR RDF data. We created the methods and tools that generate the ShEx schemas modeling the FHIR to RDF specification being developed by HL7 ITS/W3C RDF Task Force, and evaluated the applicability of ShEx in the description and validation of FHIR to RDF transformations. The ShEx models contributed significantly to workgroup consensus. Algorithmic transformations from the FHIR model to ShEx schemas and FHIR example data to RDF transformations were incorporated into the FHIR build process. ShEx schemas representing 109 FHIR resources were used to validate 511 FHIR RDF data examples from the Standards for Trial Use (STU 3) Ballot version. We were able to uncover unresolved issues in the FHIR to RDF specification and detect 10 types of errors and root causes in the actual implementation. The FHIR ShEx representations have been included in the official FHIR web pages for the STU 3 Ballot version since September 2016. ShEx can be used to define and validate the syntax of a FHIR resource, which is complementary to the use of RDF Schema (RDFS) and Web Ontology Language (OWL) for semantic validation. ShEx proved useful for describing a standard model of FHIR RDF data. The combination of a formal model and a succinct format enabled comprehensive review and automated validation. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Target-induced structure switching of hairpin aptamers for label-free and sensitive fluorescent detection of ATP via exonuclease-catalyzed target recycling amplification.

    Science.gov (United States)

    Xu, Yunying; Xu, Jin; Xiang, Yun; Yuan, Ruo; Chai, Yaqin

    2014-01-15

    In this work, we described the development of a new label-free, simple and sensitive fluorescent ATP sensing platform based on exonuclease III (Exo III)-catalyzed target recycling (ECTR) amplification and SYBR Green I indicator. The hairpin aptamer probes underwent conformational structure switching and re-configuration in the presence of ATP, which led to catalytic cleavage of the re-configured aptamers by Exo III to release ATP and to initiate the ECTR process. Such ECTR process resulted in the digestion of a significant number of the hairpin aptamer probes, leading to much less intercalation of SYBR Green I to the hairpin stems and drastic suppression of the fluorescence emission for sensitive ATP detection down to the low nanomolar level. Due to the highly specific affinity bindings between aptamers and ATP, the developed method exhibited excellent selectivity toward ATP against other analogous molecules. Besides, our ATP sensing approach used un-modified aptamer probes and could be performed in a "mix-and-detect" fashion in homogenous solutions. All these distinct advantages of the developed method thus made it hold great potential for the development of simple and robust sensing strategies for the detection of other small molecules. © 2013 Elsevier B.V. All rights reserved.

  12. DNA hairpin structures in solution: 500-MHz two-dimensional 1H NMR studies on d(CGCCGCAGC) and d(CGCCGTAGC)

    International Nuclear Information System (INIS)

    Gupta, G.; Sarma, M.H.; Sarma, R.H.

    1987-01-01

    A hairpin structure contains two conformationally distinct domains: a double-helical stem with Watson-Crick base pairs and a single-stranded loop that connects the two arms of the stem. By extensive 1D and 2D 500-MHz 1 H NMR studies in H 2 O and D 2 O, it has been demonstrated that the DNA oligomers d(CGCCGCAGC) and d(CGCCGTAGC) form hairpin structures under conditions of low concentration, 0.5 mM in DNA strand, and low salt (20 mM NaCl, pH 7). From examination of the nuclear Overhauser effect (NOE) between base protons H8/H6 and sugar protons H1' and H2'/H2'', it was concluded that in D(CGCCGCAGC) and d(CGCCCTAGC) all the nine nucleotides display average (C2'-endo,anti) geometry. The NMR data in conjunction with molecular model building and solvent accessibility studies were used to derive a working model for the hairpins

  13. Short Communication

    African Journals Online (AJOL)

    huis

    Short Communication. QTL analysis of production traits on SSC3 in a Large White×Meishan pig resource family. B. Zuo. 1. , Y.Z. Xiong. 1#. , Y.H. Su. 2. , C.Y. Deng. 1. , M.G. Lei. 1. , F.E. Li. 1. , R. Zheng. 1 and S.W. Jiang. 1. 1 Key Laboratory of Swine Genetics and Breeding, Ministry of Agriculture & Key Lab of Agricultural ...

  14. Peptide design using alpha,beta-dehydro amino acids: from beta-turns to helical hairpins.

    Science.gov (United States)

    Mathur, Puniti; Ramakumar, S; Chauhan, V S

    2004-01-01

    Incorporation of alpha,beta-dehydrophenylalanine (DeltaPhe) residue in peptides induces folded conformations: beta-turns in short peptides and 3(10)-helices in larger ones. A few exceptions-namely, alpha-helix or flat beta-bend ribbon structures-have also been reported in a few cases. The most favorable conformation of DeltaPhe residues are (phi,psi) approximately (-60 degrees, -30 degrees ), (-60 degrees, 150 degrees ), (80 degrees, 0 degrees ) or their enantiomers. DeltaPhe is an achiral and planar residue. These features have been exploited in designing DeltaPhe zippers and helix-turn-helix motifs. DeltaPhe can be incorporated in both right and left-handed helices. In fact, consecutive occurrence of three or more DeltaPhe amino acids induce left-handed screw sense in peptides containing L-amino acids. Weak interactions involving the DeltaPhe residue play an important role in molecular association. The C--H.O==C hydrogen bond between the DeltaPhe side-chain and backbone carboxyl moiety, pi-pi stacking interactions between DeltaPhe side chains belonging to enantiomeric helices have shown to stabilize folding. The unusual capability of a DeltaPhe ring to form the hub of multicentered interactions namely, a donor in aromatic C--H.pi and C--H.O==C and an acceptor in a CH(3).pi interaction suggests its exploitation in introducing long-range interactions in the folding of supersecondary structures. Copyright 2004 Wiley Periodicals, Inc. Biopolymers (Pept Sci), 2004

  15. Genetic disruption of the sh3pxd2a gene reveals an essential role in mouse development and the existence of a novel isoform of tks5.

    Science.gov (United States)

    Cejudo-Martin, Pilar; Yuen, Angela; Vlahovich, Nicole; Lock, Peter; Courtneidge, Sara A; Díaz, Begoña

    2014-01-01

    Tks5 is a scaffold protein and Src substrate involved in cell migration and matrix degradation through its essential role in invadosome formation and function. We have previously described that Tks5 is fundamental for zebrafish neural crest cell migration in vivo. In the present study, we sought to investigate the function of Tks5 in mammalian development by analyzing mice mutant for sh3pxd2a, the gene encoding Tks5. Homozygous disruption of the sh3pxd2a gene by gene-trapping in mouse resulted in neonatal death and the presence of a complete cleft of the secondary palate. Interestingly, embryonic fibroblasts from homozygous gene-trap sh3pxd2a mice lacked only the highest molecular weight band of the characteristic Tks5 triplet observed in protein extracts, leaving the lower molecular weight bands unaffected. This finding, together with the existence of two human Expressed Sequence Tags lacking the first 5 exons of SH3PXD2A, made us hypothesize about the presence of a second alternative transcription start site located in intron V. We performed 5'RACE on mouse fibroblasts and isolated a new transcript of the sh3pxd2a gene encoding a novel Tks5 isoform, that we named Tks5β. This novel isoform diverges from the long form of Tks5 in that it lacks the PX-domain, which confers affinity for phosphatidylinositol-3,4-bisphosphate. Instead, Tks5β has a short unique amino terminal sequence encoded by the newly discovered exon 6β; this exon includes a start codon located 29 bp from the 5'-end of exon 6. Tks5β mRNA is expressed in MEFs and all mouse adult tissues analyzed. Tks5β is a substrate for the Src tyrosine kinase and its expression is regulated through the proteasome degradation pathway. Together, these findings indicate the essentiality of the larger Tks5 isoform for correct mammalian development and the transcriptional complexity of the sh3pxd2a gene.

  16. Genetic disruption of the sh3pxd2a gene reveals an essential role in mouse development and the existence of a novel isoform of tks5.

    Directory of Open Access Journals (Sweden)

    Pilar Cejudo-Martin

    Full Text Available Tks5 is a scaffold protein and Src substrate involved in cell migration and matrix degradation through its essential role in invadosome formation and function. We have previously described that Tks5 is fundamental for zebrafish neural crest cell migration in vivo. In the present study, we sought to investigate the function of Tks5 in mammalian development by analyzing mice mutant for sh3pxd2a, the gene encoding Tks5. Homozygous disruption of the sh3pxd2a gene by gene-trapping in mouse resulted in neonatal death and the presence of a complete cleft of the secondary palate. Interestingly, embryonic fibroblasts from homozygous gene-trap sh3pxd2a mice lacked only the highest molecular weight band of the characteristic Tks5 triplet observed in protein extracts, leaving the lower molecular weight bands unaffected. This finding, together with the existence of two human Expressed Sequence Tags lacking the first 5 exons of SH3PXD2A, made us hypothesize about the presence of a second alternative transcription start site located in intron V. We performed 5'RACE on mouse fibroblasts and isolated a new transcript of the sh3pxd2a gene encoding a novel Tks5 isoform, that we named Tks5β. This novel isoform diverges from the long form of Tks5 in that it lacks the PX-domain, which confers affinity for phosphatidylinositol-3,4-bisphosphate. Instead, Tks5β has a short unique amino terminal sequence encoded by the newly discovered exon 6β; this exon includes a start codon located 29 bp from the 5'-end of exon 6. Tks5β mRNA is expressed in MEFs and all mouse adult tissues analyzed. Tks5β is a substrate for the Src tyrosine kinase and its expression is regulated through the proteasome degradation pathway. Together, these findings indicate the essentiality of the larger Tks5 isoform for correct mammalian development and the transcriptional complexity of the sh3pxd2a gene.

  17. An Efficient Semi-supervised Learning Approach to Predict SH2 Domain Mediated Interactions.

    Science.gov (United States)

    Kundu, Kousik; Backofen, Rolf

    2017-01-01

    Src homology 2 (SH2) domain is an important subclass of modular protein domains that plays an indispensable role in several biological processes in eukaryotes. SH2 domains specifically bind to the phosphotyrosine residue of their binding peptides to facilitate various molecular functions. For determining the subtle binding specificities of SH2 domains, it is very important to understand the intriguing mechanisms by which these domains recognize their target peptides in a complex cellular environment. There are several attempts have been made to predict SH2-peptide interactions using high-throughput data. However, these high-throughput data are often affected by a low signal to noise ratio. Furthermore, the prediction methods have several additional shortcomings, such as linearity problem, high computational complexity, etc. Thus, computational identification of SH2-peptide interactions using high-throughput data remains challenging. Here, we propose a machine learning approach based on an efficient semi-supervised learning technique for the prediction of 51 SH2 domain mediated interactions in the human proteome. In our study, we have successfully employed several strategies to tackle the major problems in computational identification of SH2-peptide interactions.

  18. Examining transition metal hydrosulfides: The pure rotational spectrum of ZnSH (X̃2A').

    Science.gov (United States)

    Bucchino, M P; Adande, G R; Halfen, D T; Ziurys, L M

    2017-10-21

    The pure rotational spectrum of the ZnSH (X̃ 2 A') radical has been measured using millimeter-wave direct absorption and Fourier transform microwave (FTMW) methods across the frequency range 18-468 GHz. This work is the first gas-phase detection of ZnSH by any spectroscopic technique. Spectra of the 66 ZnSH, 68 ZnSH, and 64 ZnSD isotopologues were also recorded. In the mm-wave study, ZnSH was synthesized in a DC discharge by the reaction of zinc vapor, generated by a Broida-type oven, with H 2 S; for FTMW measurements, the radical was made in a supersonic jet expansion by the same reactants but utilizing a discharge-assisted laser ablation source. Between 7 and 9 rotational transitions were recorded for each isotopologue. Asymmetry components with K a = 0 through 6 were typically measured in the mm-wave region, each split into spin-rotation doublets. In the FTMW spectra, hyperfine interactions were also resolved, arising from the hydrogen or deuterium nuclear spins of I = 1/2 or I = 1, respectively. The data were analyzed using an asymmetric top Hamiltonian, and rotational, spin-rotation, and magnetic hyperfine parameters were determined for ZnSH, as well as the quadrupole coupling constant for ZnSD. The observed spectra clearly indicate that ZnSH has a bent geometry. The r m (1) structure was determined to be r Zn-S = 2.213(5) Å, r S-H = 1.351(3) Å, and θ Zn-S-H = 90.6(1)°, suggesting that the bonding occurs primarily through sulfur p orbitals, analogous to H 2 S. The hyperfine constants indicate that the unpaired electron in ZnSH primarily resides on the zinc nucleus.

  19. Conformational determinants of phosphotyrosine peptides complexed with the Src SH2 domain.

    Directory of Open Access Journals (Sweden)

    Joseph Nachman

    2010-06-01

    Full Text Available The inhibition of specific SH2 domain mediated protein-protein interactions as an effective chemotherapeutic approach in the treatment of diseases remains a challenge. That different conformations of peptide-ligands are preferred by different SH2 domains is an underappreciated observation from the structural analysis of phosphotyrosine peptide binding to SH2 domains that may aid in future drug design. To explore the nature of ligand binding, we use simulated annealing (SA to sample the conformational space of phosphotyrosine-containing peptides complexed with the Src SH2 domain. While in good agreement with the crystallographic and NMR studies of high-affinity phosphopeptide-SH2 domain complexes, the results suggest that the structural basis for phopsphopeptide- Src SH2 interactions is more complex than the "two-pronged plug two-hole socket" model. A systematic study of peptides of type pYEEX, where pY is phosphotyrosine and X is a hydrophobic residue, indicates that these peptides can assume two conformations, one extended and one helical, representing the balance between the interaction of residue X with the hydrophobic hole on the surface of the Src SH2 domain, and its contribution to the inherent tendency of the two glutamic acids to form an alpha-helix. In contrast, a beta-turn conformation, almost identical to that observed in the crystal structure of pYVNV bound to the Grb2 SH2 domain, predominates for pYXNX peptides, even in the presence of isoleucine at the third position. While peptide binding affinities, as measured by fluorescence polarization, correlate with the relative proportion of extended peptide conformation, these results suggest a model where all three residues C-terminal to the phosphotyrosine determine the conformation of the bound phosphopeptide. The information obtained in this work can be used in the design of specific SH2 domain inhibitors.

  20. The Spectrum of Jupiters Great Red Spot: the Case for Ammonium Hydrosulfide (NH4SH)

    Science.gov (United States)

    Loeffler, Mark J.; Hudson, Reggie L.; Chanover, Nancy J.; Simon, Amy A.

    2016-01-01

    Here we present new ultraviolet-visible spectra of irradiated ammonium hydrosul?de (NH4SH), a reported Jovian atmospheric cloud component, for a range of temperatures and radiation doses and make assignments to the spectral features. We show that the combination of radiolysis and thermal annealing of NH4SH causes the originally featureless ultraviolet-visible re?ectance spectrum to evolve into one that absorbs in the ultraviolet-visible region. Furthermore, we ?nd that our laboratory spectra resemble HST (Hubble Space Telescope) spectra below 500 nanometers, suggesting that the more stable reaction products of NH4SH radiolysis are likely an important component of the Great Red Spot.

  1. The Spectrum of Jupiter's Great Red Spot: The Case for Ammonium Hydrosulfide (NH4SH)

    Science.gov (United States)

    Loeffler, Mark J.; Hudson, Reggie L.; Chanover, Nancy J.; Simon, Amy A.

    2016-01-01

    Here we present new ultraviolet-visible spectra of irradiated ammonium hydrosul?de (NH4SH), a reported Jovian atmospheric cloud component, for a range of temperatures and radiation doses and make assignments to the spectral features. We show that the combination of radiolysis and thermal annealing of NH4SH causes the originally featureless ultraviolet-visible re?ectance spectrum to evolve into one that absorbs in the ultraviolet-visible region. Furthermore, we ?nd that our laboratory spectra resemble HST (Hubble Space Telescope) spectra below 500 nanometers, suggesting that the more stable reaction products of NH4SH radiolysis are likely an important component of the Great Red Spot.

  2. Energy in elastic fiber embedded in elastic matrix containing incident SH wave

    Science.gov (United States)

    Williams, James H., Jr.; Nagem, Raymond J.

    1989-01-01

    A single elastic fiber embedded in an infinite elastic matrix is considered. An incident plane SH wave is assumed in the infinite matrix, and an expression is derived for the total energy in the fiber due to the incident SH wave. A nondimensional form of the fiber energy is plotted as a function of the nondimensional wavenumber of the SH wave. It is shown that the fiber energy attains maximum values at specific values of the wavenumber of the incident wave. The results obtained here are interpreted in the context of phenomena observed in acousto-ultrasonic experiments on fiber reinforced composite materials.

  3. Kit W-sh Mutation Prevents Cancellous Bone Loss during Calcium Deprivation.

    Science.gov (United States)

    Lotinun, Sutada; Suwanwela, Jaijam; Poolthong, Suchit; Baron, Roland

    2018-01-01

    Calcium is essential for normal bone growth and development. Inadequate calcium intake increases the risk of osteoporosis and fractures. Kit ligand/c-Kit signaling plays an important role in regulating bone homeostasis. Mice with c-Kit mutations are osteopenic. The present study aimed to investigate whether impairment of or reduction in c-Kit signaling affects bone turnover during calcium deprivation. Three-week-old male WBB6F1/J-Kit W /Kit W-v /J (W/W v ) mice with c-Kit point mutation, Kit W-sh /HNihrJaeBsmJ (W sh /W sh ) mice with an inversion mutation in the regulatory elements upstream of the c-Kit promoter region, and their wild-type controls (WT) were fed either a normal (0.6% calcium) or a low calcium diet (0.02% calcium) for 3 weeks. μCT analysis indicated that both mutants fed normal calcium diet had significantly decreased cortical thickness and cancellous bone volume compared to WT. The low calcium diet resulted in a comparable reduction in cortical bone volume and cortical thickness in the W/W v and W sh /W sh mice, and their corresponding controls. As expected, the low calcium diet induced cancellous bone loss in the W/W v mice. In contrast, W sh /W sh cancellous bone did not respond to this diet. This c-Kit mutation prevented cancellous bone loss by antagonizing the low calcium diet-induced increase in osteoblast and osteoclast numbers in the W sh /W sh mice. Gene expression profiling showed that calcium deficiency increased Osx, Ocn, Alp, type I collagen, c-Fms, M-CSF, and RANKL/OPG mRNA expression in controls; however, the W sh mutation suppressed these effects. Our findings indicate that although calcium restriction increased bone turnover, leading to osteopenia, the decreased c-Kit expression levels in the W sh /W sh mice prevented the low calcium diet-induced increase in cancellous bone turnover and bone loss but not the cortical bone loss.

  4. Hairpin DNA-Templated Silver Nanoclusters as Novel Beacons in Strand Displacement Amplification for MicroRNA Detection.

    Science.gov (United States)

    Zhang, Jingpu; Li, Chao; Zhi, Xiao; Ramón, Gabriel Alfranca; Liu, Yanlei; Zhang, Chunlei; Pan, Fei; Cui, Daxiang

    2016-01-19

    MicroRNA (miRNA) biomarkers display great potential for cancer diagnosis and prognosis. The development of rapid and specific methods for miRNA detection has become a hotspot. Herein, hairpin DNA-templated silver nanoclusters (AgNCs/HpDNA) were prepared and integrated into strand-displacement amplification (SDA) as a novel beacon for miRNA detection. The light-up platform was established based on guanine (G)-rich fluorescence enhancement that essentially converted the excitation/emission pair of AgNCs/HpDNAs from a shorter wavelength to a longer wavelength, and then achieved fluorescent enhancement at longer wavelength. On the basis of the validation of the method, the single and duplex detection were conducted in two plasma biomarkers (miR-16-5p and miR-19b-3p) for the diagnosis of gastric cancer. The probe (AgNCs/RED 16(7s)C) utilized for miR-16-5p detection adopted a better conformation with high specificity to recognize single-base mismatches by producing dramatically opposite signals (increase or decrease at 580 nm ex/640 nm em) while the probe (AgNCs/GRE 19b(5s)C) for miR-19b-3p generated dual signals (increase at 490 nm ex/570 nm em and decrease at 430 nm ex/530 nm em) with bright fluorescence in one reaction during the amplification, but unexpectedly was partially digested. This is for the first time to allow the generation of enhanced fluorescent AgNCs and the target recognition integrated into a single process, which offers great opportunity for specific miRNA detection in an easy and rapid way.

  5. Optimization of Critical Hairpin Features Allows miRNA-based Gene Knockdown Upon Single-copy Transduction

    Directory of Open Access Journals (Sweden)

    Renier Myburgh

    2014-01-01

    Full Text Available Gene knockdown using micro RNA (miRNA-based vector constructs is likely to become a prominent gene therapy approach. It was the aim of this study to improve the efficiency of gene knockdown through optimizing the structure of miRNA mimics. Knockdown of two target genes was analyzed: CCR5 and green fluorescent protein. We describe here a novel and optimized miRNA mimic design called mirGE comprising a lower stem length of 13 base pairs (bp, positioning of the targeting strand on the 5′ side of the miRNA, together with nucleotide mismatches in upper stem positions 1 and 12 placed on the passenger strand. Our mirGE proved superior to miR-30 in four aspects: yield of targeting strand incorporation into RNA-induced silencing complex (RISC; incorporation into RISC of correct targeting strand; precision of cleavage by Drosha; and ratio of targeting strand over passenger strand. A triple mirGE hairpin cassette targeting CCR5 was constructed. It allowed CCR5 knockdown with an efficiency of over 90% upon single-copy transduction. Importantly, single-copy expression of this construct rendered transduced target cells, including primary human macrophages, resistant to infection with a CCR5-tropic strain of HIV. Our results provide new insights for a better knockdown efficiency of constructs containing miRNA. Our results also provide the proof-of-principle that cells can be rendered HIV resistant through single-copy vector transduction, rendering this approach more compatible with clinical applications.

  6. SH2-inositol phosphatase 1 negatively influences early megakaryocyte progenitors.

    Directory of Open Access Journals (Sweden)

    Lia E Perez

    Full Text Available The SH2-containing-5'inositol phosphatase-1 (SHIP influences signals downstream of cytokine/chemokine receptors that play a role in megakaryocytopoiesis, including thrombopoietin, stromal-cell-derived-Factor-1/CXCL-12 and interleukin-3. We hypothesize that SHIP might control megakaryocytopoiesis through effects on proliferation of megakaryocyte progenitors (MKP and megakaryocytes (MK.Herein, we report the megakaryocytic phenotype and MK functional assays of hematopoietic organs of two strains of SHIP deficient mice with deletion of the SHIP promoter/first exon or the inositol phosphatase domain. Both SHIP deficient strains exhibit a profound increase in MKP numbers in bone marrow (BM, spleen and blood as analyzed by flow cytometry (Lin(-c-Kit+CD41+ and functional assays (CFU-MK. SHIP deficient MKP display increased phosphorylation of Signal Transducers and Activators of Transcription 3 (STAT-3, protein kinase B (PKB/AKT and extracellular signal-regulated kinases (ERKs. Despite increased MKP content, total body number of mature MK (Lin(-c-kit(-CD41+ are not significantly changed as SHIP deficient BM contains reduced MK while spleen MK numbers are increased. Reduction of CXCR-4 expression in SHIP deficient MK may influence MK localization to the spleen instead of the BM. Endomitosis, process involved in MK maturation, was preserved in SHIP deficient MK. Circulating platelets and red blood cells are also reduced in SHIP deficient mice.SHIP may play an important role in regulation of essential signaling pathways that control early megakaryocytopoiesis in vivo.

  7. Association between receptor protein-tyrosine phosphatase RPTPalpha and the Grb2 adaptor. Dual Src homology (SH) 2/SH3 domain requirement and functional consequences

    DEFF Research Database (Denmark)

    Su, J; Yang, L T; Sap, J

    1996-01-01

    domain in Grb2 (, ). We show here that association of Grb2 with RPTPalpha also involves a critical function for the C-terminal SH3 domain of Grb2. Furthermore, Grb2 SH3 binding peptides interfere with RPTPalpha-Grb2 association in vitro, and the RPTPalpha protein can dissociate the Grb2-Sos complex...... in vivo. These observations constitute a novel mode of Grb2 association and suggest a model in which association with a tyrosine-phosphorylated protein restricts the repertoire of SH3 binding proteins with which Grb2 can simultaneously interact. The function of the Tyr798 tyrosine phosphorylation/Grb2...... binding site in RPTPalpha was studied further by expression of wild type or mutant RPTPalpha proteins in PC12 cells. In these cells, wild type RPTPalpha interferes with acidic fibroblast growth factor-induced neurite outgrowth; this effect requires both the catalytic activity and the Grb2 binding Tyr798...

  8. Infrared Spectra and Band Strengths of CH3SH, an Interstellar Molecule

    Science.gov (United States)

    Hudson, R. L.

    2016-01-01

    Three solid phases of CH3SH (methanethiol or methyl mercaptan) have been prepared and their mid-infrared spectra recorded at 10-110 degrees Kelvin, with an emphasis on the 17-100 degrees Kelvin region. Refractive indices have been measured at two temperatures and used to estimate ice densities and infrared band strengths. Vapor pressures for the two crystalline phases of CH3SH at 110 degrees Kelvin are estimated. The behavior of amorphous CH3SH on warming is presented and discussed in terms of Ostwald's step rule. Comparisons to CH3OH under similar conditions are made, and some inconsistencies and ambiguities in the CH3SH literature are examined and corrected.

  9. Polymorphisms in sh2b1 and spns1 loci are associated with ...

    Indian Academy of Sciences (India)

    SH2B1, which encodes a signal transduction adaptor protein ... Here, we studied the associa- tion of eight single ... Health Study (NSPHS) cohort, consisting of 719 individuals ... mate can lower triglyceride levels, and elevate high-density.

  10. USAF TPS L-23 Shear Wind Observed Optimized Path Investigation for NASA (SENIOR ShWOOPIN)

    National Research Council Canada - National Science Library

    Gordon, Randy; Fails, Robert; Baase, Solomon; Eckberg, Jason; Ryan, Charles; Smith, Chris

    2006-01-01

    The SENIOR ShWOOPIN TMP was conducted at the request of the USAF TPS as part of a NASA investigation into the viability of aircraft endurance enhancement through the extraction of energy from horizontal wind gradients...

  11. Deciphering Phosphotyrosine-Dependent Signaling Networks in Cancer by SH2 Profiling

    Science.gov (United States)

    Machida, Kazuya; Khenkhar, Malik

    2012-01-01

    It has been a decade since the introduction of SH2 profiling, a modular domain-based molecular diagnostics tool. This review covers the original concept of SH2 profiling, different analytical platforms, and their applications, from the detailed analysis of single proteins to broad screening in translational research. Illustrated by practical examples, we discuss the uniqueness and advantages of the approach as well as its limitations and challenges. We provide guidance for basic researchers and oncologists who may consider SH2 profiling in their respective cancer research, especially for those focusing on tyrosine phosphoproteomics. SH2 profiling can serve as an alternative phosphoproteomics tool to dissect aberrant tyrosine kinase pathways responsible for individual malignancies, with the goal of facilitating personalized diagnostics for the treatment of cancer. PMID:23226573

  12. Semi-supervised prediction of SH2-peptide interactions from imbalanced high-throughput data.

    Science.gov (United States)

    Kundu, Kousik; Costa, Fabrizio; Huber, Michael; Reth, Michael; Backofen, Rolf

    2013-01-01

    Src homology 2 (SH2) domains are the largest family of the peptide-recognition modules (PRMs) that bind to phosphotyrosine containing peptides. Knowledge about binding partners of SH2-domains is key for a deeper understanding of different cellular processes. Given the high binding specificity of SH2, in-silico ligand peptide prediction is of great interest. Currently however, only a few approaches have been published for the prediction of SH2-peptide interactions. Their main shortcomings range from limited coverage, to restrictive modeling assumptions (they are mainly based on position specific scoring matrices and do not take into consideration complex amino acids inter-dependencies) and high computational complexity. We propose a simple yet effective machine learning approach for a large set of known human SH2 domains. We used comprehensive data from micro-array and peptide-array experiments on 51 human SH2 domains. In order to deal with the high data imbalance problem and the high signal-to-noise ration, we casted the problem in a semi-supervised setting. We report competitive predictive performance w.r.t. state-of-the-art. Specifically we obtain 0.83 AUC ROC and 0.93 AUC PR in comparison to 0.71 AUC ROC and 0.87 AUC PR previously achieved by the position specific scoring matrices (PSSMs) based SMALI approach. Our work provides three main contributions. First, we showed that better models can be obtained when the information on the non-interacting peptides (negative examples) is also used. Second, we improve performance when considering high order correlations between the ligand positions employing regularization techniques to effectively avoid overfitting issues. Third, we developed an approach to tackle the data imbalance problem using a semi-supervised strategy. Finally, we performed a genome-wide prediction of human SH2-peptide binding, uncovering several findings of biological relevance. We make our models and genome-wide predictions, for all the 51 SH2

  13. Src binds cortactin through an SH2 domain cystine-mediated linkage

    Science.gov (United States)

    Evans, Jason V.; Ammer, Amanda G.; Jett, John E.; Bolcato, Chris A.; Breaux, Jason C.; Martin, Karen H.; Culp, Mark V.; Gannett, Peter M.; Weed, Scott A.

    2012-01-01

    Summary Tyrosine-kinase-based signal transduction mediated by modular protein domains is critical for cellular function. The Src homology (SH)2 domain is an important conductor of intracellular signaling that binds to phosphorylated tyrosines on acceptor proteins, producing molecular complexes responsible for signal relay. Cortactin is a cytoskeletal protein and tyrosine kinase substrate that regulates actin-based motility through interactions with SH2-domain-containing proteins. The Src kinase SH2 domain mediates cortactin binding and tyrosine phosphorylation, but how Src interacts with cortactin is unknown. Here we demonstrate that Src binds cortactin through cystine bonding between Src C185 in the SH2 domain within the phosphotyrosine binding pocket and cortactin C112/246 in the cortactin repeats domain, independent of tyrosine phosphorylation. Interaction studies show that the presence of reducing agents ablates Src-cortactin binding, eliminates cortactin phosphorylation by Src, and prevents Src SH2 domain binding to cortactin. Tandem MS/MS sequencing demonstrates cystine bond formation between Src C185 and cortactin C112/246. Mutational studies indicate that an intact cystine binding interface is required for Src-mediated cortactin phosphorylation, cell migration, and pre-invadopodia formation. Our results identify a novel phosphotyrosine-independent binding mode between the Src SH2 domain and cortactin. Besides Src, one quarter of all SH2 domains contain cysteines at or near the analogous Src C185 position. This provides a potential alternative mechanism to tyrosine phosphorylation for cysteine-containing SH2 domains to bind cognate ligands that may be widespread in propagating signals regulating diverse cellular functions. PMID:23097045

  14. A photoaffinity scan maps regions of the p85 SH2 domain involved in phosphoprotein binding.

    Science.gov (United States)

    Williams, K P; Shoelson, S E

    1993-03-15

    Src homology 2 (SH2) domains are modular phosphotyrosine binding pockets found within a wide variety of cytoplasmic signaling molecules. Here we develop a new approach to analyzing protein-protein interfaces termed photoaffinity scanning, and apply the method to map regions of the phosphatidylinositol 3-kinase p85 SH2 domain that participate in phospho-protein binding. Each residue except phosphotyrosine (pY) within a tightly binding, IRS-1-derived phosphopeptide (GNGDpYMPMSPKS) was substituted with the photoactive amino acid, benzoylphenylalanine (Bpa). Whereas most substitutions had little effect on binding affinity, Bpa substitution of either Met (+1 and +3 with respect to pY) reduced affinity 50-100-fold to confirm their importance in the pYMXM recognition motif. In three cases photolysis of SH2 domain/Bpa phosphopeptide complexes led to cross-linking of > 50% of the SH2 domain; cross-link positions were identified by microsequence, amino acid composition, and electrospray mass spectrometric analyses. Bpa-1 cross-links within alpha-helix I, whereas Bpa+1 and Bpa+4 cross-link the SH2 domain within the flexible loop C-terminal to alpha-helix II. Moreover, cross-linking at any position prevents SH2 domain cleavage at a trypsin-sensitive site within the flexible loop between beta-strands 1 and 2. Therefore, at least three distinct SH2 regions in addition to the beta-sheet participate in phosphoprotein binding; the loop cross-linked by phosphopeptide residues C-terminal to pY appears to confer specificity to the phosphoprotein/SH2 domain interaction.

  15. Abl N-terminal Cap stabilization of SH3 domain dynamics†

    OpenAIRE

    Chen, Shugui; Dumitrescu, Teodora Pene; Smithgall, Thomas E.; Engen, John R.

    2008-01-01

    Crystal structures and other biochemical data indicate that the N-terminal cap (NCap) region of the Abelson tyrosine kinase (c-Abl) is important for maintaining the downregulated conformation of the kinase domain. The exact contributions that NCap makes in stabilizing the various intramolecular interactions within c-Abl are less clear. While the NCap appears important for locking the SH3/SH2 domains to the back of the kinase domain, there may be other more subtle elements of regulation. Hydro...

  16. Dental size variation in the Atapuerca-SH Middle Pleistocene hominids.

    Science.gov (United States)

    Bermúdez de Castro, J M; Sarmiento, S; Cunha, E; Rosas, A; Bastir, M

    2001-09-01

    The Middle Pleistocene Atapuerca-Sima de los Huesos (SH) site in Spain has yielded the largest sample of fossil hominids so far found from a single site and belonging to the same biological population. The SH dental sample includes a total of 452 permanent and deciduous teeth, representing a minimum of 27 individuals. We present a study of the dental size variation in these hominids, based on the analysis of the mandibular permanent dentition: lateral incisors, n=29; canines, n=27; third premolars, n=30; fourth premolars, n=34; first molars, n=38; second molars, n=38. We have obtained the buccolingual diameter and the crown area (measured on occlusal photographs) of these teeth, and used the bootstrap method to assess the amount of variation in the SH sample compared with the variation of a modern human sample from the Museu Antropologico of the Universidade of Coimbra (Portugal). The SH hominids have, in general terms, a dental size variation higher than that of the modern human sample. The analysis is especially conclusive for the canines. Furthermore, we have estimated the degree of sexual dimorphism of the SH sample by obtaining male and female dental subsamples by means of sexing the large sample of SH mandibular specimens. We obtained the index of sexual dimorphism (ISD=male mean/female mean) and the values were compared with those obtained from the sexed modern human sample from Coimbra, and with data found in the literature concerning several recent human populations. In all tooth classes the ISD of the SH hominids was higher than that of modern humans, but the differences were generally modest, except for the canines, thus suggesting that canine size sexual dimorphism in Homo heidelbergensis was probably greater than that of modern humans. Since the approach of sexing fossil specimens has some obvious limitations, these results should be assessed with caution. Additional data from SH and other European Middle Pleistocene sites would be necessary to test

  17. Spectral theory of differential operators M. Sh. Birman 80th anniversary collection

    CERN Document Server

    Suslina, T

    2009-01-01

    This volume is dedicated to Professor M. Sh. Birman in honor of his eightieth birthday. It contains original articles in spectral and scattering theory of differential operators, in particular, Schrodinger operators, and in homogenization theory. All articles are written by members of M. Sh. Birman's research group who are affiliated with different universities all over the world. A specific feature of the majority of the papers is a combination of traditional methods with new modern ideas.

  18. Cold collisions of SH- with He: Potential energy surface and rate coefficients

    Science.gov (United States)

    Bop, C. T.; Trabelsi, T.; Hammami, K.; Mogren Al Mogren, M.; Lique, F.; Hochlaf, M.

    2017-09-01

    Collisional energy transfer under cold conditions is of great importance from the fundamental and applicative point of view. Here, we investigate low temperature collisions of the SH- anion with He. We have generated a three-dimensional potential energy surface (PES) for the SH-(X1Σ+)-He(1S) van der Waals complex. The ab initio multi-dimensional interaction PES was computed using the explicitly correlated coupled cluster approach with simple, double, and perturbative triple excitation in conjunction with the augmented-correlation consistent-polarized valence triple zeta Gaussian basis set. The PES presents two minima located at linear geometries. Then, the PES was averaged over the ground vibrational wave function of the SH- molecule and the resulting two-dimensional PES was incorporated into exact quantum mechanical close coupling calculations to study the collisional excitation of SH- by He. We have computed inelastic cross sections among the 11 first rotational levels of SH- for energies up to 2500 cm-1. (De-)excitation rate coefficients were deduced for temperatures ranging from 1 to 300 K by thermally averaging the cross sections. We also performed calculations using the new PES for a fixed internuclear SH- distance. Both sets of results were found to be in reasonable agreement despite differences existing at low temperatures confirming that accurate predictions require the consideration of all internal degrees of freedom in the case of molecular hydrides. The rate coefficients presented here may be useful in interpreting future experimental work on the SH- negative ion colliding with He as those recently done for the OH--He collisional system as well as for possible astrophysical applications in case SH- would be detected in the interstellar medium.

  19. Src binds cortactin through an SH2 domain cystine-mediated linkage.

    Science.gov (United States)

    Evans, Jason V; Ammer, Amanda G; Jett, John E; Bolcato, Chris A; Breaux, Jason C; Martin, Karen H; Culp, Mark V; Gannett, Peter M; Weed, Scott A

    2012-12-15

    Tyrosine-kinase-based signal transduction mediated by modular protein domains is critical for cellular function. The Src homology (SH)2 domain is an important conductor of intracellular signaling that binds to phosphorylated tyrosines on acceptor proteins, producing molecular complexes responsible for signal relay. Cortactin is a cytoskeletal protein and tyrosine kinase substrate that regulates actin-based motility through interactions with SH2-domain-containing proteins. The Src kinase SH2 domain mediates cortactin binding and tyrosine phosphorylation, but how Src interacts with cortactin is unknown. Here we demonstrate that Src binds cortactin through cystine bonding between Src C185 in the SH2 domain within the phosphotyrosine binding pocket and cortactin C112/246 in the cortactin repeats domain, independent of tyrosine phosphorylation. Interaction studies show that the presence of reducing agents ablates Src-cortactin binding, eliminates cortactin phosphorylation by Src, and prevents Src SH2 domain binding to cortactin. Tandem MS/MS sequencing demonstrates cystine bond formation between Src C185 and cortactin C112/246. Mutational studies indicate that an intact cystine binding interface is required for Src-mediated cortactin phosphorylation, cell migration, and pre-invadopodia formation. Our results identify a novel phosphotyrosine-independent binding mode between the Src SH2 domain and cortactin. Besides Src, one quarter of all SH2 domains contain cysteines at or near the analogous Src C185 position. This provides a potential alternative mechanism to tyrosine phosphorylation for cysteine-containing SH2 domains to bind cognate ligands that may be widespread in propagating signals regulating diverse cellular functions.

  20. Application of a fiber Fabry-Perot interferometer sensor for receiving SH-EMAT signals

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jin Hyuk; Kim, Dae Hyun; Park, Ik Keun [Seoul National University of Technology, Seoul (Korea, Republic of)

    2014-04-15

    Shear horizontal (SH) waves propagate as a type of plate wave in a thin sheet. The dispersion characteristics of SH waves can be used for signal analysis. Therefore, SH-waves are useful for monitoring the structural health of a thin-sheet-structure. An electromagnetic acoustic transducer (EMAT), which is a non-contact ultrasonic transducer, can generate SH-waves easily by varying the shape and array of magnets and coils. Therefore, an EMAT can be applied to an automated ultrasonic testing system for structural health monitoring. When used as a sensor, however, the EMAT has a weakness in that electromagnetic interference (EMI) noise can occur easily in the automated system because of motors and electric devices. Alternatively, a fiber optic sensor works well in the same environment with EMI noise because it uses a light signal instead of an electric signal. In this paper, a fiber Fabry-Prot interferometer (FFPI) was proposed as a sensor to receive the SH-waves generated by an EMAT. A simple test was performed to verify the performance of the FFPI sensor. It is thus shown that the FFPI can receive SH-wave signals clearly.

  1. Evolution of Src Homology 2 (SH2) Domain to Recognize Sulfotyrosine.

    Science.gov (United States)

    Ju, Tong; Niu, Wei; Guo, Jiantao

    2016-09-16

    Protein tyrosine O-sulfation is considered as the most common type of post-translational tyrosine modification in nature and plays important roles in extracellular biomolecular interactions. To facilitate the mapping, biological study, and medicinal application of this type of post-translational modification, we seek to evolve a small protein scaffold that recognizes sulfotyrosine with high affinity. We focused our efforts on the engineering of the Src Homology 2 (SH2) domain, which represents the largest class of known phosphotyrosine-recognition domain in nature and has a highly evolvable binding pocket. By using phage display, we successfully engineered the SH2 domain to recognize sulfotyrosine with high affinity. The best mutant, SH2-60.1, displayed more than 1700 fold higher sulfotyrosine-binding affinity than that of the wild-type SH2 domain. We also demonstrated that the evolved SH2 domain mutants could be used to detect sulfoprotein levels on the cell surface. These evolved SH2 domain mutants can be potentially applied to the study of protein tyrosine O-sulfation with proper experimental designs.

  2. SH2 Domains Serve as Lipid-Binding Modules for pTyr-Signaling Proteins.

    Science.gov (United States)

    Park, Mi-Jeong; Sheng, Ren; Silkov, Antonina; Jung, Da-Jung; Wang, Zhi-Gang; Xin, Yao; Kim, Hyunjin; Thiagarajan-Rosenkranz, Pallavi; Song, Seohyeon; Yoon, Youngdae; Nam, Wonhee; Kim, Ilshin; Kim, Eui; Lee, Dong-Gyu; Chen, Yong; Singaram, Indira; Wang, Li; Jang, Myoung Ho; Hwang, Cheol-Sang; Honig, Barry; Ryu, Sungho; Lorieau, Justin; Kim, You-Me; Cho, Wonhwa

    2016-04-07

    The Src-homology 2 (SH2) domain is a protein interaction domain that directs myriad phosphotyrosine (pY)-signaling pathways. Genome-wide screening of human SH2 domains reveals that ∼90% of SH2 domains bind plasma membrane lipids and many have high phosphoinositide specificity. They bind lipids using surface cationic patches separate from pY-binding pockets, thus binding lipids and the pY motif independently. The patches form grooves for specific lipid headgroup recognition or flat surfaces for non-specific membrane binding and both types of interaction are important for cellular function and regulation of SH2 domain-containing proteins. Cellular studies with ZAP70 showed that multiple lipids bind its C-terminal SH2 domain in a spatiotemporally specific manner and thereby exert exquisite spatiotemporal control over its protein binding and signaling activities in T cells. Collectively, this study reveals how lipids control SH2 domain-mediated cellular protein-protein interaction networks and suggest a new strategy for therapeutic modulation of pY-signaling pathways. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Stabilization of the H,K-ATPase M5M6 membrane hairpin by K+ ions. Mechanistic significance for p2-type atpases.

    Science.gov (United States)

    Gatto, C; Lutsenko, S; Shin, J M; Sachs, G; Kaplan, J H

    1999-05-14

    The integral membrane protein, the gastric H,K-ATPase, is an alpha-beta heterodimer, with 10 putative transmembrane segments in the alpha-subunit and one such segment in the beta-subunit. All transmembrane segments remain within the membrane domain following trypsinization of the intact gastric H,K-ATPase in the presence of K+ ions, identified as M1M2, M3M4, M5M6, and M7, M8, M9, and M10. Removal of K+ ions from this digested preparation results in the selective loss of the M5M6 hairpin from the membrane. The release of the M5M6 fragment is directed to the extracellular phase as evidenced by the accumulation of the released M5M6 hairpin inside the sealed inside out vesicles. The stabilization of the M5M6 hairpin in the membrane phase by the transported cation as well as loss to the aqueous phase in the absence of the transported cation has been previously observed for another P2-type ATPase, the Na, K-ATPase (Lutsenko, S., Anderko, R., and Kaplan, J. H. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 7936-7940). Thus, the effects of the counter-transported cation on retention of the M5M6 segment in the membrane as compared with the other membrane pairs may be a general feature of P2-ATPase ion pumps, reflecting a flexibility of this region that relates to the mechanism of transport.

  4. Binding, folding and insertion of a β-hairpin peptide at a lipid bilayer surface: Influence of electrostatics and lipid tail packing.

    Science.gov (United States)

    Reid, Keon A; Davis, Caitlin M; Dyer, R Brian; Kindt, James T

    2018-03-01

    Antimicrobial peptides (AMPs) act as host defenses against microbial pathogens. Here we investigate the interactions of SVS-1 (KVKVKVKV d P l PTKVKVKVK), an engineered AMP and anti-cancer β-hairpin peptide, with lipid bilayers using spectroscopic studies and atomistic molecular dynamics simulations. In agreement with literature reports, simulation and experiment show preferential binding of SVS-1 peptides to anionic over neutral bilayers. Fluorescence and circular dichroism studies of a Trp-substituted SVS-1 analogue indicate, however, that it will bind to a zwitterionic DPPC bilayer under high-curvature conditions and folds into a hairpin. In bilayers formed from a 1:1 mixture of DPPC and anionic DPPG lipids, curvature and lipid fluidity are also observed to promote deeper insertion of the fluorescent peptide. Simulations using the CHARMM C36m force field offer complementary insight into timescales and mechanisms of folding and insertion. SVS-1 simulated at an anionic mixed POPC/POPG bilayer folded into a hairpin over a microsecond, the final stage in folding coinciding with the establishment of contact between the peptide's valine sidechains and the lipid tails through a "flip and dip" mechanism. Partial, transient folding and superficial bilayer contact are seen in simulation of the peptide at a zwitterionic POPC bilayer. Only when external surface tension is applied does the peptide establish lasting contact with the POPC bilayer. Our findings reveal the influence of disruption to lipid headgroup packing (via curvature or surface tension) on the pathway of binding and insertion, highlighting the collaborative effort of electrostatic and hydrophobic interactions on interaction of SVS-1 with lipid bilayers. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Proximity hybridization-regulated catalytic DNA hairpin assembly for electrochemical immunoassay based on in situ DNA template-synthesized Pd nanoparticles

    International Nuclear Information System (INIS)

    Zhou, Fuyi; Yao, Yao; Luo, Jianjun; Zhang, Xing; Zhang, Yu; Yin, Dengyang; Gao, Fenglei; Wang, Po

    2017-01-01

    Novel hybridization proximity-regulated catalytic DNA hairpin assembly strategy has been proposed for electrochemical immunoassay based on in situ DNA template-synthesized Pd nanoparticles as signal label. The DNA template-synthesized Pd nanoparticles were characterized with atomic force microscopic and X-ray photoelectron spectroscopy. The highly efficient electrocatalysis by DNA template synthesized Pd nanoparticles for NaBH 4 oxidation produced an intense detection signal. The label-free electrochemical method achieved the detection of carcinoembryonic antigen (CEA) with a linear range from 10 −15 to 10 −11  g mL −1 and a detection limit of 0.43 × 10 −15  g mL −1 . Through introducing a supersandwich reaction to increase the DNA length, the electrochemical signal was further amplified, leading to a detection limit of 0.52 × 10 −16  g mL −1 . And it rendered satisfactory analytical performance for the determination of CEA in serum samples. Furthermore, it exhibited good reproducibility and stability; meanwhile, it also showed excellent specificity due to the specific recognition of antigen by antibody. Therefore, the DNA template synthesized Pd nanoparticles based signal amplification approach has great potential in clinical applications and is also suitable for quantification of biomarkers at ultralow level. - Graphical abstract: A novel label-free and enzyme-free electrochemical immunoassay based on proximity hybridization-regulated catalytic DNA hairpin assemblies for recycling of the CEA. - Highlights: • A novel enzyme-free electrochemical immunosensor was developed for detection of CEA. • The signal amplification was based on catalytic DNA hairpin assembly and DNA-template-synthesized Pd nanoparticles. • The biosensor could detect CEA down to 0.52 × 10 −16  g mL −1 level with a dynamic range spanning 5 orders of magnitude.

  6. Metschnikowia Species Share a Pool of Diverse rRNA Genes Differing in Regions That Determine Hairpin-Loop Structures and Evolve by Reticulation.

    Directory of Open Access Journals (Sweden)

    Matthias Sipiczki

    Full Text Available Modern taxonomy of yeasts is mainly based on phylogenetic analysis of conserved DNA and protein sequences. By far the most frequently used sequences are those of the repeats of the chromosomal rDNA array. It is generally accepted that the rDNA repeats of a genome have identical sequences due to the phenomenon of sequence homogenisation and can thus be used for identification and barcoding of species. Here we show that the rDNA arrays of the type strains of Metschnikowia andauensis and M. fructicola are not homogenised. Both have arrays consisting of diverse repeats that differ from each other in the D1/D2 domains by up to 18 and 25 substitutions. The variable sites are concentrated in two regions that correspond to back-folding stretches of hairpin loops in the predicted secondary structure of the RNA molecules. The substitutions do not alter significantly the overall hairpin-loop structure due to wobble base pairing at sites of C-T transitions and compensatory mutations in the complementary strand of the hairpin stem. The phylogenetic and network analyses of the cloned sequences revealed that the repeats had not evolved in a vertical tree-like way but reticulation might have shaped the rDNA arrays of both strains. The neighbour-net analysis of all cloned sequences of the type strains and the database sequences of different strains further showed that these species share a continuous pool of diverse repeats that appear to evolve by reticulate evolution.

  7. Kinetics of end-to-end collision in short single-stranded nucleic acids.

    Science.gov (United States)

    Wang, Xiaojuan; Nau, Werner M

    2004-01-28

    A novel fluorescence-based method, which entails contact quenching of the long-lived fluorescent state of 2,3-diazabicyclo[2.2.2]-oct-2-ene (DBO), was employed to measure the kinetics of end-to-end collision in short single-stranded oligodeoxyribonucleotides of the type 5'-DBO-(X)n-dG with X = dA, dC, dT, or dU and n = 2 or 4. The fluorophore was covalently attached to the 5' end and dG was introduced as an efficient intrinsic quencher at the 3' terminus. The end-to-end collision rates, which can be directly related to the efficiency of intramolecular fluorescence quenching, ranged from 0.1 to 9.0 x 10(6) s(-1). They were strongly dependent on the strand length, the base sequence, as well as the temperature. Oligonucleotides containing dA in the backbone displayed much slower collision rates and significantly higher positive activation energies than strands composed of pyrimidine bases, suggesting a higher intrinsic rigidity of oligoadenylate. Comparison of the measured collision rates in short single-stranded oligodeoxyribonucleotides with the previously reported kinetics of hairpin formation indicates that the intramolecular collision is significantly faster than the nucleation step of hairpin closing. This is consistent with the configurational diffusion model suggested by Ansari et al. (Ansari, A.; Kuznetsov, S. V.; Shen, Y. Proc.Natl. Acad. Sci. USA 2001, 98, 7771-7776), in which the formation of misfolded loops is thought to slow hairpin formation.

  8. The SH2 and SH3 domains of mammalian Grb2 couple the EGF receptor to the Ras activator mSos1.

    Science.gov (United States)

    Rozakis-Adcock, M; Fernley, R; Wade, J; Pawson, T; Bowtell, D

    1993-05-06

    Many tyrosine kinases, including the receptors for hormones such as epidermal growth factor (EGF), nerve growth factor and insulin, transmit intracellular signals through Ras proteins. Ligand binding to such receptors stimulates Ras guanine-nucleotide-exchange activity and increases the level of GTP-bound Ras, suggesting that these tyrosine kinases may activate a guanine-nucleotide releasing protein (GNRP). In Caenorhabditis elegans and Drosophila, genetic studies have shown that Ras activation by tyrosine kinases requires the protein Sem-5/drk, which contains a single Src-homology (SH) 2 domain and two flanking SH3 domains. Sem-5 is homologous to the mammalian protein Grb2, which binds the autophosphorylated EGF receptor and other phosphotyrosine-containing proteins such as Shc through its SH2 domain. Here we show that in rodent fibroblasts, the SH3 domains of Grb2 are bound to the proline-rich carboxy-terminal tail of mSos1, a protein homologous to Drosophila Sos. Sos is required for Ras signalling and contains a central domain related to known Ras-GNRPs. EGF stimulation induces binding of the Grb2-mSos1 complex to the autophosphorylated EGF receptor, and mSos1 phosphorylation. Grb2 therefore appears to link tyrosine kinases to a Ras-GNRP in mammalian cells.

  9. New approaches to high-throughput structure characterization of SH3 complexes: the example of Myosin-3 and Myosin-5 SH3 domains from S. cerevisiae.

    Science.gov (United States)

    Musi, Valeria; Birdsall, Berry; Fernandez-Ballester, Gregorio; Guerrini, Remo; Salvatori, Severo; Serrano, Luis; Pastore, Annalisa

    2006-04-01

    SH3 domains are small protein modules that are involved in protein-protein interactions in several essential metabolic pathways. The availability of the complete genome and the limited number of clearly identifiable SH3 domains make the yeast Saccharomyces cerevisae an ideal proteomic-based model system to investigate the structural rules dictating the SH3-mediated protein interactions and to develop new tools to assist these studies. In the present work, we have determined the solution structure of the SH3 domain from Myo3 and modeled by homology that of the highly homologous Myo5, two myosins implicated in actin polymerization. We have then implemented an integrated approach that makes use of experimental and computational methods to characterize their binding properties. While accommodating their targets in the classical groove, the two domains have selectivity in both orientation and sequence specificity of the target peptides. From our study, we propose a consensus sequence that may provide a useful guideline to identify new natural partners and suggest a strategy of more general applicability that may be of use in other structural proteomic studies.

  10. A Discovery Strategy for Selective Inhibitors of c-Src in Complex with the Focal Adhesion Kinase SH3/SH2-binding Region.

    Science.gov (United States)

    Moroco, Jamie A; Baumgartner, Matthew P; Rust, Heather L; Choi, Hwan Geun; Hur, Wooyoung; Gray, Nathanael S; Camacho, Carlos J; Smithgall, Thomas E

    2015-08-01

    The c-Src tyrosine kinase co-operates with the focal adhesion kinase to regulate cell adhesion and motility. Focal adhesion kinase engages the regulatory SH3 and SH2 domains of c-Src, resulting in localized kinase activation that contributes to tumor cell metastasis. Using assay conditions where c-Src kinase activity required binding to a tyrosine phosphopeptide based on the focal adhesion kinase SH3-SH2 docking sequence, we screened a kinase-biased library for selective inhibitors of the Src/focal adhesion kinase peptide complex versus c-Src alone. This approach identified an aminopyrimidinyl carbamate compound, WH-4-124-2, with nanomolar inhibitory potency and fivefold selectivity for c-Src when bound to the phospho-focal adhesion kinase peptide. Molecular docking studies indicate that WH-4-124-2 may preferentially inhibit the 'DFG-out' conformation of the kinase active site. These findings suggest that interaction of c-Src with focal adhesion kinase induces a unique kinase domain conformation amenable to selective inhibition. © 2014 John Wiley & Sons A/S.

  11. Roles for SH2 and SH3 domains in Lyn kinase association with activated FcepsilonRI in RBL mast cells revealed by patterned surface analysis.

    Science.gov (United States)

    Hammond, Stephanie; Wagenknecht-Wiesner, Alice; Veatch, Sarah L; Holowka, David; Baird, Barbara

    2009-10-01

    In mast cells, antigen-mediated cross-linking of IgE bound to its high-affinity surface receptor, FcepsilonRI, initiates a signaling cascade that culminates in degranulation and release of allergic mediators. Antigen-patterned surfaces, in which the antigen is deposited in micron-sized features on a silicon substrate, were used to examine the spatial relationship between clustered IgE-FcepsilonRI complexes and Lyn, the signal-initiating tyrosine kinase. RBL mast cells expressing wild-type Lyn-EGFP showed co-redistribution of this protein with clustered IgE receptors on antigen-patterned surfaces, whereas Lyn-EGFP containing an inhibitory point mutation in its SH2 domain did not significantly accumulate with the patterned antigen, and Lyn-EGFP with an inhibitory point mutation in its SH3 domain exhibited reduced interactions. Our results using antigen-patterned surfaces and quantitative cross-correlation image analysis reveal that both the SH2 and SH3 domains contribute to interactions between Lyn kinase and cross-linked IgE receptors in stimulated mast cells.

  12. Interactions of polyomavirus middle T with the SH2 domains of the pp85 subunit of phosphatidylinositol-3-kinase.

    Science.gov (United States)

    Yoakim, M; Hou, W; Liu, Y; Carpenter, C L; Kapeller, R; Schaffhausen, B S

    1992-01-01

    The binding of phosphatidylinositol-3-kinase to the polyomavirus middle T antigen is facilitated by tyrosine phosphorylation of middle T on residue 315. The pp85 subunit of phosphatidylinositol-3-kinase contains two SH2 domains, one in the middle of the molecule and one at the C terminus. When assayed by blotting with phosphorylated middle T, the more N-terminal SH2 domain is responsible for binding to middle T. When assayed in solution with glutathione S transferase fusions, both SH2s are capable of binding phosphorylated middle T. While both SH2 fusions can compete with intact pp85 for binding to middle T, the C-terminal SH2 is the more efficient of the two. Interaction between pp85 or its SH2 domains and middle T can be blocked by a synthetic peptide comprising the tyrosine phosphorylation sequence around middle T residue 315. Despite the fact that middle T can interact with both SH2s, these domains are not equivalent. Only the C-terminal SH2-middle T interaction was blocked by anti-SH2 antibody; the two SH2 fusions also interact with different cellular proteins. Images PMID:1380095

  13. The development and application of a quantitative peptide microarray platform to SH2 domain specificity space

    Science.gov (United States)

    Engelmann, Brett Warren

    The Src homology 2 (SH2) domains evolved alongside protein tyrosine kinases (PTKs) and phosphatases (PTPs) in metazoans to recognize the phosphotyrosine (pY) post-translational modification. The human genome encodes 121 SH2 domains within 111 SH2 domain containing proteins that represent the primary mechanism for cellular signal transduction immediately downstream of PTKs. Despite pY recognition contributing to roughly half of the binding energy, SH2 domains possess substantial binding specificity, or affinity discrimination between phosphopeptide ligands. This specificity is largely imparted by amino acids (AAs) adjacent to the pY, typically from positions +1 to +4 C-terminal to the pY. Much experimental effort has been undertaken to construct preferred binding motifs for many SH2 domains. However, due to limitations in previous experimental methodologies these motifs do not account for the interplay between AAs. It was therefore not known how AAs within the context of individual peptides function to impart SH2 domain specificity. In this work we identified the critical role context plays in defining SH2 domain specificity for physiological ligands. We also constructed a high quality interactome using 50 SH2 domains and 192 physiological ligands. We next developed a quantitative high-throughput (Q-HTP) peptide microarray platform to assess the affinities four SH2 domains have for 124 physiological ligands. We demonstrated the superior characteristics of our platform relative to preceding approaches and validated our results using established biophysical techniques, literature corroboration, and predictive algorithms. The quantitative information provided by the arrays was leveraged to investigate SH2 domain binding distributions and identify points of binding overlap. Our microarray derived affinity estimates were integrated to produce quantitative interaction motifs capable of predicting interactions. Furthermore, our microarrays proved capable of resolving

  14. Investigation of phosphotyrosine recognition by the SH2 domain of the Src kinase.

    Science.gov (United States)

    Bradshaw, J M; Mitaxov, V; Waksman, G

    1999-11-05

    The binding of tyrosine phosphorylated targets by SH2 domains is required for propagation of many cellular signals in higher eukaryotes; however, the determinants of phosphotyrosine (pTyr) recognition by SH2 domains are not well understood. In order to identify the attributes of pTyr required for high affinity interaction with SH2 domains, the binding of the SH2 domain of the Src kinase (Src SH2 domain) to a dephosphorylated peptide, a phosphoserine-containing peptide, and the amino acid pTyr was studied using titration calorimetry and compared with the binding of a high affinity tyrosyl phosphopeptide. The dephosphorylated peptide and the phosphoserine containing peptide both bind extremely weakly to the Src SH2 domain (DeltaGo (dephosphorylated)=-3.6 kcal/mol, DeltaGo (phosphoserine) >-3.7 kcal/mol); however, the DeltaGo value of pTyr binding is more favorable (-4.7 kcal/mol, or 50 % of the entire binding free energy of a high affinity tyrosyl phosphopeptide). These results indicate that both the phosphate and the tyrosine ring of the pTyr are critical determinants of high affinity binding. Alanine mutagenesis was also used to evaluate the energetic contribution to binding of ten residues located in the pTyr-binding site. Mutation of the strictly conserved Arg betaB5 resulted in a large increase in DeltaGo (DeltaDeltaGo=3.2 kcal/mol) while elimination of the other examined residues each resulted in a significantly smaller (DeltaDeltaGoSH2 domain, surprisingly increased affinity by eightfold (DeltaDeltaGo=-1.1 kcal/mol). Using a double mutant cycle analysis, it was revealed that residues of the pTyr-binding pocket are not coupled to the peptide residues C-terminal to the pTyr. In addition, comparison of each residue's DeltaDeltaGo value upon mutation with that residue's sequence conservation among SH2 domains revealed only a modest correlation between a residue's energetic contribution to pTyr recognition and its conservation throughout evolution. The results of

  15. New function of the adaptor protein SH2B1 in brain-derived neurotrophic factor-induced neurite outgrowth.

    Directory of Open Access Journals (Sweden)

    Chien-Hung Shih

    Full Text Available Neurite outgrowth is an essential process for the establishment of the nervous system. Brain-derived neurotrophic factor (BDNF binds to its receptor TrkB and regulates axonal and dendritic morphology of neurons through signal transduction and gene expression. SH2B1 is a signaling adaptor protein that regulates cellular signaling in various physiological processes. The purpose of this study is to investigate the role of SH2B1 in the development of the central nervous system. In this study, we show that knocking down SH2B1 reduces neurite formation of cortical neurons whereas overexpression of SH2B1β promotes the development of hippocampal neurons. We further demonstrate that SH2B1β promotes BDNF-induced neurite outgrowth and signaling using the established PC12 cells stably expressing TrkB, SH2B1β or SH2B1β mutants. Our data indicate that overexpressing SH2B1β enhances BDNF-induced MEK-ERK1/2, and PI3K-AKT signaling pathways. Inhibition of MEK-ERK1/2 and PI3K-AKT pathways by specific inhibitors suggest that these two pathways are required for SH2B1β-promoted BDNF-induced neurite outgrowth. Moreover, SH2B1β enhances BDNF-stimulated phosphorylation of signal transducer and activator of transcription 3 at serine 727. Finally, our data indicate that the SH2 domain and tyrosine phosphorylation of SH2B1β contribute to BDNF-induced signaling pathways and neurite outgrowth. Taken together, these findings demonstrate that SH2B1β promotes BDNF-induced neurite outgrowth through enhancing pathways involved MEK-ERK1/2 and PI3K-AKT.

  16. ExoMol molecular line lists - XXVI: spectra of SH and NS

    Science.gov (United States)

    Yurchenko, Sergei N.; Bond, Wesley; Gorman, Maire N.; Lodi, Lorenzo; McKemmish, Laura K.; Nunn, William; Shah, Rohan; Tennyson, Jonathan

    2018-07-01

    Line lists for the sulphur-containing molecules SH (the mercapto radical) and NS are computed as part of the ExoMol project. These line lists consider transitions within the X2Π ground state for 32SH, 33SH, 34SH,36SH and, 32SD, and 14N32S, 14N33S, 14N34S, 14N36S, and 15N32S. Ab initio potential energy (PEC) and spin-orbit coupling (SOC) curves are computed and then improved by fitting to experimentally observed transitions. Fully ab initio dipole moment curves (DMCs) computed at high level of theory are used to produce the final line lists. For SH, our fit gives a root-mean-square (rms) error of 0.03 cm-1 between the observed (vmax = 4, Jmax = 34.5) and calculated transitions wavenumbers; this is extrapolated such that all X2Π rotational-vibrational-electronic (rovibronic) bound states are considered. For 32SH the resulting line list contains about 81 000 transitions and 2300 rovibronic states, considering levels up to vmax = 14 and Jmax = 60.5. For NS the refinement used a combination of experimentally determined frequencies and energy levels and led to an rms-fitting error of 0.002 cm-1. Each NS-calculated line list includes around 2.8 million transitions and 31 000 rovibronic states with a vibrational range up to v = 53 and rotational range up to J = 235.5, which covers up to 23 000 cm-1. Both line lists should be complete for temperatures up to 5000 K. Example spectra simulated using this line list are shown and comparisons made to the existing data in the CDMS data base. The line lists are available from the CDS (http://cdsarc.u-strasbg.fr) and ExoMol (www.exomol.com) data bases.

  17. SH003 suppresses breast cancer growth by accumulating p62 in autolysosomes.

    Science.gov (United States)

    Choi, Youn Kyung; Cho, Sung-Gook; Choi, Yu-Jeong; Yun, Yee Jin; Lee, Kang Min; Lee, Kangwook; Yoo, Hye-Hyun; Shin, Yong Cheol; Ko, Seong-Gyu

    2017-10-24

    Drug markets revisits herbal medicines, as historical usages address their therapeutic efficacies with less adverse effects. Moreover, herbal medicines save both cost and time in development. SH003, a modified version of traditional herbal medicine extracted from Astragalus membranaceus (Am), Angelica gigas (Ag), and Trichosanthes Kirilowii Maximowicz (Tk) with 1:1:1 ratio (w/w) has been revealed to inhibit tumor growth and metastasis on highly metastatic breast cancer cells, both in vivo and in vitro with no toxicity. Meanwhile, autophagy is imperative for maintenance cellular homeostasis, thereby playing critical roles in cancer progression. Inhibition of autophagy by pharmacological agents induces apoptotic cell death in cancer cells, resulting in cancer treatment. In this study, we demonstrate that SH003-induced autophagy via inhibiting STAT3 and mTOR results in an induction of lysosomal p62/SQSTM1 accumulation-mediated reactive oxygen species (ROS) generation and attenuates tumor growth. SH003 induced autophagosome and autolysosome formation by inhibiting activation of STAT3- and mTOR-mediated signaling pathways. However, SH003 blocked autophagy-mediated p62/SQSTM1 degradation through reducing of lysosomal proteases, Cathepsins, resulting in accumulation of p62/SQSTM1 in the lysosome. The accumulation of p62/SQSTM1 caused the increase of ROS, which resulted in the induction of apoptotic cell death. Therefore, we conclude that SH003 suppresses breast cancer growth by inducing autophagy. In addition, SH003-induced p62/SQSTM1 could function as an important mediator for ROS generation-dependent cell death suggesting that SH003 may be useful for treating breast cancer.

  18. Global transformation of erythrocyte properties via engagement of an SH2-like sequence in band 3.

    Science.gov (United States)

    Puchulu-Campanella, Estela; Turrini, Francesco M; Li, Yen-Hsing; Low, Philip S

    2016-11-29

    Src homology 2 (SH2) domains are composed of weakly conserved sequences of ∼100 aa that bind phosphotyrosines in signaling proteins and thereby mediate intra- and intermolecular protein-protein interactions. In exploring the mechanism whereby tyrosine phosphorylation of the erythrocyte anion transporter, band 3, triggers membrane destabilization, vesiculation, and fragmentation, we discovered a SH2 signature motif positioned between membrane-spanning helices 4 and 5. Evidence that this exposed cytoplasmic sequence contributes to a functional SH2-like domain is provided by observations that: (i) it contains the most conserved sequence of SH2 domains, GSFLVR; (ii) it binds the tyrosine phosphorylated cytoplasmic domain of band 3 (cdb3-PO 4 ) with K d = 14 nM; (iii) binding of cdb3-PO 4 to erythrocyte membranes is inhibited both by antibodies against the SH2 signature sequence and dephosphorylation of cdb3-PO 4 ; (iv) label transfer experiments demonstrate the covalent transfer of photoactivatable biotin from isolated cdb3-PO 4 (but not cdb3) to band 3 in erythrocyte membranes; and (v) phosphorylation-induced binding of cdb3-PO 4 to the membrane-spanning domain of band 3 in intact cells causes global changes in membrane properties, including (i) displacement of a glycolytic enzyme complex from the membrane, (ii) inhibition of anion transport, and (iii) rupture of the band 3-ankyrin bridge connecting the spectrin-based cytoskeleton to the membrane. Because SH2-like motifs are not retrieved by normal homology searches for SH2 domains, but can be found in many tyrosine kinase-regulated transport proteins using modified search programs, we suggest that related cases of membrane transport proteins containing similar motifs are widespread in nature where they participate in regulation of cell properties.

  19. Respiratory-aspirated 35-mm hairpin successfully retrieved with a Teflon® snare system under fluoroscopic guidance via a split endotracheal tube: a useful technique in cases of failed extraction by bronchoscopy and avoiding the need for a thoracotomy.

    Science.gov (United States)

    Gill, S S; Pease, R A; Ashwin, C J; Gill, S S; Tait, N P

    2012-09-01

    Respiratory foreign body aspiration (FBA) is a common global health problem requiring prompt recognition and early treatment to prevent potentially fatal complications. The majority of FBAs are due to organic objects and treatment is usually via either endoscopic or surgical extraction. FBA of a straight hairpin has been described as a unique entity in the literature, occurring most commonly in females, particularly during adolescence. In the process of inserting hairpins, the pins will typically be between the teeth with the head tilted backwards, while tying their hair with both hands. This position increases the risk of aspiration, particularly if there is any sudden coughing or laughing. To our knowledge, this is the first case report of a 35-mm straight metallic hairpin foreign body that has been successfully retrieved by a radiological snare system under fluoroscopic guidance. This was achieved with the use of a split endotracheal tube, and therefore avoided the need for a thoracotomy in an adolescent female patient.

  20. Stability of monomeric Cro variants: Isoenergetic transformation of a type I' to a type II' beta-hairpin by single amino acid replacements.

    Science.gov (United States)

    Mollah, A K M M; Stennis, Rhonda L; Mossing, Michael C

    2003-05-01

    The thermodynamic stabilities of three monomeric variants of the bacteriophage lambda Cro repressor that differ only in the sequence of two amino acids at the apex of an engineered beta-hairpin have been determined. The sequences of the turns are EVK-XX-EVK, where the two central residues are DG, GG, and GT, respectively. Standard-state unfolding free energies, determined from circular dichroism measurements as a function of urea concentration, range from 2.4 to 2.7 kcal/mole, while those determined from guanidine hydrochloride range from 2.8 to 3.3 kcal/mole for the three proteins. Thermal denaturation yields van't Hoff unfolding enthalpies of 36 to 40 kcal /mole at midpoint temperatures in the range of 53 to 58 degrees C. Extrapolation of the thermal denaturation free energies with heat capacities of 400 to 600 cal/mole deg gives good agreement with the parameters determined in denaturant titrations. As predicted from statistical surveys of amino acid replacements in beta-hairpins, energetic barriers to transformation from a type I' turn (DG) to a type II' turn (GT) can be quite small.

  1. Conventional (CH) vs. stapled hemorrhoidectomy (SH) in surgical treatment of hemorrhoids. Ten years experience.

    Science.gov (United States)

    Manfredelli, Simone; Montalto, Gioacchino; Leonetti, Giovanni; Covotta, Marco; Amatucci, Chiara; Covotta, Alfredo; Forte, Angelo

    2012-01-01

    Interest about hemorrhoids is related to its high incidence and elevated social costs that derive from its treatment. Several comparative studies are reported in Literature to define a standard for ideal treatment of hemorrhoidal disease. Radical surgery is the only therapeutic option in case of III and IV stage haemorrhoids. Hemorrhoids surgical techniques are classified as Open, Closed and Stapled ones. We report our decennial experience on surgical treatment focusing on early, middle and late complications, indications and contraindications, satisfaction level of each surgical procedure for hemorrhoids. Four hundred forty-eight patients have been hospitalized in our department fom 1st January to 31st December 2008. Of these 241 underwent surgery with traditional open or closed technique and 207 with the SH technique according to Longo. This retrospective study includes only patients with symptomatic hemorrhoids at III or IV stage. There were no differences between CH and SH about both pre and post surgery hospitalization and intraoperative length. Pain is the most frequently observed early complication with a statistically significant difference in favour of SH. We obtain good results in CH group using anoderma sparing and perianal anaesthetic infiltration at the end of the surgery. In all cases, pain relief was obtained only with standard analgesic drugs (NSAIDs). We also observed that pain level influences the outcome after surgical treatment. No chronic pain cases were observed in both groups. Bleeding is another relevant early complication in particular after SH: we reported 2 cases of immediate surgical reintenvention and 2 cases treated with blood transfusion. Only in SH group we report also 5 cases of thrombosis of external haemorrhoids and 7 perianal hematoma both solved with medical therapy There were no statistical significant differences between two groups about fever, incontinence to flatus, urinary retention, fecal incontinence, substenosis and anal

  2. “Girls are dancin’”: shōjo culture and feminism in contemporary Japanese art

    OpenAIRE

    Emily Jane Wakeling

    2011-01-01

    This article explores the gender-transgressive expressions found in shōjo culture in order to highlight the potential for feminist analysis in the prevalence of the shōjo motif in contemporary Japanese art. Shōjo culture is a fascinating cultural space, within contemporary Japanese culture, which fosters creative expressions of gender that negate or make complex hegemonic categories. Departing from stereotypes of Japanese girls, this article will pay particular interest to an emerging wave of...

  3. In vivo binding properties of SH2 domains from GTPase-activating protein and phosphatidylinositol 3-kinase.

    Science.gov (United States)

    Cooper, J A; Kashishian, A

    1993-01-01

    We have used a transient expression system and mutant platelet-derived growth factor (PDGF) receptors to study the binding specificities of the Src homology 2 (SH2) regions of the Ras GTPase-activator protein (GAP) and the p85 alpha subunit of phosphatidylinositol 3-kinase (PI3 kinase). A number of fusion proteins, each tagged with an epitope allowing recognition by a monoclonal antibody, were expressed at levels comparable to those of endogenous GAP. Fusion proteins containing the central SH2-SH3-SH2 region of GAP or the C-terminal region of p85 alpha, which includes two SH2 domains, bound to PDGF receptors in response to PDGF stimulation. Both fusion proteins showed the same requirements for tyrosine phosphorylation sites in the PDGF receptor as the full-length proteins from which they were derived, i.e., binding of the GAP fusion protein was reduced by mutation of Tyr-771, and binding of the p85 fusion protein was reduced by mutation of Tyr-740, Tyr-751, or both residues. Fusion proteins containing single SH2 domains from either GAP or p85 alpha did not bind detectably to PDGF receptors in this system, suggesting that two SH2 domains in a single polypeptide cooperate to raise the affinity of binding. The sequence specificities of individual SH2 domains were deduced from the binding properties of fusion proteins containing one SH2 domain from GAP and another from p85. The results suggest that the C-terminal GAP SH2 domain specifies binding to Tyr-771, the C-terminal p85 alpha SH2 domain binds to either Tyr-740 or Tyr-751, and each protein's N-terminal SH2 domain binds to unidentified phosphorylation sites.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:8382774

  4. Fusion protein based on Grb2-SH2 domain for cancer therapy

    International Nuclear Information System (INIS)

    Saito, Yuriko; Furukawa, Takako; Arano, Yasushi; Fujibayashi, Yasuhisa; Saga, Tsuneo

    2010-01-01

    Research highlights: → Grb2 mediates EGFR signaling through binding to phosphorylate EGFR with SH2 domain. → We generated fusion proteins containing 1 or 2 SH2 domains of Grb2 added with TAT. → The one with 2 SH2 domains (TSSF) interfered ERK phosphorylation. → TSSF significantly delayed the growth of EGFR overexpressing tumor in a mouse model. -- Abstract: Epidermal growth factor receptor (EGFR) is one of the very attractive targets for cancer therapy. In this study, we generated fusion proteins containing one or two Src-homology 2 (SH2) domains of growth factor receptor bound protein 2 (Grb2), which bind to phosphorylated EGFR, added with HIV-1 transactivating transcription for cell membrane penetration (termed TSF and TSSF, respectively). We examined if they can interfere Grb2-mediated signaling pathway and suppress tumor growth as expected from the lack of SH3 domain, which is necessary to intermediate EGFR-Grb2 cell signaling, in the fusion proteins. The transduction efficiency of TSSF was similar to that of TSF, but the binding activity of TSSF to EGFR was higher than that of TSF. Treatment of EGFR-overexpressing cells showed that TSSF decreased p42-ERK phosphorylation, while TSF did not. Both the proteins delayed cell growth but did not induce cell death in culture. TSSF also significantly suppressed tumor growth in vivo under consecutive administration. In conclusion, TSSF showed an ability to inhibit EGFR-Grb2 signaling and could have a potential to treat EGFR-activated cancer.

  5. Pomegranate inhibits neuroinflammation and amyloidogenesis in IL-1β-stimulated SK-N-SH cells.

    Science.gov (United States)

    Velagapudi, Ravikanth; Baco, Gina; Khela, Sunjeet; Okorji, Uchechukwu; Olajide, Olumayokun

    2016-06-01

    Pomegranate fruit, Punica granatum L. (Punicaceae), and its constituents have been shown to inhibit inflammation. In this study, we aimed to assess the effects of freeze-dried pomegranate (PWE) on PGE2 production in IL-1β-stimulated SK-N-SH cells. An enzyme immunoassay (EIA) was used to measure prostaglandin E2 (PGE2) production from supernatants of IL-1β-stimulated SK-N-SH cells. Expression of COX-2, phospho-IκB, and phospho-IKK proteins was evaluated, while NF-κB reporter gene assay was carried out in TNFα-stimulated HEK293 cells to determine the effect of PWE on NF-κB transactivation. Levels of BACE-1 and Aβ in SK-N-SH cells stimulated with IL-1β were measured with an in cell ELISA. PWE (25-200 μg/ml) dose dependently reduced COX-2-dependent PGE2 production in SK-N-SH cells stimulated with IL-1β. Phosphorylation of IκB and IKK was significantly (p pomegranate inhibits inflammation, as well as amyloidogenesis in IL-1β-stimulated SK-N-SH cells. We propose that pomegranate is a potential nutritional strategy in slowing the progression of neurodegenerative disorders such as Alzheimer's disease.

  6. Coupled motions in the SH2 and kinase domains of Csk control Src phosphorylation.

    Science.gov (United States)

    Wong, Lilly; Lieser, Scot A; Miyashita, Osamu; Miller, Meghan; Tasken, Kjetil; Onuchic, Josè N; Adams, Joseph A; Woods, Virgil L; Jennings, Patricia A

    2005-08-05

    The C-terminal Src kinase (Csk) phosphorylates and down-regulates Src family tyrosine kinases. The Csk-binding protein (Cbp) localizes Csk close to its substrates at the plasma membrane, and increases the specific activity of the kinase. To investigate this long-range catalytic effect, the phosphorylation of Src and the conformation of Csk were investigated in the presence of a high-affinity phosphopeptide derived from Cbp. This peptide binds tightly to the SH2 domain and enhances Src recognition (lowers K(m)) by increasing the apparent phosphoryl transfer rate in the Csk active site, a phenomenon detected in rapid quench flow experiments. Previous studies demonstrated that the regulation of Csk activity is linked to conformational changes in the enzyme that can be probed with hydrogen-deuterium exchange methods. We show that the Cbp peptide impacts deuterium incorporation into its binding partner (the SH2 domain), and into the SH2-kinase linker and several sequences in the kinase domain, including the glycine-rich loop in the active site. These findings, along with computational data from normal mode analyses, suggest that the SH2 domain moves in a cantilever fashion with respect to the small lobe of the kinase domain, ordering the active site for catalysis. The binding of a small Cbp-derived peptide to the SH2 domain of Csk modifies these motions, enhancing Src recognition.

  7. Estrogen Receptor Folding Modulates cSrc Kinase SH2 Interaction via a Helical Binding Mode.

    Science.gov (United States)

    Nieto, Lidia; Tharun, Inga M; Balk, Mark; Wienk, Hans; Boelens, Rolf; Ottmann, Christian; Milroy, Lech-Gustav; Brunsveld, Luc

    2015-11-20

    The estrogen receptors (ERs) feature, next to their transcriptional role, important nongenomic signaling actions, with emerging clinical relevance. The Src Homology 2 (SH2) domain mediated interaction between cSrc kinase and ER plays a key role in this; however the molecular determinants of this interaction have not been elucidated. Here, we used phosphorylated ER peptide and semisynthetic protein constructs in a combined biochemical and structural study to, for the first time, provide a quantitative and structural characterization of the cSrc SH2-ER interaction. Fluorescence polarization experiments delineated the SH2 binding motif in the ER sequence. Chemical shift perturbation analysis by nuclear magnetic resonance (NMR) together with molecular dynamics (MD) simulations allowed us to put forward a 3D model of the ER-SH2 interaction. The structural basis of this protein-protein interaction has been compared with that of the high affinity SH2 binding sequence GpYEEI. The ER features a different binding mode from that of the "two-pronged plug two-hole socket" model in the so-called specificity determining region. This alternative binding mode is modulated via the folding of ER helix 12, a structural element directly C-terminal of the key phosphorylated tyrosine. The present findings provide novel molecular entries for understanding nongenomic ER signaling and targeting the corresponding disease states.

  8. Characterizing tyrosine phosphorylation signaling in lung cancer using SH2 profiling.

    Directory of Open Access Journals (Sweden)

    Kazuya Machida

    2010-10-01

    Full Text Available Tyrosine kinases drive the proliferation and survival of many human cancers. Thus profiling the global state of tyrosine phosphorylation of a tumor is likely to provide a wealth of information that can be used to classify tumors for prognosis and prediction. However, the comprehensive analysis of tyrosine phosphorylation of large numbers of human cancer specimens is technically challenging using current methods.We used a phosphoproteomic method termed SH2 profiling to characterize the global state of phosphotyrosine (pTyr signaling in human lung cancer cell lines. This method quantifies the phosphorylated binding sites for SH2 domains, which are used by cells to respond to changes in pTyr during signaling. Cells could be grouped based on SH2 binding patterns, with some clusters correlated with EGF receptor (EGFR or K-RAS mutation status. Binding of specific SH2 domains, most prominently RAS pathway activators Grb2 and ShcA, correlated with EGFR mutation and sensitivity to the EGFR inhibitor erlotinib. SH2 binding patterns also reflected MET activation and could identify cells driven by multiple kinases. The pTyr responses of cells treated with kinase inhibitors provided evidence of distinct mechanisms of inhibition.This study illustrates the potential of modular protein domains and their proteomic binding profiles as powerful molecular diagnostic tools for tumor classification and biomarker identification.

  9. Crystal Structure of the FERM-SH2 Module of Human Jak2.

    Science.gov (United States)

    McNally, Randall; Toms, Angela V; Eck, Michael J

    2016-01-01

    Jak-family tyrosine kinases mediate signaling from diverse cytokine receptors. Binding of Jaks to their cognate receptors is mediated by their N-terminal region, which contains FERM and SH2 domains. Here we describe the crystal structure of the FERM-SH2 region of Jak2 at 3.0Å resolution. The structure reveals that these domains and their flanking linker segments interact intimately to form an integrated structural module. The Jak2 FERM-SH2 structure closely resembles that recently described for Tyk2, another member of the Jak family. While the overall architecture and interdomain orientations are preserved between Jak2 and Tyk2, we identify residues in the putative receptor-binding groove that differ between the two and may contribute to the specificity of receptor recognition. Analysis of Jak mutations that are reported to disrupt receptor binding reveals that they lie in the hydrophobic core of the FERM domain, and are thus expected to compromise the structural integrity of the FERM-SH2 unit. Similarly, analysis of mutations in Jak3 that are associated with severe combined immunodeficiency suggests that they compromise Jak3 function by destabilizing the FERM-SH2 structure.

  10. Structural basis for activation of ZAP-70 by phosphorylation of the SH2-kinase linker.

    Science.gov (United States)

    Yan, Qingrong; Barros, Tiago; Visperas, Patrick R; Deindl, Sebastian; Kadlecek, Theresa A; Weiss, Arthur; Kuriyan, John

    2013-06-01

    Serial activation of the tyrosine kinases Lck and ZAP-70 initiates signaling downstream of the T cell receptor. We previously reported the structure of an autoinhibited ZAP-70 variant in which two regulatory tyrosine residues (315 and 319) in the SH2-kinase linker were replaced by phenylalanine. We now present a crystal structure of ZAP-70 in which Tyr 315 and Tyr 319 are not mutated, leading to the recognition of a five-residue sequence register error in the SH2-kinase linker of the original crystallographic model. The revised model identifies distinct roles for these two tyrosines. As seen in a recently reported structure of the related tyrosine kinase Syk, Tyr 315 of ZAP-70 is part of a hydrophobic interface between the regulatory apparatus and the kinase domain, and the integrity of this interface would be lost upon engagement of doubly phosphorylated peptides by the SH2 domains. Tyr 319 is not necessarily dislodged by SH2 engagement, which activates ZAP-70 only ∼5-fold in vitro. In contrast, phosphorylation by Lck activates ZAP-70 ∼100-fold. This difference is due to the ability of Tyr 319 to suppress ZAP-70 activity even when the SH2 domains are dislodged from the kinase domain, providing stringent control of ZAP-70 activity downstream of Lck.

  11. Solution structure, dynamics and thermodynamics of the three SH3 domains of CD2AP

    Energy Technology Data Exchange (ETDEWEB)

    Roldan, Jose L. Ortega [Universidad de Granada, Departamento de Quimica Fisica e Instituto de Biotecnologia, Facultad de Ciencias (Spain); Blackledge, Martin [Institut de Biologie Structurale Jean-Pierre Ebel, CEA, CNRS, UJF UMR 5075, Protein Dynamics and Flexibility by NMR (France); Nuland, Nico A. J. van, E-mail: nvnuland@vub.ac.be [Vrije Universiteit Brussel, Structural Biology Brussels (Belgium); Azuaga, Ana I. [Universidad de Granada, Departamento de Quimica Fisica e Instituto de Biotecnologia, Facultad de Ciencias (Spain)

    2011-06-15

    CD2 associated protein (CD2AP) is an adaptor protein that plays an important role in cell to cell union needed for the kidney function. It contains three N-terminal SH3 domains that are able to interact among others with CD2, ALIX, c-Cbl and Ubiquitin. To understand the role of the individual SH3 domains of this adaptor protein we have performed a complete structural, thermodynamic and dynamic characterization of the separate domains using NMR and DSC. The energetic contributions to the stability and the backbone dynamics have been related to the structural features of each domain using the structure-based FoldX algorithm. We have found that the N-terminal SH3 domain of both adaptor proteins CD2AP and CIN85 are the most stable SH3 domains that have been studied until now. This high stability is driven by a more extensive network of intra-molecular interactions. We believe that this increased stabilization of N-terminal SH3 domains in adaptor proteins is crucial to maintain the necessary conformation to establish the proper interactions critical for the recruitment of their natural targets.

  12. SH1 leaf rust and bacterial halo blight coffee resistances are genetically independent

    Directory of Open Access Journals (Sweden)

    Lucas Mateus Rivero Rodrigues

    Full Text Available ABSTRACT Coffee resistance to Pseudomonas syringae pv. garcae has been associated to pleiotropic effect of SH1 allele, present in coffee plants resistant to certain races of Hemileia vastatrix, the causal agent of leaf rust, or genetic linkage between resistance alleles to both pathogens. To validate this hypothesis, 63 coffee plants in F2 generation were evaluated for resistance to 2 isolates of H. vastatrix carriers of alleles, respectively, v2, v5 (isolate I/2015 and v1; v2; v5 (isolate II/2015 with the objective to confirm presence of SH1 allele in resistant plants to isolate I/2015. The same coffee plants were evaluated for resistance to a mixture of P. syringae pv. garcae strains highly pathogenic to coffee. Results showed that, among F2 coffee allele SH1 carriers, resistant to isolate I/2015, resistant and susceptible plants to bacterial halo blight were found; the same segregation occurs between F2 homozygous for SH1 allele, susceptible to the same isolate (I/2015 of H. vastatrix. Results also indicate that there is no pleiotropic effect of gene or allele SH1 connection between genes conferring resistance to leaf rust caused by H. vastatrix and bacterial halo blight caused by P. syringae pv. garcae.

  13. Characterization of AKT independent effects of the synthetic AKT inhibitors SH-5 and SH-6 using an integrated approach combining transcriptomic profiling and signaling pathway perturbations

    Directory of Open Access Journals (Sweden)

    Schäfer Reinhold

    2010-06-01

    Full Text Available Abstract Background Signal transduction processes mediated by phosphatidyl inositol phosphates affect a broad range of cellular processes such as cell cycle progression, migration and cell survival. The protein kinase AKT is one of the major effectors in this signaling network. Chronic AKT activation contributes to oncogenic transformation and tumor development. Therefore, analogs of phosphatidyl inositol phosphates (PIAs were designed as new small drugs to block AKT activity for cancer treatment. Here we characterize the biological effects of the PIAs SH-5 and SH-6 in colorectal cancer cell lines. Methods Serum-starved or serum-supplemented human colorectal cancer cell lines SW480, HT29 and HCT116 were exposed to SH-5 and SH-6. AKT activation was determined by western blotting. Cell viability was assessed using a colorimetric XTT-based assay, apoptosis and cell cycle changes were monitored by FACS analysis. The dynamics of cell morphology alterations was evaluated by confocal and time-lapse microscopy. Transcriptional changes due to inhibitor treatment were analyzed using Affymetrix HG-U133A microarrays and RT-PCR. Results While the PIAs clearly reduce AKT phosphorylation in serum starved cells, we did not observe a significant reduction under serum supplemented conditions, giving us the opportunity to analyze AKT independent effects of these compounds. Both inhibitors induce broadly the same morphological alterations, in particular changes in cell shape and formation of intracellular vesicles. Moreover, we observed the induction of binucleated cells specifically in the SW480 cell line. Gene expression analysis revealed transcriptional alterations, which are mostly cell line specific. In accordance to the phenotype we found a gene group associated with mitosis and spindle organization down regulated in SW480 cells, but not in the other cell lines. A bioinformatics analysis using the Connectivity Map linked the gene expression pattern of the

  14. Characterization of AKT independent effects of the synthetic AKT inhibitors SH-5 and SH-6 using an integrated approach combining transcriptomic profiling and signaling pathway perturbations

    International Nuclear Information System (INIS)

    Krech, Till; Thiede, Margarethe; Hilgenberg, Ellen; Schäfer, Reinhold; Jürchott, Karsten

    2010-01-01

    Signal transduction processes mediated by phosphatidyl inositol phosphates affect a broad range of cellular processes such as cell cycle progression, migration and cell survival. The protein kinase AKT is one of the major effectors in this signaling network. Chronic AKT activation contributes to oncogenic transformation and tumor development. Therefore, analogs of phosphatidyl inositol phosphates (PIAs) were designed as new small drugs to block AKT activity for cancer treatment. Here we characterize the biological effects of the PIAs SH-5 and SH-6 in colorectal cancer cell lines. Serum-starved or serum-supplemented human colorectal cancer cell lines SW480, HT29 and HCT116 were exposed to SH-5 and SH-6. AKT activation was determined by western blotting. Cell viability was assessed using a colorimetric XTT-based assay, apoptosis and cell cycle changes were monitored by FACS analysis. The dynamics of cell morphology alterations was evaluated by confocal and time-lapse microscopy. Transcriptional changes due to inhibitor treatment were analyzed using Affymetrix HG-U133A microarrays and RT-PCR. While the PIAs clearly reduce AKT phosphorylation in serum starved cells, we did not observe a significant reduction under serum supplemented conditions, giving us the opportunity to analyze AKT independent effects of these compounds. Both inhibitors induce broadly the same morphological alterations, in particular changes in cell shape and formation of intracellular vesicles. Moreover, we observed the induction of binucleated cells specifically in the SW480 cell line. Gene expression analysis revealed transcriptional alterations, which are mostly cell line specific. In accordance to the phenotype we found a gene group associated with mitosis and spindle organization down regulated in SW480 cells, but not in the other cell lines. A bioinformatics analysis using the Connectivity Map linked the gene expression pattern of the inhibitor treated SW480 cells to PKC signaling. Using

  15. Solution structure of tensin2 SH2 domain and its phosphotyrosine-independent interaction with DLC-1.

    Directory of Open Access Journals (Sweden)

    Kun Dai

    Full Text Available Src homology 2 (SH2 domain is a conserved module involved in various biological processes. Tensin family member was reported to be involved in tumor suppression by interacting with DLC-1 (deleted-in-liver-cancer-1 via its SH2 domain. We explore here the important questions that what the structure of tensin2 SH2 domain is, and how it binds to DLC-1, which might reveal a novel binding mode.Tensin2 SH2 domain adopts a conserved SH2 fold that mainly consists of five β-strands flanked by two α-helices. Most SH2 domains recognize phosphorylated ligands specifically. However, tensin2 SH2 domain was identified to interact with nonphosphorylated ligand (DLC-1 as well as phosphorylated ligand.We determined the solution structure of tensin2 SH2 domain using NMR spectroscopy, and revealed the interactions between tensin2 SH2 domain and its ligands in a phosphotyrosine-independent manner.

  16. Quality of pharmacy-specific Medical Subject Headings (MeSH) assignment in pharmacy journals indexed in MEDLINE.

    Science.gov (United States)

    Minguet, Fernando; Salgado, Teresa M; van den Boogerd, Lucienne; Fernandez-Llimos, Fernando

    2015-01-01

    The Medical Subject Headings (MeSH) is the National Library of Medicine (NLM) controlled vocabulary for indexing articles. Inaccuracies in the MeSH thesaurus have been reported for several areas including pharmacy. To assess the quality of pharmacy-specific MeSH assignment to articles indexed in pharmacy journals. The 10 journals containing the highest number of articles published in 2012 indexed under the MeSH 'Pharmacists' were identified. All articles published over a 5-year period (2008-2012) in the 10 previously selected journals were retrieved from PubMed. MeSH terms used to index these articles were extracted and pharmacy-specific MeSH terms were identified. The frequency of use of pharmacy-specific MeSH terms was calculated across journals. A total of 6989 articles were retrieved from the 10 pharmacy journals, of which 328 (4.7%) were articles not fully indexed and therefore did not contain any MeSH terms assigned. Among the 6661 articles fully indexed, the mean number of MeSH terms was 10.1 (SD = 4.0), being 1.0 (SD = 1.3) considered as Major MeSH. Both values significantly varied across journals. The mean number of pharmacy-specific MeSH terms per article was 0.9 (SD = 1.2). A total of 3490 (52.4%) of the 6661 articles were indexed in pharmacy journals without a single pharmacy-specific MeSH. Of the total 67193 MeSH terms assigned to articles, on average 10.5% (SD = 13.9) were pharmacy-specific MeSH. A statistically significant different pattern of pharmacy-specific MeSH assignment was identified across journals (Kruskal-Wallis P journals can be improved to further enhance evidence gathering in pharmacy. Over half of the articles published in the top-10 journals publishing pharmacy literature were indexed without a single pharmacy-specific MeSH. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. Identification of SH2-Bbeta as a substrate of the tyrosine kinase JAK2 involved in growth hormone signaling.

    OpenAIRE

    Rui, L; Mathews, L S; Hotta, K; Gustafson, T A; Carter-Su, C

    1997-01-01

    Activation of the tyrosine kinase JAK2 is an essential step in cellular signaling by growth hormone (GH) and multiple other hormones and cytokines. Murine JAK2 has a total of 49 tyrosines which, if phosphorylated, could serve as docking sites for Src homology 2 (SH2) or phosphotyrosine binding domain-containing signaling molecules. Using a yeast two-hybrid screen of a rat adipocyte cDNA library, we identified a splicing variant of the SH2 domain-containing protein SH2-B, designated SH2-Bbeta,...

  18. Time-resolved multimodal analysis of Src Homology 2 (SH2) domain binding in signaling by receptor tyrosine kinases.

    Science.gov (United States)

    Jadwin, Joshua A; Oh, Dongmyung; Curran, Timothy G; Ogiue-Ikeda, Mari; Jia, Lin; White, Forest M; Machida, Kazuya; Yu, Ji; Mayer, Bruce J

    2016-04-12

    While the affinities and specificities of SH2 domain-phosphotyrosine interactions have been well characterized, spatio-temporal changes in phosphosite availability in response to signals, and their impact on recruitment of SH2-containing proteins in vivo, are not well understood. To address this issue, we used three complementary experimental approaches to monitor phosphorylation and SH2 binding in human A431 cells stimulated with epidermal growth factor (EGF): 1) phospho-specific mass spectrometry; 2) far-Western blotting; and 3) live cell single-molecule imaging of SH2 membrane recruitment. Far-Western and MS analyses identified both well-established and previously undocumented EGF-dependent tyrosine phosphorylation and binding events, as well as dynamic changes in binding patterns over time. In comparing SH2 binding site phosphorylation with SH2 domain membrane recruitment in living cells, we found in vivo binding to be much slower. Delayed SH2 domain recruitment correlated with clustering of SH2 domain binding sites on the membrane, consistent with membrane retention via SH2 rebinding.

  19. Ultraviolet absorption spectra and kinetics of CH3S and CH2SH radicals

    DEFF Research Database (Denmark)

    Anastasi, C.; Broomfield, M.; Nielsen, O.J.

    1991-01-01

    The ultraviolet absorption spectra of CH3S and CH2SH radicals have been measured between 215 and 380 nm using the pulse-radiolysis/kinetic-absorption method. One absorption band between 250 and 300 nm and one around 215 nm have been tentatively assigned to the CH2SH and CH3S radicals, respectively....... This spectrum has been used to measure the self-reaction rates of these radicals. Rate constants of 4 x 10(-11) and 7 x 10(-11) cm3 molecule-1 s-1 have been measured at 298 K for CH3S and CH2SH recombination, respectively. The possible reaction pathways are discussed....

  20. Identification of Tyrosine Phosphorylated Proteins by SH2 Domain Affinity Purification and Mass Spectrometry.

    Science.gov (United States)

    Buhs, Sophia; Gerull, Helwe; Nollau, Peter

    2017-01-01

    Phosphotyrosine signaling plays a major role in the control of many important biological functions such as cell proliferation and apoptosis. Deciphering of phosphotyrosine-dependent signaling is therefore of great interest paving the way for the understanding of physiological and pathological processes of signal transduction. On the basis of the specific binding of SH2 domains to phosphotyrosine residues, we here present an experimental workflow for affinity purification and subsequent identification of tyrosine phosphorylated proteins by mass spectrometry. In combination with SH2 profiling, a broadly applicable platform for the characterization of phosphotyrosine profiles in cell extracts, our pull down strategy enables researchers by now to identify proteins in signaling cascades which are differentially phosphorylated and selectively recognized by distinct SH2 domains.

  1. Hydrogen Peroxide Toxicity Induces Ras Signaling in Human Neuroblastoma SH-SY5Y Cultured Cells

    Directory of Open Access Journals (Sweden)

    Jirapa Chetsawang

    2010-01-01

    Full Text Available It has been reported that overproduction of reactive oxygen species occurs after brain injury and mediates neuronal cells degeneration. In the present study, we examined the role of Ras signaling on hydrogen peroxide-induced neuronal cells degeneration in dopaminergic neuroblastoma SH-SY5Y cells. Hydrogen peroxide significantly reduced cell viability in SH-SY5Y cultured cells. An inhibitor of the enzyme that catalyzes the farnesylation of Ras proteins, FTI-277, and a competitive inhibitor of GTP-binding proteins, GDP-beta-S significantly decreased hydrogen peroxide-induced reduction in cell viability in SH-SY5Y cultured cells. The results of this study might indicate that a Ras-dependent signaling pathway plays a role in hydrogen peroxide-induced toxicity in neuronal cells.

  2. Strong SH-to-Love wave scattering off the Southern California Continental Borderland

    Science.gov (United States)

    Yu, Chunquan; Zhan, Zhongwen; Hauksson, Egill; Cochran, Elizabeth S.

    2017-01-01

    Seismic scattering is commonly observed and results from wave propagation in heterogeneous medium. Yet, deterministic characterization of scatterers associated with lateral heterogeneities remains challenging. In this study, we analyze broadband waveforms recorded by the Southern California Seismic Network and observe strongly scattered Love waves following the arrival of teleseismic SH wave. These scattered Love waves travel approximately in the same (azimuthal) direction as the incident SH wave at a dominant period of ~10 s but at an apparent velocity of ~3.6 km/s as compared to the ~11 km/s for the SH wave. Back-projection suggests that this strong scattering is associated with pronounced bathymetric relief in the Southern California Continental Borderland, in particular the Patton Escarpment. Finite-difference simulations using a simplified 2-D bathymetric and crustal model are able to predict the arrival times and amplitudes of major scatterers. The modeling suggests a relatively low shear wave velocity in the Continental Borderland.

  3. An assessment of the visibility of MeSH-indexed medical web catalogs through search engines.

    Science.gov (United States)

    Zweigenbaum, P; Darmoni, S J; Grabar, N; Douyère, M; Benichou, J

    2002-01-01

    Manually indexed Internet health catalogs such as CliniWeb or CISMeF provide resources for retrieving high-quality health information. Users of these quality-controlled subject gateways are most often referred to them by general search engines such as Google, AltaVista, etc. This raises several questions, among which the following: what is the relative visibility of medical Internet catalogs through search engines? This study addresses this issue by measuring and comparing the visibility of six major, MeSH-indexed health catalogs through four different search engines (AltaVista, Google, Lycos, Northern Light) in two languages (English and French). Over half a million queries were sent to the search engines; for most of these search engines, according to our measures at the time the queries were sent, the most visible catalog for English MeSH terms was CliniWeb and the most visible one for French MeSH terms was CISMeF.

  4. The MeSH model for hospital-physician joint ventures.

    Science.gov (United States)

    Anderson, J G

    1985-01-01

    The MeSH (Medical Staff-Hospital Joint Venture Company) concept has arisen to meet the perceived need for hospital-physician cooperation in a modern age of prospective payment systems, increased supply of health-care providers, cost conscious consumers, corporate health care organizations, and a general trend toward industrialization of health care. Supply and demand economics have created a situation which threatens the autonomy and financial integrity of both hospitals ans physicians, forcing cooperation or mutual destruction. MeSH seeks to preserve the autonomy and financial integrity of both parties through the creation of a free-standing business entity jointly owned by a hospital and those members of its medical staff who choose to participate. This article presents reasons for the need for cooperation, the objectives of MeSH, a description of its structure and operation, and a list of potential projects the program could include.

  5. A novel mutation in the SH3BP2 gene causes cherubism: case report

    Directory of Open Access Journals (Sweden)

    Yu Shi-Feng

    2006-12-01

    Full Text Available Abstract Background Cherubism is a rare hereditary multi-cystic disease of the jaws, characterized by its typical appearance in early childhood, and stabilization and remission after puberty. It is genetically transmitted in an autosomal dominant fashion and the gene coding for SH3-binding protein 2 (SH3BP2 may be involved. Case presentation We investigated a family consisting of 21 members with 3 female affected individuals with cherubism from Northern China. Of these 21 family members, 17 were recruited for the genetic analysis. We conducted the direct sequence analysis of the SH3BP2 gene among these 17 family members. A disease-causing mutation was identified in exon 9 of the gene. It was an A1517G base change, which leads to a D419G amino acid substitution. Conclusion To our knowledge, the A1517G mutation has not been reported previously in cherubism. This finding is novel.

  6. Annotating patents with Medline MeSH codes via citation mapping.

    Science.gov (United States)

    Griffin, Thomas D; Boyer, Stephen K; Councill, Isaac G

    2010-01-01

    Both patents and Medline are important document collections for discovering new relationships between chemicals and biology, searching for prior art for patent applications and retrieving background knowledge for current research activities. Finding relevance to a topic within patents is often made difficult by poor categorization, badly written descriptions, and even intentional obfuscation. Unlike patents, the Medline corpus has Medical Subject Heading (MeSH) keywords manually added to their articles, giving a medically relevant taxonomy to the 18 million article abstracts. Our work attempts to accurately recognize the citations made in patents to Medline-indexed articles, linking them to their corresponding PubMed ID and exploiting the associated MeSH to enhance patent search by annotating the referencing patents with their Medline citations' MeSH codes. The techniques, system features, and benefits are explained.

  7. The T-cell-specific adapter protein family: TSAd, ALX, and SH2D4A/SH2D4B.

    Science.gov (United States)

    Lapinski, Philip E; Oliver, Jennifer A; Bodie, Jennifer N; Marti, Francesc; King, Philip D

    2009-11-01

    Adapter proteins play key roles in intracellular signal transduction through complex formation with catalytically active signaling molecules. In T lymphocytes, the role of several different types of adapter proteins in T-cell antigen receptor signal transduction is well established. An exception to this is the family of T-cell-specific adapter (TSAd) proteins comprising of TSAd, adapter protein of unknown function (ALX), SH2D4A, and SH2D4B. Only recently has the function of these adapters in T-cell signal transduction been explored. Here, we discuss advances in our understanding of the role of this family of adapter proteins in T cells. Their function as regulators of signal transduction in other cell types is also discussed.

  8. Synthesis and in vitro cytotoxicity of mPEG-SH modified gold nanorods

    Science.gov (United States)

    Didychuk, Candice L.; Ephrat, Pinhas; Belton, Michelle; Carson, Jeffrey J. L.

    2008-02-01

    Plasmon-resonant gold nanorods show great potential as an agent for contrast-enhanced biomedical imaging or for phototherapeutics. This is primarily due to the high molar extinction coefficient at the absorption maximum and the dependence of the wavelength of the absorption maximum on the aspect ratio, which is tunable in the near-infrared (NIR) during synthesis. Although gold nanorods can be produced in high-yield through the seed-mediated growth technique, the presence of residual cetyltrimethylammonium bromide (CTAB), a stabilizing surfactant required for nanorod growth, interferes with cell function and causes cytotoxicity. To overcome this potential obstacle to in vivo use, we synthesized gold nanorods and conjugated them to a methoxy (polyethylene glycol)-thiol (mPEG (5000)-SH). This approach yielded mPEG-SH modified gold nanorods with optical and morphometric properties that were similar to raw (CTAB) nanorods. Both the CTAB and mPEG-SH nanorods were tested for cytotoxicity against the HL-60 human leukemia cell line by trypan blue exclusion, and the mPEG-SH modified gold nanorods were also tested against a rat insulinoma (RIN-38) and squamous cell carcinoma (SCCVII) cell line. Cells incubated for 24 h with the mPEG-SH modified nanorods had little change in cell viability compared to cells incubated with vehicle alone. This was in contrast to cytotoxicity of CTAB nanorods on HL-60 cells. These results suggest that mPEG-SH modified gold nanorods are better suited for cell loading protocols and injection into animals and facilitate their use for imaging and phototherapeutic purposes.

  9. ExoMol molecular line lists - XXVI: spectra of SH and NS

    Science.gov (United States)

    Yurchenko, Sergei N.; Bond, Wesley; Gorman, Maire N.; Lodi, Lorenzo; McKemmish, Laura K.; Nunn, William; Shah, Rohan; Tennyson, Jonathan

    2018-04-01

    Line lists for the sulphur-containing molecules SH (the mercapto radical) and NS are computed as part of the ExoMol project. These line lists consider transitions within the X 2Π ground state for 32SH, 33SH, 34SH and 32SD, and 14N32S, 14N33S, 14N34S, 14N36S and 15N32S. Ab initio potential energy (PEC) and spin-orbit coupling (SOC) curves are computed and then improved by fitting to experimentally observed transitions. Fully ab initio dipole moment curves (DMCs) computed at high level of theory are used to produce the final line lists. For SH, our fit gives a root-mean-square (rms) error of 0.03 cm-1 between the observed (vmax = 4, Jmax = 34.5) and calculated transitions wavenumbers; this is extrapolated such that all X 2Π rotational-vibrational-electronic (rovibronic) bound states are considered. For 32SH the resulting line list contains about 81 000 transitions and 2 300 rovibronic states, considering levels up to vmax = 14 and Jmax = 60.5. For NS the refinement used a combination of experimentally determined frequencies and energy levels and led to an rms fitting error of 0.002 cm-1. Each NS calculated line list includes around 2.8 million transitions and 31 000 rovibronic states with a vibrational range up to v = 53 and rotational range to J = 235.5, which covers up to 23 000 cm-1. Both line lists should be complete for temperatures up to 5000 K. Example spectra simulated using this line list are shown and comparisons made to the existing data in the CDMS database. The line lists are available from the CDS (http://cdsarc.u-strasbg.fr) and ExoMol (www.exomol.com) data bases.

  10. Eroding dipoles and vorticity growth for Euler flows in {{{R}}}^{3}: the hairpin geometry as a model for finite-time blowup

    Science.gov (United States)

    Childress, Stephen; Gilbert, Andrew D.

    2018-02-01

    A theory of an eroding ‘hairpin’ vortex dipole structure in three-dimensions is developed, extending our previous study of an axisymmetric eroding dipole without swirl. The axisymmetric toroidal dipole was found to lead to maximal growth of vorticity, as {t}4/3. The hairpin is here similarly proposed as a model to produce large ‘self-stretching’ of vorticity, with the possibility of finite-time blow-up. We derive a system of partial differential equations of ‘generalized’ form, involving contour averaging of a locally two-dimensional Euler flow. We do not attempt here to solve the system exactly, but point out that non-existence of physically acceptable solutions would most probably be a result of the axial flow. Because of the axial flow the vorticity distribution within the dipole eddies is no longer of the simple Sadovskii type (vorticity constant over a cross-section) obtained in the axisymmetric problem. Thus the solution of the system depends upon the existence of a larger class of propagating two-dimensional dipoles. The hairpin model is obtained by formal asymptotic analysis. As in the axisymmetric problem a local transformation to ‘shrinking’ coordinates is introduced, but now in a self-similar form appropriate to the study of a possible finite-time singularity. We discuss some properties of the model, including a study of the helicity and a first step in iterating toward a solution from the Sadovskii structure. We also present examples of two-dimensional propagating dipoles not previously studied, which have a vorticity profile consistent with our model. Although no rigorous results can be given, and analysis of the system is only partial, the formal calculations are consistent with the possibility of a finite time blowup of vorticity at a point of vanishing circulation of the dipole eddies, but depending upon the existence of the necessary two-dimensional propagating dipole. Our results also suggest that conservation of kinetic energy as

  11. Proximity hybridization-regulated catalytic DNA hairpin assembly for electrochemical immunoassay based on in situ DNA template-synthesized Pd nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Fuyi [School of Chemistry and Chemical Engineering, Jiangsu Normal University, Xuzhou 221116 (China); Jiangsu Key Laboratory of New Drug Research and Clinical Pharmacy, Department of Pharmaceutical Analysis, School of Pharmacy, Xuzhou Medical College, 221004, Xuzhou (China); Yao, Yao; Luo, Jianjun; Zhang, Xing; Zhang, Yu; Yin, Dengyang [Jiangsu Key Laboratory of New Drug Research and Clinical Pharmacy, Department of Pharmaceutical Analysis, School of Pharmacy, Xuzhou Medical College, 221004, Xuzhou (China); Gao, Fenglei, E-mail: jsxzgfl@sina.com [Jiangsu Key Laboratory of New Drug Research and Clinical Pharmacy, Department of Pharmaceutical Analysis, School of Pharmacy, Xuzhou Medical College, 221004, Xuzhou (China); Wang, Po, E-mail: wangpo@jsnu.edu.cn [School of Chemistry and Chemical Engineering, Jiangsu Normal University, Xuzhou 221116 (China)

    2017-05-29

    Novel hybridization proximity-regulated catalytic DNA hairpin assembly strategy has been proposed for electrochemical immunoassay based on in situ DNA template-synthesized Pd nanoparticles as signal label. The DNA template-synthesized Pd nanoparticles were characterized with atomic force microscopic and X-ray photoelectron spectroscopy. The highly efficient electrocatalysis by DNA template synthesized Pd nanoparticles for NaBH{sub 4} oxidation produced an intense detection signal. The label-free electrochemical method achieved the detection of carcinoembryonic antigen (CEA) with a linear range from 10{sup −15} to 10{sup −11} g mL{sup −1} and a detection limit of 0.43 × 10{sup −15} g mL{sup −1}. Through introducing a supersandwich reaction to increase the DNA length, the electrochemical signal was further amplified, leading to a detection limit of 0.52 × 10{sup −16} g mL{sup −1}. And it rendered satisfactory analytical performance for the determination of CEA in serum samples. Furthermore, it exhibited good reproducibility and stability; meanwhile, it also showed excellent specificity due to the specific recognition of antigen by antibody. Therefore, the DNA template synthesized Pd nanoparticles based signal amplification approach has great potential in clinical applications and is also suitable for quantification of biomarkers at ultralow level. - Graphical abstract: A novel label-free and enzyme-free electrochemical immunoassay based on proximity hybridization-regulated catalytic DNA hairpin assemblies for recycling of the CEA. - Highlights: • A novel enzyme-free electrochemical immunosensor was developed for detection of CEA. • The signal amplification was based on catalytic DNA hairpin assembly and DNA-template-synthesized Pd nanoparticles. • The biosensor could detect CEA down to 0.52 × 10{sup −16} g mL{sup −1} level with a dynamic range spanning 5 orders of magnitude.

  12. Mutation of CD2AP and SH3KBP1 Binding Motif in Alphavirus nsP3 Hypervariable Domain Results in Attenuated Virus

    Directory of Open Access Journals (Sweden)

    Margit Mutso

    2018-04-01

    Full Text Available Infection by Chikungunya virus (CHIKV of the Old World alphaviruses (family Togaviridae in humans can cause arthritis and arthralgia. The virus encodes four non-structural proteins (nsP (nsP1, nsp2, nsP3 and nsP4 that act as subunits of the virus replicase. These proteins also interact with numerous host proteins and some crucial interactions are mediated by the unstructured C-terminal hypervariable domain (HVD of nsP3. In this study, a human cell line expressing EGFP tagged with CHIKV nsP3 HVD was established. Using quantitative proteomics, it was found that CHIKV nsP3 HVD can bind cytoskeletal proteins, including CD2AP, SH3KBP1, CAPZA1, CAPZA2 and CAPZB. The interaction with CD2AP was found to be most evident; its binding site was mapped to the second SH3 ligand-like element in nsP3 HVD. Further assessment indicated that CD2AP can bind to nsP3 HVDs of many different New and Old World alphaviruses. Mutation of the short binding element hampered the ability of the virus to establish infection. The mutation also abolished ability of CD2AP to co-localise with nsP3 and replication complexes of CHIKV; the same was observed for Semliki Forest virus (SFV harbouring a similar mutation. Similar to CD2AP, its homolog SH3KBP1 also bound the identified motif in CHIKV and SFV nsP3.

  13. Mutation of CD2AP and SH3KBP1 Binding Motif in Alphavirus nsP3 Hypervariable Domain Results in Attenuated Virus.

    Science.gov (United States)

    Mutso, Margit; Morro, Ainhoa Moliner; Smedberg, Cecilia; Kasvandik, Sergo; Aquilimeba, Muriel; Teppor, Mona; Tarve, Liisi; Lulla, Aleksei; Lulla, Valeria; Saul, Sirle; Thaa, Bastian; McInerney, Gerald M; Merits, Andres; Varjak, Margus

    2018-04-27

    Infection by Chikungunya virus (CHIKV) of the Old World alphaviruses (family Togaviridae) in humans can cause arthritis and arthralgia. The virus encodes four non-structural proteins (nsP) (nsP1, nsp2, nsP3 and nsP4) that act as subunits of the virus replicase. These proteins also interact with numerous host proteins and some crucial interactions are mediated by the unstructured C-terminal hypervariable domain (HVD) of nsP3. In this study, a human cell line expressing EGFP tagged with CHIKV nsP3 HVD was established. Using quantitative proteomics, it was found that CHIKV nsP3 HVD can bind cytoskeletal proteins, including CD2AP, SH3KBP1, CAPZA1, CAPZA2 and CAPZB. The interaction with CD2AP was found to be most evident; its binding site was mapped to the second SH3 ligand-like element in nsP3 HVD. Further assessment indicated that CD2AP can bind to nsP3 HVDs of many different New and Old World alphaviruses. Mutation of the short binding element hampered the ability of the virus to establish infection. The mutation also abolished ability of CD2AP to co-localise with nsP3 and replication complexes of CHIKV; the same was observed for Semliki Forest virus (SFV) harbouring a similar mutation. Similar to CD2AP, its homolog SH3KBP1 also bound the identified motif in CHIKV and SFV nsP3.

  14. MEDLINE MeSH Indexing: Lessons Learned from Machine Learning and Future Directions

    DEFF Research Database (Denmark)

    Jimeno-Yepes, Antonio; Mork, James G.; Wilkowski, Bartlomiej

    2012-01-01

    and analyzed the issues when using standard machine learning algorithms. We show that in some cases machine learning can improve the annotations already recommended by MTI, that machine learning based on low variance methods achieves better performance and that each MeSH heading presents a different behavior......Map and a k-NN approach called PubMed Related Citations (PRC). Our motivation is to improve the quality of MTI based on machine learning. Typical machine learning approaches fit this indexing task into text categorization. In this work, we have studied some Medical Subject Headings (MeSH) recommended by MTI...

  15. NH4SH and cloud cover in the atmospheres of the giant planets

    Science.gov (United States)

    Ibragimov, K. Iu.; Solodovnik, A. A.

    1991-02-01

    The probability of the formation of NH4SH and (NH4)2S is examined on the basis of the Le Chatelier principle. It is shown that it is very doubtful if NH4SH can be created in the atmospheres of the giant planets in quantities sufficient for cloud formation. Thus (NH4)2S is considered as a more likely candidate for cloud formation in the atmospheres of these planets, inasmuch as the conditions for its production there are more favorable.

  16. Envisioning the Shôjo Aesthetic in Illustrations of Miyazawa Kenji’s Literature.

    Directory of Open Access Journals (Sweden)

    Helen Claire Kilpatrick

    2013-01-01

    Full Text Available Despite an ever-growing body of scholarship on the shôjo (girl in manga and anime, little has been written about representations of the ‘girl’ in Japanese picture books. Shôjo literature and culture have grown exponentially in Japan since about the 1980s, but there has been a tendency in popular media to overemphasise the 'cute', disempowering aspects of the ‘girl’. By using Takahara Eiri's (1999 concept of “girl consciousness” and Honda Masuko's (1992 envisioning of the girl’s imagined freedom through a hirahira (fluttering aesthetic, notions of the powerless or mindlessly consuming shôjo can be dispelled. Such concepts help demonstrate that the girl ‘has her own creative, critical and cultural, if not social or political, power’ (Aoyama 2008: 286. This paper examines the shôjo tropes in contemporary illustrations that were produced to accompany two tales by the renowned author Miyazawa Kenji (1896-1933, Futago no Hoshi (Twin Stars and Ginga Tetsudô no Yoru (Night of the Milky Way Railway. Although Kenji (as he is known is not generally considered a shôjo author, some of his works incorporate gently transgressive shôjo themes reminiscent of, for example, Yoshiya Nobuko’s Hana Monogatari (Flower Tales from the 1920s. I argue that the current artwork of two award-winning artists, Makino Suzuko and Azuma Itsuko, reflects and enhances Kenji’s ‘girlish’ verbal images, bringing them to the fore in their accompanying imagery for Futago and Ginga by drawing on shôjo art, manga and literature. The artists thus bring into play intertextual references that occur not only across different historical temporalities but also through relations between the author, the artist, the text(s, the protagonists and the reading/viewing audience. The analysis of their striking artwork shows how they bring Kenji’s 1920s’ works firmly into the arena of the contemporary ‘girl’, expanding the abstract consciousness of the shôjo to

  17. Sleep of reason? The practices of reading shônen manga

    OpenAIRE

    Gallacher, Lesley-Anne

    2011-01-01

    In this thesis, I explore the practices of English-speaking readers of shônen manga (Japanese comics written primarily for an audience of teenage boys). I concentrate on three series in particular: Hiromu Arakawa’s Fullmetal Alchemist (2001–2010), Tite Kubo’s Bleach (2001–ongoing), and Masashi Kishimoto’s Naruto (1999–ongoing). I argue that, although it may appear to be inherently imbued with (authorial) meaning, the shônen manga text emerges from a curious ‘alchemy’ through...

  18. Structure of the SH3 domain of human osteoclast-stimulating factor at atomic resolution

    International Nuclear Information System (INIS)

    Chen, Liqing; Wang, Yujun; Wells, David; Toh, Diana; Harold, Hunt; Zhou, Jing; DiGiammarino, Enrico; Meehan, Edward J.

    2006-01-01

    The crystal structure of the SH3 domain of human osteoclast-stimulating factor has been determined and refined to the ultrahigh resolution of 1.07 Å. The structure at atomic resolution provides an accurate framework for structure-based design of its inhibitors. Osteoclast-stimulating factor (OSF) is an intracellular signaling protein, produced by osteoclasts themselves, that enhances osteoclast formation and bone resorption. It is thought to act via an Src-related signaling pathway and contains SH3 and ankyrin-repeat domains which are involved in protein–protein interactions. As part of a structure-based anti-bone-loss drug-design program, the atomic resolution X-ray structure of the recombinant human OSF SH3 domain (hOSF-SH3) has been determined. The domain, residues 12–72, yielded crystals that diffracted to the ultrahigh resolution of 1.07 Å. The overall structure shows a characteristic SH3 fold consisting of two perpendicular β-sheets that form a β-barrel. Structure-based sequence alignment reveals that the putative proline-rich peptide-binding site of hOSF-SH3 consists of (i) residues that are highly conserved in the SH3-domain family, including residues Tyr21, Phe23, Trp49, Pro62, Asn64 and Tyr65, and (ii) residues that are less conserved and/or even specific to hOSF, including Thr22, Arg26, Thr27, Glu30, Asp46, Thr47, Asn48 and Leu60, which might be key to designing specific inhibitors for hOSF to fight osteoporosis and related bone-loss diseases. There are a total of 13 well defined water molecules forming hydrogen bonds with the above residues in and around the peptide-binding pocket. Some of those water molecules might be important for drug-design approaches. The hOSF-SH3 structure at atomic resolution provides an accurate framework for structure-based design of its inhibitors

  19. Dissection of the BCR-ABL signaling network using highly specific monobody inhibitors to the SHP2 SH2 domains.

    Science.gov (United States)

    Sha, Fern; Gencer, Emel Basak; Georgeon, Sandrine; Koide, Akiko; Yasui, Norihisa; Koide, Shohei; Hantschel, Oliver

    2013-09-10

    The dysregulated tyrosine kinase BCR-ABL causes chronic myelogenous leukemia in humans and forms a large multiprotein complex that includes the Src-homology 2 (SH2) domain-containing phosphatase 2 (SHP2). The expression of SHP2 is necessary for BCR-ABL-dependent oncogenic transformation, but the precise signaling mechanisms of SHP2 are not well understood. We have developed binding proteins, termed monobodies, for the N- and C-terminal SH2 domains of SHP2. Intracellular expression followed by interactome analysis showed that the monobodies are essentially monospecific to SHP2. Two crystal structures revealed that the monobodies occupy the phosphopeptide-binding sites of the SH2 domains and thus can serve as competitors of SH2-phosphotyrosine interactions. Surprisingly, the segments of both monobodies that bind to the peptide-binding grooves run in the opposite direction to that of canonical phosphotyrosine peptides, which may contribute to their exquisite specificity. When expressed in cells, monobodies targeting the N-SH2 domain disrupted the interaction of SHP2 with its upstream activator, the Grb2-associated binder 2 adaptor protein, suggesting decoupling of SHP2 from the BCR-ABL protein complex. Inhibition of either N-SH2 or C-SH2 was sufficient to inhibit two tyrosine phosphorylation events that are critical for SHP2 catalytic activity and to block ERK activation. In contrast, targeting the N-SH2 or C-SH2 revealed distinct roles of the two SH2 domains in downstream signaling, such as the phosphorylation of paxillin and signal transducer and activator of transcription 5. Our results delineate a hierarchy of function for the SH2 domains of SHP2 and validate monobodies as potent and specific antagonists of protein-protein interactions in cancer cells.

  20. Natural short sleeper

    Science.gov (United States)

    Sleep - natural short sleeper ... 7 to 9 hours of sleep each night. Short sleepers sleep less than 75% of what is normal for their age. Natural short sleepers are different from people who chronically do ...

  1. MeSH key terms for validation and annotation of gene expression clusters

    Energy Technology Data Exchange (ETDEWEB)

    Rechtsteiner, A. (Andreas); Rocha, L. M. (Luis Mateus)

    2004-01-01

    Integration of different sources of information is a great challenge for the analysis of gene expression data, and for the field of Functional Genomics in general. As the availability of numerical data from high-throughput methods increases, so does the need for technologies that assist in the validation and evaluation of the biological significance of results extracted from these data. In mRNA assaying with microarrays, for example, numerical analysis often attempts to identify clusters of co-expressed genes. The important task to find the biological significance of the results and validate them has so far mostly fallen to the biological expert who had to perform this task manually. One of the most promising avenues to develop automated and integrative technology for such tasks lies in the application of modern Information Retrieval (IR) and Knowledge Management (KM) algorithms to databases with biomedical publications and data. Examples of databases available for the field are bibliographic databases c ntaining scientific publications (e.g. MEDLINE/PUBMED), databases containing sequence data (e.g. GenBank) and databases of semantic annotations (e.g. the Gene Ontology Consortium and Medical Subject Headings (MeSH)). We present here an approach that uses the MeSH terms and their concept hierarchies to validate and obtain functional information for gene expression clusters. The controlled and hierarchical MeSH vocabulary is used by the National Library of Medicine (NLM) to index all the articles cited in MEDLINE. Such indexing with a controlled vocabulary eliminates some of the ambiguity due to polysemy (terms that have multiple meanings) and synonymy (multiple terms have similar meaning) that would be encountered if terms would be extracted directly from the articles due to differing article contexts or author preferences and background. Further, the hierarchical organization of the MeSH terms can illustrate the conceptuallfunctional relationships of genes

  2. Disulfide-stabilized Helical Hairpin Structure and Activity of a Novel Antifungal Peptide EcAMP1 from Seeds of Barnyard Grass (Echinochloa crus-galli)*

    Science.gov (United States)

    Nolde, Svetlana B.; Vassilevski, Alexander A.; Rogozhin, Eugene A.; Barinov, Nikolay A.; Balashova, Tamara A.; Samsonova, Olga V.; Baranov, Yuri V.; Feofanov, Alexey V.; Egorov, Tsezi A.; Arseniev, Alexander S.; Grishin, Eugene V.

    2011-01-01

    This study presents purification, activity characterization, and 1H NMR study of the novel antifungal peptide EcAMP1 from kernels of barnyard grass Echinochloa crus-galli. The peptide adopts a disulfide-stabilized α-helical hairpin structure in aqueous solution and thus represents a novel fold among naturally occurring antimicrobial peptides. Micromolar concentrations of EcAMP1 were shown to inhibit growth of several fungal phytopathogens. Confocal microscopy revealed intensive EcAMP1 binding to the surface of fungal conidia followed by internalization and accumulation in the cytoplasm without disturbance of membrane integrity. Close spatial structure similarity between EcAMP1, the trypsin inhibitor VhTI from seeds of Veronica hederifolia, and some scorpion and cone snail toxins suggests natural elaboration of different functions on a common fold. PMID:21561864

  3. Disulfide-stabilized helical hairpin structure and activity of a novel antifungal peptide EcAMP1 from seeds of barnyard grass (Echinochloa crus-galli).

    Science.gov (United States)

    Nolde, Svetlana B; Vassilevski, Alexander A; Rogozhin, Eugene A; Barinov, Nikolay A; Balashova, Tamara A; Samsonova, Olga V; Baranov, Yuri V; Feofanov, Alexey V; Egorov, Tsezi A; Arseniev, Alexander S; Grishin, Eugene V

    2011-07-15

    This study presents purification, activity characterization, and (1)H NMR study of the novel antifungal peptide EcAMP1 from kernels of barnyard grass Echinochloa crus-galli. The peptide adopts a disulfide-stabilized α-helical hairpin structure in aqueous solution and thus represents a novel fold among naturally occurring antimicrobial peptides. Micromolar concentrations of EcAMP1 were shown to inhibit growth of several fungal phytopathogens. Confocal microscopy revealed intensive EcAMP1 binding to the surface of fungal conidia followed by internalization and accumulation in the cytoplasm without disturbance of membrane integrity. Close spatial structure similarity between EcAMP1, the trypsin inhibitor VhTI from seeds of Veronica hederifolia, and some scorpion and cone snail toxins suggests natural elaboration of different functions on a common fold.

  4. Analysis of cis and trans Requirements for DNA Replication at the Right-End Hairpin of the Human Bocavirus 1 Genome.

    Science.gov (United States)

    Shen, Weiran; Deng, Xuefeng; Zou, Wei; Engelhardt, John F; Yan, Ziying; Qiu, Jianming

    2016-09-01

    Parvoviruses are single-stranded DNA viruses that use the palindromic structures at the ends of the viral genome for their replication. The mechanism of parvovirus replication has been studied mostly in the dependoparvovirus adeno-associated virus 2 (AAV2) and the protoparvovirus minute virus of mice (MVM). Here, we used human bocavirus 1 (HBoV1) to understand the replication mechanism of bocaparvovirus. HBoV1 is pathogenic to humans, causing acute respiratory tract infections, especially in young children under 2 years old. By using the duplex replicative form of the HBoV1 genome in human embryonic kidney 293 (HEK293) cells, we identified the HBoV1 minimal replication origin at the right-end hairpin (OriR). Mutagenesis analyses confirmed the putative NS1 binding and nicking sites within the OriR. Of note, unlike the large nonstructural protein (Rep78/68 or NS1) of other parvoviruses, HBoV1 NS1 did not specifically bind OriR in vitro, indicating that other viral and cellular components or the oligomerization of NS1 is required for NS1 binding to the OriR. In vivo studies demonstrated that residues responsible for NS1 binding and nicking are within the origin-binding domain. Further analysis identified that the small nonstructural protein NP1 is required for HBoV1 DNA replication at OriR. NP1 and other viral nonstructural proteins (NS1 to NS4) colocalized within the viral DNA replication centers in both OriR-transfected cells and virus-infected cells, highlighting a direct involvement of NP1 in viral DNA replication at OriR. Overall, our study revealed the characteristics of HBoV1 DNA replication at OriR, suggesting novel characteristics of autonomous parvovirus DNA replication. Human bocavirus 1 (HBoV1) causes acute respiratory tract infections in young children. The duplex HBoV1 genome replicates in HEK293 cells and produces progeny virions that are infectious in well-differentiated airway epithelial cells. A recombinant AAV2 vector pseudotyped with an HBoV1

  5. The SH2 Domain–Containing Proteins in 21 Species Establish the Provenance and Scope of Phosphotyrosine Signaling in Eukaryotes

    Science.gov (United States)

    Liu, Bernard A.; Shah, Eshana; Jablonowski, Karl; Stergachis, Andrew; Engelmann, Brett; Nash, Piers D.

    2014-01-01

    The Src homology 2 (SH2) domains are participants in metazoan signal transduction, acting as primary mediators for regulated protein-protein interactions with tyrosine-phosphorylated substrates. Here, we describe the origin and evolution of SH2 domain proteins by means of sequence analysis from 21 eukaryotic organisms from the basal unicellular eukaryotes, where SH2 domains first appeared, through the multicellular animals and increasingly complex metazoans. On the basis of our results, SH2 domains and phosphotyrosine signaling emerged in the early Unikonta, and the numbers of SH2 domains expanded in the choanoflagellate and metazoan lineages with the development of tyrosine kinases, leading to rapid elaboration of phosphotyrosine signaling in early multicellular animals. Our results also indicated that SH2 domains coevolved and the number of the domains expanded alongside protein tyrosine kinases and tyrosine phosphatases, thereby coupling phosphotyrosine signaling to downstream signaling networks. Gene duplication combined with domain gain or loss produced novel SH2-containing proteins that function within phosphotyrosine signaling, which likely have contributed to diversity and complexity in metazoans. We found that intra- and intermolecular interactions within and between SH2 domain proteins increased in prevalence along with organismal complexity and may function to generate more highly connected and robust phosphotyrosine signaling networks. PMID:22155787

  6. Tyrosine Phosphorylation of the Lyn Src Homology 2 (SH2) Domain Modulates Its Binding Affinity and Specificity*

    Science.gov (United States)

    Jin, Lily L.; Wybenga-Groot, Leanne E.; Tong, Jiefei; Taylor, Paul; Minden, Mark D.; Trudel, Suzanne; McGlade, C. Jane; Moran, Michael F.

    2015-01-01

    Src homology 2 (SH2) domains are modular protein structures that bind phosphotyrosine (pY)-containing polypeptides and regulate cellular functions through protein-protein interactions. Proteomics analysis showed that the SH2 domains of Src family kinases are themselves tyrosine phosphorylated in blood system cancers, including acute myeloid leukemia, chronic lymphocytic leukemia, and multiple myeloma. Using the Src family kinase Lyn SH2 domain as a model, we found that phosphorylation at the conserved SH2 domain residue Y194 impacts the affinity and specificity of SH2 domain binding to pY-containing peptides and proteins. Analysis of the Lyn SH2 domain crystal structure supports a model wherein phosphorylation of Y194 on the EF loop modulates the binding pocket that engages amino acid side chains at the pY+2/+3 position. These data indicate another level of regulation wherein SH2-mediated protein-protein interactions are modulated by SH2 kinases and phosphatases. PMID:25587033

  7. SH2 domains of the p85 alpha subunit of phosphatidylinositol 3-kinase regulate binding to growth factor receptors.

    Science.gov (United States)

    McGlade, C J; Ellis, C; Reedijk, M; Anderson, D; Mbamalu, G; Reith, A D; Panayotou, G; End, P; Bernstein, A; Kazlauskas, A

    1992-01-01

    The binding of cytoplasmic signaling proteins such as phospholipase C-gamma 1 and Ras GTPase-activating protein to autophosphorylated growth factor receptors is directed by their noncatalytic Src homology region 2 (SH2) domains. The p85 alpha regulatory subunit of phosphatidylinositol (PI) 3-kinase, which associates with several receptor protein-tyrosine kinases, also contains two SH2 domains. Both p85 alpha SH2 domains, when expressed individually as fusion proteins in bacteria, bound stably to the activated beta receptor for platelet-derived growth factor (PDGF). Complex formation required PDGF stimulation and was dependent on receptor tyrosine kinase activity. The bacterial p85 alpha SH2 domains recognized activated beta PDGF receptor which had been immobilized on a filter, indicating that SH2 domains contact autophosphorylated receptors directly. Several receptor tyrosine kinases within the PDGF receptor subfamily, including the colony-stimulating factor 1 receptor and the Steel factor receptor (Kit), also associate with PI 3-kinase in vivo. Bacterially expressed SH2 domains derived from the p85 alpha subunit of PI 3-kinase bound in vitro to the activated colony-stimulating factor 1 receptor and to Kit. We infer that the SH2 domains of p85 alpha bind to high-affinity sites on these receptors, whose creation is dependent on receptor autophosphorylation. The SH2 domains of p85 are therefore primarily responsible for the binding of PI 3-kinase to activated growth factor receptors. Images PMID:1372092

  8. Tyrosine phosphorylation of the Lyn Src homology 2 (SH2) domain modulates its binding affinity and specificity.

    Science.gov (United States)

    Jin, Lily L; Wybenga-Groot, Leanne E; Tong, Jiefei; Taylor, Paul; Minden, Mark D; Trudel, Suzanne; McGlade, C Jane; Moran, Michael F

    2015-03-01

    Src homology 2 (SH2) domains are modular protein structures that bind phosphotyrosine (pY)-containing polypeptides and regulate cellular functions through protein-protein interactions. Proteomics analysis showed that the SH2 domains of Src family kinases are themselves tyrosine phosphorylated in blood system cancers, including acute myeloid leukemia, chronic lymphocytic leukemia, and multiple myeloma. Using the Src family kinase Lyn SH2 domain as a model, we found that phosphorylation at the conserved SH2 domain residue Y(194) impacts the affinity and specificity of SH2 domain binding to pY-containing peptides and proteins. Analysis of the Lyn SH2 domain crystal structure supports a model wherein phosphorylation of Y(194) on the EF loop modulates the binding pocket that engages amino acid side chains at the pY+2/+3 position. These data indicate another level of regulation wherein SH2-mediated protein-protein interactions are modulated by SH2 kinases and phosphatases. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. Combining biophysical methods to analyze the disulfide bond in SH2 domain of C-terminal Src kinase.

    Science.gov (United States)

    Liu, Dongsheng; Cowburn, David

    2016-01-01

    The Src Homology 2 (SH2) domain is a structurally conserved protein domain that typically binds to a phosphorylated tyrosine in a peptide motif from the target protein. The SH2 domain of C-terminal Src kinase (Csk) contains a single disulfide bond, which is unusual for most SH2 domains. Although the global motion of SH2 domain regulates Csk function, little is known about the relationship between the disulfide bond and binding of the ligand. In this study, we combined X-ray crystallography, solution NMR, and other biophysical methods to reveal the interaction network in Csk. Denaturation studies have shown that disulfide bond contributes significantly to the stability of SH2 domain, and crystal structures of the oxidized and C122S mutant showed minor conformational changes. We further investigated the binding of SH2 domain to a phosphorylated peptide from Csk-binding protein upon reduction and oxidation using both NMR and fluorescence approaches. This work employed NMR, X-ray cryptography, and other biophysical methods to study a disulfide bond in Csk SH2 domain. In addition, this work provides in-depth understanding of the structural dynamics of Csk SH2 domain.

  10. Hydrophobic interaction between the SH2 domain and the kinase domain is required for the activation of Csk.

    Science.gov (United States)

    Mikkola, Esa T; Gahmberg, Carl G

    2010-06-18

    The protein tyrosine kinase C-terminal Src kinase (Csk) is activated by the engagement of its Src homology (SH) 2 domain. However, the molecular mechanism required for this is not completely understood. The crystal structure of the active Csk indicates that Csk could be activated by contact between the SH2 domain and the beta3-alphaC loop in the N-terminal lobe of the kinase domain. To study the importance of this interaction for the SH2-domain-mediated activation of Csk, we mutated the amino acid residues forming the contacts between the SH2 domain and the beta3-alphaC loop. The mutation of the beta3-alphaC loop Ala228 to glycine and of the SH2 domain Tyr116, Tyr133, Leu138, and Leu149 to alanine resulted in the inability of the SH2 domain ligand to activate Csk. Furthermore, the overexpressed Csk mutants A228G, Y133A/Y116A, L138A, and L149A were unable to efficiently inactivate endogenous Src in human embryonic kidney 293 cells. The results suggest that the SH2-domain-mediated activation of Csk is dependent on the binding of the beta3-alphaC loop Ala228 to the hydrophobic pocket formed by the side chains of Tyr116, Tyr133, Leu138, and Leu149 on the surface of the SH2 domain. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  11. Use of the shrunken-2 (sh2) mutant to study source-sink relations in maize during reproductive development

    International Nuclear Information System (INIS)

    Ritchie, S.W.

    1987-01-01

    Leaf metabolism, 14 C-assimilate distribution, and kernel (sink) metabolism were compared in a normal wild-type (homozygous sh2) inbred (Oh43) of maize (Zea mays L.) and a genetically related shrunken-2 (homozygous sh2) inbred of Oh43. In comparison to normal starchy kernels, kernels from the shrunken-2 (sh2) mutant showed highly decreased starch contents and subsequently decreased total kernel dry matter. As measured by dry matter accumulation and 14 C-assimilate distribution patterns, sh2 kernel assimilate demand did not differ from normal kernel assimilate demand throughout most of the early linear grain-fill period. However, sh2 kernel demand began to decrease toward the end of early grain-fill and was highly decreased during all of the middle grain-fill period. During the late grain-fill period, sh2 kernel assimilate demand was non-existent. The initial evidence for decreased sh2 kernel assimilate demand was a change in 14 C label distribution in the sh2 ear tissues (husks, shank, cob, and kernels) toward the end of early grain-fill

  12. Resonance hairpin and Langmuir probe-assisted laser photodetachment measurements of the negative ion density in a pulsed dc magnetron discharge

    Energy Technology Data Exchange (ETDEWEB)

    Bradley, James W.; Dodd, Robert; You, S.-D.; Sirse, Nishant; Karkari, Shantanu Kumar [Department of Electrical Engineering and Electronics, University of Liverpool, Liverpool (United Kingdom); National Centre for Plasma Science and Technology, Dublin City University, Dublin 9, Republic of Ireland (Ireland); National Centre for Plasma Science and Technology, Dublin City University, Dublin 9, Republic of Ireland and Institute for Plasma Research, Bhat Gandhinagar, Gujarat (India)

    2011-05-15

    The time-resolved negative oxygen ion density n{sub -} close to the center line in a reactive pulsed dc magnetron discharge (10 kHz and 50% duty cycle) has been determined for the first time using a combination of laser photodetachment and resonance hairpin probing. The discharge was operated at a power of 50 W in 70% argon and 30% oxygen gas mixtures at 1.3 Pa pressure. The results show that the O{sup -} density remains pretty constant during the driven phase of the discharge at values typically below 5x10{sup 14} m{sup -3}; however, in the off-time, the O{sup -} density grows reaching values several times those in the on-time. This leads to the negative ion fraction (or degree of electronegativity) {alpha}=n{sub -}/n{sub e} being higher in the off phase (maximum value {alpha}{approx}1) than in the on phase ({alpha}=0.05-0.3). The authors also see higher values of {alpha} at positions close to the magnetic null than in the more magnetized region of the plasma. This fractional increase in negative ion density during the off-phase is attributed to the enhanced dissociative electron attachment of highly excited oxygen molecules in the cooling plasma. The results show that close to the magnetic null the photodetached electron density decays quickly after the laser pulse, followed by a slow decay over a few microseconds governed by the negative ion temperature. However, in the magnetized regions of the plasma, this decay is more gradual. This is attributed to the different cross-field transport rates for electrons in these two regions. The resonance hairpin probe measurements of the photoelectron densities are compared directly to photoelectron currents obtained using a conventional Langmuir probe. There is good agreement in the general trends, particularly in the off-time.

  13. Activation of PI3K/Akt signaling by n-terminal SH2 domain mutants of the p85α regulatory subunit of PI3K is enhanced by deletion of its c-terminal SH2 domain.

    Science.gov (United States)

    Hofmann, Bianca T; Jücker, Manfred

    2012-10-01

    The phosphoinositide 3-kinase (PI3K) is frequently activated in human cancer cells due to gain of function mutations in the catalytic (p110) and the regulatory (p85) subunits. The regulatory subunit consists of an SH3 domain and two SH2 domains. An oncogenic form of p85α named p65 lacking the c-terminal SH2 domain (cSH2) has been cloned from an irradiation-induced murine thymic lymphoma and transgenic mice expressing p65 in T lymphocytes develop a lymphoproliferative disorder. We have recently detected a c-terminal truncated form of p85α named p76α in a human lymphoma cell line lacking most of the cSH2 domain due to a frame shift mutation. Here, we report that the deletion of the cSH2 domain enhances the activating effects of the n-terminal SH2 domain (nSH2) mutants K379E and R340E on the PI3K/Akt pathway and micro tumor formation in a focus assay. Further analysis revealed that this transforming effect is mediated by activation of the catalytic PI3K isoform p110α and downstream signaling through mTOR. Our data further support a mechanistic model in which mutations of the cSH2 domain of p85α can abrogate its negative regulatory function on PI3K activity via the nSH2 domain of p85α. Copyright © 2012 Elsevier Inc. All rights reserved.

  14. A Model for Spheroid versus Monolayer Response of SK-N-SH Neuroblastoma Cells to Treatment with 15-Deoxy-PGJ2

    Directory of Open Access Journals (Sweden)

    Dorothy I. Wallace

    2016-01-01

    Full Text Available Researchers have observed that response of tumor cells to treatment varies depending on whether the cells are grown in monolayer, as in vitro spheroids or in vivo. This study uses data from the literature on monolayer treatment of SK-N-SH neuroblastoma cells with 15-deoxy-PGJ2 and couples it with data on growth rates for untreated SK-N-SH neuroblastoma cells grown as multicellular spheroids. A linear model is constructed for untreated and treated monolayer data sets, which is tuned to growth, death, and cell cycle data for the monolayer case for both control and treatment with 15-deoxy-PGJ2. The monolayer model is extended to a five-dimensional nonlinear model of in vitro tumor spheroid growth and treatment that includes compartments of the cell cycle (G1,S,G2/M as well as quiescent (Q and necrotic (N cells. Monolayer treatment data for 15-deoxy-PGJ2 is used to derive a prediction of spheroid response under similar treatments. For short periods of treatment, spheroid response is less pronounced than monolayer response. The simulations suggest that the difference in response to treatment of monolayer versus spheroid cultures observed in laboratory studies is a natural consequence of tumor spheroid physiology rather than any special resistance to treatment.

  15. Conformation of an Shc-derived phosphotyrosine-containing peptide complexed with the Grb2 SH2 domain

    International Nuclear Information System (INIS)

    Ogura, Kenji; Tsuchiya, Shigeo; Terasawa, Hiroaki; Yuzawa, Satoru; Hatanaka, Hideki; Mandiyan, Valsan; Schlessinger, Joseph; Inagaki, Fuyuhiko

    1997-01-01

    We have determined the structure of an Shc-derived phosphotyrosine-containing peptide complexed with Grb2 SH2 based on intra-and intermolecular NOE correlations observed by a series of isotope-filtered NMR experiments using a PFG z-filter. In contrast to an extended conformation of phosphotyrosine-containing peptides bound to Src, Syp and PLC γ SH2s, the Shc-derived peptide formed a turn at the +1 and +2 positions next to the phosphotyrosine residue. Trp 121 , located at the EF1 site of Grb2 SH2, blocked the peptide binding in an extended conformation. The present study confirms that each phosphotyrosine-containing peptide binds to the cognate SH2 with a specific conformation, which gives the structural basis for the binding specificity between SH2s and target proteins

  16. Use of NLM medical subject headings with the MeSH2010 thesaurus in the PORTAL-DOORS system.

    Science.gov (United States)

    Taswell, Carl

    2010-01-01

    The NLM MeSH Thesaurus has been incorporated for use in the PORTAL-DOORS System (PDS) for resource metadata management on the semantic web. All 25588 descriptor records from the NLM 2010 MeSH Thesaurus have been exposed as web accessible resources by the PDS MeSH2010 Thesaurus implemented as a PDS PORTAL Registry operating as a RESTful web service. Examples of records from the PDS MeSH2010 PORTAL are demonstrated along with their use by records in other PDS PORTAL Registries that reference the concepts from the MeSH2010 Thesaurus. Use of this important biomedical terminology will greatly enhance the quality of metadata content of other PDS records thus improving cross-domain searches between different problem oriented domains and amongst different clinical specialty fields.

  17. Silencing effect of shRNA expression vectors with stem length of 21 ...

    African Journals Online (AJOL)

    Then, the recombinant plasmids were transfected into mouse embryonic fibroblast with lipofection and injected into leg muscle of mouse. The mRNA expression level of the green fluorescent protein gene was checked by real-time quantitative polymerase chain reaction (RT-PCR). The silencing effect of the 29 bp shRNA ...

  18. Novel high-throughput screening system for identifying STAT3-SH2 antagonists

    International Nuclear Information System (INIS)

    Uehara, Yutaka; Mochizuki, Masato; Matsuno, Kenji; Haino, Takeharu; Asai, Akira

    2009-01-01

    Constitutive activation of the oncogenic transcription factor STAT3 frequently occurs in various human malignancies. STAT3 activation involves dimerization via intermolecular pTyr-SH2 interaction. Thus, antagonizing this interaction is a feasible approach to inhibit STAT3 activation for cancer therapy. In order to identify selective STAT3 inhibitors, we developed a biochemical HTS system based on AlphaScreen technology, which measures the abilities of test compounds to antagonize pTyr-SH2 interactions. We screened our chemical libraries using this system and identified 5,15-diphenylporphyrin (5,15-DPP) as a selective STAT3-SH2 antagonist. Selective inhibition of STAT3 nuclear translocation and DNA biding activity was observed in cells treated with 5,15-DPP. IL-6-dependent dimerization of STAT3, c-myc promoter binding and c-myc protein expression were all suppressed by 5,15-DPP, whereas no decrement in either expression or phosphorylation level of STAT3 was observed. Thus, the HTS assay system represented herein may be useful for identifying novel STAT3-SH2 antagonists.

  19. The Eighty Six Hα Spectra from the Orion Nebula (M42, Sh2-281)

    Indian Academy of Sciences (India)

    ∼40′×40′) of the Orion Nebula (NGC1976, M42, Sh2-281) have been obtained using DEFPOS spectrometer with a circular field of view of 4′ at TUBITAK National Observatory (TUG, Antalya, Turkey). Measurements provide information ...

  20. Fast evaluation of complete synthetic SH seismograms based on asymptotic mode theory

    NARCIS (Netherlands)

    Bastians, M.W.J.M.

    1986-01-01

    In this thesis we have developed an asymptotic mode theory with the following features. 1) Complete synthetic SH seismograms can be evaluated for both realistic models of Earth and crust. 2) The method is of practical value and can be used even on small computers wi th reasonable computation

  1. Fast evaluation of complete synthetic SH seismograms based on asymptotic mode theory

    NARCIS (Netherlands)

    Bastians, M.W.J.M.

    1986-01-01

    In this thesis we have developed an asymptotic mode theory with the following features. 1) Complete synthetic SH seismograms can be evaluated for both realistic models of Earth and crust. 2) The method is of practical value and can be used even on small computers wi th reasonable computation times

  2. The SH-SY5Y cell line in Parkinson's disease research: a systematic review.

    Science.gov (United States)

    Xicoy, Helena; Wieringa, Bé; Martens, Gerard J M

    2017-01-24

    Parkinson's disease (PD) is a devastating and highly prevalent neurodegenerative disease for which only symptomatic treatment is available. In order to develop a truly effective disease-modifying therapy, improvement of our current understanding of the molecular and cellular mechanisms underlying PD pathogenesis and progression is crucial. For this purpose, standardization of research protocols and disease models is necessary. As human dopaminergic neurons, the cells mainly affected in PD, are difficult to obtain and maintain as primary cells, current PD research is mostly performed with permanently established neuronal cell models, in particular the neuroblastoma SH-SY5Y lineage. This cell line is frequently chosen because of its human origin, catecholaminergic (though not strictly dopaminergic) neuronal properties, and ease of maintenance. However, there is no consensus on many fundamental aspects that are associated with its use, such as the effects of culture media composition and of variations in differentiation protocols. Here we present the outcome of a systematic review of scientific articles that have used SH-SY5Y cells to explore PD. We describe the cell source, culture conditions, differentiation protocols, methods/approaches used to mimic PD and the preclinical validation of the SH-SY5Y findings by employing alternative cellular and animal models. Thus, this overview may help to standardize the use of the SH-SY5Y cell line in PD research and serve as a future user's guide.

  3. Adsorption of Pb2+ on Thiol-functionalized Mesoporous Silica, SH-MCM-48

    Science.gov (United States)

    Taba, P.; Mustafa, R. D. P.; Ramang, L. M.; Kasim, A. H.

    2018-03-01

    Modification of mesoporous silica, MCM-48, by using 3- mercaptopropyltrimethoxysilane has been successfully conducted. MCM-48 and SH-MCM-48 were characterized using XRD and FTIR. SH-MCM-48 was used as an adsorbent of Pb2+ ions from solution. A number of Pb2+ ions adsorbed were studied as the function of time, pH, and concentration. The concentration of the ions after adsorption was determined by an Atomic Absorption Spectrophotometer. The removal of the adsorbed ions from the SH-MCM-48 was also studied using several desorbing agents. The result showed that the optimum time was 20 minutes and optimum pH was 4. The adsorption of Pb(II) ion followed the pseudo-second-order with the rate constant of 0,2632 g•mg-1•min-1. Adsorption of Pb(II) ion fitted the Langmuir isotherm with the adsorption capacity of 0,1088 mmol/g. The best desorbing agent to remove the adsorbed ion from SH-MCM-48 was 0.3 M HCl solution with the desorption percentage of 58.6%.

  4. Challenges and Opportunities for Mainstreaming Climate Change Adaptation into WaSH Development Planning in Ghana.

    Science.gov (United States)

    Alhassan, Salley; Hadwen, Wade L

    2017-07-10

    Climate change threatens water, sanitation and hygiene (WaSH) facilities and services, as these are intimately linked to the water cycle and are vulnerable to changes in the quantity and quality of available water resources. Floods and droughts, which pollute and reduce water delivery respectively, have now become a perennial issue to deal with in the northern regions of Ghana. This study aimed to assess the degree to which climate change adaptation measures are mainstreamed into the water, sanitation and hygiene (WaSH) development planning process in Ghana. Stakeholders from government and non-government agencies were interviewed to gain perspectives on the threat of climate change, the inclusion of climate change in WaSH planning and the barriers preventing mainstreaming. Despite awareness of climate change, adaptation measures have not been considered, and the immediate WaSH needs remain the priority. Overall, stakeholders felt the adaptive capacity of the Municipality was low and that mainstreaming has not yet occurred. Despite the lack of progress, there are great opportunities for mainstreaming climate change adaptation into planning through increasing awareness and capacity, legislative and institutional changes and the development of participatory systems to provide early warning systems and disaster risk analyses that will inform future planning.

  5. Comparative Genomics and Disorder Prediction Identify Biologically Relevant SH3 Protein Interactions.

    Directory of Open Access Journals (Sweden)

    2005-08-01

    Full Text Available Protein interaction networks are an important part of the post-genomic effort to integrate a part-list view of the cell into system-level understanding. Using a set of 11 yeast genomes we show that combining comparative genomics and secondary structure information greatly increases consensus-based prediction of SH3 targets. Benchmarking of our method against positive and negative standards gave 83% accuracy with 26% coverage. The concept of an optimal divergence time for effective comparative genomics studies was analyzed, demonstrating that genomes of species that diverged very recently from Saccharomyces cerevisiae(S. mikatae, S. bayanus, and S. paradoxus, or a long time ago (Neurospora crassa and Schizosaccharomyces pombe, contain less information for accurate prediction of SH3 targets than species within the optimal divergence time proposed. We also show here that intrinsically disordered SH3 domain targets are more probable sites of interaction than equivalent sites within ordered regions. Our findings highlight several novel S. cerevisiae SH3 protein interactions, the value of selection of optimal divergence times in comparative genomics studies, and the importance of intrinsic disorder for protein interactions. Based on our results we propose novel roles for the S. cerevisiae proteins Abp1p in endocytosis and Hse1p in endosome protein sorting.

  6. Comparative genomics and disorder prediction identify biologically relevant SH3 protein interactions.

    Directory of Open Access Journals (Sweden)

    Pedro Beltrao

    2005-08-01

    Full Text Available Protein interaction networks are an important part of the post-genomic effort to integrate a part-list view of the cell into system-level understanding. Using a set of 11 yeast genomes we show that combining comparative genomics and secondary structure information greatly increases consensus-based prediction of SH3 targets. Benchmarking of our method against positive and negative standards gave 83% accuracy with 26% coverage. The concept of an optimal divergence time for effective comparative genomics studies was analyzed, demonstrating that genomes of species that diverged very recently from Saccharomyces cerevisiae(S. mikatae, S. bayanus, and S. paradoxus, or a long time ago (Neurospora crassa and Schizosaccharomyces pombe, contain less information for accurate prediction of SH3 targets than species within the optimal divergence time proposed. We also show here that intrinsically disordered SH3 domain targets are more probable sites of interaction than equivalent sites within ordered regions. Our findings highlight several novel S. cerevisiae SH3 protein interactions, the value of selection of optimal divergence times in comparative genomics studies, and the importance of intrinsic disorder for protein interactions. Based on our results we propose novel roles for the S. cerevisiae proteins Abp1p in endocytosis and Hse1p in endosome protein sorting.

  7. Comparing CλaSH and VHDL by implementing a dataflow processor

    NARCIS (Netherlands)

    Niedermeier, A.; Wester, Rinse; Wester, Rinse; Baaij, C.P.R.; Kuper, Jan; Smit, Gerardus Johannes Maria

    2010-01-01

    As embedded systems are becoming increasingly complex, the design process and verification have become very time-consuming. Additionally, specifying hardware manually in a low-level hardware description language like VHDL is usually an error-prone task. In our group, a tool (the ClaSH compiler) was

  8. Challenges and Opportunities for Mainstreaming Climate Change Adaptation into WaSH Development Planning in Ghana

    Directory of Open Access Journals (Sweden)

    Salley Alhassan

    2017-07-01

    Full Text Available Climate change threatens water, sanitation and hygiene (WaSH facilities and services, as these are intimately linked to the water cycle and are vulnerable to changes in the quantity and quality of available water resources. Floods and droughts, which pollute and reduce water delivery respectively, have now become a perennial issue to deal with in the northern regions of Ghana. This study aimed to assess the degree to which climate change adaptation measures are mainstreamed into the water, sanitation and hygiene (WaSH development planning process in Ghana. Stakeholders from government and non-government agencies were interviewed to gain perspectives on the threat of climate change, the inclusion of climate change in WaSH planning and the barriers preventing mainstreaming. Despite awareness of climate change, adaptation measures have not been considered, and the immediate WaSH needs remain the priority. Overall, stakeholders felt the adaptive capacity of the Municipality was low and that mainstreaming has not yet occurred. Despite the lack of progress, there are great opportunities for mainstreaming climate change adaptation into planning through increasing awareness and capacity, legislative and institutional changes and the development of participatory systems to provide early warning systems and disaster risk analyses that will inform future planning.

  9. Isolation and characterization of an isoproturon mineralizing Sphingomonas sp. strain SH from a French agricultural soil.

    Science.gov (United States)

    Hussain, Sabir; Devers-Lamrani, Marion; El Azhari, Najoi; Martin-Laurent, Fabrice

    2011-06-01

    The phenylurea herbicide isoproturon, 3-(4-isopropylphenyl)-1,1-dimethylurea (IPU), was found to be rapidly mineralized in an agricultural soil in France that had been periodically exposed to IPU. Enrichment cultures from samples of this soil isolated a bacterial strain able to mineralize IPU. 16S rRNA sequence analysis showed that this strain belonged to the phylogeny of the genus Sphingomonas (96% similarity with Sphingomonas sp. JEM-14, AB219361) and was designated Sphingomonas sp. strain SH. From this strain, a partial sequence of a 1,2-dioxygenase (catA) gene coding for an enzyme degrading catechol putatively formed during IPU mineralization was amplified. Phylogenetic analysis revealed that the catA sequence was related to Sphingomonas spp. and showed a lack of congruence between the catA and 16S rRNA based phylogenies, implying horizontal gene transfer of the catA gene cluster between soil microbiota. The IPU degrading ability of strain SH was strongly influenced by pH with maximum degradation taking place at pH 7.5. SH was only able to mineralize IPU and its known metabolites including 4-isopropylaniline and it could not degrade other structurally related phenylurea herbicides such as diuron, linuron, monolinuron and chlorotoluron or their aniline derivatives. These observations suggest that the catabolic abilities of the strain SH are highly specific to the metabolism of IPU.

  10. The Janus Kinase (JAK) FERM and SH2 Domains: Bringing Specificity to JAK-Receptor Interactions.

    Science.gov (United States)

    Ferrao, Ryan; Lupardus, Patrick J

    2017-01-01

    The Janus kinases (JAKs) are non-receptor tyrosine kinases essential for signaling in response to cytokines and interferons and thereby control many essential functions in growth, development, and immune regulation. JAKs are unique among tyrosine kinases for their constitutive yet non-covalent association with class I and II cytokine receptors, which upon cytokine binding bring together two JAKs to create an active signaling complex. JAK association with cytokine receptors is facilitated by N-terminal FERM and SH2 domains, both of which are classical mediators of peptide interactions. Together, the JAK FERM and SH2 domains mediate a bipartite interaction with two distinct receptor peptide motifs, the proline-rich "Box1" and hydrophobic "Box2," which are present in the intracellular domain of cytokine receptors. While the general sidechain chemistry of Box1 and Box2 peptides is conserved between receptors, they share very weak primary sequence homology, making it impossible to posit why certain JAKs preferentially interact with and signal through specific subsets of cytokine receptors. Here, we review the structure and function of the JAK FERM and SH2 domains in light of several recent studies that reveal their atomic structure and elucidate interaction mechanisms with both the Box1 and Box2 receptor motifs. These crystal structures demonstrate how evolution has repurposed the JAK FERM and SH2 domains into a receptor-binding module that facilitates interactions with multiple receptors possessing diverse primary sequences.

  11. Estrogen Receptor Folding Modulates cSrc Kinase SH2 Interaction via a Helical Binding Mode

    NARCIS (Netherlands)

    Nieto, Lidia; Tharun, Inga M; Balk, Mark; Wienk, Hans; Boelens, Rolf; Ottmann, Christian; Milroy, Lech-Gustav; Brunsveld, Luc

    2015-01-01

    The estrogen receptors (ERs) feature, next to their transcriptional role, important nongenomic signaling actions, with emerging clinical relevance. The Src Homology 2 (SH2) domain mediated interaction between cSrc kinase and ER plays a key role in this; however the molecular determinants of this

  12. Estrogen receptor folding modulates cSrc kinase SH2 interaction via a helical binding mode

    NARCIS (Netherlands)

    Nieto, L.; Tharun, I.M.; Balk, M.; Wienk, H.; Boelens, R.; Ottmann, C.; Milroy, L.-G.; Brunsveld, L.

    2015-01-01

    The estrogen receptors (ERs) feature, next to their transcriptional role, important nongenomic signaling actions, with emerging clinical relevance. The Src Homology 2 (SH2) domain mediated interaction between cSrc kinase and ER plays a key role in this; however the molecular determinants of this

  13. Targeting the SH2-kinase interface in Bcr-Abl inhibits leukemogenesis.

    Science.gov (United States)

    Grebien, Florian; Hantschel, Oliver; Wojcik, John; Kaupe, Ines; Kovacic, Boris; Wyrzucki, Arkadiusz M; Gish, Gerald D; Cerny-Reiterer, Sabine; Koide, Akiko; Beug, Hartmut; Pawson, Tony; Valent, Peter; Koide, Shohei; Superti-Furga, Giulio

    2011-10-14

    Chronic myelogenous leukemia (CML) is caused by the constitutively active tyrosine kinase Bcr-Abl and treated with the tyrosine kinase inhibitor (TKI) imatinib. However, emerging TKI resistance prevents complete cure. Therefore, alternative strategies targeting regulatory modules of Bcr-Abl in addition to the kinase active site are strongly desirable. Here, we show that an intramolecular interaction between the SH2 and kinase domains in Bcr-Abl is both necessary and sufficient for high catalytic activity of the enzyme. Disruption of this interface led to inhibition of downstream events critical for CML signaling and, importantly, completely abolished leukemia formation in mice. Furthermore, disruption of the SH2-kinase interface increased sensitivity of imatinib-resistant Bcr-Abl mutants to TKI inhibition. An engineered Abl SH2-binding fibronectin type III monobody inhibited Bcr-Abl kinase activity both in vitro and in primary CML cells, where it induced apoptosis. This work validates the SH2-kinase interface as an allosteric target for therapeutic intervention. Copyright © 2011 Elsevier Inc. All rights reserved.

  14. The SH2 domain of Abl kinases regulates kinase autophosphorylation by controlling activation loop accessibility

    Science.gov (United States)

    Lamontanara, Allan Joaquim; Georgeon, Sandrine; Tria, Giancarlo; Svergun, Dmitri I.; Hantschel, Oliver

    2014-11-01

    The activity of protein kinases is regulated by multiple molecular mechanisms, and their disruption is a common driver of oncogenesis. A central and almost universal control element of protein kinase activity is the activation loop that utilizes both conformation and phosphorylation status to determine substrate access. In this study, we use recombinant Abl tyrosine kinases and conformation-specific kinase inhibitors to quantitatively analyse structural changes that occur after Abl activation. Allosteric SH2-kinase domain interactions were previously shown to be essential for the leukemogenesis caused by the Bcr-Abl oncoprotein. We find that these allosteric interactions switch the Abl activation loop from a closed to a fully open conformation. This enables the trans-autophosphorylation of the activation loop and requires prior phosphorylation of the SH2-kinase linker. Disruption of the SH2-kinase interaction abolishes activation loop phosphorylation. Our analysis provides a molecular mechanism for the SH2 domain-dependent activation of Abl that may also regulate other tyrosine kinases.

  15. Molecular dynamics simulations from putative transition states of alpha-spectrin SH3 domain

    NARCIS (Netherlands)

    Periole, Xavier; Vendruscolo, Michele; Mark, Alan E.

    2007-01-01

    A series of molecular dynamics simulations in explicit solvent were started from nine structural models of the transition state of the SH3 domain of alpha-spectrin, which were generated by Lindorff Larsen et al. (Nat Struct Mol Biol 2004;11:443-449) using molecular dynamics simulations in which

  16. On the Performance of Medical Information Retrieval using MeSH Terms – A Survey

    Directory of Open Access Journals (Sweden)

    Swetha S

    2014-09-01

    Full Text Available Internet users have increased everywhere. Searching and retrieving documents is a common thing nowadays. Retrieving related documents from the search engines are difficult task. To retrieve correct documents, knowledge about the search topic is essential. Even though separate search engines are there to retrieve medical documents the users are not familiar with MeSH terms (Medical Subject Heading. So, both the search browser and the MeSH terms have to be integrated to make the search effective and efficient. To implement this integration, SimpleMed and MeSHMed were introduced. The MeSH terms have to be ranked to know how frequently it has been used and to know the importance of the MeSH terms. To rank it a semi – automated tool called MeSHy was developed. The terms were extracted, filtered, ranked and displayed to the user. Classifiers have to be constructed to label the documents as health and non – health. Three strategies were used to classify them. The errors that are commonly done by the users have to be found out. It was calculated based on the queries presented by the user to the search browser.

  17. Paracrine Maturation and Migration of SH-SY5Y Cells by Dental Pulp Stem Cells.

    Science.gov (United States)

    Gervois, P; Wolfs, E; Dillen, Y; Hilkens, P; Ratajczak, J; Driesen, R B; Vangansewinkel, T; Bronckaers, A; Brône, B; Struys, T; Lambrichts, I

    2017-06-01

    Neurological disorders are characterized by neurodegeneration and/or loss of neuronal function, which cannot be adequately repaired by the host. Therefore, there is need for novel treatment options such as cell-based therapies that aim to salvage or reconstitute the lost tissue or that stimulate host repair. The present study aimed to evaluate the paracrine effects of human dental pulp stem cells (hDPSCs) on the migration and neural maturation of human SH-SY5Y neuroblastoma cells. The hDPSC secretome had a significant chemoattractive effect on SH-SY5Y cells as shown by a transwell assay. To evaluate neural maturation, SH-SY5Y cells were first induced toward neuronal cells, after which they were exposed to the hDPSC secretome. In addition, SH-SY5Y cells subjected to the hDPSC secretome showed increased neuritogenesis compared with nonexposed cells. Maturated cells were shown to increase immune reactivity for neuronal markers compared with controls. Ultrastructurally, retinoic acid (RA) signaling and subsequent exposure to the hDPSC secretome induced a gradual rise in metabolic activity and neuronal features such as multivesicular bodies and cytoskeletal elements associated with cellular communication. In addition, electrophysiological recordings of differentiating cells demonstrated a transition toward a neuronal electrophysiological profile based on the maximum tetrodotoxin (TTX)-sensitive, Na + current. Moreover, conditioned medium (CM)-hDPSC-maturated SH-SY5Y cells developed distinct features including, Cd 2+ -sensitive currents, which suggests that CM-hDPSC-maturated SH-SY5Y acquired voltage-gated Ca 2+ channels. The results reported in this study demonstrate the potential of hDPSCs to support differentiation and recruitment of cells with neuronal precursor characteristics in a paracrine manner. Moreover, this in vitro experimental design showed that the widely used SH-SY5Y cell line can improve and simplify the preclinical in vitro research on the molecular

  18. Therapeutic effects of lentivirus-mediated shRNA targeting of cyclin D1 in human gastric cancer

    International Nuclear Information System (INIS)

    Seo, Jin-Hee; Jeong, Eui-Suk; Choi, Yang-Kyu

    2014-01-01

    Gastric cancer is the second most common cause of cancer-related death in males and the fourth in females. Traditional treatment has poor prognosis because of recurrence and systemic side effects. Therefore, the development of new therapeutic strategies is an important issue. Lentivirus-mediated shRNA stably inhibits target genes and can efficiently transduce most cells. Since overexpressed cyclin D1 is closely related to human gastric cancer progression, inhibition of cyclin D1 using specific targeting could be an effective treatment method of human gastric cancer. The therapeutic effect of lentivirus-mediated shRNA targeting of cyclin D1 (ShCCND1) was analyzed both in vitro and in vivo experiments. In vitro, NCI-N87 cells with downregulation of cyclin D1 by ShCCND1 showed significant inhibition of cell proliferation, cell motility, and clonogenicity. Downregulation of cyclin D1 in NCI-N87 cells also resulted in significantly increased G1 arrest and apoptosis. In vivo, stable NCI-N87 cells expressing ShCCND1 were engrafted into nude mice. Then, the cancer-growth inhibition effect of lentivirus was confirmed. To assess lentivirus including ShCCND1 as a therapeutic agent, intratumoral injection was conducted. Tumor growth of the lentivirus-treated group was significantly inhibited compared to growth of the control group. These results are in accordance with the in vitro data and lend support to the mitotic figure count and apoptosis analysis of the tumor mass. The lentivirus-mediated ShCCND1 was constructed, which effectively inhibited growth of NCI-N87-derived cancer both in vitro and in vivo. The efficiency of shRNA knockdown and variation in the degree of inhibition is mediated by different shRNA sequences and cancer cell lines. These experimental results suggest the possibility of developing new gastric cancer therapies using lentivirus-mediated shRNA

  19. Expression and isotopic labelling of the potassium channel blocker ShK toxin as a thioredoxin fusion protein in bacteria.

    Science.gov (United States)

    Chang, Shih Chieh; Galea, Charles A; Leung, Eleanor W W; Tajhya, Rajeev B; Beeton, Christine; Pennington, Michael W; Norton, Raymond S

    2012-10-01

    The polypeptide toxin ShK is a potent blocker of Kv1.3 potassium channels, which play a crucial role in the activation of human effector memory T-cells (T(EM)). Selective blockers constitute valuable therapeutic leads for the treatment of autoimmune diseases mediated by T(EM) cells, such as multiple sclerosis, rheumatoid arthritis, and type-1 diabetes. We have established a recombinant peptide expression system in order to generate isotopically-labelled ShK and various ShK analogues for in-depth biophysical and pharmacological studies. ShK was expressed as a thioredoxin fusion protein in Escherichia coli BL21 (DE3) cells and purified initially by Ni²⁺ iminodiacetic acid affinity chromatography. The fusion protein was cleaved with enterokinase and purified to homogeneity by reverse-phase HPLC. NMR spectra of ¹⁵N-labelled ShK were similar to those reported previously for the unlabelled synthetic peptide, confirming that recombinant ShK was correctly folded. Recombinant ShK blocked Kv1.3 channels with a K(d) of 25 pM and inhibited the proliferation of human and rat T lymphocytes with a preference for T(EM) cells, with similar potency to synthetic ShK in all assays. This expression system also enables the efficient production of ¹⁵N-labelled ShK for NMR studies of peptide dynamics and of the interaction of ShK with Kv1.3 channels. Copyright © 2012 Elsevier Ltd. All rights reserved.

  20. Uranium Mill Tailings Remedial Action Program. Partial radiological survey of Shiprock vicinity property SH13 Shiprock, New Mexico, November 1982

    International Nuclear Information System (INIS)

    Flynn, K.F.; Justus, A.L.; Sholeen, C.M.; Smith, W.H.; Wynveen, R.A.

    1984-05-01

    As part of a detailed radiological assessment of the vicinity properties at Shiprock, a comprehensive survey of the vicinity property designated as SH13 was initiated on November 19, 1982. At that time, a single residential structure existed in the northwest corner of the property. The lands surrounding the structure were extensively cluttered with junk. The initial assessment activities were limited to measurements within the residential structure of the ambient external penetrating radiation level at a 1-meter height and analyses of indoor air samples for airborne radioactivity. The external penetrating radiation exposure rate (12.3 μR/h) was less than the 20 μR/h above background limit specified in the EPA Standard (40 CFR 192.12[b][2]). As determined by the air samples, the short-term radon daughter concentration within the structure (0.36 mWL) did not exceed the 0.02 WL (or 20 mWL) limit for average annual concentration including background as specified in the EPA Standard. Further measurements required to completely determine the radiological status of this vicinity property, such as measurements of surface radiation both indoors and outdoors and collection and analyses of soil samples, were planned for the final phase of this assessment. However, that phase of the program was terminated before these measurements were accomplished. Thus, the extent of outdoor radiological contamination is presently unknown, and the evaluation of indoor contamination (if any) is incomplete

  1. The globular cluster system of NGC 1316. II. The extraordinary object SH2

    Science.gov (United States)

    Richtler, T.; Kumar, B.; Bassino, L. P.; Dirsch, B.; Romanowsky, A. J.

    2012-07-01

    Context. SH2 has been described as an isolated HII-region, located about 6.5' south of the nucleus of NGC 1316 (Fornax A), a merger remnant in the the outskirts of the Fornax cluster of galaxies. Aims: We give a first, preliminary description of the stellar content and environment of this remarkable object. Methods: We used photometric data in the Washington system and HST photometry from the Hubble Legacy Archive for a morphological description and preliminary aperture photometry. Low-resolution spectroscopy provides radial velocities of the brightest star cluster in SH2 and a nearby intermediate-age cluster. Results: SH2 is not a normal HII-region, ionized by very young stars. It contains a multitude of star clusters with ages of approximately 108 yr. A ring-like morphology is striking. SH2 seems to be connected to an intermediate-age massive globular cluster with a similar radial velocity, which itself is the main object of a group of fainter clusters. Metallicity estimates from emission lines remain ambiguous. Conclusions: The present data do not yet allow firm conclusions about the nature or origin of SH2. It might be a dwarf galaxy that has experienced a burst of extremely clustered star formation. We may witness how globular clusters are donated to a parent galaxy. Based on observations taken at the European Southern Observatory, Cerro Paranal, Chile, under the programmes 082.B-0680, on observations taken at the Interamerican Observatory, Cerro Tololo, Chile. Furthermore based on observations made with the NASA/ESA Hubble Space Telescope (HST, PI: A. Sandage, Prop.ID: 7504), and obtained from the Hubble Legacy Archive, which is a collaboration between the Space Telescope Science Institute (STScI/NASA), the Space Telescope European Coordinating Facility (ST-ECF/ESA) and the Canadian Astronomy Data Centre (CADC/NRC/CSA).

  2. Novel multiplexed assay for identifying SH2 domain antagonists of STAT family proteins.

    Science.gov (United States)

    Takakuma, Kazuyuki; Ogo, Naohisa; Uehara, Yutaka; Takahashi, Susumu; Miyoshi, Nao; Asai, Akira

    2013-01-01

    Some of the signal transducer and activator of transcription (STAT) family members are constitutively activated in a wide variety of human tumors. The activity of STAT depends on their Src homology 2 (SH2) domain-mediated binding to sequences containing phosphorylated tyrosine. Thus, antagonizing this binding is a feasible approach to inhibiting STAT activation. We have developed a novel multiplexed assay for STAT3- and STAT5b-SH2 binding, based on amplified luminescent proximity homogeneous assay (Alpha) technology. AlphaLISA and AlphaScreen beads were combined in a single-well assay, which allowed the binding of STAT3- and STAT5b-SH2 to phosphotyrosine peptides to be simultaneously monitored. Biotin-labeled recombinant human STAT proteins were obtained as N- and C-terminal deletion mutants. The spacer length of the DIG-labeled peptide, the reaction time, and the concentration of sodium chloride were optimized to establish a HTS system with Z' values of greater than 0.6 for both STAT3- and STAT5b-SH2 binding. We performed a HTS campaign for chemical libraries using this multiplexed assay and identified hit compounds. A 2-chloro-1,4-naphthalenedione derivative, Compound 1, preferentially inhibited STAT3-SH2 binding in vitro, and the nuclear translocation of STAT3 in HeLa cells. Initial structure activity relationship (SAR) studies using the multiplexed assay showed the 3-substituent effect on both the activity and selectivity of STAT3 and STAT5b inhibition. Therefore, this multiplexed assay is useful for not only searching for potential lead compounds but also obtaining SAR data for developing new STAT3/STAT5b inhibitors.

  3. MERTK interactions with SH2-domain proteins in the retinal pigment epithelium.

    Science.gov (United States)

    Shelby, Shameka J; Colwill, Karen; Dhe-Paganon, Sirano; Pawson, Tony; Thompson, Debra A

    2013-01-01

    The receptor tyrosine kinase MERTK plays an essential role in the phagocytic uptake of shed photoreceptor membranes by the retinal pigment epithelium (RPE). A fundamental aspect of signal transduction by receptor tyrosine kinases involves autophosphorylation of tyrosine residues that recruit Src-homology 2 (SH2)-domain proteins to the receptor intracellular domain. The goal of the current study was to evaluate the interactions of human MERTK with SH2-domain proteins present in the RPE. The MERTK intracellular domain was expressed as a 6xHis-fusion protein (6xHis-rMERTK(571-999)), purified and phosphorylated. Ni(2+)-NTA pull downs were performed using 6xHis-rMERTK(571-999) in incubations with recombinant phosphotyrosine-recognition sequences expressed as GST-fusion proteins. In addition, pull downs of native SH2-domain proteins were performed using 6xHis-rMERTK(571-999) and protein homogenates from rat RPE/choroid. For both recombinant and native proteins, western analysis detected MERTK interactions with GRB2, PIK3R1 (P85α), VAV3, and SRC. Immunohistochemical analysis localized each protein to mouse RPE. In cultured RPE-J cells incubated with rod outer segments (OS), siRNA knockdown of Grb2 had no effect on OS binding, but significantly reduced OS uptake. Pik3r1 localized to early phagosomes along with Rab5 and Eea1. Phosphorylation and activation of Src was detected downstream of phagocytosis and Mertk activation. These findings suggest that MERTK signaling in the RPE involves a cohort of SH2-domain proteins with the potential to regulate both cytoskeletal rearrangement and membrane movement. Identification of the SH2-domain signaling partners of MERTK is an important step toward further defining the mechanism of RPE phagocytosis that is central to the function and survival of the retina.

  4. MERTK interactions with SH2-domain proteins in the retinal pigment epithelium.

    Directory of Open Access Journals (Sweden)

    Shameka J Shelby

    Full Text Available The receptor tyrosine kinase MERTK plays an essential role in the phagocytic uptake of shed photoreceptor membranes by the retinal pigment epithelium (RPE. A fundamental aspect of signal transduction by receptor tyrosine kinases involves autophosphorylation of tyrosine residues that recruit Src-homology 2 (SH2-domain proteins to the receptor intracellular domain. The goal of the current study was to evaluate the interactions of human MERTK with SH2-domain proteins present in the RPE. The MERTK intracellular domain was expressed as a 6xHis-fusion protein (6xHis-rMERTK(571-999, purified and phosphorylated. Ni(2+-NTA pull downs were performed using 6xHis-rMERTK(571-999 in incubations with recombinant phosphotyrosine-recognition sequences expressed as GST-fusion proteins. In addition, pull downs of native SH2-domain proteins were performed using 6xHis-rMERTK(571-999 and protein homogenates from rat RPE/choroid. For both recombinant and native proteins, western analysis detected MERTK interactions with GRB2, PIK3R1 (P85α, VAV3, and SRC. Immunohistochemical analysis localized each protein to mouse RPE. In cultured RPE-J cells incubated with rod outer segments (OS, siRNA knockdown of Grb2 had no effect on OS binding, but significantly reduced OS uptake. Pik3r1 localized to early phagosomes along with Rab5 and Eea1. Phosphorylation and activation of Src was detected downstream of phagocytosis and Mertk activation. These findings suggest that MERTK signaling in the RPE involves a cohort of SH2-domain proteins with the potential to regulate both cytoskeletal rearrangement and membrane movement. Identification of the SH2-domain signaling partners of MERTK is an important step toward further defining the mechanism of RPE phagocytosis that is central to the function and survival of the retina.

  5. Quantifying information transfer by protein domains: Analysis of the Fyn SH2 domain structure

    Directory of Open Access Journals (Sweden)

    Serrano Luis

    2008-10-01

    Full Text Available Abstract Background Efficient communication between distant sites within a protein is essential for cooperative biological response. Although often associated with large allosteric movements, more subtle changes in protein dynamics can also induce long-range correlations. However, an appropriate formalism that directly relates protein structural dynamics to information exchange between functional sites is still lacking. Results Here we introduce a method to analyze protein dynamics within the framework of information theory and show that signal transduction within proteins can be considered as a particular instance of communication over a noisy channel. In particular, we analyze the conformational correlations between protein residues and apply the concept of mutual information to quantify information exchange. Mapping out changes of mutual information on the protein structure then allows visualizing how distal communication is achieved. We illustrate the approach by analyzing information transfer by the SH2 domain of Fyn tyrosine kinase, obtained from Monte Carlo dynamics simulations. Our analysis reveals that the Fyn SH2 domain forms a noisy communication channel that couples residues located in the phosphopeptide and specificity binding sites and a number of residues at the other side of the domain near the linkers that connect the SH2 domain to the SH3 and kinase domains. We find that for this particular domain, communication is affected by a series of contiguous residues that connect distal sites by crossing the core of the SH2 domain. Conclusion As a result, our method provides a means to directly map the exchange of biological information on the structure of protein domains, making it clear how binding triggers conformational changes in the protein structure. As such it provides a structural road, next to the existing attempts at sequence level, to predict long-range interactions within protein structures.

  6. Partial Correction of Psoriasis upon Genetic Knock-Down of Human TNF-α by Lentivirus-Encoded shRNAs in a Xenograft Mouse Model

    DEFF Research Database (Denmark)

    Jakobsen, Maria; Stenderup, Karin; Rosada, Cecilia

    samples treated with irrelevant shRNAs, were selected and cloned into lentiviral vectors. The lentiviral vectors expressing TNF- shRNAs were used to transduce HEK-293 cells and verify vector-derived knock-down of stable TNF- expression in vitro. The most efficient TNF- -directed shRNA, which in cell lines...

  7. Protein flexibility and ligand rigidity : a thermodynamic and kinetic study of ITAM-based ligand binding to Syk tandem SH2

    NARCIS (Netherlands)

    de Mol, Nico J; Catalina, M Isabel; Dekker, Frank J; Fischer, Marcel J E; Heck, Albert J R; Liskamp, Rob M J; Dekker, Frank

    2005-01-01

    The Syk tandem Src homology 2 domain (Syk tSH2) constitutes a flexible protein module involved in the regulation of Syk kinase activity. The Syk tSH2 domain is assumed to function by adapting the distance between its two SH2 domains upon bivalent binding to diphosphotyrosine ligands. A thermodynamic

  8. The conservation pattern of short linear motifs is highly correlated with the function of interacting protein domains

    Directory of Open Access Journals (Sweden)

    Wang Yiguo

    2008-10-01

    Full Text Available Abstract Background Many well-represented domains recognize primary sequences usually less than 10 amino acids in length, called Short Linear Motifs (SLiMs. Accurate prediction of SLiMs has been difficult because they are short (often Results Our combined approach revealed that SLiMs are highly conserved in proteins from functional classes that are known to interact with a specific domain, but that they are not conserved in most other protein groups. We found that SLiMs recognized by SH2 domains were highly conserved in receptor kinases/phosphatases, adaptor molecules, and tyrosine kinases/phosphatases, that SLiMs recognized by SH3 domains were highly conserved in cytoskeletal and cytoskeletal-associated proteins, that SLiMs recognized by PDZ domains were highly conserved in membrane proteins such as channels and receptors, and that SLiMs recognized by S/T kinase domains were highly conserved in adaptor molecules, S/T kinases/phosphatases, and proteins involved in transcription or cell cycle control. We studied Tyr-SLiMs recognized by SH2 domains in more detail, and found that SH2-recognized Tyr-SLiMs on the cytoplasmic side of membrane proteins are more highly conserved than those on the extra-cellular side. Also, we found that SH2-recognized Tyr-SLiMs that are associated with SH3 motifs and a tyrosine kinase phosphorylation motif are more highly conserved. Conclusion The interactome of protein domains is reflected by the evolutionary conservation of SLiMs recognized by these domains. Combining scoring matrixes derived from peptide libraries and conservation analysis, we would be able to find those protein groups that are more likely to interact with specific domains.

  9. A novel disulfide bond in the SH2 Domain of the C-terminal Src kinase controls catalytic activity.

    Science.gov (United States)

    Mills, Jamie E; Whitford, Paul C; Shaffer, Jennifer; Onuchic, Jose N; Adams, Joseph A; Jennings, Patricia A

    2007-02-02

    The SH2 domain of the C-terminal Src kinase [Csk] contains a unique disulfide bond that is not present in other known SH2 domains. To investigate whether this unusual disulfide bond serves a novel function, the effects of disulfide bond formation on catalytic activity of the full-length protein and on the structure of the SH2 domain were investigated. The kinase activity of full-length Csk decreases by an order of magnitude upon formation of the disulfide bond in the distal SH2 domain. NMR spectra of the fully oxidized and fully reduced SH2 domains exhibit similar chemical shift patterns and are indicative of similar, well-defined tertiary structures. The solvent-accessible disulfide bond in the isolated SH2 domain is highly stable and far from the small lobe of the kinase domain. However, reduction of this bond results in chemical shift changes of resonances that map to a cluster of residues that extend from the disulfide bond across the molecule to a surface that is in direct contact with the small lobe of the kinase domain in the intact molecule. Normal mode analyses and molecular dynamics calculations suggest that disulfide bond formation has large effects on residues within the kinase domain, most notably within the active-site cleft. Overall, the data indicate that reversible cross-linking of two cysteine residues in the SH2 domain greatly impacts catalytic function and interdomain communication in Csk.

  10. Giant-Planet Chemistry: Ammonium Hydrosulfide (NH4SH), Its IR Spectra and Thermal and Radiolytic Stabilities

    Science.gov (United States)

    Loeffler, Mark J.; Hudson, Reggie L.; Chanover, Nancy J.; Simon, Amy A.

    2015-01-01

    Here we present our recent studies of proton-irradiated and unirradiated ammonium hydrosulfide, NH4SH, a compound predicted to be an important tropospheric cloud component of Jupiter and other giant planets. We irradiated both crystalline and amorphous NH4SH at 10-160 K and used IR spectroscopy to observe and identify reaction products in the ice, specifically NH3 and long-chained sulfur-containing ions. Crystalline NH4SH was amorphized during irradiation at all temperatures studied with the rate being the fastest at the lowest temperatures. Irradiation of amorphous NH4SH at approximately 10-75 K showed that 60-80% of the NH4 + remained when equilibrium was reached, and that NH4SH destruction rates were relatively constant within this temperature range. Irradiations at higher temperatures produced different dose dependence and were accompanied by pressure outbursts that, in some cases, fractured the ice. The thermal stability of irradiated NH4SH was found to be greater than that of unirradiated NH4SH, suggesting that an irradiated giant-planet cloud precipitate can exist at temperatures and altitudes not previously considered.

  11. Corneal-protective effects of an artificial tear containing sodium hyaluronate and castor oil on a porcine short-term dry eye model.

    Science.gov (United States)

    Hasegawa, Takashi; Amako, Hideki; Yamamoto, Takeshi; Tazawa, Mariko; Sakamoto, Yuji

    2014-09-01

    The corneal-protective effects of an artificial tear containing sodium hyaluronate (SH) and castor oil (CO) were evaluated on a porcine short-term dry eye model. Fresh porcine eyes with an intact cornea were treated with an artificial tear of saline, SH solution (0.1%, 0.5% or 1%), CO solution (0.5%, 1% or 5%) or a mixture solution containing 0.5% SH and 1% CO and then desiccated for 60, 90 or 180 min. To assess corneal damage, the eyes were stained with methylene blue (MB) or lissamine green (LG). The staining score of MB, absorbance of MB extracted from the cornea and staining density of LG increased significantly with increasing desiccation time in untreated and all artificial tear-treated eyes, although there were no significant differences in staining scores and absorbance of MB between eyes treated continuously with saline and 1% SH-treated ones at 60 and 90 min of desiccation or the mixture-treated eyes at 60 min of desiccation. No significant differences in the staining density of LG were also found between continuous saline-treated eyes and ones desiccated for 60 min and treated with 1% SH and the mixture. Mild cytoplasmic vacuolations were histopathologically observed in the basal and wing cells in eyes desiccated for 60 min and treated with 1% SH and the mixture. The mixture solution containing 0.5% SH and 1% CO has protective effects against corneal desiccation similar to those of 1% SH and would be helpful as an artificial tear.

  12. Loss of Sh3gl2/Endophilin A1 Is a Common Event in Urothelial Carcinoma that Promotes Malignant Behavior

    Directory of Open Access Journals (Sweden)

    Shyama Majumdar

    2013-07-01

    Full Text Available Urothelial carcinoma (UC causes substantial morbidity and mortality worldwide. However, the molecular mechanisms underlying urothelial cancer development and tumor progression are still largely unknown. Using informatics analysis, we identified Sh3gl2 (endophilin A1 as a bladder urothelium-enriched transcript. The gene encoding Sh3gl2 is located on chromosome 9p, a region frequently altered in UC. Sh3gl2 is known to regulate endocytosis of receptor tyrosine kinases implicated in oncogenesis, such as the epidermal growth factor receptor (EGFR and c-Met. However, its role in UC pathogenesis is unknown. Informatics analysis of expression profiles as well as immunohistochemical staining of tissue microarrays revealed Sh3gl2 expression to be decreased in UC specimens compared to nontumor tissues. Loss of Sh3gl2 was associated with increasing tumor grade and with muscle invasion, which is a reliable predictor of metastatic disease and cancer-derived mortality. Sh3gl2 expression was undetectable in 19 of 20 human UC cell lines but preserved in the low-grade cell line RT4. Stable silencing of Sh3gl2 in RT4 cells by RNA interference 1 enhanced proliferation and colony formation in vitro, 2 inhibited EGF-induced EGFR internalization and increased EGFR activation, 3 stimulated phosphorylation of Src family kinases and STAT3, and 4 promoted growth of RT4 xenografts in subrenal capsule tissue recombination experiments. Conversely, forced re-expression of Sh3gl2 in T24 cells and silenced RT4 clones attenuated oncogenic behaviors, including growth and migration. Together, these findings identify loss of Sh3gl2 as a frequent event in UC development that promotes disease progression.

  13. Improving MeSH classification of biomedical articles using citation contexts.

    Science.gov (United States)

    Aljaber, Bader; Martinez, David; Stokes, Nicola; Bailey, James

    2011-10-01

    Medical Subject Headings (MeSH) are used to index the majority of databases generated by the National Library of Medicine. Essentially, MeSH terms are designed to make information, such as scientific articles, more retrievable and assessable to users of systems such as PubMed. This paper proposes a novel method for automating the assignment of biomedical publications with MeSH terms that takes advantage of citation references to these publications. Our findings show that analysing the citation references that point to a document can provide a useful source of terms that are not present in the document. The use of these citation contexts, as they are known, can thus help to provide a richer document feature representation, which in turn can help improve text mining and information retrieval applications, in our case MeSH term classification. In this paper, we also explore new methods of selecting and utilising citation contexts. In particular, we assess the effect of weighting the importance of citation terms (found in the citation contexts) according to two aspects: (i) the section of the paper they appear in and (ii) their distance to the citation marker. We conduct intrinsic and extrinsic evaluations of citation term quality. For the intrinsic evaluation, we rely on the UMLS Metathesaurus conceptual database to explore the semantic characteristics of the mined citation terms. We also analyse the "informativeness" of these terms using a class-entropy measure. For the extrinsic evaluation, we run a series of automatic document classification experiments over MeSH terms. Our experimental evaluation shows that citation contexts contain terms that are related to the original document, and that the integration of this knowledge results in better classification performance compared to two state-of-the-art MeSH classification systems: MeSHUP and MTI. Our experiments also demonstrate that the consideration of Section and Distance factors can lead to statistically

  14. Morphological Differentiation Towards Neuronal Phenotype of SH-SY5Y Neuroblastoma Cells by Estradiol, Retinoic Acid and Cholesterol

    OpenAIRE

    Teppola, Heidi; Sarkanen, Jertta-Riina; Jalonen, Tuula O.; Linne, Marja-Leena

    2015-01-01

    Human SH-SY5Y neuroblastoma cells maintain their potential for differentiation and regression in culture conditions. The induction of differentiation could serve as a strategy to inhibit cell proliferation and tumor growth. Previous studies have shown that differentiation of SH-SY5Y cells can be induced by all-trans-retinoic-acid (RA) and cholesterol (CHOL). However, signaling pathways that lead to terminal differentiation of SH-SY5Y cells are still largely unknown. The goal of this study was...

  15. Morphological Differentiation Towards Neuronal Phenotype of SH-SY5Y Neuroblastoma Cells by Estradiol, Retinoic Acid and Cholesterol

    OpenAIRE

    Teppola, Heidi; Sarkanen, Jertta-Riina; Jalonen, Tuula; Linne, Marja-Leena

    2016-01-01

    Human SH-SY5Y neuroblastoma cells maintain their potential for differentiation and regression in culture conditions. The induction of differentiation could serve as a strategy to inhibit cell proliferation and tumor growth. Previous studies have shown that differentiation of SH-SY5Y cells can be induced by all-trans-retinoic-acid (RA) and cholesterol (CHOL). However, signaling pathways that lead to terminal differentiation of SH-SY5Y cells are still largely unknown. The goal of this study was...

  16. Interactions of polyomavirus middle T with the SH2 domains of the pp85 subunit of phosphatidylinositol-3-kinase.

    OpenAIRE

    Yoakim, M; Hou, W; Liu, Y; Carpenter, C L; Kapeller, R; Schaffhausen, B S

    1992-01-01

    The binding of phosphatidylinositol-3-kinase to the polyomavirus middle T antigen is facilitated by tyrosine phosphorylation of middle T on residue 315. The pp85 subunit of phosphatidylinositol-3-kinase contains two SH2 domains, one in the middle of the molecule and one at the C terminus. When assayed by blotting with phosphorylated middle T, the more N-terminal SH2 domain is responsible for binding to middle T. When assayed in solution with glutathione S transferase fusions, both SH2s are ca...

  17. Intramolecular dynamics within the N-Cap-SH3-SH2 regulatory unit of the c-Abl tyrosine kinase reveal targeting to the cellular membrane.

    Science.gov (United States)

    de Oliveira, Guilherme A P; Pereira, Elen G; Ferretti, Giulia D S; Valente, Ana Paula; Cordeiro, Yraima; Silva, Jerson L

    2013-09-27

    c-Abl is a key regulator of cell signaling and is under strict control via intramolecular interactions. In this study, we address changes in the intramolecular dynamics coupling within the c-Abl regulatory unit by presenting its N-terminal segment (N-Cap) with an alternative function in the cell as c-Abl becomes activated. Using small angle x-ray scattering, nuclear magnetic resonance, and confocal microscopy, we demonstrate that the N-Cap and the Src homology (SH) 3 domain acquire μs-ms motions upon N-Cap association with the SH2-L domain, revealing a stabilizing synergy between these segments. The N-Cap-myristoyl tether likely triggers the protein to anchor to the membrane because of these flip-flop dynamics, which occur in the μs-ms time range. This segment not only presents the myristate during c-Abl inhibition but may also trigger protein localization inside the cell in a functional and stability-dependent mechanism that is lost in Bcr-Abl(+) cells, which underlie chronic myeloid leukemia. This loss of intramolecular dynamics and binding to the cellular membrane is a potential therapeutic target.

  18. SH2-Balpha is an insulin-receptor adapter protein and substrate that interacts with the activation loop of the insulin-receptor kinase.

    OpenAIRE

    Kotani, K; Wilden, P; Pillay, T S

    1998-01-01

    We identified SH2-Balpha as an insulin-receptor-binding protein based on interaction screening in yeast hybrid systems and co-precipitation in cells. SH2-Balpha contains pleckstrin-homology ('PH') and Src homology 2 (SH2) domains and is closely related to APS (adapter protein with a PH domain and an SH2 domain) and lnk, adapter proteins first identified in lymphocytes. SH2-Balpha is ubiquitously expressed and is present in rat epididymal adipose tissue, liver and skeletal muscle, physiologica...

  19. Phosphorylation of the adaptor protein SH2B1β regulates its ability to enhance growth hormone-dependent macrophage motility

    OpenAIRE

    Su, Hsiao-Wen; Lanning, Nathan J.; Morris, David L.; Argetsinger, Lawrence S.; Lumeng, Carey N.; Carter-Su, Christin

    2013-01-01

    Previous studies have shown that growth hormone (GH) recruits the adapter protein SH2B1β to the GH-activated, GH receptor-associated tyrosine kinase JAK2, implicating SH2B1β in GH-dependent actin cytoskeleton remodeling, and suggesting that phosphorylation at serines 161 and 165 in SH2B1β releases SH2B1β from the plasma membrane. Here, we examined the role of SH2B1β in GH regulation of macrophage migration. We show that GH stimulates migration of cultured RAW264.7 macrophages, and primary cul...

  20. Expression of self-complementary hairpin RNA under the control of the rolC promoter confers systemic disease resistance to plum pox virus without preventing local infection.

    Science.gov (United States)

    Pandolfini, Tiziana; Molesini, Barbara; Avesani, Linda; Spena, Angelo; Polverari, Annalisa

    2003-06-25

    Homology-dependent selective degradation of RNA, or post-transcriptional gene silencing (PTGS), is involved in several biological phenomena, including adaptative defense mechanisms against plant viruses. Small interfering RNAs mediate the selective degradation of target RNA by guiding a multicomponent RNAse. Expression of self-complementary hairpin RNAs within two complementary regions separated by an intron elicits PTGS with high efficiency. Plum pox virus (PPV) is the etiological agent of sharka disease in Drupaceae, although it can also be transmitted to herbaceous species (e.g. Nicotiana benthamiana). Once inside the plant, PPV is transmitted via plasmodesmata from cell to cell, and at longer distances, via phloem. The rolC promoter drives expression in phloem cells. RolC expression is absent in both epidermal and mesophyll cells. The aim of the present study was to confer systemic disease resistance without preventing local viral infection. In the ihprolC-PP197 gene (intron hair pin rolC PPV 197), a 197 bp sequence homologous to the PPV RNA genome (from base 134 to 330) was placed as two inverted repeats separated by the DNA sequence of the rolA intron. This hairpin construct is under the control of the rolC promoter.N. benthamiana plants transgenic for the ihprolC-PP197 gene contain siRNAs homologous to the 197 bp sequence. The transgenic progeny of ihprolC-PP197 plants are resistant to PPV systemic infection. Local infection is unaffected. Most (80%) transgenic plants are virus free and symptomless. Some plants (20%) contain virus in uninoculated apical leaves; however they show only mild symptoms of leaf mottling. PPV systemic resistance cosegregates with the ihprolC-PP197 transgene and was observed in progeny plants of all independent transgenic lines analyzed. SiRNAs of 23-25 nt homologous to the PPV sequence used in the ihprolC-PP197 construct were detected in transgenic plants before and after inoculation. Transitivity of siRNAs was observed in

  1. Expression of self-complementary hairpin RNA under the control of the rolC promoter confers systemic disease resistance to plum pox virus without preventing local infection

    Directory of Open Access Journals (Sweden)

    Spena Angelo

    2003-06-01

    Full Text Available Abstract Background Homology-dependent selective degradation of RNA, or post-transcriptional gene silencing (PTGS, is involved in several biological phenomena, including adaptative defense mechanisms against plant viruses. Small interfering RNAs mediate the selective degradation of target RNA by guiding a multicomponent RNAse. Expression of self-complementary hairpin RNAs within two complementary regions separated by an intron elicits PTGS with high efficiency. Plum pox virus (PPV is the etiological agent of sharka disease in Drupaceae, although it can also be transmitted to herbaceous species (e.g. Nicotiana benthamiana. Once inside the plant, PPV is transmitted via plasmodesmata from cell to cell, and at longer distances, via phloem. The rolC promoter drives expression in phloem cells. RolC expression is absent in both epidermal and mesophyll cells. The aim of the present study was to confer systemic disease resistance without preventing local viral infection. Results In the ihprolC-PP197 gene (intron hair pin rolC PPV 197, a 197 bp sequence homologous to the PPV RNA genome (from base 134 to 330 was placed as two inverted repeats separated by the DNA sequence of the rolA intron. This hairpin construct is under the control of the rolC promoter.N. benthamiana plants transgenic for the ihprolC-PP197 gene contain siRNAs homologous to the 197 bp sequence. The transgenic progeny of ihprolC-PP197 plants are resistant to PPV systemic infection. Local infection is unaffected. Most (80% transgenic plants are virus free and symptomless. Some plants (20% contain virus in uninoculated apical leaves; however they show only mild symptoms of leaf mottling. PPV systemic resistance cosegregates with the ihprolC-PP197 transgene and was observed in progeny plants of all independent transgenic lines analyzed. SiRNAs of 23–25 nt homologous to the PPV sequence used in the ihprolC-PP197 construct were detected in transgenic plants before and after inoculation

  2. Shortness of Breath

    Science.gov (United States)

    ... filled with air (called pneumotho- rax), it will hinder expansion of the lung, resulting in shortness of ... of Chest Physi- cians. Shortness of Breath: Patient Education. http: / / www. onebreath. org/ document. doc? id= 113. ...

  3. Suppression of IL-6 Gene by shRNA Augments Gemcitabine Chemosensitization in Pancreatic Adenocarcinoma Cells

    Directory of Open Access Journals (Sweden)

    Hai-Bo Xing

    2018-01-01

    Full Text Available Pancreatic adenocarcinoma has an exceedingly poor prognosis, accounting for five-year survival of less than 5%. Presently, improving the efficacy of pancreatic adenocarcinoma treatment has been the focus of medical researchers worldwide. Recently, it has been suggested that deregulation of interleukin- (IL- 6 is caused by a key gene involved in the beginning and development of pancreatic adenocarcinoma. Herein, we investigated whether suppression of IL-6 could augment gemcitabine sensitivity in the PANC-1 cells. We found considerably higher expression of IL-6 in pancreatic