WorldWideScience

Sample records for shock normal direction

  1. Multiple spacecraft observations of interplanetary shocks Four spacecraft determination of shock normals

    Science.gov (United States)

    Russell, C. T.; Mellott, M. M.; Smith, E. J.; King, J. H.

    1983-01-01

    ISEE 1, 2, 3, IMP 8, and Prognoz 7 observations of interplanetary shocks in 1978 and 1979 provide five instances where a single shock is observed by four spacecraft. These observations are used to determine best-fit normals for these five shocks. In addition to providing well-documented shocks for future investigations these data allow the evaluation of the accuracy of several shock normal determination techniques. When the angle between upstream and downstream magnetic field is greater than 20 deg, magnetic coplanarity can be an accurate single spacecraft method. However, no technique based solely on the magnetic measurements at one or multiple sites was universally accurate. Thus, the use of overdetermined shock normal solutions, utilizing plasma measurements, separation vectors, and time delays together with magnetic constraints, is recommended whenever possible.

  2. On possible structures of normal ionizing shock waves in electromagnetic shock tubes

    International Nuclear Information System (INIS)

    Liberman, M.A.; Synakh, V.S.; Zakajdakhov, V.V.; Velikovich, A.L.

    1982-01-01

    The problem of possible structures of normal ionizing shock waves is studied. On the basis of the general theory of ionizing shock waves in magnetic fields, a similarity solution of the piston problem for an impenetrable piston and a magnetic piston is described and a numerical solution of the non-stationary piston problem is obtained. It is shown that precursor photo-ionization of the neutral gas by the radiation of the shock-heated gas is the dominant factor in shaping normal ionizing shock structures. In particular, it is shown that the strong overheating of atoms and ions in shock fronts is due to the tensor form of Ohm's law in the precursor region. (author)

  3. Multiple spacecraft observations of interplanetary shocks: four spacecraft determination of shock normals

    International Nuclear Information System (INIS)

    Russell, C.T.; Mellott, M.M.; Smith, E.J.; King, J.H.

    1983-01-01

    ISEE 1,2,3 IMP8, and Prognoz 7 observations of interplanetary shocks in 1978 and 1979 provide five instances where a single shock is observed by four spacecraft. These observations are used to determine best-fit normals for these five shocks. In addition to providing well-documented shocks for furture techniques. When the angle between upstream and downstream magnetic field is greater than 20, magnetic coplanarity can be an accurate single spacecraft method. However, no technique based solely on the magnetic measurements at one or multiple sites was universally accurate. Thus, we recommend using overdetermined shock normal solutions whenever possible, utilizing plasma measurements, separation vectors, and time delays together with magnetic constraints

  4. Validation of MCDS by comparison of predicted with experimental velocity distribution functions in rarefied normal shocks

    Science.gov (United States)

    Pham-Van-diep, Gerald C.; Erwin, Daniel A.

    1989-01-01

    Velocity distribution functions in normal shock waves in argon and helium are calculated using Monte Carlo direct simulation. These are compared with experimental results for argon at M = 7.18 and for helium at M = 1.59 and 20. For both argon and helium, the variable-hard-sphere (VHS) model is used for the elastic scattering cross section, with the velocity dependence derived from a viscosity-temperature power-law relationship in the way normally used by Bird (1976).

  5. On the evolution of normal ionizing shock waves in helium

    International Nuclear Information System (INIS)

    Synakh, V.S.; Zakajdakov, V.V.

    1982-01-01

    The generation, structure and propagation of one-dimensional ionizing MHD shock waves in helium under a pressure of 100 mTorr are investigated with the help of numerical simulation. The normal magnetic field varies within 3 to 10 kG and the longitudinal magnetic field varies up to 2.5 kG. The model includes the kinetics of ionization and photo-processes. If a solid conducting piston is a source of perturbation, it may give rise to generation and further development of an MHD switch-on wave. Its evolution at an advanced stage depends weakly on the source. The curves for the dependence of the shock speed on time and the driving magnetic field as well as the profiles for the main quantities are presented. A possibility of comparison with real experiments is discussed. Algorithms based on Godunov's sliding meshes and the imbedding methods are used for numerical simulation. (author)

  6. Direct measurement technique for shock wave velocity with irradiation drive

    International Nuclear Information System (INIS)

    Wang Feng; Peng Xiaoshi; Liu Shenye; Jiang Xiaohua; Ding Yongkun

    2011-01-01

    According to the ionization mechanism of transparent material under super high pressure, the direct diagnosis method of shock wave has been analyzed. With the Drude free electron model, the reflectivity difference of shock wave front under different pressures was analyzed. The blank effect in the detector was studied, which is caused by the X-ray ionization of transparent material, after analyzing the reflectivity data in space-time scale. The experiment shows that the beginning point and duration of blank effect are consistent with the start point and duration of laser pulse, respectively. And the reflectivity of shock wave front is about 35% when the shock velocity is 32 km/s. The reason and solution for blank effect was presented. The formula to calculate the shock wave velocity in transparent material was also deduced and verified. (authors)

  7. The Effect of Shock Stress and Field Strength on Shock-Induced Depoling of Normally Poled PZT 95/5

    International Nuclear Information System (INIS)

    CHHABILDAS, LALIT C.; FURNISH, MICHAEL D.; MONTGOMERY, STEPHEN T.; SETCHELL, ROBERT E.

    1999-01-01

    Shock-induced depoling of the ferroelectric ceramic PZT 95/5 is utilized in a number of pulsed power devices. Several experimental and theoretical efforts are in progress in order to improve numerical simulations of these devices. In this study we have examined the shock response of normally poled PZT 95/5 under uniaxial strain conditions. On each experiment the current produced in an external circuit and the transmitted waveform at a window interface were recorded. The peak electrical field generated within the PZT sample was varied through the choice of external circuit resistance. Shock pressures were varied from 0.6 to 4.6 GPa, and peak electrical fields were varied from 0.2 to 37 kV/cm. For a 2.4 GPa shock and the lowest peak field, a nearly constant current governed simply by the remanent polarization and the shock velocity was recorded. Both decreasing the shock pressure and increasing the electrical field resulted in reduced current generation, indicating a retardation of the depoling kinetics

  8. Estimating the Heading Direction Using Normal Flow

    Science.gov (United States)

    1994-01-01

    understood (Faugeras and Maybank 1990), 3 Kinetic Stabilization under the assumption that optic flow or correspon- dence is known with some uncertainty...accelerometers can achieve very It can easily be shown (Koenderink and van Doom high accuracy, the same is not true for inexpensive 1975; Maybank 1985... Maybank . ’Motion from point matches: Multi- just don’t compute normal flow there (see Section 6). plicity of solutions". Int’l J. Computer Vision 4

  9. Dynamic analysis to establish normal shock and vibration of radioactive material shipping packages

    International Nuclear Information System (INIS)

    Fields, S.R.

    1980-01-01

    A computer model, CARDS (Cask-Railcar Dynamic Simulator) was developed to provide input data for a broad range of radioactive material package-tiedown structural assessments. CARDS simulates the dynamic behavior of shipping packages and their transporters during normal transport conditions. The model will be used to identify parameters which significantly affect the normal shock and vibration environments which, in turn, provide the basis for determining the forces transmitted to the packages

  10. Maximization of energy recovery inside supersonic separator in the presence of condensation and normal shock wave

    International Nuclear Information System (INIS)

    Shooshtari, S.H. Rajaee; Shahsavand, A.

    2017-01-01

    Natural gases provide around a quarter of energy consumptions around the globe. Supersonic separators (3S) play multifaceted role in natural gas industry processing, especially for water and hydrocarbon dew point corrections. These states of the art devices have minimum energy requirement and favorable process economy compared to conventional facilities. Their relatively large pressure drops may limit their application in some situations. To maximize the energy recovery of the dew point correction facility, the pressure loss across the 3S unit should be minimized. The optimal structure of 3s unit (including shock wave location and diffuser angle) is selected using simultaneous combination of normal shock occurrence and condensation in the presence of nucleation and growth processes. The condense-free gas enters the non-isentropic normal shock wave. The simulation results indicate that the normal shock location, pressure recovery coefficient and onset position strongly vary up to a certain diffuser angle (β = 8°) with the maximum pressure recovery of 0.88 which leads to minimum potential energy loss. Computational fluid dynamic simulations show that separation of boundary layer does not happen for the computed optimal value of β and it is essentially constant when the inlet gas temperatures and pressures vary over a relatively broad range. - Highlights: • Supersonic separators have found numerous applications in oil and gas industries. • Maximum pressure recovery is crucial for such units to maximize energy efficiency. • Simultaneous condensation and shock wave occurrence are studied for the first time. • Diverging nozzle angle of 8° can provide maximum pressure recovery of 0.88. • The optimal diffuser angle remains constant over a broad range of inlet conditions.

  11. Shock and vibration environments encountered during normal rail transportation of heavy cargo

    International Nuclear Information System (INIS)

    Magnuson, C.F.

    1982-08-01

    This study was conducted to obtain vibration and superimposed shock data during normal rail shipment of heavy cargo. The data were obtained during a regularly scheduled rail shipment of a 45-tonne (50-ton) cargo which consisted of an empty spent-fuel container, its supporting structure, and associated hoisting devices. The shipment was made over rail lines which are operated by the Atchison, Topeka, and Santa Fe Railway Company between Denver, Colorado and Albuquerque, New Mexico. The instrumented rail car was equipped with 0.38-m (15-in.) hydraulic end-of-car coupling devices. The 99 percentile levels of vibration acceleration amplitudes and single degree-of-freedom superimposed shock response spectra for the longitudinal, transverse, and vertical axes are presented

  12. Directly acting spring loaded safety valves as shock reducing measure

    International Nuclear Information System (INIS)

    Ismaier, A.; Schluecker, E.

    2010-01-01

    Hydraulic shocks as induced by fast closure of armatures or by sudden pump failures are massive impacts in piping systems and require extensive measures to absorb the generated load. Basically the avoidance of water hammers are preferable but in case of emergency shutdowns unavoidable hydraulic shocks have to be reduced by appropriate measures. The authors describe experiments with spring loaded safety valves as shock reducing measures. It was shown that the vale dimensions is essential for the efficacy. A realistic modeling is possible using the one-dimensional fluid mechanics code ROLAST.

  13. Variable field-to-normal angles in the shock foreshock boundary observed by ISEE 1 and 2

    International Nuclear Information System (INIS)

    Greenstadt, E.W.; Mellot, M.M.

    1985-01-01

    Saturated ULF waves in the foreshock, with amplitudes comparable to the magnitude of the average field, are convected by the solar wind to the quasi-parallel shock where the average field-normal angle is less than, or about, 45 0 . Several examples from ISEE 1 and 2 magnetometer data show waves that defined local, instantaneous field-normal angles very different periodically from the average. Local geometric conditions at the nominally quasi-parallel shock varied from nearly parallel to nearly perpendicular, at the periods of typical upstream waves. Clear magnetic shock transitions occurred under temporarily quasi-perpendicular geometry

  14. COMPARATIVE EFFICACY OF HYPERTONIC SALINE AND NORMAL SALINE SOLUTIONS IN EXPERIMENTALLY INDUCED ENDOTOXIC SHOCK IN DOGS

    Directory of Open Access Journals (Sweden)

    M. A. ZAFAR, G. MUHAMMAD, M. H. HUSSAIN, T. AHMAD, A. YOUSAF AND I. SARFARAZ

    2009-07-01

    Full Text Available This study was contemplated to determine the comparative beneficial effects of hypertonic saline solution and sterile saline solution in induced endotoxic shock in dogs. For this purpose, 12 healthy Mongrel dogs were randomly divided into two equal groups (A and B. All the animals were induced endotoxaemia by slow intravenous administration of Escherichia coli endotoxins 0111:B4. Group A was treated with normal saline solution @ 90 ml/kg BW, while group B was given hypertonic saline solution @ 4 ml/kg BW, followed by normal saline solution @ 10 ml/kg BW. Different parameters were observed for evaluation of these fluids including clinical and haematological parameters, serum electrolytes, mean arterial pressure, and blood gases at different time intervals up to 24 hours post treatments. After infusion of respective fluids, all parameters returned to baseline values in both the groups but group B showed better results than group A except bicarbonates, which better recovered in group A. Thus, it was concluded that a small-volume of hypertonic saline solution could be effectively used in reversing the endotoxaemia. Moreover, it provides a rapid and inexpensive resuscitation from endotoxic shock.

  15. Thermodynamic bounds for existence of normal shock in compressible fluid flow in pipes

    Directory of Open Access Journals (Sweden)

    SERGIO COLLE

    Full Text Available Abstract The present paper is concerned with the thermodynamic theory of the normal shock in compressible fluid flow in pipes, in the lights of the pioneering works of Lord Rayleigh and G. Fanno. The theory of normal shock in pipes is currently presented in terms of the Rayleigh and Fanno curves, which are shown to cross each other in two points, one corresponding to a subsonic flow and the other corresponding to a supersonic flow. It is proposed in this paper a novel differential identity, which relates the energy flux density, the linear momentum flux density, and the entropy, for constant mass flow density. The identity so obtained is used to establish a theorem, which shows that Rayleigh and Fanno curves become tangent to each other at a single sonic point. At the sonic point the entropy reaches a maximum, either as a function of the pressure and the energy density flux or as a function of the pressure and the linear momentum density flux. A Second Law analysis is also presented, which is fully independent of the Second Law analysis based on the Rankine-Hugoniot adiabatic carried out by Landau and Lifshitz (1959.

  16. Normal saline influences coagulation and endothelial function after traumatic brain injury and hemorrhagic shock in pigs

    DEFF Research Database (Denmark)

    Dekker, Simone E; Sillesen, Martin; Bambakidis, Ted

    2014-01-01

    ), colloids (Hextend [HEX]), and fresh frozen plasma (FFP) resuscitation are associated with differential effects on coagulation and endothelial systems. METHODS: We subjected 15 Yorkshire swine to TBI and HS (40% blood volume), and kept in HS for 2 hours before resuscitation with NS, HEX, or FFP. Markers......BACKGROUND: Traumatic brain injury (TBI) and hemorrhagic shock (HS) are the leading causes of trauma-related deaths. These insults disrupt coagulation and endothelial systems. This study investigated whether previously reported differences in lesion size and brain swelling during normal saline (NS...... of endothelial activation (E-selectin, Intercellular adhesion molecule [ICAM]-1), coagulation activation (prothrombin fragment 1 + 2), and natural anticoagulation (activated protein C [aPC]) were determined in serum and brain whole cell lysates. RESULTS: Serum levels of aPC were greater in the NS group (203 ± 30...

  17. Analysis of the interaction of a weak normal shock wave with a turbulent boundary layer

    Science.gov (United States)

    Melnik, R. E.; Grossman, B.

    1974-01-01

    The method of matched asymptotic expansions is used to analyze the interaction of a normal shock wave with an unseparated turbulent boundary layer on a flat surface at transonic speeds. The theory leads to a three-layer description of the interaction in the double limit of Reynolds number approaching infinity and Mach number approaching unity. The interaction involves an outer, inviscid rotational layer, a constant shear-stress wall layer, and a blending region between them. The pressure distribution is obtained from a numerical solution of the outer-layer equations by a mixed-flow relaxation procedure. An analytic solution for the skin friction is determined from the inner-layer equations. The significance of the mathematical model is discussed with reference to existing experimental data.

  18. Direct effects of cold shock: bioassays with three Columbia River organisms

    International Nuclear Information System (INIS)

    Becker, C.D.; Schneider, M.J.

    1975-01-01

    Results of studies of the direct effects of cold shock on the pumpkinseed sunfish (representing a warmwater fish), the rainbow trout (representing a coldwater fish), and the common crayfish showed that resistance to cold shock varies between species, is dependent on acclimation temperature, and resistance to temperature declines is dependent on the decline rate. Severe cold shock at a sublethal level is accompanied by disorientation, loss of equilibrium, and immobilization. Pumpkinseed, the warm water species, are most susceptible. Rainbow, the cold water species, are less susceptible; at an acclimation 10 0 C, rainbow survive abrupt shock to levels slightly above freezing. Crayfish, the decapod crustacean, are most resistant; at an acclimation of 15 0 C, crayfish survive abrupt shock to the point just above freezing

  19. Normal Reflection Characteristics of One-Dimensional Unsteady Flow Shock Waves on Rigid Walls from Pulse Discharge in Water

    Directory of Open Access Journals (Sweden)

    Dong Yan

    2017-01-01

    Full Text Available Strong shock waves can be generated by pulse discharge in water, and the characteristics due to the shock wave normal reflection from rigid walls have important significance to many fields, such as industrial production and defense construction. This paper investigates the effects of hydrostatic pressures and perturbation of wave source (i.e., charging voltage on normal reflection of one-dimensional unsteady flow shock waves. Basic properties of the incidence and reflection waves were analyzed theoretically and experimentally to identify the reflection mechanisms and hence the influencing factors and characteristics. The results indicated that increased perturbation (i.e., charging voltage leads to increased peak pressure and velocity of the reflected shock wave, whereas increased hydrostatic pressure obviously inhibited superposition of the reflection waves close to the rigid wall. The perturbation of wave source influence on the reflected wave was much lower than that on the incident wave, while the hydrostatic pressure obviously affected both incident and reflection waves. The reflection wave from the rigid wall in water exhibited the characteristics of a weak shock wave, and with increased hydrostatic pressure, these weak shock wave characteristics became more obvious.

  20. Direct-drive shock-ignition for the Laser MégaJoule

    Directory of Open Access Journals (Sweden)

    Canaud B.

    2013-11-01

    Full Text Available We present a review of direct-drive shock ignition studies done as an alternative for the Laser MégaJoule (LMJ. One and two dimensional systematic analyses of HiPER-like shock-ignited target designs are performed for the fuel assembly irradiation uniformity using the whole LMJ configuration or a part of the facility, and for the uniformity of the ignitor spike. High-gain shock-ignition is shown to be possible with intensity of each quad less than 1015 W/cm2 but low modes asymmetries displace the power required in the ignitor spike towards higher powers. Shock-ignition of Direct-Drive Double-Shell non-cryogenic targets is also addressed.

  1. Direct Numerical Simulation of Passive Scalar Mixing in Shock Turbulence Interaction

    Science.gov (United States)

    Gao, Xiangyu; Bermejo-Moreno, Ivan; Larsson, Johan

    2017-11-01

    Passive scalar mixing in the canonical shock-turbulence interaction configuration is investigated through shock-capturing Direct Numerical Simulations (DNS). Scalar fields with different Schmidt numbers are transported by an initially isotropic turbulent flow field passing across a nominally planar shock wave. A solution-adaptive hybrid numerical scheme on Cartesian structured grids is used, that combines a fifth-order WENO scheme near shocks and a sixth-order central-difference scheme away from shocks. The simulations target variations in the shock Mach number, M (from 1.5 to 3), turbulent Mach number, Mt (from 0.1 to 0.4, including wrinkled- and broken-shock regimes), and scalar Schmidt numbers, Sc (from 0.5 to 2), while keeping the Taylor microscale Reynolds number constant (Reλ 40). The effects on passive scalar statistics are investigated, including the streamwise evolution of scalar variance budgets, pdfs and spectra, in comparison with their temporal evolution in decaying isotropic turbulence.

  2. Slow shocks and their transition to fast shocks in the inner solar wind

    International Nuclear Information System (INIS)

    Wang, Y.C.

    1987-01-01

    The jump conditions of MHD shocks may be directly calculated as functions of three upstream conditions: the shock Alfven number based on the normal component of the relative shock speed, the shock angle, and the plasma β value. The shock Alfven number is less than 1 for a slow shock and greater than 1 for a fast shock. A traveling, forward shock can be a slow shock in coronal space, where the Alfven speed is of the order of 1000 km/s. The surface of a forward slow shock has a bow-shaped geometry with its nose facing toward the sun. The decrease in the Alfven speed at increasing heliocentric distance causes the shock Alfven number of a forward slow shock to become greater than 1, and the shock eventually evolves from a slow shock into a fast shock. During the transition the shock system consists of a slow shock, a fast shock, and a rotational discontinuity. They intersect along a closed transition line. As the system moves outward from the sun, the area enclosed by the transition line expands, the fast shock grows stronger, and the slow shock becomes weaker. Eventually, the slow shock diminishes, and the entire shock system evolves into a forward fast shock. copyrightAmerican Geophysical Union 1987

  3. Interaction between a normal shock wave and a turbulent boundary layer at high transonic speeds. II - Wall shear stress

    Science.gov (United States)

    Liou, M. S.; Adamson, T. C., Jr.

    1980-01-01

    Asymptotic methods are used to calculate the shear stress at the wall for the interaction between a normal shock wave and a turbulent boundary layer on a flat plate. A mixing length model is used for the eddy viscosity. The shock wave is taken to be strong enough that the sonic line is deep in the boundary layer and the upstream influence is thus very small. It is shown that unlike the result found for laminar flow an asymptotic criterion for separation is not found; however, conditions for incipient separation are computed numerically using the derived solution for the shear stress at the wall. Results are compared with available experimental measurements.

  4. Direct immunofluorescence of normal skin in rheumatoid arthritis.

    Science.gov (United States)

    Fitzgerald, O M; Barnes, L; Woods, R; McHugh, L; Barry, C; O'Loughlin, S

    1985-11-01

    The clinical significance of previously described immunoglobulin and complement deposition in the superficial dermal vessel walls of patients with rheumatoid arthritis is unknown. In the present study, skin biopsies were obtained from the normal forearm and buttock of 48 unselected patients with rheumatoid arthritis and were examined by direct immunofluorescence (IF) for the presence of immunoglobulin (IgG,A,M) and complement (C3) in the vessel walls. Deposits of C3, IgM or IgG were detected in 10 patients. Five patients had deposits at the forearm sample alone, four patients had deposits at both biopsy sites, while one patient was positive at the buttock alone. Clinical features were similar in patients with and without vessel IF. However, patients with IF were significantly more seropositive with lower levels of complement and raised levels of serum IgA and IgM. There was also an increased level of circulating IgG immune complexes in these patients. Further analysis following exclusion of seronegative patients revealed similar results. This study suggests that the presence of vessel IF identifies a subgroup of patients who have evidence of more severe immunological disturbance.

  5. Interaction between a normal shock wave and a turbulent boundary layer at high transonic speeds. I - Pressure distribution

    Science.gov (United States)

    Messiter, A. F.

    1980-01-01

    Asymptotic solutions are derived for the pressure distribution in the interaction of a weak normal shock wave with a turbulent boundary layer. The undisturbed boundary layer is characterized by the law of the wall and the law of the wake for compressible flow. In the limiting case considered, for 'high' transonic speeds, the sonic line is very close to the wall. Comparisons with experiment are shown, with corrections included for the effect of longitudinal wall curvature and for the boundary-layer displacement effect in a circular pipe.

  6. Effects of non-adiabatic walls on shock/boundary-layer interaction using direct numerical simulations

    Science.gov (United States)

    Volpiani, Pedro S.; Bernardini, Matteo; Larsson, Johan

    2017-11-01

    The influence of wall thermal conditions on the properties of an impinging shock wave interacting with a turbulent supersonic boundary layer is a research topic that still remains underexplored. In the present study, direct numerical simulations (DNS) are employed to investigate the flow properties of a shock wave interacting with a turbulent boundary layer at free-stream Mach number M∞ = 2.28 with distinct wall thermal conditions and shock strengths. Instantaneous and mean flow fields, wall quantities and the low-frequency unsteadiness are analyzed. While heating contributes to increase the extent of the interaction zone, wall cooling turns out to be a good candidate for flow control. The distribution of the Stanton number shows a good agreement with prior experimental studies and confirms the strong heat transfer and complex pattern within the interaction region. Numerical results indicate that the changes in the interaction length are mainly linked to the incoming boundary layer as suggested in previous studies (Souverein et al., 2013 and Jaunet et al., 2014). This work was supported by the Air Force Office of Scientific Research, Grant FA95501610385.

  7. A Lever Coupling Mechanism in Dual-Mass Micro-Gyroscopes for Improving the Shock Resistance along the Driving Direction

    Directory of Open Access Journals (Sweden)

    Yang Gao

    2017-04-01

    Full Text Available This paper presents the design and application of a lever coupling mechanism to improve the shock resistance of a dual-mass silicon micro-gyroscope with drive mode coupled along the driving direction without sacrificing the mechanical sensitivity. Firstly, the mechanical sensitivity and the shock response of the micro-gyroscope are theoretically analyzed. In the mechanical design, a novel lever coupling mechanism is proposed to change the modal order and to improve the frequency separation. The micro-gyroscope with the lever coupling mechanism optimizes the drive mode order, increasing the in-phase mode frequency to be much larger than the anti-phase one. Shock analysis results show that the micro-gyroscope structure with the designed lever coupling mechanism can notably reduce the magnitudes of the shock response and cut down the stress produced in the shock process compared with the traditional elastic coupled one. Simulations reveal that the shock resistance along the drive direction is greatly increased. Consequently, the lever coupling mechanism can change the gyroscope’s modal order and improve the frequency separation by structurally offering a higher stiffness difference ratio. The shock resistance along the driving direction is tremendously enhanced without loss of the mechanical sensitivity.

  8. Theoretical quantification of shock-timing sensitivities for direct-drive inertial confinement fusion implosions on OMEGA

    Science.gov (United States)

    Cao, D.; Boehly, T. R.; Gregor, M. C.; Polsin, D. N.; Davis, A. K.; Radha, P. B.; Regan, S. P.; Goncharov, V. N.

    2018-05-01

    Using temporally shaped laser pulses, multiple shocks can be launched in direct-drive inertial confinement fusion implosion experiments to set the shell on a desired isentrope or adiabat. The velocity of the first shock and the times at which subsequent shocks catch up to it are measured through the velocity interferometry system for any reflector diagnostic [T. R. Boehly et al., Phys. Plasmas 18, 092706 (2011)] on OMEGA [T. R. Boehly et al., Opt. Commun. 133, 495 (1997)]. Simulations reproduce these velocity and shock-merger time measurements when using laser pulses designed for setting mid-adiabat (α ˜ 3) implosions, but agreement degrades for lower-adiabat (α ˜ 1) designs. Simulation results indicate that the shock timing discrepancy is most sensitive to details of the density and temperature profiles in the coronal plasma, which influences the laser energy coupled into the target, and only marginally sensitive to the target offset and beam power imbalance. To aid in verifying the coronal profile's influence, a new technique under development to infer coronal profiles using x-ray self-emission imaging [A. K. Davis et al., Bull. Am. Phys. Soc. 61, BAPS.2016.DPP.NO8.7 (2016)] can be applied to the pulse shapes used in shock-timing experiments.

  9. Directional output distance functions: endogenous directions based on exogenous normalization constraints

    Science.gov (United States)

    In this paper we develop a model for computing directional output distance functions with endogenously determined direction vectors. We show how this model is related to the slacks-based directional distance function introduced by Fare and Grosskopf and show how to use the slacks-based function to e...

  10. 'Cold shock' increases the frequency of homology directed repair gene editing in induced pluripotent stem cells.

    Science.gov (United States)

    Guo, Q; Mintier, G; Ma-Edmonds, M; Storton, D; Wang, X; Xiao, X; Kienzle, B; Zhao, D; Feder, John N

    2018-02-01

    Using CRISPR/Cas9 delivered as a RNA modality in conjunction with a lipid specifically formulated for large RNA molecules, we demonstrate that homology directed repair (HDR) rates between 20-40% can be achieved in induced pluripotent stem cells (iPSC). Furthermore, low HDR rates (between 1-20%) can be enhanced two- to ten-fold in both iPSCs and HEK293 cells by 'cold shocking' cells at 32 °C for 24-48 hours following transfection. This method can also increases the proportion of loci that have undergone complete sequence conversion across the donor sequence, or 'perfect HDR', as opposed to partial sequence conversion where nucleotides more distal to the CRISPR cut site are less efficiently incorporated ('partial HDR'). We demonstrate that the structure of the single-stranded DNA oligo donor can influence the fidelity of HDR, with oligos symmetric with respect to the CRISPR cleavage site and complementary to the target strand being more efficient at directing 'perfect HDR' compared to asymmetric non-target strand complementary oligos. Our protocol represents an efficient method for making CRISPR-mediated, specific DNA sequence changes within the genome that will facilitate the rapid generation of genetic models of human disease in iPSCs as well as other genome engineered cell lines.

  11. Strong normalization by type-directed partial evaluation and run-time code generation

    DEFF Research Database (Denmark)

    Balat, Vincent; Danvy, Olivier

    1998-01-01

    We investigate the synergy between type-directed partial evaluation and run-time code generation for the Caml dialect of ML. Type-directed partial evaluation maps simply typed, closed Caml values to a representation of their long βη-normal form. Caml uses a virtual machine and has the capability...... to load byte code at run time. Representing the long βη-normal forms as byte code gives us the ability to strongly normalize higher-order values (i.e., weak head normal forms in ML), to compile the resulting strong normal forms into byte code, and to load this byte code all in one go, at run time. We...... conclude this note with a preview of our current work on scaling up strong normalization by run-time code generation to the Caml module language....

  12. Strong Normalization by Type-Directed Partial Evaluation and Run-Time Code Generation

    DEFF Research Database (Denmark)

    Balat, Vincent; Danvy, Olivier

    1997-01-01

    We investigate the synergy between type-directed partial evaluation and run-time code generation for the Caml dialect of ML. Type-directed partial evaluation maps simply typed, closed Caml values to a representation of their long βη-normal form. Caml uses a virtual machine and has the capability...... to load byte code at run time. Representing the long βη-normal forms as byte code gives us the ability to strongly normalize higher-order values (i.e., weak head normal forms in ML), to compile the resulting strong normal forms into byte code, and to load this byte code all in one go, at run time. We...... conclude this note with a preview of our current work on scaling up strong normalization by run-time code generation to the Caml module language....

  13. Uniformity of spherical shock wave dynamically stabilized by two successive laser profiles in direct-drive inertial confinement fusion implosions

    Energy Technology Data Exchange (ETDEWEB)

    Temporal, M., E-mail: mauro.temporal@hotmail.com [Centre de Mathématiques et de Leurs Applications, ENS Cachan and CNRS, 61 Av. du President Wilson, F-94235 Cachan Cedex (France); Canaud, B. [CEA, DIF, F-91297 Arpajon Cedex (France); Garbett, W. J. [AWE plc, Aldermaston, Reading, Berkshire RG7 4PR (United Kingdom); Ramis, R. [ETSI Aeronáutica y del Espacio, Universidad Politécnica de Madrid, 28040 Madrid (Spain)

    2015-10-15

    The implosion uniformity of a directly driven spherical inertial confinement fusion capsule is considered within the context of the Laser Mégajoule configuration. Two-dimensional (2D) hydrodynamic simulations have been performed assuming irradiation with two laser beam cones located at 49° and 131° with respect to the axis of symmetry. The laser energy deposition causes an inward shock wave whose surface is tracked in time, providing the time evolution of its non-uniformity. The illumination model has been used to optimize the laser intensity profiles used as input in the 2D hydro-calculations. It is found that a single stationary laser profile does not maintain a uniform shock front over time. To overcome this drawback, it is proposed to use two laser profiles acting successively in time, in order to dynamically stabilize the non-uniformity of the shock front.

  14. Early, Goal-Directed Therapy for Septic Shock - A Patient-Level Meta-Analysis.

    Science.gov (United States)

    Rowan, Kathryn M; Angus, Derek C; Bailey, Michael; Barnato, Amber E; Bellomo, Rinaldo; Canter, Ruth R; Coats, Timothy J; Delaney, Anthony; Gimbel, Elizabeth; Grieve, Richard D; Harrison, David A; Higgins, Alisa M; Howe, Belinda; Huang, David T; Kellum, John A; Mouncey, Paul R; Music, Edvin; Peake, Sandra L; Pike, Francis; Reade, Michael C; Sadique, M Zia; Singer, Mervyn; Yealy, Donald M

    2017-06-08

    After a single-center trial and observational studies suggesting that early, goal-directed therapy (EGDT) reduced mortality from septic shock, three multicenter trials (ProCESS, ARISE, and ProMISe) showed no benefit. This meta-analysis of individual patient data from the three recent trials was designed prospectively to improve statistical power and explore heterogeneity of treatment effect of EGDT. We harmonized entry criteria, intervention protocols, outcomes, resource-use measures, and data collection across the trials and specified all analyses before unblinding. After completion of the trials, we pooled data, excluding the protocol-based standard-therapy group from the ProCESS trial, and resolved residual differences. The primary outcome was 90-day mortality. Secondary outcomes included 1-year survival, organ support, and hospitalization costs. We tested for treatment-by-subgroup interactions for 16 patient characteristics and 6 care-delivery characteristics. We studied 3723 patients at 138 hospitals in seven countries. Mortality at 90 days was similar for EGDT (462 of 1852 patients [24.9%]) and usual care (475 of 1871 patients [25.4%]); the adjusted odds ratio was 0.97 (95% confidence interval, 0.82 to 1.14; P=0.68). EGDT was associated with greater mean (±SD) use of intensive care (5.3±7.1 vs. 4.9±7.0 days, P=0.04) and cardiovascular support (1.9±3.7 vs. 1.6±2.9 days, P=0.01) than was usual care; other outcomes did not differ significantly, although average costs were higher with EGDT. Subgroup analyses showed no benefit from EGDT for patients with worse shock (higher serum lactate level, combined hypotension and hyperlactatemia, or higher predicted risk of death) or for hospitals with a lower propensity to use vasopressors or fluids during usual resuscitation. In this meta-analysis of individual patient data, EGDT did not result in better outcomes than usual care and was associated with higher hospitalization costs across a broad range of patient and

  15. An Introduction to the Physics of Collisionless Shocks

    International Nuclear Information System (INIS)

    Russell, C.T.

    2005-01-01

    Collisionless shocks are important in astrophysical, heliospheric and magnetospheric settings. They deflect flows around obstacles; they heat the plasma, and they alter the properties of the flow as it intersects those obstacles. The physical processes occurring at collisionless shocks depend on the Mach number (strength) and beta (magnetic to thermal pressure) of the shocks and the direction of the magnetic field relative to the shock normal. Herein we review how the shock has been modeled in numerical simulations, the basic physical processes at work, including dissipation and thermalization, the electric potential drop at the shock, and the formation of the electron and ion foreshocks

  16. Experimental Method for Characterizing Electrical Steel Sheets in the Normal Direction

    Directory of Open Access Journals (Sweden)

    Thierry Belgrand

    2010-10-01

    Full Text Available This paper proposes an experimental method to characterise magnetic laminations in the direction normal to the sheet plane. The principle, which is based on a static excitation to avoid planar eddy currents, is explained and specific test benches are proposed. Measurements of the flux density are made with a sensor moving in and out of an air-gap. A simple analytical model is derived in order to determine the permeability in the normal direction. The experimental results for grain oriented steel sheets are presented and a comparison is provided with values obtained from literature.

  17. Converging cylindrical shocks in ideal magnetohydrodynamics

    International Nuclear Information System (INIS)

    Pullin, D. I.; Mostert, W.; Wheatley, V.; Samtaney, R.

    2014-01-01

    We consider a cylindrically symmetrical shock converging onto an axis within the framework of ideal, compressible-gas non-dissipative magnetohydrodynamics (MHD). In cylindrical polar co-ordinates we restrict attention to either constant axial magnetic field or to the azimuthal but singular magnetic field produced by a line current on the axis. Under the constraint of zero normal magnetic field and zero tangential fluid speed at the shock, a set of restricted shock-jump conditions are obtained as functions of the shock Mach number, defined as the ratio of the local shock speed to the unique magnetohydrodynamic wave speed ahead of the shock, and also of a parameter measuring the local strength of the magnetic field. For the line current case, two approaches are explored and the results compared in detail. The first is geometrical shock-dynamics where the restricted shock-jump conditions are applied directly to the equation on the characteristic entering the shock from behind. This gives an ordinary-differential equation for the shock Mach number as a function of radius which is integrated numerically to provide profiles of the shock implosion. Also, analytic, asymptotic results are obtained for the shock trajectory at small radius. The second approach is direct numerical solution of the radially symmetric MHD equations using a shock-capturing method. For the axial magnetic field case the shock implosion is of the Guderley power-law type with exponent that is not affected by the presence of a finite magnetic field. For the axial current case, however, the presence of a tangential magnetic field ahead of the shock with strength inversely proportional to radius introduces a length scale R=√(μ 0 /p 0 ) I/(2 π) where I is the current, μ 0 is the permeability, and p 0 is the pressure ahead of the shock. For shocks initiated at r ≫ R, shock convergence is first accompanied by shock strengthening as for the strictly gas-dynamic implosion. The diverging magnetic field

  18. Converging cylindrical shocks in ideal magnetohydrodynamics

    KAUST Repository

    Pullin, D. I.

    2014-09-01

    We consider a cylindrically symmetrical shock converging onto an axis within the framework of ideal, compressible-gas non-dissipative magnetohydrodynamics (MHD). In cylindrical polar co-ordinates we restrict attention to either constant axial magnetic field or to the azimuthal but singular magnetic field produced by a line current on the axis. Under the constraint of zero normal magnetic field and zero tangential fluid speed at the shock, a set of restricted shock-jump conditions are obtained as functions of the shock Mach number, defined as the ratio of the local shock speed to the unique magnetohydrodynamic wave speed ahead of the shock, and also of a parameter measuring the local strength of the magnetic field. For the line current case, two approaches are explored and the results compared in detail. The first is geometrical shock-dynamics where the restricted shock-jump conditions are applied directly to the equation on the characteristic entering the shock from behind. This gives an ordinary-differential equation for the shock Mach number as a function of radius which is integrated numerically to provide profiles of the shock implosion. Also, analytic, asymptotic results are obtained for the shock trajectory at small radius. The second approach is direct numerical solution of the radially symmetric MHD equations using a shock-capturing method. For the axial magnetic field case the shock implosion is of the Guderley power-law type with exponent that is not affected by the presence of a finite magnetic field. For the axial current case, however, the presence of a tangential magnetic field ahead of the shock with strength inversely proportional to radius introduces a length scale R = √μ0/p0 I/(2π) where I is the current, μ0 is the permeability, and p0 is the pressure ahead of the shock. For shocks initiated at r ≫ R, shock convergence is first accompanied by shock strengthening as for the strictly gas-dynamic implosion. The diverging magnetic field then

  19. Converging cylindrical shocks in ideal magnetohydrodynamics

    KAUST Repository

    Pullin, D. I.; Mostert, W.; Wheatley, V.; Samtaney, Ravi

    2014-01-01

    We consider a cylindrically symmetrical shock converging onto an axis within the framework of ideal, compressible-gas non-dissipative magnetohydrodynamics (MHD). In cylindrical polar co-ordinates we restrict attention to either constant axial magnetic field or to the azimuthal but singular magnetic field produced by a line current on the axis. Under the constraint of zero normal magnetic field and zero tangential fluid speed at the shock, a set of restricted shock-jump conditions are obtained as functions of the shock Mach number, defined as the ratio of the local shock speed to the unique magnetohydrodynamic wave speed ahead of the shock, and also of a parameter measuring the local strength of the magnetic field. For the line current case, two approaches are explored and the results compared in detail. The first is geometrical shock-dynamics where the restricted shock-jump conditions are applied directly to the equation on the characteristic entering the shock from behind. This gives an ordinary-differential equation for the shock Mach number as a function of radius which is integrated numerically to provide profiles of the shock implosion. Also, analytic, asymptotic results are obtained for the shock trajectory at small radius. The second approach is direct numerical solution of the radially symmetric MHD equations using a shock-capturing method. For the axial magnetic field case the shock implosion is of the Guderley power-law type with exponent that is not affected by the presence of a finite magnetic field. For the axial current case, however, the presence of a tangential magnetic field ahead of the shock with strength inversely proportional to radius introduces a length scale R = √μ0/p0 I/(2π) where I is the current, μ0 is the permeability, and p0 is the pressure ahead of the shock. For shocks initiated at r ≫ R, shock convergence is first accompanied by shock strengthening as for the strictly gas-dynamic implosion. The diverging magnetic field then

  20. Converging cylindrical shocks in ideal magnetohydrodynamics

    Energy Technology Data Exchange (ETDEWEB)

    Pullin, D. I. [Graduate Aerospace Laboratories, California Institute of Technology, Pasadena, California 91125 (United States); Mostert, W.; Wheatley, V. [School of Mechanical and Mining Engineering, University of Queensland, Queensland 4072 (Australia); Samtaney, R. [Mechanical Engineering, Physical Sciences and Engineering Division, King Abdullah University of Science and Technology, Thuwal (Saudi Arabia)

    2014-09-15

    We consider a cylindrically symmetrical shock converging onto an axis within the framework of ideal, compressible-gas non-dissipative magnetohydrodynamics (MHD). In cylindrical polar co-ordinates we restrict attention to either constant axial magnetic field or to the azimuthal but singular magnetic field produced by a line current on the axis. Under the constraint of zero normal magnetic field and zero tangential fluid speed at the shock, a set of restricted shock-jump conditions are obtained as functions of the shock Mach number, defined as the ratio of the local shock speed to the unique magnetohydrodynamic wave speed ahead of the shock, and also of a parameter measuring the local strength of the magnetic field. For the line current case, two approaches are explored and the results compared in detail. The first is geometrical shock-dynamics where the restricted shock-jump conditions are applied directly to the equation on the characteristic entering the shock from behind. This gives an ordinary-differential equation for the shock Mach number as a function of radius which is integrated numerically to provide profiles of the shock implosion. Also, analytic, asymptotic results are obtained for the shock trajectory at small radius. The second approach is direct numerical solution of the radially symmetric MHD equations using a shock-capturing method. For the axial magnetic field case the shock implosion is of the Guderley power-law type with exponent that is not affected by the presence of a finite magnetic field. For the axial current case, however, the presence of a tangential magnetic field ahead of the shock with strength inversely proportional to radius introduces a length scale R=√(μ{sub 0}/p{sub 0}) I/(2 π) where I is the current, μ{sub 0} is the permeability, and p{sub 0} is the pressure ahead of the shock. For shocks initiated at r ≫ R, shock convergence is first accompanied by shock strengthening as for the strictly gas-dynamic implosion. The

  1. The law of distribution of light beam direction fluctuations in telescopes. [normal density functions

    Science.gov (United States)

    Divinskiy, M. L.; Kolchinskiy, I. G.

    1974-01-01

    The distribution of deviations from mean star trail directions was studied on the basis of 105 star trails. It was found that about 93% of the trails yield a distribution in agreement with the normal law. About 4% of the star trails agree with the Charlier distribution.

  2. Evaluation of directional normalization methods for Landsat TM/ETM+ over primary Amazonian lowland forests

    Science.gov (United States)

    Van doninck, Jasper; Tuomisto, Hanna

    2017-06-01

    Biodiversity mapping in extensive tropical forest areas poses a major challenge for the interpretation of Landsat images, because floristically clearly distinct forest types may show little difference in reflectance. In such cases, the effects of the bidirectional reflection distribution function (BRDF) can be sufficiently strong to cause erroneous image interpretation and classification. Since the opening of the Landsat archive in 2008, several BRDF normalization methods for Landsat have been developed. The simplest of these consist of an empirical view angle normalization, whereas more complex approaches apply the semi-empirical Ross-Li BRDF model and the MODIS MCD43-series of products to normalize directional Landsat reflectance to standard view and solar angles. Here we quantify the effect of surface anisotropy on Landsat TM/ETM+ images over old-growth Amazonian forests, and evaluate five angular normalization approaches. Even for the narrow swath of the Landsat sensors, we observed directional effects in all spectral bands. Those normalization methods that are based on removing the surface reflectance gradient as observed in each image were adequate to normalize TM/ETM+ imagery to nadir viewing, but were less suitable for multitemporal analysis when the solar vector varied strongly among images. Approaches based on the MODIS BRDF model parameters successfully reduced directional effects in the visible bands, but removed only half of the systematic errors in the infrared bands. The best results were obtained when the semi-empirical BRDF model was calibrated using pairs of Landsat observation. This method produces a single set of BRDF parameters, which can then be used to operationally normalize Landsat TM/ETM+ imagery over Amazonian forests to nadir viewing and a standard solar configuration.

  3. Illumination normalization of face image based on illuminant direction estimation and improved Retinex.

    Science.gov (United States)

    Yi, Jizheng; Mao, Xia; Chen, Lijiang; Xue, Yuli; Rovetta, Alberto; Caleanu, Catalin-Daniel

    2015-01-01

    Illumination normalization of face image for face recognition and facial expression recognition is one of the most frequent and difficult problems in image processing. In order to obtain a face image with normal illumination, our method firstly divides the input face image into sixteen local regions and calculates the edge level percentage in each of them. Secondly, three local regions, which meet the requirements of lower complexity and larger average gray value, are selected to calculate the final illuminant direction according to the error function between the measured intensity and the calculated intensity, and the constraint function for an infinite light source model. After knowing the final illuminant direction of the input face image, the Retinex algorithm is improved from two aspects: (1) we optimize the surround function; (2) we intercept the values in both ends of histogram of face image, determine the range of gray levels, and stretch the range of gray levels into the dynamic range of display device. Finally, we achieve illumination normalization and get the final face image. Unlike previous illumination normalization approaches, the method proposed in this paper does not require any training step or any knowledge of 3D face and reflective surface model. The experimental results using extended Yale face database B and CMU-PIE show that our method achieves better normalization effect comparing with the existing techniques.

  4. Illumination normalization of face image based on illuminant direction estimation and improved Retinex.

    Directory of Open Access Journals (Sweden)

    Jizheng Yi

    Full Text Available Illumination normalization of face image for face recognition and facial expression recognition is one of the most frequent and difficult problems in image processing. In order to obtain a face image with normal illumination, our method firstly divides the input face image into sixteen local regions and calculates the edge level percentage in each of them. Secondly, three local regions, which meet the requirements of lower complexity and larger average gray value, are selected to calculate the final illuminant direction according to the error function between the measured intensity and the calculated intensity, and the constraint function for an infinite light source model. After knowing the final illuminant direction of the input face image, the Retinex algorithm is improved from two aspects: (1 we optimize the surround function; (2 we intercept the values in both ends of histogram of face image, determine the range of gray levels, and stretch the range of gray levels into the dynamic range of display device. Finally, we achieve illumination normalization and get the final face image. Unlike previous illumination normalization approaches, the method proposed in this paper does not require any training step or any knowledge of 3D face and reflective surface model. The experimental results using extended Yale face database B and CMU-PIE show that our method achieves better normalization effect comparing with the existing techniques.

  5. Design of Gages for Direct Skin Friction Measurements in Complex Turbulent Flows with Shock Impingement Compensation

    Science.gov (United States)

    2007-06-07

    100 kW/m2 for 0.1 s. Along with the material change, an oil leak problem required a geometric change. Initially, we considered TIG welding or...shear and moment, is addressed through the design, development, and testing of the CF1 and CF2 gages. Chapter 3 presents the evolutionary process ...a shock. Chapter 4 examines the performance of each gage to the nominal load conditions. Through this process , objective 2 is met. The best

  6. A combination of HARMONIE short time direct normal irradiance forecasts and machine learning: The #hashtdim procedure

    Science.gov (United States)

    Gastón, Martín; Fernández-Peruchena, Carlos; Körnich, Heiner; Landelius, Tomas

    2017-06-01

    The present work describes the first approach of a new procedure to forecast Direct Normal Irradiance (DNI): the #hashtdim that treats to combine ground information and Numerical Weather Predictions. The system is centered in generate predictions for the very short time. It combines the outputs from the Numerical Weather Prediction Model HARMONIE with an adaptive methodology based on Machine Learning. The DNI predictions are generated with 15-minute and hourly temporal resolutions and presents 3-hourly updates. Each update offers forecasts to the next 12 hours, the first nine hours are generated with 15-minute temporal resolution meanwhile the last three hours present hourly temporal resolution. The system is proved over a Spanish emplacement with BSRN operative station in south of Spain (PSA station). The #hashtdim has been implemented in the framework of the Direct Normal Irradiance Nowcasting methods for optimized operation of concentrating solar technologies (DNICast) project, under the European Union's Seventh Programme for research, technological development and demonstration framework.

  7. Controlled austempering of hammer forgings aimed at pseudo normalized microstructure directly after deformation

    Directory of Open Access Journals (Sweden)

    P. Skubisz

    2017-01-01

    Full Text Available The study concerns cost-effective realization of controlled thermomechanical processing (CTMP of medium-carbon and HSLA steel aimed at producing microstructure and properties equivalent to normalized condition directly after forging. The results of theoretical and physical modeling of hot forging with subsequent heat treating adopted for industrial realization in continuous manner were verified in semi-industrial conditions of a forge plant.

  8. Normal Impingement of a Supersonic Jet on a Plane - A Basic Study of Shock-Interference Heating

    Science.gov (United States)

    1975-12-01

    George Xaler, Pail Zone Dr. H. Lew 28i0 Mr. J. W. Paust A . Mkrtallucci W. Daskin J. D. Cresaswell J. pvttu" J. Cor%.nto C. l!arri, F. GCOrge1. 4...NSWC/WOL/TR 75195 low zE ~ 1 WHITE OAK LABORATORY SNORMAL IMPINGEMENT OF A SUPERSONIC JET ON A PLANE - A BASIC STUDY OF SHOCK-INTERFERENCE HEATING...OF THIS PAGE ("oin DomejaE’ored) __________________ REPORT DOCUMENTATION PAGE READ INSTRUCTIONS4 2. OV ACE.~ CONTRAT O0GRN NUMBER~ a NS. P ER OR M I

  9. Direct Observation of Strong Ion Coupling in Laser-Driven Shock-Compressed Targets

    International Nuclear Information System (INIS)

    Ravasio, A.; Benuzzi-Mounaix, A.; Loupias, B.; Ozaki, N.; Rabec le Gloahec, M.; Koenig, M.; Gregori, G.; Daligault, J.; Delserieys, A.; Riley, D.; Faenov, A. Ya.; Pikuz, T. A.

    2007-01-01

    In this Letter we report on a near collective x-ray scattering experiment on shock-compressed targets. A highly coupled Al plasma was generated and probed by spectrally resolving an x-ray source forward scattered by the sample. A significant reduction in the intensity of the elastic scatter was observed, which we attribute to the formation of an incipient long-range order. This speculation is confirmed by x-ray scattering calculations accounting for both electron degeneracy and strong coupling effects. Measurements from rear side visible diagnostics are consistent with the plasma parameters inferred from x-ray scattering data. These results give the experimental evidence of the strongly coupled ionic dynamics in dense plasmas

  10. The Neural Substrates for Letter String Readings in The Normal and Reverse Directions: An fMRI Study

    Science.gov (United States)

    Ge, Sheng; Saito, Takashi; Wu, Jing-Long; Ogasawara, Jun-Ichi; Yamauchi, Shuichi; Matsunaga, Naofumi; Iramina, Keiji

    In order to investigate the difference in cortical activations between reading letter strings in the normal direction and the reverse direction, an fMRI study was conducted. In this study, the cortical activations elicited by Japanese letter string reading and Chinese letter string reading were investigated. The subjects performed the normal direction reading task (read letter strings from left to right), and the reverse direction reading task (read letter strings from right to left). According to the experimental results, the activated brain regions during the normal and the reverse direction reading tasks were compared. It was found that visuospatial transformation was involved in the reverse direction reading task, while this function was not significant during the normal direction reading task. Furthermore, we found that there was no significant difference in cortical activation between Japanese and Chinese letter string readings.

  11. Response of Seven Crystallographic Orientations of Sapphire Crystals to Shock Stresses of 16 to 86 GPa

    OpenAIRE

    Kanel, G. I.; Nellis, W. J.; Savinykh, A. S.; Razorenov, S. V.; Rajendran, A. M.

    2009-01-01

    Shock-wave profiles of sapphire (single-crystal Al2O3) with seven crystallographic orientations were measured with time-resolved VISAR interferometry at shock stresses in the range 16 to 86 GPa. Shock propagation was normal to the surface of each cut. The angle between the c-axis of the hexagonal crystal structure and the direction of shock propagation varied from 0 for c-cut up to 90 degrees for m-cut in the basal plane. Based on published shock-induced transparencies, shock-induced optical ...

  12. Detección Simultánea de diferentes tipos de Shocks en Modelos Lineales Dinámicos Normales Matriciales

    Directory of Open Access Journals (Sweden)

    Salvador Figueras, Manuel

    2003-01-01

    Full Text Available En este trabajo se plantea el proceso de detección de diversos tipos de shocks en un Modelo Lineal Dinámico Normal Matricial (MLDNM como un problema de comparación bayesiana de modelos. Dicho planteamiento permite analizar, de forma simultánea y secuencial, la existencia de una gran cantidad de comportamientos atípicos en la evolución de series de tiempo multivariantes (outliers aislados, cambios de nivel, cambios en pendiente, cambios en el patrón estacional, etc. e intervenir de acuerdo con el tipo de shock detectado. El esquema planteado extiende el algoritmo de monitorización e intervención automáticas propuesto por Gargallo y Salvador (2002c para el análisis de series univariantes. Finalmente, el procedimiento se ilustra con el análisis de la evolución de las hipotecas y de los depósitos del sistema bancario en Aragón

  13. Increasing the temporal resolution of direct normal solar irradiance forecasted series

    Science.gov (United States)

    Fernández-Peruchena, Carlos M.; Gastón, Martin; Schroedter-Homscheidt, Marion; Marco, Isabel Martínez; Casado-Rubio, José L.; García-Moya, José Antonio

    2017-06-01

    A detailed knowledge of the solar resource is a critical point in the design and control of Concentrating Solar Power (CSP) plants. In particular, accurate forecasting of solar irradiance is essential for the efficient operation of solar thermal power plants, the management of energy markets, and the widespread implementation of this technology. Numerical weather prediction (NWP) models are commonly used for solar radiation forecasting. In the ECMWF deterministic forecasting system, all forecast parameters are commercially available worldwide at 3-hourly intervals. Unfortunately, as Direct Normal solar Irradiance (DNI) exhibits a great variability due to the dynamic effects of passing clouds, 3-h time resolution is insufficient for accurate simulations of CSP plants due to their nonlinear response to DNI, governed by various thermal inertias due to their complex response characteristics. DNI series of hourly or sub-hourly frequency resolution are normally used for an accurate modeling and analysis of transient processes in CSP technologies. In this context, the objective of this study is to propose a methodology for generating synthetic DNI time series at 1-h (or higher) temporal resolution from 3-h DNI series. The methodology is based upon patterns as being defined with help of the clear-sky envelope approach together with a forecast of maximum DNI value, and it has been validated with high quality measured DNI data.

  14. Assessment of ANN and SVM models for estimating normal direct irradiation (H_b)

    International Nuclear Information System (INIS)

    Santos, Cícero Manoel dos; Escobedo, João Francisco; Teramoto, Érico Tadao; Modenese Gorla da Silva, Silvia Helena

    2016-01-01

    Highlights: • The performance of SVM and ANN in estimating Normal Direct Irradiation (H_b) was evaluated. • 12 models using different input variables are developed (hourly and daily partitions). • The most relevant input variables for DNI are kt, H_s_c and insolation ratio (r′ = n/N). • Support Vector Machine (SVM) provides accurate estimates and outperforms the Artificial Neural Network (ANN). - Abstract: This study evaluates the estimation of hourly and daily normal direct irradiation (H_b) using machine learning techniques (ML): Artificial Neural Network (ANN) and Support Vector Machine (SVM). Time series of different meteorological variables measured over thirteen years in Botucatu were used for training and validating ANN and SVM. Seven different sets of input variables were tested and evaluated, which were chosen based on statistical models reported in the literature. Relative Mean Bias Error (rMBE), Relative Root Mean Square Error (rRMSE), determination coefficient (R"2) and “d” Willmott index were used to evaluate ANN and SVM models. When compared to statistical models which use the same set of input variables (R"2 between 0.22 and 0.78), ANN and SVM show higher values of R"2 (hourly models between 0.52 and 0.88; daily models between 0.42 and 0.91). Considering the input variables, atmospheric transmissivity of global radiation (kt), integrated solar constant (H_s_c) and insolation ratio (n/N, n is sunshine duration and N is photoperiod) were the most relevant in ANN and SVM models. The rMBE and rRMSE values in the two time partitions of SVM models are lower than those obtained with ANN. Hourly ANN and SVM models have higher rRMSE values than daily models. Optimal performance with hourly models was obtained with ANN4"h (rMBE = 12.24%, rRMSE = 23.99% and “d” = 0.96) and SVM4"h (rMBE = 1.75%, rRMSE = 20.10% and “d” = 0.96). Optimal performance with daily models was obtained with ANN2"d (rMBE = −3.09%, rRMSE = 18.95% and “d” = 0

  15. Towards the intrahour forecasting of direct normal irradiance using sky-imaging data.

    Science.gov (United States)

    Nou, Julien; Chauvin, Rémi; Eynard, Julien; Thil, Stéphane; Grieu, Stéphane

    2018-04-01

    Increasing power plant efficiency through improved operation is key in the development of Concentrating Solar Power (CSP) technologies. To this end, one of the most challenging topics remains accurately forecasting the solar resource at a short-term horizon. Indeed, in CSP plants, production is directly impacted by both the availability and variability of the solar resource and, more specifically, by Direct Normal Irradiance (DNI). The present paper deals with a new approach to the intrahour forecasting (the forecast horizon [Formula: see text] is up to [Formula: see text] ahead) of DNI, taking advantage of the fact that this quantity can be split into two terms, i.e. clear-sky DNI and the clear sky index. Clear-sky DNI is forecasted from DNI measurements, using an empirical model (Ineichen and Perez, 2002) combined with a persistence of atmospheric turbidity. Moreover, in the framework of the CSPIMP (Concentrating Solar Power plant efficiency IMProvement) research project, PROMES-CNRS has developed a sky imager able to provide High Dynamic Range (HDR) images. So, regarding the clear-sky index, it is forecasted from sky-imaging data, using an Adaptive Network-based Fuzzy Inference System (ANFIS). A hybrid algorithm that takes inspiration from the classification algorithm proposed by Ghonima et al. (2012) when clear-sky anisotropy is known and from the hybrid thresholding algorithm proposed by Li et al. (2011) in the opposite case has been developed to the detection of clouds. Performance is evaluated via a comparative study in which persistence models - either a persistence of DNI or a persistence of the clear-sky index - are included. Preliminary results highlight that the proposed approach has the potential to outperform these models (both persistence models achieve similar performance) in terms of forecasting accuracy: over the test data used, RMSE (the Root Mean Square Error) is reduced of about [Formula: see text], with [Formula: see text], and [Formula: see

  16. Explosive Evaporating Phenomena of Cryogenic Fluids by Direct Contacting Normal Temperature Fluids

    Directory of Open Access Journals (Sweden)

    T Watanabe

    2016-09-01

    Full Text Available Cryogenic fluids have characteristics such as thermal stratification and flashing by pressure release in storage vessel. The mixture of the extreme low temperature fluid and the normal temperature fluid becomes the cause which causes pressure vessel and piping system crush due to explosive boiling and rapid freezing. In recent years in Japan, the demand of cryogenic fluids like a LH2, LNG is increasing because of the advance of fuel cell device technology, hydrogen of engine, and stream of consciousness for environmental agreement. These fuel liquids are cryogenic fluids. On the other hand, as for fisheries as well, the use of a source of energy that environment load is small has been being a pressing need. And, the need of the ice is high, as before, for keeping freshness of marine products in fisheries. Therefore, we carried out the experiments related to promotion of evaporating cryogenic fluids and generation of ice, in the contact directly of the water and liquid nitrogen. From the results of visualization, phenomena of explosive evaporating and ice forming were observed by using video camera.

  17. A methodology for the stochastic generation of hourly synthetic direct normal irradiation time series

    Science.gov (United States)

    Larrañeta, M.; Moreno-Tejera, S.; Lillo-Bravo, I.; Silva-Pérez, M. A.

    2018-02-01

    Many of the available solar radiation databases only provide global horizontal irradiance (GHI) while there is a growing need of extensive databases of direct normal radiation (DNI) mainly for the development of concentrated solar power and concentrated photovoltaic technologies. In the present work, we propose a methodology for the generation of synthetic DNI hourly data from the hourly average GHI values by dividing the irradiance into a deterministic and stochastic component intending to emulate the dynamics of the solar radiation. The deterministic component is modeled through a simple classical model. The stochastic component is fitted to measured data in order to maintain the consistency of the synthetic data with the state of the sky, generating statistically significant DNI data with a cumulative frequency distribution very similar to the measured data. The adaptation and application of the model to the location of Seville shows significant improvements in terms of frequency distribution over the classical models. The proposed methodology applied to other locations with different climatological characteristics better results than the classical models in terms of frequency distribution reaching a reduction of the 50% in the Finkelstein-Schafer (FS) and Kolmogorov-Smirnov test integral (KSI) statistics.

  18. Shock absorbing structure

    International Nuclear Information System (INIS)

    Kojima, Naoki; Matsushita, Kazuo.

    1992-01-01

    Small pieces of shock absorbers are filled in a space of a shock absorbing vessel which is divided into a plurality of sections by partitioning members. These sections function to prevent excess deformation or replacement of the fillers upon occurrence of falling accident. Since the shock absorbing small pieces in the shock absorbing vessel are filled irregularly, shock absorbing characteristics such as compression strength is not varied depending on the direction, but they exhibit excellent shock absorbing performance. They surely absorb shocks exerted on a transportation vessel upon falling or the like. If existing artificial fillers such as pole rings made of metal or ceramic and cut pieces such as alumium extrusion molding products are used as the shock absorbing pieces, they have excellent fire-proofness and cold resistance since the small pieces are inflammable and do not contain water. (T.M.)

  19. Unlimited Relativistic Shock Surfing Acceleration

    International Nuclear Information System (INIS)

    Ucer, D.; Shapiro, V. D.

    2001-01-01

    Nonrelativistic shock surfing acceleration at quasiperpendicular shocks is usually considered to be a preacceleration mechanism for slow pickup ions to initiate diffusive shock acceleration. In shock surfing, the particle accelerates along the shock front under the action of the convective electric field of the plasma flow. However, the particle also gains kinetic energy normal to the shock and eventually escapes downstream. We consider the case when ions are accelerated to relativistic velocities. In this case, the ions are likely to be trapped for infinitely long times, because the energy of bounce oscillations tends to decrease during acceleration. This suggests the possibility of unlimited acceleration by shock surfing

  20. Large-Area Direct Laser-Shock Imprinting of a 3D Biomimic Hierarchical Metal Surface for Triboelectric Nanogenerators.

    Science.gov (United States)

    Jin, Shengyu; Wang, Yixiu; Motlag, Maithilee; Gao, Shengjie; Xu, Jin; Nian, Qiong; Wu, Wenzhuo; Cheng, Gary J

    2018-03-01

    Ongoing efforts in triboelectric nanogenerators (TENGs) focus on enhancing power generation, but obstacles concerning the economical and cost-effective production of TENGs continue to prevail. Micro-/nanostructure engineering of polymer surfaces has been dominantly utilized for boosting the contact triboelectrification, with deposited metal electrodes for collecting the scavenged energy. Nevertheless, this state-of-the-art approach is limited by the vague potential for producing 3D hierarchical surface structures with conformable coverage of high-quality metal. Laser-shock imprinting (LSI) is emerging as a potentially scalable approach for directly surface patterning of a wide range of metals with 3D nanoscale structures by design, benefiting from the ultrahigh-strain-rate forming process. Here, a TENG device is demonstrated with LSI-processed biomimetic hierarchically structured metal electrodes for efficient harvesting of water-drop energy in the environment. Mimicking and transferring hierarchical microstructures from natural templates, such as leaves, into these water-TENG devices is effective regarding repelling water drops from the device surface, since surface hydrophobicity from these biomicrostructures maximizes the TENG output. Among various leaves' microstructures, hierarchical microstructures from dried bamboo leaves are preferable regarding maximizing power output, which is attributed to their unique structures, containing both dense nanostructures and microscale features, compared with other types of leaves. Also, the triboelectric output is significantly improved by closely mimicking the hydrophobic nature of the leaves in the LSI-processed metal surface after functionalizing it with low-surface-energy self-assembled-monolayers. The approach opens doors to new manufacturable TENG technologies for economically feasible and ecologically friendly production of functional devices with directly patterned 3D biomimic metallic surfaces in energy

  1. Directly acting spring loaded safety valves as shock reducing measure; Direkt wirkende, federbelastete Sicherheitsventile als Druckstossreduzierende Massnahme

    Energy Technology Data Exchange (ETDEWEB)

    Ismaier, A.; Schluecker, E. [Erlangen-Nuernberg Univ. (DE). Lehrstuhl fuer Prozessmaschinen und Anlagentechnik (IPAT)

    2010-05-15

    Hydraulic shocks as induced by fast closure of armatures or by sudden pump failures are massive impacts in piping systems and require extensive measures to absorb the generated load. Basically the avoidance of water hammers are preferable but in case of emergency shutdowns unavoidable hydraulic shocks have to be reduced by appropriate measures. The authors describe experiments with spring loaded safety valves as shock reducing measures. It was shown that the vale dimensions is essential for the efficacy. A realistic modeling is possible using the one-dimensional fluid mechanics code ROLAST.

  2. Improving historical spelling normalization with bi-directional LSTMs and multi-task learning

    OpenAIRE

    Bollmann, Marcel; Søgaard, Anders

    2016-01-01

    Natural-language processing of historical documents is complicated by the abundance of variant spellings and lack of annotated data. A common approach is to normalize the spelling of historical words to modern forms. We explore the suitability of a deep neural network architecture for this task, particularly a deep bi-LSTM network applied on a character level. Our model compares well to previously established normalization algorithms when evaluated on a diverse set of texts from Early New Hig...

  3. PRDM14 directly interacts with heat shock proteins HSP90α and glucose-regulated protein 78.

    Science.gov (United States)

    Moriya, Chiharu; Taniguchi, Hiroaki; Nagatoishi, Satoru; Igarashi, Hisayoshi; Tsumoto, Kouhei; Imai, Kohzoh

    2018-02-01

    PRDM14 is overexpressed in various cancers and can regulate cancer phenotype under certain conditions. Inhibiting PRDM14 expression in breast and pancreatic cancers has been reported to reduce cancer stem-like phenotypes, which are associated with aggressive tumor properties. Therefore, PRDM14 is considered a promising target for cancer therapy. To develop a pharmaceutical treatment, the mechanism and interacting partners of PRDM14 need to be clarified. Here, we identified the proteins interacting with PRDM14 in triple-negative breast cancer (TNBC) cells, which do not express the three most common types of receptor (estrogen receptors, progesterone receptors, and HER2). We obtained 13 candidates that were pulled down with PRDM14 in TNBC HCC1937 cells and identified them by mass spectrometry. Two candidates-glucose-regulated protein 78 (GRP78) and heat shock protein 90-α (HSP90α)-were confirmed in immunoprecipitation assay in two TNBC cell lines (HCC1937 and MDA-MB231). Surface plasmon resonance analysis using GST-PRDM14 showed that these two proteins directly interacted with PRDM14 and that the interactions required the C-terminal region of PRDM14, which includes zinc finger motifs. We also confirmed the interactions in living cells by NanoLuc luciferase-based bioluminescence resonance energy transfer (NanoBRET) assay. Moreover, HSP90 inhibitors (17DMAG and HSP990) significantly decreased breast cancer stem-like CD24 -  CD44 + and side population (SP) cells in HCC1937 cells, but not in PRDM14 knockdown HCC1937 cells. The combination of the GRP78 inhibitor HA15 and PRDM14 knockdown significantly decreased cell proliferation and SP cell number in HCC1937 cells. These results suggest that HSP90α and GRP78 interact with PRDM14 and participate in cancer regulation. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

  4. Direct Numerical Simulation of Acoustic Waves Interacting with a Shock Wave in a Quasi-1D Convergent-Divergent Nozzle Using an Unstructured Finite Volume Algorithm

    Science.gov (United States)

    Bui, Trong T.; Mankbadi, Reda R.

    1995-01-01

    Numerical simulation of a very small amplitude acoustic wave interacting with a shock wave in a quasi-1D convergent-divergent nozzle is performed using an unstructured finite volume algorithm with a piece-wise linear, least square reconstruction, Roe flux difference splitting, and second-order MacCormack time marching. First, the spatial accuracy of the algorithm is evaluated for steady flows with and without the normal shock by running the simulation with a sequence of successively finer meshes. Then the accuracy of the Roe flux difference splitting near the sonic transition point is examined for different reconstruction schemes. Finally, the unsteady numerical solutions with the acoustic perturbation are presented and compared with linear theory results.

  5. Resonant ion acceleration by collisionless magnetosonic shock waves

    International Nuclear Information System (INIS)

    Ohsawa, Y.

    1985-01-01

    Resonant ion acceleration ( the ν/sub rho/xΒ acceleration ) in laminar magnetosonic shock waves is studied by theory and simulation. Theoretical analysis based on a two-fluid model shows that, in laminar shocks, the electric field strength in the direction of the wave normal is about (m/sub i/m/sub e/) 1 2 times large for quasi-perpendicular shocks than that for the quasi-parallel shocks, which is a reflection of the fact that the width of quasi-perpendicular shocks is much smaller than that of the quasi-parallel shocks. Trapped ions can be accelerated up to the speed about ν/sub A/(m/sub i/m/sub e/) 1 2(M/sub A/-1) 3 2 in quasi-perpendicular shocks. Time evolution of self-consistent magnetosonic shock waves is studied by using a 2-12 dimensional fully relativistic, fully electromagnetic particle simulation with full ion and electron dynamics. Even a low-Mach-number shock wave can significantly accelerate trapped ions by the ν/sub rho/xΒ acceleration. The resonant ion acceleration occurs more strongly in quasi-perpendicular shocks, because the magnitude of this acceleration is proportional to the electric field strength

  6. On a direct algorithm for the generation of log-normal pseudo-random numbers

    CERN Document Server

    Chamayou, J M F

    1976-01-01

    The random variable ( Pi /sub i=1//sup n/X/sub i//X/sub i+n/)/sup 1/ square root 2n/ is used to generate standard log normal variables Lambda (0, 1), where the X/sub i/ are independent uniform variables on (0, 1). (8 refs).

  7. Blood pressure directly correlates with blood viscosity in diabetes type 1 children but not in normals.

    Science.gov (United States)

    Vázquez, Beatriz Y Salazar; Vázquez, Miguel A Salazar; Jáquez, Manuel Guajardo; Huemoeller, Antonio H Bracho; Intaglietta, Marcos; Cabrales, Pedro

    2010-01-01

    To determine the relationship between mean arterial blood pressure (MAP) and blood viscosity in diabetic type 1 children and healthy controls to investigate whether MAP is independent of blood viscosity in healthy children, and vice versa. Children with diabetes type 1 treated by insulin injection were studied. Controls were healthy children of both sexes. MAP was calculated from systolic and diastolic pressure measurements. Blood viscosity was determined indirectly by measuring blood hemoglobin (Hb) content. The relationship between Hb, hematocrit (Hct) and blood viscosity was determined in a subgroup of controls and diabetics selected at random. 21 (10.6+/-2.5 years) type 1 diabetic children treated with insulin and 25 healthy controls age 9.6+/-1.7 years were studied. Hb was 13.8+/-0.8 g/dl in normal children vs. 14.3+/-0.9 g/dl in the diabetic group (p<0.05). MAP was 71.4+/-8.2 in the normal vs. 82.9+/-7.2 mmHg in the diabetic group (p<0.001). Glucose was 89.3+/-10.6 vs. 202.4+/-87.4 mg/dl respectively. Diabetics had a positive MAP/Hb correlation (p=0.007), while normals showed a non significant (p=0.2) negative correlation. The blood viscosity/Hb relationship was studied in a subgroup of 8 healthy controls and 8 diabetic type 1 children. There was no significant difference in Hb and Hct between groups. Diabetics showed a trend of increasing blood viscosity (+7%, p=0.15). Normal children compensate for the increase in vascular resistance due to increased blood viscosity (increased Hb and Hct) while diabetic children do not, probably due to endothelial dysfunction.

  8. Characteristics of six small heat shock protein genes from Bactrocera dorsalis: Diverse expression under conditions of thermal stress and normal growth.

    Science.gov (United States)

    Dou, Wei; Tian, Yi; Liu, Hong; Shi, Yan; Smagghe, Guy; Wang, Jin-Jun

    2017-11-01

    To explore the functions of small heat shock proteins (sHsps) in relation to thermal stress and development in Bactrocera dorsalis (Hendel), one of the most economically important pest species attacking a wide range of fruits and vegetables, six full-length cDNAs of sHsp genes (BdHsp17.7, 18.4, 20.4, 20.6, 21.6 and 23.8) were cloned, and the expression patterns in different developmental stages and tissues, as well as in response to both thermal and 20-hydroxyecdysone (20E) exposures, were examined using real time quantitative PCR. The open reading frames (ORFs) of six sHsps are 453, 489, 537, 543, 567 and 630bp in length, encoding proteins with molecular weights of 17.7, 18.4, 20.4, 20.6, 21.6 and 23.8kDa, respectively. BdHsp18.4 and BdHsp20.4 maintained lower expression levels in both eggs and larvae, whereas remarkably up-regulated after the larval-pupal transformation, suggesting that these two sHsps may be involved in metamorphosis. Significant tissue specificity exists among sHsps: the highest expression of BdHsp20.6 and BdHsp23.8 in the Malpighian tubules and ovary, respectively, versus a peak in the fat body for others. BdHsp20.4 and BdHsp20.6 were significantly up-regulated by thermal stress. In contrast, BdHsp18.4 and BdHsp23.8 reacted only to heat stress. BdHsp17.7 and BdHsp21.6 were insensitive to both heat and cold stresses. The degree of sHsps response depends on intensity of 20E treatment, i.e., dose and time. These results strongly suggest functional differentiation within the sHsp subfamily in B. dorsalis. The physiological function of sHsp members under thermal stress and normal growth remains the subjects of further investigation. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Hepatic Shock Differential Diagnosis and Risk Factors: A Review Article.

    Science.gov (United States)

    Soleimanpour, Hassan; Safari, Saeid; Rahmani, Farzad; Nejabatian, Arezu; Alavian, Seyed Moayed

    2015-10-01

    Liver as an important organ has a vital role in physiological processes in the body. Different causes can disrupt normal function of liver. Factors such as hypo-perfusion, hypoxemia, infections and some others can cause hepatic injury and hepatic shock. Published research resources from 2002 to May 2015 in some databases (PubMed, Scopus, Index Copernicus, DOAJ, EBSCO-CINAHL, Science direct, Cochrane library and Google scholar and Iranian search database like SID and Iranmedex) were investigated for the present study. Different causes can lead to hepatic shock. Most of these causes can be prevented by early resuscitation and treatment of underlying factors. Hepatic shock is detected in ill patients, especially those with hemodynamic disorders. It can be prevented by early treatment of underlying disease. There is no definite treatment for hepatic shock and should be managed conservatively. Hepatic shock in patients can increase the mortality rate.

  10. Semi-empirical models for the estimation of clear sky solar global and direct normal irradiances in the tropics

    International Nuclear Information System (INIS)

    Janjai, S.; Sricharoen, K.; Pattarapanitchai, S.

    2011-01-01

    Highlights: → New semi-empirical models for predicting clear sky irradiance were developed. → The proposed models compare favorably with other empirical models. → Performance of proposed models is comparable with that of widely used physical models. → The proposed models have advantage over the physical models in terms of simplicity. -- Abstract: This paper presents semi-empirical models for estimating global and direct normal solar irradiances under clear sky conditions in the tropics. The models are based on a one-year period of clear sky global and direct normal irradiances data collected at three solar radiation monitoring stations in Thailand: Chiang Mai (18.78 o N, 98.98 o E) located in the North of the country, Nakhon Pathom (13.82 o N, 100.04 o E) in the Centre and Songkhla (7.20 o N, 100.60 o E) in the South. The models describe global and direct normal irradiances as functions of the Angstrom turbidity coefficient, the Angstrom wavelength exponent, precipitable water and total column ozone. The data of Angstrom turbidity coefficient, wavelength exponent and precipitable water were obtained from AERONET sunphotometers, and column ozone was retrieved from the OMI/AURA satellite. Model validation was accomplished using data from these three stations for the data periods which were not included in the model formulation. The models were also validated against an independent data set collected at Ubon Ratchathani (15.25 o N, 104.87 o E) in the Northeast. The global and direct normal irradiances calculated from the models and those obtained from measurements are in good agreement, with the root mean square difference (RMSD) of 7.5% for both global and direct normal irradiances. The performance of the models was also compared with that of other models. The performance of the models compared favorably with that of empirical models. Additionally, the accuracy of irradiances predicted from the proposed model are comparable with that obtained from some

  11. Fatal Pasteurella haemolytica pneumonia in bighorn sheep after direct contact with clinically normal domestic sheep.

    Science.gov (United States)

    Foreyt, W J

    1989-03-01

    Six Rocky Mountain bighorn sheep were raised in captivity from birth (n = 5) or taken from the wild as a lamb (n = 1). After the bighorn sheep were in captivity for over a year, 6 clinically normal domestic sheep were placed on the 2 ha of pasture on which the bighorn sheep were kept. Nasal swab specimens were obtained from all sheep at the time the domestic sheep were introduced. Pasteurella haemolytica was isolated from swab specimens obtained from 4 of 6 domestic sheep, but not from specimens obtained from the bighorn sheep. All 6 bighorn sheep died of acute hemorrhagic pneumonia after exposure to domestic sheep. Death in the bighorn sheep occurred on days 4, 27, 27, 29, 36, or 71 after initial exposure to domestic sheep. Pasteurella haemolytica was isolated from respiratory tract tissue specimens of all bighorn sheep at the time of death. None of the domestic sheep were clinically ill during the study. At the end of the study, 3 of 6 domestic sheep were euthanatized, and at necropsy, P haemolytica was isolated from 2 of them. The most common serotypes in bighorn and domestic sheep were P haemolytica T-3 and A-2. Other serotypes isolated included P haemolytica A-1, A-9, and A-11 in bighorn sheep and A-1 in domestic sheep. On the basis of results of this study and of other reports, domestic sheep and bighorn sheep should not be managed in proximity to each other because of the potential fatal consequences in bighorn sheep.

  12. Shock analysis: Three useful new relations

    International Nuclear Information System (INIS)

    Smith, E.J.; Burton, M.E.

    1988-01-01

    Over the years a variety of methods for analyzing hydromagnetic shocks have been developed. The Rankine-Hugoniot relations on which the analyses are based are sufficiently complex and involve sufficiently large numbers of variables that in specific instances a decision must be made on how to proceed. The authors analyses have tended to emphasize the magnetic field (B) and velocity (V) as the starting point since they are typically the most accurately determined measurables. They authors have also tended to carry out the analysis in a reference frame aligned, and moving, with the shock. Three new relations have been derived which are generally useful. (1) The shock speed can be calculated from the upstream and downstream values of B and V independent of the shock normal or its direction relative to the upstream field. (2) An explicit relation is derived relating the angles between the jump in velocity, the shock normal, and the upstream field. (3) From the magnetic field and two-dimensional velocity measurements, which are frequently all that are available, it is possible to infer the third component of the upstream-downstream velocity jump

  13. Direct measurements of wall shear stress by buried wire gages in a shock-wave boundary-layer interaction region

    Science.gov (United States)

    Murthy, V. S.; Rose, W. C.

    1977-01-01

    Detailed measurements of wall shear stress (skin friction) were made with specially developed buried wire gages in the interaction regions of a Mach 2.9 turbulent boundary layer with externally generated shocks. Separation and reattachment points inferred by these measurements support the findings of earlier experiments which used a surface oil flow technique and pitot profile measurements. The measurements further indicate that the boundary layer tends to attain significantly higher skin-friction values downstream of the interaction region as compared to upstream. Comparisons between measured wall shear stress and published results of some theoretical calculation schemes show that the general, but not detailed, behavior is predicted well by such schemes.

  14. Experimental Investigation on Airfoil Shock Control by Plasma Aerodynamic Actuation

    International Nuclear Information System (INIS)

    Sun Quan; Cheng Bangqin; Li Yinghong; Cui Wei; Jin Di; Li Jun

    2013-01-01

    An experimental investigation on airfoil (NACA64—215) shock control is performed by plasma aerodynamic actuation in a supersonic tunnel (Ma = 2). The results of schlieren and pressure measurement show that when plasma aerodynamic actuation is applied, the position moves forward and the intensity of shock at the head of the airfoil weakens. With the increase in actuating voltage, the total pressure measured at the head of the airfoil increases, which means that the shock intensity decreases and the control effect increases. The best actuation effect is caused by upwind-direction actuation with a magnetic field, and then downwind-direction actuation with a magnetic field, while the control effect of aerodynamic actuation without a magnetic field is the most inconspicuous. The mean intensity of the normal shock at the head of the airfoil is relatively decreased by 16.33%, and the normal shock intensity is relatively reduced by 27.5% when 1000 V actuating voltage and upwind-direction actuation are applied with a magnetic field. This paper theoretically analyzes the Joule heating effect generated by DC discharge and the Lorentz force effect caused by the magnetic field. The discharge characteristics are compared for all kinds of actuation conditions to reveal the mechanism of shock control by plasma aerodynamic actuation

  15. Plasma polyunsaturated fatty acids are directly associated with cognition in overweight children but not in normal weight children.

    Science.gov (United States)

    Haapala, E A; Viitasalo, A; Venäläinen, T; Eloranta, A-M; Ågren, J; Lindi, V; Lakka, T A

    2016-12-01

    Polyunsaturated fatty acids are essential nutrients for the normal development of the brain. We investigated the associations between plasma polyunsaturated fatty acids and cognition in normal weight and overweight children. The study recruited 386 normal weight children and 58 overweight children aged six to eight years and blood samples were drawn after a 12-hour fast. We assessed plasma polyunsaturated fatty acids using gas chromatography, cognition using Raven's Coloured Progressive Matrices, and overweight and obesity using the age-specific and sex-specific cut-offs from the International Obesity Task Force. The data were analysed by linear regression analyses adjusted for age and sex. Higher proportions of eicosapentaenoic acid in plasma triacylglycerols (β = 0.311, p = 0.020, p = 0.029 for interaction) and docosahexaenoic acid in plasma triacylglycerols (β = 0.281, p = 0.038, p = 0.049 for interaction) were both associated with higher Raven's scores in overweight children but not in normal weight children. Higher eicosapentaenoic acid to arachidonic acid ratios in triacylglycerols (β = 0.317, p = 0.019) and phospholipids (β = 0.273, p = 0.046) were directly associated with the Raven's score in overweight children but not in normal weight children. These findings suggest that increasing the consumption of fish and other sources of eicosapentaenoic acid and docosahexaenoic acid may improve cognition among overweight children. ©2016 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.

  16. Physics of Collisionless Shocks Space Plasma Shock Waves

    CERN Document Server

    Balogh, André

    2013-01-01

    The present book provides a contemporary systematic treatment of shock waves in high-temperature collisionless plasmas as are encountered in near Earth space and in Astrophysics. It consists of two parts. Part I develops the complete theory of shocks in dilute hot plasmas under the assumption of absence of collisions among the charged particles when the interaction is mediated solely by the self-consistent electromagnetic fields. Such shocks are naturally magnetised implying that the magnetic field plays an important role in their evolution and dynamics. This part treats both subcritical shocks, which dissipate flow energy by generating anomalous resistance or viscosity, and supercritical shocks. The main emphasis is, however, on super-critical shocks where the anomalous dissipation is insufficient to retard the upstream flow. These shocks, depending on the direction of the upstream magnetic field, are distinguished as quasi-perpendicular and quasi-parallel shocks which exhibit different behaviours, reflecti...

  17. Pros and cons of rotating ground motion records to fault-normal/parallel directions for response history analysis of buildings

    Science.gov (United States)

    Kalkan, Erol; Kwong, Neal S.

    2014-01-01

    According to the regulatory building codes in the United States (e.g., 2010 California Building Code), at least two horizontal ground motion components are required for three-dimensional (3D) response history analysis (RHA) of building structures. For sites within 5 km of an active fault, these records should be rotated to fault-normal/fault-parallel (FN/FP) directions, and two RHAs should be performed separately (when FN and then FP are aligned with the transverse direction of the structural axes). It is assumed that this approach will lead to two sets of responses that envelope the range of possible responses over all nonredundant rotation angles. This assumption is examined here, for the first time, using a 3D computer model of a six-story reinforced-concrete instrumented building subjected to an ensemble of bidirectional near-fault ground motions. Peak values of engineering demand parameters (EDPs) were computed for rotation angles ranging from 0 through 180° to quantify the difference between peak values of EDPs over all rotation angles and those due to FN/FP direction rotated motions. It is demonstrated that rotating ground motions to FN/FP directions (1) does not always lead to the maximum responses over all angles, (2) does not always envelope the range of possible responses, and (3) does not provide maximum responses for all EDPs simultaneously even if it provides a maximum response for a specific EDP.

  18. Study of coherent structures of turbulence with large wall-normal gradients in thermophysical properties using direct numerical simulation

    International Nuclear Information System (INIS)

    Reinink, Shawn K.; Yaras, Metin I.

    2015-01-01

    Forced-convection heat transfer in a heated working fluid at a thermodynamic state near its pseudocritical point is poorly predicted by correlations calibrated with data at subcritical temperatures and pressures. This is suggested to be primarily due to the influence of large wall-normal thermophysical property gradients that develop in proximity of the pseudocritical point on the concentration of coherent turbulence structures near the wall. The physical mechanisms dominating this influence remain poorly understood. In the present study, direct numerical simulation is used to study the development of coherent vortical structures within a turbulent spot under the influence of large wall-normal property gradients. A turbulent spot rather than a fully turbulent boundary layer is used for the study, for the coherent structures of turbulence in a spot tend to be in a more organized state which may allow for more effective identification of cause-and-effect relationships. Large wall-normal gradients in thermophysical properties are created by heating the working fluid which is near the pseudocritical thermodynamic state. It is found that during improved heat transfer, wall-normal gradients in density accelerate the growth of the Kelvin-Helmholtz instability mechanism in the shear layer enveloping low-speed streaks, causing it to roll up into hairpin vortices at a faster rate. It is suggested that this occurs by the baroclinic vorticity generation mechanism which accelerates the streamwise grouping of vorticity during shear layer roll-up. The increased roll-up frequency leads to reduced streamwise spacing between hairpin vortices in wave packets. The density gradients also promote the sinuous instability mode in low-speed streaks. The resulting oscillations in the streaks in the streamwise-spanwise plane lead to locally reduced spanwise spacing between hairpin vortices forming over adjacent low-speed streaks. The reduction in streamwise and spanwise spacing between

  19. Analytical solutions of hypersonic type IV shock - shock interactions

    Science.gov (United States)

    Frame, Michael John

    An analytical model has been developed to predict the effects of a type IV shock interaction at high Mach numbers. This interaction occurs when an impinging oblique shock wave intersects the most normal portion of a detached bow shock. The flowfield which develops is complicated and contains an embedded jet of supersonic flow, which may be unsteady. The jet impinges on the blunt body surface causing very high pressure and heating loads. Understanding this type of interaction is vital to the designers of cowl lips and leading edges on air- breathing hypersonic vehicles. This analytical model represents the first known attempt at predicting the geometry of the interaction explicitly, without knowing beforehand the jet dimensions, including the length of the transmitted shock where the jet originates. The model uses a hyperbolic equation for the bow shock and by matching mass continuity, flow directions and pressure throughout the flowfield, a prediction of the interaction geometry can be derived. The model has been shown to agree well with the flowfield patterns and properties of experiments and CFD, but the prediction for where the peak pressure is located, and its value, can be significantly in error due to a lack of sophistication in the model of the jet fluid stagnation region. Therefore it is recommended that this region of the flowfield be modeled in more detail and more accurate experimental and CFD measurements be used for validation. However, the analytical model has been shown to be a fast and economic prediction tool, suitable for preliminary design, or for understanding the interactions effects, including the basic physics of the interaction, such as the jet unsteadiness. The model has been used to examine a wide parametric space of possible interactions, including different Mach number, impinging shock strength and location, and cylinder radius. It has also been used to examine the interaction on power-law shaped blunt bodies, a possible candidate for

  20. Remote sensing of local structure of the quasi-perpendicular Earth's bow shock by using field-aligned beams

    Directory of Open Access Journals (Sweden)

    B. Miao

    2009-03-01

    Full Text Available Field-aligned ion beams (FABs originate at the quasi-perpendicular Earth's bow shock and constitute an important ion population in the foreshock region. The bulk velocity of these FABs depends significantly on the shock normal angle, which is the angle between shock normal and upstream interplanetary magnetic field (IMF. This dependency may therefore be taken as an indicator of the local structure of the shock. Applying the direct reflection model to Cluster measurements, we have developed a method that uses proton FABs in the foreshock region for remote sensing of the local shock structure. The comparison of the model results with the multi-spacecraft observations of FAB events shows very good agreement in terms of wave amplitude and frequency of surface waves at the shock front.

  1. Anomalous elastic response of silicon to uniaxial shock compression on nanosecond time scales.

    Science.gov (United States)

    Loveridge-Smith, A; Allen, A; Belak, J; Boehly, T; Hauer, A; Holian, B; Kalantar, D; Kyrala, G; Lee, R W; Lomdahl, P; Meyers, M A; Paisley, D; Pollaine, S; Remington, B; Swift, D C; Weber, S; Wark, J S

    2001-03-12

    We have used x-ray diffraction with subnanosecond temporal resolution to measure the lattice parameters of orthogonal planes in shock compressed single crystals of silicon (Si) and copper (Cu). Despite uniaxial compression along the (400) direction of Si reducing the lattice spacing by nearly 11%, no observable changes occur in planes with normals orthogonal to the shock propagation direction. In contrast, shocked Cu shows prompt hydrostaticlike compression. These results are consistent with simple estimates of plastic strain rates based on dislocation velocity data.

  2. Mechanical shock absorber

    International Nuclear Information System (INIS)

    Vrillon, Bernard.

    1973-01-01

    The mechanical shock absorber described is made of a constant thickness plate pierced with circular holes regularly distributed in such a manner that for all the directions along which the strain is applied during the shock, the same section of the substance forming the plate is achieved. The shock absorber is made in a metal standing up to extensive deformation before breaking, selected from a group comprising mild steels and austenitic stainless steels. This apparatus is used for handling pots of fast neutron reactor fuel elements [fr

  3. Relationship of Interplanetary Shock Micro and Macro Characteristics: A Wind Study

    Science.gov (United States)

    Szabo, Adam; Koval, A

    2008-01-01

    The non-linear least squared MHD fitting technique of Szabo 11 9941 has been recently further refined to provide realistic confidence regions for interplanetary shock normal directions and speeds. Analyzing Wind observed interplanetary shocks from 1995 to 200 1, macro characteristics such as shock strength, Theta Bn and Mach numbers can be compared to the details of shock micro or kinetic structures. The now commonly available very high time resolution (1 1 or 22 vectors/sec) Wind magnetic field data allows the precise characterization of shock kinetic structures, such as the size of the foot, ramp, overshoot and the duration of damped oscillations on either side of the shock. Detailed comparison of the shock micro and macro characteristics will be given. This enables the elucidation of shock kinetic features, relevant for particle energization processes, for observations where high time resolution data is not available. Moreover, establishing a quantitative relationship between the shock micro and macro structures will improve the confidence level of shock fitting techniques during disturbed solar wind conditions.

  4. EnviroAtlas - Average Direct Normal Solar resources kWh/m2/Day by 12-Digit HUC for the Conterminous United States

    Data.gov (United States)

    U.S. Environmental Protection Agency — The annual average direct normal solar resources by 12-Digit Hydrologic Unit (HUC) was estimated from maps produced by the National Renewable Energy Laboratory for...

  5. Shock wave interaction with turbulence: Pseudospectral simulations

    International Nuclear Information System (INIS)

    Buckingham, A.C.

    1986-01-01

    Shock waves amplify pre-existing turbulence. Shock tube and shock wave boundary layer interaction experiments provide qualitative confirmation. However, shock pressure, temperature, and rapid transit complicate direct measurement. Computational simulations supplement the experimental data base and help isolate the mechanisms responsible. Simulations and experiments, particularly under reflected shock wave conditions, significantly influence material mixing. In these pseudospectral Navier-Stokes simulations the shock wave is treated as either a moving (tracked or fitted) domain boundary. The simulations assist development of code mix models. Shock Mach number and pre-existing turbulence intensity initially emerge as key parameters. 20 refs., 8 figs

  6. Collisionless shock waves

    International Nuclear Information System (INIS)

    Sagdeev, R.Z.; Kennel, C.F.

    1991-01-01

    Collisionless shocks cannot occur naturally on the earth, because nearly all matter here consists of electrically neutral atoms and molecules. In space, however, high temperatures and ultraviolet radiation from hot stars decompose atoms into their constituent nuclei and electrons, producing a soup of electrically charged particles known as a plasma. Plasma physicists proposed that the collective electrical and magnetic properties of plasmas could produce interactions that take the place of collisions and permit shocks to form. In 1964 the theoretical work found its first experimental confirmation. Norman F. Ness and his colleagues at the Goddard Space Flight Center, using data collected from the iMP-1 spacecraft, detected clear signs that a collisionless shock exists where the solar wind encounters the earth's magnetic field. More recent research has demonstrated that collisionless shocks appear in a dazzling array of astronomical settings. For example, shocks have been found in the solar wind upstream (sunward) of all the planet and comets that have been visited by spacecraft. Violent flares on the sun generate shocks that propagate to the far reaches of the solar system; tremendous galactic outbursts create disruptions in the intergalactic medium that are trillions of times larger. In addition, many astrophysicists think that shocks from supernova explosions in our galaxy accelerate cosmic rays, a class of extraordinarily energetic elementary particles and atomic nuclei that rain down on the earth from all directions

  7. Unified approach to catastrophic events: from the normal state to geological or biological shock in terms of spectral fractal and nonlinear analysis

    Directory of Open Access Journals (Sweden)

    K. A. Eftaxias

    2006-01-01

    Full Text Available An important question in geophysics is whether earthquakes (EQs can be anticipated prior to their occurrence. Pre-seismic electromagnetic (EM emissions provide a promising window through which the dynamics of EQ preparation can be investigated. However, the existence of precursory features in pre-seismic EM emissions is still debatable: in principle, it is difficult to prove associations between events separated in time, such as EQs and their EM precursors. The scope of this paper is the investigation of the pre-seismic EM activity in terms of complexity. A basic reason for our interest in complexity is the striking similarity in behavior close to irreversible phase transitions among systems that are otherwise quite different in nature. Interestingly, theoretical studies (Hopfield, 1994; Herz and Hopfield 1995; Rundle et al., 1995; Corral et al., 1997 suggest that the EQ dynamics at the final stage and neural seizure dynamics should have many similar features and can be analyzed within similar mathematical frameworks. Motivated by this hypothesis, we evaluate the capability of linear and non-linear techniques to extract common features from brain electrical activities and pre-seismic EM emissions predictive of epileptic seizures and EQs respectively. The results suggest that a unified theory may exist for the ways in which firing neurons and opening cracks organize themselves to produce a large crisis, while the preparation of an epileptic shock or a large EQ can be studied in terms of ''Intermittent Criticality''.

  8. Shock absorber

    International Nuclear Information System (INIS)

    Nemeth, J.D.

    1981-01-01

    A shock absorber for the support of piping and components in a nuclear power plant is described. It combines a high degree of stiffness under sudden shocks, e.g. seismic disturbances, with the ability to allow for thermal expansion without resistance when so required. (JIW)

  9. Electric field measurements at subcritical, oblique bow shock crossings

    International Nuclear Information System (INIS)

    Wygant, J.R.; Bensadoun, M.; Mozer, F.S.

    1987-01-01

    Electric field measurements at oblique, subcritical bow shock crossings are presented from the ISEE 1 University of California, Berkeley, double-probe electric field experiment. The measurements averaged over the 3-s spin period of the spacecraft provide the first observations of the large-scale (100 km) laminar oscillations in the longitudinal component of the electric field associated with the whistler precursor which is characteristic of these dispersive shocks. The amplitude of the oscillations increases from ∼0.5 mV/m to a maximum of 6 mV/m across the magnetic ramp of the shock (directed along the shock normal). The calculated electric potential drops across the shocks varied from 340 to 550 volts, which is 40-60% of the observed loss of kinetic energy associated with the bulk flow of the ions. These measurements suggest that at these shocks the additional deceleration of incident ions is due to the Lorentz force. The contributions to the normal component of the large-scale electric field at the shock due to the parallel and perpendicular components (relative to the magnetic field) of the electric field are evaluated. It is shown that the perpendicular component of the electric field dominates, accounting for most of the cross-shock potential, but that there is a nonnegligible parallel component. This large-scale parallel component has a magnitude of 1-2 mV/m which sometimes results in a potential well for electrons with a depth of ∼150 eV. It is experimentally demonstrated that the dominance of the perpendicular over the parallel component of the electric field resulted in a correlation between the longitudinal component of the large-scale electric field and the fluctuations in the magnetic field component perpendicular to the coplanarity plane

  10. Remote sensing of local structure of the quasi-perpendicular Earth's bow shock by using field-aligned beams

    Directory of Open Access Journals (Sweden)

    B. Miao

    2009-03-01

    Full Text Available Field-aligned ion beams (FABs originate at the quasi-perpendicular Earth's bow shock and constitute an important ion population in the foreshock region. The bulk velocity of these FABs depends significantly on the shock normal angle, which is the angle between shock normal and upstream interplanetary magnetic field (IMF. This dependency may therefore be taken as an indicator of the local structure of the shock. Applying the direct reflection model to Cluster measurements, we have developed a method that uses proton FABs in the foreshock region for remote sensing of the local shock structure. The comparison of the model results with the multi-spacecraft observations of FAB events shows very good agreement in terms of wave amplitude and frequency of surface waves at the shock front.

  11. Software for determining the direction of movement, shear and normal stresses of a fault under a determined stress state

    Science.gov (United States)

    Álvarez del Castillo, Alejandra; Alaniz-Álvarez, Susana Alicia; Nieto-Samaniego, Angel Francisco; Xu, Shunshan; Ochoa-González, Gil Humberto; Velasquillo-Martínez, Luis Germán

    2017-07-01

    In the oil, gas and geothermal industry, the extraction or the input of fluids induces changes in the stress field of the reservoir, if the in-situ stress state of a fault plane is sufficiently disturbed, a fault may slip and can trigger fluid leakage or the reservoir might fracture and become damaged. The goal of the SSLIPO 1.0 software is to obtain data that can reduce the risk of affecting the stability of wellbores. The input data are the magnitudes of the three principal stresses and their orientation in geographic coordinates. The output data are the slip direction of a fracture in geographic coordinates, and its normal (σn) and shear (τ) stresses resolved on a single or multiple fracture planes. With this information, it is possible to calculate the slip tendency (τ/σn) and the propensity to open a fracture that is inversely proportional to σn. This software could analyze any compressional stress system, even non-Andersonian. An example is given from an oilfield in southern Mexico, in a region that contains fractures formed in three events of deformation. In the example SSLIPO 1.0 was used to determine in which deformation event the oil migrated. SSLIPO 1.0 is an open code application developed in MATLAB. The URL to obtain the source code and to download SSLIPO 1.0 are: http://www.geociencias.unam.mx/ alaniz/main_code.txt, http://www.geociencias.unam.mx/ alaniz/ SSLIPO_pkg.exe.

  12. demystifying the shock of shocking

    African Journals Online (AJOL)

    (with a pulse), atrial fibrillation and atrial flutter. The energy dose in cardioversion is less (0.5. - 2 J/kg) than in defibrillation (2 - 4 J/kg). In cardioversion the shock is discharged synchronously with the native R wave of the patient. Without synchronisation,. VF can be induced if a shock is delivered during the refractory period ...

  13. The Heliospheric Termination Shock

    Science.gov (United States)

    Jokipii, J. R.

    2013-06-01

    The heliospheric termination shock is a vast, spheroidal shock wave marking the transition from the supersonic solar wind to the slower flow in the heliosheath, in response to the pressure of the interstellar medium. It is one of the most-important boundaries in the outer heliosphere. It affects energetic particles strongly and for this reason is a significant factor in the effects of the Sun on Galactic cosmic rays. This paper summarizes the general properties and overall large-scale structure and motions of the termination shock. Observations over the past several years, both in situ and remote, have dramatically revised our understanding of the shock. The consensus now is that the shock is quite blunt, is with the front, blunt side canted at an angle to the flow direction of the local interstellar plasma relative to the Sun, and is dynamical and turbulent. Much of this new understanding has come from remote observations of energetic charged particles interacting with the shock, radio waves and radiation backscattered from interstellar neutral atoms. The observations and the implications are discussed.

  14. Shock compression of diamond crystal

    OpenAIRE

    Kondo, Ken-ichi; Ahrens, Thomas J.

    1983-01-01

    Two shock wave experiments employing inclined mirrors have been carried out to determine the Hugoniot elastic limit (HEL), final shock state at 191 and 217 GPa, and the post-shock state of diamond crystal, which is shock-compressed along the intermediate direction between the and crystallographic axes. The HEL wave has a velocity of 19.9 ± 0.3 mm/µsec and an amplitude of 63 ± 28 GPa. An alternate interpretation of the inclined wedge mirror streak record suggests a ramp precursor wave and th...

  15. The direct costs of intensive care management and risk factors for financial burden of patients with severe sepsis and septic shock.

    Science.gov (United States)

    Khwannimit, Bodin; Bhurayanontachai, Rungsun

    2015-10-01

    The costs of severe sepsis care from middle-income countries are lacking. This study investigated direct intensive care unit (ICU) costs and factors that could affect the financial outcomes. A prospective cohort study was conducted in the medical ICU of a tertiary referral university teaching hospital in Thailand. A total of 897 patients were enrolled in the study, with 683 (76.1%) having septic shock. Community-, nosocomial, and ICU-acquired infections were documented in 574, 282, and 41 patients, respectively. The median ICU costs per patient were $2716.5 ($1296.1-$5367.6) and $599.9 ($414.3-$948.6) per day. The ICU costs accounted for 64.7% of the hospital costs. In 2008 to 2011, the ICU costs significantly decreased by 40% from $3542.5 to $2124.9, whereas, the daily ICU costs decreased only 3.3% from $609.7 to $589.7. By multivariate logistic regression analysis, age, nosocomial or ICU infection, admission from the emergency department, number of organ failures, ICU length of stay, and fluid balance the first 72 hours were independently associated with ICU costs. The ICU costs of severe sepsis management significantly declined in our study. However, the ICU costs were a financial burden accounting for two thirds of the hospital costs. It is essential for intensivists to contribute a high standard of care within a restricted budget. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Heat shock protein 90-mediated peptide-selective presentation of cytosolic tumor antigen for direct recognition of tumors by CD4(+) T cells.

    Science.gov (United States)

    Tsuji, Takemasa; Matsuzaki, Junko; Caballero, Otavia L; Jungbluth, Achim A; Ritter, Gerd; Odunsi, Kunle; Old, Lloyd J; Gnjatic, Sacha

    2012-04-15

    Tumor Ag-specific CD4(+) T cells play important functions in tumor immunosurveillance, and in certain cases they can directly recognize HLA class II-expressing tumor cells. However, the underlying mechanism of intracellular Ag presentation to CD4(+) T cells by tumor cells has not yet been well characterized. We analyzed two naturally occurring human CD4(+) T cell lines specific for different peptides from cytosolic tumor Ag NY-ESO-1. Whereas both lines had the same HLA restriction and a similar ability to recognize exogenous NY-ESO-1 protein, only one CD4(+) T cell line recognized NY-ESO-1(+) HLA class II-expressing melanoma cells. Modulation of Ag processing in melanoma cells using specific molecular inhibitors and small interfering RNA revealed a previously undescribed peptide-selective Ag-presentation pathway by HLA class II(+) melanoma cells. The presentation required both proteasome and endosomal protease-dependent processing mechanisms, as well as cytosolic heat shock protein 90-mediated chaperoning. Such tumor-specific pathway of endogenous HLA class II Ag presentation is expected to play an important role in immunosurveillance or immunosuppression mediated by various subsets of CD4(+) T cells at the tumor local site. Furthermore, targeted activation of tumor-recognizing CD4(+) T cells by vaccination or adoptive transfer could be a suitable strategy for enhancing the efficacy of tumor immunotherapy.

  17. The rapid and direct determination of ATPase activity by ion exchange chromatography and the application to the activity of heat shock protein-90.

    Science.gov (United States)

    Bartolini, Manuela; Wainer, Irving W; Bertucci, Carlo; Andrisano, Vincenza

    2013-01-25

    Adenosine nucleotides are involved as substrates or co-factors in several biochemical reactions, catalyzed by enzymes, which modulate energy production, signal transduction and cell proliferation. We here report the development and optimization of an ion exchange liquid chromatography (LC) method for the determination of ATP, ADP and AMP. This method is specifically aimed at the determination of the ATP-ase activity of human heat shock protein 90 (Hsp90), a molecular chaperone that has emerged as target enzyme in cancer therapy. Separation of the three nucleotides was achieved in a 15-min run by using a disk shaped monolithic ethylene diamine stationary phase of small dimensions (2mm×6mm i.d.), under a three-solvent gradient elution mode and UV detection at 256nm. The described direct LC method resulted highly specific as a consequence of the baseline separation of the three adenosine nucleotides and could be applied to the determination of the enzymatic activity of ADP/ATP generating or consuming enzymes (such as kinases). Furthermore, comparison of the LOD and LOQ values of the LC method with those obtained with the malachite green assay, which is one of the most used indirect screening methodologies for ATP-ase activity, showed that the LC method has a similar range of application without presenting the drawbacks related to contamination by inorganic phosphate ions and glycerol, which are present in Hsp90 commercial samples. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. A systematic review and meta-analysis of early goal-directed therapy for septic shock: the ARISE, ProCESS and ProMISe Investigators.

    Science.gov (United States)

    Angus, D C; Barnato, A E; Bell, D; Bellomo, R; Chong, C-R; Coats, T J; Davies, A; Delaney, A; Harrison, D A; Holdgate, A; Howe, B; Huang, D T; Iwashyna, T; Kellum, J A; Peake, S L; Pike, F; Reade, M C; Rowan, K M; Singer, M; Webb, S A R; Weissfeld, L A; Yealy, D M; Young, J D

    2015-09-01

    To determine whether early goal-directed therapy (EGDT) reduces mortality compared with other resuscitation strategies for patients presenting to the emergency department (ED) with septic shock. Using a search strategy of PubMed, EmBase and CENTRAL, we selected all relevant randomised clinical trials published from January 2000 to January 2015. We translated non-English papers and contacted authors as necessary. Our primary analysis generated a pooled odds ratio (OR) from a fixed-effect model. Sensitivity analyses explored the effect of including non-ED studies, adjusting for study quality, and conducting a random-effects model. Secondary outcomes included organ support and hospital and ICU length of stay. From 2395 initially eligible abstracts, five randomised clinical trials (n = 4735 patients) met all criteria and generally scored high for quality except for lack of blinding. There was no effect on the primary mortality outcome (EGDT: 23.2% [495/2134] versus control: 22.4% [582/2601]; pooled OR 1.01 [95% CI 0.88-1.16], P = 0.9, with heterogeneity [I(2) = 57%; P = 0.055]). The pooled estimate of 90-day mortality from the three recent multicentre studies (n = 4063) also showed no difference [pooled OR 0.99 (95% CI 0.86-1.15), P = 0.93] with no heterogeneity (I(2) = 0.0%; P = 0.97). EGDT increased vasopressor use (OR 1.25 [95% CI 1.10-1.41]; P < 0.001) and ICU admission [OR 2.19 (95% CI 1.82-2.65); P < 0.001]. Including six non-ED randomised trials increased heterogeneity (I(2) = 71%; P < 0.001) but did not change overall results [pooled OR 0.94 (95% CI 0.82 to 1.07); P = 0.33]. EGDT is not superior to usual care for ED patients with septic shock but is associated with increased utilisation of ICU resources.

  19. Hypovolemic shock

    Science.gov (United States)

    ... the person's position unless they are in immediate danger. Do not give fluids by mouth. If person ... the patient with shock. In: Goldman L, Schafer AI, eds. Goldman-Cecil Medicine . 25th ed. Philadelphia, PA: ...

  20. Shock absorber

    International Nuclear Information System (INIS)

    Housman, J.J.

    1978-01-01

    A shock absorber is described for use in a hostile environment at the end of a blind passage for absorbing impact loads. The shock absorber includes at least one element which occupies the passage and which is comprised of a porous brittle material which is substantially non-degradable in the hostile environment. A void volume is provided in the element to enable the element to absorb a predetermined level of energy upon being crushed due to impact loading

  1. Orientation Dependence in Molecular Dynamics Simulations of Shocked Single Crystals

    International Nuclear Information System (INIS)

    Germann, Timothy C.; Holian, Brad Lee; Lomdahl, Peter S.; Ravelo, Ramon

    2000-01-01

    We use multimillion-atom molecular dynamics simulations to study shock wave propagation in fcc crystals. As shown recently, shock waves along the direction form intersecting stacking faults by slippage along {111} close-packed planes at sufficiently high shock strengths. We find even more interesting behavior of shocks propagating in other low-index directions: for the case, an elastic precursor separates the shock front from the slipped (plastic) region. Shock waves along the direction generate a leading solitary wave train, followed (at sufficiently high shock speeds) by an elastic precursor, and then a region of complex plastic deformation. (c) 2000 The American Physical Society

  2. Electric Shock Injuries in Children

    Science.gov (United States)

    ... Issues Listen Español Text Size Email Print Share Electric Shock Injuries in Children Page Content ​When the ... comes into direct contact with a source of electricity, the current passes through it, producing what's called ...

  3. On Modeling Risk Shocks

    OpenAIRE

    Dorofeenko, Victor; Lee, Gabriel; Salyer, Kevin; Strobel, Johannes

    2016-01-01

    Within the context of a financial accelerator model, we model time-varying uncertainty (i.e. risk shocks) through the use of a mixture Normal model with time variation in the weights applied to the underlying distributions characterizing entrepreneur productivity. Specifically, we model capital producers (i.e. the entrepreneurs) as either low-risk (relatively small second moment for productivity) and high-risk (relatively large second moment for productivity) and the fraction of both types is...

  4. Coronal mass ejection shock fronts containing the two types of intermediate shocks

    International Nuclear Information System (INIS)

    Steinolfson, R.S.; Hundhausen, A.J.

    1990-01-01

    Numerical solutions of the time-dependent, magnetohydrodynamic (MHD) equations in two dimensions are used to demonstrate the formation of both types of intermediate shocks in a single shock front for physical conditions that are an idealization of those expected to occur in some observed coronal mass ejections. The key to producing such a shock configuration in the simulations is the use of an initial atmosphere containing a magnetic field representative of that in a coronal streamer with open field lines overlying a region of closed field lines. Previous attempts using just open field lines (perpendicular to the surface) produced shock configurations containing just one of the two intermediate shock types. A schematic of such a shock front containing both intermediate shock types has been constructed previously based solely on the known properties of MHD shocks from the Rankine-Hugoniot equations and specific requirements placed on the shock solution at points along the front where the shock normal and upstream magnetic field are aligned. The shock front also contains, at various locations along the front, a hydrodynamic (nonmagnetic) shock, a switch-on shock, and a fast shock in addition to the intermediate shocks. This particular configuration occurs when the shock front speed exceeds the upstream (preshock) intermediate wave speed but is less than a critical speed defined in the paper (equation 1) along at least some portion of the shock front. A distinctive feature of the front is that it is concave upward (away from the surface) near the region where the field in the preshock plasma is normal to the front of near the central portion of the shock front

  5. Comparison of multiple assays for detecting human antibodies directed against antigens on normal and malignant tissue culture cells

    International Nuclear Information System (INIS)

    Rosenberg, S.A.; Schwarz, S.; Anding, H.; Hyatt, C.; Williams, G.M.; Johns Hopkins Univ., Baltimore, Md.

    1977-01-01

    Four separate assays of human antibody reactivity to four separate normal and malignant human tissue culture cells lines from two patients have been evaluated using a single highly-reactive allogeneic serum. The visual end-point cytolysis assay and the chromium-51 release assay were equally sensitive in measuring complement mediated antibody cytotoxicity and both were far more sensitive than a trypan blue dye exclusion assay. The assay of antibody reactivity by hemadsorption technique was about 10 times more sensitive than any of the cytotoxicity assays. This latter assay measures only IgG antibody however. These assays showed that cell lines from different patients may differ greatly in 'reactivity' to an allogeneic serum and emphasized the importance of utilizing tumor and normal cells from the same patient when using tissue culture cells to search for tumor specific reactivity. These observations emphasize the importance of utilizing multiple assays against paired normal and malignant cells from the same patient to be certain of the specificity and magnitude of the measured antibody

  6. Toxic shock syndrome

    Science.gov (United States)

    Staphylococcal toxic shock syndrome; Toxic shock-like syndrome; TSLS ... Toxic shock syndrome is caused by a toxin produced by some types of staphylococcus bacteria. A similar problem, called toxic shock- ...

  7. Shocking matter to extreme conditions

    International Nuclear Information System (INIS)

    Gupta, Y.M.; Sharma, S.M.

    1997-01-01

    A good understanding of the thermodynamic response of matter at high compression and high energy densities is important to several areas of physics. Shock-wave experiments are uniquely suited for obtaining data at extreme conditions, and a shock-compressed matter can be viewed as a condensed system with or without dissociation or as a strongly coupled plasma. This article reviews work by Da Silva et al. in which irradiances ranging from 5x10 superscript 12 to 2x10 superscript 14 W/cm 2 were used to generate 8- to 10-ns square pulses in liquid deuterium. The authors demonstrated negligible pre-heating of the sample, steady propagation of the shock wave, and direct determination of the shock wave velocity along with particle velocity and density in the shocked state. Da Silva et al. results are compared with models and other experimental information, and the usefulness of the data in other areas is assessed. 11 refs., 1 fig

  8. Rectal compliance as a routine measurement: extreme volumes have direct clinical impact and normal volumes exclude rectum as a problem.

    Science.gov (United States)

    Felt-Bersma, R J; Sloots, C E; Poen, A C; Cuesta, M A; Meuwissen, S G

    2000-12-01

    The clinical impact of rectal compliance and sensitivity measurement is not clear. The aim of this study was to measure the rectal compliance in different patient groups compared with controls and to establish the clinical effect of rectal compliance. Anorectal function tests were performed in 974 consecutive patients (284 men). Normal values were obtained from 24 controls. Rectal compliance measurement was performed by filling a latex rectal balloon with water at a rate of 60 ml per minute. Volume and intraballoon pressure were measured. Volume and pressure at three sensitivity thresholds were recorded for analysis: first sensation, urge, and maximal toleration. At maximal toleration, the rectal compliance (volume/pressure) was calculated. Proctoscopy, anal manometry, anal mucosal sensitivity, and anal endosonography were also performed as part of our anorectal function tests. No effect of age or gender was observed in either controls or patients. Patients with fecal incontinence had a higher volume at first sensation and a higher pressure at maximal toleration (P = 0.03), the presence of a sphincter defect or low or normal anal pressures made no difference. Patients with constipation had a larger volume at first sensation and urge (P 500 ml had complaints of constipation. No correlation between rectal and anal mucosal sensitivity was found. Rectal compliance measurement with a latex balloon is easily feasible. In this series of 974 patients, some patient groups showed an abnormal rectal visceral sensitivity and compliance, but there was an overlap with controls. Rectal compliance measurement gave a good clinical impression about the contribution of the rectum to the anorectal problem. Patients with proctitis and pouchitis had the smallest rectal compliance. A maximal toleration volume 500 ml was only seen in constipated patients, and therapy should be given to prevent further damage to the pelvic floor. Values close to or within the normal range rule out the

  9. Evaluating new methods for direct measurement of the moderator temperature coefficient in nuclear power plants during normal operation

    International Nuclear Information System (INIS)

    Makai, M.; Kalya, Z.; Nemes, I.; Pos, I.; Por, G.

    2007-01-01

    Moderator temperature coefficient of reactivity is not monitored during fuel cycles in WWER reactors, because it is not very easy or impossible to measure it without disturbing the normal operation. Two new methods were tested in our WWER type nuclear power plant to try methodologies, which enable to measure that important to safety parameter during the fuel cycle. One is based on small perturbances, and only small changes are requested in operation, the other is based on noise methods, which means it is without interference with reactor operation. Both method is new that aspects that they uses the plant computer data(VERONA) based signals calculated by C P ORCA diffusion code (Authors)

  10. The angular interval between the direction of progression and body orientation in normal, alcohol- and cocaine treated fruit flies.

    Directory of Open Access Journals (Sweden)

    Anna Gakamsky

    Full Text Available In this study we characterize the coordination between the direction a fruit-fly walks and the direction it faces, as well as offer a methodology for isolating and validating key variables with which we phenotype fly locomotor behavior. Our fundamental finding is that the angular interval between the direction a fly walks and the direction it faces is actively managed in intact animals and modulated in a patterned way with drugs. This interval is small in intact flies, larger with alcohol and much larger with cocaine. The dynamics of this interval generates six coordinative modes that flow smoothly into each other. Under alcohol and much more so under cocaine, straight path modes dwindle and modes involving rotation proliferate. To obtain these results we perform high content analysis of video-tracked open field locomotor behavior. Presently there is a gap between the quality of descriptions of insect behaviors that unfold in circumscribed situations, and descriptions that unfold in extended time and space. While the first describe the coordination between low-level kinematic variables, the second quantify cumulative measures and subjectively defined behavior patterns. Here we reduce this gap by phenotyping extended locomotor behavior in terms of the coordination between low-level kinematic variables, which we quantify, combining into a single field two disparate fields, that of high content phenotyping and that of locomotor coordination. This will allow the study of the genes/brain/locomotor coordination interface in genetically engineered and pharmacologically manipulated animal models of human diseases.

  11. Salt flow direction and velocity during subsalt normal faulting and syn-kinematic sedimentation—implications from analytical calculations

    Science.gov (United States)

    Warsitzka, M.; Kukowski, N.; Kley, J.

    2018-04-01

    Salt flow induced by subsalt normal faulting is mainly controlled by tilting of the salt layer, the amount of differential loading due to syn-kinematic deposition, and tectonic shearing at the top or the base of the salt layer. Our study addresses the first two mechanisms and aims to examine salt flow patterns above a continuously moving subsalt normal fault and beneath a syn-kinematic minibasin. In such a setting, salt either tends to flow down towards the basin centre driven by its own weight or is squeezed up towards the footwall side owing to loading differences between the minibasin and the region above the footwall block. Applying isostatic balancing in analytical models, we calculated the steady-state flow velocity in a salt layer. This procedure gives insights into (1) the minimum vertical offset required for upward flow to occur, (2) the magnitude of the flow velocity, and (3) the average density of the supra-salt cover layer at the point at which upward flow starts. In a sensitivity study, we examined how the point of flow reversal and the velocity patterns are influenced by changes of the salt and cover layer thickness, the geometry of the cover flexure, the dip of the subsalt fault, compaction parameters of the supra-salt cover, the salt viscosity and the salt density. Our model results reveal that in most geological scenarios, salt flow above a continuously displacing subsalt normal fault goes through an early phase of downward flow. At sufficiently high fault offset in the range of 700-2600 m, salt is later squeezed upward towards the footwall side. This flow reversal occurs at smaller vertical fault displacement, if the thickness of the pre-kinematic layer is larger, the sedimentation rate of the syn-kinematic cover is higher, the compaction coefficient of cover sediments (i.e. the density increase with depth) is larger or the average density of the salt is lower. Other geometrical parameters such as the width of the cover monocline, the dip of the

  12. Direct assignment of molecular vibrations via normal mode analysis of the neutron dynamic pair distribution function technique

    International Nuclear Information System (INIS)

    Fry-Petit, A. M.; Sheckelton, J. P.; McQueen, T. M.; Rebola, A. F.; Fennie, C. J.; Mourigal, M.; Valentine, M.; Drichko, N.

    2015-01-01

    For over a century, vibrational spectroscopy has enhanced the study of materials. Yet, assignment of particular molecular motions to vibrational excitations has relied on indirect methods. Here, we demonstrate that applying group theoretical methods to the dynamic pair distribution function analysis of neutron scattering data provides direct access to the individual atomic displacements responsible for these excitations. Applied to the molecule-based frustrated magnet with a potential magnetic valence-bond state, LiZn 2 Mo 3 O 8 , this approach allows direct assignment of the constrained rotational mode of Mo 3 O 13 clusters and internal modes of MoO 6 polyhedra. We anticipate that coupling this well known data analysis technique with dynamic pair distribution function analysis will have broad application in connecting structural dynamics to physical properties in a wide range of molecular and solid state systems

  13. Normal and system lupus erythematosus red blood cell interactions studied by double trap optical tweezers: direct measurements of aggregation forces

    Science.gov (United States)

    Khokhlova, Maria D.; Lyubin, Eugeny V.; Zhdanov, Alexander G.; Rykova, Sophia Yu.; Sokolova, Irina A.; Fedyanin, Andrey A.

    2012-02-01

    Direct measurements of aggregation forces in piconewton range between two red blood cells in pair rouleau are performed under physiological conditions using double trap optical tweezers. Aggregation and disaggregation properties of healthy and pathologic (system lupus erythematosis) blood samples are analyzed. Strong difference in aggregation speed and behavior is revealed using the offered method which is proposed to be a promising tool for SLE monitoring at single cell level.

  14. Applied pressure-dependent anisotropic grain connectivity in shock consolidated MgB{sub 2} samples

    Energy Technology Data Exchange (ETDEWEB)

    Ohashi, Wataru [Graduate School of Engineering, University of Yamanashi, Takeda 4-3-11, Kofu 400-8511 (Japan); Takenaka, Kenta [Graduate School of Engineering, University of Yamanashi, Takeda 4-3-11, Kofu 400-8511 (Japan); Kondo, Tadashi [Graduate School of Engineering, University of Yamanashi, Takeda 4-3-11, Kofu 400-8511 (Japan); Tamaki, Hideyuki [Graduate School of Engineering, University of Yamanashi, Takeda 4-3-11, Kofu 400-8511 (Japan); Matsuzawa, Hidenori [Graduate School of Engineering, University of Yamanashi, Takeda 4-3-11, Kofu 400-8511 (Japan)]. E-mail: matuzawa@mx3.nns.ne.jp; Kai, Shoichiro [Advanced Materials and Process Development Group, Explosive Division, Asahi Kasei Chemicals Corporation, Oita 870-0392 (Japan); Kakimoto, Etsuji [Advanced Materials and Process Development Group, Explosive Division, Asahi Kasei Chemicals Corporation, Oita 870-0392 (Japan); Takano, Yoshihiko [National Institute for Materials Science, Tsukuba 305-0047 (Japan); Minehara, Eisuke [FEL Laboratory, Tokai Site, Japan Atomic Energy Research Institute, Shirakata-shirane 2-4, Tokai, Ibaraki 319-1195 (Japan)

    2006-09-15

    Three different cylindrical MgB{sub 2} bulk samples were prepared by the underwater shock consolidation method in which shock waves of several GPa, generated by detonation of explosives, were applied to a metallic cylinder containing commercially available MgB{sub 2} powders with no additives. Resistivity anisotropy of the samples increased with shock pressure. The highest- and medium-pressure applied samples had finite resistivities in the radial direction for the whole temperature range down to 12 K, whereas their axial and azimuthal resistivities dropped to zero at 32-35 K. By contrast, the lowest-pressure applied sample was approximately isotropic with a normal-state resistivity of {approx}40 {mu}{omega} cm, an onset temperature of {approx}38.5 K, and a transition width of {approx}4.5 K. These extremely anisotropic properties would have resulted from the distortion of grain boundaries and grain cores, caused by the shock pressures and their repeated bouncing.

  15. Effects of the shock duration on the response of CFRP composite laminates

    International Nuclear Information System (INIS)

    Gay, Elise; Berthe, Laurent; Boustie, Michel; Arrigoni, Michel; Buzaud, Eric

    2014-01-01

    Shock loads induce a local tensile stress within a sample. The location and amplitude of this high strain rate stress can be monitored respectively by the duration and intensity of the shock. The process is applied to carbon fibre reinforced polymer (CFRP) composites, involved in aeronautic or defense industry. This paper describes the response of CFRP laminates of different thicknesses to a shock load normal to the fibres direction. The effects of the shock duration on the wave propagation are key issues of this work. Experiments have been performed on high power laser facilities and on a high power pulsed generator to get a wide range of pulse duration from fs to µs. Numerical simulation provides a comprehensive approach of the wave propagation and tensile stress generation within these complex materials. The main result concerns the relation between the load duration, the tensile stress and the induced delamination within 1, 4 and 8 ply composite laminates. (paper)

  16. Shock Waves

    CERN Document Server

    Jiang, Z

    2005-01-01

    The International Symposium on Shock Waves (ISSW) is a well established series of conferences held every two years in a different location. A unique feature of the ISSW is the emphasis on bridging the gap between physicists and engineers working in fields as different as gas dynamics, fluid mechanics and materials sciences. The main results presented at these meetings constitute valuable proceedings that offer anyone working in this field an authoritative and comprehensive source of reference.

  17. Direct calculation of unambiguous electron-density distributions of Langmuir-Blodgett films normal to the membrane plane

    International Nuclear Information System (INIS)

    Frieling, M. von; Bradaczek, H.

    1990-01-01

    In regard to X-ray diffraction, Langmuir-Blodgett (LB) films consisting of lipid bilayers represent a 'one-dimensional crystal' with a very small number of unit cells in the direction of stacking. Such bounded systems yield X-ray diffraction diagrams which, in certain respects, contain more information than those of the conventional effectively infinite single crystals. This additional information consists of the profiles of the broadened reflections and their dislocation from the reciprocal-lattice points. These profiles are specific for each different structure and hence enable the direct calculation of unambiguous electron-density distributions from a single set of intensity data. At first, the Q function (the generalized Patterson function), i.e. the distance statistics of the structure sought after is calculated from the intensity data. Thereafter, the unambiguous convolution square root of the Q function must be determined, which is identical to the unknown electron-density distribution. For this purpose two mathematically completely different methods were established and compared. They were applied to diffraction patterns of Langmuir-Blodgett films of simple synthetic lipids with characteristic molecular subunits and showed identical results within the experimental resolution. This verifies the structures and the methods to calculate them. Furthermore, all features of the simple structures were compatible with the expectations. All one-dimensional electron-density distributions showed the common features of lipid bilayers. The characteristic molecular subunits can be recognized and reveal some interesting details. In general, they yield information about orientation, conformation and localization of molecular subunits and membrane components. (orig.)

  18. Relative locations of the bow shocks of the terrestrial planets

    International Nuclear Information System (INIS)

    Russell, C.T.

    1977-01-01

    The observed bow shock encounters at Mercury, Venus and Mars are least square fit using the same technique so that their sizes and shapes can be intercompared. The shock front of Mercury most resembles the terrestrial shock in shape, and the shock stand off distance is consistent with the observed moment. The shapes of the Venus and Mars shock fronts more resemble each other than the earth's and the stand off distances are consistent with direct interaction of the solar wind with the ionosphere on the dayside. The Venus shock is closer to the planet than the Mars shock suggesting more absorption of the solar wind at Venus

  19. Hypoxyradiotherapy: lack of experimental evidence for a preferential radioprotective effect on normal versus tumor tissue as shown by direct oxygenation measurements in experimental sarcomas

    International Nuclear Information System (INIS)

    Kelleher, Debra K.; Thews, Oliver; Vaupel, Peter

    1997-01-01

    Aim: In order to investigate possible pathophysiological mechanisms underlying the postulated preferential protective effect of hypoxia on normal tissue during radiotherapy, the impact of acute respiratory hypoxia (8.2% O 2 + 91.8% N 2 ) on tissue oxygenation was assessed. Methods: Tumor and normal tissue oxygenation was directly determined using O 2 -sensitive electrodes in two experimental rat tumors (DS and Yoshida sarcomas) and in the normal subcutis of the hind foot dorsum. Results: During respiratory hypoxia, arterial blood O 2 tension (pO 2 ), oxyhemoglobin saturation and mean arterial blood pressure decreased. Changes in the arterial blood gas status were accompanied by a reflex hyperventilation leading to hypocapnia and respiratory alkalosis. In the subcutis, tissue oxygenation worsened during acute hypoxia, with decreases in the mean and median pO 2 . Significant increases in the hypoxic fractions were, however, not seen. In tumor tissues, oxygenation also worsened upon hypoxic hypoxia with significant decreases in the mean and median pO 2 and increases in the size of the hypoxic fractions for both sarcomas. Conclusion: These results suggest that during respiratory hypoxia, radiobiologically relevant reductions in the oxygenation (and a subsequent selective radioprotection) of normal tissue may not be achieved. In addition, in the tumor models studied, a worsening of tumor oxygenation was seen which could result in an increased radioresistance

  20. Anodal transcranial direct current stimulation transiently improves contrast sensitivity and normalizes visual cortex activation in individuals with amblyopia.

    Science.gov (United States)

    Spiegel, Daniel P; Byblow, Winston D; Hess, Robert F; Thompson, Benjamin

    2013-10-01

    Amblyopia is a neurodevelopmental disorder of vision that is associated with abnormal patterns of neural inhibition within the visual cortex. This disorder is often considered to be untreatable in adulthood because of insufficient visual cortex plasticity. There is increasing evidence that interventions that target inhibitory interactions within the visual cortex, including certain types of noninvasive brain stimulation, can improve visual function in adults with amblyopia. We tested the hypothesis that anodal transcranial direct current stimulation (a-tDCS) would improve visual function in adults with amblyopia by enhancing the neural response to inputs from the amblyopic eye. Thirteen adults with amblyopia participated and contrast sensitivity in the amblyopic and fellow fixing eye was assessed before, during and after a-tDCS or cathodal tDCS (c-tDCS). Five participants also completed a functional magnetic resonance imaging (fMRI) study designed to investigate the effect of a-tDCS on the blood oxygen level-dependent response within the visual cortex to inputs from the amblyopic versus the fellow fixing eye. A subgroup of 8/13 participants showed a transient improvement in amblyopic eye contrast sensitivity for at least 30 minutes after a-tDCS. fMRI measurements indicated that the characteristic cortical response asymmetry in amblyopes, which favors the fellow eye, was reduced by a-tDCS. These preliminary results suggest that a-tDCS deserves further investigation as a potential tool to enhance amblyopia treatment outcomes in adults.

  1. Non-stationarity of the quasi-perpendicular bow shock: comparison between Cluster observations and simulations

    Directory of Open Access Journals (Sweden)

    H. Comişel

    2011-02-01

    Full Text Available We have performed full particle electromagnetic simulations of a quasi-perpendicular shock. The shock parameters have been chosen to be appropriate for the quasi-perpendicular Earth's bow shock observed by Cluster on 24 January 2001 (Lobzin et al., 2007. We have performed two simulations with different ion to electron mass ratio: run 1 with mi/me=1840 and run 2 with mi/me=100. In run 1 the growth rate of the modified two-stream instability (MTSI is large enough to get excited during the reflection and upstream gyration of part of the incident solar wind ions. The waves due to the MTSI are on the whistler mode branch and have downstream directed phase velocities in the shock frame. The Poynting flux (and wave group velocity far upstream in the foot is also directed in the downstream direction. However, in the density and magnetic field compression region of the overshoot the waves are refracted and the Poynting flux in the shock frame is directed upstream. The MTSI is suppressed in the low mass ratio run 2. The low mass ratio run shows more clearly the non-stationarity of the shock with a larger time scale of the order of an inverse ion gyrofrequency (Ωci: the magnetic field profile flattens and steepens with a period of ~1.5Ωci−1. This non-stationarity is different from reformation seen in previous simulations of perpendicular or quasi-perpendicular shocks. Beginning with a sharp shock ramp the large electric field in the normal direction leads to high reflection rate of solar wind protons. As they propagate upstream, the ion bulk velocity decreases and the magnetic field increases in the foot, which results in a flattening of the magnetic field profile and in a decrease of the normal electric field. Subsequently the reflection rate decreases and the whole shock profile steepens again. Superimposed on this 'breathing' behavior are in the realistic mass ratio case the waves due to the MTSI. The simulations lead us to a re-interpretation of

  2. Shock Tube Measurements for Liquid Fuels Combustion

    National Research Council Canada - National Science Library

    Hanson, Ronald K

    2006-01-01

    ...) fundamental studies of fuel spray evaporation rates and ignition times of low-vapor pressure fuels such as JP-8, diesel fuel and normal alkane surrogates in a new aerosol shock tube using state...

  3. Entropy Generation Across Earth's Bow Shock

    Science.gov (United States)

    Parks, George K.; McCarthy, Michael; Fu, Suiyan; Lee E. s; Cao, Jinbin; Goldstein, Melvyn L.; Canu, Patrick; Dandouras, Iannis S.; Reme, Henri; Fazakerley, Andrew; hide

    2011-01-01

    Earth's bow shock is a transition layer that causes an irreversible change in the state of plasma that is stationary in time. Theories predict entropy increases across the bow shock but entropy has never been directly measured. Cluster and Double Star plasma experiments measure 3D plasma distributions upstream and downstream of the bow shock that allow calculation of Boltzmann's entropy function H and his famous H-theorem, dH/dt O. We present the first direct measurements of entropy density changes across Earth's bow shock. We will show that this entropy generation may be part of the processes that produce the non-thermal plasma distributions is consistent with a kinetic entropy flux model derived from the collisionless Boltzmann equation, giving strong support that solar wind's total entropy across the bow shock remains unchanged. As far as we know, our results are not explained by any existing shock models and should be of interests to theorists.

  4. Shock loading predictions from application of indicial theory to shock-turbulence interactions

    Science.gov (United States)

    Keefe, Laurence R.; Nixon, David

    1991-01-01

    A sequence of steps that permits prediction of some of the characteristics of the pressure field beneath a fluctuating shock wave from knowledge of the oncoming turbulent boundary layer is presented. The theory first predicts the power spectrum and pdf of the position and velocity of the shock wave, which are then used to obtain the shock frequency distribution, and the pdf of the pressure field, as a function of position within the interaction region. To test the validity of the crucial assumption of linearity, the indicial response of a normal shock is calculated from numerical simulation. This indicial response, after being fit by a simple relaxation model, is used to predict the shock position and velocity spectra, along with the shock passage frequency distribution. The low frequency portion of the shock spectra, where most of the energy is concentrated, is satisfactorily predicted by this method.

  5. Shock Prevention

    Science.gov (United States)

    1978-01-01

    The electrician pictured is installing a General Electric Ground Fault Interrupter (GFI), a device which provides protection against electrical shock in the home or in industrial facilities. Shocks due to defective wiring in home appliances or other electrical equipment can cause severe burns, even death. As a result, the National Electrical Code now requires GFIs in all new homes constructed. This particular type of GFI employs a sensing element which derives from technology acquired in space projects by SCI Systems, Inc., Huntsville, Alabama, producer of sensors for GE and other manufacturers of GFI equipment. The sensor is based on the company's experience in developing miniaturized circuitry for space telemetry and other spacecraft electrical systems; this experience enabled SCI to package interruptor circuitry in the extremely limited space available and to produce sensory devices at practicable cost. The tiny sensor measures the strength of the electrical current and detects current differentials that indicate a fault in the functioning of an electrical system. The sensing element then triggers a signal to a disconnect mechanism in the GFI, which cuts off the current in the faulty circuit.

  6. The earth's foreshock, bow shock, and magnetosheath

    Science.gov (United States)

    Onsager, T. G.; Thomsen, M. F.

    1991-01-01

    Studies directly pertaining to the earth's foreshock, bow shock, and magnetosheath are reviewed, and some comparisons are made with data on other planets. Topics considered in detail include the electron foreshock, the ion foreshock, the quasi-parallel shock, the quasi-perpendicular shock, and the magnetosheath. Information discussed spans a broad range of disciplines, from large-scale macroscopic plasma phenomena to small-scale microphysical interactions.

  7. The earth's foreshock, bow shock, and magnetosheath

    International Nuclear Information System (INIS)

    Onsager, T.G.; Thomsen, M.F.

    1991-01-01

    Studies directly pertaining to the earth's foreshock, bow shock, and magnetosheath are reviewed, and some comparisons are made with data on other planets. Topics considered in detail include the electron foreshock, the ion foreshock, the quasi-parallel shock, the quasi-perpendicular shock, and the magnetosheath. Information discussed spans a broad range of disciplines, from large-scale macroscopic plasma phenomena to small-scale microphysical interactions. 184 refs

  8. Heat shock proteins of higher plants

    International Nuclear Information System (INIS)

    Key, J.L.; Lin, C.Y.; Chen, Y.M.

    1981-01-01

    The pattern of protein synthesis changes rapidly and dramatically when the growth temperture of soybean seedling tissue is increased from 28 0 C (normal) to about 40 0 C (heat shock). The synthesis of normal proteins is greatly decreased and a new set of proteins, heat shock proteins, is induced. The heat shock proteins of soybean consist of 10 new bands on one-dimensional NaDodSO 4 gels; a more complex pattern is observed on two-dimensional gels. when the tissue is returned to 28 0 C after 4 hr at 40 0 C, there is progressive decline in the synthesis of heat shock proteins and reappearance of a normal pattern of synthesis by 3 or 4 hr. In vitro translation of poly(A) + RNAs isolated from tissued grown at 28 and 40 0 C shows that the heat shock proteins are translated from a ndw set of mRNAs induced at 40 0 C; furthermore, the abundant class mRNAs for many of the normal proteins persist even though they are translated weakly (or not at all) in vivo at 40 or 42.5 0 C. The heat shock response in soybean appears similar to the much-studied heat shock phenomenon in Drosophila

  9. Evaluation of fault-normal/fault-parallel directions rotated ground motions for response history analysis of an instrumented six-story building

    Science.gov (United States)

    Kalkan, Erol; Kwong, Neal S.

    2012-01-01

    According to regulatory building codes in United States (for example, 2010 California Building Code), at least two horizontal ground-motion components are required for three-dimensional (3D) response history analysis (RHA) of buildings. For sites within 5 km of an active fault, these records should be rotated to fault-normal/fault-parallel (FN/FP) directions, and two RHA analyses should be performed separately (when FN and then FP are aligned with the transverse direction of the structural axes). It is assumed that this approach will lead to two sets of responses that envelope the range of possible responses over all nonredundant rotation angles. This assumption is examined here using a 3D computer model of a six-story reinforced-concrete instrumented building subjected to an ensemble of bidirectional near-fault ground motions. Peak responses of engineering demand parameters (EDPs) were obtained for rotation angles ranging from 0° through 180° for evaluating the FN/FP directions. It is demonstrated that rotating ground motions to FN/FP directions (1) does not always lead to the maximum responses over all angles, (2) does not always envelope the range of possible responses, and (3) does not provide maximum responses for all EDPs simultaneously even if it provides a maximum response for a specific EDP.

  10. Effects of cathodal trans-spinal direct current stimulation on lower urinary tract function in normal and spinal cord injury mice with overactive bladder

    Science.gov (United States)

    Ahmed, Zaghloul

    2017-10-01

    Objective. Lower urinary tract (LUT) dysfunction is a monumental problem affecting quality of life following neurotrauma, such as spinal cord injury (SCI). Proper function of the bladder and its associated structures depends on coordinated activity of the neuronal circuitry in the spinal cord and brain. Disconnection between the spinal and brain centers controlling the LUT causes fundamental changes in the mechanisms involved in the micturition and storage reflexes. We investigated the effects of cathodal trans-spinal direct current stimulation (c-tsDCS) of the lumbosacral spine on bladder and external urinary sphincter (EUS) functions. Approach. We used cystometry and electromyography (EMG), in mice with and without SCI. Main results. c-tsDCS caused initiation of the micturition reflex in urethane-anesthetized normal mice with depressed micturition reflexes. This effect was associated with normalized EUS-EMG activity. Moreover, in urethane-anesthetized normal mice with expressed micturition reflexes, c-tsDCS increased the firing frequency, amplitude, and duration of EUS-EMG activity. These effects were associated with increased maximum intravesical pressure (P max) and intercontraction interval (ICI). In conscious normal animals, c-tsDCS caused significant increases in P max, ICI, threshold pressure (P thres), baseline pressure (P base), and number and amplitude of non-voiding contractions (NVCnumb and P im, respectively). In conscious mice with severe contusive SCI and overactive bladder, c-tsDCS increased P max, ICI, and P thres, but decreased P base, NVCnumb, and P im. c-tsDCS reduced the detrusor-overactivity/cystometry ratio, which is a measure of bladder overactivity associated with renal deterioration. Significance. These results indicate that c-tsDCS induces robust modulation of the lumbosacral spinal-cord circuitry that controls the LUT.

  11. Riboflavin protects mice against liposaccharide-induced shock through expression of heat shock protein 25

    Science.gov (United States)

    Riboflavin (vitamin B2) is a water-soluble vitamin essential for normal cellular functions, growth and development. The study was aimed at investigating the effects of vitamin B2 on the survival rate, and expressions of tissue heat shock protein 25 (HSP25) and heat shock factor 1 (HSF1) in mice und...

  12. Experimental investigation of shock wave - bubble interaction

    Energy Technology Data Exchange (ETDEWEB)

    Alizadeh, Mohsen

    2010-04-09

    expanded beam of a Q-switched laser pulse at wavelength of λ=532 nm and with pulse duration of ∼4 ns is focused at the center of a water tank using an aberration minimized lens design. Single cavitation bubbles are initiated via optical breakdown at this location which coincides with the position of which the shock wave is focused. The energy of the shock wave source has been altered in 8 steps. The pressure pulse amplitude of the impinging shock wave measured at the distance of about 1.8 mm above the focus location range from 24.4 MPa to 108.1 MPa. The lithotripter shock wave impact time is varied in three steps which provides the possibility of investigation of the bubble dynamics in both cases of collapsing and expanding cavities at the moment of the shock wave impingement. After the shock wave impact, the bubble spherical symmetry is broken and a liquid jet develops in the original direction of the shock propagation. The speed of the jet is increasing with the shock wave energy. Due to the energy transfer from the shock wave to the bubble, the forced cavity implosion is more violent in comparison to free oscillation. The pressure pulse amplitude released from the forced bubble collapse is amplified and the collapse time is reduced. These effects are discussed in chapter 5. Generally, when the bubble is collapsing at the time of the shock impact, the forced cavity collapse is more violent with a resultant of more pressure enhancement compared to the expanding bubbles at the moment of the shock arrival. The maximum pressure enhancement and reduction of bubble collapse time occur when the time interval between the moments of the shock impact and bubble collapse approaches the pulse duration of the compression part of the shock wave profile (i.e. ∼1 μs). For each specific shock wave arrival time, increasing the shock intensity leads to the fact that the bubble collapse takes place earlier relative to the moment of the shock impact and having more collapse pressure

  13. Removal of spurious normal polarity directions in the Kanapoi Formation with progressive thermal demagnetization: implications for dating Pliocene hominin fossils from the Turkana Basin of Kenya

    Science.gov (United States)

    Lepre, C. J.; Kent, D.

    2017-12-01

    The Kanapoi Formation is a 75-m-thick sedimentary unit in northern Kenya whose fossil record documents the evolution of the genus Australopithecus and habitual bipedalism in Pliocene hominins. Published 40Ar/39Ar dates of 4.20 to 4.10 Ma for three aqueously reworked tuffs from the lower and middle stratigraphic intervals of the formation and a whole-rock K-Ar date of 3.4 ± 0.1 Ma on the Kalokwanya Basalt, which caps the succession, coupled with paleomagnetic data from an unpublished thesis have been used to constrain the age of the unit (McDougall+2012 J Geol Soc). Normal polarities at the base of the formation were correlated to normal subchron C3n.1n (Cochiti Subchron) and would extend the Kanapoi chronostratigraphy back to between 4.29 and 4.18 Ma. The credibility of the normal polarities at the base and elsewhere in the formation as records of the geomagnetic field at the time of deposition, however, is called into question by the ubiquity of the high-coercivity mineral hematite in the Kanapoi sediments and the alternating field demagnetization methods exclusively used to generate the polarity directions. We tested this proposed chronostratigraphy of the Kanapoi Fm by collecting nearly 70 independently orientated block samples from 10 outcrop localities, which sampled roughly two-thirds of the total stratigraphic thickness of the formation and covered the entire vertical extent of the supposed basal normal polarity magnetozone. For most every specimen, stepwise thermal demagnetization (TD) resolved well-defined characteristic magnetizations of uniformly reverse polarity and were carried by a high-temperature component consistent with hematite. TD of the Kalokwanya Basalt confirmed its reverse magnetic polarity, which implies emplacement most likely prior to the base of normal Chron C2An (Gauss Chron) at 3.58 Ma. Kanapoi sediments thus accumulated sometime during reverse subchron C2Ar (4.18-3.58 Ma) but over a period of much less than 600 kyr. Basal age control

  14. Complex flow morphologies in shock-accelerated gaseous flows

    Science.gov (United States)

    Kumar, S.; Vorobieff, P.; Orlicz, G.; Palekar, A.; Tomkins, C.; Goodenough, C.; Marr-Lyon, M.; Prestridge, K. P.; Benjamin, R. F.

    2007-11-01

    A Mach 1.2 planar shock wave impulsively and simultaneously accelerates a row of three heavy gas (SF 6) cylinders surrounded by a lighter gas (air), producing pairs of vortex columns. The heavy gas cylinders (nozzle diameter D) are initially equidistant in the spanwise direction (center to center spacing S), with S/D=1.5. The interaction of the vortex columns is investigated with planar laser-induced fluorescence (PLIF) in the plane normal to the axes of the cylinders. Several distinct post-shock morphologies are observed, apparently due to rather small variations of the initial conditions. We report the variation of the streamwise and spanwise growth rates of the integral scales for these flow morphologies.

  15. Collisionless electrostatic shocks

    DEFF Research Database (Denmark)

    Andersen, H.K.; Andersen, S.A.; Jensen, Vagn Orla

    1970-01-01

    An attempt was made in the laboratory to observe the standing collisionless electrostatic shocks in connection with the bow shock of the earth......An attempt was made in the laboratory to observe the standing collisionless electrostatic shocks in connection with the bow shock of the earth...

  16. Development of the apparatus for measuring magnetic properties of electrical steel sheets in arbitrary directions under compressive stress normal to their surface

    Directory of Open Access Journals (Sweden)

    Yoshitaka Maeda

    2017-05-01

    Full Text Available In designing motors, one must grasp the magnetic properties of electrical steel sheets considering actual conditions in motors. Especially important is grasping the stress dependence of magnetic power loss. This paper describes a newly developed apparatus to measure two-dimensional (2-D magnetic properties (properties under the arbitrary alternating and the rotating flux conditions of electrical steel sheets under compressive stress normal to the sheet surface. The apparatus has a 2-D magnetic excitation circuit to generate magnetic fields in arbitrary directions in the evaluation area. It also has a pressing unit to apply compressive stress normal to the sheet surface. During measurement, it is important to apply uniform stress throughout the evaluation area. Therefore, we have developed a new flux density sensor using needle probe method. It is composed of thin copper foils sputtered on electrical steel sheets. By using this sensor, the stress can be applied to the surface of the specimen without influence of this sensor. This paper described the details of newly developed apparatus with this sensor, and measurement results of iron loss by using are shown.

  17. Development of the apparatus for measuring magnetic properties of electrical steel sheets in arbitrary directions under compressive stress normal to their surface

    Science.gov (United States)

    Maeda, Yoshitaka; Urata, Shinya; Nakai, Hideo; Takeuchi, Yuuya; Yun, Kyyoul; Yanase, Shunji; Okazaki, Yasuo

    2017-05-01

    In designing motors, one must grasp the magnetic properties of electrical steel sheets considering actual conditions in motors. Especially important is grasping the stress dependence of magnetic power loss. This paper describes a newly developed apparatus to measure two-dimensional (2-D) magnetic properties (properties under the arbitrary alternating and the rotating flux conditions) of electrical steel sheets under compressive stress normal to the sheet surface. The apparatus has a 2-D magnetic excitation circuit to generate magnetic fields in arbitrary directions in the evaluation area. It also has a pressing unit to apply compressive stress normal to the sheet surface. During measurement, it is important to apply uniform stress throughout the evaluation area. Therefore, we have developed a new flux density sensor using needle probe method. It is composed of thin copper foils sputtered on electrical steel sheets. By using this sensor, the stress can be applied to the surface of the specimen without influence of this sensor. This paper described the details of newly developed apparatus with this sensor, and measurement results of iron loss by using are shown.

  18. PIV tracer behavior on propagating shock fronts

    International Nuclear Information System (INIS)

    Glazyrin, Fyodor N; Mursenkova, Irina V; Znamenskaya, Irina A

    2016-01-01

    The present work was aimed at the quantitative particle image velocimetry (PIV) measurement of a velocity field near the front of a propagating shock wave and the study of the dynamics of liquid tracers crossing the shock front. For this goal, a shock tube with a rectangular cross-section (48  ×  24 mm) was used. The flat shock wave with Mach numbers M  =  1.4–2.0 propagating inside the tube channel was studied as well as an expanding shock wave propagating outside the channel with M  =  1.2–1.8 at its main axis. The PIV imaging of the shock fronts was carried out with an aerosol of dioctyl sebacate (DEHS) as tracer particles. The pressures of the gas in front of the shock waves studied ranged from 0.013 Mpa to 0.1 MPa in the series of experiments. The processed PIV data, compared to the 1D normal shock theory, yielded consistent values of wake velocity immediately behind the plain shock wave. Special attention was paid to the blurring of the velocity jump on the shock front due to the inertial particle lag and peculiarities of the PIV technique. A numerical algorithm was developed for analysis and correction of the PIV data on the shock fronts, based on equations of particle-flow interaction. By application of this algorithm, the effective particle diameter of the DEHS aerosol tracers was estimated as 1.03  ±  0.12 μm. A number of different formulations for particle drag were tested with this algorithm, with varying success. The results show consistency with previously reported experimental data obtained for cases of stationary shock waves. (paper)

  19. Passive shock wave/boundary layer control of wing at transonic speeds

    Directory of Open Access Journals (Sweden)

    Ling Zhou

    2017-11-01

    Full Text Available At supercritical conditions a porous strip (or slot strip placed beneath a shock wave can reduce the drag by a weaker lambda shock system, and increase the buffet boundary, even may increase the lift. Passive shock wave/boundary layer control (PSBC for drag reduction was conducted by SC(2-0714 supercritical wing, with emphases on parameter of porous/slot and bump, such as porous distribution, hole diameter, cavity depth, porous direction and so on. A sequential quadratic programming (SQP optimization method coupled with adjoint method was adopted to achieve the optimized shape and position of the bumps. Computational fluid dynamics (CFD, force test and oil test with half model all indicate that PSBC with porous, slot and bump generally reduce the drag by weaker lambda shock at supercritical conditions. According to wind tunnel test results for angle of attack of 2° at Mach number M=0.8, the porous configuration with 6.21% porosity results in a drag reduction of 0.0002 and lift–drag ratio increase of 0.2, the small bump configuration results in a drag reduction of 0.0007 and lift–drag ratio increase of 0.3. Bump normally reduce drag at design point with shock wave position being accurately computed. If bump diverges from the position of shock wave, drag will not be easily reduced.

  20. Interaction between a normal shock wave and a turbulent boundary layer at high transonic speeds. Part 1: Pressure distribution. Part 2: Wall shear stress. Part 3: Simplified formulas for the prediction of surface pressures and skin friction

    Science.gov (United States)

    Adamson, T. C., Jr.; Liou, M. S.; Messiter, A. F.

    1980-01-01

    An asymptotic description is derived for the interaction between a shock wave and a turbulent boundary layer in transonic flow, for a particular limiting case. The dimensionless difference between the external flow velocity and critical sound speed is taken to be much smaller than one, but large in comparison with the dimensionless friction velocity. The basic results are derived for a flat plate, and corrections for longitudinal wall curvature and for flow in a circular pipe are also shown. Solutions are given for the wall pressure distribution and the shape of the shock wave. Solutions for the wall shear stress are obtained, and a criterion for incipient separation is derived. Simplified solutions for both the wall pressure and skin friction distributions in the interaction region are given. These results are presented in a form suitable for use in computer programs.

  1. Interaction of Accretion Shocks with Winds Kinsuk Acharya , Sandip ...

    Indian Academy of Sciences (India)

    R. Narasimhan (Krishtel eMaging) 1461 1996 Oct 15 13:05:22

    Abstract. Accretion shocks are known to oscillate in presence of cool- ing processes in the disk. This oscillation may also cause quasi-periodic oscillations of black holes. In the presence of strong winds, these shocks have oscillations in vertical direction as well. We show examples of shock oscillations under the influence of ...

  2. A shock surface geometry - The February 15-16, 1967, event. [solar flare associated interplanetary shock

    Science.gov (United States)

    Lepping, R. P.; Chao, J. K.

    1976-01-01

    An estimated shape is presented for the surface of the flare-associated interplanetary shock of February 15-16, 1967, as seen in the ecliptic-plane cross section. The estimate is based on observations by Explorer 33 and Pioneers 6 and 7. The estimated shock normal at the Explorer 33 position is obtained by a least-squares shock parameter-fitting procedure for that satellite's data; the shock normal at the Pioneer 7 position is found by using the magnetic coplanarity theorem and magnetic-field data. The average shock speed from the sun to each spacecraft is determined along with the local speed at Explorer 33 and the relations between these speeds and the position of the initiating solar flare. The Explorer 33 shock normal is found to be severely inclined and not typical of interplanetary shocks. It is shown that the curvature of the shock surface in the ecliptic plane near the earth-Pioneer 7 region is consistent with a radius of not more than 0.4 AU.

  3. Geometrical shock dynamics for magnetohydrodynamic fast shocks

    KAUST Repository

    Mostert, W.; Pullin, D. I.; Samtaney, Ravi; Wheatley, V.

    2016-01-01

    We describe a formulation of two-dimensional geometrical shock dynamics (GSD) suitable for ideal magnetohydrodynamic (MHD) fast shocks under magnetic fields of general strength and orientation. The resulting area–Mach-number–shock-angle relation is then incorporated into a numerical method using pseudospectral differentiation. The MHD-GSD model is verified by comparison with results from nonlinear finite-volume solution of the complete ideal MHD equations applied to a shock implosion flow in the presence of an oblique and spatially varying magnetic field ahead of the shock. Results from application of the MHD-GSD equations to the stability of fast MHD shocks in two dimensions are presented. It is shown that the time to formation of triple points for both perturbed MHD and gas-dynamic shocks increases as (Formula presented.), where (Formula presented.) is a measure of the initial Mach-number perturbation. Symmetry breaking in the MHD case is demonstrated. In cylindrical converging geometry, in the presence of an azimuthal field produced by a line current, the MHD shock behaves in the mean as in Pullin et al. (Phys. Fluids, vol. 26, 2014, 097103), but suffers a greater relative pressure fluctuation along the shock than the gas-dynamic shock. © 2016 Cambridge University Press

  4. Geometrical shock dynamics for magnetohydrodynamic fast shocks

    KAUST Repository

    Mostert, W.

    2016-12-12

    We describe a formulation of two-dimensional geometrical shock dynamics (GSD) suitable for ideal magnetohydrodynamic (MHD) fast shocks under magnetic fields of general strength and orientation. The resulting area–Mach-number–shock-angle relation is then incorporated into a numerical method using pseudospectral differentiation. The MHD-GSD model is verified by comparison with results from nonlinear finite-volume solution of the complete ideal MHD equations applied to a shock implosion flow in the presence of an oblique and spatially varying magnetic field ahead of the shock. Results from application of the MHD-GSD equations to the stability of fast MHD shocks in two dimensions are presented. It is shown that the time to formation of triple points for both perturbed MHD and gas-dynamic shocks increases as (Formula presented.), where (Formula presented.) is a measure of the initial Mach-number perturbation. Symmetry breaking in the MHD case is demonstrated. In cylindrical converging geometry, in the presence of an azimuthal field produced by a line current, the MHD shock behaves in the mean as in Pullin et al. (Phys. Fluids, vol. 26, 2014, 097103), but suffers a greater relative pressure fluctuation along the shock than the gas-dynamic shock. © 2016 Cambridge University Press

  5. Shock waves in helium at low temperatures

    International Nuclear Information System (INIS)

    Liepmann, H.W.; Torczynski, J.R.

    1986-01-01

    Results are reported from studies of the properties of low temperature He-4 using shock waves as a probe. Ideal shock tube theory is used to show that sonic speeds of Mach 40 are attainable in He at 300 K. Viscosity reductions at lower temperatures minimize boundary layer effects at the side walls. A two-fluid model is described to account for the phase transition which He undergoes at temperatures below 2.2 K, after which the quantum fluid (He II) and the normal compressed superfluid (He I) coexist. Analytic models are provided for pressure-induced shocks in He I and temperature-induced shock waves (called second sound) which appear in He II. The vapor-fluid interface of He I is capable of reflecting second and gasdynamic sound shocks, which can therefore be used as probes for studying phase transitions between He I and He II. 17 references

  6. The Direct and Indirect Impact of Pharmaceutical Industry in Economic Expansion and Job Creation: Evidence from Bootstrapping and Normal Theory Methods

    Directory of Open Access Journals (Sweden)

    Rizwan Raheem Ahmed

    2018-05-01

    Full Text Available The objective of this research article is to examine the role of Pakistan’s pharmaceutical industry in job creation opportunities, with the sacred intention to eradicate poverty, and expansion in economic activities. This research is quantitative in nature, and the data is directly gathered through closed-ended questionnaires from 300 respondents. Besides predictors’, four mediating variables have also been taken into consideration that contribute indirectly in job creation opportunities. Bootstrapping and Normal theory methods have been employed in order to examine the impact of predictors’ and mediating variables. The result of this research confirmed that pharmaceutical industry plays a vital role in job creation in Pakistan. It is further concluded that the pharmaceutical industry has a direct and significant impact in job creation by providing indigenous and direct job opportunities in sales, marketing, and other supporting departments for both skilled and unskilled workers. Pharmaceutical industry also provides indirect job opportunities through other industries, which are very much linked with this industry, such as: pharmaceutical distributors, dealers, retailers, wholesalers, hotel industry, and event management industry. It is also determined that pharmaceutical industry is acting like knowledge and skills imparting institutions. Therefore, skilled-based training and organizational learning are major mediating variables that transform unskilled people into human assets, which further trigger the future job prospects. Since pharmaceutical industry is one of the biggest industries in Pakistan, providing plenteous opportunities of new jobs with consistent growth. Thus, mediating variables such as motivation and interpersonal influence also preceded an active role in new job creation

  7. Current Opinions in Pediatric Septic Shock

    Directory of Open Access Journals (Sweden)

    José Irazuzta

    2009-11-01

    Full Text Available Objectives: Our aim is to describe the current clinical practice related to the management of septic shock (SS. Methods: Review of medical literature using the MEDLINE database. Articles were selected according to their relevancy to the objective and according to the author’s opinion. Summary of the findings: The outcome from SS is dependent on an early recognition and a sequential implementation of time-sensitive goal-directed therapies. The goals of the resuscitation are rapid restoration of micro circulation and improved organ tissue perfusion. Clinical and laboratory markers are needed to assess the adequacy of the treatments. Initial resuscitation involves the use of isotonic solutions (>60ml/kg either crystalloid (normal saline or colloid infusion often followed by vasoactive medications. Altered pharmacokinetics and pharmacodynamics responses dictate that vasoactive agents should be adjusted to achieve predetermined goals. An assessment of central venous pressure complements clinical and serological findings to tailor therapies. Elective airway instrumentation and mechanical ventilation as well as adjunctive therapy with stress dose of corticosteroid are indicated in selected populations. In neonates, a special attention to the presence of electrolyte imbalance and increase pulmonary vascular resistance needs to be considered early. Conclusions: Septic shock hemodynamic is a changing process that requires frequent assessment and therapeutic adjustments.

  8. Formation of fast shocks by magnetic reconnection in the solar corona

    International Nuclear Information System (INIS)

    Hsieh, M. H.; Tsai, C. L.; Ma, Z. W.; Lee, L. C.

    2009-01-01

    Reconnections of magnetic fields over the solar surface are expected to generate abundant magnetohydrodynamic (MHD) discontinuities and shocks, including slow shocks and rotational discontinuities. However, the generation of fast shocks by magnetic reconnection process is relatively not well studied. In this paper, magnetic reconnection in a current sheet is studied based on two-dimensional resistive MHD numerical simulations. Magnetic reconnections in the current sheet lead to the formation of plasma jets and plasma bulges. It is further found that the plasma bulges, the leading part of plasma jets, in turn lead to the generation of fast shocks on flanks of the bulges. The simulation results show that during the magnetic reconnection process, the plasma forms a series of structures: plasma jets, plasma bulges, and fast shocks. As time increases, the bulges spread out along the current sheet (±z direction) and the fast shocks move just ahead of the bulges. The effects of initial parameters ρ s /ρ m , β ∞ , and t rec on the fast shock generation are also examined, where ρ s /ρ m is the ratio of plasma densities on two sides of the initial current sheet, β ∞ =P ∞ /(B ∞ 2 /2μ 0 ), P ∞ is the plasma pressure and B ∞ is the magnetic field magnitude far from the current sheet, and t rec is the reconnection duration. In the asymmetric case with ρ s /ρ m =2, β ∞ =0.01 and t rec =1000, the maximum Alfven Mach number of fast shocks (M A1max ) is M A1max congruent with 1.1, where M A1 =V n1 /V A1 , and V n1 and V A1 are, respectively, the normal upstream fluid velocity and the upstream Alfven speed in the fast shocks frame. As the density ratio ρ s /ρ m (=1-8) and plasma beta β ∞ (=0.0001-1) increase, M A1max varies slightly. For the case with a large plasma beta β ∞ (=5), the fast shock is very weak. As the reconnection duration t rec increases, the bulges lead to generation of fast shocks with a higher M A1max . The present results can be

  9. Augmentation of DAA Staggered – Solution Equations in Underwater Shock Problems for Singular Structural Mass Matrices

    OpenAIRE

    DeRuntz Jr., John A.

    2005-01-01

    The numerical solution of underwater shock fluid – structure interaction problems using boundary element/finite element techniques became tractable through the development of the family of Doubly Asymptotic Approximations (DAA). Practical implementation of the method has relied on the so-called augmentation of the DAA equations. The fluid and structural systems are respectively coupled by the structural acceleration vector in the surface normal direction on the right hand side of the DAA equa...

  10. Design and Implementation of a Dual-Mass MEMS Gyroscope with High Shock Resistance.

    Science.gov (United States)

    Gao, Yang; Huang, Libin; Ding, Xukai; Li, Hongsheng

    2018-03-30

    This paper presents the design and implementation of a dual-mass MEMS gyroscope with high shock resistance by improving the in-phase frequency of the gyroscope and by using a two-stage elastic stopper mechanism and proposes a Simulink shock model of the gyroscope equipped with the two-stage stopper mechanism, which is a very efficient method to evaluate the shock resistance of the gyroscope. The structural design takes into account both the mechanical sensitivity and the shock resistance. The design of the primary structure and the analysis of the stopper mechanism are first introduced. Based on the expression of the restoring force of the stopper beam, the analytical shock response model of the gyroscope is obtained. By this model, the shock response of the gyroscope is theoretically analyzed, and the appropriate structural parameters are obtained. Then, the correctness of the model is verified by finite element (FE) analysis, where the contact collision analysis is introduced in detail. The simulation results show that the application of the two-stage elastic stopper mechanism can effectively improve the shock resistance by more than 1900 g and 1500 g in the x - and y -directions, respectively. Finally, experimental verifications are carried out by using a machete hammer on the micro-gyroscope prototype fabricated by the deep dry silicon on glass (DDSOG) technology. The results show that the shock resistance of the prototype along the x -, y - and z -axes all exceed 10,000 g. Moreover, the output of the gyroscope can return to normal in about 2 s.

  11. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  12. Radiation Modeling with Direct Simulation Monte Carlo

    Science.gov (United States)

    Carlson, Ann B.; Hassan, H. A.

    1991-01-01

    Improvements in the modeling of radiation in low density shock waves with direct simulation Monte Carlo (DSMC) are the subject of this study. A new scheme to determine the relaxation collision numbers for excitation of electronic states is proposed. This scheme attempts to move the DSMC programs toward a more detailed modeling of the physics and more reliance on available rate data. The new method is compared with the current modeling technique and both techniques are compared with available experimental data. The differences in the results are evaluated. The test case is based on experimental measurements from the AVCO-Everett Research Laboratory electric arc-driven shock tube of a normal shock wave in air at 10 km/s and .1 Torr. The new method agrees with the available data as well as the results from the earlier scheme and is more easily extrapolated to di erent ow conditions.

  13. Modified two-body potential approach to the peripheral direct capture astrophysical a+A->B+γ reaction and asymptotic normalization coefficients

    International Nuclear Information System (INIS)

    Igamov, S.B.; Yarmukhamedov, R.

    2007-01-01

    A modified two-body potential approach is proposed for determination of both the asymptotic normalization coefficient (ANC) (or the respective nuclear vertex constant (NVC)) for the A+a->B (for the virtual decay B->A+a) from an analysis of the experimental S-factor for the peripheral direct capture a+A->B+γ reaction and the astrophysical S-factor, S(E), at low experimentally inaccessible energy regions. The approach proposed involves two additional conditions which verify the peripheral character of the considered reaction and expresses S(E) in terms of the ANC. The connection between NVC (ANC) and the effective range parameters for Aa-scattering is derived. To test this approach we reanalyse the precise experimental astrophysical S-factors for t+α->Li7+γ reaction at energies E= Li7(g.s.), α+t->Li7(0.478 MeV) and of S(E) at E=<50 keV. These ANC values have been used for getting information about the ''indirect'' measured values of the effective range parameters and the p-wave phase shift for αt-scattering in the energy range of 100-bar E-bar 180 keV

  14. Effects of Shock and Turbulence Properties on Electron Acceleration

    Science.gov (United States)

    Qin, G.; Kong, F.-J.; Zhang, L.-H.

    2018-06-01

    Using test particle simulations, we study electron acceleration at collisionless shocks with a two-component model turbulent magnetic field with slab component including dissipation range. We investigate the importance of the shock-normal angle θ Bn, magnetic turbulence level {(b/{B}0)}2, and shock thickness on the acceleration efficiency of electrons. It is shown that at perpendicular shocks the electron acceleration efficiency is enhanced with the decrease of {(b/{B}0)}2, and at {(b/{B}0)}2=0.01 the acceleration becomes significant due to a strong drift electric field with long time particles staying near the shock front for shock drift acceleration (SDA). In addition, at parallel shocks the electron acceleration efficiency is increasing with the increase of {(b/{B}0)}2, and at {(b/{B}0)}2=10.0 the acceleration is very strong due to sufficient pitch-angle scattering for first-order Fermi acceleration, as well as due to the large local component of the magnetic field perpendicular to the shock-normal angle for SDA. On the other hand, the high perpendicular shock acceleration with {(b/{B}0)}2=0.01 is stronger than the high parallel shock acceleration with {(b/{B}0)}2=10.0, the reason might be the assumption that SDA is more efficient than first-order Fermi acceleration. Furthermore, for oblique shocks, the acceleration efficiency is small no matter whether the turbulence level is low or high. Moreover, for the effect of shock thickness on electron acceleration at perpendicular shocks, we show that there exists the bendover thickness, L diff,b. The acceleration efficiency does not noticeably change if the shock thickness is much smaller than L diff,b. However, if the shock thickness is much larger than L diff,b, the acceleration efficiency starts to drop abruptly.

  15. Miniature shock tube for laser driven shocks.

    Science.gov (United States)

    Busquet, Michel; Barroso, Patrice; Melse, Thierry; Bauduin, Daniel

    2010-02-01

    We describe in this paper the design of a miniature shock tube (smaller than 1 cm(3)) that can be placed in a vacuum vessel and allows transverse optical probing and longitudinal backside extreme ultraviolet emission spectroscopy in the 100-500 A range. Typical application is the study of laser launched radiative shocks, in the framework of what is called "laboratory astrophysics."

  16. Are Credit Shocks Supply or Demand Shocks?

    OpenAIRE

    Bijapur, Mohan

    2013-01-01

    This paper provides new insights into the relationship between the supply of credit and the macroeconomy. We present evidence that credit shocks constitute shocks to aggregate supply in that they have a permanent effect on output and cause inflation to rise in the short term. Our results also suggest that the effects on aggregate supply have grown stronger in recent decades.

  17. Melting under shock compression

    International Nuclear Information System (INIS)

    Bennett, B.I.

    1980-10-01

    A simple model, using experimentally measured shock and particle velocities, is applied to the Lindemann melting formula to predict the density, temperature, and pressure at which a material will melt when shocked from room temperature and zero pressure initial conditions

  18. Sphingosine-1-Phosphate (S1P) Is a Feasible Biomarker in Predicting the Efficacy of Polymyxin B-Immobilized Fiber Direct Hemoperfusion (PMX-DHP) in Patients with Septic Shock.

    Science.gov (United States)

    Inoue, Satoshi; Sakamoto, Yuichiro; Koami, Hiroyuki; Yamada C, Kosuke; Nagashima, Futoshi; Miike, Toru; Iwamura, Takashi; Obata, Toru

    2018-01-01

    The aim of this study was to identify a useful biomarker to predict the efficacy of polymyxin B-immobilized fiber direct hemoperfusion (PMX-DHP) in patients with septic shock. The 44 patients included in this study were divided into two groups. Group A had an increase in systolic blood pressure (SBP) over 30 mmHg after PMX-DHP treatment. Group B had an increase in SBP less than 30 mmHg after PMX-DHP treatment. We evaluated the clinical characteristics and demographics of both groups. We also assessed whether the cause of sepsis affected the efficacy of PMX-DHP and compared the prognosis of both groups. Finally, we investigated whether there were any significant differences in the levels of sepsis-related biomarkers, including sphingosine-1-phosphate (S1P), between both groups before PMX-DHP in an effort to identify a biomarker that could predict the efficacy of PMX-DHP. PMX-DHP significantly increased SBP regardless of the cause of sepsis. Although there was some tendency, PMX-DHP did not significantly improve the prognosis of effective cases in comparison with non-effective cases, probably because of the limited number of patients included. Among the sepsis-related biomarkers, only S1P values were significantly different between the two groups before PMX-DHP, and S1P levels were significantly increased after treatment in the effective cases. S1P levels prior to PMX-DHP can be used to predict its efficacy. In addition, continuous monitoring of S1P levels can indicate the effectiveness of PMX-DHP in patients with septic shock.

  19. Biomass shock pretreatment

    Science.gov (United States)

    Holtzapple, Mark T.; Madison, Maxine Jones; Ramirez, Rocio Sierra; Deimund, Mark A.; Falls, Matthew; Dunkelman, John J.

    2014-07-01

    Methods and apparatus for treating biomass that may include introducing a biomass to a chamber; exposing the biomass in the chamber to a shock event to produce a shocked biomass; and transferring the shocked biomass from the chamber. In some aspects, the method may include pretreating the biomass with a chemical before introducing the biomass to the chamber and/or after transferring shocked biomass from the chamber.

  20. 1,3,5-Trihydroxy-13,13-dimethyl-2H-pyran [7,6-b] xanthone directly targets heat shock protein 27 in hepatocellular carcinoma.

    Science.gov (United States)

    Fu, Wei-Ming; Wang, Wei-Mao; Wang, Hua; Zhu, Xiao; Liang, Yan; Kung, Hsiang-Fu; Zhang, Jin-Fang

    2014-02-01

    We previously showed that the small molecule 1,3,5-trihydroxy-13,13-dimethyl-2H-pyran [7,6-b] xanthone (TDP) induces apoptosis in hepatocellular carcinoma (HCC) by suppressing Hsp27 expression, although the mechanism is not fully understood. To investigate the functional association between TDP and Hsp27 protein in HCC, recombinant Hsp27 protein was incubated with TDP at room temperature, and assayed by mass spectrum (MS) and natural electrophoresis. TDP effectively stimulated Hsp27 to form aggregates ex vitro, leading to suppression of its chaperone activity. The aggregates were degraded by the ubiquitin-proteasome (UPS) pathway. TDP directly interacted with Asp17 and Phe55 in chain C of Hsp27 on the basis of bioinformatic prediction. In conclusion, Hsp27 is a direct target of TDP in its anti-cancer activity, which provides strong support for a clinical application. © 2013 International Federation for Cell Biology.

  1. Relativistic Shock Acceleration

    International Nuclear Information System (INIS)

    Duffy, P.; Downes, T.P.; Gallant, Y.A.; Kirk, J.G.

    1999-01-01

    In this paper we briefly review the basic theory of shock waves in relativistic hydrodynamics and magneto-hydrodynamics, emphasising some astrophysically interesting cases. We then present an overview of the theory of particle acceleration at such shocks describing the methods used to calculate the spectral indices of energetic particles. Recent results on acceleration at ultra-relativistic shocks are discussed. (author)

  2. Surface instabilities in shock loaded granular media

    Science.gov (United States)

    Kandan, K.; Khaderi, S. N.; Wadley, H. N. G.; Deshpande, V. S.

    2017-12-01

    The initiation and growth of instabilities in granular materials loaded by air shock waves are investigated via shock-tube experiments and numerical calculations. Three types of granular media, dry sand, water-saturated sand and a granular solid comprising PTFE spheres were experimentally investigated by air shock loading slugs of these materials in a transparent shock tube. Under all shock pressures considered here, the free-standing dry sand slugs remained stable while the shock loaded surface of the water-saturated sand slug became unstable resulting in mixing of the shocked air and the granular material. By contrast, the PTFE slugs were stable at low pressures but displayed instabilities similar to the water-saturated sand slugs at higher shock pressures. The distal surfaces of the slugs remained stable under all conditions considered here. Eulerian fluid/solid interaction calculations, with the granular material modelled as a Drucker-Prager solid, reproduced the onset of the instabilities as seen in the experiments to a high level of accuracy. These calculations showed that the shock pressures to initiate instabilities increased with increasing material friction and decreasing yield strain. Moreover, the high Atwood number for this problem implied that fluid/solid interaction effects were small, and the initiation of the instability is adequately captured by directly applying a pressure on the slug surface. Lagrangian calculations with the directly applied pressures demonstrated that the instability was caused by spatial pressure gradients created by initial surface perturbations. Surface instabilities are also shown to exist in shock loaded rear-supported granular slugs: these experiments and calculations are used to infer the velocity that free-standing slugs need to acquire to initiate instabilities on their front surfaces. The results presented here, while in an idealised one-dimensional setting, provide physical understanding of the conditions required to

  3. Impact of Shock Front Rippling and Self-reformation on the Electron Dynamics at Low-Mach-number Shocks

    Science.gov (United States)

    Yang, Zhongwei; Lu, Quanming; Liu, Ying D.; Wang, Rui

    2018-04-01

    Electron dynamics at low-Mach-number collisionless shocks are investigated by using two-dimensional electromagnetic particle-in-cell simulations with various shock normal angles. We found: (1) The reflected ions and incident electrons at the shock front provide an effective mechanism for the quasi-electrostatic wave generation due to the charge-separation. A fraction of incident electrons can be effectively trapped and accelerated at the leading edge of the shock foot. (2) At quasi-perpendicular shocks, the electron trapping and reflection is nonuniform due to the shock rippling along the shock surface and is more likely to take place at some locations accompanied by intense reflected ion-beams. The electron trapping process has a periodical evolution over time due to the shock front self-reformation, which is controlled by ion dynamics. Thus, this is a cross-scale coupling phenomenon. (3) At quasi-parallel shocks, reflected ions can travel far back upstream. Consequently, quasi-electrostatic waves can be excited in the shock transition and the foreshock region. The electron trajectory analysis shows these waves can trap electrons at the foot region and reflect a fraction of them far back upstream. Simulation runs in this paper indicate that the micro-turbulence at the shock foot can provide a possible scenario for producing the reflected electron beam, which is a basic condition for the type II radio burst emission at low-Mach-number interplanetary shocks driven by Coronal Mass Ejections (CMEs).

  4. Comment on Risk Shocks by Christiano, Motto, and Rostagno (2014)

    OpenAIRE

    Lee, Gabriel; Salyer, Kevin; Strobel, Johannes

    2016-01-01

    In a recent paper, Christiano, Motto and Rostagno (2014, henceforth CMR) report that risk shocks are the most important source of business cycle fluctuations. This result is in contrast to much of the existing literature; e.g. Bachmann and Bayer (2013) report that risk shocks account for 4% of the volatility in GDP. We resolve this apparent contradiction by first highlighting that CMR depart from the normal definition of a risk shock by including an additional \

  5. Two dimensional hybrid simulation of a curved bow shock

    International Nuclear Information System (INIS)

    Thomas, V.A.; Winske, D.

    1990-01-01

    Results are presented from two dimensional hybrid simulations of curved collisionless supercritical shocks, retaining both quasi-perpendicular and quasi-parallel sections of the shock in order to study the character and origin of the foreshock ion population. The simulations demonstrate that the foreshock ion population is dominated by ions impinging upon the quasi-parallel side of the shock, while nonlocal transport from the quasi-perpendicular side of the shock into the foreshock region is minimal. Further, it is shown that the ions gain energy by drifting significantly in the direction of the convection electric field through multiple shock encounters

  6. Shock propagation in a heterogeneous medium

    International Nuclear Information System (INIS)

    Elbaz, D.

    2011-01-01

    In the frame of the inertial confinement fusion in direct drive, the use of foams as ablator allows the reduction of hydrodynamic instabilities created on the target by the direct laser irradiation. The foam is made up of carbon (CH) fibers impregnated of cryogenic deuterium-tritium (DT). In the past, studies have been carried out considering this foam to be a homogeneous medium. Yet, the foam presents heterogeneous features. We study the effects of this heterogeneity on the shock velocity when the laser irradiates the target. Thanks to experimental and numerical studies, we show that the shock propagates faster in the heterogeneous medium than in the homogeneous one with the same averaged density. This velocity gap depends on the presence rate of the CH fibers in the foam, the density ratio, the adiabatic coefficient and the foam geometry. We model the foam by different ways, more and more complex. The shock velocity modification is due to the baroclinicity which, during the interaction between the shock front and the interface, creates a vorticity deposition, responsible for the shock acceleration. Accordingly, an interface, which is plane and perpendicular to the front shock, maximizes the vorticity deposition and increases the velocity gaps between heterogeneous and homogeneous media. We found a correlation between the kinetic energy behind the shock front and the velocities relative difference. We compared our results with two analytical models. However, the system is not closed, so we can't for the moment develop a predictive model. (author) [fr

  7. Alfven shock trains

    International Nuclear Information System (INIS)

    Malkov, M.A.; Kennel, C.F.; Wu, C.C.; Pellat, R.; Shapiro, V.D.

    1991-01-01

    The Cohen--Kulsrud--Burgers equation (CKB) is used to consider the nonlinear evolution of resistive, quasiparallel Alfven waves subject to a long-wavelength, plane-polarized, monochromatic instability. The instability saturates by nonlinear steepening, which proceeds until the periodic waveform develops an interior scale length comparable to the dissipation length; a fast or an intermediate shock then forms. The result is a periodic train of Alfven shocks of one or the other type. For propagation strictly parallel to the magnetic field, there will be two shocks per instability wavelength. Numerical integration of the time-dependent CKB equation shows that an initial, small-amplitude growing wave asymptotes to a stable, periodic stationary wave whose analytic solution specifies how the type of shock embedded in the shock train, and the amplitude and speed of the shock train, depend on the strength and phase of the instability. Waveforms observed upstream of the Earth's bowshock and cometary shocks resemble those calculated here

  8. Recent oil price shock and Tunisian economy

    International Nuclear Information System (INIS)

    Jbir, Rafik; Zouari-Ghorbel, Sonia

    2009-01-01

    The objective of this paper is to study the oil prices-macroeconomy relationship by the analysis of the role of subsidy policy. The vector autoregression (VAR) method was employed to analyze the data over the period 1993 Q1 - 2007 Q3. The results of the model using both linear and non-linear specifications indicate that there is no direct impact of oil price shock on the economic activity. The shock of oil prices affects economic activity indirectly. The most significant channel by which the effects of the shock are transmitted is the government's spending. (author)

  9. Turbulent energy generated by accelerations and shocks

    International Nuclear Information System (INIS)

    Mikaelian, K.O.

    1986-01-01

    The turbulent energy generated at the interface between two fluids undergoing a constant acceleration or a shock is calculated. Assuming linear density profiles in the mixed region we find E/sub turbulent//E/sub directed/ = 2.3A 2 % (constant acceleration) and 9.3A 2 % (shock), where A is the Atwood number. Diffusion models predict somewhat less turbulent energy and a density profile with a tail extending into the lower density fluid. Eddy sizes are approximately 27% (constant acceleration) and 17% (shock) of the mixing depth into the heavier fluid. 6 refs., 3 figs

  10. Integrated microelectromechanical gyroscope under shock loads

    Science.gov (United States)

    Nesterenko, T. G.; Koleda, A. N.; Barbin, E. S.

    2018-01-01

    The paper presents a new design of a shock-proof two-axis microelectromechanical gyroscope. Without stoppers, the shock load enables the interaction between the silicon sensor elements. Stoppers were installed in the gyroscope to prevent the contact interaction between electrodes and spring elements with fixed part of the sensor. The contact of stoppers occurs along the plane, thereby preventing the system from serious contact stresses. The shock resistance of the gyroscope is improved by the increase in its eigenfrequency at which the contact interaction does not occur. It is shown that the shock load directed along one axis does not virtually cause the movement of sensing elements along the crosswise axes. Maximum stresses observed in the proposed gyroscope at any loading direction do not exceed the value allowable for silicon.

  11. Superdiffusion of relativistic electrons at supernova remnant shocks

    Science.gov (United States)

    Perri, Silvia

    2018-01-01

    Anomalous transport has been observed in various systems as nonlinear systems, numerical simulations of plasma turbulence, in laboratory plasmas, and recently in the propagation of energetic particles in the interplanetary space. Thanks to in situ observations it has been possible to deduce transport properties directly from spacecraft data. This technique has further found applicability to remote observations of relativistic electrons accelerated at supernova remnants (SNRs) shocks, pointing out that far upstream of the blast waves, the x-ray synchrotron emission, as captured by the Chandra spacecraft, is consistent with models of superdiffusive transport (i.e., transport faster than normal diffusive). Here we present and summarize evidences of superdiffusion both in the interplanetary space and upstream of SNRs shock fronts, in particular by analyzing, for the first time in the framework of superdiffusion, the transport properties of electrons accelerated at the young G1.9+0.3 SNR. We also briefly describe how this new model can be used to interpret radio emissions from electrons accelerated at shocks forming during galaxy cluster mergers.

  12. Magnetohydrodynamic shocks in molecular clouds

    International Nuclear Information System (INIS)

    Chernoff, D.F.

    1985-01-01

    Part one develops the mathematical and physical theory of one-dimensional, time-independent subalfvenic flow in partially ionized gas with magnetic fields, for application to shocks in molecular clouds. Unlike normal gas-dynamic shocks, the neutral flow may be continuous and cool if the gas radiates efficiently and does not self-ionize. Analytic solutions are given in the limit that the neutral gas is either adiabatic or isothermal (cold). Numerical techniques are developed and applied to find the neutral flow under general circumstances. Part two extends the theory and results of part one in three ways: (1) to faster, superalfvenic flow, (2) to complex gases containing heavy charged particles (grains) in addition to ions, containing heavy charged particles (grains) in addition to ions, electrons and neutrals, and (3) to the entire range in (Omega tau), the ratio of charged particle damping time to gyroperiod, expected in gas flows in molecular clouds

  13. Role of drifts in diffusive shock acceleration

    International Nuclear Information System (INIS)

    Decker, R.B.

    1988-01-01

    The role played by shock-associated drifts during the diffusive acceleration of charged particles at collisionless MHD shocks is evaluated. In the rest frame of the shock, the total energy gained by a particle is shown to result from two coupled acceleration mechanisms, the usual first-order Fermi mechanism and the drift mechanism. When averaged over a distribution of particles, the ratio of the drift-associated energy gain to the total energy is found to be independent of the total energy at a given theta1 (the angle between the shock normal and the unperturbed upstream magnetic field) in agreement with theoretical predictions. No evidence is found for drift-associated deceleration, suggesting that drifts always augment acceleration. 35 references

  14. Reflection of the solar wind ions at the earth's bow shock: energization

    International Nuclear Information System (INIS)

    Bonifazi, C.; Moreno, G.; Russell, C.T.

    1983-01-01

    The energies of the field-aligned proton beams observed upstream of the earth's bow shock are tested, on a statistical basis, against a simple reflection model. The comparison is carried out using both plasma and magnetic field data collected by the ISEE 2 spacecraft. The observations refer to the period from November 5 to December 20, 1977. According to this model, some of the solar wind protons incident upon the earth's shock front when reflected upstream gain energy by displacement parallel to the interplanetary electric field. The energy gained in the reflection can be described as a function of the angles between the interplanetary magnetic field, the solar wind bulk velocity, and the local shock normal. The task of finding these angles, i.e., the expected source point of the reflected ions at the earth's shock front, has been resolved using both the measured magnetic field direction and actual beam trajectory. The latter method, which takes into account the ion drift velocity, leads to a better agreement between theory and observations when far from the shock. In particular, it allows us to check the energies of the field-aligned beams even when they are observed far from the earth's bow shock (at distances up to 10-15 R/sub E/). We confirm, on a statistical basis, the test of the model recently carried out using the Los Alamos National Laboratory/Max-Planck-extraterrestrische observations on ISEE 1 and 2. We infer that reflected beams can sometimes propagate far upstream of the earth's bow shock without changing their energy properties

  15. Supersonic flow. Pt. 5 Shock waves; Fondamenti fisici dei fasci molecolari supersonici. Pt 5 Onde di Shock

    Energy Technology Data Exchange (ETDEWEB)

    Sanna, G.; Tomassetti, G. [L`Aquila Univ. (Italy). Dipt. di Fisica

    1998-02-01

    The discontinuities in the flow fields (both tangential and shocks) are considered and the equations for the quantities conserved across them are written. The post-shock flow variables are expressed by the Mach number of the incident supersonic flow and its deflection angle operated by rigid wall. Normal and oblique shocks are considered and graphs and polar diagrams are introduced. Then the reflections of a shock wave operated by a rigid wall and by the boundary between a jet and a stagnating gas are analyzed. Finally, the interactions between two distinct shock waves are considered. [Italiano] Vengono considerate le discontinuita` (tangenziali e shocks) nei campi di flusso e sono scritte le equazioni per le quantita` che si conservano attraverso di esse. Le variabili del flusso oltre lo shock sono espresse in funzione del numero di Mach del flusso supersonico incidente e dell`angolo di deflessione di questo operato da una parete rigida. I casi di shock normale, obliquo e distaccato sono considerati e sono introdotti grafici vari e rappresentazioni polari. Sono quindi considerate le riflessioni di un fronte di shock da una parete rigida e dalla frontiera tra un gas in moto ed uno stagnante. Sono infine considerate le diverse interazioni tra due shock distinti.

  16. 14 CFR 27.475 - Tires and shock absorbers.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Tires and shock absorbers. 27.475 Section 27.475 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION AIRCRAFT AIRWORTHINESS STANDARDS: NORMAL CATEGORY ROTORCRAFT Strength Requirements Ground Loads § 27.475 Tires and shock absorbers. Unless otherwise prescribed...

  17. Transonic shock wave. Boundary layer interaction at a convex wall

    NARCIS (Netherlands)

    Koren, B.; Bannink, W.J.

    1984-01-01

    A standard finite element procedure has been applied to the problem of transonic shock wave – boundary layer interaction at a convex wall. The method is based on the analytical Bohning-Zierep model, where the boundary layer is perturbed by a weak normal shock wave which shows a singular pressure

  18. System Shock: The Archetype of Operational Shock

    Science.gov (United States)

    2017-05-25

    the battle space. They can also facilitate a much greater understanding of the variables involved in each party’s decision - making process. However...system shock nests within current US Army Unified Land Operations doctrine. In order to test the utility of system shock theory to Gray Zone...23 Neil E. Harrison, “Thinking about the World We Make ” in Chaos Theory in the Social Sciences: Foundations and Applications

  19. Long-Term Effects of Repeated Prefrontal Cortex Transcranial Direct Current Stimulation (tDCS) on Food Craving in Normal and Overweight Young Adults.

    Science.gov (United States)

    Ljubisavljevic, M; Maxood, K; Bjekic, J; Oommen, J; Nagelkerke, N

    The dorsolateral prefrontal cortex (DLPFC) plays an important role in the regulation of food intake. Several previous studies demonstrated that a single session of transcranial direct current stimulation (tDCS) of the DLPFC reduces food craving and caloric intake. We hypothesized that repeated tDCS of the right DLPFC cortex may exert long-term changes in food craving in young, healthy adults and that these changes may differ between normal and overweight subjects. Thirty healthy individuals who reported frequent food cravings without a prior history of eating disorders were initially recruited. Subjects were randomized into an ACTIVE group who received 5 days of real tDCS (20 minutes, anode right-cathode left montage, 2 mA with current density kept at 0.06 mA/cm2, 1 min ramp-up/ramp-down), and a SHAM group, who received one day of real tDCS, on the first day (same parameters), followed by 4 days of sham tDCS. Food craving intensity was examined by Food Craving Questionnaires State and Trait and Food Craving Inventory before, during, (5-days) and one month (30-days) after tDCS. Single session of tDCS significantly reduced the intensity of current food craving (FCQ-S). Five days of active tDCS significantly reduced habitual experiences of food craving (FCQ-T), when compared to baseline pre-stimulation levels. Furthermore, both current (FCQ-S) and habitual craving (FCQ-T) were significantly reduced 30 days after active tDCS, while sham tDCS, i.e. a single tDCS session did not have significant effects. Also, active tDCS significantly decreased craving for fast food and sweets, and to a lesser degree for fat, while it did not have significant effects on craving for carbohydrates (FCI). There were no significant differences between individual FCQ-T subscales (craving dimensions) after 5 or 30 days of either sham or active tDCS. Changes in craving were not significantly associated with the initial weight, or with weight changes 30 days after the stimulation in the

  20. The NASA POWER SSE: Deriving the Direct Normal Counterpart from the CERES SYN1deg Hourly Global Horizontal Irradiance during Early 2000 to Near Present

    Science.gov (United States)

    Zhang, T.; Stackhouse, P. W., Jr.; Westberg, D. J.

    2017-12-01

    The NASA Prediction of Worldwide Energy Resource (POWER) Surface meteorology and Solar Energy (SSE) provides solar direct normal irradiance (DNI) data as well as a variety of other solar parameters. The currently available DNIs are monthly means on a quasi-equal-area grid system with grid boxes roughly equivalent to 1 degree longitude by 1 degree latitude around the equator from July 1983 to June 2005, and the data were derived from the GEWEX Surface Radiation Budget (SRB) monthly mean global horizontal irradiance (GHI, Release 3) and regression analysis of the Baseline Surface Radiation Network (BSRN) data. To improve the quality of the DNI data and push the temporal coverage of the data to near present, we have applied a modified version of the DIRINDEX global-to-beam model to the GEWEX SRB (Release 3) all-sky and clear-sky 3-hourly GHI data and derived their DNI counterparts for the period from July 1983 to December 2007. The results have been validated against the BSRN data. To further expand the data in time to near present, we are now applying the DIRINDEX model to the Clouds and the Earth's Radiant Energy System (CERES) data. The CERES SYN1deg (Edition 4A) offers hourly all-sky and clear-sky GHIs on a 1 degree longitude by 1 degree latitude grid system from March 2000 to October 2016 as of this writing. Comparisons of the GHIs with their BSRN counterparts show remarkable agreements. Besides the GHIs, the inputs will also include the atmospheric water vapor and surface pressure from the Modern Era Retrospective-Analysis for Research and Applications (MERRA) and the aerosol optical depth from the Max-Planck Institute Climatology (MAC-v1). Based on the performance of the DIRINDEX model with the GEWEX SRB GHI data, we expect at least equally good or even better results. In this paper, we will show the derived hourly, daily, and monthly mean DNIs from the CERES SYN1deg hourly GHIs from March 2000 to October 2016 and how they compare with the BSRN data.

  1. Radiative shocks with electron thermal conduction

    International Nuclear Information System (INIS)

    Borkowski, Kazimierz.

    1988-01-01

    The authors studies the influence of electron thermal conduction on radiative shock structure for both one- and two-temperature plasmas. The dimensionless ratio of the conductive length to the cooling length determines whether or not conduction is important, and shock jump conditions with conduction are established for a collisionless shock front. He obtains approximate solutions with the assumptions that the ionization state of the gas is constant and the cooling rate is a function of temperature alone. In the absence of magnetic fields, these solutions indicate that conduction noticeably influences normal-abundance interstellar shocks with velocities 50-100 km s -1 and dramatically affects metal-dominated shocks over a wide range of shock velocities. Magnetic fields inhibit conduction, but the conductive energy flux and the corresponding decrease in the post-shock electron temperature may still be appreciable. He calculates detailed steady-state radiative shock models in gas composed entirely of oxygen, with the purpose of explaining observations of fast-moving knots in Cas A and other oxygen-rich supernova remnants (SNRs). The O III ion, whose forbidden emission usually dominates the observed spectra, is present over a wide range of shock velocities, from 100 to 170 kms -1 . All models with conduction have extensive warm photoionization zones, which provides better agreement with observed optical (O I) line strengths. However, the temperatures in these zones could be lowered by (Si II) 34.8 μm and (Ne II) 12.8 μm cooling if Si and Ne are present in appreciable abundance relative to O. Such low temperatures would be inconsistent with the observed (O I) emission in oxygen-rich SNRs

  2. Pioneer Venus and near-earth observations of interplanetary shocks

    International Nuclear Information System (INIS)

    Mihalov, J.D.; Russell, C.T.; Knudsen, W.C.; Scarf, F.L.

    1987-01-01

    Twenty-three transient interplanetary shocks observed near earth during 1978-1982, and mostly reported in the literature, have also been identified at the Pioneer Venus Orbiter spacecraft. There seems to be a fairly consistent trend for lower shock speeds, farther from the sun. Shock normals obtained using the Pioneer Venus data correspond well with published values from near earth. By referring to the portion of the Pioneer Venus plasma data used here from locations at longitudes within 37 degree of earth, it is found that shocks are weaker at earth, compared with closer to the sun

  3. Clarifying Normalization

    Science.gov (United States)

    Carpenter, Donald A.

    2008-01-01

    Confusion exists among database textbooks as to the goal of normalization as well as to which normal form a designer should aspire. This article discusses such discrepancies with the intention of simplifying normalization for both teacher and student. This author's industry and classroom experiences indicate such simplification yields quicker…

  4. Protocolised Management In Sepsis (ProMISe): a multicentre randomised controlled trial of the clinical effectiveness and cost-effectiveness of early, goal-directed, protocolised resuscitation for emerging septic shock.

    Science.gov (United States)

    Mouncey, Paul R; Osborn, Tiffany M; Power, G Sarah; Harrison, David A; Sadique, M Zia; Grieve, Richard D; Jahan, Rahi; Tan, Jermaine C K; Harvey, Sheila E; Bell, Derek; Bion, Julian F; Coats, Timothy J; Singer, Mervyn; Young, J Duncan; Rowan, Kathryn M

    2015-11-01

    Early goal-directed therapy (EGDT) is recommended in international guidance for the resuscitation of patients presenting with early septic shock. However, adoption has been limited and uncertainty remains over its clinical effectiveness and cost-effectiveness. The primary objective was to estimate the effect of EGDT compared with usual resuscitation on mortality at 90 days following randomisation and on incremental cost-effectiveness at 1 year. The secondary objectives were to compare EGDT with usual resuscitation for requirement for, and duration of, critical care unit organ support; length of stay in the emergency department (ED), critical care unit and acute hospital; health-related quality of life, resource use and costs at 90 days and at 1 year; all-cause mortality at 28 days, at acute hospital discharge and at 1 year; and estimated lifetime incremental cost-effectiveness. A pragmatic, open, multicentre, parallel-group randomised controlled trial with an integrated economic evaluation. Fifty-six NHS hospitals in England. A total of 1260 patients who presented at EDs with septic shock. EGDT (n = 630) or usual resuscitation (n = 630). Patients were randomly allocated 1 : 1. All-cause mortality at 90 days after randomisation and incremental net benefit (at £20,000 per quality-adjusted life-year) at 1 year. Following withdrawals, data on 1243 (EGDT, n = 623; usual resuscitation, n = 620) patients were included in the analysis. By 90 days, 184 (29.5%) in the EGDT and 181 (29.2%) patients in the usual-resuscitation group had died [p = 0.90; absolute risk reduction -0.3%, 95% confidence interval (CI) -5.4 to 4.7; relative risk 1.01, 95% CI 0.85 to 1.20]. Treatment intensity was greater for the EGDT group, indicated by the increased use of intravenous fluids, vasoactive drugs and red blood cell transfusions. Increased treatment intensity was reflected by significantly higher Sequential Organ Failure Assessment scores and more advanced

  5. Heat Shock Protein 90 Inhibitor (17-AAG) Induces Apoptosis and Decreases Cell Migration/Motility of Keloid Fibroblasts.

    Science.gov (United States)

    Yun, In Sik; Lee, Mi Hee; Rah, Dong Kyun; Lew, Dae Hyun; Park, Jong-Chul; Lee, Won Jai

    2015-07-01

    The regulation of apoptosis, proliferation, and migration of fibroblasts is altered in keloids. The 90-kDa heat shock protein (heat shock protein 90) is known to play a key role in such regulation. Therefore, the authors investigated whether the inhibition of heat shock protein 90 in keloid fibroblasts could induce apoptosis and attenuate keloid fibroblast proliferation and migration. The authors evaluated heat shock protein 90 expression in keloid tissues with immunohistochemistry. The authors used cell viability [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assays and annexin V/propidium iodide staining for apoptosis, a wound healing model and cell tracking system to assess cell migration, and Akt Western blotting analysis in keloid fibroblasts after inhibition of heat shock protein 90 with 17-allylaminodemethoxygeldanamycin (17-AAG). The expression of heat shock protein 90 in keloid tissues was significantly increased compared with normal tissues. The 17-AAG-treated keloid fibroblasts showed significantly decreased proliferation, promotion of apoptosis, and decreased expression of Akt. Furthermore, a dose-dependent decrease in cell migration was noted after 17-AAG treatment of keloid fibroblasts. The 17-AAG-treated keloid fibroblasts had less directionality to the wound center and migrated a shorter distance. The authors confirmed that the inhibition of heat shock protein 90 in keloid fibroblasts could promote apoptosis and attenuate proliferation and migration of keloid fibroblasts. Therefore, the authors think that the inhibition of heat shock protein 90 is a key factor in the regulation of biological processes in keloids. With further preclinical study, the authors will be able to apply these results clinically for keloid treatment.

  6. Shock modification and chemistry and planetary geologic processes

    International Nuclear Information System (INIS)

    Boslough, M.S.

    1991-01-01

    This paper brings the rapid advances on shock processing of materials to the attention of Earth scientists, and to put these advances in the context of planetary geologic processes. Most of the recent research in this area has been directed at materials modification an synthesis, and the information gained has direct relevance to shock effects in nature. Research on various types of shock modification and chemistry in both naturally and experimentally shocked rocks and minerals is reviewed, and where appropriate their significance to planetary processes is indicated. As a case study, the surface of Mars is suggested as a place where conditions are optimal for shock processing to be a dominant factor. The various mechanisms of shock modification, activation, synthesis and decomposition are all proposed as major contributors to the evolution of chemical, mineralogical, and physical properties of the Martian regolith

  7. Comparative review of bow shocks and magnetopauses

    International Nuclear Information System (INIS)

    Lepping, R.P.

    1984-04-01

    Bow shock and magnetopauses formation is discussed. Plasma and magnetic field environments of all the planets from Mercury to Saturn were measured. It was found that all the planets have bow shocks and almost all have a magnetopause. Venus is the only planet with no measurable intrinsic magnetic field and the solar wind interacts directly with Venus ionosphere. The bow shock characteristics depend on the changing solar wind conditions. The shape of a magnetopause or any obstacle to flow depends on the three dimensional pressure profile that it presents to the solar wind. Jupiter is unusual because of the considerable amount of plasma which is contained in its magnetosphere. Magentopause boundaries in ecliptic plane projection are modelled by segments of ellipses, matched to straight lines for the magnetotool boundaries or parabolas. Specific properties of known planetary bow shocks and magnetopauses are reviewed

  8. Martian Bow Shock and Magnetic Pile-Up Barrier Formation Due to the Exosphere Ion Mass-Loading

    Directory of Open Access Journals (Sweden)

    Eojin Kim

    2011-03-01

    Full Text Available Bow shock, formed by the interaction between the solar wind and a planet, is generated in different patterns depending on the conditions of the planet. In the case of the earth, its own strong magnetic field plays a critical role in determining the position of the bow shock. However, in the case of Mars of which has very a small intrinsic magnetic field, the bow shock is formed by the direct interaction between the solar wind and the Martian ionosphere. It is known that the position of the Martian bow shock is affected by the mass loading-effect by which the supersonic solar wind velocity becomes subsonic as the heavy ions originating from the planet are loaded on the solar wind. We simulated the Martian magnetosphere depending on the changes of the density and velocity of the solar wind by using the three-dimensional magnetohydrodynamic model built by modifying the comet code that includes the mass loading effect. The Martian exosphere model of was employed as the Martian atmosphere model, and only the photoionization by the solar radiation was considered in the ionization process of the neutral atmosphere. In the simulation result under the normal solar wind conditions, the Martian bow shock position in the subsolar point direction was consistent with the result of the previous studies. The three-dimensional simulation results produced by varying the solar wind density and velocity were all included in the range of the Martian bow shock position observed by Mariner 4, Mars 2, 3, 5, and Phobos 2. Additionally, the simulation result also showed that the change of the solar wind density had a greater effect on the Martian bow shock position than the change of the solar wind velocity. Our result may be useful in analyzing the future observation data by Martian probes.

  9. Interaction of Interstellar Shocks with Dense Obstacles: Formation of ``Bullets''

    Science.gov (United States)

    Gvaramadze, V. V.

    The so-called cumulative effect take place in converging conical shock waves arising behind dense obstacles overtaken by incident interstellar shock. A significant part of energy of converging flow of matter swept-up by a radiative conical shock can be transferred to a dense jet-like ejection (``bullet'') directed along the cone axis. Possible applications of this effect for star-forming regions (e.g., OMC-1) and supernova remnants (e.g., Vela SNR) are discussed.

  10. Modeling shock waves in an ideal gas: combining the Burnett approximation and Holian's conjecture.

    Science.gov (United States)

    He, Yi-Guang; Tang, Xiu-Zhang; Pu, Yi-Kang

    2008-07-01

    We model a shock wave in an ideal gas by combining the Burnett approximation and Holian's conjecture. We use the temperature in the direction of shock propagation rather than the average temperature in the Burnett transport coefficients. The shock wave profiles and shock thickness are compared with other theories. The results are found to agree better with the nonequilibrium molecular dynamics (NEMD) and direct simulation Monte Carlo (DSMC) data than the Burnett equations and the modified Navier-Stokes theory.

  11. Hydraulic shock absorbers

    International Nuclear Information System (INIS)

    Thatcher, G.; Davidson, D. F.

    1984-01-01

    A hydraulic shock absorber of the dash pot kind for use with electrically conducting liquid such as sodium, has magnet means for electro magnetically braking a stream of liquid discharged from the cylinder. The shock absorber finds use in a liquid metal cooled nuclear reactor for arresting control rods

  12. Our Favorite Film Shocks

    DEFF Research Database (Denmark)

    Willerslev, Rane; Suhr, Christian

    2014-01-01

    The modern medium of film has long been hailed for its capacity for producing shocks of an entertaining, thought-provoking, or even politically emancipative nature. But what is a shock, how and when does it occur, how long does it last, and are there particular techniques for producing cinematic...

  13. Climate shocks and conflict

    NARCIS (Netherlands)

    Papaioannou, Kostadis J.

    2016-01-01

    This paper offers a historical micro-level analysis of the impact of climate shocks on the incidence of civil conflict in colonial Nigeria (1912-1945). Primary historical sources on court cases, prisoners and homicides are used to capture conflict. To measure climate shocks we use the deviation

  14. Inferring Pre-shock Acoustic Field From Post-shock Pitot Pressure Measurement

    Science.gov (United States)

    Wang, Jian-Xun; Zhang, Chao; Duan, Lian; Xiao, Heng; Virginia Tech Team; Missouri Univ of Sci; Tech Team

    2017-11-01

    Linear interaction analysis (LIA) and iterative ensemble Kalman method are used to convert post-shock Pitot pressure fluctuations to static pressure fluctuations in front of the shock. The LIA is used as the forward model for the transfer function associated with a homogeneous field of acoustic waves passing through a nominally normal shock wave. The iterative ensemble Kalman method is then employed to infer the spectrum of upstream acoustic waves based on the post-shock Pitot pressure measured at a single point. Several test cases with synthetic and real measurement data are used to demonstrate the merits of the proposed inference scheme. The study provides the basis for measuring tunnel freestream noise with intrusive probes in noisy supersonic wind tunnels.

  15. Synthesis and thermotolerance of heat shock proteins in Campylobacter jejuni

    International Nuclear Information System (INIS)

    Kim, C.K.; Kim, H.O.; Lee, K.J.

    1991-01-01

    The heat shock responses of Campylobacter jejuni were studied by examination of their survival rates and synthesis of heat shock proteins. When C. jejuni cells were treated at the sublethal temperatures of 48C° for 30 minutes, most of the cells maintained their viabilities and synthesized the heat shock proteins of 90, 73, and 66 kD in molecular weight. By the method of two-dimensional electrophoresis, the heat shock proteins of C. jejuni were identified to be Hsp90, Hsp73, and Hsp66. During the heat shock at 48C°, the heat shock proteins were induced from about 5 minutes after the heat shock treatment. Their synthesis was continued upto 30 minutes, but remarkably retarded after 50 minutes. When C. jejune cells were heat shocked at 51C° for 30 minutes, the survival rates of the cells were decreased by about 10 3 fold and synthesis of heat shock proteins and normal proteins was also generally retarded. The cells exposed to 55C° for 30 minutes died off by more than 10 5 cells and the new protein synthesis was not observed. But when C. jejuni cells were heat-shocked at the sublethal temperature of 48C° for 15 to 20 minutes and then were exposed at the lethal temperature of 55C° for 30 minutes, their viabilities were higher than those exposed at 55C° for 30 minutes without pre-heat shock at 48C°. Therefore, the heat shock proteins synthesized at the sublethal temperature of 48C° in C. jejuni were thought to be responsible for thermotolerance. However, when C. jejuni cells heat-shocked at various ranges of sublethal and lethal temperatures were placed back to the optimum temperature of 42C°, the multiplication patterns of the cells pretreated at different temperatures were not much different each other

  16. Birkhoff normalization

    NARCIS (Netherlands)

    Broer, H.; Hoveijn, I.; Lunter, G.; Vegter, G.

    2003-01-01

    The Birkhoff normal form procedure is a widely used tool for approximating a Hamiltonian systems by a simpler one. This chapter starts out with an introduction to Hamiltonian mechanics, followed by an explanation of the Birkhoff normal form procedure. Finally we discuss several algorithms for

  17. Mechanical Properties of Shock-Damaged Rocks

    Science.gov (United States)

    He, Hongliang; Ahrens, T. J.

    1994-01-01

    Stress-strain tests were performed both on shock-damaged gabbro and limestone. The effective Young's modulus decreases with increasing initial damage parameter value, and an apparent work-softening process occurs prior to failure. To further characterize shock-induced microcracks, the longitudinal elastic wave velocity behavior of shock-damaged gabbro in the direction of compression up to failure was measured using an acoustic transmission technique under uniaxial loading. A dramatic increase in velocity was observed for the static compressive stress range of 0-50 MPa. Above that stress range, the velocity behavior of lightly damaged (D(sub 0) less than 0.1) gabbro is almost equal to unshocked gabbro. The failure strength of heavily-damaged (D(sub 0) greater than 0.1) gabbro is approx. 100-150 MPa, much lower than that of lightly damaged and unshocked gabbros (approx. 230-260 MPa). Following Nur's theory, the crack shape distribution was analyzed. The shock-induced cracks in gabbro appear to be largely thin penny-shaped cracks with c/a values below 5 x 10(exp -4). Moreover, the applicability of Ashby and Sammis's theory relating failure strength and damage parameter of shock-damaged rocks was examined and was found to yield a good estimate of the relation of shock-induced deficit in elastic modulus with the deficit in compressive strength.

  18. Study of shock coalescence in laser-irradiated targets

    International Nuclear Information System (INIS)

    Coe, S.E.; Willi, O.; Afshar-Rad, T.; Rose, S.J.

    1988-01-01

    We report on the first direct experimental observation of the coalescence of two shocks induced by a shaped laser pulse. Optical streak photography of the rear surface of aluminum multiple step targets was used to study the breakout of these shocks and observe their behavior. The experimental results are compared with simulations by a one-dimensional Lagrangian hydrodynamic code

  19. Pediatric Toxic Shock Syndrome

    Directory of Open Access Journals (Sweden)

    Jennifer Yee

    2017-09-01

    Full Text Available Audience: This scenario was developed to educate emergency medicine residents on the diagnosis and management of a pediatric patient with toxic shock syndrome. The case is also appropriate for teaching of medical students and advanced practice providers, as well as a review of the principles of crisis resource management, teamwork, and communication. Introduction: Toxic shock syndrome is a low-frequency, high-acuity scenario requiring timely identification and aggressive management. If patients suffering from this condition are managed incorrectly, they may progress into multi-organ dysfunction and potentially death. Toxic shock syndrome has been associated with Streptococcus and Staphylococcus aureus (Staph. Approximately half of Staph cases are associated with menstruation, which was first described in the 1970s-1980s and was associated with the use of absorbent tampons.1 Group A Streptococcus may cause complications such as necrotizing fasciitis and gangrenous myositis.2 Pediatric patients may present critically ill from toxic shock syndrome. Providers need to perform a thorough history and physical exam to discern the source of infection. Management requires aggressive care with antibiotics and IV fluids. Objectives: By the end of this simulation session, the learner will be able to: 1 Recognize toxic shock syndrome. 2 Review the importance of a thorough physical exam. 3 Discuss management of toxic shock syndrome, including supportive care and the difference in antibiotic choices for streptococcal and staphylococcal toxic shock syndrome. 4 Appropriately disposition a patient suffering from toxic shock syndrome. 5 Communicate effectively with team members and nursing staff during a resuscitation of a critically ill patient. Method: This session was conducted using high-fidelity simulation, followed by a debriefing session and lecture on toxic shock syndrome.

  20. Thermophysical properties of multi-shock compressed dense argon.

    Science.gov (United States)

    Chen, Q F; Zheng, J; Gu, Y J; Chen, Y L; Cai, L C; Shen, Z J

    2014-02-21

    In contrast to the single shock compression state that can be obtained directly via experimental measurements, the multi-shock compression states, however, have to be calculated with the aid of theoretical models. In order to determine experimentally the multiple shock states, a diagnostic approach with the Doppler pins system (DPS) and the pyrometer was used to probe multiple shocks in dense argon plasmas. Plasma was generated by a shock reverberation technique. The shock was produced using the flyer plate impact accelerated up to ∼6.1 km/s by a two-stage light gas gun and introduced into the plenum argon gas sample, which was pre-compressed from the environmental pressure to about 20 MPa. The time-resolved optical radiation histories were determined using a multi-wavelength channel optical transience radiance pyrometer. Simultaneously, the particle velocity profiles of the LiF window was measured with multi-DPS. The states of multi-shock compression argon plasma were determined from the measured shock velocities combining the particle velocity profiles. We performed the experiments on dense argon plasmas to determine the principal Hugonoit up to 21 GPa, the re-shock pressure up to 73 GPa, and the maximum measure pressure of the fourth shock up to 158 GPa. The results are used to validate the existing self-consistent variational theory model in the partial ionization region and create new theoretical models.

  1. Shocks near Jamming

    Science.gov (United States)

    Gómez, Leopoldo R.; Turner, Ari M.; van Hecke, Martin; Vitelli, Vincenzo

    2012-02-01

    Nonlinear sound is an extreme phenomenon typically observed in solids after violent explosions. But granular media are different. Right when they jam, these fragile and disordered solids exhibit a vanishing rigidity and sound speed, so that even tiny mechanical perturbations form supersonic shocks. Here, we perform simulations in which two-dimensional jammed granular packings are dynamically compressed and demonstrate that the elementary excitations are strongly nonlinear shocks, rather than ordinary phonons. We capture the full dependence of the shock speed on pressure and impact intensity by a surprisingly simple analytical model.

  2. Shock formation of HCO+

    International Nuclear Information System (INIS)

    Elitzur, M.

    1983-01-01

    It is shown that shocks propagating in dense molecular regions will lead to a decrease in HCO + relative abundance, in agreement with previous results by Iglesias and Silk. The shock enhancement of HCO + detected in the supernova remnant IC 443 by Dickenson et al. is due to enhanced ionization in the shocked material. This is the result of the material penetrating the remnant cavity where it becomes exposed to the trapped cosmic rays. A similar enhancement appears to have been detected by Wootten in W28 and is explained by the same model

  3. Adaptive inertial shock-absorber

    International Nuclear Information System (INIS)

    Faraj, Rami; Holnicki-Szulc, Jan; Knap, Lech; Seńko, Jarosław

    2016-01-01

    This paper introduces and discusses a new concept of impact absorption by means of impact energy management and storage in dedicated rotating inertial discs. The effectiveness of the concept is demonstrated in a selected case-study involving spinning management, a recently developed novel impact-absorber. A specific control technique performed on this device is demonstrated to be the main source of significant improvement in the overall efficiency of impact damping process. The influence of various parameters on the performance of the shock-absorber is investigated. Design and manufacturing challenges and directions of further research are formulated. (paper)

  4. Shock Isolation Elements Testing for High Input Loadings. Volume II. Foam Shock Isolation Elements.

    Science.gov (United States)

    SHOCK ABSORBERS ), (*GUIDED MISSILE SILOS, SHOCK ABSORBERS ), (*EXPANDED PLASTICS, (*SHOCK(MECHANICS), REDUCTION), TEST METHODS, SHOCK WAVES, STRAIN(MECHANICS), LOADS(FORCES), MATHEMATICAL MODELS, NUCLEAR EXPLOSIONS, HARDENING.

  5. On ion injection at quasiparallel shocks

    International Nuclear Information System (INIS)

    Scholer, M.; Kucharek, H.; Kato, C.

    2002-01-01

    A large number of numerical experiments has been performed in order to study the interaction of interstellar pickup protons and helium ions with quasiparallel collisionless shocks. The shocks are modeled by a one-dimensional hybrid simulation method which treats the ions as macroparticles and the electrons as a massless fluid. Solar wind alpha particles and pickup protons are included self-consistently. In addition, the particle splitting method is used for the solar wind ions so that the distribution function can be followed over more than 10 orders of magnitude. A large part of the pickup ion distribution is reflected; the reflection efficiency is very high, and can reach in cases where the pickup ion density is low as much as 50%-60%. The reflection efficiency is almost independent of magnetic field-shock normal angle. This indicates that magnetic mirroring is unimportant and does not lead to larger reflection efficiencies. The reflection efficiency of pickup protons rapidly decreases when the pickup ion density exceeds a few percent of the solar wind density. An addition of 25% pickup protons decreases the reflection coefficient for these ions to ∼10%. This represents the fact that a quasiparallel shock cannot be considered as being uncoupled from the upstream region: at high additions of pickup ions the shock structure is changed in such a way as to reflect less pickup ions. The intensity of diffuse ions upstream of a quasiparallel shock does not depend on the temperature of the core distribution. Within the framework of the present model even solar wind distributions with a hard power law tail do not produce higher intensities of diffuse ions. It is argued that this can be understood by the fact that the intrinsic self-consistency between the processes in the upstream region and at the shock transition determines the injection and reflection properties of the core solar wind distribution

  6. Spherical strong-shock generation for shock-ignition inertial fusion

    Energy Technology Data Exchange (ETDEWEB)

    Theobald, W.; Seka, W.; Lafon, M.; Anderson, K. S.; Hohenberger, M.; Marshall, F. J.; Michel, D. T.; Solodov, A. A.; Stoeckl, C.; Edgell, D. H.; Yaakobi, B.; Shvydky, A. [Laboratory for Laser Energetics and Fusion Science Center, University of Rochester, Rochester, New York 14623 (United States); Nora, R.; Betti, R. [Laboratory for Laser Energetics and Fusion Science Center, University of Rochester, Rochester, New York 14623 (United States); Department of Mechanical Engineering and Department of Physics, University of Rochester, Rochester, New York 14623 (United States); Casner, A.; Reverdin, C. [CEA, DAM, DIF, F-91297 Arpajon (France); Ribeyre, X.; Vallet, A. [Université de Bordeaux-CNRS-CEA, CELIA (Centre Lasers Intenses et Applications) UMR 5107 F-33400 Talence (France); Peebles, J.; Beg, F. N. [University of California, San Diego, La Jolla, California 92093 (United States); and others

    2015-05-15

    Recent experiments on the Laboratory for Laser Energetics' OMEGA laser have been carried out to produce strong shocks in solid spherical targets with direct laser illumination. The shocks are launched at pressures of several hundred Mbars and reach Gbar upon convergence. The results are relevant to the validation of the shock-ignition scheme and to the development of an OMEGA experimental platform to study material properties at Gbar pressures. The experiments investigate the strength of the ablation pressure and the hot-electron production at incident laser intensities of ∼2 to 6 × 10{sup 15 }W/cm{sup 2} and demonstrate ablation pressures exceeding 300 Mbar, which is crucial to developing a shock-ignition target design for the National Ignition Facility. The timing of the x-ray flash from shock convergence in the center of the solid plastic target is used to infer the ablation and shock pressures. Laser–plasma instabilities produce hot-electrons with a moderate temperature (<100 keV). The instantaneous conversion efficiencies of laser power into hot-electron power reached up to ∼15% in the intensity spike. The large amount of hot electrons is correlated with an earlier x-ray flash and a strong increase in its magnitude. This suggests that hot electrons contribute to the augmentation of the shock strength.

  7. Thermal shock cracking of GSO single crystal

    International Nuclear Information System (INIS)

    Miyazaki, Noriyuki; Yamamoto, Kazunari; Tamura, Takaharu; Kurashige, Kazuhisa; Ishibashi, Hiroyuki; Susa, Kenzo

    1998-01-01

    The quantitative estimation of the failure stress of a gadolinium orthosilicate (Gd 2 SiO 5 , hereafter abbreviated as GSO) single crystal due to thermal shock was investigated. A cylindrical test specimen was heated in a silicone oil bath, then subjected to thermal shock by pouring room temperature silicone oil. Cracking occurred during cooling. The heat conduction analysis was performed to obtain temperature distribution in a GSO single crystal at cracking, using the surface temperatures measured in the thermal shock cracking test. Then the thermal stress was calculated using temperature profile of the test specimen obtained from the heat conduction analysis. It is found from the results of the thermal stress analysis and the observation of the cracking in test specimens that the thermal shock cracking occurs in a cleavage plane due to the stress normal to the plane. Three-point bending tests were also performed to examine the relationship between the critical stress for thermal shock cracking and the three-point bending strength obtained from small-sized test specimens. (author)

  8. Counseling For Future Shock

    Science.gov (United States)

    Morgan, Lewis B.

    1974-01-01

    In this article the author looks at some of the searing prophecies made by Alvin Toffler in his book Future Shock and relates them to the world of the professional counselor and the clientele the counselor attempts to serve. (Author)

  9. Life shocks and homelessness.

    Science.gov (United States)

    Curtis, Marah A; Corman, Hope; Noonan, Kelly; Reichman, Nancy E

    2013-12-01

    We exploited an exogenous health shock-namely, the birth of a child with a severe health condition-to investigate the effect of a life shock on homelessness in large cities in the United States as well as the interactive effects of the shock with housing market characteristics. We considered a traditional measure of homelessness, two measures of housing instability thought to be precursors to homelessness, and a combined measure that approximates the broadened conceptualization of homelessness under the 2009 Homeless Emergency Assistance and Rapid Transition to Housing Act (2010). We found that the shock substantially increases the likelihood of family homelessness, particularly in cities with high housing costs. The findings are consistent with the economic theory of homelessness, which posits that homelessness results from a conjunction of adverse circumstances in which housing markets and individual characteristics collide.

  10. Technology shocks matter

    OpenAIRE

    Jonas D. M. Fisher

    2002-01-01

    This paper uses the neoclassical growth model to identify the effects of technological change on the US business cycle. In the model there are two sources of technological change: neutral, which effects the production of all goods homogeneously, and investment-specific. Investment-specific shocks are the unique source of the secular trend in the real price of investment goods, while shocks to both kinds of technology are the only factors which affect labor productivity in the long run. Consis...

  11. Femtosecond visualization of lattice dynamics in shock-compressed matter.

    Science.gov (United States)

    Milathianaki, D; Boutet, S; Williams, G J; Higginbotham, A; Ratner, D; Gleason, A E; Messerschmidt, M; Seibert, M M; Swift, D C; Hering, P; Robinson, J; White, W E; Wark, J S

    2013-10-11

    The ultrafast evolution of microstructure is key to understanding high-pressure and strain-rate phenomena. However, the visualization of lattice dynamics at scales commensurate with those of atomistic simulations has been challenging. Here, we report femtosecond x-ray diffraction measurements unveiling the response of copper to laser shock-compression at peak normal elastic stresses of ~73 gigapascals (GPa) and strain rates of 10(9) per second. We capture the evolution of the lattice from a one-dimensional (1D) elastic to a 3D plastically relaxed state within a few tens of picoseconds, after reaching shear stresses of 18 GPa. Our in situ high-precision measurement of material strength at spatial (<1 micrometer) and temporal (<50 picoseconds) scales provides a direct comparison with multimillion-atom molecular dynamics simulations.

  12. Shocked plate metal atom oxidation laser

    International Nuclear Information System (INIS)

    De Koker, J.G.; Rice, W.W. Jr.; Jensen, R.J.

    1975-01-01

    A method and apparatus for producing metal atom oxidation lasing wherein an explosively shocked grooved metal plate produces metal vapor jets directed through an appropriate gaseous oxidizer are described. Reaction of the metal vapor with the oxidizer produces molecular species having a population inversion therein. (U.S.)

  13. Normalized modes at selected points without normalization

    Science.gov (United States)

    Kausel, Eduardo

    2018-04-01

    As every textbook on linear algebra demonstrates, the eigenvectors for the general eigenvalue problem | K - λM | = 0 involving two real, symmetric, positive definite matrices K , M satisfy some well-defined orthogonality conditions. Equally well-known is the fact that those eigenvectors can be normalized so that their modal mass μ =ϕT Mϕ is unity: it suffices to divide each unscaled mode by the square root of the modal mass. Thus, the normalization is the result of an explicit calculation applied to the modes after they were obtained by some means. However, we show herein that the normalized modes are not merely convenient forms of scaling, but that they are actually intrinsic properties of the pair of matrices K , M, that is, the matrices already "know" about normalization even before the modes have been obtained. This means that we can obtain individual components of the normalized modes directly from the eigenvalue problem, and without needing to obtain either all of the modes or for that matter, any one complete mode. These results are achieved by means of the residue theorem of operational calculus, a finding that is rather remarkable inasmuch as the residues themselves do not make use of any orthogonality conditions or normalization in the first place. It appears that this obscure property connecting the general eigenvalue problem of modal analysis with the residue theorem of operational calculus may have been overlooked up until now, but which has in turn interesting theoretical implications.Á

  14. Bow Shock Generator Current Systems: MMS Observations of Possible Current Closure

    Science.gov (United States)

    Hamrin, M.; Gunell, H.; Lindkvist, J.; Lindqvist, P.-A.; Ergun, R. E.; Giles, B. L.

    2018-01-01

    We use data from the first two dayside seasons of the Magnetospheric Multiscale (MMS) mission to study current systems associated with quasi-perpendicular bow shocks of generator type. We have analyzed 154 MMS bow shock crossings near the equatorial plane. We compute the current density during the crossings and conclude that the component perpendicular to the shock normal (J⊥) is consistent with a pileup of the interplanetary magnetic field (IMF) inside the magnetosheath. For predominantly southward IMF, we observe a component Jn parallel (antiparallel) to the normal for GSM Y > 0 (MMS probing region. For IMF clock angles near 90∘, we find indications of the current system being tilted toward the north-south direction, obtaining a significant Jz component, and we suggest that the current closes off the equatorial plane at higher latitudes where the spacecraft are not probing. The observations are complicated for several reasons. For example, variations in the solar wind and the magnetospheric currents and loads affect the closure, and Jn is distributed over large regions, making it difficult to resolve inside the magnetosheath proper.

  15. Strength and deformation of shocked diamond single crystals: Orientation dependence

    Science.gov (United States)

    Lang, J. M.; Winey, J. M.; Gupta, Y. M.

    2018-03-01

    Understanding and quantifying the strength or elastic limit of diamond single crystals is of considerable scientific and technological importance, and has been a subject of long standing theoretical and experimental interest. To examine the effect of crystalline anisotropy on strength and deformation of shocked diamond single crystals, plate impact experiments were conducted to measure wave profiles at various elastic impact stresses up to ˜120 GPa along [110] and [111] crystal orientations. Using laser interferometry, particle velocity histories and shock velocities in the diamond samples were measured and were compared with similar measurements published previously for shock compression along the [100] direction. Wave profiles for all three orientations showed large elastic wave amplitudes followed by time-dependent inelastic deformation. From the measured wave profiles, the elastic limits were determined under well characterized uniaxial strain loading conditions. The measured elastic wave amplitudes for the [110] and [111] orientations were lower for higher elastic impact stress (stress attained for an elastic diamond response), consistent with the result reported previously for [100] diamond. The maximum resolved shear stress (MRSS) on the {111}⟨110⟩ slip systems was determined for each orientation, revealing significant orientation dependence. The MRSS values for the [100] and [110] orientations (˜33 GPa) are 25%-30% of theoretical estimates; the MRSS value for the [111] orientation is significantly lower (˜23 GPa). Our results demonstrate that the MRSS depends strongly on the stress component normal to the {111} planes or the resolved normal stress (RNS), suggesting that the RNS plays a key role in inhibiting the onset of inelastic deformation. Lower elastic wave amplitudes at higher peak stress and the effect of the RNS are inconsistent with typical dislocation slip mechanisms of inelastic deformation, suggesting instead an inelastic response

  16. Network-directed cis-mediator analysis of normal prostate tissue expression profiles reveals downstream regulatory associations of prostate cancer susceptibility loci.

    Science.gov (United States)

    Larson, Nicholas B; McDonnell, Shannon K; Fogarty, Zach; Larson, Melissa C; Cheville, John; Riska, Shaun; Baheti, Saurabh; Weber, Alexandra M; Nair, Asha A; Wang, Liang; O'Brien, Daniel; Davila, Jaime; Schaid, Daniel J; Thibodeau, Stephen N

    2017-10-17

    Large-scale genome-wide association studies have identified multiple single-nucleotide polymorphisms associated with risk of prostate cancer. Many of these genetic variants are presumed to be regulatory in nature; however, follow-up expression quantitative trait loci (eQTL) association studies have to-date been restricted largely to cis -acting associations due to study limitations. While trans -eQTL scans suffer from high testing dimensionality, recent evidence indicates most trans -eQTL associations are mediated by cis -regulated genes, such as transcription factors. Leveraging a data-driven gene co-expression network, we conducted a comprehensive cis -mediator analysis using RNA-Seq data from 471 normal prostate tissue samples to identify downstream regulatory associations of previously identified prostate cancer risk variants. We discovered multiple trans -eQTL associations that were significantly mediated by cis -regulated transcripts, four of which involved risk locus 17q12, proximal transcription factor HNF1B , and target trans -genes with known HNF response elements ( MIA2 , SRC , SEMA6A , KIF12 ). We additionally identified evidence of cis -acting down-regulation of MSMB via rs10993994 corresponding to reduced co-expression of NDRG1 . The majority of these cis -mediator relationships demonstrated trans -eQTL replicability in 87 prostate tissue samples from the Gene-Tissue Expression Project. These findings provide further biological context to known risk loci and outline new hypotheses for investigation into the etiology of prostate cancer.

  17. Shock drift acceleration in the presence of waves

    Science.gov (United States)

    Decker, R. B.; Vlahos, L.

    1985-01-01

    Attention is given to the initial results of a model designed to study the modification of the scatter-free, shock drift acceleration of energetic test particles by wave activity in the vicinity of a quasi-perpendicular, fast-mode MHD shock. It is emphasized that the concept of magnetic moment conservation is a valid approximation only in the perpendicular and nearly perpendicular regimes, when the angle theta-Bn between the shock normal and the upstream magnetic field vector is in the range from 70 deg to 90 deg. The present investigation is concerned with one step in a program which is being developed to combine the shock drift and diffusive processes at a shock of arbitrary theta-Bn.

  18. Kinematical Compatibility Conditions for Vorticity Across Shock Waves

    Science.gov (United States)

    Baty, Roy

    2015-11-01

    This work develops the general kinematical compatibility conditions for vorticity across arbitrary shock waves in compressible, inviscid fluids. The vorticity compatibility conditions are derived from the curl of the momentum equation using singular distributions defined on two-dimensional shock wave surfaces embedded in three-dimensional flow fields. The singular distributions are represented as generalized differential operators concentrated on moving shock wave surfaces. The derivation of the compatibility conditions for vorticity requires the application of second-order generalized derivatives and elementary tensor algebra. The well-known vorticity jump conditions across a shock wave are then shown to follow from the general kinematical compatibility conditions for vorticity by expressing the flow field velocity in vectorial components normal and tangential to a shock surface.

  19. A numerical study of fundamental shock noise mechanisms. Ph.D. Thesis - Cornell Univ.

    Science.gov (United States)

    Meadows, Kristine R.

    1995-01-01

    The results of this thesis demonstrate that direct numerical simulation can predict sound generation in unsteady aerodynamic flows containing shock waves. Shock waves can be significant sources of sound in high speed jet flows, on helicopter blades, and in supersonic combustion inlets. Direct computation of sound permits the prediction of noise levels in the preliminary design stage and can be used as a tool to focus experimental studies, thereby reducing cost and increasing the probability of a successfully quiet product in less time. This thesis reveals and investigates two mechanisms fundamental to sound generation by shocked flows: shock motion and shock deformation. Shock motion is modeled by the interaction of a sound wave with a shock. During the interaction, the shock wave begins to move and the sound pressure is amplified as the wave passes through the shock. The numerical approach presented in this thesis is validated by the comparison of results obtained in a quasi-one dimensional simulation with linear theory. Analysis of the perturbation energy demonstrated for the first time that acoustic energy is generated by the interaction. Shock deformation is investigated by the numerical simulation of a ring vortex interacting with a shock. This interaction models the passage of turbulent structures through the shock wave. The simulation demonstrates that both acoustic waves and contact surfaces are generated downstream during the interaction. Analysis demonstrates that the acoustic wave spreads cylindrically, that the sound intensity is highly directional, and that the sound pressure level increases significantly with increasing shock strength. The effect of shock strength on sound pressure level is consistent with experimental observations of shock noise, indicating that the interaction of a ring vortex with a shock wave correctly models a dominant mechanism of shock noise generation.

  20. Ground Shock Effects from Accidental Explosions

    Science.gov (United States)

    1976-11-01

    1,200 P0 A = V P cp 8 Horizontal Dh = Dv tannin " 1 (cp/U)] Vh = Vv tan [sin" 1 (cp/U)] \\ - \\ tanfainŕ (cp/U)] For tan sin (c /U...explosive are not included in the present analysis . This effect will limit the credibility of the direct- induced ground shock predictions, but if the... analysis . Dr. D. R. Richmond of Lovelace Foundation provided data on human shock tolerances. 26 REFERENCES 1. "Structures to Resist the Effects of

  1. Investigation of Dynamic Friction Induced by Shock Loading Conditions

    International Nuclear Information System (INIS)

    Juanicotena, A.; Szarzynski, S.

    2006-01-01

    Modeling the frictional sliding of one surface against another under high pressure is often required to correctly describe the response of complex systems to shock loading. In order to provide data for direct code and model comparison, a new friction experiment investigating dry sliding characteristics of metal on metal at normal pressures up to 10 GPa and sliding velocities up to 400 m/s has been developed. The test consists of a specifically designed target made of two materials. A plane shock wave generated by plate impact results in one material sliding against the other. The material velocity of the rear surface of the target is recorded versus time by Doppler Laser Interferometry. The dynamic friction coefficient μ is then indirectly determined by comparison with results of numerical simulations involving the conventional Coulomb law. Using this new experimental configuration, three dynamic friction experiments were performed on AA 5083-Al (H111) / AISI 321 stainless steel tribo-pair. Results suggest a decrease in the friction coefficient with increasing sliding velocity

  2. Structure of fast shocks in the presence of heat conduction

    International Nuclear Information System (INIS)

    Tsai, C. L.; Chen, H. H.; Wu, B. H.; Lee, L. C.

    2007-01-01

    There are three types of magnetohydrodynamic (MHD) shocks: the fast shock, intermediate shock, and slow shock. The structure of slow shocks and intermediate shocks in the presence of heat conduction has been studied earlier [C. L. Tsai, R. H. Tsai, B. H. Wu, and L. C. Lee, Phys. Plasmas 9, 1185 (2002); C. L. Tsai, B. H. Wu, and L. C. Lee, Phys. Plasmas 12, 82501 (2005)]. Based on one-dimensional MHD numerical simulations with a heat conduction term, the evolution and structure of fast shocks are studied. The fast shock will form a foreshock in the presence of heat conduction. The foreshock is formed due to the heat flow from downstream to upstream and located in the immediate upstream of the main shock. In the steady state, the value of diffusion velocity V d in the foreshock is found to nearly equal the upstream convection velocity in the fast shock frame. It is found that the density jump across the main shock in high Mach number case can be much larger than 4 in the early simulation time. However the density jump will gradually evolve to a value smaller than 4 at steady state. By using the modified Rankine-Hugoniot relations with heat flux, the density jump across the fast shock is examined for various upstream parameters. The results show that the calculated density jump with heat flux is very close to the simulation value and the density jump can far exceed the maximum value of 4 without heat conduction. The structure of foreshock and main shock is also studied under different plasma parameters, such as the heat conductivity K 0 , the ratio of upstream plasma pressure to magnetic pressure β 1 , Alfven Mach number M A1 , and the angle θ 1 between shock normal and magnetic field. It is found that as the upstream shock parameters K 0 , β 1 , and M A1 increase or θ 1 decreases, the width of foreshock L d increases. The present results can be applied to fast shocks in the solar corona, solar wind, and magnetosphere, in which the heat conduction effects are

  3. Vorticity dynamics after the shock-turbulence interaction

    Science.gov (United States)

    Livescu, D.; Ryu, J.

    2016-05-01

    The interaction of a shock wave with quasi-vortical isotropic turbulence (IT) represents a basic problem for studying some of the phenomena associated with high speed flows, such as hypersonic flight, supersonic combustion and Inertial Confinement Fusion (ICF). In general, in practical applications, the shock width is much smaller than the turbulence scales and the upstream turbulent Mach number is modest. In this case, recent high resolution shock-resolved Direct Numerical Simulations (DNS) (Ryu and Livescu, J Fluid Mech 756:R1, 2014) show that the interaction can be described by the Linear Interaction Approximation (LIA). Using LIA to alleviate the need to resolve the shock, DNS post-shock data can be generated at much higher Reynolds numbers than previously possible. Here, such results with Taylor Reynolds number approximately 180 are used to investigate the changes in the vortical structure as a function of the shock Mach number, Ms, up to Ms=10. It is shown that, as Ms increases, the shock interaction induces a tendency towards a local axisymmetric state perpendicular to the shock front, which has a profound influence on the vortex-stretching mechanism and divergence of the Lamb vector and, ultimately, on the flow evolution away from the shock.

  4. Reply to comment on "Direct evidence of ancient shock metamorphism at the site of the 1908 Tunguska event" by Vannucchi et al. (Earth Planet. Sci. Lett. 409 (2015) 168-174)

    Science.gov (United States)

    Vannucchi, Paola; Morgan, Jason P.

    2015-04-01

    Our paper (Vannucchi et al., 2015) focuses on geologic evidence for shock metamorphism found at the epicentral region of the 1908 Tunguska event. None of the currently proposed bolide explanations for the 1908 event can produce the shock pressures indicated by the geological evidence described in Vannucchi et al. (2015). If the 1908 event would have generated these pressures over the epicentral region, an observable crater should have also formed. The comment by Melott and Overholt discusses the possibility that a 1908 cometary bolide strike in Tunguska cannot be excluded because of the absence of a detectable 14C increase at this site. They dispute the findings of a recent Liu et al.'s (2014) study that an East Asian comet impact recorded by eyewitness accounts in 773 AD was coincident with a detectable 14C increase in regional South China Sea corals that grew at that time. Their point, whether true or not, is fairly peripheral to our study because the bolide hypothesis for the 1908 Tunguska event, no matter the nature of the bolide itself, does not provide a viable explanation for the geological evidence of shock metamorphism found at the 1908 Tunguska site. Furthermore, as we discuss in our paper, the probability of a prior large impact-shock event having occurred at the site of the 1908 event is extremely low, suggesting that a terrestrial shock-generating mechanism may be linked to the resolution of the Tunguska enigma. Our preferred resolution is that a terrestrial hyper-explosive gas release event, a Verneshot (Morgan et al., 2004), created the large shock-event during the emplacement of the Siberian Traps. In this scenario, the 1908 Tunguska event was due to a much smaller gas-burst that re-used the lithospheric weakness created by the ancient Verneshot. Melott and Overholt's discussion regarding the existence and size of regional and global 14C anomalies related to cometary impacts seems, therefore, to be better addressed in response to the work of Liu et

  5. Hydrogen-Helium shock Radiation tests for Saturn Entry Probes

    Science.gov (United States)

    Cruden, Brett A.

    2016-01-01

    This paper describes the measurement of shock layer radiation in Hydrogen/Helium mixtures representative of that encountered by probes entering the Saturn atmosphere. Normal shock waves are measured in Hydrogen-Helium mixtures (89:11% by volume) at freestream pressures between 13-66 Pa (0.1-0.5 Torr) and velocities from 20-30 km/s. Radiance is quantified from the Vacuum Ultraviolet through Near Infrared. An induction time of several centimeters is observed where electron density and radiance remain well below equilibrium. Radiance is observed in front of the shock layer, the characteristics of which match the expected diffusion length of Hydrogen.

  6. Shocks in fragile matter

    Science.gov (United States)

    Vitelli, Vincenzo

    2012-02-01

    Non-linear sound is an extreme phenomenon typically observed in solids after violent explosions. But granular media are different. Right when they unjam, these fragile and disordered solids exhibit vanishing elastic moduli and sound speed, so that even tiny mechanical perturbations form supersonic shocks. Here, we perform simulations in which two-dimensional jammed granular packings are continuously compressed, and demonstrate that the resulting excitations are strongly nonlinear shocks, rather than linear waves. We capture the full dependence of the shock speed on pressure and compression speed by a surprisingly simple analytical model. We also treat shear shocks within a simplified viscoelastic model of nearly-isostatic random networks comprised of harmonic springs. In this case, anharmonicity does not originate locally from nonlinear interactions between particles, as in granular media; instead, it emerges from the global architecture of the network. As a result, the diverging width of the shear shocks bears a nonlinear signature of the diverging isostatic length associated with the loss of rigidity in these floppy networks.

  7. Plerocercoid growth factor (PGF), a human growth hormone (hGH) analogue produced by the tapeworm Spirometra mansonoides, has direct insulin-like action in adipose tissue of normal rats in vitro

    International Nuclear Information System (INIS)

    Salem, M.A.M.; Phares, C.K.

    1986-01-01

    The metabolic actions of GH can be divided into acute (insulin-like) and chronic (lipolytic/anti-insulin). The insulin-like actions of GH are most readily elicited in GH-deficient animals as GH induces resistance to its own insulin-like action. Like GH, PGF stimulates growth and cross-reacts with anti-hGH antibodies. Independent experiments were conducted comparing the direct actions of PGF to insulin or hGH in vitro. Insulin-like effects were determined by the ability of PGF, insulin or hGH to stimulate [U- 14 C]glucose metabolism in epidydimal fat pads from normal rats and by inhibition of epinephrine-stimulated lipolysis. Direct stimulation of lipolysis was used as anti-insulin activity. To determine if PGF competes for insulin or GH receptors, adipocytes (3 x 10 5 cells/ml) were incubated with either [ 125 I]insulin or [ 125 I]hGH +/- PGF, +/- insulin or +/- hGH. PGF stimulated glucose oxidation and 14 C-incorporation into lipids. Insulin, hGH and PGF inhibited lipolysis (33%, 29% and 34%, respectively). Adipose tissue was very sensitive to the lipolytic effect of hGH but PGF was neither lipolytic nor did it confer refractoriness to its insulin-like action. PGF bound to GH but not to insulin receptors. Therefore, PGF had direct insulin-like effects but did not stimulate lipolysis in tissue from normal rats in vitro

  8. Malware Normalization

    OpenAIRE

    Christodorescu, Mihai; Kinder, Johannes; Jha, Somesh; Katzenbeisser, Stefan; Veith, Helmut

    2005-01-01

    Malware is code designed for a malicious purpose, such as obtaining root privilege on a host. A malware detector identifies malware and thus prevents it from adversely affecting a host. In order to evade detection by malware detectors, malware writers use various obfuscation techniques to transform their malware. There is strong evidence that commercial malware detectors are susceptible to these evasion tactics. In this paper, we describe the design and implementation of a malware normalizer ...

  9. Life Shocks and Homelessness

    Science.gov (United States)

    Corman, Hope; Noonan, Kelly; Reichman, Nancy E.

    2014-01-01

    We exploited an exogenous health shock—namely, the birth of a child with a severe health condition—to investigate the effect of a life shock on homelessness in large cities in the United States as well as the interactive effects of the shock with housing market characteristics. We considered a traditional measure of homelessness, two measures of housing instability thought to be precursors to homelessness, and a combined measure that approximates the broadened conceptualization of homelessness under the 2009 Homeless Emergency Assistance and Rapid Transition to Housing Act (2010). We found that the shock substantially increases the likelihood of family homelessness, particularly in cities with high housing costs. The findings are consistent with the economic theory of homelessness, which posits that homelessness results from a conjunction of adverse circumstances in which housing markets and individual characteristics collide. PMID:23868747

  10. Health Shocks and Retirement:

    DEFF Research Database (Denmark)

    Datta Gupta, Nabanita; Larsen, Mona

    We investigate the effect of an acute health shock on retirement among elderly male workers in Denmark, 1991-1999, and in particular whether various welfare state programs and institutions impinge on the retirement effect. The results show that an acute health event increases the retirement chances...... significant. For the most part, the retirement effect following a health shock seems to be immune to the availability of a multitude of government programs for older workers in Denmark....... benefits in Denmark nor by the promotion of corporate social responsibility initiatives since the mid-1990s. In the late 1990s, however, the retirement rate following a health shock is reduced to 3% with the introduction of the subsidized employment program (fleksjob) but this effect is not strongly...

  11. The Shock Routine

    DEFF Research Database (Denmark)

    van Hooren, Franca; Kaasch, Alexandra; Starke, Peter

    2014-01-01

    in Australia, Belgium, the Netherlands and Sweden over the course of four global economic shocks, we ask whether the notion of critical junctures is useful in understanding the nature of change triggered by crisis. The main empirical finding is that fundamental change in the aftermath of an exogenous shock...... is the exception rather than the rule. Instead, incremental ‘crisis routines’ based on existing policy instruments are overwhelmingly used to deal with economic hardship. We discuss these findings in the light of the psychological ‘threat-rigidity’ effect and reflect on their consequences for theories...

  12. Normal accidents

    International Nuclear Information System (INIS)

    Perrow, C.

    1989-01-01

    The author has chosen numerous concrete examples to illustrate the hazardousness inherent in high-risk technologies. Starting with the TMI reactor accident in 1979, he shows that it is not only the nuclear energy sector that bears the risk of 'normal accidents', but also quite a number of other technologies and industrial sectors, or research fields. The author refers to the petrochemical industry, shipping, air traffic, large dams, mining activities, and genetic engineering, showing that due to the complexity of the systems and their manifold, rapidly interacting processes, accidents happen that cannot be thoroughly calculated, and hence are unavoidable. (orig./HP) [de

  13. Shock absorber in Ignalina NPP

    International Nuclear Information System (INIS)

    Bulavas, A.; Muralis, J.

    1996-09-01

    Theoretical calculation and experimental analysis of models of shock absorber in Ignalina NPP is presented. The results obtained from the investigation with model of shock absorber coincide with the theoretical calculation. (author). 2 figs., 3 refs

  14. Shock Response of Boron Carbide

    National Research Council Canada - National Science Library

    Dandekar, D. P. (Dattatraya Purushottam)

    2001-01-01

    .... The present work was undertaken to determine tensile/spall strength of boron carbide under plane shock wave loading and to analyze all available shock compression data on boron carbide materials...

  15. Fascinating World of Shock Waves

    Indian Academy of Sciences (India)

    Srimath

    travelling at supersonic speeds (more than the sound speed at ... actual earth- quake, travel at supersonic speeds. .... The time scale of the shock wave is also important ..... real lithotripsy where a shock wave is used shatter the kidney stones!

  16. Dissociative Functions in the Normal Mourning Process.

    Science.gov (United States)

    Kauffman, Jeffrey

    1994-01-01

    Sees dissociative functions in mourning process as occurring in conjunction with integrative trends. Considers initial shock reaction in mourning as model of normal dissociation in mourning process. Dissociation is understood to be related to traumatic significance of death in human consciousness. Discerns four psychological categories of…

  17. Shock wave convergence in water with parabolic wall boundaries

    International Nuclear Information System (INIS)

    Yanuka, D.; Shafer, D.; Krasik, Ya.

    2015-01-01

    The convergence of shock waves in water, where the cross section of the boundaries between which the shock wave propagates is either straight or parabolic, was studied. The shock wave was generated by underwater electrical explosions of planar Cu wire arrays using a high-current generator with a peak output current of ∼45 kA and rise time of ∼80 ns. The boundaries of the walls between which the shock wave propagates were symmetric along the z axis, which is defined by the direction of the exploding wires. It was shown that with walls having a parabolic cross section, the shock waves converge faster and the pressure in the vicinity of the line of convergence, calculated by two-dimensional hydrodynamic simulations coupled with the equations of state of water and copper, is also larger

  18. Radiating shocks and condensations in flares

    International Nuclear Information System (INIS)

    Fisher, G.H.

    1985-01-01

    Rapid energy release (by either ''thick target'' (beam) or ''thermal'' models of heating) in solar flare loop models usually leads to ''chromospheric evaporation,'' the process of heating cool chromospheric material to coronal temperatures, and the resulting increase in hot soft x-ray emitting plasma. The evaporated plasma flows up into the coronal portion of the loop because of the increased pressure in the evaporated region. However, the pressure increase also leads to a number of interesting phenomena in the flare chromosphere, which will be the subject of this paper. The sudden pressure increase in the evaporated plasma initiates a downward moving ''chromospheric condensation,'' an overdense region which gradually decelerates as it accretes material and propagates into the gravitationally stratified chromosphere. Solutions to an equation of motion for this condensation shows that its motion decays after about one minute of propagation into the chromosphere. When the front of this downflowing region is supersonic relative to the atmosphere ahead of it, a radiating shock will form. If the downflow is rapid enough, the shock strength should be sufficient to excite uv radiation normally associated with the transition region, and furthermore, the radiating shock will be brighter than the transition region. These results lead to a number of observationally testable relationships between the optical and ultraviolet spectra from the condensation and radiating shock

  19. INTERFERENCE OF UNIDIRECTIONAL SHOCK WAVES

    Directory of Open Access Journals (Sweden)

    P. V. Bulat

    2015-05-01

    Full Text Available Subject of study.We consider interference of unidirectional shock waves or, as they are called, catching up shock waves. The scope of work is to give a classification of the shock-wave structures that arise in this type of interaction of shock waves, and the area of their existence. Intersection of unidirectional shock waves results in arising of a shock-wave structure at the intersection point, which contains the main shock wave, tangential discontinuity and one more reflected gas-dynamic discontinuity of unknown beforehand type. The problem of determining the type of reflected discontinuity is the main problem that one has to solve in the study of catching shock waves interference. Main results.The paper presents the pictures of shock-wave structures arising at the interaction of catching up shock waves. The areas with a regular and irregular unidirectional interaction of shocks are described. Characteristic shock-wave structures are of greatest interest, where reflected gas-dynamic discontinuity degenerates into discontinuous characteristics. Such structures have a number of extreme properties. We have found the areas of existence for such shock-wave structures. There are also areas in which the steady-state solution is not available. The latter has determined revival of interest for the theoretical study of the problem, because the facts of sudden shock-wave structure destruction inside the air intake of supersonic aircrafts at high Mach numbers have been discovered. Practical significance.The theory of interference for unidirectional shock waves and design procedure are usable in the design of supersonic air intakes. It is also relevant for application possibility investigation of catching up oblique shock waves to create overcompressed detonation in perspective detonation air-jet and rocket engines.

  20. Shock tube Multiphase Experiments

    Science.gov (United States)

    Middlebrooks, John; Allen, Roy; Paudel, Manoj; Young, Calvin; Musick, Ben; McFarland, Jacob

    2017-11-01

    Shock driven multiphase instabilities (SDMI) are unique physical phenomena that have far-reaching practical applications in engineering and science. The instability is present in high energy explosions, scramjet combustors, and supernovae events. The SDMI arises when a multiphase interface is impulsively accelerated by the passage of a shockwave. It is similar in development to the Richtmyer-Meshkov (RM) instability however, particle-to-gas coupling is the driving mechanism of the SDMI. As particle effects such as lag and phase change become more prominent, the SDMI's development begins to significantly deviate from the RM instability. We have developed an experiment for studying the SDMI in our shock tube facility. In our experiments, a multiphase interface is created using a laminar jet and flowed into the shock tube where it is accelerated by the passage of a planar shockwave. The interface development is captured using CCD cameras synchronized with planar laser illumination. This talk will give an overview of new experiments conducted to examine the development of a shocked cylindrical multiphase interface. The effects of Atwood number, particle size, and a second acceleration (reshock) of the interface will be discussed.

  1. Teleconnected food supply shocks

    Science.gov (United States)

    Bren d'Amour, Christopher; Wenz, Leonie; Kalkuhl, Matthias; Steckel, Jan Christoph; Creutzig, Felix

    2016-03-01

    The 2008-2010 food crisis might have been a harbinger of fundamental climate-induced food crises with geopolitical implications. Heat-wave-induced yield losses in Russia and resulting export restrictions led to increases in market prices for wheat across the Middle East, likely contributing to the Arab Spring. With ongoing climate change, temperatures and temperature variability will rise, leading to higher uncertainty in yields for major nutritional crops. Here we investigate which countries are most vulnerable to teleconnected supply-shocks, i.e. where diets strongly rely on the import of wheat, maize, or rice, and where a large share of the population is living in poverty. We find that the Middle East is most sensitive to teleconnected supply shocks in wheat, Central America to supply shocks in maize, and Western Africa to supply shocks in rice. Weighing with poverty levels, Sub-Saharan Africa is most affected. Altogether, a simultaneous 10% reduction in exports of wheat, rice, and maize would reduce caloric intake of 55 million people living in poverty by about 5%. Export bans in major producing regions would put up to 200 million people below the poverty line at risk, 90% of which live in Sub-Saharan Africa. Our results suggest that a region-specific combination of national increases in agricultural productivity and diversification of trade partners and diets can effectively decrease future food security risks.

  2. STEREO interplanetary shocks and foreshocks

    International Nuclear Information System (INIS)

    Blanco-Cano, X.; Kajdič, P.; Aguilar-Rodríguez, E.; Russell, C. T.; Jian, L. K.; Luhmann, J. G.

    2013-01-01

    We use STEREO data to study shocks driven by stream interactions and the waves associated with them. During the years of the extended solar minimum 2007-2010, stream interaction shocks have Mach numbers between 1.1-3.8 and θ Bn ∼20-86°. We find a variety of waves, including whistlers and low frequency fluctuations. Upstream whistler waves may be generated at the shock and upstream ultra low frequency (ULF) waves can be driven locally by ion instabilities. The downstream wave spectra can be formed by both, locally generated perturbations, and shock transmitted waves. We find that many quasiperpendicular shocks can be accompanied by ULF wave and ion foreshocks, which is in contrast to Earth's bow shock. Fluctuations downstream of quasi-parallel shocks tend to have larger amplitudes than waves downstream of quasi-perpendicular shocks. Proton foreshocks of shocks driven by stream interactions have extensions dr ≤0.05 AU. This is smaller than foreshock extensions for ICME driven shocks. The difference in foreshock extensions is related to the fact that ICME driven shocks are formed closer to the Sun and therefore begin to accelerate particles very early in their existence, while stream interaction shocks form at ∼1 AU and have been producing suprathermal particles for a shorter time.

  3. STEREO interplanetary shocks and foreshocks

    Energy Technology Data Exchange (ETDEWEB)

    Blanco-Cano, X. [Instituto de Geofisica, UNAM, CU, Coyoacan 04510 DF (Mexico); Kajdic, P. [IRAP-University of Toulouse, CNRS, Toulouse (France); Aguilar-Rodriguez, E. [Instituto de Geofisica, UNAM, Morelia (Mexico); Russell, C. T. [ESS and IGPP, University of California, Los Angeles, 603 Charles Young Drive, Los Angeles, CA 90095 (United States); Jian, L. K. [NASA Goddard Space Flight Center, Greenbelt, MD and University of Maryland, College Park, MD (United States); Luhmann, J. G. [SSL, University of California Berkeley (United States)

    2013-06-13

    We use STEREO data to study shocks driven by stream interactions and the waves associated with them. During the years of the extended solar minimum 2007-2010, stream interaction shocks have Mach numbers between 1.1-3.8 and {theta}{sub Bn}{approx}20-86 Degree-Sign . We find a variety of waves, including whistlers and low frequency fluctuations. Upstream whistler waves may be generated at the shock and upstream ultra low frequency (ULF) waves can be driven locally by ion instabilities. The downstream wave spectra can be formed by both, locally generated perturbations, and shock transmitted waves. We find that many quasiperpendicular shocks can be accompanied by ULF wave and ion foreshocks, which is in contrast to Earth's bow shock. Fluctuations downstream of quasi-parallel shocks tend to have larger amplitudes than waves downstream of quasi-perpendicular shocks. Proton foreshocks of shocks driven by stream interactions have extensions dr {<=}0.05 AU. This is smaller than foreshock extensions for ICME driven shocks. The difference in foreshock extensions is related to the fact that ICME driven shocks are formed closer to the Sun and therefore begin to accelerate particles very early in their existence, while stream interaction shocks form at {approx}1 AU and have been producing suprathermal particles for a shorter time.

  4. The repeated extracorporeal shock waves and the renal parenchyma injury on normal and diabetic rats A repetição de ondas de choque extracorpóreas e a lesão do parênquima renal em ratos normais e diabéticos

    Directory of Open Access Journals (Sweden)

    Vicente Massaji Kira

    2007-08-01

    Full Text Available PURPOSE: To assess the effect of repeated extracorporeal shock waves (ESW on renal parenchyma of normal and diabetic rats. METHODS: 40 normal rats (A and 40 diabetic rats (B were assigned for ESW (Direx Tripter X1® - 14 KVA as follow: A1/B1 and A3/B3 no ESW; A2/B2 one ESW (2,000 SW; A4/B4 two ESW (4,000 SW in an elapsed 14 days. All the animals were sacrificed 3 days after the ESW and samples of renal parenchyma were histological prepared, stained by H&E. For each animal the frequency of hemorrhage focus (HF in the subcapasular, interstitial and glomerulus area was calculated (porcentage on 20 randomly histological sections. RESULTS: No one HF was identified in all normal or diabetic animals without ESW (A1, A3 and B1, B3. In the normal rats the HF frequency was similar to one ESW (subcapsular =15%; interstitial =20% and glomerular =10% or repetead ESW (subcapsular =25%; interstitial =20%; glomerular=10%. In diabetic rats the occurence of HF with repetead ESW was more frequent (subcapsular =40%; interstitial =30% and glomerular =10% than with a single ESW (subcapsular =25%; interstitial =15% and glomerular =15%. CONCLUSION: A single ESW or a repeated ESW caused a mild and similar damage on renal cortex of normal rats. In diabetic rats the repetead ESW may result in an accumulated damage, especially with focus of hemorrhage in subcapsular and interstitial tissue and glomerulus edema.RESUMO OBJETIVO: Avaliar o efeito de repetidas ondas de choque extracorpóreas (OCE sobre o parênquima renal de ratos normais e diabéticos. MÉTODOS: 40 ratos normais e 40 ratos diabéticos foram distribuídos para aplicação de OCE (Direx Tripter X1® - 14 KVA como segue: A1/B1 e A3/B3 sem OCE; A2/B2 uma sessão de OCE (2000 OC; A4/B4 duas sessões de OC (4000 OC num intervalo de 14 dias. Todos os animais foram sacrificados no 3º. dia após a aplicação da OCE e amostras de parênquima renal foram histologicamente preparados e corados em H&E. Para cada animal

  5. Absolute Hugoniot measurements from a spherically convergent shock using x-ray radiography

    Science.gov (United States)

    Swift, Damian C.; Kritcher, Andrea L.; Hawreliak, James A.; Lazicki, Amy; MacPhee, Andrew; Bachmann, Benjamin; Döppner, Tilo; Nilsen, Joseph; Collins, Gilbert W.; Glenzer, Siegfried; Rothman, Stephen D.; Kraus, Dominik; Falcone, Roger W.

    2018-05-01

    The canonical high pressure equation of state measurement is to induce a shock wave in the sample material and measure two mechanical properties of the shocked material or shock wave. For accurate measurements, the experiment is normally designed to generate a planar shock which is as steady as possible in space and time, and a single state is measured. A converging shock strengthens as it propagates, so a range of shock pressures is induced in a single experiment. However, equation of state measurements must then account for spatial and temporal gradients. We have used x-ray radiography of spherically converging shocks to determine states along the shock Hugoniot. The radius-time history of the shock, and thus its speed, was measured by radiographing the position of the shock front as a function of time using an x-ray streak camera. The density profile of the shock was then inferred from the x-ray transmission at each instant of time. Simultaneous measurement of the density at the shock front and the shock speed determines an absolute mechanical Hugoniot state. The density profile was reconstructed using the known, unshocked density which strongly constrains the density jump at the shock front. The radiographic configuration and streak camera behavior were treated in detail to reduce systematic errors. Measurements were performed on the Omega and National Ignition Facility lasers, using a hohlraum to induce a spatially uniform drive over the outside of a solid, spherical sample and a laser-heated thermal plasma as an x-ray source for radiography. Absolute shock Hugoniot measurements were demonstrated for carbon-containing samples of different composition and initial density, up to temperatures at which K-shell ionization reduced the opacity behind the shock. Here we present the experimental method using measurements of polystyrene as an example.

  6. Reconstructing Normality

    DEFF Research Database (Denmark)

    Gildberg, Frederik Alkier; Bradley, Stephen K.; Fristed, Peter Billeskov

    2012-01-01

    Forensic psychiatry is an area of priority for the Danish Government. As the field expands, this calls for increased knowledge about mental health nursing practice, as this is part of the forensic psychiatry treatment offered. However, only sparse research exists in this area. The aim of this study...... was to investigate the characteristics of forensic mental health nursing staff interaction with forensic mental health inpatients and to explore how staff give meaning to these interactions. The project included 32 forensic mental health staff members, with over 307 hours of participant observations, 48 informal....... The intention is to establish a trusting relationship to form behaviour and perceptual-corrective care, which is characterized by staff's endeavours to change, halt, or support the patient's behaviour or perception in relation to staff's perception of normality. The intention is to support and teach the patient...

  7. Pursuing Normality

    DEFF Research Database (Denmark)

    Madsen, Louise Sofia; Handberg, Charlotte

    2018-01-01

    implying an influence on whether to participate in cancer survivorship care programs. Because of "pursuing normality," 8 of 9 participants opted out of cancer survivorship care programming due to prospects of "being cured" and perceptions of cancer survivorship care as "a continuation of the disease......BACKGROUND: The present study explored the reflections on cancer survivorship care of lymphoma survivors in active treatment. Lymphoma survivors have survivorship care needs, yet their participation in cancer survivorship care programs is still reported as low. OBJECTIVE: The aim of this study...... was to understand the reflections on cancer survivorship care of lymphoma survivors to aid the future planning of cancer survivorship care and overcome barriers to participation. METHODS: Data were generated in a hematological ward during 4 months of ethnographic fieldwork, including participant observation and 46...

  8. The 60 kDa heat shock proteins in the hyperthermophilic archaeon Sulfolobus shibatae.

    Science.gov (United States)

    Kagawa, H K; Osipiuk, J; Maltsev, N; Overbeek, R; Quaite-Randall, E; Joachimiak, A; Trent, J D

    1995-11-10

    One of the most abundant proteins in the hyperthermophilic archaeon Sulfolobus shibatae is the 59 kDa heat shock protein (TF55) that is believed to form a homo-oligomeric double ring complex structurally similar to the bacterial chaperonins. We discovered a second protein subunit in the S. shibatae ring complex (referred to as alpha) that is stoichiometric with TF55 (renamed beta). The gene and flanking regions of alpha were cloned and sequenced and its inferred amino acid sequence has 54.4% identity and 74.4% similarity to beta. Transcription start sites for both alpha and beta were mapped and three potential transcription regulatory regions were identified. Northern analyses of cultures shifted from normal growth temperatures (70 to 75 degrees C) to heat shock temperatures (85 to 90 degrees C) indicated that the levels of alpha and beta mRNAs increased during heat shock, but at all temperatures their relative proportions remained constant. Monitoring protein synthesis by autoradiography of total proteins from cultures pulse labeled with L(-)[35S]methionine at normal and heat shock temperatures indicated significant increases in alpha and beta synthesis during heat shock. Under extreme heat shock conditions (> or = 90 degrees C) alpha and beta appeared to be the only two proteins synthesized. The purified alpha and beta subunits combined to form high molecular mass complexes with similar mobilities on native polyacrylamide gels to the complexes isolated directly from cells. Equal proportions of the two subunits gave the greatest yield of the complex, which we refer to as a "rosettasome". It is argued that the rosettasome consists of two homo-oligomeric rings; one of alpha and the other of beta. Polyclonal antibodies against alpha and beta from S. shibatae cross-reacted with proteins of similar molecular mass in 10 out of the 17 archaeal species tested, suggesting that the two rosettasome proteins are highly conserved among the archaea. The archaeal sequences were

  9. Multiple spacecraft observations of interplanetary shocks: characteristics of the upstream ulf turbulence

    International Nuclear Information System (INIS)

    Russell, C.T.; Smith, E.J.; Tsurutani, B.T.; Gosling, J.T.; Bame, S.J.

    1982-01-01

    All interplanetary shocks observed by ISEE-3 and either ISEE-1 or ISEE-2 or both in 1978 and 1979 are examined for evidence of upstream waves. In order to characterize the properties of these shocks it is necessary to determine accurate shock normals. We invert an overdetermined set of equations to obtain shock normals, velocities and error estimates for all these shocks. Tests of the method indicate it is quite reliable. Using these normals we then calculate the Mach number and angle between the interplanetary magnetic field and the shock normal for each shock. These parameters allow us to separate the upstream waves into two classes: whistler-mode precursors which occur at low Mach numbers and upstream turbulence whose amplitude at Mach numbers greater than 1.5 is controlled by the angle of the field to the shock normal. The former waves are right-hand circularly polarized and quite monochromatic. The latter waves are more linearly polarized and have a broadband featureless spectrum

  10. In-tube shock wave driven by atmospheric millimeter-wave plasma

    International Nuclear Information System (INIS)

    Oda, Yasuhisa; Kajiwara, Ken; Takahashi, Koji; Kasugai, Atsushi; Sakamoto, Keishi; Komurasaki, Kimiya

    2009-01-01

    A shock wave in a tube supported by atmospheric millimeter-wave plasma is discussed. After atmospheric breakdown, the shock wave supported by the millimeter wave propagates at a constant velocity in the tube. In this study, a driving model of the millimeter-wave shock wave is proposed. The model consists of a normal shock wave supported by a propagating heat-supply area in which an ionization front is located. The flow properties predicted by the model show good agreement with the measured properties of the shock wave generated in the tube using a 170 GHz millimeter wave beam. The shock propagation velocity U shock is identical to the propagation velocity of the ionization front U ioniz when U ioniz is supersonic. Then the pressure increment at the tube end is independent of the power density. (author)

  11. Shock Dynamics in Stellar Outbursts. I. Shock Formation

    Energy Technology Data Exchange (ETDEWEB)

    Ro, Stephen; Matzner, Christopher D., E-mail: ro@astro.utoronto.ca [Department of Astronomy and Astrophysics, University of Toronto, 50 St. George Street, Toronto, ON M5S 3H4 (Canada)

    2017-05-20

    Wave-driven outflows and non-disruptive explosions have been implicated in pre-supernova outbursts, supernova impostors, luminous blue variable eruptions, and some narrow-line and superluminous supernovae. To model these events, we investigate the dynamics of stars set in motion by strong acoustic pulses and wave trains, focusing on nonlinear wave propagation, shock formation, and an early phase of the development of a weak shock. We identify the shock formation radius, showing that a heuristic estimate based on crossing characteristics matches an exact expansion around the wave front and verifying both with numerical experiments. Our general analytical condition for shock formation applies to one-dimensional motions within any static environment, including both eruptions and implosions. We also consider the early phase of shock energy dissipation. We find that waves of super-Eddington acoustic luminosity always create shocks, rather than damping by radiative diffusion. Therefore, shock formation is integral to super-Eddington outbursts.

  12. Particle acceleration and injection problem in relativistic and nonrelativistic shocks

    International Nuclear Information System (INIS)

    Hoshino, M.

    2008-01-01

    Acceleration of charged particles at the collisionless shock is believed to be responsible for production of cosmic rays in a variety of astrophysical objects such as supernova, AGN jet, and GRB etc., and the diffusive shock acceleration model is widely accepted as a key process for generating cosmic rays with non-thermal, power-law energy spectrum. Yet it is not well understood how the collisionless shock can produce such high energy particles. Among several unresolved issues, two major problems are the so-called '' injection '' problem of the supra-thermal particles and the generation of plasma waves and turbulence in and around the shock front. With recent advance of computer simulations, however, it is now possible to discuss those issues together with dynamical evolution of the kinetic shock structure. A wealth of modern astrophysical observations also inspires the dynamical shock structure and acceleration processes along with the theoretical and computational studies on shock. In this presentation, we focus on the plasma wave generation and the associated particle energization that directly links to the injection problem by taking into account the kinetic plasma processes of both non-relativistic and relativistic shocks by using a particle-in-cell simulation. We will also discuss some new particle acceleration mechanisms such as stochastic surfing acceleration and wakefield acceleration by the action of nonlinear electrostatic fields. (author)

  13. A DATA-DRIVEN ANALYTIC MODEL FOR PROTON ACCELERATION BY LARGE-SCALE SOLAR CORONAL SHOCKS

    Energy Technology Data Exchange (ETDEWEB)

    Kozarev, Kamen A. [Smithsonian Astrophysical Observatory (United States); Schwadron, Nathan A. [Institute for the Study of Earth, Oceans, and Space, University of New Hampshire (United States)

    2016-11-10

    We have recently studied the development of an eruptive filament-driven, large-scale off-limb coronal bright front (OCBF) in the low solar corona, using remote observations from the Solar Dynamics Observatory ’s Advanced Imaging Assembly EUV telescopes. In that study, we obtained high-temporal resolution estimates of the OCBF parameters regulating the efficiency of charged particle acceleration within the theoretical framework of diffusive shock acceleration (DSA). These parameters include the time-dependent front size, speed, and strength, as well as the upstream coronal magnetic field orientations with respect to the front’s surface normal direction. Here we present an analytical particle acceleration model, specifically developed to incorporate the coronal shock/compressive front properties described above, derived from remote observations. We verify the model’s performance through a grid of idealized case runs using input parameters typical for large-scale coronal shocks, and demonstrate that the results approach the expected DSA steady-state behavior. We then apply the model to the event of 2011 May 11 using the OCBF time-dependent parameters derived by Kozarev et al. We find that the compressive front likely produced energetic particles as low as 1.3 solar radii in the corona. Comparing the modeled and observed fluences near Earth, we also find that the bulk of the acceleration during this event must have occurred above 1.5 solar radii. With this study we have taken a first step in using direct observations of shocks and compressions in the innermost corona to predict the onsets and intensities of solar energetic particle events.

  14. Ion distribution dynamics near the Earth's bow shock: first measurements with the 2D ion energy spectrometer CORALL on the INTERBALL/Tail-probe satellite

    Directory of Open Access Journals (Sweden)

    Yu. I. Yermolaev

    1997-05-01

    Full Text Available The dynamics of the ion distribution function near the Earth's bow shock is studied on the basis of quasi-3D measurements of ion energy spectra in the range of 30–24200 eV/q with the Russian-Cuban CORALL instrument on the INTERBALL/Tail-probe satellite. The instrument was designed for observations of magnetospheric plasma and measures ions, in an angular range of 36°–144° from the Earth-Sun direction. Ion populations generated by the Earth bow shock are often observed upstream from the bow shock. In the solar-wind stream compressed and heated by the passing of very dense magnetic cloud (CME, two types of these ion populations were measured upstream and before the bow shock crossing on 25 August 1995 at 07:37 UT. Both populations were observed in the energy range above 2 keV. At ~06:20 UT, when the angle between the direction of the interplanetary magnetic field and normal to the bow shock VBn was ≃ 43° the instrument observed a narrow, fast (~800 km/s field-aligned beam moving from the Earth. At ~07:30, when Bn ≃ 28°, the wide ion pitch-angle distribution was observed. A similar suprathermal ion population is observed in the magnetosheath simultaneously with the solar-wind ion population being heated and deflected from the Sun-Earth direction. The similarity of observations during the mentioned time-interval and under usual solar-wind conditions allows us to conclude that types of suprathermal ion populations upstream and downstream from the bow shock do not depend on the solar-wind disturbance generated by magnetic cloud.

  15. Grain destruction in interstellar shocks

    International Nuclear Information System (INIS)

    Seab, C.G.; Shull, J.M.

    1984-01-01

    One of the principal methods for removing grains from the Interstellar Medium is to destroy them in shock waves. Previous theoretical studies of shock destruction have generally assumed only a single size and type of grain; most do not account for the effect of the grain destruction on the structure of the shock. Earlier calculations have been improved in three ways: first, by using a ''complete'' grain model including a distribution of sizes and types of grains; second, by using a self-consistent shock structure that incorporates the changing elemental depletions as the grains are destroyed; and third, by calculating the shock-processed ultraviolet extinction curves for comparison with observations. (author)

  16. Fluid resuscitation does not improve renal oxygenation during hemorrhagic shock in rats

    OpenAIRE

    Legrand, Matthieu; Mik, Egbert; Balestra, Gianmarco; Lutter, Rene; Pirracchio, Romain; Payen, Didier; Ince, Can

    2010-01-01

    textabstractBackground: The resuscitation strategy for hemorrhagic shock remains controversial, with the kidney being especially prone to hypoxia. Methods: The authors used a three-phase hemorrhagic shock model to investigate the effects of fluid resuscitation on renal oxygenation. After a 1-h shock phase, rats were randomized into four groups to receive either normal saline or hypertonic saline targeting a mean arterial pressure (MAP) of either 40 or 80 mmHg. After such resuscitation, rats w...

  17. Back-pressure Effect on Shock-Train Location in a Scramjet Engine Isolator

    Science.gov (United States)

    2010-03-01

    breathing single-stage-to-orbit ( SSTO ) reusable spacecraft, X-30. It made a great contribution towards developing a rectangular, airframe-integrated...scramjet. This program was cancelled without conducting a flight test. The goal of this program was to build a full scale operational SSTO vehicle...bomber, SSTO , or hypersonic transportation. Shock system A shock-train is a system of series of oblique or normal shocks, which is a very complex flow

  18. Intraluminal bubble dynamics induced by lithotripsy shock wave

    Science.gov (United States)

    Song, Jie; Bai, Jiaming; Zhou, Yufeng

    2016-12-01

    Extracorporeal shock wave lithotripsy (ESWL) has been the first option in the treatment of calculi in the upper urinary tract since its introduction. ESWL-induced renal injury is also found after treatment and is assumed to associate with intraluminal bubble dynamics. To further understand the interaction of bubble expansion and collapse with the vessel wall, the finite element method (FEM) was used to simulate intraluminal bubble dynamics and calculate the distribution of stress in the vessel wall and surrounding soft tissue during cavitation. The effects of peak pressure, vessel size, and stiffness of soft tissue were investigated. Significant dilation on the vessel wall occurs after contacting with rapid and large bubble expansion, and then vessel deformation propagates in the axial direction. During bubble collapse, large shear stress is found to be applied to the vessel wall at a clinical lithotripter setting (i.e. 40 MPa peak pressure), which may be the mechanism of ESWL-induced vessel rupture. The decrease of vessel size and viscosity of soft tissue would enhance vessel deformation and, consequently, increase the generated shear stress and normal stresses. Meanwhile, a significantly asymmetric bubble boundary is also found due to faster axial bubble expansion and shrinkage than in radial direction, and deformation of the vessel wall may result in the formation of microjets in the axial direction. Therefore, this numerical work would illustrate the mechanism of ESWL-induced tissue injury in order to develop appropriate counteractive strategies for reduced adverse effects.

  19. Bubble Dynamics and Shock Waves

    CERN Document Server

    2013-01-01

    This volume of the Shock Wave Science and Technology Reference Library is concerned with the interplay between bubble dynamics and shock waves. It is divided into four parts containing twelve chapters written by eminent scientists. Topics discussed include shock wave emission by laser generated bubbles (W Lauterborn, A Vogel), pulsating bubbles near boundaries (DM Leppinen, QX Wang, JR Blake), interaction of shock waves with bubble clouds (CD Ohl, SW Ohl), shock propagation in polydispersed bubbly liquids by model equations (K Ando, T Colonius, CE Brennen. T Yano, T Kanagawa,  M Watanabe, S Fujikawa) and by DNS (G Tryggvason, S Dabiri), shocks in cavitating flows (NA Adams, SJ Schmidt, CF Delale, GH Schnerr, S Pasinlioglu) together with applications involving encapsulated bubble dynamics in imaging (AA Doinikov, A Novell, JM Escoffre, A Bouakaz),  shock wave lithotripsy (P Zhong), sterilization of ships’ ballast water (A Abe, H Mimura) and bubbly flow model of volcano eruptions ((VK Kedrinskii, K Takayama...

  20. Normalization of satellite imagery

    Science.gov (United States)

    Kim, Hongsuk H.; Elman, Gregory C.

    1990-01-01

    Sets of Thematic Mapper (TM) imagery taken over the Washington, DC metropolitan area during the months of November, March and May were converted into a form of ground reflectance imagery. This conversion was accomplished by adjusting the incident sunlight and view angles and by applying a pixel-by-pixel correction for atmospheric effects. Seasonal color changes of the area can be better observed when such normalization is applied to space imagery taken in time series. In normalized imagery, the grey scale depicts variations in surface reflectance and tonal signature of multi-band color imagery can be directly interpreted for quantitative information of the target.

  1. Effects of explosion-generated shock waves in ducts

    International Nuclear Information System (INIS)

    Busby, M.R.; Kahn, J.E.; Belk, J.P.

    1976-01-01

    An explosion in a space causes an increase in temperature and pressure. To quantify the challenge that will be presented to essential components in a ventilation system, it is necessary to analyze the dynamics of a shock wave generated by an explosion, with attention directed to the propagation of such a wave in a duct. Using the equations of unsteady flow and shock tube theory, a theoretical model has been formulated to provide flow properties behind moving shock waves that have interacted with various changes in duct geometry. Empirical equations have been derived to calculate air pressure, temperature, Mach number, and velocity in a duct following an explosion

  2. Shock waves in water at low energy pulsed electric discharges

    International Nuclear Information System (INIS)

    Pinchuk, M E; Kolikov, V A; Rutberg, Ph G; Leks, A G; Dolinovskaya, R V; Snetov, V N; Stogov, A Yu

    2012-01-01

    Experimental results of shock wave formation and propagation in water at low energy pulsed electric discharges are presented. To study the hydrodynamic structure of the shock waves, the direct shadow optical diagnostic device with time resolution of 5 ns and spatial resolution of 0.1 mm was designed and developed. Synchronization of the diagnostic and electrodischarge units by the fast optocouplers was carried out. The dependences of shock wave velocities after breakdown of interelectrode gap for various energy inputs (at range of ≤1 J) into discharge were obtained. Based on the experimental results the recommendations for the adjustment parameters of the power supply and load were suggested.

  3. International Shock-Wave Database: Current Status

    Science.gov (United States)

    Levashov, Pavel

    2013-06-01

    speed in the Hugoniot state, and time-dependent free-surface or window-interface velocity profiles. Users are able to search the information in the database and obtain the experimental points in tabular or plain text formats directly via the Internet using common browsers. It is also possible to plot the experimental points for comparison with different approximations and results of equation-of-state calculations. The user can present the results of calculations in text or graphical forms and compare them with any experimental data available in the database. A short history of the shock-wave database will be presented and current possibilities of ISWdb will be demonstrated. Web-site of the project: http://iswdb.info. This work is supported by SNL contracts # 1143875, 1196352.

  4. Shock wave overtake measurements on cesium iodide

    International Nuclear Information System (INIS)

    Swenson, C.A.

    1986-01-01

    The luminosity of the shock front for CsI makes it an ideal material for which to measure directly sound velocities along the Hugoniot using shock wave overtake methods. In these measurements, the occurrence of melting along the Hugoniot is marked by a discontinuous decrease in the measured sound velocity. In addition, CsI is isoelectronic with xenon and is expected to begin to show metallic behavior along the Hugoniot near 0.9 Mbar. The directly-determined sound velocities and corresponding elastic moduli would be expected to be more sensitive to this transition than either Hugoniot equations of state or optical pyrometry experiments. This paper presents a brief description of the present experiments and results

  5. Regular shock refraction in planar ideal MHD

    International Nuclear Information System (INIS)

    Delmont, P; Keppens, R

    2010-01-01

    We study the classical problem of planar shock refraction at an oblique density discontinuity, separating two gases at rest, in planar ideal (magneto)hydrodynamics. In the hydrodynamical case, 3 signals arise and the interface becomes Richtmyer-Meshkov unstable due to vorticity deposition on the shocked contact. In the magnetohydrodynamical case, on the other hand, when the normal component of the magnetic field does not vanish, 5 signals will arise. The interface then typically remains stable, since the Rankine-Hugoniot jump conditions in ideal MHD do not allow for vorticity deposition on a contact discontinuity. We present an exact Riemann solver based solution strategy to describe the initial self similar refraction phase. Using grid-adaptive MHD simulations, we show that after reflection from the top wall, the interface remains stable.

  6. Some new results on shock chemistry in IC 443

    International Nuclear Information System (INIS)

    DeNoyer, L.K.; Frerking, M.A.

    1981-01-01

    We have made new observations of CO, 13 CO, SiO, SO, H 2 CO, HCO + , N 2 H + , CS, OCS, HCN, and OH in the shocked clouds of IC 443. At position IC 443 B, we find (a) the shocked CO is optically thin, (b) the HCO + /CO abundance ratio is 4--9 x 10 -4 , a tenfold enhancement over normal interstellar clouds, (c) HCN/CO = 1--3 x 10 -4 and CS/CO = 2--3 x 10 -4 , consistent with abundances found in ordinary clouds, (d) no enhancements of SO or SiO as occur in Orion KL, (e) optically thin preshock OH, confirming a hundredfold enhancement of OH/CO in the shock, and (f) an OH main line anomaly, with T/sub ex/(1667)>T/sub ex/(1665) in the shocked region

  7. DSMC Computations for Regions of Shock/Shock and Shock/Boundary Layer Interaction

    Science.gov (United States)

    Moss, James N.

    2001-01-01

    This paper presents the results of a numerical study of hypersonic interacting flows at flow conditions that include those for which experiments have been conducted in the Calspan-University of Buffalo Research Center (CUBRC) Large Energy National Shock (LENS) tunnel and the ONERA R5Ch low-density wind tunnel. The computations are made with the direct simulation Monte Carlo (DSMC) method of Bird. The focus is on Mach 9.3 to 11.4 flows about flared axisymmetric configurations, both hollow cylinder flares and double cones. The results presented highlight the sensitivity of the calculations to grid resolution, provide results concerning the conditions for incipient separation, and provide information concerning the flow structure and surface results for the extent of separation, heating, pressure, and skin friction.

  8. Effect of shock pressure on the structure and superconducting properties of Y-Ba-Cu-O in explosively fabricated bulk metal-matrix composites

    Science.gov (United States)

    Murr, L. E.; Niou, C. S.; Pradhan-Advani, M.

    1991-01-01

    While it is now well established that copper-oxide-based power, or virtually any other ceramic superconductor powder, can be consolidated and encapsulated within a metal matrix by explosive consolidation, the erratic superconductivity following fabrication has posed a major problem for bulk applications. The nature of this behavior was found to arise from microstructural damage created in the shock wave front, and the residual degradation in superconductivity was demonstrated to be directly related to the peak shock pressure. The explosively fabricated or shock loaded YBa2Cu3Ox examples exhibit drastically altered rho (or R) - T curves. The deterioration in superconductivity is even more noticeable in the measurement of ac magnetic susceptibility and flux exclusion or shielding fraction which is also reduced in proportion to increasing peak shock pressure. The high frequency surface resistance (in the GHz range) is also correspondingly compromised in explosively fabricated, bulk metal-matrix composites based on YBa2Cu3O7. Transmission electron microscopy (including lattice imaging techniques) is being applied in an effort to elucidate the fundamental (microstructural) nature of the shock-induced degradation of superconductivity and normal state conductivity. One focus of TEM observations has assumed that oxygen displaced from b-chains rather than oxygen-vacancy disorder in the basal plane of oxygen deficient YBa2Cu3Ox may be a prime mechanism. Shock-wave displaced oxygen may also be locked into new positions or interstitial clusters or chemically bound to displaced metal (possibly copper) atoms to form precipitates, or such displacements may cause the equivalent of local lattice cell changes as a result of stoichiometric changes. While the shock-induced suppression of T(sub c) is not desirable in the explosive fabrication of bulk metal-matrix superconductors, it may be turned into an advantage if the atomic-scale distortion can be understood and controlled as local

  9. Banking System Shocks and REIT Performance

    OpenAIRE

    Olliges, Jan-Willem; Raudszus, Malte H.; Mueller, Glenn R.

    2013-01-01

    The purpose of this study is to directly contrast the REIT market’s stock return response to bank failures versus bank bailouts. The non-negativity constraints of the GARCH model measuring risk dynamics are mitigated by the use of the EGARCH model. EGARCH accounts for non-symmetrical effects of risk adjustments in response to return shocks. Previous research shows that bank failures cause a positive abnormal return effect for REITs. This confirms the expectation that during crises, market par...

  10. Adjustable Shock Absorbers

    OpenAIRE

    Adamiec, Radek

    2012-01-01

    Bakalářská práce obsahuje přehled používaných tlumičů osobních automobilů, závodních automobilů a motocyklů. Jsou zde popsány systémy t lumením, konstrukce tlumičů a vidlic používaných u motocyklů. Dále je zde přehled prvků používaných u podvozků automobilů. This bachelor´s thesis contains the survey of the shock absorbers of passenger cars, racing cars and motorcycles. Are described damping systems, the design used shock absorbers and forks for motorcycles. Then there is the list of the e...

  11. Radiative relativistic shock adiabate

    International Nuclear Information System (INIS)

    Tsintsadze, L.N.; Nishikawa, K.

    1997-01-01

    The influences of thermal radiation on the state equation of shock waves, derived in the previous paper [L. N. Tsintsadze, Phys. Plasmas 2, 4462 (1995)], are studied and a series of relations of thermodynamic quantities that hold for shock waves are derived. It is shown that the presence of radiation can strongly change the compressibility of the plasma. It is well known that for polytropic gases the compressibility cannot change more than four times the initial value in the case of nonrelativistic temperatures. The numerical calculations show that there are no such restrictions, when the radiation energy exceeds the kinetic energy of the plasma. The ultrarelativistic temperature range is also covered in our numerical calculations. Also studied are the influences of the radiation on the PT and the TV diagrams. A significant modification due to radiation is found in every case studied. copyright 1997 American Institute of Physics

  12. POSTURAL SHOCK IN PREGNANCY

    Science.gov (United States)

    Wilkening, Ralph L.; Knauer, John; Larson, Roger K.

    1955-01-01

    Signs and symptoms of shock may be produced in some patients in late pregnancy by putting them in the dorsal recumbent posture. Change from this position will relieve the condition. The features of the supine hypotensive syndrome can be duplicated by applying pressure to the abdomen with the patient in a lateral position. The postural variations of venous pressure, blood pressure, and pulse appear to be due to obstruction of venous return from the lower portion of the body caused by the large uterus of late pregnancy compressing the vena cava. When shock is observed in a woman in late pregnancy, she should be turned to a lateral position before more active measures of treatment are begun. ImagesFigure 1. PMID:14351983

  13. Bow shock data analysis

    Science.gov (United States)

    Zipf, Edward C.; Erdman, Peeter W.

    1994-08-01

    The University of Pittsburgh Space Physics Group in collaboration with the Army Research Office (ARO) modeling team has completed a systematic organization of the shock and plume spectral data and the electron temperature and density measurements obtained during the BowShock I and II rocket flights which have been submitted to the AEDC Data Center, has verified the presence of CO Cameron band emission during the Antares engine burn and for an extended period of time in the post-burn plume, and have adapted 3-D radiation entrapment codes developed by the University of Pittsburgh to study aurora and other atmospheric phenomena that involve significant spatial effects to investigate the vacuum ultraviolet (VUV) and extreme ultraviolet (EUV) envelope surrounding the re-entry that create an extensive plasma cloud by photoionization.

  14. Shock Isolation Elements Testing for High Input Loadings. Volume III. Mechanical Shock Isolation Elements.

    Science.gov (United States)

    SHOCK ABSORBERS ), (*GUIDED MISSILE SILOS, SHOCK ABSORBERS ), (*SPRINGS, (*SHOCK(MECHANICS), REDUCTION), TORSION BARS, ELASTOMERS, DAMPING, EQUATIONS OF MOTION, MODEL TESTS, TEST METHODS, NUCLEAR EXPLOSIONS, HARDENING.

  15. A nova outburst powered by shocks

    Science.gov (United States)

    Li, Kwan-Lok; Metzger, Brian D.; Chomiuk, Laura; Vurm, Indrek; Strader, Jay; Finzell, Thomas; Beloborodov, Andrei M.; Nelson, Thomas; Shappee, Benjamin J.; Kochanek, Christopher S.; Prieto, José L.; Kafka, Stella; Holoien, Thomas W.-S.; Thompson, Todd A.; Luckas, Paul J.; Itoh, Hiroshi

    2017-10-01

    Classical novae are runaway thermonuclear burning events on the surfaces of accreting white dwarfs in close binary star systems, sometimes appearing as new naked-eye sources in the night sky1. The standard model of novae predicts that their optical luminosity derives from energy released near the hot white dwarf, which is reprocessed through the ejected material2-5. Recent studies using the Fermi Large Area Telescope have shown that many classical novae are accompanied by gigaelectronvolt γ-ray emission6,7. This emission likely originates from strong shocks, providing new insights into the properties of nova outflows and allowing them to be used as laboratories for the study of the unknown efficiency of particle acceleration in shocks. Here, we report γ-ray and optical observations of the Milky Way nova ASASSN-16ma, which is among the brightest novae ever detected in γ-rays. The γ-ray and optical light curves show a remarkable correlation, implying that the majority of the optical light comes from reprocessed emission from shocks rather than the white dwarf8. The ratio of γ-ray to optical flux in ASASSN-16ma directly constrains the acceleration efficiency of non-thermal particles to be around 0.005, favouring hadronic models for the γ-ray emission9. The need to accelerate particles up to energies exceeding 100 gigaelectronvolts provides compelling evidence for magnetic field amplification in the shocks.

  16. Shock resistance testing

    International Nuclear Information System (INIS)

    Pouard, M.

    1984-03-01

    In the framework of mechanical tests and to answer the different requests for tests, the T.C.R (Transport Conditionnement et Retraitement) laboratory got test facilities. These installations allow to carry out tests of resistance to shocks, mainly at the safety level of components of nuclear power plants, mockups of transport casks for fuel elements and transport containers for radioactive materials. They include a tower and a catapult. This paper give a decription of the facilities and explain their operation way [fr

  17. The Shock Doctrine

    OpenAIRE

    Dionysios K. Solomos; Dimitrios N. Koumparoulis

    2011-01-01

    Naomi Klein attempts to redefine the economic history discovering the historical continuities and to reveal the neoliberal theory which functions via the utilization of specific “tools”. The state of shock is the key for the opponents of Chicago School and Milton Friedman in order for them to establish neoliberal policies and to promote the deregulated capitalism which includes less welfare state, less public sector, less regulation, weakened labor unions, privatizations and laissez-faire. Th...

  18. Characterization of shocked beryllium

    Directory of Open Access Journals (Sweden)

    Papin P.A.

    2012-08-01

    Full Text Available While numerous studies have investigated the low-strain-rate constitutive response of beryllium, the combined influence of high strain rate and temperature on the mechanical behavior and microstructure of beryllium has received limited attention over the last 40 years. In the current work, high strain rate tests were conducted using both explosive drive and a gas gun to accelerate the material. Prior studies have focused on tensile loading behavior, or limited conditions of dynamic strain rate and/or temperature. Two constitutive strength (plasticity models, the Preston-Tonks-Wallace (PTW and Mechanical Threshold Stress (MTS models, were calibrated using common quasi-static and Hopkinson bar data. However, simulations with the two models give noticeably different results when compared with the measured experimental wave profiles. The experimental results indicate that, even if fractured by the initial shock loading, the Be remains sufficiently intact to support a shear stress following partial release and subsequent shock re-loading. Additional “arrested” drive shots were designed and tested to minimize the reflected tensile pulse in the sample. These tests were done to both validate the model and to put large shock induced compressive loads into the beryllium sample.

  19. Selfsimilar time dependent shock structures

    International Nuclear Information System (INIS)

    Beck, R.; Drury, L.O.

    1985-01-01

    Diffusive shock acceleration as an astrophysical mechanism for accelerating charged particles has the advantage of being highly efficient. This means however that the theory is of necessity nonlinear; the reaction of the accelerated particles on the shock structure and the acceleration process must be self-consistently included in any attempt to develop a complete theory of diffusive shock acceleration. Considerable effort has been invested in attempting, at least partially, to do this and it has become clear that in general either the maximum particle energy must be restricted by introducing additional loss processes into the problem or the acceleration must be treated as a time dependent problem (Drury, 1984). It is concluded that stationary modified shock structures can only exist for strong shocks if additional loss processes limit the maximum energy a particle can attain. This is certainly possible and if it occurs the energy loss from the shock will lead to much greater shock compressions. It is however equally possible that no such processes exist and we must then ask what sort of nonstationary shock structure develops. The same argument which excludes stationary structures also rules out periodic solutions and indeed any solution where the width of the shock remains bounded. It follows that the width of the shock must increase secularly with time and it is natural to examine the possibility of selfsimilar time dependent solutions

  20. Selfsimilar time dependent shock structures

    Science.gov (United States)

    Beck, R.; Drury, L. O.

    1985-01-01

    Diffusive shock acceleration as an astrophysical mechanism for accelerating charged particles has the advantage of being highly efficient. This means however that the theory is of necessity nonlinear; the reaction of the accelerated particles on the shock structure and the acceleration process must be self-consistently included in any attempt to develop a complete theory of diffusive shock acceleration. Considerable effort has been invested in attempting, at least partially, to do this and it has become clear that in general either the maximum particle energy must be restricted by introducing additional loss processes into the problem or the acceleration must be treated as a time dependent problem (Drury, 1984). It is concluded that stationary modified shock structures can only exist for strong shocks if additional loss processes limit the maximum energy a particle can attain. This is certainly possible and if it occurs the energy loss from the shock will lead to much greater shock compressions. It is however equally possible that no such processes exist and we must then ask what sort of nonstationary shock structure develops. The ame argument which excludes stationary structures also rules out periodic solutions and indeed any solution where the width of the shock remains bounded. It follows that the width of the shock must increase secularly with time and it is natural to examine the possibility of selfsimilar time dependent solutions.

  1. Comparison of three methods for the estimation of cross-shock electric potential using Cluster data

    Directory of Open Access Journals (Sweden)

    A. P. Dimmock

    2011-05-01

    Full Text Available Cluster four point measurements provide a comprehensive dataset for the separation of temporal and spatial variations, which is crucial for the calculation of the cross shock electrostatic potential using electric field measurements. While Cluster is probably the most suited among present and past spacecraft missions to provide such a separation at the terrestrial bow shock, it is far from ideal for a study of the cross shock potential, since only 2 components of the electric field are measured in the spacecraft spin plane. The present paper is devoted to the comparison of 3 different techniques that can be used to estimate the potential with this limitation. The first technique is the estimate taking only into account the projection of the measured components onto the shock normal. The second uses the ideal MHD condition E·B = 0 to estimate the third electric field component. The last method is based on the structure of the electric field in the Normal Incidence Frame (NIF for which only the potential component along the shock normal and the motional electric field exist. All 3 approaches are used to estimate the potential for a single crossing of the terrestrial bow shock that took place on the 31 March 2001. Surprisingly all three methods lead to the same order of magnitude for the cross shock potential. It is argued that the third method must lead to more reliable results. The effect of the shock normal inaccuracy is investigated for this particular shock crossing. The resulting electrostatic potential appears too high in comparison with the theoretical results for low Mach number shocks. This shows the variability of the potential, interpreted in the frame of the non-stationary shock model.

  2. A shock surface geometry: The February 15--16, 1967, event

    International Nuclear Information System (INIS)

    Lepping, R.P.; Chao, J.K.

    1976-01-01

    The flare-associated interplanetary (IP) shock of February 15--16, 1967, observed by Explorer 33 and Pioneer 7 is analyzed to yield an estimation of the ecliptic plane geometry of the shock surface near 1 AU. These spacecraft were separated by 23degree in heliocentric longitude, and Pioneer 7 was at a distance of 1.12 AU from the sun. There was an 18.9-hour delay between the two observations. The estimated shock normal, obtained by using a least squares shock parameter fitting procedure for the Explorer 33 data, is found to be theta/subS//subE/=-53degree and phi/subS//subE/=198degree. The error cone angle for the shock normal of the Explorer 33 observation was approximately 7degree. This severely inclined shock normal is not typical of IP shocks. The shock normal at the Pioneer 7 position is found to be theta/subn/=-14degree and phi/subn/=161degree. However, the uncertainty is large (approx. =25degree for a 1sigma cone angle). Although a data gap occurred at the apparent time of passage of the disturbance at Pioneer 6,the recovered data did not suggest such a passage. A consistent picture of the shock propagation is given. The average shock speed from the sun to each spacecraft and the local speed at Explorer 33 and their relations to the position of the initiating solar flare are obtained and discussed. In the region of space between the earth and Pioneer 7 the shock surface radius of curvature in the ecliptic plane appears to have been 0.4 AU or less

  3. Measurements of ion velocity separation and ionization in multi-species plasma shocks

    Science.gov (United States)

    Rinderknecht, Hans G.; Park, H.-S.; Ross, J. S.; Amendt, P. A.; Wilks, S. C.; Katz, J.; Hoffman, N. M.; Kagan, G.; Vold, E. L.; Keenan, B. D.; Simakov, A. N.; Chacón, L.

    2018-05-01

    The ion velocity structure of a strong collisional shock front in a plasma with multiple ion species is directly probed in laser-driven shock-tube experiments. Thomson scattering of a 263.25 nm probe beam is used to diagnose ion composition, temperature, and flow velocity in strong shocks ( M ˜6 ) propagating through low-density ( ρ˜0.1 mg/cc) plasmas composed of mixtures of hydrogen (98%) and neon (2%). Within the preheat region of the shock front, two velocity populations of ions are observed, a characteristic feature of strong plasma shocks. The ionization state of the Ne is observed to change within the shock front, demonstrating an ionization-timescale effect on the shock front structure. The forward-streaming proton feature is shown to be unexpectedly cool compared to predictions from ion Fokker-Planck simulations; the neon ionization gradient is evaluated as a possible cause.

  4. Direct Extraction of InP/GaAsSb/InP DHBT Equivalent-Circuit Elements From S-Parameters Measured at Cut-Off and Normal Bias Conditions

    DEFF Research Database (Denmark)

    Johansen, Tom Keinicke; Leblanc, Rémy; Poulain, Julien

    2016-01-01

    A unique direct parameter extraction method for the small-signal equivalent-circuit model of InP/GaAsSb/InP double heterojunction bipolar transistors (DHBTs) is presented. $S$-parameters measured at cut-off bias are used, at first, to extract the distribution factor $X_{0}$ for the base-collector......A unique direct parameter extraction method for the small-signal equivalent-circuit model of InP/GaAsSb/InP double heterojunction bipolar transistors (DHBTs) is presented. $S$-parameters measured at cut-off bias are used, at first, to extract the distribution factor $X_{0}$ for the base......-collector capacitance at zero collector current and the collector-to-emitter overlap capacitance $C_{ceo}$ present in InP DHBT devices. Low-frequency $S$-parameters measured at normal bias conditions then allows the extraction of the external access resistances $R_{bx}$, $R_{e}$, and $R_{cx}$ as well as the intrinsic...

  5. Fast, multiphase volume adaptation to hyperosmotic shock by Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Teuta Pilizota

    Full Text Available All living cells employ an array of different mechanisms to help them survive changes in extra cellular osmotic pressure. The difference in the concentration of chemicals in a bacterium's cytoplasm and the external environment generates an osmotic pressure that inflates the cell. It is thought that the bacterium Escherichia coli use a number of interconnected systems to adapt to changes in external pressure, allowing them to maintain turgor and live in surroundings that range more than two-hundred-fold in external osmolality. Here, we use fluorescence imaging to make the first measurements of cell volume changes over time during hyperosmotic shock and subsequent adaptation on a single cell level in vivo with a time resolution on the order of seconds. We directly observe two previously unseen phases of the cytoplasmic water efflux upon hyperosmotic shock. Furthermore, we monitor cell volume changes during the post-shock recovery and observe a two-phase response that depends on the shock magnitude. The initial phase of recovery is fast, on the order of 15-20 min and shows little cell-to-cell variation. For large sucrose shocks, a secondary phase that lasts several hours adds to the recovery. We find that cells are able to recover fully from shocks as high as 1 Osmol/kg using existing systems, but that for larger shocks, protein synthesis is required for full recovery.

  6. Shock-timing experiments for Inertial Confinement Fusion

    International Nuclear Information System (INIS)

    Debras, G.

    2012-01-01

    The Laser Megajoule (LMJ), which should achieve energy gain in an indirect drive inertial confinement fusion configuration, is being built in France by the CEA (Commissariat a l'Energie Atomique et aux Energies Alternatives). To achieve thermonuclear ignition, the compression of a spherical target will have to be controlled by a series of accurately timed centripetal shocks, with a finely tuned level. A first experiment, performed in 2010 on the LIL (Ligne d'Integration Laser) facility at CEA, has allowed us to study the coalescence of two planar shocks in an indirectly-driven sample of polystyrene, within the framework of shock timing. The main objectives were to validate the experimental concept and the numerical simulations, as a proof-of-principle for future shock-timing campaigns. The main diagnostics used for this study are VISAR (Velocity Interferometer System for Any Reflection) and an optical shock breakout diagnostic, taking into account optical perturbations caused by X-rays. In another experiment, conducted on the LULI (Laboratoire pour l'Utilisation des Lasers Intenses) laser facility in 2010, we studied the timing of two planar directly-driven shocks using the same diagnostics. This latter study is related to the shock ignition concept, with the long-term perspective of energy production. This thesis presents these two experiments and their results. (author) [fr

  7. Risk shocks and housing markets

    OpenAIRE

    Dorofeenko, Viktor; Lee, Gabriel S.; Salyer, Kevin D.

    2010-01-01

    Abstract: This paper analyzes the role of uncertainty in a multi-sector housing model with financial frictions. We include time varying uncertainty (i.e. risk shocks) in the technology shocks that affect housing production. The analysis demonstratesthat risk shocks to the housing production sector are a quantitatively important impulse mechanism for the business cycle. Also, we demonstrate that bankruptcy costs act as an endogenous markup factor in housing prices; as a consequence, the volati...

  8. Fluid dynamics of the shock wave reactor

    Science.gov (United States)

    Masse, Robert Kenneth

    2000-10-01

    High commercial incentives have driven conventional olefin production technologies to near their material limits, leaving the possibility of further efficiency improvements only in the development of entirely new techniques. One strategy known as the Shock Wave Reactor, which employs gas dynamic processes to circumvent limitations of conventional reactors, has been demonstrated effective at the University of Washington. Preheated hydrocarbon feedstock and a high enthalpy carrier gas (steam) are supersonically mixed at a temperature below that required for thermal cracking. Temperature recovery is then effected via shock recompression to initiate pyrolysis. The evolution to proof-of-concept and analysis of experiments employing ethane and propane feedstocks are presented. The Shock Wave Reactor's high enthalpy steam and ethane flows severely limit diagnostic capability in the proof-of-concept experiment. Thus, a preliminary blow down supersonic air tunnel of similar geometry has been constructed to investigate recompression stability and (especially) rapid supersonic mixing necessary for successful operation of the Shock Wave Reactor. The mixing capabilities of blade nozzle arrays are therefore studied in the air experiment and compared with analytical models. Mixing is visualized through Schlieren imaging and direct photography of condensation in carbon dioxide injection, and interpretation of visual data is supported by pressure measurement and flow sampling. The influence of convective Mach number is addressed. Additionally, thermal behavior of a blade nozzle array is analyzed for comparison to data obtained in the course of succeeding proof-of-concept experiments. Proof-of-concept is naturally succeeded by interest in industrial adaptation of the Shock Wave Reactor, particularly with regard to issues involving the scaling and refinement of the shock recompression. Hence, an additional, variable geometry air tunnel has been constructed to study the parameter

  9. Differential Gene Expression of Fibroblasts: Keloid versus Normal

    Directory of Open Access Journals (Sweden)

    Michael F. Angel

    2002-11-01

    Full Text Available Abstract: This study investigated gene regulation and unique gene products in both keloid (KDF and normal (NDF dermal fibroblasts in established cell lines. For gene regulation, NDF versus KDF were compared using Clontech's Atlas™ Human cDNA Expression Array while unique gene products were studied using RNA Fingerprinting Kit. RNA from each sample was converted to cDNA using oligo-dT primers. Down-regulated genes using Atlas Array in KDF were 1 60 S ribosomal protein, 2 Thioredoxin dependent peroxidase, 3 Nuclease sensitive element DNA binding protein, 4 c-myc purine-binding transcription factor, 5 c-AMP dependent protein kinase, and, 6 Heat Shock Protein 90 kDa. Genes that are up regulated in KDF were 1 Tubulin and 2 Heat Shock Protein 27 kDa. With the differential display, we found 17 bands unique to both KDF and NDF. The specific gene and the manner in which they were differentially regulated have direct implications to understanding keloid fibroblast proliferation.

  10. The Shock and Vibration Digest. Volume 12, Number 10,

    Science.gov (United States)

    1980-10-01

    171 calculations will allow safety checks of existing dams (1970). and the execution of dynamic designs of future dams. It will be possible to have...a Normal Shock Wave Contained limits are also presented, in an Aerodynamic Inlet (Pulsation d’un Choc Droit en Aerodynamique Interne) A. Agnes, E

  11. Health shocks and risk aversion.

    Science.gov (United States)

    Decker, Simon; Schmitz, Hendrik

    2016-12-01

    We empirically assess whether a health shock influences individual risk aversion. We use grip strength data to obtain an objective health shock indicator. In order to account for the non-random nature of our data regression-adjusted matching is employed. Risk preferences are traditionally assumed to be constant. However, we find that a health shock increases individual risk aversion. The finding is robust to a series of sensitivity analyses and persists for at least four years after the shock. Income changes do not seem to be the driving mechanism. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Shock in the emergency department

    DEFF Research Database (Denmark)

    Holler, Jon Gitz; Henriksen, Daniel Pilsgaard; Mikkelsen, Søren

    2016-01-01

    BACKGROUND: The knowledge of the frequency and associated mortality of shock in the emergency department (ED) is limited. The aim of this study was to describe the incidence, all-cause mortality and factors associated with death among patients suffering shock in the ED. METHODS: Population...... failures. Outcomes were annual incidence per 100,000 person-years at risk (pyar), all-cause mortality at 0-7, and 8-90 days and risk factors associated with death. RESULTS: We identified 1646 of 438,191 (0.4 %) ED patients with shock at arrival. Incidence of shock increased from 53.8 to 80.6 cases per 100...

  13. Phase transition of KCl under shock compression

    CERN Document Server

    Mashimo, T; Tsumoto, K; Zhang, Y; Ando, S; Tonda, H

    2002-01-01

    It had been reported that for potassium chloride (KCl) the B1-B2 phase transition (PT) occurs under shock and static compressions, but the measured transition points showed large scatter. In this study, Hugoniot measurement experiments were performed on KCl single crystals by the inclined-mirror method combined with use of a powder gun. The anisotropic Hugoniot elastic limits and PT points were observed. The PT points along the (100), (110) and (111) axis directions were determined as 2.5, 2.2 and 2.1 GPa, respectively. The anisotropic transition was reasonably explained in terms of the displacement mechanism along the (111) axis direction.

  14. Shock buffer for nuclear control element assembly

    International Nuclear Information System (INIS)

    Bevilacqua, F.

    1977-01-01

    A shock buffer for a control element assembly in a nuclear reactor is described, comprising a piston and a cylinder. The piston is affixed to and extends upward from the control rod guide structure; the cylinder is supported by the upper portion of the control element assembly and is vertically oriented with open end downward for receiving the piston. Coolant liquid normally has free access to the cylinder. The piston displaces liquid from the cylinder when inserted, thereby decelerating the control element assembly near its lower extent of travel. (LL)

  15. A Shocking Solar Nebula?

    OpenAIRE

    Liffman, Kurt

    2009-01-01

    It has been suggested that shock waves in the solar nebula formed the high temperature materials observed in meteorites and comets. It is shown that the temperatures at the inner rim of the solar nebula could have been high enough over a sufficient length of time to produce chondrules, CAIs, refractory dust grains and other high-temperature materials observed in comets and meteorites. The solar bipolar jet flow may have produced an enrichment of 16O in the solar nebula over time and the chond...

  16. Myths of "shock therapy".

    Science.gov (United States)

    Fink, M

    1977-09-01

    The author discusses the myths of the ECT process--that shock and the convulsion are essential, memory loss and brain damage are inescapable, and little is known of the process--and assesses the fallacies in these ideas. Present views of the ECT process suggest that its mode of action in depression may best be described as a prolonged form of diencephalic stimulation, particularly useful to affect the hypothalamic dysfunctions that characterize depressive illness. The author emphasizes the need for further study of this treatment modality and for self-regulation by the profession.

  17. Gravitational shock waves and extreme magnetomaterial shock waves

    International Nuclear Information System (INIS)

    Lichnerowicz, Andre.

    1975-01-01

    Within an astrophysical context corresponding to high densities, a self-gravitating model is studied, which is the set of an extreme material medium of infinite conductivity and of a magnetic field. Corresponding shock waves generate necessarily, in general, gravitational shock waves [fr

  18. Shock Producers and Shock Absorbers in the Crisis

    OpenAIRE

    Sinn, Hans-Werner

    2009-01-01

    It is not surprising that the U.S. has been by far the world’s largest shock producer in this crisis. The big shock absorbers on the other hand were Japan, Russia and Germany, whose exports shrank more than their imports.

  19. Simulations of Converging Shock Collisions for Shock Ignition

    Science.gov (United States)

    Sauppe, Joshua; Dodd, Evan; Loomis, Eric

    2016-10-01

    Shock ignition (SI) has been proposed as an alternative to achieving high gain in inertial confinement fusion (ICF) targets. A central hot spot below the ignition threshold is created by an initial compression pulse, and a second laser pulse drives a strong converging shock into the fuel. The collision between the rebounding shock from the compression pulse and the converging shock results in amplification of the converging shock and increases the hot spot pressure above the ignition threshold. We investigate shock collision in SI drive schemes for cylindrical targets with a polystyrene foam interior using radiation-hydrodynamics simulations with the RAGE code. The configuration is similar to previous targets fielded on the Omega laser. The CH interior results in a lower convergence ratio and the cylindrical geometry facilitates visualization of the shock transit using an axial X-ray backlighter, both of which are important for comparison to potential experimental measurements. One-dimensional simulations are used to determine shock timing, and the effects of low mode asymmetries in 2D computations are also quantified. LA-UR-16-24773.

  20. Cardiogenic shock following blunt chest trauma

    Directory of Open Access Journals (Sweden)

    Rodríguez-González Fayna

    2010-01-01

    Full Text Available Cardiac contusion, usually caused by blunt chest trauma, has been recognized with increased frequency over the past decades. Traffic accidents are the most frequent cause of cardiac contusions resulting from a direct blow to the chest. Other causes of blunt cardiac injury are numerous and include violent fall impacts, interpersonal aggression, explosions, and various types of high-risk sports. Myocardial contusion is difficult to diagnose; clinical presentation varies greatly, ranging from lack of symptoms to cardiogenic shock and arrhythmia. Although death is rare, cardiac contusion can be fatal. We present a case of cardiac contusion due to blunt chest trauma secondary to a fall impact, which manifested as cardiogenic shock.

  1. High pressure multiple shock response of aluminum

    International Nuclear Information System (INIS)

    Lawrence, R.J.; Asay, J.R.

    1977-01-01

    It is well known that both dynamic yield strength and rate-dependent material response exert direct influence on the development of surface and interface instabilities under conditions of strong shock loading. A detailed understanding of these phenomena is therefore an important aspect of the analysis of dynamic inertial confinement techniques which are being used in such applications as the generation of controlled thermonuclear fusion. In these types of applications the surfaces and interfaces under consideration can be subjected to cyclic loading characterized by shock pressures on the order of 100 GPa or more. It thus becomes important to understand how rate effects and material strength differ from the values observed in the low pressure regime where they are usually measured, as well as how they are altered by the loading history

  2. Shock ignition of thermonuclear fuel: principles and modelling

    International Nuclear Information System (INIS)

    Atzeni, S.; Ribeyre, X.; Schurtz, G.; Schmitt, A.J.; Canaud, B.; Betti, R.; Perkins, L.J.

    2014-01-01

    Shock ignition is an approach to direct-drive inertial confinement fusion (ICF) in which the stages of compression and hot spot formation are partly separated. The fuel is first imploded at a lower velocity than in conventional ICF. Close to stagnation, an intense laser spike drives a strong converging shock, which contributes to hot spot formation. Shock ignition shows potentials for high gain at laser energies below 1 MJ, and could be tested on the National Ignition Facility or Laser MegaJoule. Shock ignition principles and modelling are reviewed in this paper. Target designs and computer-generated gain curves are presented and discussed. Limitations of present studies and research needs are outlined. (special topic)

  3. X-ray diffraction measurements in KCl shocked along [100

    International Nuclear Information System (INIS)

    D'Almeida, T.; Gupta, Y.M.

    2000-01-01

    Real time x-ray diffraction measurements were used to examine the polymorphic phase transformation in KCl shocked along the [100] direction. Shock wave continuum data, obtained previously by Hayes, were used to design the experiments and to predict diffraction from KCl shocked to different peak stresses. Here, we present the results obtained below the transition stress: between 1.4 and 2 GPa. Diffraction data obtained were quantitatively related to macroscopic compression. Interplanar spacing measurements revealed isotropic compression of the unit cell in contrast to previously reported results. Above the transition stress, descriptions of the atomic arrangement with respect to shock propagation (not available in the literature) are required for setting up the detection system. Hence, continuum results in combination with various crystallographic considerations were utilized to obtain data above the transition stress

  4. Neutral hydrogen in the galaxy and the galactic shocks

    International Nuclear Information System (INIS)

    Sawa, T.

    1978-01-01

    To discriminate the galactic shock theory from the linear density-wave theory in comparison with neutral hydrogen data in the Galaxy, model-line profiles and Tsub(b)(l, γ) (brightness temperature) diagrams of 21-cm line are calculated both for the two theories in the longitude range 15 0 0 . It is shown that major differences between the two models appear in the tangential directions of spiral arms and of inter-arm regions. The inter-arm region appears as a trough of the brightness temperature in the shock model. An observed trough on a Tsub(b)(l, γ) diagram at l = 80 0 -100 0 , γ = -20 km s -1 is reproduced reasonably well by the shock model, while the linear model fails to reproduce it. Effects of the galactic shocks on the terminal velocity is also discussed. (Auth.)

  5. Highly Resolved Measurements of a Developing Strong Collisional Plasma Shock

    Science.gov (United States)

    Rinderknecht, Hans G.; Park, H.-S.; Ross, J. S.; Amendt, P. A.; Higginson, D. P.; Wilks, S. C.; Haberberger, D.; Katz, J.; Froula, D. H.; Hoffman, N. M.; Kagan, G.; Keenan, B. D.; Vold, E. L.

    2018-03-01

    The structure of a strong collisional shock front forming in a plasma is directly probed for the first time in laser-driven gas-jet experiments. Thomson scattering of a 526.5 nm probe beam was used to diagnose temperature and ion velocity distribution in a strong shock (M ˜11 ) propagating through a low-density (ρ ˜0.01 mg /cc ) plasma composed of hydrogen. A forward-streaming population of ions traveling in excess of the shock velocity was observed to heat and slow down on an unmoving, unshocked population of cold protons, until ultimately the populations merge and begin to thermalize. Instabilities are observed during the merging, indicating a uniquely plasma-phase process in shock front formation.

  6. Reliability for systems of degrading components with distinct component shock sets

    International Nuclear Information System (INIS)

    Song, Sanling; Coit, David W.; Feng, Qianmei

    2014-01-01

    This paper studies reliability for multi-component systems subject to dependent competing risks of degradation wear and random shocks, with distinct shock sets. In practice, many systems are exposed to distinct and different types of shocks that can be categorized according to their sizes, function, affected components, etc. Previous research primarily focuses on simple systems with independent failure processes, systems with independent component time-to-failure, or components that share the same shock set or type of shocks. In our new model, we classify random shocks into different sets based on their sizes or function. Shocks with specific sizes or function can selectively affect one or more components in the system but not necessarily all components. Additionally the shocks from the different shock sets can arrive at different rates and have different relative magnitudes. Preventive maintenance (PM) optimization is conducted for the system with different component shock sets. Decision variables for two different maintenance scheduling problems, the PM replacement time interval, and the PM inspection time interval, are determined by minimizing a defined system cost rate. Sensitivity analysis is performed to provide insight into the behavior of the proposed maintenance policies. These models can be applied directly or customized for many complex systems that experience dependent competing failure processes with different component shock sets. A MEMS (Micro-electro mechanical systems) oscillator is a typical system subject to dependent and competing failure processes, and it is used as a numerical example to illustrate our new reliability and maintenance models

  7. 30th International Symposium on Shock Waves

    CERN Document Server

    Sadot, Oren; Igra, Ozer

    2017-01-01

    These proceedings collect the papers presented at the 30th International Symposium on Shock Waves (ISSW30), which was held in Tel-Aviv Israel from July 19 to July 24, 2015. The Symposium was organized by Ortra Ltd. The ISSW30 focused on the state of knowledge of the following areas: Nozzle Flow, Supersonic and Hypersonic Flows with Shocks, Supersonic Jets, Chemical Kinetics, Chemical Reacting Flows, Detonation, Combustion, Ignition, Shock Wave Reflection and Interaction, Shock Wave Interaction with Obstacles, Shock Wave Interaction with Porous Media, Shock Wave Interaction with Granular Media, Shock Wave Interaction with Dusty Media, Plasma, Magnetohyrdrodynamics, Re-entry to Earth Atmosphere, Shock Waves in Rarefied Gases, Shock Waves in Condensed Matter (Solids and Liquids), Shock Waves in Dense Gases, Shock Wave Focusing, Richtmyer-Meshkov Instability, Shock Boundary Layer Interaction, Multiphase Flow, Blast Waves, Facilities, Flow Visualization, and Numerical Methods. The two volumes serve as a reference ...

  8. Molecular diagnostics of interstellar shocks

    International Nuclear Information System (INIS)

    Hartquist, T.W.; Oppenheimer, M.; Dalgarno, A.

    1980-01-01

    The chemistry of molecules in shocked regions of the interstellar gas is considered and calculations are carried out for a region subjected to a shock at a velocity of 8 km s -1 Substantial enhancements are predicted in the concentrations of the molecules H 2 S, SO, and SiO compared to those anticipated in cold interstellar clouds

  9. Molecular diagnostics of interstellar shocks

    Science.gov (United States)

    Hartquist, T. W.; Dalgarno, A.; Oppenheimer, M.

    1980-02-01

    The chemistry of molecules in shocked regions of the interstellar gas is considered and calculations are carried out for a region subjected to a shock at a velocity of 8 km/sec. Substantial enhancements are predicted in the concentrations of the molecules H2S, SO, and SiO compared to those anticipated in cold interstellar clouds.

  10. How Culture Shock Affects Communication.

    Science.gov (United States)

    Barna, LaRay M.

    The paper defines the term "culture shock" and discusses the changes that this state can make in a person's behavior. Culture shock refers to the emotional and physiological reaction of high activation that is brought about by sudden immersion in a new culture. Because one's own culture shields one from the unknown and reduces the need to make…

  11. Molecular diagnostics of interstellar shocks

    Science.gov (United States)

    Hartquist, T. W.; Dalgarno, A.; Oppenheimer, M.

    1980-01-01

    The chemistry of molecules in shocked regions of the interstellar gas is considered and calculations are carried out for a region subjected to a shock at a velocity of 8 km/sec. Substantial enhancements are predicted in the concentrations of the molecules H2S, SO, and SiO compared to those anticipated in cold interstellar clouds.

  12. Shock wave treatment in medicine

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Biosciences; Volume 30; Issue 2 ... In the present paper we discuss the basic theory and application of shock waves and its history in medicine. The idea behind using shock wave therapy for orthopedic diseases is the stimulation of healing in tendons, surrounding tissue and bones. This is a ...

  13. Shock wave treatment in medicine

    Indian Academy of Sciences (India)

    Unknown

    to open surgery, the cost of the ESWT is very reasonable. But nevertheless it is necessary to improve the basic un ... In second group, shock waves are used to measure distances because of the low energy loss over large distances ... pared to a piezoelectric hydrophone. The rise time of an electrohydraulic generated shock ...

  14. Numerical modeling of slow shocks

    International Nuclear Information System (INIS)

    Winske, D.

    1987-01-01

    This paper reviews previous attempt and the present status of efforts to understand the structure of slow shocks by means of time dependent numerical calculations. Studies carried out using MHD or hybrid-kinetic codes have demonstrated qualitative agreement with theory. A number of unresolved issues related to hybrid simulations of the internal shock structure are discussed in some detail. 43 refs., 8 figs

  15. Dynamic shock wave: hammer blow

    International Nuclear Information System (INIS)

    Lackme, Claude

    1978-01-01

    The general properties of shocks, their generation and the conditions of reflexion to an interface are dealt with in turn. By then applying these concepts to a liquid column and its environment (wall, free area, closing devices) the hammer blow is presented as being a relatively weak shock [fr

  16. Electron transport and shock ignition

    Energy Technology Data Exchange (ETDEWEB)

    Bell, A R; Tzoufras, M, E-mail: t.bell1@physics.ox.ac.uk [Clarendon Laboratory, University of Oxford, Parks Road, Oxford OX1 3PU (United Kingdom)

    2011-04-15

    Inertial fusion energy (IFE) offers one possible route to commercial energy generation. In the proposed 'shock ignition' route to fusion, the target is compressed at a relatively low temperature and then ignited using high intensity laser irradiation which drives a strong converging shock into the centre of the fuel. With a series of idealized calculations we analyse the electron transport of energy into the target, which produces the pressure responsible for driving the shock. We show that transport in shock ignition lies near the boundary between ablative and heat front regimes. Moreover, simulations indicate that non-local effects are significant in the heat front regime and might lead to increased efficiency by driving the shock more effectively and reducing heat losses to the plasma corona.

  17. Oscillating nonlinear acoustic shock waves

    DEFF Research Database (Denmark)

    Gaididei, Yuri; Rasmussen, Anders Rønne; Christiansen, Peter Leth

    2016-01-01

    We investigate oscillating shock waves in a tube using a higher order weakly nonlinear acoustic model. The model includes thermoviscous effects and is non isentropic. The oscillating shock waves are generated at one end of the tube by a sinusoidal driver. Numerical simulations show that at resona......We investigate oscillating shock waves in a tube using a higher order weakly nonlinear acoustic model. The model includes thermoviscous effects and is non isentropic. The oscillating shock waves are generated at one end of the tube by a sinusoidal driver. Numerical simulations show...... polynomial in the space and time variables, we find analytical approximations to the observed single shock waves in an infinitely long tube. Using perturbation theory for the driven acoustic system approximative analytical solutions for the off resonant case are determined....

  18. Magnetic field fluctuations across the Earth’s bow shock

    Directory of Open Access Journals (Sweden)

    A. Czaykowska

    Full Text Available We present a statistical analysis of 132 dayside (LT 0700-1700 bow shock crossings of the AMPTE/IRM spacecraft. We perform a superposed epoch analysis of low frequency, magnetic power spectra some minutes up-stream and downstream of the bow shock. The events are devided into categories depending on the angle θBn between bow shock normal and interplanetary magnetic field, and on plasma-β. In the foreshock upstream of the quasi-parallel bow shock, the power of the magnetic fluctuations is roughly 1 order of magnitude larger (δB ~ 4 nT for frequencies 0.01–0.04 Hz than upstream of the quasi-perpendicular shock. There is no significant difference in the magnetic power spectra upstream and downstream of the quasi-parallel bow shock; only at the shock itself, is the magnetic power enhanced by a factor of 4. This enhancement may be due to either an amplification of convecting upstream waves or to wave generation at the shock interface. On the contrary, downstream of the quasi-perpendicular shock, the magnetic wave activity is considerably higher than upstream. Down-stream of the quasi-perpendicular low-β bow shock, we find a dominance of the left-hand polarized component at frequencies just below the ion-cyclotron frequency, with amplitudes of about 3 nT. These waves are identified as ion-cyclotron waves, which grow in a low-β regime due to the proton temperature anisotropy. We find a strong correlation of this anisotropy with the intensity of the left-hand polarized component. Downstream of some nearly perpendicular (θBn ≈ 90° high-β crossings, mirror waves are identified. However, there are also cases where the conditions for mirror modes are met downstream of the nearly perpendicular shock, but no mirror waves are observed.

    Key words. Interplanetary physics (plasma waves and turbulence – Magnetospheric physics (magnetosheath; plasma waves and

  19. Magnetic field fluctuations across the Earth’s bow shock

    Directory of Open Access Journals (Sweden)

    A. Czaykowska

    2001-03-01

    Full Text Available We present a statistical analysis of 132 dayside (LT 0700-1700 bow shock crossings of the AMPTE/IRM spacecraft. We perform a superposed epoch analysis of low frequency, magnetic power spectra some minutes up-stream and downstream of the bow shock. The events are devided into categories depending on the angle θBn between bow shock normal and interplanetary magnetic field, and on plasma-β. In the foreshock upstream of the quasi-parallel bow shock, the power of the magnetic fluctuations is roughly 1 order of magnitude larger (δB ~ 4 nT for frequencies 0.01–0.04 Hz than upstream of the quasi-perpendicular shock. There is no significant difference in the magnetic power spectra upstream and downstream of the quasi-parallel bow shock; only at the shock itself, is the magnetic power enhanced by a factor of 4. This enhancement may be due to either an amplification of convecting upstream waves or to wave generation at the shock interface. On the contrary, downstream of the quasi-perpendicular shock, the magnetic wave activity is considerably higher than upstream. Down-stream of the quasi-perpendicular low-β bow shock, we find a dominance of the left-hand polarized component at frequencies just below the ion-cyclotron frequency, with amplitudes of about 3 nT. These waves are identified as ion-cyclotron waves, which grow in a low-β regime due to the proton temperature anisotropy. We find a strong correlation of this anisotropy with the intensity of the left-hand polarized component. Downstream of some nearly perpendicular (θBn ≈ 90° high-β crossings, mirror waves are identified. However, there are also cases where the conditions for mirror modes are met downstream of the nearly perpendicular shock, but no mirror waves are observed.Key words. Interplanetary physics (plasma waves and turbulence – Magnetospheric physics (magnetosheath; plasma waves and instabilities

  20. The German model of capitalism and the persistence of outward foreign direct investment: evidence from German manufacturing industries

    Directory of Open Access Journals (Sweden)

    Martin T Bohl

    2011-06-01

    Full Text Available Against the backdrop of critique on the German model of capitalism in general, and German public policy in particular as to the ability to successfully adjust to rapid change and exogenous shocks in wake of economic globalisation, this paper investigates the degree of shock persistence in foreign direct investment (FDI of ten German manufacturing industries for the period 1976 to 2003. Theory on exports and non-FDI investment suggests that FDI should exhibit a considerable degree of shock persistence because they are subject to high sunk costs because of high entry and exit costs associated with the high level of asset specificity that is normally connected to FDI. Persistence in foreign direct investment time series data is established by applying various unit root tests. The results are robust to the potential presence of structural breaks in the data. The empirical analysis shows that German outward FDI in mature manufacturing industries, with one exception, exhibits a high degree of shock persistence. The results suggest, at least for mature German industries, that the sunk costs view on shock persistency is confirmed for outward FDI. The results furnish evidence for a tentative assessment of the relationship between German public policy and FDI strategies of multinational firms.

  1. Active current sheets near the earth's bow shock

    International Nuclear Information System (INIS)

    Schwartz, S.J.; Kessel, R.L.; Brown, C.C.; Woolliscroft, L.J.C.; Dunlop, M.W.; Farrugia, C.J.; Hall, D.S.

    1988-01-01

    The authors present here an investigation of active current sheets observed by the AMPTE UK spacecraft near the Earth's bow shock, concentrating on their macroscopic features and geometry. Events selected primarily by flow directions which deviate substantially from the Sun-Earth line show similar characteristics, including their association with an underlying macroscopic current sheet and a hot central region whose flow direction is organized, at least in part, by location relative to the inferred initial intersection point between the current sheet and the bow shock. This region is flanked by edges which, according to a Rankine-Hugoniot analysis, are often fast shocks whose orientation is consistent with that expected if a bulge on the bow shock convected past the spacecraft. They have found the magnetosheath manifestations of these events which they study in detail. They suggest that these events are the direct result of the disruption and reformation of the bow shock by the passage of an interplanetary current sheet, most probably a tangential discontinuity

  2. Shock waves & explosions

    CERN Document Server

    Sachdev, PL

    2004-01-01

    Understanding the causes and effects of explosions is important to experts in a broad range of disciplines, including the military, industrial and environmental research, aeronautic engineering, and applied mathematics. Offering an introductory review of historic research, Shock Waves and Explosions brings analytic and computational methods to a wide audience in a clear and thorough way. Beginning with an overview of the research on combustion and gas dynamics in the 1970s and 1980s, the author brings you up to date by covering modeling techniques and asymptotic and perturbative methods and ending with a chapter on computational methods.Most of the book deals with the mathematical analysis of explosions, but computational results are also included wherever they are available. Historical perspectives are provided on the advent of nonlinear science, as well as on the mathematical study of the blast wave phenomenon, both when visualized as a point explosion and when simulated as the expansion of a high-pressure ...

  3. Analysis of shock implosion

    Energy Technology Data Exchange (ETDEWEB)

    Mishkin, E.A.; Alejaldre, C. (Polytechnic Inst. of New York, Brooklyn (USA))

    1984-06-01

    An imploding shock wave, coming from infinity, moves through an ideal gas with the adiabatic constant ..gamma... To define a single-valued self-similar coefficient over the whole classical interval 1<..gamma..

  4. The cosmic-ray shock structure problem for relativistic shocks

    Science.gov (United States)

    Webb, G. M.

    1985-01-01

    The time asymptotic behaviour of a relativistic (parallel) shock wave significantly modified by the diffusive acceleration of cosmic-rays is investigated by means of relativistic hydrodynamical equations for both the cosmic-rays and thermal gas. The form of the shock structure equation and the dispersion relation for both long and short wavelength waves in the system are obtained. The dependence of the shock acceleration efficiency on the upstream fluid spped, long wavelength Mach number and the ratio N = P sub co/cP sub co+P sub go)(Psub co and P sub go are the upstream cosmic-ray and thermal gas pressures respectively) are studied.

  5. Cosmic-ray shock acceleration in oblique MHD shocks

    Science.gov (United States)

    Webb, G. M.; Drury, L. OC.; Volk, H. J.

    1986-01-01

    A one-dimensional, steady-state hydrodynamical model of cosmic-ray acceleration at oblique MHD shocks is presented. Upstream of the shock the incoming thermal plasma is subject to the adverse pressure gradient of the accelerated particles, the J x B force, as well as the thermal gas pressure gradient. The efficiency of the acceleration of cosmic-rays at the shock as a function of the upstream magnetic field obliquity and upstream plasma beta is investigated. Astrophysical applications of the results are briefly discussed.

  6. Suicidality, Economic Shocks, and Egalitarian Gender Norms.

    Science.gov (United States)

    Reeves, Aaron; Stuckler, David

    2016-02-01

    Durkheim conceived of suicide as a product of social integration and regulation. Although the sociology of suicide has focused on the role of disintegration, to our knowledge, the interaction between integration and regulation has yet to be empirically evaluated. In this article we test whether more egalitarian gender norms, an important form of macro-regulation, protects men and women against suicidality during economic shocks. Using cross-national data covering 20 European Union countries from the years 1991 to 2011, including the recent economic crises in Europe, we first assessed the relation between unemployment and suicide. Then we evaluated potential effect modification using three measures of gender equality, the gender ratio in labour force participation, the gender pay gap, and women's representation in parliament using multiple measures. We found no evidence of a significant, direct link between greater gender equality and suicide rates in either men or women. However, a greater degree of gender equality helped protect against suicidality associated with economic shocks. At relatively high levels of gender equality in Europe, such as those seen in Sweden and Austria, the relationship between rising unemployment rates and suicide in men disappeared altogether. Our findings suggest that more egalitarian forms of gender regulation may help buffer the suicidal consequences of economic shocks, especially in men.

  7. 3D Printed Shock Mitigating Structures

    Science.gov (United States)

    Schrand, Amanda; Elston, Edwin; Dennis, Mitzi; Metroke, Tammy; Chen, Chenggang; Patton, Steven; Ganguli, Sabyasachi; Roy, Ajit

    Here we explore the durability, and shock mitigating potential, of solid and cellular 3D printed polymers and conductive inks under high strain rate, compressive shock wave and high g acceleration conditions. Our initial designs include a simple circuit with 4 resistors embedded into circular discs and a complex cylindrical gyroid shape. A novel ink consisting of silver-coated carbon black nanoparticles in a thermoplastic polyurethane was used as the trace material. One version of the disc structural design has the advantage of allowing disassembly after testing for direct failure analysis. After increasing impacts, printed and traditionally potted circuits were examined for functionality. Additionally, in the open disc design, trace cracking and delamination of resistors were able to be observed. In a parallel study, we examined the shock mitigating behavior of 3D printed cellular gyroid structures on a Split Hopkinson Pressure Bar (SHPB). We explored alterations to the classic SHPB setup for testing the low impedance, cellular samples to most accurately reflect the stress state inside the sample (strain rates from 700 to 1750 s-1). We discovered that the gyroid can effectively absorb the impact of the test resulting in crushing the structure. Future studies aim to tailor the unit cell dimensions for certain frequencies, increase print accuracy and optimize material compositions for conductivity and adhesion to manufacture more durable devices.

  8. Suicidality, Economic Shocks, and Egalitarian Gender Norms

    Science.gov (United States)

    Reeves, Aaron; Stuckler, David

    2015-01-01

    Durkheim conceived of suicide as a product of social integration and regulation. Although the sociology of suicide has focused on the role of disintegration, to our knowledge, the interaction between integration and regulation has yet to be empirically evaluated. In this article we test whether more egalitarian gender norms, an important form of macro-regulation, protects men and women against suicidality during economic shocks. Using cross-national data covering 20 European Union countries from the years 1991 to 2011, including the recent economic crises in Europe, we first assessed the relation between unemployment and suicide. Then we evaluated potential effect modification using three measures of gender equality, the gender ratio in labour force participation, the gender pay gap, and women’s representation in parliament using multiple measures. We found no evidence of a significant, direct link between greater gender equality and suicide rates in either men or women. However, a greater degree of gender equality helped protect against suicidality associated with economic shocks. At relatively high levels of gender equality in Europe, such as those seen in Sweden and Austria, the relationship between rising unemployment rates and suicide in men disappeared altogether. Our findings suggest that more egalitarian forms of gender regulation may help buffer the suicidal consequences of economic shocks, especially in men. PMID:26877572

  9. Factors influencing flow steadiness in laminar boundary layer shock interactions

    Science.gov (United States)

    Tumuklu, Ozgur; Levin, Deborah A.; Gimelshein, Sergey F.; Austin, Joanna M.

    2016-11-01

    The Direct Simulation Monte Carlo method has been used to model laminar shock wave boundary interactions of hypersonic flow over a 30/55-deg double-wedge and "tick-shaped" model configurations studied in the Hypervelocity Expansion Tube facility and T-ADFA free-piston shock tunnel, respectively. The impact of thermochemical effects on these interactions by changing the chemical composition from nitrogen to air as well as argon for a stagnation enthalpy of 8.0 MJ/kg flow are investigated using the 2-D wedge model. The simulations are found to reproduce many of the classic features related to Edney Type V strong shock interactions that include the attached, oblique shock formed over the first wedge, the detached bow shock from the second wedge, the separation zone, and the separation and reattachment shocks that cause complex features such as the triple point for both cases. However, results of a reacting air flow case indicate that the size of the separation length, and the movement of the triple point toward to the leading edge is much less than the nitrogen case.

  10. Simulation Study of Shock Reaction on Porous Material

    International Nuclear Information System (INIS)

    Xu Aiguo; Zhang Guangcai; Pan Xiaofei; Zhu Jianshi

    2009-01-01

    Direct modeling of porous materials under shock is a complex issue. We investigate such a system via the newly developed material-point method. The effects of shock strength and porosity size are the main concerns. For the same porosity, the effects of mean-void-size are checked. It is found that local turbulence mixing and volume dissipation are two important mechanisms for transformation of kinetic energy to heat. When the porosity is very small, the shocked portion may arrive at a dynamical steady state; the voids in the downstream portion reflect back rarefactive waves and result in slight oscillations of mean density and pressure; for the same value of porosity, a larger mean-void-size makes a higher mean temperature. When the porosity becomes large, hydrodynamic quantities vary with time during the whole shock-loading procedure: after the initial stage, the mean density and pressure decrease, but the temperature increases with a higher rate. The distributions of local density, pressure, temperature and particle-velocity are generally non-Gaussian and vary with time. The changing rates depend on the porosity value, mean-void-size and shock strength. The stronger the loaded shock, the stronger the porosity effects. This work provides a supplement to experiments for the very quick procedures and reveals more fundamental mechanisms in energy and momentum transportation. (general)

  11. Shock Heating of the Merging Galaxy Cluster A521

    Science.gov (United States)

    Bourdin, H.; Mazzotta, P.; Markevitch, M.; Giacintucci, S.; Brunetti, G.

    2013-01-01

    A521 is an interacting galaxy cluster located at z = 0.247, hosting a low-frequency radio halo connected to an eastern radio relic. Previous Chandra observations hinted at the presence of an X-ray brightness edge at the position of the relic, which may be a shock front. We analyze a deep observation of A521 recently performed with XMM-Newton in order to probe the cluster structure up to the outermost regions covered by the radio emission. The cluster atmosphere exhibits various brightness and temperature anisotropies. In particular, two cluster cores appear to be separated by two cold fronts. We find two shock fronts, one that was suggested by Chandra and that is propagating to the east, and another to the southwestern cluster outskirt. The two main interacting clusters appear to be separated by a shock-heated region, which exhibits a spatial correlation with the radio halo. The outer edge of the radio relic coincides spatially with a shock front, suggesting that this shock is responsible for the generation of cosmic-ray electrons in the relic. The propagation direction and Mach number of the shock front derived from the gas density jump, M = 2.4 +/- 0.2, are consistent with expectations from the radio spectral index, under the assumption of Fermi I acceleration mechanism.

  12. Development of Calculation Algorithm for ECCS Kinematic Shock

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Seung-Chan; Yoon, Duk-Joo; Ha, Sang-Jun [KHNP-CRI, Daejeon (Korea, Republic of)

    2014-10-15

    The void fraction of inverted U-pipes in front of SI(Safety Injection) pumps impact on the pipe system of ECCS(Emergency Core Cooling Systems). This phenomena is called as 'Kinematic Shock'. The purpose of this paper is to achieve the more exactly calculation when the kinematic shock is calculated by simplified equation. The behavior of the void packet of the ECCS pipes is illustrated by the simplified (other name is kinematic shock equation).. The kinematic shock is defined as the depth of total length of void clusters in the pipes of ECCS when the void cluster is continually reached along the part of pipes in vertical direction. In this paper, the simplified equation is evaluated by comparing calculation error each other.]. The more exact methods of calculating the depth of the kinematic shock in ECCS is achieved. The error of kinematic shock calculation is strongly depended on the calculation search gap and the order of Taylor's expansion. From this study, to select the suitable search gap and the suitable calculation order, differential root method, secant method, and Taylor's expansion form are compared one another.

  13. PLANETARY EMBRYO BOW SHOCKS AS A MECHANISM FOR CHONDRULE FORMATION

    Energy Technology Data Exchange (ETDEWEB)

    Mann, Christopher R.; Boley, Aaron C. [Department of Physics and Astronomy University of British Columbia Vancouver, BC V6T 1Z1 (Canada); Morris, Melissa A. [Physics Department State University of New York at Cortland Cortland, NY 13045 (United States)

    2016-02-20

    We use radiation hydrodynamics with direct particle integration to explore the feasibility of chondrule formation in planetary embryo bow shocks. The calculations presented here are used to explore the consequences of a Mars-size planetary embryo traveling on a moderately excited orbit through the dusty, early environment of the solar system. The embryo’s eccentric orbit produces a range of supersonic relative velocities between the embryo and the circularly orbiting gas and dust, prompting the formation of bow shocks. Temporary atmospheres around these embryos, which can be created via volatile outgassing and gas capture from the surrounding nebula, can non-trivially affect thermal profiles of solids entering the shock. We explore the thermal environment of solids that traverse the bow shock at different impact radii, the effects that planetoid atmospheres have on shock morphologies, and the stripping efficiency of planetoidal atmospheres in the presence of high relative winds. Simulations are run using adiabatic and radiative conditions, with multiple treatments for the local opacities. Shock speeds of 5, 6, and 7 km s{sup −1} are explored. We find that a high-mass atmosphere and inefficient radiative conditions can produce peak temperatures and cooling rates that are consistent with the constraints set by chondrule furnace studies. For most conditions, the derived cooling rates are potentially too high to be consistent with chondrule formation.

  14. On the shock cell structure and noise of supersonic jets

    Science.gov (United States)

    Tam, C. K. W.; Jackson, J. A.

    1983-01-01

    A linear solution modeling the shock cell structure of an axisymmetric supersonic jet operated at off-design conditions is developed by the method of multiple-scales. The model solution takes into account the gradual spatial change of the mean flow in the downstream direction. Turbulence in the mixing layer of the jet has the tendency of smoothing out the sharp velocity and density gradients induced by the shocks. To simulate this effect, eddy viscosity terms are incorporated in the model. It is known that the interaction between the quasi-periodic shock cells and the downstream propagating large turbulence structures in the mixing layer of the jet is responsible for the generation of broadband shock associated noise. Experimentally, the dominant part of this noise has been found to originate from the part of the jet near the end of the potential core. Calculated shock cell spacing at the end of the jet core according to the present model is used to estimate the peak frequencies of the shock associated noise for a range of observation angles. Very favorable agreement with experimental measurements is found.

  15. Nonlinear theory of diffusive acceleration of particles by shock waves

    Energy Technology Data Exchange (ETDEWEB)

    Malkov, M.A. [University of California at San Diego, La Jolla, CA (United States)]. E-mail: mmalkov@ucsd.edu; Drury, L. O' C. [Dublin Institute for Advanced Studies, 5 Merrion Square, Dublin 2 (Ireland)

    2001-04-01

    Among the various acceleration mechanisms which have been suggested as responsible for the nonthermal particle spectra and associated radiation observed in many astrophysical and space physics environments, diffusive shock acceleration appears to be the most successful. We review the current theoretical understanding of this process, from the basic ideas of how a shock energizes a few reactionless particles to the advanced nonlinear approaches treating the shock and accelerated particles as a symbiotic self-organizing system. By means of direct solution of the nonlinear problem we set the limit to the test-particle approximation and demonstrate the fundamental role of nonlinearity in shocks of astrophysical size and lifetime. We study the bifurcation of this system, proceeding from the hydrodynamic to kinetic description under a realistic condition of Bohm diffusivity. We emphasize the importance of collective plasma phenomena for the global flow structure and acceleration efficiency by considering the injection process, an initial stage of acceleration and, the related aspects of the physics of collisionless shocks. We calculate the injection rate for different shock parameters and different species. This, together with differential acceleration resulting from nonlinear large-scale modification, determines the chemical composition of accelerated particles. The review concentrates on theoretical and analytical aspects but our strategic goal is to link the fundamental theoretical ideas with the rapidly growing wealth of observational data. (author)

  16. A critical analysis of shock models for chondrule formation

    Science.gov (United States)

    Stammler, Sebastian M.; Dullemond, Cornelis P.

    2014-11-01

    In recent years many models of chondrule formation have been proposed. One of those models is the processing of dust in shock waves in protoplanetary disks. In this model, the dust and the chondrule precursors are overrun by shock waves, which heat them up by frictional heating and thermal exchange with the gas. In this paper we reanalyze the nebular shock model of chondrule formation and focus on the downstream boundary condition. We show that for large-scale plane-parallel chondrule-melting shocks the postshock equilibrium temperature is too high to avoid volatile loss. Even if we include radiative cooling in lateral directions out of the disk plane into our model (thereby breaking strict plane-parallel geometry) we find that for a realistic vertical extent of the solar nebula disk the temperature decline is not fast enough. On the other hand, if we assume that the shock is entirely optically thin so that particles can radiate freely, the cooling rates are too high to produce the observed chondrules textures. Global nebular shocks are therefore problematic as the primary sources of chondrules.

  17. Chondrule destruction in nebular shocks

    Energy Technology Data Exchange (ETDEWEB)

    Jacquet, Emmanuel; Thompson, Christopher, E-mail: ejacquet@mnhn.fr [Canadian Institute for Theoretical Astrophysics, University of Toronto, 60 St George Street, Toronto, ON M5S 3H8 (Canada)

    2014-12-10

    Chondrules are millimeter-sized silicate spherules ubiquitous in primitive meteorites, but whose origin remains mysterious. One of the main proposed mechanisms for producing them is melting of solids in shock waves in the gaseous protoplanetary disk. However, evidence is mounting that chondrule-forming regions were enriched in solids well above solar abundances. Given the high velocities involved in shock models, destructive collisions would be expected between differently sized grains after passage of the shock front as a result of differential drag. We investigate the probability and outcome of collisions of particles behind a one-dimensional shock using analytic methods as well as a full integration of the coupled mass, momentum, energy, and radiation equations. Destruction of protochondrules seems unavoidable for solid/gas ratios ε ≳ 0.1, and possibly even for solar abundances because of 'sandblasting' by finer dust. A flow with ε ≳ 10 requires much smaller shock velocities (∼2 versus 8 km s{sup –1}) in order to achieve chondrule-melting temperatures, and radiation trapping allows slow cooling of the shocked fragments. Initial destruction would still be extensive; although re-assembly of millimeter-sized particles would naturally occur by grain sticking afterward, the compositional heterogeneity of chondrules may be difficult to reproduce. We finally note that solids passing through small-scale bow shocks around few kilometer-sized planetesimals might experience partial melting and yet escape fragmentation.

  18. Normal Pressure Hydrocephalus (NPH)

    Science.gov (United States)

    ... local chapter Join our online community Normal Pressure Hydrocephalus (NPH) Normal pressure hydrocephalus is a brain disorder ... Symptoms Diagnosis Causes & risks Treatments About Normal Pressure Hydrocephalus Normal pressure hydrocephalus occurs when excess cerebrospinal fluid ...

  19. Thermal Shock Property of Al/Ni-ZrO2 Gradient Thermal Barrier Coatings

    Institute of Scientific and Technical Information of China (English)

    FANJin-juan; WANGQuan-sheng; ZHANGWei-fang

    2004-01-01

    Al/Ni-ZrO2 gradient thermal barrier coatings are made on aluminum substrate using plasma spraying method and one direction thermal shock properties of the coatings are studied in this paper. The results show that pores in coatings link to form cracks vertical to coating surface. They go through the whole ZrO2 coating once vertical cracks form. When thermal shock cycles increase, horizontal cracks that result in coatings failure forms in the coatings and interface. And vertical cracks delay appearance of horizontal cracks and enhance thermal shock property of coatings. Failure mechanisms of coating thermal shock are discussed using experiments and finite element method.

  20. Two-state ion heating at quasi-parallel shocks

    International Nuclear Information System (INIS)

    Thomsen, M.F.; Gosling, J.T.; Bame, S.J.; Onsager, T.G.; Russell, C.T.

    1990-01-01

    In a previous study of ion heating at quasi-parallel shocks, the authors showed a case in which the ion distributions downstream from the shock alternated between a cooler, denser, core/shoulder type and a hotter, less dense, more Maxwellian type. In this paper they further document the alternating occurrence of two different ion states downstream from several quasi-parallel shocks. Three separate lines of evidence are presented to show that the two states are not related in an evolutionary sense, but rather both are produced alternately at the shock: (1) the asymptotic downstream plasma parameters (density, ion temperature, and flow speed) are intermediate between those characterizing the two different states closer to the shock, suggesting that the asymptotic state is produced by a mixing of the two initial states; (2) examples of apparently interpenetrating (i.e., mixing) distributions can be found during transitions from one state to the other; and (3) examples of both types of distributions can be found at actual crossings of the shock ramp. The alternation between the two different types of ion distribution provides direct observational support for the idea that the dissipative dynamics of at least some quasi-parallel shocks is non-stationary and cyclic in nature, as demonstrated by recent numerical simulations. Typical cycle times between intervals of similar ion heating states are ∼2 upstream ion gyroperiods. Both the simulations and the in situ observations indicate that a process of coherent ion reflection is commonly an important part of the dissipation at quasi-parallel shocks

  1. On the effect of a tangential discontinuity on ions specularly reflected at an oblique shock

    International Nuclear Information System (INIS)

    Burgess, D.

    1989-01-01

    In seeking to explain the events observed close to the Earth's bow shock known as hot, diamagnetic cavities (HDC), or active current sheets (ACS), attention has focused on the microphysics of the interaction of a magnetic field directional discontinuity and a collisionless, supercritical shock. Here the author investigates the case of a tangential discontinuity (TD) convecting into a shock at some arbitrary angle. As a first stage he adopted an approach in which test particles represent ions specularly reflected at the shock front. Widely different behavior is possible depending on the sense of ion gyration relative to the TD. Particles can be injected into the plane of the TD so that they travel upstream trapped close to the TD. This implies that ACS events, presumed to be the result of the interaction of the solar wind with a large density reflected component, are detached from the bow shock. For other geometries, ions interact with the TD but stay close to the shock, implying that ACS events are modifications of the shock. The TD can deprive a limited spatial region of a downstream reflected gyrating ion population (necessary for the quasi-perpendicular supercritical shock to be steady), and so he could anticipate where the shock will not be in equilibrium, and consequently where strong reflection may occur. The detailed behavior of the shock in such a situation must be investigated with self-consistent simulations

  2. A schizophrenic patient with cerebral infarctions after hemorrhagic shock

    Directory of Open Access Journals (Sweden)

    Youichi Yanagawa

    2013-01-01

    Full Text Available We herein report the fourth case of cerebral infarction, concomitant with hemorrhagic shock, in English literature. A 33-year-old male, who had been diagnosed with schizophrenia and given a prescription for Olanzapine, was discovered with multiple self-inflicted bleeding cuts on his wrist. On arrival, he was in hemorrhagic shock without verbal responsiveness, but his vital signs were normalized following infusion of Lactate Ringer′s solution. The neuroradiological studies revealed multiple cerebral ischemic lesions without any vascular abnormality. He was diagnosed with speech apraxia, motor aphasia, and dysgraphia, due to multiple cerebral infarctions. As there was no obvious causative factor with regard to the occurrence of cerebral infarction in the patient, the hypoperfusion due to hemorrhagic shock, and the thromboembolic tendency due to Olanzapine, might have acted together to lead to the patient′s cerebral ischemia.

  3. Hydride transport vessel vibration and shock test report

    Energy Technology Data Exchange (ETDEWEB)

    Tipton, D.G.

    1998-06-01

    Sandia National Laboratories performed vibration and shock testing on a Savannah River Hydride Transport Vessel (HTV) which is used for bulk shipments of tritium. This testing is required to qualify the HTV for transport in the H1616 shipping container. The main requirement for shipment in the H1616 is that the contents (in this case the HTV) have a tritium leak rate of less than 1x10{sup {minus}7} cc/sec after being subjected to shock and vibration normally incident to transport. Helium leak tests performed before and after the vibration and shock testing showed that the HTV remained leaktight under the specified conditions. This report documents the tests performed and the test results.

  4. Hydride transport vessel vibration and shock test report

    International Nuclear Information System (INIS)

    Tipton, D.G.

    1998-06-01

    Sandia National Laboratories performed vibration and shock testing on a Savannah River Hydride Transport Vessel (HTV) which is used for bulk shipments of tritium. This testing is required to qualify the HTV for transport in the H1616 shipping container. The main requirement for shipment in the H1616 is that the contents (in this case the HTV) have a tritium leak rate of less than 1x10 -7 cc/sec after being subjected to shock and vibration normally incident to transport. Helium leak tests performed before and after the vibration and shock testing showed that the HTV remained leaktight under the specified conditions. This report documents the tests performed and the test results

  5. Simulation of mechanical shock environments

    International Nuclear Information System (INIS)

    Lalanne, Christian.

    1975-07-01

    Shocks can produce a severe mechanical environment which must be taken into account when designing and developing new equipments. After some mathematical (Laplace and Fourier transforms) and mechanical recalls (response of a one degree freedom system to a sinusoidal excitation), different analysis methods are compared, these methods being the most used now to compare relative severities of tests and establish specifications. A few chapter deal with the different properties of simple, easy to produce, shock shapes. Then some now-in-use programmators or shock-machines specifications are shown. A final chapter concerns acceleration transducers [fr

  6. Particle acceleration in modified shocks

    International Nuclear Information System (INIS)

    Drury, L.O'C.; Axford, W.I.; Summers, D.

    1982-01-01

    Efficient particle acceleration in shocks must modify the shock structure with consequent changes in the particle acceleration. This effect is studied and analytic solutions are found describing the diffusive acceleration of particles with momentum independent diffusion coefficients in hyperbolic tangent type velocity transitions. If the input particle spectrum is a delta function, the shock smoothing replaces the truncated power-law downstream particle spectrum by a more complicated form, but one which has a power-law tail at high momenta. For a cold plasma this solution can be made completely self-consistent. Some problems associated with momentum dependent diffusion coefficients are discussed. (author)

  7. INTERFERENCE OF COUNTERPROPAGATING SHOCK WAVES

    Directory of Open Access Journals (Sweden)

    P. V. Bulat

    2015-03-01

    Full Text Available The subject of study. We examined the interaction of counterpropagating shock waves. The necessity of counterpropagating shock waves studying occurs at designing of high Mach number modern internal compression air intakes, Ramjets with subsonic and supersonic combustion, in asymmetrical supersonic nozzles and in some other cases. In a sense, this problem is a generalization of the case of an oblique shock reflection from the wall or from the plane of symmetry. With the renewed vigor, the interest to this problem emerged at the end of the 90s. This was due to the start of the programs for flight study at hypersonic speeds. The first experiments performed with air intakes, which realized the interaction of counterpropagating shock waves have shown that the change in flow velocity is accompanied by abrupt alteration of shock-wave structure, the occurrence of nonstationary and oscillatory phenomena. With an increase of flow velocity these phenomena undesirable for aircraft structure became more marked. The reason is that there are two fundamentally different modes of interaction of counterpropagating shock waves: a four-wave regular and a five-wave irregular. The transition from one mode to another can be nonstationary abrupt or gradual, it can also be accompanied by hysteresis. Main results. Criteria for the transition from regular reflection of counterpropagating shock waves to irregular are described: the criterion of von Neumann and the stationary Mach configuration criterion. We described areas in which the transition from one reflection type to another is possible only in abrupt way, as well as areas of possible gradual transition. Intensity dependences of the reflected shock waves from the intensity of interacting counterpropagating shocks were given. Qualitative pictures of shock-wave structures arising from the interaction of counterpropagating shock waves were shown. Calculation results of the intensity of outgoing gas

  8. Particle acceleration in modified shocks

    Energy Technology Data Exchange (ETDEWEB)

    Drury, L.O' C. (Max-Planck-Institut fuer Kernphysik, Heidelberg (Germany, F.R.)); Axford, W.I. (Max-Planck-Institut fuer Aeronomie, Katlenburg-Lindau (Germany, F.R.)); Summers, D. (Memorial Univ. of Newfoundland, St. John' s (Canada))

    1982-03-01

    Efficient particle acceleration in shocks must modify the shock structure with consequent changes in the particle acceleration. This effect is studied and analytic solutions are found describing the diffusive acceleration of particles with momentum independent diffusion coefficients in hyperbolic tangent type velocity transitions. If the input particle spectrum is a delta function, the shock smoothing replaces the truncated power-law downstream particle spectrum by a more complicated form, but one which has a power-law tail at high momenta. For a cold plasma this solution can be made completely self-consistent. Some problems associated with momentum dependent diffusion coefficients are discussed.

  9. Shocks in the Early Universe.

    Science.gov (United States)

    Pen, Ue-Li; Turok, Neil

    2016-09-23

    We point out a surprising consequence of the usually assumed initial conditions for cosmological perturbations. Namely, a spectrum of Gaussian, linear, adiabatic, scalar, growing mode perturbations not only creates acoustic oscillations of the kind observed on very large scales today, it also leads to the production of shocks in the radiation fluid of the very early Universe. Shocks cause departures from local thermal equilibrium as well as create vorticity and gravitational waves. For a scale-invariant spectrum and standard model physics, shocks form for temperatures 1  GeVUniverse as early as 10^{-30}  sec after the big bang.

  10. Noncoplanar magnetic fields at collisionless shocks: A test of a new approach

    International Nuclear Information System (INIS)

    Gosling, J.T.; Winske, D.; Thomsen, M.F.

    1988-01-01

    Within the foot and ramp of a fast mode collisionless shock the magnetic field rotates out of the plane of coplanarity defined by the upstream magnetic field and the shock normal. As previously noted (Goodrich and Scudder, 1984), the sense of this rotation is such as to reduce the cross-shock potential drop when measured in the deHoffman-Teller frame relative to that measured in the normal incidence frame. From a consideration of the requirement that there be zero current in the coplanarity plane downstream of the shock, Jones and Ellison (1987) have argued that the field rotation and potential drop difference are a consequence of unequal ion and electron masses, and have derived an expression for the spatial integral of the noncoplanar field component in terms of the electron current within the shock layer. Moreover, by assuming that the ion current within the shock layer is negligible compared to the electron current, they derive equations which predict the magnitude of both the field rotation and the potential drop difference in terms of upstream quantities and the field jump at the shock. We have tested their equations with ISEE 1 and 2 plasma and field measurements at the Earth's bow shock and by means of numerical simulations. We find substantial support for their suggestion that the field rotation and thus also the frame dependence of the potential drop are fundamentally a consequence of unequal ion and electron masses. Further, for subcritical shocks (low Mach number) one can neglect the ion current to predict both the sign and the magnitude of the field rotation and potential drop difference. However, at supercritical shocks (high Mach numbers) the ion current associated with reflected, gyrating ions cannot be neglected, and the final equations of Jones and Ellison seriously underestimate the magnitude of the field rotation and the potential drop difference at these shocks

  11. Reynolds-Stress Budgets in an Impinging Shock Wave/Boundary-Layer Interaction

    Science.gov (United States)

    Vyas, Manan A.; Yoder, Dennis A.; Gaitonde, Datta V.

    2018-01-01

    Implicit large-eddy simulation (ILES) of a shock wave/boundary-layer interaction (SBLI) was performed. Comparisons with experimental data showed a sensitivity of the current prediction to the modeling of the sidewalls. This was found to be common among various computational studies in the literature where periodic boundary conditions were used in the spanwise direction, as was the case in the present work. Thus, although the experiment was quasi-two-dimensional, the present simulation was determined to be two-dimensional. Quantities present in the exact equation of the Reynolds-stress transport, i.e., production, molecular diffusion, turbulent transport, pressure diffusion, pressure strain, dissipation, and turbulent mass flux were calculated. Reynolds-stress budgets were compared with past large-eddy simulation and direct numerical simulation datasets in the undisturbed portion of the turbulent boundary layer to validate the current approach. The budgets in SBLI showed the growth in the production term for the primary normal stress and energy transfer mechanism was led by the pressure strain term in the secondary normal stresses. The pressure diffusion term, commonly assumed as negligible by turbulence model developers, was shown to be small but non-zero in the normal stress budgets, however it played a key role in the primary shear stress budget.

  12. Ion distributions in the Earth's foreshock upstream from the bow shock

    Science.gov (United States)

    Fuselier, S. A.

    1995-01-01

    A variety of suprathermal and energetic ion distributions are found upstream from shocks. Some distributions, such as field-aligned beams, are generated directly at the shock either through reflection processes or through leakage from the hotter downstream region. Other distributions, such as intermediate distributions, evolve from these parent distributions through wave-particle interactions. This paper reviews our current understanding of the creation and evolution of suprathermal distributions at shocks. Examples of suprathermal ion distributions are taken from observations at the Earth's bow shock. Particular emphasis is placed on the creation of field-aligned beams and specularly reflected ion distributions and on the evolution of these distributions in the Earth's ion foreshock. However, the results from this heavily studied region are applicable to interplanetary shocks, bow shocks at other planets, and comets.

  13. Molecular origins of anisotropic shock propagation in crystalline and amorphous polyethylene

    Science.gov (United States)

    O'Connor, Thomas C.; Elder, Robert M.; Sliozberg, Yelena R.; Sirk, Timothy W.; Andzelm, Jan W.; Robbins, Mark O.

    2018-03-01

    Molecular dynamics simulations are used to analyze shock propagation in amorphous and crystalline polyethylene. Results for the shock velocity Us are compared to predictions from Pastine's equation of state and hydrostatic theory. The results agree with Pastine at high impact velocities. At low velocities the yield stress becomes important, increasing the shock velocity and leading to anisotropy in the crystalline response. Detailed analysis of changes in atomic order reveals the origin of the anisotropic response. For shock along the polymer backbone, an elastic front is followed by a plastic front where chains buckle with a characteristic wavelength. Shock perpendicular to the chain backbone can produce plastic deformation or transitions to different orthorhombic or monoclinic structures, depending on the impact speed and direction. Tensile loading does not produce stable shocks: Amorphous systems craze and fracture while for crystals the front broadens linearly with time.

  14. Wound shock: a history of its study and treatment by military surgeons.

    Science.gov (United States)

    Hardaway, Robert M

    2004-04-01

    The treatment of wounds has received considerable attention from the time of the Trojan War. However, it was not until the American Civil War that shock was described as an entity distinct from the wounds themselves and that efforts were directed at more than just treatment of the wound. The need for fluid resuscitation in the treatment of hemorrhagic shock was first recognized in the Spanish American War, as was the association of sepsis with shock. World War I showed the need for blood in the treatment of "wound shock," a lesson that had to be relearned in World War II through bitter experience. Studies in the Korean War described the concept of disseminated intravascular coagulation and multiple organ failure, and the existence of disseminated intravascular coagulation was confirmed by studies in Vietnam. The treatment of hemorrhagic shock is now very effective, but the treatment of traumatic and septic shock remains unsatisfactory.

  15. Structure of slow shocks in a magnetized plasma with heat conduction

    International Nuclear Information System (INIS)

    Tsai, C.L.; Tsai, R.H.; Wu, B.H.; Lee, L.C.

    2002-01-01

    The structure of slow shocks in the presence of a heat conduction parallel to the local magnetic field is simulated from the set of magnetohydrodynamic equations. In this study, a pair of slow shocks is formed through the evolution of a current sheet initiated by the presence of a normal magnetic field. It is found that the slow shock consists of two parts: The isothermal main shock and foreshock. Significant jumps in plasma density, velocity and magnetic field occur across the main shock, but the temperature is found to be continuous across the main shock. The foreshock is featured by a smooth temperature variation and is formed due to the heat flow from downstream to upstream region. The plasma density downstream of the main shock decreases with time, while the downstream temperature increases with time, keeping the downstream pressure constant. It is shown that the jumps in plasma density, pressure, velocity, and magnetic field across the main shock are determined by the set of modified isothermal Rankine-Hugoniot conditions. It is also found that a jump in the temperature gradient is present across the main shock in order to satisfy the energy conservation. The present results can be applied to the heating in the solar corona and solar wind

  16. Structure of oblique subcritical bow shocks: ISEE 1 and 2 observations

    International Nuclear Information System (INIS)

    Mellott, M.M.; Greenstadt, E.W.

    1984-01-01

    We have studied the structural elements, including shock ramps and precursor wave trains, of a series of oblique low-Mach number terrestrial bow shocks. We used magnetic field data from the dual ISEE 1 and 2 spacecraft to determine the scale lengths of various elements of shock structure as well as wavelengths and wave polarizations. Bow shocks structure under these conditions is esstentially that of a large-amplitude damped whistler mode wave which extends upstream in the form of a precursor wave train. Shock thicknesses, which are determined by the dispersive properties of the ambient plasma, are too broad to support current-driven electrostatic waves, ruling out such turbulence as the source of dissipation in these shocks. Dissipative processes are reflected in the damping of the precursors, and dissipative scale lengths are approx.200--800 km (several times greater than shock thicknesses). Precursor damping is not related to shock normal angle or Mach number, but is correlated with T/sub e//T/sub t/. The source of the dissipation in the shocks does not appear to be wave-wave decay of the whistlers, for which no evidence is found. We cannot rule out the possibility of contribution to the dissipation from ion acoustic and, or lower hybrid mode turbulence, but interaction of the whistler itself with upstream electrons offers a simpler and more self-consistent explanation for the observed wave train damping

  17. Shock parameter calculations at weak interplanetary shock waves

    Directory of Open Access Journals (Sweden)

    J. M. Gloag

    2005-02-01

    Full Text Available A large set of interplanetary shock waves observed using the Ulysses spacecraft is analysed in order to determine their local parameters. For the first time a detailed analysis is extended to the thermodynamic properties of a large number of events. The intention is to relate the shock parameters to the requirements set by MHD shock theory. A uniform approach is adopted in the selection of up and downstream regions for this analysis and applied to all the shock waves. Initially, the general case of a 3 component adiabatic plasma is considered. However, the calculation of magnetosonic and Alfvénic Mach numbers and the ratio of downstream to upstream entropy produce some unexpected results. In some cases there is no clear increase in entropy across the shock and also the magnetosonic Mach number can be less than 1. It is found that a more discerning use of data along with an empirical value for the polytropic index can raise the distribution of downstream to upstream entropy ratios to a more acceptable level. However, it is also realised that many of these shocks are at the very weakest end of the spectrum and associated phenomena may also contribute to the explanation of these results.

  18. Quasilinear simulations of interplanetary shocks and Earth's bow shock

    Science.gov (United States)

    Afanasiev, Alexandr; Battarbee, Markus; Ganse, Urs; Vainio, Rami; Palmroth, Minna; Pfau-Kempf, Yann; Hoilijoki, Sanni; von Alfthan, Sebastian

    2016-04-01

    We have developed a new self-consistent Monte Carlo simulation model for particle acceleration in shocks. The model includes a prescribed large-scale magnetic field and plasma density, temperature and velocity profiles and a self-consistently computed incompressible ULF foreshock under the quasilinear approximation. Unlike previous analytical treatments, our model is time dependent and takes full account of the anisotropic particle distributions and scattering in the wave-particle interaction process. We apply the model to the problem of particle acceleration at traveling interplanetary (IP) shocks and Earth's bow shock and compare the results with hybrid-Vlasov simulations and spacecraft observations. A qualitative agreement in terms of spectral shape of the magnetic fluctuations and the polarization of the unstable mode is found between the models and the observations. We will quantify the differences of the models and explore the region of validity of the quasilinear approach in terms of shock parameters. We will also compare the modeled IP shocks and the bow shock, identifying the similarities and differences in the spectrum of accelerated particles and waves in these scenarios. The work has received funding from the European Union's Horizon 2020 research and innovation programme under grant agreement No 637324 (HESPERIA). The Academy of Finland is thanked for financial support. We acknowledge the computational resources provided by CSC - IT Centre for Science Ltd., Espoo.

  19. Diaphragmless shock wave generators for industrial applications of shock waves

    Science.gov (United States)

    Hariharan, M. S.; Janardhanraj, S.; Saravanan, S.; Jagadeesh, G.

    2011-06-01

    The prime focus of this study is to design a 50 mm internal diameter diaphragmless shock tube that can be used in an industrial facility for repeated loading of shock waves. The instantaneous rise in pressure and temperature of a medium can be used in a variety of industrial applications. We designed, fabricated and tested three different shock wave generators of which one system employs a highly elastic rubber membrane and the other systems use a fast acting pneumatic valve instead of conventional metal diaphragms. The valve opening speed is obtained with the help of a high speed camera. For shock generation systems with a pneumatic cylinder, it ranges from 0.325 to 1.15 m/s while it is around 8.3 m/s for the rubber membrane. Experiments are conducted using the three diaphragmless systems and the results obtained are analyzed carefully to obtain a relation between the opening speed of the valve and the amount of gas that is actually utilized in the generation of the shock wave for each system. The rubber membrane is not suitable for industrial applications because it needs to be replaced regularly and cannot withstand high driver pressures. The maximum shock Mach number obtained using the new diaphragmless system that uses the pneumatic valve is 2.125 ± 0.2%. This system shows much promise for automation in an industrial environment.

  20. Shock-induced transformations in crystalline RDX: a uniaxial constant-stress Hugoniostat molecular dynamics simulation study.

    Science.gov (United States)

    Bedrov, Dmitry; Hooper, Justin B; Smith, Grant D; Sewell, Thomas D

    2009-07-21

    Molecular dynamics (MD) simulations of uniaxial shock compression along the [100] and [001] directions in the alpha polymorph of hexahydro-1,3,5-trinitro-1,3,5-triazine (alpha-RDX) have been conducted over a wide range of shock pressures using the uniaxial constant stress Hugoniostat method [Ravelo et al., Phys. Rev. B 70, 014103 (2004)]. We demonstrate that the Hugoniostat method is suitable for studying shock compression in atomic-scale models of energetic materials without the necessity to consider the extremely large simulation cells required for an explicit shock wave simulation. Specifically, direct comparison of results obtained using the Hugoniostat approach to those reported by Thompson and co-workers [Phys. Rev. B 78, 014107 (2008)] based on large-scale MD simulations of shocks using the shock front absorbing boundary condition (SFABC) approach indicates that Hugoniostat simulations of systems containing several thousand molecules reproduced the salient features observed in the SFABC simulations involving roughly a quarter-million molecules, namely, nucleation and growth of nanoscale shear bands for shocks propagating along the [100] direction and the polymorphic alpha-gamma phase transition for shocks directed along the [001] direction. The Hugoniostat simulations yielded predictions of the Hugoniot elastic limit for the [100] shock direction consistent with SFABC simulation results.

  1. Microbial pathogenesis in cystic fibrosis: co-ordinate regulation of heat-shock response and conversion to mucoidy in Pseudomonas aeruginosa.

    Science.gov (United States)

    Schurr, M J; Deretic, V

    1997-04-01

    Conversion of Pseudomonas aeruginosa to the mucoid phenotype plays a major role in the pathogenesis of respiratory infections in cystic fibrosis (CF). One mechanism responsible for mucoidy is based on mutations that inactivate the anti-sigma factor, MucA, which normally inhibits the alternative sigma factor, AIgU. The loss of MucA allows AIgU to freely direct transcription of the genes responsible for the production of the exopolysaccharide alginate resulting in mucoid colony morphology. In Escherichia coli, a close homologue of AIgU, sigma(E), directs transcription of several genes under conditions of extreme heat shock. Here we examined whether AIgU, besides its role in controlling alginate production, affects the heat-shock response in P. aeruginosa. The P. aeruginosa rpoH gene encoding a homologue of the major heat-shock sigma factor, sigma32, was found to be transcribed by AIgU containing RNA polymerase from one of its promoters (P3) identified in this study. Transcription of rpoH from P3 was elevated upon exposure to extreme heat shock in an aIgU-dependent manner. Importantly, the AIgU-dependent promoter of rpoH was found to be activated in mucoid mucA mutants. In keeping with this observation, introduction of a wild-type mucA gene abrogated AIgU-dependent rpoH transcription in mucoid P. aeruginosa laboratory isolates and CF isolates. These results suggest that conversion to mucoidy and the heat-shock response are co-ordinately regulated in P. aeruginosa. The simultaneous activation of both systems in mucA mutants, selected in the lungs of CF patients, may have significance for the inflammatory processes characteristic of the establishment of chronic infection and ensuing clinical deterioration in CF.

  2. Shock wave dynamics derivatives and related topics

    CERN Document Server

    Emanuel, George

    2012-01-01

    "...this monograph develops an esoteric niche within shock wave theory. …treats shock waves from an analytical approach assuming perfect gas. Emanuel has made significant contributions to the theory of shock waves and has selected a number of topics that reflect those contributions."-Shock Waves, 2013.

  3. CALCULATION OF SHOCK-WAVE PULSE EFFECT ON OUTSTRETCHED SPINE

    Directory of Open Access Journals (Sweden)

    G. A. Esman

    2011-01-01

    Full Text Available Combined effects of a shock-wave pulse method and mechanotherapy on a spine is considered as an alternative to conservative and operative methods.Methodology for spinal disease treatment while applying a shock-wave therapy is characterized by the following specific features. Firstly, it is necessary to limit a penetration depth of shock pulses in a biological object in order to exclude damage to a spinal cord. Secondly, it is necessary to limit an energy flux density:Imax≤ 0,280 J∕m2and  pressure in focus:PFmax≤ 0,040 MPа,in order to exclude traumatizing of spinal tissue and only stimulate blood  circulation and metabolic processes in them.Where an acceptable value of the force acting on the inter-vertebral disc while a shock wave is passing is determined by the following formula: F max = PFmaxS = PFmax πr02 = 0,040 ∙106 ∙3,14 ∙(8∙10-32 = 9 N, where r0 – a focal spot radius, mm.Mechanotherapy is applied in combination with the shock-wave therapy and it presupposes the following: an outstretching force acts created in a longitudinal direction of the spine and it is directed across a vertebral column, whose value usually ranges from 50 to 500 N.   

  4. Mechanical analysis of a heat-shock induced developmental defect

    Science.gov (United States)

    Crews, Sarah M.; McCleery, W. Tyler; Hutson, M. Shane

    2014-03-01

    Embryonic development in Drosophila is a complex process involving coordinated movements of mechanically interacting tissues. Perturbing this system with a transient heat shock can result in a number of developmental defects. In particular, a heat shock applied during the earliest morphogenetic movements of gastrulation can lead to apparent recovery, but then subsequent morphogenetic failure 5-6 hours later during germ band retraction. The process of germ band retraction requires an intact amnioserosa - a single layered extra-embryonic epithelial tissue - and heat shock at gastrulation can induce the later opening of holes in the amnioserosa. These holes are highly correlated with failures of germ band retraction. These holes could be caused by a combination of mechanical weakness in the amnioserosa or local increases in mechanical stress. Here, we assess the role of mechanical stress using confocal imaging to compare cell and tissue morphology in the amnioserosa of normal and heat-shocked embryos and laser hole drilling to map the stress field around the times and locations at which heat-shock induced holes open.

  5. Nonlinearity, Conservation Law and Shocks

    Indian Academy of Sciences (India)

    Almost all natural phenomena, and social and economic changes, .... reference moving with velocity c also by the same symbol x and ... abstract as can be seen from the publication of the book Shock Waves and Reaction Diffusion Equation.

  6. Shock Thermodynamic Applied Research Facility

    Data.gov (United States)

    Federal Laboratory Consortium — The Shock Thermodynamic Applied Research Facility (STAR) facility, within Sandia’s Solid Dynamic Physics Department, is one of a few institutions in the world with a...

  7. Target design for shock ignition

    International Nuclear Information System (INIS)

    Schurtz, G; Ribeyre, X; Lafon, M

    2010-01-01

    The conventional approach of laser driven inertial fusion involves the implosion of cryogenic shells of deuterium-tritium ice. At sufficiently high implosion velocities, the fuel ignites by itself from a central hot spot. In order to reduce the risks of hydrodynamic instabilities inherent to large implosion velocities, it was proposed to compress the fuel at low velocity, and ignite the compressed fuel by means of a convergent shock wave driven by an intense spike at the end of the laser pulse. This scheme, known as shock ignition, reduces the risks of shell break-up during the acceleration phase, but it may be impeded by a low coupling efficiency of the laser pulse with plasma at high intensities. This work provides a relationship between the implosion velocity and the laser intensity required to ignite the target by a shock. The operating domain of shock ignition at different energies is described.

  8. Undercuts by Laser Shock Forming

    International Nuclear Information System (INIS)

    Wielage, Hanna; Vollertsen, Frank

    2011-01-01

    In laser shock forming TEA-CO 2 -laser induced shock waves are used to form metal foils, such as aluminum or copper. The process utilizes an initiated plasma shock wave on the target surface, which leads to a forming of the foil. A challenge in forming technologies is the manufacturing of undercuts. By conventional forming methods these special forms are not feasible. In this article, it is presented that undercuts in the micro range can be produced by laser shock deep drawing. Different drawing die diameters, drawing die depths and the material aluminum in the thicknesses 20 and 50 μm were investigated. It will be presented that smaller die diameters facilitate undercuts compared to bigger die diameters. The phenomena can be explained by Barlow's formula. Furthermore, it is shown which maximum undercut depth at different die diameters can be reached. To this end, cross-sections of the different parameter combinations are displayed.

  9. Relativistic shocks and particle acceleration

    International Nuclear Information System (INIS)

    Heavens, A.F.

    1988-01-01

    In this paper, we investigate the fluid dynamics of relativistic shock waves, and use the results to calculate the spectral index of particles accelerated by the Fermi process in such shocks. We have calculated the distributions of Fermi-accelerated particles at shocks propagating into cold proton-electron plasma and also cold electron-positron plasma. We have considered two different power spectra for the scattering waves, and find, in contrast to the non-relativistic case, that the spectral index of the accelerated particles depends on the wave power spectrum. On the assumption of thermal equilibrium both upstream and downstream, we present some useful fits for the compression ratio of shocks propagating at arbitrary speeds into gas of any temperature. (author)

  10. Analytic MHD Theory for Earth's Bow Shock at Low Mach Numbers

    Science.gov (United States)

    Grabbe, Crockett L.; Cairns, Iver H.

    1995-01-01

    A previous MHD theory for the density jump at the Earth's bow shock, which assumed the Alfven M(A) and sonic M(s) Mach numbers are both much greater than 1, is reanalyzed and generalized. It is shown that the MHD jump equation can be analytically solved much more directly using perturbation theory, with the ordering determined by M(A) and M(s), and that the first-order perturbation solution is identical to the solution found in the earlier theory. The second-order perturbation solution is calculated, whereas the earlier approach cannot be used to obtain it. The second-order terms generally are important over most of the range of M(A) and M(s) in the solar wind when the angle theta between the normal to the bow shock and magnetic field is not close to 0 deg or 180 deg (the solutions are symmetric about 90 deg). This new perturbation solution is generally accurate under most solar wind conditions at 1 AU, with the exception of low Mach numbers when theta is close to 90 deg. In this exceptional case the new solution does not improve on the first-order solutions obtained earlier, and the predicted density ratio can vary by 10-20% from the exact numerical MHD solutions. For theta approx. = 90 deg another perturbation solution is derived that predicts the density ratio much more accurately. This second solution is typically accurate for quasi-perpendicular conditions. Taken together, these two analytical solutions are generally accurate for the Earth's bow shock, except in the rare circumstance that M(A) is less than or = 2. MHD and gasdynamic simulations have produced empirical models in which the shock's standoff distance a(s) is linearly related to the density jump ratio X at the subsolar point. Using an empirical relationship between a(s) and X obtained from MHD simulations, a(s) values predicted using the MHD solutions for X are compared with the predictions of phenomenological models commonly used for modeling observational data, and with the predictions of a

  11. Adiabatic energy change of plasma electrons and the frame dependence of the cross-shock potential at collisionless magnetosonic shock waves

    International Nuclear Information System (INIS)

    Goodrich, C.C.; Scudder, J.D.

    1984-01-01

    In collisionless magnetosonic shock waves, ions are commonly thought to be decelerated by dc electrostatic cross-shock electric field along the shock normal n. In a frame where ions are normally incident to the shock the change in the potential energy [qphi/sup N/] in the quasi-perpendicular geommetry is of the order of the change of the energy of normal ion flow: [qphi/sup N/]roughly-equal[1/2m/sub i/(V/sub i//sup N/xn) 2 ], which is approximately 200-500 eV at the earth's bow shock. We show that the electron energy gain, typically 1/10 this number, is consistent with such a large potential jump in this geometry. Key facts are the different paths taken by electrons an ions through the shock wave and the frame dependence of the potential jump in the geometry. In the normal incidence frame, electrons lose energy by doing work against the solar wind motional electric field E/sub M//sup N/, which partially offsets the energy gain from the cross-shock electrostatic potential energy [ephi/sub asterisk//sup N/]. In the de Hoffman-Teller frame the motional electric field vanishes; the elctrons gain the full electrostatic potential energy jump e[phi/sub asterisk//sup H//sup T/] of that frame, which is not, however, equal to the electrostatic potential energy jump e[phi/sub asterisk//sup N/] of that frame, which is not, however, equal to the electrostatic potential energy jump e[phi/sub asterisk//sup N/] in the normal incidence frame

  12. Dominant acceleration processes of ambient energetic protons (E>= 50 keV) at the bow shock: conditions and limitations

    International Nuclear Information System (INIS)

    Anagnostopoulos, G.C.; Sarris, E.T.

    1983-01-01

    Energetic proton (Esub(p)>= 50 keV) and magnetic field observations during crossings of the Earth's Bow Shock by the IMP-7 and 8 spacecraft are incorporated in this work in order to examine the effect of the Bow Shock on a pre-existing proton population under different ''interplanetary magnetic field-Bow Shock'' configurations, as well as the conditions for the presence of the Bow Shock associated energetic proton intensity enhancements. The presented observations indicate that the dominant process for the efficient acceleration of ambient energetic particles to energies exceeding approximately 50 keV is by ''gradient-B'' drifting parallel to the induced electric field at quasi-perpendicular Bow Shocks under certain well defined limitations deriving from the finite and curved Bow Shock surface. It is shown that the proton acceleration at the Bow Shock is most efficient for high values of the upstream magnetic field (in general B 1 > 8#betta#), high upstream plasma speed and expanded Bow Shock fronts, as well as for direction of the induced electric field oriented almost parallel to the flanks of the Bow Shock, i.e. when the drift distance of protons parallel to the electric field at the shock front is considerably smaller than the local radius of curvature of the Bow Shock. The implications of the presented observations of Bow Shock crossings as to the source of the energetic proton intensity enhancements are discussed. (author)

  13. The Efficacy of Cognitive Shock

    Science.gov (United States)

    2015-05-21

    way, causing dissonance or cognitive conflict, so that the mental model has to be ‘accommodated’ to the new data. Categories and knowledge have to...The Efficacy of Cognitive Shock A Monograph by MAJ Anthony L. Marston United States Army School of Advanced Military Studies...DATES COVERED (From - To) JUN 2014 – MAY 2015 4. TITLE AND SUBTITLE The Efficacy of Cognitive Shock 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c

  14. Converging cylindrical magnetohydrodynamic shock collapse onto a power-law-varying line current

    KAUST Repository

    Mostert, W.

    2016-03-16

    We investigate the convergence behaviour of a cylindrical, fast magnetohydrodynamic (MHD) shock wave in a neutrally ionized gas collapsing onto an axial line current that generates a power law in time, azimuthal magnetic field. The analysis is done within the framework of a modified version of ideal MHD for an inviscid, non-dissipative, neutrally ionized compressible gas. The time variation of the magnetic field is tuned such that it approaches zero at the instant that the shock reaches the axis. This configuration is motivated by the desire to produce a finite magnetic field at finite shock radius but a singular gas pressure and temperature at the instant of shock impact. Our main focus is on the variation with shock radius, as, of the shock Mach number and pressure behind the shock as a function of the magnetic field power-law exponent, where gives a constant-in-time line current. The flow problem is first formulated using an extension of geometrical shock dynamics (GSD) into the time domain to take account of the time-varying conditions ahead of the converging shock, coupled with appropriate shock-jump conditions for a fast, symmetric MHD shock. This provides a pair of ordinary differential equations describing both and the time evolution on the shock, as a function of, constrained by a collapse condition required to achieve tuned shock convergence. Asymptotic, analytical results for and are obtained over a range of for general, and for both small and large . In addition, numerical solutions of the GSD equations are performed over a large range of, for selected parameters using . The accuracy of the GSD model is verified for some cases using direct numerical solution of the full, radially symmetric MHD equations using a shock-capturing method. For the GSD solutions, it is found that the physical character of the shock convergence to the axis is a strong function of . For μ≤0.816, and both approach unity at shock impact owing to the dominance of the strong

  15. Pressurized Thermal Shock, Pts

    International Nuclear Information System (INIS)

    Boyd, C.

    2008-01-01

    Pressurized Thermal Shock (Pts) refers to a condition that challenges the integrity of the reactor pressure vessel. The root cause of this problem is the radiation embrittlement of the reactor vessel. This embrittlement leads to an increase in the reference temperature for nil ductility transition (RTNDT). RTNDT can increase to the point where the reactor vessel material can loose fracture toughness during overcooling events. The analysis of the risk of having a Pts for a specific plant is a multi-disciplinary problem involving probabilistic risk analysis (PRA), thermal-hydraulic analysis, and ultimately a structural and fracture analysis of the vessel wall. The PRA effort involves the postulation of overcooling events and ultimately leads to an integrated risk analysis. The thermal-hydraulic effort involves the difficult task of predicting the system behavior during a postulated overcooling scenario with a special emphasis on predicting the thermal and mechanic loadings on the reactor pressure vessel wall. The structural and fracture analysis of the reactor vessel wall relies on the thermal-hydraulic conditions as boundary conditions. The US experience has indicated that medium and large diameter primary system breaks dominate the risk of Pts along with scenarios that involve a stuck open valve (and associated system cooldown) that recloses resulting in system re-pressurization while the vessel wall is cool.

  16. Sepsis and septic shock

    Science.gov (United States)

    Hotchkiss, Richard S.; Moldawer, Lyle L.; Opal, Steven M.; Reinhart, Konrad; Turnbull, Isaiah R.; Vincent, Jean-Louis

    2017-01-01

    For more than two decades, sepsis was defined as a microbial infection that produces fever (or hypothermia), tachycardia, tachypnoea and blood leukocyte changes. Sepsis is now increasingly being considered a dysregulated systemic inflammatory and immune response to microbial invasion that produces organ injury for which mortality rates are declining to 15–25%. Septic shock remains defined as sepsis with hyperlactataemia and concurrent hypotension requiring vasopressor therapy, with in-hospital mortality rates approaching 30–50%. With earlier recognition and more compliance to best practices, sepsis has become less of an immediate life-threatening disorder and more of a long-term chronic critical illness, often associated with prolonged inflammation, immune suppression, organ injury and lean tissue wasting. Furthermore, patients who survive sepsis have continuing risk of mortality after discharge, as well as long-term cognitive and functional deficits. Earlier recognition and improved implementation of best practices have reduced in-hospital mortality, but results from the use of immunomodulatory agents to date have been disappointing. Similarly, no biomarker can definitely diagnose sepsis or predict its clinical outcome. Because of its complexity, improvements in sepsis outcomes are likely to continue to be slow and incremental. PMID:28117397

  17. A New Method to Comprehensively Diagnose Shock Waves in the Solar Atmosphere Based on Simultaneous Spectroscopic and Imaging Observations

    Science.gov (United States)

    Ruan, Wenzhi; Yan, Limei; He, Jiansen; Zhang, Lei; Wang, Linghua; Wei, Yong

    2018-06-01

    Shock waves are believed to play an important role in plasma heating. The shock-like temporal jumps in radiation intensity and Doppler shift have been identified in the solar atmosphere. However, a quantitative diagnosis of the shocks in the solar atmosphere is still lacking, seriously hindering the understanding of shock dissipative heating of the solar atmosphere. Here, we propose a new method to realize the goal of the shock quantitative diagnosis, based on Rankine–Hugoniot equations and taking the advantages of simultaneous imaging and spectroscopic observations from, e.g., IRIS (Interface Region Imaging Spectrograph). Because of this method, the key parameters of shock candidates can be derived, such as the bulk velocity and temperature of the plasma in the upstream and downstream, the propagation speed and direction. The method is applied to the shock candidates observed by IRIS, and the overall characteristics of the shocks are revealed quantitatively for the first time. This method is also tested with the help of forward modeling, i.e., virtual observations of simulated shocks. The parameters obtained from the method are consistent with the parameters of the shock formed in the model and are independent of the viewing direction. Therefore, the method we proposed here is applicable to the quantitative and comprehensive diagnosis of the observed shocks in the solar atmosphere.

  18. Oxygen radicals in experimental shock: effects of spin-trapping nitrones in ameliorating shock pathophysiology (see comments)

    Energy Technology Data Exchange (ETDEWEB)

    Novelli, G.P. (Institute of Anesthesiology and Intensive Care, University of Florence, Careggi Hospital, (Italy))

    1992-04-01

    Circulatory shock is accepted as a consequence of an acute oxygen radical overgeneration. Spin-trapping nitrones inactivate free radicals by forming relatively stable adducts. Three spin-trapping nitrones (N-tert-phenyl-butyl-nitrone; alpha-4-pyridyl-oxide-N-tert-butyl-nitrone; 5-5,dimethyl,1,pyrroline-N-oxide) were tested regarding their role in the pathophysiology and evolution of circulatory shock in rats. A prospective, randomized, controlled trial of spin-trapping nitrones in rats experiencing three different models of circulatory shock was designed. In the first group, endotoxic, traumatic, and mesenteric artery occlusion shock (all 100% lethal in control experiments) was prevented by the ip administration of N-tert-phenyl-butyl-nitrone (150 mg/kg); alpha-4-pyridyl-oxide-N-tert-butyl-nitrone (100 mg/kg); or 5-5,dimethyl,1,pyrroline-N-oxide (100 mg/kg). However, the evolution of shock was unaffected by the same compounds when all three nitrones had been previously inactivated by exposure to light and air. In the second group, microcirculatory derangements that were provoked by endotoxin and were observed in the mesocecum of rats were completely prevented by pretreatment with either peritoneal administration of each of the three nitrones or by their topical application to the microscopic field. While the rats survived after systemic treatment, those rats receiving topical nitrones died from endotoxic shock. In the third group, cell-membrane stiffness (a sign of peroxidative damage) was measured by spin-probes and electron-spin resonance in mitochondrial and microsomal membranes. Cell membranes obtained from shocked rats were more rigid than those membranes of controls. However, the membranes obtained from rats that were submitted to trauma or endotoxin after pretreatment with N-tert-phenyl-butyl-nitrone had normal stiffness.

  19. Augmentation of DAA Staggered – Solution Equations in Underwater Shock Problems for Singular Structural Mass Matrices

    Directory of Open Access Journals (Sweden)

    John A. DeRuntz Jr.

    2005-01-01

    Full Text Available The numerical solution of underwater shock fluid – structure interaction problems using boundary element/finite element techniques became tractable through the development of the family of Doubly Asymptotic Approximations (DAA. Practical implementation of the method has relied on the so-called augmentation of the DAA equations. The fluid and structural systems are respectively coupled by the structural acceleration vector in the surface normal direction on the right hand side of the DAA equations, and the total pressure applied to the structural equations on its right hand side. By formally solving for the acceleration vector from the structural system and substituting it into its place in the DAA equations, the augmentation introduces a term involving the inverse of the structural mass matrix. However there exist at least two important classes of problems in which the structural mass matrix is singular. This paper develops a method to carry out the augmentation for such problems using a generalized inverse technique.

  20. Normalization: A Preprocessing Stage

    OpenAIRE

    Patro, S. Gopal Krishna; Sahu, Kishore Kumar

    2015-01-01

    As we know that the normalization is a pre-processing stage of any type problem statement. Especially normalization takes important role in the field of soft computing, cloud computing etc. for manipulation of data like scale down or scale up the range of data before it becomes used for further stage. There are so many normalization techniques are there namely Min-Max normalization, Z-score normalization and Decimal scaling normalization. So by referring these normalization techniques we are ...

  1. Focusing of Shear Shock Waves

    Science.gov (United States)

    Giammarinaro, Bruno; Espíndola, David; Coulouvrat, François; Pinton, Gianmarco

    2018-01-01

    Focusing is a ubiquitous way to transform waves. Recently, a new type of shock wave has been observed experimentally with high-frame-rate ultrasound: shear shock waves in soft solids. These strongly nonlinear waves are characterized by a high Mach number, because the shear wave velocity is much slower, by 3 orders of magnitude, than the longitudinal wave velocity. Furthermore, these waves have a unique cubic nonlinearity which generates only odd harmonics. Unlike longitudinal waves for which only compressional shocks are possible, shear waves exhibit cubic nonlinearities which can generate positive and negative shocks. Here we present the experimental observation of shear shock wave focusing, generated by the vertical motion of a solid cylinder section embedded in a soft gelatin-graphite phantom to induce linearly vertically polarized motion. Raw ultrasound data from high-frame-rate (7692 images per second) acquisitions in combination with algorithms that are tuned to detect small displacements (approximately 1 μ m ) are used to generate quantitative movies of gel motion. The features of shear shock wave focusing are analyzed by comparing experimental observations with numerical simulations of a retarded-time elastodynamic equation with cubic nonlinearities and empirical attenuation laws for soft solids.

  2. Shock compression of synthetic opal

    International Nuclear Information System (INIS)

    Inoue, A; Okuno, M; Okudera, H; Mashimo, T; Omurzak, E; Katayama, S; Koyano, M

    2010-01-01

    Structural change of synthetic opal by shock-wave compression up to 38.1 GPa has been investigated by using SEM, X-ray diffraction method (XRD), Infrared (IR) and Raman spectroscopies. Obtained information may indicate that the dehydration and polymerization of surface silanole due to high shock and residual temperature are very important factors in the structural evolution of synthetic opal by shock compression. Synthetic opal loses opalescence by 10.9 and 18.4 GPa of shock pressures. At 18.4 GPa, dehydration and polymerization of surface silanole and transformation of network structure may occur simultaneously. The 4-membered ring of TO 4 tetrahedrons in as synthetic opal may be relaxed to larger ring such as 6-membered ring by high residual temperature. Therefore, the residual temperature may be significantly high at even 18.4 GPa of shock compression. At 23.9 GPa, opal sample recovered the opalescence. Origin of this opalescence may be its layer structure by shock compression. Finally, sample fuse by very high residual temperature at 38.1 GPa and the structure closes to that of fused SiO 2 glass. However, internal silanole groups still remain even at 38.1 GPa.

  3. Computations of slowly moving shocks

    International Nuclear Information System (INIS)

    Karni, S.; Canic, S.

    1997-01-01

    Computations of slowly moving shocks by shock capturing schemes may generate oscillations are generated already by first-order schemes, but become more pronounced in higher-order schemes which seem to exhibit different behaviors: (i) the first-order upwind (UW) scheme which generates strong oscillations and (ii) the Lax-Friedrichs scheme which appears not to generate any disturbances at all. A key observation is that in the UW case, the numerical viscosity in the shock family vanishes inside the slow shock layer. Simple scaling arguments show the third-order effects on the solution may no longer be neglected. We derive the third-order modified equation for the UW scheme and regard the oscillatory solution as a traveling wave solution of the parabolic modified equation for the perturbation. We then look at the governing equation for the perturbation, which points to a plausible mechanism by which postshock oscillations are generated. It contains a third-order source term that becomes significant inside the shock layer, and a nonlinear coupling term which projects the perturbation on all characteristic fields, including those not associated with the shock family. 5 refs., 8 figs

  4. Shock compression of synthetic opal

    Science.gov (United States)

    Inoue, A.; Okuno, M.; Okudera, H.; Mashimo, T.; Omurzak, E.; Katayama, S.; Koyano, M.

    2010-03-01

    Structural change of synthetic opal by shock-wave compression up to 38.1 GPa has been investigated by using SEM, X-ray diffraction method (XRD), Infrared (IR) and Raman spectroscopies. Obtained information may indicate that the dehydration and polymerization of surface silanole due to high shock and residual temperature are very important factors in the structural evolution of synthetic opal by shock compression. Synthetic opal loses opalescence by 10.9 and 18.4 GPa of shock pressures. At 18.4 GPa, dehydration and polymerization of surface silanole and transformation of network structure may occur simultaneously. The 4-membered ring of TO4 tetrahedrons in as synthetic opal may be relaxed to larger ring such as 6-membered ring by high residual temperature. Therefore, the residual temperature may be significantly high at even 18.4 GPa of shock compression. At 23.9 GPa, opal sample recovered the opalescence. Origin of this opalescence may be its layer structure by shock compression. Finally, sample fuse by very high residual temperature at 38.1 GPa and the structure closes to that of fused SiO2 glass. However, internal silanole groups still remain even at 38.1 GPa.

  5. Shock compression of synthetic opal

    Energy Technology Data Exchange (ETDEWEB)

    Inoue, A; Okuno, M; Okudera, H [Department of Earth Sciences, Kanazawa University Kanazawa, Ishikawa, 920-1192 (Japan); Mashimo, T; Omurzak, E [Shock Wave and Condensed Matter Research Center, Kumamoto University, Kumamoto, 860-8555 (Japan); Katayama, S; Koyano, M, E-mail: okuno@kenroku.kanazawa-u.ac.j [JAIST, Nomi, Ishikawa, 923-1297 (Japan)

    2010-03-01

    Structural change of synthetic opal by shock-wave compression up to 38.1 GPa has been investigated by using SEM, X-ray diffraction method (XRD), Infrared (IR) and Raman spectroscopies. Obtained information may indicate that the dehydration and polymerization of surface silanole due to high shock and residual temperature are very important factors in the structural evolution of synthetic opal by shock compression. Synthetic opal loses opalescence by 10.9 and 18.4 GPa of shock pressures. At 18.4 GPa, dehydration and polymerization of surface silanole and transformation of network structure may occur simultaneously. The 4-membered ring of TO{sub 4} tetrahedrons in as synthetic opal may be relaxed to larger ring such as 6-membered ring by high residual temperature. Therefore, the residual temperature may be significantly high at even 18.4 GPa of shock compression. At 23.9 GPa, opal sample recovered the opalescence. Origin of this opalescence may be its layer structure by shock compression. Finally, sample fuse by very high residual temperature at 38.1 GPa and the structure closes to that of fused SiO{sub 2} glass. However, internal silanole groups still remain even at 38.1 GPa.

  6. Electromagnetically driven radiative shocks and their measurements

    International Nuclear Information System (INIS)

    Kondo, K.; Watanabe, M.; Nakajima, M.; Kawamura, T.; Horioka, K.

    2005-01-01

    Experimental results on a generation of strong shocks in a compact pulse power device are reported. The characteristics of strong shocks are different from hydrodynamical shocks' because they depend on not only collisions but radiation processes. Radiative shocks are relevant to high energy density phenomena such as the explosions of supernovae. When initial pressure is lower than about 50 mtorr, an interesting structure is confirmed at the shock front, which might indicate a phenomenon proceeded by the radiative process. (author)

  7. Normalized cDNA libraries

    Science.gov (United States)

    Soares, Marcelo B.; Efstratiadis, Argiris

    1997-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

  8. Steady flow on to a conveyor belt - Causal viscosity and shear shocks

    Science.gov (United States)

    Syer, D.; Narayan, Ramesh

    1993-01-01

    Some hydrodynamical consequences of the adoption of a causal theory of viscosity are explored. Causality is introduced into the theory by letting the coefficient of viscosity go to zero as the flow velocity approaches a designated propagation speed for viscous signals. Consideration is given to a model of viscosity which has a finite propagation speed of shear information, and it is shown that it produces two kinds of shear shock. A 'pure shear shock' corresponds to a transition from a superviscous to a subviscous state with no discontinuity in the velocity. A 'mixed shear shock' has a shear transition occurring at the same location as a normal adiabatic or radiative shock. A generalized version of the Rankine-Hugoniot conditions for mixed shear shocks is derived, and self-consistent numerical solutions to a model 2D problem in which an axisymmetric radially infalling stream encounters a spinning star are presented.

  9. Modeling of ion acceleration through drift and diffusion at interplanetary shocks

    Science.gov (United States)

    Decker, R. B.; Vlahos, L.

    1986-01-01

    A test particle simulation designed to model ion acceleration through drift and diffusion at interplanetary shocks is described. The technique consists of integrating along exact particle orbits in a system where the angle between the shock normal and mean upstream magnetic field, the level of magnetic fluctuations, and the energy of injected particles can assume a range of values. The technique makes it possible to study time-dependent shock acceleration under conditions not amenable to analytical techniques. To illustrate the capability of the numerical model, proton acceleration was considered under conditions appropriate for interplanetary shocks at 1 AU, including large-amplitude transverse magnetic fluctuations derived from power spectra of both ambient and shock-associated MHD waves.

  10. High-energy air shock study in steel and grout pipes

    International Nuclear Information System (INIS)

    Glenn, H.D.; Kratz, H.R.; Keough, D.D.; Duganne, D.A.; Ruffner, D.J.; Swift, R.P.; Baum, D.

    1979-01-01

    Voitenko compressors are used to generate 43 mm/μs air shocks in both a steel and a grout outlet pipe containing ambient atmospheric air. Fiber-optic ports provide diaphragm burst times, time-of-arrival (TOA) data, and velocities for the shock front along the 20-mm-ID exit pipes. Pressure profiles are obtained at higher enthalpy shock propagation than ever before and at many locations along the exit pipes. Numerous other electronic sensors and postshot observations are described, as well as experimental results. The primary objectives of the experiments are as follows: (1) provide a data base for normalization/improvement of existing finite-difference codes that describe high-energy air shocks and gas propagation; (2) obtain quantitative results on the relative attenuation effects of two very different wall materials for high-energy air shocks and gas flows. The extensive experimental results satisfy both objectives

  11. Shock-jump conditions in a general medium: weak-solution approach

    Science.gov (United States)

    Forbes, L. K.; Krzysik, O. A.

    2017-05-01

    General conservation laws are considered, and the concept of a weak solution is extended to the case of an equation involving three space variables and time. Four-dimensional vector calculus is used to develop general jump conditions at a shock wave in the material. To illustrate the use of this result, jump conditions at a shock in unsteady three-dimensional compressible gas flow are presented. It is then proved rigorously that these reduce to the commonly assumed conditions in coordinates normal and tangential to the shock face. A similar calculation is also outlined for an unsteady three-dimensional shock in magnetohydrodynamics, and in a chemically reactive fluid. The technique is available for determining shock-jump conditions in quite general continuous media.

  12. Pressurized thermal shock (PTS)

    International Nuclear Information System (INIS)

    Rosso, Ricardo D.; Ventura, Mirta A.

    2006-01-01

    In the present work, a description of Thermal Shock in Pressurized conditions (PTS), and its influence in the treatment of the integrity of the pressure vessel (RPV) of a Pressurized Water Reactor (PWR) and/or of a Heavy water Pressurized water Reactor (PHWR) is made. Generally, the analysis of PTS involves a process of three stages: a-) Modeling with a System Code of relevant thermohydraulics transients in reference with the thermal shock; b-) The local distribution of temperatures in the downcomer and the heat transference coefficients from the RPV wall to the fluid, are determined; c-) The fracture mechanical analysis. These three stages are included in this work: Results with the thermohydraulics code Relap5/mod.3, are obtained, for a LOCA scenario in the hot leg of the cooling System of the Primary System of the CAN-I reactor. The method used in obtaining results is described. A study on the basis of lumped parameters of the local evolutions of the temperature of the flow is made, in the downcomer of the reactor pressure vessel. The purpose of this study is to determine how the intensification of the stress coefficient, varies in function of the emergency injected water during the thermohydraulic transients that take place under the imposed conditions in the postulated scene. Specially, it is considered a 50 cm 2 break, located in the neighborhoods of the pressurized with the corresponding hot leg connection. This size is considered like the most critical. The method used to obtain the results is described. The fracture mechanical analysis is made. From the obtained results we confirmed that we have a simple tool of easy application in order to analyze phenomena of the type PTS in the postulated scenes by break in the cold and hot legs of the primary system. This methodology of calculus is completely independent of the used ones by the Nucleoelectrica Argentina S.A. (NASA) in the analysis of the PTS phenomena in the CAN-I. The results obtained with the adopted

  13. DSMC simulations of shock interactions about sharp double cones

    Science.gov (United States)

    Moss, James N.

    2001-08-01

    This paper presents the results of a numerical study of shock interactions resulting from Mach 10 flow about sharp double cones. Computations are made by using the direct simulation Monte Carlo (DSMC) method of Bird. The sensitivity and characteristics of the interactions are examined by varying flow conditions, model size, and configuration. The range of conditions investigated includes those for which experiments have been or will be performed in the ONERA R5Ch low-density wind tunnel and the Calspan-University of Buffalo Research Center (CUBRC) Large Energy National Shock (LENS) tunnel.

  14. The importance of microjet vs shock wave formation in sonophoresis.

    Science.gov (United States)

    Wolloch, Lior; Kost, Joseph

    2010-12-01

    Low-frequency ultrasound application has been shown to greatly enhance transdermal drug delivery. Skin exposed to ultrasound is affected in a heterogeneous manner, thus mass transport through the stratum corneum occurs mainly through highly permeable localized transport regions (LTRs). Shock waves and microjets generated during inertial cavitations are responsible for the transdermal permeability enhancement. In this study, we evaluated the effect of these two phenomena using direct and indirect methods, and demonstrated that the contribution of microjets to skin permeability enhancement is significantly higher than shock waves. Copyright © 2010. Published by Elsevier B.V.

  15. Shock behaviour of 3D carbon-carbon composite

    International Nuclear Information System (INIS)

    Hereil, P.-L.; Allix, O.; Gratton, M.

    1997-01-01

    The compressive response of a 3D carbon-carbon composite under shock wave was studied in a plate-impact configuration. Two directions of impact were achieved until a nominal value of longitudinal stress of 2.5 GPa. The measured wave profiles are consistent with previous results on 3D composites and confirm the behaviour of such materials under impact. It is shown that the initial loading is decomposed in two waves. The first one is transmitted by the longitudinal fibres, the second one corresponds to the propagation of a shock wave in the 'matrix'. Macroscopic characteristics of this material are provided. (orig.)

  16. Shock ignition of high gain inertial fusion capsules

    International Nuclear Information System (INIS)

    Schurtz, G.; Ribeyre, X.; Lebel, E.; Casner, A.

    2010-01-01

    Complete text of publication follows. Inertial Confinement Fusion relies on the compression of small amounts of an equimolar mix of Deuterium and Tritium (DT) up to volumic masses of several hundreds of g/cm 3 . Such high densities are obtained by means of the implosion of a spherical shell made of cryogenic DT fuel. In the conventional scheme a hot spot is formed in the central part of the pellet at the end of the implosion. If the pressure of this hot spot is large enough (several hundreds of Gbars), thermonuclear heating occurs with a characteristic time shorter than the hydrodynamic confinement time and the target self ignites. Since the central hot spot pressure results from the conversion of the shell kinetic energy into thermal energy, the threshold for the ignition of a given mass of DT is a direct function of the implosion velocity. Typical implosion velocities for central self ignition are of the order of 400 km/s. Such high velocities imply both a strong acceleration of the shell and the use of large aspect ration shells in order to optimize the hydrodynamic efficiency of the implosion, at least in direct drive. These two features strongly enhance the risk of shell beak up at time of acceleration under the Rayleigh-Taylor instability. Furthermore the formation of the hot spot may itself the unstable, this reducing its effective mass. High compression may be achieved at much lower velocities, thus reducing the energy budget and enhancing the implosion safety, but the corresponding fuel assembly requires an additional heating in order to reach ignition. This heating may be obtained from a 70-100 kJ laser pulse, delivered in 10-15 ps (Fast Ignition). An alternative idea is to boost up the central pressure of a target imploded at a sub-ignition velocity by means of a convergent strong shock launched at the end of the compression phase. This Shock Ignition (SI) concept has been suggested in 1983 by Scherbakov et al. More recently, R. Betti et al. developed

  17. Feedforward somatosensory inhibition is normal in cervical dystonia.

    Science.gov (United States)

    Ferrè, Elisa R; Ganos, Christos; Bhatia, Kailash P; Haggard, Patrick

    2015-03-01

    Insufficient cortical inhibition is a key pathophysiological finding in dystonia. Subliminal sensory stimuli were reported to transiently inhibit somatosensory processing. Here we investigated whether such subliminal feedforward inhibition is reduced in patients with cervical dystonia. Sixteen cervical dystonia patients and 16 matched healthy controls performed a somatosensory detection task. We measured the drop in sensitivity to detect a threshold-level digital nerve shock when it was preceded by a subliminal conditioning shock, compared to when it was not. Subliminal conditioning shocks reduced sensitivity to threshold stimuli to a similar extent in both patients and controls, suggesting that somatosensory subliminal feedforward inhibition is normal in cervical dystonia. Somatosensory feedforward inhibition was normal in this group of cervical dystonia patients. Our results qualify previous concepts of a general dystonic deficit in sensorimotor inhibitory processing. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. The "Visual Shock" of Francis Bacon: an essay in neuroesthetics.

    Science.gov (United States)

    Zeki, Semir; Ishizu, Tomohiro

    2013-01-01

    In this paper we discuss the work of Francis Bacon in the context of his declared aim of giving a "visual shock."We explore what this means in terms of brain activity and what insights into the brain's visual perceptive system his work gives. We do so especially with reference to the representation of faces and bodies in the human visual brain. We discuss the evidence that shows that both these categories of stimuli have a very privileged status in visual perception, compared to the perception of other stimuli, including man-made artifacts such as houses, chairs, and cars. We show that viewing stimuli that depart significantly from a normal representation of faces and bodies entails a significant difference in the pattern of brain activation. We argue that Bacon succeeded in delivering his "visual shock" because he subverted the normal neural representation of faces and bodies, without at the same time subverting the representation of man-made artifacts.

  19. 3j Symbols: To Normalize or Not to Normalize?

    Science.gov (United States)

    van Veenendaal, Michel

    2011-01-01

    The systematic use of alternative normalization constants for 3j symbols can lead to a more natural expression of quantities, such as vector products and spherical tensor operators. The redefined coupling constants directly equate tensor products to the inner and outer products without any additional square roots. The approach is extended to…

  20. Heat shock-induced interactions among nuclear HSFs detected by fluorescence cross-correlation spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Pack, Chan-Gi, E-mail: changipack@amc.seoul.kr [Asan Institute for Life Sciences, University of Ulsan, College of Medicine, Asan Medical Center, Seoul 138-736 (Korea, Republic of); Ahn, Sang-Gun [Dept. of Pathology, College of Dentistry, Chosun University, Seosuk-dong, Dong-gu, Gwangju 501-759 (Korea, Republic of)

    2015-07-31

    The cellular response to stress is primarily controlled in cells via transcriptional activation by heat shock factor 1 (HSF1). HSF1 is well-known to form homotrimers for activation upon heat shock and subsequently bind to target DNAs, such as heat-shock elements, by forming stress granules. A previous study demonstrated that nuclear HSF1 and HSF2 molecules in live cells interacted with target DNAs on the stress granules. However, the process underlying the binding interactions of HSF family in cells upon heat shock remains unclear. This study demonstrate for the first time that the interaction kinetics among nuclear HSF1, HSF2, and HSF4 upon heat shock can be detected directly in live cells using dual color fluorescence cross-correlation spectroscopy (FCCS). FCCS analyses indicated that the binding between HSFs was dramatically changed by heat shock. Interestingly, the recovery kinetics of interaction between HSF1 molecules after heat shock could be represented by changes in the relative interaction amplitude and mobility. - Highlights: • The binding interactions among nuclear HSFs were successfully detected. • The binding kinetics between HSF1s during recovery was quantified. • HSF2 and HSF4 strongly formed hetero-complex, even before heat shock. • Nuclear HSF2 and HSF4 bound to HSF1 only after heat shock.

  1. Radiation- and pair-loaded shocks

    Science.gov (United States)

    Lyutikov, Maxim

    2018-06-01

    We consider the structure of mildly relativistic shocks in dense media, taking into account the radiation and pair loading, and diffusive radiation energy transfer within the flow. For increasing shock velocity (increasing post-shock temperature), the first important effect is the efficient energy redistribution by radiation within the shock that leads to the appearance of an isothermal jump, whereby the flow reaches the final state through a discontinuous isothermal transition. The isothermal jump, on scales much smaller than the photon diffusion length, consists of a weak shock and a quick relaxation to the isothermal conditions. Highly radiation-dominated shocks do not form isothermal jump. Pair production can mildly increase the overall shock compression ratio to ≈10 (4 for matter-dominated shocks and 7 of the radiation-dominated shocks).

  2. Shock Ignition of Thermonuclear Fuel with High Areal Density

    International Nuclear Information System (INIS)

    Betti, R.; Zhou, C. D.; Anderson, K. S.; Theobald, W.; Solodov, A. A.; Perkins, L. J.

    2007-01-01

    A novel method by C. Zhou and R. Betti [Bull. Am. Phys. Soc. 50, 140 (2005)] to assemble and ignite thermonuclear fuel is presented. Massive cryogenic shells are first imploded by direct laser light with a low implosion velocity and on a low adiabat leading to fuel assemblies with large areal densities. The assembled fuel is ignited from a central hot spot heated by the collision of a spherically convergent ignitor shock and the return shock. The resulting fuel assembly features a hot-spot pressure greater than the surrounding dense fuel pressure. Such a nonisobaric assembly requires a lower energy threshold for ignition than the conventional isobaric one. The ignitor shock can be launched by a spike in the laser power or by particle beams. The thermonuclear gain can be significantly larger than in conventional isobaric ignition for equal driver energy

  3. Shock ignition of thermonuclear fuel with high areal density.

    Science.gov (United States)

    Betti, R; Zhou, C D; Anderson, K S; Perkins, L J; Theobald, W; Solodov, A A

    2007-04-13

    A novel method by C. Zhou and R. Betti [Bull. Am. Phys. Soc. 50, 140 (2005)] to assemble and ignite thermonuclear fuel is presented. Massive cryogenic shells are first imploded by direct laser light with a low implosion velocity and on a low adiabat leading to fuel assemblies with large areal densities. The assembled fuel is ignited from a central hot spot heated by the collision of a spherically convergent ignitor shock and the return shock. The resulting fuel assembly features a hot-spot pressure greater than the surrounding dense fuel pressure. Such a nonisobaric assembly requires a lower energy threshold for ignition than the conventional isobaric one. The ignitor shock can be launched by a spike in the laser power or by particle beams. The thermonuclear gain can be significantly larger than in conventional isobaric ignition for equal driver energy.

  4. Cardioprotective effects of 70-kDa heat shock protein in transgenic mice.

    Science.gov (United States)

    Radford, N B; Fina, M; Benjamin, I J; Moreadith, R W; Graves, K H; Zhao, P; Gavva, S; Wiethoff, A; Sherry, A D; Malloy, C R; Williams, R S

    1996-03-19

    Heat shock proteins are proposed to limit injury resulting from diverse environmental stresses, but direct metabolic evidence for such a cytoprotective function in vertebrates has been largely limited to studies of cultured cells. We generated lines of transgenic mice to express human 70-kDa heat shock protein constitutively in the myocardium. Hearts isolated from these animals demonstrated enhanced recovery of high energy phosphate stores and correction of metabolic acidosis following brief periods of global ischemia sufficient to induce sustained abnormalities of these variables in hearts from nontransgenic littermates. These data demonstrate a direct cardioprotective effect of 70-kDa heat shock protein to enhance postischemic recovery of the intact heart.

  5. Prediction of massive bleeding. Shock index and modified shock index.

    Science.gov (United States)

    Terceros-Almanza, L J; García-Fuentes, C; Bermejo-Aznárez, S; Prieto-Del Portillo, I J; Mudarra-Reche, C; Sáez-de la Fuente, I; Chico-Fernández, M

    2017-12-01

    To determine the predictive value of the Shock Index and Modified Shock Index in patients with massive bleeding due to severe trauma. Retrospective cohort. Severe trauma patient's initial attention at the intensive care unit of a tertiary hospital. Patients older than 14 years that were admitted to the hospital with severe trauma (Injury Severity Score >15) form January 2014 to December 2015. We studied the sensitivity (Se), specificity (Sp), positive and negative predictive value (PV+ and PV-), positive and negative likelihood ratio (LR+ and LR-), ROC curves (Receiver Operating Characteristics) and the area under the same (AUROC) for prediction of massive hemorrhage. 287 patients were included, 76.31% (219) were male, mean age was 43,36 (±17.71) years and ISS was 26 (interquartile range [IQR]: 21-34). The overall frequency of massive bleeding was 8.71% (25). For Shock Index: AUROC was 0.89 (95% confidence intervals [CI] 0.84 to 0.94), with an optimal cutoff at 1.11, Se was 91.3% (95% CI: 73.2 to 97.58) and Sp was 79.69% (95% CI: 74.34 to 84.16). For the Modified Shock Index: AUROC was 0.90 (95% CI: 0.86 to 0.95), with an optimal cutoff at 1.46, Se was 95.65% (95% CI: 79.01 to 99.23) and Sp was 75.78% (95% CI: 70.18 to 80.62). Shock Index and Modified Shock Index are good predictors of massive bleeding and could be easily incorporated to the initial workup of patients with severe trauma. Copyright © 2017 Elsevier España, S.L.U. y SEMICYUC. All rights reserved.

  6. Magnetic field fluctuations across the Earth's bow shock

    Energy Technology Data Exchange (ETDEWEB)

    Czaykowska, A.; Bauer, T.M. [Max-Planck-Institut fuer Extraterrestrische Physik, Garching (Germany); Treumann, R.A. [Max-Planck-Institut fuer Extraterrestrische Physik, Garching (Germany); Centre for Interdisciplinary Plasma Science, Garching (Germany); International Space Science Inst. (ISSI), Bern (Switzerland); Baumjohann, W. [Max-Planck-Institut fuer Extraterrestrische Physik, Garching (Germany); Inst. fuer Weltraumforschung der Oesterreichischen Akademie der Wissenschaften, Graz (Austria)

    2001-03-01

    We present a statistical analysis of 132 dayside (LT 0700-1700) bow shock crossings of the AMPTE/IRM spacecraft. We perform a superposed epoch analysis of low frequency, magnetic power spectra some minutes upstream and downstream of the bow shock. The events are devided into categories depending on the angle {theta}{sub Bn} between bow shock normal and interplanetary magnetic field, and on plasma-{beta}. In the foreshock upstream of the quasi-parallel bow shock, the power of the magnetic fluctuations is roughly 1 order of magnitude larger ({delta}B {proportional_to} 4 nT for frequencies 0.01-0.04 Hz) than upstream of the quasi-perpendicular shock. There is no significant difference in the magnetic power spectra upstream and downstream of the quasi-parallel bow shock; only at the shock itself, is the magnetic power enhanced by a factor of 4. This enhancement may be due to either an amplification of convecting upstream waves or to wave generation at the shock interface. On the contrary, downstream of the quasi-perpendicular shock, the magnetic wave activity is considerably higher than upstream. Downstream of the quasi-perpendicular low-{beta} bow shock, we find a dominance of the left-hand polarized component at frequencies just below the ion-cyclotron frequency, with amplitudes of about 3 nT. These waves are identified as ion-cyclotron waves, which grow in a low-{beta} regime due to the proton temperature anisotropy. We find a strong correlation of this anisotropy with the intensity of the left-hand polarized component. Downstream of some nearly perpendicular ({theta}{sub Bn} {approx} 90 ) high-{beta} crossings, mirror waves are identified. However, there are also cases where the conditions for mirror modes are met downstream of the nearly perpendicular shock, but no mirror waves are observed. (orig.)

  7. Investigation of Heat Transfer to a Flat Plate in a Shock Tube.

    Science.gov (United States)

    1987-12-01

    2 Objectives and Scope . . . . . .. .. .. .... 5 11. Theory ............... ....... 7 Shock Tube Principles........... 7 Boundary Layer Theory ...in *excess of theory , but the rounded edge flat plate exhibited data which matched or was less than what theory predicted for each Mach number tested...normal shock advancing along an infinite flat plate. For x< Ugt there is a region of interaction between the downstream influence of the leading edge

  8. Shock Tube/Laser Absorption Studies of Jet Fuels at Low Temperatures (600-1200K)

    Science.gov (United States)

    2013-08-27

    Davidson, Ronald K. Hanson. A second-generation aerosol shock tube and its use in studying ignition delay times of large biodiesel surrogates, 28th... Biodiesel Surrogate behind Reflected Shock Waves,” 8th US National Combustion Meeting, Paper 070RK-0008 Park City, UT 5/2013.   These  studies provide...www.elsevier .com/locate / fuel 1. Introduction Normal alkanes have been widely used as fuels and are major components of many commercial transportation fuels

  9. Shock diffraction in alumina powder

    International Nuclear Information System (INIS)

    Venz, G.; Killen, P.D.; Page, N.W.

    1996-01-01

    In order to produce complex shaped components by dynamic compaction of ceramic powders detailed knowledge of their response under shock loading conditions is required. This work attempts to provide data on release effects and shock attenuation in 1 μm and 5 μm α-alumina powders which were compacted to between 85 % and 95 % of the solid phase density by the impact of high velocity steel projectiles. As in previous work, the powder was loaded into large cylindrical dies with horizontal marker layers of a contrasting coloured powder to provide a record of powder displacement in the recovered specimens. After recovery and infiltration with a thermosetting resin the specimens were sectioned and polished to reveal the structure formed by the passage of the projectile and shock wave. Results indicate that the shock pressures generated were of the order of 0.5 to 1.4 GPa and higher, with shock velocities and sound speeds in the ranges 650 to 800 m/s and 350 to 400 m/s respectively

  10. Transient shocks beyond the heliopause

    International Nuclear Information System (INIS)

    Fermo, R L; Pogorelov, N V; Burlaga, L F

    2015-01-01

    The heliopause is a rich, dynamic surface affected by the time-dependent solar wind. Stream interactions due to coronal mass ejections (CMEs), corotating interaction regions (CIRs), and other transient phenomena are known to merge producing global merged interaction regions (GMIRs). Numerical simulations of the solar wind interaction with the local interstellar medium (LISM) show that GMIRs, as well other time-dependent structures in the solar wind, may produce compression/rarefaction waves and shocks in the LISM behind the heliopause. These shocks may initiate wave activity observed by the Voyager spacecraft. The magnetometer onboard Voyager 1 indeed observed a few structures that may be interpreted as shocks. We present numerical simulations of such shocks in the year of 2000, when both Voyager spacecraft were in the supersonic solar wind region, and in 2012, when Voyager 1 observed traveling shocks. In the former case, Voyager observations themselves provide time- dependent boundary conditions in the solar wind. In the latter case, we use OMNI data at 1 AU to analyze the plasma and magnetic field behavior after Voyager 1 crossed the heliospheric boundary. Numerical results are compared with spacecraft observations. (paper)

  11. An improved method to experimentally determine temperature and pressure behind laser-induced shock waves at low Mach numbers

    International Nuclear Information System (INIS)

    Hendijanifard, Mohammad; Willis, David A

    2011-01-01

    Laser-matter interactions are frequently studied by measuring the propagation of shock waves caused by the rapid laser-induced material removal. An improved method for calculating the thermo-fluid parameters behind shock waves is introduced in this work. Shock waves in ambient air, induced by pulsed Nd : YAG laser ablation of aluminium films, are measured using a shadowgraph apparatus. Normal shock solutions are applied to experimental data for shock wave positions and used to calculate pressure, temperature, and velocity behind the shock wave. Non-dimensionalizing the pressure and temperature with respect to the ambient values, the dimensionless pressure and temperature are estimated to be as high as 90 and 16, respectively, at a time of 10 ns after the ablation pulse for a laser fluence of F = 14.5 J cm -2 . The results of the normal shock solution and the Taylor-Sedov similarity solution are compared to show that the Taylor-Sedov solution under-predicts pressure when the Mach number of the shock wave is small. At a fluence of 3.1 J cm -2 , the shock wave Mach number is less than 3, and the Taylor-Sedov solution under-predicts the non-dimensional pressure by as much as 45%.

  12. Kinetic structures of quasi-perpendicular shocks in global particle-in-cell simulations

    International Nuclear Information System (INIS)

    Peng, Ivy Bo; Markidis, Stefano; Laure, Erwin; Johlander, Andreas; Vaivads, Andris; Khotyaintsev, Yuri; Henri, Pierre; Lapenta, Giovanni

    2015-01-01

    We carried out global Particle-in-Cell simulations of the interaction between the solar wind and a magnetosphere to study the kinetic collisionless physics in super-critical quasi-perpendicular shocks. After an initial simulation transient, a collisionless bow shock forms as a result of the interaction of the solar wind and a planet magnetic dipole. The shock ramp has a thickness of approximately one ion skin depth and is followed by a trailing wave train in the shock downstream. At the downstream edge of the bow shock, whistler waves propagate along the magnetic field lines and the presence of electron cyclotron waves has been identified. A small part of the solar wind ion population is specularly reflected by the shock while a larger part is deflected and heated by the shock. Solar wind ions and electrons are heated in the perpendicular directions. Ions are accelerated in the perpendicular direction in the trailing wave train region. This work is an initial effort to study the electron and ion kinetic effects developed near the bow shock in a realistic magnetic field configuration

  13. Plasma waves in the Earth's foreshock, bow shock, and magnetosheath

    International Nuclear Information System (INIS)

    Onsager, T.G.

    1988-01-01

    The research presented in this dissertation is a detailed analysis of electrostatic waves in the Earth's foreshock, bow shock, and magnetosheath. The wave modes measured in these regions, the possible generation mechanisms, and the process which drive the plasma to its unstable state are investigated. The measurements used in this study were obtained from the plasma wave receiver, the particle instrument, and the magnetometer on board the Active Magnetospheric Particle Tracer Explorer (AMPTE) Ion Release Module (IRM). Electron beam mode waves have been identified in the Earth's foreshock. A technique is developed which allows the rest frame frequency and wave number of the electron beam mode waves to be determined from the measurements. The experimentally determined values are compared with theoretical predictions, and approximate limits are put on the beam temperatures. It is demonstrated that electrostatic waves are present in the bow shock and magnetosheath with frequencies above the maximum frequency for Doppler shifted ion acoustic waves, yet below the Langmuir frequency. Waves in this frequency range are tentatively identified as electron beam mode waves. This identification is based on the measured frequencies and electric field polarization directions. Data from 45 bow shock crossings are then used to investigate possible correlations between the electron beam mode waves and the near shock plasma parameters. The best correlations are found with Alfven Mach number and electron beta. Possible mechanism which might produce electron beams in the shock and magnetosheath are discussed in terms of the correlation study results

  14. Subgrid-scale turbulence in shock-boundary layer flows

    Science.gov (United States)

    Jammalamadaka, Avinash; Jaberi, Farhad

    2015-04-01

    Data generated by direct numerical simulation (DNS) for a Mach 2.75 zero-pressure gradient turbulent boundary layer interacting with shocks of different intensities are used for a priori analysis of subgrid-scale (SGS) turbulence and various terms in the compressible filtered Navier-Stokes equations. The numerical method used for DNS is based on a hybrid scheme that uses a non-dissipative central scheme in the shock-free turbulent regions and a robust monotonicity-preserving scheme in the shock regions. The behavior of SGS stresses and their components, namely Leonard, Cross and Reynolds components, is examined in various regions of the flow for different shock intensities and filter widths. The backscatter in various regions of the flow is found to be significant only instantaneously, while the ensemble-averaged statistics indicate no significant backscatter. The budgets for the SGS kinetic energy equation are examined for a better understanding of shock-tubulence interactions at the subgrid level and also with the aim of providing useful information for one-equation LES models. A term-by-term analysis of SGS terms in the filtered total energy equation indicate that while each term in this equation is significant by itself, the net contribution by all of them is relatively small. This observation is consistent with our a posteriori analysis.

  15. Dynamics of Laser-Driven Shock Waves in Solid Targets

    Science.gov (United States)

    Aglitskiy, Y.; Karasik, M.; Velikovich, A. L.; Serlin, V.; Weaver, J.; Schmitt, A. J.; Obenschain, S. P.; Grun, J.; Metzler, N.; Zalesak, S. T.; Gardner, J. H.; Oh, J.; Harding, E. C.

    2009-11-01

    Accurate shock timing is a key issue of both indirect- and direct-drive laser fusions. The experiments on the Nike laser at NRL presented here were made possible by improvements in the imaging capability of our monochromatic x-ray diagnostics based on Bragg reflection from spherically curved crystals. Side-on imaging implemented on Nike makes it possible to observe dynamics of the shock wave and ablation front in laser-driven solid targets. We can choose to observe a sequence of 2D images or a continuous time evolution of an image resolved in one spatial dimension. A sequence of 300 ps snapshots taken using vanadium backlighter at 5.2 keV reveals propagation of a shock wave in a solid plastic target. The shape of the shock wave reflects the intensity distribution in the Nike beam. The streak records with continuous time resolution show the x-t trajectory of a laser-driven shock wave in a 10% solid density DVB foam.

  16. Forkhead Box M1 Is Regulated by Heat Shock Factor 1 and Promotes Glioma Cells Survival under Heat Shock Stress*

    Science.gov (United States)

    Dai, Bingbing; Gong, Aihua; Jing, Zhitao; Aldape, Kenneth D.; Kang, Shin-Hyuk; Sawaya, Raymond; Huang, Suyun

    2013-01-01

    The forkhead box M1 (FoxM1) is a key transcription factor regulating multiple aspects of cell biology. Prior studies have shown that FoxM1 is overexpressed in a variety of human tumors, including brain tumor, and plays a critical role in cancer development and progression. In this study we found that FoxM1 was up-regulated by heat shock factor 1 (HSF1) under heat shock stress condition in multiple cell lines. Knockdown of HSF1 with HSF1 siRNA or inhibition of HSF1 with a HSF1 inhibitor abrogated heat shock-induced expression of FoxM1. Genetic deletion of HSF1 in mouse embryo fibroblast cells also abolished heat shock stress-induced FoxM1 expression. Moreover, we showed that HSF1 directly bound to FoxM1 promoter and increased FoxM1 promoter activity. Furthermore, we demonstrated that FoxM1 was required for the G2-M phase progression through regulating Cdc2, Cdc20, and Cdc25B under a mild heat shock stress but enhanced cell survival under lethal heat shock stress condition. Finally, in human glioblastoma specimens, FoxM1 overexpression correlated with elevated HSF1 expression. Our results indicate that FoxM1 is regulated by HSF1 and is critical for HSF1-mediated heat shock response. We demonstrated a novel mechanism of stress resistance controlled by HSF1 and a new HSF-FoxM1 connection that mediates cellular thermotolerance. PMID:23192351

  17. Subcritical-to-supercritical transition in quasi-perpendicular fast shocks

    International Nuclear Information System (INIS)

    Livesey, W.A.

    1985-01-01

    The magnetic structure of collisionless quasi-perpendicular bow shock waves was observed and studied using fluxgate magnetometer data from the ISEE-1 and 2 spacecraft. The angle theta/sub Bn/ between upstream magnetic field and the shock normal was determined for each case. The fast Mach number M, β/sub i/, and β/sub e/ of the shock waves were estimated using solar wind plasma parameters. The critical fast Mach number M/sub c/, the Mach number for which the downstream flow speed just equals the downstream sound speed, was calculated for each shock using the Rankine-Hugoniot shock jump conditions. A survey of the dependence of various magnetic substructures upon these parameters was performed. A precursor foot to the shock was noted for shock waves characterized by M/M/sub c/ > 1. The thickness of this foot region was in good quantitative agreement with predicted trajectories of solar wind ions undergoing specular reflection from the shock ramp

  18. Normal forms in Poisson geometry

    NARCIS (Netherlands)

    Marcut, I.T.

    2013-01-01

    The structure of Poisson manifolds is highly nontrivial even locally. The first important result in this direction is Conn's linearization theorem around fixed points. One of the main results of this thesis (Theorem 2) is a normal form theorem in Poisson geometry, which is the Poisson-geometric

  19. Energetic ion acceleration at collisionless shocks

    Science.gov (United States)

    Decker, R. B.; Vlahos, L.

    1985-01-01

    An example is presented from a test particle simulation designed to study ion acceleration at oblique turbulent shocks. For conditions appropriate at interplanetary shocks near 1 AU, it is found that a shock with theta sub B n = 60 deg is capable of producing an energy spectrum extending from 10 keV to approx. 1 MeV in approx 1 hour. In this case total energy gains result primarily from several separate episodes of shock drift acceleration, each of which occurs when particles are scattered back to the shock by magnetic fluctuations in the shock vicinity.

  20. Energetic ion acceleration at collisionless shocks

    International Nuclear Information System (INIS)

    Decker, R.B.; Vlahos, L.

    1985-01-01

    An example is presented from a test particle simulation designed to study ion acceleration at oblique turbulent shocks. For conditions appropriate at interplanetary shocks near 1 AU, it is found that a shock with theta sub B n = 60 deg is capable of producing an energy spectrum extending from 10 keV to approx 1 MeV in approx 1 hour. In this case total energy gains result primarily from several separate episodes of shock drift acceleration, each of which occurs when particles are scattered back to the shock by magnetic fluctuations in the shock vicinity

  1. Why the Nature of Oil Shocks Matters

    International Nuclear Information System (INIS)

    Archanskaia, Elizaveta; Hubert, Paul; Creel, Jerome

    2009-03-01

    This article studies the impact of oil shocks on the macro-economy in two ways insofar unexploited in the literature. The analysis is conducted at the global level, and it explicitly accounts for the potentially changing nature of oil shocks. Based on an original world GDP series and a grouping of oil shocks according to their nature, we find that oil supply shocks negatively impact world growth, contrary to oil demand shocks, pro-cyclical in their nature. This result is robust at the national level for the US. Furthermore, endogenous monetary policy is shown to have no counter-cyclical effects in the context of an oil demand shock. (authors)

  2. MHD intermediate shock discontinuities: Pt. 1

    International Nuclear Information System (INIS)

    Kennel, C.F.; Blandford, R.D.; Coppi, P.

    1989-01-01

    Recent numerical investigations have focused attention once more on the role of intermediate shocks in MHD. Four types of intermediate shock are identified using a graphical representation of the MHD Rankine-Hugoniot conditions. This same representation can be used to exhibit the close relationship of intermediate shocks to switch-on shocks and rotational discontinuities. The conditions under which intermediate discontinuities can be found are elucidated. The variations in velocity, pressure, entropy and magnetic-field jumps with upstream parameters in intermediate shocks are exhibited graphically. The evolutionary arguments traditionally advanced against intermediate shocks may fail because the equations of classical MHD are not strictly hyperbolic. (author)

  3. Shock waves in weakly compressed granular media.

    Science.gov (United States)

    van den Wildenberg, Siet; van Loo, Rogier; van Hecke, Martin

    2013-11-22

    We experimentally probe nonlinear wave propagation in weakly compressed granular media and observe a crossover from quasilinear sound waves at low impact to shock waves at high impact. We show that this crossover impact grows with the confining pressure P0, whereas the shock wave speed is independent of P0-two hallmarks of granular shocks predicted recently. The shocks exhibit surprising power law attenuation, which we model with a logarithmic law implying that shock dissipation is weak and qualitatively different from other granular dissipation mechanisms. We show that elastic and potential energy balance in the leading part of the shocks.

  4. Internal energy relaxation in shock wave structure

    International Nuclear Information System (INIS)

    Josyula, Eswar; Suchyta, Casimir J.; Boyd, Iain D.; Vedula, Prakash

    2013-01-01

    The Wang Chang-Uhlenbeck (WCU) equation is numerically integrated to characterize the internal structure of Mach 3 and Mach 5 shock waves in a gas with excitation in the internal energy states for the treatment of inelastic collisions. Elastic collisions are modeled with the hard sphere collision model and the transition rates for the inelastic collisions modified appropriately using probabilities based on relative velocities of the colliding particles. The collision integral is evaluated by the conservative discrete ordinate method [F. Tcheremissine, “Solution of the Boltzmann kinetic equation for high-speed flows,” Comput. Math. Math. Phys. 46, 315–329 (2006); F. Cheremisin, “Solution of the Wang Chang-Uhlenbeck equation,” Dokl. Phys. 47, 487–490 (2002)] developed for the Boltzmann equation. For the treatment of the diatomic molecules, the internal energy modes in the Boltzmann equation are described quantum mechanically given by the WCU equation. As a first step in the treatment of the inelastic collisions by the WCU equation, a two- and three-quantum system is considered to study the effect of the varying of (1) the inelastic cross section and (2) the energy gap between the quantum energy states. An alternative method, the direct simulation Monte Carlo method, is used for the Mach 3 shock wave to ensure the consistency of implementation in the two methods and there is an excellent agreement between the two methods. The results from the WCU implementation showed consistent trends for the Mach 3 and Mach5 standing shock waves simulations. Inelastic contributions change the downstream equilibrium state and allow the flow to transition to the equilibrium state further upstream

  5. Shock, diaschisis and von Monakow

    Directory of Open Access Journals (Sweden)

    Eliasz Engelhardt

    2013-07-01

    Full Text Available The concept of shock apparently emerged in the middle of the 18th century (Whyett as an occurrence observed experimentally after spinal cord transection, and identified as "shock" phenomenon one century later (Hall. The concept was extended (Brown-Séquard and it was suggested that brain lesions caused functional rupture in regions distant from the injured one ("action à distance". The term "diaschisis" (von Monakow, proposed as a new modality of shock, had its concept broadened, underpinned by observations of patients, aiming at distinguishing between symptoms of focal brain lesions and transitory effects they produced, attributable to depression of distant parts of the brain connected to the injured area. Presently, diaschisis is related mainly to cerebrovascular lesions and classified according to the connection fibers involved, as proposed by von Monakow. Depression of metabolism and blood flow in regions anatomically separated, but related by connections with the lesion, allows observing diaschisis with neuroimaging.

  6. Shock compression of geological materials

    International Nuclear Information System (INIS)

    Kirk, S; Braithwaite, C; Williamson, D; Jardine, A

    2014-01-01

    Understanding the shock compression of geological materials is important for many applications, and is particularly important to the mining industry. During blast mining the response to shock loading determines the wave propagation speed and resulting fragmentation of the rock. The present work has studied the Hugoniot of two geological materials; Lake Quarry Granite and Gosford Sandstone. For samples of these materials, the composition was characterised in detail. The Hugoniot of Lake Quarry Granite was predicted from this information as the material is fully dense and was found to be in good agreement with the measured Hugoniot. Gosford Sandstone is porous and undergoes compaction during shock loading. Such behaviour is similar to other granular material and we show how it can be described using a P-a compaction model.

  7. Shock compression of simulated adobe

    Science.gov (United States)

    Braithwaite, C. H.; Church, P. D.; Gould, P. J.; Stewart, B.; Jardine, A. P.

    2017-01-01

    A series of plate impact experiments were conducted to investigate the shock response of a simulant for adobe, a traditional form of building material widely used around the world. Air dried bricks were sourced from the London brick company, dry machined and impacted at a range of velocities in a single stage gas gun. The shock Hugoniot was determined (Us =2.26up+0.37) as well as release information. The material was found to behave in a manner which was similar to that of loose sand and considerably less stiff than a weak porous sandstone. The effect of any cementing of the grains was examined by shocking powdered samples contained within a cell arrangement.

  8. Shock Initiation of Damaged Explosives

    Energy Technology Data Exchange (ETDEWEB)

    Chidester, S K; Vandersall, K S; Tarver, C M

    2009-10-22

    Explosive and propellant charges are subjected to various mechanical and thermal insults that can increase their sensitivity over the course of their lifetimes. To quantify this effect, shock initiation experiments were performed on mechanically and thermally damaged LX-04 (85% HMX, 15% Viton by weight) and PBX 9502 (95% TATB, 5% Kel-F by weight) to obtain in-situ manganin pressure gauge data and run distances to detonation at various shock pressures. We report the behavior of the HMX-based explosive LX-04 that was damaged mechanically by applying a compressive load of 600 psi for 20,000 cycles, thus creating many small narrow cracks, or by cutting wedge shaped parts that were then loosely reassembled, thus creating a few large cracks. The thermally damaged LX-04 charges were heated to 190 C for long enough for the beta to delta solid - solid phase transition to occur, and then cooled to ambient temperature. Mechanically damaged LX-04 exhibited only slightly increased shock sensitivity, while thermally damaged LX-04 was much more shock sensitive. Similarly, the insensitive explosive PBX 9502 was mechanically damaged using the same two techniques. Since PBX 9502 does not undergo a solid - solid phase transition but does undergo irreversible or 'rachet' growth when thermally cycled, thermal damage to PBX 9502 was induced by this procedure. As for LX-04, the thermally damaged PBX 9502 demonstrated a greater shock sensitivity than mechanically damaged PBX 9502. The Ignition and Growth reactive flow model calculated the increased sensitivities by igniting more damaged LX-04 and PBX 9502 near the shock front based on the measured densities (porosities) of the damaged charges.

  9. Shock compaction of molybdenum powder

    Science.gov (United States)

    Ahrens, T. J.; Kostka, D.; Vreeland, T., Jr.; Schwarz, R. B.; Kasiraj, P.

    1983-01-01

    Shock recovery experiments which were carried out in the 9 to 12 GPa range on 1.4 distension Mo and appear adequate to compact to full density ( 45 (SIGMA)m) powders were examined. The stress levels, however, are below those calculated to be from 100 to approx. 22 GPa which a frictional heating model predicts are required to consolidate approx. 10 to 50 (SIGMA)m particles. The model predicts that powders that have a distension of m=1.6 shock pressures of 14 to 72 GPa are required to consolidate Mo powders in the 50 to 10 (SIGMA)m range.

  10. Cation disorder in shocked orthopyroxene.

    Science.gov (United States)

    Dundon, R. W.; Hafner, S. S.

    1971-01-01

    The study of cation distributions over nonequivalent lattice sites in minerals may reveal information on the history of temperature and pressure in rocks. Chemically homogeneous orthopyroxene specimens were shocked under well-controlled conditions in the laboratory in order to provide a basis for the interpretation of more complex natural materials. As a result of the investigation it is concluded that the distribution of magnesium and iron over the M1 and M2 positions in Bamle enstatite shocked at 1 megabar is highly disordered. It corresponds to an equilibrium distribution of at least 1000 C.

  11. Sepsis and Septic Shock Strategies.

    Science.gov (United States)

    Armstrong, Bracken A; Betzold, Richard D; May, Addison K

    2017-12-01

    Three therapeutic principles most substantially improve organ dysfunction and survival in sepsis: early, appropriate antimicrobial therapy; restoration of adequate cellular perfusion; timely source control. The new definitions of sepsis and septic shock reflect the inadequate sensitivity, specify, and lack of prognostication of systemic inflammatory response syndrome criteria. Sequential (sepsis-related) organ failure assessment more effectively prognosticates in sepsis and critical illness. Inadequate cellular perfusion accelerates injury and reestablishing perfusion limits injury. Multiple organ systems are affected by sepsis and septic shock and an evidence-based multipronged approach to systems-based therapy in critical illness results in improve outcomes. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Shock/shock interactions between bodies and wings

    Directory of Open Access Journals (Sweden)

    Gaoxiang XIANG

    2018-02-01

    Full Text Available This paper examines the Shock/Shock Interactions (SSI between the body and wing of aircraft in supersonic flows. The body is simplified to a flat wedge and the wing is assumed to be a sharp wing. The theoretical spatial dimension reduction method, which transforms the 3D problem into a 2D one, is used to analyze the SSI between the body and wing. The temperature and pressure behind the Mach stem induced by the wing and body are obtained, and the wave configurations in the corner are determined. Numerical validations are conducted by solving the inviscid Euler equations in 3D with a Non-oscillatory and Non-free-parameters Dissipative (NND finite difference scheme. Good agreements between the theoretical and numerical results are obtained. Additionally, the effects of the wedge angle and sweep angle on wave configurations and flow field are considered numerically and theoretically. The influences of wedge angle are significant, whereas the effects of sweep angle on wave configurations are negligible. This paper provides useful information for the design and thermal protection of aircraft in supersonic and hypersonic flows. Keywords: Body and wing, Flow field, Hypersonic flow, Shock/shock interaction, Wave configurations

  13. The relationship between elastic constants and structure of shock waves in a zinc single crystal

    Science.gov (United States)

    Krivosheina, M. N.; Kobenko, S. V.; Tuch, E. V.

    2017-12-01

    The paper provides a 3D finite element simulation of shock-loaded anisotropic single crystals on the example of a Zn plate under impact using a mathematical model, which allows for anisotropy in hydrostatic stress and wave velocities in elastic and plastic ranges. The simulation results agree with experimental data, showing the absence of shock wave splitting into an elastic precursor and a plastic wave in Zn single crystals impacted in the [0001] direction. It is assumed that the absence of an elastic precursor under impact loading of a zinc single crystal along the [0001] direction is determined by the anomalously large ratio of the c/a-axes and close values of the propagation velocities of longitudinal and bulk elastic waves. It is shown that an increase in only one elastic constant along the [0001] direction results in shock wave splitting into an elastic precursor and a shock wave of "plastic" compression.

  14. "Driverless" Shocks in the Interplanetary Medium

    Science.gov (United States)

    Gopalswamy, N.; Kaiser, M. L.; Lara, A.

    1999-01-01

    Many interplanetary shocks have been detected without an obvious driver behind them. These shocks have been thought to be either blast waves from solar flares or shocks due to sudden increase in solar wind speed caused by interactions between large scale open and closed field lines of the Sun. We investigated this problem using a set of interplanetary shock detected {\\it in situ} by the Wind space craft and tracing their solar origins using low frequency radio data obtained by the Wind/WAVES experiment. For each of these "driverless shocks" we could find a unique coronal mass ejections (CME) event observed by the SOHO (Solar and Heliospheric Observatory) coronagraphs. We also found that these CMEs were ejected at large angles from the Sun-Earth line. It appears that the "driverless shocks" are actually driver shocks, but the drivers were not intercepted by the spacecraft. We conclude that the interplanetary shocks are much more extended than the driving CMEs.

  15. Shock and Vibration. Volume 1, Issue 1

    National Research Council Canada - National Science Library

    Pilkey, Walter D

    1994-01-01

    ..., and earthquake engineering. Among the specific areas to be covered are vibration testing and control, vibration condition monitoring and diagnostics, shock hardenings, modal technology, shock testing, data acquisition, fluid...

  16. Initial ISEE magnetometer results: shock observation

    International Nuclear Information System (INIS)

    Russell, C.T.

    1979-01-01

    ISEE-1 and -2 magnetic field profiles across 6 terrestrial bow shock and one interplanetary shock are examined. The inteplanetary shock illustrates the behavior of a low Mach number shock. Three examples of low or moderate β, high Mach number, quasi-perpendicular shocks are examined. These did not have upstream waves, but rather had waves growing in the field gradient. Two examples of high β shocks showed little coherence in field variation even though the two vehicles were only a few hundred kilometers apart. The authors present the joint behavior of wave, particle and field data across some of these shocks to show some of the myriad of shock features whose behavior they are now beginning to investigate. (Auth.)

  17. 29th International Symposium on Shock Waves

    CERN Document Server

    Ranjan, Devesh

    2015-01-01

    This proceedings present the results of the 29th International Symposium on Shock Waves (ISSW29) which was held in Madison, Wisconsin, U.S.A., from July 14 to July 19, 2013. It was organized by the Wisconsin Shock Tube Laboratory, which is part of the College of Engineering of the University of Wisconsin-Madison. The ISSW29 focused on the following areas: Blast Waves, Chemically Reactive Flows, Detonation and Combustion,  Facilities, Flow Visualization, Hypersonic Flow, Ignition, Impact and Compaction, Industrial Applications, Magnetohydrodynamics, Medical and Biological Applications, Nozzle Flow, Numerical Methods, Plasmas, Propulsion, Richtmyer-Meshkov Instability, Shock-Boundary Layer Interaction, Shock Propagation and Reflection, Shock Vortex Interaction, Shock Waves in Condensed Matter, Shock Waves in Multiphase Flow, as well as Shock Waves in Rarefield Flow. The two Volumes contain the papers presented at the symposium and serve as a reference for the participants of the ISSW 29 and individuals interes...

  18. Inferior vena cava obstruction and shock

    Directory of Open Access Journals (Sweden)

    Megri Mohammed

    2018-01-01

    Full Text Available Shock is one of the most challenging life-threatening conditions with high mortality and morbidity; the outcomes are highly dependent on the early detection and management of the condition. Septic shock is the most common type of shock in the Intensive Care Unit. While not as common as other subsets of shock, obstructive shock is a significant subtype due to well defined mechanical and pathological causes, including tension pneumothorax, massive pulmonary embolism, and cardiac tamponade. We are presenting a patient with obstructive shock due to inferior vena cava obstruction secondary to extensive deep venous thrombosis. Chance of survival from obstructive shock in our patient was small; however, there was complete and immediate recovery after treatment of the obstruction on recognizing the affected vessels. This case alerts the practicing intensivist and the emergency medicine physician to consider occlusion of the great vessels other than the pulmonary artery or aorta as causes of obstructive shock.

  19. Shock dynamics in layered periodic media

    KAUST Repository

    Ketcheson, David I.

    2012-01-01

    Solutions of constant-coeffcient nonlinear hyperbolic PDEs generically develop shocks, even if the initial data is smooth. Solutions of hyperbolic PDEs with variable coeffcients can behave very differently. We investigate formation and stability of shock waves in a one-dimensional periodic layered medium by a computational study of time-reversibility and entropy evolution. We find that periodic layered media tend to inhibit shock formation. For small initial conditions and large impedance variation, no shock formation is detected even after times much greater than the time of shock formation in a homogeneous medium. Furthermore, weak shocks are observed to be dynamically unstable in the sense that they do not lead to significant long-term entropy decay. We propose a characteristic condition for admissibility of shocks in heterogeneous media that generalizes the classical Lax entropy condition and accurately predicts the formation or absence of shocks in these media.

  20. A direct comparison of popular models of normal memory loss and Alzheimer's disease in samples of African Americans, Mexican Americans, and refugees and immigrants from the former Soviet Union.

    Science.gov (United States)

    Schrauf, Robert W; Iris, Madelyn

    2011-04-01

    To understand how people differentiate normal memory loss from Alzheimer's disease (AD) by investigating cultural models of these conditions. Ethnographic interviews followed by a survey. Cultural consensus analysis was used to test for the presence of group models, derive the "culturally correct" set of beliefs, and compare models of normal memory loss and AD. Chicago, Illinois. One hundred eight individuals from local neighborhoods: African Americans, Mexican Americans, and refugees and immigrants from the former Soviet Union. Participants responded to yes-or-no questions about the nature and causes of normal memory loss and AD and provided information on ethnicity, age, sex, acculturation, and experience with AD. Groups held a common model of AD as a brain-based disease reflecting irreversible cognitive decline. Higher levels of acculturation predicted greater knowledge of AD. Russian speakers favored biological over psychological models of the disease. Groups also held a common model of normal memory loss, including the important belief that "normal" forgetting involves eventual recall of the forgotten material. Popular models of memory loss and AD confirm that patients and clinicians are speaking the same "language" in their discussions of memory loss and AD. Nevertheless, the presence of coherent models of memory loss and AD, and the unequal distribution of that knowledge across groups, suggests that clinicians should include wider circles of patients' families and friends in their consultations. These results frame knowledge as distributed across social groups rather than simply the possession of individual minds. © 2011, Copyright the Authors. Journal compilation © 2011, The American Geriatrics Society.

  1. Ionospheric shock waves triggered by rockets

    Directory of Open Access Journals (Sweden)

    C. H. Lin

    2014-09-01

    Full Text Available This paper presents a two-dimensional structure of the shock wave signatures in ionospheric electron density resulting from a rocket transit using the rate of change of the total electron content (TEC derived from ground-based GPS receivers around Japan and Taiwan for the first time. From the TEC maps constructed for the 2009 North Korea (NK Taepodong-2 and 2013 South Korea (SK Korea Space Launch Vehicle-II (KSLV-II rocket launches, features of the V-shaped shock wave fronts in TEC perturbations are prominently seen. These fronts, with periods of 100–600 s, produced by the propulsive blasts of the rockets appear immediately and then propagate perpendicularly outward from the rocket trajectory with supersonic velocities between 800–1200 m s−1 for both events. Additionally, clear rocket exhaust depletions of TECs are seen along the trajectory and are deflected by the background thermospheric neutral wind. Twenty minutes after the rocket transits, delayed electron density perturbation waves propagating along the bow wave direction appear with phase velocities of 800–1200 m s−1. According to their propagation character, these delayed waves may be generated by rocket exhaust plumes at earlier rocket locations at lower altitudes.

  2. A Comprehensive Review of the Techniques on Regenerative Shock Absorber Systems

    Directory of Open Access Journals (Sweden)

    Ran Zhang

    2018-05-01

    Full Text Available In this paper, the current technologies of the regenerative shock absorber systems have been categorized and evaluated. Three drive modes of the regenerative shock absorber systems, namely the direct drive mode, the indirect drive mode and hybrid drive mode are reviewed for their readiness to be implemented. The damping performances of the three different modes are listed and compared. Electrical circuit and control algorithms have also been evaluated to maximize the power output and to deliver the premium ride comfort and handling performance. Different types of parameterized road excitations have been applied to vehicle suspension systems to investigate the performance of the regenerative shock absorbers. The potential of incorporating nonlinearity into the regenerative shock absorber design analysis is discussed. The research gaps for the comparison of the different drive modes and the nonlinearity analysis of the regenerative shock absorbers are identified and, the corresponding research questions have been proposed for future work.

  3. The impact of kinetic effects on the properties of relativistic electron–positron shocks

    International Nuclear Information System (INIS)

    Stockem, Anne; Fiúza, Frederico; Fonseca, Ricardo A; Silva, Luis O

    2012-01-01

    We assess the impact of non-thermally shock-accelerated particles on the magnetohydrodynamic (MHD) jump conditions of relativistic shocks. The adiabatic constant is calculated directly from first-principles particle-in-cell simulation data, enabling a semi-kinetic approach to improve the standard fluid model and allowing for an identification of the key parameters that define the shock structure. We find that the evolving upstream parameters have a stronger impact than the corrections due to non-thermal particles. We find that the decrease in the upstream bulk speed result in deviations from the standard MHD model up to 10%. Furthermore, we obtain a quantitative definition of the shock transition region from our analysis. For Weibel-mediated shocks the inclusion of a magnetic field in the MHD conservation equations is addressed for the first time. (paper)

  4. On the Nonlinear Dynamics of a Tunable Shock Micro-switch

    Science.gov (United States)

    Azizi, Saber; Javaheri, Hamid; Ghanati, Parisa

    2016-12-01

    A tunable shock micro-switch based on piezoelectric excitation is proposed in this study. This model includes a clamped-clamped micro-beam sandwiched with two piezoelectric layers throughout the entire length. Actuation of the piezoelectric layers via a DC voltage leads to an initial axial force in the micro-beam and directly affects on its overall bending stiffness; accordingly enables two-side tuning of both the trigger time and threshold shock. The governing motion equation, in the presence of an electrostatic actuation and a shock wave, is derived using Hamilton's principle. We employ the finite element method based on the Galerkin technique to obtain the temporal and phase responses subjected to three different shock waves including half sine, triangular and rectangular forms. Subsequently, we investigate the effect of the piezoelectric excitations on the threshold shock amplitude and trigger time.

  5. Interaction of a conical shock wave with a turbulent boundary layer

    Science.gov (United States)

    Teh, S. L.; Gai, S. L.

    The paper reports an investigation on the interaction of an incident conical shock wave with a turbulent boundary layer. Although a conical shock theoretically creates a hyperbolic shock trace on the flat plate, the line joining all the experimental interaction origins takes a different form due to varying upstream influence. The existence of strong pressure gradients in the spanwise direction after the shock leads to the boundary-layer twist. A model based on the upstream influence of the shock when combined with McCabe's secondary-flow theory showed separation to occur at an external flow deflection of 11.8 deg. The oil flow measurements however show this to occur at 9.2 deg. This discrepancy is of the same order as that found by McCabe. Detailed data involving Schlieren and shadowgraph photography, surface-flow visualization, and surface-pressure measurements are presented.

  6. Shock unsteadiness in a thrust optimized parabolic nozzle

    Science.gov (United States)

    Verma, S. B.

    2009-07-01

    This paper discusses the nature of shock unsteadiness, in an overexpanded thrust optimized parabolic nozzle, prevalent in various flow separation modes experienced during start up {(δ P0 /δ t > 0)} and shut down {(δ P0/δ t The results are based on simultaneously acquired data from real-time wall pressure measurements using Kulite pressure transducers, high-speed schlieren (2 kHz) of the exhaust flow-field and from strain-gauges installed on the nozzle bending tube. Shock unsteadiness in the separation region is seen to increase significantly just before the onset of each flow transition, even during steady nozzle operation. The intensity of this measure ( rms level) is seen to be strongly influenced by relative locations of normal and overexpansion shock, the decrease in radial size of re-circulation zone in the back-flow region, and finally, the local nozzle wall contour. During restricted shock separation, the pressure fluctuations in separation region exhibit periodic characteristics rather than the usually observed characteristics of intermittent separation. The possible physical mechanisms responsible for the generation of flow unsteadiness in various separation modes are discussed. The results are from an experimental study conducted in P6.2 cold-gas subscale test facility using a thrust optimized parabolic nozzle of area-ratio 30.

  7. DebtRank: A Microscopic Foundation for Shock Propagation

    Science.gov (United States)

    Bardoscia, Marco; Battiston, Stefano; Caccioli, Fabio; Caldarelli, Guido

    2015-01-01

    The DebtRank algorithm has been increasingly investigated as a method to estimate the impact of shocks in financial networks, as it overcomes the limitations of the traditional default-cascade approaches. Here we formulate a dynamical “microscopic” theory of instability for financial networks by iterating balance sheet identities of individual banks and by assuming a simple rule for the transfer of shocks from borrowers to lenders. By doing so, we generalise the DebtRank formulation, both providing an interpretation of the effective dynamics in terms of basic accounting principles and preventing the underestimation of losses on certain network topologies. Depending on the structure of the interbank leverage matrix the dynamics is either stable, in which case the asymptotic state can be computed analytically, or unstable, meaning that at least one bank will default. We apply this framework to a dataset of the top listed European banks in the period 2008–2013. We find that network effects can generate an amplification of exogenous shocks of a factor ranging between three (in normal periods) and six (during the crisis) when we stress the system with a 0.5% shock on external (i.e. non-interbank) assets for all banks. PMID:26091013

  8. Electron Dropout Echoes Induced by Interplanetary Shock: A Statistical Study

    Science.gov (United States)

    Liu, Z.; Zong, Q.; Hao, Y.; Zhou, X.; Ma, X.; Liu, Y.

    2017-12-01

    "Electron dropout echo" as indicated by repeated moderate dropout and recovery signatures of the flux of energetic electron in the out radiation belt region has been investigated systematically. The electron dropout and its echoes are usually found for higher energy (> 300 keV) channels fluxes, whereas the flux enhancements are obvious for lower energy electrons simultaneously after the interplanetary shock arrives at the Earth's geosynchronous orbit. 104 dropout echo events have been found from 215 interplanetary shock events from 1998 to 2007 based on LANL satellite data. In analogy to substorm injections, these 104 events could be naturally divided into two categories: dispersionless (49 events) or dispersive (55 events) according to the energy dispersion of the initial dropout. It is found that locations of dispersionless events are distributed mainly in the duskside magnetosphere. Further, the obtained locations derived from dispersive events with the time-of-flight technique of the initial dropout regions are mainly located at the duskside as well. Statistical studies have shown that the effect of shock normal, interplanetary magnetic field Bz and solar wind dynamic pressure may be insignificant to these electron dropout events. We suggest that the electric field impulse induced by the IP shock produces a more pronounced inward migration of electrons at the dusk side, resulting in the observed dusk-side moderate dropout of electron flux and its consequent echoes.

  9. DebtRank: A Microscopic Foundation for Shock Propagation.

    Directory of Open Access Journals (Sweden)

    Marco Bardoscia

    Full Text Available The DebtRank algorithm has been increasingly investigated as a method to estimate the impact of shocks in financial networks, as it overcomes the limitations of the traditional default-cascade approaches. Here we formulate a dynamical "microscopic" theory of instability for financial networks by iterating balance sheet identities of individual banks and by assuming a simple rule for the transfer of shocks from borrowers to lenders. By doing so, we generalise the DebtRank formulation, both providing an interpretation of the effective dynamics in terms of basic accounting principles and preventing the underestimation of losses on certain network topologies. Depending on the structure of the interbank leverage matrix the dynamics is either stable, in which case the asymptotic state can be computed analytically, or unstable, meaning that at least one bank will default. We apply this framework to a dataset of the top listed European banks in the period 2008-2013. We find that network effects can generate an amplification of exogenous shocks of a factor ranging between three (in normal periods and six (during the crisis when we stress the system with a 0.5% shock on external (i.e. non-interbank assets for all banks.

  10. DebtRank: A Microscopic Foundation for Shock Propagation.

    Science.gov (United States)

    Bardoscia, Marco; Battiston, Stefano; Caccioli, Fabio; Caldarelli, Guido

    2015-01-01

    The DebtRank algorithm has been increasingly investigated as a method to estimate the impact of shocks in financial networks, as it overcomes the limitations of the traditional default-cascade approaches. Here we formulate a dynamical "microscopic" theory of instability for financial networks by iterating balance sheet identities of individual banks and by assuming a simple rule for the transfer of shocks from borrowers to lenders. By doing so, we generalise the DebtRank formulation, both providing an interpretation of the effective dynamics in terms of basic accounting principles and preventing the underestimation of losses on certain network topologies. Depending on the structure of the interbank leverage matrix the dynamics is either stable, in which case the asymptotic state can be computed analytically, or unstable, meaning that at least one bank will default. We apply this framework to a dataset of the top listed European banks in the period 2008-2013. We find that network effects can generate an amplification of exogenous shocks of a factor ranging between three (in normal periods) and six (during the crisis) when we stress the system with a 0.5% shock on external (i.e. non-interbank) assets for all banks.

  11. Entropy jump across an inviscid shock wave

    Science.gov (United States)

    Salas, Manuel D.; Iollo, Angelo

    1995-01-01

    The shock jump conditions for the Euler equations in their primitive form are derived by using generalized functions. The shock profiles for specific volume, speed, and pressure are shown to be the same, however density has a different shock profile. Careful study of the equations that govern the entropy shows that the inviscid entropy profile has a local maximum within the shock layer. We demonstrate that because of this phenomenon, the entropy, propagation equation cannot be used as a conservation law.

  12. Collisionless Electrostatic Shock Modeling and Simulation

    Science.gov (United States)

    2016-10-21

    equations with piston -like boundary conditions gives a solution for the shock behavior. • Assumes cold upstream ions, therefore neglecting shock...temperature ratio (>10) – Wave Train Wavelength – Shock-Front Mach Number – Reflected Ion Beam Velocity Gathering Experiment Data – Double Plasma Device...experimental shock data. • Inconsistencies in published 1969 double -plasma device data hampered validation. Future Work: Extension to Moderately

  13. Shock waves in gas and plasma

    International Nuclear Information System (INIS)

    Niu, K.

    1996-01-01

    A shock wave is a discontinuous surface that connects supersonic flow with subsonic flow. After a shock wave, flow velocity is reduced, and pressure and temperature increase; entropy especially increases across a shock wave. Therefore, flow is in nonequilibrium, and irreversible processes occur inside the shock layer. The thickness of a shock wave in neutral gas is of the order of the mean free path of the fluid particle. A shock wave also appears in magnetized plasma. Provided that when the plasma flow is parallel to the magnetic field, a shock wave appears if the governing equation for velocity potential is in hyperbolic type in relation with the Mach number and the Alfven number. When the flow is perpendicular to the magnetic field, the Maxwell stress, in addition to the pressure, plays a role in the shock wave in plasma. When the plasma temperature is so high, as the plasma becomes collision-free, another type of shock wave appears. In a collision-free shock wave, gyromotions of electrons around the magnetic field lines cause the shock formation instead of collisions in a collision-dominant plasma or neutral gas. Regardless of a collision-dominant or collision-free shock wave, the fluid that passes through the shock wave is heated in addition to being compressed. In inertial confinement fusion, the fuel must be compressed. Really, implosion motion performs fuel compression. A shock wave, appearing in the process of implosion, compresses the fuel. The shock wave, however, heats the fuel more intensively, and it makes it difficult to compress the fuel further because high temperatures invite high pressure. Adiabatic compression of the fuel is the desired result during the implosion, without the formation of a shock wave. (Author)

  14. Electric shock and electrical fire specialty

    International Nuclear Information System (INIS)

    2011-02-01

    This book deals with electric shock and electrical fire, which is made up seven chapters. It describes of special measurement for electric shock and electrical fire. It mentions concretely about electrical fire analysis and precautionary measurement, electrical shock analysis cases, occurrence of static electricity and measurement, gas accident, analysis of equipment accident and precautionary measurement. The book is published to educate the measurement on electric shock and electrical fire by electrical safety technology education center in Korea Electrical Safety Corporation.

  15. Prenatal temperature shocks reduce cooperation

    NARCIS (Netherlands)

    Duchoslav, Jan

    2017-01-01

    Climate change has not only led to a sustained rise in mean global temperature over the past decades, but also increased the frequency of extreme weather events. This paper explores the effect of temperature shocks in utero on later-life taste for cooperation. Using historical climate data combined

  16. Shock Incarceration: Rehabilitation or Retribution?

    Science.gov (United States)

    MacKenzie, Doris Layton; And Others

    1989-01-01

    Reviews Louisiana's shock incarceration program used as alternative to standard prison incarceration. Program involves short period of imprisonment in a "boot camp" type atmosphere followed by three phases of intensive parole supervision. Examines the program in regard to its rehabilitative potential and compares program elements to…

  17. Shock Mounting for Heavy Machines

    Science.gov (United States)

    Thompson, A. R.

    1984-01-01

    Elastomeric bearings eliminate extraneous forces. Rocket thrust transmitted from motor to load cells via support that absorbs extraneous forces so they do not affect accuracy of thrust measurements. Adapter spoked cone fits over forward end of rocket motor. Shock mounting developed for rocket engines under test used as support for heavy machines, bridges, or towers.

  18. 2-Shock layered tuning campaign

    Science.gov (United States)

    Masse, Laurent; Dittrich, T.; Khan, S.; Kyrala, G.; Ma, T.; MacLaren, S.; Ralph, J.; Salmonson, J.; Tipton, R.; Los Alamos Natl Lab Team; Lawrence Livermore Natl Lab Team

    2016-10-01

    The 2-Shock platform has been developed to maintain shell sphericity throughout the compression phase of an indirect-drive target implosion and produce a stagnating hot spot in a quasi 1D-like manner. A sub-scale, 1700 _m outer diameter, and thick, 200 _m, uniformly Silicon doped, gas-filled plastic capsule is driven inside a nominal size 5750 _m diameter ignition hohlraum. The hohlraum fill is near vacuum to reduce back-scatter and improve laser/drive coupling. A two-shock pulse of about 1 MJ of laser energy drives the capsule. The thick capsule prevents ablation front feed-through to the imploded core. This platform has demonstrated its efficiency to tune a predictable and reproducible 1-D implosion with a nearly round shape. It has been shown that the high foot performance was dominated by the local defect growth due to the ablation front instability and by the hohlraum radiation asymmetries. The idea here is to take advantage of this 2-Shock platform to design a 1D-like layered implosion and eliminates the deleterious effects of radiation asymmetries and ablation front instability growth. We present the design work and our first experimental results of this near one-dimensional 2-Shock layered design. This work was performed under the auspices of the Lawrence Livermore National Security, LLC, (LLNS) under Contract No. DE-AC52-07NA27344.

  19. Interstellar turbulence and shock waves

    International Nuclear Information System (INIS)

    Bykov, A.M.

    1982-01-01

    Random deflections of shock fronts propagated through the turbulent interstellar medium can produce the strong electro-density fluctuations on scales l> or approx. =10 13 cm inferred from pulsar radio scintillations. The development of turbulence in the hot-phase ISM is discussed

  20. Nonlinearity, Conservation Law and Shocks

    Indian Academy of Sciences (India)

    However, genuine nonlinearity is always present in an ideal gas. The conservation form of the equation (25) brings in shocks which cut off the growing part of the amplitUde as shown in. Figure 15. Acknowledgements. The author sincerely thanks the two referees whose valuable comments led to an improvement of the ...

  1. Model for Shock Wave Chaos

    KAUST Repository

    Kasimov, Aslan R.

    2013-03-08

    We propose the following model equation, ut+1/2(u2−uus)x=f(x,us) that predicts chaotic shock waves, similar to those in detonations in chemically reacting mixtures. The equation is given on the half line, x<0, and the shock is located at x=0 for any t≥0. Here, us(t) is the shock state and the source term f is taken to mimic the chemical energy release in detonations. This equation retains the essential physics needed to reproduce many properties of detonations in gaseous reactive mixtures: steady traveling wave solutions, instability of such solutions, and the onset of chaos. Our model is the first (to our knowledge) to describe chaos in shock waves by a scalar first-order partial differential equation. The chaos arises in the equation thanks to an interplay between the nonlinearity of the inviscid Burgers equation and a novel forcing term that is nonlocal in nature and has deep physical roots in reactive Euler equations.

  2. EXTRACORPOREAL SHOCK WAVE LITHOTRIPSY AS ...

    African Journals Online (AJOL)

    Objective To evaluate extracorporeal shock wave lithotripsy (ESWL) as a monotherapy for urolithiasis in patients with solitary kidney and to determine the factors that may affect its results. Patients and Methods Using the Dornier MFL 5000 lithotriptor, 106 patients with solitary kidney (80 men and 26 women) were treated for ...

  3. Shock formation within sonoluminescence bubbles

    International Nuclear Information System (INIS)

    Vuong, V.Q.; Szeri, A.J.; Young, D.A.

    1999-01-01

    A strong case has been made by several authors that sharp, spherically symmetric shocks converging on the center of a spherical bubble driven by a strong acoustic field give rise to rapid compression and heating that produces the brief flash of light known as sonoluminescence. The formation of such shocks is considered. It is found that, although at the main collapse the bubble wall does indeed launch an inwardly-traveling compression wave, and although the subsequent reflection of the wave at the bubble center produces a very rapid temperature peak, the wave is prevented from steepening into a sharp shock by an adverse gradient in the sound speed caused by heat transfer. It is shown that the mathematical characteristics of the flow can be prevented from accumulating into a shock front by this adverse sound speed gradient. A range of results is presented for a variety of bubble ambient radii and sound field amplitudes suggested by experiments. The time scale of the peak temperature in the bubble is set by the dynamics of the compression wave: this is typically in the range 100 - 300 ps (FWHM) in concert with recent measurements of the sonoluminescence pulse width. copyright 1999 American Institute of Physics

  4. Model for Shock Wave Chaos

    KAUST Repository

    Kasimov, Aslan R.; Faria, Luiz; Rosales, Rodolfo R.

    2013-01-01

    : steady traveling wave solutions, instability of such solutions, and the onset of chaos. Our model is the first (to our knowledge) to describe chaos in shock waves by a scalar first-order partial differential equation. The chaos arises in the equation

  5. Studying shocks in model astrophysical flows

    International Nuclear Information System (INIS)

    Chakrabarti, S.K.

    1989-01-01

    We briefly discuss some properties of the shocks in the existing models for quasi two-dimensional astrophysical flows. All of these models which allow the study of shock analytically have some unphysical characteristics due to inherent assumptions made. We propose a hybrid model for a thin flow which has fewer unpleasant features and is suitable for the study of shocks. (author). 5 refs

  6. Shock waves in relativistic nuclear matter, I

    International Nuclear Information System (INIS)

    Gleeson, A.M.; Raha, S.

    1979-02-01

    The relativistic Rankine-Hugoniot relations are developed for a 3-dimensional plane shock and a 3-dimensional oblique shock. Using these discontinuity relations together with various equations of state for nuclear matter, the temperatures and the compressibilities attainable by shock compression for a wide range of laboratory kinetic energy of the projectile are calculated. 12 references

  7. The microphysics of collisionless shock waves

    DEFF Research Database (Denmark)

    Marcowith, Alexandre; Bret, Antoine; Bykov, Andrei

    2016-01-01

    Collisionless shocks, that is shocks mediated by electromagnetic processes, are customary in space physics and in astrophysics. They are to be found in a great variety of objects and environments: magnetospheric and heliospheric shocks, supernova remnants, pulsar winds and their nebulæ, active ga...

  8. Pickup protons at quasi-perpendicular shocks: full particle electrodynamic simulations

    Directory of Open Access Journals (Sweden)

    S. Matsukiyo

    2007-02-01

    Full Text Available We have performed 3 one-dimensional full particle electromagnetic simulations of a quasi-perpendicular shock with the same Alfvén Mach number MA~5, shock normal-magnetic field angle ΘBn=87° and ion and electron beta (particle to magnetic field pressure of 0.1. In the first run we used an ion to electron mass ratio close to the physical one (mi/me=1024. As expected from previous high mass ratio simulations the Modified Two-Stream instability develops in the foot of the shock, and the shock periodically reforms itself. We have then self-consistently included in the simulation 10% pickup protons distributed on a shell in velocity space as a third component. In a run with an unrealistically low mass ratios of 200 the shock still reforms itself; reformation is due to accumulation of specularly reflected particles at the upstream edge of the foot. In a third run including pickup protons we used a mass ratio of 1024. The shock reforms periodically as in the low mass ratio run with a somewhat smaller time constant. The specular reflection of pickup protons results in an increase of the shock potential some distance ahead of the shock foot and ramp. The minimum scale of the cross shock potential during reformation is about 7 electron inertial length λe. We do not find any pickup proton acceleration in the ramp or downstream of the shock beyond the energy which specularly reflected ions gain by the motional electric field of the solar wind during their upstream gyration.

  9. Pickup protons at quasi-perpendicular shocks: full particle electrodynamic simulations

    Directory of Open Access Journals (Sweden)

    S. Matsukiyo

    2007-02-01

    Full Text Available We have performed 3 one-dimensional full particle electromagnetic simulations of a quasi-perpendicular shock with the same Alfvén Mach number MA~5, shock normal-magnetic field angle ΘBn=87° and ion and electron beta (particle to magnetic field pressure of 0.1. In the first run we used an ion to electron mass ratio close to the physical one (mi/me=1024. As expected from previous high mass ratio simulations the Modified Two-Stream instability develops in the foot of the shock, and the shock periodically reforms itself. We have then self-consistently included in the simulation 10% pickup protons distributed on a shell in velocity space as a third component. In a run with an unrealistically low mass ratios of 200 the shock still reforms itself; reformation is due to accumulation of specularly reflected particles at the upstream edge of the foot. In a third run including pickup protons we used a mass ratio of 1024. The shock reforms periodically as in the low mass ratio run with a somewhat smaller time constant. The specular reflection of pickup protons results in an increase of the shock potential some distance ahead of the shock foot and ramp. The minimum scale of the cross shock potential during reformation is about 7 electron inertial length λe. We do not find any pickup proton acceleration in the ramp or downstream of the shock beyond the energy which specularly reflected ions gain by the motional electric field of the solar wind during their upstream gyration.

  10. Permeability enhancement by shock cooling

    Science.gov (United States)

    Griffiths, Luke; Heap, Michael; Reuschlé, Thierry; Baud, Patrick; Schmittbuhl, Jean

    2015-04-01

    The permeability of an efficient reservoir, e.g. a geothermal reservoir, should be sufficient to permit the circulation of fluids. Generally speaking, permeability decreases over the life cycle of the geothermal system. As a result, is usually necessary to artificially maintain and enhance the natural permeability of these systems. One of the methods of enhancement -- studied here -- is thermal stimulation (injecting cold water at low pressure). This goal of this method is to encourage new thermal cracks within the reservoir host rocks, thereby increasing reservoir permeability. To investigate the development of thermal microcracking in the laboratory we selected two granites: a fine-grained (Garibaldi Grey granite, grain size = 0.5 mm) and a course-grained granite (Lanhelin granite, grain size = 2 mm). Both granites have an initial porosity of about 1%. Our samples were heated to a range of temperatures (100-1000 °C) and were either cooled slowly (1 °C/min) or shock cooled (100 °C/s). A systematic microstructural (2D crack area density, using standard stereological techniques, and 3D BET specific surface area measurements) and rock physical property (porosity, P-wave velocity, uniaxial compressive strength, and permeability) analysis was undertaken to understand the influence of slow and shock cooling on our reservoir granites. Microstructurally, we observe that the 2D crack surface area per unit volume and the specific surface area increase as a result of thermal stressing, and, for the same maximum temperature, crack surface area is higher in the shock cooled samples. This observation is echoed by our rock physical property measurements: we see greater changes for the shock cooled samples. We can conclude that shock cooling is an extremely efficient method of generating thermal microcracks and modifying rock physical properties. Our study highlights that thermal treatments are likely to be an efficient method for the "matrix" permeability enhancement of

  11. Shock loading and reactive flow modeling studies of void induced AP/AL/HTPB propellant

    Science.gov (United States)

    Miller, P. J.; Lindfors, A. J.

    1998-07-01

    The unreactive Hugoniot of a class 1.3 propellant has been investigated by shock compression experiments. The results are analyzed in terms of an ignition and growth reactive flow model using the DYNA2D hydrocode. The calculated shock ignition parameters of the model show a linear dependence on measured void volume which appears to reproduce the observed gauge records well. Shock waves were generated by impact in a 75 mm single stage powder gun. Manganin and PVDF pressure gauges provided pressure-time histories to 140 kbar. The propellants were of similar formulation differing only in AP particle size and the addition of a burn rate modifer (Fe2O3) from that of previous investigations. Results show neglible effect of AP particle size on shock response in contrast to the addition of Fe2O3 which appears to `stiffen' the unreactive Hugoniot and enhances significantly the reactive rates under shock. The unreactive Hugoniot, within experimental error, compares favorably to the solid AP Hugoniot. Shock experiments were performed on propellant samples strained to induce insitu voids. The material state was quantified by uniaxial tension dialatometry. The experimental records show a direct correlation between void volume (0 to 1.7%) and chemical reactivity behind the shock front. These results are discussed in terms of `hot spot' ignition resulting from the shock collapse of the voids.

  12. MMS observations of the Earth bow shock during magnetosphere compression and expansion: comparison of whistler wave properties around the shock ramp

    Science.gov (United States)

    Russell, C. T.; Strangeway, R. J.; Schwartz, S. J.

    2017-12-01

    The Magnetospheric Multiscale (MMS) spacecraft, with their state-of-the-art plasma and field instruments onboard, allow us to investigate electromagnetic waves at the bow shock and their association with small-scale disturbances in the shocked plasmas. Understanding these waves could improve our knowledge on the heating of electrons and ions across the shock ramp and the energy dissipation of supercritical shocks. We have found broad-band and narrow band waves across the shock ramp and slightly downstream. The broad-band waves propagate obliquely to the magnetic field direction and have frequencies up to the electron cyclotron frequency, while the narrow-band waves have frequencies of a few hundred Hertz, durations under a second, and are right-handed circularly polarized and propagate along the magnetic field lines. Both wave types are likely to be whistler mode with different generation mechanisms. When the solar wind pressure changes, MMS occasionally observed a pair of bow shocks when the magnetosphere was compressed and then expanded. We compare the wave observations under these two situations to understand their roles in the shock ramp as well as the upstream and downstream plasmas.

  13. Underwater hydraulic shock shovel control system

    Science.gov (United States)

    Liu, He-Ping; Luo, A.-Ni; Xiao, Hai-Yan

    2008-06-01

    The control system determines the effectiveness of an underwater hydraulic shock shovel. This paper begins by analyzing the working principles of these shovels and explains the importance of their control systems. A new type of control system’s mathematical model was built and analyzed according to those principles. Since the initial control system’s response time could not fulfill the design requirements, a PID controller was added to the control system. System response time was still slower than required, so a neural network was added to nonlinearly regulate the proportional element, integral element and derivative element coefficients of the PID controller. After these improvements to the control system, system parameters fulfilled the design requirements. The working performance of electrically-controlled parts such as the rapidly moving high speed switch valve is largely determined by the control system. Normal control methods generally can’t satisfy a shovel’s requirements, so advanced and normal control methods were combined to improve the control system, bringing good results.

  14. Normal foot and ankle

    International Nuclear Information System (INIS)

    Weissman, S.D.

    1989-01-01

    The foot may be thought of as a bag of bones tied tightly together and functioning as a unit. The bones re expected to maintain their alignment without causing symptomatology to the patient. The author discusses a normal radiograph. The bones must have normal shape and normal alignment. The density of the soft tissues should be normal and there should be no fractures, tumors, or foreign bodies

  15. Geomagnetic activity associated with Earth passage of interplanetary shock disturbances and coronal mass ejections

    International Nuclear Information System (INIS)

    Gosling, J.T.; McComas, D.J.; Phillips, J.L.; Bame, S.J.

    1991-01-01

    Previous work indicates that virtually all transient shock wave disturbances in the solar wind are driven by fast coronal mass ejection events (CMEs). Using a recently appreciated capability for distinguishing CMEs in solar wind data in the form of counterstreaming solar wind electron events, this paper explores the overall effectiveness of shock wave disturbances and CMEs in general in stimulating geomagnetic activity. The study is confined to the interval from mid-August 1978 through mid-October 1982, spanning the last solar activity maximum, when ISEE 3 was in orbit about the L1 Lagrange point 220 R e upstream from Earth. The authors find that all but one of the 37 largest geomagnetic storms in that era were associated with Earth passage of CMEs and/or shock disturbances, with the large majority of these storms being associated with interplanetary events where Earth encountered both a shock and the CME driving the shock (shock/CME events). Although CMEs and/or shock disturbances were increasingly the cause of geomagnetic activity as the level of geomagnetic activity increased, many smaller geomagnetic disturbances were unrelated to these events. Further, approximately half of all CMEs and half of all shock disturbances encountered by Earth did not produce any substantial geomagnetic activity as measured by the planetary geomagnetic index Kp. The geomagnetic effectiveness of Earth directed CMEs and shock wave disturbances was directly related to the flow speed, the magnetic field magnitude, and the strength of the southward (GSM) field component associated with the events. The initial speed of a CME close to the Sun appears to be the most crucial factor in determining if an earthward directed event will be effective in exciting a large geomagnetic disturbance

  16. Inappropriate shocks in the subcutaneous ICD

    DEFF Research Database (Denmark)

    Olde Nordkamp, Louise R A; Brouwer, Tom F; Barr, Craig

    2015-01-01

    shocks have been reported. METHODS: We analyzed the incidence, predictors and management of inappropriate shocks in the EFFORTLESS S-ICD Registry, which collects S-ICD implantation information and follow-up data from clinical centers in Europe and New Zealand. RESULTS: During a follow-up of 21 ± 13...... xyphoid to V6) reduced the risk. Reprogramming or optimization of SVT treatment after the first clinical event of inappropriate shock was successful in preventing further inappropriate shocks for cardiac oversensing and SVT events. CONCLUSIONS: Inappropriate shocks, mainly due to cardiac oversensing...

  17. Nonstationarity of a two-dimensional quasiperpendicular supercritical collisionless shock by self-reformation

    International Nuclear Information System (INIS)

    Lembege, B.; Savoini, P.

    1992-01-01

    Two-dimensional electromagnetic particle simulations evidence a self-reformation of the shock front for a collisionless supercritical magnetosonic shock propagating at angle θ 0 around 90 degree, where θ 0 is the angle between the normal to the shock front and the upstream magnetostatic field. This self-reformation is due to reflected ions which accumulate in front of the shock and is observed (i) in both electric and magnetic components, (ii) for both resistive and nonresistive two-dimensional shocks, and (iii) over a cyclic time period equal to the mean ion gyroperiod measured downstream in the overshoot; resistive effects may be self-consistently included or excluded for θ 0 congruent 90 degree according to a judicious choice of the upstream magnetostatic field orientation. The self-reformation leads to a nonstationary behavior of the shock; however, present results show evidence that the shock becomes stationary for θ less than a critical value θ r , below which the self-reformation disappears. Present results are compared to previous works where one/two-dimensional hybrid and particle codes have been used, and to experimental measurements

  18. Shock and vibration environments for large shipping containers on rail cars and trucks

    International Nuclear Information System (INIS)

    Magnuson, C.F.; Wilson, L.T.

    1977-06-01

    The purpose of this study was to provide definitions of shock and vibration environment to which fissile material shipping containers may be exposed during normal shipment by truck and rail cars. The definitions of vibration, shock superimposed on vibration and rail coupling shock result from existing data. The dependence of shock environment, from rail coupling operations, on parameters like cargo weight and shock attenuation couplers was also studied using spring-mass models. These studies show that for rail cars equipped with standard draft gear, the cargo response decreases with increased cargo weight until the springs bottom out. For rail cars equipped with shock attenuation couplers, cargo weight has little effect on cargo response. The study also shows the importance of matching couplers and tiedown stiffnesses to decrease the cargo response. Vibration and shock data samples have been obtained during truck shipment of heavy cargo and the data will be presented in subsequent reports. Similar data need to be obtained for rail shipment of heavy cargo and during rail coupling operations with heavy cargo

  19. Perpendicular relativistic shocks in magnetized pair plasma

    Science.gov (United States)

    Plotnikov, Illya; Grassi, Anna; Grech, Mickael

    2018-04-01

    Perpendicular relativistic (γ0 = 10) shocks in magnetized pair plasmas are investigated using two dimensional Particle-in-Cell simulations. A systematic survey, from unmagnetized to strongly magnetized shocks, is presented accurately capturing the transition from Weibel-mediated to magnetic-reflection-shaped shocks. This transition is found to occur for upstream flow magnetizations 10-3 10-2, it leaves place to a purely electromagnetic precursor following from the strong emission of electromagnetic waves at the shock front. Particle acceleration is found to be efficient in weakly magnetized perpendicular shocks in agreement with previous works, and is fully suppressed for σ > 10-2. Diffusive Shock Acceleration is observed only in weakly magnetized shocks, while a dominant contribution of Shock Drift Acceleration is evidenced at intermediate magnetizations. The spatial diffusion coefficients are extracted from the simulations allowing for a deeper insight into the self-consistent particle kinematics and scale with the square of the particle energy in weakly magnetized shocks. These results have implications for particle acceleration in the internal shocks of AGN jets and in the termination shocks of Pulsar Wind Nebulae.

  20. Computations of the Shock Waves at Hypersonic Velocities Taken into Account the Chemical Reactions that Appear in the Air at High Temperatures

    Directory of Open Access Journals (Sweden)

    Mihai Leonida NICULESCU

    2015-09-01

    Full Text Available The temperature in the nose region of a hypersonic vehicle can be extremely high, for example, reaching approximately 11 000 K at a Mach number of 36 (Apollo reentry. The bow shock wave is normal, or nearly normal, in the nose region of a blunt body, and the gas temperature behind this shock wave can be enormous at hypersonic speeds. In this case, the assumption of a calorically perfect nonreacting gas with the ratio of specific heats  of 1.4 gives an unrealistically high value of temperature. Therefore, the proper inclusion of chemically reacting effects is vital to the calculation of an accurate normal shock wave temperature.

  1. Initial conditions of radiative shock experiments

    International Nuclear Information System (INIS)

    Kuranz, C. C.; Drake, R. P.; Krauland, C. M.; Marion, D. C.; Grosskopf, M. J.; Rutter, E.; Torralva, B.; Holloway, J. P.; Bingham, D.; Goh, J.; Boehly, T. R.; Sorce, A. T.

    2013-01-01

    We performed experiments at the Omega Laser Facility to characterize the initial, laser-driven state of a radiative shock experiment. These experiments aimed to measure the shock breakout time from a thin, laser-irradiated Be disk. The data are then used to inform a range of valid model parameters, such as electron flux limiter and polytropic γ, used when simulating radiative shock experiments using radiation hydrodynamics codes. The characterization experiment and the radiative shock experiment use a laser irradiance of ∼7 × 10 14 W cm −2 to launch a shock in the Be disk. A velocity interferometer and a streaked optical pyrometer were used to infer the amount of time for the shock to move through the Be disk. The experimental results were compared with simulation results from the Hyades code, which can be used to model the initial conditions of a radiative shock system using the CRASH code

  2. Exploratory laser-driven shock wave studies

    International Nuclear Information System (INIS)

    Solem, J.C.; Veeser, L.R.

    1977-11-01

    We show the results of a feasibility study for investigating shock structure and for measuring equation-of-state parameters using high-energy, short-pulse lasers. We discuss the temporal and spatial structure of the luminosity from laser-driven shock unloading in aluminum foils. We demonstrate that shock velocity can be measured by observing the time interval between shock emergence across two thicknesses and show data for shocks of 1.3 and 2.1 Mbar. The fact that we observe shock fronts cleanly breaking through steps as small as 3 μm indicates that the shock front thickness is very small in the few megabar region; this is the first experimental verification that these fronts are not more than a few micrometers thick. We present approximate measurements of free-surface velocity. Finally, we speculate on the use of these techniques to obtain detailed equation-of-state data

  3. Shock-induced chemistry in organic materials

    Energy Technology Data Exchange (ETDEWEB)

    Dattelbaum, Dana M [Los Alamos National Laboratory; Sheffield, Steve [Los Alamos National Laboratory; Engelke, Ray [Los Alamos National Laboratory; Manner, Virginia [Los Alamos National Laboratory; Chellappa, Raja [Los Alamos National Laboratory; Yoo, Choong - Shik [WASHINGTON STATE UNIV

    2011-01-20

    The combined 'extreme' environments of high pressure, temperature, and strain rates, encountered under shock loading, offer enormous potential for the discovery of new paradigms in chemical reactivity not possible under more benign conditions. All organic materials are expected to react under these conditions, yet we currently understand very little about the first bond-breaking steps behind the shock front, such as in the shock initiation of explosives, or shock-induced reactivity of other relevant materials. Here, I will present recent experimental results of shock-induced chemistry in a variety of organic materials under sustained shock conditions. A comparison between the reactivity of different structures is given, and a perspective on the kinetics of reaction completion under shock drives.

  4. Experimental methods of shock wave research

    CERN Document Server

    Seiler, Friedrich

    2016-01-01

    This comprehensive and carefully edited volume presents a variety of experimental methods used in Shock Waves research. In 14 self contained chapters this 9th volume of the “Shock Wave Science and Technology Reference Library” presents the experimental methods used in Shock Tubes, Shock Tunnels and Expansion Tubes facilities. Also described is their set-up and operation. The uses of an arc heated wind tunnel and a gun tunnel are also contained in this volume. Whenever possible, in addition to the technical description some typical scientific results obtained using such facilities are described. Additionally, this authoritative book includes techniques for measuring physical properties of blast waves and laser generated shock waves. Information about active shock wave laboratories at different locations around the world that are not described in the chapters herein is given in the Appendix, making this book useful for every researcher involved in shock/blast wave phenomena.

  5. Motion of shocks through interplanetary streams

    International Nuclear Information System (INIS)

    Burlaga, L.F.; Scudder, J.D.

    1975-01-01

    A model for the motion of flare-generated shocks through interplanetary streams is presented, illustrating the effects of a stream-shock interaction on the shock strength and geometry. It is a gas dynamic calculation based on Whitham's method and on an empirical approximation for the relevant characteristics of streams. The results show that the Mach number of a shock can decrease appreciably to near unity in the interaction region ahead of streams and that the interaction of a spherically symmetric shock with a spiral-shaped corotating stream can cause significant distortions of the initial shock front geometry. The geometry of the February 15--16, 1967, shock discussed by Lepping and Chao (1972) is qualitatively explained by this model

  6. Do oil shocks predict economic policy uncertainty?

    Science.gov (United States)

    Rehman, Mobeen Ur

    2018-05-01

    Oil price fluctuations have influential role in global economic policies for developed as well as emerging countries. I investigate the role of international oil prices disintegrated into structural (i) oil supply shock, (ii) aggregate demand shock and (iii) oil market specific demand shocks, based on the work of Kilian (2009) using structural VAR framework on economic policies uncertainty of sampled markets. Economic policy uncertainty, due to its non-linear behavior is modeled in a regime switching framework with disintegrated structural oil shocks. Our results highlight that Indian, Spain and Japanese economic policy uncertainty responds to the global oil price shocks, however aggregate demand shocks fail to induce any change. Oil specific demand shocks are significant only for China and India in high volatility state.

  7. Shock Wave Dynamics in Weakly Ionized Plasmas

    Science.gov (United States)

    Johnson, Joseph A., III

    1999-01-01

    An investigation of the dynamics of shock waves in weakly ionized argon plasmas has been performed using a pressure ruptured shock tube. The velocity of the shock is observed to increase when the shock traverses the plasma. The observed increases cannot be accounted for by thermal effects alone. Possible mechanisms that could explain the anomalous behavior include a vibrational/translational relaxation in the nonequilibrium plasma, electron diffusion across the shock front resulting from high electron mobility, and the propagation of ion-acoustic waves generated at the shock front. Using a turbulence model based on reduced kinetic theory, analysis of the observed results suggest a role for turbulence in anomalous shock dynamics in weakly ionized media and plasma-induced hypersonic drag reduction.

  8. Lack of effect of laboratory-provoked anxiety on plasma homovanillic acid concentration in normal subjects.

    Science.gov (United States)

    Zemishlany, Z; Davidson, M

    1996-08-15

    The present study was undertaken to investigate if acute anxiety can affect plasma concentrations of homovanillic acid (pHVA). Since elevated pHVA levels have been associated with severity of schizophrenic symptoms, the results of this study will help determine if the pHVA elevations are directly related to psychosis or if anxiety is also a contributory factor. Anxiety was provoked in 10 young normal subjects by a combined paradigm of mental arithmetic task and threat of electrical shock. A significant increase in self-ratings of anxiety, blood pressure, and plasma levels of norepinephrine, 3-methoxy-4-hydroxyphenylethyleneglycol and growth hormone indicated that the paradigm used was effective in provoking anxiety; however, anxiety did not affect pHVA concentrations. The results may support the notion that increased pHVA levels in severely ill schizophrenic patients are related to the schizophrenic pathophysiology rather than to anxiety.

  9. Evaluating the Mechanism of Oil Price Shocks and Fiscal Policy Responses in the Malaysian Economy

    International Nuclear Information System (INIS)

    Bekhet, Hussain A; Yusoff, Nora Yusma Mohamed

    2013-01-01

    The paper aims to explore the symmetric impact of oil price shock on economy, to understand its mechanism channel and how fiscal policy response towards it. The Generalized Impulse Response Function and Variance Decomposition under the VAR methodology were employed. The empirical findings suggest that symmetric oil price shock has a positive and direct impact on oil revenue and government expenditure. However, the real GDP is vulnerable in a short-term but not in the long term period. These results would confirm that fiscal policy is the main mechanism channel that mitigates the adverse effects oil price shocks to the economy.

  10. Development of a General Shocked-Materials-Response Description for Simulations

    Energy Technology Data Exchange (ETDEWEB)

    Steven M. Valone

    2000-07-01

    This report outlines broad modeling issues pertaining to polymeric materials behavior under detonation conditions. Models applicable system wide are necessary to cope with the broad range of polymers and complex composite forms that can appear in Laboratory weapons systems. Nine major topics are discussed to span the breadth of materials, forms, and physical phenomena encountered when shocking polymers and foams over wide ranges of temperatures, pressures, shock strengths, confinement conditions, and geometries. The recommendations for directions of more intensive investigation consider physical fidelity, computational complexity, and application over widely varying physical conditions of temperature, pressure, and shock strength.

  11. Evaluating the Mechanism of Oil Price Shocks and Fiscal Policy Responses in the Malaysian Economy

    Science.gov (United States)

    Bekhet, Hussain A.; Yusoff, Nora Yusma Mohamed

    2013-06-01

    The paper aims to explore the symmetric impact of oil price shock on economy, to understand its mechanism channel and how fiscal policy response towards it. The Generalized Impulse Response Function and Variance Decomposition under the VAR methodology were employed. The empirical findings suggest that symmetric oil price shock has a positive and direct impact on oil revenue and government expenditure. However, the real GDP is vulnerable in a short-term but not in the long term period. These results would confirm that fiscal policy is the main mechanism channel that mitigates the adverse effects oil price shocks to the economy.

  12. EVOLUTION OF SHOCKS AND TURBULENCE IN MAJOR CLUSTER MERGERS

    International Nuclear Information System (INIS)

    Paul, S.; Mannheim, K.; Iapichino, L.; Miniati, F.; Bagchi, J.

    2011-01-01

    We performed a set of cosmological simulations of major mergers in galaxy clusters, in order to study the evolution of merger shocks and the subsequent injection of turbulence in the post-shock region and in the intra-cluster medium (ICM). The computations have been performed with the grid-based, adaptive mesh refinement hydrodynamical code Enzo, using a refinement criterion especially designed for refining turbulent flows in the vicinity of shocks. When a major merger event occurs, a substantial amount of turbulence energy is injected in the ICM of the newly formed cluster. Our simulations show that the shock launched after a major merger develops an ellipsoidal shape and gets broken by the interaction with the filamentary cosmic web around the merging cluster. The size of the post-shock region along the direction of shock propagation is of the order of 300 kpc h -1 , and the turbulent velocity dispersion in this region is larger than 100 km s -1 . We performed a scaling analysis of the turbulence energy within our cluster sample. The best fit for the scaling of the turbulence energy with the cluster mass is consistent with M 5/3 , which is also the scaling law for the thermal energy in the self-similar cluster model. This clearly indicates the close relation between virialization and injection of turbulence in the cluster evolution. As for the turbulence in the cluster core, we found that within 2 Gyr after the major merger (the timescale for the shock propagation in the ICM), the ratio of the turbulent to total pressure is larger than 10%, and after about 4 Gyr it is still larger than 5%, a typical value for nearly relaxed clusters. Turbulence at the cluster center is thus sustained for several gigayears, which is substantially longer than typically assumed in the turbulent re-acceleration models, invoked to explain the statistics of observed radio halos. Striking similarities in the morphology and other physical parameters between our simulations and the

  13. An empirical model of the Earth's bow shock based on an artificial neural network

    Science.gov (United States)

    Pallocchia, Giuseppe; Ambrosino, Danila; Trenchi, Lorenzo

    2014-05-01

    All of the past empirical models of the Earth's bow shock shape were obtained by best-fitting some given surfaces to sets of observed crossings. However, the issue of bow shock modeling can be addressed by means of artificial neural networks (ANN) as well. In this regard, here it is presented a perceptron, a simple feedforward network, which computes the bow shock distance along a given direction using the two angular coordinates of that direction, the bow shock predicted distance RF79 (provided by Formisano's model (F79)) and the upstream alfvénic Mach number Ma. After a brief description of the ANN architecture and training method, we discuss the results of the statistical comparison, performed over a test set of 1140 IMP8 crossings, between the prediction accuracies of ANN and F79 models.

  14. Numerical solutions of several reflected shock-wave flow fields with nonequilibrium chemical reactions

    Science.gov (United States)

    Hanson, R. K.; Presley, L. L.; Williams, E. V.

    1972-01-01

    The method of characteristics for a chemically reacting gas is used in the construction of the time-dependent, one-dimensional flow field resulting from the normal reflection of an incident shock wave at the end wall of a shock tube. Nonequilibrium chemical reactions are allowed behind both the incident and reflected shock waves. All the solutions are evaluated for oxygen, but the results are generally representative of any inviscid, nonconducting, and nonradiating diatomic gas. The solutions clearly show that: (1) both the incident- and reflected-shock chemical relaxation times are important in governing the time to attain steady state thermodynamic properties; and (2) adjacent to the end wall, an excess-entropy layer develops wherein the steady state values of all the thermodynamic variables except pressure differ significantly from their corresponding Rankine-Hugoniot equilibrium values.

  15. Propagation of shock waves in elastic solids caused by cavitation microjet impact. I: Theoretical formulation.

    Science.gov (United States)

    Zhong, P; Chuong, C J

    1993-07-01

    To understand the physical process of the impingement of cavitation microjet and the resultant shock wave propagation in an elastic solid, a theoretical model using geometrical acoustics was developed. Shock waves induced in both the jet head (water) and the solid were analyzed during a tri-supersonic impact configuration when the contact edge between the jet head and the elastic boundary expands faster than the longitudinal wave speed in the solid. Impact pressure at the boundary was solved using continuity conditions along the boundary normal. Reflection and refraction of shock waves from a solid-water interface were also included in the model. With this model, the impact pressure at the solid boundary and the stress, strain as well as velocity discontinuities at the propagating shock fronts were calculated. A comparison with results from previous studies shows that this model provides a more complete and general solution for the jet impact problem.

  16. Comparison of local International Sensitivity Index calibration and 'Direct INR' methods in correction of locally reported International Normalized Ratios: an international study. On behalf of the European Action of Anticoagulation

    DEFF Research Database (Denmark)

    Poller, L; Keown, M; Ibrahim, S

    2007-01-01

    collaborative study at 77 centers has compared local INR correction using the two alternative methods recommended in the Scientific and Standardization Committee of the International Society on Thrombosis and Haemostasis guidelines: local ISI calibration and 'Direct INR'. METHODS: Success of INR correction...

  17. Study on Reflected Shock Wave/Boundary Layer Interaction in a Shock Tube

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Dong Wook; Kim, Tae Ho; Kim, Heuy Dong [Andong Nat’l Univ., Andong (Korea, Republic of)

    2017-07-15

    The interaction between a shock wave and a boundary layer causes boundary layer separation, shock train, and in some cases, strong unsteadiness in the flow field. Such a situation is also observed in a shock tube, where the reflected shock wave interacts with the unsteady boundary layer. However, only a few studies have been conducted to investigate the shock train phenomenon in a shock tube. In the present study, numerical studies were conducted using the two-dimensional axisymmetric domain of a shock tube, and compressible Navier-Stokes equations were solved to clarify the flow characteristics of shock train phenomenon inside a shock tube. A detailed wave diagram was developed based on the present computational results, which were validated with existing experimental data.

  18. Ploidy Manipulation of Zebrafish Embryos with Heat Shock 2 Treatment

    OpenAIRE

    Baars, Destiny L.; Takle, Kendra A.; Heier, Jonathon; Pelegri, Francisco

    2016-01-01

    Manipulation of ploidy allows for useful transformations, such as diploids to tetraploids, or haploids to diploids. In the zebrafish Danio rerio, specifically the generation of homozygous gynogenetic diploids is useful in genetic analysis because it allows the direct production of homozygotes from a single heterozygous mother. This article describes a modified protocol for ploidy duplication based on a heat pulse during the first cell cycle, Heat Shock 2 (HS2). Through inhibition of centriole...

  19. Individual and combined effects of organic, toxic, and hydraulic shocks on sequencing batch reactor in treating petroleum refinery wastewater

    Energy Technology Data Exchange (ETDEWEB)

    Mizzouri, Nashwan Sh., E-mail: nashwan_mizzouri@yahoo.com [Department of Civil Engineering, University of Malaya, Lembah Pantai, 50603 Kuala Lumpur (Malaysia); Department of Civil Engineering, University of Duhok, Kurdistan (Iraq); Shaaban, Md Ghazaly [Department of Civil Engineering, University of Malaya, Lembah Pantai, 50603 Kuala Lumpur (Malaysia)

    2013-04-15

    Highlights: ► This research focuses on the combined impact of shock loads on the PRWW treatment. ► System failure resulted when combined shock of organic and hydraulic was applied. ► Recovery was achieved by replacing glucose with PRWW and OLR was decreased to half. ► Worst COD removals were 68.9, and 57.8% for organic, and combined shocks. -- Abstract: This study analyzes the effects of toxic, hydraulic, and organic shocks on the performance of a lab-scale sequencing batch reactor (SBR) with a capacity of 5 L. Petroleum refinery wastewater (PRWW) was treated with an organic loading rate (OLR) of approximately 0.3 kg chemical oxygen demand (COD)/kg MLSS d at 12.8 h hydraulic retention time (HRT). A considerable variation in the COD was observed for organic, toxic, hydraulic, and combined shocks, and the worst values observed were 68.9, 77.1, 70.2, and 57.8%, respectively. Improved control of toxic shock loads of 10 and 20 mg/L of chromium (VI) was identified. The system was adversely affected by the organic shock when a shock load thrice the normal value was used, and this behavior was repeated when the hydraulic shock was 4.8 h HRT. The empirical recovery period was greater than the theoretical period because of the inhibitory effects of phenols, sulfides, high oil, and grease in the PRWW. The system recovery rates from the shocks were in the following order: toxic, organic, hydraulic, and combined shocks. System failure occurred when the combined shocks of organic and hydraulic were applied. The system was resumed by replacing the PRWW with glucose, and the OLR was reduced to half its initial value.

  20. Insight into magnetorheological shock absorbers

    CERN Document Server

    Gołdasz, Janusz

    2015-01-01

    This book deals with magnetorheological fluid theory, modeling and applications of automotive magnetorheological dampers. On the theoretical side a review of MR fluid compositions and key factors affecting the characteristics of these fluids is followed by a description of existing applications in the area of vibration isolation and flow-mode shock absorbers in particular. As a majority of existing magnetorheological devices operates in a so-called flow mode a critical review is carried out in that regard. Specifically, the authors highlight common configurations of flow-mode magnetorheological shock absorbers, or so-called MR dampers that have been considered by the automotive industry for controlled chassis applications. The authors focus on single-tube dampers utilizing a piston assembly with one coil or multiple coils and at least one annular flow channel in the piston.