WorldWideScience

Sample records for shift assays emsa

  1. The electrophoretic mobility shift assay (EMSA)

    OpenAIRE

    sprotocols

    2015-01-01

    The electrophoretic mobility shift assay (EMSA), also known as “gel shift assay”, is used to examine the binding parameters and relative affinities of protein and DNA interactions. We produced recombinant CCA1 protein and tested its binding affinity for the promoter fragments that contain CBS (AAAAATCT) or evening element (EE, AAAATATCT) (1) using a modified procedure adopted from published protocols (2,3).

  2. Biochemical techniques for the characterization of G-quadruplex structures: EMSA, DMS footprinting, and DNA polymerase stop assay.

    Science.gov (United States)

    Sun, Daekyu; Hurley, Laurence H

    2010-01-01

    The proximal promoter region of many human growth-related genes contains a polypurine/polypyrimidine tract that serves as multiple binding sites for Sp1 or other transcription factors. These tracts often contain a guanine-rich sequence consisting of four runs of three or more contiguous guanines separated by one or more bases, corresponding to a general motif known for the formation of an intramolecular G-quadruplex. Recent results provide strong evidence that specific G-quadruplex structures form naturally within these polypurine/polypyrimidine tracts in many human promoter regions, raising the possibility that the transcriptional control of these genes can be modulated by G-quadruplex-interactive agents. In this chapter, we describe three general biochemical methodologies, electrophoretic mobility shift assay (EMSA), dimethylsulfate (DMS) footprinting, and the DNA polymerase stop assay, which can be useful for initial characterization of G-quadruplex structures formed by G-rich sequences.

  3. Using electrophoretic mobility shift assays to measure equilibrium dissociation constants: GAL4-p53 binding DNA as a model system.

    Science.gov (United States)

    Heffler, Michael A; Walters, Ryan D; Kugel, Jennifer F

    2012-01-01

    An undergraduate biochemistry laboratory experiment is described that will teach students the practical and theoretical considerations for measuring the equilibrium dissociation constant (K(D) ) for a protein/DNA interaction using electrophoretic mobility shift assays (EMSAs). An EMSA monitors the migration of DNA through a native gel; the DNA migrates more slowly when bound to a protein. To determine a K(D) the amount of unbound and protein-bound DNA in the gel is measured as the protein concentration increases. By performing this experiment, students will be introduced to making affinity measurements and gain experience in performing quantitative EMSAs. The experiment describes measuring the K(D) for the interaction between the chimeric protein GAL4-p53 and its DNA recognition site; however, the techniques are adaptable to other DNA binding proteins. In addition, the basic experiment described can be easily expanded to include additional inquiry-driven experimentation. © 2012 by The International Union of Biochemistry and Molecular Biology. Copyright © 2012 Wiley Periodicals, Inc.

  4. siRNA Transfection and EMSA Analyses on Freshly Isolated Human Villous Cytotrophoblasts.

    Science.gov (United States)

    Lokossou, Adjimon Gatien; Toufaily, Chirine; Vargas, Amandine; Barbeau, Benoit

    2016-09-20

    Human primary villous cytotrophoblasts are a very useful source of primary cells to study placental functions and regulatory mechanisms, and to comprehend diseases related to pregnancy. In this protocol, human primary villous cytotrophoblasts freshly isolated from placentas through a standard DNase/trypsin protocol are microporated with small interfering RNA (siRNA). This approach provided greater efficiency for siRNA transfection when compared to a lipofection-based method. Transfected cells can subsequently be analyzed by standard Western blot within a time frame of 3-4 days post-transfection. In addition, using cultured primary villous cytotrophoblasts, Electrophoretic Mobility Shift Assay (EMSA) analysis was optimized and performed on extracts from days 1 to 4. The use of these cultured primary cells and the protocol described allow for an evaluation of the implication of specific genes and transcription factors in the process of villous cytotrophoblast differentiation into a syncytiotrophoblast-like cell layer. However, the limited time span allowable in culture precludes the use of methods requiring more time, such as generation of a stable cell population. Therefore testing of this cell population requires highly optimized gene transfer protocols.

  5. Polyherbal EMSA ERITIN Promotes Erythroid Lineages and Lymphocyte Migration in Irradiated Mice

    Directory of Open Access Journals (Sweden)

    Ibrahim Mansur

    2016-01-01

    Full Text Available Radiotherapy is commonly used to kill malignant cells, but it can significantly deplete hematopoietic and splenic erythroblasts. Radioprotective agents are therefore very important in clinical radiotherapy. We examined the effect of poly-herbal EMSA ERITIN on immunological responses when administered to sublethally irradiated mice with the aim of highlighting promotes erythroid lineages and lymphocytes migration in irradiated mice with the parameter are TER119+CD123+in bone marrow and SDF-1 in bone marrow and spleen organ. Normal BALB/c mice were sublethally irradiated with 600 rad. EMSA ERITIN was administered orally at different doses:(1.04, 3.125 and 9.375 mg/g body weight for 15 days. On day 16 erythroid lineages (TER-119+CD123+ were observed in bone marrow and lymphocytes migration by the production of SDF-1 in spleen and bone marrow. Lymphocytes migration was indicated by the production of SDF-1 in spleen and bone marrow using flow cytometry analysis. EMSA ERITIN increased the generation of erythroid lineage cells marked by TER119+CD123+ and promoted lymphocyte migration by increasing SDF-1 production in bone marrow and spleen. EMSA ERITIN appears to be a powerful medicinal herb with potential as a food supplement to normalize homeostasis and erythropoiesis after radiation.

  6. Optimization of protein samples for NMR using thermal shift assays

    International Nuclear Information System (INIS)

    Kozak, Sandra; Lercher, Lukas; Karanth, Megha N.; Meijers, Rob; Carlomagno, Teresa; Boivin, Stephane

    2016-01-01

    Maintaining a stable fold for recombinant proteins is challenging, especially when working with highly purified and concentrated samples at temperatures >20 °C. Therefore, it is worthwhile to screen for different buffer components that can stabilize protein samples. Thermal shift assays or ThermoFluor"® provide a high-throughput screening method to assess the thermal stability of a sample under several conditions simultaneously. Here, we describe a thermal shift assay that is designed to optimize conditions for nuclear magnetic resonance studies, which typically require stable samples at high concentration and ambient (or higher) temperature. We demonstrate that for two challenging proteins, the multicomponent screen helped to identify ingredients that increased protein stability, leading to clear improvements in the quality of the spectra. Thermal shift assays provide an economic and time-efficient method to find optimal conditions for NMR structural studies.

  7. Optimization of protein samples for NMR using thermal shift assays

    Energy Technology Data Exchange (ETDEWEB)

    Kozak, Sandra [European Molecular Biology Laboratory (EMBL), Hamburg Outstation, SPC Facility (Germany); Lercher, Lukas; Karanth, Megha N. [European Molecular Biology Laboratory (EMBL), SCB Unit (Germany); Meijers, Rob [European Molecular Biology Laboratory (EMBL), Hamburg Outstation, SPC Facility (Germany); Carlomagno, Teresa, E-mail: teresa.carlomagno@oci.uni-hannover.de [European Molecular Biology Laboratory (EMBL), SCB Unit (Germany); Boivin, Stephane, E-mail: sboivin77@hotmail.com, E-mail: s.boivin@embl-hamburg.de [European Molecular Biology Laboratory (EMBL), Hamburg Outstation, SPC Facility (Germany)

    2016-04-15

    Maintaining a stable fold for recombinant proteins is challenging, especially when working with highly purified and concentrated samples at temperatures >20 °C. Therefore, it is worthwhile to screen for different buffer components that can stabilize protein samples. Thermal shift assays or ThermoFluor{sup ®} provide a high-throughput screening method to assess the thermal stability of a sample under several conditions simultaneously. Here, we describe a thermal shift assay that is designed to optimize conditions for nuclear magnetic resonance studies, which typically require stable samples at high concentration and ambient (or higher) temperature. We demonstrate that for two challenging proteins, the multicomponent screen helped to identify ingredients that increased protein stability, leading to clear improvements in the quality of the spectra. Thermal shift assays provide an economic and time-efficient method to find optimal conditions for NMR structural studies.

  8. Specific DNA Binding of a Potential Transcriptional Regulator, Inosine 5′-Monophosphate Dehydrogenase-Related Protein VII, to the Promoter Region of a Methyl Coenzyme M Reductase I-Encoding Operon Retrieved from Methanothermobacter thermautotrophicus Strain ΔH▿

    OpenAIRE

    Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi

    2008-01-01

    Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus ΔH are expressed in response to H2 availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cul...

  9. A substrate-optimized electrophoretic mobility shift assay for ADAM12

    DEFF Research Database (Denmark)

    Kotzsch, Alexander; Skovgaard, Tine; Buus, Uwe

    2014-01-01

    long been investigated as pharmaceutical drug targets; however, due to lack of potency and in vivo side effects, none of the small-molecule inhibitors discovered so far has made it beyond clinical testing. Ongoing research on novel selective inhibitors of ADAMs requires reliable biochemical assays...... to validate molecular probes from large-scale screening efforts. Here we describe an electrophoretic mobility shift assay for ADAM12 based on the identification of an optimized peptide substrate that is characterized by excellent performance and reproducibility....

  10. Agarose gel shift assay reveals that calreticulin favors substrates with a quaternary structure in solution

    DEFF Research Database (Denmark)

    Boelt, Sanne Grundvad; Houen, Gunnar; Højrup, Peter

    2015-01-01

    Here we present an agarose gel shift assay that, in contrast to other electrophoresis approaches, is loaded in the center of the gel. This allows proteins to migrate in either direction according to their isoelectric points. Therefore, the presented assay enables a direct visualization, separation...... structure. It is also demonstrated that the agarose gel shift assay is useful in the study of other protein interactions and can be used as an alternative method to native polyacrylamide gel electrophoresis....... measure of interactions. Therefore, no interaction studies between calreticulin and substrates in solution have been investigated previously. The results presented here indicate that calreticulin has a preference for substrates with a quaternary structure and primarily β-sheets in their secondary...

  11. Core Promoter Structure in the Oomycete Phytophthora infestans

    Science.gov (United States)

    McLeod, Adele; Smart, Christine D.; Fry, William E.

    2004-01-01

    We have investigated the core promoter structure of the oomycete Phytophthora infestans. The transcriptional start sites (TSS) of three previously characterized P. infestans genes, Piexo1, Piexo3, and Piendo1, were determined by primer extension analyses. The TSS regions were homologous to a previously identified 16-nucleotide (nt) core sequence that overlaps the TSS in most oomycete genes. The core promoter regions of Piexo1 and Piendo1 were investigated by using a transient protoplast expression assay and the reporter gene β-glucuronidase. Mutational analyses of the promoters of Piexo1 and Piendo1 showed that there is a putative core promoter element encompassing the TSS (−2 to + 5) that has high sequence and functional homology to a known core promoter element present in other eukaryotes, the initiator element (Inr). Downstream and flanking the Inr is a highly conserved oomycete promoter region (+7 to + 15), hereafter referred to as FPR (flanking promoter region), which is also important for promoter function. The importance of the 19-nt core promoter region (Inr and FPR) in Piexo1 and Piendo1 was further investigated through electrophoretic mobility shift assays (EMSA). The EMSA studies showed that (i) both core promoters were able to specifically bind a protein or protein complex in a P. infestans whole-cell protein extract and (ii) the same mutations that reduced binding of the EMSA complex also reduced β-glucuronidase (GUS) levels in transient expression assays. The consistency of results obtained using two different assays (GUS transient assays [in vivo] and EMSA studies [in vitro]) supports a convergence of inference about the relative importance of specific nucleotides within the 19-nt core promoter region. PMID:14871940

  12. Analysis of protein stability and ligand interactions by thermal shift assay.

    Science.gov (United States)

    Huynh, Kathy; Partch, Carrie L

    2015-02-02

    Purification of recombinant proteins for biochemical assays and structural studies is time-consuming and presents inherent difficulties that depend on the optimization of protein stability. The use of dyes to monitor thermal denaturation of proteins with sensitive fluorescence detection enables rapid and inexpensive determination of protein stability using real-time PCR instruments. By screening a wide range of solution conditions and additives in a 96-well format, the thermal shift assay easily identifies conditions that significantly enhance the stability of recombinant proteins. The same approach can be used as an initial low-cost screen to discover new protein-ligand interactions by capitalizing on increases in protein stability that typically occur upon ligand binding. This unit presents a methodological workflow for small-scale, high-throughput thermal denaturation of recombinant proteins in the presence of SYPRO Orange dye. Copyright © 2015 John Wiley & Sons, Inc.

  13. Demonstrating Interactions of Transcription Factors with DNA by Electrophoretic Mobility Shift Assay.

    Science.gov (United States)

    Yousaf, Nasim; Gould, David

    2017-01-01

    Confirming the binding of a transcription factor with a particular DNA sequence may be important in characterizing interactions with a synthetic promoter. Electrophoretic mobility shift assay is a powerful approach to demonstrate the specific DNA sequence that is bound by a transcription factor and also to confirm the specific transcription factor involved in the interaction. In this chapter we describe a method we have successfully used to demonstrate interactions of endogenous transcription factors with sequences derived from endogenous and synthetic promoters.

  14. PuF, an antimetastatic and developmental signaling protein, interacts with the Alzheimer’s amyloid-β precursor protein via a tissue-specific proximal regulatory element (PRE

    Directory of Open Access Journals (Sweden)

    Lahiri Debomoy K

    2013-01-01

    Full Text Available Abstract Background Alzheimer’s disease (AD is intimately tied to amyloid-β (Aβ peptide. Extraneuronal brain plaques consisting primarily of Aβ aggregates are a hallmark of AD. Intraneuronal Aβ subunits are strongly implicated in disease progression. Protein sequence mutations of the Aβ precursor protein (APP account for a small proportion of AD cases, suggesting that regulation of the associated gene (APP may play a more important role in AD etiology. The APP promoter possesses a novel 30 nucleotide sequence, or “proximal regulatory element” (PRE, at −76/−47, from the +1 transcription start site that confers cell type specificity. This PRE contains sequences that make it vulnerable to epigenetic modification and may present a viable target for drug studies. We examined PRE-nuclear protein interaction by gel electrophoretic mobility shift assay (EMSA and PRE mutant EMSA. This was followed by functional studies of PRE mutant/reporter gene fusion clones. Results EMSA probed with the PRE showed DNA-protein interaction in multiple nuclear extracts and in human brain tissue nuclear extract in a tissue-type specific manner. We identified transcription factors that are likely to bind the PRE, using competition gel shift and gel supershift: Activator protein 2 (AP2, nm23 nucleoside diphosphate kinase/metastatic inhibitory protein (PuF, and specificity protein 1 (SP1. These sites crossed a known single nucleotide polymorphism (SNP. EMSA with PRE mutants and promoter/reporter clone transfection analysis further implicated PuF in cells and extracts. Functional assays of mutant/reporter clone transfections were evaluated by ELISA of reporter protein levels. EMSA and ELISA results correlated by meta-analysis. Conclusions We propose that PuF may regulate the APP gene promoter and that AD risk may be increased by interference with PuF regulation at the PRE. PuF is targeted by calcium/calmodulin-dependent protein kinase II inhibitor 1, which also

  15. Biochemical analysis of NSs from different tospoviruses

    OpenAIRE

    Hedil, Marcio; Ronde, de, Dryas; Kormelink, Richard

    2017-01-01

    Tospoviruses suppress antiviral RNA interference by coding for an RNA silencing suppressor (NSs) protein. Previously, using NSs-containing crude plant and insect cell extracts, the affinity of NSs for double-stranded (ds)RNA molecules was demonstrated by electrophoretic mobility shifts assays (EMSAs). While NSs from tomato spotted wilt virus (TSWV) and groundnut ringspot virus (GRSV) were able to bind small and long dsRNA molecules, the one from tomato yellow ring virus (TYRV), a distinct Asi...

  16. Protein-ligand interactions investigated by thermal shift assays (TSA) and dual polarization interferometry (DPI).

    Science.gov (United States)

    Grøftehauge, Morten K; Hajizadeh, Nelly R; Swann, Marcus J; Pohl, Ehmke

    2015-01-01

    Over the last decades, a wide range of biophysical techniques investigating protein-ligand interactions have become indispensable tools to complement high-resolution crystal structure determinations. Current approaches in solution range from high-throughput-capable methods such as thermal shift assays (TSA) to highly accurate techniques including microscale thermophoresis (MST) and isothermal titration calorimetry (ITC) that can provide a full thermodynamic description of binding events. Surface-based methods such as surface plasmon resonance (SPR) and dual polarization interferometry (DPI) allow real-time measurements and can provide kinetic parameters as well as binding constants. DPI provides additional spatial information about the binding event. Here, an account is presented of new developments and recent applications of TSA and DPI connected to crystallography.

  17. Specific DNA binding of a potential transcriptional regulator, inosine 5'-monophosphate dehydrogenase-related protein VII, to the promoter region of a methyl coenzyme m reductase I-encoding operon retrieved from Methanothermobacter thermautotrophicus strain DeltaH.

    Science.gov (United States)

    Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi

    2008-10-01

    Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus DeltaH are expressed in response to H(2) availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cultures restricted them to 46- and 41-bp-long mcr and mrt upstream regions, respectively. Affinity particle purification of DNA-binding proteins conjugated with putative operator regions resulted in the retrieval of a protein attributed to IMP dehydrogenase-related protein VII (IMPDH VII). IMPDH VII is predicted to have a winged helix-turn-helix DNA-binding motif and two cystathionine beta-synthase domains, and it has been suspected to be an energy-sensing module. EMSA with oligonucleotide probes with unusual sequences showed that the binding site of IMPDH VII mostly overlaps the factor B-responsible element-TATA box of the mcr operon. The results presented here suggest that IMPDH VII encoded by MTH126 is a plausible candidate for the transcriptional regulator of the mcr operon in this methanogen.

  18. The Response Regulator ResD Plays a Role in Metabolism of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Larsen, Marianne Halberg; Sørensen, Martine; Ingmer, Hanne

    to be transmitted to food processing plants from where it can establish and survive for extended periods of time contaminating processed food products. Recently we have identified the response regulator ResD of L. monocytogenes and showed that it is important for growth in laboratory media and for sugar uptake...... in the upstream regulatory region of several genes of L. monocytogenes and the binding of the ResD protein to some of these regulatory regions upstream putative target genes is analysed by electrophoretic mobility shift assays (EMSAs). In conclusion, the response regulator ResD act is important for metabolisme...

  19. NF-{kappa}B p50 promotes tumor cell invasion through negative regulation of invasion suppressor gene CRMP-1 in human lung adenocarcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Ming, Gao [Cancer Research Center, College of Medicine, National Taiwan University, Taipei, Taiwan (China); National Center of Excellence for Clinical Trial and Research, National Taiwan University, Hospital, Taipei, Taiwan (China); Institute of Toxicology, College of Medicine, National Taiwan University, Taipei, Taiwan (China); Yeh, P Y [Cancer Research Center, College of Medicine, National Taiwan University, Taipei, Taiwan (China); Department of Oncology, National Taiwan University Hospital, No. 7, Chung-Shan South Road, Taipei 10016, Taiwan (China); Lu, Y -S [Cancer Research Center, College of Medicine, National Taiwan University, Taipei, Taiwan (China); National Center of Excellence for Clinical Trial and Research, National Taiwan University, Hospital, Taipei, Taiwan (China); Department of Oncology, National Taiwan University Hospital, No. 7, Chung-Shan South Road, Taipei 10016, Taiwan, ROC (China); Chang, W C [Cancer Research Center, College of Medicine, National Taiwan University, Taipei, Taiwan (China); Kuo, M -L [Institute of Toxicology, College of Medicine, National Taiwan University, Taipei, Taiwan (China); Cheng, A -L [Cancer Research Center, College of Medicine, National Taiwan University, Taipei, Taiwan (China); National Center of Excellence for Clinical Trial and Research, National Taiwan University, Hospital, Taipei, Taiwan (China); Institute of Toxicology, College of Medicine, National Taiwan University, Taipei, Taiwan (China); Department of Oncology, National Taiwan University Hospital, No. 7, Chung-Shan South Road, Taipei 10016, Taiwan (China); Department of Internal Medicine, National Taiwan University Hospital, No. 7, Chung-Shan South Road, Taipei 10016, Taiwan (China)], E-mail: alcheng@ntu.edu.tw

    2008-11-14

    Lung adenocarcinoma Cl1-5 cells were selected from parental Cl1-0 cells based on their high metastatic potential. In a previous study, CRMP-1, an invasion suppressor gene, was shown to be suppressed in Cl1-5 cells. However, the regulation of CRMP-1 expression has not been explored. In this study, we showed nuclear factor-{kappa}B controls CRMP-1 expression. The electromobility shift assay showed that while Cl1-0 cells exhibited low NF-{kappa}B activity in response to TNF-{alpha}, an abundance of basal and TNF-{alpha}-induced NF-{kappa}B-DNA complex was detected in Cl1-5 cells. Supershift-coupled EMSA and Western blotting of nuclear proteins, however, revealed p50 protein, but not classic p65/p50 heterodimer in the complex. ChIP and EMSA demonstrated that p50 binds to a {kappa}B site residing between -1753 and -1743 of the CRMP-1 promoter region. Transfection of antisense p50 gene into Cl1-5 cells increased the CRMP-1 protein level and decreased the invasive activity of Cl1-5 cells.

  20. NF-κB p50 promotes tumor cell invasion through negative regulation of invasion suppressor gene CRMP-1 in human lung adenocarcinoma cells

    International Nuclear Information System (INIS)

    Gao Ming; Yeh, P.Y.; Lu, Y.-S.; Chang, W.C.; Kuo, M.-L.; Cheng, A.-L.

    2008-01-01

    Lung adenocarcinoma Cl1-5 cells were selected from parental Cl1-0 cells based on their high metastatic potential. In a previous study, CRMP-1, an invasion suppressor gene, was shown to be suppressed in Cl1-5 cells. However, the regulation of CRMP-1 expression has not been explored. In this study, we showed nuclear factor-κB controls CRMP-1 expression. The electromobility shift assay showed that while Cl1-0 cells exhibited low NF-κB activity in response to TNF-α, an abundance of basal and TNF-α-induced NF-κB-DNA complex was detected in Cl1-5 cells. Supershift-coupled EMSA and Western blotting of nuclear proteins, however, revealed p50 protein, but not classic p65/p50 heterodimer in the complex. ChIP and EMSA demonstrated that p50 binds to a κB site residing between -1753 and -1743 of the CRMP-1 promoter region. Transfection of antisense p50 gene into Cl1-5 cells increased the CRMP-1 protein level and decreased the invasive activity of Cl1-5 cells

  1. Binding to the minor groove of the double-strand, tau protein prevents DNA from damage by peroxidation.

    Science.gov (United States)

    Wei, Yan; Qu, Mei-Hua; Wang, Xing-Sheng; Chen, Lan; Wang, Dong-Liang; Liu, Ying; Hua, Qian; He, Rong-Qiao

    2008-07-02

    Tau, an important microtubule associated protein, has been found to bind to DNA, and to be localized in the nuclei of both neurons and some non-neuronal cells. Here, using electrophoretic mobility shifting assay (EMSA) in the presence of DNA with different chain-lengths, we observed that tau protein favored binding to a 13 bp or a longer polynucleotide. The results from atomic force microscopy also showed that tau protein preferred a 13 bp polynucleotide to a 12 bp or shorter polynucleotide. In a competitive assay, a minor groove binder distamycin A was able to replace the bound tau from the DNA double helix, indicating that tau protein binds to the minor groove. Tau protein was able to protect the double-strand from digestion in the presence of DNase I that was bound to the minor groove. On the other hand, a major groove binder methyl green as a negative competitor exhibited little effect on the retardation of tau-DNA complex in EMSA. This further indicates the DNA minor groove as the binding site for tau protein. EMSA with truncated tau proteins showed that both the proline-rich domain (PRD) and the microtubule-binding domain (MTBD) contributed to the interaction with DNA; that is to say, both PRD and MTBD bound to the minor groove of DNA and bent the double-strand, as observed by electron microscopy. To investigate whether tau protein is able to prevent DNA from the impairment by hydroxyl free radical, the chemiluminescence emitted by the phen-Cu/H(2)O(2)/ascorbate was measured. The emission intensity of the luminescence was markedly decreased when tau protein was present, suggesting a significant protection of DNA from the damage in the presence of hydroxyl free radical.

  2. Induction of truncated form of tenascin-X (XB-S) through dissociation of HDAC1 from SP-1/HDAC1 complex in response to hypoxic conditions

    International Nuclear Information System (INIS)

    Kato, Akari; Endo, Toshiya; Abiko, Shun; Ariga, Hiroyoshi; Matsumoto, Ken-ichi

    2008-01-01

    ABSTRACT: XB-S is an amino-terminal truncated protein of tenascin-X (TNX) in humans. The levels of the XB-S transcript, but not those of TNX transcripts, were increased upon hypoxia. We identified a critical hypoxia-responsive element (HRE) localized to a GT-rich element positioned from - 1410 to - 1368 in the XB-S promoter. Using an electrophoretic mobility shift assay (EMSA), we found that the HRE forms a DNA-protein complex with Sp1 and that GG positioned in - 1379 and - 1378 is essential for the binding of the nuclear complex. Transfection experiments in SL2 cells, an Sp1-deficient model system, with an Sp1 expression vector demonstrated that the region from - 1380 to - 1371, an HRE, is sufficient for efficient activation of the XB-S promoter upon hypoxia. The EMSA and a chromatin immunoprecipitation (ChIP) assay showed that Sp1 together with the transcriptional repressor histone deacetylase 1 (HDAC1) binds to the HRE of the XB-S promoter under normoxia and that hypoxia causes dissociation of HDAC1 from the Sp1/HDAC1 complex. The HRE promoter activity was induced in the presence of a histone deacetylase inhibitor, trichostatin A, even under normoxia. Our results indicate that the hypoxia-induced activation of the XB-S promoter is regulated through dissociation of HDAC1 from an Sp1-binding HRE site

  3. Prevalence, distribution and functional significance of the -237C to T polymorphism in the IL-12Rβ2 promoter in Indian tuberculosis patients.

    Directory of Open Access Journals (Sweden)

    Vikas Kumar Verma

    Full Text Available Cytokine/cytokine receptor gene polymorphisms related to structure/expression could impact immune response. Hence, the -237 polymorphic site in the 5' promoter region of the IL-12Rβ2 (SNP ID: rs11810249 gene associated with the AP-4 transcription motif GAGCTG, was examined. Amplicons encompassing the polymorphism were generated from 46 pulmonary tuberculosis patients, 35 family contacts and 28 miscellaneous volunteers and sequenced. The C allele predominated among patients, (93.4%, 43/46, and in all volunteers and contacts screened, but the T allele was exclusively limited to patients, (6.5%, 3/46. The functional impact of this polymorphism on transcriptional activity was assessed by Luciferase-reporter and electrophoretic mobility shift assays (EMSA. Luciferase-reporter assays showed a significant reduction in transcriptional efficiency with T compared to C allele. The reduction in transcriptional efficiency with the T allele construct (pGIL-12Rb2-T, in U-87MG, THP-1 and Jurkat cell lines, were 53, 37.6, and 49.8% respectively, compared to the C allele construct (pGIL-12Rb2-C. Similarly, densitometric analysis of the EMSA assay showed reduced binding of the AP-4 transcription factor, to T compared to the C nucleotide probe. Reduced mRNA expression in all patients (3/3 harboring the T allele was seen, whereas individuals with the C allele exhibited high mRNA expression (17/25; 68%, p = 0.05. These observations were in agreement with the in vitro assessment of the promoter activity by Luciferase-reporter and EMSA assays. The reduced expression of IL-12Rβ2 transcripts in 8 patients despite having the C allele was attributed to the predominant over expression of the suppressors (IL-4 and GATA-3 and reduced expression of enhancers (IFN-α of IL-12Rβ2 transcripts. The 17 high IL-12Rβ2 mRNA expressers had significantly elevated IFN-α mRNA levels compared to low expressers and volunteers. Notwithstanding the presence of high levels of IL-12R

  4. Triplex DNA-binding proteins are associated with clinical outcomes revealed by proteomic measurements in patients with colorectal cancer

    Directory of Open Access Journals (Sweden)

    Nelson Laura D

    2012-06-01

    Full Text Available Abstract Background Tri- and tetra-nucleotide repeats in mammalian genomes can induce formation of alternative non-B DNA structures such as triplexes and guanine (G-quadruplexes. These structures can induce mutagenesis, chromosomal translocations and genomic instability. We wanted to determine if proteins that bind triplex DNA structures are quantitatively or qualitatively different between colorectal tumor and adjacent normal tissue and if this binding activity correlates with patient clinical characteristics. Methods Extracts from 63 human colorectal tumor and adjacent normal tissues were examined by gel shifts (EMSA for triplex DNA-binding proteins, which were correlated with clinicopathological tumor characteristics using the Mann-Whitney U, Spearman’s rho, Kaplan-Meier and Mantel-Cox log-rank tests. Biotinylated triplex DNA and streptavidin agarose affinity binding were used to purify triplex-binding proteins in RKO cells. Western blotting and reverse-phase protein array were used to measure protein expression in tissue extracts. Results Increased triplex DNA-binding activity in tumor extracts correlated significantly with lymphatic disease, metastasis, and reduced overall survival. We identified three multifunctional splicing factors with biotinylated triplex DNA affinity: U2AF65 in cytoplasmic extracts, and PSF and p54nrb in nuclear extracts. Super-shift EMSA with anti-U2AF65 antibodies produced a shifted band of the major EMSA H3 complex, identifying U2AF65 as the protein present in the major EMSA band. U2AF65 expression correlated significantly with EMSA H3 values in all extracts and was higher in extracts from Stage III/IV vs. Stage I/II colon tumors (p = 0.024. EMSA H3 values and U2AF65 expression also correlated significantly with GSK3 beta, beta-catenin, and NF- B p65 expression, whereas p54nrb and PSF expression correlated with c-Myc, cyclin D1, and CDK4. EMSA values and expression of all three splicing factors correlated

  5. Electrophoretic mobility shift assay reveals a novel recognition sequence for Setaria italica NAC protein.

    Science.gov (United States)

    Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S; Prasad, Manoj

    2011-10-01

    The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncations of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T][T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein.

  6. Leveraging the contribution of thermodynamics in drug discovery with the help of fluorescence-based thermal shift assays.

    Science.gov (United States)

    Hau, Jean Christophe; Fontana, Patrizia; Zimmermann, Catherine; De Pover, Alain; Erdmann, Dirk; Chène, Patrick

    2011-06-01

    The development of new drugs with better pharmacological and safety properties mandates the optimization of several parameters. Today, potency is often used as the sole biochemical parameter to identify and select new molecules. Surprisingly, thermodynamics, which is at the core of any interaction, is rarely used in drug discovery, even though it has been suggested that the selection of scaffolds according to thermodynamic criteria may be a valuable strategy. This poor integration of thermodynamics in drug discovery might be due to difficulties in implementing calorimetry experiments despite recent technological progress in this area. In this report, the authors show that fluorescence-based thermal shift assays could be used as prescreening methods to identify compounds with different thermodynamic profiles. This approach allows a reduction in the number of compounds to be tested in calorimetry experiments, thus favoring greater integration of thermodynamics in drug discovery.

  7. The adeno-associated virus major regulatory protein Rep78-c-Jun-DNA motif complex modulates AP-1 activity

    International Nuclear Information System (INIS)

    Prasad, C. Krishna; Meyers, Craig; Zhan Dejin; You Hong; Chiriva-Internati, Maurizio; Mehta, Jawahar L.; Liu Yong; Hermonat, Paul L.

    2003-01-01

    Multiple epidemiologic studies show that adeno-associated virus (AAV) is negatively associated with cervical cancer (CX CA), a cancer which is positively associated with human papillomavirus (HPV) infection. Mechanisms for this correlation may be by Rep78's (AAV's major regulatory protein) ability to bind the HPV-16 p97 promoter DNA and inhibit transcription, to bind and interfere with the functions of the E7 oncoprotein of HPV-16, and to bind a variety of HPV-important cellular transcription factors such as Sp1 and TBP. c-Jun is another important cellular factor intimately linked to the HPV life cycle, as well as keratinocyte differentiation and skin development. Skin is the natural host tissue for both HPV and AAV. In this article it is demonstrated that Rep78 directly interacts with c-Jun, both in vitro and in vivo, as analyzed by Western blot, yeast two-hybrid cDNA, and electrophoretic mobility shift-supershift assay (EMSA supershift). Addition of anti-Rep78 antibodies inhibited the EMSA supershift. Investigating the biological implications of this interaction, Rep78 inhibited the c-Jun-dependent c-jun promoter in transient and stable chloramphenicol acetyl-transferase (CAT) assays. Rep78 also inhibited c-Jun-augmented c-jun promoter as well as the HPV-16 p97 promoter activity (also c-Jun regulated) in in vitro transcription assays in T47D nuclear extracts. Finally, the Rep78-c-Jun interaction mapped to the amino-half of Rep78. The ability of Rep78 to interact with c-Jun and down-regulate AP-1-dependent transcription suggests one more mechanism by which AAV may modulate the HPV life cycle and the carcinogenesis process

  8. Functional analysis of two PLA2G2A variants associated with secretory phospholipase A2-IIA levels.

    Directory of Open Access Journals (Sweden)

    Holly J Exeter

    Full Text Available Secretory phospholipase A2 group IIA (sPLA2-IIA has been identified as a biomarker of atherosclerosis in observational and animal studies. The protein is encoded by the PLA2G2A gene and the aim of this study was to test the functionality of two PLA2G2A non-coding SNPs, rs11573156 C>G and rs3767221 T>G where the rare alleles have been previously associated with higher and lower sPLA2-IIA levels respectively.Luciferase assays, electrophoretic mobility shift assays (EMSA, and RNA expression by RT-PCR were used to examine allelic differences. For rs3767221 the G allele showed ∼55% lower luciferase activity compared to the T allele (T = 62.1 (95% CI 59.1 to 65.1 G = 27.8 (95% CI 25.0 to 30.6, p = 1.22×10⁻³⁵, and stronger EMSA binding of a nuclear protein compared to the T-allele. For rs11573156 C >G there were no luciferase or EMSA allelic differences seen. In lymphocyte cell RNA, from individuals of known rs11573156 genotype, there was no allelic RNA expression difference for exons 5 and 6, but G allele carriers (n = 7 showed a trend to lower exon 1-2 expression compared to CC individuals. To take this further, in the ASAP study (n = 223, an rs11573156 proxy (r² = 0.91 showed ∼25% higher liver expression of PLA2G2A (1.67×10⁻¹⁷ associated with the G allele. However, considering exon specific expression, the association was greatly reduced for exon 2 (4.5×10⁻⁵ compared to exons 3-6 (10⁻¹⁰ to 10⁻²⁰, suggesting rs11573156 G allele-specific exon 2 skipping.Both SNPs are functional and provide useful tools for Mendelian Randomisation to determine whether the relationship between sPLA2-IIA and coronary heart disease is causal.

  9. CCAAT/Enhancer Binding Protein β Regulates Expression of Indian Hedgehog during Chondrocytes Differentiation

    Science.gov (United States)

    Ushijima, Takahiro; Okazaki, Ken; Tsushima, Hidetoshi; Ishihara, Kohei; Doi, Toshio; Iwamoto, Yukihide

    2014-01-01

    Background CCAAT/enhancer binding protein β (C/EBPβ) is a transcription factor that promotes hypertrophic differentiation of chondrocytes. Indian hedgehog (Ihh) also stimulates the hypertrophic transition of chondrocytes. Furthermore, runt-related transcription factor-2 (RUNX2) was reported to regulate chondrocyte maturation during skeletal development and to directly regulate transcriptional activity of Ihh. In this study, we investigated whether the interaction of C/EBPβ and RUNX2 regulates the expression of Ihh during chondrocyte differentiation. Methodology/Results Immunohistochemistry of embryonic growth plate revealed that both C/EBPβ and Ihh were strongly expressed in pre-hypertrophic and hypertrophic chondrocytes. Overexpression of C/EBPβ by adenovirus vector in ATDC5 cells caused marked stimulation of Ihh and Runx2. Conversely, knockdown of C/EBPβ by lentivirus expressing shRNA significantly repressed Ihh and Runx2 in ATDC5 cells. A reporter assay revealed that C/EBPβ stimulated transcriptional activity of Ihh. Deletion and mutation analysis showed that the C/EBPβ responsive element was located between −214 and −210 bp in the Ihh promoter. An electrophoretic mobility shift assay (EMSA) and a chromatin immunoprecipitation (ChIP) assay also revealed the direct binding of C/EBPβ to this region. Moreover, reporter assays demonstrated that RUNX2 failed to stimulate the transcriptional activity of the Ihh promoter harboring a mutation at the C/EBPβ binding site. EMSA and ChIP assays showed that RUNX2 interacted to this element with C/EBPβ. Immunoprecipitation revealed that RUNX2 and C/EBPβ formed heterodimer complex with each other in the nuclei of chondrocytes. These data suggested that the C/EBPβ binding element is also important for RUNX2 to regulate the expression of Ihh. Ex vivo organ culture of mouse limbs transfected with C/EBPβ showed that the expression of Ihh and RUNX2 was increased upon ectopic C/EBPβ expression. Conclusions C

  10. CCAAT/enhancer binding protein β regulates expression of Indian hedgehog during chondrocytes differentiation.

    Directory of Open Access Journals (Sweden)

    Takahiro Ushijima

    Full Text Available CCAAT/enhancer binding protein β (C/EBPβ is a transcription factor that promotes hypertrophic differentiation of chondrocytes. Indian hedgehog (Ihh also stimulates the hypertrophic transition of chondrocytes. Furthermore, runt-related transcription factor-2 (RUNX2 was reported to regulate chondrocyte maturation during skeletal development and to directly regulate transcriptional activity of Ihh. In this study, we investigated whether the interaction of C/EBPβ and RUNX2 regulates the expression of Ihh during chondrocyte differentiation.Immunohistochemistry of embryonic growth plate revealed that both C/EBPβ and Ihh were strongly expressed in pre-hypertrophic and hypertrophic chondrocytes. Overexpression of C/EBPβ by adenovirus vector in ATDC5 cells caused marked stimulation of Ihh and Runx2. Conversely, knockdown of C/EBPβ by lentivirus expressing shRNA significantly repressed Ihh and Runx2 in ATDC5 cells. A reporter assay revealed that C/EBPβ stimulated transcriptional activity of Ihh. Deletion and mutation analysis showed that the C/EBPβ responsive element was located between -214 and -210 bp in the Ihh promoter. An electrophoretic mobility shift assay (EMSA and a chromatin immunoprecipitation (ChIP assay also revealed the direct binding of C/EBPβ to this region. Moreover, reporter assays demonstrated that RUNX2 failed to stimulate the transcriptional activity of the Ihh promoter harboring a mutation at the C/EBPβ binding site. EMSA and ChIP assays showed that RUNX2 interacted to this element with C/EBPβ. Immunoprecipitation revealed that RUNX2 and C/EBPβ formed heterodimer complex with each other in the nuclei of chondrocytes. These data suggested that the C/EBPβ binding element is also important for RUNX2 to regulate the expression of Ihh. Ex vivo organ culture of mouse limbs transfected with C/EBPβ showed that the expression of Ihh and RUNX2 was increased upon ectopic C/EBPβ expression.C/EBPβ and RUNX2 cooperatively stimulate

  11. Mass spectrometry for identification of proteins that specifically bind to a distal enhancer of the Oct4 gene

    Science.gov (United States)

    Bakhmet, E. I.; Nazarov, I. B.; Artamonova, T. O.; Khodorkovsky, M. A.; Tomilin, A. N.

    2017-11-01

    Transcription factor Oct4 is a marker of pluripotent stem cells and has a significant role in their self-renewal. Oct4 gene is controlled by three cis-regulatory elements - proximal promoter, proximal enhancer and distal enhancer. All of these elements are targets for binding of regulatory proteins. Distal enhancer is in our research focus because of its activity in early stages of embryonic development. There are two main sequences called site 2A and site 2B that are presented in distal enhancer. For this moment proteins which bind to a site 2A (CCCCTCCCCCC) remain unknown. Using combination of in vitro method electrophoretic mobility shift assay (EMSA) and mass spectromery we identified several candidates that can regulate Oct4 gene expression through site 2A.

  12. GSTT2 promoter polymorphisms and colorectal cancer risk

    Directory of Open Access Journals (Sweden)

    Ahn Sun-A

    2007-01-01

    Full Text Available Abstract Background Glutathione S-transferases are a group of enzymes that participate in detoxification and defense mechanisms against toxic carcinogens and other compounds. These enzymes play an important role in human carcinogenesis. In the present study, we sought to determine whether GSTT2 promoter single nucleotide polymorphisms (SNPs are associated with colorectal cancer risk. Methods A total of 436 colorectal cancer patients and 568 healthy controls were genotyped for three GSTT2 promoter SNPs (-537G>A, -277T>C and -158G>A, using real-time TaqMan assay and direct sequencing. An electrophoretic mobility shift assay (EMSA was performed to determine the effects of polymorphisms on protein binding to the GSTT2 promoter. Results The -537A allele (-537G/A or A/A was significantly associated with colorectal cancer risk (OR = 1.373, p = 0.025, while the -158A allele (-158G/A or A/A was involved in protection against colorectal cancer (OR = 0.539, p = 0.032. Haplotype 2 (-537A, -277T, -158G was significantly associated with colorectal cancer risk (OR = 1.386, p = 0.021, while haplotype 4 (-537G, -277C, -158A protected against colorectal cancer (OR = 0.539, p = 0.032. EMSA data revealed lower promoter binding activity in the -537A allele than its -537G counterpart. Conclusion Our results collectively suggest that SNPs and haplotypes of the GSTT2 promoter region are associated with colorectal cancer risk in the Korean population.

  13. Rapid and Simple Detection of Hot Spot Point Mutations of Epidermal Growth Factor Receptor, BRAF, and NRAS in Cancers Using the Loop-Hybrid Mobility Shift Assay

    Science.gov (United States)

    Matsukuma, Shoichi; Yoshihara, Mitsuyo; Kasai, Fumio; Kato, Akinori; Yoshida, Akira; Akaike, Makoto; Kobayashi, Osamu; Nakayama, Haruhiko; Sakuma, Yuji; Yoshida, Tsutomu; Kameda, Yoichi; Tsuchiya, Eiju; Miyagi, Yohei

    2006-01-01

    A simple and rapid method to detect the epidermal growth factor receptor hot spot mutation L858R in lung adenocarcinoma was developed based on principles similar to the universal heteroduplex generator technology. A single-stranded oligonucleotide with an internal deletion was used to generate heteroduplexes (loop-hybrids) bearing a loop in the complementary strand derived from the polymerase chain reaction product of the normal or mutant allele. By placing deletion in the oligonucleotide adjacent to the mutational site, difference in electrophoretic mobility between loop-hybrids with normal and mutated DNA was distinguishable in a native polyacrylamide gel. The method was also modified to detect in-frame deletion mutations of epidermal growth factor receptor in lung adenocarcinomas. In addition, the method was adapted to detect hot spot mutations in the B-type Raf kinase (BRAF) at V600 and in a Ras-oncogene (NRAS) at Q61, the mutations commonly found in thyroid carcinomas. Our mutation detection system, designated the loop-hybrid mobility shift assay was sensitive enough to detect mutant DNA comprising 7.5% of the total DNA. As a simple and straightforward mutation detection technique, loop-hybrid mobility shift assay may be useful for the molecular diagnosis of certain types of clinical cancers. Other applications are also discussed. PMID:16931592

  14. A functional haplotype of NFKB1 influence susceptibility to oral cancer: a population-based and in vitro study.

    Science.gov (United States)

    Chen, Fa; Liu, Fengqiong; Yan, Lingjun; Lin, Lisong; Qiu, Yu; Wang, Jing; Wu, Junfeng; Bao, Xiaodan; Hu, Zhijian; Cai, Lin; He, Baochang

    2018-05-01

    Genetic variations of NF-κB and its inhibitor IκB genes and their biological mechanism in oral cancer were not well recognized. The purpose of this study was to evaluate the associations of polymorphisms in NFKB1 and NFKBIA with oral cancer susceptibility, and further explore their potential mechanism in vitro. First, the polymorphisms of NFKB1 and NFKBIA were genotyped through iPLEX Sequenom MassARRAY platform in a case-control study with 425 oral cancer patients and 485 healthy controls. Then, the function was explored by a luciferase reporter assay and an electrophoretic mobility shift assay (EMSA) in human tongue squamous cell carcinoma cell lines. The results indicated that NFKB1 rs28362491 Del/Del and rs72696119 G/G genotypes were associated with the risk of oral cancer, with a strong linkage disequilibrium (D' = 0.991, r 2  = 0.971). Moreover, DG haplotype of NFKB1 also showed a significant increased risk (OR = 1.25, 95% CI: 1.02-1.53, P = 0.030). Dual-luciferase reporter assays further revealed that the plasmids with DG or IG or DC haplotype transfected with Tca-8113 cells or CAL-27 cells had a lower luciferase expression than that with IC haplotype. EMSA demonstrated that 4-bp ATTG deletion in the promoter of NFKB1 abolished the binding site of transcription factor. Our preliminary findings suggest that the haplotype of rs28362491 and rs72696119 in NFKB1 could act as a novel genetic marker to predict oral cancer risk in the southeast of China, but much more extensive researches still need to be conducted. © 2018 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  15. Yeast one-hybrid system used to identify the binding proteins for rat glutathione S-transferase P enhancer I.

    Science.gov (United States)

    Liao, Ming-Xiang; Liu, Dong-Yuan; Zuo, Jin; Fang, Fu-De

    2002-03-01

    To detect the trans-factors specifically binding to the strong enhancer element (GPEI) in the upstream of rat glutathione S-transferase P (GST-P) gene. Yeast one-hybrid system was used to screen rat lung MATCHMAKER cDNA library to identify potential trans-factors that can interact with core sequence of GPEI(cGPEI). Electrophoresis mobility shift assay (EMSA) was used to analyze the binding of transfactors to cGPEI. cDNA fragments coding for the C-terminal part of the transcription factor c-Jun and rat adenine nucleotide translocator (ANT) were isolated. The binding of c-Jun and ANT to GPEI core sequence were confirmed. Rat c-jun transcriptional factor and ANT may interact with cGPEI. They could play an important role in the induced expression of GST-P gene.

  16. [The effect of hypoxia preconditioning no binding activity of HIF-1 on the HRE with EPO in the hippocampus of mice].

    Science.gov (United States)

    Shao, Guo; Zhou, Wei-Hua; Gao, Cui-Ying; Zhang, Ran; Lu, Guo-Wei

    2007-02-01

    To observe change of binding activity of HIF-1 with erythropoietin (EPO) hypoxia response element (HRE) in the hippocampus of mice preconditioned to hypoxia and explore relationship between the changes and the preconditioning. The hippocampus was removed from mice exposed to hypoxia for 0 run (control group), 1 run (H1 group) and 4 runs(H4 group). Electrophoretic mobility shift assays (EMSA), chromatin immunoprecipitation (ChIP)and real time PCR were used to detect the change of activity of HIF-1 on HRE of EPO. Both in vitro and in vivo binding tests showed that the HIF-1 DNA-binding activities were increased in group H1 and markedly increased in group H4. The increase of HIF-1 and HRE of EPO binding activities is thought be involved in hypoxic preconditioning.

  17. Upregulation of human heme oxygenase gene expression by Ets-family proteins.

    Science.gov (United States)

    Deramaudt, B M; Remy, P; Abraham, N G

    1999-03-01

    Overexpression of human heme oxygenase-1 has been shown to have the potential to promote EC proliferation and angiogenesis. Since Ets-family proteins have been shown to play an important role in angiogenesis, we investigated the presence of ETS binding sites (EBS), GGAA/T, and ETS protein contributing to human HO-1 gene expression. Several chloramphenicol acetyltransferase constructs were examined in order to analyze the effect of ETS family proteins on the transduction of HO-1 in Xenopus oocytes and in microvessel endothelial cells. Heme oxygenase promoter activity was up-regulated by FLI-1ERGETS-1 protein(s). Chloramphenicol acetyltransferase (CAT) assays demonstrated that the promoter region (-1500 to +19) contains positive and negative control elements and that all three members of the ETS protein family were responsible for the up-regulation of HHO-1. Electrophoretic mobility shift assays (EMSA), performed with nuclear extracts from endothelial cells overexpressing HHO-1 gene, and specific HHO-1 oligonucleotides probes containing putative EBS resulted in a specific and marked bandshift. Synergistic binding was observed in EMSA between AP-1 on the one hand, FLI-1, ERG, and ETS-1 protein on the other. Moreover, 5'-deletion analysis demonstrated the existence of a negative control element of HHO-1 expression located between positions -1500 and -120 on the HHO-1 promoter. The presence of regulatory sequences for transcription factors such as ETS-1, FLI-1, or ERG, whose activity is associated with cell proliferation, endothelial cell differentiation, and matrix metalloproteinase transduction, may be an indication of the important role that HO-1 may play in coronary collateral circulation, tumor growth, angiogenesis, and hemoglobin-induced endothelial cell injuries.

  18. Inverted repeats in the promoter as an autoregulatory sequence for TcrX in Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Bhattacharya, Monolekha; Das, Amit Kumar

    2011-01-01

    Highlights: ► The regulatory sequences recognized by TcrX have been identified. ► The regulatory region comprises of inverted repeats segregated by 30 bp region. ► The mode of binding of TcrX with regulatory sequence is unique. ► In silico TcrX–DNA docked model binds one of the inverted repeats. ► Both phosphorylated and unphosphorylated TcrX binds regulatory sequence in vitro. -- Abstract: TcrY, a histidine kinase, and TcrX, a response regulator, constitute a two-component system in Mycobacterium tuberculosis. tcrX, which is expressed during iron scarcity, is instrumental in the survival of iron-dependent M. tuberculosis. However, the regulator of tcrX/Y has not been fully characterized. Crosslinking studies of TcrX reveal that it can form oligomers in vitro. Electrophoretic mobility shift assays (EMSAs) show that TcrX recognizes two regions in the promoter that are comprised of inverted repeats separated by ∼30 bp. The dimeric in silico model of TcrX predicts binding to one of these inverted repeat regions. Site-directed mutagenesis and radioactive phosphorylation indicate that D54 of TcrX is phosphorylated by H256 of TcrY. However, phosphorylated and unphosphorylated TcrX bind the regulatory sequence with equal efficiency, which was shown with an EMSA using the D54A TcrX mutant.

  19. Andrographolide suppresses high glucose-induced fibronectin expression in mesangial cells via inhibiting the AP-1 pathway.

    Science.gov (United States)

    Lan, Tian; Wu, Teng; Gou, Hongju; Zhang, Qianqian; Li, Jiangchao; Qi, Cuiling; He, Xiaodong; Wu, Pingxiang; Wang, Lijing

    2013-11-01

    Mesangial cells (MCs) proliferation and accumulation of glomerular matrix proteins such as fibronectin (FN) are the early features of diabetic nephropathy, with MCs known to upregulate matrix protein synthesis in response to high glucose. Recently, it has been found that andrographolide has renoprotective effects on diabetic nephropathy. However, the molecular mechanism underlying these effects remains unclear. Cell viability and proliferation was evaluated by MTT. FN expression was examined by immunofluorescence and immunoblotting. Activator protein-1 (AP-1) activation was assessed by immunoblotting, luciferase reporter and electrophoretic mobility shift assays. Andrographolide significantly decreased high glucose-induced cell proliferation and FN expression in MCs. Exposure of MCs to high glucose markedly stimulated the expression of phosphorylated c-jun, whereas the stimulation was inhibited by andrographolide. Plasmid pAP-1-Luc luciferase reporter assay showed that andrographolide blocked high glucose-induced AP-1 transcriptional activity. EMSA assay demonstrated that increased AP-1 binding to an AP-1 binding site at -1,029 in the FN gene promoter upon high glucose stimulation, and the binding were disrupted by andrographolide treatment. These data indicate that andrographolide suppresses high glucose-induced FN expression by inhibiting AP-1-mediated pathway. © 2013 Wiley Periodicals, Inc.

  20. Functional defect of truncated hepatocyte nuclear factor-1{alpha} (G554fsX556) associated with maturity-onset diabetes of the young

    Energy Technology Data Exchange (ETDEWEB)

    Kooptiwut, Suwattanee, E-mail: S_kooptiwut@hotmail.com [Department of Physiology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Sujjitjoon, Jatuporn [Department of Immunology and Immunology Graduate Program, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Plengvidhya, Nattachet [Department of Immunology and Immunology Graduate Program, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Division of Endocrinology and Metabolism, Department of Medicine, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Boonyasrisawat, Watip; Chongjaroen, Nalinee; Jungtrakoon, Prapapron [Department of Immunology and Immunology Graduate Program, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Semprasert, Namoiy [Department of Physiology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Furuta, Hiroto; Nanjo, Kishio [The First Department, Wakayama Medical University (Japan); Banchuin, Napatawn [Department of Immunology and Immunology Graduate Program, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Yenchitsomanus, Pa-thai [Division of Medical Molecular Biology, Medicine Department of Research and Development, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Medical Biotechnology Unit, National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Development Agency (NSTDA), Bangkok (Thailand)

    2009-05-22

    A novel frameshift mutation attributable to 14-nucleotide insertion in hepatocyte nuclear factor-1{alpha} (HNF-1{alpha}) encoding a truncated HNF-1{alpha} (G554fsX556) with 76-amino acid deletion at its carboxyl terminus was identified in a Thai family with maturity-onset diabetes of the young (MODY). The wild-type and mutant HNF-1{alpha} proteins were expressed by in vitro transcription and translation (TNT) assay and by transfection in HeLa cells. The wild-type and mutant HNF-1{alpha} could similarly bind to human glucose-transporter 2 (GLUT2) promoter examined by electrophoretic mobility shift assay (EMSA). However, the transactivation activities of mutant HNF-1{alpha} on human GLUT2 and rat L-type pyruvate kinase (L-PK) promoters in HeLa cells determined by luciferase reporter assay were reduced to approximately 55-60% of the wild-type protein. These results suggested that the functional defect of novel truncated HNF-1{alpha} (G554fsX556) on the transactivation of its target-gene promoters would account for the {beta}-cell dysfunction associated with the pathogenesis of MODY.

  1. Functional defect of truncated hepatocyte nuclear factor-1α (G554fsX556) associated with maturity-onset diabetes of the young

    International Nuclear Information System (INIS)

    Kooptiwut, Suwattanee; Sujjitjoon, Jatuporn; Plengvidhya, Nattachet; Boonyasrisawat, Watip; Chongjaroen, Nalinee; Jungtrakoon, Prapapron; Semprasert, Namoiy; Furuta, Hiroto; Nanjo, Kishio; Banchuin, Napatawn; Yenchitsomanus, Pa-thai

    2009-01-01

    A novel frameshift mutation attributable to 14-nucleotide insertion in hepatocyte nuclear factor-1α (HNF-1α) encoding a truncated HNF-1α (G554fsX556) with 76-amino acid deletion at its carboxyl terminus was identified in a Thai family with maturity-onset diabetes of the young (MODY). The wild-type and mutant HNF-1α proteins were expressed by in vitro transcription and translation (TNT) assay and by transfection in HeLa cells. The wild-type and mutant HNF-1α could similarly bind to human glucose-transporter 2 (GLUT2) promoter examined by electrophoretic mobility shift assay (EMSA). However, the transactivation activities of mutant HNF-1α on human GLUT2 and rat L-type pyruvate kinase (L-PK) promoters in HeLa cells determined by luciferase reporter assay were reduced to approximately 55-60% of the wild-type protein. These results suggested that the functional defect of novel truncated HNF-1α (G554fsX556) on the transactivation of its target-gene promoters would account for the β-cell dysfunction associated with the pathogenesis of MODY.

  2. Identification of a p53-response element in the promoter of the proline oxidase gene

    International Nuclear Information System (INIS)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  3. Direct inhibition of TNF-α promoter activity by Fanconi anemia protein FANCD2.

    Directory of Open Access Journals (Sweden)

    Nobuko Matsushita

    Full Text Available Fanconi anemia (FA, an inherited disease, is associated with progressive bone marrow failure, predisposition to cancer, and genomic instability. Genes corresponding to 15 identified FA complementation groups have been cloned, and each gene product functions in the response to DNA damage induced by cross-linking agents and/or in protection against genome instability. Interestingly, overproduction of inflammatory cytokines such as tumor necrosis factor alpha (TNF-α and aberrant activation of NF-κB-dependent transcriptional activity have been observed in FA cells. Here we demonstrated that FANCD2 protein inhibits NF-κB activity in its monoubiquitination-dependent manner. Furthermore, we detected a specific association between FANCD2 and an NF-κB consensus element in the TNF-α promoter by electrophoretic mobility shift assays (EMSA and chromatin immunoprecipitation (ChIP assay. Therefore, we propose FANCD2 deficiency promotes transcriptional activity of the TNF-α promoter and induces overproduction of TNF-which then sustains prolonged inflammatory responses. These results also suggest that artificial modulation of TNFα production could be a promising therapeutic approach to FA.

  4. Rce1, a novel transcriptional repressor, regulates cellulase gene expression by antagonizing the transactivator Xyr1 in Trichoderma reesei.

    Science.gov (United States)

    Cao, Yanli; Zheng, Fanglin; Wang, Lei; Zhao, Guolei; Chen, Guanjun; Zhang, Weixin; Liu, Weifeng

    2017-07-01

    Cellulase gene expression in the model cellulolytic fungus Trichoderma reesei is supposed to be controlled by an intricate regulatory network involving multiple transcription factors. Here, we identified a novel transcriptional repressor of cellulase gene expression, Rce1. Disruption of the rce1 gene not only facilitated the induced expression of cellulase genes but also led to a significant delay in terminating the induction process. However, Rce1 did not participate in Cre1-mediated catabolite repression. Electrophoretic mobility shift (EMSA) and DNase I footprinting assays in combination with chromatin immunoprecipitation (ChIP) demonstrated that Rce1 could bind directly to a cbh1 (cellobiohydrolase 1-encoding) gene promoter region containing a cluster of Xyr1 binding sites. Furthermore, competitive binding assays revealed that Rce1 antagonized Xyr1 from binding to the cbh1 promoter. These results indicate that intricate interactions exist between a variety of transcription factors to ensure tight and energy-efficient regulation of cellulase gene expression in T. reesei. This study also provides important clues regarding increased cellulase production in T. reesei. © 2017 John Wiley & Sons Ltd.

  5. The monomeric form of Neisseria DNA mimic protein DMP19 prevents DNA from binding to the histone-like HU protein

    Science.gov (United States)

    Ko, Tzu-Ping; Liao, Yi-Ting; Hsu, Kai-Cheng

    2017-01-01

    DNA mimicry is a direct and effective strategy by which the mimic competes with DNA for the DNA binding sites on other proteins. Until now, only about a dozen proteins have been shown to function via this strategy, including the DNA mimic protein DMP19 from Neisseria meningitides. We have shown previously that DMP19 dimer prevents the operator DNA from binding to the transcription factor NHTF. Here, we provide new evidence that DMP19 monomer can also interact with the Neisseria nucleoid-associated protein HU. Using BS3 crosslinking, gel filtration and isothermal titration calorimetry assays, we found that DMP19 uses its monomeric form to interact with the Neisseria HU dimer. Crosslinking conjugated mass spectrometry was used to investigate the binding mode of DMP19 monomer and HU dimer. Finally, an electrophoretic mobility shift assay (EMSA) confirmed that the DNA binding affinity of HU is affected by DMP19. These results showed that DMP19 is bifunctional in the gene regulation of Neisseria through its variable oligomeric forms. PMID:29220372

  6. Biochemical analysis of NSs from different tospoviruses.

    Science.gov (United States)

    Hedil, Marcio; de Ronde, Dryas; Kormelink, Richard

    2017-10-15

    Tospoviruses suppress antiviral RNA interference by coding for an RNA silencing suppressor (NSs) protein. Previously, using NSs-containing crude plant and insect cell extracts, the affinity of NSs for double-stranded (ds)RNA molecules was demonstrated by electrophoretic mobility shifts assays (EMSAs). While NSs from tomato spotted wilt virus (TSWV) and groundnut ringspot virus (GRSV) were able to bind small and long dsRNA molecules, the one from tomato yellow ring virus (TYRV), a distinct Asian tospovirus, only bound small dsRNA. Here, using bacterially expressed and purified NSs from GRSV and TYRV, it is shown that they are both able to bind to small and long dsRNA. Binding of siRNAs by NSs revealed two consecutive shifts, i.e. a first shift at low NSs concentrations followed by a second larger one at higher concentrations. When NSs of TSWV resistance inducing (RI) and resistance breaking (RB) isolates were analyzed using extracts from infected plants only a major siRNA shift was observed. In contrast, plant extracts containing the respective transiently expressed NSs proteins showed only the lower shift with NSs RI but no shift with NSs RB . The observed affinity for RNA duplexes, as well as the two-stepwise shift pattern, is discussed in light of NSs as a suppressor of silencing and its importance for tospovirus infection. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  7. Myc Decoy Oligodeoxynucleotide Inhibits Growth and Modulates Differentiation of Mouse Embryonic Stem Cells as a Model of Cancer Stem Cells.

    Science.gov (United States)

    Johari, Behrooz; Ebrahimi-Rad, Mina; Maghsood, Faezeh; Lotfinia, Majid; Saltanatpouri, Zohreh; Teimoori-Toolabi, Ladan; Sharifzadeh, Zahra; Karimipoor, Morteza; Kadivar, Mehdi

    2017-01-01

    Myc (c-Myc) alone activates the embryonic stem cell-like transcriptional module in both normal and transformed cells. Its dysregulation might lead to increased cancer stem cells (CSCs) population in some tumor cells. In order to investigate the potential of Myc decoy oligodeoxynucleotides for differentiation therapy, mouse embryonic stem cells (mESCs) were used in this study as a model of CSCs. To our best of knowledge this is the first report outlining the application of Myc decoy in transcription factor decoy "TFD" strategy for inducing differentiation in mESCs. A 20-mer double-stranded Myc transcription factor decoy and scrambled oligodeoxynucleotides (ODNs) were designed, analyzed by electrophoretic mobility shift (EMSA) assay and transfected into the mESCs under 2 inhibitors (2i) condition. Further investigations were carried out using fluorescence and confocal microscopy, cell proliferation and apoptosis analysis, alkaline phosphatase and embryoid body formation assay, real-time PCR and western blotting. EMSA data showed that Myc decoy ODNs bound specifically to c-Myc protein. They were found to be localized in both cytoplasm and nucleus of mESCs. Our results revealed the potential capability of Myc decoy ODNs to decrease cell viability by (16.1±2%), to increase the number of cells arrested in G0/G1 phases and apoptosis by (14.2±3.1%) and (12.1±3.2%), respectively regarding the controls. Myc decoy could also modulate differentiation in mESCs despite the presence of 2i/LIF in our medium the presence of 2i/LIF in our medium. The optimized Myc decoy ODNs approach might be considered as a promising alternative strategy for differentiation therapy investigations. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  8. Analysis of the substrate recognition state of TDP-43 to single-stranded DNA using fluorescence correlation spectroscopy

    Directory of Open Access Journals (Sweden)

    Akira Kitamura

    2018-07-01

    Full Text Available Normal function and abnormal aggregation of transactivation response (TAR DNA/RNA-binding protein 43 kDa (TDP-43 are directly associated with the lethal genetic diseases: cystic fibrosis, amyotrophic lateral sclerosis (ALS, and frontotemporal lobar degeneration (FTLD. The binding of TDP-43 to single-stranded DNA (ssDNA or RNA is involved in transcriptional repression, regulation of RNA splicing, and RNA stabilization. Equilibrium dissociation constants (Kd of TDP-43 and ssDNA or RNA have been determined using various methods; however, methods that can measure Kd with high sensitivity in a short time using a small amount of TDP-43 in solution would be advantageous. Here, in order to determine the Kd of TDP-43 and fluorescence-labeled ssDNA as well as the binding stoichiometry, we use fluorescence correlation spectroscopy (FCS, which detects the slowed diffusion of molecular interactions in solution with single-molecule sensitivity, in addition to electrophoretic mobility shift assay (EMSA. Using tandem affinity chromatography of TDP-43 dually tagged with glutathione-S-transferase and poly-histidine tags, highly purified protein was obtained. FCS successfully detected specific interaction between purified TDP-43 and TG ssDNA repeats, with a Kd in the nanomolar range. The Kd of the TDP-43 mutant was not different from the wild type, although mutant oligomers, which did not bind ssDNA, were observed. Analysis of the fluorescence brightness per dimerized TDP-43/ssDNA complex was used to evaluate their binding stoichiometry. The results suggest that an assay combining FCS and EMSA can precisely analyze ssDNA recognition mechanisms, and that FCS may be applied for the rapid and quantitative determination of the interaction strength between TDP-43 and ssDNA or RNA. These methods will aid in the elucidation of the substrate recognition mechanism of ALS- and FTLD-associated variants of TDP-43.

  9. LexA Binds to Transcription Regulatory Site of Cell Division Gene ftsZ in Toxic Cyanobacterium Microcystis aeruginosa.

    Science.gov (United States)

    Honda, Takashi; Morimoto, Daichi; Sako, Yoshihiko; Yoshida, Takashi

    2018-05-17

    Previously, we showed that DNA replication and cell division in toxic cyanobacterium Microcystis aeruginosa are coordinated by transcriptional regulation of cell division gene ftsZ and that an unknown protein specifically bound upstream of ftsZ (BpFz; DNA-binding protein to an upstream site of ftsZ) during successful DNA replication and cell division. Here, we purified BpFz from M. aeruginosa strain NIES-298 using DNA-affinity chromatography and gel-slicing combined with gel electrophoresis mobility shift assay (EMSA). The N-terminal amino acid sequence of BpFz was identified as TNLESLTQ, which was identical to that of transcription repressor LexA from NIES-843. EMSA analysis using mutant probes showed that the sequence GTACTAN 3 GTGTTC was important in LexA binding. Comparison of the upstream regions of lexA in the genomes of closely related cyanobacteria suggested that the sequence TASTRNNNNTGTWC could be a putative LexA recognition sequence (LexA box). Searches for TASTRNNNNTGTWC as a transcriptional regulatory site (TRS) in the genome of M. aeruginosa NIES-843 showed that it was present in genes involved in cell division, photosynthesis, and extracellular polysaccharide biosynthesis. Considering that BpFz binds to the TRS of ftsZ during normal cell division, LexA may function as a transcriptional activator of genes related to cell reproduction in M. aeruginosa, including ftsZ. This may be an example of informality in the control of bacterial cell division.

  10. An IFNG SNP with an estrogen-like response element selectively enhances promoter expression in peripheral but not lamina propria T cells.

    Science.gov (United States)

    Gonsky, R; Deem, R L; Bream, J H; Young, H A; Targan, S R

    2006-07-01

    This study examines mucosa-specific regulatory pathways involved in modulation of interferon-gamma (IFN-gamma) in lamina propria T cells. Previous studies identified mucosa-specific CD2 cis-elements within the -204 to -108 bp IFNG promoter. Within this region, a single-site nucleotide polymorphism, -179G/T, imparts tumor necrosis factor-alpha stimulation of IFNG in peripheral blood lymphocytes, and is linked with accelerated AIDS progression. We discovered a putative estrogen response element (ERE) introduced by the -179T, which displays selective activation in peripheral blood mononuclear cells (PBMC) vs lamina propria mononuclear cells (LPMC). Transfection of PBMC with constructs containing the -179G or -179T site revealed CD2-mediated enhancement of the -179T compared to -179G allele, although, in LPMC, a similar level of expression was detected. Electrophoretic mobility shift assay (EMSA) analysis demonstrated CD2-mediated nucleoprotein binding to the -179T but not the -179G in PBMC. In LPMC, binding is constitutive to both -179G and -179T regions. Sequence and EMSA analysis suggests that the -179T allele creates an ERE-like binding site capable of binding recombinant estrogen receptor. Estrogen response element transactivation is enhanced by CD2 signaling, but inhibited by estrogen in PBMC but not in LPMC, although expression of estrogen receptor was similar. This is the first report to describe a potential molecular mechanism responsible for selectively controlling IFN-gamma production in LPMC.

  11. Regulation of MntH by a dual Mn(II- and Fe(II-dependent transcriptional repressor (DR2539 in Deinococcus radiodurans.

    Directory of Open Access Journals (Sweden)

    Hongxing Sun

    Full Text Available The high intracellular Mn/Fe ratio observed within the bacteria Deinococcus radiodurans may contribute to its remarkable resistance to environmental stresses. We isolated DR2539, a novel regulator of intracellular Mn/Fe homeostasis in D. radiodurans. Electrophoretic gel mobility shift assays (EMSAs revealed that DR2539 binds specifically to the promoter of the manganese acquisition transporter (MntH gene, and that DR0865, the only Fur homologue in D. radiodurans, cannot bind to the promoter of mntH, but it can bind to the promoter of another manganese acquisition transporter, MntABC. β-galactosidase expression analysis indicated that DR2539 acts as a manganese- and iron-dependent transcriptional repressor. Further sequence alignment analysis revealed that DR2539 has evolved some special characteristics. Site-directed mutagenesis suggested that His98 plays an important role in the activities of DR2539, and further protein-DNA binding activity assays showed that the activity of H98Y mutants decreased dramatically relative to wild type DR2539. Our study suggests that D. radiodurans has evolved a very efficient manganese regulation mechanism that involves its high intracellular Mn/Fe ratio and permits resistance to extreme conditions.

  12. The impact of chronotype on melatonin levels among shift workers.

    Science.gov (United States)

    Bhatti, Parveen; Mirick, Dana K; Davis, Scott

    2014-03-01

    The association between shift work and cancer, which is thought to be mediated by effects on circulating melatonin levels, may be modified by chronotype (ie, the inherent preference for activity in the morning or the evening); however, few studies have examined the potential impact of chronotype on the carcinogenic effects of shift work. The authors analysed the impact of chronotype on previously reported differences in melatonin levels among healthcare workers that exclusively worked night or day shifts. The cross-sectional study included 664 men and women (310 day shift and 354 night shift workers) from which urine samples were collected throughout work and sleep periods and were assayed for 6-sulfatoxymelatonin. Participants also completed the Composite Scale of Morningness, a questionnaire used to assess chronotype. Among both morning and evening-type night shift workers, 6-sulfatoxymelatonin levels were constitutively lower during daytime sleep, night-time sleep and night work compared with day shift workers during night-time sleep. However, morning-type night shift workers consistently showed 6-sulfatoxymelatonin levels that were closer to levels in day shift workers than did evening-type night shift workers. Differences in 6-sulfatoxymelatonin levels between morning-type and evening-type night shift workers relative to day shift workers were statistically significant in every instance (pnight shift workers may be better able to maintain a 'normal' circadian pattern of melatonin production as compared with evening-type night shift workers. The impact of this chronotype effect on cancer risk among shift workers requires further study.

  13. Inhibition of NF-κB activity in rabbit vascular smooth muscle cells by lovastatin

    International Nuclear Information System (INIS)

    Luan Zhaoxia; Lan Xiaoli

    2003-01-01

    Nuclear factor NF-κB is believed to play an important role in regulating the production of matrix metalloproteinase (MMPs), which induce atherosclerosis, restenosis and plaque rupture. We incubated rabbit vascular smooth muscle cells (RVSMCs) with 5 μmol/L lovastatin in the presence of IL-1-α and PDGF BB (20 μg/L, respectively) to study whether lovastatin inhibited NF-κB binding activity induced by IL-1 and PDGF. The NF-κB activity was detected by electrophoretic mobility shift assay (EMSA); MMP-1 and MMP-3 were measured by western blotting; and MMP-9 was detected by zymography. The result showed that lovastatin strongly reduced NF-κB activity upregulated by IL-1 combined with PDGF, and lovastatin also dose-dependently inhibited the expression of MMP-1, -3 and -9 induced by IL-1 and PDGF. It suggested that the beneficial effects of statins may extend to mechanisms beyond cholesterol reduction

  14. Effect of lovastatin on rabbit vascular smooth muscle cells

    International Nuclear Information System (INIS)

    Luan Zhaoxia; Pei Zhuguo

    2003-01-01

    Objective: To investigate the effect of lovastatin on binding activity of nuclear factor activator protein-1 (AP-1) to NF-κB and the expression of matrix metalloproteinase-9 (MMP-9) in rabbit vascular smooth muscle cells (VSMCs). Methods: The oligonucleotide corresponding to the consensus NF-κB element or the consensus AP-1 element was labeled by [γ- 32 P]-ATP. AP-1 and NF-κB binding activity was detected by electrophoretic mobility shift assay (EMSA), expression of MMP-9 was detected by zymography. Results: Lovastatin inhibited the expression of MMP-9 in a dose-dependent manner, this effect was reversed by mevalonate and GGPP but not by squalene; lovastatin significantly decreased AP-1 and NF-κB binding activity. Conclusion: Lovastatin decreased AP-1 and NF-κB binding activity and inhibited MMP-9 expression in rabbit VSMCs by the way of inhibiting prenylation of protein but not by cholestrol-lowering, and this might be the mechanism of its arteriosclerostic plaque stabilizing effects

  15. Association between DNA methylation in the miR-328 5'-flanking region and inter-individual differences in miR-328 and BCRP expression in human placenta.

    Directory of Open Access Journals (Sweden)

    Jumpei Saito

    Full Text Available MicroRNA (miRNA are non-coding small RNA that regulate gene expression. MiR-328 is reported to influence breast cancer resistance protein (BCRP expression in cancer cells. As a large inter-individual difference in BCRP levels is observed in various human tissues, the contribution of miR-328 to these differences is of interest. We hypothesized that DNA methylation in the miR-328 promoter region is responsible for the difference in miR-328 levels, leading to inter-individual variability in BCRP levels in human placenta. The association between placental miR-328 and BCRP levels was analyzed, and then DNA methylation in the miR-328 5'-flanking region and regulatory mechanisms causing inter-individual differences in miR-328 and BCRP levels were examined. MiR-328 expression was significantly correlated with BCRP mRNA (Rs = -0.560, P < 0.01 and protein (Rs = -0.730, P < 0.01 levels. It was also up-regulated by the demethylating agent 5-aza-2'-deoxycytidine in BCRP-expressing cells. Luciferase assays with differentially methylated reporter constructs indicated that methylation in the miR-328 5'-flanking region including a predicted CpG island remarkably decreased transcriptional activity compared to that in unmethylated constructs. We selected CCAAT/enhancer binding protein α (C/EBPα, located within the predicted CpG island, by in silico analysis. To elucidate the role of C/EBPα in miR-328 expression, a chromatin immunoprecipitation assay, promoter deletion analysis, and electrophoretic mobility shift assay (EMSA were performed. C/EBPα-binding site-truncated constructs showed significantly decreased promoter activity, and EMSA indicated that the C/EBPα-binding sites were located in the CpG island. Finally, the methylation patterns of several CpG dinucleotides proximal to two C/EBPα-binding sites in the miR-328 5'-flanking region were correlated negatively with miR-328 levels, and positively with BCRP levels in human placental samples. These

  16. Effect of dioxins on regulation of tyrosine hydroxylase gene expression by aryl hydrocarbon receptor: a neurotoxicology study

    Directory of Open Access Journals (Sweden)

    Akahoshi Eiichi

    2009-06-01

    Full Text Available Abstract Background Dioxins and related compounds are suspected of causing neurological disruption. Epidemiological studies indicated that exposure to these compounds caused neurodevelopmental disturbances such as learning disability and attention deficit hyperactivity disorder, which are thought to be closely related to dopaminergic dysfunction. Although the molecular mechanism of their actions has not been fully investigated, a major participant in the process is aryl hydrocarbon receptor (AhR. This study focused on the effect of 2, 3, 7, 8-tetrachlorodibenzo-p-dioxin (TCDD exposure on the regulation of TH, a rate-limiting enzyme of dopamine synthesis, gene expression by AhR. Methods N2a-Rβ cells were established by transfecting murine neuroblastoma Neuro2a with the rat AhR cDNA. TH expression induced by TCDD was assessed by RT-PCR and Western blotting. Participation of AhR in TCDD-induced TH gene expression was confirmed by suppressing AhR expression using the siRNA method. Catecholamines including dopamine were measured by high-performance liquid chromatography. A reporter gene assay was used to identify regulatory motifs in the promoter region of TH gene. Binding of AhR with the regulatory motif was confirmed by an electrophoretic mobility shift assay (EMSA. Results Induction of TH by TCDD through AhR activation was detected at mRNA and protein levels. Induced TH protein was functional and its expression increased dopamine synthesis. The reporter gene assay and EMSA indicated that AhR directly regulated TH gene expression. Regulatory sequence called aryl hydrocarbon receptor responsive element III (AHRE-III was identified upstream of the TH gene from -285 bp to -167 bp. Under TCDD exposure, an AhR complex was bound to AHRE-III as well as the xenobiotic response element (XRE, though AHRE-III was not identical to XRE, the conventional AhR-binding motif. Conclusion Our results suggest TCDD directly regulate the dopamine system by TH gene

  17. Myeloid cell leukemia-1 (Mc1-1 is a candidate target gene of hypoxia-inducible factor-1 (HIF-1 in the testis

    Directory of Open Access Journals (Sweden)

    Palladino Michael A

    2012-12-01

    Full Text Available Abstract Background Spermatic cord torsion can lead to testis ischemia (I and subsequent ischemia-reperfusion (I/R causing germ cell-specific apoptosis. Previously, we demonstrated that the hypoxia-inducible factor-1 (HIF-1 transcription factor, a key regulator of physiological responses to hypoxia, is abundant in Leydig cells in normoxic and ischemic testes. We hypothesize that testicular HIF-1 activates the expression of antiapoptotic target genes to protect Leydig cells from apoptosis. In silico analysis of testis genes containing a consensus hypoxia response element (HRE, 5’-RCGTG-3’ identified myeloid cell leukemia-1 (Mcl-1 as a potential HIF-1 target gene. The purpose of this study was to determine whether HIF-1 shows DNA-binding activity in normoxic and ischemic testes and whether Mcl-1 is a target gene of testicular HIF-1. Methods The testicular HIF-1 DNA-binding capacity was analyzed in vitro using a quantitative enzyme-linked immunosorbent assay (ELISA and electrophoretic mobility shift assays (EMSA. MCL-1 protein expression was evaluated by immunoblot analysis and immunohistochemistry. The binding of testicular HIF-1 to the Mcl-1 gene was examined via chromatin immunoprecipitation (ChIP analysis. Results The ELISA and EMSA assays demonstrated that testicular HIF-1 from normoxic and ischemic testes binds DNA equally strongly, suggesting physiological roles for HIF-1 in the normoxic testis, unlike most tissues in which HIF-1 is degraded under normoxic conditions and is only activated by hypoxia. MCL-1 protein was determined to be abundant in both normoxic and ischemic testes and expressed in Leydig cells. In a pattern identical to that of HIF-1 expression, the steady-state levels of MCL-1 were not significantly affected by I or I/R and MCL-1 co-localized with HIF-1α in Leydig cells. Chromatin immunoprecipitation (ChIP analysis using a HIF-1 antibody revealed sequences enriched for the Mcl-1 promoter. Conclusions The results

  18. A nonradioactive assay for poly(a)-specific ribonuclease activity by methylene blue colorimetry.

    Science.gov (United States)

    Cheng, Yuan; Liu, Wei-Feng; Yan, Yong-Bin; Zhou, Hai-Meng

    2006-01-01

    A simple nonradioactive assay, which was based on the specific shift of the absorbance maximum of methylene blue induced by its intercalation into poly(A) molecules, was developed for poly(A)-specific ribonuclease (PARN). A good linear relationship was found between the absorbance at 662 nm and the poly(A) concentration. The assay conditions, including the concentration of methylene blue, the incubation temperature and time, and the poly(A) concentration were evaluated and optimized.

  19. Shift Work and Cognitive Flexibility: Decomposing Task Performance.

    Science.gov (United States)

    Cheng, Philip; Tallent, Gabriel; Bender, Thomas John; Tran, Kieulinh Michelle; Drake, Christopher L

    2017-04-01

    Deficits in cognitive functioning associated with shift work are particularly relevant to occupational performance; however, few studies have examined how cognitive functioning is associated with specific components of shift work. This observational study examined how circadian phase, nocturnal sleepiness, and daytime insomnia in a sample of shift workers ( N = 30) were associated with cognitive flexibility during the night shift. Cognitive flexibility was measured using a computerized task-switching paradigm, which produces 2 indexes of flexibility: switch cost and set inhibition. Switch cost represents the additional cognitive effort required in switching to a different task and can impact performance when multitasking is involved. Set inhibition is the efficiency in returning to previously completed tasks and represents the degree of cognitive perseveration, which can lead to reduced accuracy. Circadian phase was measured via melatonin assays, nocturnal sleepiness was assessed using the Multiple Sleep Latency Test, and daytime insomnia was assessed using the Insomnia Severity Index. Results indicated that those with an earlier circadian phase, insomnia, and sleepiness exhibited reduced cognitive flexibility; however, specific components of cognitive flexibility were differentially associated with circadian phase, insomnia, and sleepiness. Individuals with an earlier circadian phase (thus more misaligned to the night shift) exhibited larger switch costs, which was also associated with reduced task efficiency. Shift workers with more daytime insomnia demonstrated difficulties with cognitive inhibition, whereas nocturnal sleepiness was associated with difficulties in reactivating previous tasks. Deficits in set inhibition were also related to reduced accuracy and increased perseverative errors. Together, this study indicates that task performance deficits in shift work are complex and are variably impacted by different mechanisms. Future research may examine

  20. Sox6 directly silences epsilon globin expression in definitive erythropoiesis.

    Directory of Open Access Journals (Sweden)

    2006-02-01

    Full Text Available Sox6 is a member of the Sox transcription factor family that is defined by the conserved high mobility group (HMG DNA binding domain, first described in the testis determining gene, Sry. Previous studies have suggested that Sox6 plays a role in the development of the central nervous system, cartilage, and muscle. In the Sox6-deficient mouse, p100H, epsilony globin is persistently expressed, and increased numbers of nucleated red cells are present in the fetal circulation. Transfection assays in GM979 (erythroleukemic cells define a 36-base pair region of the epsilony proximal promoter that is critical for Sox6 mediated repression. Electrophoretic mobility shift assay (EMSA and chromatin immunoprecipitation (ChIP assays demonstrate that Sox6 acts as a repressor by directly binding to the epsilony promoter. The normal expression of Sox6 in wild-type fetal liver and the ectopic expression of epsilony in p100H homozygous fetal liver demonstrate that Sox6 functions in definitive erythropoiesis. The present study shows that Sox6 is required for silencing of epsilony globin in definitive erythropoiesis and suggests a role for Sox6 in erythroid cell maturation. Thus, Sox6 regulation of epsilony globin might provide a novel therapeutical target in the treatment of hemoglobinopathies such as sickle cell anemia and thalassemia.

  1. Single nucleotide polymorphism rs13042395 in the SLC52A3 gene as a biomarker for regional lymph node metastasis and relapse-free survival of esophageal squamous cell carcinoma patients

    International Nuclear Information System (INIS)

    Tan, Hua-Zhen; Wu, Zhi-Yong; Wu, Jian-Yi; Long, Lin; Jiao, Ji-Wei; Peng, Yu-Hui; Xu, Yi-Wei; Li, Shan-Shan; Wang, Wei; Zhang, Jian-Jun; Li, En-Min; Xu, Li-Yan

    2016-01-01

    SLC52A3 was recently identified as a susceptibility gene for esophageal squamous cell carcinoma (ESCC). However, associations between the single nucleotide polymorphisms (SNPs) rs13042395 (C > T) and rs3746803 (G > A) in SLC52A3 and risk, tumor characteristics and survival of ESCC patients remain inconclusive and of unknown prognostic significance. Analyses of the association between SNPs in SLC52A3 and ESCC risk were performed on 479 ESCC cases, together with 479 controls, in a case-control study. Blood samples for cases and controls were collected and genotyped by real-time polymerase chain reaction (PCR) using TaqMan assays. Among the 479 ESCC cases, 343 cases with complete clinical data were used to investigate the association between SNPs and ESCC clinical characteristics; 288 cases with complete clinical data and 5-year follow-up data were used to analyze the association between SNPs and prognosis. Dual luciferase reporter assays and electrophoretic mobility shift assays (EMSAs) were used to investigate the biological function of rs13042395. No association was found between SLC52A3 rs3746803 and susceptibility, tumor characteristics or survival of ESCC patients. For rs13042395, TT genotype carriers were likely to have reduced lymph node metastasis (odds ratio (OR) = 0.55, 95 % confidence interval (CI), 0.31–0.98) and longer relapse-free survival time (P = 0.03) . Also, both rs13042395 (hazard ratio (HR) = 0.62, 95 % CI, 0.38–0.99) and regional lymph node metastasis (HR = 2.06, 95 % CI, 1.36–3.13 for N1 vs. N0; HR = 2.88, 95 % CI, 1.70–4.86 for N2 vs. N0; HR = 2.08, 95 % CI, 1.01–4.30 for N3 vs. N0) were independent factors affecting relapse-free survival for ESCC patients who underwent surgery. Dual luciferase reporter assays and EMSAs suggested that the CC genotype of rs13042395 enhanced SLC52A3 expression, probably via binding with specific transcription factors. The rs13042395 polymorphism in SLC52A3 is associated with regional lymph node

  2. Centrifugation assay for measuring adhesion of serially passaged bovine chondrocytes to polystyrene surfaces.

    Science.gov (United States)

    Kaplan, David S; Hitchins, Victoria M; Vegella, Thomas J; Malinauskas, Richard A; Ferlin, Kimberly M; Fisher, John P; Frondoza, Carmelita G

    2012-07-01

    A major obstacle in chondrocyte-based therapy for cartilage repair is the limited availability of cells that maintain their original phenotype. Propagation of chondrocytes as monolayer cultures on polystyrene surfaces is used extensively for amplifying cell numbers. However, chondrocytes undergo a phenotypic shift when propagated in this manner and display characteristics of more adherent fibroblastic cells. Little information is available about the effect of this phenotypic shift on cellular adhesion properties. We evaluated changes in adhesion property as bovine chondrocytes were serially propagated up to five passages in monolayer culture using a centrifugation cell adhesion assay, which was based on counting of cells before and after being exposed to centrifugal dislodgement forces of 120 and 350 g. Chondrocytes proliferated well in a monolayer culture with doubling times of 2-3 days, but they appeared more fibroblastic and exhibited elongated cell morphology with continued passage. The centrifugation cell adhesion assay showed that chondrocytes became more adhesive with passage as the percentage of adherent cells after centrifugation increased and was not statistically different from the adhesion of the fibroblast cell line, L929, starting at passage 3. This increased adhesiveness correlated with a shift to a fibroblastic morphology and increased collagen I mRNA expression starting at passage 2. Our findings indicate that the centrifugation cell adhesion assay may serve as a reproducible tool to track alterations in chondrocyte phenotype during their extended propagation in culture.

  3. Rapid Detection of Glycogen Synthase Kinase-3 Activity in Mouse Sperm Using Fluorescent Gel Shift Electrophoresis

    Directory of Open Access Journals (Sweden)

    Hoseok Choi

    2016-04-01

    Full Text Available Assaying the glycogen synthase kinase-3 (GSK3 activity in sperm is of great importance because it is closely implicated in sperm motility and male infertility. While a number of studies on GSK3 activity have relied on labor-intensive immunoblotting to identify phosphorylated GSK3, here we report the simple and rapid detection of GSK3 activity in mouse sperm using conventional agarose gel electrophoresis and a fluorescent peptide substrate. When a dye-tethered and prephosphorylated (primed peptide substrate for GSK3 was employed, a distinct mobility shift in the fluorescent bands on the agarose was observed by GSK3-induced phosphorylation of the primed peptides. The GSK3 activity in mouse testes and sperm were quantifiable by gel shift assay with low sample consumption and were significantly correlated with the expression levels of GSK3 and p-GSK3. We suggest that our assay can be used for reliable and rapid detection of GSK3 activity in cells and tissue extracts.

  4. Rapid Detection of Glycogen Synthase Kinase-3 Activity in Mouse Sperm Using Fluorescent Gel Shift Electrophoresis

    Science.gov (United States)

    Choi, Hoseok; Choi, Bomi; Seo, Ju Tae; Lee, Kyung Jin; Gye, Myung Chan; Kim, Young-Pil

    2016-01-01

    Assaying the glycogen synthase kinase-3 (GSK3) activity in sperm is of great importance because it is closely implicated in sperm motility and male infertility. While a number of studies on GSK3 activity have relied on labor-intensive immunoblotting to identify phosphorylated GSK3, here we report the simple and rapid detection of GSK3 activity in mouse sperm using conventional agarose gel electrophoresis and a fluorescent peptide substrate. When a dye-tethered and prephosphorylated (primed) peptide substrate for GSK3 was employed, a distinct mobility shift in the fluorescent bands on the agarose was observed by GSK3-induced phosphorylation of the primed peptides. The GSK3 activity in mouse testes and sperm were quantifiable by gel shift assay with low sample consumption and were significantly correlated with the expression levels of GSK3 and p-GSK3. We suggest that our assay can be used for reliable and rapid detection of GSK3 activity in cells and tissue extracts. PMID:27092510

  5. Have you stress tested your assay?

    Directory of Open Access Journals (Sweden)

    Zheng Cao

    2016-08-01

    Full Text Available Objectives: When a clinical assay is stressed with extraordinarily high volume of specimens over a short period of time, extra caution may be needed to avoid systematic errors and biases. Here we report our experience with a HgbA1c assay used for high volume wellness screening purpose, to illustrate the importance of stress testing during assay validation. Design and Methods: Over 15,000 whole blood specimens were tested for HgbA1c in a period of 2 months. HgbA1c was tested by an immunoturbidimetric method on a high through-put automation line. The HgbA1c population distribution in our study was compared to that from the NHANES database. Daily distributions of HgbA1c values ≥6%, means and medians were plotted. Correlation studies were performed between the high through-put immunoturbidimetric assay and a medium through-put HPLC method. Results: We observed a shift of HgbA1c distribution to the higher values compared to the NHANES. A bias of 15–20% was noted from further stress testing where large number of samples were batched and tested using the immunoturbidimetric assay. A 5–7% higher bias remained after implementing a cuvette washing program after each HgbA1c sample. We hypothesized this bias was caused by build-up of blood cell fragments in the cuvettes when continuous whole blood samples are run through the system. Our experience suggests stress testing needs to be incorporated early in the test validation process for high volume batched screening applications. This seemingly extra validation step may save significant troubleshooting and retesting efforts down the road. Keywords: Hemoglobin A1c, Immunoturbidimetric assay, HPLC, Quality assurance, Systematic bias, High volume, Automation

  6. Hypoxia Inducible Factor 1 (HIF1) Activation in U87 Glioma Cells Involves a Decrease in Reactive Oxygen Species Production and Protein Kinase C Activity

    Science.gov (United States)

    1998-06-29

    Curcumin DFX Desferrioxamine DNA Deoxyribonucleic Acid DPI Diphenyliodinium DPPD Diphenylphenylenediamine DTH Dithionite EMSA Electrophoretic mobility shift... neuroprotective effects (Fern et al., 1996, Morishita et al., 1 1997). The identification of a hypoxia inducible transcription factor known as HIF-1 (Semenza...derived EPO in the eNS neuroprotective response to hypoxia. Cloning of the human and murine EPO gene, the availability of a convenient EPa producing

  7. Field experience with a mobile tomographic nondestructive assay system

    International Nuclear Information System (INIS)

    Prettyman, T.H.; Betts, S.E.; Taggart, D.P.; Estep, R.J.; Nicholas, N.J.; Lucas, M.C.; Harlan, R.A.

    1995-01-01

    A mobile tomographic gamma-ray scanner (TGS) developed by Los Alamos National Laboratory was recently demonstrated at the Rocky Flats Environmental Technology Site and is currently in use at Los Alamos waste storage areas. The scanner was developed to assay radionuclides in low-level, transuranic, and mixed waste in containers ranging in size from 2 ft 3 boxes to 83-gallon overpacks. The tomographic imaging capability provides a complete correction for source distribution and matrix attenuation effects, enabling accurate assays of Pu-239 and other gamma-ray emitting isotopes. In addition, the system can reliably detect self-absorbing material such as plutonium metal shot, and can correct for bias caused by self-absorption. The system can be quickly configured to execute far-field scans, segmented gamma-ray scans, and a host of intermediate scanning protocols, enabling higher throughput (up to 20 drums per 8-hour shift). In this paper, we will report on the results of field trials of the mobile system at Rocky Flats and Los Alamos. Assay accuracy is confirmed for cases in which TGS assays can be compared with assays (e.g. with calorimetry) of individual packages within the drums. The mobile tomographic technology is expected to considerably reduce characterization costs at DOE production and environmental technology sites

  8. Structural characterization of the RNA chaperone Hfq from the nitrogen-fixing bacterium Herbaspirillum seropedicae SmR1.

    Science.gov (United States)

    Kadowaki, Marco Antonio Seiki; Iulek, Jorge; Barbosa, João Alexandre Ribeiro Gonçalves; Pedrosa, Fábio de Oliveira; de Souza, Emanuel Maltempi; Chubatsu, Leda Satie; Monteiro, Rose Adele; de Oliveira, Marco Aurélio Schüler; Steffens, Maria Berenice Reynaud

    2012-02-01

    The RNA chaperone Hfq is a homohexamer protein identified as an E. coli host factor involved in phage Qβ replication and it is an important posttranscriptional regulator of several types of RNA, affecting a plethora of bacterial functions. Although twenty Hfq crystal structures have already been reported in the Protein Data Bank (PDB), new insights into these protein structures can still be discussed. In this work, the structure of Hfq from the β-proteobacterium Herbaspirillum seropedicae, a diazotroph associated with economically important agricultural crops, was determined by X-ray crystallography and small-angle X-ray scattering (SAXS). Biochemical assays such as exclusion chromatography and RNA-binding by the electrophoretic shift assay (EMSA) confirmed that the purified protein is homogeneous and active. The crystal structure revealed a conserved Sm topology, composed of one N-terminal α-helix followed by five twisted β-strands, and a novel π-π stacking intra-subunit interaction of two histidine residues, absent in other Hfq proteins. Moreover, the calculated ab initio envelope based on small-angle X-ray scattering (SAXS) data agreed with the Hfq crystal structure, suggesting that the protein has the same folding structure in solution. Copyright © 2011 Elsevier B.V. All rights reserved.

  9. Felodipine attenuates vascular inflammation in a fructose-induced rat model of metabolic syndrome via the inhibition of NF-kappaB activation.

    Science.gov (United States)

    Tan, Hong-wei; Xing, Shan-shan; Bi, Xiu-ping; Li, Li; Gong, Hui-ping; Zhong, Ming; Zhang, Yun; Zhang, Wei

    2008-09-01

    Metabolic syndrome is associated with an increased incidence of atherosclerosis. Clinical studies have shown that calcium channel blockers (CCB) inhibit the progression of atherosclerosis. However, the underlying mechanism is unclear. We investigated the inhibitory effect of felodipine on adhesion molecular expression and macrophage infiltration in the aorta of high fructose-fed rats (FFR). Male Wistar rats were given 10% fructose in drinking water. After 32 weeks of high fructose feeding, they were treated with felodipine (5 mg x kg(-1) x d(-1)) for 6 weeks. The control rats were given a normal diet and water. The aortic expression of intercellular adhesion molecule-1 (ICAM-1) and vascular cell adhesion molecule-1 (VCAM-1) and the infiltration of macrophages were measured by real-time RT-PCR and/or immunohistochemistry. NF-kappaB activity was measured by electrophoretic mobility shift assay (EMSA). After 32 weeks of high fructose feeding, FFR displayed increased body weight, systolic blood pressure (SBP), serum insulin, and triglycerides when compared with the control rats. The aortic expressions of ICAM-1 and VCAM-1 were significantly increased in FFR than in the control rats and accompanied by the increased activity of NF-kappaB. FFR also showed significantly increased CD68- positive macrophages in the aortic wall. After treatment with felodipine, SBP, serum insulin, and the homeostasis model assessment decreased significantly. In addition to reducing ICAM-1 and VCAM-1, felodipine decreased macrophages in the aortic wall. EMSA revealed that felodipine inhibited NF-kappaB activation in FFR. Felodipine inhibited vessel wall inflammation. The inhibition of NF-kappaB may be involved in the modulation of vascular inflammatory response by CCB in metabolic syndrome.

  10. WORTMANNIN affect cellular response by radiation

    International Nuclear Information System (INIS)

    Li Yu; Li Bailong

    2010-01-01

    Objective: To observe radiation Response of cells by WORTMANNIN (WT), which is inhibitor for Phosphatidylinositol-3 Kinase (PI-3K). Methods: LP3 cells are prepared with different concentration of WT for 1 hour and receive different dose γ irradiation. To continue the cell for clone culture, and get the production of dose-survival curve. 1800 pulsed-field gel electrophoresis is used to detect DNA double-strand breaks after the 20 Gy γ irradiation. Continue to use the mobility shift assays (Electrophoresis Mobility Shift Assay, EMSA) to observe NF-kB transcription factor of the corresponding changes. Result: WT can be found to increase the radiation sensitivity of SP3 cells, the best sensitizer concentration in 20 μmol /L or more, obvious sensitizing effect within 6 h time; the electrophoresis experiments showed that after irradiation with time, by 50 μmol /L WT group DNA the gel is higher than that of the simple exposure group; transcription factor NF-kB binding activity in the 6 hours after exposure experiences a low-rise and then the process of rising with its the peak of the change reaching after about 3 hours after irradiation. Conclusion: It suggests the existence of PI-3K-mediated radiation sensitizer pathways. Ionizing radiation may activate NF-kB, which caused some DNA damage repair and other defense mechanisms and cell-related gene activity in order to reduce radiation damage. WT may block this process through the early stages of radiation-sensitizing effect. (authors)

  11. Patient pools and the use of "patient means" are valuable tools in quality control illustrated by a bone-specific alkaline phosphatase assay

    DEFF Research Database (Denmark)

    Hinge, Maja; Lund, Erik D.; Brandslund, Ivan

    2016-01-01

    BACKGROUND: Quality control (QC) is an essential part of clinical biochemistry to ensure that laboratory test results are reliable and correct. Those tests without a defined reference method constitute a special challenge, as is the case with bone-specific alkaline phosphatase (BAP). METHODS...... AND RESULTS: The present study reports an example where a shift in a BAP assay was detected by use of a patient pool and supported by a retrospective calculation of "patient mean", while the external QC and specific assay control material were unaffected by the shift. CONCLUSIONS: Patient pools and the use...

  12. Long noncoding RNA HOTAIR, a hypoxia-inducible factor-1α activated driver of malignancy, enhances hypoxic cancer cell proliferation, migration, and invasion in non-small cell lung cancer.

    Science.gov (United States)

    Zhou, Chunxia; Ye, Lincai; Jiang, Chuan; Bai, Jie; Chi, Yongbin; Zhang, Haibo

    2015-12-01

    Despite the fact that great advances have been made in the management of non-small cell lung cancer (NSCLC), the prognosis of advanced NSCLC remains very poor. HOX transcript antisense intergenic RNA (HOTAIR) has been identified as an oncogenic long noncoding RNA (lncRNA) that is involved in the progression of a variety of carcinomas and acts as a negative prognostic biomarker. Yet, little is known about the effect of HOTAIR in the hypoxic microenvironment of NSCLC. The expression and promoter activity of HOTAIR were measured by quantitative real-time polymerase chain reaction (qRT-PCR) and luciferase reporter assay. The function of the hypoxia-inducible factor-1α (HIF-1α) binding site to hypoxia-responsive elements (HREs) in the HOTAIR promoter region was tested by luciferase reporter assay with nucleotide substitutions. The binding of HIF-1α to the HOTAIR promoter in vivo was confirmed by chromatin immunoprecipitation assay (CHIP) and electrophoretic mobility shift assay (EMSA). The effect of HIF-1α suppression by small interference RNA or YC-1 on HOTAIR expression was also determined. In the present study, we demonstrated that HOTAIR was upregulated by hypoxia in NSCLC cells. HOTAIR is a direct target of HIF-1α through interaction with putative HREs in the upstream region of HOTAIR in NSCLC cells. Furthermore, HIF-1α knockdown or inhibition could prevent HOTAIR upregulation under hypoxic conditions. Under hypoxic conditions, HOTAIR enhanced cancer cell proliferation, migration, and invasion. These data suggested that suppression of HOTAIR upon hypoxia of NSCLC could be a novel therapeutic strategy.

  13. Oxidative stress and inflammatory response to printer toner particles in human epithelial A549 lung cells.

    Science.gov (United States)

    Könczöl, Mathias; Weiß, Adilka; Gminski, Richard; Merfort, Irmgard; Mersch-Sundermann, Volker

    2013-02-04

    Reports on adverse health effects related to occupational exposure to toner powder are still inconclusive. Therefore, we have previously conducted an in vitro-study to characterize the genotoxic potential of three commercially available black printer toner powders in A549 lung cells. In these cell-based assays it was clearly demonstrated that the tested toner powders damage DNA and induce micronucleus (MN) formation. Here, we have studied the cytotoxic and proinflammatory potential of these three types of printer toner particles and the influence of ROS and NF-κB induction in order to unravel the underlying mechanisms. A549 cells were exposed to various concentrations of printer toner particle suspensions for 24 h. The toner particles were observed to exert significant cytotoxic effects in the WST-1 and neutral red (NR)-assays, although to a varying extent. Caspase 3/7 activity increased, while the mitochondrial membrane potential (MMP) was not affected. Particles of all three printer toner powders induced concentration-dependent formation of reactive oxygen species (ROS), as measured in the DCFH-DA assay. Furthermore, toner particle exposure enhanced interleukin-6 and interleukin-8 production, which is in agreement with activation of the transcription factor NF-κB in A549 cells shown by the electrophoretic mobility shift assay (EMSA). Therefore, it can be concluded that exposure of A549 lung cells to three selected printer toner powders caused oxidative stress through induction of ROS. Increased ROS formation may trigger genotoxic effects and activate proinflammatory pathways. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  14. Transcriptional regulation of human RANK ligand gene expression by E2F1

    International Nuclear Information System (INIS)

    Hu Yan; Sun Meng; Nadiminty, Nagalakshmi; Lou Wei; Pinder, Elaine; Gao, Allen C.

    2008-01-01

    Receptor activator of nuclear factor kappa B ligand (RANKL) is a critical osteoclastogenic factor involved in the regulation of bone resorption, immune function, the development of mammary gland and cardiovascular system. To understand the transcriptional regulation of RANKL, we amplified and characterized a 1890 bp 5'-flanking sequence of human RANKL gene (-1782 bp to +108 bp relative to the transcription start site). Using a series of deletion mutations of the 1890 bp RANKL promoter, we identified a 72 bp region (-172 to -100 bp) mediating RANKL basal transcriptional activity. Sequence analysis revealed a putative E2F binding site within this 72 bp region in the human RANKL promoter. Overexpression of E2F1 increased RANKL promoter activity, while down-regulation of E2F1 expression by small interfering RNA decreased RANKL promoter activity. RT-PCR and enzyme linked immunosorbent assays (ELISA) further demonstrated that E2F1 induced the expression of RANKL. Electrophoretic gel mobility shift assays (EMSA) and antibody competition assays confirmed that E2F1 proteins bind to the consensus E2F binding site in the RANKL promoter. Mutation of the E2F consensus binding site in the RANKL promoter profoundly reduced the basal promoter activity and abolished the transcriptional modulation of RANKL by E2F1. These results suggest that E2F1 plays an important role in regulating RANKL transcription through binding to the E2F consensus binding site

  15. A homeodomain transcription factor gene, PfMSX, activates expression of Pif gene in the pearl oyster Pinctada fucata.

    Directory of Open Access Journals (Sweden)

    Mi Zhao

    Full Text Available We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs PfMSX binded to MSX consensus binding sites in the 5' flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster.

  16. A Homeodomain Transcription Factor Gene, PfMSX, Activates Expression of Pif Gene in the Pearl Oyster Pinctada fucata

    Science.gov (United States)

    Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi

    2014-01-01

    We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5′ flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster. PMID:25099698

  17. NF-kappaB mediates FGF signal regulation of msx-1 expression.

    Science.gov (United States)

    Bushdid, P B; Chen, C L; Brantley, D M; Yull, F; Raghow, R; Kerr, L D; Barnett, J V

    2001-09-01

    The nuclear factor-kappaB (NF-kappaB) family of transcription factors is involved in proliferation, differentiation, and apoptosis in a stage- and cell-dependent manner. Recent evidence has shown that NF-kappaB activity is necessary for both chicken and mouse limb development. We report here that the NF-kappaB family member c-rel and the homeodomain gene msx-1 have partially overlapping expression patterns in the developing chick limb. In addition, inhibition of NF-kappaB activity resulted in a decrease in msx-1 mRNA expression. Sequence analysis of the msx-1 promoter revealed three potential kappaB-binding sites similar to the interferon-gamma (IFN-gamma) kappaB-binding site. These sites bound to c-Rel, as shown by electrophoretic mobility shift assay (EMSA). Furthermore, inhibition of NF-kappaB activity significantly reduced transactivation of the msx-1 promoter in response to FGF-2/-4, known stimulators of msx-1 expression. These results suggest that NF-kappaB mediates the FGF-2/-4 signal regulation of msx-1 gene expression. Copyright 2001 Academic Press.

  18. A homeodomain transcription factor gene, PfMSX, activates expression of Pif gene in the pearl oyster Pinctada fucata.

    Science.gov (United States)

    Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi

    2014-01-01

    We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5' flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster.

  19. Regulatory role of tetR gene in a novel gene cluster of Acidovorax avenae subsp. avenae RS-1 under oxidative stress

    Directory of Open Access Journals (Sweden)

    He eLiu

    2014-10-01

    Full Text Available Acidovorax avenae subsp. avenae is the causal agent of bacterial brown stripe disease in rice. In this study, we characterized a novel horizontal transfer of a gene cluster, including tetR, on the chromosome of A. avenae subsp. avenae RS-1 by genome-wide analysis. TetR acted as a repressor in this gene cluster and the oxidative stress resistance was enhanced in tetR-deletion mutant strain. Electrophoretic mobility shift assay (EMSA demonstrated that TetR regulator bound directly to the promoter of this gene cluster. Consistently, the results of quantitative real-time PCR also showed alterations in expression of associated genes. Moreover, the proteins affected by TetR under oxidative stress were revealed by comparing proteomic profiles of wild-type and mutant strains via 1D SDS-PAGE and LC-MS/MS analyses. Taken together, our results demonstrated that tetR gene in this novel gene cluster contributed to cell survival under oxidative stress, and TetR protein played an important regulatory role in growth kinetics, biofilm-forming capability, SOD and catalase activity, and oxide detoxicating ability.

  20. Identification of a peroxisome proliferator responsive element (PPRE)-like cis-element in mouse plasminogen activator inhibitor-1 gene promoter

    International Nuclear Information System (INIS)

    Chen Jiegen; Li Xi; Huang Haiyan; Liu Honglei; Liu Deguo; Song Tanjing; Ma Chungu; Ma Duan; Song Houyan; Tang Qiqun

    2006-01-01

    PAI-1 is expressed and secreted by adipose tissue which may mediate the pathogenesis of obesity-associated cardiovascular complications. Evidence is presented in this report that PAI-1 is not expressed by preadipocyte, but significantly induced during 3T3-L1 adipocyte differentiation and the PAI-1 expression correlates with the induction of peroxisome proliferator-activated receptor γ (PPARγ). A peroxisome proliferator responsive element (PPRE)-like cis-element (-206TCCCCCATGCCCT-194) is identified in the mouse PAI-1 gene promoter by electrophoretic mobility shift assay (EMSA) combined with transient transfection experiments; the PPRE-like cis-element forms a specific DNA-protein complex only with adipocyte nuclear extracts, not with preadipocyte nuclear extracts; the DNA-protein complex can be totally competed away by non-labeled consensus PPRE, and can be supershifted with PPARγ antibody. Mutation of this PPRE-like cis-element can abolish the transactivation of mouse PAI-1 promoter mediated by PPARγ. Specific PPARγ ligand Pioglitazone can significantly induce the PAI-1 expression, and stimulate the secretion of PAI-1 into medium

  1. Is Shift Work Associated with Lipid Disturbances and Increased Insulin Resistance?

    Science.gov (United States)

    Alefishat, Eman; Abu Farha, Rana

    2015-11-01

    Shift work is associated with higher risk of metabolic disturbances and cardiovascular diseases. There are contradictory reports on the effect of shift work on lipid parameters in the literature. No studies have investigated any possible association between shift work and the ratio of serum triglyceride to high density lipoprotein cholesterol (TG/HDL-C ratio). This ratio can be used as a predictor for insulin resistance. The main aim of the present cross-sectional study was to investigate the association between shift work and serum TG/HDL-C ratio, TG level, and HDL-C level. One hundred and forty adult Jordanian employees were recruited. Demographic data, lifestyle habits, clinical parameters, and working patterns data were documented through a well-structured questionnaire. Serum TG and HDL-C levels were measured after at least 9 hours fasting using enzymatic assay procedure. Compared with daytime workers (58 subjects), shift workers (82 subjects) displayed higher TG/HDL-C ratio (r = 0.217, P = 0.013), higher serum TG levels (r = 0.220, P = 0.012), and lower HDL-C levels (r = -0.200, P = 0.016). Among shift workers, 30.5% were found to have a TG/HDL-C ratio >3.5 compared with 8.6% of daytime workers (P = 0.002). In the present study, shift work was shown to be associated with higher TG/HDL-C ratio, higher serum TG, and lower HDL-C levels. These findings might indicate that shift work is associated with increased insulin resistance and consequently higher risk of metabolic syndrome and cardiovascular diseases.

  2. Shift Colors

    Science.gov (United States)

    Publications & News Shift Colors Pages default Sign In NPC Logo Banner : Shift Colors Search Navy Personnel Command > Reference Library > Publications & News > Shift Colors Top Link Bar Navy Personnel Library Expand Reference Library Quick Launch Shift Colors Shift Colors Archives Mailing Address How to

  3. Lanthanide shift reagents, binding, shift mechanisms and exchange

    International Nuclear Information System (INIS)

    Boer, J.W.M. de

    1977-01-01

    Paramagnetic lanthanide shift reagents, when added to a solution of a substrate, induce shifts in the nuclear magnetic resonance (NMR) spectrum of the substrate molecules. The induced shifts contain information about the structure of the shift reagent substrate complex. The structural information, however, may be difficult to extract because of the following effects: (1) different complexes between shift reagent and substrate may be present in solution, e.g. 1:1 and 1:2 complexes, and the shift observed is a weighed average of the shifts of the substrate nuclei in the different complexes; (2) the Fermi contact interaction, arising from the spin density at the nucleus, contributes to the induced shift; (3) chemical exchange effects may complicate the NMR spectrum. In this thesis, the results of an investigation into the influence of these effects on the NMR spectra of solutions containing a substrate and LSR are presented. The equations describing the pseudo contact and the Fermi contact shift are derived. In addition, it is shown how the modified Bloch equations describing the effect of the chemical exchange processes occurring in the systems studied can be reduced to the familiar equations for a two-site exchange case. The binding of mono- and bifunctional ethers to the shift reagent are reported. An analysis of the induced shifts is given. Finally, the results of the experiments performed to study the exchange behavior of dimethoxyethane and heptafluorodimethyloctanedionato ligands are presented

  4. Chemical composition, antioxidant, antitumor, anticancer and cytotoxic effects of Psidium guajava leaf extracts.

    Science.gov (United States)

    Ashraf, Aisha; Sarfraz, Raja Adil; Rashid, Muhammad Abid; Mahmood, Adeel; Shahid, Muhammad; Noor, Nadia

    2016-10-01

    Context Psidium guajava L. (Myrtaceae) leaves are used in traditional medicines for the treatment of cancer, inflammation and other ailments. Objective The current study explores scientific validation for this traditional medication. Materials and methods We used ferric-reducing antioxidant power (FRAP) and 2,2-diphenyl-1-picryl hydrazil (DPPH) assays to estimate antioxidant activity of P. guajava leaf extracts (methanol, hexane and chloroform). Antitumour and in vivo cytotoxic activities were determined using potato disc assay (PDA) and brine shrimp lethality assay, respectively. Three human carcinoma cell lines (KBM5, SCC4 and U266) were incubated with different doses (10-100 μg/mL) of extracts and the anticancer activity was estimated by MTT assay. NF-κB suppressing activity was determined using electrophoretic mobility shift assay (EMSA). Chemical composition of the three extracts was identified by GC-MS. Total phenolic and flavonoid contents were measured by colorimetric assays. Results and discussions The order of antioxidant activity of three extracts was methanol > chloroform > hexane. The IC50 values ranged from 22.73 to 51.65 μg/mL for KBM5; 22.82 to 70.25 μg/mL for SCC4 and 20.97 to 89.55 μg/mL for U266 cells. The hexane extract exhibited potent antitumour (IC50  value = 65.02 μg/mL) and cytotoxic (LC50  value = 32.18 μg/mL) activities. This extract also completely inhibited the TNF-α induced NF-κB activation in KBM5 cells. GC-MS results showed that pyrogallol, palmitic acid and vitamin E were the major components of methanol, chloroform and hexane extracts. We observed significant (p guajava leaf extracts play a substantial role against cancer and down-modulate inflammatory nuclear factor kB.

  5. Tilt shift determinations with spatial-carrier phase-shift method in temporal phase-shift interferometry

    International Nuclear Information System (INIS)

    Liu, Qian; Wang, Yang; He, Jianguo; Ji, Fang; Wang, Baorui

    2014-01-01

    An algorithm is proposed to deal with tilt-shift errors in temporal phase-shift interferometry (PSI). In the algorithm, the tilt shifts are detected with the spatial-carrier phase-shift (SCPS) method and then the tilt shifts are applied as priori information to the least-squares fittings of phase retrieval. The algorithm combines the best features of the SCPS and the temporal PSI. The algorithm could be applied to interferograms of arbitrary aperture without data extrapolation for the Fourier transform is not involved. Simulations and experiments demonstrate the effectiveness of the algorithm. The statistics of simulation results show a satisfied accuracy in detecting tilt-shift errors. Comparisons of the measurements with and without environmental vibration show that the proposed algorithm could compensate tilt-shift errors and retrieve wavefront phase accurately. The algorithm provides an approach to retrieve wavefront phase for the temporal PSI in vibrating environment. (paper)

  6. Promoter hypermethylation-induced transcriptional down-regulation of the gene MYCT1 in laryngeal squamous cell carcinoma

    International Nuclear Information System (INIS)

    Yang, Min; Li, Wei; Liu, Yi-Ying; Fu, Shuang; Qiu, Guang-Bin; Sun, Kai-Lai; Fu, Wei-Neng

    2012-01-01

    MYCT1, previously named MTLC, is a novel candidate tumor suppressor gene. MYCT1 was cloned from laryngeal squamous cell cancer (LSCC) and has been found to be down-regulated in LSCC; however, the regulatory details have not been fully elucidated. Here, we sought to investigate the methylation status of the CpG islands of MYCT1 and mRNA levels by bisulfite-specific PCR (BSP) based on sequencing restriction enzyme digestion, reverse transcription and real-time quantitative polymerase chain reaction (RQ-PCR). The function of specific sites in the proximal promoter of MYCT1 in LSCC was measured by transient transfection, luciferase assays, electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation assay (ChIP). The results suggested hypermethylation of 12 CpG sites of the promoter in both laryngeal cancer tissues and the laryngeal cancer line Hep-2 cell. The hypermethylation of the site CGCG (−695 to −692), which has been identified as the c-Myc binding site, was identified in laryngeal cancer tissues (59/73) compared to paired mucosa (13/73); in addition, statistical analysis revealed that the methylation status of this site significantly correlated with cancer cell differentiation(p < 0.01). The mRNA level of MYCT1 increased in Hep-2 cells treated with 5-aza-C (p < 0.01). The luciferase activity from mutant transfectants pGL3-MYCT1m (−852/+12, mut-695-C > A, mut-693-C > G) was significantly reduced compared with the wild type pGL3-MYCT1 (−852/+12), while the luciferase activity from wild transfectants pGL3-MYCT1 (−852/+12) rose after 5-aza treatment in Hep-2 cells. Finally, EMSA and ChIP confirmed that the methylation of the CGCG (−695 to −692) site prevented c-Myc from binding of the site and demethylation treatment of the 5′ flanking region of MYCT1 by 5-aza induced the increased occupation of the core promoter by c-Myc (p < 0.01). In summary, this study concluded that hypermethylation contributed to the transcriptional down

  7. The Copper Homeostasis Transcription Factor CopR Is Involved in H2O2 Stress in Lactobacillus plantarum CAUH2

    Directory of Open Access Journals (Sweden)

    Yang Yang

    2017-10-01

    Full Text Available Transcriptional factors (TFs play important roles in the responses to oxidative, acid, and other environmental stresses in Gram-positive bacteria, but the regulatory mechanism of TFs involved in oxidative stress remains unknown in lactic acid bacteria. In the present work, homologous overexpression strains with 43 TFs were constructed in the Lactobacillus plantarum CAUH2 parent strain. The strain overexpressing CopR displayed the highest sensitivity and a 110-fold decrease in survival rate under H2O2 challenge. The importance of CopR in the response to H2O2 stress was further confirmed by a 10.8-fold increase in the survival of a copR insertion mutant. In silico analysis of the genes flanking copR revealed putative CopR-binding “cop box” sequences in the promoter region of the adjacent gene copB encoding a Cu2+-exporting ATPase. Electrophoretic mobility shift assay (EMSA analysis demonstrated the specific binding of CopR with copB in vitro, suggesting copB is a target gene of CopR in L. plantarum. The role of CopB involved in oxidative stress was verified by the significantly decreased survival in the copB mutant. Furthermore, a growth defect in copper-containing medium demonstrated that CopB functions as an export ATPase for copper ions. Furthermore, EMSAs revealed that CopR functions as a regulator that negatively regulates copB gene and Cu2+ serves as inducer of CopR to activate the expression of CopB in response to H2O2 stress in L. plantarum CAUH2. Our findings indicated that CopR plays an important role in enhancing oxidative resistance by regulating copB to modulate copper homeostasis.

  8. DNA binding specificity of the basic-helix-loop-helix protein MASH-1.

    Science.gov (United States)

    Meierhan, D; el-Ariss, C; Neuenschwander, M; Sieber, M; Stackhouse, J F; Allemann, R K

    1995-09-05

    Despite the high degree of sequence similarity in their basic-helix-loop-helix (BHLH) domains, MASH-1 and MyoD are involved in different biological processes. In order to define possible differences between the DNA binding specificities of these two proteins, we investigated the DNA binding properties of MASH-1 by circular dichroism spectroscopy and by electrophoretic mobility shift assays (EMSA). Upon binding to DNA, the BHLH domain of MASH-1 underwent a conformational change from a mainly unfolded to a largely alpha-helical form, and surprisingly, this change was independent of the specific DNA sequence. The same conformational transition could be induced by the addition of 20% 2,2,2-trifluoroethanol. The apparent dissociation constants (KD) of the complexes of full-length MASH-1 with various oligonucleotides were determined from half-saturation points in EMSAs. MASH-1 bound as a dimer to DNA sequences containing an E-box with high affinity KD = 1.4-4.1 x 10(-14) M2). However, the specificity of DNA binding was low. The dissociation constant for the complex between MASH-1 and the highest affinity E-box sequence (KD = 1.4 x 10(-14) M2) was only a factor of 10 smaller than for completely unrelated DNA sequences (KD = approximately 1 x 10(-13) M2). The DNA binding specificity of MASH-1 was not significantly increased by the formation of an heterodimer with the ubiquitous E12 protein. MASH-1 and MyoD displayed similar binding site preferences, suggesting that their different target gene specificities cannot be explained solely by differential DNA binding. An explanation for these findings is provided on the basis of the known crystal structure of the BHLH domain of MyoD.

  9. Gold nanoparticles-based colorimetric and visual creatinine assay

    International Nuclear Information System (INIS)

    He, Yi; Zhang, Xianhui; Yu, Haili

    2015-01-01

    We demonstrate a selective and sensitive method for determination of creatinine using citrate-stabilized gold nanoparticles (AuNPs) as a colorimetric probe. It is based on a direct cross-linking reaction that occurs between creatinine and AuNPs that causes aggregation of AuNPs and results in a color change from wine red to blue. The absorption peak is shifted from 520 to 670 nm. Under the optimized conditions, the shift in the absorption peak is related the logarithm of the creatinine concentration in the 0.1 to 20 mM range, and the instrumental detection limit (LOD) is 80 μM. This LOD is about one order of magnitude better than that that of the Jaffé method (720 μM). The assay displays good selectivity over interfering substances including various inorganic ions, organic small compounds, proteins, and biothiols. It was successfully employed to the determination of creatinine in spiked human urine. (author)

  10. Andrographolide Inhibits Inflammatory Cytokines Secretion in LPS-Stimulated RAW264.7 Cells through Suppression of NF-κB/MAPK Signaling Pathway.

    Science.gov (United States)

    Li, Yu; He, Shengnan; Tang, Jishun; Ding, Nana; Chu, Xiaoyan; Cheng, Lianping; Ding, Xuedong; Liang, Ting; Feng, Shibin; Rahman, Sajid Ur; Wang, Xichun; Wu, Jinjie

    2017-01-01

    Andrographolide, the main active component extracted from Andrographis paniculata (Burm.f.) Wall. ex Nees, exerts anti-inflammatory effects; however, the principal molecular mechanisms remain unclear. The objective of this study was to investigate the molecular mechanisms of Andrographolide in modifying lipopolysaccharide- (LPS-) induced signaling pathway in RAW264.7 cells. An in vitro model of inflammation was induced by LPS in mouse RAW264.7 cells in the presence of Andrographolide. The concentration and expression levels of proinflammatory cytokines were determined by an enzyme-linked immunosorbent assay (ELISA) and quantitative real-time polymerase chain reaction (qRT-PCR), respectively. The nuclear level of NF- κ B was measured by an electrophoretic mobility shift assay (EMSA). The expression levels of NF- κ B, p38, ERK, and JNK were determined by western blot. Andrographolide dose-dependently inhibited the release and mRNA expression of TNF- α , IL-6, and IL-1 β in LPS-stimulated RAW264.7 cells. The nuclear level of p65 protein was decreased in Andrographolide treatment group. Western blot analysis showed that Andrographolide suppressed LPS-induced NF- κ B activation and the phosphorylation of IkBa, ERK1/2, JNK, and p38. These results suggest that Andrographolide exerts an anti-inflammatory effect by inhibiting the activation of NF- κ B/MAPK signaling pathway and the induction of proinflammatory cytokines.

  11. The bZIP transcription factor HY5 interacts with the promoter of the monoterpene synthase gene QH6 in modulating its rhythmic expression.

    Science.gov (United States)

    Zhou, Fei; Sun, Tian-Hu; Zhao, Lei; Pan, Xi-Wu; Lu, Shan

    2015-01-01

    The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site) which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA), we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS) transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD) and constant dark (DD) conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC) driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.

  12. Andrographolide Inhibits Inflammatory Cytokines Secretion in LPS-Stimulated RAW264.7 Cells through Suppression of NF-κB/MAPK Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Yu Li

    2017-01-01

    Full Text Available Andrographolide, the main active component extracted from Andrographis paniculata (Burm.f. Wall. ex Nees, exerts anti-inflammatory effects; however, the principal molecular mechanisms remain unclear. The objective of this study was to investigate the molecular mechanisms of Andrographolide in modifying lipopolysaccharide- (LPS- induced signaling pathway in RAW264.7 cells. An in vitro model of inflammation was induced by LPS in mouse RAW264.7 cells in the presence of Andrographolide. The concentration and expression levels of proinflammatory cytokines were determined by an enzyme-linked immunosorbent assay (ELISA and quantitative real-time polymerase chain reaction (qRT-PCR, respectively. The nuclear level of NF-κB was measured by an electrophoretic mobility shift assay (EMSA. The expression levels of NF-κB, p38, ERK, and JNK were determined by western blot. Andrographolide dose-dependently inhibited the release and mRNA expression of TNF-α, IL-6, and IL-1β in LPS-stimulated RAW264.7 cells. The nuclear level of p65 protein was decreased in Andrographolide treatment group. Western blot analysis showed that Andrographolide suppressed LPS-induced NF-κB activation and the phosphorylation of IkBa, ERK1/2, JNK, and p38. These results suggest that Andrographolide exerts an anti-inflammatory effect by inhibiting the activation of NF-κB/MAPK signaling pathway and the induction of proinflammatory cytokines.

  13. Identification of RegIV as a novel GLI1 target gene in human pancreatic cancer.

    Directory of Open Access Journals (Sweden)

    Feng Wang

    2011-04-01

    Full Text Available GLI1 is the key transcriptional factor in the Hedgehog signaling pathway in pancreatic cancer. RegIV is associated with regeneration, and cell growth, survival, adhesion and resistance to apoptosis. We aimed to study RegIV expression in pancreatic cancer and its relationship to GLI1.GLI1 and RegIV expression were evaluated in tumor tissue and adjacent normal tissues of pancreatic cancer patients and 5 pancreatic cancer cell lines by qRT-PCR, Western blot, and immunohistochemistry (IHC, and the correlation between them. The GLI1-shRNA lentiviral vector was constructed and transfected into PANC-1, and lentiviral vector containing the GLI1 expression sequence was constructed and transfected into BxPC-3. GLI1 and RegIV expression were evaluated by qRT-PCR and Western blot. Finally we demonstrated RegIV to be the target of GLI1 by chromatin immunoprecipitation (CHIP and electrophoretic mobility shift assays (EMSA.The results of IHC and qRT-PCR showed that RegIV and GLI1 expression was higher in pancreatic cancer tissues versus adjacent normal tissues (p<0.001. RegIV expression correlated with GLI1 expression in these tissues (R = 0.795, p<0.0001. These results were verified for protein (R = 0.939, p = 0.018 and mRNA expression (R = 0.959, p = 0.011 in 5 pancreatic cancer cell lines. RegIV mRNA and protein expression was decreased (94.7±0.3%, 84.1±0.5%; respectively when GLI1 was knocked down (82.1±3.2%, 76.7±2.2%; respectively by the RNAi technique. GLI1 overexpression in mRNA and protein level (924.5±5.3%, 362.1±3.5%; respectively induced RegIV overexpression (729.1±4.3%, 339.0±3.7%; respectively. Moreover, CHIP and EMSA assays showed GLI1 protein bound to RegIV promotor regions (GATCATCCA in pancreatic cancer cells.GLI1 promotes RegIV transcription by binding to the RegIV gene promoter in pancreatic cancer.

  14. The putative Agrobacterium transcriptional activator-like virulence protein VirD5 may target T-complex to prevent the degradation of coat proteins in the plant cell nucleus.

    Science.gov (United States)

    Wang, Yafei; Peng, Wei; Zhou, Xu; Huang, Fei; Shao, Lingyun; Luo, Meizhong

    2014-09-01

    Agrobacterium exports at least five virulence proteins (VirE2, VirE3, VirF, VirD2, VirD5) into host cells and hijacks some host plant factors to facilitate its transformation process. Random DNA binding selection assays (RDSAs), electrophoretic mobility shift assays (EMSAs) and yeast one-hybrid systems were used to identify protein-bound DNA elements. Bimolecular fluorescence complementation, glutathione S-transferase pull-down and yeast two-hybrid assays were used to detect protein interactions. Protoplast transformation, coprecipitation, competitive binding and cell-free degradation assays were used to analyze the relationships among proteins. We found that Agrobacterium VirD5 exhibits transcriptional activation activity in yeast, is located in the plant cell nucleus, and forms homodimers. A specific VirD5-bound DNA element designated D5RE (VirD5 response element) was identified. VirD5 interacted directly with Arabidopsis VirE2 Interacting Protein 1 (AtVIP1). However, the ternary complex of VirD5-AtVIP1-VirE2 could be detected, whereas that of VirD5-AtVIP1-VBF (AtVIP1 Binding F-box protein) could not. We demonstrated that VirD5 competes with VBF for binding to AtVIP1 and stabilizes AtVIP1 and VirE2 in the cell-free degradation system. Our results indicated that VirD5 may act as both a transcriptional activator-like effector to regulate host gene expression and a protector preventing the coat proteins of the T-complex from being quickly degraded by the host's ubiquitin proteasome system (UPS). © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

  15. ERK inhibition enhances TSA-induced gastric cancer cell apoptosis via NF-κB-dependent and Notch-independent mechanism.

    Science.gov (United States)

    Yao, Jun; Qian, Cui-Juan; Ye, Bei; Zhang, Xin; Liang, Yong

    2012-09-04

    To analyze the combined impact of the histone deacetylase inhibitor (HDACI) Trichostatin A (TSA) and the extracellular-signal-regulated kinase 1/2 (ERK1/2) inhibitor PD98059 on gastric cancer (GC) cell line SGC7901 growth. SGC7901 cells were treated with TSA, PD98059 or with a TSA-PD98059 combination. Effects of drug treatment on tumor cell proliferation, apoptosis, cell cycle progression, and cell signaling pathways were investigated by MTS assay, flow cytometry, Western blotting, chromatin immunoprecipitation (ChIP) assay, electrophoretic mobility shift assay (EMSA), and luciferase reporter assay, respectively. PD98059 enhanced TSA-induced cell growth arrest, apoptosis and activation of p21(WAF1/CIP1), but reversed TSA-induced activation of ERK1/2 and nuclear factor-κB (NF-κB). TSA alone up-regulated Notch1 and Hes1, and down-regulated Notch2, but PD98059 did not affect the trends of Notch1 and Notch2 induced by TSA. Particularly, PD98059 did potentiate the ability of TSA to down-regulate phospho-histone H3 protein, but increased levels of the acetylated forms of histone H3 bound to the p21(WAF1/CIP1) promoter, leading to enhanced expression of p21(WAF1/CIP1) in SGC7901 cells. PD98059 synergistically potentiates TSA-induced GC growth arrest and apoptosis by manipulating NF-κB and p21(WAF1/CIP1) independent of Notch. Therefore, concomitant administration of HDACIs and ERK1/2 inhibitors may be a promising treatment strategy for individuals with GC. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Dormancy-Associated MADS-Box (DAM) and the Abscisic Acid Pathway Regulate Pear Endodormancy Through a Feedback Mechanism.

    Science.gov (United States)

    Tuan, Pham Anh; Bai, Songling; Saito, Takanori; Ito, Akiko; Moriguchi, Takaya

    2017-08-01

    In the pear 'Kosui' (Pyrus pyrifolia Nakai), the dormancy-associated MADS-box (PpDAM1 = PpMADS13-1) gene has been reported to play an essential role in bud endodormancy. Here, we found that PpDAM1 up-regulated expression of 9-cis-epoxycarotenoid dioxygenase (PpNCED3), which is a rate-limiting gene for ABA biosynthesis. Transient assays with a dual luciferase reporter system (LUC assay) and electrophoretic mobility shift assay (EMSA) showed that PpDAM1 activated PpNCED3 expression by binding to the CArG motif in the PpNCED3 promoter. PpNCED3 expression was increased toward endodormancy release in lateral flower buds of 'Kosui', which is consistent with the induced levels of ABA, its catabolism (ABA 8'-hydroxylase) and signaling genes (type 2C protein phosphatase genes and SNF1-related protein kinase 2 genes). In addition, we found that an ABA response element (ABRE)-binding transcription factor, PpAREB1, exhibiting high expression concomitant with endodormancy release, bound to three ABRE motifs in the promoter region of PpDAM1 and negatively regulated its activity. Taken together, our results suggested a feedback regulation between PpDAM1 and the ABA metabolism and signaling pathway during endodormancy of pear. This first evidence of an interaction between a DAM and ABA biosynthesis in vitro will provide further insights into bud endodormancy regulatory mechanisms of deciduous trees including pear. © The Author 2017. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  17. Nonviral gene-delivery by highly fluorinated gemini bispyridinium surfactant-based DNA nanoparticles.

    Science.gov (United States)

    Fisicaro, Emilia; Compari, Carlotta; Bacciottini, Franco; Contardi, Laura; Pongiluppi, Erika; Barbero, Nadia; Viscardi, Guido; Quagliotto, Pierluigi; Donofrio, Gaetano; Krafft, Marie Pierre

    2017-02-01

    Biological and thermodynamic properties of a new homologous series of highly fluorinated bispyridinium cationic gemini surfactants, differing in the length of the spacer bridging the pyridinium polar heads in 1,1' position, are reported for the first time. Interestingly, gene delivery ability is closely associated with the spacer length due to a structural change of the molecule in solution. This conformation change is allowed when the spacer reaches the right length, and it is suggested by the trends of the apparent and partial molar enthalpies vs molality. To assess the compounds' biological activity, they were tested with an agarose gel electrophoresis mobility shift assay (EMSA), MTT proliferation assay and Transient Transfection assays on a human rhabdomyosarcoma cell line. Data from atomic force microscopy (AFM) allow for morphological characterization of DNA nanoparticles. Dilution enthalpies, measured at 298K, enabled the determination of apparent and partial molar enthalpies vs molality. All tested compounds (except that with the longest spacer), at different levels, can deliver the plasmid when co-formulated with 1,2-dioleyl-sn-glycero-3-phosphoethanolamine (DOPE). The compound with a spacer formed by eight carbon atoms gives rise to a gene delivery ability that is comparable to that of the commercial reagent. The compound with the longest spacer compacts DNA in loosely condensed structures by forming bows, which are not suitable for transfection. Regarding the compounds' hydrogenated counterparts, the tight relationship between the solution thermodynamics data and their biological performance is amazing, making "old" methods the foundation to deeply understanding "new" applications. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. ERalpha and AP-1 interact in vivo with a specific sequence of the F promoter of the human ERalpha gene in osteoblasts.

    Science.gov (United States)

    Lambertini, Elisabetta; Tavanti, Elisa; Torreggiani, Elena; Penolazzi, Letizia; Gambari, Roberto; Piva, Roberta

    2008-07-01

    Estrogen-responsive genes often have an estrogen response element (ERE) positioned next to activator protein-1 (AP-1) binding sites. Considering that the interaction between ERE and AP-1 elements has been described for the modulation of bone-specific genes, we investigated the 17-beta-estradiol responsiveness and the role of these cis-elements present in the F promoter of the human estrogen receptor alpha (ERalpha) gene. The F promoter, containing the sequence analyzed here, is one of the multiple promoters of the human ERalpha gene and is the only active promoter in bone tissue. Through electrophoretic mobility shift (EMSA), chromatin immunoprecipitation (ChIP), and re-ChIP assays, we investigated the binding of ERalpha and four members of the AP-1 family (c-Jun, c-fos, Fra-2, and ATF2) to a region located approximately 800 bp upstream of the transcriptional start site of exon F of the human ERalpha gene in SaOS-2 osteoblast-like cells. Reporter gene assay experiments in combination with DNA binding assays demonstrated that F promoter activity is under the control of upstream cis-acting elements which are recognized by specific combinations of ERalpha, c-Jun, c-fos, and ATF2 homo- and heterodimers. Moreover, ChIP and re-ChIP experiments showed that these nuclear factors bind the F promoter in vivo with a simultaneous occupancy stimulated by 17-beta-estradiol. Taken together, our findings support a model in which ERalpha/AP-1 complexes modulate F promoter activity under conditions of 17-beta-estradiol stimulation. (c) 2008 Wiley-Liss, Inc.

  19. An acoustic prion assay

    Directory of Open Access Journals (Sweden)

    Gordon Hayward

    2016-12-01

    Full Text Available An acoustic prion assay has been demonstrated for sheep brain samples. Only five false positives and no false negatives were observed in a test of 45 positive and 45 negative samples. The acoustic prion sensor was constructed using a thickness shear mode quartz resonator coated with a covalently bound recombinant prion protein. The characteristic indicator of a scrapie infected sheep brain sample was an observed shoulder in the frequency decrease in response to a sample.The response of the sensor aligns with a conformational shift in the surface protein and with the propagation mechanism of the disease. This alignment is evident in the response timing and shape, dependence on concentration, cross species behaviour and impact of blood plasma. This alignment is far from sufficient to prove the mechanism of the sensor but it does offer the possibility of a rapid and inexpensive additional tool to explore prion disease. Keywords: Prions, Thickness shear mode quartz sensor

  20. Study on the binding sites of radiosensitivity associated transcription factor in the promoter region of Ier5 gene

    International Nuclear Information System (INIS)

    Cui Wei; Yin Lingling; Dong Lingyue

    2012-01-01

    Objective: To clarify the mechanism of immediate early response gene 5 (Ier5) transcription induced by radiation. Methods: Deletant construction, site-specific mutagenesis,electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) were used to forecast the promoter region, binding sites and transcription factors of Ier5 gene in HeLa cells. Results: The promoter region of Ier5 gene might be in the region of Ier5 -8 deletant (-408 - -238 bp). The Ier5 gene had two transcription factors of GCF and NFI, and GCF had two binding sites located in the region of -388 - -382 bp and -274 - -270 bp of Ier5 promoter. The binding site of NFI was located in -362 - -357 bp of Ier5 promoter. GCF could inhibit the expression of Ier5 gene and this inhibition was diminished when the radiation dose increased. In contrast, NFI increased the expression of Ier5. Conclusions: The most possible region of Ier5 promoter is from -408 to -238 bp which has two binding sites for the radiosensitivity transcription factors of GCF and NFI that could negatively and positively regulate the expression of Ier5 respectively. (authors)

  1. A two-component regulatory system controls autoregulated serpin expression in Bifidobacterium breve UCC2003.

    Science.gov (United States)

    Alvarez-Martin, Pablo; O'Connell Motherway, Mary; Turroni, Francesca; Foroni, Elena; Ventura, Marco; van Sinderen, Douwe

    2012-10-01

    This work reports on the identification and molecular characterization of a two-component regulatory system (2CRS), encoded by serRK, which is believed to control the expression of the ser(2003) locus in Bifidobacterium breve UCC2003. The ser(2003) locus consists of two genes, Bbr_1319 (sagA) and Bbr_1320 (serU), which are predicted to encode a hypothetical membrane-associated protein and a serpin-like protein, respectively. The response regulator SerR was shown to bind to the promoter region of ser(2003), and the probable recognition sequence of SerR was determined by a combinatorial approach of in vitro site-directed mutagenesis coupled to transcriptional fusion and electrophoretic mobility shift assays (EMSAs). The importance of the serRK 2CRS in the response of B. breve to protease-mediated induction was confirmed by generating a B. breve serR insertion mutant, which was shown to exhibit altered ser(2003) transcriptional induction patterns compared to the parent strain, UCC2003. Interestingly, the analysis of a B. breve serU mutant revealed that the SerRK signaling pathway appears to include a SerU-dependent autoregulatory loop.

  2. Gel shift analysis of the empA promoter region in Vibrio anguillarum

    Directory of Open Access Journals (Sweden)

    Denkin Steven M

    2004-10-01

    Full Text Available Abstract Background The induction of metalloprotease encoded by empA in Vibrio anguillarum occurs at high cell density in salmon intestinal mucus. Previously we have shown that there are significant differences in empA expression in two strains of V. anguillarum, M93Sm and NB10. It is hypothesized that differences in empA regulation are due to differences in binding of regulatory elements. Results Two strains of V. anguillarum, M93Sm and NB10, were examined and compared for the presence of DNA regulatory proteins that bind to and control the empA promoter region. Gel mobility shift assays, using a digoxigenin (DIG-labeled oligomer containing a lux box-like element and the promoter for empA, were done to demonstrate the presence of a DNA-binding protein. Protein extracts from NB10 cells incubated in Luria Bertani broth + 2% NaCl (LB20, nine salts solution + 200 μg/ml mucus (NSSM, 3M (marine minimal medium, or NSS resulted in a gel mobility shift. No gel mobility shift was seen when protein extracts from either LB20- or NSSM-grown M93Sm cells were mixed with the DIG-labeled empA oligomer. The azocasein assay detected protease activity in all incubation conditions for NB10 culture supernatants. In contrast, protease activity was detected in M93Sm culture supernatants only when incubated in NSSM. Since the luxR homologue in V. anguillarum, vanT, has been cloned, sequenced, and shown to be required for protease activity, we wanted to determine if vanT mutants of NB10 exhibit the same gel shift observed in the wild-type. Site-directed mutagenesis was used to create vanT mutants in V. anguillarum M93Sm and NB10 to test whether VanT is involved with the gel mobility shift. Both vanT mutants, M02 and NB02, did not produce protease activity in any conditions. However, protein extracts from NB02 incubated in each condition still exhibited a gel shift when mixed with the DIG-labeled empA oligomer. Conclusions The data demonstrate that protein extracts of V

  3. Inhibitory Effect of Curcumol on Jak2-STAT Signal Pathway Molecules of Fibroblast-Like Synoviocytes in Patients with Rheumatoid Arthritis

    Directory of Open Access Journals (Sweden)

    Heng Wang

    2012-01-01

    Full Text Available Hyperplasia of synovial membrane in rheumatoid arthritis (RA is a critical pathological foundation for inducing articular injury. The janus kinase and signal transducer and activator of transcription (Jak-STAT pathway plays a critical role in synovial membrane proliferation induced by platelet-derived growth factor (PDGF. To explore the anti-cell proliferation mechanism of curcumol, a pure monomer extracted from Chinese medical plant zedoary rhizome, the changes of Jak2-STAT1/3 signal pathway-related molecules in synoviocytes were observed in vitro. In this study, the fibroblast-like synoviocytes (FLS in patients with RA were collected and cultured. The following parameters were measured: cell proliferation (WST-1 assay, cell cycles (fluorescence-activated cell sorting, FACS, STAT1 and STAT3 activities (electrophoretic mobility shift assay, EMSA, and the protein expressions of phosphorylated Jak2, STAT1, and STAT3 (Western blot. It was shown that curcumol could inhibit the RA-FLS proliferation and DNA synthesis induced by PDGF-BB in a dose-dependent manner in vitro. The transcription factors activities of STAT1 and STAT3 were obviously elevated after PDGF-BB stimulation (P<0.05. Super-shift experiments identified the STAT1 or STAT3 proteins in the complex. Furthermore, the different concentration curcumol could downregulate the DNA binding activities of STAT1 and STAT3 (P<0.05 and inhibit the phosphorylation of Jak2 while it had no effect on the protein expressions of STAT1 and STAT3. Positive correlations were found between changes of cell proliferation and DNA-binding activities of STAT1 and STAT3, respectively (P<0.01. In conclusion, curcumol might suppress the FLS proliferation and DNA synthesis induced by PDGF-BB through attenuating Jak2 phosphorylation, downregulating STAT1 and STAT3 DNA-binding activities, which could provide theoretical foundation for clinical treatment of RA.

  4. Shift Work Disorder and Mental and Physical Effects of Shift Work

    Directory of Open Access Journals (Sweden)

    Pinar Guzel Ozdemir

    2018-03-01

    Full Text Available With the growing prevalence of shift work all over the the world, the relationship between the daily lives of irregular lifestyles and rhythms is being investigated for those working as shift workers and their families. The effect of shift work on physical and mental health is a very important field of research in recent years. The onset and persistence of medical complications in shift workers includes impaired synchronization between work schedule rhythms and circadian clock. In this context, studies have been carried out showing the increased risk of sleep-wake disorders, gastrointestinal problems, and cardiovascular diseases. There is little information about the actual frequency, effect on health and treatment of shift work disorder, known as circadian rhythm sleep disorder. Shift work disorder includes insomnia and/or excessive sleepiness related with the work schedule. The aim of this rewiev, mentioning about the physical and mental effects of shift work, and to provide information about the diagnosis, clinic and treatment methods of shift-work disorder.

  5. Non-occupational physical activity levels of shift workers compared with non-shift workers

    Science.gov (United States)

    Loef, Bette; Hulsegge, Gerben; Wendel-Vos, G C Wanda; Verschuren, W M Monique; Bakker, Marije F; van der Beek, Allard J; Proper, Karin I

    2017-01-01

    Objectives Lack of physical activity (PA) has been hypothesised as an underlying mechanism in the adverse health effects of shift work. Therefore, our aim was to compare non-occupational PA levels between shift workers and non-shift workers. Furthermore, exposure–response relationships for frequency of night shifts and years of shift work regarding non-occupational PA levels were studied. Methods Data of 5980 non-shift workers and 532 shift workers from the European Prospective Investigation into Cancer and Nutrition-Netherlands (EPIC-NL) were used in these cross-sectional analyses. Time spent (hours/week) in different PA types (walking/cycling/exercise/chores) and intensities (moderate/vigorous) were calculated based on self-reported PA. Furthermore, sports were operationalised as: playing sports (no/yes), individual versus non-individual sports, and non-vigorous-intensity versus vigorous-intensity sports. PA levels were compared between shift workers and non-shift workers using Generalized Estimating Equations and logistic regression. Results Shift workers reported spending more time walking than non-shift workers (B=2.3 (95% CI 1.2 to 3.4)), but shift work was not associated with other PA types and any of the sports activities. Shift workers who worked 1–4 night shifts/month (B=2.4 (95% CI 0.6 to 4.3)) and ≥5 night shifts/month (B=3.7 (95% CI 1.8 to 5.6)) spent more time walking than non-shift workers. No exposure–response relationships were found between years of shift work and PA levels. Conclusions Shift workers spent more time walking than non-shift workers, but we observed no differences in other non-occupational PA levels. To better understand if and how PA plays a role in the negative health consequences of shift work, our findings need to be confirmed in future studies. PMID:27872151

  6. Assaying Cellular Viability Using the Neutral Red Uptake Assay.

    Science.gov (United States)

    Ates, Gamze; Vanhaecke, Tamara; Rogiers, Vera; Rodrigues, Robim M

    2017-01-01

    The neutral red uptake assay is a cell viability assay that allows in vitro quantification of xenobiotic-induced cytotoxicity. The assay relies on the ability of living cells to incorporate and bind neutral red, a weak cationic dye, in lysosomes. As such, cytotoxicity is expressed as a concentration-dependent reduction of the uptake of neutral red after exposure to the xenobiotic under investigation. The neutral red uptake assay is mainly used for hazard assessment in in vitro toxicology applications. This method has also been introduced in regulatory recommendations as part of 3T3-NRU-phototoxicity-assay, which was regulatory accepted in all EU member states in 2000 and in the OECD member states in 2004 as a test guideline (TG 432). The present protocol describes the neutral red uptake assay using the human hepatoma cell line HepG2, which is often employed as an alternative in vitro model for human hepatocytes. As an example, the cytotoxicity of acetaminophen and acetyl salicylic acid is assessed.

  7. Reduced Tolerance to Night Shift in Chronic Shift Workers: Insight From Fractal Regulation.

    Science.gov (United States)

    Li, Peng; Morris, Christopher J; Patxot, Melissa; Yugay, Tatiana; Mistretta, Joseph; Purvis, Taylor E; Scheer, Frank A J L; Hu, Kun

    2017-07-01

    Healthy physiology is characterized by fractal regulation (FR) that generates similar structures in the fluctuations of physiological outputs at different time scales. Perturbed FR is associated with aging and age-related pathological conditions. Shift work, involving repeated and chronic exposure to misaligned environmental and behavioral cycles, disrupts circadian coordination. We tested whether night shifts perturb FR in motor activity and whether night shifts affect FR in chronic shift workers and non-shift workers differently. We studied 13 chronic shift workers and 14 non-shift workers as controls using both field and in-laboratory experiments. In the in-laboratory study, simulated night shifts were used to induce a misalignment between the endogenous circadian pacemaker and the sleep-wake cycles (ie, circadian misalignment) while environmental conditions and food intake were controlled. In the field study, we found that FR was robust in controls but broke down in shift workers during night shifts, leading to more random activity fluctuations as observed in patients with dementia. The night shift effect was present even 2 days after ending night shifts. The in-laboratory study confirmed that night shifts perturbed FR in chronic shift workers and showed that FR in controls was more resilience to the circadian misalignment. Moreover, FR during real and simulated night shifts was more perturbed in those who started shift work at older ages. Chronic shift work causes night shift intolerance, which is probably linked to the degraded plasticity of the circadian control system. © Sleep Research Society 2017. Published by Oxford University Press on behalf of the Sleep Research Society. All rights reserved. For permissions, please e-mail journals.permissions@oup.com.

  8. The bZIP transcription factor HY5 interacts with the promoter of the monoterpene synthase gene QH6 in modulating its rhythmic expression

    Directory of Open Access Journals (Sweden)

    Fei eZhou

    2015-04-01

    Full Text Available The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA, we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD and constant dark (DD conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.

  9. Phytochrome-interacting factors PIF4 and PIF5 negatively regulate anthocyanin biosynthesis under red light in Arabidopsis seedlings.

    Science.gov (United States)

    Liu, Zhongjuan; Zhang, Yongqiang; Wang, Jianfeng; Li, Ping; Zhao, Chengzhou; Chen, Yadi; Bi, Yurong

    2015-09-01

    Light is an important environmental factor inducing anthocyanin accumulation in plants. Phytochrome-interacting factors (PIFs) have been shown to be a family of bHLH transcription factors involved in light signaling in Arabidopsis. Red light effectively increased anthocyanin accumulation in wild-type Col-0, whereas the effects were enhanced in pif4 and pif5 mutants but impaired in overexpression lines PIF4OX and PIF5OX, indicating that PIF4 and PIF5 are both negative regulators for red light-induced anthocyanin accumulation. Consistently, transcript levels of several genes involved in anthocyanin biosynthesis and regulatory pathway, including CHS, F3'H, DFR, LDOX, PAP1 and TT8, were significantly enhanced in mutants pif4 and pif5 but decreased in PIF4OX and PIF5OX compared to in Col-0, indicating that PIF4 and PIF5 are transcriptional repressor of these gene. Transient expression assays revealed that PIF4 and PIF5 could repress red light-induced promoter activities of F3'H and DFR in Arabidopsis protoplasts. Furthermore, chromatin immunoprecipitation-quantitative PCR (ChIP-qPCR) test and electrophoretic mobility shift assay (EMSA) showed that PIF5 could directly bind to G-box motifs present in the promoter of DFR. Taken together, these results suggest that PIF4 and PIF5 negatively regulate red light-induced anthocyanin accumulation through transcriptional repression of the anthocyanin biosynthetic genes in Arabidopsis. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  10. DasR is a pleiotropic regulator required for antibiotic production, pigment biosynthesis, and morphological development in Saccharopolyspora erythraea.

    Science.gov (United States)

    Liao, Cheng-Heng; Xu, Ya; Rigali, Sébastien; Ye, Bang-Ce

    2015-12-01

    The GntR-family transcription regulator, DasR, was previously identified as pleiotropic, controlling the primary amino sugar N-acetylglucosamine (GlcNAc) and chitin metabolism in Saccharopolyspora erythraea and Streptomyces coelicolor. Due to the remarkable regulatory impact of DasR on antibiotic production and development in the model strain of S. coelicolor, we here identified and characterized the role of DasR to secondary metabolite production and morphological development in industrial erythromycin-producing S. erythraea. The physiological studies have shown that a constructed deletion of dasR in S. erythraea resulted in antibiotic, pigment, and aerial hyphae production deficit in a nutrient-rich condition. DNA microarray assay, combined with quantitative real-time reverse transcription PCR (qRT-PCR), confirmed these results by showing the downregulation of the genes relating to secondary metabolite production in the dasR null mutant. Notably, electrophoretic mobility shift assays (EMSA) showed DasR as being the first identified regulator that directly regulates the pigment biosynthesis rpp gene cluster. In addition, further studies indicated that GlcNAc, the major nutrient signal of DasR-responsed regulation, blocked secondary metabolite production and morphological development. The effects of GlcNAc were shown to be caused by DasR mediation. These findings demonstrated that DasR is an important pleiotropic regulator for both secondary metabolism and morphological development in S. erythraea, providing new insights for the genetic engineering of S. erythraea with increased erythromycin production.

  11. An oilseed rape WRKY-type transcription factor regulates ROS accumulation and leaf senescence in Nicotiana benthamiana and Arabidopsis through modulating transcription of RbohD and RbohF.

    Science.gov (United States)

    Yang, Liu; Ye, Chaofei; Zhao, Yuting; Cheng, Xiaolin; Wang, Yiqiao; Jiang, Yuan-Qing; Yang, Bo

    2018-06-01

    Overexpression of BnaWGR1 causes ROS accumulation and promotes leaf senescence. BnaWGR1 binds to promoters of RbohD and RbohF and regulates their expression. Manipulation of leaf senescence process affects agricultural traits of crop plants, including biomass, seed yield and stress resistance. Since delayed leaf senescence usually enhances tolerance to multiple stresses, we analyzed the function of specific MAPK-WRKY cascades in abiotic and biotic stress tolerance as well as leaf senescence in oilseed rape (Brassica napus L.), one of the important oil crops. In the present study, we showed that expression of one WRKY gene from oilseed rape, BnaWGR1, induced an accumulation of reactive oxygen species (ROS), cell death and precocious leaf senescence both in Nicotiana benthamiana and transgenic Arabidopsis (Arabidopsis thaliana). BnaWGR1 regulates the transcription of two genes encoding key enzymes implicated in production of ROS, that is, respiratory burst oxidase homolog (Rboh) D and RbohF. A dual-luciferase reporter assay confirmed the transcriptional regulation of RbohD and RbohF by BnaWGR1. In vitro electrophoresis mobility shift assay (EMSA) showed that BnaWGR1 could bind to W-box cis-elements within promoters of RbohD and RbohF. Moreover, RbohD and RbohF were significantly upregulated in transgenic Arabidopsis overexpressing BnaWGR1. In summary, these results suggest that BnaWGR1 could positively regulate leaf senescence through regulating the expression of RbohD and RbohF genes.

  12. Mechanical stretch modulates microRNA 21 expression, participating in proliferation and apoptosis in cultured human aortic smooth muscle cells.

    Directory of Open Access Journals (Sweden)

    Jian tao Song

    Full Text Available OBJECTIVES: Stretch affects vascular smooth muscle cell proliferation and apoptosis, and several responsible genes have been proposed. We tested whether the expression of microRNA 21 (miR-21 is modulated by stretch and is involved in stretch-induced proliferation and apoptosis of human aortic smooth muscle cells (HASMCs. METHODS AND RESULTS: RT-PCR revealed that elevated stretch (16% elongation, 1 Hz increased miR-21 expression in cultured HASMCs, and moderate stretch (10% elongation, 1 Hz decreased the expression. BrdU incorporation assay and cell counting showed miR-21 involved in the proliferation of HASMCs mediated by stretch, likely by regulating the expression of p27 and phosphorylated retinoblastoma protein (p-Rb. FACS analysis revealed that the complex of miR-21 and programmed cell death protein 4 (PDCD4 participated in regulating apoptosis with stretch. Stretch increased the expression of primary miR-21 and pre-miR-21 in HASMCs. Electrophoretic mobility shift assay (EMSA demonstrated that stretch increased NF-κB and AP-1 activities in HASMCs, and blockade of AP-1 activity by c-jun siRNA significantly suppressed stretch-induced miR-21 expression. CONCLUSIONS: Cyclic stretch modulates miR-21 expression in cultured HASMCs, and miR-21 plays important roles in regulating proliferation and apoptosis mediated by stretch. Stretch upregulates miR-21 expression at least in part at the transcription level and AP-1 is essential for stretch-induced miR-21 expression.

  13. Non-occupational physical activity levels of shift workers compared with non-shift workers.

    Science.gov (United States)

    Loef, Bette; Hulsegge, Gerben; Wendel-Vos, G C Wanda; Verschuren, W M Monique; Vermeulen, Roel C H; Bakker, Marije F; van der Beek, Allard J; Proper, Karin I

    2017-05-01

    Lack of physical activity (PA) has been hypothesised as an underlying mechanism in the adverse health effects of shift work. Therefore, our aim was to compare non-occupational PA levels between shift workers and non-shift workers. Furthermore, exposure-response relationships for frequency of night shifts and years of shift work regarding non-occupational PA levels were studied. Data of 5980 non-shift workers and 532 shift workers from the European Prospective Investigation into Cancer and Nutrition-Netherlands (EPIC-NL) were used in these cross-sectional analyses. Time spent (hours/week) in different PA types (walking/cycling/exercise/chores) and intensities (moderate/vigorous) were calculated based on self-reported PA. Furthermore, sports were operationalised as: playing sports (no/yes), individual versus non-individual sports, and non-vigorous-intensity versus vigorous-intensity sports. PA levels were compared between shift workers and non-shift workers using Generalized Estimating Equations and logistic regression. Shift workers reported spending more time walking than non-shift workers (B=2.3 (95% CI 1.2 to 3.4)), but shift work was not associated with other PA types and any of the sports activities. Shift workers who worked 1-4 night shifts/month (B=2.4 (95% CI 0.6 to 4.3)) and ≥5 night shifts/month (B=3.7 (95% CI 1.8 to 5.6)) spent more time walking than non-shift workers. No exposure-response relationships were found between years of shift work and PA levels. Shift workers spent more time walking than non-shift workers, but we observed no differences in other non-occupational PA levels. To better understand if and how PA plays a role in the negative health consequences of shift work, our findings need to be confirmed in future studies. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  14. Random assay in radioimmunoassay: Feasibility and application compared with batch assay

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jung Min; Lee, Hwan Hee; Park, Sohyun; Kim, Tae Sung; Kim, Seok Ki [Dept. of Nuclear MedicineNational Cancer Center, Goyang (Korea, Republic of)

    2016-12-15

    The batch assay has been conventionally used for radioimmunoassay (RIA) because of its technical robustness and practical convenience. However, it has limitations in terms of the relative lag of report time due to the necessity of multiple assays in a small number of samples compared with the random assay technique. In this study, we aimed to verify whether the random assay technique can be applied in RIA and is feasible in daily practice. The coefficients of variation (CVs) of eight standard curves within a single kit were calculated in a CA-125 immunoradiometric assay (IRMA) for the reference of the practically ideal CV of the CA-125 kit. Ten standard curves of 10 kits from 2 prospectively collected lots (pLot) and 85 standard curves of 85 kits from 3 retrospectively collected lots (Lot) were obtained. Additionally, the raw measurement data of both 170 control references and 1123 patients' sera were collected retrospectively between December 2015 and January 2016. A standard curve of the first kit of each lot was used as a master standard curve for a random assay. The CVs of inter-kits were analyzed in each lot, respectively. All raw measurements were normalized by decay and radioactivity. The CA-125 values from control samples and patients' sera were compared using the original batch assay and random assay. In standard curve analysis, the CVs of inter-kits in pLots and Lots were comparable to those within a single kit. The CVs from the random assay with normalization were similar to those from the batch assay in the control samples (CVs % of low/high concentration; Lot1 2.71/1.91, Lot2 2.35/1.83, Lot3 2.83/2.08 vs. Lot1 2.05/1.21, Lot2 1.66/1.48, Lot3 2.41/2.14). The ICCs between the batch assay and random assay using patients' sera were satisfactory (Lot1 1.00, Lot2 0.999, Lot3 1.00). The random assay technique could be successfully applied to the conventional CA-125 IRMA kits. The random assay showed strong agreement with the batch assay. The

  15. Blue and red shifted temperature dependence of implicit phonon shifts in graphene

    Science.gov (United States)

    Mann, Sarita; Jindal, V. K.

    2017-07-01

    We have calculated the implicit shift for various modes of frequency in a pure graphene sheet. Thermal expansion and Grüneisen parameter which are required for implicit shift calculation have already been studied and reported. For this calculation, phonon frequencies are obtained using force constants derived from dynamical matrix calculated using VASP code where the density functional perturbation theory (DFPT) is used in interface with phonopy software. The implicit phonon shift shows an unusual behavior as compared to the bulk materials. The frequency shift is large negative (red shift) for ZA and ZO modes and the value of negative shift increases with increase in temperature. On the other hand, blue shift arises for all other longitudinal and transverse modes with a similar trend of increase with increase in temperature. The q dependence of phonon shifts has also been studied. Such simultaneous red and blue shifts in transverse or out plane modes and surface modes, respectively leads to speculation of surface softening in out of plane direction in preference to surface melting.

  16. Matrix effects of TRU [transuranic] assays using the SWEPP PAN assay system

    International Nuclear Information System (INIS)

    Smith, J.R.

    1990-08-01

    The Drum Assay System (DAS) at the Stored Waste Experimental Pilot Plant (SWEPP) is a second-generation active-passive neutron assay system. It has been used to assay over 5000 208-liter drums of transuranic waste from the Rocky Flats Plant (RFP). Data from these assays have been examined and compared with the assays performed at Rocky Flats, mainly utilize counting of 239 Pu gamma rays. For the most part the passive assays are in very good agreement with the Rocky Flats assays. The active assays are strongly correlated with the results of the other two methods, but require matrix-dependent correction factors beyond those provided by the system itself. A set of matrix-dependent correction factors has been developed from the study of the assay results. 3 refs., 4 figs., 3 tabs

  17. Comparison of Batch Assay and Random Assay Using Automatic Dispenser in Radioimmunoassay

    Energy Technology Data Exchange (ETDEWEB)

    Moon, Seung Hwan; Jang, Su Jin; Kang, Ji Yeon; Lee, Dong Soo; Chung, June Key; Lee, Myung Chul [Seoul Metropolitan Government Seoul National University Boramae Medical Center, Seoul (Korea, Republic of); Lee, Ho Young; Shin, Sun Young; Min, Gyeong Sun; Lee, Hyun Joo [Seoul National University college of Medicine, Seoul (Korea, Republic of)

    2009-08-15

    Radioimmunoassay (RIA) was usually performed by the batch assay. To improve the efficiency of RIA without increase of the cost and time, random assay could be a choice. We investigated the possibility of the random assay using automatic dispenser by assessing the agreement between batch assay and random assay. The experiments were performed with four items; Triiodothyronine (T3), free thyroxine (fT4), Prostate specific antigen (PSA), Carcinoembryonic antigen (CEA). In each item, the sera of twenty patients, the standard, and the control samples were used. The measurements were done 4 times with 3 hour time intervals by random assay and batch assay. The coefficient of variation (CV) of the standard samples and patients' data in T3, fT4, PSA, and CEA were assessed. ICC (Intraclass correlation coefficient) and coefficient of correlation were measured to assessing the agreement between two methods. The CVs (%) of T3, fT4, PSA, and CEA measured by batch assay were 3.2+-1.7%, 3.9+-2.1%, 7.1+-6.2%, 11.2+-7.2%. The CVs by random assay were 2.1+-1.7%, 4.8+-3.1%, 3.6+-4.8%, and 7.4+-6.2%. The ICC between the batch assay and random assay were 0.9968 (T3), 0.9973 (fT4), 0.9996 (PSA), and 0.9901 (CEA). The coefficient of correlation between the batch assay and random assay were 0.9924(T3), 0.9974 (fT4), 0.9994 (PSA), and 0.9989 (CEA) (p<0.05). The results of random assay showed strong agreement with the batch assay in a day. These results suggest that random assay using automatic dispenser could be used in radioimmunoassay

  18. Comparison of Batch Assay and Random Assay Using Automatic Dispenser in Radioimmunoassay

    International Nuclear Information System (INIS)

    Moon, Seung Hwan; Jang, Su Jin; Kang, Ji Yeon; Lee, Dong Soo; Chung, June Key; Lee, Myung Chul; Lee, Ho Young; Shin, Sun Young; Min, Gyeong Sun; Lee, Hyun Joo

    2009-01-01

    Radioimmunoassay (RIA) was usually performed by the batch assay. To improve the efficiency of RIA without increase of the cost and time, random assay could be a choice. We investigated the possibility of the random assay using automatic dispenser by assessing the agreement between batch assay and random assay. The experiments were performed with four items; Triiodothyronine (T3), free thyroxine (fT4), Prostate specific antigen (PSA), Carcinoembryonic antigen (CEA). In each item, the sera of twenty patients, the standard, and the control samples were used. The measurements were done 4 times with 3 hour time intervals by random assay and batch assay. The coefficient of variation (CV) of the standard samples and patients' data in T3, fT4, PSA, and CEA were assessed. ICC (Intraclass correlation coefficient) and coefficient of correlation were measured to assessing the agreement between two methods. The CVs (%) of T3, fT4, PSA, and CEA measured by batch assay were 3.2±1.7%, 3.9±2.1%, 7.1±6.2%, 11.2±7.2%. The CVs by random assay were 2.1±1.7%, 4.8±3.1%, 3.6±4.8%, and 7.4±6.2%. The ICC between the batch assay and random assay were 0.9968 (T3), 0.9973 (fT4), 0.9996 (PSA), and 0.9901 (CEA). The coefficient of correlation between the batch assay and random assay were 0.9924(T3), 0.9974 (fT4), 0.9994 (PSA), and 0.9989 (CEA) (p<0.05). The results of random assay showed strong agreement with the batch assay in a day. These results suggest that random assay using automatic dispenser could be used in radioimmunoassay

  19. OpenShift Workshop

    CERN Multimedia

    CERN. Geneva; Rodriguez Peon, Alberto

    2017-01-01

    Workshop to introduce developers to the OpenShift platform available at CERN. Several use cases will be shown, including deploying an existing application into OpenShift. We expect attendees to realize about OpenShift features and general architecture of the service.

  20. A Simple and Sensitive High-Content Assay for the Characterization of Antiproliferative Therapeutic Antibodies.

    Science.gov (United States)

    Stengl, Andreas; Hörl, David; Leonhardt, Heinrich; Helma, Jonas

    2017-03-01

    Monoclonal antibodies (mAbs) have become a central class of therapeutic agents in particular as antiproliferative compounds. Their often complex modes of action require sensitive assays during early, functional characterization. Current cell-based proliferation assays often detect metabolites that are indicative of metabolic activity but do not directly account for cell proliferation. Measuring DNA replication by incorporation of base analogues such as 5-bromo-2'-deoxyuridine (BrdU) fills this analytical gap but was previously restricted to bulk effect characterization in enzyme-linked immunosorbent assay formats. Here, we describe a cell-based assay format for the characterization of antiproliferative mAbs regarding potency and mode of action in a single experiment. The assay makes use of single cell-based high-content-analysis (HCA) for the reliable quantification of replicating cells and DNA content via 5-ethynyl-2'-deoxyuridine (EdU) and 4',6-diamidino-2-phenylindole (DAPI), respectively, as sensitive measures of antiproliferative mAb activity. We used trastuzumab, an antiproliferative therapeutic antibody interfering with HER2 cell surface receptor-mediated growth signal transduction, and HER2-overexpressing cell lines BT474 and SKBR3 to demonstrate up to 10-fold signal-to-background (S/B) ratios for treated versus untreated cells and a shift in cell cycle profiles indicating antibody-induced cell cycle arrest. The assay is simple, cost-effective, and sensitive, providing a cell-based format for preclinical characterization of therapeutic mAbs.

  1. Radioreceptor opioid assay

    International Nuclear Information System (INIS)

    Miller, R.J.; Chang, K.-J.

    1981-01-01

    A radioreceptor assay is described for assaying opioid drugs in biological fluids. The method enables the assay of total opioid activity, being specific for opioids as a class but lacking specificity within the class. A radio-iodinated opioid and the liquid test sample are incubated with an opiate receptor material. The percentage inhibition of the binding of the radio-iodinated compound to the opiate receptor is calculated and the opioid activity of the test liquid determined from a standard curve. Examples of preparing radio-iodinated opioids and assaying opioid activity are given. A test kit for the assay is described. Compared to other methods, this assay is cheap, easy and rapid. (U.K.)

  2. Contributors to shift work tolerance in South Korean nurses working rotating shift.

    Science.gov (United States)

    Jung, Hye-Sun; Lee, Bokim

    2015-05-01

    Shift workers have rapidly increased in South Korea; however, there is no published research exploring shift work tolerance among South Korean workers. This study aimed to investigate factors related to shift work tolerance in South Korean nurses. The sample comprised of 660 nurses who worked shifts in a large hospital in South Korea. A structured questionnaire included following comprehensive variables: demographic (age and number of children), individual (morningness and self-esteem), psychosocial (social support and job stress), lifestyle (alcohol consumption, physical activity, and BMI), and working condition factors (number of night shifts and working hours). Shift work tolerance was measured in terms of insomnia, fatigue, and depression. The results of hierarchical regressions indicate that all variables, except for three, number of children, BMI, and working hours, were related to at least one of the symptoms associated with shift work tolerance. Based on these results, we offer some practical implications to help improve shift work tolerance of workers. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. Both hMutSα and hMutSß DNA mismatch repair complexes participate in 5-fluorouracil cytotoxicity.

    Directory of Open Access Journals (Sweden)

    Akihiro Tajima

    Full Text Available Patients with advanced microsatellite unstable colorectal cancers do not show a survival benefit from 5-fluorouracil (5-FU-based chemotherapy. We and others have shown that the DNA mismatch repair (MMR complex hMutSα binds 5-FU incorporated into DNA. Although hMutSß is known to interact with interstrand crosslinks (ICLs induced by drugs such as cisplatin and psoralen, it has not been demonstrated to interact with 5-FU incorporated into DNA. Our aim was to examine if hMutSß plays a role in 5-FU recognition.We compared the normalized growth of 5-FU treated cells containing either or both mismatch repair complexes using MTT and clonogenic assays. We utilized oligonucleotides containing 5-FU and purified baculovirus-synthesized hMutSα and hMutSß in electromobility shift assays (EMSA and further analyzed binding using surface plasmon resonance.MTT and clonogenic assays after 5-FU treatment demonstrated the most cytotoxicity in cells with both hMutSα and hMutSß, intermediate cytotoxicity in cells with hMutSα alone, and the least cytotoxicity in cells with hMutSß alone, hMutSß binds 5-FU-modified DNA, but its relative binding is less than the binding of 5-FU-modified DNA by hMutSα.Cytotoxicity induced by 5-FU is dependent on intact DNA MMR, with relative cell death correlating directly with hMutSα and/or hMutSß 5-FU binding ability (hMutSα>hMutSß. The MMR complexes provide a hierarchical chemosensitivity for 5-FU cell death, and may have implications for treatment of patients with certain MMR-deficient tumors.

  4. Aspirin counteracts cancer stem cell features, desmoplasia and gemcitabine resistance in pancreatic cancer

    Science.gov (United States)

    Zhang, Yiyao; Liu, Li; Fan, Pei; Bauer, Nathalie; Gladkich, Jury; Ryschich, Eduard; Bazhin, Alexandr V.; Giese, Nathalia A.; Strobel, Oliver; Hackert, Thilo; Hinz, Ulf; Gross, Wolfgang; Fortunato, Franco; Herr, Ingrid

    2015-01-01

    Pancreatic ductal adenocarcinoma (PDA) is characterized by an extremely poor prognosis. An inflammatory microenvironment triggers the pronounced desmoplasia, the selection of cancer stem-like cells (CSCs) and therapy resistance. The anti-inflammatory drug aspirin is suggested to lower the risk for PDA and to improve the treatment, although available results are conflicting and the effect of aspirin to CSC characteristics and desmoplasia in PDA has not yet been investigated. We characterized the influence of aspirin on CSC features, stromal reactions and gemcitabine resistance. Four established and 3 primary PDA cell lines, non-malignant cells, 3 patient tumor-derived CSC-enriched spheroidal cultures and tissues from patients who did or did not receive aspirin before surgery were analyzed using MTT assays, flow cytometry, colony and spheroid formation assays, Western blot analysis, antibody protein arrays, electrophoretic mobility shift assays (EMSAs), immunohistochemistry and in vivo xenotransplantation. Aspirin significantly induced apoptosis and reduced the viability, self-renewal potential, and expression of proteins involved in inflammation and stem cell signaling. Aspirin also reduced the growth and invasion of tumors in vivo, and it significantly prolonged the survival of mice with orthotopic pancreatic xenografts in combination with gemcitabine. This was associated with a decreased expression of markers for progression, inflammation and desmoplasia. These findings were confirmed in tissue samples obtained from patients who had or had not taken aspirin before surgery. Importantly, aspirin sensitized cells that were resistant to gemcitabine and thereby enhanced the therapeutic efficacy. Aspirin showed no obvious toxic effects on normal cells, chick embryos or mice. These results highlight aspirin as an effective, inexpensive and well-tolerated co-treatment to target inflammation, desmoplasia and CSC features PDA. PMID:25846752

  5. Expert system application for prioritizing preventive actions for shift work: shift expert.

    Science.gov (United States)

    Esen, Hatice; Hatipoğlu, Tuğçen; Cihan, Ahmet; Fiğlali, Nilgün

    2017-09-19

    Shift patterns, work hours, work arrangements and worker motivations have increasingly become key factors for job performance. The main objective of this article is to design an expert system that identifies the negative effects of shift work and prioritizes mitigation efforts according to their importance in preventing these negative effects. The proposed expert system will be referred to as the shift expert. A thorough literature review is conducted to determine the effects of shift work on workers. Our work indicates that shift work is linked to demographic variables, sleepiness and fatigue, health and well-being, and social and domestic conditions. These parameters constitute the sections of a questionnaire designed to focus on 26 important issues related to shift work. The shift expert is then constructed to provide prevention advice at the individual and organizational levels, and it prioritizes this advice using a fuzzy analytic hierarchy process model, which considers comparison matrices provided by users during the prioritization process. An empirical study of 61 workers working on three rotating shifts is performed. After administering the questionnaires, the collected data are analyzed statistically, and then the shift expert produces individual and organizational recommendations for these workers.

  6. Implementing OpenShift

    CERN Document Server

    Miller, Adam

    2013-01-01

    A standard tutorial-based approach to using OpenShift and deploying custom or pre-built web applications to the OpenShift Online cloud.This book is for software developers and DevOps alike who are interested in learning how to use the OpenShift Platform-as-a-Service for developing and deploying applications, how the environment works on the back end, and how to deploy their very own open source Platform-as-a-Service based on the upstream OpenShift Origin project.

  7. NRF2 Orchestrates the Metabolic Shift during Induced Pluripotent Stem Cell Reprogramming

    Directory of Open Access Journals (Sweden)

    Kate E. Hawkins

    2016-03-01

    Full Text Available The potential of induced pluripotent stem cells (iPSCs in disease modeling and regenerative medicine is vast, but current methodologies remain inefficient. Understanding the cellular mechanisms underlying iPSC reprogramming, such as the metabolic shift from oxidative to glycolytic energy production, is key to improving its efficiency. We have developed a lentiviral reporter system to assay longitudinal changes in cell signaling and transcription factor activity in living cells throughout iPSC reprogramming of human dermal fibroblasts. We reveal early NF-κB, AP-1, and NRF2 transcription factor activation prior to a temporal peak in hypoxia inducible factor α (HIFα activity. Mechanistically, we show that an early burst in oxidative phosphorylation and elevated reactive oxygen species generation mediates increased NRF2 activity, which in turn initiates the HIFα-mediated glycolytic shift and may modulate glucose redistribution to the pentose phosphate pathway. Critically, inhibition of NRF2 by KEAP1 overexpression compromises metabolic reprogramming and results in reduced efficiency of iPSC colony formation.

  8. Selection of non-destructive assay methods: Neutron counting or calorimetric assay?

    International Nuclear Information System (INIS)

    Cremers, T.L.; Wachter, J.R.

    1994-01-01

    The transition of DOE facilities from production to D ampersand D has lead to more measurements of product, waste, scrap, and other less attractive materials. Some of these materials are difficult to analyze by either neutron counting or calorimetric assay. To determine the most efficacious analysis method, variety of materials, impure salts and hydrofluorination residues have been assayed by both calorimetric assay and neutron counting. New data will be presented together with a review of published data. The precision and accuracy of these measurements are compared to chemistry values and are reported. The contribution of the gamma ray isotopic determination measurement to the overall error of the calorimetric assay or neutron assay is examined and discussed. Other factors affecting selection of the most appropriate non-destructive assay method are listed and considered

  9. Shifting schedules: the health effects of reorganizing shift work.

    Science.gov (United States)

    Bambra, Clare L; Whitehead, Margaret M; Sowden, Amanda J; Akers, Joanne; Petticrew, Mark P

    2008-05-01

    Approximately one fifth of workers are engaged in some kind of shift work. The harmful effects of shift work on the health and work-life balance of employees are well known. A range of organizational interventions has been suggested to address these negative effects. This study undertook the systematic review (following Quality Of Reporting Of Meta [QUORUM] analyses guidelines) of experimental and quasi-experimental studies, from any country (in any language) that evaluated the effects on health and work-life balance of organizational-level interventions that redesign shift work schedules. Twenty-seven electronic databases (medical, social science, economic) were searched. Data extraction and quality appraisal were carried out by two independent reviewers. Narrative synthesis was performed. The review was conducted between October 2005 and November 2006. Twenty-six studies were found relating to a variety of organizational interventions. No one type of intervention was found to be consistently harmful to workers. However, three types were found to have beneficial effects on health and work-life balance: (1) switching from slow to fast rotation, (2) changing from backward to forward rotation, and (3) self-scheduling of shifts. Improvements were usually at little or no direct organizational cost. However, there were concerns about the generalizability of the evidence, and no studies reported on impacts on health inequalities. This review reinforces the findings of epidemiologic and laboratory-based research by suggesting that certain organizational-level interventions can improve the health of shift workers, their work-life balance, or both. This evidence could be useful when designing interventions to improve the experience of shift work.

  10. Correlation between the genotoxicity endpoints measured by two different genotoxicity assays: comet assay and CBMN assay

    Directory of Open Access Journals (Sweden)

    Carina Ladeira

    2015-06-01

    The results concerning of positive findings by micronuclei and non significant ones by comet assay, are corroborated by Deng et al. (2005 study performed in workers occupationally exposed to methotrexate, also a cytostatic drug. According to Cavallo et al. (2009, the comet assay seems to be more suitable for the prompt evaluation of the genotoxic effects, for instance, of polycyclic aromatic hydrocarbons mixtures containing volatile substances, whereas the micronucleus test seems more appropriate to evaluate the effects of exposure to antineoplastic agents. However, there are studies that observed an increase in both the comet assay and the micronucleus test in nurses handling antineoplastic drugs, although statistical significance was only seen in the comet assay, quite the opposite of our results (Maluf & Erdtmann, 2000; Laffon et al. 2005.

  11. Josephson shift registers

    International Nuclear Information System (INIS)

    Przybysz, J.X.

    1989-01-01

    This paper gives a review of Josephson shift register circuits that were designed, fabricated, or tested, with emphasis on work in the 1980s. Operating speed is most important, since it often limits system performance. Older designs used square-wave clocks, but most modern designs use offset sine waves, with either two or three phases. Operating margins and gate bias uniformity are key concerns. The fastest measured Josephson shift register operated at 2.3 GHz, which compares well with a GaAs shift register that consumes 250 times more power. The difficulties of high-speed testing have prevented many Josephson shift registers from being operated at their highest speeds. Computer simulations suggest that 30-GHz operation is possible with current Nb/Al 2 O 3 /Nb technology. Junctions with critical current densities near 10 kA/cm 2 would make 100-GHz shift registers feasible

  12. The impact of gate width setting and gate utilization factors on plutonium assay in passive correlated neutron counting

    International Nuclear Information System (INIS)

    Henzlova, D.; Menlove, H.O.; Croft, S.; Favalli, A.; Santi, P.

    2015-01-01

    In the field of nuclear safeguards, passive neutron multiplicity counting (PNMC) is a method typically employed in non-destructive assay (NDA) of special nuclear material (SNM) for nonproliferation, verification and accountability purposes. PNMC is generally performed using a well-type thermal neutron counter and relies on the detection of correlated pairs or higher order multiplets of neutrons emitted by an assayed item. To assay SNM, a set of parameters for a given well-counter is required to link the measured multiplicity rates to the assayed item properties. Detection efficiency, die-away time, gate utilization factors (tightly connected to die-away time) as well as optimum gate width setting are among the key parameters. These parameters along with the underlying model assumptions directly affect the accuracy of the SNM assay. In this paper we examine the role of gate utilization factors and the single exponential die-away time assumption and their impact on the measurements for a range of plutonium materials. In addition, we examine the importance of item-optimized coincidence gate width setting as opposed to using a universal gate width value. Finally, the traditional PNMC based on multiplicity shift register electronics is extended to Feynman-type analysis and application of this approach to Pu mass assay is demonstrated

  13. The impact of gate width setting and gate utilization factors on plutonium assay in passive correlated neutron counting

    Energy Technology Data Exchange (ETDEWEB)

    Henzlova, D., E-mail: henzlova@lanl.gov [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Menlove, H.O. [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Croft, S. [Oak Ridge National Laboratory, Oak Ridge, TN 37831 (United States); Favalli, A.; Santi, P. [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States)

    2015-10-11

    In the field of nuclear safeguards, passive neutron multiplicity counting (PNMC) is a method typically employed in non-destructive assay (NDA) of special nuclear material (SNM) for nonproliferation, verification and accountability purposes. PNMC is generally performed using a well-type thermal neutron counter and relies on the detection of correlated pairs or higher order multiplets of neutrons emitted by an assayed item. To assay SNM, a set of parameters for a given well-counter is required to link the measured multiplicity rates to the assayed item properties. Detection efficiency, die-away time, gate utilization factors (tightly connected to die-away time) as well as optimum gate width setting are among the key parameters. These parameters along with the underlying model assumptions directly affect the accuracy of the SNM assay. In this paper we examine the role of gate utilization factors and the single exponential die-away time assumption and their impact on the measurements for a range of plutonium materials. In addition, we examine the importance of item-optimized coincidence gate width setting as opposed to using a universal gate width value. Finally, the traditional PNMC based on multiplicity shift register electronics is extended to Feynman-type analysis and application of this approach to Pu mass assay is demonstrated.

  14. On the influence of matrix's heterogeneity on uncertainty of gamma-spectrometry at activity assay of radioactive waste

    Directory of Open Access Journals (Sweden)

    V. S. Prokopenko

    2009-09-01

    Full Text Available The influence of the waste matrix heterogeneity on the flux density value of initial gamma quanta at the transport of quanta in the matrix was considered. It is shown that the waste heterogeneity leads to the positive shift of the average flux density value comparing with corresponding value for homogeneous waste if average value of the attenuation factor in heterogeneous matrix is equal to the attenuation factor of homogeneous matrix. Due to this the activity assay of heterogeneous waste by a technique which was calibrated by using a homogeneous standard (surrogate container the measurement results will be positively shifted, or, in other words, conservative estimation of the waste activity will be obtained.

  15. Microbead agglutination based assays

    KAUST Repository

    Kodzius, Rimantas

    2013-01-21

    We report a simple and rapid room temperature assay for point-of-care (POC) testing that is based on specific agglutination. Agglutination tests are based on aggregation of microbeads in the presence of a specific analyte thus enabling the macroscopic observation. Such tests are most often used to explore antibody-antigen reactions. Agglutination has been used for protein assays using a biotin/streptavidin system as well as a hybridization based assay. The agglutination systems are prone to selftermination of the linking analyte, prone to active site saturation and loss of agglomeration at high analyte concentrations. We investigated the molecular target/ligand interaction, explaining the common agglutination problems related to analyte self-termination, linkage of the analyte to the same bead instead of different microbeads. We classified the agglutination process into three kinds of assays: a two- component assay, a three-component assay and a stepped three- component assay. Although we compared these three kinds of assays for recognizing DNA and protein molecules, the assay can be used for virtually any molecule, including ions and metabolites. In total, the optimized assay permits detecting analytes with high sensitivity in a short time, 5 min, at room temperature. Such a system is appropriate for POC testing.

  16. Shifting Attention

    Science.gov (United States)

    Ingram, Jenni

    2014-01-01

    This article examines the shifts in attention and focus as one teacher introduces and explains an image that represents the processes involved in a numeric problem that his students have been working on. This paper takes a micro-analytic approach to examine how the focus of attention shifts through what the teacher and students do and say in the…

  17. Cellulase from Trichoderma harzianum interacts with roots and triggers induced systemic resistance to foliar disease in maize

    Science.gov (United States)

    Saravanakumar, Kandasamy; Fan, Lili; Fu, Kehe; Yu, Chuanjin; Wang, Meng; Xia, Hai; Sun, Jianan; Li, Yaqian; Chen, Jie

    2016-01-01

    Trichoderma harzianum is well known to exhibit induced systemic resistance (ISR) to Curvularia leaf spot. We previously reported that a C6 zinc finger protein (Thc6) is responsible for a major contribution to the ISR to the leaf disease, but the types of effectors and the signals mediated by Thc6 from Trichoderma are unclear. In this work, we demonstrated that two hydrolases, Thph1 and Thph2, from T. harzianum were regulated by Thc6. Furthermore, an electrophoretic mobility shift assay (EMSA) study revealed that Thc6 regulated mRNA expression by binding to GGCTAA and GGCTAAA in the promoters of the Thph1 and Thph2 genes, respectively. Moreover, the Thph1 and Thph2 proteins triggered the transient production of reactive oxygen species (ROS) and elevated the free cytosolic calcium levels in maize leaf. Furthermore, the genes related to the jasmonate/ethylene signaling pathway were up-regulated in the wild-type maize strain. However, the ΔThph1- or ΔThph2-deletion mutants could not activate the immune defense-related genes in maize to protect against leaf disease. Therefore, we conclude that functional Thph1 and Thph2 may be required in T. harzianum to activate ISR in maize. PMID:27830829

  18. Autoantibodies Targeting AT1 Receptor from Patients with Acute Coronary Syndrome Upregulate Proinflammatory Cytokines Expression in Endothelial Cells Involving NF-κB Pathway

    Directory of Open Access Journals (Sweden)

    Weijuan Li

    2014-01-01

    Full Text Available Our study intended to prove whether agonistic autoantibodies to angiotensin II type 1 receptor (AT1-AAs exist in patients with coronary heart disease (CHD and affect the human endothelial cell (HEC by upregulating proinflammatory cytokines expression involved in NF-κB pathway. Antibodies were determined by chronotropic responses of cultured neonatal rat cardiomyocytes coupled with receptor-specific antagonists (valsartan and AT1-EC2 as described previously. Interleukin-6 (IL-6, vascular cell adhesion molecule-1 (VCAM-1, and monocyte chemotactic protein-1 (MCP-1 expression were improved at both mRNA and protein levels in HEC, while NF-κB in the DNA level was improved detected by electrophoretic mobility shift assays (EMSA. These improvements could be inhibited by specific AT1 receptor blocker valsartan, NF-κB blocker pyrrolidine dithiocarbamate (PDTC, and specific short peptides from the second extracellular loop of AT1 receptor. These results suggested that AT1-AAs, via the AT1 receptor, induce expression of proinflammatory cytokines involved in the activation of NF-κB. AT1-AAs may play a great role in the pathogenesis of the acute coronary syndrome by mediating vascular inflammatory effects involved in the NF-κB pathway.

  19. Naturally occurring mutations in the human 5-lipoxygenase gene promoter that modify transcription factor binding and reporter gene transcription.

    Science.gov (United States)

    In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M

    1997-03-01

    Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation.

  20. RNA-binding properties and mapping of the RNA-binding domain from the movement protein of Prunus necrotic ringspot virus.

    Science.gov (United States)

    Herranz, M Carmen; Pallás, Vicente

    2004-03-01

    The movement protein (MP) of Prunus necrotic ringspot virus (PNRSV) is involved in intercellular virus transport. In this study, putative RNA-binding properties of the PNRSV MP were studied. The PNRSV MP was produced in Escherichia coli using an expression vector. Electrophoretic mobility shift assays (EMSAs) using DIG-labelled riboprobes demonstrated that PNRSV MP bound ssRNA cooperatively without sequence specificity. Two different ribonucleoprotein complexes were found to be formed depending on the molar MP : PNRSV RNA ratio. The different responses of the complexes to urea treatment strongly suggested that they have different structural properties. Deletion mutagenesis followed by Northwestern analysis allowed location of a nucleic acid binding domain to aa 56-88. This 33 aa RNA-binding motif is the smallest region delineated among members of the family Bromoviridae for which RNA-binding properties have been demonstrated. This domain is highly conserved within all phylogenetic subgroups previously described for PNRSV isolates. Interestingly, the RNA-binding domain described here and the one described for Alfamovirus are located at the N terminus of their corresponding MPs, whereas similar domains previously characterized in members of the genera Bromovirus and Cucumovirus are present at the C terminus, strongly reflecting their corresponding phylogenetic relationships. The evolutionary implications of this observation are discussed.

  1. Identification and functional analysis of a CDE/CHR element in the POLDI promoter

    Institute of Scientific and Technical Information of China (English)

    SONG NanMeng; ZHU XiaoYu; SHI Lei; AN Jing; WU YanWei; SANG JianLi

    2009-01-01

    Chinese Center for Disease Control and Prevention, Beijing 102206, China DNA polymerase delta is encoded by the POLD1 gene, the transcription of which is strictly cell cy-cle-dependent. However, the means by which POLD1 transcription is regulated by the cell cycle mechanism is currently unknown. We discovered a novel element in the POLD1 promoter known as a CDE(cell cycle-dependent element)lCHR(cell cycle gene homology region) element. A series of luci-ferase reporter constructs containing various POLD1 promoter mutations were used to investigate the role of the CDF_JCHR element in POLD1 transcription. When the CDE/CHR element was mutated, the promoter activity was up-regulated, and the cell-cycle related factors E2F1 and p21 stopped regulating the promoter. Furthermore, cell cycle-dependent changes in the promoter activity required the integra-tive CDE/CHR element. Electrophoretic mobility shift assay (EMSA) revealed the presence of at least three types of DNA/protein complexes binding to the CDE/CHR element. Our findings provide strong evidence that the CDE/CHR-like sequence is an active functional element in the POLD1 promoter, which is important for the cell cycle regulation of the POLD1 gene.

  2. Cellulase from Trichoderma harzianum interacts with roots and triggers induced systemic resistance to foliar disease in maize.

    Science.gov (United States)

    Saravanakumar, Kandasamy; Fan, Lili; Fu, Kehe; Yu, Chuanjin; Wang, Meng; Xia, Hai; Sun, Jianan; Li, Yaqian; Chen, Jie

    2016-11-10

    Trichoderma harzianum is well known to exhibit induced systemic resistance (ISR) to Curvularia leaf spot. We previously reported that a C6 zinc finger protein (Thc6) is responsible for a major contribution to the ISR to the leaf disease, but the types of effectors and the signals mediated by Thc6 from Trichoderma are unclear. In this work, we demonstrated that two hydrolases, Thph1 and Thph2, from T. harzianum were regulated by Thc6. Furthermore, an electrophoretic mobility shift assay (EMSA) study revealed that Thc6 regulated mRNA expression by binding to GGCTAA and GGCTAAA in the promoters of the Thph1 and Thph2 genes, respectively. Moreover, the Thph1 and Thph2 proteins triggered the transient production of reactive oxygen species (ROS) and elevated the free cytosolic calcium levels in maize leaf. Furthermore, the genes related to the jasmonate/ethylene signaling pathway were up-regulated in the wild-type maize strain. However, the ΔThph1- or ΔThph2-deletion mutants could not activate the immune defense-related genes in maize to protect against leaf disease. Therefore, we conclude that functional Thph1 and Thph2 may be required in T. harzianum to activate ISR in maize.

  3. Effect of X-irradiation on DNA binding activity of NF-kB in EL-4 cells

    International Nuclear Information System (INIS)

    He Shujie; Jin Shunzi; Liu Shuzheng

    2002-01-01

    Changes in time course of the DNA-binding activity of NF-κB as well as the subcellular localization of p65 subunit and expression of IκBα in EL-4 cells after irradiation with 2 Gy and 0.075 Gy X-rays were examined using electrophoresis mobility shift assay (EMSA) and immunohistochemistry (IHC), respectively. Results showed that the increases in DNA-binding activity of NF-κB p50/p50 and p50/p65 were induced by both 0.075 Gy and 2 Gy X-rays. However, the amplitude of the increase in activity of the two dimers was different after irradiation with the two doses of X-rays. After irradiation with 0.075 Gy, the increase in p50/p65 activity was higher than that of p50/p50 activity. After irradiation with 2 Gy, the situation was reversed. Irradiation with both 2 Gy and 0.075 Gy induced an increase in the rate of p65 nuclear translocation and the degradation of IκBα before the increase of its expression, but the degree of these changes after different dose irradiation was different. These results suggest that the transcriptional regulation of NF-κB changes with irradiation dose, resulted in the difference in responses of cells

  4. Identification of SNPs involved in regulating a novel alternative transcript of P450 CYP6ER1 in the brown planthopper.

    Science.gov (United States)

    Liang, Zhi-Kun; Pang, Rui; Dong, Yi; Sun, Zhong-Xiang; Ling, Yan; Zhang, Wen-Qing

    2017-04-29

    Cytochrome P450-mediated metabolic resistance is one of the major mechanisms involved in insecticide resistance. Although the up-regulation of cytochrome P450 plays a vital role in insecticide metabolism, the molecular basis for the transcriptional regulation of cytochrome P450 remains largely unknown. The P450 gene CYP6ER1, has been reported to confer imidacloprid resistance to the brown planthopper, Nilaparvata lugens. Here, we identified a novel alternative transcript of CYP6ER1 (transcript A2) that had different expression patterns between resistant and susceptible populations, and was more stable after insecticide induction. The promoter of this transcript was sequenced and multiple single nucleotide polymorphisms (SNPs) were detected in individuals from susceptible and resistant field-collected populations. Resistant alleles of four SNPs were found to significantly enhance the promoter activity of the CYP6ER1 transcript A2. Electrophoretic mobility shift assays (EMSAs) revealed that these SNPs might regulate the binding of transcription factors to the promoter. Our findings provide novel evidence regarding the transcriptional regulation of a metabolic resistance-related gene and may be useful to understand the resistance mechanism of N. lugens in the field. © 2017 Institute of Zoology, Chinese Academy of Sciences.

  5. Work shift duration: a review comparing eight hour and 12 hour shift systems.

    Science.gov (United States)

    Smith, L; Folkard, S; Tucker, P; Macdonald, I

    1998-04-01

    Shiftwork is now a major feature of working life across a broad range of industries. The features of the shift systems operated can impact on the wellbeing, performance, and sleep of shiftworkers. This paper reviews the current state of knowledge on one major characteristic of shift rotas-namely, shift duration. Evidence comparing the relative effects of eight hour and 12 hour shifts on fatigue and job performance, safety, sleep, and physical and psychological health are considered. At the organisational level, factors such as the mode of system implementation, attitudes towards shift rotas, sickness absence and turnover, overtime, and moonlighting are discussed. Manual and electronic searches of the shiftwork research literature were conducted to obtain information on comparisons between eight hour and 12 hour shifts. The research findings are largely equivocal. The bulk of the evidence suggests few differences between eight and 12 hour shifts in the way they affect people. There may even be advantages to 12 hour shifts in terms of lower stress levels, better physical and psychological wellbeing, improved durations and quality of off duty sleep as well as improvements in family relations. On the negative side, the main concerns are fatigue and safety. It is noted that a 12 hour shift does not equate with being active for only 12 hours. There can be considerable extension of the person's time awake either side of the shift. However, the effects of longer term exposure to extended work days have been relatively uncharted in any systematic way. Longitudinal comparative research into the chronic impact of the compressed working week is needed.

  6. Third ventricle midline shift on computed tomography as an alternative to septum pellucidum shift

    International Nuclear Information System (INIS)

    Santiago, Carlos Francis A.; Oropilla, Jean Quint L; Alvarez, Victor M.

    2000-01-01

    The cerebral midline shift is measured using the displacement from midline of the third ventricle. It is an easily determined criterion from which CT scans of patients with spontaneous intracerebral hematoma may be investigated. Midline shift is a significant criteria in which to gauge the neurological status of patients. In a retrospective study of 32 patients with spontaneous unilateral intracerebral hemorrhage, a midline third ventricle shift correlated well with septum pellucidum shift. A greater than 7 mm midline third ventricle shift was associated with a significantly lower Glasgow Coma scale score compared a shift less than 7mm. For the septum pellucidum, a greater than 10 mm shift was similarly associated with a significantly lower Glasgow Coma scale score. (Author)

  7. Insomnia in shift work.

    Science.gov (United States)

    Vallières, Annie; Azaiez, Aïda; Moreau, Vincent; LeBlanc, Mélanie; Morin, Charles M

    2014-12-01

    Shift work disorder involves insomnia and/or excessive sleepiness associated with the work schedule. The present study examined the impact of insomnia on the perceived physical and psychological health of adults working on night and rotating shift schedules compared to day workers. A total of 418 adults (51% women, mean age 41.4 years), including 51 night workers, 158 rotating shift workers, and 209 day workers were selected from an epidemiological study. An algorithm was used to classify each participant of the two groups (working night or rotating shifts) according to the presence or absence of insomnia symptoms. Each of these individuals was paired with a day worker according to gender, age, and income. Participants completed several questionnaires measuring sleep, health, and psychological variables. Night and rotating shift workers with insomnia presented a sleep profile similar to that of day workers with insomnia. Sleep time was more strongly related to insomnia than to shift work per se. Participants with insomnia in the three groups complained of anxiety, depression, and fatigue, and reported consuming equal amounts of sleep-aid medication. Insomnia also contributed to chronic pain and otorhinolaryngology problems, especially among rotating shift workers. Work productivity and absenteeism were more strongly related to insomnia. The present study highlights insomnia as an important component of the sleep difficulties experienced by shift workers. Insomnia may exacerbate certain physical and mental health problems of shift workers, and impair their quality of life. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Effects of extended work shifts and shift work on patient safety, productivity, and employee health.

    Science.gov (United States)

    Keller, Simone M

    2009-12-01

    It is estimated 1.3 million health care errors occur each year and of those errors 48,000 to 98,000 result in the deaths of patients (Barger et al., 2006). Errors occur for a variety of reasons, including the effects of extended work hours and shift work. The need for around-the-clock staff coverage has resulted in creative ways to maintain quality patient care, keep health care errors or adverse events to a minimum, and still meet the needs of the organization. One way organizations have attempted to alleviate staff shortages is to create extended work shifts. Instead of the standard 8-hour shift, workers are now working 10, 12, 16, or more hours to provide continuous patient care. Although literature does support these staffing patterns, it cannot be denied that shifts beyond the traditional 8 hours increase staff fatigue, health care errors, and adverse events and outcomes and decrease alertness and productivity. This article includes a review of current literature on shift work, the definition of shift work, error rates and adverse outcomes related to shift work, health effects on shift workers, shift work effects on older workers, recommended optimal shift length, positive and negative effects of shift work on the shift worker, hazards associated with driving after extended shifts, and implications for occupational health nurses. Copyright 2009, SLACK Incorporated.

  9. Development of a novel in vitro assay for the evaluation of integron DNA integrase activity

    Directory of Open Access Journals (Sweden)

    Fatemeh Tohidi

    2016-05-01

    Full Text Available Integrons play an important role in multidrug resistance. The integron platform codes for integrase (intI that is required for gene cassette integration through site-specific recombination. The recombination crossover occurs between the G and TT nucleotides in non-palindromic attI and palindromic attC sites. The aim of this study was to establish an efficient in vitro assay for integrase purification and activity detection. To this end, the intI gene was cloned into the pET-22b plasmid. Then, the resulting recombinant plasmid was transformed into Escherichia coli Origami™ strain. The recombinant protein expression was confirmed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE and western blot assays. The recombinant intI protein was purified by nickel–nitrilotriacetic acid (Ni–NTA affinity chromatography, and its activity was measured by a newly introduced assay. Briefly, specific primers for each side of attI and attC were used, thereby, a polymerase chain reaction would be performed, if a fused plasmid containing both attI and attC sites was created upon recombination. SDS-PAGE and western blotting confirmed the presence of a 38-kDa recombinant protein. Optimum conditions were established for the measurement of the integrase activity and a new model assay was conducted to analyse the recombination activity in vitro. Although the electrophoretic mobility shift assay is an efficient and reliable method, the newly introduced assay provided new or enhanced capability to determine the integrase activity, suggesting that there is no need for expensive and advanced equipment.

  10. Modelling a Nurse Shift Schedule with Multiple Preference Ranks for Shifts and Days-Off

    Directory of Open Access Journals (Sweden)

    Chun-Cheng Lin

    2014-01-01

    Full Text Available When it comes to nurse shift schedules, it is found that the nursing staff have diverse preferences about shift rotations and days-off. The previous studies only focused on the most preferred work shift and the number of satisfactory days-off of the schedule at the current schedule period but had few discussions on the previous schedule periods and other preference levels for shifts and days-off, which may affect fairness of shift schedules. As a result, this paper proposes a nurse scheduling model based upon integer programming that takes into account constraints of the schedule, different preference ranks towards each shift, and the historical data of previous schedule periods to maximize the satisfaction of all the nursing staff's preferences about the shift schedule. The main contribution of the proposed model is that we consider that the nursing staff’s satisfaction level is affected by multiple preference ranks and their priority ordering to be scheduled, so that the quality of the generated shift schedule is more reasonable. Numerical results show that the planned shifts and days-off are fair and successfully meet the preferences of all the nursing staff.

  11. Identification of functional SNPs in the 5-prime flanking sequences of human genes

    Directory of Open Access Journals (Sweden)

    Lenhard Boris

    2005-02-01

    Full Text Available Abstract Background Over 4 million single nucleotide polymorphisms (SNPs are currently reported to exist within the human genome. Only a small fraction of these SNPs alter gene function or expression, and therefore might be associated with a cell phenotype. These functional SNPs are consequently important in understanding human health. Information related to functional SNPs in candidate disease genes is critical for cost effective genetic association studies, which attempt to understand the genetics of complex diseases like diabetes, Alzheimer's, etc. Robust methods for the identification of functional SNPs are therefore crucial. We report one such experimental approach. Results Sequence conserved between mouse and human genomes, within 5 kilobases of the 5-prime end of 176 GPCR genes, were screened for SNPs. Sequences flanking these SNPs were scored for transcription factor binding sites. Allelic pairs resulting in a significant score difference were predicted to influence the binding of transcription factors (TFs. Ten such SNPs were selected for mobility shift assays (EMSA, resulting in 7 of them exhibiting a reproducible shift. The full-length promoter regions with 4 of the 7 SNPs were cloned in a Luciferase based plasmid reporter system. Two out of the 4 SNPs exhibited differential promoter activity in several human cell lines. Conclusions We propose a method for effective selection of functional, regulatory SNPs that are located in evolutionary conserved 5-prime flanking regions (5'-FR regions of human genes and influence the activity of the transcriptional regulatory region. Some SNPs behave differently in different cell types.

  12. The effect of chemical carcinogenesis on rat glutathione S-transferase P1 gene transcriptional regulation.

    Science.gov (United States)

    Liu, D; Liao, M; Zuo, J; Henner, W D; Fan, F

    2001-03-01

    To investigate mechanisms of rat glutathione S-transferase P1 gene (rGSTP1) expression regulation during chemical carcinogenesis. we studied enhancer elements located in the region between -2.5 kb to -2.2 kb. The region was upstream from the start site of transcription and was divided into two major fragments, GPEI and GPEII. The GPEII fragment was further divided into two smaller fragments, GPEII- I and GPEII-2. Using a luciferase reporter system, we identified a strong enhancer of GPEI and a weak enhancer of GPEII in HeLa and a rat hepatoma cell line CBRH79 19 cell. The enhancer of GPEII was located within the GPEII-I region. Chemical stimulation by glycidyl methatylate (GMA) and phorbol 12-o-tetradecanoate 13-acetate (TPA) analysis revealed that induction of rGSTP1 expression was mainly through GPEI. Although H2O2 could enhance GPEII enhancer activity, the enhancement is not mediated by the NF-kappaB factor that bound the NF-kappaB site in GPEII. Using electrophoretic mobility shift assays (EMSA) and the UV cross-linking assays, we found that HeLa and CBRH7919 cells had proteins that specifically bound GPEI core sequence and a 64 kDa protein that interacted with GPEII-1. The cells from normal rat liver did not express the binding proteins. Therefore, the trans-acting factors seem to be closely related to GPEI, GPEII enhancer activities and may play an important role in high expression of rGSTPI gene.

  13. Molecular evidence for the coordination of nitrogen and carbon metabolisms, revealed by a study on the transcriptional regulation of the agl3EFG operon that encodes a putative carbohydrate transporter in Streptomyces coelicolor.

    Science.gov (United States)

    Cen, Xu-Feng; Wang, Jing-Zhi; Zhao, Guo-Ping; Wang, Ying; Wang, Jin

    2016-03-18

    In the agl3EFGXYZ operon (SCO7167-SCO7162, abbreviated as agl3 operon) of Streptomyces coelicolor M145, agl3EFG genes encode a putative ABC-type carbohydrate transporter. The transcription of this operon has been proved to be repressed by Agl3R (SCO7168), a neighboring GntR-family regulator, and this repression can be released by growth on poor carbon sources. Here in this study, we prove that the transcription of agl3 operon is also directly repressed by GlnR, a central regulator governing the nitrogen metabolism in S. coelicolor. The electrophoretic mobility shift assay (EMSA) employing the agl3 promoter and mixtures of purified recombinant GlnR and Agl3R indicates that GlnR and Agl3R bind to different DNA sequences within the promoter region of agl3 operon, which is further confirmed by the DNase I footprinting assay. As Agl3R and GlnR have been demonstrated to sense the extracellular carbon and nitrogen supplies, respectively, it is hypothesized that the transcription of agl3 operon is stringently governed by the availabilities of extracellular carbon and nitrogen sources. Consistent with the hypothesis, the agl3 operon is further found to be derepressed only under the condition of poor carbon and rich nitrogen supplies, when both regulators are inactivated. It is believed that activation of the expression of agl3 operon may facilitate the absorption of extracellular carbohydrates to balance the ratio of intracellular carbon to nitrogen. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Nucleolin inhibits G4 oligonucleotide unwinding by Werner helicase.

    Directory of Open Access Journals (Sweden)

    Fred E Indig

    Full Text Available The Werner protein (WRNp, a member of the RecQ helicase family, is strongly associated with the nucleolus, as is nucleolin (NCL, an important nucleolar constituent protein. Both WRNp and NCL respond to the effects of DNA damaging agents. Therefore, we have investigated if these nuclear proteins interact and if this interaction has a possible functional significance in DNA damage repair.Here we report that WRNp interacts with the RNA-binding protein, NCL, based on immunoprecipitation, immunofluorescent co-localization in live and fixed cells, and direct binding of purified WRNp to nucleolin. We also map the binding region to the C-terminal domains of both proteins. Furthermore, treatment of U2OS cells with 15 µM of the Topoisomerase I inhibitor, camptothecin, causes the dissociation of the nucleolin-Werner complex in the nucleolus, followed by partial re-association in the nucleoplasm. Other DNA damaging agents, such as hydroxyurea, Mitomycin C, and aphidicolin do not have these effects. Nucleolin or its C-terminal fragment affected the helicase, but not the exonuclease activity of WRNp, by inhibiting WRN unwinding of G4 tetraplex DNA structures, as seen in activity assays and electrophoretic mobility shift assays (EMSA.These data suggest that nucleolin may regulate G4 DNA unwinding by WRNp, possibly in response to certain DNA damaging agents. We postulate that the NCL-WRNp complex may contain an inactive form of WRNp, which is released from the nucleolus upon DNA damage. Then, when required, WRNp is released from inhibition and can participate in the DNA repair processes.

  15. Shift systems in nuclear power plants - aspects for planning, shift systems, utility practice

    International Nuclear Information System (INIS)

    Grauf, E.

    1986-01-01

    This lecture contains the most important aspects of shift structure and shift organisation. The criteria for shift planning involving essential tasks, duties, laws and regulations, medical aspects, social aspects, will be presented. In the Federal Republic of Germany some basic models were established, which will be shown and explained with special reference to the number of teams, size of shift crews and absence regulations. Moreover, the lecture will deal with rotation systems and provisions for the transfer of shift responsibilities. By example of a utility plant commissioning time scale (1300 MW PWR) the practice of shift installations will be shown as well as the most important points of education and training. Within this compass the criteria and requirements for training and education of operational personnel in the Federal Republic of Germany will also be touched. (orig.)

  16. Nurses' shift reports

    DEFF Research Database (Denmark)

    Buus, Niels; Hoeck, Bente; Hamilton, Bridget Elizabeth

    2017-01-01

    AIMS AND OBJECTIVES: To identify reporting practices that feature in studies of nurses' shift reports across diverse nursing specialities. The objectives were to perform an exhaustive systematic literature search and to critically review the quality and findings of qualitative field studies...... of nurses' shift reports. BACKGROUND: Nurses' shift reports are routine occurrences in healthcare organisations that are viewed as crucial for patient outcomes, patient safety and continuity of care. Studies of communication between nurses attend primarily to 1:1 communication and analyse the adequacy...... and accuracy of patient information and feature handovers at the bedside. Still, verbal reports between groups of nurses about patients are commonplace. Shift reports are obvious sites for studying the situated accomplishment of professional nursing at the group level. This review is focused exclusively...

  17. Assay-specific decision limits for two new automated parathyroid hormone and 25-hydroxyvitamin D assays.

    Science.gov (United States)

    Souberbielle, Jean-Claude; Fayol, Véronique; Sault, Corinne; Lawson-Body, Ethel; Kahan, André; Cormier, Catherine

    2005-02-01

    The recent development of nonradioactive automated assays for serum parathyroid hormone (PTH) and 25-hydroxyvitamin D (25OHD) has made measurement of these two hormones possible in many laboratories. In this study, we compared two new assays for PTH and 25OHD adapted on an automated analyzer, the LIAISON, with two manual immunoassays used worldwide. We studied 228 osteoporotic patients, 927 healthy individuals, 38 patients with primary hyperparathyroidism, and 167 hemodialyzed patients. Serum PTH was measured with the Allegro and the LIAISON assays, and 25OHD was measured with DiaSorin RIA and the LIAISON assay. Regression analysis was used to calculate decision thresholds for the LIAISON assays that were equivalent to those of the Allegro PTH and DiaSorin 25OHD assays. The 25OHD concentrations obtained with the LIAISON assay and the RIA in osteoporotic patients were well correlated (r = 0.83; P 50 nmol/L as eligible for the reference population for the LIAISON PTH assay. In this group, the 3rd-97th percentile interval for LIAISON PTH was 3-51 ng/L. Considering upper reference limits of 46 and 51 ng/L for the Allegro and LIAISON assays, respectively, the frequency of above-normal PTH concentrations in patients with primary hyperparathyroidism was similar in both assays. Regression analysis between serum PTH measured by the Allegro and LIAISON assays in 167 hemodialyzed patients and the corresponding Bland-Altman analysis of these data suggest that the LIAISON PTH assay tends to read higher than the Allegro assay at low concentrations but lower at high concentrations (>300 ng/L). Because clinical decision limits for both PTH and 25OHD should be assay specific, we propose equivalences between these assays and two manual assays used worldwide. These assay-specific decision limits should help potential users of the LIAISON PTH and 25OHD assays.

  18. Spectral Shifting in Nondestructive Assay Instrumentation

    Energy Technology Data Exchange (ETDEWEB)

    Trellue, Holly Renee [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Nettleton, Anthony Steven [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Tutt, James Robert [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Menlove, Howard Olsen [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); LaFleur, Adrienne Marie [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Tobin, Stephen Joseph [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-11-17

    This project involves spectrum tailoring research that endeavors to better distinguish energies of gamma rays using different spectral material thicknesses and determine neutron energies by coating detectors with various materials.

  19. [Sleep quality of nurses working in shifts - Hungarian adaptation of the Bergen Shift Work Sleep Questionnaire].

    Science.gov (United States)

    Fusz, Katalin; Tóth, Ákos; Fullér, Noémi; Müller, Ágnes; Oláh, András

    2015-12-06

    Sleep disorders among shift workers are common problems due to the disturbed circadian rhythm. The Bergen Shift Work Sleep Questionnaire assesses discrete sleep problems related to work shifts (day, evening and night shifts) and rest days. The aim of the study was to develop the Hungarian version of this questionnaire and to compare the sleep quality of nurses in different work schedules. 326 nurses working in shifts filled in the questionnaire. The authors made convergent and discriminant validation of the questionnaire with the Athens Insomnia Scale and the Perceived Stress Questionnaire. The questionnaire based on psychometric characteristics was suitable to assess sleep disorders associated with shift work in a Hungarian sample. The frequency of discrete symptoms significantly (pshifts. Nurses experienced the worst sleep quality and daytime fatigue after the night shift. Nurses working in irregular shift system had worse sleep quality than nurses working in regular and flexible shift system (pworking in shifts should be assessed with the Hungarian version of the Bergen Shift Work Sleep Questionnaire on a nationally representative sample, and the least burdensome shift system could be established.

  20. Age differences in strategy shift: retrieval avoidance or general shift reluctance?

    Science.gov (United States)

    Frank, David J; Touron, Dayna R; Hertzog, Christopher

    2013-09-01

    Previous studies of metacognitive age differences in skill acquisition strategies have relied exclusively on tasks with a processing shift from an algorithm to retrieval strategy. Older adults' demonstrated reluctance to shift strategies in such tasks could reflect either a specific aversion to a memory retrieval strategy or a general, inertial resistance to strategy change. Haider and Frensch's (1999) alphabet verification task (AVT) affords a non-retrieval-based strategy shift. Participants verify the continuation of alphabet strings such as D E F G [4] L, with the bracketed digit indicating a number of letters to be skipped. When all deviations are restricted to the letter-digit-letter portion, participants can speed their responses by selectively attending to only that part of the stimulus. We adapted the AVT to include conditions that promoted shift to a retrieval strategy, a selective attention strategy, or both strategies. Item-level strategy reports were validated by eye movement data. Older adults shifted more slowly to the retrieval strategy but more quickly to the selective attention strategy than young adults, indicating a retrieval-strategy avoidance. Strategy confidence and perceived strategy difficulty correlated with shift to the two strategies in both age groups. Perceived speed of responses with each strategy specifically correlated with older adults' strategy choices, suggesting that some older adults avoid retrieval because they do not appreciate its efficiency benefits.

  1. Age Differences in Strategy Shift: Retrieval Avoidance or General Shift Reluctance?

    Science.gov (United States)

    Frank, David J.; Touron, Dayna R.; Hertzog, Christopher

    2013-01-01

    Previous studies of metacognitive age differences in skill acquisition strategies have relied exclusively on tasks with a processing shift from an algorithm to retrieval strategy. Older adults’ demonstrated reluctance to shift strategies in such tasks could reflect either a specific aversion to a memory retrieval strategy or a general, inertial resistance to strategy change. Haider and Frensch’s (1999) alphabet verification task (AVT) affords a non-retrieval-based strategy shift. Participants verify the continuation of alphabet strings such as D E F G [4] L, with the bracketed digit indicating a number of letters to be skipped. When all deviations are restricted to the letter-digit-letter portion, participants can speed their responses by selectively attend only to that part of the stimulus. We adapted the AVT to include conditions which promoted shift to a retrieval strategy, a selective attention strategy, or both strategies. Item-level strategy reports were validated by eye movement data. Older adults shifted more slowly to the retrieval strategy but more quickly to the selective attention strategy than young adults, indicating a retrieval-strategy avoidance. Strategy confidence and perceived strategy difficulty correlated with shift to the two strategies in both age groups. Perceived speed of responses with each strategy specifically correlated with older adults’ strategy choices, suggesting that some older adults avoid retrieval because they do not appreciate its efficiency benefits. PMID:23088195

  2. Non-occupational physical activity levels of shift workers compared with non-shift workers

    NARCIS (Netherlands)

    Loef, Bette; Hulsegge, Gerben; Wendel-Vos, G C Wanda; Verschuren, W M Monique; Vermeulen, Roel C H; Bakker, Marije F.; van der Beek, Allard J.; Proper, Karin I

    2017-01-01

    OBJECTIVES: Lack of physical activity (PA) has been hypothesised as an underlying mechanism in the adverse health effects of shift work. Therefore, our aim was to compare non-occupational PA levels between shift workers and non-shift workers. Furthermore, exposure-response relationships for

  3. Domain-specific phosphomimetic mutation allows dissection of different protein kinase C (PKC) isotype-triggered activities of the RNA binding protein HuR.

    Science.gov (United States)

    Schulz, Sebastian; Doller, Anke; Pendini, Nicole R; Wilce, Jacqueline A; Pfeilschifter, Josef; Eberhardt, Wolfgang

    2013-12-01

    The ubiquitous mRNA binding protein human antigen R (HuR) participates in the post-transcriptional regulation of many AU-rich element (ARE)-bearing mRNAs. Previously, by using in vitro kinase assay, we have identified serines (Ser) 158, 221 and 318 as targets of protein kinase C (PKC)-triggered phosphorylation. In this study, we tested whether GFP- or GST-tagged HuR constructs bearing a phosphomimetic Ser (S)-to-Asp (D) substitution at the different PKC target sites, would affect different HuR functions including HuR nucleo-cytoplasmic redistribution and binding to different types of ARE-containing mRNAs. The phosphomimetic GFP-tagged HuR protein bearing a phosphomimetic substitution in the hinge region of HuR (HuR-S221D) showed an increased cytoplasmic abundance when compared to wild-type HuR. Conversely, data from in vitro kinase assay and electrophoretic mobility shift assay (EMSA), implicates that phosphorylation at Ser 221 is not relevant for mRNA binding of HuR. Quantification of in vitro binding affinities of GST-tagged wild-type HuR and corresponding HuR proteins bearing a phosphomimetic substitution in either RRM2 (HuR-S158D) or in RRM3 (HuR-S318D) by microscale thermophoresis (MST) indicates a specific binding of wild-type HuR to type I, II or type III-ARE-oligonucleotides in the high nanomolar range. Interestingly, phosphomimetic mutation at position 158 or 318 had a negative influence on HuR binding to type I- and type II-ARE-mRNAs whereas it significantly enhanced HuR affinity to a type III-ARE substrate. Our data suggest that differential phosphorylation of HuR by PKCs at different HuR domains coordinates subcellular HuR distribution and leads to a preferential binding to U-rich bearing target mRNA. © 2013.

  4. Night Shift Work and Levels of 6-Sulfatoxymelatonin and Cortisol in Men

    Science.gov (United States)

    Mirick, Dana K.; Bhatti, Parveen; Chen, Chu; Nordt, Frank; Stanczyk, Frank Z.; Davis, Scott

    2016-01-01

    Background Nightshift work is associated with cancer among men, but the biological mechanism is unclear. We investigated whether male nightshift workers demonstrated changes in levels of melatonin and cortisol, potential biomarkers of cancer risk. Methods Urine was collected from 185 nightshift and 158 dayshift-working male healthcare providers, aged 22-55, throughout work and sleep periods and assayed for 6-sulfatoxymelatonin and cortisol. Morning serum was collected within 90 minutes of completing the night and assayed for cortisol. Results Nightshift workers had significantly lower 6-sulfatoxymelatonin levels during daytime sleep, nighttime work, and nighttime sleep on off-nights (57%, 62% and 40% lower, respectively), relative to the dayshift workers during nighttime sleep (pnights (pnight work and daytime sleep, and levels remain low when nightshift workers sleep at night. Chronic reduction in melatonin among nightshift workers may be an important carcinogenic mechanism. Cortisol secretion patterns may be impacted by night shift work, which could affect cancer risk. Impact Shiftwork could be an important risk factor for many types of cancer. PMID:23563887

  5. Biomonitoring of genotoxic risk in radar facility workers: comparison of the comet assay with micronucleus assay and chromatid breakage assay

    International Nuclear Information System (INIS)

    Garaj-Vrhovac, V.; Kopjar, N.

    2003-01-01

    Genotoxic risks of occupational exposure in a radar facility were evaluated by using alkaline comet assay, micronucleus assay and chromatid breakage assay on peripheral blood leukocytes in exposed subjects and corresponding controls. Results show that occupational exposure to microwave radiation correlates with an increase of genome damage in somatic cells. The levels of DNA damage in exposed subjects determined by using alkaline comet assay were increased compared to control and showed interindividual variations. Incidence of micronuclei was also significantly increased compared to baseline control values. After short exposure of cultured lymphocytes to bleomycin, cells of occupationally exposed subjects responded with high numbers of chromatid breaks. Although the level of chromosome damage generated by bleomycin varied greatly between individuals, in exposed subjects a significantly elevated number of chromatid breaks was observed. Our results support data reported in literature indicating that microwave radiation represents a potential DNA-damaging hazard. Alkaline comet assay is confirmed as a sensitive and highly reproducible technique for detection of primary DNA damage inflicted in somatic cells. Micronucleus assay was confirmed as reliable bio-markers of effect and chromatid breakage assay as sensitive bio-marker of individual cancer susceptibility. The results obtained also confirm the necessity to improve measures and to perform accurate health surveillance of individuals occupationally exposed to microwave radiation

  6. Chemical shift imaging: a review

    International Nuclear Information System (INIS)

    Brateman, L.

    1986-01-01

    Chemical shift is the phenomenon that is seen when an isotope possessing a nuclear magnetic dipole moment resonates at a spectrum of resonance frequencies in a given magnetic field. These resonance frequencies, or chemical shifts, depend on the chemical environments of particular nuclei. Mapping the spatial distribution of nuclei associated with a particular chemical shift (e.g., hydrogen nuclei associated with water molecules or with lipid groups) is called chemical shift imaging. Several techniques of proton chemical shift imaging that have been applied in vivo are presented, and their clinical findings are reported and summarized. Acquiring high-resolution spectra for large numbers of volume elements in two or three dimensions may be prohibitive because of time constraints, but other methods of imaging lipid of water distributions (i.e., selective excitation, selective saturation, or variations in conventional magnetic resonance imaging pulse sequences) can provide chemical shift information. These techniques require less time, but they lack spectral information. Since fat deposition seen by chemical shift imaging may not be demonstrated by conventional magnetic resonance imaging, certain applications of chemical shift imaging, such as in the determination of fatty liver disease, have greater diagnostic utility than conventional magnetic resonance imaging. Furthermore, edge artifacts caused by chemical shift effects can be eliminated by certain selective methods of data acquisition employed in chemical shift imaging

  7. Adaptation of Shift Sequence Based Method for High Number in Shifts Rostering Problem for Health Care Workers

    Directory of Open Access Journals (Sweden)

    Mindaugas Liogys

    2013-08-01

    Full Text Available Purpose—is to investigate a shift sequence-based approach efficiency then problem consisting of a high number of shifts.Research objectives:• Solve health care workers rostering problem using a shift sequence based method.• Measure its efficiency then number of shifts increases.Design/methodology/approach—Usually rostering problems are highly constrained. Constraints are classified to soft and hard constraints. Soft and hard constraints of the problem are additionally classified to: sequence constraints, schedule constraints and roster constraints. Sequence constraints are considered when constructing shift sequences. Schedule constraints are considered when constructing a schedule. Roster constraints are applied, then constructing overall solution, i.e. combining all schedules.Shift sequence based approach consists of two stages:• Shift sequences construction,• The construction of schedules.In the shift sequences construction stage, the shift sequences are constructed for each set of health care workers of different skill, considering sequence constraints. Shifts sequences are ranked by their penalties for easier retrieval in later stage.In schedules construction stage, schedules for each health care worker are constructed iteratively, using the shift sequences produced in stage 1.Shift sequence based method is an adaptive iterative method where health care workers who received the highest schedule penalties in the last iteration are scheduled first at the current iteration.During the roster construction, and after a schedule has been generated for the current health care worker, an improvement method based on an efficient greedy local search is carried out on the partial roster. It simply swaps any pair of shifts between two health care workers in the (partial roster, as long as the swaps satisfy hard constraints and decrease the roster penalty.Findings—Using shift sequence method for solving health care workers rostering problem

  8. Adaptation of Shift Sequence Based Method for High Number in Shifts Rostering Problem for Health Care Workers

    Directory of Open Access Journals (Sweden)

    Mindaugas Liogys

    2011-08-01

    Full Text Available Purpose—is to investigate a shift sequence-based approach efficiency then problem consisting of a high number of shifts. Research objectives:• Solve health care workers rostering problem using a shift sequence based method.• Measure its efficiency then number of shifts increases. Design/methodology/approach—Usually rostering problems are highly constrained.Constraints are classified to soft and hard constraints. Soft and hard constraints of the problem are additionally classified to: sequence constraints, schedule constraints and roster constraints. Sequence constraints are considered when constructing shift sequences. Schedule constraints are considered when constructing a schedule. Roster constraints are applied, then constructing overall solution, i.e. combining all schedules.Shift sequence based approach consists of two stages:• Shift sequences construction,• The construction of schedules.In the shift sequences construction stage, the shift sequences are constructed for each set of health care workers of different skill, considering sequence constraints. Shifts sequences are ranked by their penalties for easier retrieval in later stage.In schedules construction stage, schedules for each health care worker are constructed iteratively, using the shift sequences produced in stage 1. Shift sequence based method is an adaptive iterative method where health care workers who received the highest schedule penalties in the last iteration are scheduled first at the current iteration. During the roster construction, and after a schedule has been generated for the current health care worker, an improvement method based on an efficient greedy local search is carried out on the partial roster. It simply swaps any pair of shifts between two health care workers in the (partial roster, as long as the swaps satisfy hard constraints and decrease the roster penalty.Findings—Using shift sequence method for solving health care workers rostering

  9. Combined chemical shift changes and amino acid specific chemical shift mapping of protein-protein interactions

    Energy Technology Data Exchange (ETDEWEB)

    Schumann, Frank H.; Riepl, Hubert [University of Regensburg, Institute of Biophysics and Physical Biochemistry (Germany); Maurer, Till [Boehringer Ingelheim Pharma GmbH and Co. KG, Analytical Sciences Department (Germany); Gronwald, Wolfram [University of Regensburg, Institute of Biophysics and Physical Biochemistry (Germany); Neidig, Klaus-Peter [Bruker BioSpin GmbH, Software Department (Germany); Kalbitzer, Hans Robert [University of Regensburg, Institute of Biophysics and Physical Biochemistry (Germany)], E-mail: hans-robert.kalbitzer@biologie.uni-regensburg.de

    2007-12-15

    Protein-protein interactions are often studied by chemical shift mapping using solution NMR spectroscopy. When heteronuclear data are available the interaction interface is usually predicted by combining the chemical shift changes of different nuclei to a single quantity, the combined chemical shift perturbation {delta}{delta}{sub comb}. In this paper different procedures (published and non-published) to calculate {delta}{delta}{sub comb} are examined that include a variety of different functional forms and weighting factors for each nucleus. The predictive power of all shift mapping methods depends on the magnitude of the overlap of the chemical shift distributions of interacting and non-interacting residues and the cut-off criterion used. In general, the quality of the prediction on the basis of chemical shift changes alone is rather unsatisfactory but the combination of chemical shift changes on the basis of the Hamming or the Euclidian distance can improve the result. The corrected standard deviation to zero of the combined chemical shift changes can provide a reasonable cut-off criterion. As we show combined chemical shifts can also be applied for a more reliable quantitative evaluation of titration data.

  10. Assay strategies and methods for phospholipases

    International Nuclear Information System (INIS)

    Reynolds, L.J.; Washburn, W.N.; Deems, R.A.; Dennis, E.A.

    1991-01-01

    Of the general considerations discussed, the two issues which are most important in choosing an assay are (1) what sensitivity is required to assay a particular enzyme and (2) whether the assay must be continuous. One can narrow the options further by considering substrate availability, enzyme specificity, assay convenience, or the presence of incompatible side reactions. In addition, the specific preference of a particular phospholipase for polar head group, micellar versus vesicular substrates, and anionic versus nonionic detergents may further restrict the options. Of the many assays described in this chapter, several have limited applicability or serious drawbacks and are not commonly employed. The most commonly used phospholipase assays are the radioactive TLC assay and the pH-stat assay. The TLC assay is probably the most accurate, sensitive assay available. These aspects often outweigh the disadvantages of being discontinuous, tedious, and expensive. The radioactive E. coli assay has become popular recently as an alternative to the TLC assay for the purification of the mammalian nonpancreatic phospholipases. The assay is less time consuming and less expensive than the TLC assay, but it is not appropriate when careful kinetics are required. Where less sensitivity is needed, or when a continuous assay is necessary, the pH-stat assay is often employed. With purified enzymes, when free thiol groups are not present, a spectrophotometric thiol assay can be used. This assay is ∼ as sensitive as the pH-stat assay but is more convenient and more reproducible, although the substrate is not available commercially. Despite the many assay choices available, the search continues for a convenient, generally applicable assay that is both sensitive and continuous

  11. Comparison of sleep disturbances in shift workers and people working with a fixed shift

    Directory of Open Access Journals (Sweden)

    Zohreh Yazdi

    2013-11-01

    Full Text Available Background: Different types of sleep disturbances can have a serious negative effect on a person’s ability, function and overall well-being. One of the most important issues that can result in sleep disturbances are occupational causes, the most important among them is shift work. The objective of this study was to compare the prevalence of sleep disturbances between shift work and non-shift workers. Material and Methods: This study was designed as a case-control study in 196 shift workers and 204 non-shift workers in a textile factory. The data were collected by using a comprehensive questionnaire including Pittsburg Sleep Quality Index questionnaire, Berlin Questionnaire, Epworth Sleepiness Scale, Insomnia Severity Index and Restless Leg Syndrome Questionnaire. Data analyses were carried out using the SPSS software version 13 by student's t-test, Chi square and multiple logistic regressions. Results: The duration of night sleep in shift workers was less than day workers (p<0.001. Prevalence of poor sleep quality and insomnia were higher in shift workers significantly than non shift workers (p<0.001, OR=2.3 95% CI: 1.7-2.9. The most prevalent type of insomnia was problems in initiating sleep (P=0.022, OR=2.2 95% CI: 1.5-3.2. There was no difference in the prevalence of excessive day-time sleepiness, restless leg syndrome, snoring, obstructive sleep apnea and different types of parasomnias between two groups. Conclusion: Reduced length of sleep and higher prevalence of poor sleep quality and insomnia in shift workers emphasizes the importance of serious attention to sleep disorders in shift workers.

  12. Solid phase assays

    International Nuclear Information System (INIS)

    Reese, M.G.; Johnson, L.R.; Ransom, D.K.

    1980-01-01

    In a solid phase assay for quantitative determination of biological and other analytes, a sample such as serum is contacted with a receptor for the analyte being assayed, the receptor being supported on a solid support. No tracer for the analyte is added to the sample before contacting with the receptor; instead the tracer is contacted with the receptor after unbound analyte has been removed from the receptor. The assay can be otherwise performed in a conventional manner but can give greater sensitivity. (author)

  13. Chemical shift homology in proteins

    International Nuclear Information System (INIS)

    Potts, Barbara C.M.; Chazin, Walter J.

    1998-01-01

    The degree of chemical shift similarity for homologous proteins has been determined from a chemical shift database of over 50 proteins representing a variety of families and folds, and spanning a wide range of sequence homologies. After sequence alignment, the similarity of the secondary chemical shifts of C α protons was examined as a function of amino acid sequence identity for 37 pairs of structurally homologous proteins. A correlation between sequence identity and secondary chemical shift rmsd was observed. Important insights are provided by examining the sequence identity of homologous proteins versus percentage of secondary chemical shifts that fall within 0.1 and 0.3 ppm thresholds. These results begin to establish practical guidelines for the extent of chemical shift similarity to expect among structurally homologous proteins

  14. Detection of induced male germline mutation: Correlations and comparisons between traditional germline mutation assays, transgenic rodent assays and expanded simple tandem repeat instability assays

    Energy Technology Data Exchange (ETDEWEB)

    Singer, Timothy M. [Mutagenesis Section, Environmental and Occupational Toxicology Division, Safe Environments Programme, 0803A, Health Canada, Ottawa, Ont., K1A 0K9 (Canada); Department of Biology, Carleton University, 1125 Colonel By Drive, Ottawa, Ont., K1S 5B6 (Canada); Lambert, Iain B. [Department of Biology, Carleton University, 1125 Colonel By Drive, Ottawa, Ont., K1S 5B6 (Canada); Williams, Andrew [Biostatistics and Epidemiology Division, Safe Environments Programme, 6604B, Health Canada, Ottawa, Ont., K1A 0K9 (Canada); Douglas, George R. [Mutagenesis Section, Environmental and Occupational Toxicology Division, Safe Environments Programme, 0803A, Health Canada, Ottawa, Ont., K1A 0K9 (Canada); Yauk, Carole L. [Mutagenesis Section, Environmental and Occupational Toxicology Division, Safe Environments Programme, 0803A, Health Canada, Ottawa, Ont., K1A 0K9 (Canada)]. E-mail: carole_yauk@hc-sc.gc.ca

    2006-06-25

    Several rodent assays are capable of monitoring germline mutation. These include traditional assays, such as the dominant lethal (DL) assay, the morphological specific locus (SL) test and the heritable translocation (HT) assay, and two assays that have been developed more recently-the expanded simple tandem repeat (ESTR) and transgenic rodent (TGR) mutation assays. In this paper, we have compiled the limited amount of experimental data that are currently available to make conclusions regarding the comparative ability of the more recently developed assays to detect germline mutations induced by chemical and radiological agents. The data suggest that ESTR and TGR assays are generally comparable with SL in detecting germline mutagenicity induced by alkylating agents and radiation, though TGR offered less sensitivity than ESTR in some cases. The DL and HT assays detect clastogenic events and are most susceptible to mutations arising in post-spermatogonial cells, and they may not provide the best comparisons with TGR and ESTR instability. The measurement of induced ESTR instability represents a relatively sensitive method of identifying agents causing germline mutation in rodents, and may also be useful for bio-monitoring exposed individuals in the human population. Any future use of the TGR and ESTR germline mutation assays in a regulatory testing context will entail more robust and extensive characterization of assay performance. This will require substantially more data, including experiments measuring multiple endpoints, a greatly expanded database of chemical agents and a focus on characterizing stage-specific activity of mutagens in these assays, preferably by sampling epididymal sperm exposed at defined pre-meiotic, meiotic and post-meiotic stages of development.

  15. Detection of induced male germline mutation: Correlations and comparisons between traditional germline mutation assays, transgenic rodent assays and expanded simple tandem repeat instability assays

    International Nuclear Information System (INIS)

    Singer, Timothy M.; Lambert, Iain B.; Williams, Andrew; Douglas, George R.; Yauk, Carole L.

    2006-01-01

    Several rodent assays are capable of monitoring germline mutation. These include traditional assays, such as the dominant lethal (DL) assay, the morphological specific locus (SL) test and the heritable translocation (HT) assay, and two assays that have been developed more recently-the expanded simple tandem repeat (ESTR) and transgenic rodent (TGR) mutation assays. In this paper, we have compiled the limited amount of experimental data that are currently available to make conclusions regarding the comparative ability of the more recently developed assays to detect germline mutations induced by chemical and radiological agents. The data suggest that ESTR and TGR assays are generally comparable with SL in detecting germline mutagenicity induced by alkylating agents and radiation, though TGR offered less sensitivity than ESTR in some cases. The DL and HT assays detect clastogenic events and are most susceptible to mutations arising in post-spermatogonial cells, and they may not provide the best comparisons with TGR and ESTR instability. The measurement of induced ESTR instability represents a relatively sensitive method of identifying agents causing germline mutation in rodents, and may also be useful for bio-monitoring exposed individuals in the human population. Any future use of the TGR and ESTR germline mutation assays in a regulatory testing context will entail more robust and extensive characterization of assay performance. This will require substantially more data, including experiments measuring multiple endpoints, a greatly expanded database of chemical agents and a focus on characterizing stage-specific activity of mutagens in these assays, preferably by sampling epididymal sperm exposed at defined pre-meiotic, meiotic and post-meiotic stages of development

  16. Adaptation to shift work: physiologically based modeling of the effects of lighting and shifts' start time.

    Directory of Open Access Journals (Sweden)

    Svetlana Postnova

    Full Text Available Shift work has become an integral part of our life with almost 20% of the population being involved in different shift schedules in developed countries. However, the atypical work times, especially the night shifts, are associated with reduced quality and quantity of sleep that leads to increase of sleepiness often culminating in accidents. It has been demonstrated that shift workers' sleepiness can be improved by a proper scheduling of light exposure and optimizing shifts timing. Here, an integrated physiologically-based model of sleep-wake cycles is used to predict adaptation to shift work in different light conditions and for different shift start times for a schedule of four consecutive days of work. The integrated model combines a model of the ascending arousal system in the brain that controls the sleep-wake switch and a human circadian pacemaker model. To validate the application of the integrated model and demonstrate its utility, its dynamics are adjusted to achieve a fit to published experimental results showing adaptation of night shift workers (n = 8 in conditions of either bright or regular lighting. Further, the model is used to predict the shift workers' adaptation to the same shift schedule, but for conditions not considered in the experiment. The model demonstrates that the intensity of shift light can be reduced fourfold from that used in the experiment and still produce good adaptation to night work. The model predicts that sleepiness of the workers during night shifts on a protocol with either bright or regular lighting can be significantly improved by starting the shift earlier in the night, e.g.; at 21:00 instead of 00:00. Finally, the study predicts that people of the same chronotype, i.e. with identical sleep times in normal conditions, can have drastically different responses to shift work depending on their intrinsic circadian and homeostatic parameters.

  17. Adaptation to shift work: physiologically based modeling of the effects of lighting and shifts' start time.

    Science.gov (United States)

    Postnova, Svetlana; Robinson, Peter A; Postnov, Dmitry D

    2013-01-01

    Shift work has become an integral part of our life with almost 20% of the population being involved in different shift schedules in developed countries. However, the atypical work times, especially the night shifts, are associated with reduced quality and quantity of sleep that leads to increase of sleepiness often culminating in accidents. It has been demonstrated that shift workers' sleepiness can be improved by a proper scheduling of light exposure and optimizing shifts timing. Here, an integrated physiologically-based model of sleep-wake cycles is used to predict adaptation to shift work in different light conditions and for different shift start times for a schedule of four consecutive days of work. The integrated model combines a model of the ascending arousal system in the brain that controls the sleep-wake switch and a human circadian pacemaker model. To validate the application of the integrated model and demonstrate its utility, its dynamics are adjusted to achieve a fit to published experimental results showing adaptation of night shift workers (n = 8) in conditions of either bright or regular lighting. Further, the model is used to predict the shift workers' adaptation to the same shift schedule, but for conditions not considered in the experiment. The model demonstrates that the intensity of shift light can be reduced fourfold from that used in the experiment and still produce good adaptation to night work. The model predicts that sleepiness of the workers during night shifts on a protocol with either bright or regular lighting can be significantly improved by starting the shift earlier in the night, e.g.; at 21:00 instead of 00:00. Finally, the study predicts that people of the same chronotype, i.e. with identical sleep times in normal conditions, can have drastically different responses to shift work depending on their intrinsic circadian and homeostatic parameters.

  18. Shift Work, Chronotype, and Melatonin Patterns among Female Hospital Employees on Day and Night Shifts.

    Science.gov (United States)

    Leung, Michael; Tranmer, Joan; Hung, Eleanor; Korsiak, Jill; Day, Andrew G; Aronson, Kristan J

    2016-05-01

    Shift work-related carcinogenesis is hypothesized to be mediated by melatonin; however, few studies have considered the potential effect modification of this underlying pathway by chronotype or specific aspects of shift work such as the number of consecutive nights in a rotation. In this study, we examined melatonin patterns in relation to shift status, stratified by chronotype and number of consecutive night shifts, and cumulative lifetime exposure to shift work. Melatonin patterns of 261 female personnel (147 fixed-day and 114 on rotations, including nights) at Kingston General Hospital were analyzed using cosinor analysis. Urine samples were collected from all voids over a 48-hour specimen collection period for measurement of 6-sulfatoxymelatonin concentrations using the Buhlmann ELISA Kit. Chronotypes were assessed using mid-sleep time (MSF) derived from the Munich Chronotype Questionnaire (MCTQ). Sociodemographic, health, and occupational information were collected by questionnaire. Rotational shift nurses working nights had a lower mesor and an earlier time of peak melatonin production compared to day-only workers. More pronounced differences in mesor and acrophase were seen among later chronotypes, and shift workers working ≥3 consecutive nights. Among nurses, cumulative shift work was associated with a reduction in mesor. These results suggest that evening-types and/or shift workers working ≥3 consecutive nights are more susceptible to adverse light-at-night effects, whereas long-term shift work may also chronically reduce melatonin levels. Cumulative and current exposure to shift work, including nights, affects level and timing of melatonin production, which may be related to carcinogenesis and cancer risk. Cancer Epidemiol Biomarkers Prev; 25(5); 830-8. ©2016 AACR. ©2016 American Association for Cancer Research.

  19. Evaluation of total PSA assay on vitros ECi and correlation with Kryptor-PSA assay.

    Science.gov (United States)

    Cassinat, B; Wacquet, M; Toubert, M E; Rain, J D; Schlageter, M H

    2001-01-01

    An increasing number of multiparametric immuno-analysers for PSA assays are available. As different immuno-assays may vary in their analytical quality and their accuracy for the follow-up of patients, expertise is necessary for each new assay. The PSA assay on the Vitros-ECi analyser has been evaluated and compared with the PSA assay from the Kryptor analyser. Variation coefficients were 0.91 to 1.98% for within-run assays, and 4.2% to 5.4% for interassay (PSA levels = 0.8 microgram/L to 33.6 micrograms/L). Dilution tests showed 93 to 136% recovery until 70 micrograms/L PSA. Functional sensitivity was estimated at 0.03 microgram/L. Equimolarity of the test was confirmed. Correlation of PSA levels measured with Vitros-ECi and Kryptor analysers displayed a correlation coefficient r2 of 0.9716. The half-lives and doubling times of PSA were similar using both methods. Vitros-ECi PSA assay meets the major criteria for the management of prostate cancer patients.

  20. Hormone assay

    International Nuclear Information System (INIS)

    Eisentraut, A.M.

    1977-01-01

    An improved radioimmunoassay is described for measuring total triiodothyronine or total thyroxine levels in a sample of serum containing free endogenous thyroid hormone and endogenous thyroid hormone bound to thyroid hormone binding protein. The thyroid hormone is released from the protein by adding hydrochloric acid to the serum. The pH of the separated thyroid hormone and thyroid hormone binding protein is raised in the absence of a blocking agent without interference from the endogenous protein. 125 I-labelled thyroid hormone and thyroid hormone antibodies are added to the mixture, allowing the labelled and unlabelled thyroid hormone and the thyroid hormone antibody to bind competitively. This results in free thyroid hormone being separated from antibody bound thyroid hormone and thus the unknown quantity of thyroid hormone may be determined. A thyroid hormone test assay kit is described for this radioimmunoassay. It provides a 'single tube' assay which does not require blocking agents for endogenous protein interference nor an external solid phase sorption step for the separation of bound and free hormone after the competitive binding step; it also requires a minimum number of manipulative steps. Examples of the assay are given to illustrate the reproducibility, linearity and specificity of the assay. (UK)

  1. Clinical and economic impact of the introduction of a nucleic acid amplification assay for Clostridium difficile.

    Science.gov (United States)

    Guinta, Margaret M; Bunnell, Kristen; Harrington, Amanda; Bleasdale, Susan; Danziger, Larry; Wenzler, Eric

    2017-12-04

    The clinical outcomes and cost implications of a diagnostic shift from an EIA- to PCR-based assay for Clostridium difficile infection (CDI) have not been completely described in the literature. The impact of the PCR-based assay on the incidence and duration of CDI therapy was compared to the EIA assay for patients with a negative CDI diagnostic result. Secondary clinical and economic outcomes were also evaluated. Independent predictors of receipt of antibiotic therapy were assessed via logistic regression. 141 EIA and 140 PCR patients were included. Significantly more patients were started or continued on anti-CDI antibiotic therapy after a known negative assay result in the EIA group (26 patients vs. 8 patients, P = 0.002). Duration of antibiotic therapy after a known negative result was significantly shorter in the PCR group (1 vs. 4 days, P = 0.029) and a 23% reduction in the number of tests obtained per patient was observed (1.41 ± 0.86 vs. 1.82 ± 1.35, P = 0.007). The over fourfold difference in per-test cost of the EIA assay ($8.33 vs. $42.86, P costs required for the increased treatment in the EIA group ($546.60 vs. $188.96, P = 0.191). Utilization of the EIA-based CDI assay was associated with increased odds of CDI treatment after a negative test (aOR 4.71, 95% CI 1.93-11.46, P = 0.001). The transition from an EIA to PCR-based assay for diagnosing CDI resulted in a significant decrease in the number of patients treated and the duration of treatment in response to a negative test result. This significant decrease in treatment resulted in decreased costs offsetting the utilization of a more expensive molecular test for patients with a negative CDI diagnostic result.

  2. Effect of Shift Work on Nocturia.

    Science.gov (United States)

    Kim, Jin Wook

    2016-01-01

    To identify the circadian sensitive component of nocturia by comparing nocturia in patients who voluntarily choose a disrupted circadian rhythm, that is, shift workers, with those who maintain normal day-night cycles. Between 2011 and 2013, a total of 1741 untreated patients, 1376 nonshift workers and 365 shift workers, were compared for nocturia indices based on frequency volume charts (FVCs). General linear model of 8-hour interval urine production and frequency were compared between FVCs of nonshift workers, FVCs of night-shift workers, and FVCs of day-shift workers. Nocturia frequency was increased in the night-shift workers (2.38 ± 1.44) compared with nonshift workers (2.18 ± 1.04) (P night-shift workers, 0.34 ± 0.13 for nonshift workers, P = .24), nocturnal bladder capacity index increased significantly (1.41 ± 1.06 for night-shift workers, 1.26 ± 0.92 for nonshift workers, P shift (P shift changes (P = .35). Patients in alternating work shifts showed increased nocturia, especially during their night shift. These changes tended to be more associated with decreased nocturnal bladder capacity than increased nocturnal polyuria. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Associations between number of consecutive night shifts and impairment of neurobehavioral performance during a subsequent simulated night shift.

    Science.gov (United States)

    Magee, Michelle; Sletten, Tracey L; Ferguson, Sally A; Grunstein, Ronald R; Anderson, Clare; Kennaway, David J; Lockley, Steven W; Rajaratnam, Shantha Mw

    2016-05-01

    This study aimed to investigate sleep and circadian phase in the relationships between neurobehavioral performance and the number of consecutive shifts worked. Thirty-four shift workers [20 men, mean age 31.8 (SD 10.9) years] worked 2-7 consecutive night shifts immediately prior to a laboratory-based, simulated night shift. For 7 days prior, participants worked their usual shift sequence, and sleep was assessed with logs and actigraphy. Participants completed a 10-minute auditory psychomotor vigilance task (PVT) at the start (~21:00 hours) and end (~07:00 hours) of the simulated night shift. Mean reaction times (RT), number of lapses and RT distribution was compared between those who worked 2-3 consecutive night shifts versus those who worked 4-7 shifts. Following 4-7 shifts, night shift workers had significantly longer mean RT at the start and end of shift, compared to those who worked 2-3 shifts. The slowest and fastest 10% RT were significantly slower at the start, but not end, of shift among participants who worked 4-7 nights. Those working 4-7 nights also demonstrated a broader RT distribution at the start and end of shift and had significantly slower RT based on cumulative distribution analysis (5 (th), 25 (th), 50 (th), 75 (th)percentiles at the start of shift; 75th percentile at the end of shift). No group differences in sleep parameters were found for 7 days and 24 hours prior to the simulated night shift. A greater number of consecutive night shifts has a negative impact on neurobehavioral performance, likely due to cognitive slowing.

  4. Change from an 8-hour shift to a 12-hour shift, attitudes, sleep, sleepiness and performance.

    Science.gov (United States)

    Lowden, A; Kecklund, G; Axelsson, J; Akerstedt, T

    1998-01-01

    The present study sought to evaluate the effect of a change from a rotating 3-shift (8-hour) to a 2-shift shift (12 hour) schedule on sleep, sleepiness, performance, perceived health, and well-being. Thirty-two shift workers at a chemical plant (control room operators) responded to a questionnaire a few months before a change was made in their shift schedule and 10 months after the change. Fourteen workers also filled out a diary, carried activity loggers, and carried out reaction-time tests (beginning and end of shift). Fourteen day workers served as a reference group for the questionnaires and 9 were intensively studied during a week with workdays and a free weekend. The questionnaire data showed that the shift change increased satisfaction with workhours, sleep, and time for social activities. Health, perceived accident risk, and reaction-time performance were not negatively affected. Alertness improved and subjective recovery time after night work decreased. The quick changes in the 8-hour schedule greatly increased sleep problems and fatigue. Sleepiness integrated across the entire shift cycle showed that the shift workers were less alert than the day workers, across workdays and days off (although alertness increased with the 12-hour shift). The change from 8-hour to 12-hour shifts was positive in most respects, possibly due to the shorter sequences of the workdays, the longer sequences of consecutive days off, the fewer types of shifts (easier planning), and the elimination of quick changes. The results may differ in groups with a higher work load.

  5. SHIFT: server for hidden stops analysis in frame-shifted translation.

    Science.gov (United States)

    Gupta, Arun; Singh, Tiratha Raj

    2013-02-23

    Frameshift is one of the three classes of recoding. Frame-shifts lead to waste of energy, resources and activity of the biosynthetic machinery. In addition, some peptides synthesized after frame-shifts are probably cytotoxic which serve as plausible cause for innumerable number of diseases and disorders such as muscular dystrophies, lysosomal storage disorders, and cancer. Hidden stop codons occur naturally in coding sequences among all organisms. These codons are associated with the early termination of translation for incorrect reading frame selection and help to reduce the metabolic cost related to the frameshift events. Researchers have identified several consequences of hidden stop codons and their association with myriad disorders. However the wealth of information available is speckled and not effortlessly acquiescent to data-mining. To reduce this gap, this work describes an algorithmic web based tool to study hidden stops in frameshifted translation for all the lineages through respective genetic code systems. This paper describes SHIFT, an algorithmic web application tool that provides a user-friendly interface for identifying and analyzing hidden stops in frameshifted translation of genomic sequences for all available genetic code systems. We have calculated the correlation between codon usage frequencies and the plausible contribution of codons towards hidden stops in an off-frame context. Markovian chains of various order have been used to model hidden stops in frameshifted peptides and their evolutionary association with naturally occurring hidden stops. In order to obtain reliable and persuasive estimates for the naturally occurring and predicted hidden stops statistical measures have been implemented. This paper presented SHIFT, an algorithmic tool that allows user-friendly exploration, analysis, and visualization of hidden stop codons in frameshifted translations. It is expected that this web based tool would serve as a useful complement for

  6. Shifted-modified Chebyshev filters

    OpenAIRE

    ŞENGÜL, Metin

    2013-01-01

    This paper introduces a new type of filter approximation method that utilizes shifted-modified Chebyshev filters. Construction of the new filters involves the use of shifted-modified Chebyshev polynomials that are formed using the roots of conventional Chebyshev polynomials. The study also includes 2 tables containing the shifted-modified Chebyshev polynomials and the normalized element values for the low-pass prototype filters up to degree 6. The transducer power gain, group dela...

  7. OpenShift cookbook

    CERN Document Server

    Gulati, Shekhar

    2014-01-01

    If you are a web application developer who wants to use the OpenShift platform to host your next big idea but are looking for guidance on how to achieve this, then this book is the first step you need to take. This is a very accessible cookbook where no previous knowledge of OpenShift is needed.

  8. Multi-platform metabolomics assays for human lung lavage fluids in an air pollution exposure study.

    Science.gov (United States)

    Surowiec, Izabella; Karimpour, Masoumeh; Gouveia-Figueira, Sandra; Wu, Junfang; Unosson, Jon; Bosson, Jenny A; Blomberg, Anders; Pourazar, Jamshid; Sandström, Thomas; Behndig, Annelie F; Trygg, Johan; Nording, Malin L

    2016-07-01

    Metabolomics protocols are used to comprehensively characterize the metabolite content of biological samples by exploiting cutting-edge analytical platforms, such as gas chromatography (GC) or liquid chromatography (LC) coupled to mass spectrometry (MS) assays, as well as nuclear magnetic resonance (NMR) assays. We have developed novel sample preparation procedures combined with GC-MS, LC-MS, and NMR metabolomics profiling for analyzing bronchial wash (BW) and bronchoalveolar lavage (BAL) fluid from 15 healthy volunteers following exposure to biodiesel exhaust and filtered air. Our aim was to investigate the responsiveness of metabolite profiles in the human lung to air pollution exposure derived from combustion of biofuels, such as rapeseed methyl ester biodiesel, which are increasingly being promoted as alternatives to conventional fossil fuels. Our multi-platform approach enabled us to detect the greatest number of unique metabolites yet reported in BW and BAL fluid (82 in total). All of the metabolomics assays indicated that the metabolite profiles of the BW and BAL fluids differed appreciably, with 46 metabolites showing significantly different levels in the corresponding lung compartments. Furthermore, the GC-MS assay revealed an effect of biodiesel exhaust exposure on the levels of 1-monostearylglycerol, sucrose, inosine, nonanoic acid, and ethanolamine (in BAL) and pentadecanoic acid (in BW), whereas the LC-MS assay indicated a shift in the levels of niacinamide (in BAL). The NMR assay only identified lactic acid (in BW) as being responsive to biodiesel exhaust exposure. Our findings demonstrate that the proposed multi-platform approach is useful for wide metabolomics screening of BW and BAL fluids and can facilitate elucidation of metabolites responsive to biodiesel exhaust exposure. Graphical Abstract Graphical abstract illustrating the study workflow. NMR Nuclear Magnetic Resonance, LC-TOFMS Liquid chromatography-Time Of Flight Mass Spectrometry, GC Gas

  9. Performance and sleepiness in nurses working 12-h day shifts or night shifts in a community hospital.

    Science.gov (United States)

    Wilson, Marian; Permito, Regan; English, Ashley; Albritton, Sandra; Coogle, Carlana; Van Dongen, Hans P A

    2017-10-05

    Hospitals are around-the-clock operations and nurses are required to care for patients night and day. The nursing shortage and desire for a more balanced work-to-home life has popularized 12-h shifts for nurses. The present study investigated sleep/wake cycles and fatigue levels in 22 nurses working 12-h shifts, comparing day versus night shifts. Nurses (11day shift and 11 night shift) were recruited from a suburban acute-care medical center. Participants wore a wrist activity monitor and kept a diary to track their sleep/wake cycles for 2 weeks. They also completed a fatigue test battery, which included the Psychomotor Vigilance Test (PVT) and the Karolinska Sleepiness Scale (KSS), at the beginning, middle and end of 4 duty shifts. Daily sleep duration was 7.1h on average. No overall difference in mean daily sleep duration was found between nurses working day shifts versus night shifts. Objective performance on the PVT remained relatively good and stable at the start, middle, and end of duty shifts in day shift workers, but gradually degraded across duty time in night shift workers. Compared to day shift workers, night shift workers also exhibited more performance variability among measurement days and between participants at each testing time point. The same pattern was observed for subjective sleepiness on the KSS. However, congruence between objective and subjective measures of fatigue was poor. Our findings suggest a need for organizations to evaluate practices and policies to mitigate the inevitable fatigue that occurs during long night shifts, in order to improve patient and healthcare worker safety. Examination of alternative shift lengths or sanctioned workplace napping may be strategies to consider. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Shift Verification and Validation

    Energy Technology Data Exchange (ETDEWEB)

    Pandya, Tara M. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Evans, Thomas M. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Davidson, Gregory G [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Johnson, Seth R. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Godfrey, Andrew T. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2016-09-07

    This documentation outlines the verification and validation of Shift for the Consortium for Advanced Simulation of Light Water Reactors (CASL). Five main types of problems were used for validation: small criticality benchmark problems; full-core reactor benchmarks for light water reactors; fixed-source coupled neutron-photon dosimetry benchmarks; depletion/burnup benchmarks; and full-core reactor performance benchmarks. We compared Shift results to measured data and other simulated Monte Carlo radiation transport code results, and found very good agreement in a variety of comparison measures. These include prediction of critical eigenvalue, radial and axial pin power distributions, rod worth, leakage spectra, and nuclide inventories over a burn cycle. Based on this validation of Shift, we are confident in Shift to provide reference results for CASL benchmarking.

  11. Choice Shifts in Groups

    OpenAIRE

    Kfir Eliaz; Debraj Ray

    2004-01-01

    The phenomenon of "choice shifts" in group decision-making is fairly ubiquitous in the social psychology literature. Faced with a choice between a ``safe" and ``risky" decision, group members appear to move to one extreme or the other, relative to the choices each member might have made on her own. Both risky and cautious shifts have been identified in different situations. This paper demonstrates that from an individual decision-making perspective, choice shifts may be viewed as a systematic...

  12. The Comet Assay: Tails of the (Unexpected. Use of the comet assay in pharmaceutical development.

    Directory of Open Access Journals (Sweden)

    Bas-jan Van Der Leede

    2015-08-01

    Full Text Available In genotoxicity testing of pharmaceuticals the rodent alkaline comet assay is being increasingly used as a second in vivo assay in addition to the in vivo micronucleus assay to mitigate in vitro positive results as recommended by regulatory guidance. In this presentation we want to give insight into the circumstances in vivo comet assay is deployed in a Genetic Toxicology Department of a pharmaceutical company. As the in vivo comet assay is a salvage assay, it means that some events have occurred in an in vitro assay and that the compound (or metabolite responsible for this signal is potentially deselected for further development. More than often the decision to perform an in vivo comet assay is at a very early stage in development and the first time that the compound will be tested in vivo at high/toxic dose levels. As almost no toxicokinetic data and tissue distribution data are available a careful design with maximizes the chances for successful mitigation is necessary. Decisions on acute or repeated dosing need to be made and arrangements for combining the in vivo comet assay with the in vivo micronucleus assay are to be considered. Often synthesis methods need to be scaled up fast to provide the required amount of compound and information on suitable formulations needs to be in place. As exposure data is crucial for interpretation of results, analytical methods need to be brought in place rapidly. An experienced multi skilled and communicative team needs to be available to deploy successfully this kind of assays at an early stage of development. We will present a few scenarios on study conduct and demonstrate how this assay can make a difference for the further development of a new drug.

  13. Night shift work exposure profile and obesity: Baseline results from a Chinese night shift worker cohort.

    Science.gov (United States)

    Sun, Miaomiao; Feng, Wenting; Wang, Feng; Zhang, Liuzhuo; Wu, Zijun; Li, Zhimin; Zhang, Bo; He, Yonghua; Xie, Shaohua; Li, Mengjie; Fok, Joan P C; Tse, Gary; Wong, Martin C S; Tang, Jin-Ling; Wong, Samuel Y S; Vlaanderen, Jelle; Evans, Greg; Vermeulen, Roel; Tse, Lap Ah

    2018-01-01

    This study aimed to evaluate the associations between types of night shift work and different indices of obesity using the baseline information from a prospective cohort study of night shift workers in China. A total of 3,871 workers from five companies were recruited from the baseline survey. A structured self-administered questionnaire was employed to collect the participants' demographic information, lifetime working history, and lifestyle habits. Participants were grouped into rotating, permanent and irregular night shift work groups. Anthropometric parameters were assessed by healthcare professionals. Multiple logistic regression models were used to evaluate the associations between night shift work and different indices of obesity. Night shift workers had increased risk of overweight and obesity, and odds ratios (ORs) were 1.17 (95% CI, 0.97-1.41) and 1.27 (95% CI, 0.74-2.18), respectively. Abdominal obesity had a significant but marginal association with night shift work (OR = 1.20, 95% CI, 1.01-1.43). A positive gradient between the number of years of night shift work and overweight or abdominal obesity was observed. Permanent night shift work showed the highest odds of being overweight (OR = 3.94, 95% CI, 1.40-11.03) and having increased abdominal obesity (OR = 3.34, 95% CI, 1.19-9.37). Irregular night shift work was also significantly associated with overweight (OR = 1.56, 95% CI, 1.13-2.14), but its association with abdominal obesity was borderline (OR = 1.26, 95% CI, 0.94-1.69). By contrast, the association between rotating night shift work and these parameters was not significant. Permanent and irregular night shift work were more likely to be associated with overweight or abdominal obesity than rotating night shift work. These associations need to be verified in prospective cohort studies.

  14. Night shift work exposure profile and obesity: Baseline results from a Chinese night shift worker cohort

    Science.gov (United States)

    Feng, Wenting; Wang, Feng; Zhang, Liuzhuo; Wu, Zijun; Li, Zhimin; Zhang, Bo; He, Yonghua; Xie, Shaohua; Li, Mengjie; Fok, Joan P. C.; Tse, Gary; Wong, Martin C. S.; Tang, Jin-ling; Wong, Samuel Y. S.; Vlaanderen, Jelle; Evans, Greg; Vermeulen, Roel; Tse, Lap Ah

    2018-01-01

    Aims This study aimed to evaluate the associations between types of night shift work and different indices of obesity using the baseline information from a prospective cohort study of night shift workers in China. Methods A total of 3,871 workers from five companies were recruited from the baseline survey. A structured self-administered questionnaire was employed to collect the participants’ demographic information, lifetime working history, and lifestyle habits. Participants were grouped into rotating, permanent and irregular night shift work groups. Anthropometric parameters were assessed by healthcare professionals. Multiple logistic regression models were used to evaluate the associations between night shift work and different indices of obesity. Results Night shift workers had increased risk of overweight and obesity, and odds ratios (ORs) were 1.17 (95% CI, 0.97–1.41) and 1.27 (95% CI, 0.74–2.18), respectively. Abdominal obesity had a significant but marginal association with night shift work (OR = 1.20, 95% CI, 1.01–1.43). A positive gradient between the number of years of night shift work and overweight or abdominal obesity was observed. Permanent night shift work showed the highest odds of being overweight (OR = 3.94, 95% CI, 1.40–11.03) and having increased abdominal obesity (OR = 3.34, 95% CI, 1.19–9.37). Irregular night shift work was also significantly associated with overweight (OR = 1.56, 95% CI, 1.13–2.14), but its association with abdominal obesity was borderline (OR = 1.26, 95% CI, 0.94–1.69). By contrast, the association between rotating night shift work and these parameters was not significant. Conclusion Permanent and irregular night shift work were more likely to be associated with overweight or abdominal obesity than rotating night shift work. These associations need to be verified in prospective cohort studies. PMID:29763461

  15. Shift schedule, work-family relationships, marital communication, job satisfaction and health among transport service shift workers.

    Science.gov (United States)

    Iskra-Golec, Irena; Smith, Lawrence; Wilczek-Rużyczka, Ewa; Siemiginowska, Patrycja; Wątroba, Joanna

    2017-02-21

    Existing research has documented that shiftwork consequences may depend on the shift system parameters. Fast rotating systems (1-3 shifts of the same kind in a row) and day work have been found to be less disruptive biologically and socially than slower rotating systems and afternoon and night work. The aim of this study was to compare day workers and shift workers of different systems in terms of rotation speed and shifts worked with regard to work-family and family-work positive and negative spillover, marital communication style, job satisfaction and health. Employees (N = 168) of the maintenance workshops of transportation service working different shift systems (day shift, weekly rotating 2 and 3‑shift system, and fast rotating 3-shift system) participated in the study. They completed the Work- Family Spillover Questionnaire, Marital Communication Questionnaire, Minnesota Job Satisfaction Questionnaire and the Physical Health Questionnaire (a part of the Standard Shiftwork Index). The workers of quicker rotating 3-shift systems reported significantly higher scores of family-to-work facilitation (F(3, 165) = 4.175, p = 0.007) and a higher level of constructive style of marital communication (Engagement F(3, 165) = 2.761, p = 0.044) than the workers of slower rotating 2-shift systems. There were no differences between the groups of workers with regard to health and job satisfaction. A higher level of work-family facilitation and a more constructive style of marital communication were found among the workers of faster rotating 3-shift system when compared to the workers of a slower rotating 2-shift system (afternoon, night). This may indicate that the fast rotating shift system in contrary to the slower rotating one is more friendly for the work and family domains and for the relationship between them. Int J Occup Med Environ Health 2017;30(1):121-131. This work is available in Open Access model and licensed under a CC BY-NC 3.0 PL license.

  16. Shift schedule, work–family relationships, marital communication, job satisfaction and health among transport service shift workers

    Directory of Open Access Journals (Sweden)

    Irena Iskra-Golec

    2017-02-01

    Full Text Available Objectives: Existing research has documented that shiftwork consequences may depend on the shift system parameters. Fast rotating systems (1–3 shifts of the same kind in a row and day work have been found to be less disruptive biologically and socially than slower rotating systems and afternoon and night work. The aim of this study was to compare day workers and shift workers of different systems in terms of rotation speed and shifts worked with regard to work–family and family–work positive and negative spillover, marital communication style, job satisfaction and health. Material and Methods: Employees (N = 168 of the maintenance workshops of transportation service working different shift systems (day shift, weekly rotating 2 and 3‑shift system, and fast rotating 3-shift system participated in the study. They completed the Work– Family Spillover Questionnaire, Marital Communication Questionnaire, Minnesota Job Satisfaction Questionnaire and the Physical Health Questionnaire (a part of the Standard Shiftwork Index. Results: The workers of quicker rotating 3-shift systems reported significantly higher scores of family-to-work facilitation (F(3, 165 = 4.175, p = 0.007 and a higher level of constructive style of marital communication (Engagement F(3, 165 = 2.761, p = 0.044 than the workers of slower rotating 2-shift systems. There were no differences between the groups of workers with regard to health and job satisfaction. Conclusions: A higher level of work–family facilitation and a more constructive style of marital communication were found among the workers of faster rotating 3-shift system when compared to the workers of a slower rotating 2-shift system (afternoon, night. This may indicate that the fast rotating shift system in contrary to the slower rotating one is more friendly for the work and family domains and for the relationship between them. Int J Occup Med Environ Health 2017;30(1:121–131

  17. Radioreceptor assays: plasma membrane receptors and assays for polypeptide and glycoprotein hormones

    International Nuclear Information System (INIS)

    Schulster, D.

    1977-01-01

    Receptors for peptide, protein and glycoprotein hormones, and the catecholamines are located on the plasma membranes of their target cells. Preparations of the receptors may be used as specific, high-affinity binding agents for these hormones in assay methodology akin to that for radioimmunoassay. A particular advantage of the radioreceptor assay is that it has a specificity directed towards the biologically active region of the hormone, rather than to some immunologically active region that may have little (or no) involvement in the expression of hormonal activity. Methods for hormone receptor preparation vary greatly, and range from the use of intact cells (as the source of hormone receptor) to the use of purified or solubilized membrane receptors. Receptors isolated from plasma membranes have proved to be of variable stability, and may be damaged during preparation and/or storage. Moreover, since they are present in relatively low concentration in the cell, their preparation in sufficient quantity for use in a radioreceptor assay may present technical problems. In general, there is good correlation between radioreceptor assays and in-vitro bioassays; differences between results from radioreceptor assays and radioimmunoassays are similar to those noted between in-vitro bioassays and radioimmunoassays. The sensitivity of the method is such that normal plasma concentrations of various hormones have been assayed by this technique. (author)

  18. Real life working shift assignment problem

    Science.gov (United States)

    Sze, San-Nah; Kwek, Yeek-Ling; Tiong, Wei-King; Chiew, Kang-Leng

    2017-07-01

    This study concerns about the working shift assignment in an outlet of Supermarket X in Eastern Mall, Kuching. The working shift assignment needs to be solved at least once in every month. Current approval process of working shifts is too troublesome and time-consuming. Furthermore, the management staff cannot have an overview of manpower and working shift schedule. Thus, the aim of this study is to develop working shift assignment simulation and propose a working shift assignment solution. The main objective for this study is to fulfill manpower demand at minimum operation cost. Besides, the day off and meal break policy should be fulfilled accordingly. Demand based heuristic is proposed to assign working shift and the quality of the solution is evaluated by using the real data.

  19. Dynamics and computation in functional shifts

    Science.gov (United States)

    Namikawa, Jun; Hashimoto, Takashi

    2004-07-01

    We introduce a new type of shift dynamics as an extended model of symbolic dynamics, and investigate the characteristics of shift spaces from the viewpoints of both dynamics and computation. This shift dynamics is called a functional shift, which is defined by a set of bi-infinite sequences of some functions on a set of symbols. To analyse the complexity of functional shifts, we measure them in terms of topological entropy, and locate their languages in the Chomsky hierarchy. Through this study, we argue that considering functional shifts from the viewpoints of both dynamics and computation gives us opposite results about the complexity of systems. We also describe a new class of shift spaces whose languages are not recursively enumerable.

  20. Relationship between the radioisotopic footpad assay and other immunological assays in tumor bearing rats

    International Nuclear Information System (INIS)

    Mizushima, Yutaka; Takeichi, Noritoshi; Minami, Akio; Kasai, Masaharu; Itaya, Toshiyuki

    1981-01-01

    KMT-17, a fibrosarcoma induced by 3-methylcholanthrene in a WKA rat, is a sensitive tumor to various kinds of immunological assays and is a suitable model tumor for the study of the immune status in tumor bearing hosts. The antitumor immune response of KMT-17 bearing rats was studied by a radioisotopic footpad assay (FPA) in comparison with other in vivo and in vitro assays. Delayed hypersensitivity to tumor antigens measured by the FPA was observed from the 8th day after transplantation of KMT-17 cells, reached a peak on the 12 - 15th day, and then declined in the late stage on the 17th day. The kinetics of the FPA correlated well with those of an in vivo Winn assay and of an in vitro lymphocyte cytotoxicity assay ( 51 Cr-release assay). The appearance of an antitumor antibody detected by a complement dependent cytotoxicity test also correlated well with the kinetics of the FPA. A growth inhibition assay (GIA) for non-specific cell-mediated immunity also showed similar kinetics to that of the FPA. The delayed hypersensitivity footpad reaction to tumor cell extracts measured by this FPA was tumor-specific. These results suggest that the FPA is a simple and reliable in vivo assay for evaluating antitumor immunity in tumor bearing hosts. (author)

  1. Performance of a Multiplex Serological Helicobacter pylori Assay on a Novel Microfluidic Assay Platform

    Directory of Open Access Journals (Sweden)

    Angela Filomena

    2017-10-01

    Full Text Available Infection with Helicobacter pylori (H. pylori occurs in 50% of the world population, and is associated with the development of ulcer and gastric cancer. Serological diagnostic tests indicate an H. pylori infection by detecting antibodies directed against H. pylori proteins. In addition to line blots, multiplex assay platforms provide smart solutions for the simultaneous analysis of antibody responses towards several H. pylori proteins. We used seven H. pylori proteins (FliD, gGT, GroEL, HpaA, CagA, VacA, and HP0231 and an H. pylori lysate for the development of a multiplex serological assay on a novel microfluidic platform. The reaction limited binding regime in the microfluidic channels allows for a short incubation time of 35 min. The developed assay showed very high sensitivity (99% and specificity (100%. Besides sensitivity and specificity, the technical validation (intra-assay CV = 3.7 ± 1.2% and inter-assay CV = 5.5 ± 1.2% demonstrates that our assay is also a robust tool for the analysis of the H. pylori-specific antibody response. The integration of the virulence factors CagA and VacA allow for the assessment of the risk for gastric cancer development. The short assay time and the performance of the platform shows the potential for implementation of such assays in a clinical setting.

  2. Liquor oligoclonal bands assay: interpretation, correlation with other laboratory assays and importance for diagnostics of neurological disorders

    OpenAIRE

    Bagdonas, Dovydas

    2017-01-01

    Aim: to analyse the possible relationship between liquor IgG oligoclonal bands assay and other laboratory assays in neurological patients. Objectives: to determine the frequency of oligoclonal bands in neurological patients; to compare the results between serum and liquor laboratory assays in dependence of oligoclonal bands assay results; to evaluate the relationships between oligoclonal bands assay and serological-immunological assays for infectious diseases, gender, age and neurological ...

  3. Associations of rotational shift work and night shift status with hypertension: a systematic review and meta-analysis.

    Science.gov (United States)

    Manohar, Sandhya; Thongprayoon, Charat; Cheungpasitporn, Wisit; Mao, Michael A; Herrmann, Sandra M

    2017-10-01

    The reported risks of hypertension (HTN) in rotating shift and night shift workers are controversial. The objective of this meta-analysis was to assess the association between shift work status and HTN. A literature search was performed using MEDLINE, EMBASE and Cochrane Database from inception through October 2016. Studies that reported odds ratios (OR) comparing the risk of HTN in shift workers were included. A prespecified subgroup analysis by rotating shift and night shift statuses were also performed. Pooled OR and 95% confidence interval (CI) were calculated using a random-effect, generic inverse variance method. The protocol for this study is registered with International Prospective Register of Systematic Reviews; no. CRD42016051843. Twenty-seven observational studies (nine cohort and 18 cross-sectional studies) with a total of 394 793 individuals were enrolled. The pooled ORs of HTN in shift workers in cohort and cross-sectional studies were 1.31 (95% CI, 1.07-1.60) and 1.10 (95% CI, 1.00-1.20), respectively. When meta-analysis was restricted only to cohort studies in rotating shift, the pooled OR of HTN in rotating shift workers was 1.34 (95% CI, 1.08-1.67). The data regarding night shift and HTN in cohort studies was limited. The pooled OR of HTN in night shift workers in cross-sectional studies was 1.07 (95% CI, 0.85-1.35). Based on the findings of our meta-analysis, shiftwork status may play an important role in HTN, as there is a significant association between rotating shift work and HTN. However, there is no significant association between night shift status and risk of HTN.

  4. Micropatch Antenna Phase Shifting

    National Research Council Canada - National Science Library

    Thursby, Michael

    2000-01-01

    .... We have been looking at the ability of embedded element to adjust the phase shift seen by the element with the goal of being able to remove the phase shifting devices from the antenna and replace...

  5. Micropatch Antenna Phase Shifting

    National Research Council Canada - National Science Library

    Thursby, Michael

    1999-01-01

    .... We have been looking at the ability of embedded element to adjust the phase shift seen by the element wit the goal of being able to remove the phase shifting devices from the antenna and replace...

  6. Endogenous Locus Reporter Assays.

    Science.gov (United States)

    Liu, Yaping; Hermes, Jeffrey; Li, Jing; Tudor, Matthew

    2018-01-01

    Reporter gene assays are widely used in high-throughput screening (HTS) to identify compounds that modulate gene expression. Traditionally a reporter gene assay is built by cloning an endogenous promoter sequence or synthetic response elements in the regulatory region of a reporter gene to monitor transcriptional activity of a specific biological process (exogenous reporter assay). In contrast, an endogenous locus reporter has a reporter gene inserted in the endogenous gene locus that allows the reporter gene to be expressed under the control of the same regulatory elements as the endogenous gene, thus more accurately reflecting the changes seen in the regulation of the actual gene. In this chapter, we introduce some of the considerations behind building a reporter gene assay for high-throughput compound screening and describe the methods we have utilized to establish 1536-well format endogenous locus reporter and exogenous reporter assays for the screening of compounds that modulate Myc pathway activity.

  7. Influences on Dietary Choices during Day versus Night Shift in Shift Workers: A Mixed Methods Study.

    Science.gov (United States)

    Bonnell, Emily K; Huggins, Catherine E; Huggins, Chris T; McCaffrey, Tracy A; Palermo, Claire; Bonham, Maxine P

    2017-02-26

    Shift work is associated with diet-related chronic conditions such as obesity and cardiovascular disease. This study aimed to explore factors influencing food choice and dietary intake in shift workers. A fixed mixed method study design was undertaken on a convenience sample of firefighters who continually work a rotating roster. Six focus groups ( n = 41) were conducted to establish factors affecting dietary intake whilst at work. Dietary intake was assessed using repeated 24 h dietary recalls ( n = 19). Interviews were audio recorded, transcribed verbatim, and interpreted using thematic analysis. Dietary data were entered into FoodWorks and analysed using Wilcoxon signed-rank test; p night shift. Energy intakes (kJ/day) did not differ between days that included a day or night shift but greater energy density (ED energy , kJ/g/day) of the diet was observed on night shift compared with day shift. This study has identified a number of dietary-specific shift-related factors that may contribute to an increase in unhealthy behaviours in a shift-working population. Given the increased risk of developing chronic diseases, organisational change to support workers in this environment is warranted.

  8. A compressed shift schedule: dealing with some of the problems of shift work

    Energy Technology Data Exchange (ETDEWEB)

    Cunningham, J B [Victoria University, Victoria, BC (Canada). School of Public Administration

    1989-07-01

    This study examines some of the psychological and behavioural effects of a 12-hour compressed shift schedule on coal miners in two organisations in Western Canada. It suggests that young, married compressed shift workers are more satisfied with their family relationship. They spend less of their leisure time with spouses when working shifts, and do not spend any more time with them on their days off. They have less time available for many leisure activities on their workdays. The extra time on days off is not reallocated to the leisure activities they were unable to do on their workdays. Some extra leisure time on days off may be spent on personal hobbies. There is no suggestion that the compressed shift schedule has any negative effect on the individual's health. 38 refs., 3 tabs.

  9. Shift work as an oxidative stressor

    OpenAIRE

    Pasalar Parvin; Farahani Saeed; Sharifian Akbar; Gharavi Marjan; Aminian Omid

    2005-01-01

    Abstract Background Some medical disorders have higher prevalence in shift workers than others. This study was designed to evaluate the effect of night-shift-working on total plasma antioxidant capacity, with respect to the causative role of oxidative stress in induction of some of these disorders. Methods Two blood samples were taken from 44 workers with a rotational shift schedule, one after their day shift and one after their night shift. The total plasma antioxidant capacity of each worke...

  10. Influences on Dietary Choices during Day versus Night Shift in Shift Workers: A Mixed Methods Study

    Science.gov (United States)

    Bonnell, Emily K.; Huggins, Catherine E.; Huggins, Chris T.; McCaffrey, Tracy A.; Palermo, Claire; Bonham, Maxine P.

    2017-01-01

    Shift work is associated with diet-related chronic conditions such as obesity and cardiovascular disease. This study aimed to explore factors influencing food choice and dietary intake in shift workers. A fixed mixed method study design was undertaken on a convenience sample of firefighters who continually work a rotating roster. Six focus groups (n = 41) were conducted to establish factors affecting dietary intake whilst at work. Dietary intake was assessed using repeated 24 h dietary recalls (n = 19). Interviews were audio recorded, transcribed verbatim, and interpreted using thematic analysis. Dietary data were entered into FoodWorks and analysed using Wilcoxon signed-rank test; p shift schedule; attitudes and decisions of co-workers; time and accessibility; and knowledge of the relationship between food and health. Participants reported consuming more discretionary foods and limited availability of healthy food choices on night shift. Energy intakes (kJ/day) did not differ between days that included a day or night shift but greater energy density (EDenergy, kJ/g/day) of the diet was observed on night shift compared with day shift. This study has identified a number of dietary-specific shift-related factors that may contribute to an increase in unhealthy behaviours in a shift-working population. Given the increased risk of developing chronic diseases, organisational change to support workers in this environment is warranted. PMID:28245625

  11. Faktor Dan Penjadualan Shift Kerja

    OpenAIRE

    Maurits, Lientje Setyawati; Widodo, Imam Djati

    2008-01-01

    Work shift has negative effect in physical and mental health, work performance and job accident. Disturbance of circadian rhythms is indicated as source of the problems. This article explores some researches related to the impacts of work shift and establishes basic principles of work shift scheduling that considers human need and limitation.

  12. Visual attention shifting in autism spectrum disorders.

    Science.gov (United States)

    Richard, Annette E; Lajiness-O'Neill, Renee

    2015-01-01

    Abnormal visual attention has been frequently observed in autism spectrum disorders (ASD). Abnormal shifting of visual attention is related to abnormal development of social cognition and has been identified as a key neuropsychological finding in ASD. Better characterizing attention shifting in ASD and its relationship with social functioning may help to identify new targets for intervention and improving social communication in these disorders. Thus, the current study investigated deficits in attention shifting in ASD as well as relationships between attention shifting and social communication in ASD and neurotypicals (NT). To investigate deficits in visual attention shifting in ASD, 20 ASD and 20 age- and gender-matched NT completed visual search (VS) and Navon tasks with attention-shifting demands as well as a set-shifting task. VS was a feature search task with targets defined in one of two dimensions; Navon required identification of a target letter presented at the global or local level. Psychomotor and processing speed were entered as covariates. Relationships between visual attention shifting, set shifting, and social functioning were also examined. ASD and NT showed comparable costs of shifting attention. However, psychomotor and processing speed were slower in ASD than in NT, and psychomotor and processing speed were positively correlated with attention-shifting costs on Navon and VS, respectively, for both groups. Attention shifting on VS and Navon were correlated among NT, while attention shifting on Navon was correlated with set shifting among ASD. Attention-shifting costs on Navon were positively correlated with restricted and repetitive behaviors among ASD. Relationships between attention shifting and psychomotor and processing speed, as well as relationships between measures of different aspects of visual attention shifting, suggest inefficient top-down influences over preattentive visual processing in ASD. Inefficient attention shifting may be

  13. Shift work as an oxidative stressor

    Directory of Open Access Journals (Sweden)

    Pasalar Parvin

    2005-12-01

    Full Text Available Abstract Background Some medical disorders have higher prevalence in shift workers than others. This study was designed to evaluate the effect of night-shift-working on total plasma antioxidant capacity, with respect to the causative role of oxidative stress in induction of some of these disorders. Methods Two blood samples were taken from 44 workers with a rotational shift schedule, one after their day shift and one after their night shift. The total plasma antioxidant capacity of each worker was measured through the FRAP method. The impacts of age and weight were also assessed. Results The total plasma antioxidant capacity was measured in 44 shift-workers with a mean age of 36.57 years (SD: 10.18 and mean BMI of 26.06 (SD: 4.37 after their day and night shifts. The mean reduction of total plasma antioxidant capacity after the night shift was 105.8 μmol/L (SD: 146.39. Also, a significant correlation was shown between age and weight and total plasma antioxidant capacity. Age and weight were found to be inversely related to total plasma antioxidant capacity; as age and weight increased, the total plasma antioxidant capacity decreased. Conclusion Shift work can act as an oxidative stressor and may induce many medical disorders. Aging and obesity in shift workers makes them more sensitive to this hazardous effect.

  14. Shift work-related health problems in

    Directory of Open Access Journals (Sweden)

    S. Khavaji

    2010-04-01

    Full Text Available Background and aimsShift work is a major feature of working life that affects diverse aspects of human life. The main purposes of this study were to investigate shift work-related health problems and their risk factors among workers of "12-hour shift" schedule.MethodsThis cross-sectional study was carried out at 8 petrochemical industries in Asalooyeh area. Study population consisted of 1203 workers including 549 shift worker (46% and 654 day worker (54%. Data on personal details, shift schedule and adverse effects of shift work werecollected by anonymous questionnaire. Statistical analyses were performed using SPSS, version 11.5. The level of significance was set at 5%.ResultsAlthough, the results showed that health problems among shift workers was more prevalent than day workers, but the differences were just significant in gastrointestinal and musculoskeletal disorders (p<0.05. Multiple linear regressions indicated that in addition to shift working, other variants such as long work hours, type of employment, second job, number of children and job title were associated with health problems.ConclusionPrevalence rates of gastrointestinal and musculoskeletal problems among shift workers were significantly higher than that of day workers. Although, working in shift system was the main significant factor associated with the reported problems, but other demographic andwork variables were also found to have association.

  15. Dual Regulation of Bacillus subtilis kinB Gene Encoding a Sporulation Trigger by SinR through Transcription Repression and Positive Stringent Transcription Control.

    Science.gov (United States)

    Fujita, Yasutaro; Ogura, Mitsuo; Nii, Satomi; Hirooka, Kazutake

    2017-01-01

    It is known that transcription of kinB encoding a trigger for Bacillus subtilis sporulation is under repression by SinR, a master repressor of biofilm formation, and under positive stringent transcription control depending on the adenine species at the transcription initiation nucleotide (nt). Deletion and base substitution analyses of the kinB promoter (P kinB ) region using lacZ fusions indicated that either a 5-nt deletion (Δ5, nt -61/-57, +1 is the transcription initiation nt) or the substitution of G at nt -45 with A (G-45A) relieved kinB repression. Thus, we found a pair of SinR-binding consensus sequences (GTTCTYT; Y is T or C) in an inverted orientation (SinR-1) between nt -57/-42, which is most likely a SinR-binding site for kinB repression. This relief from SinR repression likely requires SinI, an antagonist of SinR. Surprisingly, we found that SinR is essential for positive stringent transcription control of P kinB . Electrophoretic mobility shift assay (EMSA) analysis indicated that SinR bound not only to SinR-1 but also to SinR-2 (nt -29/-8) consisting of another pair of SinR consensus sequences in a tandem repeat arrangement; the two sequences partially overlap the '-35' and '-10' regions of P kinB . Introduction of base substitutions (T-27C C-26T) in the upstream consensus sequence of SinR-2 affected positive stringent transcription control of P kinB , suggesting that SinR binding to SinR-2 likely causes this positive control. EMSA also implied that RNA polymerase and SinR are possibly bound together to SinR-2 to form a transcription initiation complex for kinB transcription. Thus, it was suggested in this work that derepression of kinB from SinR repression by SinI induced by Spo0A∼P and occurrence of SinR-dependent positive stringent transcription control of kinB might induce effective sporulation cooperatively, implying an intimate interplay by stringent response, sporulation, and biofilm formation.

  16. Comparison of Mental Health and Quality of Life between Shift and Non-shift Employees of Service Industries

    Directory of Open Access Journals (Sweden)

    Nahal Salimi

    2016-12-01

    Full Text Available This study examined the relationship between the employment practices and employees' mental health and quality of life in Iran. In particular, the study compared the mental health and quality of life of shift and non-shift workers in sensitive employment settings. Using a cross-sectional survey design, 120 individuals employed in two airline companies as either shift or non-shift employees completed the survey for the study. Data was collected using General Health Question (GHQ28 for mental health, the Short Form (36 Health Survey (SF-36 for Quality of Life and a demographic questionnaire. Multivariate analysis of variance (MANOVA was used to analyze the collected data. The results showed that (1 type of work (shift or non-shift has an effect on mental health and quality of life; and (2 there are significant differences in dimensions of quality of life and mental health between shift and non-shift staff.

  17. SimShiftDB; local conformational restraints derived from chemical shift similarity searches on a large synthetic database

    Energy Technology Data Exchange (ETDEWEB)

    Ginzinger, Simon W. [Center of Applied Molecular Engineering, University of Salzburg, Department of Molecular Biology, Division of Bioinformatics (Austria)], E-mail: simon@came.sbg.ac.at; Coles, Murray [Max-Planck-Institute for Developmental Biology, Department of Protein Evolution (Germany)], E-mail: Murray.Coles@tuebingen.mpg.de

    2009-03-15

    We present SimShiftDB, a new program to extract conformational data from protein chemical shifts using structural alignments. The alignments are obtained in searches of a large database containing 13,000 structures and corresponding back-calculated chemical shifts. SimShiftDB makes use of chemical shift data to provide accurate results even in the case of low sequence similarity, and with even coverage of the conformational search space. We compare SimShiftDB to HHSearch, a state-of-the-art sequence-based search tool, and to TALOS, the current standard tool for the task. We show that for a significant fraction of the predicted similarities, SimShiftDB outperforms the other two methods. Particularly, the high coverage afforded by the larger database often allows predictions to be made for residues not involved in canonical secondary structure, where TALOS predictions are both less frequent and more error prone. Thus SimShiftDB can be seen as a complement to currently available methods.

  18. SimShiftDB; local conformational restraints derived from chemical shift similarity searches on a large synthetic database

    International Nuclear Information System (INIS)

    Ginzinger, Simon W.; Coles, Murray

    2009-01-01

    We present SimShiftDB, a new program to extract conformational data from protein chemical shifts using structural alignments. The alignments are obtained in searches of a large database containing 13,000 structures and corresponding back-calculated chemical shifts. SimShiftDB makes use of chemical shift data to provide accurate results even in the case of low sequence similarity, and with even coverage of the conformational search space. We compare SimShiftDB to HHSearch, a state-of-the-art sequence-based search tool, and to TALOS, the current standard tool for the task. We show that for a significant fraction of the predicted similarities, SimShiftDB outperforms the other two methods. Particularly, the high coverage afforded by the larger database often allows predictions to be made for residues not involved in canonical secondary structure, where TALOS predictions are both less frequent and more error prone. Thus SimShiftDB can be seen as a complement to currently available methods

  19. Fuzzy Determination of Target Shifting Time and Torque Control of Shifting Phase for Dry Dual Clutch Transmission

    Directory of Open Access Journals (Sweden)

    Zhiguo Zhao

    2014-01-01

    Full Text Available Based on the independently developed five-speed dry dual clutch transmission (DDCT, the paper proposes the torque coordinating control strategy between engine and two clutches, which obtains engine speed and clutch transferred torque in the shifting process, adequately reflecting the driver intention and improving the shifting quality. Five-degree-of-freedom (DOF shifting dynamics model of DDCT with single intermediate shaft is firstly established according to its physical characteristics. Then the quantitative control objectives of the shifting process are presented. The fuzzy decision of shifting time and the model-based torque coordinating control strategy are proposed and also verified by simulating under different driving intentions in up-/downshifting processes with the DCT model established on the MATLAB/Simulink. Simulation results validate that the shifting control algorithm proposed in this paper can not only meet the shifting quality requirements, but also adapt to the various shifting intentions, having a strong robustness.

  20. Transcriptional Regulation of Frizzled-1 in Human Osteoblasts by Sp1.

    Directory of Open Access Journals (Sweden)

    Shibing Yu

    Full Text Available The wingless pathway has a powerful influence on bone metabolism and is a therapeutic target in skeletal disorders. Wingless signaling is mediated in part through the Frizzled (FZD receptor family. FZD transcriptional regulation is poorly understood. Herein we tested the hypothesis that Sp1 plays an important role in the transcriptional regulation of FZD1 expression in osteoblasts and osteoblast mineralization. To test this hypothesis, we conducted FZD1 promoter assays in Saos2 cells with and without Sp1 overexpression. We found that Sp1 significantly up-regulates FZD1 promoter activity in Saos2 cells. Chromatin immunoprecipitation (ChIP and electrophoretic mobility shift (EMSA assays identified a novel and functional Sp1 binding site at -44 to -40 from the translation start site in the FZD1 promoter. The Sp1-dependent activation of the FZD1 promoter was abolished by mithramycin A (MMA, an antibiotic affecting both Sp1 binding and Sp1 protein levels in Saos2 cells. Similarly, down-regulation of Sp1 in hFOB cells resulted in less FZD1 expression and lower alkaline phosphatase activity. Moreover, over-expression of Sp1 increased FZD1 expression and Saos2 cell mineralization while MMA decreased Sp1 and FZD1 expression and Saos2 cell mineralization. Knockdown of FZD1 prior to Sp1 overexpression partially abolished Sp1 stimulation of osteoblast differentiation markers. Taken together, our results suggest that Sp1 plays a role in human osteoblast differentiation and mineralization, which is at least partially mediated by Sp1-dependent transactivation of FZD1.

  1. Relevance of the palatal protein kinase A pathway to the pathogenesis of cleft palate by secalonic acid D in mice

    International Nuclear Information System (INIS)

    Dhulipala, Vamsidhara C.; Hanumegowda, Umesh M.; Balasubramanian, Ganesh; Reddy, Chada S.

    2004-01-01

    Secalonic acid-D (SAD) is a teratogenic mycotoxin inducing cleft palate (CP) in the offspring of the exposed mice by reducing palatal shelf size secondary to reduced proliferation of the palatal mesenchymal (PM) cells. Co-administration of dimethylsulfoxide (DMSO) reversed the CP-inducing effect of SAD. Although SAD has been shown to affect both protein kinases A (PKA) and C (PKC) pathways, the relevance of each of these pathways to its CP induction is unknown. The present studies were designed to test the hypothesis that the protective effect of DMSO is mediated by its specific reversal of the effect(s) of SAD on one of these two pathways using ELISA-based activity assays, Western blot analysis, electrophoretic mobility shift assays (EMSA), and murine embryonic PM (MEPM) cell growth in culture. Within the PKA pathway, SAD inhibited the activity of the catalytic subunit of PKA and its migration into the nucleus, elevated phosphorylated cyclic AMP (cAMP) response element (CRE)-binding protein (pCREB) level, and reduced the binding of CREB to CRE. In the PKC pathway, SAD reduced the activity of PKC and the binding of transcription factors (TF) to 12-O-tetradecanoate-13 phorbol acetate-response element (TRE). SAD also inhibited MEPM cell growth and the expression of the CRE- and TRE-containing gene, proliferating cell nuclear antigen (PCNA). Reversal, by DMSO, of the effects of SAD on MEPM cell growth, on PCNA expression and on all components of the PKA, but not of PKC, pathway suggests that the perturbation of the PKA pathway by SAD is relevant to its induction of CP in mice

  2. Resveratrol-induced transcriptional up-regulation of ASMase (SMPD1) of human leukemia and cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Mizutani, Naoki [Department of Pathophysiological Laboratory Science, Nagoya University Graduate School of Medicine, Nagoya (Japan); College of Life and Health Sciences, Chubu University, Kasugai (Japan); Omori, Yukari [Department of Pathophysiological Laboratory Science, Nagoya University Graduate School of Medicine, Nagoya (Japan); Kawamoto, Yoshiyuki; Sobue, Sayaka; Ichihara, Masatoshi [College of Life and Health Sciences, Chubu University, Kasugai (Japan); Suzuki, Motoshi [Division of Molecular Carcinogenesis, Nagoya University Graduate School of Medicine, Nagoya (Japan); Kyogashima, Mamoru [Department of Microbiology and Molecular Biology, Nihon Pharmaceutical University, Saitama (Japan); Nakamura, Mitsuhiro [Department of Drug Information, Gifu Pharmaceutical University, Gifu (Japan); Tamiya-Koizumi, Keiko [College of Life and Health Sciences, Chubu University, Kasugai (Japan); Nozawa, Yoshinori [Tokai Gakuin University, Kakamigahara (Japan); Murate, Takashi, E-mail: murate@isc.chubu.ac.jp [College of Life and Health Sciences, Chubu University, Kasugai (Japan)

    2016-02-19

    Resveratrol (RSV) is a plant-derived phytoalexin present in plants, whose pleiotropic effects for health benefits have been previously reported. Its anti-cancer activity is among the current topics for novel cancer treatment. Here, effects of RSV on cell proliferation and the sphingolipid metabolism of K562, a human leukemia cell line, were analyzed. Some experiments were also performed in HCT116, a human colon cancer cell line. RSV inhibited cell proliferation of both cell lines. Increased cellular ceramide and decreased sphingomyelin and S1P by RSV were observed in RSV-treated K562 cells. Further analysis revealed that acid sphingomyelinase mRNA and enzyme activity levels were increased by RSV. Desipramine, a functional ASMase inhibitor, prevented RSV-induced ceramide increase. RSV increased ATF3, EGR1, EGR3 proteins and phosphorylated c-Jun and FOXO3. However, co-transfection using these transcription factor expression vectors and ASMase promoter reporter vector revealed positive effects of EGR1 and EGR3 but not others. Electrophoresis mobility shift assay (EMSA) and Chromatin immunoprecipitation (ChIP) assay demonstrated the direct binding of EGR1/3 transcription factors with ASMase 5′-promoter. These results indicate that increased EGR1/3 and ASMase expression play an important role in cellular ceramide increase by RSV treatment. - Highlights: • Resveratrol inhibited cell proliferation of K562 and HCT116 cells. • Resveratrol increased cellular ceramide and decreased sphingomyelin and S1P. • ASMase mRNA and activity were increased with resveratrol. • ASMase inhibition suppressed RSV-induced ceramide accumulation. • Increased ASMase transcription was at least partially due to EGR family proteins.

  3. Resveratrol-induced transcriptional up-regulation of ASMase (SMPD1) of human leukemia and cancer cells

    International Nuclear Information System (INIS)

    Mizutani, Naoki; Omori, Yukari; Kawamoto, Yoshiyuki; Sobue, Sayaka; Ichihara, Masatoshi; Suzuki, Motoshi; Kyogashima, Mamoru; Nakamura, Mitsuhiro; Tamiya-Koizumi, Keiko; Nozawa, Yoshinori; Murate, Takashi

    2016-01-01

    Resveratrol (RSV) is a plant-derived phytoalexin present in plants, whose pleiotropic effects for health benefits have been previously reported. Its anti-cancer activity is among the current topics for novel cancer treatment. Here, effects of RSV on cell proliferation and the sphingolipid metabolism of K562, a human leukemia cell line, were analyzed. Some experiments were also performed in HCT116, a human colon cancer cell line. RSV inhibited cell proliferation of both cell lines. Increased cellular ceramide and decreased sphingomyelin and S1P by RSV were observed in RSV-treated K562 cells. Further analysis revealed that acid sphingomyelinase mRNA and enzyme activity levels were increased by RSV. Desipramine, a functional ASMase inhibitor, prevented RSV-induced ceramide increase. RSV increased ATF3, EGR1, EGR3 proteins and phosphorylated c-Jun and FOXO3. However, co-transfection using these transcription factor expression vectors and ASMase promoter reporter vector revealed positive effects of EGR1 and EGR3 but not others. Electrophoresis mobility shift assay (EMSA) and Chromatin immunoprecipitation (ChIP) assay demonstrated the direct binding of EGR1/3 transcription factors with ASMase 5′-promoter. These results indicate that increased EGR1/3 and ASMase expression play an important role in cellular ceramide increase by RSV treatment. - Highlights: • Resveratrol inhibited cell proliferation of K562 and HCT116 cells. • Resveratrol increased cellular ceramide and decreased sphingomyelin and S1P. • ASMase mRNA and activity were increased with resveratrol. • ASMase inhibition suppressed RSV-induced ceramide accumulation. • Increased ASMase transcription was at least partially due to EGR family proteins.

  4. OxyR-regulated catalase CatB promotes the virulence in rice via detoxifying hydrogen peroxide in Xanthomonas oryzae pv. oryzae.

    Science.gov (United States)

    Yu, Chao; Wang, Nu; Wu, Maosen; Tian, Fang; Chen, Huamin; Yang, Fenghuan; Yuan, Xiaochen; Yang, Ching-Hong; He, Chenyang

    2016-11-08

    To facilitate infection, Xanthomonas oryzae pv. oryzae (Xoo), the bacterial blight pathogen of rice, needs to degrade hydrogen peroxide (H 2 O 2 ) generated by the host defense response via a mechanism that is mediated by the transcriptional regulator OxyR. The catalase (CAT) gene catB has previously been shown to belong to the OxyR regulon in Xoo. However, its expression patterns and function in H 2 O 2 detoxification and bacterial pathogenicity on rice remain to be elucidated. The catB gene encodes a putative catalase and is highly conserved in the sequenced strains of Xanthomonas spp. β-galactosidase analysis and electrophoretic mobility shift assays (EMSA) showed that OxyR positively regulated the transcription of catB by directly binding to its promoter region. The quantitative real-time PCR (qRT-PCR) assays revealed that the expression levels of catB and oxyR were significantly induced by H 2 O 2 . Deletion of catB or oxyR drastically impaired bacterial viability in the presence of extracellular H 2 O 2 and reduced CAT activity, demonstrating that CatB and OxyR contribute to H 2 O 2 detoxification in Xoo. In addition, ΔcatB and ΔoxyR displayed shorter bacterial blight lesions and reduced bacterial growth in rice compared to the wild-type stain, indicating that CatB and OxyR play essential roles in the virulence of Xoo. Transcription of catB is enhanced by OxyR in response to exogenous H 2 O 2 . CatB functions as an active catalase that is required for the full virulence of Xoo in rice.

  5. Mechanism of enhanced responses after combination photodynamic therapy (cPDT) in carcinoma cells involves C/EBP-mediated transcriptional upregulation of the coproporphyrinogen oxidase (CPO) gene

    Science.gov (United States)

    Anand, Sanjay; Hasan, Tayyaba; Maytin, Edward V.

    2013-03-01

    Photodynamic therapy (PDT) with aminolevulinate (ALA) is widely accepted as an effective treatment for superficial carcinomas and pre-cancers. However, PDT is still suboptimal for deeper tumors, mainly due to inadequate ALA penetration and subsequent conversion to PpIX. We are interested in improving the effectiveness of photodynamic therapy (PDT) for deep tumors, using a combination approach (cPDT) in which target protoporphyrin (PpIX) levels are significantly enhanced by differentiation caused by giving Vitamin D or methotrexate (MTX) for 3 days prior to ALAPDT. In LNCaP and MEL cells, a strong correlation between inducible differentiation and expression of C/EBP transcription factors, as well as between differentiation and mRNA levels of CPO (a key heme-synthetic enzyme), indicates the possibility of CPO transcriptional regulation by the C/EBPs. Sequence analysis of the first 1300 base pairs of the murine CPO upstream region revealed 15 consensus C/EBP binding sites. Electrophoretic Mobility Shift Assays (EMSA) proved that these sites form specific complexes that have strong, moderate or weak affinities for C/EBPs. However, in the context of the full-length CPO promoter, inactivation of any type of site (strong or weak) reduced CPO promoter activity (luciferase assay) to nearly the same extent, suggesting cooperative interactions. A comparative analysis of murine and human CPO promoters revealed possible protein-protein interactions between C/EBPs and several neighboring transcription factors such as NFkB, Sp1, AP-1, CBP/p300 and CREB (an enhanceosome complex). Overall, these results confirm that C/EBP's are important for CPO expression via complex mechanisms which upregulate PpIX and enhance the outcome of cPDT.

  6. Transcriptional regulation of Hb-α and Hb-β through nuclear factor E2-related factor-2 (Nrf2) activation in human vaginal cells: A novel mechanism of cellular adaptability to oxidative stress.

    Science.gov (United States)

    Saha, Debarchana; Koli, Swanand; Reddy, Kudumula Venkata Rami

    2017-06-01

    Hemoglobin (Hb), a major protein involved in transport of oxygen (O 2 ), is expressed by erythroid lineages. Until recently, it was not known whether non-erythroid cells express Hb. The objective was to evaluate the expression and functional significance of Hb-α and Hb-β in human primary vaginal epithelial cells (hPVECs) and decipher downstream signaling. RT-PCR, qRT-PCR, flow cytometry, Western blot, immunofluorescence were used to evaluate the expression of Hb-α, Hb-β, and nuclear factor E2-related factor-2(Nrf2) after hydrogen peroxide (H 2 O 2 ) induction. Electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) assay were used to determine the binding efficiency of Nrf2 on the Hb-α promoter. Stimulation of hPVECs and human vaginal epithelial cell line, VK2/E6E7 with H 2 O 2 augmented the expression of Hb-α, Hb-β, Nrf2, heme oxygenase-1 (HO-1), and reactive oxygen species (ROS). Treatment of these cells with Nrf2 inhibitor, trigonelline (Trig) inhibited Hb-α and Hb-β expressions. Hb-α and Hb-β overexpression downregulated H 2 O 2 -induced ROS. The presence of Nrf2 binding domain was demonstrated within Hb-α promoter. The results revealed for the first time that Hb-α and Hb-β were induced by oxidative stress through the activation of Nrf2. Overexpression of Hb-α and Hb-β ameliorated H 2 O 2 -induced oxidative stress, indicating one of the possible mechanism(s) to protect hPVECS from oxidative stress. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. Capturing the target genes of BldD in Saccharopolyspora erythraea using improved genomic SELEX method.

    Science.gov (United States)

    Wu, Hang; Mao, Yongrong; Chen, Meng; Pan, Hui; Huang, Xunduan; Ren, Min; Wu, Hao; Li, Jiali; Xu, Zhongdong; Yuan, Hualing; Geng, Ming; Weaver, David T; Zhang, Lixin; Zhang, Buchang

    2015-03-01

    BldD (SACE_2077), a key developmental regulator in actinomycetes, is the first identified transcriptional factor in Saccharopolyspora erythraea positively regulating erythromycin production and morphological differentiation. Although the BldD of S. erythraea binds to the promoters of erythromycin biosynthetic genes, the interaction affinities are relatively low, implying the existence of its other target genes in S. erythraea. Through the genomic systematic evolution of ligands by exponential enrichment (SELEX) method that we herein improved, four DNA sequences of S. erythraea A226, corresponding to the promoter regions of SACE_0306 (beta-galactosidase), SACE_0811 (50S ribosomal protein L25), SACE_3410 (fumarylacetoacetate hydrolase), and SACE_6014 (aldehyde dehydrogenase), were captured with all three BldD concentrations of 0.5, 1, and 2 μM, while the previously identified intergenic regions of eryBIV-eryAI and ermE-eryCI plus the promoter region of SACE_7115, the amfC homolog for aerial mycelium formation, could be captured only when the BldD's concentration reached 2 μM. Electrophoretic mobility shift assay (EMSA) analysis indicated that BldD specifically bound to above seven DNA sequences, and quantitative real-time PCR (qRT-PCR) assay showed that the transcriptional levels of the abovementioned target genes decreased when bldD was disrupted in A226. Furthermore, SACE_7115 and SACE_0306 in A226 were individually inactivated, showing that SACE_7115 was predominantly involved in aerial mycelium formation, while SACE_0306 mainly controlled erythromycin production. This study provides valuable information for better understanding of the pleiotropic regulator BldD in S. erythraea, and the improved method may be useful for uncovering regulatory networks of other transcriptional factors.

  8. Estimating the Dieaway Time and its Precision from Shift Register Data

    Energy Technology Data Exchange (ETDEWEB)

    Croft, S.; Evans, L. G.; Henzlova, D.; Miller, K. A. [Los Alamos National Laboratory, Nuclear Nonproliferation Division, Safeguards Science and Technology Group, Los Alamos (United States)

    2012-06-15

    Neutron coincidence counting is widely used throughout the nuclear fuel cycle to quantify special nuclear materials that fission, for example Pu. Before calibration and setting to work, instruments undergo a range of performance and characterization tests that typically include measurement of the neutron dieaway characteristic. The neutron dieaway characteristic is a general measure of the likelihood that a neutron will be detected following another neutron, and describes time behavior of detected neutrons in the assay system. This paper shows how the effective 1/ecapture dieaway time of the observable coincidence (doubles) rate may be extracted simply and quickly from two coincidence counting rates recorded with different shift register time gate settings. In particular we address how to assign the precision to such estimates including when the rates are correlated.

  9. Plasticity of regulation of mannitol phosphotransferase system operon by CRP-cAMP complex in Vibrio cholerae.

    Science.gov (United States)

    Zhou, Yan Yan; Zhang, Hong Zhi; Liang, Wei Li; Zhang, Li Juan; Zhu, Jun; Kan, Biao

    2013-10-01

    The complex of the cyclic AMP receptor protein (CRP) and cAMP is an important transcriptional regulator of numerous genes in prokaryotes. The transport of mannitol through the phosphotransferase systems (PTS) is regulated by the CRP-cAMP complex. The aim of the study is to investigate how the CRP-cAMP complex acting on the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype. The crp mutant strain was generated by homologous recombination to assess the need of CRP to activate the mannitol PTS operon of V. cholerae El Tor. Electrophoretic mobility shift assays (EMSA) and the reporter plasmid pBBRlux were used to confirm the role that the CRP-cAMP complex playing on the mannitol PTS operon mtl. In this study, we confirmed that CRP is strictly needed for the activation of the mtl operon. We further experimentally identified five CRP binding sites within the promoter region upstream of the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype and found that these sites display different affinities for CRP and provide different contributions to the activation of the operon. The five binding sites collectively confer the strong activation of mannitol transfer by CRP in V. cholerae, indicating an elaborate and subtle CRP activation mechanism. Copyright © 2013 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  10. Combination of Medicinal Herbs KIOM-79 Reduces Advanced Glycation End Product Accumulation and the Expression of Inflammatory Factors in the Aorta of Zucker Diabetic Fatty Rats

    Directory of Open Access Journals (Sweden)

    Eunjin Sohn

    2011-01-01

    Full Text Available Previous studies have reported that KIOM-79 shows a strong inhibitory effect on AGE formation and inhibited a proinflammatory state in a murine macrophage cell line. In the present study, we investigated the effect of KIOM-79 on AGE accumulation and vascular inflammation in the aorta of Zucker diabetic fatty (ZDF rats, a commonly used model of type 2 diabetes. Seven-week-old male ZDF rats were treated with KIOM-79 (50 mg/kg once a day orally for 13 weeks. We examined the dissected aortas for AGE accumulation, expression of the receptor for AGEs (RAGE, and the expression of proinflammatory factors, including monocyte chemoattractant protein-1 (MCP-1, vascular endothelial growth factor (VEGF, and vascular adhesion molecule-1 (VCAM-1. Nuclear factor-kappaB (NF-κB and inducible nitric oxide synthase (iNOS were also measured by Southwestern histochemistry, electrophoretic mobility shift assay (EMSA, and immunohistochemistry, respectively. KIOM-79 markedly reduced the accumulation of AGEs and the expression of RAGE in the aorta. We also found that KIOM-79 attenuated the expression of inflammatory factors including NF-κB, MCP-1, VEGF, VCAM-1, and iNOS in the aortas of ZDF rats. These data suggest that KIOM-79 may prevent or retard the development of inflammation in diabetic vascular disease.

  11. Transcription factor organic cation transporter 1 (OCT-1 affects the expression of porcine Klotho (KL gene

    Directory of Open Access Journals (Sweden)

    Yan Li

    2016-07-01

    Full Text Available Klotho (KL, originally discovered as an aging suppressor, is a membrane protein that shares sequence similarity with the β-glucosidase enzymes. Recent reports showed Klotho might play a role in adipocyte maturation and systemic glucose metabolism. However, little is known about the transcription factors involved in regulating the expression of porcine KL gene. Deletion fragment analysis identified KL-D2 (−418 bp to −3 bp as the porcine KL core promoter. MARC0022311SNP (A or G in KL intron 1 was detected in Landrace × DIV pigs using the Porcine SNP60 BeadChip. The pGL-D2-A and pGL-D2-G were constructed with KL-D2 and the intron fragment of different alleles and relative luciferase activity of pGL3-D2-G was significantly higher than that of pGL3-D2-A in the PK cells and ST cells. This was possibly the result of a change in KL binding ability with transcription factor organic cation transporter 1 (OCT-1, which was confirmed using electrophoretic mobility shift assays (EMSA and chromatin immune-precipitation (ChIP. Moreover, OCT-1 regulated endogenous KL expression by RNA interference experiments. Our study indicates SNP MARC0022311 affects porcine KL expression by regulating its promoter activity via OCT-1.

  12. Direct 125I-radioligand assays for serum progesterone compared with assays involving extraction of serum

    International Nuclear Information System (INIS)

    Ratcliffe, W.A.; Corrie, J.E.T.; Dalziel, A.H.; Macpherson, J.S.

    1982-01-01

    Two direct radioimmunoassays for progesterone in 50 μL of unextracted serum or plasma with assays involving extraction of serum were compared. The direct assays include the use of either danazol at pH 7.4 or 8-anilino-1-naphthalenesulfonic acid at pH 4.0 to displace progesterone from serum binding-proteins. Progesterone is then assayed by using an antiserum to a progesterone 11α-hemisuccinyl conjugate and the radioligand 125 I-labeled progesterone 11α-glucuronyl tyramine, with separation by double-antibody techniques. Direct assays with either displacing agent gave good analytical recovery of progesterone added to human serum, and progesterone values for patients' specimens correlated well (r > 0.96) with results of assays involving extraction of serum. Precision was similar with each displacing agent over the working range 2.5-100 nmol/L and superior to that of extraction assays. We conclude that these direct assays of progesterone are analytically valid and more robust, precise, and technically convenient than many conventional methods involving extraction of serum

  13. Individual vulnerability to insomnia, excessive sleepiness and shift work disorder amongst healthcare shift workers. A systematic review.

    Science.gov (United States)

    Booker, Lauren A; Magee, Michelle; Rajaratnam, Shantha M W; Sletten, Tracey L; Howard, Mark E

    2018-03-27

    Shift workers often experience reduced sleep quality, duration and/or excessive sleepiness due to the imposed conflict between work and their circadian system. About 20-30% of shift workers experience prominent insomnia symptoms and excessive daytime sleepiness consistent with the circadian rhythm sleep disorder known as shift work disorder. Individual factors may influence this vulnerability to shift work disorder or sleep-related impairment associated with shift work. This paper was registered with Prospero and was conducted using recommended standards for systematic reviews and meta-analyses. Published literature that measured sleep-related impairment associated with shift work including reduced sleep quality and duration and increased daytime sleepiness amongst healthcare shift workers and explored characteristics associated with individual variability were reviewed. Fifty-eight studies were included. Older age, morning-type, circadian flexibility, being married or having children, increased caffeine intake, higher scores on neuroticism and lower on hardiness were related to a higher risk of sleep-related impairment in response to shift work, whereas physical activity was a protective factor. The review highlights the diverse range of measurement tools used to evaluate the impact of shift work on sleep. Use of standardised and validated tools would enable cross-study comparisons. Longitudinal studies are required to establish causal relationships between individual factors and the development of shift work disorder. Copyright © 2018 Elsevier Ltd. All rights reserved.

  14. Absolute nuclear material assay

    Science.gov (United States)

    Prasad, Manoj K [Pleasanton, CA; Snyderman, Neal J [Berkeley, CA; Rowland, Mark S [Alamo, CA

    2010-07-13

    A method of absolute nuclear material assay of an unknown source comprising counting neutrons from the unknown source and providing an absolute nuclear material assay utilizing a model to optimally compare to the measured count distributions. In one embodiment, the step of providing an absolute nuclear material assay comprises utilizing a random sampling of analytically computed fission chain distributions to generate a continuous time-evolving sequence of event-counts by spreading the fission chain distribution in time.

  15. Homogeneous bilateral block shifts

    Indian Academy of Sciences (India)

    Douglas class were classified in [3]; they are unilateral block shifts of arbitrary block size (i.e. dim H(n) can be anything). However, no examples of irreducible homogeneous bilateral block shifts of block size larger than 1 were known until now.

  16. Quantized beam shifts in graphene

    Energy Technology Data Exchange (ETDEWEB)

    de Melo Kort-Kamp, Wilton Junior [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Sinitsyn, Nikolai [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Dalvit, Diego Alejandro Roberto [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-10-08

    We predict the existence of quantized Imbert-Fedorov, Goos-Hanchen, and photonic spin Hall shifts for light beams impinging on a graphene-on-substrate system in an external magnetic field. In the quantum Hall regime the Imbert-Fedorov and photonic spin Hall shifts are quantized in integer multiples of the fine structure constant α, while the Goos-Hanchen ones in multiples of α2. We investigate the influence on these shifts of magnetic field, temperature, and material dispersion and dissipation. An experimental demonstration of quantized beam shifts could be achieved at terahertz frequencies for moderate values of the magnetic field.

  17. Assay method and compositions

    International Nuclear Information System (INIS)

    1977-01-01

    Methods are described for measuring catecholamine levels in human and animal body fluids and tissues using the catechol-O-methyl-transferase (COMT) radioassay. The assay involves incubating the biological sample with COMT and the tritiated methyl donor, S-adenosyl-L-methionine( 3 H)-methyl. The O-methylated ( 3 H) epinephrine and/or norepinephrine are extracted and oxidised to vanillin- 3 H which in turn is extracted and its radioactivity counted. When analysing dopamine levels the assay is extended by vanillin- 3 H and raising the pH of the aqueous periodate phase from which O-methylated ( 3 H) dopamine is extracted and counted. The assay may be modified depending on whether measurements of undifferentiated total endogenous catecholamine levels or differential analyses of the catecholamine levels are being performed. The sensitivity of the assay can be as low as 5 picograms for norepinephrine and epinephrine and 12 picograms for dopamine. The assemblance of the essential components of the assay into a kit for use in laboratories is also described. (U.K.)

  18. Fluid Shifts

    Science.gov (United States)

    Stenger, M. B.; Hargens, A. R.; Dulchavsky, S. A.; Arbeille, P.; Danielson, R. W.; Ebert, D. J.; Garcia, K. M.; Johnston, S. L.; Laurie, S. S.; Lee, S. M. C.; hide

    2017-01-01

    Introduction. NASA's Human Research Program is focused on addressing health risks associated with long-duration missions on the International Space Station (ISS) and future exploration-class missions beyond low Earth orbit. Visual acuity changes observed after short-duration missions were largely transient, but now more than 50 percent of ISS astronauts have experienced more profound, chronic changes with objective structural findings such as optic disc edema, globe flattening and choroidal folds. These structural and functional changes are referred to as the visual impairment and intracranial pressure (VIIP) syndrome. Development of VIIP symptoms may be related to elevated intracranial pressure (ICP) secondary to spaceflight-induced cephalad fluid shifts, but this hypothesis has not been tested. The purpose of this study is to characterize fluid distribution and compartmentalization associated with long-duration spaceflight and to determine if a relation exists with vision changes and other elements of the VIIP syndrome. We also seek to determine whether the magnitude of fluid shifts during spaceflight, as well as any VIIP-related effects of those shifts, are predicted by the crewmember's pre-flight status and responses to acute hemodynamic manipulations, specifically posture changes and lower body negative pressure. Methods. We will examine a variety of physiologic variables in 10 long-duration ISS crewmembers using the test conditions and timeline presented in the figure below. Measures include: (1) fluid compartmentalization (total body water by D2O, extracellular fluid by NaBr, intracellular fluid by calculation, plasma volume by CO rebreathe, interstitial fluid by calculation); (2) forehead/eyelids, tibia, and calcaneus tissue thickness (by ultrasound); (3) vascular dimensions by ultrasound (jugular veins, cerebral and carotid arteries, vertebral arteries and veins, portal vein); (4) vascular dynamics by MRI (head/neck blood flow, cerebrospinal fluid

  19. Isotope shifting capacity of rock

    International Nuclear Information System (INIS)

    Blattner, P.; Department of Scientific and Industrial Research, Lower Hutt

    1980-01-01

    Any oxygen isotope shifted rock volume exactly defines a past throughput of water. An expression is derived that relates the throughput of an open system to the isotope shift of reservoir rock and present-day output. The small isotope shift of Ngawha reservoir rock and the small, high delta oxygen-18 output are best accounted for by a magmatic water source

  20. Sleep and satisfaction in 8- and 12-h forward-rotating shift systems: Industrial employees prefer 12-h shifts.

    Science.gov (United States)

    Karhula, Kati; Härmä, Mikko; Ropponen, Annina; Hakola, Tarja; Sallinen, Mikael; Puttonen, Sampsa

    2016-01-01

    Twelve-hour shift systems have become more popular in industry. Survey data of shift length, shift rotation speed, self-rated sleep, satisfaction and perceived health were investigated for the associations among 599 predominantly male Finnish industrial employees. The studied forward-rotating shift systems were 12-h fast (12fast, DDNN------, n = 268), 8-h fast (8fast, MMEENN----, n = 161) and 8-h slow (8slow, MMMM-EEEE-NNNN, n = 170). Satisfaction with shift system differed between the groups (p effects on sleep and alertness were rare (8%) in the 12fast group (53% 8fast, 66% 8 slow, p effects of the current shift system on general health (12fast 4%, 8fast 30%, 8slow 41%, p work-life balance (12fast 8%, 8fast 52%, 8slow 63%, p effects of shift work were dependent on both shift length and shift rotation speed: employees in the 12-h rapidly forward-rotating shift system were most satisfied, perceived better work-life balance and slept better than the employees in the 8fast or especially the employees in the 8-h slowly rotating systems.

  1. Tempo of Diversification of Global Amphibians: One-Constant Rate, One-Continuous Shift or Multiple-Discrete Shifts?

    Directory of Open Access Journals (Sweden)

    Youhua Chen

    2014-01-01

    Full Text Available In this brief report, alternative time-varying diversification rate models were fitted onto the phylogeny of global amphibians by considering one-constant-rate (OCR, one-continuous-shift (OCS and multiplediscrete- shifts (MDS situations. The OCS diversification model was rejected by γ statistic (γ=-5.556, p⁄ 0.001, implying the existence of shifting diversification rates for global amphibian phylogeny. Through model selection, MDS diversification model outperformed OCS and OCR models using “laser” package under R environment. Moreover, MDS models, implemented using another R package “MEDUSA”, indicated that there were sixteen shifts over the internal nodes for amphibian phylogeny. Conclusively, both OCS and MDS models are recommended to compare so as to better quantify rate-shifting trends of species diversification. MDS diversification models should be preferential for large phylogenies using “MEDUSA” package in which any arbitrary numbers of shifts are allowed to model.

  2. Phenological shifts conserve thermal niches in North American birds and reshape expectations for climate-driven range shifts.

    Science.gov (United States)

    Socolar, Jacob B; Epanchin, Peter N; Beissinger, Steven R; Tingley, Morgan W

    2017-12-05

    Species respond to climate change in two dominant ways: range shifts in latitude or elevation and phenological shifts of life-history events. Range shifts are widely viewed as the principal mechanism for thermal niche tracking, and phenological shifts in birds and other consumers are widely understood as the principal mechanism for tracking temporal peaks in biotic resources. However, phenological and range shifts each present simultaneous opportunities for temperature and resource tracking, although the possible role for phenological shifts in thermal niche tracking has been widely overlooked. Using a canonical dataset of Californian bird surveys and a detectability-based approach for quantifying phenological signal, we show that Californian bird communities advanced their breeding phenology by 5-12 d over the last century. This phenological shift might track shifting resource peaks, but it also reduces average temperatures during nesting by over 1 °C, approximately the same magnitude that average temperatures have warmed over the same period. We further show that early-summer temperature anomalies are correlated with nest success in a continental-scale database of bird nests, suggesting avian thermal niches might be broadly limited by temperatures during nesting. These findings outline an adaptation surface where geographic range and breeding phenology respond jointly to constraints imposed by temperature and resource phenology. By stabilizing temperatures during nesting, phenological shifts might mitigate the need for range shifts. Global change ecology will benefit from further exploring phenological adjustment as a potential mechanism for thermal niche tracking and vice versa.

  3. [Burden and health effects of shift work].

    Science.gov (United States)

    Heitmann, Jörg

    2010-10-01

    In Germany aprox. 15% of all employees have irregular or flexible working hours. Disturbed sleep and/or hypersomnia are direct consequences of shift work and therefore described as shift work disorder. Beyond this, shift work can also be associated with specific pathological disorders. There are individual differences in tolerance to shift work. Optimization of both shift schedules and sleep to "non-physiological" times of the day are measures to counteract the negative effects of shift work. There is still not enough evidence to recommend drugs for routine use in shift workers. © Georg Thieme Verlag Stuttgart · New York.

  4. Shifted Independent Component Analysis

    DEFF Research Database (Denmark)

    Mørup, Morten; Madsen, Kristoffer Hougaard; Hansen, Lars Kai

    2007-01-01

    Delayed mixing is a problem of theoretical interest and practical importance, e.g., in speech processing, bio-medical signal analysis and financial data modelling. Most previous analyses have been based on models with integer shifts, i.e., shifts by a number of samples, and have often been carried...

  5. The impact of shift work on the psychological and physical health of nurses in a general hospital: a comparison between rotating night shifts and day shifts.

    Science.gov (United States)

    Ferri, Paola; Guadi, Matteo; Marcheselli, Luigi; Balduzzi, Sara; Magnani, Daniela; Di Lorenzo, Rosaria

    2016-01-01

    Shift work is considered necessary to ensure continuity of care in hospitals and residential facilities. In particular, the night shift is one of the most frequent reasons for the disruption of circadian rhythms, causing significant alterations of sleep and biological functions that can affect physical and psychological well-being and negatively impact work performance. The aim of this study was to highlight if shift work with nights, as compared with day work only, is associated with risk factors predisposing nurses to poorer health conditions and lower job satisfaction. This cross-sectional study was conducted from June 1, 2015 to July 31, 2015 in 17 wards of a general hospital and a residential facility of a northern Italian city. This study involved 213 nurses working in rotating night shifts and 65 in day shifts. The instrument used for data collection was the "Standard Shift Work Index," validated in Italian. Data were statistically analyzed. The response rate was 86%. The nurses engaged in rotating night shifts were statistically significantly younger, more frequently single, and had Bachelors and Masters degrees in nursing. They reported the lowest mean score in the items of job satisfaction, quality and quantity of sleep, with more frequent chronic fatigue, psychological, and cardiovascular symptoms in comparison with the day shift workers, in a statistically significant way. Our results suggest that nurses with rotating night schedule need special attention due to the higher risk for both job dissatisfaction and undesirable health effects.

  6. Expert system for transuranic waste assay

    Energy Technology Data Exchange (ETDEWEB)

    Zoolalian, M.L.; Gibbs, A.; Kuhns, J.D.

    1989-01-01

    Transuranic wastes are generated at the Savannah River Site (SRS) as a result of routine production of nuclear materials. These wastes contain Pu-238 and Pu-239 and are placed into lined 55-gallon waste drums. The drums are placed on monitored storage pads pending shipment to the Waste Isolation Pilot Plant in New Mexico. A passive-active neutron (PAN) assay system is used to determine the mass of the radioactive material within the waste drums. Assay results are used to classify the wastes as either low-level or transuranic (TRU). During assays, the PAN assay system communicates with an IBM-AT computer. A Fortran computer program, called NEUT, controls and performs all data analyses. Unassisted, the NEUT program cannot adequately interpret assay results. To eliminate this limitation, an expert system shell was used to write a new algorithm, called the Transuranic Expert System (TRUX), to drive the NEUT program and add decision making capabilities for analysis of the assay results. The TRUX knowledge base was formulated by consulting with human experts in the field of neutron assay, by direct experimentation on the PAN assay system, and by observing operations on a daily basis. TRUX, with its improved ability to interpret assay results, has eliminated the need for close supervision by a human expert, allowing skilled technicians to operate the PAN assay system. 4 refs., 1 fig., 4 tabs.

  7. Expert system for transuranic waste assay

    International Nuclear Information System (INIS)

    Zoolalian, M.L.; Gibbs, A.; Kuhns, J.D.

    1989-01-01

    Transuranic wastes are generated at the Savannah River Site (SRS) as a result of routine production of nuclear materials. These wastes contain Pu-238 and Pu-239 and are placed into lined 55-gallon waste drums. The drums are placed on monitored storage pads pending shipment to the Waste Isolation Pilot Plant in New Mexico. A passive-active neutron (PAN) assay system is used to determine the mass of the radioactive material within the waste drums. Assay results are used to classify the wastes as either low-level or transuranic (TRU). During assays, the PAN assay system communicates with an IBM-AT computer. A Fortran computer program, called NEUT, controls and performs all data analyses. Unassisted, the NEUT program cannot adequately interpret assay results. To eliminate this limitation, an expert system shell was used to write a new algorithm, called the Transuranic Expert System (TRUX), to drive the NEUT program and add decision making capabilities for analysis of the assay results. The TRUX knowledge base was formulated by consulting with human experts in the field of neutron assay, by direct experimentation on the PAN assay system, and by observing operations on a daily basis. TRUX, with its improved ability to interpret assay results, has eliminated the need for close supervision by a human expert, allowing skilled technicians to operate the PAN assay system. 4 refs., 1 fig., 4 tabs

  8. Fluocinolone acetonide partially restores the mineralization of LPS-stimulated dental pulp cells through inhibition of NF-κB pathway and activation of AP-1 pathway

    Science.gov (United States)

    Liu, Zhongning; Jiang, Ting; Wang, Xinzhi; Wang, Yixiang

    2013-01-01

    BACKGROUND AND PURPOSE Fluocinolone acetonide (FA) is commonly used as a steroidal anti-inflammatory drug. We recently found that in dental pulp cells (DPCs) FA has osteo-/odonto-inductive as well as anti-inflammatory effects. However, the mechanism by which FA induces these effects in DPCs is poorly understood. EXPERIMENTAL APPROACH The effect of FA on the mineralization of DPCs during inflammatory conditions and the underlying mechanism were investigated by real-time PCR, Western blot, EMSA, histochemical staining, immunostaining and pathway blockade assays. KEY RESULTS FA significantly inhibited the inflammatory response in LPS-treated DPCs not only by down-regulating the expression of pro–inflammation-related genes, but also by up-regulating the expression of the anti-inflammatory gene PPAR-γ and mineralization-related genes. Moreover, histochemical staining and immunostaining showed that FA could partially restore the expressions of alkaline phosphatase, osteocalcin and dentin sialophosphoprotein (DSPP) and mineralization in LPS-stimulated DPCs. Real-time PCR and Western blot analysis revealed that FA up-regulated DSPP and runt-related transcription factor 2 expression by inhibiting the expression of phosphorylated-NF-κB P65 and activating activator protein-1 (AP-1) (p-c-Jun and Fra-1). These results were further confirmed through EMSA, by detection of NF-κB DNA-binding activity and pathway blockade assays using a NF-κB pathway inhibitor, AP-1 pathway inhibitor and glucocorticoid receptor antagonist. CONCLUSIONS AND IMPLICATIONS Inflammation induced by LPS suppresses the mineralization process in DPCs. FA partially restored this osteo-/odonto-genesis process in LPS-treated DPCs and had an anti-inflammatory effect through inhibition of the NF-κB pathway and activation of the AP-1 pathway. Hence, FA is a potential new treatment for inflammation-associated bone/teeth diseases. PMID:24024985

  9. First results with a radioreceptor-assay (TRAK-Assay) for TSH-receptor-autoantibodies

    International Nuclear Information System (INIS)

    Becker, W.; Reiners, C.; Boerner, W.

    1983-01-01

    A new radioreceptor-assay (TRAK-assay) for autoantibodies against TSH-receptors was tested in 48 untreated thyrotoxic patients (26 regional autonomies, 22 toxic diffuse goiters). None of the 26 patients with regional autonomy showed positive autoantibody-titers. 4 patients with toxic diffuse goiter and thyrotoxic exophthalmos were TRAK-positive. Positive titers of microsomal and thyreoglobulin autoantibodies could be seen in 8 of 9 patients with positive TRAK-titers. In accordance with the conventional methods for detecting thyroid-stimulating immunoglobulins the new TRAK-assay seems to be suited for differentiating between immunogenic toxic diffuse goiter (Graves' disease) and goiter with disseminated autonomy as well as for prediction of relapse. (orig.) [de

  10. Comprehensive analysis of sperm DNA fragmentation by five different assays: TUNEL assay, SCSA, SCD test and alkaline and neutral Comet assay.

    Science.gov (United States)

    Ribas-Maynou, J; García-Peiró, A; Fernández-Encinas, A; Abad, C; Amengual, M J; Prada, E; Navarro, J; Benet, J

    2013-09-01

    Sperm DNA fragmentation (SDF) is becoming an important test to assess male infertility. Several different tests are available, but no consensus has yet been reached as to which tests are most predictive of infertility. Few publications have reported a comprehensive analysis comparing these methods within the same population. The objective of this study was to analyze the differences between the five most common methodologies, to study their correlations and to establish their cut-off values, sensitivity and specificity in predicting male infertility. We found differences in SDF between fertile donors and infertile patients in TUNEL, SCSA, SCD and alkaline Comet assays, but none with the neutral Comet assay. The alkaline COMET assay was the best in predicting male infertility followed by TUNEL, SCD and SCSA, whereas the neutral COMET assay had no predictive power. For our patient population, threshold values for infertility were 20.05% for TUNEL assay, 18.90% for SCSA, 22.75% for the SCD test, 45.37% for alkaline Comet and 34.37% for neutral Comet. This work establishes in a comprehensive study that the all techniques except neutral Comet are useful to distinguish fertile and infertile men. © 2013 American Society of Andrology and European Academy of Andrology.

  11. Cα chemical shift tensors in helical peptides by dipolar-modulated chemical shift recoupling NMR

    International Nuclear Information System (INIS)

    Yao Xiaolan; Yamaguchi, Satoru; Hong Mei

    2002-01-01

    The Cα chemical shift tensors of proteins contain information on the backbone conformation. We have determined the magnitude and orientation of the Cα chemical shift tensors of two peptides with α-helical torsion angles: the Ala residue in G*AL (φ=-65.7 deg., ψ=-40 deg.), and the Val residue in GG*V (φ=-81.5 deg., ψ=-50.7 deg.). The magnitude of the tensors was determined from quasi-static powder patterns recoupled under magic-angle spinning, while the orientation of the tensors was extracted from Cα-Hα and Cα-N dipolar modulated powder patterns. The helical Ala Cα chemical shift tensor has a span of 36 ppm and an asymmetry parameter of 0.89. Its σ 11 axis is 116 deg. ± 5 deg. from the Cα-Hα bond while the σ 22 axis is 40 deg. ± 5 deg. from the Cα-N bond. The Val tensor has an anisotropic span of 25 ppm and an asymmetry parameter of 0.33, both much smaller than the values for β-sheet Val found recently (Yao and Hong, 2002). The Val σ 33 axis is tilted by 115 deg. ± 5 deg. from the Cα-Hα bond and 98 deg. ± 5 deg. from the Cα-N bond. These represent the first completely experimentally determined Cα chemical shift tensors of helical peptides. Using an icosahedral representation, we compared the experimental chemical shift tensors with quantum chemical calculations and found overall good agreement. These solid-state chemical shift tensors confirm the observation from cross-correlated relaxation experiments that the projection of the Cα chemical shift tensor onto the Cα-Hα bond is much smaller in α-helices than in β-sheets

  12. Methodological aspects of shift-work research.

    Science.gov (United States)

    Knutsson, Anders

    2004-01-01

    A major issue in shift-work research is to understand the possible ways in which shift work can impact performance and health. Nearly all body functions, from those of the cellular level to those of the entire body, are circadian rhythmic. Disturbances of these rhythms as well as the social consequences of odd work hours are of importance for the health and well-being of shift workers. This article reviews a number of common methodological issues which are of relevance to epidemiological studies in this area of research. It discusses conceptual problems regarding the use of the term "shift work," and it underscores the need to develop models that explain the mechanisms of disease in shift workers.

  13. SAT in shift manager training

    International Nuclear Information System (INIS)

    Lecuyer, F.

    1995-01-01

    EDF has improved the organization of the operation shift teams with the replacement of shift supervisor in shift manager function. The shift manager is not only responsible for tasks associated to plant operation (production), but he is also responsible for safety of these tasks and for management of shift team members. A job analysis of this new job position has been performed in order to design the training programme. It resulted in a 10-month training programme that includes 8 weeks in safety-related topics and 12 weeks in soft-skills related topics. The safety related training courses are mandatory, the other courses are optional courses depending on individual trainee needs. The training also includes the development of management competencies. During the 10 month period, each trainee develops an individual project that is evaluated by NPP manager. As well, as group project is undertaken by the trainees and overseen by a steering committee. The steering committee participates in the evaluation process and provides operational experience feedback to the trainee groups and to the overall programme

  14. Individual differences in shift work tolerance

    NARCIS (Netherlands)

    Lammers-van der Holst, H.M.

    2016-01-01

    Shift work is a key feature of our contemporary 24/7 society, employing several successive work teams to sustain around-the-clock operations. However, numerous studies imply that frequently shifting the periods of sleep and wakefulness poses a serious threat to the shift worker’s physical, mental

  15. Validation of a UV Spectrometric Method for the Assay of Tolfenamic Acid in Organic Solvents

    Directory of Open Access Journals (Sweden)

    Sofia Ahmed

    2015-01-01

    Full Text Available The present study has been carried out to validate a UV spectrometric method for the assay of tolfenamic acid (TA in organic solvents. TA is insoluble in water; therefore, a total of thirteen commonly used organic solvents have been selected in which the drug is soluble. Fresh stock solutions of TA in each solvent in a concentration of 1 × 10−4 M (2.62 mg% were prepared for the assay. The method has been validated according to the guideline of International Conference on Harmonization and parameters like linearity, range, accuracy, precision, sensitivity, and robustness have been studied. Although the method was found to be efficient for the determination of TA in all solvents on the basis of statistical data 1-octanol, followed by ethanol and methanol, was found to be comparatively better than the other studied solvents. No change in the stock solution stability of TA has been observed in each solvent for 24 hours stored either at room (25±1°C or at refrigerated temperature (2–8°C. A shift in the absorption maxima has been observed for TA in various solvents indicating drug-solvent interactions. The studied method is simple, rapid, economical, accurate, and precise for the assay of TA in different organic solvents.

  16. Safeguards and Non-destructive Assay

    International Nuclear Information System (INIS)

    Carchon, R.; Bruggeman, M.

    2001-01-01

    SCK-CEN's programme on safeguards and non-destructive assay includes: (1) various activities to assure nuclear materials accountancy; (2) contributes to the implementation of Integrated Safeguards measures in Belgium and to assist the IAEA through the Belgian Support Programme; (3) renders services to internal and external customers in the field of safeguards; (4) improves passive neutron coincidence counting techniques for waste assay and safeguards verification measurements by R and D on correlation algorithms implemented via software or dedicated hardware; (5) improves gamma assay techniques for waste assay by implementing advanced scanning techniques and different correlation algorithms; and (6) develops numerical calibration techniques. Major achievements in these areas in 2000 are reported

  17. Comparison of human immunodeficiency virus type 1 tropism profiles in clinical samples by the Trofile and MT-2 assays.

    Science.gov (United States)

    Coakley, Eoin; Reeves, Jacqueline D; Huang, Wei; Mangas-Ruiz, Marga; Maurer, Irma; Harskamp, Agnes M; Gupta, Soumi; Lie, Yolanda; Petropoulos, Christos J; Schuitemaker, Hanneke; van 't Wout, Angélique B

    2009-11-01

    The recent availability of CCR5 antagonists as anti-human immunodeficiency virus (anti-HIV) therapeutics has highlighted the need to accurately identify CXCR4-using variants in patient samples when use of this new drug class is considered. The Trofile assay (Monogram Biosciences) has become the method that is the most widely used to define tropism in the clinic prior to the use of a CCR5 antagonist. By comparison, the MT-2 assay has been used since early in the HIV epidemic to define tropism in clinical specimens. Given that there are few data from direct comparisons of these two assays, we evaluated the performance of the plasma-based Trofile assay and the peripheral blood mononuclear cell (PBMC)-based MT-2 assay for the detection of CXCR4 use in defining the tropism of HIV isolates derived from clinical samples. The various samples used for this comparison were derived from participants of the Amsterdam Cohort Studies on HIV infection and AIDS who underwent consecutive MT-2 assay testing of their PBMCs at approximately 3-month intervals. This unique sample set was specifically selected because consecutive MT-2 assays had demonstrated a shift from negative to positive in PBMCs, reflecting the first emergence of CXCR4-using virus in PBMCs above the level of detection of the assay in these individuals. Trofile testing was performed with clonal HIV type 1 (HIV-1) variants (n = 21), MT-2 cell culture-derived cells (n = 20) and supernatants (n = 42), and plasma samples (n = 76). Among the clonal HIV-1 variants and MT-2 cell culture-derived samples, the results of the Trofile and MT-2 assays demonstrated a high degree of concordance (95% to 98%). Among consecutive plasma samples, detection of CXCR4-using virus was at or before the time of first detection by the MT-2 assay in 5/10 patients by the original Trofile assay and in 9/10 patients by the enhanced-sensitivity Trofile assay. Differences in the time to the first detection of CXCR4 use between the MT-2 assay (PBMCs

  18. A coupled photometric assay for characterization of S-adenosyl-l-homocysteine hydrolases in the physiological hydrolytic direction.

    Science.gov (United States)

    Kailing, Lyn L; Bertinetti, Daniela; Herberg, Friedrich W; Pavlidis, Ioannis V

    2017-10-25

    S-Adenosyl-l-homocysteine hydrolases (SAHases) are important metabolic enzymes and their dysregulation is associated with some severe diseases. In vivo they catalyze the hydrolysis of S-adenosyl-l-homocysteine (SAH), the by-product of methylation reactions in various organisms. SAH is a potent inhibitor of methyltransferases, thus its removal from the equilibrium is an important requirement for methylation reactions. SAH hydrolysis is also the first step in the cellular regeneration process of the methyl donor S-adenosyl-l-methionine (SAM). However, in vitro the equilibrium lies towards the synthetic direction. To enable characterization of SAHases in the physiologically relevant direction, we have developed a coupled photometric assay that shifts the equilibrium towards hydrolysis by removing the product adenosine, using a high affinity adenosine kinase (AK). This converts adenosine to AMP and thereby forms equimolar amounts of ADP, which is phosphorylated by a pyruvate kinase (PK), in turn releasing pyruvate. The readout of the assay is the consumption of NADH during the lactate dehydrogenase (LDH) catalyzed reduction of pyruvate to lactic acid. The applicability of the assay is showcased for the determination of the kinetic constants of an SAHase from Bradyrhizobium elkanii (K M,SAH 41±5μM, v max,SAH 25±1μM/min with 0.13mg/mL enzyme). This assay is a valuable tool for in vitro characterization of SAHases with biotechnological potential, and for monitoring SAHase activity in diagnostics. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. An analysis of clock-shift experiments: is scatter increased and deflection reduced in clock-shifted homing pigeons?

    Science.gov (United States)

    Chappell

    1997-01-01

    Clock-shifting (altering the phase of the internal clock) in homing pigeons leads to a deflection in the vanishing bearing of the clock-shifted group relative to controls. However, two unexplained phenomena are common in clock-shift experiments: the vanishing bearings of the clock-shifted group are often more scattered (with a shorter vector length) than those of the control group, and the deflection of the mean bearing of the clock-shifted group from that of the controls is often smaller than expected theoretically. Here, an analysis of 55 clock-shift experiments performed in four countries over 21 years is reported. The bearings of the clock-shifted groups were significantly more scattered than those of controls and less deflected than expected, but these effects were not significantly different at familiar and unfamiliar sites. The possible causes of the effects are discussed and evaluated with reference to this analysis and other experiments. The most likely causes appear to be conflict between the directions indicated by the sun compass and either unshifted familiar visual landmarks (at familiar sites only) or the unshifted magnetic compass (possible at both familiar and unfamiliar sites).

  20. Examining paid sickness absence by shift workers.

    Science.gov (United States)

    Catano, V M; Bissonnette, A B

    2014-06-01

    Shift workers are at greater risk than day workers with respect to psychological and physical health, yet little research has linked shift work to increased sickness absence. To investigate the relationship between shift work and sickness absence while controlling for organizational and individual characteristics and shift work attributes that have confounded previous research. The study used archive data collected from three national surveys in Canada, each involving over 20000 employees and 6000 private-sector firms in 14 different occupational groups. The employees reported the number of paid sickness absence days in the past 12 months. Data were analysed using both chi-squared statistics and hierarchical regressions. Contrary to previous research, shift workers took less paid sickness absence than day workers. There were no differences in the length of the sickness absence between both groups or in sickness absence taken by female and male workers whether working days or shifts. Only job tenure, the presence of a union in the workplace and working rotating shifts predicted sickness absence in shift workers. The results were consistent across all three samples. In general, shift work does not seem to be linked to increased sickness absence. However, such associations may be true for specific industries. Male and female workers did not differ in the amount of sickness absence taken. Rotating shifts, regardless of industry, predicted sickness absence among shift workers. Consideration should be given to implementing scheduled time off between shift changes. © The Author 2014. Published by Oxford University Press on behalf of the Society of Occupational Medicine. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  1. Molecular Electronic Shift Registers

    Science.gov (United States)

    Beratan, David N.; Onuchic, Jose N.

    1990-01-01

    Molecular-scale shift registers eventually constructed as parts of high-density integrated memory circuits. In principle, variety of organic molecules makes possible large number of different configurations and modes of operation for such shift-register devices. Several classes of devices and implementations in some specific types of molecules proposed. All based on transfer of electrons or holes along chains of repeating molecular units.

  2. Blue-shifted and red-shifted hydrogen bonds: Theoretical study of the CH3CHO· · ·HNO complexes

    Science.gov (United States)

    Yang, Yong; Zhang, Weijun; Gao, Xiaoming

    The blue-shifted and red-shifted H-bonds have been studied in complexes CH3CHO?HNO. At the MP2/6-31G(d), MP2/6-31+G(d,p) MP2/6-311++G(d,p), B3LYP/6-31G(d), B3LYP/6-31+G(d,p) and B3LYP/6-311++G(d,p) levels, the geometric structures and vibrational frequencies of complexes CH3CHO?HNO are calculated by both standard and CP-corrected methods, respectively. Complex A exhibits simultaneously red-shifted C bond H?O and blue-shifted N bond H?O H-bonds. Complex B possesses simultaneously two blue-shifted H-bonds: C bond H?O and N bond H?O. From NBO analysis, it becomes evident that the red-shifted C bond H?O H-bond can be explained on the basis of the two opposite effects: hyperconjugation and rehybridization. The blue-shifted C bond H?O H-bond is a result of conjunct C bond H bond strengthening effects of the hyperconjugation and the rehybridization due to existence of the significant electron density redistribution effect. For the blue-shifted N bond H?O H-bonds, the hyperconjugation is inhibited due to existence of the electron density redistribution effect. The large blue shift of the N bond H stretching frequency is observed because the rehybridization dominates the hyperconjugation.

  3. Shift Work: Improving Daytime Sleep

    Science.gov (United States)

    ... night. Good daytime sleep is possible, though, if shift work is a necessary part of your work life. ... mayoclinic.org/healthy-lifestyle/adult-health/expert-answers/shift-work/faq-20057991 . Mayo Clinic Footer Legal Conditions and ...

  4. Radioactive wastes assay technique and equipment

    International Nuclear Information System (INIS)

    Lee, K. M.; Hong, D. S; Kim, T. K.; Bae, S. M.; Shon, J. S.; Hong, K. P.

    2004-12-01

    The waste inventory records such as the activities and radio- nuclides contained in the waste packages are to be submitted with the radioactive wastes packages for the final disposal. The nearly around 10,000 drums of waste stocked in KAERI now should be assayed for the preparation of the waste inventory records too. For the successive execution of the waste assay, the investigation into the present waste assay techniques and equipment are to be taken first. Also the installation of the waste assay equipment through the comprehensive design, manufacturing and procurement should be proceeded timely. As the characteristics of the KAERI-stocked wastes are very different from that of the nuclear power plant and those have no regular waste streams, the application of the in-direct waste assay method using the scaling factors are not effective for the KAERI-generated wastes. Considering for the versal conveniency including the accuracy over the wide range of waste forms and the combination of assay time and sensitivity, the TGS(Tomographic Gamma Scanner) is appropriate as for the KAERI -generated radioactive waste assay equipment

  5. Night shift work and modifiable lifestyle factors.

    Science.gov (United States)

    Pepłońska, Beata; Burdelak, Weronika; Krysicka, Jolanta; Bukowska, Agnieszka; Marcinkiewicz, Andrzej; Sobala, Wojciech; Klimecka-Muszyńska, Dorota; Rybacki, Marcin

    2014-10-01

    Night shift work has been linked to some chronic diseases. Modification of lifestyle by night work may partially contribute to the development of these diseases, nevertheless, so far epidemiological evidence is limited. The aim of the study was to explore association between night shift work and lifestyle factors using data from a cross-sectional study among blue-collar workers employed in industrial plants in Łódź, Poland. The anonymous questionnaire was self-administered among 605 employees (236 women and 369 men, aged 35 or more) - 434 individuals currently working night shifts. Distribution of the selected lifestyle related factors such as smoking, alcohol drinking, physical activity, body mass index (BMI), number of main meals and the hour of the last meal was compared between current, former, and never night shift workers. Adjusted ORs or predicted means were calculated, as a measure of the associations between night shift work and lifestyle factors, with age, marital status and education included in the models as covariates. Recreational inactivity (defined here as less than one hour per week of recreational physical activity) was associated with current night shift work when compared to never night shift workers (OR = 2.43, 95% CI: 1.13-5.22) among men. Alcohol abstinence and later time of the last meal was associated with night shift work among women. Statistically significant positive relationship between night shift work duration and BMI was observed among men (p = 0.029). This study confirms previous studies reporting lower exercising among night shift workers and tendency to increase body weight. This finding provides important public health implication for the prevention of chronic diseases among night shift workers. Initiatives promoting physical activity addressed in particular to the night shift workers are recommended.

  6. Night shift work and modifiable lifestyle factors

    Directory of Open Access Journals (Sweden)

    Beata Pepłońska

    2014-10-01

    Full Text Available Objectives: Night shift work has been linked to some chronic diseases. Modification of lifestyle by night work may partially contribute to the development of these diseases, nevertheless, so far epidemiological evidence is limited. The aim of the study was to explore association between night shift work and lifestyle factors using data from a cross-sectional study among blue-collar workers employed in industrial plants in Łódź, Poland. Material and Methods: The anonymous questionnaire was self-administered among 605 employees (236 women and 369 men, aged 35 or more - 434 individuals currently wor­king night shifts. Distribution of the selected lifestyle related factors such as smoking, alcohol drinking, physical activity, body mass index (BMI, number of main meals and the hour of the last meal was compared between current, former, and never night shift workers. Adjusted ORs or predicted means were calculated, as a measure of the associations between night shift work and lifestyle factors, with age, marital status and education included in the models as covariates. Results: Recreational inactivity (defined here as less than one hour per week of recreational physical activity was associated with current night shift work when compared to never night shift workers (OR = 2.43, 95% CI: 1.13-5.22 among men. Alcohol abstinence and later time of the last meal was associated with night shift work among women. Statistically significant positive relationship between night shift work duration and BMI was observed among men (p = 0.029. Conclusions: This study confirms previous studies reporting lower exercising among night shift workers and tendency to increase body weight. This finding provides important public health implication for the prevention of chronic diseases among night shift workers. Initiatives promoting physical activity addressed in particular to the night shift workers are recommended.

  7. Radioactive waste package assay facility. Volume 1. Application of assay technology

    International Nuclear Information System (INIS)

    Findlay, D.J.S.; Green, T.H.; Molesworth, T.V.; Staniforth, D.; Strachan, N.R.; Rogers, J.D.; Wise, M.O.; Forrest, K.R.

    1992-01-01

    This report, in three volumes, covers the work carried out by Taylor Woodrow Construction Ltd., and two major sub-contractors: Harwell Laboratory (AEA Technology) and Siemens Plessey Controls Ltd., on the development of a radioactive waste package assay facility, for cemented 500 litre intermediate level waste drums. In volume 1, the reasons for assay are considered together with the various techniques that can be used, and the information that can be obtained. The practical problems associated with the use of the various techniques in an integrated assay facility are identified, and the key parameters defined. Engineering and operational features are examined and provisional designs proposed for facilities at three throughput levels: 15,000, 750 and 30 drums per year respectively. The capital and operating costs for such facilities have been estimated. A number of recommendations are made for further work. 16 refs., 14 figs., 13 tabs

  8. Automation of the dicentric chromosome assay and related assays

    International Nuclear Information System (INIS)

    Balajee, Adayabalam S.; Dainiak, Nicholas

    2016-01-01

    Dicentric Chromosome Assay (DCA) is considered to be the 'gold standard' for personalized dose assessment in humans after accidental or incidental radiation exposure. Although this technique is superior to other cytogenetic assays in terms of specificity and sensitivity, its potential application to radiation mass casualty scenarios is highly restricted because DCA is time consuming and labor intensive when performed manually. Therefore, it is imperative to develop high throughput automation techniques to make DCA suitable for radiological triage scenarios. At the Cytogenetic Biodosimetry Laboratory in Oak Ridge, efforts are underway to develop high throughput automation of DCA. Current status on development of various automated cytogenetic techniques in meeting the biodosimetry needs of radiological/nuclear incident(s) will be discussed

  9. Study of insomnia in rotating shift-workers

    Directory of Open Access Journals (Sweden)

    Kaushik Chatterjee

    2017-01-01

    Full Text Available Background: Shift-workers commonly suffer from insomnia. This study evaluates different domains of insomnia. Aim: This study was aimed to study sleep and insomnia in rotating shift-workers and compare with day-workers. Materials and Methods: This was case–control study. The sleep of rotating shift-workers is compared with day workers using Athens Insomnia Scale. Results: Rotating shift-workers had significantly higher scores on Athens insomnia scale on domains of initial, intermediate and terminal insomnia than day workers. Duration and quality of sleep and sense of well-being are lower in rotating shift-workers. Rotating shift-workers also experienced more day-time sleepiness than day workers. However, there was no difference in perceived physical and mental functioning between the two groups. Conclusion: Individuals working in rotating shifts for more than 15 days have significantly higher prevalence of insomnia than day-workers.

  10. Radiometric assays for glycerol, glucose, and glycogen

    International Nuclear Information System (INIS)

    Bradley, D.C.; Kaslow, H.R.

    1989-01-01

    We have developed radiometric assays for small quantities of glycerol, glucose and glycogen, based on a technique described by Thorner and Paulus for the measurement of glycerokinase activity. In the glycerol assay, glycerol is phosphorylated with [32P]ATP and glycerokinase, residual [32P]ATP is hydrolyzed by heating in acid, and free [32P]phosphate is removed by precipitation with ammonium molybdate and triethylamine. Standard dose-response curves were linear from 50 to 3000 pmol glycerol with less than 3% SD in triplicate measurements. Of the substances tested for interference, only dihydroxyacetone gave a slight false positive signal at high concentration. When used to measure glycerol concentrations in serum and in media from incubated adipose tissue, the radiometric glycerol assay correlated well with a commonly used spectrophotometric assay. The radiometric glucose assay is similar to the glycerol assay, except that glucokinase is used instead of glycerokinase. Dose response was linear from 5 to 3000 pmol glucose with less than 3% SD in triplicate measurements. Glucosamine and N-acetylglucosamine gave false positive signals when equimolar to glucose. When glucose concentrations in serum were measured, the radiometric glucose assay agreed well with hexokinase/glucose-6-phosphate dehydrogenase (H/GDH)-based and glucose oxidase/H2O2-based glucose assays. The radiometric method for glycogen measurement incorporates previously described isolation and digestion techniques, followed by the radiometric assay of free glucose. When used to measure glycogen in mouse epididymal fat pads, the radiometric glycogen assay correlated well with the H/GDH-based glycogen assay. All three radiometric assays offer several practical advantages over spectral assays

  11. Harmonization of radiobiological assays: why and how?

    International Nuclear Information System (INIS)

    Prasanna, Pataje G.

    2014-01-01

    The International Atomic Energy Agency has made available a technical manual for cytogenetic biodosimetry assays (dicentric chromosome aberration (DCA) and cytokinesis-block micronucleus (CBMN) assays) used for radiation dose assessment in radiation accidents. The International Standardization Organization, which develops standards and guidelines, also provides an avenue for laboratory accreditation, has developed guidelines and recommendations for performing cytogenetic biodosimetry assays. Harmonization of DCA and CBMN assays, has improved their accuracy. Double-blinded inter-laboratory comparison studies involving several networks have further validated DCA and CBMN assays and improved the confidence in their potential use for radiation dose assessment in mass casualties. This kind of international harmonization is lacking for pre-clinical radiobiology assays. The widely used pre-clinical assays that are relatively important to set stage for clinical trials include clonogenic assays, flow-cytometry assays, apoptotic assays, and tumor regression and growth delay assays. However, significant inter-laboratory variations occur with respect to data among laboratories. This raises concerns on the reliability and reproducibility of preclinical data that drives further development and translation. Lack of reproducibility may stem from a variety of factors such as poor scientist training, less than optimal experimental design, inadequate description of methodology, and impulse to publish only the positive data etc. Availability of technical manuals, standard operating procedures, accreditation avenues for laboratories performing such assays, inter-laboratory comparisons, and use of standardized protocols are necessary to enhance reliability and reproducibility. Thus, it is important that radiobiological assays are harmonized for laboratory protocols to ensure successful translation of pre-clinical research on radiation effect modulators to help design clinic trials with

  12. The effects of consecutive night shifts and shift length on cognitive performance and sleepiness: a field study.

    Science.gov (United States)

    Haidarimoghadam, Rashid; Kazemi, Reza; Motamedzadeh, Majid; Golmohamadi, Rostam; Soltanian, Alireza; Zoghipaydar, Mohamad Reza

    2017-06-01

    The aim of this study was to evaluate the effects of consecutive night shifts (CNS) and shift length on cognitive performance and sleepiness. This study evaluated the sleepiness and performance of 30 control room operators (CROs) working in 7 nights, 7 days, 7 days off (7N7D7O) and 30 CROs working in 4 nights, 7 days, 3 nights, 7 days off (4N7D3N7O) shift patterns in a petrochemical complex on the last night shift before swinging into the day shift. To assess cognitive performance, the n-back test, continuous performance test and simple reaction time test were employed. To assess sleepiness, the Karolinska sleepiness scale was used. Both schedules indicated that the correct responses and response times of working memory were reduced (p = 0.001), while intentional errors and sleepiness increased during the shift work (p = 0.001). CNS had a significant impact on reaction time and commission errors (p = 0.001). The main duty of CROs at a petrochemical plant is checking hazardous processes which require appropriate alertness and cognitive performance. As a result, planning for appropriate working hours and suitable number of CNS in a rotating shift system is a contribution to improving CRO performance and enhancing safety.

  13. Study of nanometer-level precise phase-shift system used in electronic speckle shearography and phase-shift pattern interferometry

    Science.gov (United States)

    Jing, Chao; Liu, Zhongling; Zhou, Ge; Zhang, Yimo

    2011-11-01

    The nanometer-level precise phase-shift system is designed to realize the phase-shift interferometry in electronic speckle shearography pattern interferometry. The PZT is used as driving component of phase-shift system and translation component of flexure hinge is developed to realize micro displacement of non-friction and non-clearance. Closed-loop control system is designed for high-precision micro displacement, in which embedded digital control system is developed for completing control algorithm and capacitive sensor is used as feedback part for measuring micro displacement in real time. Dynamic model and control model of the nanometer-level precise phase-shift system is analyzed, and high-precision micro displacement is realized with digital PID control algorithm on this basis. It is proved with experiments that the location precision of the precise phase-shift system to step signal of displacement is less than 2nm and the location precision to continuous signal of displacement is less than 5nm, which is satisfied with the request of the electronic speckle shearography and phase-shift pattern interferometry. The stripe images of four-step phase-shift interferometry and the final phase distributed image correlated with distortion of objects are listed in this paper to prove the validity of nanometer-level precise phase-shift system.

  14. Tempo of Diversification of Global Amphibians: One-Constant Rate, One-Continuous Shift or Multiple-Discrete Shifts?

    OpenAIRE

    Youhua Chen

    2014-01-01

    In this brief report, alternative time-varying diversification rate models were fitted onto the phylogeny of global amphibians by considering one-constant-rate (OCR), one-continuous-shift (OCS) and multiplediscrete- shifts (MDS) situations. The OCS diversification model was rejected by γ statistic (γ=-5.556, p⁄ 0.001), implying the existence of shifting diversification rates for global amphibian phylogeny. Through model selection, MDS diversification model outperformed OCS and OCR...

  15. MS transport assays for γ-aminobutyric acid transporters--an efficient alternative for radiometric assays.

    Science.gov (United States)

    Schmitt, Sebastian; Höfner, Georg; Wanner, Klaus T

    2014-08-05

    Transport assays for neurotransmitters based on radiolabeled substrates are widely spread and often indispensable in basic research and the drug development process, although the use of radioisotopes is inherently coupled to issues concerning radioactive waste and safety precautions. To overcome these disadvantages, we developed mass spectrometry (MS)-based transport assays for γ-aminobutyric acid (GABA), which is the major inhibitory neurotransmitter in the central nervous system (CNS). These "MS Transport Assays" provide all capabilities of [(3)H]GABA transport assays and therefore represent the first substitute for the latter. The performance of our approach is demonstrated for GAT1, the most important GABA transporter (GAT) subtype. As GABA is endogenously present in COS-7 cells employed as hGAT1 expression system, ((2)H6)GABA was used as a substrate to differentiate transported from endogenous GABA. To record transported ((2)H6)GABA, a highly sensitive, short, robust, and reliable HILIC-ESI-MS/MS quantification method using ((2)H2)GABA as an internal standard was developed and validated according to the Center for Drug Evaluation and Research (CDER) guidelines. Based on this LC-MS quantification, a setup to characterize hGAT1 mediated ((2)H6)GABA transport in a 96-well format was established, that enables automated processing and avoids any sample preparation. The K(m) value for ((2)H6)GABA determined for hGAT1 is in excellent agreement with results obtained from [(3)H]GABA uptake assays. In addition, the established assay format enables efficient determination of the inhibitory potency of GAT1 inhibitors, is capable of identifying those inhibitors transported as substrates, and furthermore allows characterization of efflux. The approach described here combines the strengths of LC-MS/MS with the high efficiency of transport assays based on radiolabeled substrates and is applicable to all GABA transporter subtypes.

  16. Clonogenic assay: adherent cells.

    Science.gov (United States)

    Rafehi, Haloom; Orlowski, Christian; Georgiadis, George T; Ververis, Katherine; El-Osta, Assam; Karagiannis, Tom C

    2011-03-13

    The clonogenic (or colony forming) assay has been established for more than 50 years; the original paper describing the technique was published in 1956. Apart from documenting the method, the initial landmark study generated the first radiation-dose response curve for X-ray irradiated mammalian (HeLa) cells in culture. Basically, the clonogenic assay enables an assessment of the differences in reproductive viability (capacity of cells to produce progeny; i.e. a single cell to form a colony of 50 or more cells) between control untreated cells and cells that have undergone various treatments such as exposure to ionising radiation, various chemical compounds (e.g. cytotoxic agents) or in other cases genetic manipulation. The assay has become the most widely accepted technique in radiation biology and has been widely used for evaluating the radiation sensitivity of different cell lines. Further, the clonogenic assay is commonly used for monitoring the efficacy of radiation modifying compounds and for determining the effects of cytotoxic agents and other anti-cancer therapeutics on colony forming ability, in different cell lines. A typical clonogenic survival experiment using adherent cells lines involves three distinct components, 1) treatment of the cell monolayer in tissue culture flasks, 2) preparation of single cell suspensions and plating an appropriate number of cells in petri dishes and 3) fixing and staining colonies following a relevant incubation period, which could range from 1-3 weeks, depending on the cell line. Here we demonstrate the general procedure for performing the clonogenic assay with adherent cell lines with the use of an immortalized human keratinocyte cell line (FEP-1811). Also, our aims are to describe common features of clonogenic assays including calculation of the plating efficiency and survival fractions after exposure of cells to radiation, and to exemplify modification of radiation-response with the use of a natural antioxidant

  17. Human serum albumin binding assay based on displacement of a non selective fluorescent inhibitor.

    Science.gov (United States)

    Thorarensen, Atli; Sarver, Ronald W; Tian, Fang; Ho, Andrea; Romero, Donna L; Marotti, Keith R

    2007-08-15

    In this paper, we describe a fluorescent antibacterial analog, 6, with utility as a competition probe to determine affinities of other antibacterial analogs for human serum albumin (HSA). Analog 6 bound to HSA with an affinity of 400+/-100 nM and the fluorescence was environmentally sensitive. With 370 nm excitation, environmental sensitivity was indicated by a quenching of the 530 nm emission when the probe bound to HSA. Displacement of dansylsarcosine from HSA by 6 indicated it competed with compounds that bound at site II (ibuprofen binding site) on HSA. Analog 6 also shifted the NMR peaks of an HSA bound oleic acid molecule that itself was affected by compounds that bound at site II. In addition to binding at site II, 6 interacted at site I (warfarin binding site) as indicated by displacement of dansylamide and the shifting of NMR peaks of an HSA bound oleic acid molecule affected by warfarin site binding. Additional evidence for multiple site interaction was discovered when a percentage of 6 could be displaced by either ibuprofen or phenylbutazone. A competition assay was established using 6 to determine relative affinities of other antibacterial inhibitors for HSA.

  18. Genotoxicity testing: Comparison of the γH2AX focus assay with the alkaline and neutral comet assays.

    Science.gov (United States)

    Nikolova, Teodora; Marini, Federico; Kaina, Bernd

    2017-10-01

    Genotoxicity testing relies on the quantitative measurement of adverse effects, such as chromosome aberrations, micronuclei, and mutations, resulting from primary DNA damage. Ideally, assays will detect DNA damage and cellular responses with high sensitivity, reliability, and throughput. Several novel genotoxicity assays may fulfill these requirements, including the comet assay and the more recently developed γH2AX assay. Although they are thought to be specific for genotoxicants, a systematic comparison of the assays has not yet been undertaken. In the present study, we compare the γH2AX focus assay with the alkaline and neutral versions of the comet assay, as to their sensitivities and limitations for detection of genetic damage. We investigated the dose-response relationships of γH2AX foci and comet tail intensities at various times following treatment with four prototypical genotoxicants, methyl methanesulfonate (MMS), N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), mitomycin C, and hydrogen peroxide (H 2 O 2 ) and we tested whether there is a correlation between the endpoints, i.e., alkali-labile sites and DNA strand breaks on the one hand and the cell's response to DNA double-strand breaks and blocked replication forks on the other. Induction of γH2AX foci gave a linear dose response and all agents tested were positive in the assay. The increase in comet tail intensity was also a function of dose; however, mitomycin C was almost completely ineffective in the comet assay, and the doses needed to achieve a significant effect were somewhat higher for some treatments in the comet assay than in the γH2AX foci assay, which was confirmed by threshold analysis. There was high correlation between tail intensity and γH2AX foci for MMS and H 2 O 2 , less for MNNG, and none for mitomycin C. From this we infer that the γH2AX foci assay is more reliable, sensitive, and robust than the comet assay for detecting genotoxicant-induced DNA damage. Copyright © 2017 Elsevier

  19. Anxiety about starting three-shift work among female workers: findings from the Female Shift Workers' Health Study.

    Science.gov (United States)

    Kubo, Tatsuhiko; Maruyama, Takashi; Shirane, Kiyoyumi; Otomo, Hajime; Matsumoto, Tetsuro; Oyama, Ichiro

    2008-03-01

    In 1999, the Japanese Law on Equal Employment Opportunity and Conditions was amended and the previous prohibition of the assignment of female workers to night work was abolished. Subsequently, the number of female shift workers has been increasing in Japan, necessitating greater attention to the health care of this population. The aim of the current study is to evaluate the relationship between anxiety expressed about starting three-shift work and background characteristics among female workers who were being assigned to three-shift work for the first time. The subjects were 38 middle-aged female workers (age range: 44 to 59 years) who were working at a chemical plant. The women completed a self-administered questionnaire before starting three-shift work. Levels of anxiety about starting three-shift work were assessed by the question 'Do you feel anxious about starting three-shift work?' The available responses were: 'Very agree', 'Considerably agree', 'Rather agree', 'Slightly agree' and 'Not agree at all', and 63% of the subjects gave one of the first two answers, which were defined as indicating anxiety. We also acquired information regarding lifestyle and occupation for each subject, including the following factors: frequency of breakfast consumption, subjective sleep insufficiency, previous experience of similar work before beginning shift work, previous experience of two-shift work, and responsibility for household duties. In the study, we found a marginally statistically significant trend association between frequent breakfast consumption and anxiety about starting three-shift work (P(trend) = 0.09). Anxiety was also high among subjects with sleep disorders, especially those suffering from subjective sleep insufficiency (P = 0.08). Due to the small study population, these results should be interpreted with caution and confirmed by future studies.

  20. Galunisertib (LY2157299), a transforming growth factor-β receptor I kinase inhibitor, attenuates acute pancreatitis in rats

    Energy Technology Data Exchange (ETDEWEB)

    Liu, X. [Department of General Surgery, the Affiliated Hospital of Qingdao University, Qingdao (China); Department of General Surgery, People' s Hospital of Chengyang, Qingdao (China); Yu, M. [Department of Clinical Laboratory, the Women and Children' s Hospital of Qingdao, Qingdao (China); Chen, Y. [Department of Traditional Chinese Medicine, the Affiliated Hospital of Qingdao University, Qingdao (China); Zhang, J. [Department of General Surgery, the Affiliated Hospital of Qingdao University, Qingdao (China)

    2016-08-08

    Galunisertib (LY2157299), a selective ATP-mimetic inhibitor of TGF-β receptor I (TGF-βRI), is the only known TGF-β pathway inhibitor. In the present study, we investigated the effect of galunisertib on taurocholate (TAC)-induced acute pancreatitis (AP) in rats, and the role of TGF-β and NF-κB signaling pathways. AP was induced by infusion of TAC into the pancreatic duct of Sprague-Dawley male rats (n=30). The rats (220±50 g) were administered galunisertib intragastrically [75 mg·kg{sup -1}·day{sup -1} for 2 days (0 and 24 h)]. Serum IL-1β, IL-6, TNF-α, amylase (AMY), lipase (LIP), and myeloperoxidase (MPO) levels were measured by ELISA. NF-κB activity was detected by electrophoretic mobility shift assay (EMSA); NF-κBp65 and TGF-β1 proteins, as well as TGF-βRI and p-Smad2/3 proteins, were detected by western blot assay. Cell apoptosis was detected by TUNEL assay. H&E staining was used to evaluate the histopathological alterations of the pancreas. Galunisertib treatment attenuated the severity of AP and decreased the pancreatic histological score. In addition, number of apoptotic cells were significantly increased in the galunisertib-treated group (16.38±2.26) than in the AP group (8.14±1.27) and sham-operated group (1.82±0.73; P<0.05 and P<0.01, respectively). Galunisertib decreased the expression levels of TGF-βRI and p-Smad2/3 and inhibited NF-κB activation and p65 translocation compared with the sham-operated group. Furthermore, serum IL-1β, IL-6, TNF-α, AMY and LIP levels and tissue MPO activity were significantly decreased in the galunisertib-treated group. Our data demonstrate that galunisertib attenuates the severity of TAC-induced experimental AP in rats by inducing apoptosis in the pancreas, inhibiting the activation of TGF-β signals and NF-κB as well as the secretion of pro-inflammatory cytokines.

  1. Molecular Characterization of the Schistosoma mansoni Zinc Finger Protein SmZF1 as a Transcription Factor

    Science.gov (United States)

    D'Astolfo, Diego S.; Cardoso, Fernanda C.; Rajão, Matheus A.; Mourão, Marina M.; Gava, Elisandra; Oliveira, Sérgio C.; Macedo, Andréa M.; Machado, Carlos R.; Pena, Sérgio D. J.; Kitten, Gregory T.; Franco, Glória R.

    2009-01-01

    Background During its development, the parasite Schistosoma mansoni is exposed to different environments and undergoes many morphological and physiological transformations as a result of profound changes in gene expression. Characterization of proteins involved in the regulation of these processes is of importance for the understanding of schistosome biology. Proteins containing zinc finger motifs usually participate in regulatory processes and are considered the major class of transcription factors in eukaryotes. It has already been shown, by EMSA (Eletrophoretic Mobility Shift Assay), that SmZF1, a S. mansoni zinc finger (ZF) protein, specifically binds both DNA and RNA oligonucleotides. This suggests that this protein might act as a transcription factor in the parasite. Methodology/Principal Findings In this study we extended the characterization of SmZF1 by determining its subcellular localization and by verifying its ability to regulate gene transcription. We performed immunohistochemistry assays using adult male and female worms, cercariae and schistosomula to analyze the distribution pattern of SmZF1 and verified that the protein is mainly detected in the cells nuclei of all tested life cycle stages except for adult female worms. Also, SmZF1 was heterologously expressed in mammalian COS-7 cells to produce the recombinant protein YFP-SmZF1, which was mainly detected in the nucleus of the cells by confocal microscopy and Western blot assays. To evaluate the ability of this protein to regulate gene transcription, cells expressing YFP-SmZF1 were tested in a luciferase reporter system. In this system, the luciferase gene is downstream of a minimal promoter, upstream of which a DNA region containing four copies of the SmZF1 putative best binding site (D1-3DNA) was inserted. SmZF1 increased the reporter gene transcription by two fold (p≤0.003) only when its specific binding site was present. Conclusion Taken together, these results strongly support the hypothesis

  2. Using chemical shift perturbation to characterise ligand binding.

    Science.gov (United States)

    Williamson, Mike P

    2013-08-01

    Chemical shift perturbation (CSP, chemical shift mapping or complexation-induced changes in chemical shift, CIS) follows changes in the chemical shifts of a protein when a ligand is added, and uses these to determine the location of the binding site, the affinity of the ligand, and/or possibly the structure of the complex. A key factor in determining the appearance of spectra during a titration is the exchange rate between free and bound, or more specifically the off-rate koff. When koff is greater than the chemical shift difference between free and bound, which typically equates to an affinity Kd weaker than about 3μM, then exchange is fast on the chemical shift timescale. Under these circumstances, the observed shift is the population-weighted average of free and bound, which allows Kd to be determined from measurement of peak positions, provided the measurements are made appropriately. (1)H shifts are influenced to a large extent by through-space interactions, whereas (13)Cα and (13)Cβ shifts are influenced more by through-bond effects. (15)N and (13)C' shifts are influenced both by through-bond and by through-space (hydrogen bonding) interactions. For determining the location of a bound ligand on the basis of shift change, the most appropriate method is therefore usually to measure (15)N HSQC spectra, calculate the geometrical distance moved by the peak, weighting (15)N shifts by a factor of about 0.14 compared to (1)H shifts, and select those residues for which the weighted shift change is larger than the standard deviation of the shift for all residues. Other methods are discussed, in particular the measurement of (13)CH3 signals. Slow to intermediate exchange rates lead to line broadening, and make Kd values very difficult to obtain. There is no good way to distinguish changes in chemical shift due to direct binding of the ligand from changes in chemical shift due to allosteric change. Ligand binding at multiple sites can often be characterised, by

  3. Multicentre comparison of a diagnostic assay

    DEFF Research Database (Denmark)

    Waters, Patrick; Reindl, Markus; Saiz, Albert

    2016-01-01

    ) assays in neuromyelitis optica spectrum disorders (NMOSD). METHODS: Coded samples from patients with neuromyelitis optica (NMO) or NMOSD (101) and controls (92) were tested at 15 European diagnostic centres using 21 assays including live (n=3) or fixed cell-based assays (n=10), flow cytometry (n=4...

  4. Working the Night Shift: The Impact of Compensating Wages and Local Economic Conditions on Shift Choice

    OpenAIRE

    Colene Trent; Walter J. Mayer

    2014-01-01

    The theory of compensating differentials asserts that night shift workers should receive compensating wage differentials due to undesirable work conditions. In weak local economies, workers may have difficulty finding jobs; thus, these workers might be more likely to accept night shift work and be less concerned with the size of the compensating differential for night shifts. Using CPS data from 2001, this paper employs maximum likelihood estimation of an endogenous switching regression model...

  5. An ultrafiltration assay for lysyl oxidase

    International Nuclear Information System (INIS)

    Shackleton, D.R.; Hulmes, D.J.

    1990-01-01

    A modification of the original microdistillation assay for lysyl oxidase is described in which Amicon C-10 microconcentrators are used to separate, by ultrafiltration, the 3H-labeled products released from a [4,5-3H]-lysine-labeled elastin substrate. Enzyme activity is determined by scintillation counting of the ultrafiltrate, after subtraction of radioactivity released in the presence of beta-aminopropionitrile, a specific inhibitor of the enzyme. Conditions are described which optimize both the sensitivity and the efficient use of substrate. The assay shows linear inhibition of activity in up to 1 M urea; hence, as the enzyme is normally diluted in the assay, samples in 6 M urea can be assayed directly, without prior dialysis, and corrected for partial inhibition. Comparable results are obtained when enzyme activity is assayed by ultrafiltration or microdistillation. The assay is simple and convenient and, by using disposable containers throughout, it eliminates the need for time-consuming decontamination of radioactive glassware

  6. Chemical shift-dependent apparent scalar couplings: An alternative concept of chemical shift monitoring in multi-dimensional NMR experiments

    International Nuclear Information System (INIS)

    Kwiatkowski, Witek; Riek, Roland

    2003-01-01

    The paper presents an alternative technique for chemical shift monitoring in a multi-dimensional NMR experiment. The monitored chemical shift is coded in the line-shape of a cross-peak through an apparent residual scalar coupling active during an established evolution period or acquisition. The size of the apparent scalar coupling is manipulated with an off-resonance radio-frequency pulse in order to correlate the size of the coupling with the position of the additional chemical shift. The strength of this concept is that chemical shift information is added without an additional evolution period and accompanying polarization transfer periods. This concept was incorporated into the three-dimensional triple-resonance experiment HNCA, adding the information of 1 H α chemical shifts. The experiment is called HNCA coded HA, since the chemical shift of 1 H α is coded in the line-shape of the cross-peak along the 13 C α dimension

  7. Doppler interpretation of quasar red shifts.

    Science.gov (United States)

    Zapolsky, H S

    1966-08-05

    The hypothesis that the quasistellar sources (quasars) are local objects moving with velocities close to the speed of light is examined. Provided there is no observational cutoff on apparent bolometric magnitude for the quasars, the transverse Doppler effect leads to the expectation of fewer blue shifts than red shifts for an isotropic distribution of velocities. Such a distribution also yields a function N(z), the number of objects with red shift less than z which is not inconsistent with the present data. On the basis of two extreme assumptions concerning the origin of such rapidly moving sources, we computed curves of red shift plotted against magnitude. In particular, the curve obtained on the assumption that the quasars originated from an explosion in or nearby our own galaxy is in as good agreement with the observations as the curve of cosmological red shift plotted against magnitude.

  8. Goos-Haenchen shift in complex crystals

    Energy Technology Data Exchange (ETDEWEB)

    Longhi, Stefano; Della Valle, Giuseppe; Staliunas, Kestutis [Dipartimento di Fisica, Politecnico di Milano, Piazza Leonardo da Vinci 32, I-20133 Milano (Italy); Departament de Fisica i Enginyeria Nuclear, Instituci Catalana de Recerca i Estudis Avanats (ICREA), Universitat Politcnica de Catalunya, Colom 11, E-08222 Terrassa, Barcelona (Spain)

    2011-10-15

    The Goos-Haenchen (GH) effect for wave scattering from complex PT-symmetric periodic potentials (complex crystals) is theoretically investigated, with specific reference to optical GH shift in photonic crystal slabs with a sinusoidal periodic modulation of both real and imaginary parts of the dielectric constant. The analysis highlights some distinct and rather unique features as compared to the GH shift found in ordinary crystals. In particular, as opposed to GH shift in ordinary crystals, which is large at the band gap edges, in complex crystals the GH shift can be large inside the reflection (amplification) band and becomes extremely large as the PT symmetry-breaking threshold is approached.

  9. Optimal control of the gear shifting process for shift smoothness in dual-clutch transmissions

    Science.gov (United States)

    Li, Guoqiang; Görges, Daniel

    2018-03-01

    The control of the transmission system in vehicles is significant for the driving comfort. In order to design a controller for smooth shifting and comfortable driving, a dynamic model of a dual-clutch transmission is presented in this paper. A finite-time linear quadratic regulator is proposed for the optimal control of the two friction clutches in the torque phase for the upshift process. An integral linear quadratic regulator is introduced to regulate the relative speed difference between the engine and the slipping clutch under the optimization of the input torque during the inertia phase. The control objective focuses on smoothing the upshift process so as to improve the driving comfort. Considering the available sensors in vehicles for feedback control, an observer design is presented to track the immeasurable variables. Simulation results show that the jerk can be reduced both in the torque phase and inertia phase, indicating good shift performance. Furthermore, compared with conventional controllers for the upshift process, the proposed control method can reduce shift jerk and improve shift quality.

  10. Serratia marcescens arn, a PhoP-Regulated Locus Necessary for Polymyxin B Resistance

    Science.gov (United States)

    Lin, Quei Yen; Tsai, Yi-Lin; Liu, Ming-Che; Lin, Wei-Cheng; Hsueh, Po-Ren

    2014-01-01

    Polymyxins, which are increasingly being used to treat infections caused by multidrug-resistant bacteria, perform poorly against Serratia marcescens. To investigate the underlying mechanisms, Tn5 mutagenesis was performed and two mutants exhibiting increased polymyxin B (PB) susceptibility were isolated. The mutants were found to have Tn5 inserted into the arnB and arnC genes. In other bacteria, arnB and arnC belong to the seven-gene arn operon, which is involved in lipopolysaccharide (LPS) modification. LPSs of arn mutants had greater PB-binding abilities than that of wild-type LPS. Further, we identified PhoP, a bacterial two-component response regulator, as a regulator of PB susceptibility in S. marcescens. By the reporter assay, we found PB- and low-Mg2+-induced expression of phoP and arn in the wild-type strain but not in the phoP mutant. Complementation of the phoP mutant with the full-length phoP gene restored the PB MIC and induction by PB and low Mg2+ levels, as in the wild type. An electrophoretic mobility shift assay (EMSA) further demonstrated that PhoP bound directly to the arn promoter. The PB challenge test confirmed that pretreatment with PB and low Mg2+ levels protected S. marcescens from a PB challenge in the wild-type strain but not in the phoP mutant. Real-time reverse transcriptase-PCR also indicated that PB serves as a signal to regulate expression of ugd, a gene required for LPS modification, in S. marcescens through a PhoP-dependent pathway. Finally, we found that PB-resistant clinical isolates displayed greater expression of arnA upon exposure to PB than did susceptible isolates. This is the first report to describe the role of S. marcescens arn in PB resistance and its modulation by PB and Mg2+ through the PhoP protein. PMID:24957827

  11. New PAH gene promoter KLF1 and 3'-region C/EBPalpha motifs influence transcription in vitro.

    Science.gov (United States)

    Klaassen, Kristel; Stankovic, Biljana; Kotur, Nikola; Djordjevic, Maja; Zukic, Branka; Nikcevic, Gordana; Ugrin, Milena; Spasovski, Vesna; Srzentic, Sanja; Pavlovic, Sonja; Stojiljkovic, Maja

    2017-02-01

    Phenylketonuria (PKU) is a metabolic disease caused by mutations in the phenylalanine hydroxylase (PAH) gene. Although the PAH genotype remains the main determinant of PKU phenotype severity, genotype-phenotype inconsistencies have been reported. In this study, we focused on unanalysed sequences in non-coding PAH gene regions to assess their possible influence on the PKU phenotype. We transiently transfected HepG2 cells with various chloramphenicol acetyl transferase (CAT) reporter constructs which included PAH gene non-coding regions. Selected non-coding regions were indicated by in silico prediction to contain transcription factor binding sites. Furthermore, electrophoretic mobility shift assay (EMSA) and supershift assays were performed to identify which transcriptional factors were engaged in the interaction. We found novel KLF1 motif in the PAH promoter, which decreases CAT activity by 50 % in comparison to basal transcription in vitro. The cytosine at the c.-170 promoter position creates an additional binding site for the protein complex involving KLF1 transcription factor. Moreover, we assessed for the first time the role of a multivariant variable number tandem repeat (VNTR) region located in the 3'-region of the PAH gene. We found that the VNTR3, VNTR7 and VNTR8 constructs had approximately 60 % of CAT activity. The regulation is mediated by the C/EBPalpha transcription factor, present in protein complex binding to VNTR3. Our study highlighted two novel promoter KLF1 and 3'-region C/EBPalpha motifs in the PAH gene which decrease transcription in vitro and, thus, could be considered as PAH expression modifiers. New transcription motifs in non-coding regions will contribute to better understanding of the PKU phenotype complexity and may become important for the optimisation of PKU treatment.

  12. Thyroid hormone receptor inhibits hepatoma cell migration through transcriptional activation of Dickkopf 4

    Energy Technology Data Exchange (ETDEWEB)

    Chi, Hsiang-Cheng; Liao, Chen-Hsin [Department of Biochemistry, School of Medicine, Chang-Gung University, Taoyuan 333, Taiwan, ROC (China); Huang, Ya-Hui [Medical Research Central, Chang Gung Memorial Hospital, Taoyuan 333, Taiwan, ROC (China); Wu, Sheng-Ming; Tsai, Chung-Ying; Liao, Chia-Jung; Tseng, Yi-Hsin; Lin, Yang-Hsiang; Chen, Cheng-Yi; Chung, I-Hsiao; Wu, Tzu-I [Department of Biochemistry, School of Medicine, Chang-Gung University, Taoyuan 333, Taiwan, ROC (China); Chen, Wei-Jan [First Cardiovascular Division, Chang Gung Memorial Hospital, Taoyuan 333, Taiwan, ROC (China); Lin, Kwang-Huei, E-mail: khlin@mail.cgu.edu.tw [Department of Biochemistry, School of Medicine, Chang-Gung University, Taoyuan 333, Taiwan, ROC (China)

    2013-09-13

    Highlights: •T{sub 3} affects DKK4 mRNA and protein expression in HepG2-TR cells. •Regulation of DKK4 by T{sub 3} is at transcriptional level. •DKK4 overexpression suppresses hepatoma cell metastasis. -- Abstract: Triiodothyronine (T{sub 3}) is a potent form of thyroid hormone mediates several physiological processes including cellular growth, development, and differentiation via binding to the nuclear thyroid hormone receptor (TR). Recent studies have demonstrated critical roles of T{sub 3}/TR in tumor progression. Moreover, long-term hypothyroidism appears to be associated with the incidence of human hepatocellular carcinoma (HCC), independent of other major HCC risk factors. Dickkopf (DKK) 4, a secreted protein that antagonizes the canonical Wnt signaling pathway, is induced by T{sub 3} at both mRNA and protein levels in HCC cell lines. However, the mechanism underlying T{sub 3}-mediated regulation of DKK4 remains unknown. In the present study, the 5′ promoter region of DKK4 was serially deleted, and the reporter assay performed to localize the T{sub 3} response element (TRE). Consequently, we identified an atypical direct repeat TRE between nucleotides −1645 and −1629 conferring T{sub 3} responsiveness to the DKK4 gene. This region was further validated using chromatin immunoprecipitation (ChIP) and electrophoretic mobility shift assay (EMSA). Stable DKK4 overexpression in SK-Hep-1 cells suppressed cell invasion and metastatic potential, both in vivo andin vitro, via reduction of matrix metalloproteinase-2 (MMP-2) expression. Our findings collectively suggest that DKK4 upregulated by T{sub 3}/TR antagonizes the Wnt signal pathway to suppress tumor cell progression, thus providing new insights into the molecular mechanism underlying thyroid hormone activity in HCC.

  13. Expression of the alaE gene is positively regulated by the global regulator Lrp in response to intracellular accumulation of l-alanine in Escherichia coli.

    Science.gov (United States)

    Ihara, Kohei; Sato, Kazuki; Hori, Hatsuhiro; Makino, Yumiko; Shigenobu, Shuji; Ando, Tasuke; Isogai, Emiko; Yoneyama, Hiroshi

    2017-04-01

    The alaE gene in Escherichia coli encodes an l-alanine exporter that catalyzes the active export of l-alanine using proton electrochemical potential. In our previous study, alaE expression was shown to increase in the presence of l-alanyl-l-alanine (Ala-Ala). In this study, the global regulator leucine-responsive regulatory protein (Lrp) was identified as an activator of the alaE gene. A promoter less β-galactosidase gene was fused to an alaE upstream region (240 nucleotides). Cells that were lacZ-deficient and harbored this reporter plasmid showed significant induction of β-galactosidase activity (approximately 17-fold) in the presence of 6 mM l-alanine, l-leucine, and Ala-Ala. However, a reporter plasmid possessing a smaller alaE upstream region (180 nucleotides) yielded transformants with strikingly low enzyme activity under the same conditions. In contrast, lrp-deficient cells showed almost no β-galactosidase induction, indicating that Lrp positively regulates alaE expression. We next performed an electrophoretic mobility shift assay (EMSA) and a DNase I footprinting assay using purified hexahistidine-tagged Lrp (Lrp-His). Consequently, we found that Lrp-His binds to the alaE upstream region spanning nucleotide -161 to -83 with a physiologically relevant affinity (apparent K D , 288.7 ± 83.8 nM). Furthermore, the binding affinity of Lrp-His toward its cis-element was increased by l-alanine and l-leucine, but not by Ala-Ala and d-alanine. Based on these results, we concluded that the gene expression of the alaE is regulated by Lrp in response to intracellular levels of l-alanine, which eventually leads to intracellular homeostasis of l-alanine concentrations. Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  14. N-terminal and C-terminal heparin-binding domain polypeptides derived from fibronectin reduce adhesion and invasion of liver cancer cells

    International Nuclear Information System (INIS)

    Tang, Nan-Hong; Chen, Yan-Lin; Wang, Xiao-Qian; Li, Xiu-Jin; Wu, Yong; Zou, Qi-Lian; Chen, Yuan-Zhong

    2010-01-01

    Fibronectin (FN) is known to be a large multifunction glycoprotein with binding sites for many substances, including N-terminal and C-terminal heparin-binding domains. We investigated the effects of highly purified rhFNHN29 and rhFNHC36 polypeptides originally cloned from the two heparin-binding domains on the adhesion and invasion of highly metastatic human hepatocellular carcinoma cells (MHCC97H) and analyzed the underlying mechanism involved. The MHCC97H cells that adhered to FN in the presence of various concentrations of rhFNHN29 and rhFNHC36 polypeptides were stained with crystal violet and measured, and the effects of rhFNHN29 and rhFNHC36 on the invasion of the MHCC97H cells were then detected using the Matrigel invasion assay as well as a lung-metastasis mouse model. The expression level of integrins and focal adhesion kinase (FAK) phosphotyrosyl protein was examined by Western blot, and the activity of matrix metalloproteinases (MMPs) and activator protein 1 (AP-1) was analyzed by gelatin zymography and the electrophoretic mobility band-shift assay (EMSA), respectively. Both of the polypeptides rhFNHN29 and rhFNHC36 inhibited adhesion and invasion of MHCC97H cells; however, rhFNHC36 exhibited inhibition at a lower dose than rhFNHN29. These inhibitory effects were mediated by integrin αvβ3 and reversed by a protein tyrosine phosphatase inhibitor. Polypeptides rhFNHN29 and rhFNHC36 abrogated the tyrosine phosphorylation of focal adhesion kinase (p-FAK) and activation of activator protein 1 (AP-1), resulting in the decrease of integrin αv, β3 and β1 expression as well as the reduction of MMP-9 activity. Polypeptides rhFNHN29 and rhFNHC36 could potentially be applicable to human liver cancer as anti-adhesive and anti-invasive agents

  15. Promoter methylation inhibits BRD7 expression in human nasopharyngeal carcinoma cells

    International Nuclear Information System (INIS)

    Liu, Huaying; Li, Guiyuan; Zhang, Liming; Niu, Zhaoxia; Zhou, Ming; Peng, Cong; Li, Xiayu; Deng, Tan; Shi, Lei; Tan, Yixin

    2008-01-01

    Nasopharyngeal carcinoma (NPC) is a head and neck malignancy with high occurrence in South-East Asia and Southern China. Recent findings suggest that epigenetic inactivation of multiple tumor suppressor genes plays an important role in the tumourigenesis of NPC. BRD7 is a NPC-associated bromodomain gene that exhibits a much higher-level of mRNA expression in normal than in NPC biopsies and cell lines. In this study, we explored the role of DNA methylation in regulation of BRD7 transcription. The presence of CpG islands within BRD7 promoter was predicted by EMBOSS CpGplot and Softberry CpGFinder, respectively. Nested methylation-specific PCR and RT-PCR were employed to detect the methylation status of BRD7 promoter and the mRNA expression of BRD7 gene in tumor cell lines as well as clinical samples. Electrophoretic mobility shift assays (EMSA) and luciferase assay were used to detect the effects of cytosine methylation on the nuclear protein binding to BRD7 promoter. We found that DNA methylation suppresses BRD7 expression in NPC cells. In vitro DNA methylation in NPC cells silenced BRD7 promoter activity and inhibited the binding of the nuclear protein (possibly Sp1) to Sp1 binding sites in the BRD7 promoter. In contrast, inhibition of DNA methylation augments induction of endogenous BRD7 mRNA in NPC cells. We also found that methylation frequency of BRD7 promoter is much higher in the tumor and matched blood samples from NPC patients than in the blood samples from normal individuals. BRD7 promoter demethylation is a prerequisite for high level induction of BRD7 gene expression. DNA methylation of BRD7 promoter might serve as a diagnostic marker in NPC

  16. Orphan nuclear receptor Nur77 is a novel negative regulator of endothelin-1 expression in vascular endothelial cells.

    Science.gov (United States)

    Qin, Qing; Chen, Ming; Yi, Bing; You, Xiaohua; Yang, Ping; Sun, Jianxin

    2014-12-01

    Endothelin-1 (ET-1) produced by vascular endothelial cells plays essential roles in the regulation of vascular tone and development of cardiovascular diseases. The objective of this study is to identify novel regulators implicated in the regulation of ET-1 expression in vascular endothelial cells (ECs). By using quantitative real-time PCR (qRT-PCR) and enzyme-linked immunosorbent assay (ELISA), we show that either ectopic expression of orphan nuclear receptor Nur77 or pharmacological activation of Nur77 by 6-mercaptopurine (6-MP) substantially inhibits ET-1 expression in human umbilical vein endothelial cells (HUVECs), under both basal and thrombin-stimulated conditions. Furthermore, thrombin-stimulated ET expression is significantly augmented in both Nur77 knockdown ECs and aort from Nur77 knockout mice, suggesting that Nur77 is a negative regulator of ET-1 expression. Inhibition of ET-1 expression by Nur77 occurs at gene transcriptional levels, since Nur77 potently inhibits ET-1 promoter activity, without affecting ET-1 mRNA stability. As shown in electrophoretic mobility shift assay (EMSA), Nur77 overexpression markedly inhibits both basal and thrombin-stimulated transcriptional activity of AP-1. Mechanistically, we demonstrate that Nur77 specially interacts with c-Jun and inhibits AP-1 dependent c-Jun promoter activity, which leads to a decreased expression of c-Jun, a critical component involved in both AP-1 transcriptional activity and ET-1 expression in ECs. These findings demonstrate that Nur77 is a novel negative regulator of ET-1 expression in vascular ECs through an inhibitory interaction with the c-Jun/AP-1 pathway. Activation of Nur77 may represent a useful therapeutic strategy for preventing certain cardiovascular diseases, such as atherosclerosis and pulmonary artery hypertension. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Radioreceptor assay for insulin

    Energy Technology Data Exchange (ETDEWEB)

    Suzuki, Kazuo [Tokyo Univ. (Japan). Faculty of Medicine

    1975-04-01

    Radioreceptor assay of insulin was discussed from the aspects of the measuring method, its merits and problems to be solved, and its clinical application. Rat liver 10 x g pellet was used as receptor site, and enzymatic degradation of insulin by the system contained in this fraction was inhibited by adding 1 mM p-CMB. /sup 125/I-labelled porcine insulin was made by lactoperoxidase method under overnight incubation at 4/sup 0/C and later purification by Sephadex G-25 column and Whatman CF-11 cellulose powder. Dog pancreatic vein serum insulin during and after the glucose load was determined by radioreceptor assay and radioimmunoassay resulting that both measurements accorded considerably. Radioreceptor assay would clarify the pathology of disorders of glucose metabolism including diabetes.

  18. Temporal dynamics of circadian phase shifting response to consecutive night shifts in healthcare workers: role of light-dark exposure.

    Science.gov (United States)

    Stone, Julia E; Sletten, Tracey L; Magee, Michelle; Ganesan, Saranea; Mulhall, Megan D; Collins, Allison; Howard, Mark; Lockley, Steven W; Rajaratnam, Shantha M W

    2018-03-28

    Shift work is highly prevalent and is associated with significant adverse health impacts. There is substantial inter-individual variability in the way the circadian clock responds to changing shift cycles. The mechanisms underlying this variability are not well understood. We tested the hypothesis that light-dark exposure is a significant contributor to this variability; when combined with diurnal preference, the relative timing of light exposure accounted for 71% of individual variability in circadian phase response to night shift work. These results will drive development of personalised approaches to manage circadian disruption among shift workers and other vulnerable populations to potentially reduce the increased risk of disease in these populations. Night shift workers show highly variable rates of circadian adaptation. This study examined the relationship between light exposure patterns and the magnitude of circadian phase resetting in response to night shift work. In 21 participants (nursing and medical staff in an intensive care unit) circadian phase was measured using 6-sulphatoxymelatonin at baseline (day/evening shifts or days off) and after 3-4 consecutive night shifts. Daily light exposure was examined relative to individual circadian phase to quantify light intensity in the phase delay and phase advance portions of the light phase response curve (PRC). There was substantial inter-individual variability in the direction and magnitude of phase shift after three or four consecutive night shifts (mean phase delay -1:08 ± 1:31 h; range -3:43 h delay to +3:07 h phase advance). The relative difference in the distribution of light relative to the PRC combined with diurnal preference accounted for 71% of the variability in phase shift. Regression analysis incorporating these factors estimated phase shift to within ±60 min in 85% of participants. No participants met criteria for partial adaptation to night work after three or four consecutive night

  19. Nano-immunosafety: issues in assay validation

    International Nuclear Information System (INIS)

    Boraschi, Diana; Italiani, Paola; Oostingh, Gertie J; Duschl, Albert; Casals, Eudald; Puntes, Victor F; Nelissen, Inge

    2011-01-01

    Assessing the safety of engineered nanomaterials for human health must include a thorough evaluation of their effects on the immune system, which is responsible for defending the integrity of our body from damage and disease. An array of robust and representative assays should be set up and validated, which could be predictive of the effects of nanomaterials on immune responses. In a trans-European collaborative work, in vitro assays have been developed to this end. In vitro tests have been preferred for their suitability to standardisation and easier applicability. Adapting classical assays to testing the immunotoxicological effects of nanoparticulate materials has raised a series of issues that needed to be appropriately addressed in order to ensure reliability of results. Besides the exquisitely immunological problem of selecting representative endpoints predictive of the risk of developing disease, assay results turned out to be significantly biased by artefactual interference of the nanomaterials or contaminating agents with the assay protocol. Having addressed such problems, a series of robust and representative assays have been developed that describe the effects of engineered nanoparticles on professional and non-professional human defence cells. Two of such assays are described here, one based on primary human monocytes and the other employing human lung epithelial cells transfected with a reporter gene.

  20. Data transformation methods for multiplexed assays

    Science.gov (United States)

    Tammero, Lance F. Bentley; Dzenitis, John M; Hindson, Benjamin J

    2013-07-23

    Methods to improve the performance of an array assay are described. A correlation between fluorescence intensity-related parameters and negative control values of the assay is determined. The parameters are then adjusted as a function of the correlation. As a result, sensitivity of the assay is improved without changes in its specificity.

  1. Understanding and controlling chromaticity shift in LED devices

    Energy Technology Data Exchange (ETDEWEB)

    Davis, Lynn; Mills, Karmann; Lamvik, Michael; Perkins, Curtis; Bobashev, Georgiy; Young, Joseph; Yaga, Robert; Johnson, Cortina

    2017-05-30

    Chromaticity shift in light-emitting diode (LED) devices arises from multiple mechanisms, and at least five different chromaticity shift modes (CSMs) have been identified to date. This paper focuses on the impacts of irreversible phosphor degradation as a cause of chromaticity shifts in LED devices. The nitride phosphors used to produce warm white LEDs are especially vulnerable to degradation due to thermal and chemical effects such as reactions with oxygen and water. As a result, LED devices utilizing these phosphors were found to undergo either a green shift or, less commonly, a red shift depending on the phosphor mix in the LED devices. These types of chromaticity shifts are classified as CSM-2 (green shift) and CSM-5 (red shift). This paper provides an overview of the kinetic processes responsible for green and red chromaticity shifts along with examples from accelerated stress testing of 6” downlights. Both CSMs appear to proceed through analogous mechanisms that are initiated at the surface of the phosphor. A green shift is produced by the surface oxidation of the nitride phosphor that changes the emission profile to lower wavelengths. As the surface oxidation reaction proceeds, reactant limitations slow the rate and bulk oxidation processes become more prevalent. We found that a red chromaticity shift arises from quenching of the green phosphor, also possibly due to surface reactions of oxygen, which shift the emission chromaticity in the red direction. In conclusion, we discuss the implications of these findings on projecting chromaticity.

  2. The development of shifting radioactive material

    International Nuclear Information System (INIS)

    Chen Haiteng; Chen Yonghong; Yin Fujun; Che Mingsheng; Hu Xiaodan; Yao Shouzhong

    2010-01-01

    In nuclear field, When the nuclear material shifting from the glove-box,use the technology of plastic welding package in accordance with tradition. There are some defects in this technology because of the plastic character, such as package pierced easily, wrapper not fitted storage for long term, etc. Because of this limit. Plastic shifting technology is only fit for shifting radwaste and nuclear material not need storage from radioactive close area to non-radioactive open area for long term.As the nuclear material exiting leak when shifting in plastic package,and the plastic material don't meet the need of storaging safely for long term.We research into a new technology of nuclear material shifting. When nuclear material is carried out from the glove box. It should be sealed by welding case, then it can be storaged safely for long term. At the same time, nuclear material wouldn't pollute the glove box outside.The study achieved well effect in apply. (authors)

  3. Association between rotating night shift work and metabolic syndrome in Korean workers: differences between 8-hour and 12-hour rotating shift work.

    Science.gov (United States)

    Oh, Jae-Il; Yim, Hyeon Woo

    2018-02-07

    This study aimed to analyze the association between the shift work schedule and metabolic syndrome (MetS). This is a retrospective longitudinal study based on the 2015 health checkup data of 2,090 workers evaluated for MetS in 2010 at a general hospital in Korea. The participants were divided according to their shift work schedule into daytime, three-shift (8-h rotation), and two-shift (12-h rotation) workers. The index that indicates the association between the shift work schedule and MetS is the odds ratio (OR) calculated using multivariate logistic regression. The analysis for the entire group of workers indicated that there was positive association between two-shift rotation and MetS (OR=1.58, 95% confidence interval [CI]: 1.09, 2.29). In the analysis of rotating night-shift workers, the years of rotating night shifts, frequency of night-shift work, and sleep disturbance were added to the confounding variables, and two-shift work remained positively associated with MetS (OR=1.72, 95% CI: 1.10, 2.70). The risk of MetS differs based on the shift work schedules they engage in. Hence, structural changes to the shift work schedules are required to prevent MetS in night-shift workers.

  4. Shift work and age in the offshore petroleum industry

    OpenAIRE

    Waage, Siri; Pallesen, Ståle; Moen, Bente Elisabeth; Bjorvatn, Bjørn

    2010-01-01

    Background. Shift work is associated with sleep and health problems. Tolerance to shift work is reported to decrease with age. Shift work tolerance should be considered in different shift work populations. The aim of the study was to examine the relationship between age, shift work exposure, shift type, and morningness and sleep/health problems in oil rig shift workers. Material and methods. A total of 199 workers participated. They worked either two weeks of 12-h day shifts (n = 96) or tw...

  5. Flexible Schedules and Shift Work.

    Science.gov (United States)

    Beers, Thomas M.

    2000-01-01

    Flexible work hours have gained prominence, as more than 25 million workers (27.6% of all full-time workers) can now vary their schedules. However, there has been little change since the mid-1980s in the proportion who work a shift other than a regular daytime shift. (JOW)

  6. Ecosystem regime shifts disrupt trophic structure.

    Science.gov (United States)

    Hempson, Tessa N; Graham, Nicholas A J; MacNeil, M Aaron; Hoey, Andrew S; Wilson, Shaun K

    2018-01-01

    Regime shifts between alternative stable ecosystem states are becoming commonplace due to the combined effects of local stressors and global climate change. Alternative states are characterized as substantially different in form and function from pre-disturbance states, disrupting the delivery of ecosystem services and functions. On coral reefs, regime shifts are typically characterized by a change in the benthic composition from coral to macroalgal dominance. Such fundamental shifts in the benthos are anticipated to impact associated fish communities that are reliant on the reef for food and shelter, yet there is limited understanding of how regime shifts propagate through the fish community over time, relative to initial or recovery conditions. This study addresses this knowledge gap using long-term data of coral reef regime shifts and recovery on Seychelles reefs following the 1998 mass bleaching event. It shows how trophic structure of the reef fish community becomes increasingly dissimilar between alternative reef ecosystem states (regime-shifted vs. recovering) with time since disturbance. Regime-shifted reefs developed a concave trophic structure, with increased biomass in base trophic levels as herbivorous species benefitted from increased algal resources. Mid trophic level species, including specialists such as corallivores, declined with loss of coral habitat, while biomass was retained in upper trophic levels by large-bodied, generalist invertivores. Recovering reefs also experienced an initial decline in mid trophic level biomass, but moved toward a bottom-heavy pyramid shape, with a wide range of feeding groups (e.g., planktivores, corallivores, omnivores) represented at mid trophic levels. Given the importance of coral reef fishes in maintaining the ecological function of coral reef ecosystems and their associated fisheries, understanding the effects of regime shifts on these communities is essential to inform decisions that enhance ecological

  7. Development of a loop-mediated isothermal amplification (LAMP) assay for rapid screening of ticks and fleas for spotted fever group rickettsia.

    Science.gov (United States)

    Noden, Bruce H; Martin, Jaclyn; Carrillo, Yisel; Talley, Justin L; Ochoa-Corona, Francisco M

    2018-01-01

    The importance of tick and flea-borne rickettsia infections is increasingly recognized worldwide. While increased focus has shifted in recent years to the development of point-of-care diagnostics for various vector-borne diseases in humans and animals, little research effort has been devoted to their integration into vector surveillance and control programs, particularly in resource-challenged countries. One technology which may be helpful for large scale vector surveillance initiatives is loop-mediated isothermal amplification (LAMP). The aim of this study was to develop a LAMP assay to detect spotted fever group (SFG) rickettsia DNA from field-collected ticks and fleas and compare with published end-point PCR results. A Spotted Fever Group rickettsia-specific loop-mediated isothermal amplification (SFGR-LAMP) assay was developed using primers based on a region of the R. rickettsii 17kDa protein gene. The sensitivity, specificity, and reproducibility of the assay were evaluated. The assay was then compared with the results of end-point PCR assays for pooled tick and flea samples obtained from field-based surveillance studies. The sensitivity of the SFGR-LAMP assay was 0.00001 ng/μl (25μl volume) which was 10 times more sensitive than the 17kDa protein gene end-point PCR used as the reference method. The assay only recognized gDNA from SFG and transitional group (TRG) rickettsia species tested but did not detect gDNA from typhus group (TG) rickettsia species or closely or distantly related bacterial species. The SFGR-LAMP assay detected the same positives from a set of pooled tick and flea samples detected by end-point PCR in addition to two pooled flea samples not detected by end-point PCR. To our knowledge, this is the first study to develop a functional LAMP assay to initially screen for SFG and TRG rickettsia pathogens in field-collected ticks and fleas. With a high sensitivity and specificity, the results indicate the potential use as a field

  8. Spectrophotometric Enzyme Assays for High-Throughput Screening

    Directory of Open Access Journals (Sweden)

    Jean-Louis Reymond

    2004-01-01

    Full Text Available This paper reviews high-throughput screening enzyme assays developed in our laboratory over the last ten years. These enzyme assays were initially developed for the purpose of discovering catalytic antibodies by screening cell culture supernatants, but have proved generally useful for testing enzyme activities. Examples include TLC-based screening using acridone-labeled substrates, fluorogenic assays based on the β-elimination of umbelliferone or nitrophenol, and indirect assays such as the back-titration method with adrenaline and the copper-calcein fluorescence assay for aminoacids.

  9. Identification of RNAIII-binding proteins in Staphylococcus aureus using tethered RNAs and streptavidin aptamers based pull-down assay.

    Science.gov (United States)

    Zhang, Xu; Zhu, Qing; Tian, Tian; Zhao, Changlong; Zang, Jianye; Xue, Ting; Sun, Baolin

    2015-05-15

    It has been widely recognized that small RNAs (sRNAs) play important roles in physiology and virulence control in bacteria. In Staphylococcus aureus, many sRNAs have been identified and some of them have been functionally studied. Since it is difficult to identify RNA-binding proteins (RBPs), very little has been known about the RBPs in S. aureus, especially those associated with sRNAs. Here we adopted a tRNA scaffold streptavidin aptamer based pull-down assay to identify RBPs in S. aureus. The tethered RNA was successfully captured by the streptavidin magnetic beads, and proteins binding to RNAIII were isolated and analyzed by mass spectrometry. We have identified 81 proteins, and expressed heterologously 9 of them in Escherichia coli. The binding ability of the recombinant proteins with RNAIII was further analyzed by electrophoresis mobility shift assay, and the result indicates that proteins CshA, RNase J2, Era, Hu, WalR, Pyk, and FtsZ can bind to RNAIII. This study suggests that some proteins can bind to RNA III in S. aureus, and may be involved in RNA III function. And tRSA based pull-down assay is an effective method to search for RBPs in bacteria, which should facilitate the identification and functional study of RBPs in diverse bacterial species.

  10. Radioenzymatic assay of DOPA (3,4-dihydroxyphenylalanine)

    International Nuclear Information System (INIS)

    Johnson, G.A.; Gren, J.M.; Kupiecki, R.

    1978-01-01

    We modified the single-isotope radioenzymatic assay for catecholamines [Life Sci. 21, 625(1977)] to assay 3,4-dihydroxyphenylalanine (DOPA). DOPA decarboxylase is used to convert DOPA to dopamine, which concurrently is converted to [ 3 H]-3-O-methyldopamine in the presence of catechol-O-methyltransferase and [methyl- 3 H]-S-adenosylmethionine and assayed radioenzymatically. For assay of plasma DOPA, 50 μl of untreated plasma is added directly into the incubation mixture. A duplicate mixture containing an internal standard requires a second 50-μl aliquot of plasma. Because the assay measures both DOPA and endogenous dopamine, two additional aliquots of plasma must be assayed for dopamine in the absence of the decarboxylase by the differential assay; DOPA is estimated by difference. The assay is sensitive to 25 pg (500 ng/liter of plasma). Analysis of DOPA (DOPA plus dopamine) and the concurrent differential assay of catecholamines in at least 10 samples can be done in a single working day. Plasma DOPA concentrations for 42 normotensive adults were 1430 +- 19 ng/liter (mean +- SEM). In contrast, dopamine concentrations for these same subjects averaged 23 +- 20 ng/liter. Values for the 24 women subjects (1510 +- 62 ng/liter) significantly (P = 0.04) exceeded those for the men

  11. RAS - Screens & Assays - Drug Discovery

    Science.gov (United States)

    The RAS Drug Discovery group aims to develop assays that will reveal aspects of RAS biology upon which cancer cells depend. Successful assay formats are made available for high-throughput screening programs to yield potentially effective drug compounds.

  12. Achieving excellence on shift through teamwork

    International Nuclear Information System (INIS)

    Newman, L.

    1988-01-01

    Anyone familiar with the nuclear industry realizes the importance of operators. Operators can achieve error-free plant operations, i.e., excellence on shift through teamwork. As a shift supervisor (senior reactor operator/shift technical advisor) the author went through the plant's first cycle of operations with no scrams and no equipment damaged by operator error, having since changed roles (and companies) to one of assessing plant operations. This change has provided the opportunity to see objectively the importance of operators working together and of the team building and teamwork that contribute to the shift's success. This paper uses examples to show the effectiveness of working together and outlines steps for building a group of operators into a team

  13. The fluorometric microculture cytotoxicity assay.

    Science.gov (United States)

    Lindhagen, Elin; Nygren, Peter; Larsson, Rolf

    2008-01-01

    The fluorometric microculture cytotoxicity assay (FMCA) is a nonclonogenic microplate-based cell viability assay used for measurement of the cytotoxic and/or cytostatic effect of different compounds in vitro. The assay is based on hydrolysis of the probe, fluorescein diacetate (FDA) by esterases in cells with intact plasma membranes. The assay is available as both a semiautomated 96-well plate setup and a 384-well plate version fully adaptable to robotics. Experimental plates are prepared with a small amount of drug solution and can be stored frozen. Cells are seeded on the plates and cell viability is evaluated after 72 h. The protocol described here is applicable both for cell lines and freshly prepared tumor cells from patients and is suitable both for screening in drug development and as a basis for a predictive test for individualization of anticancer drug therapy.

  14. Solution assay instrument operations manual

    International Nuclear Information System (INIS)

    Li, T.K.; Marks, T.; Parker, J.L.

    1983-09-01

    An at-line solution assay instrument (SAI) has been developed and installed in a plutonium purification and americium recovery process area in the Los Alamos Plutonium Processing Facility. The instrument was designed for accurate, timely, and simultaneous nondestructive analysis of plutonium and americium in process solutions that have a wide range of concentrations and americium/plutonium ratios and for routine operation by process technicians who lack instrumentation background. The SAI, based on transmission-corrected, high-resolution gamma-ray spectroscopy, has two measurement stations attached to a single multichannel analyzer/computer system. To ensure the quality of assay results, the SAI has an internal measurement control program, which requires daily and weekly check runs and monitors key aspects of all assay runs. For a 25-ml sample, the assay precision is 5 g/l within a 2000-s count time

  15. Shift in Food Intake and Changes in Metabolic Regulation and Gene Expression during Simulated Night-Shift Work : A Rat Model

    NARCIS (Netherlands)

    Marti, Andrea Rørvik; Meerlo, Peter; Grønli, Janne; van Hasselt, Sjoerd Johan; Mrdalj, Jelena; Pallesen, Ståle; Pedersen, Torhild Thue; Henriksen, Tone Elise Gjøtterud; Skrede, Silje

    2016-01-01

    Night-shift work is linked to a shift in food intake toward the normal sleeping period, and to metabolic disturbance. We applied a rat model of night-shift work to assess the immediate effects of such a shift in food intake on metabolism. Male Wistar rats were subjected to 8 h of forced activity

  16. Overexpression of p65 attenuates celecoxib-induced cell death in MDA-MB-231 human breast cancer cell line

    Directory of Open Access Journals (Sweden)

    Wang Ling

    2013-02-01

    Full Text Available Abstract Background Celecoxib is a selective cyclooxygenase (COX-2 inhibitor that has been reported to reduce the risk of breast cancer. In our previous study, celecoxib induced apoptosis and caused cell cycle arrest at the G0/G1 phase in the breast cancer cell line MDA-MB-231, and its effects were mediated by downregulation of NF-κB signaling. The NF-κB p65/RelA subunit may play a role in cell death through the activation of anti-apoptotic target genes including the inhibitor of apoptosis (IAP and Bcl-2 families, and inhibition of protein kinase B/Akt. The aim of the present study was to investigate p65 as the potential target of celecoxib treatment and determine whether p65 overexpression can override the inhibitory effect of celecoxib on NF-κB activity and affect cell survival. Methods The effects of p65 overexpression on celecoxib-inhibited NF-κB transcriptional activity were examined by western blotting, electrophoretic mobility shift assay (EMSA and luciferase reporter gene assay. Cell viability and cell death were evaluated by the 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazoliumbromide (MTT assay, and the levels of cleaved poly(ADP-ribose polymerase (PARP and caspase. Anti-apoptotic NF-κB target genes and cell cycle regulators were examined by western blotting to screen for the expression of target genes under direct regulation by p65. Results Overexpression of p65 increased NF-κB transcriptional activity and interfered with celecoxib-mediated apoptosis as assessed by MTT assay and caspase-3, caspase-9, and PARP expressions. Exogenously overexpressed p65 upregulated NF-κB-responsive genes, including anti-apoptotic genes such as survivin and XIAP, and the cell cycle regulatory gene cyclin D1. However, p65 overexpression did not affect celecoxib-induced p-Akt inactivation, suggesting that celecoxib might have separate molecular mechanisms for regulating Akt signaling independently of its inhibition of NF-κB transcriptional

  17. Making transuranic assay measurements using modern controllers

    International Nuclear Information System (INIS)

    Kuckertz, T.H.; Caldwell, J.T.; Medvick, P.A.; Kunz, W.E.; Hastings, R.D.

    1987-01-01

    This paper describes methodology and computer-controlled instrumentation developed at the Los Alamos National Laboratory that accurately performs nondestructive assays of large containers bearing transuranic wastes and nonradioactive matrix materials. These assay systems can measure fissile isotopes with 1-mg sensitivity and spontaneous neutron-emitting isotopes at a 10-mg sensitivity. The assays are performed by neutron interrogation, detection, and counting in a custom assay chamber. An International Business Machines Personal Computer (IBM-PC) is used to control the CAMAC-based instrumentation system that acquires the assay data. 6 refs., 7 figs

  18. Time-resolved immunofluorometric assay of serum ferritin

    Energy Technology Data Exchange (ETDEWEB)

    Yan, Yao [China Inst. of Atomic Energy, Beijing (China)

    2007-06-15

    This assay is a solid phase, two-site fluoroimmunometric assay based on the direct sandwish technique. Standards or samples containing ferritin are first reacted with immobilized anti-ferritin antibodies. Then the europium-lablled antibodies are reacted with the bound antigen. The range of this assay is 2-1000 ng/mL. The analytical sentivity is better than 0.05 ng/mL. The intra-assay variation and inter-assay variation are both below 5%; This kit was compared with Wallac DELFIA kit. The correlation is r=0.96. (authors)

  19. Scintillation proximity assay

    International Nuclear Information System (INIS)

    Hart, H.

    1980-01-01

    In a method of immunological assay two different classes of particles which interact at short distances to produce characteristic detectable signals are employed in a modification of the usual latex fixation test. In one embodiment an aqueous suspension of antigen coated tritiated latex particles (LH) and antigen coated polystyrene scintillant particles (L*) is employed to assay antibody in the aqueous medium. The amount of (LH) (L*) dimer formation and higher order aggregation induced and therefore the concentration of antibody (or antigen) present which caused the aggregation can be determined by using standard liquid scintillation counting equipment. (author)

  20. Objectively measured physical activity of hospital shift workers.

    NARCIS (Netherlands)

    Loef, Bette; van der Beek, Allard J; Holtermann, Andreas; Hulsegge, Gerben; van Baarle, Debbie; Proper, Karin I

    2018-01-01

    Objectives Shift work may alter workers' leisure-time and occupational physical activity (PA) levels, which might be one of the potential underlying mechanisms of the negative health effects of shift work. Therefore, we compared objectively measured PA levels between hospital shift and non-shift

  1. Evaluating the traditional day and night shift in an acute care surgery fellowship: Is the swing shift a better choice?

    Science.gov (United States)

    Chestovich, Paul J; McNicoll, Christopher F; Ingalls, Nichole K; Kuhls, Deborah A; Fraser, Douglas R; Morrissey, Shawna L; Fildes, John J

    2018-01-01

    Fellowship trainees in acute care surgery require experience in the management of complex and operative trauma cases. Trauma center staffing usually follows standard 12-hour or 24-hour shifts, with resident and fellow trainees following a similar schedule. Although trauma admissions can be generally unpredictable, we analyzed temporal trends of trauma patient arrival times to determine the best time frame to maximize trainee experience during each day. We reviewed 10 years (2007-2016) of trauma registry data for blunt and penetrating trauma activations. Hourly volumetric trends were observed, and three specific events were chosen for detailed analysis: (1) trauma activation with Injury Severity Score (ISS) greater than 15, (2) laparotomy for trauma, and (3) thoracotomy for trauma. A retrospective shift log was created, which included day (7:00 AM to 7:00 PM), night (7:00 PM to 7:00 AM), and swing (noon to midnight) shifts. A swing shift was chosen because it captures the peak volume for all three events. Means and 95% confidence intervals were calculated, and comparisons were made between shifts using the Wilcoxon matched-pairs signed rank test with Bonferroni correction, and p less than 0.05 considered significant. During the 10-year study period, 28,287 patients were treated at our trauma center. This included the evaluation and management of 7,874 patients with ISS greater than 15, performance of 1,766 laparotomies, and 392 thoracotomies for trauma. Swing shift was superior to both day and night shifts for ISS greater than 15 (p night shifts were superior to day shift for laparotomies (p day shift (p night shift (p = 0.031). Shifts with the highest yield of ISS greater than 15, laparotomies, and thoracotomies include night and swing shifts on Fridays and Saturdays. Projected experience of acute care surgery fellows in managing complex trauma patients increases with the integration of swing shifts into the schedule. Daily trauma volume follows a temporal pattern

  2. Random coil chemical shift for intrinsically disordered proteins

    DEFF Research Database (Denmark)

    Kjærgaard, Magnus; Brander, Søren; Poulsen, Flemming Martin

    2011-01-01

    . Temperature has a non-negligible effect on the (13)C random coil chemical shifts, so temperature coefficients are reported for the random coil chemical shifts to allow extrapolation to other temperatures. The pH dependence of the histidine random coil chemical shifts is investigated in a titration series......, which allows the accurate random coil chemical shifts to be obtained at any pH. By correcting the random coil chemical shifts for the effects of temperature and pH, systematic biases of the secondary chemical shifts are minimized, which will improve the reliability of detection of transient secondary...

  3. Associations between shift schedule characteristics with sleep, need for recovery, health and performance measures for regular (semi-)continuous 3-shift systems.

    Science.gov (United States)

    van de Ven, Hardy A; Brouwer, Sandra; Koolhaas, Wendy; Goudswaard, Anneke; de Looze, Michiel P; Kecklund, Göran; Almansa, Josue; Bültmann, Ute; van der Klink, Jac J L

    2016-09-01

    In this cross-sectional study associations were examined between eight shift schedule characteristics with shift-specific sleep complaints and need for recovery and generic health and performance measures. It was hypothesized that shift schedule characteristics meeting ergonomic recommendations are associated with better sleep, need for recovery, health and performance. Questionnaire data were collected from 491 shift workers of 18 companies with 9 regular (semi)-continuous shift schedules. The shift schedule characteristics were analyzed separately and combined using multilevel linear regression models. The hypothesis was largely not confirmed. Relatively few associations were found, of which the majority was in the direction as expected. In particular early starts of morning shifts and many consecutive shifts seem to be avoided. The healthy worker effect, limited variation between included schedules and the cross-sectional design might explain the paucity of significant results. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Shift Performance Test and Analysis of Multipurpose Vehicle

    Directory of Open Access Journals (Sweden)

    Can Yang

    2014-08-01

    Full Text Available This paper presented an analysis of the gear shifting performances of a multipurpose vehicle transmission in driving condition by Ricardo's Gear Shift Quality Assessment (GSQA system. The performances of the transmission included the travel and effort of the gear shift lever and synchronizing time. The mathematic models of the transmission including the gear shift mechanism and synchronizer were developed in MATLAB. The model of the gear shift mechanism was developed to analyze the travel map of the gear shift lever and the model of the synchronizer was developed to obtain the force-time curve of the synchronizer during the slipping time. The model of the synchronizer was used to investigate the relationship between the performances of the transmission and the variation of parameters during gear shifting. The mathematic models of the gear shift mechanism and the synchronizer provided a rapid design and verification method for the transmission with ring spring.

  5. Assessing sediment contamination using six toxicity assays

    Directory of Open Access Journals (Sweden)

    Allen G. BURTON Jr.

    2001-08-01

    Full Text Available An evaluation of sediment toxicity at Lake Orta, Italy was conducted to compare a toxicity test battery of 6 assays and to evaluate the extent of sediment contamination at various sediment depths. Lake Orta received excessive loadings of copper and ammonia during the 1900’s until a large remediation effort was conducted in 1989-90 using lime addition. Since that time, the lake has shown signs of a steady recovery of biological communities. The study results showed acute toxicity still exists in sediments at a depth of 5 cm and greater. Assays that detected the highest levels of toxicity were two whole sediment exposures (7 d using Hyalella azteca and Ceriodaphnia dubia. The MicrotoxR assay using pore water was the third most sensitive assay. The Thamnotox, Rototox, Microtox solid phase, and Seed Germination-Root Elongation (pore and solid phase assays showed occasional to no toxicity. Based on similarity of responses and assay sensitivity, the two most useful assays were the C. dubia (or H. azteca and Microtox pore water. These assays were effective at describing sediment toxicity in a weight-of-evidence approach.

  6. Night shift and rotating shift in association with sleep problems, burnout and minor mental disorder in male and female employees.

    Science.gov (United States)

    Cheng, Wan-Ju; Cheng, Yawen

    2017-07-01

    Shift work is associated with adverse physical and psychological health outcomes. However, the independent health effects of night work and rotating shift on workers' sleep and mental health risks and the potential gender differences have not been fully evaluated. We used data from a nationwide survey of representative employees of Taiwan in 2013, consisting of 16 440 employees. Participants reported their work shift patterns 1 week prior to the survey, which were classified into the four following shift types: fixed day, rotating day, fixed night and rotating night shifts. Also obtained were self-reported sleep duration, presence of insomnia, burnout and mental disorder assessed by the Brief Symptom Rating Scale. Among all shift types, workers with fixed night shifts were found to have the shortest duration of sleep, highest level of burnout score, and highest prevalence of insomnia and minor mental disorders. Gender-stratified regression analyses with adjustment of age, education and psychosocial work conditions showed that both in male and female workers, fixed night shifts were associated with greater risks for short sleep duration (night shifts were also associated with increased risks for burnout and mental disorders, but after adjusting for insomnia, the associations between fixed night shifts and poor mental health were no longer significant. The findings of this study suggested that a fixed night shift was associated with greater risks for sleep and mental health problems, and the associations might be mediated by sleep disturbance. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  7. Validity of self-reported exposure to shift work.

    Science.gov (United States)

    Härmä, Mikko; Koskinen, Aki; Ropponen, Annina; Puttonen, Sampsa; Karhula, Kati; Vahtera, Jussi; Kivimäki, Mika

    2017-03-01

    To evaluate the validity of widely used questionnaire items on work schedule using objective registry data as reference. A cohort study of hospital employees who responded to a self-administered questionnaire on work schedule in 2008, 2012 and 2014 and were linked to individual-level pay-roll-based records on work shifts. For predictive validity, leisure-time fatigue was assessed. According to the survey data in 2014 (n=8896), 55% of the day workers had at least 1 year of earlier shift work experience. 8% of the night shift workers changed to day work during the follow-up. Using pay-roll data as reference, questions on 'shift work with night shifts' and 'permanent night work' showed high sensitivity (96% and 90%) and specificity (92% and 97%). Self-reported 'regular day work' showed moderate sensitivity (73%), but high specificity (99%) and 'shift work without night shifts' showed low sensitivity (62%) and moderate specificity (87%). In multivariate logistic regression analysis, the age-adjusted, sex-adjusted and baseline fatigue-adjusted association between 'shift work without night shifts' and leisure-time fatigue was lower for self-reported compared with objective assessment (1.30, 95% CI 0.94 to 1.82, n=1707 vs 1.89, 95% CI 1.06 to 3.39, n=1627). In contrast, shift work with night shifts, compared with permanent day work, was similarly associated with fatigue in the two assessments (2.04, 95% CI 1.62 to 2.57, n=2311 vs 1.82, 95% CI 1.28 to 2.58, n=1804). The validity of self-reported assessment of shift work varies between work schedules. Exposure misclassification in self-reported data may contribute to bias towards the null in shift work without night shifts. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  8. 5 CFR 532.505 - Night shift differentials.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Night shift differentials. 532.505... PREVAILING RATE SYSTEMS Premium Pay and Differentials § 532.505 Night shift differentials. (a) Employees shall be entitled to receive night shift differentials in accordance with section 5343 of title 5...

  9. Shifting Cultivation : Promoting Innovative Policy and Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Shifting Cultivation : Promoting Innovative Policy and Development Options in the Eastern Himalayas. Shifting ... pressure and market forces. The idea is to share good policies and practices related to shifting cultivation and alternative options through regional exchange. ... Les chaînes de valeur comme leviers stratégiques.

  10. ManA is regulated by RssAB signaling and promotes motility in Serratia marcescens.

    Science.gov (United States)

    Soo, Po-Chi; Horng, Yu-Tze; Chang, Yung-Lin; Tsai, Wei-Wen; Jeng, Wen-Yih; Lu, Chia-Chen; Lai, Hsin-Chih

    2014-01-01

    Serratia marcescens swarms on 0.8% LB agar at 30 °C but not at 37 °C. To understand the molecular mechanism regulating Serratia swarming, transposon mutagenesis was performed to screen for mutants that swarmed at 37 °C. In one mutant, S. marcescens WW100, the transposon was inserted in the upstream region of manA, which encodes mannose-6-phosphate isomerase, a type I phosphomannose isomerase. The transcriptional and translational levels of manA were higher in S. marcescens WW100 than in the wild-type strain. S. marcescens WW100 produced more serrawettin W1 (biosurfactant) than the wild-type, as detected by thin-layer chromatography, to promote surface motility by reducing surface tension. Serratia swarming was previously shown to be negatively regulated by the RssA-RssB two-component system. An electrophoretic mobility shift assay (EMSA) indicated that phosphorylated RssB (the response regulator) binds upstream of the transposon insertion site and manA in S. marcescens WW100. Analysis by real-time RT-PCR (qRT-PCR) revealed that, compared to the wild-type level, manA mRNA was increased in the rssA deletion mutant. The results indicated that RssA-RssB signaling directly represses the expression of manA and that overexpression of manA increases the production of serrawettin for Serratia swarming at 37 °C. Copyright © 2013 Institut Pasteur. All rights reserved.

  11. Overlapping ETS and CRE Motifs (G/CCGGAAGTGACGTCA) Preferentially Bound by GABPα and CREB Proteins

    Science.gov (United States)

    Chatterjee, Raghunath; Zhao, Jianfei; He, Ximiao; Shlyakhtenko, Andrey; Mann, Ishminder; Waterfall, Joshua J.; Meltzer, Paul; Sathyanarayana, B. K.; FitzGerald, Peter C.; Vinson, Charles

    2012-01-01

    Previously, we identified 8-bps long DNA sequences (8-mers) that localize in human proximal promoters and grouped them into known transcription factor binding sites (TFBS). We now examine split 8-mers consisting of two 4-mers separated by 1-bp to 30-bps (X4-N1-30-X4) to identify pairs of TFBS that localize in proximal promoters at a precise distance. These include two overlapping TFBS: the ETS⇔ETS motif (C/GCCGGAAGCGGAA) and the ETS⇔CRE motif (C/GCGGAAGTGACGTCAC). The nucleotides in bold are part of both TFBS. Molecular modeling shows that the ETS⇔CRE motif can be bound simultaneously by both the ETS and the B-ZIP domains without protein-protein clashes. The electrophoretic mobility shift assay (EMSA) shows that the ETS protein GABPα and the B-ZIP protein CREB preferentially bind to the ETS⇔CRE motif only when the two TFBS overlap precisely. In contrast, the ETS domain of ETV5 and CREB interfere with each other for binding the ETS⇔CRE. The 11-mer (CGGAAGTGACG), the conserved part of the ETS⇔CRE motif, occurs 226 times in the human genome and 83% are in known regulatory regions. In vivo GABPα and CREB ChIP-seq peaks identified the ETS⇔CRE as the most enriched motif occurring in promoters of genes involved in mRNA processing, cellular catabolic processes, and stress response, suggesting that a specific class of genes is regulated by this composite motif. PMID:23050235

  12. Andrographolide interferes with binding of nuclear factor-κB to DNA in HL-60-derived neutrophilic cells

    Science.gov (United States)

    Hidalgo, María A; Romero, Alex; Figueroa, Jaime; Cortés, Patricia; Concha, Ilona I; Hancke, Juan L; Burgos, Rafael A

    2005-01-01

    Andrographolide, the major active component from Andrographis paniculata, has shown to possess anti-inflammatory activity. Andrographolide inhibits the expression of several proinflammatory proteins that exhibit a nuclear factor kappa B (NF-κB) binding site in their gene. In the present study, we analyzed the effect of andrographolide on the activation of NF-κB induced by platelet-activating factor (PAF) and N-formyl-methionyl-leucyl-phenylalanine (fMLP) in HL-60 cells differentiated to neutrophils. PAF (100 nM) and fMLP (100 nM) induced activation of NF-κB as determined by degradation of inhibitory factor B α (IκBα) using Western blotting in cytosolic extracts and by binding to DNA using electrophoretic mobility shift assay (EMSA) in nuclear extracts. Andrographolide (5 and 50 μM) inhibited the NF-κB-luciferase activity induced by PAF. However, andrographolide did not reduce phosphorylation of p38 MAPK or ERK1/2 and did not change IκBα degradation induced by PAF and fMLP. Andrographolide reduced the DNA binding of NF-κB in whole cells and in nuclear extracts induced by PAF and fMLP. Andrographolide reduced cyclooxygenase-2 (COX-2) expression induced by PAF and fMLP in HL-60/neutrophils. It is concluded that andrographolide exerts its anti-inflammatory effects by inhibiting NF-κB binding to DNA, and thus reducing the expression of proinflammatory proteins, such as COX-2. PMID:15678086

  13. DNA cross-linking by dehydromonocrotaline lacks apparent base sequence preference.

    Science.gov (United States)

    Rieben, W Kurt; Coulombe, Roger A

    2004-12-01

    Pyrrolizidine alkaloids (PAs) are ubiquitous plant toxins, many of which, upon oxidation by hepatic mixed-function oxidases, become reactive bifunctional pyrrolic electrophiles that form DNA-DNA and DNA-protein cross-links. The anti-mitotic, toxic, and carcinogenic action of PAs is thought to be caused, at least in part, by these cross-links. We wished to determine whether the activated PA pyrrole dehydromonocrotaline (DHMO) exhibits base sequence preferences when cross-linked to a set of model duplex poly A-T 14-mer oligonucleotides with varying internal and/or end 5'-d(CG), 5'-d(GC), 5'-d(TA), 5'-d(CGCG), or 5'-d(GCGC) sequences. DHMO-DNA cross-links were assessed by electrophoretic mobility shift assay (EMSA) of 32P endlabeled oligonucleotides and by HPLC analysis of cross-linked DNAs enzymatically digested to their constituent deoxynucleosides. The degree of DNA cross-links depended upon the concentration of the pyrrole, but not on the base sequence of the oligonucleotide target. Likewise, HPLC chromatograms of cross-linked and digested DNAs showed no discernible sequence preference for any nucleotide. Added glutathione, tyrosine, cysteine, and aspartic acid, but not phenylalanine, threonine, serine, lysine, or methionine competed with DNA as alternate nucleophiles for cross-linking by DHMO. From these data it appears that DHMO exhibits no strong base preference when forming cross-links with DNA, and that some cellular nucleophiles can inhibit DNA cross-link formation.

  14. Functional studies of ssDNA binding ability of MarR family protein TcaR from Staphylococcus epidermidis.

    Directory of Open Access Journals (Sweden)

    Yu-Ming Chang

    Full Text Available The negative transcription regulator of the ica locus, TcaR, regulates proteins involved in the biosynthesis of poly-N-acetylglucosamine (PNAG. Absence of TcaR increases PNAG production and promotes biofilm formation in Staphylococci. Previously, the 3D structure of TcaR in its apo form and its complex structure with several antibiotics have been analyzed. However, the detailed mechanism of multiple antibiotic resistance regulator (MarR family proteins such as TcaR is unclear and only restricted on the binding ability of double-strand DNA (dsDNA. Here we show by electrophoretic mobility shift assay (EMSA, electron microscopy (EM, circular dichroism (CD, and Biacore analysis that TcaR can interact strongly with single-stranded DNA (ssDNA, thereby identifying a new role in MarR family proteins. Moreover, we show that TcaR preferentially binds 33-mer ssDNA over double-stranded DNA and inhibits viral ssDNA replication. In contrast, such ssDNA binding properties were not observed for other MarR family protein and TetR family protein, suggesting that the results from our studies are not an artifact due to simple charge interactions between TcaR and ssDNA. Overall, these results suggest a novel role for TcaR in regulation of DNA replication. We anticipate that the results of this work will extend our understanding of MarR family protein and broaden the development of new therapeutic strategies for Staphylococci.

  15. STAT3-Activated GM-CSFRα Translocates to the Nucleus and Protects CLL Cells from Apoptosis

    Science.gov (United States)

    Li, Ping; Harris, David; Liu, Zhiming; Rozovski, Uri; Ferrajoli, Alessandra; Wang, Yongtao; Bueso-Ramos, Carlos; Hazan-Halevy, Inbal; Grgurevic, Srdana; Wierda, William; Burger, Jan; O'Brien, Susan; Faderl, Stefan; Keating, Michael; Estrov, Zeev

    2014-01-01

    Here it was determined that Chronic Lymphocytic Leukemia (CLL) cells express the α-subunit but not the β-subunit of the granulocyte-macrophage colony-stimulating factor receptor (GM-CSFR/CSF3R). GM-CSFRα was detected on the surface, in the cytosol, and the nucleus of CLL cells via confocal microscopy, cell fractionation, and GM-CSFRα antibody epitope mapping. Because STAT3 is frequently activated in CLL and the GM-CSFRα promoter harbors putative STAT3 consensus binding sites, MM1 cells were transfected with truncated forms of the GM-CSFRα promoter, then stimulated with IL-6 to activate STAT3 to identify STAT3 binding sites. Chromatin immunoprecipitation (ChIP) and an electoromobility shift assay (EMSA) confirmed STAT3 occupancy to those promoter regions in both IL-6 stimulated MM1 and CLL cells. Transfection of MM1 cells with STAT3 siRNA or CLL cells with STAT3 shRNA significantly down-regulated GM-CSFRα mRNA and protein levels. RNA transcripts, involved in regulating cell-survival pathways, and the proteins KAP1 (TRIM28) and ISG15 co-immunoprecipitated with GM-CSFRα. GM-CSFRα-bound KAP1 enhanced the transcriptional activity of STAT3, whereas ISG15 inhibited the NF-κB pathway. Nevertheless, overexpression of GM-CSFRα protected MM1 cells from dexamethasone-induced apoptosis, and GM-CSFRα knockdown induced apoptosis in CLL cells, suggesting that GM-CSFRα provides a ligand-independent survival advantage. PMID:24836891

  16. The mitochondrial fatty acid synthesis (mtFASII) pathway is capable of mediating nuclear-mitochondrial cross talk through the PPAR system of transcriptional activation

    International Nuclear Information System (INIS)

    Parl, Angelika; Mitchell, Sabrina L.; Clay, Hayley B.; Reiss, Sara; Li, Zhen; Murdock, Deborah G.

    2013-01-01

    Highlights: •The function of the mitochondria fatty acid synthesis pathway is partially unknown. •Overexpression of the pathway causes transcriptional activation through PPARs. •Knock down of the pathway attenuates that activation. •The last enzyme in the pathway regulates its own transcription. •Products of the mtFASII pathway are able to drive nuclear transcription. -- Abstract: Mammalian cells contain two fatty acid synthesis pathways, the cytosolic FASI pathway, and the mitochondrial FASII pathway. The selection behind the conservation of the mitochondrial pathway is not completely understood, given the presence of the cytosolic FAS pathway. In this study, we show through heterologous gene reporter systems and PCR-based arrays that overexpression of MECR, the last step in the mtFASII pathway, causes modulation of gene expression through the PPAR pathway. Electromobility shift assays (EMSAs) demonstrate that overexpression of MECR causes increased binding of PPARs to DNA, while cell fractionation and imaging studies show that MECR remains localized to the mitochondria. Interestingly, knock down of the mtFASII pathway lessens the effect of MECR on this transcriptional modulation. Our data are most consistent with MECR-mediated transcriptional activation through products of the mtFASII pathway, although we cannot rule out MECR acting as a coactivator. Further investigation into the physiological relevance of this communication will be necessary to better understand some of the phenotypic consequences of deficits in this pathway observed in animal models and human disease

  17. Co-expression analysis identifies CRC and AP1 the regulator of Arabidopsis fatty acid biosynthesis.

    Science.gov (United States)

    Han, Xinxin; Yin, Linlin; Xue, Hongwei

    2012-07-01

    Fatty acids (FAs) play crucial rules in signal transduction and plant development, however, the regulation of FA metabolism is still poorly understood. To study the relevant regulatory network, fifty-eight FA biosynthesis genes including de novo synthases, desaturases and elongases were selected as "guide genes" to construct the co-expression network. Calculation of the correlation between all Arabidopsis thaliana (L.) genes with each guide gene by Arabidopsis co-expression dating mining tools (ACT) identifies 797 candidate FA-correlated genes. Gene ontology (GO) analysis of these co-expressed genes showed they are tightly correlated to photosynthesis and carbohydrate metabolism, and function in many processes. Interestingly, 63 transcription factors (TFs) were identified as candidate FA biosynthesis regulators and 8 TF families are enriched. Two TF genes, CRC and AP1, both correlating with 8 FA guide genes, were further characterized. Analyses of the ap1 and crc mutant showed the altered total FA composition of mature seeds. The contents of palmitoleic acid, stearic acid, arachidic acid and eicosadienoic acid are decreased, whereas that of oleic acid is increased in ap1 and crc seeds, which is consistent with the qRT-PCR analysis revealing the suppressed expression of the corresponding guide genes. In addition, yeast one-hybrid analysis and electrophoretic mobility shift assay (EMSA) revealed that CRC can bind to the promoter regions of KCS7 and KCS15, indicating that CRC may directly regulate FA biosynthesis. © 2012 Institute of Botany, Chinese Academy of Sciences.

  18. Untangling the transcription regulatory network of the bacitracin synthase operon in Bacillus licheniformis DW2.

    Science.gov (United States)

    Wang, Dong; Wang, Qin; Qiu, Yimin; Nomura, Christopher T; Li, Junhui; Chen, Shouwen

    The bacitracin synthetase gene cluster in Bacillus licheniformis DW2 is composed of the bacABC operon encoding a non-ribosomal peptide synthetase and bacT encoding a thioesterase. Although the bacitracin gene cluster has been well studied, little is known about how this gene cluster is regulated. This study provides insight into how the transcription factors Spo0A and AbrB regulate bacitracin biosynthesis. Deletion of spo0A resulted in drastically reduced expression of bacA and bacT, and subsequently bacitracin production. On the other hand, the expression of bacA and bacT increased significantly in B. licheniformis DW2ΔabrB and DW2Δ0AΔabrB compared to the wild-type strain DW2. The bacitracin yields on cell numbers (U/CFU) in DW2ΔabrB and DW2Δ0A/pHY300-0A-sad67 were 17.5% and 14.9% higher than that of the wild-type strain. An electrophoretic mobility shift assay (EMSA) further confirmed that AbrB could directly bind to the promoter regions of bacA and bacT. These results indicate that AbrB acts as a repressor of bacitracin biosynthesis by inhibiting bacA and bacT expression, while Spo0A indirectly promotes bacitracin biosynthesis by repressing abrB expression. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  19. The mitochondrial fatty acid synthesis (mtFASII) pathway is capable of mediating nuclear-mitochondrial cross talk through the PPAR system of transcriptional activation

    Energy Technology Data Exchange (ETDEWEB)

    Parl, Angelika; Mitchell, Sabrina L.; Clay, Hayley B.; Reiss, Sara; Li, Zhen; Murdock, Deborah G., E-mail: deborah.murdock@vanderbilt.edu

    2013-11-15

    Highlights: •The function of the mitochondria fatty acid synthesis pathway is partially unknown. •Overexpression of the pathway causes transcriptional activation through PPARs. •Knock down of the pathway attenuates that activation. •The last enzyme in the pathway regulates its own transcription. •Products of the mtFASII pathway are able to drive nuclear transcription. -- Abstract: Mammalian cells contain two fatty acid synthesis pathways, the cytosolic FASI pathway, and the mitochondrial FASII pathway. The selection behind the conservation of the mitochondrial pathway is not completely understood, given the presence of the cytosolic FAS pathway. In this study, we show through heterologous gene reporter systems and PCR-based arrays that overexpression of MECR, the last step in the mtFASII pathway, causes modulation of gene expression through the PPAR pathway. Electromobility shift assays (EMSAs) demonstrate that overexpression of MECR causes increased binding of PPARs to DNA, while cell fractionation and imaging studies show that MECR remains localized to the mitochondria. Interestingly, knock down of the mtFASII pathway lessens the effect of MECR on this transcriptional modulation. Our data are most consistent with MECR-mediated transcriptional activation through products of the mtFASII pathway, although we cannot rule out MECR acting as a coactivator. Further investigation into the physiological relevance of this communication will be necessary to better understand some of the phenotypic consequences of deficits in this pathway observed in animal models and human disease.

  20. Paradigm Shifts in Ophthalmic Diagnostics.

    Science.gov (United States)

    Sebag, J; Sadun, Alfredo A; Pierce, Eric A

    2016-08-01

    Future advances in ophthalmology will see a paradigm shift in diagnostics from a focus on dysfunction and disease to better measures of psychophysical function and health. Practical methods to define genotypes will be increasingly important and non-invasive nanotechnologies are needed to detect molecular changes that predate histopathology. This is not a review nor meant to be comprehensive. Specific topics have been selected to illustrate the principles of important paradigm shifts that will influence the future of ophthalmic diagnostics. It is our impression that future evaluation of vision will go beyond visual acuity to assess ocular health in terms of psychophysical function. The definition of disease will incorporate genotype into what has historically been a phenotype-centric discipline. Non-invasive nanotechnologies will enable a paradigm shift from disease detection on a cellular level to a sub-cellular molecular level. Vision can be evaluated beyond visual acuity by measuring contrast sensitivity, color vision, and macular function, as these provide better insights into the impact of aging and disease. Distortions can be quantified and the psychophysical basis of vision can be better evaluated than in the past by designing tests that assess particular macular cell function(s). Advances in our understanding of the genetic basis of eye diseases will enable better characterization of ocular health and disease. Non-invasive nanotechnologies can assess molecular changes in the lens, vitreous, and macula that predate visible pathology. Oxygen metabolism and circulatory physiology are measurable indices of ocular health that can detect variations of physiology and early disease. This overview of paradigm shifts in ophthalmology suggests that the future will see significant improvements in ophthalmic diagnostics. The selected topics illustrate the principles of these paradigm shifts and should serve as a guide to further research and development. Indeed

  1. Digoxin Downregulates NDRG1 and VEGF through the Inhibition of HIF-1α under Hypoxic Conditions in Human Lung Adenocarcinoma A549 Cells

    Directory of Open Access Journals (Sweden)

    Dong Wei

    2013-04-01

    Full Text Available Digoxin, an inhibitor of Na+/K+ ATPase, has been used in the treatment of heart-related diseases (such as congestive heart failure and atrial arrhythmia for decades. Recently, it was reported that digoxin is also an effective HIF-1α inhibitor. We investigated whether digoxin could suppress tumor cell growth through HIF-1α in non-small cell lung cancer cells (A549 cells under hypoxic conditions. An MTT assay was used to measure cell viability. RT-PCR and western blotting were performed to analyze the mRNA and protein expression of VEGF, NDRG1, and HIF-1α. HIF-1α nuclear translocation was then determined by EMSA. Digoxin was found to inhibit the proliferation of A549 cells under hypoxic conditions. Our results showed that hypoxia led to the upregulation of VEGF, NDRG1, and HIF-1α both at the mRNA and protein levels. We also found that the hypoxia-induced overexpression of VEGF, NDRG1, and HIF-1α was suppressed by digoxin in a concentration-dependent manner. As expected, our EMSA results demonstrated that under hypoxic conditions HIF-1α nuclear translocation was also markedly reduced by digoxin in a concentration-dependent manner. Our results suggest that digoxin downregulated hypoxia-induced overexpression of VEGF and NDRG1 at the transcriptional level probably through the inhibition of HIF-1α synthesis in A549 cells.

  2. [Regulation of sporulation by two-component system YvcPQ in Bacillus thuringiensis].

    Science.gov (United States)

    Fan, Qingyun; Zhang, Shumeng; Gong, Yujing; He, Jin

    2017-01-04

    To study the regulation of sporulation controlled by two-component system (TCS) YvcPQ. β-galactosidase experiment was used to verify the regulation of YvcP on kapD expression; bacterial one-hybrid assay, EMSA and RT-qPCR were applied to study the regulation of AbrB on yvcPQ expression; markerless gene deletion coupled with spore count was used to reveal the influence of yvcPQ and kapD expressions on sporulation. transcriptional regulator AbrB up-regulated the expression of yvcPQ; YvcP promoted the expression of kapD to inhibit sporulation. AbrB up-regulated the transcription of yvcPQ operon, then the increased YvcP strengthened the transcriptional acitivation of sporulation inhibitor gene kapD, and subsequently inhibited sporulation.

  3. Solvent Effects on Oxygen-17 Chemical Shifts in Amides. Quantitative Linear Solvation Shift Relationships

    Science.gov (United States)

    Díez, Ernesto; Fabián, Jesús San; Gerothanassis, Ioannis P.; Esteban, Angel L.; Abboud, José-Luis M.; Contreras, Ruben H.; de Kowalewski, Dora G.

    1997-01-01

    A multiple-linear-regression analysis (MLRA) has been carried out using the Kamlet-Abboud-Taft (KAT) solvatochromic parameters in order to elucidate and quantify the solvent effects on the17O chemical shifts ofN-methylformamide (NMF),N,N-dimethylformamide (DMF),N-methylacetamide (NMA), andN,N-dimethylacetamide (DMA). The chemical shifts of the four molecules show the same dependence (in ppm) on the solvent polarity-polarizability, i.e., -22π*. The influence of the solvent hydrogen-bond-donor (HBD) acidities is slightly larger for the acetamides NMA and DMA, i.e., -48α, than for the formamides NMF and DMF, i.e., -42α. The influence of the solvent hydrogen-bond-acceptor (HBA) basicities is negligible for the nonprotic molecules DMF and DMA but significant for the protic molecules NMF and NMA, i.e., -9β. The effect of substituting the N-H hydrogen by a methyl group amounts to -5.9 ppm in NMF and 5.4 ppm in NMA. The effect of substituting the O=C-H hydrogen amounts to 5.5 ppm in NMF and 16.8 ppm in DMF. The model of specific hydration sites of amides by I. P. Gerothanassis and C. Vakka [J. Org. Chem.59,2341 (1994)] is settled in a more quantitative basis and the model by M. I. Burgar, T. E. St. Amour, and D. Fiat [J. Phys. Chem.85,502 (1981)] is critically evaluated.17O hydration shifts have been calculated for formamide (FOR) by the ab initio LORG method at the 6-31G* level. For a formamide surrounded by the four in-plane molecules of water in the first hydration shell, the calculated17O shift change due to the four hydrogen bonds, -83.2 ppm, is smaller than the empirical hydration shift, -100 ppm. The17O shift change from each out-of-plane water molecule hydrogen-bonded to the amide oxygen is -18.0 ppm. These LORG results support the conclusion that no more than four water molecules are hydrogen-bonded to the amide oxygen in formamide.

  4. Identifying Patterns of Participant Shifts in the Psalms

    NARCIS (Netherlands)

    Erwich, C.M.

    2017-01-01

    A great challenge of reading the Hebrew poetry of the Psalms is the identification of participants. The major cause of this problem is a continual shift in person, gender and number (so-called PGN-shifts, or participant shifts) in the text. To account for these PGN-shifts, scholars have always used

  5. The Relationship Between Shift Work and Men's Health.

    Science.gov (United States)

    Deng, Nanfu; Kohn, Taylor P; Lipshultz, Larry I; Pastuszak, Alexander W

    2018-01-19

    More than 21 million Americans and nearly 20% of the U.S. workforce are shift workers. Non-standard shift work, defined as work that falls outside of 6 am-6 pm, can lead to poor diet, exercise, and sleep habits that lead to decreased productivity, increased workplace accidents, and a variety of negative health outcomes. To investigate the associations between shift work exposure and chronic medical conditions such as metabolic syndromes, cardiovascular disease, gastrointestinal disturbances, and depression as well as urologic complications including hypogonadism, male infertility, lower urinary tract symptoms, and prostate cancer with a focus on the effects of shift work sleep disorder (SWSD) on the severity of these negative health outcomes. We reviewed the literature examining effects of shift work and SWSD on general and urologic health. We produced a summary of effects of shift work on health with focus on the increased risk of negative health outcomes in non-standard shift workers, particularly those with SWSD, when compared to daytime workers or workers without SWSD. Studies have associated non-standard shift work schedules and poor health outcomes, including increased risks of diabetes mellitus, dyslipidemia, hypertension, heart disease, peptic ulcer disease, and depression, in shift workers. However, few studies have focused on the role that shift work plays in men's urologic health. Current evidence supports associations between non-standard shift work and increased hypogonadal symptoms, poor semen parameters, decreased fertility, lower urinary tract symptoms, and prostate cancer. These associations are strengthened by the presence of SWSD, which affects up to 20% of shift workers. Unfortunately, interventions, such as planned naps, timed light exposure, melatonin, and sedative hypnotics, aimed at alleviating excessive nighttime sleepiness and daytime insomnia in non-standard shift workers experiencing SWSD, are limited and lack strong evidence to support

  6. Shift-Variant Multidimensional Systems.

    Science.gov (United States)

    1985-05-29

    x,y;u,v) is the system response at (x,y) to an unit impulse applied at (u,v). The presence of additive noise in the preceding input-output model of a...space model developed works very effi- ciently to deblur images affected by 2-D linear shift- varying blurs, its use, in presence of noise needs to be...causal linear shift-variant (LSV) system, whose impulse res- ponse is a K-th order degenerate sequence, a K-th order state-space model was obtained

  7. [Sleep disorders among physicians on shift work].

    Science.gov (United States)

    Schlafer, O; Wenzel, V; Högl, B

    2014-11-01

    Sleep disorders in physicians who perform shift work can result in increased risks of health problems that negatively impact performance and patient safety. Even those who cope well with shift work are likely to suffer from sleep disorders. The aim of this manuscript is to discuss possible causes, contributing factors and consequences of sleep disorders in physicians and to identify measures that can improve adaptation to shift work and treatment strategies for shift work-associated sleep disorders. The risk factors that influence the development of sleep disorders in physicians are numerous and include genetic factors (15 % of the population), age (> 50 years), undiagnosed sleep apnea,, alcohol abuse as well as multiple stress factors inherent in clinical duties (including shift work), research, teaching and family obligations. Several studies have reported an increased risk for medical errors in sleep-deprived physicians. Shift workers have an increased risk for psychiatric and cardiovascular diseases and shift work may also be a contributing factor to cancer. A relationship has been reported not only with sleep deprivation and changes in food intake but also with diabetes mellitus, obesity, hypertension and coronary heart disease. Nicotine and alcohol consumption are more frequent among shift workers. Increased sickness and accident rates among physicians when commuting (especially after night shifts) have a socioeconomic impact. In order to reduce fatigue and to improve performance, short naps during shiftwork or naps plus caffeine, have been proposed as coping strategies; however, napping during adverse circadian phases is less effective, if not impossible when unable to fall asleep. Bright and blue light supports alertness during a night shift. After shiftwork, direct sunlight exposure to the retina can be avoided by using dark sunglasses or glasses with orange lenses for commuting home. The home environment for daytime sleeping after a night shift should be

  8. A multiwell format assay for heparanase.

    Science.gov (United States)

    Behzad, Farhad; Brenchley, Paul E C

    2003-09-15

    This assay employs a biotinylated heparan sulfate glycosaminoglycan (HSGAG) substrate that is covalently linked to the surface of 96-well immunoassay plates. The ratio of biotin:HSGAG and the coating concentration of substrate bound to the wells have been optimized and allow removal of biotin HSGAG within 60 min of incubation at 37 degrees C in assay buffer with a standard dilution of bacterial heparitinase or platelet heparanase. Loss of biotin signal from the well surface is detected on incubation with peroxidase-streptavidin followed by color development using 3,3',5,5'-tetramethylbenzidine as the peroxidase substrate. The new assay allows specific detection of heparanase activity in multiple samples in a total time of 3 h including a 1-h substrate digestion step and is a significant improvement with regard to sensitivity, specificity, and ease of handling of multiple samples compared to other described assays. Heparanase specifically degrades the biotinylated HSGAG substrate, when used with an optimized assay buffer. A range of enzymes including collagenase, trypsin, plasmin, pepsin, chondroitinases, hyaluronidase, and neuraminidase show no effect on the substrate under optimized assay conditions. The covalent linkage of the substrate to the well prevents leaching of substrate and allows preparation and long-term storage of substrate-coated plates. The assay can be used to detect heparanase levels in clinical samples and cell culture supernatants and is ideal as a screening method for antagonists of enzyme activity.

  9. Frequency-shift vs phase-shift characterization of in-liquid quartz crystal microbalance applications

    International Nuclear Information System (INIS)

    Montagut, Y. J.; Garcia, J. V.; Jimenez, Y.; Arnau, A.; March, C.; Montoya, A.

    2011-01-01

    The improvement of sensitivity in quartz crystal microbalance (QCM) applications has been addressed in the last decades by increasing the sensor fundamental frequency, following the increment of the frequency/mass sensitivity with the square of frequency predicted by Sauerbrey. However, this sensitivity improvement has not been completely transferred in terms of resolution. The decrease of frequency stability due to the increase of the phase noise, particularly in oscillators, made impossible to reach the expected resolution. A new concept of sensor characterization at constant frequency has been recently proposed. The validation of the new concept is presented in this work. An immunosensor application for the detection of a low molecular weight contaminant, the insecticide carbaryl, has been chosen for the validation. An, in principle, improved version of a balanced-bridge oscillator is validated for its use in liquids, and applied for the frequency shift characterization of the QCM immunosensor application. The classical frequency shift characterization is compared with the new phase-shift characterization concept and system proposed.

  10. A quantitative comet infection assay for influenza virus

    Science.gov (United States)

    Lindsay, Stephen M.; Timm, Andrea; Yin, John

    2011-01-01

    Summary The virus comet assay is a cell-based virulence assay used to evaluate an antiviral drug or antibody against a target virus. The comet assay differs from the plaque assay in allowing spontaneous flows in 6-well plates to spread virus. When implemented quantitatively the comet assay has been shown to have an order-of-magnitude greater sensitivity to antivirals than the plaque assay. In this study, a quantitative comet assay for influenza virus is demonstrated, and is shown to have a 13-fold increase in sensitivity to ribavirin. AX4 cells (MDCK cells with increased surface concentration of α2–6 sialic acid, the influenza virus receptor) have reduced the comet size variability relative to MDCK cells, making them a better host cell for use in this assay. Because of enhanced antiviral sensitivity in flow-based assays, less drug is required, which could lead to lower reagent costs, reduced cytotoxicity, and fewer false-negative drug screen results. The comet assay also serves as a readout of flow conditions in the well. Observations from comets formed at varying humidity levels indicate a role for evaporation in the mechanism of spontaneous fluid flow in wells. PMID:22155578

  11. Assay development status report for total cyanide

    International Nuclear Information System (INIS)

    Simpson, B.C.; Jones, T.E.; Pool, K.H.

    1993-02-01

    A validated cyanide assay that is applicable to a variety of tank waste matrices is necessary to resolve certain waste tank safety issues and for purposes of overall waste characterization. The target for this effort is an assay with an applicable range of greater than 1,000 ppM (0.10 wt%) total cyanide and a confidence level greater than 80%. Figure 1 illustrates the operating regime of the proposed cyanide assay method. The Assay Development Status Report for Total Cyanide will summarize the past experience with cyanide analyses on-tank waste matrices and will rate the status of the analytical methods used to assay total cyanide (CN - ion) in the tank waste matrices as acceptable or unacceptable. This paper will also briefly describe the current efforts for improving analytical resolution of the assays and the attempts at speciation

  12. Prospects for cellular mutational assays in human populations

    International Nuclear Information System (INIS)

    Mendelsohn, M.L.

    1984-01-01

    Practical, sensitive, and effective human cellular assays for detecting somatic and germinal mutations would have great value in environmental mutagenesis and carcinogenesis studies. Such assays would fill the void between human mutagenicity and the data that exist from short-term tests and from mutagenicity in other species. This paper discusses the following possible human cellular assays: (1) HPRT (hypoxanthine phosphoribosyltransferase) somatic cell mutation based on 6-thioguanine resistance; (2) hemoglobin somatic cell mutation assay; (3) glycophorin somatic cell mutation assay; and (4) LDH-X sperm cell mutation assay. 18 references

  13. Prospects for cellular mutational assays in human populations

    Energy Technology Data Exchange (ETDEWEB)

    Mendelsohn, M.L.

    1984-06-29

    Practical, sensitive, and effective human cellular assays for detecting somatic and germinal mutations would have great value in environmental mutagenesis and carcinogenesis studies. Such assays would fill the void between human mutagenicity and the data that exist from short-term tests and from mutagenicity in other species. This paper discusses the following possible human cellular assays: (1) HPRT (hypoxanthine phosphoribosyltransferase) somatic cell mutation based on 6-thioguanine resistance; (2) hemoglobin somatic cell mutation assay; (3) glycophorin somatic cell mutation assay; and (4) LDH-X sperm cell mutation assay. 18 references.

  14. A radiochemical assay for biotin in biological materials

    International Nuclear Information System (INIS)

    Hood, R.L.

    1975-01-01

    A radiochemical assay for biotin is described. The assay was sensitive to one nanogram and simple enough for routine biotin analyses. The assay yielded results which were comparable to those obtained from a microbiological assay using Lactobacillus plantarum. (author)

  15. Does workplace health promotion reach shift workers?

    DEFF Research Database (Denmark)

    Nabe-Nielsen, Kirsten; Garde, Anne Helene; Clausen, Thomas

    2015-01-01

    OBJECTIVES: One reason for health disparities between shift and day workers may be that workplace health promotion does not reach shift workers to the same extent as it reaches day workers. This study aimed to investigate the association between shift work and the availability of and participation...... in workplace health promotion. METHODS: We used cross-sectional questionnaire data from a large representative sample of all employed people in Denmark. We obtained information on the availability of and participation in six types of workplace health promotion. We also obtained information on working hours, ie......). RESULTS: In the general working population, fixed evening and fixed night workers, and employees working variable shifts including night work reported a higher availability of health promotion, while employees working variable shifts without night work reported a lower availability of health promotion...

  16. Linearization of the Bradford Protein Assay

    OpenAIRE

    Ernst, Orna; Zor, Tsaffrir

    2010-01-01

    Determination of microgram quantities of protein in the Bradford Coomassie brilliant blue assay is accomplished by measurement of absorbance at 590 nm. This most common assay enables rapid and simple protein quantification in cell lysates, cellular fractions, or recombinant protein samples, for the purpose of normalization of biochemical measurements. However, an intrinsic nonlinearity compromises the sensitivity and accuracy of this method. It is shown that under standard assay conditions, t...

  17. New automated pellet/powder assay system

    International Nuclear Information System (INIS)

    Olsen, R.N.

    1975-01-01

    This paper discusses an automated, high precision, pellet/ powder assay system. The system is an active assay system using a small isotopic neutron source and a coincidence detection system. The handling of the pellet powder samples has been automated and a programmable calculator has been integrated into the system to provide control and data analysis. The versatile system can assay uranium or plutonium in either active or passive modes

  18. Passive nondestructive assay of nuclear materials

    International Nuclear Information System (INIS)

    Reilly, D.; Ensslin, N.; Smith, H. Jr.; Kreiner, S.

    1991-03-01

    The term nondestructive assay (NDA) is applied to a series of measurement techniques for nuclear fuel materials. The techniques measure radiation induced or emitted spontaneously from the nuclear material; the measurements are nondestructive in that they do not alter the physical or chemical state of the nuclear material. NDA techniques are characterized as passive or active depending on whether they measure radiation from the spontaneous decay of the nuclear material or radiation induced by an external source. This book emphasizes passive NDA techniques, although certain active techniques like gamma-ray absorption densitometry and x-ray fluorescence are discussed here because of their intimate relation to passive assay techniques. The principal NDA techniques are classified as gamma-ray assay, neutron assay, and calorimetry. Gamma-ray assay techniques are treated in Chapters 1--10. Neutron assay techniques are the subject of Chapters 11--17. Chapters 11--13 cover the origin of neutrons, neutron interactions, and neutron detectors. Chapters 14--17 cover the theory and applications of total and coincidence neutron counting. Chapter 18 deals with the assay of irradiated nuclear fuel, which uses both gamma-ray and neutron assay techniques. Chapter 19 covers perimeter monitoring, which uses gamma-ray and neutron detectors of high sensitivity to check that no unauthorized nuclear material crosses a facility boundary. The subject of Chapter 20 is attribute and semiquantitative measurements. The goal of these measurements is a rapid verification of the contents of nuclear material containers to assist physical inventory verifications. Waste and holdup measurements are also treated in this chapter. Chapters 21 and 22 cover calorimetry theory and application, and Chapter 23 is a brief application guide to illustrate which techniques can be used to solve certain measurement problems

  19. Lung function studies before and after a work shift

    Energy Technology Data Exchange (ETDEWEB)

    Love, R G

    1983-05-01

    The lung function of 23 underground coal workers and eight surface workers at a Scottish colliery was measured immediately before and after a work shift. Changes in lung function were assessed in relation to the measured respirable dust exposure and the time of day in which the shift was worked. Large, and statistically significant, decrements of lung function during the shift were found in night-shift workers compared with workers on other shifts. Measurements derived from the forced expiratory manoeuvre, particularly FEV1, Vmax50, and Vmax25, after three vital capacity breaths of an 80% He/20% O2 mixture, showed large reductions in night-shift men, smaller reductions in afternoon-shift men, and small increases or decreases in morning-shift underground and surface workers. Within-shift changes for other tests, such as closing volume, N2 index, and volume of isoflow, did not differ significantly between shifts. No significant relationship was found between dust exposure and functional changes during a shift for any test. Lung function changes in a control group of 25 female workers not exposed to dust (hospital nurses) did not show the same large variations between day and night shifts. Examination of a further control group of 16 office workers did not show any difference in diurnal changes between smokers and non-smokers. It is concluded that these coal miners, even on permanent shift patterns, had widely different changes in their lung function cycle depending on which shift they were working. These changes did not appear to be related to dust exposure or cigarette smoking and were not consistent with other biological adaptations known to result from regular night-shift working.

  20. Health consequences of shift work and insufficient sleep.

    Science.gov (United States)

    Kecklund, Göran; Axelsson, John

    2016-11-01

    This review summarises the literature on shift work and its relation to insufficient sleep, chronic diseases, and accidents. It is based on 38 meta-analyses and 24 systematic reviews, with additional narrative reviews and articles used for outlining possible mechanisms by which shift work may cause accidents and adverse health. Evidence shows that the effect of shift work on sleep mainly concerns acute sleep loss in connection with night shifts and early morning shifts. A link also exists between shift work and accidents, type 2 diabetes (relative risk range 1.09-1.40), weight gain, coronary heart disease (relative risk 1.23), stroke (relative risk 1.05), and cancer (relative risk range 1.01-1.32), although the original studies showed mixed results. The relations of shift work to cardiometabolic diseases and accidents mimic those with insufficient sleep. Laboratory studies indicate that cardiometabolic stress and cognitive impairments are increased by shift work, as well as by sleep loss. Given that the health and safety consequences of shift work and insufficient sleep are very similar, they are likely to share common mechanisms. However, additional research is needed to determine whether insufficient sleep is a causal pathway for the adverse health effects associated with shift work. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  1. Staphylococcus aureus shifts towards commensalism in response to Corynebacterium species

    Directory of Open Access Journals (Sweden)

    Matthew M Ramsey

    2016-08-01

    Full Text Available Staphylococcus aureus–human interactions result in a continuum of outcomes from commensalism to pathogenesis. S. aureus is a clinically important pathogen that asymptomatically colonizes ~25% of humans as a member of the nostril and skin microbiota, where it resides with other bacteria including commensal Corynebacterium species. Commensal Corynebacterium spp. are also positively correlated with S. aureus in chronic polymicrobial diabetic foot infections, distinct from acute monomicrobial S. aureus infections. Recent work by our lab and others indicates that microbe-microbe interactions between S. aureus and human skin/nasal commensals, including Corynebacterium species, affect S. aureus behavior and fitness. Thus, we hypothesized that S. aureus interactions with Corynebacterium spp. diminish S. aureus virulence. We tested this by assaying for changes in S. aureus gene expression during in vitro mono- versus coculture with Corynebacterium striatum, a common skin and nasal commensal. We observed a broad shift in S. aureus gene transcription during in vitro growth with C. striatum, including increased transcription of genes known to exhibit increased expression during human nasal colonization and decreased transcription of virulence genes. S. aureus uses several regulatory pathways to transition between commensal and pathogenic states. One of these, the quorum signal accessory gene regulator (agr system, was strongly inhibited in response to Corynebacterium spp. Phenotypically, S. aureus exposed to C. striatum exhibited increased adhesion to epithelial cells, reflecting a commensal state, and decreased hemolysin activity, reflecting an attenuation of virulence. Consistent with this, S. aureus displayed diminished fitness in experimental in vivo coinfection with C. striatum when compared to monoinfection. These data support a model in which S. aureus shifts from virulence towards a commensal state when exposed to commensal Corynebacterium species.

  2. Work shifts in Emergency Medicine

    Directory of Open Access Journals (Sweden)

    Roberto Recupero

    2007-06-01

    Full Text Available Emergency Medicine is known as a high stress specialty. The adverse effect of constantly rotating shifts is the single most important reason given for premature attrition from the field. In this work problems tied with night shift work will be taken into account and some solutions to reduce the impact of night work on the emergency physicians will be proposed.

  3. Glucose metabolism during rotational shift-work in healthcare workers.

    Science.gov (United States)

    Sharma, Anu; Laurenti, Marcello C; Dalla Man, Chiara; Varghese, Ron T; Cobelli, Claudio; Rizza, Robert A; Matveyenko, Aleksey; Vella, Adrian

    2017-08-01

    Shift-work is associated with circadian rhythm disruption and an increased risk of obesity and type 2 diabetes. We sought to determine the effect of rotational shift-work on glucose metabolism in humans. We studied 12 otherwise healthy nurses performing rotational shift-work using a randomised crossover study design. On each occasion, participants underwent an isotope-labelled mixed meal test during a simulated day shift and a simulated night shift, enabling simultaneous measurement of glucose flux and beta cell function using the oral minimal model. We sought to determine differences in fasting and postprandial glucose metabolism during the day shift vs the night shift. Postprandial glycaemic excursion was higher during the night shift (381±33 vs 580±48 mmol/l per 5 h, pshift. While insulin action did not differ between study days, the beta cell responsivity to glucose (59±5 vs 44±4 × 10 -9  min -1 ; pshift. Impaired beta cell function during the night shift may result from normal circadian variation, the effect of rotational shift-work or a combination of both. As a consequence, higher postprandial glucose concentrations are observed during the night shift.

  4. Rover waste assay system

    International Nuclear Information System (INIS)

    Akers, D.W.; Stoots, C.M.; Kraft, N.C.; Marts, D.J.

    1997-01-01

    The Rover Waste Assay System (RWAS) is a nondestructive assay system designed for the rapid assay of highly-enriched 235 U contaminated piping, tank sections, and debris from the Rover nuclear rocket fuel processing facility at the Idaho Chemical Processing Plant. A scanning system translates a NaI(Tl) detector/collimator system over the structural components where both relative and calibrated measurements for 137 Cs are made. Uranium-235 concentrations are in operation and is sufficiently automated that most functions are performed by the computer system. These functions include system calibration, problem identification, collimator control, data analysis, and reporting. Calibration of the system was done through a combination of measurements on calibration standards and benchmarked modeling. A description of the system is presented along with the methods and uncertainties associated with the calibration and analysis of the system for components from the Rover facility. 4 refs., 2 figs., 4 tabs

  5. Market shifting

    Energy Technology Data Exchange (ETDEWEB)

    Forst, Michael

    2013-11-01

    After years of oversupply and artificially low module pricing, market analysts believe that the solar industry will begin to stabilize by 2017. While the market activities are shifting from Europe to the Asia Pacific region and the United States, the solar shakeout continues to be in full swing including solar cell and module manufacturing. (orig.)

  6. Tough Shift

    DEFF Research Database (Denmark)

    Brewer, Robert S.; Verdezoto, Nervo; Holst, Thomas

    2015-01-01

    people to change their behavior at home. Leveraging prior research on encouraging reductions in residential energy use through game play, we introduce ShareBuddy: a casual mobile game intended to encourage players not only to reduce, but also to shift their electricity use. We conducted two field studies...... real-world resource use into a game....

  7. Lateral shifting in one dimensional chiral photonic crystal

    Energy Technology Data Exchange (ETDEWEB)

    You Yuan, E-mail: yctcyouyuan@163.com [School of Physics and Electronics, Yancheng Teachers University, Yancheng, 224002 Jiangsu (China); Chen Changyuan [School of Physics and Electronics, Yancheng Teachers University, Yancheng, 224002 Jiangsu (China)

    2012-07-01

    We report the lateral shifts of the transmitted waves in a one dimensional chiral photonic crystal by using the stationary-phase approach. It is revealed that two kinds of lateral shifts are observed due to the existence of cross coupling in chiral materials, which is different from what has been observed in previous non-chiral photonic crystals. Unlike the chiral slab, the positions of lateral shift peaks are closely related to the band edges of band gap characteristics of periodic structure and lateral shifts can be positive as well as negative. Besides, the lateral shifts show a strong dependence on the chiral factor, which varies the lateral shift peaks in both magnitudes and positions. These features are desirable for future device applications.

  8. Lateral shifting in one dimensional chiral photonic crystal

    International Nuclear Information System (INIS)

    You Yuan; Chen Changyuan

    2012-01-01

    We report the lateral shifts of the transmitted waves in a one dimensional chiral photonic crystal by using the stationary-phase approach. It is revealed that two kinds of lateral shifts are observed due to the existence of cross coupling in chiral materials, which is different from what has been observed in previous non-chiral photonic crystals. Unlike the chiral slab, the positions of lateral shift peaks are closely related to the band edges of band gap characteristics of periodic structure and lateral shifts can be positive as well as negative. Besides, the lateral shifts show a strong dependence on the chiral factor, which varies the lateral shift peaks in both magnitudes and positions. These features are desirable for future device applications.

  9. Choice Shift in Opinion Network Dynamics

    Science.gov (United States)

    Gabbay, Michael

    Choice shift is a phenomenon associated with small group dynamics whereby group discussion causes group members to shift their opinions in a more extreme direction so that the mean post-discussion opinion exceeds the mean pre-discussion opinion. Also known as group polarization, choice shift is a robust experimental phenomenon and has been well-studied within social psychology. In opinion network models, shifts toward extremism are typically produced by the presence of stubborn agents at the extremes of the opinion axis, whose opinions are much more resistant to change than moderate agents. However, we present a model in which choice shift can arise without the assumption of stubborn agents; the model evolves member opinions and uncertainties using coupled nonlinear differential equations. In addition, we briefly describe the results of a recent experiment conducted involving online group discussion concerning the outcome of National Football League games are described. The model predictions concerning the effects of network structure, disagreement level, and team choice (favorite or underdog) are in accord with the experimental results. This research was funded by the Office of Naval Research and the Defense Threat Reduction Agency.

  10. Rapid Hydrogen Shift Reactions in Acyl Peroxy Radicals

    DEFF Research Database (Denmark)

    Knap, Hasse Christian; Jørgensen, Solvejg

    2017-01-01

    -shift with X = 6, 7, 8, or 9) in the hydroperoxy acyl peroxy radicals, this H-shift is a reversible reaction and it scrambles between two peroxides, hydroperoxy acyl peroxy and peroxy peroxoic acid radicals. The forward reaction rate constants of the 1,X-OOH H-shift reactions are estimated to be above 103 s–1...... with transition state theory corrected with Eckart quantum tunnelling correction. The ratio between the forward and reverse reaction rate constant of the 1,X-OOH H-shift reactions is around ∼105. Therefore, the equilibrium is pushed toward the production of peroxy peroxoic acid radicals. These very fast 1,X-OOH H......We have used quantum mechanical chemical calculations (CCSD(T)-F12a/cc-pVDZ-F12//M06-2X/aug-cc-pVTZ) to investigate the hydrogen shift (H-shift) reactions in acyl peroxy and hydroperoxy acyl peroxy radicals. We have focused on the H-shift reactions from a hydroperoxy group (OOH) (1,X-OOH H...

  11. Radioreceptor assay: theory and applications to pharmacology

    International Nuclear Information System (INIS)

    Perret, G.; Simon, P.

    1984-01-01

    The aim of the first part of this work is to present the theory of the radioreceptor assay and to compare it to the other techniques of radioanalysis (radioimmunoassay, competitive protein binding assays). The technology of the radioreceptor assay is then presented and its components (preparation of the receptors, radioligand, incubation medium) are described. The analytical characteristics of the radioreceptor assay (specificity, sensitivity, reproductibility, accuracy) and the pharmacological significance of the results are discussed. The second part is devoted to the description of the radioreceptor assays of some pharmacological classes (neuroleptics, tricyclic antidepressants, benzodiazepines, β-blockers, anticholinergic drugs) and to their use in therapeutic drug monitoring. In conclusion, by their nature, radioreceptor assays are highly sensitive, reliable, precise, accurate and simple to perform. Their chief disadvantage relates to specificity, since any substance having an appreciable affinity to the receptor site will displace the specifically bound radioligand. Paradoxically in some cases, this lack of specificity may be advantageous in that it allows for the detection of not only the apparent compound but of active metabolites and endogenous receptor agonists as well and in that radioreceptors assays can be devised for a whole pharmacological class and not only for one drug as it is the case for classical physico-chemical techniques. For all these reasons future of radioreceptor assay in pharmacology appears promising [fr

  12. Giant Lamb shift in photonic crystals

    International Nuclear Information System (INIS)

    Wang Xuehua; Kivshar, Yuri S.; Gu Benyuan

    2004-01-01

    We obtain a general result for the Lamb shift of excited states of multilevel atoms in inhomogeneous electromagnetic structures and apply it to study atomic hydrogen in inverse-opal photonic crystals. We find that the photonic-crystal environment can lead to very large values of the Lamb shift, as compared to the case of vacuum. We also suggest that the position-dependent Lamb shift should extend from a single level to a miniband for an assembly of atoms with random distribution in space, similar to the velocity-dependent Doppler effect in atomic/molecular gases

  13. Assay optimization for molecular detection of Zika virus

    NARCIS (Netherlands)

    Corman, Victor M.; Rasche, Andrea; Baronti, Cecile; Aldabbagh, Souhaib; Cadar, Daniel; Reusken, Chantal Bem; Pas, Suzan D.; Goorhuis, Abraham; Schinkel, Janke; Molenkamp, Richard; Kümmerer, Beate M.; Bleicker, Tobias; Brünink, Sebastian; Eschbach-Bludau, Monika; Eis-Hübinger, Anna M.; Koopmans, Marion P.; Schmidt-Chanasit, Jonas; Grobusch, Martin P.; de Lamballerie, Xavier; Drosten, Christian; Drexler, Jan Felix

    2016-01-01

    To examine the diagnostic performance of real-time reverse transcription (RT)-polymerase chain reaction (PCR) assays for Zika virus detection. We compared seven published real-time RT-PCR assays and two new assays that we have developed. To determine the analytical sensitivity of each assay, we

  14. Origins of Stokes shift in PbS nanocrystals

    KAUST Repository

    Voznyy, Oleksandr

    2017-10-27

    Stokes shift, an energy difference between the excitonic absorption and emission, is a property of colloidal quantum dots (CQDs) typically ascribed to splitting between dark and bright excitons. In some materials, e.g., PbS, CuInS2, CdHgTe, a Stokes shift of up to 200 meV is observed, substantially larger than the estimates of dark-bright state splitting or vibronic relaxations. The shift origin remains highly debated, as contradictory signatures of both surface and bulk character were reported for the Stokes-shifted electronic state. Here we show that the energy transfer among CQDs in a polydispersed ensemble in solution suffices to explain the excess Stokes shift. This energy transfer is primarily due to CQD aggregation, and can be substantially eliminated by extreme dilution, higher-viscosity solvent, or better-dispersed colloids. Our findings highlight that ensemble polydispersity remains the primary source of the Stokes shift in CQDs in solution, propagating into the Stokes shift in films and the open-circuit voltage deficit in CQD solar cells. Improved synthetic control can bring notable advancements in CQD photovoltaics, and the Stokes shift continues to provide a sensitive and significant metric to monitor ensemble size distribution.

  15. The androgen receptor malignancy shift in prostate cancer.

    Science.gov (United States)

    Copeland, Ben T; Pal, Sumanta K; Bolton, Eric C; Jones, Jeremy O

    2018-05-01

    Androgens and the androgen receptor (AR) are necessary for the development, function, and homeostatic growth regulation of the prostate gland. However, once prostate cells are transformed, the AR is necessary for the proliferation and survival of the malignant cells. This change in AR function appears to occur in nearly every prostate cancer. We have termed this the AR malignancy shift. In this review, we summarize the current knowledge of the AR malignancy shift, including the DNA-binding patterns that define the shift, the transcriptome changes associated with the shift, the putative drivers of the shift, and its clinical implications. In benign prostate epithelial cells, the AR primarily binds consensus AR binding sites. In carcinoma cells, the AR cistrome is dramatically altered, as the AR associates with FOXA1 and HOXB13 motifs, among others. This shift leads to the transcription of genes associated with a malignant phenotype. In model systems, some mutations commonly found in localized prostate cancer can alter the AR cistrome, consistent with the AR malignancy shift. Current evidence suggests that the AR malignancy shift is necessary but not sufficient for transformation of prostate epithelial cells. Reinterpretation of prostate cancer genomic classification systems in light of the AR malignancy shift may improve our ability to predict clinical outcomes and treat patients appropriately. Identifying and targeting the molecular factors that contribute to the AR malignancy shift is not trivial but by doing so, we may be able to develop new strategies for the treatment or prevention of prostate cancer. © 2018 Wiley Periodicals, Inc.

  16. Thyroglobulin (Tg) Testing Revisited: Tg Assays, TgAb Assays, and Correlation of Results With Clinical Outcomes.

    Science.gov (United States)

    Netzel, Brian C; Grebe, Stefan K G; Carranza Leon, B Gisella; Castro, M Regina; Clark, Penelope M; Hoofnagle, Andrew N; Spencer, Carole A; Turcu, Adina F; Algeciras-Schimnich, Alicia

    2015-08-01

    Measurement of thyroglobulin (Tg) by mass spectrometry (Tg-MS) is emerging as a tool for accurate Tg quantification in patients with anti-Tg autoantibodies (TgAbs). The objective of the study was to perform analytical and clinical evaluations of two Tg-MS assays in comparison with immunometric Tg assays (Tg-IAs) and Tg RIAs (Tg-RIAs) in a cohort of thyroid cancer patients. A total of 589 samples from 495 patients, 243 TgAb-/252 TgAb+, were tested by Beckman, Roche, Siemens-Immulite, and Thermo-Brahms Tg and TgAb assays, two Tg-RIAs, and two Tg-MS assays. The frequency of TgAb+ was 58%, 41%, 27%, and 39% for Roche, Beckman, Siemens-Immulite, and Thermo-Brahms, respectively. In TgAb- samples, clinical sensitivities and specificities of 100% and 74%-100%, respectively, were observed across all assays. In TgAb+ samples, all Tg-IAs demonstrated assay-dependent Tg underestimation, ranging from 41% to 86%. In TgAb+ samples, the use of a common cutoff (0.5 ng/mL) for the Tg-MS, three Tg-IAs, and the USC-RIA improved the sensitivity for the Tg-MSs and Tg-RIAs when compared with the Tg-IAs. In up to 20% of TgAb+ cases, Tg-IAs failed to detect Tg that was detectable by Tg-MS. In Tg-RIAs false-high biases were observed in TgAb+ samples containing low Tg concentrations. Tg-IAs remain the method of choice for Tg quantitation in TgAb- patients. In TgAb+ patients with undetectable Tg by immunometric assay, the Tg-MS will detect Tg in up to 20% additional cases. The Tg-RIA will detect Tg in approximately 35% cases, but a significant proportion of these will be clinical false-positive results. The undetectable Tg-MS seen in approximately 40% of TgAb+ cases in patients with disease need further evaluation.

  17. poolHiTS: A Shifted Transversal Design based pooling strategy for high-throughput drug screening

    Directory of Open Access Journals (Sweden)

    Woolf Peter J

    2008-05-01

    Full Text Available Abstract Background A key goal of drug discovery is to increase the throughput of small molecule screens without sacrificing screening accuracy. High-throughput screening (HTS in drug discovery involves testing a large number of compounds in a biological assay to identify active compounds. Normally, molecules from a large compound library are tested individually to identify the activity of each molecule. Usually a small number of compounds are found to be active, however the presence of false positive and negative testing errors suggests that this one-drug one-assay screening strategy can be significantly improved. Pooling designs are testing schemes that test mixtures of compounds in each assay, thereby generating a screen of the whole compound library in fewer tests. By repeatedly testing compounds in different combinations, pooling designs also allow for error-correction. These pooled designs, for specific experiment parameters, can be simply and efficiently created using the Shifted Transversal Design (STD pooling algorithm. However, drug screening contains a number of key constraints that require specific modifications if this pooling approach is to be useful for practical screen designs. Results In this paper, we introduce a pooling strategy called poolHiTS (Pooled High-Throughput Screening which is based on the STD algorithm. In poolHiTS, we implement a limit on the number of compounds that can be mixed in a single assay. In addition, we show that the STD-based pooling strategy is limited in the error-correction that it can achieve. Due to the mixing constraint, we show that it is more efficient to split a large library into smaller blocks of compounds, which are then tested using an optimized strategy repeated for each block. We package the optimal block selection algorithm into poolHiTS. The MATLAB codes for the poolHiTS algorithm and the corresponding decoding strategy are also provided. Conclusion We have produced a practical version

  18. Shift work disorder, depression, and anxiety in the transition to rotating shifts: the role of sleep reactivity.

    Science.gov (United States)

    Kalmbach, David A; Pillai, Vivek; Cheng, Philip; Arnedt, J Todd; Drake, Christopher L

    2015-12-01

    The aim of this study is to investigate premorbid sleep reactivity as a vulnerability to incident shift work disorder (SWD), and related changes in depression as well as anxiety following a transition to a rotating shifts work schedule. This is a longitudinal study with two waves of data collection. The community-based sample included normal sleeping non-shift workers (N = 96; 62.5% female; 47.9 ± 13.3 years) without a lifetime history of insomnia or baseline excessive daytime sleepiness who transitioned to rotating shift work one year later. Participants reported demographic characteristics, trait sleep reactivity on the Ford Insomnia Response to Stress Test, depression symptoms on the Quick Inventory of Depression Symptomatology, and anxiety symptoms on the Beck Anxiety Inventory. SWD was determined based on significant sleep disturbance and/or excessive sleepiness in the context of working in a rotating-shift schedule. Analyses revealed that the odds were over five times greater for highly sleep-reactive individuals to develop SWD after transitioning to rotating shifts (OR = 5.59, p = 0.04). Nearly 90% of participants who suffered from SWD were accurately identified as high risk at one year before disease onset. Furthermore, individuals who developed SWD reported greater increases in symptoms of depression and anxiety. Finally, analyses revealed significant indirect effects wherein high sleep reactivity increased risk for SWD, which led to greater severity of anxiety and depression symptoms. The Ford Insomnia Response to Stress Test (FIRST) accurately identifies a focused target population in which the premorbid psychobiological processes complicit in SWD onset and progression, as well as shift work-related depression and anxiety changes, can be better investigated, thus improving future preventative efforts. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Lamb shift of Rydberg atoms in a resonator

    International Nuclear Information System (INIS)

    Belov, A.A.; Lozovik, Yu.E.; Pokrovsky, V.L.

    1988-08-01

    The Lamb shift of a Rydberg atom in a cavity is shown to be enhanced with the resonance interaction of a virtual atomic transition and cavity modes. The dependence of the Lamb shift on quantum numbers and atomic number changes drastically. Shifting cavity walls and scanning the atomic beam one can vary the Lamb shift. The value of the Lamb shift in a cavity may exceed a typical magnitude of the fine structure energy. For a rough resonance tuning the Coulumb multiplet occurs to be strongly mixed and a novel classification is necessary. (author). 8 refs, 2 figs

  20. The calculation of proton chemical shifts in hydrocarbons

    Energy Technology Data Exchange (ETDEWEB)

    Abraham, Raymond J [Liverpool Univ. (United Kingdom). Dept. of Chemistry

    1994-12-31

    Novel extension of the CHARGE3 semi-empirical calculation of the partial atomic charges in molecules are described which allow the accurate calculation of the proton chemical shifts of a variety of acyclic alkanes. This simple scheme predicts the proton chemical shifts of all the simple alkanes, cyclohexane and methyl cyclohexanes, norbornane, trans-decalin and trans perhydrophenanthrene, comprising a range of chemical shifts from 0.3 to 2.2 {delta} with the known substituent chemical shifts of other functional groups this could allow the general prediction of proton chemical shifts in a simple and useful format. (author) 13 refs., 2 figs.

  1. Assessment and reduction of comet assay variation in relation to DNA damage: studies from the European Comet Assay Validation Group

    DEFF Research Database (Denmark)

    Møller, Peter; Möller, Lennart; Godschalk, Roger W L

    2010-01-01

    The alkaline single cell gel electrophoresis (comet) assay has become a widely used method for the detection of DNA damage and repair in cells and tissues. Still, it has been difficult to compare results from different investigators because of differences in assay conditions and because the data...... are reported in different units. The European Comet Assay Validation Group (ECVAG) was established for the purpose of validation of the comet assay with respect to measures of DNA damage formation and its repair. The results from this inter-laboratory validation trail showed a large variation in measured level...... reliability for the measurement of DNA damage by the comet assay but there is still a need for further validation to reduce both assay and inter-laboratory variation....

  2. Does the ARFIMA really shift?

    DEFF Research Database (Denmark)

    Monache, Davide Delle; Grassi, Stefano; Santucci de Magistris, Paolo

    Short memory models contaminated by level shifts have long-memory features similar to those associated to processes generated under fractional integration. In this paper, we propose a robust testing procedure, based on an encompassing parametric specification, that allows to disentangle the level...... the highest power compared to other existing tests for spurious long-memory. Finally, we illustrate the usefulness of the proposed approach on the daily series of bipower variation and share turnover and on the monthly inflation series of G7 countries....... shift term from the ARFIMA component. The estimation is carried out via a state-space methodology and it leads to a robust estimate of the fractional integration parameter also in presence of level shifts.The Monte Carlo simulations show that this approach produces unbiased estimates of the fractional...

  3. A European multicientre study on the comparison of HIV-1 viral loads between VERIS HIV-1 Assay and Roche COBAS® TAQMAN® HIV-1 test, Abbott RealTime HIV-1 Assay, and Siemens VERSANT HIV-1 Assay.

    Science.gov (United States)

    Braun, Patrick; Delgado, Rafael; Drago, Monica; Fanti, Diana; Fleury, Hervé; Hofmann, Jörg; Izopet, Jacques; Kühn, Sebastian; Lombardi, Alessandra; Mancon, Alessandro; Marcos, Mª Angeles; Mileto, Davide; Sauné, Karine; O'Shea, Siobhan; Pérez-Rivilla, Alfredo; Ramble, John; Trimoulet, Pascale; Vila, Jordi; Whittaker, Duncan; Artus, Alain; Rhodes, Daniel

    2017-07-01

    Viral load monitoring is essential for patients under treatment for HIV. Beckman Coulter has developed the VERIS HIV-1 Assay for use on the novel, automated DxN VERIS Molecular Diagnostics System. ¥ OBJECTIVES: Evaluation of the clinical performance of the new quantitative VERIS HIV-1 Assay at multiple EU laboratories. Method comparison with the VERIS HIV-1 Assay was performed with 415 specimens at 5 sites tested with COBAS ® AmpliPrep/COBAS ® TaqMan ® HIV-1 Test, v2.0, 169 specimens at 3 sites tested with RealTime HIV-1 Assay, and 202 specimens from 2 sites tested with VERSANT HIV-1 Assay. Patient monitoring sample results from 4 sites were also compared. Bland-Altman analysis showed the average bias between VERIS HIV-1 Assay and COBAS HIV-1 Test, RealTime HIV-1 Assay, and VERSANT HIV-1 Assay to be 0.28, 0.39, and 0.61 log 10 cp/mL, respectively. Bias at low end levels below 1000cp/mL showed predicted bias to be <0.3 log 10 cp/mL for VERIS HIV-1 Assay versus COBAS HIV-1 Test and RealTime HIV-1 Assay, and <0.5 log 10 cp/mL versus VERSANT HIV-1 Assay. Analysis on 174 specimens tested with the 0.175mL volume VERIS HIV-1 Assay and COBAS HIV-1 Test showed average bias of 0.39 log 10 cp/mL. Patient monitoring results using VERIS HIV-1 Assay demonstrated similar viral load trends over time to all comparators. The VERIS HIV-1 Assay for use on the DxN VERIS System demonstrated comparable clinical performance to COBAS ® HIV-1 Test, RealTime HIV-1 Assay, and VERSANT HIV-1 Assay. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Immune chromatography: a quantitative radioimmunological assay

    International Nuclear Information System (INIS)

    Davis, J.W.; Demetriades, M.; Bowen, J.M.

    1984-01-01

    Immune chromatography, a radioimmunological binding assay, employs paper chromatography to separate immune complexes from free antigen and antibodies. During chromatography free antigen and antibodies become distributed throughout the paper, while immune complexes remain near the bottoms of the strips. The chromatographic differences can be made quantitative by using either iodinated antigens or antibodies. Under these conditions nanogram quantities of antigen can be detected or antibodies in sera diluted several 1000-fold. The immune chromatography assay can also be performed as an indirect assay, since the paper strips are cut from nitrocellulose paper. In this case the immune components are absorbed by the paper during chromatography. Antigen is then detected with an iodinated second antibody. The indirect immune chromatography assay is particularly useful for identifying different sera that react with the same antigen. Reaction with the first serum before chromatography reduces the amount of antigen available to the second serum following chromatography. In addition to characterizing the immune chromatography procedure, we discuss the possible applications of chromatography assays for the quantitation of other types of molecular binding interactions. (Auth.)

  5. Introducing MINA--The Molecularly Imprinted Nanoparticle Assay.

    Science.gov (United States)

    Shutov, Roman V; Guerreiro, Antonio; Moczko, Ewa; de Vargas-Sansalvador, Isabel Perez; Chianella, Iva; Whitcombe, Michael J; Piletsky, Sergey A

    2014-03-26

    A new ELISA- (enzyme-linked immunosorbent assay)-like assay is demonstrated in which no elements of biological origin are used for molecular recognition or signaling. Composite imprinted nanoparticles that contain a catalytic core and which are synthesized by using a solid-phase approach can simultaneously act as recognition/signaling elements, and be used with minimal modifications to standard assay protocols. This assay provides a new route towards replacement of unstable biomolecules in immunoassays. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Differences in cortisol profiles and circadian adjustment time between nurses working night shifts and regular day shifts: A prospective longitudinal study.

    Science.gov (United States)

    Niu, Shu-Fen; Chung, Min-Huey; Chu, Hsin; Tsai, Jui-Chen; Lin, Chun-Chieh; Liao, Yuan-Mei; Ou, Keng-Liang; O'Brien, Anthony Paul; Chou, Kuei-Ru

    2015-07-01

    This study explored the differences in the circadian salivary cortisol profiles between nurses working night shifts and regular day shifts following a slow rotating shift schedule to assess the number of days required for adjusting the circadian rhythm of salivary cortisol levels in nurses working consecutive night shifts and the number of days off required to restore the diurnal circadian rhythm of salivary cortisol levels. This was a prospective, longitudinal, parallel-group comparative study. The participants were randomly assigned to night and day-shift groups, and saliva samples were collected to measure their cortisol levels and circadian secretion patterns. Significant differences were observed in the overall salivary cortisol pattern parameters (cortisol awakening response, changes in cortisol profiles between 6 and 12h after awakening, and changes in cortisol profiles between 30 min and 12 h after awakening) from Days 2 to 4 of the workdays between both groups. However, on Day 2 of the days off, both groups exhibited similar cortisol profiles and the cortisol profiles in the night-shift group were restored. Nurses working night shifts require at least 4 days to adjust their circadian rhythms of cortisol secretions. Moreover, on changing from night shift to other shifts, nurses must be allowed more than 2 days off work. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Rover waste assay system

    Energy Technology Data Exchange (ETDEWEB)

    Akers, D.W.; Stoots, C.M.; Kraft, N.C.; Marts, D.J. [Idaho National Engineering Lab., Idaho Falls, ID (United States)

    1997-11-01

    The Rover Waste Assay System (RWAS) is a nondestructive assay system designed for the rapid assay of highly-enriched {sup 235}U contaminated piping, tank sections, and debris from the Rover nuclear rocket fuel processing facility at the Idaho Chemical Processing Plant. A scanning system translates a NaI(Tl) detector/collimator system over the structural components where both relative and calibrated measurements for {sup 137}Cs are made. Uranium-235 concentrations are in operation and is sufficiently automated that most functions are performed by the computer system. These functions include system calibration, problem identification, collimator control, data analysis, and reporting. Calibration of the system was done through a combination of measurements on calibration standards and benchmarked modeling. A description of the system is presented along with the methods and uncertainties associated with the calibration and analysis of the system for components from the Rover facility. 4 refs., 2 figs., 4 tabs.

  8. Assay system

    International Nuclear Information System (INIS)

    Patzke, J.B.; Rosenberg, B.J.

    1984-01-01

    The accuracy of assays for monitoring concentrations of basic drugs in biological fluids containing a 1 -acid glycoproteins, such as blood (serum or plasma), is improved by the addition of certain organic phosphate compounds to minimize the ''protein effect.'' Kits containing the elements of the invention are also disclosed

  9. Medical Devices; Immunology and Microbiology Devices; Classification of the Assayed Quality Control Material for Clinical Microbiology Assays. Final order.

    Science.gov (United States)

    2017-07-27

    The Food and Drug Administration (FDA, Agency, or we) is classifying the assayed quality control material for clinical microbiology assays into class II (special controls). The special controls that will apply to the device are identified in this order and will be part of the codified language for the assayed quality control material for clinical microbiology assays' classification. The Agency is classifying the device into class II (special controls) to provide a reasonable assurance of safety and effectiveness of the device.

  10. Isotope shift studies in gadolinium spectra

    International Nuclear Information System (INIS)

    Ahmad, S.A.; Saksena, G.D.; Venugopalan, A.

    1976-01-01

    Isotope shift studies have been carried out in the gadolinium spectrum using a recording Fabry-Perot spectrometer and gadolinium samples enriched in 156 Gd and 160 Gd isotopes. Isotope shifts Δsigma(156-160) have been recorded in 134 lines in the region 3930-4140 A. Some of these lines involve the recently identified even configuration 4f 8 5d6s of Gd I and the newly classified transition 4f 8 6s-4f 8 6p of Gd II. From the isotope shift measurements of lines involving the 4f 8 6s-4f 8 6p transition in Gd II, the isotope shift, ΔT(156-160)=87 mK, has been obtained for the 4f 8 6s configuration. Electronic configurations have been suggested for a number of energy levels and configuration mixing has been pointed out in certain cases. (Auth.)

  11. Capillary Electrophoresis Analysis of Conventional Splicing Assays

    DEFF Research Database (Denmark)

    de Garibay, Gorka Ruiz; Acedo, Alberto; García-Casado, Zaida

    2014-01-01

    of these assays is often challenging. Here, we explore this issue by conducting splicing assays in 31 BRCA2 genetic variants. All variants were assessed by RT-PCR followed by capillary electrophoresis and direct sequencing. If assays did not produce clear-cut outputs (Class-2 or Class-5 according to analytical...

  12. Association between exposure to rotating night shift versus day shift using levels of 6-sulfatoxymelatonin and cortisol and other sex hormones in women.

    Science.gov (United States)

    Gómez-Acebo, Inés; Dierssen-Sotos, Trinidad; Papantoniou, Kyriaki; García-Unzueta, María Teresa; Santos-Benito, María Francisca; Llorca, Javier

    2015-02-01

    The present study aims to compare 6-sulfatoxymelatonin (aMT6s) secretion patterns and levels of cortisol and sex hormones (estradiol, progesterone, DHEA, DHEAS, and testosterone) among rotating night-shift workers and day-shift workers. We performed a cross-sectional study in Cantabria (northern Spain) including 136 women (73 day-shift workers and 63 rotating night-shift workers). Blood and urine samples were obtained after two consecutive working days. Differences in means were estimated using ANCOVA, stratified by menopausal status, ovulation phase, and adjusted for season, age, body mass index, consumption of cigarettes in the last 24 h. aMT6s circadian rhythm was analyzed using the cosinor analysis. The present study showed that rotating night-shift workers had lower excretion of aMT6s than day-shift workers (mesor = 50.26 ng aMT6s/mg creatinine in women with rotating night shift versus 88.79 ng aMT6s/mg creatinine in women with day shift), lower fluctuation (amplitude = 45.24 ng aMT6s/mg creatinine in rotating night-shift workers versus 79.71 ng aMT6s/mg creatinine in day-shift workers), and a later acrophase (aMT6s peak time: 08:31 in rotating night-shift workers versus 07:13 h in day-shift workers). Additionally, women with rotating night shift had higher estradiol and progesterone levels, compared to day workers, especially in the follicular phase on the menstrual cycle.

  13. Controlling variation in the comet assay

    Directory of Open Access Journals (Sweden)

    Andrew Richard Collins

    2014-10-01

    Full Text Available Variability of the comet assay is a serious issue, whether it occurs from experiment to experiment in the same laboratory, or between different laboratories analysing identical samples. Do we have to live with high variability, just because the comet assay is a biological assay rather than analytical chemistry? Numerous attempts have been made to limit variability by standardising the assay protocol, and the critical steps in the assay have been identified; agarose concentration, duration of alkaline incubation, and electrophoresis conditions (time, temperature and voltage gradient are particularly important. Even when these are controlled, variation seems to be inevitable. It is helpful to include in experiments reference standards, i.e. cells with a known amount of specific damage to the DNA. They can be aliquots frozen from a single large batch of cells, either untreated (negative controls or treated with, for example, H2O2 or X-rays to induce strand breaks (positive control for the basic assay, or photosensitiser plus light to oxidise guanine (positive control for Fpg- or OGG1-sensitive sites. Reference standards are especially valuable when performing a series of experiments over a long period - for example, analysing samples of white blood cells from a large human biomonitoring trial - to check that the assay is performing consistently, and to identify anomalous results necessitating a repeat experiment. The reference values of tail intensity can also be used to iron out small variations occurring from day to day. We present examples of the use of reference standards in human trials, both within one laboratory and between different laboratories, and describe procedures that can be used to control variation.

  14. Quality Improvement to Demonstrate the Lack of Reliability of the Human Papillomavirus mRNA Assay to Identify Women With Latent Human Papillomavirus Infections.

    Science.gov (United States)

    Cotton, Sarah; Brown, Robert E; Nugent, Elizabeth K; Robazetti, Sonia C; Berens, Pamela D; Smith, Judith A

    2018-04-01

    To assess the consistency between human papillomavirus (HPV) mRNA testing in women with a history of previous HPV infections diagnosed by HPV DNA assay and the potential effects on follow-up HPV screening. This was a quality improvement study that used data from a pathology laboratory software database reviewed from November 2014 to June 2016 to identify female patients aged 30 years or older with greater than one HPV-positive result, including one or more HPV mRNA assay results and one or more documented HPV DNA assay results for comparison. Previous correlative cytology and colposcopic histopathology were also documented. American College of Obstetricians and Gynecologists' cervical cancer screening guidelines were used to compare potential differences in follow-up recommendations. Four hundred twenty-five charts for female patients 30 years of age or older were identified with one or more prior high-risk HPV infections by DNA assay. There was a 69.3% difference in HPV mRNA results compared with previous HPV DNA-positive results. There was a potential change in follow-up for 71.7% of patients with one prior high-risk-HPV-positive result and 60.0% of patients with two or more prior high-risk HPV-positive results. There were 231 colposcopy reports evaluated in this study. Of these, 62 (26.8%) were abnormal colposcopy reports, including 45 low-grade squamous intraepithelial lesions, 15 high-grade squamous intraepithelial lesions, and two cancers. Twenty-five (40.3%) abnormal colposcopy findings were in patients with a history of at least than two prior HPV DNA-positive results and a report of currently being HPV-negative with the mRNA assay. The HPV mRNA assays are less sensitive for detection of latent HPV infections compared with HPV DNA assays. Based on these data and the potential change in follow-up care, the HPV mRNA assay should not be used for a primary screening tool for cervical cancer. Many pathology laboratories have shifted to using the HPV mRNA assay

  15. Validation of archived chemical shifts through atomic coordinates

    Science.gov (United States)

    Rieping, Wolfgang; Vranken, Wim F

    2010-01-01

    The public archives containing protein information in the form of NMR chemical shift data at the BioMagResBank (BMRB) and of 3D structure coordinates at the Protein Data Bank are continuously expanding. The quality of the data contained in these archives, however, varies. The main issue for chemical shift values is that they are determined relative to a reference frequency. When this reference frequency is set incorrectly, all related chemical shift values are systematically offset. Such wrongly referenced chemical shift values, as well as other problems such as chemical shift values that are assigned to the wrong atom, are not easily distinguished from correct values and effectively reduce the usefulness of the archive. We describe a new method to correct and validate protein chemical shift values in relation to their 3D structure coordinates. This method classifies atoms using two parameters: the per-atom solvent accessible surface area (as calculated from the coordinates) and the secondary structure of the parent amino acid. Through the use of Gaussian statistics based on a large database of 3220 BMRB entries, we obtain per-entry chemical shift corrections as well as Z scores for the individual chemical shift values. In addition, information on the error of the correction value itself is available, and the method can retain only dependable correction values. We provide an online resource with chemical shift, atom exposure, and secondary structure information for all relevant BMRB entries (http://www.ebi.ac.uk/pdbe/nmr/vasco) and hope this data will aid the development of new chemical shift-based methods in NMR. Proteins 2010. © 2010 Wiley-Liss, Inc. PMID:20602353

  16. Nurse perceptions of workplace environment: differences across shifts.

    Science.gov (United States)

    Teclaw, Robert; Osatuke, Katerine

    2015-11-01

    To evaluate whether nurse work shift affected workplace perceptions. Although the importance of work schedule in shaping work attitudes, generally (and specifically for nurses) is well accepted, much work remains in characterising how and why nurses' perceptions might differ across shifts. Using an exploratory study of observational data, we examined whether shift influenced non-supervisory nurses' job perceptions in the Veterans Health Administration All Employee Survey (n = 14057; years 2008, 2010, 2012). The size of differences in item means (95% C.I.) across shifts was evaluated graphically. Using ordinal logistic regression, we accounted for the ordinal outcome variables and controlled for the demographic and survey year effects. Nurses' perceptions of workplace climate differed across shifts. Items with the greatest differences, consistent across years and analytic methods, involved supervisors and fairness. Night and weekend shift nurse ratings were more negative than for weekday shift nurses. Off-shift nurses are less satisfied with work/life balance, their supervisors and especially fairness. Overall satisfaction and turnover intention are not affected to the same extent. These results indicate several specific areas that nurse managers can address through workforce support and communication. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.

  17. 233U Assay A Neutron NDA System

    International Nuclear Information System (INIS)

    Hensley, D.C.; Lucero, A.J.; Pierce, L.

    1998-01-01

    The assay of highly enriched 233 U material presents some unique challenges. Techniques which apply to the assay of materials of Pu or enriched 235 U do not convert easily over to the assay of 233 U. A specialized neutron assay device is being fabricated to exploit the singles neutron signal, the weak correlated neutron signal, and an active correlated signal. These pieces of information when combined with γ ray isotopics information should give a good overall determination of 233 U material now stored in bldg. 3019 at the Oak Ridge National Laboratory

  18. Soft theorems for shift-symmetric cosmologies

    Science.gov (United States)

    Finelli, Bernardo; Goon, Garrett; Pajer, Enrico; Santoni, Luca

    2018-03-01

    We derive soft theorems for single-clock cosmologies that enjoy a shift symmetry. These so-called consistency conditions arise from a combination of a large diffeomorphism and the internal shift symmetry and fix the squeezed limit of all correlators with a soft scalar mode. As an application, we show that our results reproduce the squeezed bispectrum for ultra-slow-roll inflation, a particular shift-symmetric, nonattractor model which is known to violate Maldacena's consistency relation. Similar results have been previously obtained by Mooij and Palma using background-wave methods. Our results shed new light on the infrared structure of single-clock cosmological spacetimes.

  19. MCNP efficiency calculations of INEEL passive active neutron assay system for simulated TRU waste assays

    International Nuclear Information System (INIS)

    Yoon, W.Y.; Meachum, T.R.; Blackwood, L.G.; Harker, Y.D.

    2000-01-01

    The Idaho National Engineering and Environmental Laboratory Stored Waste Examination Pilot Plant (SWEPP) passive active neutron (PAN) radioassay system is used to certify transuranic (TRU) waste drums in terms of quantifying plutonium and other TRU element activities. Depending on the waste form involved, significant systematic and random errors need quantification in addition to the counting statistics. To determine the total uncertainty of the radioassay results, a statistical sampling and verification approach has been developed. In this approach, the total performance of the PAN nondestructive assay system is simulated using the computer models of the assay system, and the resultant output is compared with the known input to assess the total uncertainty. The supporting steps in performing the uncertainty analysis for the passive assay measurements in particular are as follows: (1) Create simulated waste drums and associated conditions; (2) Simulate measurements to determine the basic counting data that would be produced by the PAN assay system under the conditions specified; and (3) Apply the PAN assay system analysis algorithm to the set of counting data produced by simulating measurements to determine the measured plutonium mass. The validity of this simulation approach was verified by comparing simulated output against results from actual measurements using known plutonium sources and surrogate waste drums. The computer simulation of the PAN system performance uses the Monte Carlo N-Particle (MCNP) Code System to produce a neutron transport calculation for a simulated waste drum. Specifically, the passive system uses the neutron coincidence counting technique, utilizing the spontaneous fission of 240 Pu. MCNP application to the SWEPP PAN assay system uncertainty analysis has been very useful for a variety of waste types contained in 208-ell drums measured by a passive radioassay system. The application of MCNP to the active radioassay system is also feasible

  20. Computer-determined assay time based on preset precision

    International Nuclear Information System (INIS)

    Foster, L.A.; Hagan, R.; Martin, E.R.; Wachter, J.R.; Bonner, C.A.; Malcom, J.E.

    1994-01-01

    Most current assay systems for special nuclear materials (SNM) operate on the principle of a fixed assay time which provides acceptable measurement precision without sacrificing the required throughput of the instrument. Waste items to be assayed for SNM content can contain a wide range of nuclear material. Counting all items for the same preset assay time results in a wide range of measurement precision and wastes time at the upper end of the calibration range. A short time sample taken at the beginning of the assay could optimize the analysis time on the basis of the required measurement precision. To illustrate the technique of automatically determining the assay time, measurements were made with a segmented gamma scanner at the Plutonium Facility of Los Alamos National Laboratory with the assay time for each segment determined by counting statistics in that segment. Segments with very little SNM were quickly determined to be below the lower limit of the measurement range and the measurement was stopped. Segments with significant SNM were optimally assays to the preset precision. With this method the total assay time for each item is determined by the desired preset precision. This report describes the precision-based algorithm and presents the results of measurements made to test its validity

  1. Anthropometric changes and fluid shifts

    Science.gov (United States)

    Thornton, W. E.; Hoffler, G. W.; Rummel, J. A.

    1974-01-01

    Several observations of body size, shape, posture, and configuration were made to document changes resulting from direct effects of weightlessness during the Skylab 4 mission. After the crewmen were placed in orbit, a number of anatomical and anthropometric changes occurred including a straightening of the thoracolumbar spine, a general decrease in truncal girth, and an increase in height. By the time of the earliest in-flight measurement on mission day 3, all crewmen had lost more than two liters of extravascular fluid from the calf and thigh. The puffy facies, the bird legs effect, the engorgement of upper body veins, and the reduced volume of lower body veins were all documented with photographs. Center-of-mass measurements confirmed a fluid shift cephalad. This shift remained throughout the mission until recovery, when a sharp reversal occurred; a major portion of the reversal was completed in a few hours. The anatomical changes are of considerable scientific interest and of import to the human factors design engineer, but the shifts of blood and extravascular fluid are of more consequence. It is hypothesized that the driving force for the fluid shift is the intrinsic and unopposed lower limb elasticity that forces venous blood and then other fluid cephalad.

  2. Serotype determination of Salmonella by xTAG assay.

    Science.gov (United States)

    Zheng, Zhibei; Zheng, Wei; Wang, Haoqiu; Pan, Jincao; Pu, Xiaoying

    2017-10-01

    Currently, no protocols or commercial kits are available to determine the serotypes of Salmonella by using Luminex MAGPIX®. In this study, an xTAG assay for serotype determination of Salmonella suitable for Luminex MAGPIX® is described and 228 Salmonella isolates were serotype determined by this xTAG assay. The xTAG assay consists of two steps: 1) Multiplex PCR to amplify simultaneously O, H and Vi antigen genes of Salmonella, and 2) Magplex-TAG™ microsphere hybridization to identify accurately the specific PCR products of different antigens. Compared with the serotyping results of traditional serum agglutination test, the sensitivity and specificity of the xTAG assay were 95.1% and 100%, respectively. The agreement rate of these two assays was 95.2%. Compared with Luminex xMAP® Salmonella Serotyping Assay (SSA) kit, the advantages of this xTAG assay are: First, the magnetic beads make it applicable to both the Luminex®100/200™ and MAGPIX® systems. Second, only primers rather than both primers and probes are needed in the xTAG assay, and the process of coupling antigen-specific oligonucleotide probes to beads is circumvented, which make the xTAG assay convenient to be utilized by other laboratories. The xTAG assay may serve as a rapid alternative or complementary method for traditional Salmonella serotyping tests, especially for laboratories that utilize the MAGPIX® systems. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. The comet assay: ready for 30 more years.

    Science.gov (United States)

    Møller, Peter

    2018-02-24

    During the last 30 years, the comet assay has become widely used for the measurement of DNA damage and repair in cells and tissues. A landmark achievement was reached in 2016 when the Organization for Economic Co-operation and Development adopted a comet assay guideline for in vivo testing of DNA strand breaks in animals. However, the comet assay has much more to offer than being an assay for testing DNA strand breaks in animal organs. The use of repair enzymes increases the range of DNA lesions that can be detected with the assay. It can also be modified to measure DNA repair activity. Still, despite the long-term use of the assay, there is a need for studies that assess the impact of variation in specific steps of the procedure. This is particularly important for the on-going efforts to decrease the variation between experiments and laboratories. The articles in this Special Issue of Mutagenesis cover important technical issues of the comet assay procedure, nanogenotoxicity and ionising radiation sensitivity on plant cells. The included biomonitoring studies have assessed seasonal variation and certain predictors for the basal level of DNA damage in white blood cells. Lastly, the comet assay has been used in studies on genotoxicity of environmental and occupational exposures in human biomonitoring studies and animal models. Overall, the articles in this Special Issue demonstrate the versatility of the comet assay and they hold promise that the assay is ready for the next 30 years.

  4. Associations between shift schedule characteristics with sleep, need for recovery, health and performance measures for regular (semi-) continuous 3-shift systems

    NARCIS (Netherlands)

    van de Ven, Hardy A.; Brouwer, Sandra; Koolhaas, Wendy; Goudswaard, Anneke; de Looze, Michiel P.; Kecklund, Goran; Almansa, Josue; Bultmann, Ute; van der Klink, Jac J. L.

    In this cross-sectional study associations were examined between eight shift schedule characteristics with shift-specific sleep complaints and need for recovery and generic health and performance measures. It was hypothesized that shift schedule characteristics meeting ergonomic recommendations are

  5. Associations between shift schedule characteristics with sleep, need for recovery, health and performance measures for regular (semi-)continuous 3-shift systems

    NARCIS (Netherlands)

    van de Ven, Hardy A.; Brouwer, Sandra; Koolhaas, Wendy; Goudswaard, Anneke; de Looze, Michiel P.; Kecklund, Göran; Almansa, Josue; Bültmann, Ute; van der Klink, Jac J L

    2016-01-01

    In this cross-sectional study associations were examined between eight shift schedule characteristics with shift-specific sleep complaints and need for recovery and generic health and performance measures. It was hypothesized that shift schedule characteristics meeting ergonomic recommendations are

  6. Dietary habits among persons hired on shift work

    OpenAIRE

    Joanna Strzemecka; Iwona Bojar; Ewa Strzemecka; Alfred Owoc

    2014-01-01

    Introduction. Shift-work determinates irregular nutrition habits. The quality as well as the quantity of meals consumed by shift-workers can significantly affects their health. Objective. The aim of this study was to evaluate the dietary habits of people performing shift work in the Bogdanka mine. Material and Methods. The study was carried out in the Bogdanka mine in Leczna. The questionnaire, which was designed by the author of this dissertation, was conducted among 700 shift-workers,...

  7. Shift work and burnout among health care workers.

    Science.gov (United States)

    Wisetborisut, A; Angkurawaranon, C; Jiraporncharoen, W; Uaphanthasath, R; Wiwatanadate, P

    2014-06-01

    Burnout, defined as a syndrome derived from prolonged exposure to stressors at work, is often seen in health care workers. Shift work is considered one of the occupational risks for burnout in health care workers. To identify and describe the association between shift work and burnout among health care workers. A cross-sectional study of health care workers in Chiang Mai University Hospital, Thailand. Data were collected via an online self-answered questionnaire and included details of shift work and burnout. Burnout was measured by the Maslach Burnout Inventory (MBI). Two thousand seven hundred and seventy two health care workers participated, a 52% response rate. Burnout was found more frequently among shift workers than those who did not work shifts (adjusted odds ratio [aOR] 1.4, 95% confidence interval [CI]: 1.0-1.9). Among shift workers, over 10 years of being a shift worker was associated with increasing burnout (aOR 1.7, 95% CI: 1.2-2.6) and having 6-8 sleeping hours per day was associated with having less burnout (aOR 0.7, 95% CI: 0.5-0.9). Nurses who had at least 8 days off per month had lower odds of burnout compared with those with fewer than 8 days off (aOR 0.6, 95% CI: 0.5-0.8). Shift work was associated with burnout in this sample. Increased years of work as a shift worker were associated with more frequent burnout. Adequate sleeping hours and days off were found to be possible protective factors. Policies on shift work should take into account the potential of such work for contributing towards increasing burnout. © The Author 2014. Published by Oxford University Press on behalf of the Society of Occupational Medicine. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  8. Assays for calcitonin receptors

    International Nuclear Information System (INIS)

    Teitelbaum, A.P.; Nissenson, R.A.; Arnaud, C.D.

    1985-01-01

    The assays for calcitonin receptors described focus on their use in the study of the well-established target organs for calcitonin, bone and kidney. The radioligand used in virtually all calcitonin binding studies is 125 I-labelled salmon calcitonin. The lack of methionine residues in this peptide permits the use of chloramine-T for the iodination reaction. Binding assays are described for intact bone, skeletal plasma membranes, renal plasma membranes, and primary kidney cell cultures of rats. Studies on calcitonin metabolism in laboratory animals and regulation of calcitonin receptors are reviewed

  9. Machiavellianism, Discussion Time, and Group Shift

    Science.gov (United States)

    Lamm, Helmut; Myers, David G.

    1976-01-01

    Social-emotional and rational-cognitive explanations of group risky shift on choice dilemmas (hypothetical life situations) were evaluated by comparing shift in groups of low Mach (emotional) and high Mach (non-emotional) subjects. Effects of Machiavellian beliefs on social functioning are examined. Group composition was not observed to affect…

  10. Multiscale regime shifts and planetary boundaries

    NARCIS (Netherlands)

    Hughes, T.P.; Carpenter, S.; Rockstrom, J.; Scheffer, M.; Walker, B.

    2013-01-01

    Life on Earth has repeatedly displayed abrupt and massive changes in the past, and there is no reason to expect that comparable planetary-scale regime shifts will not continue in the future. Different lines of evidence indicate that regime shifts occur when the climate or biosphere transgresses a

  11. Integrated bioassays in microfluidic devices: botulinum toxin assays.

    Science.gov (United States)

    Mangru, Shakuntala; Bentz, Bryan L; Davis, Timothy J; Desai, Nitin; Stabile, Paul J; Schmidt, James J; Millard, Charles B; Bavari, Sina; Kodukula, Krishna

    2005-12-01

    A microfluidic assay was developed for screening botulinum neurotoxin serotype A (BoNT-A) by using a fluorescent resonance energy transfer (FRET) assay. Molded silicone microdevices with integral valves, pumps, and reagent reservoirs were designed and fabricated. Electrical and pneumatic control hardware were constructed, and software was written to automate the assay protocol and data acquisition. Detection was accomplished by fluorescence microscopy. The system was validated with a peptide inhibitor, running 2 parallel assays, as a feasibility demonstration. The small footprint of each bioreactor cell (0.5 cm2) and scalable fluidic architecture enabled many parallel assays on a single chip. The chip is programmable to run a dilution series in each lane, generating concentration-response data for multiple inhibitors. The assay results showed good agreement with the corresponding experiments done at a macroscale level. Although the system has been developed for BoNT-A screening, a wide variety of assays can be performed on the microfluidic chip with little or no modification.

  12. Environmental tax shifting in Canada : theory and application

    International Nuclear Information System (INIS)

    Taylor, A.; Hornung, R.; Cairns, S.

    2003-03-01

    Canada's leading energy and resource companies along with the Pembina Institute for Appropriate Development have collaborated in the Triple E Tax Shift Research Collaborative which examines the use of environmental tax shifting in Canada. The objective is to design, evaluate and advance federal and provincial environmental tax shifts that will influence individual behaviour and decisions to improve ecological integrity through measurable reductions in materials and energy throughput, and to maintain or increase economic competitiveness through the creation of a tax framework that would encourage businesses to improve energy efficiency. Another objective is to increase employment and social benefits through more employment opportunities and improved quality of life. Environmental tax shifting means shifting a portion of a government's tax base onto goods, services and activities associated with harmful environmental impacts that add to societal costs. Tax shifting can be implemented by offering rebates to consumers of environmental significant goods, or by adjustments to existing taxes so that environmentally sensitive goods are taxed at a lower rate than environmentally harmful goods and services. Environmental tax shifting can also be implemented by reducing existing environmental taxes and introducing a carbon dioxide emissions tax. This report is the first product of the collaboration and is intended to promote public dialogue on the subject and identify ways to implement environmental tax shifting. tabs., figs

  13. Comet assay on mice testicular cells

    Directory of Open Access Journals (Sweden)

    Anoop Kumar Sharma

    2015-05-01

    Full Text Available Heritable mutations may result in a variety of adverse outcomes including genetic disease in the offspring. In recent years the focus on germ cell mutagenicity has increased and the “Globally Harmonized System of Classification and Labelling of Chemicals (GHS” has published classification criteria for germ cell mutagens (Speit et al., 2009. The in vivo Comet assay is considered a useful tool for investigating germ cell genotoxicity. In the present study DNA strand breaks in testicular cells of mice were investigated. Different classes of chemicals were tested in order to evaluate the sensitivity of the comet assay in testicular cells. The chemicals included environmentally relevant substances such as Bisphenol A, PFOS and Tetrabrombisphenol A. Statistical power calculations will be presented to aid in the design of future Comet assay studies on testicular cells. Power curves were provided with different fold changes in % tail DNA, different number of cells scored and different number of gels (Hansen et al., 2014. An example is shown in Figure 1. A high throughput version of the Comet assay was used. Samples were scored with a fully automatic comet assay scoring system that provided faster scoring of randomly selected cells.

  14. Immunoradiometric assay for cytomegalovirus-specific IgG antibodies; Assay development and evaluation in blood transfusion practice

    Energy Technology Data Exchange (ETDEWEB)

    Klapper, P.E.; Cleator, G.M.; Prinja-Wolks, D.; Morris, D.J. (Medical School, Manchester (United Kingdom). Department of Medical microbiology, Virology Unit); Morell, G. (Regional Blood Transfusion Centre, manchester (United Kingdom))

    1990-03-01

    An immunoradiometric assay (radio-immunosorbent test; RIST) for the detection of IgG antibodies to human herpesvirus 4 (human cytomegalovirus (CMV)) has been developed. The technique utilizes CMV antigen passively adsorbed to a polyvinyl microtitration plate and a radiolabelled murine monoclonal anti-human IgG antibody to detect binding of human antibody to the 'solid phase' reagent. The assay was optimized, and its specifity confirmed by testing paired acute and convalescent sera from patients with acute CMV or other human herpesvirus infections. To determine the assay's sensitivity 1433 blood donor sera were examined. The RIST was more sensitive than a standard complement fixation (CFT). Use of a monoclonal anti-human IgG antibody in the RIST reduced non-specific binding to the control uninfected cell antigen such that blood donor sera could be tested in the assay using only a CMV antigen without generating an unacceptable false positive rate. (author). 23 refs.; 1 tab.

  15. 233U Assay A Neutron NDA System

    Energy Technology Data Exchange (ETDEWEB)

    Hensley, D.C.; Lucero, A.J.; Pierce, L.

    1998-11-17

    The assay of highly enriched {sup 233}U material presents some unique challenges. Techniques which apply to the assay of materials of Pu or enriched {sup 235}U do not convert easily over to the assay of {sup 233}U. A specialized neutron assay device is being fabricated to exploit the singles neutron signal, the weak correlated neutron signal, and an active correlated signal. These pieces of information when combined with {gamma} ray isotopics information should give a good overall determination of {sup 233}U material now stored in bldg. 3019 at the Oak Ridge National Laboratory.

  16. Health and Occupational Outcomes Among Injured, Nonstandard Shift Workers.

    Science.gov (United States)

    Wong, Imelda S; Smith, Peter M; Mustard, Cameron A; Gignac, Monique A M

    2015-11-01

    This study compares health and occupational outcomes following a work-related injury for nonstandard and day-shift workers. National Population Health Survey data were used to explore outcomes 2 years post-work injury. Retrospective-matched cohort analyses examined main effects and interactions of shift schedule and work injury with changes in health, shift schedule, and labor force status. Models were adjusted for respondent characteristics, baseline health status, and occupational strength requirements. Injured nonstandard shift workers reported lower health utility index scores, compared with uninjured and injured daytime workers and uninjured nonstandard-shift workers. No significant interactions between shift and injury were found with schedule change and leaving the labor force. Injured nonstandard-shift workers are as likely to remain employed as other groups, but may be vulnerable in terms of diminished health.

  17. TIPS (trigger an IIF paradigm shift)

    Energy Technology Data Exchange (ETDEWEB)

    Kilcup, P.E. Glen [Intel Corporation, MS: F9-016, 4100 Sara Road, Rio Rancho, NM 87124 (United States)]. E-mail: glen.w.kilcup@intel.com; Hickox, Dick [Intel Corporation, MS: F9-016, 4100 Sara Road, Rio Rancho, NM 87124 (United States); Reynaga, Adolfo [Intel Corporation, MS: F9-016, 4100 Sara Road, Rio Rancho, NM 87124 (United States)

    2007-04-11

    Challenge: New Mexico Corporate Services (NMCS) recordable injuries have been averaging 2-4 per year for the last 5 years with no statistical improvement. However, we believe all NM employees must go home incident and injury free every day and just as healthy as they came to work. In addition, we have received feedback from several sources, that indicates some employees are reluctant to report injuries. These indicators showed us that continuing our current strategies, making incremental improvement and changes, would not give us the improvement desired. We needed a paradigm shift to get everyone completely engaged in the IIF (Incident and Injury Free) culture, in order to achieve true IIF results. Methods/Strategies: We formed a small (3-person) taskforce consisting of safety representatives from EHS, Site Services and CS Operations. We reviewed 5 years worth of data to determine what was injuring our people. We also decided to review all injuries, not simply those classified as recordable by OSHA standards. First we identified the types of injury information needed to get a true picture of our safety issues. We analyzed IRB (Incident Review Board) data showing us the following factors and whether any of them contributed to the injury: - Date - Incident Description - Severity - Root Cause - Type of Injury - Season - Work Group/Shift - Area - Improper evaluation of hazard - Inadequate work procedures - Incorrect Mental Model - Inadequate PPE Requirement - Failure to Follow or Unaware of PPE Requirement - Shortcut or Schedule Pressure - Last or First Day of Shift or Adjacent to Holiday - OT - Aggravate Existing Condition - Inadequate Training or Passdown - Experience in Task - Corrective Action Taken - Overall Quality of Response. Once this information was collected for all injuries in an Excel file, we graphed it several ways to help reveal trends: - Shift 7 had double the injuries of shift 5 - Night shift injuries were relatively high but lower than Shift 7 -Shift

  18. TIPS (trigger an IIF paradigm shift)

    International Nuclear Information System (INIS)

    Kilcup, P.E. Glen; Hickox, Dick; Reynaga, Adolfo

    2007-01-01

    Challenge: New Mexico Corporate Services (NMCS) recordable injuries have been averaging 2-4 per year for the last 5 years with no statistical improvement. However, we believe all NM employees must go home incident and injury free every day and just as healthy as they came to work. In addition, we have received feedback from several sources, that indicates some employees are reluctant to report injuries. These indicators showed us that continuing our current strategies, making incremental improvement and changes, would not give us the improvement desired. We needed a paradigm shift to get everyone completely engaged in the IIF (Incident and Injury Free) culture, in order to achieve true IIF results. Methods/Strategies: We formed a small (3-person) taskforce consisting of safety representatives from EHS, Site Services and CS Operations. We reviewed 5 years worth of data to determine what was injuring our people. We also decided to review all injuries, not simply those classified as recordable by OSHA standards. First we identified the types of injury information needed to get a true picture of our safety issues. We analyzed IRB (Incident Review Board) data showing us the following factors and whether any of them contributed to the injury: - Date - Incident Description - Severity - Root Cause - Type of Injury - Season - Work Group/Shift - Area - Improper evaluation of hazard - Inadequate work procedures - Incorrect Mental Model - Inadequate PPE Requirement - Failure to Follow or Unaware of PPE Requirement - Shortcut or Schedule Pressure - Last or First Day of Shift or Adjacent to Holiday - OT - Aggravate Existing Condition - Inadequate Training or Passdown - Experience in Task - Corrective Action Taken - Overall Quality of Response. Once this information was collected for all injuries in an Excel file, we graphed it several ways to help reveal trends: - Shift 7 had double the injuries of shift 5 - Night shift injuries were relatively high but lower than Shift 7 -Shift

  19. TIPS (trigger an IIF paradigm shift).

    Science.gov (United States)

    Kilcup P E, Glen; Hickox, Dick; Reynaga, Adolfo

    2007-04-11

    New Mexico Corporate Services (NMCS) recordable injuries have been averaging 2-4 per year for the last 5 years with no statistical improvement. However, we believe all NM employees must go home incident and injury free every day and just as healthy as they came to work. In addition, we have received feedback from several sources, that indicates some employees are reluctant to report injuries. These indicators showed us that continuing our current strategies, making incremental improvement and changes, would not give us the improvement desired. We needed a paradigm shift to get everyone completely engaged in the IIF (Incident & Injury Free) culture, in order to achieve true IIF results. We formed a small (3-person) taskforce consisting of safety representatives from EHS, Site Services and CS Operations. We reviewed 5 years worth of data to determine what was injuring our people. We also decided to review all injuries, not simply those classified as recordable by OSHA standards. First we identified the types of injury information needed to get a true picture of our safety issues. We analyzed IRB (Incident Review Board) data showing us the following factors and whether any of them contributed to the injury: - Date - Incident Description - Severity - Root Cause - Type of Injury - Season - Work Group/Shift - Area - Improper evaluation of hazard - Inadequate work procedures - Incorrect Mental Model - Inadequate PPE Requirement - Failure to Follow or Unaware of PPE Requirement - Shortcut or Schedule Pressure - Last or First Day of Shift or Adjacent to Holiday - OT - Aggravate Existing Condition - Inadequate Training or Passdown - Experience in Task - Corrective Action Taken - Overall Quality of Response. Once this information was collected for all injuries in an Excel file, we graphed it several ways to help reveal trends: Shift 7 had double the injuries of shift 5. Night shift injuries were relatively high but lower than Shift 7. Shift 5 had no severe (recordable

  20. Nanoparticle-assay marker interaction: effects on nanotoxicity assessment

    International Nuclear Information System (INIS)

    Zhao, Xinxin; Xiong, Sijing; Huang, Liwen Charlotte; Ng, Kee Woei; Loo, Say Chye Joachim

    2015-01-01

    Protein-based cytotoxicity assays such as lactate dehydrogenase (LDH) and tumor necrosis factor-alpha (TNF-α) are commonly used in cytotoxic evaluation of nanoparticles (NPs) despite numerous reports on possible interactions with protein markers in these assays that can confound the results obtained. In this study, conventional cytotoxicity assays where assay markers may (LDH and TNF- α) or may not (PicoGreen and WST-8) come into contact with NPs were used to evaluate the cytotoxicity of NPs. The findings revealed selective interactions between negatively charged protein assay markers (LDH and TNF- α) and positively charged ZnO NPs under abiotic conditions. The adsorption and interaction with these protein assay markers were strongly influenced by surface charge, concentration, and specific surface area of the NPs, thereby resulting in less than accurate cytotoxic measurements, as observed from actual cell viability measurements. An improved protocol for LDH assay was, therefore, proposed and validated by eliminating any effects associated with protein–particle interactions. In view of this, additional measures and precautions should be taken when evaluating cytotoxicity of NPs with standard protein-based assays, particularly when they are of opposite charges

  1. Nanoparticle-assay marker interaction: effects on nanotoxicity assessment

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Xinxin; Xiong, Sijing; Huang, Liwen Charlotte; Ng, Kee Woei, E-mail: kwng@ntu.edu.sg; Loo, Say Chye Joachim, E-mail: joachimloo@ntu.edu.sg [Nanyang Technological University, School of Materials Science and Engineering (Singapore)

    2015-01-15

    Protein-based cytotoxicity assays such as lactate dehydrogenase (LDH) and tumor necrosis factor-alpha (TNF-α) are commonly used in cytotoxic evaluation of nanoparticles (NPs) despite numerous reports on possible interactions with protein markers in these assays that can confound the results obtained. In this study, conventional cytotoxicity assays where assay markers may (LDH and TNF- α) or may not (PicoGreen and WST-8) come into contact with NPs were used to evaluate the cytotoxicity of NPs. The findings revealed selective interactions between negatively charged protein assay markers (LDH and TNF- α) and positively charged ZnO NPs under abiotic conditions. The adsorption and interaction with these protein assay markers were strongly influenced by surface charge, concentration, and specific surface area of the NPs, thereby resulting in less than accurate cytotoxic measurements, as observed from actual cell viability measurements. An improved protocol for LDH assay was, therefore, proposed and validated by eliminating any effects associated with protein–particle interactions. In view of this, additional measures and precautions should be taken when evaluating cytotoxicity of NPs with standard protein-based assays, particularly when they are of opposite charges.

  2. Nanoparticle-assay marker interaction: effects on nanotoxicity assessment

    Science.gov (United States)

    Zhao, Xinxin; Xiong, Sijing; Huang, Liwen Charlotte; Ng, Kee Woei; Loo, Say Chye Joachim

    2015-01-01

    Protein-based cytotoxicity assays such as lactate dehydrogenase (LDH) and tumor necrosis factor-alpha (TNF-α) are commonly used in cytotoxic evaluation of nanoparticles (NPs) despite numerous reports on possible interactions with protein markers in these assays that can confound the results obtained. In this study, conventional cytotoxicity assays where assay markers may (LDH and TNF- α) or may not (PicoGreen and WST-8) come into contact with NPs were used to evaluate the cytotoxicity of NPs. The findings revealed selective interactions between negatively charged protein assay markers (LDH and TNF- α) and positively charged ZnO NPs under abiotic conditions. The adsorption and interaction with these protein assay markers were strongly influenced by surface charge, concentration, and specific surface area of the NPs, thereby resulting in less than accurate cytotoxic measurements, as observed from actual cell viability measurements. An improved protocol for LDH assay was, therefore, proposed and validated by eliminating any effects associated with protein-particle interactions. In view of this, additional measures and precautions should be taken when evaluating cytotoxicity of NPs with standard protein-based assays, particularly when they are of opposite charges.

  3. Qualification of standard membrane-feeding assay with Plasmodium falciparum malaria and potential improvements for future assays.

    Directory of Open Access Journals (Sweden)

    Kazutoyo Miura

    Full Text Available Vaccines that interrupt malaria transmission are of increasing interest and a robust functional assay to measure this activity would promote their development by providing a biologically relevant means of evaluating potential vaccine candidates. Therefore, we aimed to qualify the standard membrane-feeding assay (SMFA. The assay measures the transmission-blocking activity of antibodies by feeding cultured P. falciparum gametocytes to Anopheles mosquitoes in the presence of the test antibodies and measuring subsequent mosquito infection. The International Conference on Harmonisation (ICH Harmonised Tripartite Guideline Q2(R1 details characteristics considered in assay validation. Of these characteristics, we decided to qualify the SMFA for Precision, Linearity, Range and Specificity. The transmission-blocking 4B7 monoclonal antibody was tested over 6 feeding experiments at several concentrations to determine four suitable concentrations that were tested in triplicate in the qualification experiments (3 additional feeds to evaluate Precision, Linearity and Range. For Specificity, 4B7 was tested in the presence of normal mouse IgG. We determined intra- and inter-assay variability of % inhibition of mean oocyst intensity at each concentration of 4B7 (lower concentrations showed higher variability. We also showed that % inhibition was dependent on 4B7 concentration and the activity is specific to 4B7. Since obtaining empirical data is time-consuming, we generated a model using data from all 9 feeds and simulated the effects of different parameters on final readouts to improve the assay procedure and analytical methods for future studies. For example, we estimated the effect of number of mosquitoes dissected on variability of % inhibition, and simulated the relationship between % inhibition in oocyst intensity and % inhibition of prevalence of infected mosquitos at different mean oocysts in the control. SMFA is one of the few biological assays used in

  4. Time Zones, Shift Working and International Outsourcing

    OpenAIRE

    Matsuoka, Yuji; Fukushima, Marcelo

    2009-01-01

    We build a trade model with two identical countries located in different time zones and a monopolistically competitive sector of which production requires differentiated goods produced in two successive stages. We introduce shift working disutility and allow consumers to choose between day and night shifts. Shift working disutility raises the cost of night production and firms can reduce costs by “virtually” outsourcing foreign labor. We found that firms only outsource if relat...

  5. Metal-amplified Density Assays, (MADAs), including a Density-Linked Immunosorbent Assay (DeLISA).

    Science.gov (United States)

    Subramaniam, Anand Bala; Gonidec, Mathieu; Shapiro, Nathan D; Kresse, Kayleigh M; Whitesides, George M

    2015-02-21

    This paper reports the development of Metal-amplified Density Assays, or MADAs - a method of conducting quantitative or multiplexed assays, including immunoassays, by using Magnetic Levitation (MagLev) to measure metal-amplified changes in the density of beads labeled with biomolecules. The binding of target analytes (i.e. proteins, antibodies, antigens) to complementary ligands immobilized on the surface of the beads, followed by a chemical amplification of the binding in a form that results in a change in the density of the beads (achieved by using gold nanoparticle-labeled biomolecules, and electroless deposition of gold or silver), translates analyte binding events into changes in density measureable using MagLev. A minimal model based on diffusion-limited growth of hemispherical nuclei on a surface reproduces the dynamics of the assay. A MADA - when performed with antigens and antibodies - is called a Density-Linked Immunosorbent Assay, or DeLISA. Two immunoassays provided a proof of principle: a competitive quantification of the concentration of neomycin in whole milk, and a multiplexed detection of antibodies against Hepatitis C virus NS3 protein and syphilis T. pallidum p47 protein in serum. MADAs, including DeLISAs, require, besides the requisite biomolecules and amplification reagents, minimal specialized equipment (two permanent magnets, a ruler or a capillary with calibrated length markings) and no electrical power to obtain a quantitative readout of analyte concentration. With further development, the method may be useful in resource-limited or point-of-care settings.

  6. Chromosome aberration assays in Allium

    Energy Technology Data Exchange (ETDEWEB)

    Grant, W.F.

    1982-01-01

    The common onion (Allium cepa) is an excellent plant for the assay of chromosome aberrations after chemical treatment. Other species of Allium (A. cepa var. proliferum, A. carinatum, A. fistulosum and A. sativum) have also been used but to a much lesser extent. Protocols have been given for using root tips from either bulbs or seeds of Allium cepa to study the cytological end-points, such as chromosome breaks and exchanges, which follow the testing of chemicals in somatic cells. It is considered that both mitotic and meiotic end-points should be used to a greater extent in assaying the cytogenetic effects of a chemical. From a literature survey, 148 chemicals are tabulated that have been assayed in 164 Allium tests for their clastogenic effect. Of the 164 assays which have been carried out, 75 are reported as giving a positive reaction, 49 positive and with a dose response, 1 positive and temperature-related, 9 borderline positive, and 30 negative; 76% of the chemicals gave a definite positive response. It is proposed that the Allium test be included among those tests routinely used for assessing chromosomal damage induced by chemicals.

  7. An indole alkaloid from a tribal folklore inhibits immediate early event in HSV-2 infected cells with therapeutic efficacy in vaginally infected mice.

    Directory of Open Access Journals (Sweden)

    Paromita Bag

    Full Text Available Herpes genitalis, caused by HSV-2, is an incurable genital ulcerative disease transmitted by sexual intercourse. The virus establishes life-long latency in sacral root ganglia and reported to have synergistic relationship with HIV-1 transmission. Till date no effective vaccine is available, while the existing therapy frequently yielded drug resistance, toxicity and treatment failure. Thus, there is a pressing need for non-nucleotide antiviral agent from traditional source. Based on ethnomedicinal use we have isolated a compound 7-methoxy-1-methyl-4,9-dihydro-3H-pyrido[3,4-b]indole (HM from the traditional herb Ophiorrhiza nicobarica Balkr, and evaluated its efficacy on isolates of HSV-2 in vitro and in vivo. The cytotoxicity (CC50, effective concentrations (EC50 and the mode of action of HM was determined by MTT, plaque reduction, time-of-addition, immunofluorescence (IFA, Western blot, qRT-PCR, EMSA, supershift and co-immunoprecipitation assays; while the in vivo toxicity and efficacy was evaluated in BALB/c mice. The results revealed that HM possesses significant anti-HSV-2 activity with EC50 of 1.1-2.8 µg/ml, and selectivity index of >20. The time kinetics and IFA demonstrated that HM dose dependently inhibited 50-99% of HSV-2 infection at 1.5-5.0 µg/ml at 2-4 h post-infection. Further, HM was unable to inhibit viral attachment or penetration and had no synergistic interaction with acyclovir. Moreover, Western blot and qRT-PCR assays demonstrated that HM suppressed viral IE gene expression, while the EMSA and co-immunoprecipitation studies showed that HM interfered with the recruitment of LSD-1 by HCF-1. The in vivo studies revealed that HM at its virucidal concentration was nontoxic and reduced virus yield in the brain of HSV-2 infected mice in a concentration dependent manner, compared to vaginal tissues. Thus, our results suggest that HM can serve as a prototype to develop non-nucleotide antiviral lead targeting the viral IE

  8. An indole alkaloid from a tribal folklore inhibits immediate early event in HSV-2 infected cells with therapeutic efficacy in vaginally infected mice.

    Science.gov (United States)

    Bag, Paromita; Ojha, Durbadal; Mukherjee, Hemanta; Halder, Umesh Chandra; Mondal, Supriya; Chandra, Nidhi S; Nandi, Suman; Sharon, Ashoke; Sarkar, Mamta Chawla; Chakrabarti, Sekhar; Chattopadhyay, Debprasad

    2013-01-01

    Herpes genitalis, caused by HSV-2, is an incurable genital ulcerative disease transmitted by sexual intercourse. The virus establishes life-long latency in sacral root ganglia and reported to have synergistic relationship with HIV-1 transmission. Till date no effective vaccine is available, while the existing therapy frequently yielded drug resistance, toxicity and treatment failure. Thus, there is a pressing need for non-nucleotide antiviral agent from traditional source. Based on ethnomedicinal use we have isolated a compound 7-methoxy-1-methyl-4,9-dihydro-3H-pyrido[3,4-b]indole (HM) from the traditional herb Ophiorrhiza nicobarica Balkr, and evaluated its efficacy on isolates of HSV-2 in vitro and in vivo. The cytotoxicity (CC50), effective concentrations (EC50) and the mode of action of HM was determined by MTT, plaque reduction, time-of-addition, immunofluorescence (IFA), Western blot, qRT-PCR, EMSA, supershift and co-immunoprecipitation assays; while the in vivo toxicity and efficacy was evaluated in BALB/c mice. The results revealed that HM possesses significant anti-HSV-2 activity with EC50 of 1.1-2.8 µg/ml, and selectivity index of >20. The time kinetics and IFA demonstrated that HM dose dependently inhibited 50-99% of HSV-2 infection at 1.5-5.0 µg/ml at 2-4 h post-infection. Further, HM was unable to inhibit viral attachment or penetration and had no synergistic interaction with acyclovir. Moreover, Western blot and qRT-PCR assays demonstrated that HM suppressed viral IE gene expression, while the EMSA and co-immunoprecipitation studies showed that HM interfered with the recruitment of LSD-1 by HCF-1. The in vivo studies revealed that HM at its virucidal concentration was nontoxic and reduced virus yield in the brain of HSV-2 infected mice in a concentration dependent manner, compared to vaginal tissues. Thus, our results suggest that HM can serve as a prototype to develop non-nucleotide antiviral lead targeting the viral IE transcription for the

  9. Forecasting interest rates with shifting endpoints

    DEFF Research Database (Denmark)

    Van Dijk, Dick; Koopman, Siem Jan; Wel, Michel van der

    2014-01-01

    We consider forecasting the term structure of interest rates with the assumption that factors driving the yield curve are stationary around a slowly time-varying mean or ‘shifting endpoint’. The shifting endpoints are captured using either (i) time series methods (exponential smoothing) or (ii......) long-range survey forecasts of either interest rates or inflation and output growth, or (iii) exponentially smoothed realizations of these macro variables. Allowing for shifting endpoints in yield curve factors provides substantial and significant gains in out-of-sample predictive accuracy, relative...... to stationary and random walk benchmarks. Forecast improvements are largest for long-maturity interest rates and for long-horizon forecasts....

  10. Beta-shifts, their languages and computability

    DEFF Research Database (Denmark)

    Simonsen, Jakob Grue

    2011-01-01

    they give into the dynamics of the underlying system. We prove that the language of the ß-shift is recursive iff ß is a computable real number. That fact yields a precise characterization of the reals: The real numbers ß for which we can compute arbitrarily good approximations—hence in particular......For every real number ß >1, the ß-shift is a dynamical system describing iterations of the map x ¿ ßx mod 1 and is studied intensively in number theory. Each ß-shift has an associated language of finite strings of characters; properties of this language are studied for the additional insight...

  11. Lamb Shift in Nonrelativistic Quantum Electrodynamics.

    Science.gov (United States)

    Grotch, Howard

    1981-01-01

    The bound electron self-energy or Lamb shift is calculated in nonrelativistic quantum electrodynamics. Retardation is retained and also an interaction previously dropped in other nonrelativistic approaches is kept. Results are finite without introducing a cutoff and lead to a Lamb shift in hydrogen of 1030.9 MHz. (Author/JN)

  12. Gear shift map design methodology for automotive transmissions

    NARCIS (Netherlands)

    Ngo, Viet Dac; Hofman, Theo; Steinbuch, Maarten; Serrarens, Alex

    In this paper, a design methodology is developed to condtruct the gear shift map for the automotive transmissions used in conventional and hybrid electric vehicles. The methodology utilizes an optimal gear shift strategy to derive the optimal gear shift patterns over a wide range of driving

  13. Uniqueness and zeros of q-shift difference polynomials

    Indian Academy of Sciences (India)

    In this paper, we consider the zero distributions of -shift difference polynomials of meromorphic functions with zero order, and obtain two theorems that extend the classical Hayman results on the zeros of differential polynomials to -shift difference polynomials. We also investigate the uniqueness problem of -shift ...

  14. Principles of validation of diagnostic assays for infectious diseases

    International Nuclear Information System (INIS)

    Jacobson, R.H.

    1998-01-01

    Assay validation requires a series of inter-related processes. Assay validation is an experimental process: reagents and protocols are optimized by experimentation to detect the analyte with accuracy and precision. Assay validation is a relative process: its diagnostic sensitivity and diagnostic specificity are calculated relative to test results obtained from reference animal populations of known infection/exposure status. Assay validation is a conditional process: classification of animals in the target population as infected or uninfected is conditional upon how well the reference animal population used to validate the assay represents the target population; accurate predictions of the infection status of animals from test results (PV+ and PV-) are conditional upon the estimated prevalence of disease/infection in the target population. Assay validation is an incremental process: confidence in the validity of an assay increases over time when use confirms that it is robust as demonstrated by accurate and precise results; the assay may also achieve increasing levels of validity as it is upgraded and extended by adding reference populations of known infection status. Assay validation is a continuous process: the assay remains valid only insofar as it continues to provide accurate and precise results as proven through statistical verification. Therefore, the work required for validation of diagnostic assays for infectious diseases does not end with a time-limited series of experiments based on a few reference samples rather, to assure valid test results from an assay requires constant vigilance and maintenance of the assay, along with reassessment of its performance characteristics for each unique population of animals to which it is applied. (author)

  15. Written Language Shift among Norwegian Youth

    Directory of Open Access Journals (Sweden)

    Kamil ÖZERK

    2013-07-01

    Full Text Available In Norway there are two written Norwegian languages, Bokmål and Nynorsk. Of these two written languages Bokmål is being used by the majority of the people, and Bokmål has the highest prestige in the society. This article is about the shift of written language from Nynorsk to Bokmål among young people in a traditional Nynorsk district in the country. Drawing on empirical data we conclude that many adolescents are experiencing written language shift. We discuss various reasons for this phenomenon in the linguistic landscape of Norway. In our discussions we emphasize the importance of the school with regard to language maintenance and language revitalization. We call for a new language policy in the educational system that can prevent language shift. Having several dialects and two officially written forms of Norwegian in the country, creates a special linguistic landscape in Norway. Despite the fact that the Norwegian language situation is in several ways unique, it’s done very little research on how the existing policy works in practice. Our research reveals that the existing language policy and practice in the school system is not powerful enough to prevent language shift and language decay among the youngsters. The school system functions like a fabric for language shift.

  16. Factor IX assay

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/003679.htm Factor IX assay To use the sharing features on ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  17. Factor VIII assay

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/003678.htm Factor VIII assay To use the sharing features on ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  18. Factor II assay

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/003674.htm Factor II assay To use the sharing features on ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  19. Factor VII assay

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/003676.htm Factor VII assay To use the sharing features on ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  20. Task Shifting in Dermatology: A Call to Action.

    Science.gov (United States)

    Brown, Danielle N; Langan, Sinéad M; Freeman, Esther E

    2017-11-01

    Can task shifting be used to improve the delivery of dermatologic care in resource-poor settings worldwide? Task shifting is a means of redistributing available resources, whereby highly trained individuals train an available workforce to provide necessary care in low-resource settings. Limited evidence exists for task shifting in dermatology; however, studies from psychiatry demonstrate its efficacy. In the field of dermatology there is a need for high-quality evidence including randomized clinical trials to validate the implementation of task shifting in low-resource settings globally.

  1. Relationship between thyroid stimulating hormone and night shift work.

    Science.gov (United States)

    Moon, So-Hyun; Lee, Bum-Joon; Kim, Seong-Jin; Kim, Hwan-Cheol

    2016-01-01

    Night shift work has well-known adverse effects on health. However, few studies have investigated the relationship between thyroid diseases and night shift work. This study aimed to examine night shift workers and their changes in thyroid stimulating hormones (TSH) levels over time. Medical check-up data (2011-2015) were obtained from 967 female workers at a university hospital in Incheon, Korea. Data regarding TSH levels were extracted from the records, and 2015 was used as a reference point to determine night shift work status. The relationships between TSH levels and night shift work in each year were analyzed using the general linear model (GLM). The generalized estimating equation (GEE) was used to evaluate the repeated measurements over the 5-year period. The GEE analysis revealed that from 2011 to 2015, night shift workers had TSH levels that were 0.303 mIU/L higher than the levels of non-night shift workers (95 % CI: 0.087-0.519 mIU/L, p  = 0.006) after adjusting for age and department. When we used TSH levels of 4.5 ≥ mIU/L to identify subclinical hypothyroidism, night shift workers exhibited a 1.399 fold higher risk of subclinical hypothyroidism (95 % CI: 1.050-1.863, p  = 0.022), compared to their non-night shift counterparts. This result of this study suggests that night shift workers may have an increased risk of thyroid diseases, compared to non-night shift workers.

  2. Impacts of shift work on sleep and circadian rhythms.

    Science.gov (United States)

    Boivin, D B; Boudreau, P

    2014-10-01

    Shift work comprises work schedules that extend beyond the typical "nine-to-five" workday, wherein schedules often comprise early work start, compressed work weeks with 12-hour shifts, and night work. According to recent American and European surveys, between 15 and 30% of adult workers are engaged in some type of shift work, with 19% of the European population reportedly working at least 2 hours between 22:00 and 05:00. The 2005 International Classification of Sleep Disorders estimates that a shift work sleep disorder can be found in 2-5% of workers. This disorder is characterized by excessive sleepiness and/or sleep disruption for at least one month in relation with the atypical work schedule. Individual tolerance to shift work remains a complex problem that is affected by the number of consecutive work hours and shifts, the rest periods, and the predictability of work schedules. Sleepiness usually occurs during night shifts and is maximal at the end of the night. Impaired vigilance and performance occur around times of increased sleepiness and can seriously compromise workers' health and safety. Indeed, workers suffering from a shift work sleep-wake disorder can fall asleep involuntarily at work or while driving back home after a night shift. Working on atypical shifts has important socioeconomic impacts as it leads to an increased risk of accidents, workers' impairment and danger to public safety, especially at night. The aim of the present review is to review the circadian and sleep-wake disturbances associated with shift work as well as their medical impacts. Copyright © 2014. Published by Elsevier SAS.

  3. On the energy shift the ECC cusp. Does the shift really exist?

    International Nuclear Information System (INIS)

    Sarkadi, L.; Barrachina, R.O.

    2004-01-01

    The cusplike 'electron capture to the continuum' (ECC) peak appearing in the spectrum of the forward emitted electrons in ion-atom collisions are generally thought to be a divergence. Recently Shah et al., however, claimed that 'the ECC cusp is indeed a cusp, and not a divergence smoothed by the experiment'. These authors measured the ECC cusp for collisions of 10- and 20-keV protons with H 2 and He, and found that the peak was shifted to lower velocity than its expected position. We also carried out CTMC calculations (for the case of 20-keV protons on He) by which we demonstrated that the shift really exists but its value depends on the angular window of the electron detection. (K.A.)

  4. Stochastic dynamical models for ecological regime shifts

    DEFF Research Database (Denmark)

    Møller, Jan Kloppenborg; Carstensen, Jacob; Madsen, Henrik

    the physical and biological knowledge of the system, and nonlinearities introduced here can generate regime shifts or enhance the probability of regime shifts in the case of stochastic models, typically characterized by a threshold value for the known driver. A simple model for light competition between...... definition and stability of regimes become less subtle. Ecological regime shifts and their modeling must be viewed in a probabilistic manner, particularly if such model results are to be used in ecosystem management....

  5. Comparison of second-order impact line shifts

    International Nuclear Information System (INIS)

    Griem, H.R.; Iglesias, C.A.; Boercker, D.B.

    1991-01-01

    The second-order impact shifts in hydrogen obtained from the Baranger formalism are compared with those from a kinetic theory approach. The resulting Δn=0 contributions to the shift from the two theories are shown to be identical, except for the neglect of electron-electron correlations in the Baranger formalism. It is also shown that some care is required in taking the classical limit for the perturbing electrons, or else the shift from Δn=0 interactions vanishes

  6. Shift versus no-shift in local regularization of Chern-Simons theory

    International Nuclear Information System (INIS)

    Giavarini, G.; Parma Univ.; Martin, C.P.; Ruiz Ruiz, F.

    1994-01-01

    We consider a family of local BRS-invariant higher covariant derivative regularizations of SU(N) Chern-Simons theory that do not shift the value of the Chern-Simons parameter k to k + sign(k) c v at one loop. (orig.)

  7. Habituation as an adaptive shift in response strategy mediated by neuropeptides

    Science.gov (United States)

    Ardiel, Evan L.; Yu, Alex J.; Giles, Andrew C.; Rankin, Catharine H.

    2017-08-01

    Habituation is a non-associative form of learning characterized by a decremented response to repeated stimulation. It is typically framed as a process of selective attention, allowing animals to ignore irrelevant stimuli in order to free up limited cognitive resources. However, habituation can also occur to threatening and toxic stimuli, suggesting that habituation may serve other functions. Here we took advantage of a high-throughput Caenorhabditis elegans learning assay to investigate habituation to noxious stimuli. Using real-time computer vision software for automated behavioral tracking and optogenetics for controlled activation of a polymodal nociceptor, ASH, we found that neuropeptides mediated habituation and performed an RNAi screen to identify candidate receptors. Through subsequent mutant analysis and cell-type-specific gene expression, we found that pigment-dispersing factor (PDF) neuropeptides function redundantly to promote habituation via PDFR-1-mediated cAMP signaling in both neurons and muscles. Behavioral analysis during learning acquisition suggests that response habituation and sensitization of locomotion are parts of a shifting behavioral strategy orchestrated by pigment dispersing factor signaling to promote dispersal away from repeated aversive stimuli.

  8. Multiplexing a high-throughput liability assay to leverage efficiencies.

    Science.gov (United States)

    Herbst, John; Anthony, Monique; Stewart, Jeremy; Connors, David; Chen, Taosheng; Banks, Martyn; Petrillo, Edward W; Agler, Michele

    2009-06-01

    In order to identify potential cytochrome P-450 3A4 (drug-metabolizing enzyme) inducers at an early stage of the drug discovery process, a cell-based transactivation high-throughput luciferase reporter assay for the human pregnane X receptor (PXR) in HepG2 cells has been implemented and multiplexed with a viability end point for data interpretation, as part of a Lead Profiling portfolio of assays. As a routine part of Lead Profiling operations, assays are periodically evaluated for utility as well as for potential improvements in technology or process. We used a recent evaluation of our PXR-transactivation assay as a model for the application of Lean Thinking-based process analysis to lab-bench assay optimization and automation. This resulted in the development of a 384-well multiplexed homogeneous assay simultaneously detecting PXR transactivation and HepG2 cell cytotoxicity. In order to multiplex fluorescent and luminescent read-outs, modifications to each assay were necessary, which included optimization of multiple assay parameters such as cell density, plate type, and reagent concentrations. Subsequently, a set of compounds including known cytotoxic compounds and PXR inducers were used to validate the multiplexed assay. Results from the multiplexed assay correlate well with those from the singleplexed assay formats measuring PXR transactivation and viability separately. Implementation of the multiplexed assay for routine compound profiling provides improved data quality, sample conservation, cost savings, and resource efficiencies.

  9. Evaluation of Presto(plus) assay and LightMix kit Trichomonas vaginalis assay for detection of Trichomonas vaginalis in dry vaginal swabs.

    Science.gov (United States)

    de Waaij, Dewi J; Ouburg, Sander; Dubbink, Jan Henk; Peters, Remco P H; Morré, Servaas A

    2016-08-01

    This is an evaluation study of the Presto(plus) Assay for T. vaginalis by comparing to the TIB MOLBIOL LightMix Kit Trichomonas vaginalis Assay using 615 dry collected vaginal and rectal swabs. Discordant samples were analyzed by the Qiagen® Microbial DNA qPCR for TV Assay. Both assays showed comparable performances (McNemar p>0.05). Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Nondestructive assay methods for irradiated nuclear fuels

    International Nuclear Information System (INIS)

    Hsue, S.T.; Crane, T.W.; Talbert, W.L. Jr.; Lee, J.C.

    1978-01-01

    This report is a review of the status of nondestructive assay (NDA) methods used to determine burnup and fissile content of irradiated nuclear fuels. The gamma-spectroscopy method measures gamma activities of certain fission products that are proportional to the burnup. Problems associated with this method are migration of the fission products and gamma-ray attenuation through the relatively dense fuel material. The attenuation correction is complicated by generally unknown activity distributions within the assemblies. The neutron methods, which usually involve active interrogation and prompt or delayed signal counting, are designed to assay the fissile content of the spent-fuel elements. Systems to assay highly enriched spent-fuel assemblies have been tested extensively. Feasibility studies have been reported of systems to assay light-water reactor spent-fuel assemblies. The slowing-down spectrometer and neutron resonance absorption methods can distinguish between the uranium and plutonium fissile contents, but they are limited to the assay of individual rods. We have summarized the status of NDA techniques for spent-fuel assay and present some subjects in need of further investigation. Accuracy of the burnup calculations for power reactors is also reviewed

  11. [Shift and night work and mental health].

    Science.gov (United States)

    Sancini, Angela; Ciarrocca, Manuela; Capozzella, Assunta; Corbosiero, Paola; Fiaschetti, Maria; Caciari, Tiziana; Cetica, Carlotta; Scimitto, Lara; Ponticiello, Barnaba Giuseppina; Tasciotti, Zaira; Schifano, Maria Pia; Andreozzit, Giorgia; Tomei, Francesco; Tomei, Gianfranco

    2012-01-01

    Aim of our study was to evaluate the influence that shift work and night work could have on mental health. A review of literary articles from 1990 to 2011 on shift work and night work was carried out. The results of this review confirmed that the shift work and night work affect mental health with the onset of neuropsychological disorders such as mood disorders, anxiety, nervousness, depressive anxiety syndromes, chronic fatigue and chronic insomnia irritability, sleep disturbances, reduction in levels of attention, cognitive impairments, alteration of circadian rhythm. Night work and shift work cause severe desynchronization of the cronobiological rhythms and a disruption of social life with negative effects on performance at work, on health and on social relationships. In the light of these results and recognizing shift work and night work as risk factors for the health of workers is necessary to implement preventive and periodic health checks by the occupational doctor to ensure the health and safety of workers taking account of the different environmental and individual factors.

  12. Dietary habits among persons hired on shift work.

    Science.gov (United States)

    Strzemecka, Joanna; Bojar, Iwona; Strzemecka, Ewa; Owoc, Alfred

    2014-01-01

    Shift-work determinates irregular nutrition habits. The quality as well as the quantity of meals consumed by shift-workers can significantly affects their health. The aim of this study was to evaluate the dietary habits of people performing shift work in the Bogdanka mine. The study was carried out in the Bogdanka mine in Leczna. The questionnaire, which was designed by the author of this dissertation, was conducted among 700 shift-workers, working underground. The results were subjected to statistical analysis based on STATISTICA v. 7.1 (StatSoft, Poland) software. Nearly half of respondents reported regular consumption of meals (40.0%) Interviewees admitted having warm meals during the day (81.4%). The most frequently consumed meal during the day was the hot one (50.9%), three meals and more were consumed the least frequently (8.1%). Almost half of respondents considered their eating habits as inappropriate (46.3%). Among those, nearly half (68.2%) stated that shift - work is the reason for their nutrition habits. More than half of respondents (66.0%) admitted that shift work hampers regular consumption of meals. Shift work makes nourishment and regular consumption difficult. It contributes to the limited amount of warm meals eaten during the day. In order to maintain preventive health care and the improvement of quality of life, shift workers should be provided with an easier access to meals (including warm one) at specified times of the day.

  13. The microculture-kinetic (MiCK) assay: the role of a drug-induced apoptosis assay in drug development and clinical care.

    Science.gov (United States)

    Bosserman, Linda; Prendergast, Franklyn; Herbst, Roy; Fleisher, Martin; Salom, Emery; Strickland, Steven; Raptis, Anastasios; Hallquist, Allan; Perree, Mathieu; Rajurkar, Swapnil; Karimi, Misagh; Rogers, Karl; Davidson, Dirk; Willis, Carl; Penalver, Manuel; Homesley, Howard; Burrell, Matthew; Garrett, Audrey; Rutledge, James; Chernick, Michael; Presant, Cary A

    2012-08-15

    A drug-induced apoptosis assay, termed the microculture-kinetic (MiCK) assay, has been developed. Blinded clinical trials have shown higher response rates and longer survival in groups of patients with acute myelocytic leukemia and epithelial ovarian cancer who have been treated with drugs that show high apoptosis in the MiCK assay. Unblinded clinical trials in multiple tumor types have shown that the assay will be used frequently by clinicians to determine treatment, and when used, results in higher response rates, longer times to relapse, and longer survivals. Model economic analyses suggest possible cost savings in clinical use based on increased generic drug use and single-agent substitution for combination therapies. Two initial studies with drugs in development are promising. The assay may help reduce costs and speed time to drug approval. Correlative studies with molecular biomarkers are planned. This assay may have a role both in personalized clinical therapy and in more efficient drug development. ©2012 AACR.

  14. Metabolic syndrome in fixed-shift workers.

    Science.gov (United States)

    Canuto, Raquel; Pattussi, Marcos Pascoal; Macagnan, Jamile Block Araldi; Henn, Ruth Liane; Olinto, Maria Teresa Anselmo

    2015-01-01

    OBJECTIVE To analyze if metabolic syndrome and its altered components are associated with demographic, socioeconomic and behavioral factors in fixed-shift workers. METHODS A cross-sectional study was conducted on a sample of 902 shift workers of both sexes in a poultry processing plant in Southern Brazil in 2010. The diagnosis of metabolic syndrome was determined according to the recommendations from Harmonizing the Metabolic Syndrome. Its frequency was evaluated according to the demographic (sex, skin color, age and marital status), socioeconomic (educational level, income and work shift), and behavioral characteristics (smoking, alcohol intake, leisure time physical activity, number of meals and sleep duration) of the sample. The multivariate analysis followed a theoretical framework for identifying metabolic syndrome in fixed-shift workers. RESULTS The prevalence of metabolic syndrome in the sample was 9.3% (95%CI 7.4;11.2). The most frequently altered component was waist circumference (PR 48.4%; 95%CI 45.5;51.2), followed by high-density lipoprotein. Work shift was not associated with metabolic syndrome and its altered components. After adjustment, the prevalence of metabolic syndrome was positively associated with women (PR 2.16; 95%CI 1.28;3.64), workers aged over 40 years (PR 3.90; 95%CI 1.78;8.93) and those who reported sleeping five hours or less per day (PR 1.70; 95%CI 1.09;2.24). On the other hand, metabolic syndrome was inversely associated with educational level and having more than three meals per day (PR 0.43; 95%CI 0.26;0.73). CONCLUSIONS Being female, older and deprived of sleep are probable risk factors for metabolic syndrome, whereas higher educational level and higher number of meals per day are protective factors for metabolic syndrome in fixed-shift workers.

  15. Shift work in a security environment

    International Nuclear Information System (INIS)

    Longhouser, G.A. Jr.

    1993-01-01

    Human beings are diurnal species, normally active by day and asleep by night. Yet over thirty million Americans struggle with work schedules that include an off-normal work effort. The railroads, law enforcement, health services, Department of Defense, factory workers, chemical plants and public services, communications and utility workers must provide some form of around-the-clock effort. Shift work has been around since the advent of recorded history. There has always been a need for some type of off-normal service and assistance. The impact of shift work is replete with tales and factual evidence of an increased personnel error rate; disorders, both personal and family, and of course, increased accident events. In recent memory, the Three Mile Island Nuclear Plant incident, Union Carbide's explosion in Bhopal, and the Chernobyl Nuclear Plant catastrophe all occurred during off-normal working hours. Yet management overall has done little to correct the production-driven twelve hour, seven day week shift mentality of the nineteenth century. Most schedules in use today are nothing more than cosmetic variations of the old production schedules. This could be driven by a management consideration of the worker's response to change coupled with a reluctant buy-in of responsibility for the effects of change. Florida Power Corporation has developed for its nuclear security force, a unique work schedule which attempts to employ the sound principles of circadian rhythms coupled with a comprehensive training program to counter the problems associated with shift work. The results over the last four years have seen a marked reduction in the generic problems of personnel errors, absenteeism, unscheduled overtime and turnover rates. Utilization and understanding of this scheduling process for rotational shift work needs to be assessed to determine if the benefits are site specific or provide an expected response to the problems of shift work

  16. Metabolic syndrome in fixed-shift workers

    Directory of Open Access Journals (Sweden)

    Raquel Canuto

    2015-01-01

    Full Text Available OBJECTIVE To analyze if metabolic syndrome and its altered components are associated with demographic, socioeconomic and behavioral factors in fixed-shift workers. METHODS A cross-sectional study was conducted on a sample of 902 shift workers of both sexes in a poultry processing plant in Southern Brazil in 2010. The diagnosis of metabolic syndrome was determined according to the recommendations from Harmonizing the Metabolic Syndrome. Its frequency was evaluated according to the demographic (sex, skin color, age and marital status, socioeconomic (educational level, income and work shift, and behavioral characteristics (smoking, alcohol intake, leisure time physical activity, number of meals and sleep duration of the sample. The multivariate analysis followed a theoretical framework for identifying metabolic syndrome in fixed-shift workers. RESULTS The prevalence of metabolic syndrome in the sample was 9.3% (95%CI 7.4;11.2. The most frequently altered component was waist circumference (PR 48.4%; 95%CI 45.5;51.2, followed by high-density lipoprotein. Work shift was not associated with metabolic syndrome and its altered components. After adjustment, the prevalence of metabolic syndrome was positively associated with women (PR 2.16; 95%CI 1.28;3.64, workers aged over 40 years (PR 3.90; 95%CI 1.78;8.93 and those who reported sleeping five hours or less per day (PR 1.70; 95%CI 1.09;2.24. On the other hand, metabolic syndrome was inversely associated with educational level and having more than three meals per day (PR 0.43; 95%CI 0.26;0.73. CONCLUSIONS Being female, older and deprived of sleep are probable risk factors for metabolic syndrome, whereas higher educational level and higher number of meals per day are protective factors for metabolic syndrome in fixed-shift workers.

  17. Measuring proton shift tensors with ultrafast MAS NMR.

    Science.gov (United States)

    Miah, Habeeba K; Bennett, David A; Iuga, Dinu; Titman, Jeremy J

    2013-10-01

    A new proton anisotropic-isotropic shift correlation experiment is described which operates with ultrafast MAS, resulting in good resolution of isotropic proton shifts in the detection dimension. The new experiment makes use of a recoupling sequence designed using symmetry principles which reintroduces the proton chemical shift anisotropy in the indirect dimension. The experiment has been used to measure the proton shift tensor parameters for the OH hydrogen-bonded protons in tyrosine·HCl and citric acid at Larmor frequencies of up to 850 MHz. Copyright © 2013 Elsevier Inc. All rights reserved.

  18. Josephson shift register design and layout

    International Nuclear Information System (INIS)

    Przybysz, J.X.; Buttyan, J.; Blaugher, R.D.

    1989-01-01

    Integrated circuit chips were designed and fabricated, based on Josephson shift register circuit that simulated operation at 25 GHz using the SPICE program. The 6.25 mm square chip featured a twelve-gate, four-stage shift register fabricated with Nb/AlO/sub x//Nb Josephson junctions with a design value of 2000 A/cm/sup 2/ critical current density. SUPERCOMPACT, a general program for the design of monolithic microwave integrated circuits, was used to model the effects of layout geometry on the uniformity and phase coherence of logic gate bias currents. Gate bias resistors were treated as resistive transmission lines. A layout geometry for the superconductive transmission lines and thin film bias resistors was developed. The original SPICE-designed circuit was modified as a result of these calculations. Modeling indicated that bias current variations could be limited to 3% for all possible logic states of the shift register, and phase coherence of the gates could be maintained to within 2 degrees of 10 Ghz. The fundamental soundness of the circuit design was demonstrated by the proper operation of fabricated shift registers

  19. Radioligand assay in reproductive biology

    International Nuclear Information System (INIS)

    Korenman, S.G.; Sherman, B.M.

    1975-01-01

    Radioligand assays have been developed for the principal reproductive steroids and peptide hormones. Specific binding reagents have included antibodies, plasma binders, and intracellular receptors. In each assay, problems of specificity, sensitivity, and nonspecific inhibitors were encountered. Many features of the endocrine physiology in childhood, during puberty, and in adulthood have been characterized. Hormonal evaluations of endocrine disorders of reproduction are characterized on the basis of their characteristic pathophysiologic alterations. (U.S.)

  20. Scandinavian Object Shift and Optimality Theory

    DEFF Research Database (Denmark)

    Engels, Eva; Vikner, Sten

    This study presents an account of object shift, a word order phenomenon found in most of the Scandinavian languages where an object occurs unexpectedly to the left and not to the right of a sentential adverbial. The book examines object shift across many of the Scandinavian languages and dialects...... and original observations, this book is an important addition to the fields of phonology, optimality theory and theoretical syntax......., and analyses the variation, for example whether object shift is optional or obligatory, whether it applies only to pronouns or other objects as well, and whether it applies to adverbials. The authors show that optimality theory, traditionally used in phonology, is a useful framework for accounting...

  1. Special offer for early shift takers!

    CERN Multimedia

    Muriel

    Peter Jenni, spokesperson of the ATLAS collaboration, just made the following announcement. "Despite the few problems that we are encountering, which of course are unavoidable in such a large project, I am very pleased with the way the ATLAS experiment is taking shape. With the imminence of data taking, I would like to make a special gesture as a thank you to all of you who are working so hard for ATLAS to meet its many deadlines. The first 100 ATLAS members who will sign up for shifts will receive twice the standard OTSMOU credit." You can sign up for shifts as of April 1st by sending an e-mail to Atlas.Shifts@cern.ch.

  2. Profit shifting in the Norwegian and British petroleum industry: Differentiating between the real and shifting response to tax changes

    OpenAIRE

    Vada, Helene

    2016-01-01

    In this master’s thesis, I explain the concept of profit shifting within multinational enterprises and investigate whether petroleum companies on the Norwegian and British continental shelves engage in tax motivated profit shifting, by applying ordinary least squares and company fixed effects estimation. To be able to distinguish between traditional tax distortions and profit shifting, I extend the model developed by James R. Hines and Eric M. Rice in their 1994 article “Fiscal Paradise: Fore...

  3. Thermometric enzyme linked immunosorbent assay: TELISA.

    Science.gov (United States)

    Mattiasson, B; Borrebaeck, C; Sanfridson, B; Mosbach, K

    1977-08-11

    A new method, thermometric enzyme linked immunosorbent assay (TELISA), for the assay of endogenous and exogenous compounds in biological fluids is described. It is based on the previously described enzyme linked immunosorbent assay technique, ELISA, but utilizes enzymic heat formation which is measured in an enzyme thermistor unit. In the model system studied determination of human serum albumin down to a concentration of 10(-10) M (5 ng/ml) was achieved, with both normal and catalase labelled human serum albumin competing for the binding sites on the immunosorbent, which was rabbit antihuman serum albumin immobilized onto Sepharose CL-4B.

  4. Cost effective shift schedules enhance utility operations

    International Nuclear Information System (INIS)

    Coleman, R.M.

    1995-01-01

    This article describes how new shift scheduling concepts can save utility operations millions of dollars every year and yet maintain safety and improve employee morale. The key to scheduling is to define and match the work load. This includes discretionary as well as daily, weekly, and yearly core work loads. In most power plants the overall work load (including maintenance, operations, materials handling, etc.) on day shift is greater than on other shifts, hence an unbalanced schedule would be appropriate

  5. Use of enzyme-linked immunosorbent assay and dipstick assay for detection of Strongyloides stercoralis infection in humans

    NARCIS (Netherlands)

    van Doorn, H. Rogier; Koelewijn, Rob; Hofwegen, Henk; Gilis, Henk; Wetsteyn, Jose C. F. M.; Wismans, Pieter J.; Sarfati, Claudine; Vervoort, Tony; van Gool, Tom

    2007-01-01

    A homemade enzyme-linked immunosorbent assay (ELISA) (Academic Medical Center ELISA [AMC-ELISA]) and a dipstick assay for the detection of anti-Strongyloides stercoralis antibodies in serum were developed and evaluated together with two commercially available ELISAs (IVD-ELISA [IVD Research, Inc.

  6. Lateral shift in one-dimensional quasiperiodic chiral photonic crystal

    Energy Technology Data Exchange (ETDEWEB)

    Da, Jian, E-mail: dajian521@sina.com [Department of Information Engineering, Huaian Senior Vocational and Technical School, Feiyao road, Huaian 223005, Jiangsu Province (China); Mo, Qi, E-mail: moqiyueyang@163.com [School of Software, Yunnan University, Cuihu Bai Road, Kunming City, Yunnan Province 650091 (China); Cheng, Yaokun [Department of Information Engineering, Huaian Senior Vocational and Technical School, Feiyao road, Huaian 223005, Jiangsu Province (China); Liu, Taixiang [Taishan Vocational College of Nursing, Shandong Province 271000 (China)

    2015-02-01

    We investigate the lateral shift of a one-dimensional quasiperiodic photonic crystal consisting of chiral and conventional dielectric materials. The effect of structural irregularity on lateral shift is evaluated by stationary-phase approach. Our results show that the lateral shift can be modulated by varying the structural irregularity in quasiperiodic structure. Besides, the position of peak in lateral shift spectrum stays sensitive to the chiral factor of chiral materials. In comparison with that of periodic structure, quasiperiodic structure provides an extra degree of freedom to manipulate the lateral shift.

  7. Dynamic Characteristics Analysis of Power Shift Control Valve

    Directory of Open Access Journals (Sweden)

    Feng Ren

    2014-07-01

    Full Text Available In order to study the influence that dynamic performance of shift control valve has on shifting process of construction machinery, the paper introduces working principle of the shift control valve and sets up the dynamically mathematical model and corresponding simulation model with simulation software LMS Imagine. Lab AMESim. Based on simulation, the paper analyzes the influence of pressure variation characteristics and buffering characteristics acting on vehicle performance during the process of shifting, meanwhile conducting experiments to verify the simulation. The results indicate that the simulation model is accurate and credible; the performance of the valve is satisfactory, which indeed reduces impact during shifting. Furthermore, the valve can meet the demand of other construction machineries in better degree by suitable matching between control spring stiffness and damping holes diameter.

  8. Shift manager workload assessment - A case study

    International Nuclear Information System (INIS)

    Berntson, K.; Kozak, A.; Malcolm, J. S.

    2006-01-01

    In early 2003, Bruce Power restarted two of its previously laid up units in the Bruce A generating station, Units 3 and 4. However, due to challenges relating to the availability of personnel with active Shift Manager licenses, an alternate shift structure was proposed to ensure the safe operation of the station. This alternate structure resulted in a redistribution of responsibility, and a need to assess the resulting changes in workload. Atomic Energy of Canada Limited was contracted to perform a workload assessment based on the new shift structure, and to provide recommendations, if necessary, to ensure Shift Managers had sufficient resources available to perform their required duties. This paper discusses the performance of that assessment, and lessons learned as a result of the work performed during the Restart project. (authors)

  9. Lambda shifted photonic crystal cavity laser

    DEFF Research Database (Denmark)

    Schubert, Martin; Skovgård, Troels Suhr; Ek, Sara

    2010-01-01

    We propose and demonstrate an alternative type of photonic crystal laser design that shifts all the holes in the lattice by a fixed fraction of the targeted emission wavelength. The structures are realized in InGaAsP =1.15 with InGaAsP quantum wells =1.52 as gain material. Cavities with shifts of...

  10. Parallel force assay for protein-protein interactions.

    Science.gov (United States)

    Aschenbrenner, Daniela; Pippig, Diana A; Klamecka, Kamila; Limmer, Katja; Leonhardt, Heinrich; Gaub, Hermann E

    2014-01-01

    Quantitative proteome research is greatly promoted by high-resolution parallel format assays. A characterization of protein complexes based on binding forces offers an unparalleled dynamic range and allows for the effective discrimination of non-specific interactions. Here we present a DNA-based Molecular Force Assay to quantify protein-protein interactions, namely the bond between different variants of GFP and GFP-binding nanobodies. We present different strategies to adjust the maximum sensitivity window of the assay by influencing the binding strength of the DNA reference duplexes. The binding of the nanobody Enhancer to the different GFP constructs is compared at high sensitivity of the assay. Whereas the binding strength to wild type and enhanced GFP are equal within experimental error, stronger binding to superfolder GFP is observed. This difference in binding strength is attributed to alterations in the amino acids that form contacts according to the crystal structure of the initial wild type GFP-Enhancer complex. Moreover, we outline the potential for large-scale parallelization of the assay.

  11. Night shift decreases cognitive performance of ICU physicians.

    Science.gov (United States)

    Maltese, François; Adda, Mélanie; Bablon, Amandine; Hraeich, Sami; Guervilly, Christophe; Lehingue, Samuel; Wiramus, Sandrine; Leone, Marc; Martin, Claude; Vialet, Renaud; Thirion, Xavier; Roch, Antoine; Forel, Jean-Marie; Papazian, Laurent

    2016-03-01

    The relationship between tiredness and the risk of medical errors is now commonly accepted. The main objective of this study was to assess the impact of an intensive care unit (ICU) night shift on the cognitive performance of a group of intensivists. The influence of professional experience and the amount of sleep on cognitive performance was also investigated. A total of 51 intensivists from three ICUs (24 seniors and 27 residents) were included. The study participants were evaluated after a night of rest and after a night shift according to a randomized order. Four cognitive skills were tested according to the Wechsler Adult Intelligence Scale and the Wisconsin Card Sorting Test. All cognitive abilities worsened after a night shift: working memory capacity (11.3 ± 0.3 vs. 9.4 ± 0.3; p night shift. The cognitive abilities of intensivists were significantly altered following a night shift in the ICU, regardless of either the amount of professional experience or the duration of sleep during the shift. The consequences for patients' safety and physicians' health should be further evaluated.

  12. Shift work and its association with metabolic disorders.

    Science.gov (United States)

    Brum, Maria Carlota Borba; Filho, Fábio Fernandes Dantas; Schnorr, Claudia Carolina; Bottega, Gustavo Borchardt; Rodrigues, Ticiana C

    2015-01-01

    Although the health burden of shift work has not been extensively studied, evidence suggests that it may affect the metabolic balance and cause obesity and other metabolic disorders. Sleep deprivation, circadian desynchronization and behavioral changes in diet and physical activity are among the most commonly mentioned factors in studies of the association between night work and metabolic disorders. Individual adaptation to night work depends greatly on personal factors such as family and social life, but occupational interventions may also make a positive contribution to the transition to shift work, such as exposure to bright lights during the night shift, melatonin use, shift regularity and clockwise rotation, and dietary adaptations for the metabolic needs of night workers. The evaluation of the impact of night work on health and of the mechanisms underlying this relationship can serve as a basis for intervention strategies to minimize the health burden of shift work. This review aimed to identify highlights regarding therapeutic implications following the association between night and shift work and metabolic disorders, as well as the mechanisms and pathways responsible for these relationships.

  13. Linearization of the bradford protein assay.

    Science.gov (United States)

    Ernst, Orna; Zor, Tsaffrir

    2010-04-12

    Determination of microgram quantities of protein in the Bradford Coomassie brilliant blue assay is accomplished by measurement of absorbance at 590 nm. This most common assay enables rapid and simple protein quantification in cell lysates, cellular fractions, or recombinant protein samples, for the purpose of normalization of biochemical measurements. However, an intrinsic nonlinearity compromises the sensitivity and accuracy of this method. It is shown that under standard assay conditions, the ratio of the absorbance measurements at 590 nm and 450 nm is strictly linear with protein concentration. This simple procedure increases the accuracy and improves the sensitivity of the assay about 10-fold, permitting quantification down to 50 ng of bovine serum albumin. Furthermore, the interference commonly introduced by detergents that are used to create the cell lysates is greatly reduced by the new protocol. A linear equation developed on the basis of mass action and Beer's law perfectly fits the experimental data.

  14. Nondestructive assay of HTGR fuel rods

    International Nuclear Information System (INIS)

    Menlove, H.O.

    1974-01-01

    Performance characteristics of three different radioactive source NDA systems are compared for the assay of HTGR fuel rods and stacks of rods. These systems include the fast neutron Sb-Be assay system, the 252 Cf ''Shuffler,'' and the thermal neutron PAPAS assay system. Studies have been made to determinethe perturbation on the measurements from particle size, kernel Th/U ratio, thorium content, and hydrogen content. In addition to the total 235 U determination, the pellet-to-pellet or rod-to-rod uniformity of HTGR fuel rod stacks has been measured by counting the delayed gamma rays with a NaI through-hole in the PAPAS system. These measurements showed that rod substitutions can be detected easily in a fuel stack, and that detailed information is available on the loading variations in a uniform stack. Using a 1.0 mg 252 Cf source, assay rates of 2 to 4 rods/s are possible, thus facilitating measurement of 100 percent of a plant's throughput. (U.S.)

  15. Staffing, overtime, and shift scheduling project

    International Nuclear Information System (INIS)

    Lewis, P.M.

    1989-01-01

    Recent events at the Peach Bottom nuclear power plant have demonstrated the need to establish a quantifiable basis for assessing the safety significance of long work hours on nuclear power plant operators. The incidents at TMI-2, Chernobyl, and Bhopal, which all occurred during the late evening/night shift, further highlight the importance of the relationship between shift scheduling and performance. The objective of this project is to estimate, using statistical analysis on data from the nuclear industry, the effects on safety of staffing levels, overtime, and shift scheduling for operators and maintenance personnel. Regarding staffing levels, the Nuclear Regulatory Commission (NRC) currently has no explicit regulation concerning the minimum acceptable levels of staffing in a plant that has an operating license. The NRC has no systematic method for collecting data on the number of licensed operators on the operating crews. In 1982 the NRC recommended that plants write into their technical specifications a model policy on overtime. Currently, 77 nuclear power plant units have the model policy or a modification of it written into their technical specifications; 33 units have no policy on overtime. The model policy sets limits on overtime for safety related personnel, although these limits can be exceeded with plant manger approval. The US nuclear power industry has three types of shift schedules: (1) forward-rotating 8-hour/day shift schedules, (2) backward-rotating 8-hour/day schedules, and (3) 12-hour/day schedules

  16. Night Shift Work and Its Health Effects on Nurses.

    Science.gov (United States)

    Books, Candie; Coody, Leon C; Kauffman, Ryan; Abraham, Sam

    The purpose of this research was to study night shift work and its health effects on nurses. This was a quantitative study using descriptive design; it also incorporated three qualitative open-ended questions to complement the study. The data were collected using Survey Monkey, with an Internet-based confidential data collection tool. The population of relevance to this study was nurses employed in hospital settings in the United States. E-mail addresses and Facebook were used to recruit participants. Results indicated that there is an increased risk of sleep deprivation, family stressors, and mood changes because of working the night shift. Rotating shifts were mentioned as a major concern for night shift nurses. Respondents agreed that complaints about fatigue and fatigue-related illnesses in night shift workers were ignored. There was also a general perception among nurses working the night shift that sleep deprivation leads to negative health consequences including obesity; however, they were not as high a concern as rotating shifts or fatigue.

  17. Recurrence phase shift in Fermi-Pasta-Ulam nonlinear dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Devine, N., E-mail: nnd124@rsphysse.anu.edu.au [Optical Sciences Group, Research School of Physics and Engineering, The Australian National University, Canberra ACT 0200 (Australia); Ankiewicz, A. [Optical Sciences Group, Research School of Physics and Engineering, The Australian National University, Canberra ACT 0200 (Australia); Genty, G. [Tampere University of Technology, Optics Laboratory, FI-33101 Tampere (Finland); Dudley, J.M. [Institut FEMTO-ST UMR 6174 CNRS/Universite de Franche-Comte, Besancon (France); Akhmediev, N. [Optical Sciences Group, Research School of Physics and Engineering, The Australian National University, Canberra ACT 0200 (Australia)

    2011-11-07

    We show that the dynamics of Fermi-Pasta-Ulam recurrence is associated with a nonlinear phase shift between initial and final states that are otherwise identical, after a full growth-return cycle. The properties of this phase shift are studied for the particular case of the self-focussing nonlinear Schroedinger equation, and we describe the magnitude of the phase shift in terms of the system parameters. This phase shift, accumulated during the nonlinear recurrence cycle, is a previously-unremarked feature of the Fermi-Pasta-Ulam problem, and we anticipate its wide significance as an essential feature of related dynamics in other systems. -- Highlights: → The dynamics of FPU recurrence is associated with a phase shift between initial and final states. → The properties of this phase shift are studied for the self-focussing NLS equation. → This phase shift is a previously-unremarked feature of the FPU growth-return cycle. → We anticipate its wide significance as an essential feature of related dynamics in other systems.

  18. Recurrence phase shift in Fermi-Pasta-Ulam nonlinear dynamics

    International Nuclear Information System (INIS)

    Devine, N.; Ankiewicz, A.; Genty, G.; Dudley, J.M.; Akhmediev, N.

    2011-01-01

    We show that the dynamics of Fermi-Pasta-Ulam recurrence is associated with a nonlinear phase shift between initial and final states that are otherwise identical, after a full growth-return cycle. The properties of this phase shift are studied for the particular case of the self-focussing nonlinear Schroedinger equation, and we describe the magnitude of the phase shift in terms of the system parameters. This phase shift, accumulated during the nonlinear recurrence cycle, is a previously-unremarked feature of the Fermi-Pasta-Ulam problem, and we anticipate its wide significance as an essential feature of related dynamics in other systems. -- Highlights: → The dynamics of FPU recurrence is associated with a phase shift between initial and final states. → The properties of this phase shift are studied for the self-focussing NLS equation. → This phase shift is a previously-unremarked feature of the FPU growth-return cycle. → We anticipate its wide significance as an essential feature of related dynamics in other systems.

  19. Passing the Baton: An Experimental Study of Shift Handover

    Science.gov (United States)

    Parke, Bonny; Hobbs, Alan; Kanki, Barbara

    2010-01-01

    Shift handovers occur in many safety-critical environments, including aviation maintenance, medicine, air traffic control, and mission control for space shuttle and space station operations. Shift handovers are associated with increased risk of communication failures and human error. In dynamic industries, errors and accidents occur disproportionately after shift handover. Typical shift handovers involve transferring information from an outgoing shift to an incoming shift via written logs, or in some cases, face-to-face briefings. The current study explores the possibility of improving written communication with the support modalities of audio and video recordings, as well as face-to-face briefings. Fifty participants participated in an experimental task which mimicked some of the critical challenges involved in transferring information between shifts in industrial settings. All three support modalities, face-to-face, video, and audio recordings, reduced task errors significantly over written communication alone. The support modality most preferred by participants was face-to-face communication; the least preferred was written communication alone.

  20. Barcoded microchips for biomolecular assays.

    Science.gov (United States)

    Zhang, Yi; Sun, Jiashu; Zou, Yu; Chen, Wenwen; Zhang, Wei; Xi, Jianzhong Jeff; Jiang, Xingyu

    2015-01-20

    Multiplexed assay of analytes is of great importance for clinical diagnostics and other analytical applications. Barcode-based bioassays with the ability to encode and decode may realize this goal in a straightforward and consistent manner. We present here a microfluidic barcoded chip containing several sets of microchannels with different widths, imitating the commonly used barcode. A single barcoded microchip can carry out tens of individual protein/nucleic acid assays (encode) and immediately yield all assay results by a portable barcode reader or a smartphone (decode). The applicability of a barcoded microchip is demonstrated by human immunodeficiency virus (HIV) immunoassays for simultaneous detection of three targets (anti-gp41 antibody, anti-gp120 antibody, and anti-gp36 antibody) from six human serum samples. We can also determine seven pathogen-specific oligonucleotides by a single chip containing both positive and negative controls.

  1. Dietary habits among persons hired on shift work

    Directory of Open Access Journals (Sweden)

    Joanna Strzemecka

    2014-03-01

    Full Text Available Introduction. Shift-work determinates irregular nutrition habits. The quality as well as the quantity of meals consumed by shift-workers can significantly affects their health. Objective. The aim of this study was to evaluate the dietary habits of people performing shift work in the Bogdanka mine. Material and Methods. The study was carried out in the Bogdanka mine in Leczna. The questionnaire, which was designed by the author of this dissertation, was conducted among 700 shift-workers, working underground. The results were subjected to statistical analysis based on STATISTICA v. 7.1 (StatSoft, Poland software. Results. Nearly half of respondents reported regular consumption of meals (40.0% Interviewees admitted having warm meals during the day (81.4%. The most frequently consumed meal during the day was the hot one (50.9%, three meals and more were consumed the least frequently (8.1%. Almost half of respondents considered their eating habits as inappropriate (46.3%. Among those, nearly half (68.2% stated that shift – work is the reason for their nutrition habits. More than half of respondents (66.0% admitted that shift work hampers regular consumption of meals. Conclusions. Shift work makes nourishment and regular consumption difficult. It contributes to the limited amount of warm meals eaten during the day. In order to maintain preventive health care and the improvement of quality of life, shift workers should be provided with an easier access to meals (including warm one at specified times of the day.

  2. The Prerequisites for a Degrowth Paradigm Shift

    DEFF Research Database (Denmark)

    Buch-Hansen, Hubert

    2018-01-01

    What would it take for a degrowth paradigm shift to take place? Drawing on contemporary critical political economy scholarship, this article identifies four prerequisites for socio-economic paradigm shifts: deep crisis, an alternative political project, a comprehensive coalition of social forces...... currently facing humanity. On the other hand, the prospects for a degrowth paradigm shift remain bleak: unlike political projects that became hegemonic in the past, degrowth has neither support from a comprehensive coalition of social forces nor any consent to its agenda among the broader population....

  3. Regulation of the intronic promoter of rat estrogen receptor alpha gene, responsible for truncated estrogen receptor product-1 expression.

    Science.gov (United States)

    Schausi, Diane; Tiffoche, Christophe; Thieulant, Marie-Lise

    2003-07-01

    We have characterized the intronic promoter of the rat estrogen receptor (ER) alpha gene, responsible for the lactotrope-specific truncated ER product (TERP)-1 isoform expression. Transcriptional regulation was investigated by transient transfections using 5'-deletion constructs. TERP promoter constructs were highly active in MMQ cells, a pure lactotrope cell line, whereas a low basal activity was detected in alphaT3-1 gonadotrope cells or in COS-7 monkey kidney cells. Serial deletion analysis revealed that 1) a minimal -693-bp region encompassing the TATA box is sufficient to allow lactotrope-specific expression; 2) the promoter contains strong positive cis-acting elements both in the distal and proximal regions, and 3) the region spanning the -1698/-1194 region includes repressor elements. Transient transfection studies, EMSAs, and gel shifts demonstrated that estrogen activates the TERP promoter via an estrogen-responsive element (ERE1) located within the proximal region. Mutation of ERE1 site completely abolishes the estradiol-dependent transcription, indicating that ERE1 site is sufficient to confer estrogen responsiveness to TERP promoter. In addition, ERalpha action was synergized by transfection of the pituitary-specific factor Pit-1. EMSAs showed that a single Pit-1 DNA binding element in the vicinity of the TATA box is sufficient to confer response by the TERP promoter. In conclusion, we demonstrated, for the first time, that TERP promoter regulation involves ERE and Pit-1 cis-elements and corresponding trans-acting factors, which could play a role in the physiological changes that occur in TERP-1 transcription in lactotrope cells.

  4. Performance characteristics of the ARCHITECT anti-HCV assay.

    Science.gov (United States)

    Jonas, Gesa; Pelzer, Claudia; Beckert, Christian; Hausmann, Michael; Kapprell, Hans-Peter

    2005-10-01

    The ARCHITECT Anti-HCV assay is a fully automated high throughput chemiluminescent microparticle immunoassay (CMIA) for the detection of antibodies to structural and nonstructural proteins of the hepatitis C virus (HCV). To further enhance the performance of this test, the assay was modified to improve the specificity for blood donor specimens. The specificity of the enhanced ARCHITECT Anti-HCV assay was evaluated by screening blood donor samples randomly collected from various German blood banks, as well as hospitalized patient samples derived from Germany and the US. Additionally, antibody sensitivity was determined on commercially available anti-HCV seroconversion panels and on a commercially available worldwide anti-HCV genotype performance panel. Apparent specificity of the modified ARCHITECT Anti-HCV assay in a blood donor population consisting of 3811 specimens was 99.92%, compared to 99.76% for the current on-market assay. Additionally, antibody sensitivity was determined on commercially available anti-HCV seroconversion panels. Seroconversion sensitivity equivalent to or better than the current on-market product was observed by testing 33 seroconversion panels. This study demonstrates that the modified version of the ARCHITECT Anti-HCV assay shows improved specificity for blood donor specimens compared to the current assay on market without compromising sensitivity. With the availability of the improved ARCHITECT Anti-HCV assay and the recent launch of the ARCHITECT HIV Ag/Ab Combo assay, the ARCHITECT system now offers a full hepatitis/retrovirus menu with excellent performance on a high throughput, random access, automated analyzer, ideally suited for blood screening and diagnostic applications.

  5. Telmisartan Exerts Anti-Tumor Effects by Activating Peroxisome Proliferator-Activated Receptor-γ in Human Lung Adenocarcinoma A549 Cells

    Directory of Open Access Journals (Sweden)

    Juan Li

    2014-03-01

    Full Text Available Telmisartan, a member of the angiotensin II type 1 receptor blockers, is usually used for cardiovascular diseases. Recent studies have showed that telmisartan has the property of PPARγ activation. Meanwhile, PPARγ is essential for tumor proliferation, invasion and metastasis. In this work we explore whether telmisartan could exert anti-tumor effects through PPARγ activation in A549 cells. MTT and trypan blue exclusion assays were included to determine the survival rates and cell viabilities. RT-PCR and western blotting were used to analyze the expression of ICAM-1, MMP-9 and PPARγ. DNA binding activity of PPARγ was evaluated by EMSA. Our data showed that the survival rates and cell viabilities of A549 cells were all reduced by telmisartan in a time- and concentration-dependent manner. Meanwhile, our results also demonstrated that telmisartan dose-dependently inhibited the expression of ICAM-1 and MMP-9. Moreover, the cytotoxic and anti-proliferative effects, ICAM-1 and MMP-9 inhibitive properties of telmisartan were totally blunted by the PPARγ antagonist GW9662. Our findings also showed that the expression of PPARγ was up-regulated by telmisartan in a dose dependent manner. And, the EMSA results also figured out that DNA binding activity of PPARγ was dose-dependently increased by telmisartan. Additionally, our data also revealed that telmisartan-induced PPARγ activation was abrogated by GW9662. Taken together, our results indicated that telmisartan inhibited the expression of ICAM-1 and MMP-9 in A549 cells, very likely through the up-regulation of PPARγ synthesis.

  6. Shifting Sugars and Shifting Paradigms

    Science.gov (United States)

    Siegal, Mark L.

    2015-01-01

    No organism lives in a constant environment. Based on classical studies in molecular biology, many have viewed microbes as following strict rules for shifting their metabolic activities when prevailing conditions change. For example, students learn that the bacterium Escherichia coli makes proteins for digesting lactose only when lactose is available and glucose, a better sugar, is not. However, recent studies, including three PLOS Biology papers examining sugar utilization in the budding yeast Saccharomyces cerevisiae, show that considerable heterogeneity in response to complex environments exists within and between populations. These results join similar recent results in other organisms that suggest that microbial populations anticipate predictable environmental changes and hedge their bets against unpredictable ones. The classical view therefore represents but one special case in a range of evolutionary adaptations to environmental changes that all organisms face. PMID:25688600

  7. Shifting sugars and shifting paradigms.

    Directory of Open Access Journals (Sweden)

    Mark L Siegal

    2015-02-01

    Full Text Available No organism lives in a constant environment. Based on classical studies in molecular biology, many have viewed microbes as following strict rules for shifting their metabolic activities when prevailing conditions change. For example, students learn that the bacterium Escherichia coli makes proteins for digesting lactose only when lactose is available and glucose, a better sugar, is not. However, recent studies, including three PLOS Biology papers examining sugar utilization in the budding yeast Saccharomyces cerevisiae, show that considerable heterogeneity in response to complex environments exists within and between populations. These results join similar recent results in other organisms that suggest that microbial populations anticipate predictable environmental changes and hedge their bets against unpredictable ones. The classical view therefore represents but one special case in a range of evolutionary adaptations to environmental changes that all organisms face.

  8. Frequency Constrained ShiftCP Modeling of Neuroimaging Data

    DEFF Research Database (Denmark)

    Mørup, Morten; Hansen, Lars Kai; Madsen, Kristoffer H.

    2011-01-01

    The shift invariant multi-linear model based on the CandeComp/PARAFAC (CP) model denoted ShiftCP has proven useful for the modeling of latency changes in trial based neuroimaging data[17]. In order to facilitate component interpretation we presently extend the shiftCP model such that the extracted...... components can be constrained to pertain to predefined frequency ranges such as alpha, beta and gamma activity. To infer the number of components in the model we propose to apply automatic relevance determination by imposing priors that define the range of variation of each component of the shiftCP model...

  9. Short communication. Microculture syncytia assay for bovine leukemia virus

    Energy Technology Data Exchange (ETDEWEB)

    Paul, P.S.; Castro, A.E.; Pomeroy, K.A.; Johnson, D.W.; Muscoplat, C.C.

    1978-01-01

    A microculture syncytia assay for the detection of bovine leukemia virus (BLV) has been described and compared with the conventional macroculture assay. The microculture assay required fewer indicator cells, was as sensitive as the macroculture assay and provided a reproducible test for the detection and titration of BLV.

  10. Advantages of shift changeovers with meetings: ergonomic analysis of shift supervisors' activity in aircraft building.

    Science.gov (United States)

    Le Bris, Valérie; Barthe, Béatrice; Marquié, Jean-Claude; Kerguelen, Alain; Aubert, Sophie; Bernadou, Bernadette

    2012-03-01

    Good shift changeovers contribute to ensuring continuity and reliability in shift work. In situations where production is not maintained 24 h a day, changeovers with meetings (SCM) between the two work teams (written plus oral face-to-face handovers) alternate with changeovers without meetings (SCnM; written handovers only). An ergonomic work analysis on an aircraft assembly line showed that (1) incoming and outgoing operators met during the overlap time allotted by the company, and (2) the content of the exchanges was richer for SCMs than for SCnMs. SCMs enabled the operators to pass on and process more aspects of their work than SCnMs did. SCMs also allowed incoming operators to validate their predictions, and enabled both outgoing and incoming operators to update their mental models and work together on peripheral aspects of the technical process over a greater time span. The findings highlight the importance of allowing overlap time in shift work. Copyright © 2011 Elsevier Ltd and The Ergonomics Society. All rights reserved.

  11. Gain Shift Corrections at Chi-Nu

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Tristan Brooks [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Univ. of Massachusetts, Lowell, MA (United States). Dept. of Physics and Applied Physics; Devlin, Matthew James [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-08-30

    Ambient conditions have the potential to cause changes in liquid scintillator detector gain that vary with time and temperature. These gain shifts can lead to poor resolution in both energy as well as pulse shape discrimination. In order to correct for these shifts in the Chi-Nu high energy array, a laser system has been developed for calibration of the pulse height signals.

  12. Shift Work and Sleep Quality Among Urban Police Officers

    Science.gov (United States)

    Fekedulegn, Desta; Burchfiel, Cecil M.; Charles, Luenda E.; Hartley, Tara A.; Andrew, Michael E.; Violanti, John M.

    2016-01-01

    Objective The aim of the study was to examine association of shift work with sleep quality in police officers. Methods Data were obtained from the Buffalo Cardio-Metabolic Occupational Police Stress study (n =363). An electronic work history database was used to define shift as day, afternoon, or night for three durations: past month, 1 year, and 15 years. Sleep quality was determined using the Pittsburgh Sleep Quality Index. Results The overall prevalence of poor sleep quality was 54%; 44% for day, 60% for afternoon, and 69% for night shift. Poor sleep quality was 70% more prevalent among night-shift officers (P shift (P =0.003) relative to officers working on the day shift. Conclusions Night and evening work schedules are associated with elevated prevalence of poor sleep quality among police officers. PMID:26949891

  13. Do working environment interventions reach shift workers?

    DEFF Research Database (Denmark)

    Nabe-Nielsen, Kirsten; Jørgensen, Marie Birk; Garde, Anne Helene

    2016-01-01

    PURPOSE: Shift workers are exposed to more physical and psychosocial stressors in the working environment as compared to day workers. Despite the need for targeted prevention, it is likely that workplace interventions less frequently reach shift workers. The aim was therefore to investigate whether...... the reach of workplace interventions varied between shift workers and day workers and whether such differences could be explained by the quality of leadership exhibited at different times of the day. METHODS: We used questionnaire data from 5361 female care workers in the Danish eldercare sector...

  14. Phase-shift interferometry with a digital photocamera

    International Nuclear Information System (INIS)

    Vannoni, Maurizio; Trivi, Marcelo; Molesini, Giuseppe

    2007-01-01

    A phase-shift interferometry experiment is proposed, working on a Twyman-Green optical configuration with additional polarization components. A guideline is provided to modern phase-shift interferometry, using concepts and laboratory equipment at the level of undergraduate optics courses

  15. 21 CFR 864.7525 - Heparin assay.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Heparin assay. 864.7525 Section 864.7525 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Hematology Kits and Packages § 864.7525 Heparin assay. (a) Identification. A...

  16. Phase shifts in the Fourier spectra of phase gratings and phase grids: an application for one-shot phase-shifting interferometry.

    Science.gov (United States)

    Toto-Arellano, Noel-Ivan; Rodriguez-Zurita, Gustavo; Meneses-Fabian, Cruz; Vazquez-Castillo, Jose F

    2008-11-10

    Among several techniques, phase shifting interferometry can be implemented with a grating used as a beam divider to attain several interference patterns around each diffraction order. Because each pattern has to show a different phase-shift, a suitable shifting technique must be employed. Phase gratings are attractive to perform the former task due to their higher diffraction efficiencies. But as is very well known, the Fourier coefficients of only-phase gratings are integer order Bessel functions of the first kind. The values of these real-valued functions oscillate around zero, so they can adopt negative values, thereby introducing phase shifts of pi at certain diffraction orders. Because this almost trivial fact seems to have been overlooked in the literature regarding its practical implications, in this communication such phase shifts are stressed in the description of interference patterns obtained with grating interferometers. These patterns are obtained by placing two windows in the object plane of a 4f system with a sinusoidal grating/grid in the Fourier plane. It is shown that the corresponding experimental observations of the fringe modulation, as well as the corresponding phase measurements, are all in agreement with the proposed description. A one-shot phase shifting interferometer is finally proposed taking into account these properties after proper incorporation of modulation of polarization.

  17. Suitability of a liquid chromatography assay of neomycin sulfate to replace the microbiological assay for neomycin in USP Monographs.

    Science.gov (United States)

    Hanko, Valoran P; Rohrer, Jeffrey S

    2010-01-05

    The current USP National Formulary contains 65 Monographs for drug formulations containing neomycin. All 65 Monographs prescribe a bioassay for neomycin assay. This bioassay, based on cell culture, is labor intensive, has poor precision, and cannot be adapted for purity or identification. High-performance anion-exchange chromatography with integrated pulsed amperometric detection (HPAE-IPAD), a liquid chromatography technique, has been shown to be suitable for neomycin purity analysis and neomycin assay of an over-the-counter first aid cream (Hanko and Rohrer [17]). Here we propose that an HPAE-IPAD assay can replace the bioassay in the 65 neomycin-containing Monographs. We applied the HPAE-IPAD assay to four neomycin-containing drug products representing the four classes of formulations found in the 65 Monographs, liquid, solid, suspension, and cream. Each drug was analyzed with two chromatography systems, and on 3 separate days. For all products, HPAE-IPAD measurements were precise and accurate with respect to the label concentrations. There was also high accuracy for spike recovery of neomycin from the four drug products throughout 70-150% of the labeled concentration. These results suggest that an HPAE-IPAD assay would be an accurate assay for neomycin, and would be faster and more precise than the current bioassay.

  18. Shifting identities : the musician as theatrical perfomer

    NARCIS (Netherlands)

    Hübner, Falk

    2013-01-01

    The artistic PhD research "Shifting Identities" investigates the musicians' professional identity and how this identity might shift when musicians start acting as theatrical performers. In most of the theatrical situations where musicians "perform", their profession is extended by additional tasks

  19. Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.

    Science.gov (United States)

    Black, W C; Gorrochotegui-Escalante, N; Duteau, N M

    2006-03-01

    Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

  20. The narrow therapeutic window of glycated hemoglobin and assay variability.

    Science.gov (United States)

    Hosseini, S S; Bibler, I; Charles, M A

    1999-12-01

    Glycated hemoglobin is measured by a variety of assays, each of which has a unique normal level. Our purpose is to show that among the different assays available in the United States, using the same patient's blood sample, assay results may vary widely and may more or less easily achieve a glycated hemoglobin value within the normal range. The following assays were compared using the same patient's blood sample for each pair of assays: glycohemoglobin affinity assay (GHB Reader; Isolab, Akron, OH) versus gel electrophoresis assay (n = 76); Isolab versus ion capture assay (IMX; Abbott Laboratories, Irving, TX) (n = 57); monoclonal antibody assay (DCA2000; Bayer Diagnostics, Pittsburgh, PA) versus IMX (n = 100); and high-performance liquid chromatography (HPLC) assay (Bio-Rad Variant A1c; Bio-Rad Laboratories, Richmond, CA) versus IMX assay (n = 55). Our analyses indicate that a relative ranking can be established for the ease of achieving a normal glycated hemoglobin level. The ranking indicates that the most stringent or difficult assays for achieving a normal level are the Isolab and DCA2000 assays. The intermediate assays are the IMX and Bio-Rad Variant, and the easiest method for achieving a normal value is the gel electrophoresis assay. Our results indicate that various glycated hemoglobin assays vary widely and are associated with more or less difficulty for an individual patient to achieve a glycated hemoglobin level within the normal range. These results are especially significant with respect to (1) the clinically narrow therapeutic window of glycated hemoglobin values in type 1 diabetes to avoid rapidly advancing severe hypoglycemia rates and chronic microvascular complication rates, and (2) the glycated hemoglobin threshold for rapidly advancing macrovascular disease in both type 1 and type 2 patients.