
Sample records for serratia marcescens as-1

  1. [Efflux systems in Serratia marcescens]. (United States)

    Mardanova, A M; Bogomol'naia, L M; Romanova, Iu D; Sharipova, M R


    A widespread bacterium Serratia marcescens (family Enterobacteriaceae) is an opportunistic and exhibits multiple drug resistance. Active removal of antibiotics and other antimicrobials from pathogen and exhibits multiple drug resistance. Active removal of antibiotics and other antimicrobials from the cells by efflux systems is one of the mechanisms responsible for microbial resistance to these compounds. Among enterobacteria, efflux systems of Escherichia coli and Salmonella enterica var. Typhimurium have been studied most extensively. Few efflux systems that belong to different families have been reported for S. marcescens. In this review, we analyzed available literature about S. marcescens efflux systems and carried out the comparative analysis of the genes encoding the RND type systems in different Serratia species and in other enterobacteria. Bioinformatical analysis of the S. marcescens genome allowed us to identify the previously unknown efflux systems based on their homology with the relevant E. coli genes. Identification of additional efflux systems in S. marcescens genome will promote our understanding of physiology of these bacteria, will detect new molecular mechanisms of resistance and will reveal their resistance potential.

  2. Chitinase Production by Serratia marcescens GG5


    SINGH, Gursharan; SHARMA, Joginder Ram; HOONDAL, Gurinder Singh


    Swollen chitin, flake chitin, powder chitin, and mushroom paste were used as substrates for chitinase production by Serratia marcescens GG5 in submerged fermentation. Enzyme production was 0.3 U/ml when the organism was grown in M9 medium supplemented with 0.5% swollen chitin and 0.5% soluble starch. Scanning electron microscopy revealed that Serratia marcescens GG5 digested the chitin flakes by producing chitinase.

  3. Killing of Serratia marcescens biofilms with chloramphenicol. (United States)

    Ray, Christopher; Shenoy, Anukul T; Orihuela, Carlos J; González-Juarbe, Norberto


    Serratia marcescens is a Gram-negative bacterium with proven resistance to multiple antibiotics and causative of catheter-associated infections. Bacterial colonization of catheters mainly involves the formation of biofilm. The objectives of this study were to explore the susceptibility of S. marcescens biofilms to high doses of common antibiotics and non-antimicrobial agents. Biofilms formed by a clinical isolate of S. marcescens were treated with ceftriaxone, kanamycin, gentamicin, and chloramphenicol at doses corresponding to 10, 100 and 1000 times their planktonic minimum inhibitory concentration. In addition, biofilms were also treated with chemical compounds such as polysorbate-80 and ursolic acid. S. marcescens demonstrated susceptibility to ceftriaxone, kanamycin, gentamicin, and chloramphenicol in its planktonic form, however, only chloramphenicol reduced both biofilm biomass and biofilm viability. Polysorbate-80 and ursolic acid had minimal to no effect on either planktonic and biofilm grown S. marcescens. Our results suggest that supratherapeutic doses of chloramphenicol can be used effectively against established S. marcescens biofilms.

  4. Cysteine Biosynthesis Controls Serratia marcescens Phospholipase Activity. (United States)

    Anderson, Mark T; Mitchell, Lindsay A; Mobley, Harry L T


    Serratia marcescens causes health care-associated opportunistic infections that can be difficult to treat due to a high incidence of antibiotic resistance. One of the many secreted proteins of S. marcescens is the PhlA phospholipase enzyme. Genes involved in the production and secretion of PhlA were identified by screening a transposon insertion library for phospholipase-deficient mutants on phosphatidylcholine-containing medium. Mutations were identified in four genes ( cyaA , crp , fliJ , and fliP ) that are involved in the flagellum-dependent PhlA secretion pathway. An additional phospholipase-deficient isolate harbored a transposon insertion in the cysE gene encoding a predicted serine O -acetyltransferase required for cysteine biosynthesis. The cysE requirement for extracellular phospholipase activity was confirmed using a fluorogenic phospholipase substrate. Phospholipase activity was restored to the cysE mutant by the addition of exogenous l-cysteine or O -acetylserine to the culture medium and by genetic complementation. Additionally, phlA transcript levels were decreased 6-fold in bacteria lacking cysE and were restored with added cysteine, indicating a role for cysteine-dependent transcriptional regulation of S. marcescens phospholipase activity. S. marcescens cysE mutants also exhibited a defect in swarming motility that was correlated with reduced levels of flhD and fliA flagellar regulator gene transcription. Together, these findings suggest a model in which cysteine is required for the regulation of both extracellular phospholipase activity and surface motility in S. marcescens IMPORTANCE Serratia marcescens is known to secrete multiple extracellular enzymes, but PhlA is unusual in that this protein is thought to be exported by the flagellar transport apparatus. In this study, we demonstrate that both extracellular phospholipase activity and flagellar function are dependent on the cysteine biosynthesis pathway. Furthermore, a disruption of cysteine

  5. Biological activity of Serratia marcescens cytotoxin

    Directory of Open Access Journals (Sweden)

    G.V. Carbonell


    Full Text Available Serratia marcescens cytotoxin was purified to homogeneity by ion-exchange chromatography on a DEAE Sepharose Fast Flow column, followed by gel filtration chromatography on a Sephadex G100 column. The molecular mass of the cytotoxin was estimated to be about 50 kDa. Some biological properties of the cytotoxin were analyzed and compared with well-characterized toxins, such as VT1, VT2 and CNF from Escherichia coli and hemolysin produced by S. marcescens. The sensitivity of the cell lines CHO, HeLa, HEp-2, Vero, BHK-21, MA 104 and J774 to the cytotoxin was determined by the cell viability assay using neutral red. CHO and HEp-2 were highly sensitive, with massive cellular death after 1 h of treatment, followed by BHK-21, HeLa, Vero and J774 cells, while MA 104 was insensitive to the toxin. Cytotoxin induced morphological changes such as cell rounding with cytoplasmic retraction and nuclear compactation which were evident 15 min after the addition of cytotoxin. The cytotoxic assays show that 15 min of treatment with the cytotoxin induced irreversible intoxication of the cells, determined by loss of cell viability. Concentrations of 2 CD50 (0.56 µg/ml of purified cytotoxin did not present any hemolytic activity, showing that the cytotoxin is distinct from S. marcescens hemolysin. Antisera prepared against S. marcescens cytotoxin did not neutralize the cytotoxic activity of VT1, VT2 or CNF toxin, indicating that these toxins do not share antigenic determinants with cytotoxin. Moreover, we did not detect gene sequences for any of these toxins in S. marcescens by PCR assay. These results suggest that S. marcescens cytotoxin is not related to any of these toxins from E. coli.

  6. Radiosensitization of Serratia marcescens by nitropyridinium

    International Nuclear Information System (INIS)

    Anderson, R.F.; Patel, K.B.; Smithen, C.E.


    The two nitropyridinium compounds tested sensitize hypoxic Serratia marcescens to irradiation up to the oxygen enhancement level by two components which can be separated as a function of compound concentration. Sensitization above the initial plateau level is in order of their determined one-electron reduction potentials, Ro 03-5580(E 7 1 =-335mV) being more efficient than Ro 03-5637(E 7 1 =-358mV). Additivity in sensitization up to a maximum enhancement level of 2.1+-0.1 is found on combining these hydrophilic compounds, at concentrations to give sensitization at the plateau level, with the hydrophobic sensitizer paranitroacetophenone (PNAP). It is concluded that the nitropyridinium compounds and PNAP sensitize the same site. (author)

  7. Serratia marcescens harboring SME-4 in Brazil: A silent threat. (United States)

    Cayô, Rodrigo; Leme, Rodrigo Cuiabano Paes; Streling, Ana Paula; Matos, Adriana Pereira; Nodari, Carolina Silva; Chaves, Jessica Reis Esteves; Brandão, Jorge Luiz Ferreira; de Almeida, Maíra Fernandes; Carrareto, Valério; de Castro Pereira, Marco Aurélio; de Almeida, Jean Pierre Aquino; Ferreira, Demian Candido; Gales, Ana Cristina


    The intrinsic polymyxin resistance displayed by Serratia marcescens makes the acquisition of carbapenemase encoding genes a worrisome event. This study report a SME-4-producing S. marcescens isolate causing septic shock in Brazil. The insertion of novel resistance determinants and their consequent spread in our territory is noteworthy. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Intracranial complications of Serratia marcescens infection in neonates. (United States)

    Madide, Ayanda; Smith, Johan


    Even though Serratia marcescens is not one of the most common causes of infection in neonates, it is associated with grave morbidity and mortality. We describe the evolution of brain parenchymal affectation observed in association with S. marcescens infection in neonates. This retrospective case series details brain ultrasound findings of five neonates with hospital-acquired S. marcescens infection. Neonatal S. marcescens infection with or without associated meningitis can be complicated by brain parenchymal affectation, leading to cerebral abscess formation. It is recommended that all neonates with this infection should undergo neuro-imaging more than once before discharge from hospital; this can be achieved using bedside ultrasonography.

  9. Serratia marcescens is injurious to intestinal epithelial cells. (United States)

    Ochieng, John B; Boisen, Nadia; Lindsay, Brianna; Santiago, Araceli; Ouma, Collins; Ombok, Maurice; Fields, Barry; Stine, O Colin; Nataro, James P


    Diarrhea causes substantial morbidity and mortality in children in low-income countries. Although numerous pathogens cause diarrhea, the etiology of many episodes remains unknown. Serratia marcescens is incriminated in hospital-associated infections, and HIV/AIDS associated diarrhea. We have recently found that Serratia spp. may be found more commonly in the stools of patients with diarrhea than in asymptomatic control children. We therefore investigated the possible enteric pathogenicity of S. marcescens in vitro employing a polarized human colonic epithelial cell (T84) monolayer. Infected monolayers were assayed for bacterial invasion, transepithelial electrical resistance (TEER), cytotoxicity, interleukin-8 (IL-8) release and morphological changes by scanning electron microscopy. We observed significantly greater epithelial cell invasion by S. marcescens compared to Escherichia coli strain HS (p = 0.0038 respectively). Cell invasion was accompanied by reduction in TEER and secretion of IL-8. Lactate dehydrogenase (LDH) extracellular concentration rapidly increased within a few hours of exposure of the monolayer to S. marcescens. Scanning electron microscopy of S. marcescens-infected monolayers demonstrated destruction of microvilli and vacuolization. Our results suggest that S. marcescens interacts with intestinal epithelial cells in culture and induces dramatic alterations similar to those produced by known enteric pathogens.

  10. Risk factors for mortality in patients with Serratia marcescens bacteremia. (United States)

    Kim, Sun Bean; Jeon, Yong Duk; Kim, Jung Ho; Kim, Jae Kyoung; Ann, Hea Won; Choi, Heun; Kim, Min Hyung; Song, Je Eun; Ahn, Jin Young; Jeong, Su Jin; Ku, Nam Su; Han, Sang Hoon; Choi, Jun Yong; Song, Young Goo; Kim, June Myung


    Over the last 30 years, Serratia marcescens (S. marcescens) has emerged as an important pathogen, and a common cause of nosocomial infections. The aim of this study was to identify risk factors associated with mortality in patients with S. marcescens bacteremia. We performed a retrospective cohort study of 98 patients who had one or more blood cultures positive for S. marcescens between January 2006 and December 2012 in a tertiary care hospital in Seoul, South Korea. Multiple risk factors were compared with association with 28-day all-cause mortality. The 28-day mortality was 22.4% (22/98 episodes). In a univariate analysis, the onset of bacteremia during the intensive care unit stay (p=0.020), serum albumin level (p=0.011), serum C-reactive protein level (p=0.041), presence of indwelling urinary catheter (p=0.023), and Sequential Oran Failure Assessment (SOFA) score at the onset of bacteremia (pmarcescens bacteremia.

  11. Non-contiguous multifocal vertebral osteomyelitis caused by Serratia marcescens. (United States)

    Lau, Jen Xin; Li, Jordan Yuanzhi; Yong, Tuck Yean


    Serratia marcescens is a common nosocomial infection but a rare cause of osteomyelitis and more so of vertebral osteomyelitis. Vertebral osteomyelitis caused by this organism has been reported in few studies. We report a case of S. marcescens vertebral discitis and osteomyelitis affecting multiple non-contiguous vertebras. Although Staphylococcus aureus is the most common cause of vertebral osteomyelitis, rare causes, such as S. marcescens, need to be considered, especially when risk factors such as intravenous heroin use, post-spinal surgery and immunosuppression are present. Therefore, blood culture and where necessary biopsy of the infected region should be undertaken to establish the causative organism and determine appropriate antibiotic susceptibility. Prompt diagnosis of S. marcescens vertebral osteomyelitis followed by the appropriate treatment can achieve successful outcomes.

  12. Serratia marcescens endophthalmitis after pterygium surgery: a case report. (United States)

    Yi, Myeong Yeon; Chung, Jin Kwon; Choi, Kyung Seek


    To report a case of Serratia marcescens endophthalmitis after pterygium surgery using the bare sclera technique with mitomycin C (MMC). A 69-year-old male patient underwent pterygium excision surgery using the bare sclera technique and 0.02% MMC. The patient presented with decreased visual acuity and pain from the day after the operation. Trans pars plana vitrectomy was performed and intravitreal antibiotics were administered. Cultures from the aqueous humor and intraocular lens were all positive for S. marcescens, which was sensitive to an empiric antibiotic regimen. The best corrected distant visual acuity, 1 month after treatment, was a finger count/50 cm, but the retinal layer structure and the vasculature were relatively well preserved. This is the first reported case of S. marcescens endophthalmitis after pterygium surgery. Endophthalmitis caused by S. marcescens has a devastating visual prognosis and may show a high clinical risk-benefit ratio for the application of MMC in pterygium surgery.


    NARCIS (Netherlands)



    Serratia marcescens is an important pathogen with noteworthy hydrophobicity characteristics as assessed by microbial adhesion to hydrocarbons. However, the present knowledge on the surface characteristics of S. marcescens strains does not include physicochemical properties relevant for adhesion such

  14. Highly Solvent Tolerance in Serratia marcescens IBBPo15

    Directory of Open Access Journals (Sweden)

    Mihaela Marilena Stancu

    Full Text Available ABSTRACT The aim of this study was to investigate the solvent tolerance mechanisms in Serratia marcescens strain IBBPo15 (KT315653. Serratia marcescens IBBPo15 exhibited remarkable solvent-tolerance, being able to survive in the presence of high concentrations (above 40% of toxic organic solvents, such as cyclohexane, n-hexane, n-decane, toluene, styrene, and ethylbenzene. S. marcescens IBBPo15 produced extracellular protease and the enzyme production decreased in cells exposed to 5% cyclohexane, n-hexane, toluene, styrene, and ethylbenzene, as compared with the control and n-decane exposed cells. S. marcescens IBBPo15 cells produced carotenoid pigments and alteration of pigments profile (i.e., phytoene, lycopene were observed in cells exposed to 5% cyclohexane, n-hexane, n-decane, toluene, styrene, and ethylbenzene. The exposure of S. marcescens IBBPo15 cells to 5% cyclohexane, n-hexane, n-decane, toluene, styrene, ethylbenzene induced also changes in the intracellular (e.g., 50 kDa protein and extracellular (e.g., 39, 41, 43, 53, 110 kDa proteins proteins profile. Significant RAPD, ARDRA, rep-PCR and PCR pattern modifications were not observed in DNA extracted from S. marcescens IBBPo15 cells exposed to 5% cyclohexane, n-hexane, n-decane, toluene, styrene, and ethylbenzene. Though only HAE1 and acrAB genes were detected in the genome of S. marcescens IBBPo15 cells, the unspecific amplification of other fragments being observed also when the primers for ompF and recA genes were used.

  15. Cerebral abscess caused by Serratia marcescens in a premature neonate Abscesso cerebral causado por Serratia marcescens em prematuro

    Directory of Open Access Journals (Sweden)

    Tatiana Mattos Hirooka


    Full Text Available BACKGROUND: Cerebral abscesses are extremely rare in neonates. Serratia marcescens is an unusual cause of sepsis and neurological spread is especially ominous. PURPOSE: To report the case of a 34-week neonate who developed this rare condition and to discuss diagnostic and therapeutic measures. CASE REPRT: A 34-week male neonate sequentially developed respiratory distress syndrome, early sepsis and necrotizing enterocolitis; later cultures revealed S. marcescens. After deterioration, a cerebral abscess became evident, which revealed S. marcescens. Clinical improvement ensued after high-dose amikacin and meropenem. CONCLUSION: Clinical signs are often non-specific. Proper diagnostic measures, neurosurgical consultation and aggressive antibiotic therapy are essential for these high-risk neonates.INTRODUÇÃO: Abscessos cerebrais são extremamente raros em neonatos. Serratia marcescens é causadora incomum de sepse nestes pacientes e a disseminação no sistema nervoso central é grave. OBJETIVO: Relatar um prematuro de 34 semanas que desenvolveu esta condição e discutir as medidas diagnósticas e terapêuticas. RELATO DE CASO: Prematuro masculino de 34 semanas desenvolveu síndrome do desconforto respiratório, sepse neonatal e enterocolite necrotizante; hemoculturas revelaram S. marcescens. Após deterioração clínica, evidenciou-se um abscesso cerebral cuja drenagem revelou S. marcescens. Houve melhora após introdução de amicacina e meropenem. CONCLUSÃO: Os sinais clínicos são inespecíficos. Passos diagnósticos apropriados, avaliação neurocirúrgica precoce e antibioticoterapia agressiva são essenciais para estes prematuros.

  16. Identification of a Csr system in Serratia marcescens 2170. (United States)

    Ito, Manabu; Nomura, Kazuki; Sugimoto, Hayuki; Watanabe, Takeshi; Suzuki, Kazushi


    The carbon storage regulator (Csr) global regulatory system is conserved in many eubacteria and coordinates the expression of various genes that facilitate adaptation during the major physiological growth phase. The Csr system in Escherichia coli comprises an RNA-binding protein, CsrA; small non-coding RNAs, CsrB and CsrC; and a decay factor for small RNAs, CsrD. In this study, we identified the Csr system in Serratia marcescens 2170. S. marcescens CsrA was 97% identical to E. coli CsrA. CsrB and CsrC RNAs had typical stem-loop structures, including a GGA motif that is the CsrA binding site. CsrD was composed of N-terminal two times transmembrane region and HAMP-like, GGDEF, and EAL domains. Overexpression of S. marcescens csr genes complemented the phenotype of E. coli csr mutants. S. marcescens CsrD affected the decay of CsrB and CsrC RNAs in E. coli. These results suggest that the Csr system in S. marcescens is composed of an RNA-binding protein, two Csr small RNAs, and a decay factor for Csr small RNAs.

  17. Serratia marcescens meningitis: epidemiology, prognostic factors and treatment outcomes. (United States)

    Wu, Yen-Mu; Hsu, Po-Chang; Yang, Chien-Chang; Chang, Hong-Jyun; Ye, Jung-Jr; Huang, Ching-Tai; Lee, Ming-Hsun


    Serratia marcescens is a rare pathogen of central nervous system infections. This study was to investigate the epidemiology, prognostic factors, and treatment outcomes of S. marcescens meningitis. This retrospective analysis included 33 patients with culture-proven S. marcescens meningitis hospitalized between January 2000 and June 2011. Of the 33 patients enrolled, only one did not receive neurosurgery before the onset of S. marcescens meningitis. Patients with S. marcescens meningitis had higher ratios of brain solid tumors (54.5%) and neurosurgery (97.0%) with a mortality rate of 15.2%. The mean interval between the first neurosurgical procedure and the diagnosis of meningitis was 17.1 days (range, 4-51 days). Only one third-generation cephalosporin-resistant S. marcescens isolate was recovered from the patients' cerebrospinal fluid (CSF) specimens. Compared with the favorable outcome group (n = 20), the unfavorable outcome group (n = 13) had a higher percentage of brain solid tumors, more intensive care unit stays, and higher Sequential Organ Failure Assessment score, CSF lactate and serum C-reactive protein concentrations at diagnosis of meningitis. Under the multiple regression analysis, CSF lactate concentration ≥2-fold the upper limit of normal (ULN) was independently associated with unfavorable outcomes (odds ratio, 7.20; 95% confidence interval, 1.08-47.96; p = 0.041). S. marcescens meningitis is highly associated with neurosurgical procedures for brain solid tumors. CSF lactate concentration ≥2x ULN may predict an unfavorable outcome. Its mortality is not high and empiric treatment with parenteral third-generation cephalosporins may have a satisfactory clinical response. Copyright © 2012. Published by Elsevier B.V.

  18. Prolonged outbreak of Serratia marcescens in Tartu University Hospital: a case-control study. (United States)

    Adamson, Vivika; Mitt, Piret; Pisarev, Heti; Metsvaht, Tuuli; Telling, Kaidi; Naaber, Paul; Maimets, Matti


    The aim of our study was to investigate and control an outbreak and identify risk factors for colonization and infection with Serratia marcescens in two departments in Tartu University Hospital. The retrospective case-control study was conducted from July 2005 to December 2006. Molecular typing by pulsed field gel electrophoresis was used to confirm the relatedness of Serratia marcescens strains. Samples from the environment and from the hands of personnel were cultured. The outbreak involved 210 patients, 61 (29%) developed an infection, among them 16 were invasive infections. Multivariate analysis identified gestational age, arterial catheter use and antibiotic treatment as independent risk factors for colonization and infection with Serratia marcescens. Molecular typing was performed on 83 Serratia marcescens strains, 81 of them were identical and 2 strains were different. Given the occasionally severe consequences of Serratia marcescens in infants, early implementation of aggressive infection control measures involving patients and mothers as well as the personnel is of utmost importance.


    Directory of Open Access Journals (Sweden)



    Full Text Available A new benzoate-utilizing strain, Serratia marcescens DS-8, isolated from the environment was characterized. The strain was enterobacilli, Gram negative, mesophilic, non ha lophilic, and aerobic bacterium that showed motile ovale-rod shaped cells. The isolate produced extracellular chitinase, protease, and prodigiosin (a red pigment pr oduced by several Serratia strains yielding bright red or pink colonies. A physiological assay using Microbact* test showed that the strain was closely related to Klebsiella ozaenae (49.85% and Serratia liquefaciens (24.42%, respectively. However, 16S rRNA sequence analysis indicated that the strain was closely related to S. marcescens DSM 30121 with similarity level of 98%. DS-8 strain was able to synthesize its own vitamins. Optimum growth in benzoate was obtained at pH between 7-8.5 and NaCl concentration of 1- 1.5% (w/v. The isolate could grow in benzoate-containing medium up to 10 mM. Other carbon sources that could support the growth of DS-8 were casamino acid, glutamate, glucose, acetate, potato star ch, and ethanol.

  20. Ocorrência de Serratia marcescens bizio sobre lagartas de Heliothis virescens (Fabr. Occurrence of Serratia marcescens bizio on Heliothis virescens (Fabr.

    Directory of Open Access Journals (Sweden)

    Margarida Fumiko Ito


    Full Text Available Observou-se, em laboratório, grande número de lagartas mortas em uma criação de Heliothis virescens (Fabr.. Dessas lagartas, isolou-se uma bactéria, posteriormente identificada como Serratia marcescens Bizio. O presente trabalho registra sua ocorrência e comprova-lhe a patogenicidade sobre aquelas lagartas.A large quantity of dead worms was observed in rearing of Heliothis virescens. A bacteria, later identified as Serratia marcescens Bizio, was isolated from the dead worms. The present work registers the occurrence and confirms the pathogenicity of S. marcescens on H. virescens.

  1. Comparative analysis of prodigiosin isolated from endophyte Serratia marcescens. (United States)

    Khanam, B; Chandra, R


    Extraction of pigments from endophytes is an uphill task. Up till now, there are no efficient methods available to extract the maximum amount of prodigiosin from Serratia marcescens. This is one of the important endophytes of Beta vulgaris L. The present work was carried out for the comparative study of six different extraction methods such as homogenization, ultrasonication, freezing and thawing, heat treatment, organic solvents and inorganic acids to evaluate the efficiency of prodigiosin yield. Our results demonstrated that highest extraction was observed in ultrasonication (98·1 ± 1·7%) while the lowest extraction by freezing and thawing (31·8 ± 3·8%) methods. However, thin layer chromatography, high-performance liquid chromatography and Fourier transform infrared data suggest that bioactive pigment in the extract was prodigiosin. To the best of our knowledge, this is the first comprehensive study of extraction methods and identification and purification of prodigiosin from cell biomass of Ser. marcescens isolated from Beta vulgaris L. The prodigiosin family is a potent drug with anticancer, antimalarial, antibacterial, antifungal, antiproliferative and immunosuppressive activities. Moreover, it has immense potential in pharmaceutical, food and textile industries. For the industrial perspective, it is essential to achieve purified, high yield and cost-effective extraction of prodigiosin. To the best of our knowledge, this is the first comprehensive study on prodigiosin extraction and also the first report on endophyte Serratia marcescens isolated from Beta vulgaris L. The significance of our results is to extract high amount and good quality prodigiosin for commercial application. © 2017 The Society for Applied Microbiology.

  2. Genomic, Physiologic, and Symbiotic Characterization of Serratia marcescens Strains Isolated from the Mosquito Anopheles stephensi

    Directory of Open Access Journals (Sweden)

    Shicheng Chen


    Full Text Available Strains of Serratia marcescens, originally isolated from the gut lumen of adult female Anopheles stephensi mosquitoes, established persistent infection at high rates in adult A. stephensi whether fed to larvae or in the sugar meal to adults. By contrast, the congener S. fonticola originating from Aedes triseriatus had lower infection in A. stephensi, suggesting co-adaptation of Serratia strains in different species of host mosquitoes. Coinfection at high infection rate in adult A. stephensi resulted after feeding S. marcescens and Elizabethkingia anophelis in the sugar meal, but when fed together to larvae, infection rates with E. anophelis were much higher than were S. marcescens in adult A. stephensi, suggesting a suppression effect of coinfection across life stages. A primary isolate of S. marcescens was resistant to all tested antibiotics, showed high survival in the mosquito gut, and produced alpha-hemolysins which contributed to lysis of erythrocytes ingested with the blood meal. Genomes of two primary isolates from A. stephensi, designated S. marcescens ano1 and ano2, were sequenced and compared to other Serratia symbionts associated with insects, nematodes and plants. Serratia marcescens ano1 and ano2 had predicted virulence factors possibly involved in attacking parasites and/or causing opportunistic infection in mosquito hosts. S. marcescens ano1 and ano2 possessed multiple mechanisms for antagonism against other microorganisms, including production of bacteriocins and multi-antibiotic resistance determinants. These genes contributing to potential anti-malaria activity including serralysins, hemolysins and chitinases are only found in some Serratia species. It is interesting that genome sequences in S. marcescens ano1 and ano2 are distinctly different from those in Serratia sp. Ag1 and Ag2 which were isolated from Anopheles gambiae. Compared to Serratia sp. Ag1 and Ag2, S. marcescens ano1 and ano2 have more rRNAs and many important

  3. Genomic, Physiologic, and Symbiotic Characterization of Serratia marcescens Strains Isolated from the Mosquito Anopheles stephensi. (United States)

    Chen, Shicheng; Blom, Jochen; Walker, Edward D


    Strains of Serratia marcescens , originally isolated from the gut lumen of adult female Anopheles stephensi mosquitoes, established persistent infection at high rates in adult A. stephensi whether fed to larvae or in the sugar meal to adults. By contrast, the congener S. fonticola originating from Aedes triseriatus had lower infection in A. stephensi , suggesting co-adaptation of Serratia strains in different species of host mosquitoes. Coinfection at high infection rate in adult A. stephensi resulted after feeding S. marcescens and Elizabethkingia anophelis in the sugar meal, but when fed together to larvae, infection rates with E. anophelis were much higher than were S. marcescens in adult A. stephensi , suggesting a suppression effect of coinfection across life stages. A primary isolate of S. marcescens was resistant to all tested antibiotics, showed high survival in the mosquito gut, and produced alpha-hemolysins which contributed to lysis of erythrocytes ingested with the blood meal. Genomes of two primary isolates from A. stephensi , designated S. marcescens ano1 and ano2, were sequenced and compared to other Serratia symbionts associated with insects, nematodes and plants. Serratia marcescens ano1 and ano2 had predicted virulence factors possibly involved in attacking parasites and/or causing opportunistic infection in mosquito hosts. S. marcescens ano1 and ano2 possessed multiple mechanisms for antagonism against other microorganisms, including production of bacteriocins and multi-antibiotic resistance determinants. These genes contributing to potential anti-malaria activity including serralysins, hemolysins and chitinases are only found in some Serratia species. It is interesting that genome sequences in S. marcescens ano1 and ano2 are distinctly different from those in Serratia sp. Ag1 and Ag2 which were isolated from Anopheles gambiae . Compared to Serratia sp. Ag1 and Ag2, S. marcescens ano1 and ano2 have more rRNAs and many important genes involved in

  4. Intracellular and extracellular radiosensitization of Serratia marcescens by bipyridinium compounds

    International Nuclear Information System (INIS)

    Anderson, R.F.; Patel, K.B.


    The one-electron reduced form of the bipyridinium compounds benzylviologen and methylviologen have been found to diffuse across the cytoplasmic membrane of Serratia marcescens cells. Subsequent reoxidation of the viologens to the dicationic form traps the compound inside the cells. Cells at a density of 4 x 10 9 ml -1 took up approximately half of the compound when incubated with an initial extracellular concentration of 200μM of either reduced viologen. The degree of radiosensitization in anoxia afforded by the compounds parallels the rise in internal concentration and reaches a maximum enhancement ratio of 2.0 +- 0.1 for both compounds. This level in sensitization is similar to that found when the compounds are external to the cell. No additivity in sensitization is found when the viologens are both internal and external to the cells at the time of irradiation suggesting that the same target site is sensitized. This site is probably some membrane-associated structure


    NARCIS (Netherlands)


    A gene encoding a chitinase from Serratia marcescens BJL200 was cloned and expressed in Escherichia coli and S. marcescens. Nucleotide sequencing revealed an open reading frame encoding a 55.5 kDa protein of 499 amino acids without a typical signal peptide for export. The cellular localization of

  6. Serratamolide is a hemolytic factor produced by Serratia marcescens.

    Directory of Open Access Journals (Sweden)

    Robert M Q Shanks

    Full Text Available Serratia marcescens is a common contaminant of contact lens cases and lenses. Hemolytic factors of S. marcescens contribute to the virulence of this opportunistic bacterial pathogen. We took advantage of an observed hyper-hemolytic phenotype of crp mutants to investigate mechanisms of hemolysis. A genetic screen revealed that swrW is necessary for the hyper-hemolysis phenotype of crp mutants. The swrW gene is required for biosynthesis of the biosurfactant serratamolide, previously shown to be a broad-spectrum antibiotic and to contribute to swarming motility. Multicopy expression of swrW or mutation of the hexS transcription factor gene, a known inhibitor of swrW expression, led to an increase in hemolysis. Surfactant zones and expression from an swrW-transcriptional reporter were elevated in a crp mutant compared to the wild type. Purified serratamolide was hemolytic to sheep and murine red blood cells and cytotoxic to human airway and corneal limbal epithelial cells in vitro. The swrW gene was found in the majority of contact lens isolates tested. Genetic and biochemical analysis implicate the biosurfactant serratamolide as a hemolysin. This novel hemolysin may contribute to irritation and infections associated with contact lens use.

  7. Serratia marcescens Bullous Cellulitis in a Splenectomized Patient: A Case Report and Review of the Literature. (United States)

    Fournier, John B; Dabiri, Ganary; Thomas, Vinod; Skowron, Gail; Carson, Polly; Falanga, Vincent


    Serratia marcescens is a Gram-negative bacillus belonging to the Enterobacteriaceae family. Cutaneous infection with Serratia is rare, and usually occurs in immunocompromised individuals. Primary cutaneous infections are uncommon, but they are typically severe and are associated with significant morbidity and mortality. The pathogenetic factors leading to S. marcescens infection are not fully understood, but contributing virulence factors include proteases, secreted exotoxins, and the formation of biofilm. We report a case of cellulitis occurring in a splenectomized patient, which led to multiple wound debridements and a transmetatarsal amputation. This dramatic case led us to review the published literature on soft tissue infections caused by S. marcescens. © The Author(s) 2016.

  8. Skin ulcers caused by Serratia marcescens: three cases and a review of the literature. (United States)

    Veraldi, Stefano; Nazzaro, Gianluca


    Serratia marcescens is a Gram-negative, encapsulated, motile, anaerobic, non-sporulating bacillus that belongs to the Enterobacteriaceae family. It is found in water, soil, plants, food, and garbage. S. marcescens is an opportunistic pathogen. It usually causes nosocomial infections, such as lung and genitourinary infections, sinusitis, otitis, endocarditis, and sepsis. Skin infections caused by S. marcescens are rare. To describe three new cases of skin ulcers of the leg caused by S. marcescens and review the relevant literature. We investigated three patients admitted for ulcers on the leg. In two patients, post-traumatic aetiology was concluded. The modality of infection was not identified for the other patient. One patient was diabetic. All patients recovered with specific antibiotic therapy (ciprofloxacin, ceftriaxone and levofloxacin, respectively). Skin ulcers due to S. marcescens are very rare. The three cases presented here add to the limited literature of skin infections caused by S. marcescens.

  9. Effects of Dimerization of Serratia marcescens Endonuclease on Water Dynamics.

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Chuanying; Beck, Brian W.; Krause, Kurt; Weksberg, Tiffany E.; Pettitt, Bernard M.


    The research described in this product was performed in part in the Environmental Molecular Sciences Laboratory, a national scientific user facility sponsored by the Department of Energy's Office of Biological and Environmental Research and located at Pacific Northwest National Laboratory. The dynamics and structure of Serratia marcescens endonuclease and its neighboring solvent are investigated by molecular dynamics (MD). Comparisons are made with structural and biochemical experiments. The dimer form is physiologic and functions more processively than the monomer. We previously found a channel formed by connected clusters of waters from the active site to the dimer interface. Here, we show that dimerization clearly changes correlations in the water structure and dynamics in the active site not seen in the monomer. Our results indicate that water at the active sites of the dimer is less affected compared with bulk solvent than in the monomer where it has much slower characteristic relaxation times. Given that water is a required participant in the reaction, this gives a clear advantage to dimerization in the absence of an apparent ability to use both active sites simultaneously.

  10. A case of pulmonary Serratia marcescens granuloma radiologically mimicking metastatic malignancy and tuberculosis infection. (United States)

    Das, Joyutpal; Layton, Benjamin; Lamb, Harriet; Sinnott, Nicola; Leahy, Bernard C


    Serratia marcescens is a saprophytic gram-negative bacillus capable of causing a wide range of infections. A 57-year-old female was admitted to our hospital for four weeks with community acquired pneumonia. A chest x-ray, six weeks after discharge, demonstrated multiple, bilateral 'cannon ball'-like opacities and mediastinal lymphadenopathy which were highly suspicious of disseminated malignancy or tuberculosis. The only symptom that this patient had was a productive cough. She had multiple commodities, but no specific immunodeficiency disorder. Interestingly, her sputum and bronchial washing samples grew S. marcescens. The computed tomography-guided lung biopsy demonstrated necrotic granulomatous changes. There was no pathological evidence of tuberculosis or fungal infection, malignancy or vasculitis. There are only a handful of reported cases of Serratia granulomas. Thus, we are reporting a rare instance of pulmonary Serratia marcescens granuloma radiologically mimicking metastatic malignancy and tuberculosis infection. © The Author(s) 2015.

  11. Nosocomial Serratia marcescens infections associated with extrinsic contamination of a liquid nonmedicated soap. (United States)

    Sartor, C; Jacomo, V; Duvivier, C; Tissot-Dupont, H; Sambuc, R; Drancourt, M


    To determine the role of nonmedicated soap as a source of Serratia marcescens nosocomial infections (NIs) in hospital units with endemic S marcescens NI and to examine the mechanisms of soap colonization. University-affiliated tertiary-care hospitals. A prospective case-control study and an environmental investigation were performed to assess the relationship between S marcescens NIs in hospital units and S marcescens-contaminated soap. Soap-bottle use and handwashing practices were reviewed. Cultures of healthcare workers' (HCWs) hands were obtained before and after hand washing with soap. 5 of 7 hospital units with S marcescens NIs had soap bottles contaminated with S marcescens, compared to 1 of 14 other units (P=.006). After hand washing with an S marcescens-contaminated soap pump, HCWs' hands were 54 times more likely to be contaminated with S marcescens (Pliquid soap by S marcescens resulted in handborne transmission of S marcescens NIs by HCWs in our setting. This finding led to the application of strict guidelines for nonmedicated soap use and to the reinforcement of alcoholic hand disinfection.

  12. Draft genome sequence of a GES-5-producing Serratia marcescens isolated in southern Brazil

    Directory of Open Access Journals (Sweden)

    Carolina Silva Nodari

    Full Text Available Abstract Serratia marcescens is a Gram-negative rod intrinsically resistant to polymyxins and usually associated with wound, respiratory and urinary tract infections. The whole genome of the first GES-5-producing S. marcescens isolated from a Brazilian patient was sequenced using Ion Torrent PGM System. Besides blaGES-5, we were able to identify genes encoding for other β-lactamases, for aminoglycoside modifying enzymes and for an efflux pump to tetracyclines.

  13. Ozone Sensitivity and Catalase Activity in Pigmented and Non-Pigmented Strains of Serratia Marcescens. (United States)

    de Ondarza, José


    Ozone exposure rapidly leads to bacterial death, making ozone an effective disinfectant in food industry and health care arena. However, microbial defenses may moderate this effect and play a role in the effective use of oxidizing agents for disinfection. Serratia marcescens is an opportunistic pathogen, expressing genes differentially during infection of a human host. A better understanding of regulatory systems that control expression of Serratia 's virulence genes and defenses is therefore valuable. Here, we investigated the role of pigmentation and catalase in Serratia marcescens on survival to ozone exposure. Pigmented and non-pigmented strains of Serratia marcescens were cultured to exponential or stationary phase and exposed to 5 ppm of gaseous ozone for 2.5 - 10 minutes. Survival was calculated via plate counts. Catalase activity was measured photometrically and tolerance to hydrogen peroxide was assayed by disk-diffusion. Exposure of S. marcescens to 5 ppm gaseous ozone kills > 90% of cells within 10 minutes in a time and concentration-dependent manner. Although pigmented Serratia (grown at 28°C) survived ozonation better than unpigmented Serratia (grown at 35°C), non-pigmented mutant strains of Serratia had similar ozone survival rates, catalase activity and H 2 O 2 tolerance as wild type strains. Rather, ozone survival and catalase activity were elevated in 6 hour cultures compared to 48 hour cultures. Our studies did not bear out a role for prodigiosin in ozone survival. Rather, induction of oxidative stress responses during exponential growth increased both catalase activity and ozone survival in both pigmented and unpigmented S. marcescens .

  14. Severe Acute Infection Due to Serratia marcescens Causing Respiratory Distress in An Immunocompetent Adult. (United States)

    Ruiz-Sada, Pablo; Escalante, Mikel; Lizarralde, Eva


    The role of Serratia marcescens changed from a harmless saprophytic microorganism to an important opportunistic human pathogen. It often causes nosocomial device-associated outbreaks and rarely serious invasive community acquired infections. We present a case of a community-acquired Serratia marcescens bacteremia leading to Respiratory Distress Syndrome in a previously healthy 51-year-old man without identifiable risk factors. Full recovery was achieved with solely medical treatment and observation in ICU during three days. To our knowledge it is an extremely uncommon presentation and just few cases have been previously reported in the literature.

  15. Characterization of putative virulence factors of Serratia marcescens strain SEN for pathogenesis in Spodoptera litura. (United States)

    Aggarwal, Chetana; Paul, Sangeeta; Tripathi, Vishwas; Paul, Bishwajeet; Khan, Md Aslam


    Two Serratia marcescens strains, SEN and ICC-4, isolated from diseased insect cadavers were observed to differ considerably in their virulence towards Spodoptera litura. The present study was aimed to characterize the possible virulence factors present in the virulent Serratia marcescens strain SEN. Both the S. marcescens strains were evaluated for the presence of various lytic enzymes such as chitinase, lipase, protease and phospholipase. The virulent S. marcescens strain SEN was observed to possess considerably higher activity of chitinase and protease enzymes; activity of phospholipase enzyme was also higher. Although, all the three toxin genes shlA, phlA and swr could be detected in both the S. marcescens strains, there was a higher expression of these genes in the virulent strain SEN. S. marcescens strain ICC-4 showed greater reduction in overall growth yield in the post-exponential phase in the presence of midgut juice and hemolymph of S. litura larvae, as compared to S. marcescens strain SEN. Proliferation of the S. marcescens strain SEN was also considerably higher in foregut, midgut and hemolymph of S. litura larvae, as compared to strain ICC-4. Peritrophic membrane treated with broth culture of the S. marcescens strain SEN showed higher damage as compared to strain ICC-4. The peritrophic membrane of larvae fed on diet treated with the virulent strain showed considerable damage while the peritrophic membrane of larvae fed on diet treated with the non-virulent strain showed no damage. This is the first report documenting the fate of ingested S. marcescens in S. litura gut and the relative expression of toxin genes from two S. marcescens strains differing in their virulence towards S. litura. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. The red pigment prodigiosin is not an essential virulence factor in entomopathogenic Serratia marcescens. (United States)

    Zhou, Wei; Li, JingHua; Chen, Jie; Liu, XiaoYuan; Xiang, TingTing; Zhang, Lin; Wan, YongJi


    Although pigments produced by pathogenic microbes are generally hypothesized as essential virulence factors, the role of red pigment prodigiosin in the pathogenesis of entomopathogenic Serratia marcescens is not clear. In this study, we analyzed the pathogenicity of different pigmented S. marcescens strains and their non-pigmented mutants in silkworms. Each pigmented strain and the corresponding non-pigmented mutants showed very similar LD50 value (statistically no difference), but caused very different symptom (color of the dead larva). Our results clearly indicated that the red pigment prodigiosin is not an essential virulence factor in entomopathogenic S. marcescens. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Aromatic-Mediated Carbohydrate Recognition in Processive Serratia marcescens Chitinases. (United States)

    Jana, Suvamay; Hamre, Anne Grethe; Wildberger, Patricia; Holen, Matilde Mengkrog; Eijsink, Vincent G H; Beckham, Gregg T; Sørlie, Morten; Payne, Christina M


    Microorganisms use a host of enzymes, including processive glycoside hydrolases, to deconstruct recalcitrant polysaccharides to sugars. Processive glycoside hydrolases closely associate with polymer chains and repeatedly cleave glycosidic linkages without dissociating from the crystalline surface after each hydrolytic step; they are typically the most abundant enzymes in both natural secretomes and industrial cocktails by virtue of their significant hydrolytic potential. The ubiquity of aromatic residues lining the enzyme catalytic tunnels and clefts is a notable feature of processive glycoside hydrolases. We hypothesized that these aromatic residues have uniquely defined roles, such as substrate chain acquisition and binding in the catalytic tunnel, that are defined by their local environment and position relative to the substrate and the catalytic center. Here, we investigated this hypothesis with variants of Serratia marcescens family 18 processive chitinases ChiA and ChiB. We applied molecular simulation and free energy calculations to assess active site dynamics and ligand binding free energies. Isothermal titration calorimetry provided further insight into enthalpic and entropic contributions to ligand binding free energy. Thus, the roles of six aromatic residues, Trp-167, Trp-275, and Phe-396 in ChiA, and Trp-97, Trp-220, and Phe-190 in ChiB, have been examined. We observed that point mutation of the tryptophan residues to alanine results in unfavorable changes in the free energy of binding relative to wild-type. The most drastic effects were observed for residues positioned at the "entrances" of the deep substrate-binding clefts and known to be important for processivity. Interestingly, phenylalanine mutations in ChiA and ChiB had little to no effect on chito-oligomer binding, in accordance with the limited effects of their removal on chitinase functionality.

  18. Necrotizing fasciitis due to Serratia marcescens: case report and review of the literature. (United States)

    Majumdar, Rohit; Crum-Cianflone, Nancy F


    Necrotizing fasciitis is a severe, life-threatening infection.  Serratia marcescens, a Gram-negative bacterium, is an extremely rare cause of necrotizing fasciitis. A case of S. marcescens necrotizing fasciitis is described, and a comprehensive review of the literature (1966-2015) of monomicrobial cases due to this organism performed. We report the first case of S. marcescens necrotizing fasciitis in the setting of calciphylaxis associated with end-stage renal disease.  A comprehensive review of the literature of S. marcescens necrotizing fasciitis is provided to enhance the awareness of this increasingly recognized infection, and to provide a concise summary of risk factors, treatment, and outcome. Our case and review highlight the potential risk factors for S. marcescens necrotizing fasciitis, including underlying renal disease and open wounds, and demonstrate the emergence of this organism as a cause of severe, life-threatening soft tissue infections.

  19. Production of vanillic acid from vanillin by resting cells of Serratia marcescens. (United States)

    Perestelo, F; Dalcón, M A; de la Fuente, G


    Resting-cell suspensions of Serratia marcescens were able to convert, quantitatively, 0.3% vanillin to vanillic acid. The vanillic acid-producing activity reached a maximum after 28 h of incubation with 0.01% vanillin as an inducer. PMID:2669632

  20. Production of vanillic acid from vanillin by resting cells of Serratia marcescens.


    Perestelo, F; Dalcón, M A; de la Fuente, G


    Resting-cell suspensions of Serratia marcescens were able to convert, quantitatively, 0.3% vanillin to vanillic acid. The vanillic acid-producing activity reached a maximum after 28 h of incubation with 0.01% vanillin as an inducer.

  1. Phenotypic Diversification and Adaptation of Serratia marcescens MG1 Biofilm-Derived Morphotypes

    DEFF Research Database (Denmark)

    Koh, Kai Shyang; Lam, Kin Wai; Alhede, Morten


    We report here the characterization of dispersal variants from microcolony-type biofilms of Serratia marcescens MG1. Biofilm formation proceeds through a reproducible process of attachment, aggregation, microcolony development, hollow colony formation, and dispersal. From the time when hollow col...

  2. Stabilization of a chitinase from Serratia marcescens by Gly-->Ala and Xxx-->Pro mutations.

    NARCIS (Netherlands)

    Gaseidnes, S.; Synstad, B.; Jia, X.; Kjellesvik, H.; Vriend, G.; Eijsink, V.G.


    This paper describes attempts to increase the kinetic stability of chitinase B from Serratia marcescens (ChiB) by the introduction of semi-automatically designed rigidifying mutations of the Gly-->Ala and Xxx-->Pro type. Of 15 single mutants, several displayed significant increases in thermal

  3. Effect of iron and salt on prodigiosin synthesis in Serratia marcescens. (United States)

    Silverman, M. P.; Munoz, E. F.


    Iron requirements of Serratia marcescens for growth and prodigiosin synthesis are investigated. Sodium chloride of sea salt is shown to be responsible for inhibition of prodigiosin synthesis in the microorganism. The role of sodium chloride in the terminal biosynthetic pathway of the pigment is discussed.

  4. A strain of Serratia marcescens pathogenic for larvae of Lymantria dispar: Infectivity and mechanisms of pathogenicity (United States)

    J.D. Podgwaite; B.J. Cosenza


    The ED50 of a strain of Serratia marcescens for microinjected instar III and IV gypsy moth larvae was 7.5 and 14.5 viable cells, respectively. Percentage and rate of mortality were found to be highly variable among replicates of the same instar and between instars in free-feeding bioassays. Mortality in second instar larvae...

  5. The Use of Crude Shrimp Shell Powder for Chitinase Production by Serratia marcescens WF

    Directory of Open Access Journals (Sweden)

    Jesús E. Mejía-Saulés


    Full Text Available From 102 Serratia marcescens strains screened, 57 strains showed chitinase activity and Serratia marcescens WF showed the highest chitinolytic activity so this strain was selected for further study on the use of crude shrimp waste for chitinase production. The concentration of crude shrimp shell content at 10–70 g/L, incubation temperature of 28–37 °C, pH=6–9, and time 24–96 h on kinetics of chitinase production by S. marcescens WF were evaluated. The maximal chitinase production related to process variables was obtained with the second order polynomial model: dry shrimp shell powder at 6 %, pH=6.5, temperature of 28 °C during fermentation for up to 72 h.

  6. Necrotizing cellulitis with multiple abscesses on the leg caused by Serratia marcescens. (United States)

    Hau, Estelle; Bouaziz, Jean-David; Lafaurie, Matthieu; Saussine, Anne; Masson, Vincent; Rausky, Jonathan; Bagot, Martine; Guibal, Fabien


    Serratia marcescens is an unusual cause of severe skin infection initially described in immunocompromised patients. We report a case of necrotizing cellulitis of the leg caused by S marcescens in a 68-year-old woman with diabetes mellitus and a history of chronic lymphoedema of the leg. We reviewed the literature and found 49 cases of severe skin infections from S marcescens that included 20 cases of necrotizing fasciitis (NF) as well as 29 cases of severe skin infections without NF (non-NF cases). Patients were immunocompromised in 59% to 70% of cases. The mortality rate was high in NF cases (60%) versus non-NF cases (3%). Surgery was required in 95% of NF cases and in 24% of non-NF cases. The other clinical manifestations of S marcescens skin infection reported in the literature included disseminated papular eruptions in patients infected with human immunodeficiency virus with folliculitis on the trunk. Serratia marcescens is naturally resistant to amoxicillin alone and amoxicillin associated with clavulanic acid. Broad-spectrum antibiotics are indicated to treat S marcescens skin infections, and surgery should be promptly considered in cases of severe skin infections if appropriate antibiotic therapy does not lead to rapid improvement.

  7. Imipenem-resistance in Serratia marcescens is mediated by plasmid expression of KPC-2. (United States)

    Su, W-Q; Zhu, Y-Q; Deng, N-M; Li, L


    Imipenem is a broad-spectrum carbapenem antibiotic with applications against severe bacterial infections. Here, we describe the identification of imipenem-resistant Serratia marcescens in our hospital and the role of plasmid-mediated KPC-2 expression in imipenem resistance. We used the modified Hodge test to detect carbapenemase produced in imipenem-resistant strains. His resistance can be transferred to E. coli in co-culture tests, which implicates the plasmid in imipenem resistance. PCR amplification from the plasmid identified two products consistent with KPC-2 of 583 and 1050 bp that were also present in E. coli after co-culture. The restriction pattern for both plasmids was identical, supporting the transfer from the S. marcescens isolate to E. coli. Finally, gene sequencing confirmed KPC-2 in the plasmid. Due to the presence of KPC-2 in the imipenem-resistant S. marcescens, we propose that KPC-2 mediates antibiotic resistance in the S. marcescens isolate.

  8. Inhibition of quorum sensing-mediated virulence in Serratia marcescens by Bacillus subtilis R-18. (United States)

    Devi, Kannan Rama; Srinivasan, Subramaniyan; Ravi, Arumugam Veera


    Serratia marcescens is an opportunistic human pathogen causing various nosocomial infections, most importantly urinary tract infections (UTIs). It exhibits increased resistance towards the conventional antibiotics. This study was aimed to evaluate the anti-virulence effect of a rhizosphere soil bacterium Bacillus subtilis strain R-18 against the uropathogen S. marcescens. First, the bacterial cell-free culture supernatant (CFCS) of B. subtilis strain R-18 was evaluated for its quorum sensing inhibitory (QSI) potential against biomarker strain Chromobacterium violaceum and the test pathogen S. marcescens. The B. subtilis R-18 CFCS effectively inhibited the quorum sensing (QS)-mediated violacein pigment production in C. violaceum and prodigiosin pigment production in S. marcescens. Furthermore, B. subtilis R-18 CFCS was successively extracted with different solvent systems. Of these solvents, B. subtilis R-18 petroleum ether (PE) extract showed inhibition in biofilm formation, protease, lipase, and hemolysin productions in S. marcescens. Fourier transform infrared spectroscopic (FT-IR) analysis revealed the alterations in the cellular components of bacterial cell pellets obtained from B. subtilis R-18 PE extract treated and untreated S. marcescens. The differential gene expression study further validated the downregulation of virulence-associated genes. Characterization of the active principle in B. subtilis R-18 PE extract by gas chromatography-mass spectrometry (GC-MS) analysis showed the presence of multiple compounds with therapeutic values, which could possibly reduce the QS-dependent phenotypes in S. marcescens. Copyright © 2018. Published by Elsevier Ltd.

  9. Mechanisms of Bacterial (Serratia marcescens) Attachment to, Migration along, and Killing of Fungal Hyphae. (United States)

    Hover, Tal; Maya, Tal; Ron, Sapir; Sandovsky, Hani; Shadkchan, Yana; Kijner, Nitzan; Mitiagin, Yulia; Fichtman, Boris; Harel, Amnon; Shanks, Robert M Q; Bruna, Roberto E; García-Véscovi, Eleonora; Osherov, Nir


    We have found a remarkable capacity for the ubiquitous Gram-negative rod bacterium Serratia marcescens to migrate along and kill the mycelia of zygomycete molds. This migration was restricted to zygomycete molds and several basidiomycete species. No migration was seen on any molds of the phylum Ascomycota. S. marcescens migration did not require fungal viability or surrounding growth medium, as bacteria migrated along aerial hyphae as well.S. marcescens did not exhibit growth tropism toward zygomycete mycelium. Bacterial migration along hyphae proceeded only when the hyphae grew into the bacterial colony. S. marcescens cells initially migrated along the hyphae, forming attached microcolonies that grew and coalesced to generate a biofilm that covered and killed the mycelium. Flagellum-defective strains of S. marcescens were able to migrate along zygomycete hyphae, although they were significantly slower than the wild-type strain and were delayed in fungal killing. Bacterial attachment to the mycelium does not necessitate type 1 fimbrial adhesion, since mutants defective in this adhesin migrated equally well as or faster than the wild-type strain. Killing does not depend on the secretion of S. marcescens chitinases, as mutants in which all three chitinase genes were deleted retained wild-type killing abilities. A better understanding of the mechanisms by which S. marcescens binds to, spreads on, and kills fungal hyphae might serve as an excellent model system for such interactions in general; fungal killing could be employed in agricultural fungal biocontrol. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  10. ManA is regulated by RssAB signaling and promotes motility in Serratia marcescens. (United States)

    Soo, Po-Chi; Horng, Yu-Tze; Chang, Yung-Lin; Tsai, Wei-Wen; Jeng, Wen-Yih; Lu, Chia-Chen; Lai, Hsin-Chih


    Serratia marcescens swarms on 0.8% LB agar at 30 °C but not at 37 °C. To understand the molecular mechanism regulating Serratia swarming, transposon mutagenesis was performed to screen for mutants that swarmed at 37 °C. In one mutant, S. marcescens WW100, the transposon was inserted in the upstream region of manA, which encodes mannose-6-phosphate isomerase, a type I phosphomannose isomerase. The transcriptional and translational levels of manA were higher in S. marcescens WW100 than in the wild-type strain. S. marcescens WW100 produced more serrawettin W1 (biosurfactant) than the wild-type, as detected by thin-layer chromatography, to promote surface motility by reducing surface tension. Serratia swarming was previously shown to be negatively regulated by the RssA-RssB two-component system. An electrophoretic mobility shift assay (EMSA) indicated that phosphorylated RssB (the response regulator) binds upstream of the transposon insertion site and manA in S. marcescens WW100. Analysis by real-time RT-PCR (qRT-PCR) revealed that, compared to the wild-type level, manA mRNA was increased in the rssA deletion mutant. The results indicated that RssA-RssB signaling directly represses the expression of manA and that overexpression of manA increases the production of serrawettin for Serratia swarming at 37 °C. Copyright © 2013 Institut Pasteur. All rights reserved.

  11. Capsule Production and Glucose Metabolism Dictate Fitness during Serratia marcescens Bacteremia. (United States)

    Anderson, Mark T; Mitchell, Lindsay A; Zhao, Lili; Mobley, Harry L T


    Serratia marcescens is an opportunistic pathogen that causes a range of human infections, including bacteremia, keratitis, wound infections, and urinary tract infections. Compared to other members of the Enterobacteriaceae family, the genetic factors that facilitate Serratia proliferation within the mammalian host are less well defined. An in vivo screen of transposon insertion mutants identified 212 S. marcescens fitness genes that contribute to bacterial survival in a murine model of bloodstream infection. Among those identified, 11 genes were located within an 18-gene cluster encoding predicted extracellular polysaccharide biosynthesis proteins. A mutation in the wzx gene contained within this locus conferred a loss of fitness in competition infections with the wild-type strain and a reduction in extracellular uronic acids correlating with capsule loss. A second gene, pgm , encoding a phosphoglucomutase exhibited similar capsule-deficient phenotypes, linking central glucose metabolism with capsule production and fitness of Serratia during mammalian infection. Further evidence of the importance of central metabolism was obtained with a pfkA glycolytic mutant that demonstrated reduced replication in human serum and during murine infection. An MgtB magnesium transporter homolog was also among the fitness factors identified, and an S. marcescens mgtB mutant exhibited decreased growth in defined medium containing low concentrations of magnesium and was outcompeted ~10-fold by wild-type bacteria in mice. Together, these newly identified genes provide a more complete understanding of the specific requirements for S. marcescens survival in the mammalian host and provide a framework for further investigation of the means by which S. marcescens causes opportunistic infections. IMPORTANCE Serratia marcescens is a remarkably prolific organism that replicates in diverse environments, including as an opportunistic pathogen in human bacteremia. The genetic requirements for

  12. Draft genome sequence of a GES-5-producing Serratia marcescens isolated in southern Brazil. (United States)

    Nodari, Carolina Silva; Siebert, Marina; Matte, Ursula da Silveira; Barth, Afonso Luís

    Serratia marcescens is a Gram-negative rod intrinsically resistant to polymyxins and usually associated with wound, respiratory and urinary tract infections. The whole genome of the first GES-5-producing S. marcescens isolated from a Brazilian patient was sequenced using Ion Torrent PGM System. Besides bla GES-5 , we were able to identify genes encoding for other β-lactamases, for aminoglycoside modifying enzymes and for an efflux pump to tetracyclines. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  13. The role of outer membrane in Serratia marcescens intrinsic resistance to antibiotics. (United States)

    Sánchez, L; Ruiz, N; Leranoz, S; Viñas, M; Puig, M


    Three different porins from Serratia marcescens were described. They were named Omp1, Omp2 and Omp3 and their molecular weights were 42, 40 and 39 kDa respectively. Omp2 and Omp3 showed osmoregulation and thermoregulation in a similar way to OmpC and OmpF of Escherichia coli. Permeability coefficients of the outer membrane of this species were calculated following the Zimmermann and Rosselet method. P values were similar to those obtained in Escherichia coli, which suggests that the chromosomal beta-lactamase would play a major role in the resistance of Serratia marcescens to beta-lactam antibiotics. Both MIC values and permeabilities were modified by salycilates and acetylsalycilate. Synergism between the outer membrane and the beta-lactamase was also evaluated. When bacteria grew in the presence of a beta-lactam in the medium, the beta-lactamase accounted for most of the resistance.

  14. Enhancement of virulence of bacillus thuringiensis and serratia marcescens by chemicals

    International Nuclear Information System (INIS)

    Khan, K. A.


    Studies were conducted on the enhancement of pathogenicity of Bacillus thuringiensis by 1% boric acid against various species of termites. The increase in virulence of Serratia marcescens by 1% potassium chloride or 1% Sodium citrate against the workers of M. championi has also been established. The increase in virulence is confirmed by the enhancement ratio, which are ranging from about 1.5 to 1.8 for Bacillus thuringiensis and 1.3 to 1.6 for Serratia marcescens. It was also noted that 1% boric acid alone was found toxic to various species of termites. However, Potassium chloride and Sodium citrate in a concentration of 1% were non-toxic to the workers of M. championi. (author)

  15. Intra-specific diversity of Serratia marcescens in Anopheles mosquito midgut defines Plasmodium transmission capacity (United States)

    Bando, Hironori; Okado, Kiyoshi; Guelbeogo, Wamdaogo M.; Badolo, Athanase; Aonuma, Hiroka; Nelson, Bryce; Fukumoto, Shinya; Xuan, Xuenan; Sagnon, N'Fale; Kanuka, Hirotaka


    A critical stage in malaria transmission occurs in the Anopheles mosquito midgut, when the malaria parasite, Plasmodium, ingested with blood, first makes contact with the gut epithelial surface. To understand the response mechanisms within the midgut environment, including those influenced by resident microbiota against Plasmodium, we focus on a midgut bacteria species' intra-specific variation that confers diversity to the mosquito's competency for malaria transmission. Serratia marcescens isolated from either laboratory-reared mosquitoes or wild populations in Burkina Faso shows great phenotypic variation in its cellular and structural features. Importantly, this variation is directly correlated with its ability to inhibit Plasmodium development within the mosquito midgut. Furthermore, this anti-Plasmodium function conferred by Serratia marcescens requires increased expression of the flagellum biosynthetic pathway that is modulated by the motility master regulatory operon, flhDC. These findings point to new strategies for controlling malaria through genetic manipulation of midgut bacteria within the mosquito. PMID:23571408

  16. Phosphate limitation induces the intergeneric inhibition of Pseudomonas aeruginosa by Serratia marcescens isolated from paper machines (United States)

    Kuo, Pei-An; Kuo, Chih-Horng; Lai, Yiu-Kay; Graumann, Peter L; Tu, Jenn


    Phosphate is an essential nutrient for heterotrophic bacteria, affecting bacterioplankton in aquatic ecosystems and bacteria in biofilms. However, the influence of phosphate limitation on bacterial competition and biofilm development in multispecies populations has received limited attention in existing studies. To address this issue, we isolated 13 adhesive bacteria from paper machine aggregates. Intergeneric inhibition of Pseudomonas aeruginosa WW5 by Serratia marcescens WW4 was identified under phosphate-limited conditions, but not in Luria–Bertani medium or M9 minimal medium. The viable numbers of the pure S. marcescens WW4 culture decreased over 3 days in the phosphate-limited medium; however, the mortality of S. marcescens WW4 was significantly reduced when it was co-cultured with P. aeruginosa WW5, which appeared to sustain the S. marcescens WW4 biofilm. In contrast, viable P. aeruginosa WW5 cells immediately declined in the phosphate-limited co-culture. To identify the genetic/inhibitory element(s) involved in this process, we inserted a mini-Tn5 mutant of S. marcescens WW4 that lacked inhibitory effect. The results showed that an endonuclease bacteriocin was involved in this intergeneric inhibition by S. marcescens WW4 under phosphate limitation. In conclusion, this study highlights the importance of nutrient limitation in bacterial interactions and provides a strong candidate gene for future functional characterisation. PMID:23398522

  17. Response Mechanisms in Serratia marcescens IBBPo15 During Organic Solvents Exposure. (United States)

    Stancu, Mihaela Marilena


    Serratia marcescens strain IBB Po15 (KT315653) which possesses serratiopeptidase (ser) gene (KT894207) exhibited good solvent tolerance. During the exposure of S. marcescens IBB Po15 cells to 5 % organic solvents, n-decane was less toxic for this bacterium, compared with n-hexane, cyclohexane, ethylbenzene, toluene, and styrene. The exposure of the S. marcescens IBB Po15 cells to n-hexane, cyclohexane, ethylbenzene, toluene, and styrene induced the formation of large clusters, while in control and n-decane-exposed cells, only organization into small clusters was observed. The data obtained suggested that S. marcescens IBB Po15 cells produced some secondary metabolites (i.e., surfactant serrawettin, red pigment prodigiosin) which are well known as valuable molecules due to their large applications. The exposure of the bacterial cells to organic solvents induced secondary metabolites profile modifications. However, S. marcescens IBB Po15 possesses only alkB1, todM, rhlAB, pswP, mpr, and ser genes, the unspecific amplification of other fragments being acquired also when the primers for alkM1, xylM, ndoM, and C23DO genes were used. Modifications of DNA patterns were not depicted in S. marcescens IBB Po15 cells exposed to organic solvents.

  18. A six-month Serratia marcescens outbreak in a Neonatal Intensive Care Unit. (United States)

    Morillo, Áurea; González, Verónica; Aguayo, Josefa; Carreño, Concepción; Torres, María José; Jarana, Daniel; Artacho, María José; Jiménez, Francisco; Conde, Manuel; Aznar, Javier


    To investigate a Serratia marcescens (S. marcescens) outbreak in a Neonatal Unit in a tertiary university hospital. Descriptive study of children admitted to the Unit with S. marcescens infection from November 2012 to March 2013. Conventional microbiological methods for clinical and environmental samples were used. The clonal relationship between all available isolates was established by molecular methods. A multidisciplinary team was formed, and preventive measures were taken. S. marcescens was isolated from 18 children. The overall attack rate was 12%, and the case fatality rate in the Intensive Care Unit was 23.5%. The most prevalent types of infections were pneumonia (6), conjunctivitis (6), and bloodstream infection (5). Clinical isolates and environmental isolates obtained from an incubator belonged to a unique clone. The clonal relationship between all S. marcescens strains helped us to identify the possible source of the outbreak. Isolation of S. marcescens from stored water in a container, and from the surface of an incubator after cleaning, suggests a possible environmental source as the outbreak origin, which has been perpetuated due to a failure of cleaning methods in the Unit. The strict hygiene and cleaning measures were the main factors that contributed to the end of the outbreak. Copyright © 2016 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  19. Outbreak of Serratia marcescens postsurgical bloodstream infection due to contaminated intravenous pain control fluids. (United States)

    Chiang, Ping-Cherng; Wu, Tsu-Lan; Kuo, An-Jing; Huang, Yhu-Chering; Chung, Ting-Ying; Lin, Chun-Sui; Leu, Hsieh-Shong; Su, Lin-Hui


    Serratia marcescens is an important nosocomial pathogen causing significant outbreaks. Here we report an outbreak of bloodstream infection caused by S. marcescens at a 3500-bed hospital in Taiwan. The effective cooperative efforts of both laboratory personnel and infection control practitioners (ICPs) jointly contributed to the total control of the outbreak. A sudden increase in the isolation of S. marcescens from blood cultures was noted in the Clinical Microbiology Laboratory. The information was passed to the ICPs and an investigation was initiated. Pulsed-field gel electrophoresis was used to study the relationships among the isolates. Pulsotype A was identified in 43 (82.7%) of the 52 blood isolates studied. They were isolated from 52 patients distributed across 22 wards that were surveyed by seven ICPs. All patients had undergone surgery before the infection, and fentanyl-containing intravenous fluids were used for pain control in 43 of them. Isolates from 42 belonged to pulsotype A. Three S. marcescens isolates, all from fentanyl-containing fluids and demonstrating pulsotype A, were identified from 251 environmental cultures. All fentanyl-containing fluids that were in use were withdrawn and the outbreak was stopped. The outbreak of S. marcescens bloodstream infection apparently occurred through the use of fentanyl-containing fluids contaminated by a pulsotype A S. marcescens. Copyright © 2013 International Society for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  20. Capsule Production and Glucose Metabolism Dictate Fitness during Serratia marcescens Bacteremia

    Directory of Open Access Journals (Sweden)

    Mark T. Anderson


    Full Text Available Serratia marcescens is an opportunistic pathogen that causes a range of human infections, including bacteremia, keratitis, wound infections, and urinary tract infections. Compared to other members of the Enterobacteriaceae family, the genetic factors that facilitate Serratia proliferation within the mammalian host are less well defined. An in vivo screen of transposon insertion mutants identified 212 S. marcescens fitness genes that contribute to bacterial survival in a murine model of bloodstream infection. Among those identified, 11 genes were located within an 18-gene cluster encoding predicted extracellular polysaccharide biosynthesis proteins. A mutation in the wzx gene contained within this locus conferred a loss of fitness in competition infections with the wild-type strain and a reduction in extracellular uronic acids correlating with capsule loss. A second gene, pgm, encoding a phosphoglucomutase exhibited similar capsule-deficient phenotypes, linking central glucose metabolism with capsule production and fitness of Serratia during mammalian infection. Further evidence of the importance of central metabolism was obtained with a pfkA glycolytic mutant that demonstrated reduced replication in human serum and during murine infection. An MgtB magnesium transporter homolog was also among the fitness factors identified, and an S. marcescens mgtB mutant exhibited decreased growth in defined medium containing low concentrations of magnesium and was outcompeted ~10-fold by wild-type bacteria in mice. Together, these newly identified genes provide a more complete understanding of the specific requirements for S. marcescens survival in the mammalian host and provide a framework for further investigation of the means by which S. marcescens causes opportunistic infections.

  1. Sepsis and Hemocyte Loss in Honey Bees (Apis mellifera) Infected with Serratia marcescens Strain Sicaria. (United States)

    Burritt, Nancy L; Foss, Nicole J; Neeno-Eckwall, Eric C; Church, James O; Hilger, Anna M; Hildebrand, Jacob A; Warshauer, David M; Perna, Nicole T; Burritt, James B


    Global loss of honey bee colonies is threatening the human food supply. Diverse pathogens reduce honey bee hardiness needed to sustain colonies, especially in winter. We isolated a free-living Gram negative bacillus from hemolymph of worker honey bees (Apis mellifera) found separated from winter clusters. In some hives, greater than 90% of the dying bees detached from the winter cluster were found to contain this bacterium in their hemolymph. Throughout the year, the same organism was rarely found in bees engaged in normal hive activities, but was detected in about half of Varroa destructor mites obtained from colonies that housed the septic bees. Flow cytometry of hemolymph from septic bees showed a significant reduction of plasmatocytes and other types of hemocytes. Interpretation of the16S rRNA sequence of the bacterium indicated that it belongs to the Serratia genus of Gram-negative Gammaproteobacteria, which has not previously been implicated as a pathogen of adult honey bees. Complete genome sequence analysis of the bacterium supported its classification as a novel strain of Serratia marcescens, which was designated as S. marcescens strain sicaria (Ss1). When compared with other strains of S. marcescens, Ss1 demonstrated several phenotypic and genetic differences, including 65 genes not previously found in other Serratia genomes. Some of the unique genes we identified in Ss1 were related to those from bacterial insect pathogens and commensals. Recovery of this organism extends a complex pathosphere of agents which may contribute to failure of honey bee colonies.

  2. Optimization of prodigiosin production by Serratia marcescens using crude glycerol and enhancing production using gamma radiation

    Directory of Open Access Journals (Sweden)

    Nora M. Elkenawy


    Full Text Available Prodigiosin is a red pigment produced by Serratia marcescens. Prodigiosin is regarded as a promising drug owing to its reported characteristics of possessing anti-microbial, anti-cancer, and immunosuppressive activity. A factorial design was applied to generate a set of 32 experimental combinations to study the optimal conditions for pigment production using crude glycerol obtained from local biodiesel facility as carbon source for the growth of Serratia marcescens. The maximum production (870 unit/cell was achieved at 22 °C, at pH 9 with the addition of 1% (w/v peptone and 109 cell/ml inoculum size after 6 days of incubation. Gamma radiation at dose 200 Gy was capable of doubling the production of the pigment using the optimized conditions and manipulating production temperature. Our results indicate that we have designed an economic medium supporting enhanced Serratia marcescens MN5 prodigiosin production giving an added value for crude glycerol obtained from biodiesel industry.

  3. Sepsis and Hemocyte Loss in Honey Bees (Apis mellifera) Infected with Serratia marcescens Strain Sicaria (United States)

    Burritt, Nancy L.; Foss, Nicole J.; Neeno-Eckwall, Eric C.; Church, James O.; Hildebrand, Jacob A.; Warshauer, David M.; Perna, Nicole T.; Burritt, James B.


    Global loss of honey bee colonies is threatening the human food supply. Diverse pathogens reduce honey bee hardiness needed to sustain colonies, especially in winter. We isolated a free-living Gram negative bacillus from hemolymph of worker honey bees (Apis mellifera) found separated from winter clusters. In some hives, greater than 90% of the dying bees detached from the winter cluster were found to contain this bacterium in their hemolymph. Throughout the year, the same organism was rarely found in bees engaged in normal hive activities, but was detected in about half of Varroa destructor mites obtained from colonies that housed the septic bees. Flow cytometry of hemolymph from septic bees showed a significant reduction of plasmatocytes and other types of hemocytes. Interpretation of the16S rRNA sequence of the bacterium indicated that it belongs to the Serratia genus of Gram-negative Gammaproteobacteria, which has not previously been implicated as a pathogen of adult honey bees. Complete genome sequence analysis of the bacterium supported its classification as a novel strain of Serratia marcescens, which was designated as S. marcescens strain sicaria (Ss1). When compared with other strains of S. marcescens, Ss1 demonstrated several phenotypic and genetic differences, including 65 genes not previously found in other Serratia genomes. Some of the unique genes we identified in Ss1 were related to those from bacterial insect pathogens and commensals. Recovery of this organism extends a complex pathosphere of agents which may contribute to failure of honey bee colonies. PMID:28002470

  4. Emergence of Serratia marcescens isolates possessing carbapenem-hydrolysing β-lactamase KPC-2 from China. (United States)

    Lin, X; Hu, Q; Zhang, R; Hu, Y; Xu, X; Lv, H


    Eighty-three carbapenem-resistant Serratia marcescens isolates were recovered from Zhejiang Provincial People's Hospital, China. The minimum inhibitory concentrations of imipenem, meropenem, and ertapenem for all isolates were 2 to >128 μg/mL. Polymerase chain reaction indicated that 63 S. marcescens isolates produced Klebsiella pneumoniae carbapenemase (KPC)-2. Clone A (15 isolates) and clone B (41 isolates) were the two dominant clones and clone A strains were gradually replaced by clone B strains between 2011 and 2014. The results indicate that blaKPC-2-positive S. marcescens emerged in our hospital as the major mechanism of carbapenem resistance. Copyright © 2016 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

  5. Severe necrotizing myocarditis caused by serratia marcescens infection in an axolotl (Ambystoma mexicanum). (United States)

    Del-Pozo, J; Girling, S; Pizzi, R; Mancinelli, E; Else, R W


    This report provides the first account of the pathological changes associated with infection by Serratia marcescens in an adult male axolotl. The infection resulted in septicaemia with severe multifocal necrotizing myocarditis. The latter lesion evolved to cardiac rupture, haemopericardium and death resulting from cardiac tamponade. This animal was exposed to higher than usual temperatures (24-25 °C) 2 weeks before the onset of disease and this may have resulted in immunocompromise and opportunistic bacterial infection. S. marcescens was isolated from the coelomic and pericardial cavity. Both isolates were identical and were resistant to β-lactam antibiotics, but not to aminoglycosides or fluoroquinolones. The production of red prodigiosin pigment by the bacterium suggested an environmental origin. Overall, the clinical and histopathological presentation suggests that S. marcescens should be included in the list of aetiological agents of the 'red-leg'/bacterial dermatosepticaemia syndrome of amphibians. Copyright © 2010 Elsevier Ltd. All rights reserved.

  6. Oxidation of dibenzothiophene (DBT by Serratia marcescens UCP 1549 formed biphenyl as final product

    Directory of Open Access Journals (Sweden)

    de Araújo Hélvia W


    Full Text Available Abstract Background The desulphurization of dibenzothiophene (DBT, a recalcitrant thiophenic fossil fuel component by Serratia marcescens (UCP 1549 in order for reducing the Sulphur content was investigated. The Study was carried out establishing the growth profile using Luria Bertani medium to different concentrations of DBT during 120 hours at 28°C, and orbital Shaker at 150 rpm. Results The results indicated that concentrations of DBT 0.5, 1.0 and 2.0 mM do not affected the growth of the bacterium. The DBT showed similar Minimum Inhibitory Concentration (MIC and Minimum Bactericidal Concentration (MCB (3.68 mM. The desulphurization of DBT by S. marcescens was used with 96 hours of growth on 2 mM of DBT, and was determined by gas chromatography (GC and GC-mass spectrometry. In order to study the desulphurization process by S. marcescens was observed the presence of a sulfur-free product at 16 hours of cultivation. Conclusions The data suggests the use of metabolic pathway “4S” by S. marcescens (UCP 1549 and formed biphenyl. The microbial desulphurization process by Serratia can be suggest significant reducing sulphur content in DBT, and showed promising potential for reduction of the sulfur content in diesel oil.

  7. In vitro synergistic effects of fisetin and norfloxacin against aquatic isolates of Serratia marcescens. (United States)

    Dong, Jing; Ruan, Jing; Xu, Ning; Yang, Yibin; Ai, Xiaohui


    Serratia marcescens is a common pathogenic bacterium that can cause infections in both humans and animals. It can cause a range of diseases, from slight wound infections to life-threatening bacteraemia and pneumonia. The emergence of antimicrobial resistance has limited the treatment of the diseases caused by the bacterium to a great extent. Consequently, there is an urgent need to develop novel antimicrobial strategies against this pathogen. Synergistic strategy is a new approach to treat the infections caused by drug-resistant bacteria. In this paper, we isolated and identified the first multi-resistant pathogenic Serratia marcescens strain from diseased soft-shelled turtles (Pelodiscus sinensis) in China. We then performed a checkerboard assay; the results showed that out of 10 tested natural products fisetin had synergistic effects against S. marcescens when combined with norfloxacin. The time-kill curve assay further confirmed the results of the checkerboard assay. We found that this novel synergistic effect could significantly reduce the dosage of norfloxacin against S. marcescens. © FEMS 2015. All rights reserved. For permissions, please e-mail:

  8. The Opportunistic Pathogen Serratia marcescens Utilizes Type VI Secretion To Target Bacterial Competitors ▿† (United States)

    Murdoch, Sarah L.; Trunk, Katharina; English, Grant; Fritsch, Maximilian J.; Pourkarimi, Ehsan; Coulthurst, Sarah J.


    The type VI secretion system (T6SS) is the most recently described and least understood of the protein secretion systems of Gram-negative bacteria. It is widely distributed and has been implicated in the virulence of various pathogens, but its mechanism and exact mode of action remain to be defined. Additionally there have been several very recent reports that some T6SSs can target bacteria rather than eukaryotic cells. Serratia marcescens is an opportunistic enteric pathogen, a class of bacteria responsible for a significant proportion of hospital-acquired infections. We describe the identification of a functional T6SS in S. marcescens strain Db10, the first report of type VI secretion by an opportunist enteric bacterium. The T6SS of S. marcescens Db10 is active, with secretion of Hcp to the culture medium readily detected, and is expressed constitutively under normal growth conditions from a large transcriptional unit. Expression of the T6SS genes did not appear to be dependent on the integrity of the T6SS. The S. marcescens Db10 T6SS is not required for virulence in three nonmammalian virulence models. It does, however, exhibit dramatic antibacterial killing activity against several other bacterial species and is required for S. marcescens to persist in a mixed culture with another opportunist pathogen, Enterobacter cloacae. Importantly, this antibacterial killing activity is highly strain specific, with the S. marcescens Db10 T6SS being highly effective against another strain of S. marcescens with a very similar and active T6SS. We conclude that type VI secretion plays a crucial role in the competitiveness, and thus indirectly the virulence, of S. marcescens and other opportunistic bacterial pathogens. PMID:21890705

  9. Optimized production of Serratia marcescens B742 mutants for preparing chitin from shrimp shells powders. (United States)

    Zhang, Hongcai; Fang, Jiyang; Deng, Yun; Zhao, Yanyun


    To improve the deproteinization (DP) efficacy of shrimp shell powders (SSP) for preparing chitin, Serratia marcescens B742 mutants were prepared using 2% diethyl sulfate (DES), UV-irradiation, and/or microwave heating treatments. Both single-stage and multi-stage mutations were investigated for optimizing S. marcescens B742 mutation conditions. Under the optimized mutation conditions (2% DES treatment for 30min plus successive 20min UV-irradiation), the protease and chitosanase activity produced by mutant S. marcescens B742 was 240.15 and 170.6mU/mL, respectively, as compared with 212.58±1.51 and 83.75±6.51mU/mL, respectively, by wild S. marcescens B742. DP efficacy of SSP by mutant S. marcescens B742 reached 91.4±4.6% after 3d of submerged fermentation instead of 83.4±4.7% from the wild S. marcescens B742 after 4d of submerged fermentation. Molecular mass of chitosanase and protease was 41.20 and 47.10kDa, respectively, and both enzymes were verified by mass spectrometry analysis. The chitosanase from both wild and mutant S. marcescens B742 was activated by sodium dodecyl sulfate (SDS), Tween 20, Tween 40, and Triton-100, and the protease and chitosanase were strongly inhibited by ethylenediaminetetraacetic acid (EDTA). These results suggested that S. marcescens B742 mutants can be used in the biological production of chitin through deproteinization of SSP. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Community-Acquired Serratia Marcescens Spinal Epidural Abscess in a Patient Without Risk Factors: Case Report and Review

    Directory of Open Access Journals (Sweden)

    Michael D Parkins


    Full Text Available Serratia marcescens has rarely been reported as an agent of invasive disease in patients presenting from the community. Furthermore, S marcescens is frequently opportunistic, affecting individuals with serious medical comorbidities including immune suppression and diabetes. A case of a community-acquired S marcescens spontaneous lumbar epidural abscess presenting as cauda equina syndrome is reported in a previously well 36-year-old man with no identifiable risk factors. To the authors’ knowledge, this is the first report of invasive S marcescens causing disease in a patient with no medical comorbidities.

  11. Application of the BIOLOG system for characterization of Serratia marcescens ss marcescens isolated from onsite wastewater technology (OSWT). (United States)

    Chojniak, Joanna; Jałowiecki, Łukasz; Dorgeloh, Elmar; Hegedusova, Berta; Ejhed, Helene; Magnér, Jörgen; Płaza, Grażyna


    The scope of this study was to apply the Biolog system to identify and characterize a Serratia strain isolated from the surface of black plastic pieces which constitute the fluidized bed filter (onsite wastewater technology, OSWT). The preliminary isolation of the strain was done in the medium with tetracycline at a 16 mg/l concentration. To characterize the isolated strain, the following Biolog methods were applied: (1) EcoPlates microplates for evaluation of physiological profiling, (2) GEN III OmniLog® ID System for identification of the isolate, and (3) phenotypic microarrays (PM) technology for evaluation of sensitivity to antibiotics (PM11 and PM12). Results were recorded using the original OmniLog® software. The Serratia strain was identified as Serratia marcescens ss marcescens with similarity index 0.569. The same identification was obtained by the 16S rDNA analysis. PM analysis showed an enhancement of phenotype (resistance or growth) of this strain to 35 antibiotics. The loss of phenotype (sensitivity or non-growth) was observed only for 5 antibiotics: lomefloxacin (0.4 µg/ml), enoxacin (0.9 µg/ml), nalidixic acid (18.0 µg/ml), paromomycin (25.0 µg/ml) and novobiocin (1100 µg/ml). This study acknowledges that the methods proposed by the Biolog system allow correct and complete identification and characterization of the microbes isolated from different environments. Phenotypic microarrays could be successfully used as a new tool for identification of the multi-antibiotic resistance of bacteria and for determination of the minimal inhibition concentrations (MIC).

  12. Serratia marcescens resistance profile and its susceptibility to photodynamic antimicrobial chemotherapy. (United States)

    Parente, Ticiana Mont Alverne Lopes; Rebouças, Emanuela de Lima; Santos, Vitor Coutinho Vieira Dos; Barbosa, Francisco Cesar Barroso; Zanin, Iriana Carla Junqueira


    Some authors have reported the antimicrobial action of photodynamic antimicrobial chemotherapy (PACT) on bacteria related to nosocomial infections but there are few studies evaluating PACT on Serratia marcescens grown as planktonic cultures or as biofilms. The purpose of this study was to analyze the S. marcescens resistance profile and its susceptibility to PACT. Initially, 55 S. marcescens strains isolated from environmental, oral and extra-oral infections were tested by antimicrobial resistance to cefotaxime (CTX), imipenem (IPM), ciprofloxacin (CIP), tobramycin (TOB) and doxycycline (DOX) using E-test(®). Following, isolates grown as planktonic cultures or biofilms were submitted to PACT using the association of a light-emitting diode and toluidine blue (TBO). The E-test(®) results demonstrated intermediated sensitive strains to CTX, IMP, TOB, and DOX; and resistant strains to CTX, TOB, DOX and CIP. Also, CTX and IMP demonstrated variation when CLSI 2007 and CLSI 2015 were compared. Planktonic cultures and biofilms submitted to PACT demonstrated counts varying from 10(11) to 10(7) for planktonic cultures and 10(10) to 10(7) for biofilms. There were no statistical differences in the results when planktonic cultures and biofilms were compared. Increase in the profile of S. marcescens resistance was observed when CLSI 2007 and CLSI 2015 were compared. Also, IMP remains as the drug with lower rate of resistance. Additionally, both S. marcescens planktonic cultures and early biofilms are susceptible to PACT under tested conditions. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Necrotizing soft tissue infection caused by Serratia marcescens: A case report and literature review. (United States)

    Hagiya, Hideharu; Ojima, Masahiro; Yoshida, Takeshi; Matsui, Takahiro; Morii, Eiichi; Sato, Kazuaki; Tahara, Shinichiro; Yoshida, Hisao; Tomono, Kazunori


    A 64-year-old man with advanced liver cirrhosis was transferred to an emergency center due to septic shock and markedly inflamed left leg. Under a clinical diagnosis of necrotizing soft tissue infection (NSTI), the patient undertook intensive therapy but died 25 h after arrival. The pathogenic organism, Serratia marcescens, was later isolated from blood and soft tissue cultures. NSTI is very rarely associated with S. marcescens. A literature review showed that only 16 such cases, including our case, have been reported to date. Our case is the first evidence of an S. marcescens NSTI in a patient with liver cirrhosis. S. marcescens NSTI has an extremely high mortality rate; total mortality and mortality in cases involving the extremities were 75% (12 of 16 cases) and 83.3% (10 of 12 cases), respectively. Physicians need to be aware that S. marcescens can induce fatal infections in community patients. Copyright © 2015 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  14. Pathogenicity of pan-drug-resistant Serratia marcescens harbouring blaNDM-1. (United States)

    Gruber, Teresa M; Göttig, Stephan; Mark, Laura; Christ, Sara; Kempf, Volkhard A J; Wichelhaus, Thomas A; Hamprecht, Axel


    To characterize a pan-drug-resistant Serratia marcescens clinical isolate carrying the New Delhi metallo-β-lactamase (NDM)-1. The presence of β-lactamase genes was examined by PCR and sequencing. Antibiotic susceptibility was determined by antibiotic gradient test. Transformation assays, transconjugation assays, PFGE and PCR-based replicon typing were used for plasmid analysis. Horizontal gene transfer was evaluated by liquid mating using Escherichia coli J53 as a recipient. Pathogenicity of NDM-1 expressing S. marcescens was analysed using the Galleria mellonella infection model. S. marcescens isolate SM1890 was non-susceptible to all tested antibiotics, with minocycline retaining intermediate activity. blaNDM-1 was located on a 140 kb IncA/C-type plasmid which was transferable to E. coli and Klebsiella pneumoniae by conjugation. The LD50 of the NDM-positive, SM1890 isolate was higher than that of other, NDM-1 negative, S. marcescens strains. The presence of a blaNDM-1-harbouring IncA/C plasmid resulted in marked resistance to β-lactam antibiotics, but had no significant effect on virulence of isogenic strains. Because of the intrinsic resistance of S. marcescens to colistin and reduced susceptibility to tigecycline, treatment options for infections by NDM-1-positive isolates are extremely limited in this species. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail:

  15. Requirement for Serratia marcescens cytolysin in a murine model of hemorrhagic pneumonia. (United States)

    González-Juarbe, Norberto; Mares, Chris A; Hinojosa, Cecilia A; Medina, Jorge L; Cantwell, Angelene; Dube, Peter H; Orihuela, Carlos J; Bergman, Molly A


    Serratia marcescens, a member of the carbapenem-resistant Enterobacteriaceae, is an important emerging pathogen that causes a wide variety of nosocomial infections, spreads rapidly within hospitals, and has a systemic mortality rate of ≤41%. Despite multiple clinical descriptions of S. marcescens nosocomial pneumonia, little is known regarding the mechanisms of bacterial pathogenesis and the host immune response. To address this gap, we developed an oropharyngeal aspiration model of lethal and sublethal S. marcescens pneumonia in BALB/c mice and extensively characterized the latter. Lethal challenge (>4.0 × 10(6) CFU) was characterized by fulminate hemorrhagic pneumonia with rapid loss of lung function and death. Mice challenged with a sublethal dose (marcescens strains that failed to cause profound weight loss, extended illness, hemorrhage, and prolonged lung pathology in mice. This study describes a model of S. marcescens pneumonia that mimics known clinical features of human illness, identifies neutrophils and the toxin ShlA as a key factors important for defense and infection, respectively, and provides a solid foundation for future studies of novel therapeutics for this important opportunistic pathogen. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  16. Outbreak of Serratia marcescens postoperative infection traced to barbers and razors. (United States)

    Leng, P; Huang, W L; He, T; Wang, Y Z; Zhang, H N


    Fourteen postoperative infections caused by Serratia marcescens were detected in patients on the neurosurgical wards and spinal surgery ward of a 2640-bed hospital between 26th December 2012 and 5th June 2013. To investigate the source of the outbreak, identify risk factors and implement infection control measures. Cultures were collected from healthcare workers and potential environmental sources. S. marcescens isolates were characterized by antibiotic susceptibility testing and pulsed-field gel electrophoresis (PFGE). A retrospective case-control study was performed to identify the risk factors. The outbreak involved 14 patients, five of whom required more than one surgical procedure. S. marcescens was isolated from cerebrospinal fluid, brain tissue, sputum and other secretions. S. marcescens was also cultured from samples taken from the hands of two barbers and their razors. Exposure to the two barbers [odds ratio (OR) 78.0, P marcescens from patients, barbers and razors were indistinguishable by PFGE and antibiotic susceptibility pattern. The outbreak ended after removal of the implicated barbers, extensive re-inforcement of infection control procedures and re-education. These results underscore the risk of postoperative infection associated with pre-operative wet shaving. Copyright © 2014 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

  17. Serratia marcescens outbreak in a neonatal intensive care unit: crucial role of implementing hand hygiene among external consultants. (United States)

    Montagnani, Carlotta; Cocchi, Priscilla; Lega, Laura; Campana, Silvia; Biermann, Klaus Peter; Braggion, Cesare; Pecile, Patrizia; Chiappini, Elena; de Martino, Maurizio; Galli, Luisa


    Serratia marcescens represents an important pathogen involved in hospital acquired infections. Outbreaks are frequently reported and are difficult to eradicate. The aim of this study is to describe an outbreak of Serratia marcescens occurred from May to November 2012 in a neonatal intensive care unit, to discuss the control measures adopted, addressing the role of molecular biology in routine investigations during the outbreak. After an outbreak of Serratia marcescens involving 14 neonates, all admitted patients were screened for rectal and ocular carriage every two weeks. Extensive environmental sampling procedure and hand sampling of the staff were performed. Antimicrobial susceptibility pattern and molecular analysis of isolates were carried out. Effective hand hygiene measures involving all the external consultants has been implemented. Colonized and infected babies were cohorted. Dedicated staff was established to care for the colonized or infected babies. During the surveillance, 65 newborns were sampled obtaining 297 ocular and rectal swabs in five times. Thirty-four Serratia marcescens isolates were collected: 11 out of 34 strains were isolated from eyes, being the remaining 23 isolated from rectal swabs. Two patients presented symptomatic conjunctivitis. Environmental and hand sampling resulted negative. During the fifth sampling procedure no colonized or infected patients have been identified. Two different clones have been identified. Ocular and rectal colonization played an important role in spread of infections. Implementation of infection control measures, involving also external specialists, allowed to control a serious Serratia marcescens outbreak in a neonatal intensive care unit.

  18. The PhoP/PhoQ System and Its Role in Serratia marcescens Pathogenesis (United States)

    Barchiesi, Julieta; Castelli, María Eugenia; Di Venanzio, Gisela; Colombo, María Isabel


    Serratia marcescens is able to invade, persist, and multiply inside nonphagocytic cells, residing in nonacidic, nondegradative, autophagosome-like vacuoles. In this work, we have examined the physiological role of the PhoP/PhoQ system and its function in the control of critical virulence phenotypes in S. marcescens. We have demonstrated the involvement of the PhoP/PhoQ system in the adaptation of this bacterium to growth on scarce environmental Mg2+, at acidic pH, and in the presence of polymyxin B. We have also shown that these environmental conditions constitute signals that activate the PhoP/PhoQ system. We have found that the two S. marcescens mgtE orthologs present a conserved PhoP-binding motif and demonstrated that mgtE1 expression is PhoP dependent, reinforcing the importance of PhoP control in magnesium homeostasis. Finally, we have demonstrated that phoP expression is activated intracellularly and that a phoP mutant strain is defective in survival inside epithelial cells. We have shown that the Serratia PhoP/PhoQ system is involved in prevention of the delivery to degradative/acidic compartments. PMID:22467788

  19. Comparative genome analyses of Serratia marcescens FS14 reveals its high antagonistic potential.

    Directory of Open Access Journals (Sweden)

    Pengpeng Li

    Full Text Available S. marcescens FS14 was isolated from an Atractylodes macrocephala Koidz plant that was infected by Fusarium oxysporum and showed symptoms of root rot. With the completion of the genome sequence of FS14, the first comprehensive comparative-genomic analysis of the Serratia genus was performed. Pan-genome and COG analyses showed that the majority of the conserved core genes are involved in basic cellular functions, while genomic factors such as prophages contribute considerably to genome diversity. Additionally, a Type I restriction-modification system, a Type III secretion system and tellurium resistance genes are found in only some Serratia species. Comparative analysis further identified that S. marcescens FS14 possesses multiple mechanisms for antagonism against other microorganisms, including the production of prodigiosin, bacteriocins, and multi-antibiotic resistant determinants as well as chitinases. The presence of two evolutionarily distinct Type VI secretion systems (T6SSs in FS14 may provide further competitive advantages for FS14 against other microbes. To our knowledge, this is the first report of comparative analysis on T6SSs in the genus, which identifies four types of T6SSs in Serratia spp.. Competition bioassays of FS14 against the vital plant pathogenic bacterium Ralstonia solanacearum and fungi Fusarium oxysporum and Sclerotinia sclerotiorum were performed to support our genomic analyses, in which FS14 demonstrated high antagonistic activities against both bacterial and fungal phytopathogens.

  20. Comparative genome analyses of Serratia marcescens FS14 reveals its high antagonistic potential. (United States)

    Li, Pengpeng; Kwok, Amy H Y; Jiang, Jingwei; Ran, Tingting; Xu, Dongqing; Wang, Weiwu; Leung, Frederick C


    S. marcescens FS14 was isolated from an Atractylodes macrocephala Koidz plant that was infected by Fusarium oxysporum and showed symptoms of root rot. With the completion of the genome sequence of FS14, the first comprehensive comparative-genomic analysis of the Serratia genus was performed. Pan-genome and COG analyses showed that the majority of the conserved core genes are involved in basic cellular functions, while genomic factors such as prophages contribute considerably to genome diversity. Additionally, a Type I restriction-modification system, a Type III secretion system and tellurium resistance genes are found in only some Serratia species. Comparative analysis further identified that S. marcescens FS14 possesses multiple mechanisms for antagonism against other microorganisms, including the production of prodigiosin, bacteriocins, and multi-antibiotic resistant determinants as well as chitinases. The presence of two evolutionarily distinct Type VI secretion systems (T6SSs) in FS14 may provide further competitive advantages for FS14 against other microbes. To our knowledge, this is the first report of comparative analysis on T6SSs in the genus, which identifies four types of T6SSs in Serratia spp.. Competition bioassays of FS14 against the vital plant pathogenic bacterium Ralstonia solanacearum and fungi Fusarium oxysporum and Sclerotinia sclerotiorum were performed to support our genomic analyses, in which FS14 demonstrated high antagonistic activities against both bacterial and fungal phytopathogens.

  1. Comparative Genome Analyses of Serratia marcescens FS14 Reveals Its High Antagonistic Potential (United States)

    Li, Pengpeng; Kwok, Amy H. Y.; Jiang, Jingwei; Ran, Tingting; Xu, Dongqing; Wang, Weiwu; Leung, Frederick C.


    S. marcescens FS14 was isolated from an Atractylodes macrocephala Koidz plant that was infected by Fusarium oxysporum and showed symptoms of root rot. With the completion of the genome sequence of FS14, the first comprehensive comparative-genomic analysis of the Serratia genus was performed. Pan-genome and COG analyses showed that the majority of the conserved core genes are involved in basic cellular functions, while genomic factors such as prophages contribute considerably to genome diversity. Additionally, a Type I restriction-modification system, a Type III secretion system and tellurium resistance genes are found in only some Serratia species. Comparative analysis further identified that S. marcescens FS14 possesses multiple mechanisms for antagonism against other microorganisms, including the production of prodigiosin, bacteriocins, and multi-antibiotic resistant determinants as well as chitinases. The presence of two evolutionarily distinct Type VI secretion systems (T6SSs) in FS14 may provide further competitive advantages for FS14 against other microbes. To our knowledge, this is the first report of comparative analysis on T6SSs in the genus, which identifies four types of T6SSs in Serratia spp.. Competition bioassays of FS14 against the vital plant pathogenic bacterium Ralstonia solanacearum and fungi Fusarium oxysporum and Sclerotinia sclerotiorum were performed to support our genomic analyses, in which FS14 demonstrated high antagonistic activities against both bacterial and fungal phytopathogens. PMID:25856195

  2. Inhibition of Serratia marcescens Smj-11 biofilm formation by Alcaligenes faecalis STN17 crude extract

    International Nuclear Information System (INIS)

    Lutfi, Zainal; Ahmad, Asmat; Usup, Gires


    Serratia marcescens biofilms are formed when they are bound to surfaces in aqueous environments. S. marcescens utilizes N-acylhomoserine lactone (AHL) as its quorum sensing signal molecule. The accumulation of AHL indicates the bacteria to produce matrices to form biofilms. Prodigiosin (2-methyl-3-pentyl-6-methoxyprodigiosin), which causes red pigmentation in the colonies, are also produced when the AHL reaches a certain threshold. The Alcaligenes faecalis STN17 crude extract is believed to inhibit quorum sensing in the S. marcescens Smj-11 and, thus, impedes its biofilm formation ability. A. faecalis STN17 was grown in marine broth, and ethyl acetate extraction was carried out. The crude compound of A. faecalis STN17 was diluted at high concentration (0.2-6.4 mg/mL) and was taken to confirm anti-biofilm activity through the crystal violet method in 96-wells plate. Then, the crude extract underwent purification using simple solvents partitioning test to discern the respective compounds that had the anti-biofilm activity under the crystal violet method. The crystal violet test showed that the crude did have anti-biofilm activity on S. marcescens Smj-11, but did not kill the cells. This finding signifies that the suppression of biofilm formation in S. marcescens by A. faecalis STN17 has a strong correlation. The partitioning test showed that A. faecalis STN17 crude extract has several compounds and only the compound(s) in chloroform showed activities. In conclusion, the crude extract of A. faecalis STN17 has the ability to inhibit S. marcescens Smj-11 biofilm formation

  3. A multicenter surveillance of antimicrobial resistance in Serratia marcescens in Taiwan. (United States)

    Liou, Bo-Huang; Duh, Ruay-Wang; Lin, Yi-Tsung; Lauderdale, Tsai-Ling Yang; Fung, Chang-Phone


    Serratia marcescens is an important nosocomial pathogen and the characteristic property of resistance conferred by extended-spectrum beta-lactamase or a novel AmpC cephalosporinase was not unusual in Taiwan. This study investigated the trends in antimicrobial resistance in S. marcescens from a nationwide surveillance in Taiwan. S. marcescens isolates were collected biennially between 2002 and 2010 from medical centers and regional hospitals throughout Taiwan, as part of the Taiwan Surveillance of Antimicrobial Resistance program. Minimal inhibitory concentrations were determined by the Clinical and Laboratory Standards Institute reference broth microdilution method. A total of 403 nonduplicate S. marcescens isolates were collected, mostly from respiratory samples (157, 39.0%), followed by the urinary tract samples (90, 22.3%). Overall, 99.3% isolates were susceptible to imipenem, 93.8% to ceftazidime, 89.2% to minocycline, 87.8% to amikacin, 86.8% to cefepime, 82.9% to aztreonam, 73.2% to ceftriaxone, 72.7% to levofloxacin, 63.8% to ciprofloxacin, 60.8% to trimethoprim/sulfamethoxazole (TMP/SMX), and 59.6% to gentamicin. A significantly increased susceptibility rate after 2004 was observed for the following antibiotics: amikacin (73.8% vs. 97.1%), gentamicin (40.0% vs. 72.4%), ciprofloxacin (53.8% vs. 70.4%), ceftriaxone (53.8% vs. 86.0%), cefepime (74.4% vs. 95.1%), aztreonam (72.5% vs. 89.7%), and TMP/SMX (41.3% vs. 73.7%). In this 8-year study, the susceptibility of S. marcescens to ceftazidime and imipenem remained consistently high in Taiwan. S. marcescens isolates demonstrated relatively higher resistance to ciprofloxacin and levofloxacin, and therefore continued surveillance of antimicrobial resistance, especially for fluoroquinolone, is warranted. Copyright © 2013. Published by Elsevier B.V.

  4. Inhibition of Serratia marcescens Smj-11 biofilm formation by Alcaligenes faecalis STN17 crude extract

    Energy Technology Data Exchange (ETDEWEB)

    Lutfi, Zainal; Ahmad, Asmat [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia (UKM), 43600 Bangi, Selangor (Malaysia); Usup, Gires [School of Environmental and Natural Resources Sciences, Faculty of Science and Technology, Universiti Kebangsaan Malaysia (UKM), 43600 Bangi, Selangor (Malaysia)


    Serratia marcescens biofilms are formed when they are bound to surfaces in aqueous environments. S. marcescens utilizes N-acylhomoserine lactone (AHL) as its quorum sensing signal molecule. The accumulation of AHL indicates the bacteria to produce matrices to form biofilms. Prodigiosin (2-methyl-3-pentyl-6-methoxyprodigiosin), which causes red pigmentation in the colonies, are also produced when the AHL reaches a certain threshold. The Alcaligenes faecalis STN17 crude extract is believed to inhibit quorum sensing in the S. marcescens Smj-11 and, thus, impedes its biofilm formation ability. A. faecalis STN17 was grown in marine broth, and ethyl acetate extraction was carried out. The crude compound of A. faecalis STN17 was diluted at high concentration (0.2-6.4 mg/mL) and was taken to confirm anti-biofilm activity through the crystal violet method in 96-wells plate. Then, the crude extract underwent purification using simple solvents partitioning test to discern the respective compounds that had the anti-biofilm activity under the crystal violet method. The crystal violet test showed that the crude did have anti-biofilm activity on S. marcescens Smj-11, but did not kill the cells. This finding signifies that the suppression of biofilm formation in S. marcescens by A. faecalis STN17 has a strong correlation. The partitioning test showed that A. faecalis STN17 crude extract has several compounds and only the compound(s) in chloroform showed activities. In conclusion, the crude extract of A. faecalis STN17 has the ability to inhibit S. marcescens Smj-11 biofilm formation.

  5. Prodigiosin Production by Serratia marcescens UCP 1549 Using Renewable-Resources as a Low Cost Substrate

    Directory of Open Access Journals (Sweden)

    Galba M. Campos Takaki


    Full Text Available A new strain of Serratia marcescens UCP1459 isolated from a semi-arid soil produced the natural red pigment prodigiosin, characterized by an uncommon pyrrolylpyrromethane skeleton. Prodigiosin is a promising drug due to its reported antifungal, immunosuppressive and anti-proliferative activities. The objective of this work was to indentify a suitable medium to simultaneously enhance S. marcescens growth and pigment production using renewable resources obtained from industrial wastes. S. marcescens produced the highest level of prodigiosin (49.5 g/L at 48 h of cultivation using 6% “manipueira” (cassava wastewater supplemented with mannitol (2% at pH 7 and 28 °C. Carbohydrates in “manipueira” and mannitol play a role in the enhanced cell growth and prodigiosin production. The purified pigment extracted from the biomass was analyzed by mass spectrophotometry and showed the expected molecular weight of 324 Da corresponding to prodigiosin. In conclusion, we have successfully designed a new, economically feasible medium supporting enhanced S. marcescens growth and a high yield production of prodigiosin.

  6. Enhanced production of prodigiosin by Serratia marcescens MO-1 using ram horn peptone

    Directory of Open Access Journals (Sweden)

    Esabi Basaran Kurbanoglu


    Full Text Available This work addresses the production of prodigiosin from ram horn peptone (RHP using MO-1, a local isolate in submerged culture. First, a novel gram-negative and rod-shaped bacterial strain, MO-1, was isolated from the body of the grasshopper (Poecilemon tauricola Ramme 1951, which was collected from pesticide-contaminated fields. Sequence analysis of 16S rDNA classified the microbe as Serratia marcescens. The substrate utilization potential (BIOLOG and fatty acid methyl ester profile (FAME of S. marcescens were also determined. The effect of RHP on the production of prodigiosin by S. marcescens MO-1 was investigated, and the results showed that RHP supplementation promoted the growth of MO-1 and increased the production of prodigiosin. A concentration of 0.4% (w/v RHP resulted in the greatest yield of prodigiosin (277.74 mg/L after 48 h when mannitol was used as the sole source of carbon. The pigment yield was also influenced by the types of carbon sources and peptones. As a result, RHP was demonstrated to be a suitable substrate for prodigiosin production. These results revealed that prodigiosin could be produced efficiently by S. marcescens using RHP.

  7. Identification of pigmented Serratia marcescens symbiotically associated with Rhynchophorus ferrugineus Olivier (Coleoptera: Curculionidae). (United States)

    Scrascia, Maria; Pazzani, Carlo; Valentini, Franco; Oliva, Marta; Russo, Valentina; D'Addabbo, Pietro; Porcelli, Francesco


    To characterize red pigment-producing bacteria (RPPB) regularly released during oviposition by red palm weevil (RPW), RPPB were recovered from eggs deposited in apples supplied as substrate for oviposition. The presence of RPPB was also detected from gut, the reproductive apparatus of dissected adult and virgin insects and from pupal cases collected within infested palms. RPPB were also identified all along the tissue of these palms. Analysis of the 16S rDNA, gyrB, rpoB, recA, and groEL sequences assigned RPPB to the species Serratia marcescens. RPPB exhibited an antimicrobial activity assessed by the agar well diffusion method against a number of gram-positive and gram-negative bacteria. In this study, we first report the identification of a red pigment-producing S. marcescens as extracellular symbiont of RPW. Route of transmission, detection within different organs, and a wide spread along the infested palm tissue, suggested S. marcescens is present as extracellular symbiont in different developmental stages of the RPW. Additionally, the antimicrobial activity exhibited versus Bacillus spp., Paenibacillus spp., and Lysinibacillus spp., reported as insect pathogens and potential candidates for biocontrol agents, could ascribe for S. marcescens a potential protective role. © 2016 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  8. Enhanced production of prodigiosin by Serratia marcescens MO-1 using ram horn peptone. (United States)

    Kurbanoglu, Esabi Basaran; Ozdal, Murat; Ozdal, Ozlem Gur; Algur, Omer Faruk


    This work addresses the production of prodigiosin from ram horn peptone (RHP) using MO-1, a local isolate in submerged culture. First, a novel gram-negative and rod-shaped bacterial strain, MO-1, was isolated from the body of the grasshopper (Poecilemon tauricola Ramme 1951), which was collected from pesticide-contaminated fields. Sequence analysis of 16S rDNA classified the microbe as Serratia marcescens. The substrate utilization potential (BIOLOG) and fatty acid methyl ester profile (FAME) of S. marcescens were also determined. The effect of RHP on the production of prodigiosin by S. marcescens MO-1 was investigated, and the results showed that RHP supplementation promoted the growth of MO-1 and increased the production of prodigiosin. A concentration of 0.4% (w/v) RHP resulted in the greatest yield of prodigiosin (277.74 mg/L) after 48 h when mannitol was used as the sole source of carbon. The pigment yield was also influenced by the types of carbon sources and peptones. As a result, RHP was demonstrated to be a suitable substrate for prodigiosin production. These results revealed that prodigiosin could be produced efficiently by S. marcescens using RHP.

  9. The response of Serratia marcescens JG to environmental changes by quorum sensing system. (United States)

    Sun, Shu-Jing; Liu, Hui-Jun; Weng, Cai-Hong; Lai, Chun-Fen; Ai, Liu-Ying; Liu, Yu-Chen; Zhu, Hu


    Many bacterial cells are known to regulate their cooperative behaviors and physiological processes through a molecular mechanism called quorum sensing. Quorum sensing in Serratia marcescens JG is mediated by the synthesis of autoinducer 2 (AI-2) which is a furanosyl borate diester. In this study, the response of quorum sensing in S. marcescens JG to environment changes such as the initial pH, carbon sources and boracic acid was investigated by a bioreporter and real-time PCR analysis. The results show that glucose can affect AI-2 synthesis to the greatest extent, and 2.0 % glucose can stimulate S. marcescens JG to produce more AI-2, with a 3.5-fold increase in activity compared with control culture. Furthermore, the response of quorum sensing to changes in glucose concentration was performed by changing the amount of luxS RNA transcripts. A maximum of luxS transcription appeared during the exponential growth phase when the glucose concentration was 20.0 g/L. AI-2 production was also slightly impacted by the low initial pH. It is significant for us that the addition of boracic acid at microdosage (0.1-0.2 g/L) can also induce AI-2 synthesis, which probably demonstrated the feasible fact that the 4,5-dihydroxy-2, 3-pentanedione cyclizes by the addition of borate and the loss of water, is hydrated and is converted to the final AI-2 in S. marcescens JG.

  10. Prodigiosin pigment of Serratia marcescens is associated with increased biomass production. (United States)

    Haddix, Pryce L; Shanks, Robert M Q


    Serratia marcescens is a gram-negative, facultatively-anaerobic bacterium and opportunistic pathogen which produces the red pigment prodigiosin. We employed both batch culture and chemostat growth methods to investigate prodigiosin function in the producing organism. Pigmentation correlated with an increased rate of ATP production during population lag phase. Results with a lacZ transcriptional fusion to the prodigiosin (pig) biosynthetic operon revealed that operon transcription is activated by low cellular levels of ATP at high cell density. Furthermore, these data enabled estimation of the ATP per cell minimum value at which the operon is induced. Pigmented cells were found to accumulate ATP more rapidly and to multiply more quickly than non-pigmented cells during the high density growth phase. Finally, results with both batch and chemostat culture revealed that pigmented cells grow to approximately twice the biomass yield as non-pigmented S. marcescens bacteria. Prodigiosin production may, therefore, provide a growth advantage at ambient temperatures.

  11. Epidemiological markers of Serratia marcescens isolates causing nosocomial infections in Spain (1981-1991). (United States)

    Boquete, T; Vindel, A; Martin-Bourgon, C; Azañedo, L; Sáez-Nieto, J A


    The distribution of epidemiological markers (serotyping and phage-typing) of Serratia marcescens isolates from nosocomial episodes (63 nosocomial cutbreaks with 475 isolates, and 1208 sporadic cases) received in our laboratory during the period 1981-1991 was studied. The records for 1683 isolates from Spanish hospitals have been analyzed. In relation with the sporadic cases, the predominant types were serotype O6 (13.4%) and serotype O14 (11.4%); polyagglutinable strains accounted for 15.6%; in outbreaks, type O14 is clearly predominant (27.4%). Phage-typing was a good secondary marker, with a 87.9% of typability; the number of lytic patterns was very high, extended patterns (six or more phages) being the most frequent. We have studied the characteristics of S. marcescens isolates causing infections in the nosocomial environment in Spain.

  12. KPC-PRODUCING Serratia marcescens IN A HOME-CARE PATIENT FROM RECIFE, BRAZIL. (United States)

    Margate, Emmily; Magalhães, Vera; Fehlberg, Lorena Cristina Corrêa; Gales, Ana Cristina; Lopes, Ana Catarina Souza


    In this brief communication we describe the occurrence of a KPC-producing Serratia marcescens isolate in a home-care patient from Recife, Brazil. The blaKPC, blaSPM, blaIMP, blaVIM, blaOXA, blaCTX-M, blaSHV, blaTEM and blaGES genes were investigated by Polymerase Chain Reaction (PCR) and DNA sequencing. The isolate was positive for blaKPC-2 and blaTEM-1 and was resistant to aztreonam, cefepime, cefotaxime, imipenem, meropenem, gentamicin, ciprofloxacin and cefazidime, and susceptible only to amikacin, tigecycline and gatifloxacin. This is the first report in Brazil of KPC-producing S. marcescens clinical isolate outside of a hospital environment. Caregivers should be alert for the presence of this isolate in the community setting.

  13. Long-Chain 4-Aminoquinolines as Quorum Sensing Inhibitors in Serratia marcescens and Pseudomonas aeruginosa. (United States)

    Aleksić, Ivana; Šegan, Sandra; Andrić, Filip; Zlatović, Mario; Moric, Ivana; Opsenica, Dejan M; Senerovic, Lidija


    Antibiotic resistance has become a serious global threat to public health; therefore, improved strategies and structurally novel antimicrobials are urgently needed to combat infectious diseases. Here we report a new type of highly potent 4-aminoquinoline derivatives as quorum sensing inhibitors in Serratia marcescens and Pseudomonas aeruginosa, exhibiting weak bactericidal activities (minimum inhibitory concentration (MIC) > 400 μM). Through detailed structure-activity study, we have identified 7-Cl and 7-CF 3 substituted N-dodecylamino-4-aminoquinolines (5 and 10) as biofilm formation inhibitors with 50% biofilm inhibition at 69 μM and 63 μM in S. marcescens and P. aeruginosa, respectively. These two compounds, 5 and 10, are the first quinoline derivatives with anti-biofilm formation activity reported in S. marcescens. Quantitative structure-activity relationship (QSAR) analysis identified structural descriptors such as Wiener indices, hyper-distance-path index (HDPI), mean topological charge (MTC), topological charge index (TCI), and log D(o/w) exp as the most influential in biofilm inhibition in this bacterial species. Derivative 10 is one of the most potent quinoline type inhibitors of pyocyanin production described so far (IC 50 = 2.5 μM). While we have demonstrated that 5 and 10 act as Pseudomonas quinolone system (PQS) antagonists, the mechanism of inhibition of S. marcescens biofilm formation with these compounds remains open since signaling similar to P. aeruginosa PQS system has not yet been described in Serratia and activity of these compounds on acylhomoserine lactone (AHL) signaling has not been detected. Our data show that 7-Cl and 7-CF 3 substituted N-dodecylamino-4-aminoquinolines present the promising scaffolds for developing antivirulence and anti-biofilm formation agents against multidrug-resistant bacterial species.

  14. Genome evolution and plasticity of Serratia marcescens, an important multidrug-resistant nosocomial pathogen. (United States)

    Iguchi, Atsushi; Nagaya, Yutaka; Pradel, Elizabeth; Ooka, Tadasuke; Ogura, Yoshitoshi; Katsura, Keisuke; Kurokawa, Ken; Oshima, Kenshiro; Hattori, Masahira; Parkhill, Julian; Sebaihia, Mohamed; Coulthurst, Sarah J; Gotoh, Naomasa; Thomson, Nicholas R; Ewbank, Jonathan J; Hayashi, Tetsuya


    Serratia marcescens is an important nosocomial pathogen that can cause an array of infections, most notably of the urinary tract and bloodstream. Naturally, it is found in many environmental niches, and is capable of infecting plants and animals. The emergence and spread of multidrug-resistant strains producing extended-spectrum or metallo beta-lactamases now pose a threat to public health worldwide. Here we report the complete genome sequences of two carefully selected S. marcescens strains, a multidrug-resistant clinical isolate (strain SM39) and an insect isolate (strain Db11). Our comparative analyses reveal the core genome of S. marcescens and define the potential metabolic capacity, virulence, and multidrug resistance of this species. We show a remarkable intraspecies genetic diversity, both at the sequence level and with regards genome flexibility, which may reflect the diversity of niches inhabited by members of this species. A broader analysis with other Serratia species identifies a set of approximately 3,000 genes that characterize the genus. Within this apparent genetic diversity, we identified many genes implicated in the high virulence potential and antibiotic resistance of SM39, including the metallo beta-lactamase and multiple other drug resistance determinants carried on plasmid pSMC1. We further show that pSMC1 is most closely related to plasmids circulating in Pseudomonas species. Our data will provide a valuable basis for future studies on S. marcescens and new insights into the genetic mechanisms that underlie the emergence of pathogens highly resistant to multiple antimicrobial agents. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  15. Outbreak of Serratia marcescens bloodstream infections in patients receiving parenteral nutrition prepared by a compounding pharmacy. (United States)

    Gupta, Neil; Hocevar, Susan N; Moulton-Meissner, Heather A; Stevens, Kelly M; McIntyre, Mary G; Jensen, Bette; Kuhar, David T; Noble-Wang, Judith A; Schnatz, Rick G; Becker, Shawn C; Kastango, Eric S; Shehab, Nadine; Kallen, Alexander J


    Compounding pharmacies often prepare parenteral nutrition (PN) and must adhere to rigorous standards to avoid contamination of the sterile preparation. In March 2011, Serratia marcescens bloodstream infections (BSIs) were identified in 5 patients receiving PN from a single compounding pharmacy. An investigation was conducted to identify potential sources of contamination and prevent further infections. Cases were defined as S. marcescens BSIs in patients receiving PN from the pharmacy between January and March 2011. We reviewed case patients' clinical records, evaluated pharmacy compounding practices, and obtained epidemiologically directed environmental cultures. Molecular relatedness of available Serratia isolates was determined by pulsed-field gel electrophoresis (PFGE). Nineteen case patients were identified; 9 died. The attack rate for patients receiving PN in March was 35%. No case patients were younger than 18 years. In October 2010, the pharmacy began compounding and filter-sterilizing amino acid solution for adult PN using nonsterile amino acids due to a national manufacturer shortage. Review of this process identified breaches in mixing, filtration, and sterility testing practices. S. marcescens was identified from a pharmacy water faucet, mixing container, and opened amino acid powder. These isolates were indistinguishable from the outbreak strain by PFGE. Compounding of nonsterile amino acid components of PN was initiated due to a manufacturer shortage. Failure to follow recommended compounding standards contributed to an outbreak of S. marcescens BSIs. Improved adherence to sterile compounding standards, critical examination of standards for sterile compounding from nonsterile ingredients, and more rigorous oversight of compounding pharmacies is needed to prevent future outbreaks. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2014. This work is written by (a) US Government employee(s) and is in the public

  16. Brain abscesses after Serratia marcescens infection on a neonatal intensive care unit: differences on serial imaging

    International Nuclear Information System (INIS)

    Messerschmidt, A.; Olischar, M.; Pollak, A.; Birnbacher, R.; Prayer, D.


    Serratia are known to be a possible cause of severe cerebral infections in neonates. We describe imaging of three premature infants infected with Serratia marcescens. Born in the 31 st , 25 th and 28 th weeks of gestation, they presented with signs of septicaemia on postnatal days 9, 24 and 32. Initial sonography showed cysts in the first child, two areas with anechoic centre and echogenic rim in the second, and several echogenic areas in the third. Lesions were seen on CT, of low density in two cases and minimally increased density in the third. MRI in the first patient showed cysts with incomplete contrast enhancement of the lesions, while patient 2 showed five ring-enhancing fluid-containing lesions with thick walls. In the third patient two abscesses with contrast enhancement and several high-signal spots were seen. We discuss the pathophysiology of the lesions and the impact of the various imaging methods. (orig.)

  17. Brain abscesses after Serratia marcescens infection on a neonatal intensive care unit: differences on serial imaging

    Energy Technology Data Exchange (ETDEWEB)

    Messerschmidt, A.; Olischar, M.; Pollak, A.; Birnbacher, R. [Division of Neonatology and Intensive Care, Department of Paediatrics, University of Vienna, Wahringer Guertel 18-20, 1090, Vienna (Austria); Prayer, D. [Division of Radiology, University of Vienna, Waehringer Guertel 18-20, 1090, Vienna (Austria)


    Serratia are known to be a possible cause of severe cerebral infections in neonates. We describe imaging of three premature infants infected with Serratia marcescens. Born in the 31{sup st}, 25{sup th} and 28{sup th} weeks of gestation, they presented with signs of septicaemia on postnatal days 9, 24 and 32. Initial sonography showed cysts in the first child, two areas with anechoic centre and echogenic rim in the second, and several echogenic areas in the third. Lesions were seen on CT, of low density in two cases and minimally increased density in the third. MRI in the first patient showed cysts with incomplete contrast enhancement of the lesions, while patient 2 showed five ring-enhancing fluid-containing lesions with thick walls. In the third patient two abscesses with contrast enhancement and several high-signal spots were seen. We discuss the pathophysiology of the lesions and the impact of the various imaging methods. (orig.)

  18. Genetic Dissection of Anopheles gambiae Gut Epithelial Responses to Serratia marcescens (United States)

    Stathopoulos, Stavros; Neafsey, Daniel E.; Lawniczak, Mara K. N.; Muskavitch, Marc A. T.; Christophides, George K.


    Genetic variation in the mosquito Anopheles gambiae profoundly influences its ability to transmit malaria. Mosquito gut bacteria are shown to influence the outcome of infections with Plasmodium parasites and are also thought to exert a strong drive on genetic variation through natural selection; however, a link between antibacterial effects and genetic variation is yet to emerge. Here, we combined SNP genotyping and expression profiling with phenotypic analyses of candidate genes by RNAi-mediated silencing and 454 pyrosequencing to investigate this intricate biological system. We identified 138 An. gambiae genes to be genetically associated with the outcome of Serratia marcescens infection, including the peptidoglycan recognition receptor PGRPLC that triggers activation of the antibacterial IMD/REL2 pathway and the epidermal growth factor receptor EGFR. Silencing of three genes encoding type III fibronectin domain proteins (FN3Ds) increased the Serratia load and altered the gut microbiota composition in favor of Enterobacteriaceae. These data suggest that natural genetic variation in immune-related genes can shape the bacterial population structure of the mosquito gut with high specificity. Importantly, FN3D2 encodes a homolog of the hypervariable pattern recognition receptor Dscam, suggesting that pathogen-specific recognition may involve a broader family of immune factors. Additionally, we showed that silencing the gene encoding the gustatory receptor Gr9 that is also associated with the Serratia infection phenotype drastically increased Serratia levels. The Gr9 antibacterial activity appears to be related to mosquito feeding behavior and to mostly rely on changes of neuropeptide F expression, together suggesting a behavioral immune response following Serratia infection. Our findings reveal that the mosquito response to oral Serratia infection comprises both an epithelial and a behavioral immune component. PMID:24603764

  19. Utilization of mucus from the coral Acropora palmata by the pathogen Serratia marcescens and by environmental and coral commensal bacteria. (United States)

    Krediet, Cory J; Ritchie, Kim B; Cohen, Matthew; Lipp, Erin K; Sutherland, Kathryn Patterson; Teplitski, Max


    In recent years, diseases of corals caused by opportunistic pathogens have become widespread. How opportunistic pathogens establish on coral surfaces, interact with native microbiota, and cause disease is not yet clear. This study compared the utilization of coral mucus by coral-associated commensal bacteria ("Photobacterium mandapamensis" and Halomonas meridiana) and by opportunistic Serratia marcescens pathogens. S. marcescens PDL100 (a pathogen associated with white pox disease of Acroporid corals) grew to higher population densities on components of mucus from the host coral. In an in vitro coculture on mucus from Acropora palmata, S. marcescens PDL100 isolates outgrew coral isolates. The white pox pathogen did not differ from other bacteria in growth on mucus from a nonhost coral, Montastraea faveolata. The ability of S. marcescens to cause disease in acroporid corals may be due, at least in part, to the ability of strain PDL100 to build to higher population numbers within the mucus surface layer of its acroporid host. During growth on mucus from A. palmata, similar glycosidase activities were present in coral commensal bacteria, in S. marcescens PDL100, and in environmental and human isolates of S. marcescens. The temporal regulation of these activities during growth on mucus, however, was distinct in the isolates. During early stages of growth on mucus, enzymatic activities in S. marcescens PDL100 were most similar to those in coral commensals. After overnight incubation on mucus, enzymatic activities in a white pox pathogen were most similar to those in pathogenic Serratia strains isolated from human mucosal surfaces.

  20. Carbon-Starvation Induces Cross-Resistance to Thermal, Acid, and Oxidative Stress in Serratia marcescens (United States)

    Pittman, Joseph R.; Kline, La’Kesha C.; Kenyon, William J.


    The broad host-range pathogen Serratia marcescens survives in diverse host and non-host environments, often enduring conditions in which the concentration of essential nutrients is growth-limiting. In such environments, carbon and energy source starvation (carbon-starvation) is one of the most common forms of stress encountered by S. marcescens. Related members of the family Enterobacteriaceae are known to undergo substantial changes in gene expression and physiology in response to the specific stress of carbon-starvation, enabling non-spore-forming cells to survive periods of prolonged starvation and exposure to other forms of stress (i.e., starvation-induced cross-resistance). To determine if carbon-starvation also results in elevated levels of cross-resistance in S. marcescens, both log-phase and carbon-starved cultures, depleted of glucose before the onset of high cell-density stationary-phase, were grown in minimal media at either 30 °C or 37 °C and were then challenged for resistance to high temperature (50 °C), low pH (pH 2.8), and oxidative stress (15 mM H2O2). In general, carbon-starved cells exhibited a higher level of resistance to thermal stress, acid stress, and oxidative stress compared to log-phase cells. The extent of carbon-starvation-induced cross-resistance was dependent on incubation temperature and on the particular strain of S. marcescens. In addition, strain- and temperature-dependent variations in long-term starvation survival were also observed. The enhanced stress-resistance of starved S. marcescens cells could be an important factor in their survival and persistence in many non-host environments and within certain host microenvironments where the availability of carbon sources is suboptimal for growth. PMID:27682115

  1. Interference of quorum sensing in urinary pathogen Serratia marcescens by Anethum graveolens. (United States)

    Salini, Ramesh; Pandian, Shunmugiah Karutha


    Serratia marcescens is an opportunistic turned obligate pathogen frequently associated with urinary tract infections (UTI) and are multidrug resistant at most instances. Quorum sensing (QS) system, a population-dependent global regulatory system, controls the pathogenesis machinery of S. marcescens as it does in other pathogens. In the present study, methanol extract of a common herb and spice, Anethum graveolens (AGME) was assessed for its anti-QS potential against the clinical isolate of S. marcescens. AGME notably reduced the biofilm formation and QS-dependent virulence factors production in a concentration-dependent manner (64-1024 μg mL(-1)). The light and confocal microscopic images clearly evidenced the antibiofilm activity of AGME (256 μg mL(-1)) at its minimal biofilm inhibitory concentration. Besides, in support of biochemical assays, the expression analysis of QS-regulated genes fimC, bsmA and flhD which are crucial for initial adhesion and motility confirmed their downregulation upon exposure to AGME. LC-MS analysis of AGME revealed 3-O-methyl ellagic acid (3-O-ME) as one of its active principles having nearly similar antibiofilm activity and a reduced inhibition of prodigiosin (27%) and protease (15%) compared to AGME [prodigiosin (47%) and protease (50%)]. UFLC analysis revealed that 0.355 mg g(-1) of 3-O-ME was present in the AGME. AGME and the 3-O-ME significantly interfered the QS system of a QS model strain S. marcescens MG1 and its mutant S. marcescens MG44 which in turn corroborates the anti-QS mechanism of AGME. © FEMS 2015. All rights reserved. For permissions, please e-mail:

  2. Application of Serratia marcescens RZ-21 significantly enhances peanut yield and remediates continuously cropped peanut soil. (United States)

    Ma, Hai-Yan; Yang, Bo; Wang, Hong-Wei; Yang, Qi-Yin; Dai, Chuan-Chao


    Continuous cropping practices cause a severe decline in peanut yield. The aim of this study was to investigate the remediation effect of Serratia marcescens on continuously cropped peanut soil. A pot experiment was conducted under natural conditions to determine peanut agronomic indices, soil microorganism characteristics, soil enzyme activities and antagonism ability to typical pathogens at different growth stages. Four treatments were applied to red soil as follows: an active fermentation liquor of S. marcescens (RZ-21), an equivalent sterilized fermentation liquor (M), an equivalent fermentation medium (P) and distilled water (CK). S. marcescens significantly inhibited the two typical plant pathogens Fusarium oxysporum A1 and Ralstonia solanacearum B1 and reduced their populations in rhizosphere soil. The RZ-21 treatment significantly increased peanut yield, vine dry weight, root nodules and taproot length by 62.3, 33, 72 and 61.4% respectively, followed by the M treatment. The P treatment also increased root nodules and root length slightly. RZ-21 also enhanced the activities of soil urease, sucrase and hydrogen peroxidase at various stages. In addition, RZ-21 and M treatments increased the average population of soil bacteria and decreased the average population of fungi in the three critical peanut growth stages, except for M in the case of the fungal population at flowering, thus balancing the structure of the soil microorganism community. This is the first report of S. marcescens being applied to continuously cropped peanut soil. The results suggest that S. marcescens RZ-21 has the potential to improve the soil environment and agricultural products and thus allow the development of sustainable management practices. © 2015 Society of Chemical Industry.

  3. Carbon-Starvation Induces Cross-Resistance to Thermal, Acid, and Oxidative Stress in Serratia marcescens

    Directory of Open Access Journals (Sweden)

    Joseph R. Pittman


    Full Text Available The broad host-range pathogen Serratia marcescens survives in diverse host and non-host environments, often enduring conditions in which the concentration of essential nutrients is growth-limiting. In such environments, carbon and energy source starvation (carbon-starvation is one of the most common forms of stress encountered by S. marcescens. Related members of the family Enterobacteriaceae are known to undergo substantial changes in gene expression and physiology in response to the specific stress of carbon-starvation, enabling non-spore-forming cells to survive periods of prolonged starvation and exposure to other forms of stress (i.e., starvation-induced cross-resistance. To determine if carbon-starvation also results in elevated levels of cross-resistance in S. marcescens, both log-phase and carbon-starved cultures, depleted of glucose before the onset of high cell-density stationary-phase, were grown in minimal media at either 30 °C or 37 °C and were then challenged for resistance to high temperature (50 °C, low pH (pH 2.8, and oxidative stress (15 mM H2O2. In general, carbon-starved cells exhibited a higher level of resistance to thermal stress, acid stress, and oxidative stress compared to log-phase cells. The extent of carbon-starvation-induced cross-resistance was dependent on incubation temperature and on the particular strain of S. marcescens. In addition, strain- and temperature-dependent variations in long-term starvation survival were also observed. The enhanced stress-resistance of starved S. marcescens cells could be an important factor in their survival and persistence in many non-host environments and within certain host microenvironments where the availability of carbon sources is suboptimal for growth.

  4. Genomic, proteomic and biochemical analysis of the chitinolytic machinery of Serratia marcescens BJL200. (United States)

    Tuveng, Tina R; Hagen, Live Heldal; Mekasha, Sophanit; Frank, Jeremy; Arntzen, Magnus Øverlie; Vaaje-Kolstad, Gustav; Eijsink, Vincent G H


    The chitinolytic machinery of Serratia marcescens BJL200 has been studied in detail over the last couple of decades, however, the proteome secreted by this Gram-negative bacterium during growth on chitin has not been studied in depth. In addition, the genome of this most studied chitinolytic Serratia strain has until now, not been sequenced. We report a draft genome sequence for S. marcescens BJL200. Using label-free quantification (LFQ) proteomics and a recently developed plate-method for assessing secretomes during growth on solid substrates, we find that, as expected, the chitin-active enzymes (ChiA, B, C, and CBP21) are produced in high amounts when the bacterium grows on chitin. Other proteins produced in high amounts after bacterial growth on chitin provide interesting targets for further exploration of the proteins involved in degradation of chitin-rich biomasses. The genome encodes a fourth chitinase (ChiD), which is produced in low amounts during growth on chitin. Studies of chitin degradation with mixtures of recombinantly produced chitin-degrading enzymes showed that ChiD does not contribute to the overall efficiency of the process. ChiD is capable of converting N,N'-diacetyl chitobiose to N-acetyl glucosamine, but is less efficient than another enzyme produced for this purpose, the Chitobiase. Thus, the role of ChiD in chitin degradation, if any, remains unclear. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Potential transmission of Pantoea spp. and Serratia marcescens (Enterobacteriales: Enterobacteriaceae) to plants by Lygus hesperus (Hemiptera: Miridae) (United States)

    Lygus hesperus Knight (Hemiptera: Miridae) is a key agricultural pest in the western United States. In a recent study, proteins from Pantoea ananatis and Serratia marcescens (Enterobacteriales: Enterobacteriaceae) were identified in diet that was stylet-probed and fed upon by L. hesperus adults. P...


    NARCIS (Netherlands)



    A chitinase gene from the Gram-negative bacterium Serratia marcescens BJL200 was cloned in Lactococcus lactis subsp. lactis MG1363 and in the silage inoculum strain Lactobacillus plantarum E19b. The chitinase gene was expressed as an active enzyme at a low level in Lactococcus lactis, when cloned in

  7. Outbreak of Serratia marcescens colonization and infection traced to a Healthcare worker with long-term carriage on the hands

    NARCIS (Netherlands)

    de Vries, Jutte J. C.; Baas, Willy H.; van der Ploeg, Kees; Heesink, Albert; Degener, John E.; Arends, Jan P.


    objective. To reveal the source of a nosocomial outbreak of colonization and infection with a strain of Serratia marcescens positive for Guiana extended-spectrum beta-lactamase 1 (GES-1) that occurred among patients in a neurosurgical intensive care unit (ICU) in a Dutch university medical center

  8. Computational identification of potent inhibitors for Streptomycin 3″-adenylyltransferase of Serratia marcescens. (United States)

    Prabhu, Dhamodharan; Vidhyavathi, Ramasamy; Jeyakanthan, Jeyaraman


    Serratia marcescens is an opportunistic pathogen responsible for the respiratory and urinary tract infections in humans. The antibiotic resistance mechanism of S. marcescens is mediated through aminoglycoside modification enzyme that transfer adenyl group from substrate to antibiotic through regiospecific transfers for the inactivation of antibiotics. Streptomycin 3 ″ -adenylyltransferase acts on the 3' position of the antibiotic and considered as a novel drug target to overcome bacterial antibiotic resistance. Till now, there is no experimentally solved crystal structure of Streptomycin 3″-adenylyltransferase in S. marcescens. Hence, the present study was initiated to construct the three dimensional structure of Streptomycin 3″-adenylyltransferase in order to understand the binding mechanism. The modeled structure was subjected to structure-based virtual screening to identify potent compounds from the five chemical structure databases. Furthermore, different computational methods such as molecular docking, molecular dynamics simulations, ADME toxicity assessment, free energy and density functional theory calculations predicted the structural, binding and pharmacokinetic properties of the best five compounds. Overall, the results suggested that stable binding confirmation of the five potent compounds were mediated through hydrophobic, π-π stacking, salt bridges and hydrogen bond interactions. The identified compounds could pave way for the development of anti-pathogenic agents as potential drug entities. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Failed Reverse Total Shoulder Arthroplasty Caused by Recurrent Candida glabrata Infection with Prior Serratia marcescens Coinfection

    Directory of Open Access Journals (Sweden)

    John G. Skedros


    Full Text Available This report describes a 58-year-old insulin-dependent diabetic male patient who initially sustained a proximal humerus fracture from a fall. The fracture fixation failed and then was converted to a humeral hemiarthroplasty, which became infected with Candida glabrata and Serratia marcescens. After these infections were believed to be cured with antibacterial and antifungal treatments and two-stage irrigation and debridement, he underwent conversion to a reverse total shoulder arthroplasty. Unfortunately, the C. glabrata infection recurred and, nearly 1.5 years after implantation of the reverse total shoulder, he had a resection arthroplasty (removal of all implants and cement. His surgical and pharmacologic treatment concluded with (1 placement of a tobramycin-impregnated cement spacer also loaded with amphotericin B, with no plan for revision arthroplasty (i.e., the spacer was chronically retained, and (2 chronic use of daily oral fluconazole. We located only three reported cases of Candida species causing infection in shoulder arthroplasties (two C. albicans, one C. parapsilosis. To our knowledge, a total shoulder arthroplasty infected with C. glabrata has not been reported, nor has a case of a C. glabrata and S. marcescens periprosthetic coinfection in any joint. In addition, it is well known that S. marcescens infections are uncommon in periprosthetic joint infections.

  10. Nosocomial Serratia marcescens outbreak in Osaka, Japan, from 1999 to 2000. (United States)

    Takahashi, Hiroshi; Kramer, Michael H; Yasui, Yoshinori; Fujii, Hayato; Nakase, Katsumi; Ikeda, Kazunori; Imai, Tatsuya; Okazawa, Akiko; Tanaka, Tomoyuki; Ohyama, Takaaki; Okabe, Nobuhiko


    To investigate and control an outbreak of bloodstream infections (BSIs) caused by Serratia marcescens and to identify risk factors for respiratory colonization or infection with S. marcescens. Epidemiologic investigation, including review of medical and laboratory records, procedural investigations, pulsed-field gel electrophoresis (PFGE) typing of environmental and patient isolates, statistical study, and recommendation of control measures. All patients admitted to a 380-bed, secondary-care hospital in Osaka Prefecture, Japan, from July 1999 through June 2000 (study period). Seventy-one patients were colonized or infected with S. marcescens; 3 patients who developed primary BSIs on the same ward within 5 days in June 2000 had isolates with indistinguishable PFGE patterns and indwelling intravenous catheters for more than 5 days. On multivariate analysis, among 36 case-patients with positive sputum specimens and 95 control-patients, being bedridden (odds ratio [OR], 15.91; 95% confidence interval [CI95], 4.17-60.77), receiving mechanical ventilation (OR, 7.86; CI95, 2.27-27.16), being older than 80 years (OR, 3.12; CI95, 1.05-9.27), and receiving oral cleaning care (OR, 3.10; CI95, 1-9.58) were significant risk factors. S. marcescens was isolated from the fluid tanks of three nebulizers and a liquid soap dispenser. The hospital did not have written infection control standards, and many infection control practices were found to be inadequate (eg, respiratory equipment was used without disinfection between patients). Poor hospital hygiene and the lack of standard infection control measures contributed to infections hospital-wide. Recommendations to the hospital included adoption of written infection control policies.

  11. Molecular detection and analysis of a novel metalloprotease gene of entomopathogenic Serratia marcescens strains in infected Galleria mellonella. (United States)

    Tambong, J T; Xu, R; Sadiku, A; Chen, Q; Badiss, A; Yu, Q


    Serratia marcescens strains isolated from entomopathogenic nematodes (Rhabditis sp.) were examined for their pathogenicity and establishment in wax moth (Galleria mellonella) larvae. All the Serratia strains were potently pathogenic to G. mellonella larvae, leading to death within 48 h. The strains were shown to possess a metalloprotease gene encoding for a novel serralysin-like protein. Rapid establishment of the bacteria in infected larvae was confirmed by specific polymerase chain reaction (PCR) detection of a DNA fragment encoding for this protein. Detection of the viable Serratia strains in infected larvae was validated using the SYBR Green reverse transcriptase real-time PCR assay targeting the metalloprotease gene. Nucleotide sequences of the metalloprotease gene obtained in our study showed 72 single nucleotide polymorphisms (SNP) and 3 insertions compared with the metalloprotease gene of S. marcescens E-15. The metalloprotease gene had 60 synonymous and 8 nonsynonymous substitutions relative to the closest GenBank entry, S. marcescens E-15. A comparison of the amino acid composition of the new serralysin-like protein with that of the serralysin protein of S. marcescens E-15 revealed differences at 11 positions and a new aspartic acid residue. Analysis of the effect of protein variation suggests that a new aspartic acid residue resulting from nonsynonymous nucleotide mutations in the protein structure could have the most significant effect on its biological function. The new metalloprotease gene and (or) its product could have applications in plant agricultural biotechnology.

  12. Killing Effects of an Isolated Serratia marcescens KH-001 on Diaphorina citri via Lowering the Endosymbiont Numbers

    Directory of Open Access Journals (Sweden)

    Wei Hu


    Full Text Available Huanglongbing (HLB is the most devastating citrus disease worldwide, and suppression of the Asian citrus psyllid (Diaphorina citri is regarded as an effective method to inhibit the spread of HLB. In this study, we isolated a strain named as Serratia marcescens KH-001 from D. citri nymphs suffering from disease, and evaluated its killing effect on D. citri via toxicity test and effect on microbial community in D. citri using high-throughput sequencing. Our results indicated that S. marcescens KH-001 could effectively kill 83% of D. citri nymphs, while the fermentation products of S. marcescens KH-001 only killed 40% of the D. citrinymphs. High-throughput sequencing results indicated that the S. marcescens KH-001 increased the OTU numbers from 62.5 (PBS buffer to 81.5, while significantly lowered the Shannon index compared with Escherichia coli DH5α (group E (p < 0.05. OTU analysis showed that the S. marcescens KH-001 had significantly reduced the relative abundance of endosymbionts Wolbachia, Profftella, and Carsonella in group S compared with that in other groups (p < 0.05. Therefore, the direct killing effect of the fermentation products of S. marcescens KH-001 and the indirect effect via reducing the numbers of endosymbionts (Wolbachia, Profftella, and Carsonella of D. citri endow S. marcescens KH-001 a sound killing effect on D. citri. Further work need to do before this strain is used as a sound biological control agents.

  13. Serratia marcescens Is Able to Survive and Proliferate in Autophagic-Like Vacuoles inside Non-Phagocytic Cells (United States)

    Colombo, María Isabel; García Véscovi, Eleonora


    Serratia marcescens is an opportunistic human pathogen that represents a growing problem for public health, particularly in hospitalized or immunocompromised patients. However, little is known about factors and mechanisms that contribute to S. marcescens pathogenesis within its host. In this work, we explore the invasion process of this opportunistic pathogen to epithelial cells. We demonstrate that once internalized, Serratia is able not only to persist but also to multiply inside a large membrane-bound compartment. This structure displays autophagic-like features, acquiring LC3 and Rab7, markers described to be recruited throughout the progression of antibacterial autophagy. The majority of the autophagic-like vacuoles in which Serratia resides and proliferates are non-acidic and have no degradative properties, indicating that the bacteria are capable to either delay or prevent fusion with lysosomal compartments, altering the expected progression of autophagosome maturation. In addition, our results demonstrate that Serratia triggers a non-canonical autophagic process before internalization. These findings reveal that S. marcescens is able to manipulate the autophagic traffic, generating a suitable niche for survival and proliferation inside the host cell. PMID:21901159

  14. Effect of the bacterium Serratia marcescens SCBI on the longevity and reproduction of the nematode Caenorhabditis briggsae KT0001. (United States)

    Lancaster, Jeremiah D; Mohammad, Budour; Abebe, Eyualem


    Extensive research effort has advanced our understanding of Caenorhabditis as a model system, but its natural association with bacteria remains to be explored in an ecological context. Explored associations vary vastly from mutualistic to parasitic. Serratia marcescens has been shown to be pathogenic to Caenorhabditis with a fitness cost. The recent isolation of an entomopathogenic Caenorhabditis briggsae KT0001/S. marcescens SCBI association from the wild has allowed us to examine under laboratory conditions whether such an association poses a serious cost to Caenorhabditis as previously surmised for other Serratia. A fecundity table of Caenorhabditis briggsae KT0001 fed on S. marcescens SCBI and the control fed on E. coli OP50 is presented. We found no significant difference in survivorship or total fecundity between the S. marcescens SCBI fed and E. coli OP50 fed Caenorhabditis briggsae KT0001. Only the mean onset of reproduction was significantly different between the two groups with E. coli fed C. briggsae maturing earlier (2.12 days) than those fed on Serratia (2.42 days). S. marcescens SCBI is not highly pathogenic to C. briggsae KT0001 indicating that the entomopathogenicity reported for this association may be beneficial for both the nematode and bacteria. In light of the fact that hitherto conducted experimental tests conform to widely held view that Serratia are highly pathogenic to Caenorhabditis, the absence of a high fitness cost for C. briggsae we report here may indicate that this entomopathogenic association is non-transient suggesting nematode/bacterial associations in the wild may vary greatly. Consequently, broad generalizations about nematode/bacterial associations should be interpreted with care.

  15. Effect of the bacterium Serratia marcescens SCBI on the longevity and reproduction of the nematode Caenorhabditis briggsae KT0001

    Directory of Open Access Journals (Sweden)

    Lancaster Jeremiah D


    Full Text Available Abstract Background Extensive research effort has advanced our understanding of Caenorhabditis as a model system, but its natural association with bacteria remains to be explored in an ecological context. Explored associations vary vastly from mutualistic to parasitic. Serratia marcescens has been shown to be pathogenic to Caenorhabditis with a fitness cost. The recent isolation of an entomopathogenic Caenorhabditis briggsae KT0001/S. marcescens SCBI association from the wild has allowed us to examine under laboratory conditions whether such an association poses a serious cost to Caenorhabditis as previously surmised for other Serratia. Results A fecundity table of Caenorhabditis briggsae KT0001 fed on S. marcescens SCBI and the control fed on E. coli OP50 is presented. We found no significant difference in survivorship or total fecundity between the S. marcescens SCBI fed and E. coli OP50 fed Caenorhabditis briggsae KT0001. Only the mean onset of reproduction was significantly different between the two groups with E. coli fed C. briggsae maturing earlier (2.12 days than those fed on Serratia (2.42 days. Conclusion S. marcescens SCBI is not highly pathogenic to C. briggsae KT0001 indicating that the entomopathogenicity reported for this association may be beneficial for both the nematode and bacteria. In light of the fact that hitherto conducted experimental tests conform to widely held view that Serratia are highly pathogenic to Caenorhabditis, the absence of a high fitness cost for C. briggsae we report here may indicate that this entomopathogenic association is non-transient suggesting nematode/bacterial associations in the wild may vary greatly. Consequently, broad generalizations about nematode/bacterial associations should be interpreted with care.

  16. Response surface methodology for the optimization of alpha amylase production by serratia marcescens SB08

    International Nuclear Information System (INIS)

    Venil, C.K.; Lakshmanaperumalsamy, P.


    In this work, central composite design combining with response surface methodology was successfully employed to optimize medium composition for the production of alpha amylase by Serratia marcescens SB08 in submerged fermentation. The process parameters that influence the enzyme production were identified using Plackett- Burman design. Among the various factors screened, inoculum concentration, pH, NaCl and CaCl/sub 2/ were found to be most significant. The optimum level of pH was 5.0, inoculum concentration 3%, NaCl 0.30 g/l and CaCl/sub 2/ 0.13 g/l. The actual enzyme yield before and after optimization was 56.43 U/ml and 87.23 U/ml, respectively. Thus, it is advisable to the microbial industry sponsors to apply such profitable bioprocess to maintain high yield for mass production of alpha amylase. (author)

  17. Optimization of Liquid Medium for High Phosphate Solubilization by Serratia Marcescens Strain AGKT4

    Directory of Open Access Journals (Sweden)

    Mohd Yusoff Abd. Samad


    Full Text Available This study is on the optimization of the medium for solubilization of phosphate based on the Box-Behnken design and response surface methodology. Optimization of the liquid medium for phosphate solubilization using Serratia marcescens strain AGKT4 was carried out by varying the concentrations of 3 ingredients; the fructose, peptone and inoculum size of bacteria. A mathematical model derived from the response surface methodology was then validated statistically for the target test variables. The highest phosphate solubilization in the medium was achieved at the optimal concentrations of fructose and peptone at 6% (w/v and 0.6% (w/v, respectively. The maximum phosphate solubilization at these concentrations was 239.12 µg/mL. Under the same conditions, the bacterial growth in the medium was 9 log10 CFU.

  18. Use of quantitative real-time PCR for direct detection of serratia marcescens in marine and other aquatic environments. (United States)

    Joyner, Jessica; Wanless, David; Sinigalliano, Christopher D; Lipp, Erin K


    Serratia marcescens is the etiological agent of acroporid serratiosis, a distinct form of white pox disease in the threatened coral Acropora palmata. The pathogen is commonly found in untreated human waste in the Florida Keys, which may contaminate both nearshore and offshore waters. Currently there is no direct method for detection of this bacterium in the aquatic or reef environment, and culture-based techniques may underestimate its abundance in marine waters. A quantitative real-time PCR assay was developed to detect S. marcescens directly from environmental samples, including marine water, coral mucus, sponge tissue, and wastewater. The assay targeted the luxS gene and was able to distinguish S. marcescens from other Serratia species with a reliable quantitative limit of detection of 10 cell equivalents (CE) per reaction. The method could routinely discern the presence of S. marcescens for as few as 3 CE per reaction, but it could not be reliably quantified at this level. The assay detected environmental S. marcescens in complex sewage influent samples at up to 761 CE ml(-1) and in septic system-impacted residential canals in the Florida Keys at up to 4.1 CE ml(-1). This detection assay provided rapid quantitative abilities and good sensitivity and specificity, which should offer an important tool for monitoring this ubiquitous pathogen that can potentially impact both human health and coral health.

  19. Serratia marcescens arn, a PhoP-Regulated Locus Necessary for Polymyxin B Resistance (United States)

    Lin, Quei Yen; Tsai, Yi-Lin; Liu, Ming-Che; Lin, Wei-Cheng; Hsueh, Po-Ren


    Polymyxins, which are increasingly being used to treat infections caused by multidrug-resistant bacteria, perform poorly against Serratia marcescens. To investigate the underlying mechanisms, Tn5 mutagenesis was performed and two mutants exhibiting increased polymyxin B (PB) susceptibility were isolated. The mutants were found to have Tn5 inserted into the arnB and arnC genes. In other bacteria, arnB and arnC belong to the seven-gene arn operon, which is involved in lipopolysaccharide (LPS) modification. LPSs of arn mutants had greater PB-binding abilities than that of wild-type LPS. Further, we identified PhoP, a bacterial two-component response regulator, as a regulator of PB susceptibility in S. marcescens. By the reporter assay, we found PB- and low-Mg2+-induced expression of phoP and arn in the wild-type strain but not in the phoP mutant. Complementation of the phoP mutant with the full-length phoP gene restored the PB MIC and induction by PB and low Mg2+ levels, as in the wild type. An electrophoretic mobility shift assay (EMSA) further demonstrated that PhoP bound directly to the arn promoter. The PB challenge test confirmed that pretreatment with PB and low Mg2+ levels protected S. marcescens from a PB challenge in the wild-type strain but not in the phoP mutant. Real-time reverse transcriptase-PCR also indicated that PB serves as a signal to regulate expression of ugd, a gene required for LPS modification, in S. marcescens through a PhoP-dependent pathway. Finally, we found that PB-resistant clinical isolates displayed greater expression of arnA upon exposure to PB than did susceptible isolates. This is the first report to describe the role of S. marcescens arn in PB resistance and its modulation by PB and Mg2+ through the PhoP protein. PMID:24957827

  20. Interactions between the tropical sea anemone Aiptasia pallida and Serratia marcescens, an opportunistic pathogen of corals. (United States)

    Krediet, Cory J; Meyer, Julie L; Gimbrone, Nicholas; Yanong, Roy; Berzins, Ilze; Alagely, Ali; Castro, Herman; Ritchie, Kim B; Paul, Valerie J; Teplitski, Max


    Coral reefs are under increasing stress caused by global and local environmental changes, which are thought to increase the susceptibility of corals to opportunistic pathogens. In the absence of an easily culturable model animal, the understanding of the mechanisms of disease progression in corals remains fairly limited. In the present study, we tested the susceptibility of the tropical sea anemone Aiptasia pallida to an opportunistic coral pathogen (Serratia marcescens). A. pallida was susceptible to S. marcescens PDL100 and responded to this opportunistic coral pathogen with darkening of the tissues and retraction of tentacles, followed by complete disintegration of polyp tissues. Histological observations revealed loss of zooxanthellae and structural changes in eosinophilic granular cells in response to pathogen infection. A screen of S. marcescens mutants identified a motility and tetrathionate reductase mutants as defective in virulence in the A. pallida infection model. In co-infections with the wild-type strain, the tetrathionate reductase mutant was less fit within the surface mucopolysaccharide layer of the host coral Acropora palmata. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  1. Spaceflight Causes Increased Virulence of Serratia Marcescens on a Drosophila Melanogaster Host (United States)

    Bhattacharya, Sharmila; Wade, William; Clemens-Grisham, Rachel; Hosamani, Ravikumar; Bhardwaj, Shilpa R.; Lera, Matthew P.; Gresser, Amy L.


    Drosophila melanogaster, or the fruit fly, has long been an important organism for Earth-based research, and is now increasingly utilized as a model system to understand the biological effects of spaceflight. Studies in Drosophila melanogaster have shown altered immune responses in 3rd instar larvae and adult males following spaceflight, changes similar to those observed in astronauts. In addition, spaceflight has also been shown to affect bacterial physiology, as evidenced by studies describing altered virulence of Salmonella typhimurium following spaceflight and variation in biofilm growth patterns for the opportunistic pathogen Pseudomonas aeruginosa during flight. We recently sent Serratia marcescens Db11, a Drosophila pathogen and an opportunistic human pathogen, to the ISS on SpaceX-5 (Fruit Fly Lab-01). S. marcescens samples were stored at 4degC for 24 days on-orbit and then allowed to grow for 120 hours at ambient station temperature before being returned to Earth. Upon return, bacteria were isolated and preserved in 50% glycerol or RNAlater. Storage, growth, and isolation for ground control samples were performed using the same procedures. Spaceflight and ground samples stored in 50% glycerol were diluted and injected into 5-7-day-old ground-born adult D. melanogaster. Lethality was significantly greater in flies injected with the spaceflight samples compared to those injected with ground bacterial samples. These results indicate a shift in the virulence profile of the spaceflight S. marcescens Db11 and will be further assessed with molecular biological analyses. Our findings strengthen the conclusion that spaceflight impacts the virulence of bacterial pathogens on model host organisms such as the fruit fly. This research was supported by NASA's ISS Program Office (ISSPO) and Space Life and Physical Sciences Research and Applications (SLPSRA).

  2. Investigation of a nosocomial outbreak due to Serratia marcescens in a maternity hospital. (United States)

    Berthelot, P; Grattard, F; Amerger, C; Frery, M C; Lucht, F; Pozzetto, B; Fargier, P


    To investigate an outbreak of Serratia marcescens in a maternity hospital (November 1994 to May 1995). Retrospective analysis of epidemiological data and prospective study of systematic bacteriological samples from patients and environment, with genotyping of strains by arbitrarily primed polymerase chain reaction. A private maternity hospital, Saint-Etienne, France. In the neonatal unit, 1 newborn developed a bacteremia, and 36 were colonized in stools with S marcescens. As the colonization of some newborns was shown to occur only a few hours after delivery, the inquiry was extended to other maternity wards, where 8 babies and 4 mothers were found to be colonized. Environmental sampling led to the isolation of S marcescens from a bottle of enteral feed additive in the neonatal unit and from the transducers of two internal tocographs in the delivery rooms. The genotyping of 27 strains showed two different profiles: a major epidemic profile shared by 22 strains (18 from babies of the neonatal unit, 2 from babies of other units, and 2 from breast milk) and another profile shared by 5 strains (2 from transducers of internal tocographs, 2 from babies, and 1 from a mother). The strain isolated from lipid enteral feeding was not available for typing. Although this source of contamination was removed soon from the neonatal unit, the outbreak stopped only when infection control measures were reinforced in the delivery rooms, including the nonreuse of internal tocographs. In delivery rooms, the quality of hygiene needs to be as high as in surgery rooms to prevent nosocomial colonization or infection of neonates at birth.

  3. Cutaneous Serratia marcescens infections in Korea: A retrospective analysis of 13 patients. (United States)

    Seo, Jimyung; Shin, Dongyun; Oh, Sang Ho; Lee, Ju Hee; Chung, Kee Yang; Lee, Min-Geol; Kim, Dae Suk


    Serratia marcescens is a Gram-negative bacillus belonging to the Enterobacteriaceae family. Because of increasing reports of antimicrobial resistance, this bacterium has received considerable attention and has emerged as an important pathogen. In order to reveal clinical and microbiological characteristics of S. marcescens cutaneous infection and to suggest appropriate antibiotic treatment, we retrospectively analyzed 17 strains isolated from wound swabs of Korean patients between November 2005 and March 2014. A total of 13 patients (five men and eight women) were included in our study, with a mean age of 46.3 years (range, 21-82). Based on medical history, seven patients were classified as immunocompromised. Prior predisposing factors for infections were noted in 12 patients, including pre-existing leg ulcers or dermatitis (5/13), preceding cancer surgeries (2/13), plastic surgeries and filler injection (2/13), traumas (2/13) and medical procedures following cutaneous abscess (1/13). Cutaneous infections showed various clinical presentations, including spontaneous dermal abscess, fingernail change, painful nodules and papular erosions. We found that third- and fourth-generation cephalosporins, gentamicin, levofloxacin and meropenem appeared active against all 17 strains in vitro. Clinically, all patients treated with empirical first-generation cephalosporin showed treatment resistance, and oral quinolone monotherapy was the most preferred antibiotic regimen without treatment failure, with an average treatment duration of 25 days (range, 14-42). This study demonstrates the various clinical presentations and treatment responses for cutaneous S. marcescens infection. Moreover, we suggest that initial antibiotic coverage should be broad enough to account for multidrug resistance in this rare pathogen. © 2015 Japanese Dermatological Association.

  4. Protracted Regional Dissemination of GIM-1-Producing Serratia marcescens in Western Germany. (United States)

    Wendel, Andreas F; Kaase, Martin; Autenrieth, Ingo B; Peter, Silke; Oberhettinger, Philipp; Rieber, Heime; Pfeffer, Klaus; MacKenzie, Colin R; Willmann, Matthias


    The metallo-beta-lactamase GIM-1 has been found in various bacterial host species nearly exclusively in western Germany. However, not much is known about the epidemiology of GIM-1-positive Serratia marcescens Here we report on a surprisingly protracted regional dissemination. In-hospital transmission was investigated by using conventional epidemiological tools to identify spatiotemporal links. Strain typing was performed using pulsed-field gel electrophoresis (PFGE) and whole-genome sequencing (WGS). Bayesian phylogeny was used to infer the time axis of the observed occurrence. Thirteen S. marcescens strains from 10 patients from 6 different German hospitals were investigated. Suspected in-hospital transmissions were confirmed by molecular typing at a higher resolution by WGS than by PFGE. A detailed sequence analysis demonstrated the spread of one predominant strain variant but also provided evidence for transfer of the bla GIM-1 gene cassette between different strains. A Bayesian phylogenetic analysis showed that the most recent common ancestor of the identified clonal cluster could be dated back to April 1993 (95% highest posterior density interval, January 1973 to March 2003) and that this strain might have already harbored the bla GIM-1 at that time and, therewith, years before the first detection of this resistance gene in clinical specimens. This study shows a long-standing clonal and plasmid-mediated expansion of GIM-1-producing S. marcescens that might have gone unnoticed in the absence of a standardized and effective molecular screening for carbapenemases. The systematic and early detection of resistance is thus highly advisable, especially for the prevention of potentially long-term dissemination that may progress beyond control. Copyright © 2017 American Society for Microbiology.

  5. Identification of SlpB, a Cytotoxic Protease from Serratia marcescens. (United States)

    Shanks, Robert M Q; Stella, Nicholas A; Hunt, Kristin M; Brothers, Kimberly M; Zhang, Liang; Thibodeau, Patrick H


    The Gram-negative bacterium and opportunistic pathogen Serratia marcescens causes ocular infections in healthy individuals. Secreted protease activity was characterized from 44 ocular clinical isolates, and a higher frequency of protease-positive strains was observed among keratitis isolates than among conjunctivitis isolates. A positive correlation between protease activity and cytotoxicity to human corneal epithelial cells in vitro was determined. Deletion of prtS in clinical keratitis isolate K904 reduced, but did not eliminate, cytotoxicity and secreted protease production. This indicated that PrtS is necessary for full cytotoxicity to ocular cells and implied the existence of another secreted protease(s) and cytotoxic factors. Bioinformatic analysis of the S. marcescens Db11 genome revealed three additional open reading frames predicted to code for serralysin-like proteases noted here as slpB, slpC, and slpD. Induced expression of prtS and slpB, but not slpC and slpD, in strain PIC3611 rendered the strain cytotoxic to a lung carcinoma cell line; however, only prtS induction was sufficient for cytotoxicity to a corneal cell line. Strain K904 with deletion of both prtS and slpB genes was defective in secreted protease activity and cytotoxicity to human cell lines. PAGE analysis suggests that SlpB is produced at lower levels than PrtS. Purified SlpB demonstrated calcium-dependent and AprI-inhibited protease activity and cytotoxicity to airway and ocular cell lines in vitro. Lastly, genetic analysis indicated that the type I secretion system gene, lipD, is required for SlpB secretion. These genetic data introduce SlpB as a new cytotoxic protease from S. marcescens. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  6. Preparation and characterization of vanadia-titania mixed oxide for immobilization of Serratia rubidaea CCT 5732 and Klebsiella marcescens bacteria

    International Nuclear Information System (INIS)

    Saragiotto Colpini, Leda Maria; Correia Goncalves, Regina A.; Goncalves, Jose Eduardo; Maieru Macedo Costa, Creusa


    Vanadia-titania mixed oxide was synthesized by sol-gel method and characterized by several techniques. Texturally, it is formed by mesopores and presents high-specific surface area and controlled porosity. Scanning electron microscopy revealed that vanadium is homogeneously distributed in the material. Structurally, it was possible to identify characteristic V=O stretching bands by IR. The analysis of X-ray diffraction showed that the material, particularly vanadium, is highly dispersed. Application experiments were carried out through the immobilization of Serratia rubidae CCT 5732 and Klebsiella marcescens bacteria by adsorption on the surface of mixed oxide. The micrographies revealed that the bacteria were adsorbed on the entire support, with average surface densities of 8.55 x 10 11 cells/m 2 (Serratia rubidae CCT 5732) and 3.40 x 10 11 cells/m 2 (K. marcescens)

  7. Risk Assessment for the Spread of Serratia marcescens Within Dental-Unit Waterline Systems Using Vermamoeba vermiformis. (United States)

    Lal, Sham; Singhrao, Sim K; Achilles-Day, Undine E M; Morton, L H Glyn; Pearce, Mark; Crean, StJohn


    Vermamoeba vermiformis is associated with the biofilm ecology of dental-unit waterlines (DUWLs). This study investigated whether V. vermiformis is able to act as a vector for potentially pathogenic bacteria and so aid their dispersal within DUWL systems. Clinical dental water was initially examined for Legionella species by inoculating it onto Legionella selective-medium plates. The molecular identity/profile of the glassy colonies obtained indicated none of these isolates were Legionella species. During this work bacterial colonies were identified as a non-pigmented Serratia marcescens. As the water was from a clinical DUWL which had been treated with Alpron™, this prompted the question as to whether S. marcescens had developed resistance to the biocide. Exposure to Alpron™ indicated that this dental biocide was effective, under laboratory conditions, against S. marcescens at up to 1 × 10(8) colony forming units/millilitre (cfu/ml). V. vermiformis was cultured for 8 weeks on cells of S. marcescens and Escherichia coli. Subsequent electron microscopy showed that V. vermiformis grew equally well on S. marcescens and E. coli (P = 0.0001). Failure to detect the presence of S. marcescens within the encysted amoebae suggests that V. vermiformis is unlikely to act as a vector supporting the growth of this newly isolated, nosocomial bacterium.

  8. Multi-fractal characterization of bacterial swimming dynamics: a case study on real and simulated Serratia marcescens


    Koorehdavoudi, Hana; Bogdan, Paul; Wei, Guopeng; Marculescu, Radu; Zhuang, Jiang; Carlsen, Rika Wright; Sitti, Metin


    To add to the current state of knowledge about bacterial swimming dynamics, in this paper, we study the fractal swimming dynamics of populations of Serratia marcescens bacteria both in vitro and in silico, while accounting for realistic conditions like volume exclusion, chemical interactions, obstacles and distribution of chemoattractant in the environment. While previous research has shown that bacterial motion is non-ergodic, we demonstrate that, besides the non-ergodicity, the bacterial sw...

  9. Application of Statistical Design to the Optimization of Culture Medium for Prodigiosin Production by Serratia marcescens SWML08


    Venil, C. K.; Lakshmanaperumalsamy, P.


    Combination of Plackett – Burman design (PBD) and Box – Behnken design (BBD) were applied for optimization of different factors for prodigiosin production by Serratia marcescens SWML08. Among 11 factors, incubation temperature, and supplement of (NH4)2PO4 and trace salts into the culture medium were selected due to significant positive effect on prodigiosin yield. Box - Behnken design, a response surface methodology, was used for further optimization of these selected factors for better pro...

  10. An antimicrobial protein of the Riptortus pedestris salivary gland was cleaved by a virulence factor of Serratia marcescens. (United States)

    Lee, Dong Jung; Lee, Jun Beom; Jang, Ho Am; Ferrandon, Dominique; Lee, Bok Luel


    Recently, our group demonstrated that the bean bug, Riptortus pedestris, is a good experimental symbiosis model to study the molecular cross-talk between the host insect and the gut symbiont. The Burkholderia symbiont is orally acquired by host nymphs from the environment in every generation. However, it is still unclear how Riptortus specifically interacts with entomopathogens that are abundant in the environmental soil. In preliminary experiments, we observed that a potent entomopathogen, Serratia marcescens, can colonize the midgut of Riptortus insects and was recovered from the midgut when Serratia cells were orally administered, suggesting that this pathogenic bacterium can escape host immune defenses in the salivary fluid. We examined how orally fed Serratia cells can survive in the presence of antimicrobial substances of the Riptortus salivary fluid. In this study, a 15 kDa trialysin-like protein from the salivary gland of R. pedestris and a potent virulence factor of Serratia cells, a serralysin metalloprotease, from the culture medium of S. marcescens were successfully purified to homogeneity. When the purified Riptortus trialysin (rip-trialysin) was incubated with purified serralysin, rip-trialysin was specifically hydrolyzed by serralysin, leading to the loss of antimicrobial activity. These results clearly demonstrated that a potent virulent metalloprotease of S. marcescens functions as a key player in the escape from the salivary fluid-mediated host immune response, resulting in successful colonization of S. marcescens in the host midgut. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. SME-3, a Novel Member of the Serratia marcescens SME Family of Carbapenem-Hydrolyzing β-Lactamases (United States)

    Queenan, Anne Marie; Shang, Wenchi; Schreckenberger, Paul; Lolans, Karen; Bush, Karen; Quinn, John


    Imipenem-resistant Serratia marcescens isolates were cultured from a lung transplant patient given multiple antibiotics over several months. The strains expressed SME-3, a β-lactamase of the rare SME carbapenem-hydrolyzing family. SME-3 differed from SME-1 by a single amino acid substitution of tyrosine for histidine at position 105, but the two β-lactamases displayed similar hydrolytic profiles. PMID:17005839

  12. SME-3, a novel member of the Serratia marcescens SME family of carbapenem-hydrolyzing beta-lactamases. (United States)

    Queenan, Anne Marie; Shang, Wenchi; Schreckenberger, Paul; Lolans, Karen; Bush, Karen; Quinn, John


    Imipenem-resistant Serratia marcescens isolates were cultured from a lung transplant patient given multiple antibiotics over several months. The strains expressed SME-3, a beta-lactamase of the rare SME carbapenem-hydrolyzing family. SME-3 differed from SME-1 by a single amino acid substitution of tyrosine for histidine at position 105, but the two beta-lactamases displayed similar hydrolytic profiles.

  13. Proteomic Identification of Novel Secreted Antibacterial Toxins of the Serratia marcescens Type VI Secretion System* (United States)

    Fritsch, Maximilian J.; Trunk, Katharina; Diniz, Juliana Alcoforado; Guo, Manman; Trost, Matthias; Coulthurst, Sarah J.


    It has recently become apparent that the Type VI secretion system (T6SS) is a complex macromolecular machine used by many bacterial species to inject effector proteins into eukaryotic or bacterial cells, with significant implications for virulence and interbacterial competition. “Antibacterial” T6SSs, such as the one elaborated by the opportunistic human pathogen, Serratia marcescens, confer on the secreting bacterium the ability to rapidly and efficiently kill rival bacteria. Identification of secreted substrates of the T6SS is critical to understanding its role and ability to kill other cells, but only a limited number of effectors have been reported so far. Here we report the successful use of label-free quantitative mass spectrometry to identify at least eleven substrates of the S. marcescens T6SS, including four novel effector proteins which are distinct from other T6SS-secreted proteins reported to date. These new effectors were confirmed as antibacterial toxins and self-protecting immunity proteins able to neutralize their cognate toxins were identified. The global secretomic study also unexpectedly revealed that protein phosphorylation-based post-translational regulation of the S. marcescens T6SS differs from that of the paradigm, H1-T6SS of Pseudomonas aeruginosa. Combined phosphoproteomic and genetic analyses demonstrated that conserved PpkA-dependent threonine phosphorylation of the T6SS structural component Fha is required for T6SS activation in S. marcescens and that the phosphatase PppA can reverse this modification. However, the signal and mechanism of PpkA activation is distinct from that observed previously and does not appear to require cell–cell contact. Hence this study has not only demonstrated that new and species-specific portfolios of antibacterial effectors are secreted by the T6SS, but also shown for the first time that PpkA-dependent post-translational regulation of the T6SS is tailored to fit the needs of different bacterial

  14. A Novel 6'-N-Aminoglycoside Acetyltransferase, AAC(6')-Ial, from a Clinical Isolate of Serratia marcescens. (United States)

    Tada, Tatsuya; Miyoshi-Akiyama, Tohru; Shimada, Kayo; Dahal, Rajan K; Mishra, Shyam K; Ohara, Hiroshi; Kirikae, Teruo; Pokhrel, Bharat M


    Serratia marcescens IOMTU115 has a novel 6'-N-aminoglycoside acetyltransferase-encoding gene, aac(6')-Ial. The encoded protein AAC(6')-Ial has 146 amino acids, with 91.8% identity to the amino acid sequence of AAC(6')-Ic in S. marcescens SM16 and 97.3% identity to the amino acid sequence of AAC(6')-Iap in S. marcescens WW4. The minimum inhibitory concentrations of aminoglycosides for Escherichia coli expressing AAC(6')-Ial were similar to those for E. coli expressing AAC(6')-Ic or AAC(6')-Iap. Thin-layer chromatography showed that AAC(6')-Ial, AAC(6')-Ic, or AAC(6')-Iap acetylated all the aminoglycosides tested, except for apramycin, gentamicin, and lividomycin. Kinetics assays revealed that AAC(6')-Ial is a functional acetyltransferase against aminoglycosides. The aac(6')-Ial gene was located on chromosomal DNA.

  15. Serratia marcescens Suppresses Host Cellular Immunity via the Production of an Adhesion-inhibitory Factor against Immunosurveillance Cells* (United States)

    Ishii, Kenichi; Adachi, Tatsuo; Hamamoto, Hiroshi; Sekimizu, Kazuhisa


    Injection of a culture supernatant of Serratia marcescens into the bloodstream of the silkworm Bombyx mori increased the number of freely circulating immunosurveillance cells (hemocytes). Using a bioassay with live silkworms, serralysin metalloprotease was purified from the culture supernatant and identified as the factor responsible for this activity. Serralysin inhibited the in vitro attachment of both silkworm hemocytes and murine peritoneal macrophages. Incubation of silkworm hemocytes or murine macrophages with serralysin resulted in degradation of the cellular immune factor BmSPH-1 or calreticulin, respectively. Furthermore, serralysin suppressed in vitro phagocytosis of bacteria by hemocytes and in vivo bacterial clearance in silkworms. Disruption of the ser gene in S. marcescens attenuated its host killing ability in silkworms and mice. These findings suggest that serralysin metalloprotease secreted by S. marcescens suppresses cellular immunity by decreasing the adhesive properties of immunosurveillance cells, thereby contributing to bacterial pathogenesis. PMID:24398686

  16. Serratia marcescens suppresses host cellular immunity via the production of an adhesion-inhibitory factor against immunosurveillance cells. (United States)

    Ishii, Kenichi; Adachi, Tatsuo; Hamamoto, Hiroshi; Sekimizu, Kazuhisa


    Injection of a culture supernatant of Serratia marcescens into the bloodstream of the silkworm Bombyx mori increased the number of freely circulating immunosurveillance cells (hemocytes). Using a bioassay with live silkworms, serralysin metalloprotease was purified from the culture supernatant and identified as the factor responsible for this activity. Serralysin inhibited the in vitro attachment of both silkworm hemocytes and murine peritoneal macrophages. Incubation of silkworm hemocytes or murine macrophages with serralysin resulted in degradation of the cellular immune factor BmSPH-1 or calreticulin, respectively. Furthermore, serralysin suppressed in vitro phagocytosis of bacteria by hemocytes and in vivo bacterial clearance in silkworms. Disruption of the ser gene in S. marcescens attenuated its host killing ability in silkworms and mice. These findings suggest that serralysin metalloprotease secreted by S. marcescens suppresses cellular immunity by decreasing the adhesive properties of immunosurveillance cells, thereby contributing to bacterial pathogenesis.

  17. Isolation and analysis of lipase-overproducing mutants of Serratia marcescens. (United States)

    Kawai, E; Akatsuka, H; Sakurai, N; Idei, A; Matsumae, H; Shibatani, T; Komatsubara, S; Omori, K


    We have isolated a lipase-overproducing mutant, GE14, from Serratia marcescens 8000 after three rounds of N-methyl-N'-nitro-N-nitrosoguanidine mutagenesis. The mutant GE14 produced 95 kU/ml of extracellular lipase in the lipase medium, which was about threefold higher than that of produced by the original strain 8000. Enzymatic characteristics including specific activity of purified lipases from culture supernatants of GE14 and 8000 were almost same. The lipase gene (lipA) of GE14 contained two base substitutions; one in the promoter region and another in the N-terminal region of the lipA gene without an amino acid substitution. Promoter analysis using lipA-lacZ fusion plasmids revealed that these substitutions were responsible for the increase in the lipA expression level, independently. In contrast, no base substitution was found in the genes encoding the lipase secretion device, the Lip system. In addition, the genes coding for metalloprotease and the cell surface layer protein which are both secreted through the Lip system and associated with extracellular lipase production, also contained no base substitution. The strain GE14 carrying a high-copy-number lipA plasmid produced a larger amount of the extracellular lipase than the recombinant strains of 8000 and other mutants also did, indicating that GE14 was not only a lipase-overproducing strain, but also an advantageous host strain for overproducing the lipase by a recombinant DNA technique. These results suggest that the lipase-overproducing mutant GE14 and its recombinant strains are promising candidates for the industrial production of the S. marcescens lipase.

  18. Recent independent emergence of multiple multidrug-resistant Serratia marcescens clones within the United Kingdom and Ireland. (United States)

    Moradigaravand, Danesh; Boinett, Christine J; Martin, Veronique; Peacock, Sharon J; Parkhill, Julian


    Serratia marcescens, a member of the Enterobacteriaceae family, is a Gram-negative bacterium responsible for a wide range of nosocomial infections. The emergence of multidrug-resistant strains is an increasing danger to public health. To design effective means to control the dissemination of S. marcescens, an in-depth analysis of the population structure and variation is required. Utilizing whole-genome sequencing, we characterized the population structure and variation, as well as the antimicrobial resistance determinants, of a systematic collection of antimicrobial-resistant S. marcescens associated with bloodstream infections in hospitals across the United Kingdom and Ireland between 2001 and 2011. Our results show that S. marcescens is a diverse species with a high level of genomic variation. However, the collection was largely composed of a limited number of clones that emerged from this diverse background within the past few decades. We identified potential recent transmissions of these clones, within and between hospitals, and showed that they have acquired antimicrobial resistance determinants for different beta-lactams, ciprofloxacin, and tetracyclines on multiple occasions. The expansion of these multidrug-resistant clones suggests that the treatment of S. marcescens infections will become increasingly difficult in the future. © 2016 Moradigaravand et al.; Published by Cold Spring Harbor Laboratory Press.

  19. Killing Effects of an Isolated Serratia marcescens KH-001 on Diaphorina citri via Lowering the Endosymbiont Numbers. (United States)

    Hu, Wei; Kuang, Fan; Lu, Zhanjun; Zhang, Ning; Chen, Tingtao


    Huanglongbing (HLB) is the most devastating citrus disease worldwide, and suppression of the Asian citrus psyllid ( Diaphorina citri ) is regarded as an effective method to inhibit the spread of HLB. In this study, we isolated a strain named as Serratia marcescens KH-001 from D. citri nymphs suffering from disease, and evaluated its killing effect on D. citri via toxicity test and effect on microbial community in D. citri using high-throughput sequencing. Our results indicated that S. marcescens KH-001 could effectively kill 83% of D. citri nymphs, while the fermentation products of S. marcescens KH-001 only killed 40% of the D. citri nymphs. High-throughput sequencing results indicated that the S. marcescens KH-001 increased the OTU numbers from 62.5 (PBS buffer) to 81.5, while significantly lowered the Shannon index compared with Escherichia coli DH5α (group E) ( p citri endow S. marcescens KH-001 a sound killing effect on D. citri . Further work need to do before this strain is used as a sound biological control agents.

  20. Outbreak of a cluster with epidemic behavior due to Serratia marcescens after colistin administration in a hospital setting. (United States)

    Merkier, Andrea Karina; Rodríguez, María Cecilia; Togneri, Ana; Brengi, Silvina; Osuna, Carolina; Pichel, Mariana; Cassini, Marcelo H; Centrón, Daniela


    Serratia marcescens causes health care-associated infections with important morbidity and mortality. Particularly, outbreaks produced by multidrug-resistant isolates of this species, which is already naturally resistant to several antibiotics, including colistin, are usually described with high rates of fatal outcomes throughout the world. Thus, it is important to survey factors associated with increasing frequency and/or emergence of multidrug-resistant S. marcescens nosocomial infections. We report the investigation and control of an outbreak with 40% mortality due to multidrug-resistant S. marcescens infections that happened from November 2007 to April 2008 after treatment with colistin for Acinetobacter baumannii meningitis was started at hospital H1 in 2005. Since that year, the epidemiological pattern of frequently recovered species has changed, with an increase of S. marcescens and Proteus mirabilis infections in 2006 in concordance with a significant decrease of the numbers of P. aeruginosa and A. baumannii isolates. A single pulsed-field gel electrophoresis (PFGE) cluster of S. marcescens isolates was identified during the outbreak. When this cluster was compared with S. marcescens strains (n = 21) from 10 other hospitals (1997 to 2010), it was also identified in both sporadic and outbreak isolates circulating in 4 hospitals in Argentina. In132::ISCR1::blaCTX-M-2 was associated with the multidrug-resistant cluster with epidemic behavior when isolated from outbreaks. Standard infection control interventions interrupted transmission of this cluster even when treatment with colistin continued in several wards of hospital H1 until now. Optimizing use of colistin should be achieved simultaneously with improved infection control to prevent the emergence of species naturally resistant to colistin, such as S. marcescens and P. mirabilis.

  1. Late-onset neonatal sepsis, risk factors and interventions: an analysis of recurrent outbreaks of Serratia marcescens, 2006-2011. (United States)

    Samuelsson, A; Isaksson, B; Hanberger, H; Olhager, E


    Between 2006 and 2011, 11 patients with Serratia marcescens sepsis and 47 patients colonized due to the spread of various clones were observed. These recurrent clusters brought about interventions to reduce spread between patients. To evaluate the effect of stepwise interventions to prevent S. marcescens colonization/sepsis and to analyse risk factors for late-onset sepsis (LOS). An open retrospective observational study was performed to evaluate the interventions. A retrospective case-control study was performed to analyse the risk factors for LOS. S. marcescens sepsis and colonization decreased after the stepwise adoption of hygiene interventions. Low gestational age, low birth weight, indwelling central venous or umbilical catheter, and ventilator treatment were identified as risk factors for LOS. Compliance with basic hygiene guidelines was the only intervention monitored continuously from late 2007. Compliance increased gradually to a steady high level in early 2009. There was a decrease in S. marcescens LOS, clustering after the second quarter of 2008. After the first quarter of 2009, S. marcescens colonization decreased. It was not possible to identify the specific effects of each intervention, but it is likely that an update of the hospital's antibiotic policy affected the occurrence of S. marcescens LOS. The delayed effect of interventions on S. marcescens colonization was probably due to the time it takes for new routines to have an effect, illustrated by the gradual increase in compliance with basic hygiene guidelines. Copyright © 2013 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

  2. Degradation of phenolic compounds with hydrogen peroxide catalyzed by enzyme from Serratia marcescens AB 90027. (United States)

    Yao, Ri-Sheng; Sun, Min; Wang, Chun-Ling; Deng, Sheng-Song


    In this paper, the degradation of phenolic compounds using hydrogen peroxide as oxidizer and the enzyme extract from Serratia marcescens AB 90027 as catalyst was reported. With such an enzyme/H2O2 combination treatment, a high chemical oxygen demand (COD) removal efficiency was achieved, e.g., degradation of hydroquinone exceeded 96%. From UV-visible and IR spectra, the degradation mechanisms were judged as a process of phenyl ring cleavage. HPLC analysis shows that in the degradation p-benzoquinone, maleic acid and oxalic acid were formed as intermediates and that they were ultimately converted to CO2 and H2O. With the enzyme/H2O2 treatment, vanillin, hydroquinone, catechol, o-aminophenol, p-aminophenol, phloroglucinol and p-hydroxybenzaldehyde were readily degraded, whereas the degradation of phenol, salicylic acid, resorcinol, p-cholorophenol and p-nitrophenol were limited. Their degradability was closely related to the properties and positions of their side chain groups. Electron-donating groups, such as -OH, -NH2 and -OCH3 enhanced the degradation, whereas electron-withdrawing groups, such as -NO2, -Cl and -COOH, had a negative effect on the degradation of these compounds in the presence of enzyme/H2O2. Compounds with -OH at ortho and para positions were more readily degraded than those with -OH at meta positions.

  3. Activation of peritoneal macrophages to cytoxicity against B16 melanoma cells by Serratia marcescens polyribosome fractions

    International Nuclear Information System (INIS)

    Hoover, S.K.


    Serratia marcescens polyribosomes (SMPR) have been shown to elicit an anti-tumor response in vivo. The in-vitro effects of SMPR on macrophages as the nonspecific mediators of the anti-tumor response have not previously been examined. The first objective of this research project is to corroborate and analyze the in-vivo results by the development and application of an in-vitro cytotoxicity assay. The second objective is to examine the effect of SMPR upon previously unstimulated peritoneal macrophages as representing the mechanism of cytotoxicity. The third objective is to identify the minimal effective component of SMPR responsible for an effect on macrophages. Results revealed that SMPR preparations exert a number of effects upon macrophages. Morphologic changes included increased spreading and increased perinuclear vacuolization. Macrophages were shown to be metabolically activate by two lines of evidence. SMPR-treated macrophages exhibited increased cellular metabolism by the increased uptake of 3 H-thymidine and by the increased levels of secreted leucine aminopeptidase as compared to control macrophages. Results also showed that SMPR activates macrophages to cytotoxicity against syngeneic tumor target cells. Buoyant-density fractions were isolated and assayed for macrophage activating ability. Results showed 50S ribosomal subunits to be the smallest fraction effective for macrophage activation. Both the RNA and protein were necessary for complete effectiveness

  4. Molecular genetic and biochemical analyses of a DNA repair gene from Serratia marcescens

    International Nuclear Information System (INIS)

    Murphy, K.E.


    In Escherichia coli, the SOS response and two 3-methyladenine DNA glycosylases (TagI and TagII) are required for repair of DNA damaged by alkylating agents such as methyl methanesulfonate (MMS). Mutations of the recA gene eliminate the SOS response. TagI and TagII are encoded by the tag and alkA genes, respectively. A gene (rpr) encoding 3-methyladenine DNA glycosylase activity was isolated from the Gram-negative bacterium Serratia marcescens. The gene, localized to a 1.5-kilobase pair SmaI-HindIII restriction fragment, was cloned into plasmid pUC18. The clone complemented E. coli tag alkA and recA mutations for MMS resistance. The rpr gene did not, however, complement recA mutations for resistance to ultraviolet light or the ability to perform homologous recombination reactions, nor did it complement E. coli ada or alkB mutations. Two proteins of molecular weights 42,000 and 16,000 were produced from the rpr locus. Analysis of deletion and insertion mutants of rpr suggested that the 42kD molecule is the active protein. The 16kD protein may either be a breakdown product of the 42kD species or may be encoded by another gene overlapping the reading frame of the rpr gene. Biochemical assays showed that the rpr gene product (Rpr) possesses 3-methyladenine DNA glycosylase activity

  5. Identification of the Serratia marcescens hemolysin determinant by cloning into Escherichia coli

    International Nuclear Information System (INIS)

    Braun, V.; Neuss, B.; Ruan, Y.; Schiebel, E.; Schoeffler, H.; Jander, G.


    A cosmid bank of Serratia marcescens was established from which DNA fragments were cloned into the plasmid pBR322, which conferred the chromosomally encoded hemolytic activity to Escherichia coli K-12. By transposon mutagenesis with Tn1000 and Tn5 IS50/sub L/::phoA (TnphoA), the coding region was assigned to a DNA fragment, designated hyl, comprising approximately 7 kilobases. Two proteins with molecular weights of 61,000 (61K protein) and 160,000 (160K protein) were expressed by the pBR322 derivatives and by a plasmid which contained the hly genes under the control of a phage T7 promoter and the T7 RNA polymerase. When strongly overexpressed the 160K protein was released by E. coli cells into the extracellular medium concomitant with hemolytic activity. The genes encoding the 61K and the 160K proteins were transcribed in the same direction. Mutants expressing a 160K protein truncated at the carboxyl-terminal end were partially hemolytic. Hemolysis was progressively inhibited by saccharides with increasing molecular weights from maltotriose (M/sub r/ 504) to maltoheptaose (M/sub r/ 1152) and as totally abolished by dextran 4 (M/sub r/ 4000). This result and the observed influx of [ 14 C]sucrose into erythrocytes in the presence of hemolytic E. coli transformants under osmotically protective conditions suggest the formation of defined transmembrane channels by the hemolysin

  6. RssAB signaling coordinates early development of surface multicellularity in Serratia marcescens.

    Directory of Open Access Journals (Sweden)

    Yu-Huan Tsai

    Full Text Available Bacteria can coordinate several multicellular behaviors in response to environmental changes. Among these, swarming and biofilm formation have attracted significant attention for their correlation with bacterial pathogenicity. However, little is known about when and where the signaling occurs to trigger either swarming or biofilm formation. We have previously identified an RssAB two-component system involved in the regulation of swarming motility and biofilm formation in Serratia marcescens. Here we monitored the RssAB signaling status within single cells by tracing the location of the translational fusion protein EGFP-RssB following development of swarming or biofilm formation. RssAB signaling is specifically activated before surface migration in swarming development and during the early stage of biofilm formation. The activation results in the release of RssB from its cognate inner membrane sensor kinase, RssA, to the cytoplasm where the downstream gene promoters are located. Such dynamic localization of RssB requires phosphorylation of this regulator. By revealing the temporal activation of RssAB signaling following development of surface multicellular behavior, our findings contribute to an improved understanding of how bacteria coordinate their lifestyle on a surface.

  7. Production and application of a thermostable lipase from Serratia marcescens in detergent formulation and biodiesel production. (United States)

    García-Silvera, Edgar Edurman; Martínez-Morales, Fernando; Bertrand, Brandt; Morales-Guzmán, Daniel; Rosas-Galván, Nashbly Sarela; León-Rodríguez, Renato; Trejo-Hernández, María R


    In this study, extracellular lipase was produced by Serratia marcescens wild type and three mutant strains. The maximum lipase activity (80 U/mL) was obtained with the SMRG4 mutant strain using soybean oil. Using a 2 2 factorial design, the lipase production increased 1.55-fold (124 U/mL) with 4% and 0.05% of soybean oil and Triton X-100, respectively. The optimum conditions for maximum lipase activity were 50 °C and pH 8. However, the enzyme was active in a broad range of pH (6-10) and temperatures (5-55 °C). This lipase was stable in organic solvents and in the presence of oxidizing agents. The enzyme also proved to be efficient for the removal of triacylglycerol from olive oil in cotton cloth. A Box-Behnken experimental design was used to evaluate the effects of the interactions between total lipase activity, buffer pH, and wash temperatures on oil removal. The model obtained suggested that all selected factors had a significant impact on oil removal, with optimum conditions of 550 U lipase, 45 °C, pH 9.5, with 79.45% removal. Biotransformation of waste frying oil using the enzyme and in presence of methanol resulted in the synthesis of methyl esters such as methyl oleate, methyl palmitate, and methyl stearate. © 2017 International Union of Biochemistry and Molecular Biology, Inc.

  8. Systematic Analysis of White Pox Disease in Acropora palmata of the Florida Keys and Role of Serratia marcescens. (United States)

    Joyner, Jessica L; Sutherland, Kathryn P; Kemp, Dustin W; Berry, Brett; Griffin, Ashton; Porter, James W; Amador, Molly H B; Noren, Hunter K G; Lipp, Erin K


    White pox disease (WPD) affects the threatened elkhorn coral, Acropora palmata. Owing in part to the lack of a rapid and simple diagnostic test, there have been few systematic assessments of the prevalence of acroporid serratiosis (caused specifically by Serratia marcescens) versus general WPD signs. Six reefs in the Florida Keys were surveyed between 2011 and 2013 to determine the disease status of A. palmata and the prevalence of S. marcescens. WPD was noted at four of the six reefs, with WPD lesions found on 8 to 40% of the colonies surveyed. S. marcescens was detected in 26.9% (7/26) of the WPD lesions and in mucus from apparently healthy colonies both during and outside of disease events (9%; 18/201). S. marcescens was detected with greater frequency in A. palmata than in the overlying water column, regardless of disease status (P = 0.0177). S. marcescens could not be cultured from A. palmata but was isolated from healthy colonies of other coral species and was identified as pathogenic pulsed-field gel electrophoresis type PDR60. WPD lesions were frequently observed on the reef, but unlike in prior outbreaks, no whole-colony death was observed. Pathogenic S. marcescens was circulating on the reef but did not appear to be the primary pathogen in these recent WPD episodes, suggesting that other pathogens or stressors may contribute to signs of WPD. Results highlight the critical importance of diagnostics in coral disease investigations, especially given that field manifestation of disease may be similar, regardless of the etiological agent. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  9. Outbreak of Serratia marcescens in a neonatal intensive care unit: contaminated unmedicated liquid soap and risk factors. (United States)

    Buffet-Bataillon, S; Rabier, V; Bétrémieux, P; Beuchée, A; Bauer, M; Pladys, P; Le Gall, E; Cormier, M; Jolivet-Gougeon, A


    This study describes an outbreak of Serratia marcescens and its investigation and control in a neonatal intensive care unit (NICU). During a three-month period, five infants were colonised or infected by a single strain of S. marcescens. A case-control study, culture surveys and pulse-field gel electrophoresis analysis implicated a bottle soap dispenser as a reservoir of S. marcescens (P=0.032). Infants with S. marcescens colonisation or infection were also more likely to have been exposed to a central or percutaneous venous catheter (P=0.05) and had had longer exposure to endotracheal intubation (P=0.05). Soap dispensers are used in many hospitals and may be an unrecognised source of nosocomial infections. This potential source of infection could be reduced by using 'airless' dispensers which have no air intake for the distribution of soap. Prompt intervention and strict adherence to alcoholic hand disinfection were the key factors that led to the successful control of this outbreak.

  10. SlpE is a calcium-dependent cytotoxic metalloprotease associated with clinical isolates of Serratia marcescens. (United States)

    Stella, Nicholas A; Callaghan, Jake D; Zhang, Liang; Brothers, Kimberly M; Kowalski, Regis P; Huang, Jean J; Thibodeau, Patrick H; Shanks, Robert M Q

    Serralysin-like proteases are found in a wide variety of bacteria. These metalloproteases are frequently implicated in virulence and are members of the widely conserved RTX-toxin family. We identified a serralysin-like protease in the genome of a clinical isolate of Serratia marcescens that is highly similar to the canonical serralysin protein, PrtS. This gene was named serralysin-like protease E, SlpE, and was found in the majority (67%) of tested clinical isolates, but was absent from most tested non-clinical isolates including the insect pathogen and reference S. marcescens strain Db11. Purified recombinant SlpE exhibited calcium-dependent protease activity similar to metalloproteases PrtS and SlpB. Induction of slpE in the low-protease-producing S. marcescens strain PIC3611 highly elevated extracellular protease activity, and extracellular secretion required the lipD type 1 secretion system gene. Transcription of slpE was highly reduced in an eepR transcription factor mutant. Mutation of the slpE gene in a highly proteolytic clinical isolate reduced its protease activity, and evidence suggests that SlpE confers cytotoxicity of S. marcescens to the A549 airway carcinoma cell line. Together, these data reveal SlpE to be an EepR-regulated cytotoxic metalloprotease associated with clinical isolates of an important opportunistic pathogen. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  11. Serratia marcescens Induces Apoptotic Cell Death in Host Immune Cells via a Lipopolysaccharide- and Flagella-dependent Mechanism* (United States)

    Ishii, Kenichi; Adachi, Tatsuo; Imamura, Katsutoshi; Takano, Shinya; Usui, Kimihito; Suzuki, Kazushi; Hamamoto, Hiroshi; Watanabe, Takeshi; Sekimizu, Kazuhisa


    Injection of Serratia marcescens into the blood (hemolymph) of the silkworm, Bombyx mori, induced the activation of c-Jun NH2-terminal kinase (JNK), followed by caspase activation and apoptosis of blood cells (hemocytes). This process impaired the innate immune response in which pathogen cell wall components, such as glucan, stimulate hemocytes, leading to the activation of insect cytokine paralytic peptide. S. marcescens induced apoptotic cell death of silkworm hemocytes and mouse peritoneal macrophages in vitro. We searched for S. marcescens transposon mutants with attenuated ability to induce apoptosis of silkworm hemocytes. Among the genes identified, disruption mutants of wecA (a gene involved in lipopolysaccharide O-antigen synthesis), and flhD and fliR (essential genes in flagella synthesis) showed reduced motility and impaired induction of mouse macrophage cell death. These findings suggest that S. marcescens induces apoptosis of host immune cells via lipopolysaccharide- and flagella-dependent motility, leading to the suppression of host innate immunity. PMID:22859304

  12. Endonuclease from Gram-Negative Bacteria Serratia marcescens Is as Effective as Pulmozyme in the Hydrolysis of DNA in Sputum (United States)

    Vafina, Gulnaz; Zainutdinova, Elmira; Bulatov, Emil; Filimonova, Maria N.


    One of the approaches to effective airway cleansing is the degradation of DNA into smaller fragments. For this purpose Pulmozyme® is used with high efficacy because it contains recombinant DNase I as its active component. The aim of the study was to comparatively analyze DNase activity of Pulmozyme® and the nuclease from gram-negative bacteria Serratia marcescens, because at optimal conditions the catalytic efficiency of the nuclease is much higher than the efficiency of DNase I. Highly polymerized DNA and purulent-mucous sputum were used as substrates. The examination showed that both S. marcescens nuclease and Pulmozyme® hydrolyzed DNA in sputum. Also S. marcescens nuclease was found capable of hydrolyzing DNA in conditions that are standard for Pulmozyme® and suitable for its therapeutic application. For manifesting the similar hydrolytic activity the nuclease amount in the assay mixture containing highly polymerized DNA or the sonicated sputum and NaCl together with calcium- or magnesium- cations can be about 10- time lower than that of the recombinant DNase I. In the presence of magnesium cations the DNase activity of both S. marcescens nuclease and Pulmozyme® was higher than in the presence of calcium cations. PMID:29503617

  13. Sudden death of an Indian peafowl (Pavo cristatus) at a zoo due to non-pigmented Serratia marcescens infection. (United States)

    Lee, Seung-Hun; Park, Sang-Joon; Kwak, Dongmi; Kim, Kyoo-Tae


    A 16-year-old female Indian peafowl (Pavo cristatus) died two days after recognition of conjunctivitis in the right eye, anorexia and depression. Gross necropsy revealed a thick pseudomembrane under the eyelid and hydropericardium. Histopathological examination revealed hepatocellular necrosis, sinusoidal and vascular congestion and infiltrated inflammatory cells. Infiltration by inflammatory cells was noted in the epicardium. The lungs had mild interstitial pneumonia with the extensive congestion within the capillaries of the air sacs. Tubular interstitial congestion and necrosis was noted in the kidneys. Bacterial culture and nucleotide sequencing of the inflammatory specimens identified the causative agent as Serratia marcescens, an uncommon bacterium in birds. In summary, this study describes the sudden death of an Indian peafowl due to S. marcescens infection, which is rarely seen in animals.

  14. Wound and soft tissue infections of Serratia marcescens in patients receiving wound care: A health care-associated outbreak. (United States)

    Us, Ebru; Kutlu, Huseyin H; Tekeli, Alper; Ocal, Duygu; Cirpan, Sevilay; Memikoglu, Kemal O


    We described a health care-associated Serratia marcescens outbreak of wound and soft tissue infection lasting approximately 11 months at Ankara University Ibni Sina Hospital. After identification of S marcescens strains from the clinical and environmental samples, and their susceptibility testing to antimicrobial agents, pulsed-field gel electrophoresis (PFGE) was performed to detect molecular epidemiologic relationships among these isolates. The strains which were isolated from the saline bottles used for wound cleansing in the wound care unit were found to be 100% interrelated by PFGE to the strains from the samples of the outbreak patients. Reuse of the emptied bottles has no longer been allowed since the outbreak occurred. Besides, more efficient and frequent infection control training for hospital staff has been conducted. Copyright © 2017 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  15. Serratia marcescens-contaminated baby shampoo causing an outbreak among newborns at King Abdulaziz University Hospital, Jeddah, Saudi Arabia. (United States)

    Madani, T A; Alsaedi, S; James, L; Eldeek, B S; Jiman-Fatani, A A; Alawi, M M; Marwan, D; Cudal, M; Macapagal, M; Bahlas, R; Farouq, M


    During November 2008 to January 2009, 11 babies in the neonatal intensive care (NICU) and three babies in the nursery were infected with Serratia marcescens at King Abdulaziz University Hospital in Saudi Arabia. Overall, fifteen infections were identified among 11 newborns in the NICU: septicaemia (five cases), purulent conjunctivitis (three), urinary tract infection (two), meningitis (two) and cellulitis (one). Three newborns in the nursery had three infections: purulent conjunctivitis (two cases) and omphalitis (one). Thirteen of 14 babies recovered fully but one died from S. marcescens meningitis and septicaemia. All infections were traced to intrinsically contaminated baby shampoo introduced to the units five days before the first reported case. The outbreak terminated following withdrawal of the shampoo product. Copyright © 2011 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

  16. Secretion and activation of the Serratia marcescens hemolysin by structurally defined ShlB mutants. (United States)

    Pramanik, Avijit; Könninger, Ulrich; Selvam, Arun; Braun, Volkmar


    The ShlA hemolysin of Serratia marcescens is secreted across the outer membrane by the ShlB protein; ShlB belongs to the two-partner secretion system (type Vb), a subfamily of the Omp85 outer membrane protein assembly and secretion superfamily. During secretion, ShlA is converted from an inactive non-hemolytic form into an active hemolytic form. The structure of ShlB is predicted to consist of the N-terminal α-helix H1, followed by the two polypeptide-transport-associated domains POTRA P1 and P2, and the β-barrel of 16 β-strands. H1 is inserted into the pore of the β-barrel in the outer membrane; P1 and P2 are located in the periplasm. To obtain insights into the secretion and activation of ShlA by ShlB, we isolated ShlB mutants impaired in secretion and/or activation. The triple H1 P1 P2 mutant did not secrete ShlA. The P1 and P2 deletion derivatives secreted reduced amounts of ShlA, of which P1 showed some hemolysis, whereas P2 was inactive. Deletion of loop 6 (L6), which is conserved among exporters of the Omp85 family, compromised activation but retained low secretion. Secretion-negative mutants generated by random mutagenesis were located in loop 6. The inactive secreted ShlA derivatives were complemented in vitro to active ShlA by an N-terminal ShlA fragment (ShlA242) secreted by ShlB. Deletion of H1 did not impair secretion of hemolytic ShlA. The study defines domains of ShlB which are important for ShlA secretion and activation. Copyright © 2013 Elsevier GmbH. All rights reserved.

  17. Enhancing activity and thermostability of lipase A from Serratia marcescens by site-directed mutagenesis. (United States)

    Mohammadi, Mohsen; Sepehrizadeh, Zargham; Ebrahim-Habibi, Azadeh; Shahverdi, Ahmad Reza; Faramarzi, Mohammad Ali; Setayesh, Neda


    Lipases as significant biocatalysts had been widely employed to catalyze various chemical reactions such as ester hydrolysis, ester synthesis, and transesterification. Improving the activity and thermostability of enzymes is desirable for industrial applications. The lipase of Serratia marcescens belonging to family I.3 lipase has a very important pharmaceutical application in production of chiral precursors. In the present study, to achieve improved lipase activity and thermostability, using computational predictions of protein, four mutant lipases of SML (MutG2P, MutG59P, Mut H279K and MutL613WA614P) were constructed by site-directed mutagenesis. The recombinant mutant proteins were over-expressed in E. coli and purified by affinity chromatography on the Ni-NTA system. Circular dichroism spectroscopy, differential scanning calorimetry and kinetic parameters (Km and kcat) were determined. Our results have shown that the secondary structure of all lipases was approximately similar to one another. The MutG2P and MutG59P were more stable than wild type by approximately 2.3 and 2.9 in T 1/2 , respectively. The catalytic efficiency (kcat/Km) of MutH279K was enhanced by 2-fold as compared with the wild type (p<0.05). These results indicate that using protein modeling program and creating mutation, can enhance lipase activity and/or thermostability of SML and it also could be used for improving other properties of enzyme to the desired requirements as well as further mutations. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Tetrameric structure of the flagellar cap protein FliD from Serratia marcescens. (United States)

    Cho, So Yeon; Song, Wan Seok; Hong, Ho Jeong; Lee, Geun-Shik; Kang, Seung Goo; Ko, Hyun-Jeong; Kim, Pyeung-Hyeun; Yoon, Sung-Il


    Bacterial motility is provided by the flagellum. FliD is located at the distal end of the flagellum and plays a key role in the insertion of each flagellin protein at the growing tip of the flagellar filament. Because FliD functions as an oligomer, the determination of the oligomeric state of FliD is critical to understanding the molecular mechanism of FliD-mediated flagellar growth. FliD has been shown to adopt a pentameric or a hexameric structure depending on the bacterial species. Here, we report another distinct oligomeric form of FliD based on structural and biochemical studies. The crystal structures of the D2 and D3 domains of Serratia marcescens FliD (smFliD) were determined in two crystal forms and together revealed that smFliD assembles into a tetrameric architecture that resembles a four-pointed star plate. smFliD tetramerization was also confirmed in solution by cross-linking experiments. Although smFliD oligomerizes in a head-to-tail orientation using a common primary binding interface between the D2 and D3' domains (the prime denotes the second subunit in the oligomer) similarly to other FliD orthologs, the smFliD tetramer diverges to present a unique secondary D2-D2' binding interface. Our structure-based comparative analysis of FliD suggests that bacteria have developed diverse species-specific oligomeric forms of FliD that range from tetramers to hexamers for flagellar growth. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Endophytic Colonization of Rice by a Diazotrophic Strain of Serratia marcescens (United States)

    Gyaneshwar, Prasad; James, Euan K.; Mathan, Natarajan; Reddy, Pallavolu M.; Reinhold-Hurek, Barbara; Ladha, Jagdish K.


    Six closely related N2-fixing bacterial strains were isolated from surface-sterilized roots and stems of four different rice varieties. The strains were identified as Serratia marcescens by 16S rRNA gene analysis. One strain, IRBG500, chosen for further analysis showed acetylene reduction activity (ARA) only when inoculated into media containing low levels of fixed nitrogen (yeast extract). Diazotrophy of IRBG500 was confirmed by measurement of 15N2 incorporation and by sequence analysis of the PCR-amplified fragment of nifH. To examine its interaction with rice, strain IRBG500 was marked with gusA fused to a constitutive promoter, and the marked strain was inoculated onto rice seedlings under axenic conditions. At 3 days after inoculation, the roots showed blue staining, which was most intense at the points of lateral root emergence and at the root tip. At 6 days, the blue precipitate also appeared in the leaves and stems. More detailed studies using light and transmission electron microscopy combined with immunogold labeling confirmed that IRBG500 was endophytically established within roots, stems, and leaves. Large numbers of bacteria were observed within intercellular spaces, senescing root cortical cells, aerenchyma, and xylem vessels. They were not observed within intact host cells. Inoculation of IRBG500 resulted in a significant increase in root length and root dry weight but not in total N content of rice variety IR72. The inoculated plants showed ARA, but only when external carbon (e.g., malate, succinate, or sucrose) was added to the rooting medium. PMID:11274124

  20. Characterization of a chitinase with antifungal activity from a native Serratia marcescens B4A

    Directory of Open Access Journals (Sweden)

    Mandana Zarei


    Full Text Available Chitinases have the ability of chitin digestion that constitutes a main compound of the cell wall in many of the phytopathogens such as fungi. In the following investigation, a novel chitinase with antifungal activity was characterized from a native Serratia marcescens B4A. Partially purified enzyme had an apparent molecular mass of 54 kDa. It indicated an optimum activity in pH 5 at 45ºC. Enzyme was stable in 55ºC for 20 min and at a pH range of 3-9 for 90 min at 25ºC. When the temperature was raised to 60ºC, it might affect the structure of enzymes lead to reduction of chitinase activity. Moreover, the Km and Vmax values for chitin were 8.3 mg/ml and 2.4 mmol/min, respectively. Additionally, the effect of some cations and chemical compounds were found to stimulate the chitinase activity. In addition, Iodoacetamide and Idoacetic acid did not inhibit enzyme activity, indicating that cysteine residues are not part of the catalytic site of chitinase. Finally, chitinase activity was further monitored by scanning electronic microscopy data in which progressive changes in chitin porosity appeared upon treatment with chitinase. This enzyme exhibited antifungal activity against Rhizoctonia solani, Bipolaris sp, Alternaria raphani, Alternaria brassicicola, revealing a potential application for the industry with potentially exploitable significance. Fungal chitin shows some special features, in particular with respect to chemical structure. Difference in chitinolytic ability must result from the subsite structure in the enzyme binding cleft. This implies that why the enzyme didn't have significant antifungal activity against other Fungi.

  1. Kinetics of mercury reduction by Serratia marcescens mercuric reductase expressed by pseudomonas putida strains

    Energy Technology Data Exchange (ETDEWEB)

    Schneider, M.; Deckwer, W.D. [GBF-Gesellschaft fuer Biotechnologische Forschung mbH, Abteilung TU-BCE, Mascheroder Weg 1, D-38124 Braunschweig (Germany)


    Mercury (Hg) resistance is widespread among microorganisms and is based on the intracellular transformation of Hg(II) to less toxic elemental Hg(0). The use of microbial consortia to demercurize polluted wastewater streams and environments has been demonstrated. To develop efficient and versatile microbial cleanup strategies requires detailed knowledge of transport and reaction rates. This study focuses on the kinetics of the key enzyme of the microbial transformation, e.g., the mercuric reductase (MerA) under conditions closely resembling the cell interior. To this end, previously constructed and characterized Pseudomonas putida strains expressing MerA from Serratia marcescens were applied. Of the P. putida strains considered in this study P. putida KT2442::mer73 constitutively expressing broad spectrum mercury resistance (merTPAB) yielded the highest mercuric reductase (MerA) activity directly after cell disruption. MerA in the raw extract was further purified (about 100 fold). Reduction rates were measured for various substrates (HgCl{sub 2}, Hg{sub 2}SO{sub 4}, Hg(NO{sub 3}){sub 2} and phenyl mercury acetate) up to high concentrations dependent on the purification grade. In all cases, a pronounced substrate inhibition was found. The kinetic constants determined for the cell raw extract are in agreement with those measured for intact cells. However, the rate data exhibit reduced affinity and inhibition with rising purification grade (specific activity). Therefore, the findings seemingly point to reactions preceding the catalytic reduction. Based on simplified assumptions, a kinetic model is suggested which reasonably describes the experimental findings and can advantageously be applied to the bioreactor design. (Abstract Copyright [2005], Wiley Periodicals, Inc.)

  2. Antagonism of Serratia marcescens towards Phytophthora parasitica and its effects in promoting the growth of citrus Antagonismo de Serratia marcescens contra Phytophthora parasitica e seu efeito na promoção do crescimentos de citros

    Directory of Open Access Journals (Sweden)

    Brigida Pimentel Villar de Queiroz


    Full Text Available Phytophthora parasitica causes serious widespread, and difficult-to-control root rots in warmer regions. This oomycete is one of the most important pathogen of citrus. This paper reports the biological control of the pathogen by a strain of Serratia marcescens R-35, isolated from citrus rhizosphere. In greenhouse trials, the bacterium suppressed more than 50% of the disease and promoted the plant growth.Phytophthora parasitica é um oomiceto que causa sérios problemas fitossanitários em diferentes espécies de plantas em regiões tropicais e o controle tem sido difícil. Este patógeno é um dos mais importante à citricultura. Este trabalho relata o controle biológico do patógeno por uma linhagem de Serratia marcescens R-35, isolada da rizosfera de citros. Em condições de casa-de-vegetação, a bactéria reduziu em mais de 50% a incidência da doença, ao mesmo tempo que promoveu o crescimento de plantas.

  3. CpxR-Dependent Thermoregulation of Serratia marcescens PrtA Metalloprotease Expression and Its Contribution to Bacterial Biofilm Formation. (United States)

    Bruna, Roberto E; Molino, María Victoria; Lazzaro, Martina; Mariscotti, Javier F; García Véscovi, Eleonora


    PrtA is the major secreted metalloprotease of Serratia marcescens Previous reports implicate PrtA in the pathogenic capacity of this bacterium. PrtA is also clinically used as a potent analgesic and anti-inflammatory drug, and its catalytic properties attract industrial interest. Comparatively, there is scarce knowledge about the mechanisms that physiologically govern PrtA expression in Serratia In this work, we demonstrate that PrtA production is derepressed when the bacterial growth temperature decreases from 37°C to 30°C. We show that this thermoregulation occurs at the transcriptional level. We determined that upstream of prtA , there is a conserved motif that is directly recognized by the CpxR transcriptional regulator. This feature is found along Serratia strains irrespective of their isolation source, suggesting an evolutionary conservation of CpxR-dependent regulation of PrtA expression. We found that in S. marcescen s, the CpxAR system is more active at 37°C than at 30°C. In good agreement with these results, in a cpxR mutant background, prtA is derepressed at 37°C, while overexpression of the NlpE lipoprotein, a well-known CpxAR-inducing condition, inhibits PrtA expression, suggesting that the levels of the activated form of CpxR are increased at 37°C over those at 30°C. In addition, we establish that PrtA is involved in the ability of S. marcescens to develop biofilm. In accordance, CpxR influences the biofilm phenotype only when bacteria are grown at 37°C. In sum, our findings shed light on regulatory mechanisms that fine-tune PrtA expression and reveal a novel role for PrtA in the lifestyle of S. marcescens IMPORTANCE We demonstrate that S. marcescens metalloprotease PrtA expression is transcriptionally thermoregulated. While strongly activated below 30°C, its expression is downregulated at 37°C. We found that in S. marcescens , the CpxAR signal transduction system, which responds to envelope stress and bacterial surface adhesion, is

  4. Serratia marcescens bacteraemia outbreak in haemodialysis patients with tunnelled catheters due to colonisation of antiseptic solution. Experience at 4 hospitals. (United States)

    Merino, José L; Bouarich, Hanane; Pita, Mª José; Martínez, Patricia; Bueno, Blanca; Caldés, Silvia; Corchete, Elena; Jaldo, Mª Teresa; Espejo, Beatriz; Paraíso, Vicente

    The application of antiseptic solution for handling tunnelled catheters is recommended in patients undergoing haemodialysis. These routine antiseptic procedures in handling catheters are crucial to avoid complications. We report an outbreak of Serratia marcescens (S. marcescens) bacteraemia in numerous haemodialysis units of the Community of Madrid. The first cases of bacteraemia due to S. marcescens were isolated in December 2014. The Preventive Medicine Services were informed of the detection of an atypical pathogen in several patients, suspecting a probable nosocomial outbreak. Information from 4 centres with similar S. marcescens bacteraemia was analysed. Twenty-one cases of bacteraemia related to S. marcescens were identified. The mean age of affected patients was 72±10 years. The mean time on haemodialysis of affected patients was 33±13 months (range: 3-83 months), the median time of tunnelled catheter was 22±13 months. In 11 cases the clinical picture was similar, with hypotension and general malaise during the haemodialysis session. Fever was present in a further 7 cases. In 3 cases the presentation was asymptomatic and was detected by blood cultures. All patients had tunnelled catheters (12 patients with catheter in the right jugular vein, 5 in the left jugular, 2 in the right femoral artery and 2 in the left subclavian artery). Gentamicin intravenous doses (1mg/kg) with catheter lock solution with ciprofloxacin post-dialysis were administered for 3 weeks in 6 patients. In 12 patients the treatment was ceftazidime (2g IV) plus catheter lock solution with the same antibiotic, for 2 weeks. Four patients received oral ciprofloxacin for 2 weeks, in one case together with IV vancomycin. The patients were asymptomatic and without new episodes 48hours after the treatment. No major complications were observed. The teams informed the health authorities of the situation, which then reported the presence of batches of antiseptic (chlorhexidine 0.05 and 2

  5. Seed treatment with ethanol extract of Serratia marcescens is compatible with Trichoderma isolates for control of damping-off of cucumber caused by Pythium ultimum (United States)

    Environmentally friendly control measures for soil-borne plant pathogens are needed that are effective in different soils when applied alone or as components of an integrated disease control strategy. Ethanol extracts of Serratia marcescens N4-5 when applied as a cucumber seed treatment effectively ...

  6. Consistency of control of damping-off of cucumber is improved by combining ethanol extract of Serratia marcescens with other biologically based technologies (United States)

    Environmentally friendly disease control tactics are needed that are consistently effective in soils that vary with regard to their biotic and abiotic components. An ethanol extract of Serratia marcescens N4-5, when applied as a cucumber seed treatment, effectively suppressed damping-off of cucumbe...

  7. Role of the phosphopantetheinyltransferase enzyme, PswP, in the biosynthesis of antimicrobial secondary metabolites by Serratia marcescens Db10. (United States)

    Gerc, Amy J; Stanley-Wall, Nicola R; Coulthurst, Sarah J


    Phosphopantetheinyltransferase (PPTase) enzymes fulfil essential roles in primary and secondary metabolism in prokaryotes, archaea and eukaryotes. PPTase enzymes catalyse the essential modification of the carrier protein domain of fatty acid synthases, polyketide synthases (PKSs) and non-ribosomal peptide synthetases (NRPSs). In bacteria and fungi, NRPS and PKS enzymes are often responsible for the biosynthesis of secondary metabolites with clinically relevant properties; these secondary metabolites include a variety of antimicrobial peptides. We have previously shown that in the Gram-negative bacterium Serratia marcescens Db10, the PPTase enzyme PswP is essential for the biosynthesis of an NRPS-PKS dependent antibiotic called althiomycin. In this work we utilize bioinformatic analyses to classify PswP as belonging to the F/KES subfamily of Sfp type PPTases and to putatively identify additional NRPS substrates of PswP, in addition to the althiomycin NRPS-PKS, in Ser. marcescens Db10. We show that PswP is required for the production of three diffusible metabolites by this organism, each possessing antimicrobial activity against Staphylococcus aureus. Genetic analyses identify the three metabolites as althiomycin, serrawettin W2 and an as-yet-uncharacterized siderophore, which may be related to enterobactin. Our results highlight the use of an individual PPTase enzyme in multiple biosynthetic pathways, each contributing to the ability of Ser. marcescens to inhibit competitor bacteria by the production of antimicrobial secondary metabolites. © 2014 The Authors.

  8. Batch growth kinetic studies of locally isolated cyanide-degrading Serratia marcescens strain AQ07. (United States)

    Karamba, Kabiru Ibrahim; Ahmad, Siti Aqlima; Zulkharnain, Azham; Yasid, Nur Adeela; Ibrahim, Salihu; Shukor, Mohd Yunus


    The evaluation of degradation and growth kinetics of Serratia marcescens strain AQ07 was carried out using three half-order models at all the initial concentrations of cyanide with the values of regression exceeding 0.97. The presence of varying cyanide concentrations reveals that the growth and degradation of bacteria were affected by the increase in cyanide concentration with a total halt at 700 ppm KCN after 72 h incubation. In this study, specific growth and degradation rates were found to trail the substrate inhibition kinetics. These two rates fitted well to the kinetic models of Teissier, Luong, Aiba and Heldane, while the performance of Monod model was found to be unsatisfactory. These models were used to clarify the substrate inhibition on the bacteria growth. The analyses of these models have shown that Luong model has fitted the experimental data with the highest coefficient of determination ( R 2 ) value of 0.9794 and 0.9582 with the lowest root mean square error (RMSE) value of 0.000204 and 0.001, respectively, for the specific rate of degradation and growth. It is the only model that illustrates the maximum substrate concentration ( S m ) of 713.4 and empirical constant ( n ) of 1.516. Tessier and Aiba fitted the experimental data with a R 2 value of 0.8002 and 0.7661 with low RMSE of 0.0006, respectively, for specific biodegradation rate, while having a R 2 value of 0.9 and RMSE of 0.001, respectively, for specific growth rate. Haldane has the lowest R 2 value of 0.67 and 0.78 for specific biodegradation and growth rate with RMSE of 0.0006 and 0.002, respectively. This indicates the level of the bacteria stability in varying concentrations of cyanide and the maximum cyanide concentration it can tolerate within a specific time period. The biokinetic constant predicted from this model demonstrates a good ability of the locally isolated bacteria in cyanide remediation in industrial effluents.

  9. Biodegradation and bioremediation potential of diazinon-degrading Serratia marcescens to remove other organophosphorus pesticides from soils. (United States)

    Cycoń, Mariusz; Żmijowska, Agnieszka; Wójcik, Marcin; Piotrowska-Seget, Zofia


    The ability of diazinon-degrading Serratia marcescens to remove organophosphorus pesticides (OPPs), i.e. chlorpyrifos (CP), fenitrothion (FT), and parathion (PT) was studied in a mineral salt medium (MSM) and in three soils of different characteristics. This strain was capable of using all insecticides at concentration of 50 mg/l as the only carbon source when grown in MSM, and 58.9%, 70.5%, and 82.5% of the initial dosage of CP, FT, and PT, respectively was degraded within 14 days. The biodegradation experiment showed that autochthonous microflora in all soils was characterized by a degradation potential of all tested OPPs; however, the initial lag phases for degradation of CP and FT, especially in sandy soil, were observed. During the 42-day experiment, 45.3%, 61.4% and 72.5% of the initial dose of CP, FT, and PT, respectively, was removed in sandy soil whereas the degradation of CP, FT, and PT in the same period, in sandy loam and silty soils reached 61.4%, 79.7% and 64.2%, and 68.9%, 81.0% and 63.6%, respectively. S. marcescens introduced into sterile soils showed a higher degradation potential (5-13%) for OPPs removal than those observed in non-sterile soil with naturally occurring attenuation. Inoculation of non-sterile soils with S. marcescens enhanced the disappearance rates of all insecticides, and DT50 for CP, FT, and PT was reduced by 20.7, 11.3 and 13.0 days, and 11.9, 7.0 and 8.1 days, and 9.7, 14.5 and 12.6 days in sandy, sandy loam, and silty soils, respectively, in comparison with non-sterile soils with only indigenous microflora. This ability of S. marcescens makes it a suitable strain for bioremediation of soils contaminated with OPPs. Copyright © 2013 Elsevier Ltd. All rights reserved.

  10. Enantioselective synthesis of (R)-phenylephrine by Serratia marcescens BCRC10948 cells that homologously express SM_SDR. (United States)

    Kuan, Yi-Chia; Xu, Yue-Bin; Wang, Wen-Ching; Yang, Ming-Te


    A short-chain dehydrogenase/reductase from Serratia marcescens BCRC10948, SM_SDR, has been cloned and expressed in Escherichia coli for the bioconversion of 1-(3-hydroxyphenyl)-2-(methylamino) ethanone (HPMAE) to (R)-phenylephrine[(R)-PE]. However, only 5.11mM (R)-PE was obtained from 10mM HPMAE after a 9h conversion in the previous report. To improve the biocatalytic efficiency, the homologous expression of the SM_SDR in S. marcescens BCRC10948 was achieved using the T5 promoter for expression. By using 2% glycerol as carbon source, we found that 8.00±0.15mM of (R)-PE with more than 99% enantiomeric excess was produced from 10mM HPMAE after 12h conversion at 30°C and pH 7.0. More importantly, by using 50mM HPMAE as the substrate, 23.78±0.84mM of (R)-PE was produced after a 12h conversion with the productivity and the conversion yield of 1.98mmol (R)-PE/lh and 47.50%, respectively. The recombinant S. marcescens cells could be recycled 6 times for the production of (R)-PE, and the bioconversion efficiency remained at 85% when compared to that at the first cycle. Our data indicated that a high conversion efficiency of HPMAE to (R)-PE could be achieved using S. marcescens BCRC10948 cells that homologously express the SM_SDR. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Cefepime shows good efficacy and no antibiotic resistance in pneumonia caused by Serratia marcescens and Proteus mirabilis - an observational study. (United States)

    Yayan, Josef; Ghebremedhin, Beniam; Rasche, Kurt


    Many antibiotics have no effect on Gram-positive and Gram-negative microbes, which necessitates the prescription of broad-spectrum antimicrobial agents that can lead to increased risk of antibiotic resistance. These pathogens constitute a further threat because they are also resistant to numerous beta-lactam antibiotics, as well as other antibiotic groups. This study retrospectively investigates antimicrobial resistance in hospitalized patients suffering from pneumonia triggered by Gram-negative Serratia marcescens or Proteus mirabilis. The demographic and clinical data analyzed in this study were obtained from the clinical databank of the HELIOS Clinic, Witten/Herdecke University, Wuppertal, Germany, for inpatients presenting with pneumonia triggered by S. marcescens or P. mirabilis from 2004 to 2014. An antibiogram was conducted for the antibiotics utilized as part of the management of patients with pneumonia triggered by these two pathogens. Pneumonia was caused by Gram-negative bacteria in 115 patients during the study period from January 1, 2004, to August 12, 2014. Of these, 43 (37.4 %) hospitalized patients [26 males (60.5 %, 95 % CI 45.9 %-75.1 %) and 17 females (39.5 %, 95 % CI 24.9 %-54.1 %)] with mean age of 66.2 ± 13.4 years had pneumonia triggered by S. marcescens, while 20 (17.4 %) patients [14 males (70 %, 95 % CI 49.9 %-90.1 %) and 6 females (30 %, 95 % CI 9.9 %-50.1 %)] with a mean age of 64.6 ± 12.8 years had pneumonia caused by P. mirabilis. S. marcescens showed an increased antibiotic resistance to ampicillin (100 %), ampicillin-sulbactam (100 %), and cefuroxime (100 %). P. mirabilis had a high resistance to tetracycline (100 %) and ampicillin (55 %). S. marcescens (P < 0.0001) and P. mirabilis (P = 0.0003) demonstrated no resistance to cefepime in these patients with pneumonia. S. marcescens and P. mirabilis were resistant to several commonly used antimicrobial agents, but showed no resistance to

  12. A novel medium for the enhanced cell growth and production of prodigiosin from Serratia marcescens isolated from soil

    Directory of Open Access Journals (Sweden)

    Muthukumaran Geetha


    Full Text Available Abstract Background Prodigiosin produced by Serratia marcescens is a promising drug owing to its reported characteristics of having antifungal, immunosuppressive and antiproliferative activity. From an industrial point of view the necessity to obtain a suitable medium to simultaneously enhance the growth of Serratia marcescens and the pigment production was the aim of this work. The usage of individual fatty acid as substrate in industries would be cost-effective in the long run and this paved the way for us to try the effect of different fatty acid-containing seeds and oils of peanut, sesame and coconut as source of substrate. Results The addition of sugars only showed slight enhancement of prodigiosin production in nutrient broth but not in fatty acid containing seed medium. The powdered peanut broth had supported better growth of Serratia marcescens and higher yield of prodigiosin when compared with the existing nutrient broth and peptone glycerol broth. A block in prodigiosin production was seen above 30°C in nutrient broth, but the fatty acid seed medium used by us supported prodigiosin production upto 42°C though the yields were lower than what was obtained at 28°C. From the results, the fatty acid form of carbon source has a role to play in enhanced cell growth and prodigiosin production. Conclusion We conclude by reporting that the powdered and sieved peanut seed of different quality grades were consistent in yielding a fourty fold increase in prodigiosin production over the existing media. A literature survey on the composition of the different media components in nutrient broth, peptone glycerol broth and the fatty acid containing seeds and oils enabled us to propose that the saturated form of fatty acid has a role to play in enhanced cell growth and prodigiosin production. This work has also enabled us to report that the temperature related block of prodigiosin biosynthesis varies with different media and the powdered peanut broth

  13. [Induced expression of Serratia marcescens ribonuclease III gene in transgenic Nicotiana tabacum L. cv. SR1 tobacco plants]. (United States)

    Zhirnov, I V; Trifonova, E A; Romanova, A V; Filipenko, E A; Sapotsky, M V; Malinovsky, V I; Kochetov, A V; Shumny, V K


    Transgenic Nicotiana tabacum L. cv. SR1 plants, characterized by an increase in the level of dsRNA-specific hydrolytic activity after induction by wounding, were obtained. The Solanum lycopersicum anionic peroxidase gene promoter (new for plant genetic engineering) was for the first time used for the induced expression of the target Serratia marcescens RNase III gene. Upon infection with the tobacco mosaic virus (TMV), the transgenic plants of the obtained lines did not differ significantly from the control group in the level of TMV capsid protein accumulation. In general, no delay in the development of the infection symptoms was observed in transgenic plants as compared with the control group. The obtained transgenic plants represent a new model for the study of the biological role of endoribonucleases from the RNase III family, including in molecular mechanisms of resistance to pathogens.

  14. Apoptosis of human lung adenocarcinoma A549 cells induced by prodigiosin analogue obtained from an entomopathogenic bacterium Serratia marcescens. (United States)

    Zhou, Wei; Jin, Zhi-Xiong; Wan, Yong-Ji


    An entomopathogenic bacterial strain SCQ1 was isolated from silkworm (Bombyx mori) and identified as Serratia marcescens via 16S rRNA gene analysis. This strain produces a red pigment that causes acute septicemia of silkworm. The red pigment of strain SCQ1 was identified as prodigiosin analogue (PGA) with various reported biological activities. In this study, we found that low concentration of PGA showed significant anticancer activity in human lung adenocarcinoma A549 cells, but has little effect in human bone marrow stem cells, in vitro. By exposure to different concentrations of PGA for 24 h, morphological changes and the MTT assay showed that A549 cell line was very sensitive to PGA, with IC(50) value about 2.2 mg/L. Early stage of apoptosis was detected by flow cytometry while A549 cells were treated with PGA for 4 and 12 h, respectively. The proportion of dead cells was increased with treatment time or the concentrations of PGA, but it was inversely proportional to that of apoptotic cells. These results indicate that PGA obtained from strain SCQ1 induces apoptosis in A549 cells, but the molecular mechanisms of cell death are complicated, and the S. marcescens strain SCQ1 may serve as a source of the anticancer compound, PGA.

  15. A Hospital-wide Outbreak of Serratia marcescens, and Ishikawa's “Fishbone” Analysis to Support Outbreak Control (United States)

    Vetter, Luzia; Schuepfer, Guido; Kuster, Stefan P.


    A nosocomial outbreak of Serratia marcescens in respiratory samples predominantly from patients in a surgical intensive care unit is reported. Most of these patients were cardiac surgical patients. Initially, a vigorous but inconclusive investigation was implemented on the basis of standardized (according the US Centers for Disease Control and Prevention) steps of outbreak investigation. Then, a systemic quality management approach with “fishbone” analysis was added. As a consequence, plausible causes for the outbreak were identified: (i) S marcescens was found on the transesophageal echocardiography probe used during cardiac surgery; and (ii) the quality of the surface disinfection was insufficient due to multiple reasons and was completely reengineered. In conclusion, in addition to the standardized steps of outbreak investigation, the complementary use of quality management tools such as the Ishikawa “fishbone” analysis is helpful for outbreak control. The complete reengineering of the disinfectant procurement and logistics is assumed to have been the most effective measure to control the described outbreak. PMID:26783861

  16. High Manganese Tolerance and Biooxidation Ability of Serratia marcescens Isolated from Manganese Mine Water in Minas Gerais, Brazil

    Directory of Open Access Journals (Sweden)

    Natália R. Barboza


    Full Text Available Manganese is an important metal for the maintenance of several biological functions, but it can be toxic in high concentrations. One of the main forms of human exposure to metals, such as manganese (Mn, is the consumption of solar salt contaminated. Mn-tolerant bacteria could be used to decrease the concentration of this metal from contaminated sites through safer environmental-friendly alternative technology in the future. Therefore, this study was undertaken to isolate and identify Mn resistant bacteria from water samples collected from a Mn mine in the Iron Quadrangle region (Minas Gerais, Brazil. Two bacterial isolates were identified as Serratia marcescens based on morphological, biochemical, 16S rDNA gene sequencing and phylogeny analysis. Maximum resistance of the selected isolates against increasing concentrations of Mn(II, up to 1200 mg L-1 was determined in solid media. A batch assay was developed to analyze and quantify the Mn removal capacities of the isolates. Biological Mn removal capacities of over 55% were detected for both isolates. Whereas that mechanism like biosorption, precipitation and oxidation could be explaining the Mn removal, we seek to give an insight into some of the molecular mechanisms adopted by S. marcescens isolates. For this purpose, the following approaches were adopted: leucoberbelin blue I assay, Mn(II oxidation by cell-free filtrate and electron microscopy and energy-dispersive X-ray spectroscopy analyses. Overall, these results indicate that S. marcescens promotes Mn removal in an indirect mechanism by the formation of Mn oxides precipitates around the cells, which should be further explored for potential biotechnological applications for water recycling both in hydrometallurgical and mineral processing operations.

  17. Protein Engineering and Homologous Expression of Serratia marcescens Lipase for Efficient Synthesis of a Pharmaceutically Relevant Chiral Epoxyester. (United States)

    Chen, Ke-Cai; Zheng, Ming-Min; Pan, Jiang; Li, Chun-Xiu; Xu, Jian-He


    The lipase isolated from Serratia marcescens (LipA) is a useful biocatalyst for kinetic resolution of a pharmaceutically relevant epoxyester, (±)-3-(4'-methoxyphenyl) glycidic acid methyl ester [(±)-MPGM], to afford optically pure (-)-MPGM, a key intermediate for the synthesis of diltiazem hydrochloride. Two mutants, LipA L315S and LipA S271F , were identified from the combinatorial saturation mutation library of 14 amino acid residues lining the substrate-binding pocket. LipA L315S , LipA S271F , and their combination LipA L315S/S271F showed 2.6-, 2.2-, and 4.6-fold improvements in their specific activities towards para-nitrophenyl butyrate (pNPB), respectively. Among these positive mutants, LipA S271F displayed a 3.5-fold higher specific activity towards the pharmaco substrate (±)-MPGM. Kinetic study showed that the improvement in catalytic efficiency of LipA S271F against (±)-MPGM was mainly resulted from the enhanced affinity between substrate and enzyme, as indicated by the decrease of K m . Furthermore, to address the insoluble expression issue in Escherichia coli, the homologous expression of LipA gene in S. marcescens was achieved by introducing it into an expression vector pUC18, resulting in ca. 20-fold higher lipase production. The significantly improved volumeric production and specific activity of S. marcescens lipase make it very attractive as a new-generation biocatalyst for more efficient and economical manufacturing of (-)-MPGM.

  18. SME-type carbapenem-hydrolyzing class A beta-lactamases from geographically diverse Serratia marcescens strains. (United States)

    Queenan, A M; Torres-Viera, C; Gold, H S; Carmeli, Y; Eliopoulos, G M; Moellering, R C; Quinn, J P; Hindler, J; Medeiros, A A; Bush, K


    Three sets of carbapenem-resistant Serratia marcescens isolates have been identified in the United States: 1 isolate in Minnesota in 1985 (before approval of carbapenems for clinical use), 5 isolates in Los Angeles (University of California at Los Angeles [UCLA]) in 1992, and 19 isolates in Boston from 1994 to 1999. All isolates tested produced two beta-lactamases, an AmpC-type enzyme with pI values of 8.6 to 9.0 and one with a pI value of approximately 9.5. The enzyme with the higher pI in each strain hydrolyzed carbapenems and was not inhibited by EDTA, similar to the chromosomal class A SME-1 beta-lactamase isolated from the 1982 London strain S. marcescens S6. The genes encoding the carbapenem-hydrolyzing enzymes were cloned in Escherichia coli and sequenced. The enzyme from the Minnesota isolate had an amino acid sequence identical to that of SME-1. The isolates from Boston and UCLA produced SME-2, an enzyme with a single amino acid change relative to SME-1, a substitution from valine to glutamine at position 207. Purified SME enzymes from the U. S. isolates had beta-lactam hydrolysis profiles similar to that of the London SME-1 enzyme. Pulsed-field gel electrophoresis analysis revealed that the isolates showed some similarity but differed by at least three genetic events. In conclusion, a family of rare class A carbapenem-hydrolyzing beta-lactamases first described in London has now been identified in S. marcescens isolates across the United States.

  19. SME-Type Carbapenem-Hydrolyzing Class A β-Lactamases from Geographically Diverse Serratia marcescens Strains (United States)

    Queenan, Anne Marie; Torres-Viera, Carlos; Gold, Howard S.; Carmeli, Yehuda; Eliopoulos, George M.; Moellering, Robert C.; Quinn, John P.; Hindler, Janet; Medeiros, Antone A.; Bush, Karen


    Three sets of carbapenem-resistant Serratia marcescens isolates have been identified in the United States: 1 isolate in Minnesota in 1985 (before approval of carbapenems for clinical use), 5 isolates in Los Angeles (University of California at Los Angeles [UCLA]) in 1992, and 19 isolates in Boston from 1994 to 1999. All isolates tested produced two β-lactamases, an AmpC-type enzyme with pI values of 8.6 to 9.0 and one with a pI value of approximately 9.5. The enzyme with the higher pI in each strain hydrolyzed carbapenems and was not inhibited by EDTA, similar to the chromosomal class A SME-1 β-lactamase isolated from the 1982 London strain S. marcescens S6. The genes encoding the carbapenem-hydrolyzing enzymes were cloned in Escherichia coli and sequenced. The enzyme from the Minnesota isolate had an amino acid sequence identical to that of SME-1. The isolates from Boston and UCLA produced SME-2, an enzyme with a single amino acid change relative to SME-1, a substitution from valine to glutamine at position 207. Purified SME enzymes from the U.S. isolates had β-lactam hydrolysis profiles similar to that of the London SME-1 enzyme. Pulsed-field gel electrophoresis analysis revealed that the isolates showed some similarity but differed by at least three genetic events. In conclusion, a family of rare class A carbapenem-hydrolyzing β-lactamases first described in London has now been identified in S. marcescens isolates across the United States. PMID:11036019

  20. Utilization of Mucus from the Coral Acropora palmata by the Pathogen Serratia marcescens and by Environmental and Coral Commensal Bacteria▿ † (United States)

    Krediet, Cory J.; Ritchie, Kim B.; Cohen, Matthew; Lipp, Erin K.; Sutherland, Kathryn Patterson; Teplitski, Max


    In recent years, diseases of corals caused by opportunistic pathogens have become widespread. How opportunistic pathogens establish on coral surfaces, interact with native microbiota, and cause disease is not yet clear. This study compared the utilization of coral mucus by coral-associated commensal bacteria (“Photobacterium mandapamensis” and Halomonas meridiana) and by opportunistic Serratia marcescens pathogens. S. marcescens PDL100 (a pathogen associated with white pox disease of Acroporid corals) grew to higher population densities on components of mucus from the host coral. In an in vitro coculture on mucus from Acropora palmata, S. marcescens PDL100 isolates outgrew coral isolates. The white pox pathogen did not differ from other bacteria in growth on mucus from a nonhost coral, Montastraea faveolata. The ability of S. marcescens to cause disease in acroporid corals may be due, at least in part, to the ability of strain PDL100 to build to higher population numbers within the mucus surface layer of its acroporid host. During growth on mucus from A. palmata, similar glycosidase activities were present in coral commensal bacteria, in S. marcescens PDL100, and in environmental and human isolates of S. marcescens. The temporal regulation of these activities during growth on mucus, however, was distinct in the isolates. During early stages of growth on mucus, enzymatic activities in S. marcescens PDL100 were most similar to those in coral commensals. After overnight incubation on mucus, enzymatic activities in a white pox pathogen were most similar to those in pathogenic Serratia strains isolated from human mucosal surfaces. PMID:19395569

  1. Quorum Sensing Regulation of Adhesion in Serratia Marcescens MG1 is surface dependent

    DEFF Research Database (Denmark)

    Labbate, M.; Zhu, H.; Thung, L.


    in a non-QS-controlled fashion. Therefore, the expression of these two genes appears to be cocontrolled by regulators other than the QS system for mediation of attachment to HCE cells. We also found that QS in S. marcescens regulates other potential cell surface adhesins, including exopolysaccharide...... and the outer membrane protein OmpX. We concluded that S. marcescens MG1 utilizes different regulatory systems and adhesins in attachment to biotic and abiotic surfaces and that QS is a main regulatory pathway in adhesion to an abiotic surface but not in adhesion to a biotic surface....

  2. Chorioamnionitis caused by Serratia marcescens in a healthy pregnant woman with preterm premature rupture of membranes: A rare case report and review of the literature. (United States)

    Erenberg, Miriam; Yagel, Yael; Press, Fernanda; Weintraub, Adi Y


    The incidence of chorioamnionitis varies widely. The highest incidence is reported in preterm deliveries. Among preterm deliveries, chorioamnionitis usually occurs after preterm premature rupture of membranes (PPROM). To date, only five cases of chorioamnionitis due to Serratia marcescens were reported. Here we present a case of a pregnant woman with chorioamnionitis due to Serratia marcescens who delivered a premature neonate at 28 weeks and four days of gestation. We also conducted a review of the literature in order to identify and characterize the clinical presentation and outcomes of this rare infection. A 36 year old female (gravida 9, para 6) was admitted with cervical effacement of 16mm and intact membranes at gestational age of 25 weeks and five days. One week following her admission PPROM was noticed. Treatment with the standard antibiotic regimen for PPROM was initiated. Thirteen days after the diagnosis of PPROM (28 weeks and four days) she developed chills, abdominal pain, sub febrile fever, tachycardia, leukocytosis and fetal tachycardia, and a clinical diagnosis of chorioamnionitis was made. An urgent CS was performed. In the first post-operative day the patient developed surgical sight infection. Cultures obtained from the purulent discharge of the wound, as well as cultures from the placenta and uterine cavity that were obtained during surgery grew Serratia marcescens. The patient was treated with Meropenem for six days, with a good clinical response. We present a rare case of nosocomialy acquired Serratia marcescens chorioamnionitis in a patient with PPROM. This case emphasizes the need for good infection control measures. Our favorable outcome together with the scares reports in the literature, add insight into this type of rare infection. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Coproduction of KPC-2 and IMP-10 in Carbapenem-Resistant Serratia marcescens Isolates from an Outbreak in a Brazilian Teaching Hospital. (United States)

    Silva, Kesia Esther; Cayô, Rodrigo; Carvalhaes, Cecilia Godoy; Patussi Correia Sacchi, Flávia; Rodrigues-Costa, Fernanda; Ramos da Silva, Ana Carolina; Croda, Julio; Gales, Ana Cristina; Simionatto, Simone


    We describe an outbreak caused by KPC-2- and IMP-10-producing Serratia marcescens isolates in a Brazilian teaching hospital. Tigecycline was the only active antimicrobial agent tested. The blaIMP-10 gene was located in a new class 1 integron, named In990, carried by a nonconjugative plasmid, in contrast to blaKPC-2. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  4. Assessing the stereoselectivity of Serratia marcescens CECT 977 2,3-butanediol dehydrogenase

    NARCIS (Netherlands)

    Medici, R.; Stammes, J.K.; Otten, L.G.; Hanefeld, U.; Kwakernaak, Stender


    α-Hydroxy ketones and vicinal diols constitute well-known building blocks in organic synthesis. Here we describe one enzyme that enables the enantioselective synthesis of both building blocks starting from diketones. The enzyme 2,3-butanediol dehydrogenase (BudC) from S. marcescens CECT 977 belongs

  5. A Serratia marcescens PigP homolog controls prodigiosin biosynthesis, swarming motility and hemolysis and is regulated by cAMP-CRP and HexS.

    Directory of Open Access Journals (Sweden)

    Robert M Q Shanks

    Full Text Available Swarming motility and hemolysis are virulence-associated determinants for a wide array of pathogenic bacteria. The broad host-range opportunistic pathogen Serratia marcescens produces serratamolide, a small cyclic amino-lipid, that promotes swarming motility and hemolysis. Serratamolide is negatively regulated by the transcription factors HexS and CRP. Positive regulators of serratamolide production are unknown. Similar to serratamolide, the antibiotic pigment, prodigiosin, is regulated by temperature, growth phase, HexS, and CRP. Because of this co-regulation, we tested the hypothesis that a homolog of the PigP transcription factor of the atypical Serratia species ATCC 39006, which positively regulates prodigiosin biosynthesis, is also a positive regulator of serratamolide production in S. marcescens. Mutation of pigP in clinical, environmental, and laboratory strains of S. marcescens conferred pleiotropic phenotypes including the loss of swarming motility, hemolysis, and severely reduced prodigiosin and serratamolide synthesis. Transcriptional analysis and electrophoretic mobility shift assays place PigP in a regulatory pathway with upstream regulators CRP and HexS. The data from this study identifies a positive regulator of serratamolide production, describes novel roles for the PigP transcription factor, shows for the first time that PigP directly regulates the pigment biosynthetic operon, and identifies upstream regulators of pigP. This study suggests that PigP is important for the ability of S. marcescens to compete in the environment.

  6. Phytosynthesized silver nanoparticles as antiquorum sensing and antibiofilm agent against the nosocomial pathogen Serratia marcescens: an in vitro study. (United States)

    Ravindran, D; Ramanathan, S; Arunachalam, K; Jeyaraj, G P; Shunmugiah, K P; Arumugam, V R


    Serratia marcescens is an important multidrug-resistant human pathogen. The pathogenicity of S. marcescens mainly depends on the quorum sensing (QS) mechanism, which regulates the virulence factors production and biofilm formation. Hence, targeting QS mechanism in S. marcescens will ultimately pave the way to combat its pathogenicity. Thus, the present study is intended to evaluate the efficacy of Vetiveria zizanioides root extract-mediated silver nanoparticles (AgNPs) as a potent anti-QS and antibiofilm agent against S. marcescens. The AgNPs were synthesized using V. zizanioides aqueous root extract and the physiochemical properties of V. zizanioides-based AgNPs (VzAgNPs) were evaluated using analytical techniques such as ultraviolet-visible absorption spectroscopy, X-ray diffraction, Fourier transform infrared spectroscopy, dynamic light scattering and scanning and transmission electron microscopic techniques. VzAgNPs were found to attenuate the QS-dependent virulence factors, namely prodigiosin, protease, lipase, exopolysaccharide productions and biofilm formation of S. marcescens, without inhibiting its growth. Further, the transcriptomic analysis confirmed the down-regulation of QS-dependent genes, which encode for the production of virulence factors and biofilm formation. The current study confirms VzAgNPs as an ideal anti-QS and antibiofilm agent against S. marcescens. This is the first approach that validates the anti-QS and antibiofilm potential of phytosynthesized VzAgNPs against the nosocomial pathogen, S. marcescens. As VzAgNPs exhibits potent antivirulent activities, it could be used to treat hospital-acquired S. marcescens infections. © 2018 The Society for Applied Microbiology.

  7. Intensified colonisation screening according to the recommendations of the German Commission for Hospital Hygiene and Infectious Diseases Prevention (KRINKO): identification and containment of a Serratia marcescens outbreak in the neonatal intensive care unit, Jena, Germany, 2013-2014. (United States)

    Dawczynski, Kristin; Proquitté, Hans; Roedel, Jürgen; Edel, Brigit; Pfeifer, Yvonne; Hoyer, Heike; Dobermann, Helke; Hagel, Stefan; Pletz, Mathias W


    In 2013, the German Commission for Hospital Hygiene and Infectious Disease Prevention (KRINKO) stated that extending weekly colonisation screening from very low birth weight (VLBW) infants (Serratia marcescens. Strains were typed by Pulsed Field Gel Electrophoresis (PFGE). Over 6 months, 19 out of 159 infants acquired S. marcescens. Twelve of the nineteen patients with S. marcescens were non-VLBW infants, and they were colonised significantly earlier than were VLBW infants (median 17 vs. 28 days; p marcescens.

  8. A strain of Serratia marcescens pathogenic for larvae of Lymantria dispar: Characterization (United States)

    J.D. Podgwaite; B.J. Cosenza


    A gram-negative bacillus, pathogenic for gypsy moth larvae, was characterized culturally, morphologically, and physiologically as a member of the Serratia group of the family Enterobacteriaceae. The microorganism lacked the pigmentation characteristic of the group but was generally distinguished from closely related members of the family by its...

  9. The structure of Serratia marcescens Lip, a membrane-bound component of the type VI secretion system

    Energy Technology Data Exchange (ETDEWEB)

    Rao, Vincenzo A.; Shepherd, Sharon M.; English, Grant; Coulthurst, Sarah J.; Hunter, William N., E-mail: [College of Life Sciences, University of Dundee, Dundee DD1 5EH, Scotland (United Kingdom)


    The high-resolution crystal structure of S. marcescens Lip reveals a new member of the transthyretin family of proteins. Lip, a core component of the type VI secretion apparatus, is localized to the outer membrane and is positioned to interact with other proteins forming this complex system. Lip is a membrane-bound lipoprotein and a core component of the type VI secretion system found in Gram-negative bacteria. The structure of a Lip construct (residues 29–176) from Serratia marcescens (SmLip) has been determined at 1.92 Å resolution. Experimental phases were derived using a single-wavelength anomalous dispersion approach on a sample cocrystallized with iodide. The membrane localization of the native protein was confirmed. The structure is that of the globular domain lacking only the lipoprotein signal peptide and the lipidated N-terminus of the mature protein. The protein fold is dominated by an eight-stranded β-sandwich and identifies SmLip as a new member of the transthyretin family of proteins. Transthyretin and the only other member of the family fold, 5-hydroxyisourate hydrolase, form homotetramers important for their function. The asymmetric unit of SmLip is a tetramer with 222 symmetry, but the assembly is distinct from that previously noted for the transthyretin protein family. However, structural comparisons and bacterial two-hybrid data suggest that the SmLip tetramer is not relevant to its role as a core component of the type VI secretion system, but rather reflects a propensity for SmLip to participate in protein–protein interactions. A relatively low level of sequence conservation amongst Lip homologues is noted and is restricted to parts of the structure that might be involved in interactions with physiological partners.

  10. The structure of Serratia marcescens Lip, a membrane-bound component of the type VI secretion system

    International Nuclear Information System (INIS)

    Rao, Vincenzo A.; Shepherd, Sharon M.; English, Grant; Coulthurst, Sarah J.; Hunter, William N.


    The high-resolution crystal structure of S. marcescens Lip reveals a new member of the transthyretin family of proteins. Lip, a core component of the type VI secretion apparatus, is localized to the outer membrane and is positioned to interact with other proteins forming this complex system. Lip is a membrane-bound lipoprotein and a core component of the type VI secretion system found in Gram-negative bacteria. The structure of a Lip construct (residues 29–176) from Serratia marcescens (SmLip) has been determined at 1.92 Å resolution. Experimental phases were derived using a single-wavelength anomalous dispersion approach on a sample cocrystallized with iodide. The membrane localization of the native protein was confirmed. The structure is that of the globular domain lacking only the lipoprotein signal peptide and the lipidated N-terminus of the mature protein. The protein fold is dominated by an eight-stranded β-sandwich and identifies SmLip as a new member of the transthyretin family of proteins. Transthyretin and the only other member of the family fold, 5-hydroxyisourate hydrolase, form homotetramers important for their function. The asymmetric unit of SmLip is a tetramer with 222 symmetry, but the assembly is distinct from that previously noted for the transthyretin protein family. However, structural comparisons and bacterial two-hybrid data suggest that the SmLip tetramer is not relevant to its role as a core component of the type VI secretion system, but rather reflects a propensity for SmLip to participate in protein–protein interactions. A relatively low level of sequence conservation amongst Lip homologues is noted and is restricted to parts of the structure that might be involved in interactions with physiological partners

  11. The Multifarious PGPR Serratia marcescens CDP-13 Augments Induced Systemic Resistance and Enhanced Salinity Tolerance of Wheat (Triticum aestivum L..

    Directory of Open Access Journals (Sweden)

    Rajnish Prakash Singh

    Full Text Available The present study demonstrates the plant growth promoting (PGP potential of a bacterial isolate CDP-13 isolated from 'Capparis decidua' plant, and its ability to protect plants from the deleterious effect of biotic and abiotic stressors. Based on 16S rRNA gene sequence analysis, the isolate was identified as Serratia marcescens. Among the PGP traits, the isolate was found to be positive for ACC deaminase activity, phosphate solubilization, production of siderophore, indole acetic acid production, nitrogen fixation, and ammonia production. CDP-13 showed growth at an increased salt (NaCl concentration of up to 6%, indicating its potential to survive and associate with plants growing in saline soil. The inoculation of S. marcescens enhanced the growth of wheat plant under salinity stress (150-200 mM. It significantly reduced inhibition of plant growth (15 to 85% caused by salt stressors. Application of CDP-13 also modulated concentration (20 to 75% of different osmoprotectants (proline, malondialdehyde, total soluble sugar, total protein content, and indole acetic acid in plants suggesting its role in enabling plants to tolerate salt stressors. In addition, bacterial inoculation also reduced the disease severity caused by fungal infection, which illustrated its ability to confer induced systemic resistance (ISR in host plants. Treatment of wheat plants with the test organism caused alteration in anti-oxidative enzymes activities (Superoxide dismutase, Catalase, and Peroxidase under various salinity levels, and therefore minimizes the salinity-induced oxidative damages to the plants. Colonization efficiency of strain CDP-13 was confirmed by CFU count, epi-fluorescence microscopy, and ERIC-PCR-based DNA fingerprinting approach. Hence, the study indicates that bacterium CDP-13 enhances plant growth, and has potential for the amelioration of salinity stress in wheat plants. Likewise, the results also provide insights into biotechnological approaches to

  12. Nosocomial epidemic of Serratia marcescens septicemia ascribed to contaminated blood transfusion bags

    DEFF Research Database (Denmark)

    Heltberg, Ole; Skov, F; Gerner-Smidt, P


    isolates was performed. For comparison, a strain from the production plant and eight other, unrelated bacteremia isolates were examined. In addition, a retrospective national survey was carried out. S. marcescens was cultured from 11 (0.73%) of 1515 blood units, and an additional (third) bacteremic patient...... was identified. The clinical isolates from three patients, the three units of blood transfused, and the plant-derived strain shared a unique ribotype. The incident is interpreted as a sporadic, bacterial contamination of blood bags with the S. marcescens epidemic strain, occurring during the manufacturing...... or packaging. A similar incident has not previously been reported. Attention is drawn to the possibility of significant contamination during the complex production of multiple-bag blood collection systems. Guidelines for improved registration and handling of transfusion complications in wards are suggested...

  13. Effect of Biodiesel Concentration on Corrosion of Carbon Steel by Serratia marcescens

    Directory of Open Access Journals (Sweden)

    Pusparizkita Yustina M


    Full Text Available Biodiesel come into being used as an alternative source of energy as the diminishing of petroleum reserves. This fuel is typically stored in tanks that are commonly made from carbon steel, which is easily corroded by microorganisms. Recent studies have shown that bacteria aside from SRB may also be involved in corrosion. Therefore, this research was aimed to evaluate the effect of biodiesel concentration (15%, 20% and 30% v/v mixed in diesel oil on the corrosion of carbon steel by S. marcescens that dominate biocorrosion on hydrocarbon products. In this study, the corrosion process was investigated by evaluation of biofilm morphology and composition, the rate of corrosion and the corrosion product of carbon steel which was exposed in the mixture of hydrocarbons and the presence of S. marcescens. It can be concluded that higher concentration of biodiesel in diesel oil leads to higher growth of bacteria in the biofilm and higher corrosion rate.

  14. Is there a role for Serratia marcescens in male infertility: An experimental study? (United States)

    Rana, Kalpana; Thaper, Deepali; Prabha, Vijay


    Establishment of a male BALB/c mouse model to study the role of sperm impairing S. marcescens on mouse reproductive potential. The current study can add to use of reliable animal models to provide a noteworthy evidence for the microbial cause of infertility. The mice in the test groups II, III, IV were intraperitoneally administered with different doses (10 4 , 10 6 or 10 8  cfu) of S. marcescens whereas, group I serving as control, received PBS, for 10 consecutive days. The groups were evaluated for any change in body weight, tissue somatic index (%), seminal parameters and histology. Confirmation of S. marcescens from reproductive organs was done by reisolating the same by cultural characteristics and biochemical tests. The results showed that weight gain was evident only in mice receiving PBS (group I), whereas a decrease was recorded in the test groups (group II, III and IV). Only testes of test groups showed significant changes in TSI values whereas, no change in TSI was observed in any reproductive organ of any test group. Seminal parameters viz. sperm count, motility and viability were found to decrease in test groups II, III and IV as compared to control group I. Interestingly, the number of pus cells and percent decapitation was more prominent in test groups which received higher doses (i.e. group III and group IV). The histopathological examination revealed mild to dense inflammation in vas deferens and caudal epididymis in all test groups except hypospermatogenesis which was observed only in test group III and IV. However, in group I, neither adverse changes nor any sign of inflammation were observed. Intraperitoneal inoculation of S. marcescens could lead to alteration of semen parameters, induction of decapitation in spermatozoa and histopathological changes, thereby decreasing the reproductive potential of male mice. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Multi-effect of the water-soluble Moringa oleifera lectin against Serratia marcescens and Bacillus sp.: antibacterial, antibiofilm and anti-adhesive properties. (United States)

    Moura, M C; Trentin, D S; Napoleão, T H; Primon-Barros, M; Xavier, A S; Carneiro, N P; Paiva, P M G; Macedo, A J; Coelho, L C B B


    To evaluate the antibiofilm potential of water-soluble Moringa oleifera seed lectin (WSMoL) on Serratia marcescens and Bacillus sp. WSMoL inhibited biofilm formation by S. marcescens at concentrations lower than 2·6 μg ml -1 and impaired bacterial growth at higher concentrations, avoiding biofilm formation. For Bacillus sp., the lectin inhibited bacterial growth at all concentrations. The antibiofilm action of WSMoL is associated with damage to bacterial cells. WSMoL did not disrupt preformed S. marcescens biofilms but was able to damage cells inside them. On the other hand, the lectin reduced the number of cells in Bacillus sp. biofilm treated with it. WSMoL was able to control biofilm formation when immobilized on glass surface (116 μg cm -2 ), damaging S. marcescens cells and avoiding adherence of Bacillus sp. cells on glass. The Bacillus sp. isolate is member of Bacillus subtilis species complex and closely related to species of the conspecific 'amyloliquefaciens' group. WSMoL prevented biofilm development by S. marcescens and Bacillus sp. and the antibiofilm effect is also observed when the lectin is immobilized on glass. Taking together, our results provide support to the potential use of WSMoL for controlling biofilm formation by bacteria. © 2017 The Society for Applied Microbiology.

  16. Application of Statistical Design to the Optimization of Culture Medium for Prodigiosin Production by Serratia marcescens SWML08

    Directory of Open Access Journals (Sweden)

    Venil, C. K.


    Full Text Available Combination of Plackett – Burman design (PBD and Box – Behnken design (BBD were applied for optimization of different factors for prodigiosin production by Serratia marcescens SWML08. Among 11 factors, incubation temperature, and supplement of (NH42PO4 and trace salts into the culture medium were selected due to significant positive effect on prodigiosin yield. Box - Behnken design, a response surface methodology, was used for further optimization of these selected factors for better prodigiosin output. Data were analyzed step wise and a second order polynomial model was established to identify the relationship between the prodigiosin output and the selected factors. The media formulations were optimized having the factors such as incubation temperature 30 °C, (NH42PO4 6 g/L and trace salts 0.6 g/L. The maximum experimental response for prodigiosin production was 1397.96 mg/L whereas the predicted value was 1394.26 mg/L. The high correlation between the predicted and observed values indicated the validity of the statistical design.

  17. Improved production, purification, and characterization of biosurfactants produced by Serratia marcescens SM3 and its isogenic SMRG-5 strain. (United States)

    Rosas-Galván, Nashbly Sarela; Martínez-Morales, Fernando; Marquina-Bahena, Silvia; Tinoco-Valencia, Raunel; Serrano-Carreón, Leobardo; Bertrand, Brandt; León-Rodríguez, Renato; Guzmán-Aparicio, Josefina; Alvaréz-Berber, Laura; Trejo-Hernández, María R


    In this study, the biosurfactants (Bs) production of two Serratia marcescens strains (SM3 and its isogenic SMRG-5 strain) was improved and the tenso-active agents were purified and characterized. A 2 3 factorial design was used to evaluate the effect of nitrogen and carbon sources on the surface tension (ST) reduction and emulsion index (EI 24 ) of the produced Bs. Optimum Bs production by SM3 was achieved at high concentrations of carbon and nitrogen, reducing ST to 26.5 ± 0.28 dynes/cm, with an EI 24 of 79.9 ± 0.2%. Meanwhile, the best results for SMRG-5 were obtained at low concentrations, reducing the ST to 25.2 ± 0.2 dynes/cm, with an EI 24 of 89.7 ± 0.28%. The optimal conditions for Bs production were scaled up in a 2-L reactor, yielding 4.8 and 5.2 g/L for SM3 and SMRG-5, respectively. Gas Chromatography-Mass Spectrometry (GC-MS) analysis revealed the presence of two different lipopeptides (hidrofobic fractions: octadecanoic and hexadecanoic acid for SM3 and SMRG5, respectively). Both strains were capable of benzo [a] pyrene removal (59% after 72 H of culture). © 2018 International Union of Biochemistry and Molecular Biology, Inc.

  18. Regulation of the chitin degradation and utilization system by the ChiX small RNA in Serratia marcescens 2170. (United States)

    Suzuki, Kazushi; Shimizu, Mari; Sasaki, Naomi; Ogawa, Chisana; Minami, Haruka; Sugimoto, Hayuki; Watanabe, Takeshi


    Serratia marcescens 2170 produces three different types of chitinases and chitin-binding protein CBP21. We found that transposon insertion into the 5' untranslated region (5' UTR) of chiPQ-ctb led to defective chitinase and CBP21 production. ChiX small RNA possessed the complementary sequence of the 5' UTRs of the chiPQ-ctb and chiR and repressed the expression of chiP and chiR. ChiX was detected in a medium containing glucose, glycerol, GlcNAc, and (GlcNAc)2, but the expression of both chiP and chiR was only observed in a medium containing (GlcNAc)2. ∆chiX mutant produced chitinases, CBP21, and chitobiase without induction. chiP transcripts were more abundant than those of chiR or chiX in a medium containing (GlcNAc)2. These results suggest that the constitutively expressed ChiX binds to the highly abundant chiP 5' UTR, thereby leading to the induction of chiR mRNA translation and the subsequent expression of chitinases and CBP21.

  19. Effects of temperature, nutrients, organic matter and coral mucus on the survival of the coral pathogen, Serratia marcescens PDL100. (United States)

    Looney, Erin E; Sutherland, Kathryn P; Lipp, Erin K


    Serratia marcescens is an enteric bacterium that causes white pox disease in elkhorn coral, Acropora palmata; however, it remains unclear if the pathogenic strain has adapted to seawater or if it requires a host or reservoir for survival. To begin to address this fundamental issue, the persistence of strain PDL100 was compared among seawater and coral mucus microcosms. Median survival time across all conditions ranged from a low of 15 h in natural seawater [with a first-order decay constant (k) = -0.173] at 30°C to a maximum of 120 h in glucose-amended A. palmata mucus (k = -0.029) at 30°C. Among seawater and mucus microcosms, median survival time was significantly greater within Siderastrea siderea mucus compared with seawater or mucus of Montastraea faveolata or A. palmata (P palmata mucus (P < 0.0001). Increasing the temperature of seawater to 35°C resulted in a significantly slower decay than that observed at 30°C (P < 0.0001). The results of this study indicate that PDL100 is not well-adapted to marine water; however, survival can be improved by increasing temperature, the availability of coral mucus from S. siderea and most notably the presence of dissolved organic carbon. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.

  20. Mitochondrial dysfunction in Trypanosoma cruzi: the role of Serratia marcescens prodigiosin in the alternative treatment of Chagas disease

    Directory of Open Access Journals (Sweden)

    Triana Omar


    Full Text Available Abstract Background Chagas disease is a health threat for many people, mostly those living in Latin America. One of the most important problems in treatment is the limitation of existing drugs. Prodigiosin, produced by Serratia marcescens (Rhodnius prolixus endosymbiont, belongs to the red-pigmented bacterial prodiginine family, which displays numerous biological activities, including antibacterial, antifungal, antiprotozoal, antimalarial, immunosuppressive, and anticancer properties. Here we describe its effects on Trypanosoma cruzi mitochondria belonging to Tc I and Tc II. Results Parasites exposed to prodigiosin altered the mitochondrial function and oxidative phosphorylation could not have a normal course, probably by inhibition of complex III. Prodigiosin did not produce cytotoxic effects in lymphocytes and Vero cells and has better effects than benznidazole. Our data suggest that the action of prodigiosin on the parasites is mediated by mitochondrial structural and functional disruptions that could lead the parasites to an apoptotic-like cell death process. Conclusions Here, we propose a potentially useful trypanocidal agent derived from knowledge of an important aspect of the natural life cycle of the parasite: the vector-parasite interaction. Our results indicate that prodigiosin could be a good candidate for the treatment of Chagas disease.

  1. Enhancement of prodigiosin production by Serratia marcescens TKU011 and its insecticidal activity relative to food colorants. (United States)

    Liang, Tzu-Wen; Chen, Shin-Yi; Chen, Yen-Chern; Chen, Chia-Hung; Yen, Yue-Horng; Wang, San-Lang


    Prodigiosin (PG) has been reported to have various biological activities. With the aim of increasing Serratia marcescens TKU011 PG production on squid pen powder (SPP)-containing medium, the effects of phosphate and ferrous ion supplementation, autoclave treatment, and aeration were studied. Autoclave treatment showed positive results for PG productivity (2.48 mg/mL), which increased 2.5-fold when the organism was incubated in 50 mL of 40-min autoclaved medium in a baffle-based flask (250 mL) containing 1.5% SPP at 30 °C for 1 day and then at 25 °C for 2 additional days. Furthermore, the use of pigments including PG and the food colorants Allura Red AC (R40) and Tartrazine (Y4) as insecticides was also investigated. The lethal concentrations causing 50% Drosophila larval mortality (LC50) of PG, Y4, and R40 using a 5-d exposure period were 230, 449, and 30000 ppm, respectively. The results indicated that the biopigment PG and the food colorant Y4 were potentially toxic to Drosophila larvae. © 2013 Institute of Food Technologists®

  2. Epidemiology and molecular characterization of extended-spectrum beta-lactamase-producing Enterobacter spp., Pantoea agglomerans, and Serratia marcescens isolates from a Bulgarian hospital. (United States)

    Markovska, Rumyana Donkova; Stoeva, Temenuga Jekova; Bojkova, Kalina Dineva; Mitov, Ivan Gergov


    Forty-two extended-spectrum beta-lactamase (ESBL)-producing isolates of Enterobacter aerogenes, Enterobacter cloacae, Pantoea agglomerans, and Serratia marcescens, collected consecutively during the period January-November 2011 from the University Hospital in Varna, Bulgaria, were studied to characterize their ESBLs by isoelectric focusing, group-specific PCR, and sequencing. The epidemiological relationship was evaluated by random amplified polymorphic DNA analysis (RAPD). Transferability of ESBL genes was determined by conjugation experiments. Plasmid analysis was done by replicon typing and PstI fingerprinting. The overall rate of ESBL production was 20%. The most widespread enzyme was CTX-M-3, found in 64%. It was dominant in E. aerogenes (100%) and S. marcescens (83%). SHV-12, CTX-M-3, and CTX-M-15 were found among E. cloacae isolates in 50%, 35%, and 45%, respectively. Three main CTX-M-3-producing epidemic clones of E. aerogenes and S. marcescens have been detected. Among E. cloacae isolates, six different RAPD profiles were discerned. The plasmids harboring blaCTX-M-3 belonged to IncL/M type and demonstrated similar PstI fingerprinting profiles. IncFII plasmids were detected in two CTX-M-15-producing E. cloacae isolates. Our results demonstrate wide intrahospital dissemination of clonal E. aerogenes and S. marcescens isolates, carrying IncL/M conjugative plasmids.

  3. Biodegradation of 1,1,1-trichloro-2,2-bis(4-chlorophenyl) ethane (DDT) by using Serratia marcescens NCIM 2919. (United States)

    Grewal, Jasneet; Bhattacharya, Amrik; Kumar, Sumit; Singh, Dileep K; Khare, Sunil K


    A solvent tolerant bacterium Serratia marcescens NCIM 2919 has been evaluated for degradation of DDT (1,1,1-trichloro-2,2-bis (4-chlorophenyl) ethane). The bacterium was able to degrade up to 42% of initial 50 mg L -1 of DDT within 10 days of incubation. The highlight of the work was the elucidation of DDT degradation pathway in S. marcescens. A total of four intermediates metabolites viz. 2,2-bis (chlorophenyl)-1,1-dichloroethane (DDD), 2,2-bis (chlorophenyl)-1,1-dichloroethylene (DDE), 2,2-bis (chlorophenyl)-1-chloroethylene (DDMU), and 4-chlorobenzoic acid (4-CBA) were identified by GC-Mass and FTIR. 4-CBA was found to be the stable product of DDT degradation. Metabolites preceding 4-CBA were not toxic to strain as reveled through luxuriant growth in presence of varying concentrations of exogenous DDD and DDE. However, 4-CBA was observed to inhibit the growth of bacterium. The DDT degrading efficiency of S. marcescens NCIM 2919 hence could be used in combination with 4-CBA utilizing strains either as binary culture or consortia for mineralization of DDT. Application of S. marcescens NCIM 2919 to DDT contaminated soil, showed 74.7% reduction of initial 12.0 mg kg -1 of DDT after 18-days of treatment.

  4. Genome analysis of urease positive Serratia marcescens, co-producing SRT-2 and AAC(6')-Ic with multidrug efflux pumps for antimicrobial resistance. (United States)

    Srinivasan, Vijaya Bharathi; Rajamohan, Govindan


    In this study, we present the genome sequence of Serratia marcescens SM03, recovered from a human gut in India. The final assembly consists of 26 scaffolds (4620 coding DNA sequences, 5.08 Mb, 59.6% G + C ratio) and 79 tRNA genes. Analysis identified novel genes associated with lactose utilization, virulence, P-loop GTPases involved in urease production, CFA/I fimbriae apparatus and Yersinia - type CRISPR proteins. Antibiotic susceptibility testing indicated drug tolerant phenotype and inhibition assays demonstrated involvement of extrusion in resistance. Presence of enzymes SRT-2, AAC(6')-Ic, with additional Ybh transporter and EamA-like efflux pumps signifies the genetic plasticity observed in S. marcescens SM03. Copyright © 2018 Elsevier Inc. All rights reserved.

  5. Purification, crystallization and preliminary X-ray analysis of the outer membrane complex HasA–HasR from Serratia marcescens

    International Nuclear Information System (INIS)

    Huché, Frédéric; Delepelaire, Philippe; Wandersman, Cécile; Welte, Wolfram


    The expression, purification, and crystallization in space group P2 1 2 1 2 1 of the complex HasA-HasR from S. marcescens are reported. Diffraction data have been collected and processed to 6.8 Å. Serratia marcescens is able to acquire iron using its haem-acquisition system (‘has’), which contains an outer membrane receptor HasR and a soluble haemophore HasA. After secretion, HasA binds free haem in the extracellular medium or extracts it from haemoproteins and delivers it to the receptor. Here, the crystallization of a HasA–HasR complex is reported. HasA and HasR have been overexpressed in Escherichia coli and the complex formed and crystallized. Small platelets and bunches of needles of dimensions 0.01 × 0.1 × 1 mm were obtained. A native data set has been collected to 6.8 Å

  6. Spectroscopic Characterization of Extracellular Polymeric Substances from Escherichia coli and Serratia marcescens: Suppression using Sub-Inhibitory Concentrations of Bismuth Thiols

    Energy Technology Data Exchange (ETDEWEB)

    Badireddy, Appala R.; Korpol, Bhoom Reddy; Chellam, Shankararaman; Gassman, Paul L.; Engelhard, Mark H.; Lea, Alan S.; Rosso, Kevin M.


    Free and capsular EPS produced by Escherichia coli and Serratia marcescens were characterized in detail using Fourier transform infrared spectroscopy (FTIR), X-ray photoelectron spectroscopy (XPS), and Auger electron spectroscopy (AES). Total EPS production decreased upon treatment with sub-inhibitory concentrations of lipophilic bismuth thiols (bismuth dimercaptopropanol, BisBAL; bismuth ethanedithiol, BisEDT; and bismuth pyrithione, BisPYR), BisBAL being most effective. Bismuth thiols also influenced acetylation and carboxylation of polysaccharides in EPS from S. marcescens. Extensive homology between EPS samples in the presence and absence of bismuth was observed with proteins, polysaccharides, and nucleic acids varying predominantly only in the total amount expressed. Second derivative analysis of the amide I region of FTIR spectra revealed decreases in protein secondary structures in the presence of bismuth thiols. Hence, anti-fouling properties of bismuth thiols appear to originate in their ability to suppress O-acetylation and protein secondary structures in addition to total EPS secretion.

  7. Identification of Serratia marcescens SE1 and determination of its Herbicide 2,2-dichloropropionate (2,2-DCP Degradation Potential

    Directory of Open Access Journals (Sweden)

    Abel, E.


    Full Text Available Aims: The goal of the study is to isolate species of bacteria that capable of utilizing 2,2-dichloropropionic acid (2,2-DCP as sole carbon source from soil sample collected from surrounding lake water located in Universiti Teknologi Malaysia, Skudai, Johor. Methodology and Results: Genomic DNA from bacterium SE1 was extracted and PCR amplification was carried out using universal primers, Fd1 (5’ - AGA GTT TGA TCC TGGCTC AG - 3’ and rP1 (5’- ACG GTC ATA CCT TGT TAC GAC TT - 3’ before sending for sequencing. The 16S rDNA nucleotide sequences were compared with Basic Local Alignment Search Tool nucleotide (BLASTn and further analyzed using phylogenetic tree of Neighbour-Joining method (MEGA 5. Phylogenetic analysis indicated that SE1 strain clearly shared 97% homology to the genus of Serratia marcescens and therefore designated as Serratia marcescens sp. SE1. SE1 exhibited the ability to utilize 2,2-DCP as sole carbon source at 20 mM concentration with cell doubling time of 5 h and maximum chloride ion release of 38 μmolCl-/mL. This result suggests that the dehalogenase enzyme present in the bacteria has high affinity towards the substrate. Based on morphological and partial biochemical characteristics, strain SE1 was a non-motile Gram negative bacterium with red colonies, that gave a catalase positive reaction. Conclusion, significance and impact of study: A better understanding of dehalogenases enzyme produce by this S. marcescens sp. SE1 in general will be useful to be used as bioremediation tools for environmental management. This is the first reported case that Serratia sp. has the ability to degrade halogenated compound.

  8. Identification by real-time PCR with SYBR Green of Leishmania spp. and Serratia marcescens in canine 'sterile' cutaneous nodular lesions. (United States)

    Cornegliani, Luisa; Corona, Antonio; Vercelli, Antonella; Roccabianca, Paola


    Noninfectious, non-neoplastic, nodular to diffuse, so-called 'sterile' granulomatous/pyogranulomatous skin lesions (SGPSLs) are infrequently identified in dogs and may represent a diagnostic challenge. Their correct identification is based on history, histopathology and absence of intralesional foreign bodies and micro-organisms. The aim of this study was to investigate the presence of Leishmania spp., Mycobacterium spp., Serratia marcescens and Nocardia spp. by real-time PCR in canine nodular skin lesions histologically diagnosed as putatively sterile. Formalin-fixed skin biopsies were collected from 40 dogs. All samples were associated with an SGPSL diagnosis characterized by multifocal, nodular to diffuse, periadnexal and perifollicular pyogranulomas/granulomas. Neither micro-organisms nor foreign bodies were detected with haematoxylin and eosin staining, under polarized light. Further analyses included periodic acid Schiff, Ziehl-Neelsen, Fite Faraco, Giemsa and Gram histochemical stains; anti-Bacillus Calmette-Guérin (BCG) and Leishmania spp. immunohistochemistry; and real-time PCR analysis for Leishmania spp., Mycobacterium spp., S. marcescens and Nocardia spp. Special stains and BCG/immunohistochemistry were negative in all samples. Real-time PCR was positive for Leishmania spp. in four of 40 biopsies and for S. marcescens in two of 40 samples. Real-time PCR for Mycobacterium spp. and Nocardia spp. was negative. No correlation between real-time PCR positivity and a specific histological pattern was identified. Leishmania spp. have been previously identified as possible agents of certain SGPSLs, while the involvement of S. marcescens has not been investigated previously. According to our findings, Serratia spp. should be included in the list of agents possibly associated with a subgroup of granulomatous/pyogranulomatous skin lesions in dogs. © 2015 ESVD and ACVD.

  9. Caracterización del efecto anticanceroso e identificación de dianas moleculares de principios activos procedentes de "Serratia marcescens"


    Soto Cerrato, Vanessa


    Este trabajo de tesis presenta la caracterización del efecto anticanceroso y la identificación de dianas moleculares de principios activos procedentes de la bacteria "Serratia marcescens". En particular, se ha evaluado la capacidad anticancerosa "in vitro" y "ex vivo" del ciclodepsipéptido serratamolide (AT514) en varias células cancerosas y no cancerosas de diverso origen tisular, obteniendo una mayor sensibilidad al tratamiento por parte de las células cancerosas. También hemos realizado es...

  10. Harnessing the bio-mineralization ability of urease producing Serratia marcescens and Enterobacter cloacae EMB19 for remediation of heavy metal cadmium (II). (United States)

    Bhattacharya, Amrik; Naik, S N; Khare, S K


    In the present study, urease positive Serratia marcescens (NCIM2919) and Enterobacter cloacae EMB19 (MTCC10649) were individually evaluated for remediation of cadmium (II) using ureolysis-induced calcium carbonate precipitation. Both the cultures were observed to efficiently remove cadmium from the media through co-precipitation of Cd (II) and Ca (II). S. marcescens and E. cloacae EMB19, respectively showed 96 and 98% removal of initial 5.0 mg L -1 soluble Cd (II) from the urea and CaCl 2 laden media at 96 h of incubation period. At higher Cd (II) concentrations of 10 and 15 mg L -1 , cadmium removal efficiency was much higher in case of E. cloacae EMB19 compared to S. marcescens. In-vitro cadmium (II) remediation study using urease containing cell-free culture supernatant of S. marcescens and E. cloacae EMB19 showed respective 98 and 53% removal of initial 50 mg L -1  Cd (II) from the reaction mixtures in co-presence of Ca (II). While in sole presence of Cd (II), only 16 and 8% removal of Cd (II) were detected for S. marcescens and E. cloacae EMB19, respectively. The elemental analysis of the co-precipitated mineral products using Energy Dispersive X-ray spectroscopy (EDX) clearly showed the prevalence of Ca and Cd ions. The morphology Cd-Ca composites formed with respect to both the cultures were observed to be of different shape and size as revealed through Scanning Electron Microscopy (SEM). Entire study hence comes out with a sustainable bioremediation option which could be effectively used to tackle Cd (II) or other heavy metal pollution. Copyright © 2018 Elsevier Ltd. All rights reserved.

  11. Synthesis and characterization of nanoparticles conjugated tannase and using it for enhancement of antibacterial activity of tannase produced by Serratia marcescens. (United States)

    Nsayef Muslim, D Sahira; Abbas Dham, Ziyad; J Mohammed, D Nadheer


    Fourteen isolates of Serratia marcescens were collected from patients suffering from septicemia. All theseisolates revealed different levels in tannase production. Tannase was partially purified from Serratia marcescens b9 by precipitation method at 70% saturation of ammonium sulfate. Au, Pt, SnO 2 and SiO 2 nanoparticles were prepared by laser ablation and examined by transmission electron microscopy (TEM), X-ray diffraction pattern and UV-Visible absorption spectroscopy. Conjugation of SiO 2 nanoparticles to tannase by feeding and pulses methods were prepared and characterized by TEM, X-ray diffraction pattern and UV-Visible spectrum. SiO 2 nanoparticles conjugated partially purified tannase by feeding showed the higher effectiveness and higher significant level against all tested UTI causing in comparison with ciprofloxacin antibiotic, SiO 2 nanoparticles alone, partially purified tannase alone and partially purified tannase by pulses. So that we can conclude that feeding method was the best method for enhancement partially purified tannase activity to maximum level thus SiO 2 nanoparticles conjugated partially purified tannase may be a useful antibacterial agent for the treatment of urinary tract infection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Biotransformation of hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) by a prospective consortium and its most effective isolate Serratia marcescens

    Energy Technology Data Exchange (ETDEWEB)

    Young, D.M.; Ogden, K.L. [Univ. of Arizona, Tucson, AZ (United States). Dept. of Chemical and Environmental Engineering; Unkefer, P.J. [Los Alamos National Lab., NM (United States). Chemical Science and Technology Div.


    The biotransformation of hexahydro-1,3,5-trinitro-1,3,5 triazine (RDX) has been observed in liquid culture by a consortium of bacteria found in horse manure. Five types of bacteria were found to predominate in the consortium and were isolated. The most effective of these isolates at transforming RDX was Serratia marcescens. The biotransformation of RDX by all of these bacteria was found to occur only in the anoxic stationary phase. The process of bacterial growth and RDX biotransformation was quantified for the purpose of developing a predictive type model. Cell growth was assumed to follow Monod kinetics. All of the aerobic and anoxid growth parameters were determined: {mu}{sub max}, K{sub s}, and Y{sub x/s}. RDX was found to competitively inhibit cell growth in both atmospheres. Degradation of RDX by Serratia marcescens was found to proceed through the stepwise reduction of the three nitro groups to nitroso groups. Each of these reductions was found to be first order in both component and cell concentrations. The degradation rate constant for the first step in this reduction process by the consortium was 0.022 L/g cells {center_dot} h compared to 0.033 L/g cells {center_dot} h for the most efficient isolate.

  13. Culture-dependent and culture-independent analyses reveal no prokaryotic community shifts or recovery of Serratia marcescens in Acropora palmata with white pox disease. (United States)

    Lesser, Michael P; Jarett, Jessica K


    Recently, the etiological agent of white pox (WP) disease, also known as acroporid serratiosis, in the endangered coral Acropora palmata is the enteric bacterium Serratia marcescens with the source being localized sewage release onto coastal coral reef communities. Here, we show that both culture-dependent and culture-independent approaches could not recover this bacterium from samples of tissue and mucus from A. palmata colonies affected by WP disease in the Bahamas, or seawater collected adjacent to A. palmata colonies. Additionally, a metagenetic 16S rRNA pyrosequencing study shows no significant difference in the bacterial communities of coral tissues with and without WP lesions. As recent studies have shown for other coral diseases, S. marcescens cannot be identified in all cases of WP disease in several geographically separated populations of A. palmata with the same set of signs. As a result, its identification as the etiological agent of WP disease, and cause of a reverse zoonosis, cannot be broadly supported. However, the prevalence of WP disease associated with S. marcescens does appear to be associated with proximity to population centers, and research efforts should be broadened to examine this association, and to identify other causes of this syndrome. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  14. Detection of the IncX3 plasmid carrying blaKPC-3 in a Serratia marcescens strain isolated from a kidney-liver transplanted patient. (United States)

    Gona, Floriana; Caio, Carla; Iannolo, Gioacchin; Monaco, Francesco; Di Mento, Giuseppina; Cuscino, Nicola; Fontana, Ignazio; Panarello, Giovanna; Maugeri, Gaetano; Mezzatesta, Maria Lina; Stefani, Stefania; Conaldi, Pier Giulio


    Dissemination of resistance to carbapenems among Enterobacteriaceae through plasmids is an increasingly important concern in health care worldwide. Here we report the first description of an IncX3 plasmid carrying the blaKPC-3 gene in a strain of Serratia marcescens isolated from a kidney-liver transplanted patient at the transplantation centre ISMETT (Istituto Mediterraneo per i Trapianti e Terapie ad Alta Specializzazione, Palermo, Italy). To localize the transposable element containing the resistance-associated gene Next-Generation Sequencing of the bacterial DNA was performed. S. marcescens was positive for blaKPC-3 and blaSHV-11 genes. The molecular analysis demonstrated that the blaKPC-3 gene of this bacterial strain was located in one copy of the Tn-3-like element Tn4401-a carried in a plasmid that is 53 392 bp in size and showed the typical IncX3 scaffold. Our data demonstrated the presence of a new blaKPC-3 harbouring the IncX3 plasmid in S. marcescens. The possible dissemination among Enterobacteriaceae of this type of plasmid should be monitored and evaluated in terms of clinical risk.

  15. Complete genome analysis of Serratia marcescens RSC-14: A plant growth-promoting bacterium that alleviates cadmium stress in host plants (United States)

    Khan, Abdur Rahim; Park, Gun-Seok; Asaf, Sajjad; Hong, Sung-Jun; Jung, Byung Kwon


    Serratia marcescens RSC-14 is a Gram-negative bacterium that was previously isolated from the surface-sterilized roots of the Cd-hyperaccumulator Solanum nigrum. The strain stimulates plant growth and alleviates Cd stress in host plants. To investigate the genetic basis for these traits, the complete genome of RSC-14 was obtained by single-molecule real-time sequencing. The genome of S. marcescens RSC-14 comprised a 5.12-Mbp-long circular chromosome containing 4,593 predicted protein-coding genes, 22 rRNA genes, 88 tRNA genes, and 41 pseudogenes. It contained genes with potential functions in plant growth promotion, including genes involved in indole-3-acetic acid (IAA) biosynthesis, acetoin synthesis, and phosphate solubilization. Moreover, annotation using NCBI and Rapid Annotation using Subsystem Technology identified several genes that encode antioxidant enzymes as well as genes involved in antioxidant production, supporting the observed resistance towards heavy metals, such as Cd. The presence of IAA pathway-related genes and oxidative stress-responsive enzyme genes may explain the plant growth-promoting potential and Cd tolerance, respectively. This is the first report of a complete genome sequence of Cd-tolerant S. marcescens and its plant growth promotion pathway. The whole-genome analysis of this strain clarified the genetic basis underlying its phenotypic and biochemical characteristics, underpinning the beneficial interactions between RSC-14 and plants. PMID:28187139

  16. Effects of temperature, pH and NaCl content on in vitro putrescine and cadaverine production through the growth of Serratia marcescens CCM 303. (United States)

    Bubelová, Zuzana; Buňka, František; Taťáková, Monika; Štajnochová, Kateřina; Purevdorj, Khatantuul; Buňková, Leona


    The aim of this study was to evaluate the combined effect of temperature (10, 20 and 37°C), pH (4, 5, 6, 7 and 8), and NaCl content (0, 1, 3, 4, 5 and 6% w/v) on the growth and putrescine and cadaverine production of Serratia marcescens CCM 303 under model conditions. The decarboxylase activity of S. marcescens was monitored in broth after cultivation. The cultivation medium was enriched with selected amino acids (ornithine, arginine and lysine; 0.2% w/v each) serving as precursors of biogenic amines. Levels of putrescine and cadaverine in broth were analysed by high-performance liquid chromatography after pre-column derivatisation with o-phthalaldehyde reagent. S. marcescens produced higher amounts of putrescine (up to 2096.8 mg L(-1)) compared to cadaverine content (up to 343.3 mg L(-1)) in all cultivation media. The highest putrescine and cadaverine concentrations were reached during cultivation at 10-20°C, pH 5-7 and NaCl content 1-3% w/v. On the other hand, the highest BAs production of individual cell (recalculated based on a cell; so called "yield factor") was observed at 10°C, pH 4 and salt concentration 3-5% w/v as a response to environmental stress.

  17. Characterization of the gacA-dependent surface and coral mucus colonization by an opportunistic coral pathogen Serratia marcescens PDL100. (United States)

    Krediet, Cory J; Carpinone, Emily M; Ritchie, Kim B; Teplitski, Max


    Opportunistic pathogens rely on global regulatory systems to assess the environment and to control virulence and metabolism to overcome host defenses and outcompete host-associated microbiota. In Gammaproteobacteria, GacS/GacA is one such regulatory system. GacA orthologs direct the expression of the csr (rsm) small regulatory RNAs, which through their interaction with the RNA-binding protein CsrA (RsmA), control genes with functions in carbon metabolism, motility, biofilm formation, and virulence. The csrB gene was controlled by gacA in Serratia marcescens PDL100. A disruption of the S. marcescens gacA gene resulted in an increased fitness of the mutant on mucus of the host coral Acropora palmata and its high molecular weight fraction, whereas the mutant was as competitive as the wild type on the low molecular weight fraction of the mucus. Swarming motility and biofilm formation were reduced in the gacA mutant. This indicates a critical role for gacA in the efficient utilization of specific components of coral mucus and establishment within the surface mucopolysaccharide layer. While significantly affecting early colonization behaviors (coral mucus utilization, swarming motility, and biofilm formation), gacA was not required for virulence of S. marcescens PDL100 in either a model polyp Aiptasia pallida or in brine shrimp Artemia nauplii. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  18. Evidence for an Opportunistic and Endophytic Lifestyle of the Bursaphelenchus xylophilus-Associated Bacteria Serratia marcescens PWN146 Isolated from Wilting Pinus pinaster. (United States)

    Vicente, Cláudia S L; Nascimento, Francisco X; Barbosa, Pedro; Ke, Huei-Mien; Tsai, Isheng J; Hirao, Tomonori; Cock, Peter J A; Kikuchi, Taisei; Hasegawa, Koichi; Mota, Manuel


    Pine wilt disease (PWD) results from the interaction of three elements: the pathogenic nematode, Bursaphelenchus xylophilus; the insect-vector, Monochamus sp.; and the host tree, mostly Pinus species. Bacteria isolated from B. xylophilus may be a fourth element in this complex disease. However, the precise role of bacteria in this interaction is unclear as both plant-beneficial and as plant-pathogenic bacteria may be associated with PWD. Using whole genome sequencing and phenotypic characterization, we were able to investigate in more detail the genetic repertoire of Serratia marcescens PWN146, a bacterium associated with B. xylophilus. We show clear evidence that S. marcescens PWN146 is able to withstand and colonize the plant environment, without having any deleterious effects towards a susceptible host (Pinus thunbergii), B. xylophilus nor to the nematode model C. elegans. This bacterium is able to tolerate growth in presence of xenobiotic/organic compounds, and use phenylacetic acid as carbon source. Furthermore, we present a detailed list of S. marcescens PWN146 potentials to interfere with plant metabolism via hormonal pathways and/or nutritional acquisition, and to be competitive against other bacteria and/or fungi in terms of resource acquisition or production of antimicrobial compounds. Further investigation is required to understand the role of bacteria in PWD. We have now reinforced the theory that B. xylophilus-associated bacteria may have a plant origin.

  19. Selection of hyperproduction of AmpC and SME-1 in a carbapenem-resistant Serratia marcescens isolate during antibiotic therapy. (United States)

    Hemarajata, Peera; Amick, Thomas; Yang, Shangxin; Gregson, Aric; Holzmeyer, Cameron; Bush, Karen; Humphries, Romney M


    Antibiotic selective pressure may result in changes to antimicrobial susceptibility throughout the course of infection, especially for organisms that harbour chromosomally encoded AmpC β-lactamases, notably Enterobacter spp., in which hyperexpression of ampC may be induced following treatment with cephalosporins. In this study, we document a case of bacteraemia caused by a blaSME-1-harbouring Serratia marcescens that subsequently developed resistance to expanded-spectrum cephalosporins, piperacillin/tazobactam and fluoroquinolones, over the course of several months of treatment with piperacillin/tazobactam and ciprofloxacin. Susceptibility testing and WGS were performed on three S. marcescens isolates from the patient. β-Lactamase activity in the presence or absence of induction by imipenem was measured by nitrocefin hydrolysis assays. Expression of ampC and blaSME-1 under the same conditions was determined by real-time PCR. WGS demonstrated accumulation of missense and nonsense mutations in ampD associated with stable derepression of AmpC. Gene expression and β-lactamase activity of both AmpC and SME-1 were inducible in the initial susceptible isolate, but were constitutively high in the resistant isolate, in which total β-lactamase activity was increased by 128-fold. Although development of such in vitro resistance due to selective pressure imposed by antibiotics is reportedly low in S. marcescens, our findings highlight the need to evaluate isolates on a regular basis during long-term antibiotic therapy.

  20. Serratia marcescens ShlA pore-forming toxin is responsible for early induction of autophagy in host cells and is transcriptionally regulated by RcsB. (United States)

    Di Venanzio, Gisela; Stepanenko, Tatiana M; García Véscovi, Eleonora


    Serratia marcescens is a Gram-negative bacterium that thrives in a wide variety of ambient niches and interacts with an ample range of hosts. As an opportunistic human pathogen, it has increased its clinical incidence in recent years, being responsible for life-threatening nosocomial infections. S. marcescens produces numerous exoproteins with toxic effects, including the ShlA pore-forming toxin, which has been catalogued as its most potent cytotoxin. However, the regulatory mechanisms that govern ShlA expression, as well as its action toward the host, have remained unclear. We have shown that S. marcescens elicits an autophagic response in host nonphagocytic cells. In this work, we determine that the expression of ShlA is responsible for the autophagic response that is promoted prior to bacterial internalization in epithelial cells. We show that a strain unable to express ShlA is no longer able to induce this autophagic mechanism, while heterologous expression of ShlA/ShlB suffices to confer on noninvasive Escherichia coli the capacity to trigger autophagy. We also demonstrate that shlBA harbors a binding motif for the RcsB regulator in its promoter region. RcsB-dependent control of shlBA constitutes a feed-forward regulatory mechanism that allows interplay with flagellar-biogenesis regulation. At the top of the circuit, activated RcsB downregulates expression of flagella by binding to the flhDC promoter region, preventing FliA-activated transcription of shlBA. Simultaneously, RcsB interaction within the shlBA promoter represses ShlA expression. This circuit offers multiple access points to fine-tune ShlA production. These findings also strengthen the case for an RcsB role in orchestrating the expression of Serratia virulence factors. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  1. Evaluation of the biocontrol efficacy of a Serratia marcescens strain indigenous to tea rhizosphere for the management of root rot disease in tea.

    Directory of Open Access Journals (Sweden)

    Gargee Dhar Purkayastha

    Full Text Available The aim of the present study is to evaluate plant growth promoting and biocontrol efficacy of a Serratia marcescens strain ETR17 isolated from tea rhizosphere for the effective management of root rot disease in tea. Isolated bacterial culture ETR17 showed significant level of in vitro antagonism against nine different foliar and root pathogens of tea. The phenotypic and molecular characterization of ETR17 revealed the identity of the bacterium as Serratia marcescens. The bacterium was found to produce several hydrolytic enzymes like chitinase, protease, lipase, cellulase and plant growth promoting metabolites like IAA and siderophore. Scanning electron microscopic studies on the interaction zone between pathogen and antagonistic bacterial isolate revealed severe deformities in the fungal mycelia. Spectral analyses (LC-ESI-MS, UV-VIS spectrophotometry and HPLC and TLC indicated the presence of the antibiotics pyrrolnitrin and prodigiosin in the extracellular bacterial culture extracts. Biofilm formation by ETR17 on polystyrene surface was also observed. In vivo application of talc-based formulations prepared with the isolate ETR17 in tea plantlets under green house conditions revealed effective reduction of root-rot disease as well as plant growth promotion to a considerable extent. Viability studies with the ETR17 talc formulation showed the survivability of the isolate up to six months at room temperature. The sustenance of ETR17 (concentration of 8-9x108 cfu g-1 in the soil after the application of talc formulation was recorded by ELISA. Safety studies revealed that ETR17 did not produce hemolysin as observed in pathogenic Serratia strains. The biocontrol strain reported in this study can be used for field application in order to minimize the use of chemical fungicides for disease control in tea gardens.

  2. Evaluation of the biocontrol efficacy of a Serratia marcescens strain indigenous to tea rhizosphere for the management of root rot disease in tea. (United States)

    Dhar Purkayastha, Gargee; Mangar, Preeti; Saha, Aniruddha; Saha, Dipanwita


    The aim of the present study is to evaluate plant growth promoting and biocontrol efficacy of a Serratia marcescens strain ETR17 isolated from tea rhizosphere for the effective management of root rot disease in tea. Isolated bacterial culture ETR17 showed significant level of in vitro antagonism against nine different foliar and root pathogens of tea. The phenotypic and molecular characterization of ETR17 revealed the identity of the bacterium as Serratia marcescens. The bacterium was found to produce several hydrolytic enzymes like chitinase, protease, lipase, cellulase and plant growth promoting metabolites like IAA and siderophore. Scanning electron microscopic studies on the interaction zone between pathogen and antagonistic bacterial isolate revealed severe deformities in the fungal mycelia. Spectral analyses (LC-ESI-MS, UV-VIS spectrophotometry and HPLC) and TLC indicated the presence of the antibiotics pyrrolnitrin and prodigiosin in the extracellular bacterial culture extracts. Biofilm formation by ETR17 on polystyrene surface was also observed. In vivo application of talc-based formulations prepared with the isolate ETR17 in tea plantlets under green house conditions revealed effective reduction of root-rot disease as well as plant growth promotion to a considerable extent. Viability studies with the ETR17 talc formulation showed the survivability of the isolate up to six months at room temperature. The sustenance of ETR17 (concentration of 8-9x108 cfu g-1) in the soil after the application of talc formulation was recorded by ELISA. Safety studies revealed that ETR17 did not produce hemolysin as observed in pathogenic Serratia strains. The biocontrol strain reported in this study can be used for field application in order to minimize the use of chemical fungicides for disease control in tea gardens.

  3. Structural basis for type VI secreted peptidoglycan dl-endopeptidase function, specificity and neutralization in Serratia marcescens

    Energy Technology Data Exchange (ETDEWEB)

    Srikannathasan, Velupillai; English, Grant [University of Dundee, Dundee DD1 5EH, Scotland (United Kingdom); Bui, Nhat Khai [Newcastle University, Newcastle upon Tyne NE2 4HH (United Kingdom); Trunk, Katharina; O’Rourke, Patrick E. F.; Rao, Vincenzo A. [University of Dundee, Dundee DD1 5EH, Scotland (United Kingdom); Vollmer, Waldemar [Newcastle University, Newcastle upon Tyne NE2 4HH (United Kingdom); Coulthurst, Sarah J., E-mail:; Hunter, William N., E-mail: [University of Dundee, Dundee DD1 5EH, Scotland (United Kingdom)


    Crystal structures of type VI secretion system-associated immunity proteins, a peptidoglycan endopeptidase and a complex of the endopeptidase and its cognate immunity protein are reported together with assays of endopeptidase activity and functional assessment. Some Gram-negative bacteria target their competitors by exploiting the type VI secretion system to extrude toxic effector proteins. To prevent self-harm, these bacteria also produce highly specific immunity proteins that neutralize these antagonistic effectors. Here, the peptidoglycan endopeptidase specificity of two type VI secretion-system-associated effectors from Serratia marcescens is characterized. These small secreted proteins, Ssp1 and Ssp2, cleave between γ-d-glutamic acid and l-meso-diaminopimelic acid with different specificities. Ssp2 degrades the acceptor part of cross-linked tetratetrapeptides. Ssp1 displays greater promiscuity and cleaves monomeric tripeptides, tetrapeptides and pentapeptides and dimeric tetratetra and tetrapenta muropeptides on both the acceptor and donor strands. Functional assays confirm the identity of a catalytic cysteine in these endopeptidases and crystal structures provide information on the structure–activity relationships of Ssp1 and, by comparison, of related effectors. Functional assays also reveal that neutralization of these effectors by their cognate immunity proteins, which are called resistance-associated proteins (Raps), contributes an essential role to cell fitness. The structures of two immunity proteins, Rap1a and Rap2a, responsible for the neutralization of Ssp1 and Ssp2-like endopeptidases, respectively, revealed two distinct folds, with that of Rap1a not having previously been observed. The structure of the Ssp1–Rap1a complex revealed a tightly bound heteromeric assembly with two effector molecules flanking a Rap1a dimer. A highly effective steric block of the Ssp1 active site forms the basis of effector neutralization. Comparisons with Ssp2–Rap2

  4. Targeting survivin with prodigiosin isolated from cell wall of Serratia marcescens induces apoptosis in hepatocellular carcinoma cells. (United States)

    Yenkejeh, R A; Sam, M R; Esmaeillou, M


    Abnormal activation of the Wnt/β-catenin signaling pathway increases survivin expression that is involved in hepatocarcinogenesis. Therefore, downregulation of survivin may provide an attractive strategy for treatment of hepatocellular carcinoma. In this regard, little is known about the anticancer effects of prodigiosin isolated from cell wall of Serratia marcescens on the survivin expression and induction of apoptosis in hepatocellular carcinoma cells. Human hepatocellular carcinoma (HepG2) cells were treated with 100-, 200-, 400-, and 600-nM prodigiosin after which morphology of cells, cell number, growth inhibition, survivin expression, caspase-3 activation, and apoptotic rate were evaluated by inverted microscope, hemocytometer, MTT assay, RT-PCR, fluorometric immunosorbent enzyme assay, and flow cytometric analysis, respectively. Prodigiosin changed morphology of cells to apoptotic forms and disrupted cell connections. This compound significantly increased growth inhibition rate and decreased metabolic activity of HepG2 cells in a dose- and time-dependent manner. After 24-, 48-, and 72-h treatments with prodigiosin at concentrations ranging from 100 nM to 600 nM, growth inhibition rates were measured to be 1.5-10%, 24-47.5%, and 55.5-72.5%, respectively, compared to untreated cells. At the same conditions, metabolic activities were measured to be 91-83%, 74-53%, and 47-31% for indicated concentrations of prodigiosin, respectively, compared to untreated cells. We also found that treatment of HepG2 cells for 48 h decreased significantly cell number and survivin expression and increased caspase-3 activation in a dose-dependent manner. Specifically, treatment with 600-nM prodigiosin resulted in 77% decrease in cell number, 88.5% decrease in survivin messenger RNA level, and 330% increase in caspase-3 activation level compared to untreated cells. An increase in the number of apoptotic cells (late apoptosis) ranging from 36.9% to 97.4% was observed with increasing

  5. Structural basis for type VI secreted peptidoglycan dl-endopeptidase function, specificity and neutralization in Serratia marcescens

    International Nuclear Information System (INIS)

    Srikannathasan, Velupillai; English, Grant; Bui, Nhat Khai; Trunk, Katharina; O’Rourke, Patrick E. F.; Rao, Vincenzo A.; Vollmer, Waldemar; Coulthurst, Sarah J.; Hunter, William N.


    Crystal structures of type VI secretion system-associated immunity proteins, a peptidoglycan endopeptidase and a complex of the endopeptidase and its cognate immunity protein are reported together with assays of endopeptidase activity and functional assessment. Some Gram-negative bacteria target their competitors by exploiting the type VI secretion system to extrude toxic effector proteins. To prevent self-harm, these bacteria also produce highly specific immunity proteins that neutralize these antagonistic effectors. Here, the peptidoglycan endopeptidase specificity of two type VI secretion-system-associated effectors from Serratia marcescens is characterized. These small secreted proteins, Ssp1 and Ssp2, cleave between γ-d-glutamic acid and l-meso-diaminopimelic acid with different specificities. Ssp2 degrades the acceptor part of cross-linked tetratetrapeptides. Ssp1 displays greater promiscuity and cleaves monomeric tripeptides, tetrapeptides and pentapeptides and dimeric tetratetra and tetrapenta muropeptides on both the acceptor and donor strands. Functional assays confirm the identity of a catalytic cysteine in these endopeptidases and crystal structures provide information on the structure–activity relationships of Ssp1 and, by comparison, of related effectors. Functional assays also reveal that neutralization of these effectors by their cognate immunity proteins, which are called resistance-associated proteins (Raps), contributes an essential role to cell fitness. The structures of two immunity proteins, Rap1a and Rap2a, responsible for the neutralization of Ssp1 and Ssp2-like endopeptidases, respectively, revealed two distinct folds, with that of Rap1a not having previously been observed. The structure of the Ssp1–Rap1a complex revealed a tightly bound heteromeric assembly with two effector molecules flanking a Rap1a dimer. A highly effective steric block of the Ssp1 active site forms the basis of effector neutralization. Comparisons with Ssp2–Rap2

  6. Piper betle and its bioactive metabolite phytol mitigates quorum sensing mediated virulence factors and biofilm of nosocomial pathogen Serratia marcescens in vitro. (United States)

    Srinivasan, Ramanathan; Devi, Kannan Rama; Kannappan, Arunachalam; Pandian, Shunmugiah Karutha; Ravi, Arumugam Veera


    Piper betle, a tropical creeper plant belongs to the family Piperaceae. The leaves of this plant have been well known for their therapeutic, religious and ceremonial value in South and Southeast Asia. It has also been reported to possess several biological activities including antimicrobial, antioxidant, antinociceptive, antidiabetic, insecticidal and gastroprotective activities and used as a common ingredient in indigenous medicines. In Indian system of ayurvedic medicine, P. betle has been well recognized for its antiseptic properties and is commonly applied on wounds and lesions for its healing effects. To evaluate the anti-quorum sensing (anti-QS) and antibiofilm efficacy of P. betle and its bioactive metabolite phytol against Serratia marcescens. The P. betle ethyl acetate extract (PBE) was evaluated for its anti-QS efficacy against S. marcescens by assessing the prodigiosin and lipase production at 400 and 500µgml -1 concentrations. In addition, the biofilm biomass quantification assay was performed to evaluate the antibiofilm activity of PBE against S. marcescens. Besides, the influence of PBE on bacterial biofilm formation was assessed through microscopic techniques. The biofilm related phenomenons like exopolysaccharides (EPS) production, hydrophobicity and swarming motility were also examined to support the antibiofilm activity of PBE. Transcriptional analysis of QS regulated genes in S. marcescens was also done. Characterization of PBE was done by separation through column chromatography and identification of active metabolites by gas chromatography -mass spectrometry. The major compounds of active fractions such as hexadecanoic acid, eugenol and phytol were assessed for their anti-QS activity against S. marcescens. Further, the in vitro bioassays such as protease, biofilm and HI quantification were also carried out to confirm the anti-QS and antibiofilm potential of phytol in PBE. PBE inhibits QS mediated prodigiosin pigment production in S. marcescens

  7. The Insect Pathogen Serratia marcescens Db10 Uses a Hybrid Non-Ribosomal Peptide Synthetase-Polyketide Synthase to Produce the Antibiotic Althiomycin (United States)

    Challis, Gregory L.; Stanley-Wall, Nicola R.; Coulthurst, Sarah J.


    There is a continuing need to discover new bioactive natural products, such as antibiotics, in genetically-amenable micro-organisms. We observed that the enteric insect pathogen, Serratia marcescens Db10, produced a diffusible compound that inhibited the growth of Bacillis subtilis and Staphyloccocus aureus. Mapping the genetic locus required for this activity revealed a putative natural product biosynthetic gene cluster, further defined to a six-gene operon named alb1–alb6. Bioinformatic analysis of the proteins encoded by alb1–6 predicted a hybrid non-ribosomal peptide synthetase-polyketide synthase (NRPS-PKS) assembly line (Alb4/5/6), tailoring enzymes (Alb2/3) and an export/resistance protein (Alb1), and suggested that the machinery assembled althiomycin or a related molecule. Althiomycin is a ribosome-inhibiting antibiotic whose biosynthetic machinery had been elusive for decades. Chromatographic and spectroscopic analyses confirmed that wild type S. marcescens produced althiomycin and that production was eliminated on disruption of the alb gene cluster. Construction of mutants with in-frame deletions of specific alb genes demonstrated that Alb2–Alb5 were essential for althiomycin production, whereas Alb6 was required for maximal production of the antibiotic. A phosphopantetheinyl transferase enzyme required for althiomycin biosynthesis was also identified. Expression of Alb1, a predicted major facilitator superfamily efflux pump, conferred althiomycin resistance on another, sensitive, strain of S. marcescens. This is the first report of althiomycin production outside of the Myxobacteria or Streptomyces and paves the way for future exploitation of the biosynthetic machinery, since S. marcescens represents a convenient and tractable producing organism. PMID:23028578

  8. Purification, crystallization and preliminary X-ray analysis of the outer membrane complex HasA–HasR from Serratia marcescens

    Energy Technology Data Exchange (ETDEWEB)

    Huché, Frédéric, E-mail: [Fachbereich Biologie, Universität Konstanz, 78457 Konstanz (Germany); Unité des Membranes Bactériennes, CNRS URA 2172, Département de Microbiologie Fondamentale et Médicale, Institut Pasteur, 25-28 Rue du Dr Roux, 75724 Paris CEDEX 15 (France); Delepelaire, Philippe; Wandersman, Cécile [Unité des Membranes Bactériennes, CNRS URA 2172, Département de Microbiologie Fondamentale et Médicale, Institut Pasteur, 25-28 Rue du Dr Roux, 75724 Paris CEDEX 15 (France); Welte, Wolfram [Fachbereich Biologie, Universität Konstanz, 78457 Konstanz (Germany)


    The expression, purification, and crystallization in space group P2{sub 1}2{sub 1}2{sub 1} of the complex HasA-HasR from S. marcescens are reported. Diffraction data have been collected and processed to 6.8 Å. Serratia marcescens is able to acquire iron using its haem-acquisition system (‘has’), which contains an outer membrane receptor HasR and a soluble haemophore HasA. After secretion, HasA binds free haem in the extracellular medium or extracts it from haemoproteins and delivers it to the receptor. Here, the crystallization of a HasA–HasR complex is reported. HasA and HasR have been overexpressed in Escherichia coli and the complex formed and crystallized. Small platelets and bunches of needles of dimensions 0.01 × 0.1 × 1 mm were obtained. A native data set has been collected to 6.8 Å.

  9. Outbreak of Serratia marcescens Coproducing ArmA and CTX-M-15 Mediated High Levels of Resistance to Aminoglycoside and Extended-Spectrum Beta-Lactamases, Algeria. (United States)

    Batah, Rima; Loucif, Lotfi; Olaitan, Abiola Olumuyiwa; Boutefnouchet, Nafissa; Allag, Hamoudi; Rolain, Jean-Marc


    Serratia marcescens is one of the most important pathogens responsible for nosocomial infections worldwide. Here, we have investigated the molecular support of antibiotic resistance and genetic relationships in a series of 54 S. marcescens clinical isolates collected from Eastern Algeria between December 2011 and July 2013. The 54 isolates were identified by matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry (MS). Antibiotic susceptibility testing was performed by disc diffusion and E-test methods. Antibiotic resistance genes were detected by polymerase chain reaction (PCR). The genetic transfer of antibiotic resistance was performed by conjugation using azide-resistant Escherichia coli J53 as the recipient strain, and plasmid analysis was done by PCR-based replicon typing. The relatedness of our isolates was determined by phylogenetic analysis based on partial sequences of four protein-encoding genes (gyrB, rpoB, infB, and atpD) and then compared to MALDI-TOF MS clustering. Thirty-five out of 54 isolates yielded an extended-spectrum β-lactamase (ESBL) phenotype and carried bla(CTX-M-15) (n=32), bla(TEM-1) (n=26), bla(TEM-71) (n=1), bla(SHV-1a) (n=1), and bla(PER-2) (n=12). Among these isolates, we identified a cluster of 15 isolates from a urology unit that coharbored ESBL and the 16S rRNA methyltransferase armA. Conjugation was successful for five selected strains, demonstrating the transferability of a conjugative plasmid of incompatibility group incL/M type. Phylogenetic analysis along with MALDI-TOF clustering likely suggested an outbreak of such isolates in the urology unit. In this study, we report for the first time the co-occurrence of armA methyltransferase with ESBL in S. marcescens clinical isolates in Eastern Algeria.

  10. Chitinase from Serratia marcescens

    International Nuclear Information System (INIS)

    Cabib, E.


    This paper discusses the chitinase which is assayed by the liberation of tritiated oligosaccharides from [acetyl- 3 H]chitin, 3 with phosphate buffer at pH 6.3, at a final concentration of 0.05 M in the reaction mixture (buffer A). The author explains that a unit of chitinase is that amount of enzyme which catalyzes the release of 1 μmol of soluble product (calculated as N- acetylglucosamine) in 1 min at 30 degrees

  11. Exploring the Anti-quorum Sensing and Antibiofilm Efficacy of Phytol against Serratia marcescens Associated Acute Pyelonephritis Infection in Wistar Rats (United States)

    Srinivasan, Ramanathan; Mohankumar, Ramar; Kannappan, Arunachalam; Karthick Raja, Veeramani; Archunan, Govindaraju; Karutha Pandian, Shunmugiah; Ruckmani, Kandasamy; Veera Ravi, Arumugam


    Quorum Sensing (QS) mechanism, a bacterial density-dependent gene expression system, governs the Serratia marcescens pathogenesis through the production of virulence factors and biofilm formation. The present study demonstrates the anti-quorum sensing (anti-QS), antibiofilm potential and in vivo protective effect of phytol, a diterpene alcohol broadly utilized as food additive and in therapeutics fields. In vitro treatment of phytol (5 and 10 μg/ml) showed decreasing level of biofilm formation, lipase and hemolysin production in S. marcescens compared to their respective controls. More, microscopic analyses confirmed the antibiofilm potential of phytol. The biofilm related phenomenons such as swarming motility and exopolysccharide productions were also inhibited by phytol. Furthermore, the real-time analysis elucidated the molecular mechanism of phytol which showed downregulation of fimA, fimC, flhC, flhD, bsmB, pigP, and shlA gene expressions. On the other hand, the in vivo rescue effect of phytol was assessed against S. marcescens associated acute pyelonephritis in Wistar rat. Compared to the infected and vehicle controls, the phytol treated groups (100 and 200 mg/kg) showed decreased level of bacterial counts in kidney, bladder tissues and urine samples on the 5th post infection day. As well, the phytol treatment showed reduced level of virulence enzymes such as lipase and protease productions compared to the infected and vehicle controls. Further, the infected and vehicle controls showed increasing level of inflammatory markers such as malondialdehyde (MDA), nitric oxide (NO) and myeloperoxidase (MPO) productions. In contrast, the phytol treatment showed decreasing level of inflammatory markers. In histopathology, the uninfected animal showed normal kidney and bladder structure, wherein, the infected animals showed extensive infiltration of neutrophils in kidney and bladder tissues. In contrast, the phytol treatment showed normal kidney and bladder tissues

  12. New plasmid-mediated aminoglycoside 6'-N-acetyltransferase, AAC(6')-Ian, and ESBL, TLA-3, from a Serratia marcescens clinical isolate. (United States)

    Jin, Wanchun; Wachino, Jun-Ichi; Kimura, Kouji; Yamada, Keiko; Arakawa, Yoshichika


    Enterobacteriaceae clinical isolates showing amikacin resistance (MIC 64 to >256 mg/L) in the absence of 16S rRNA methyltransferase (MTase) genes were found. The aim of this study was to clarify the molecular mechanisms underlying amikacin resistance in Enterobacteriaceae clinical isolates that do not produce 16S rRNA MTases. PCR was performed to detect already-known amikacin resistance determinants. Cloning experiments and sequence analyses were performed to characterize unknown amikacin resistance determinants. Transfer of amikacin resistance determinants was performed by conjugation and transformation. The complete nucleotide sequence of the plasmids was determined by next-generation sequencing technology. Amikacin resistance enzymes were purified with a column chromatography system. The enzymatic function of the purified protein was investigated by thin-layer chromatography (TLC) and HPLC. Among the 14 isolates, 9 were found to carry already-known amikacin resistance determinants such as aac(6')-Ia and aac(6')-Ib. Genetic analyses revealed the presence of a new amikacin acetyltransferase gene, named aac(6')-Ian, located on a 169 829 bp transferable plasmid (p11663) of the Serratia marcescens strain NUBL-11663, one of the five strains negative for known aac(6') genes by PCR. Plasmid p11663 also carried a novel ESBL gene, named blaTLA-3. HPLC and TLC analyses demonstrated that AAC(6')-Ian catalysed the transfer of an acetyl group from acetyl coenzyme A onto an amine at the 6'-position of various aminoglycosides. We identified aac(6')-Ian as a novel amikacin resistance determinant together with a new ESBL gene, blaTLA-3, on a transferable plasmid of a S. marcescens clinical isolate. © The Author 2015. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail:

  13. Chromate Reduction in Serratia marcescens Isolated from Tannery Effluent and Potential Application for Bioremediation of Chromate Pollution

    Directory of Open Access Journals (Sweden)

    M.A. Mondaca


    Full Text Available Pollution of aquatic systems by heavy metals has resulted in increasing environmental concern because they cannot be biodegraded. One metal that gives reason for concern due to its toxicity is chromium. Cr(VI and Cr(III are the principal forms of chromium found in natural waters. A chromate-resistant strain of the bacterium S. marcescens was isolated from tannery effluent. The strain was able to reduce Cr(VI to Cr(III, and about 80% of chromate was removed from the medium. The reduction seems to occur on the cell surface. Transmission electron microscopic examination of cells revealed that particles were deposited on the outside of bacterial cells. A stable biofilm was formed in less than 10 h, reaching around 1010 cfu attached per milligram of activated carbon. These findings demonstrate that immobilized S. marcescens might be used in industrial waste treatment processes.

  14. Intraspecies Competition in Serratia marcescens Is Mediated by Type VI-Secreted Rhs Effectors and a Conserved Effector-Associated Accessory Protein. (United States)

    Alcoforado Diniz, Juliana; Coulthurst, Sarah J


    The type VI secretion system (T6SS) is widespread in Gram-negative bacteria and can deliver toxic effector proteins into eukaryotic cells or competitor bacteria. Antibacterial T6SSs are increasingly recognized as key mediators of interbacterial competition and may contribute to the outcome of many polymicrobial infections. Multiple antibacterial effectors can be delivered by these systems, with diverse activities against target cells and distinct modes of secretion. Polymorphic toxins containing Rhs repeat domains represent a recently identified and as-yet poorly characterized class of T6SS-dependent effectors. Previous work had revealed that the potent antibacterial T6SS of the opportunistic pathogen Serratia marcescens promotes intraspecies as well as interspecies competition (S. L. Murdoch, K. Trunk, G. English, M. J. Fritsch, E. Pourkarimi, and S. J. Coulthurst, J Bacteriol 193:6057-6069, 2011, In this study, two new Rhs family antibacterial effectors delivered by this T6SS have been identified. One of these was shown to act as a DNase toxin, while the other contains a novel, cytoplasmic-acting toxin domain. Importantly, using S. marcescens, it has been demonstrated for the first time that Rhs proteins, rather than other T6SS-secreted effectors, can be the primary determinant of intraspecies competition. Furthermore, a new family of accessory proteins associated with T6SS effectors has been identified, exemplified by S. marcescens EagR1, which is specifically required for deployment of its associated Rhs effector. Together, these findings provide new insight into how bacteria can use the T6SS to deploy Rhs-family effectors and mediate different types of interbacterial interactions. Infectious diseases caused by bacterial pathogens represent a continuing threat to health and economic prosperity. To counter this threat, we must understand how such organisms survive and prosper. The type VI secretion system is a weapon that

  15. Complete Sequence of Four Multidrug-Resistant MOBQ1 Plasmids Harboring blaGES-5 Isolated from Escherichia coli and Serratia marcescens Persisting in a Hospital in Canada. (United States)

    Boyd, David; Taylor, Geoffrey; Fuller, Jeff; Bryce, Elizabeth; Embree, Joanne; Gravel, Denise; Katz, Kevin; Kibsey, Pamela; Kuhn, Magdalena; Langley, Joanne; Mataseje, Laura; Mitchell, Robyn; Roscoe, Diane; Simor, Andrew; Thomas, Eva; Turgeon, Nathalie; Mulvey, Michael


    The usefulness of carbapenems for gram-negative infections is becoming compromised by organisms harboring carbapenemases, enzymes which can hydrolyze the drug. Currently KPC (class A), NDM (class B), and OXA-48 types (class D) are the most globally widespread carbapenemases. However, among the GES-type class A extended-spectrum β-lactamases (ESBLs) there are variants that hydrolyze carbapenems, with blaGES-5 being the most common. Two Escherichia coli and two Serratia marcescens harboring blaGES-5 on plasmids were isolated by the Canadian Nosocomial Infection Surveillance Program (CNISP) from four different patients in a single hospital over a 2-year period. Complete sequencing of the blaGES-5 plasmids indicated that all four had nearly identical backbones consisting of genes for replication, partitioning, and stability, but contained variant accessory regions consisting of mobile elements and antimicrobial resistance genes. The plasmids were of a novel replicon type, but belonged to the MOBQ1 group based on relaxase sequences, and appeared to be mobilizable, but not self-transmissible. Considering the time periods of bacterial isolation, it would appear the blaGES-5 plasmid has persisted in an environmental niche for at least 2 years in the hospital. This has implications for infection control and clinical care when it is transferred to clinically relevant gram-negative organisms.

  16. Nosocomial outbreak of Serratia marcescens in a Neonatal Intensive Care Unit: what to do not to close the unit when cohorting is not enough

    Directory of Open Access Journals (Sweden)

    Lorenza Pugni


    Full Text Available Background. Serratia marcescens, a Gram-negative organism, is a well-recognized nosocomial pathogen, especially in Neonatal Intensive Care Units (NICUs. Even if multiple point sources have been identified, the source of an outbreak often remains unknown. Because an outbreak of S. marcescens can spread rapidly, closing the Unit sometimes is necessary. Here, we report on an outbreak of S. marcescens occurred in our NICU and describe the control measures taken to stop the epidemic without closing the Unit. Material and Methods. Our Unit is a 56-bed Unit composed of two areas: a 23-bed (4 rooms intensive-care and a 33-bed (6 rooms intermediate-care area. After some cases of S. marcescens infection were identified during a 3-month period, a prospective epidemiological study was performed in both areas during a period of 8 months. Surveillance cultures were obtained from all neonates (pharynx, rectum, eyes, ears at admission, at room-changing and twice weekly, from medical and nursing staff (pharynx, rectum and from the environment (sinks, ventilators, incubators, soap dispensers, disinfectants, breast pumps, work surfaces. The following control measures were also taken: universal precautions were intensified (handwashing, gloves, masks, education of the staff was stressed, a survey was instituted to check the observance of the control measures, admissions to the NICU were limited and infected/colonized babies were strictly cohorted. Because the outbreak continued despite these control measures, we separated new admissions from hospitalized babies by using two ways in the Unit: a clean way (green and a dirty way (red with nurses, rooms and everything different between the green and the red babies. Results. During the study period, 589 neonates underwent surveillance cultures (14.156 samples; 32/589 (5% infants had positive swabs. Four (12.5% of the 32 colonized infants had clinical signs of infection: sepsis-like symptoms (2 cases and conjunctivitis

  17. An outbreak of Serratia marcescens infection in a special-care baby unit of a community hospital in United Arab Emirates: the importance of the air conditioner duct as a nosocomial reservoir. (United States)

    Uduman, S A; Farrukh, A S; Nath, K N R; Zuhair, M Y H; Ifrah, A; Khawla, A D; Sunita, P


    We report an outbreak of Serratia marcescens infection in a special-care baby unit (SCBU) of a university-affiliated community hospital in the United Arab Emirates. The outbreak involved 36 infants and lasted for 20 weeks. Seven of the colonized infants developed invasive illnesses in the form of bacteraemia (four cases), bacteraemic meningitis (two) and clinical sepsis (one). Three other term infants had purulent conjunctivitis. There were five deaths with an overall mortality of 14%. S. marcescens was cultured from airflow samples from the air conditioning (AC) which was the reservoir of infection in this outbreak. Elimination of the nosocomial source and outbreak containment were eventually achieved by specialized robotic cleaning of the entire AC duct system of the SCBU. Strict adherence to the infection control policies was reinforced to prevent transmission of cross-infection. Copyright 2002 The Hospital Infection Society


    Directory of Open Access Journals (Sweden)

    Neni Gusmanizar


    Full Text Available Heavy metals and organic xenobiotics including dyes are important industrial components with their usage amounting to the millions of tonnes yearly. Their presence in the environment is a serious pollution issue globally. Bioremediation of these pollutants using microbes with multiple detoxification capacity is constantly being sought. In this work we screen the ability of a molybdenum-reducing bacterium isolated from contaminated soil to decolorize various azo and triphenyl methane dyes. The bacterium reduces molybdate to molybdenum blue (Mo-blue optimally at pH 6.0, and temperatures of between 25 and 40oC. Glucose was the best electron donor for supporting molybdate reduction followed by sucrose, trehalose, maltose, d-sorbitol, dmannitol, d-mannose, myo-inositol, glycerol and salicin in descending order. Other requirements include a phosphate concentration of between 5.0 and 7.5 mM and a molybdate concentration between 10 and 20 mM. The absorption spectrum of the Moblue produced was similar to previous Mo-reducing bacterium, and closely resembles a reduced phosphomolybdate. Molybdenum reduction was inhibited by copper, silver and mercury at 2 ppm by 43.8%, 42.3% and 41.7%, respectively. We screen for the ability of the bacterium to decolorize various dyes. The bacterium was able to decolorize the dye Congo Red. Biochemical analysis resulted in a tentative identification of the bacterium as Serratia marcescens strain Neni-1. The ability of this bacterium to detoxify molybdenum and decolorize azo dye makes this bacterium an important tool for bioremediation.

  19. Assessment of process parameters influencing the enhanced production of prodigiosin from Serratia marcescens and evaluation of its antimicrobial, antioxidant and dyeing potentials

    Directory of Open Access Journals (Sweden)

    Gulani, C.


    Full Text Available Aims: Prodigiosin is a bright red pigment produced by certain strains of Serratia marcescens, characterized by a common pyrrolylpyrromethane skeleton. This pigment is found to possess antibacterial, antifungal, immunosuppressive and antiproliferative activity. The present study aimed at designing process parameters for the enhanced production of this pigment.Methodology and Results: Peptone glycerol broth was selected as the best synthetic medium. The effects of various media components and process parameters like carbon and nitrogen sources, temperature, pH, incubation period and other supplements were investigated. Maximal amount of prodigiosin was produced at temperature 25 °C, pH 7.0 andincubation period of 48 h. Supplementation of media with maltose and peptone yielded maximal amount of prodigiosin. Incorporation of minimal amount of supplements like silica gel, iron salts, inorganic phosphate also showed promising results. Chromatographic separations suggested that prodigiosin is made up of three different fractions (purple, orange and red. Further investigation of antimicrobial properties of prodigiosin revealed that it is a potent inhibitor against gram positive bacteria like Staphylococcus aureus and Bacillus cereus and fungal pathogens like Candida albicans, C.parapsilosis and Cryptococcus sp. This antimicrobial potency remained stable under a wide range of temperature and pH. The antioxidant capacity of prodigiosin was found to be 22.05 Bg ascorbic acid equivalents/ml of extract. When applied to textiles, prodigiosin resisted the action of acid, alkali and detergent. Conclusion, Significance and Impact of study: Besides combating gram positive bacterial pathogens and some pathogenic yeasts, prodigiosin with strong dyeing and antioxidant activity may find broad applications in textile and therapeutic industries.

  20. Serratia marcescens harbouring SME-type class A carbapenemases in Canada and the presence of blaSME on a novel genomic island, SmarGI1-1. (United States)

    Mataseje, L F; Boyd, D A; Delport, J; Hoang, L; Imperial, M; Lefebvre, B; Kuhn, M; Van Caeseele, P; Willey, B M; Mulvey, M R


    An increasing prevalence since 2010 of Serratia marcescens harbouring the Ambler class A carbapenemase SME prompted us to further characterize these isolates. Isolates harbouring bla(SME) were identified by PCR and sequencing. Phenotypic analysis for carbapenemase activity was carried out by a modified Hodge test and a modified Carba NP test. Antimicrobial susceptibilities were determined by Etest and Vitek 2. Typing was by PFGE of macrorestriction digests. Whole-genome sequencing of three isolates was carried out to characterize the genomic region harbouring the bla(SME)-type genes. All S. marcescens harbouring SME-type enzymes could be detected using a modified Carba NP test. Isolates harbouring bla(SME) were resistant to penicillins and carbapenems, but remained susceptible to third-generation cephalosporins, as well as fluoroquinolones and trimethoprim/sulfamethoxazole. Isolates exhibited diverse genetic backgrounds, though 57% of isolates were found in three clusters. Analysis of whole-genome sequence data from three isolates revealed that the bla(SME) gene occurred in a novel cryptic prophage genomic island, SmarGI1-1. There has been an increasing occurrence of S. marcescens harbouring bla(SME) in Canada since 2010. The bla(SME) gene was found on a genomic island, SmarGI1-1, that can be excised and circularized, which probably contributes to its dissemination amongst S. marcescens. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail:

  1. Multifarious beneficial traits and plant growth promoting potential of Serratia marcescens KiSII and Enterobacter sp. RNF 267 isolated from the rhizosphere of coconut palms (Cocos nucifera L.). (United States)

    George, Priya; Gupta, Alka; Gopal, Murali; Thomas, Litty; Thomas, George V


    Two plant growth promoting bacteria designated as KiSII and RNF 267 isolated from the rhizosphere of coconut palms were identified as Serratia marcescens and Enterobacter sp. based on their phenotypic features, BIOLOG studies and 16S rRNA gene sequence analysis. Both bacteria exhibited phosphate solubilization, ammonification, and production of indole acetic acid, β-1, 3 glucanase activities and 1-aminocyclopropane-1-carboxylate-deaminase activity. They could also tolerate a range of pH conditions, low temperature and salinity (NaCl). In addition, S. marcescens KiSII exhibited N- fixation potential, chitinase activity, siderophore production and antibiotics production. Seed bacterization with these bacteria increased the growth parameters of test plants such as paddy and cowpea over uninoculated control in green house assay. In coconut seedlings, significant increase in growth and nutrient uptake accompanied with higher populations of plant beneficial microorganisms in their rhizospheres were recorded on inoculation with both the PGPRs. The present study clearly revealed that PGPRs can aid in production of healthy and vigorous seedlings of coconut palm which are hardy perennial crops. They offer a scope to be developed into novel PGPR based bioinoculants for production of elite seedlings that can benefit the coconut farming community and the coconut based ecology.

  2. Inhibition of primary roots and stimulation of lateral root development in Arabidopsis thaliana by the rhizobacterium Serratia marcescens 90-166 is through both auxin-dependent and -independent signaling pathways. (United States)

    Shi, Chun-Lin; Park, Hyo-Bee; Lee, Jong Suk; Ryu, Sangryeol; Ryu, Choong-Min


    The rhizobacterium Serratia marcescens strain 90-166 was previously reported to promote plant growth and induce resistance in Arabidopsis thaliana. In this study, the influence of strain 90-166 on root development was studied in vitro. We observed inhibition of primary root elongation, enhanced lateral root emergence, and early emergence of second order lateral roots after inoculation with strain 90-166 at a certain distance from the root. Using the DR5::GUS transgenic A. thaliana plant and an auxin transport inhibitor, N-1-naphthylphthalamic acid, the altered root development was still elicited by strain 90-166, indicating that this was not a result of changes in plant auxin levels. Intriguingly, indole-3-acetic acid, a major auxin chemical, was only identified just above the detection limit in liquid culture of strain 90-166 using liquid chromatography-mass spectrometry. Focusing on bacterial determinants of the root alterations, we found that primary root elongation was inhibited in seedlings treated with cell supernatant (secreted compounds), while lateral root formation was induced in seedlings treated with lysate supernatant (intracellular compounds). Further study revealed that the alteration of root development elicited by strain 90-166 involved the jasmonate, ethylene, and salicylic acid signaling pathways. Collectively, our results suggest that strain 90-166 can contribute to plant root development via multiple signaling pathways.

  3. Biocontrol of the Sugarcane Borer Eldana saccharina by Expression of the Bacillus thuringiensis cry1Ac7 and Serratia marcescens chiA Genes in Sugarcane-Associated Bacteria (United States)

    Downing, Katrina J.; Leslie, Graeme; Thomson, Jennifer A.


    The cry1Ac7 gene of Bacillus thuringiensis strain 234, showing activity against the sugarcane borer Eldana saccharina, was cloned under the control of the tac promoter. The fusion was introduced into the broad-host-range plasmid pKT240 and the integration vector pJFF350 and without the tac promoter into the broad-host-range plasmids pML122 and pKmM0. These plasmids were introduced into a Pseudomonas fluorescens strain isolated from the phylloplane of sugarcane and the endophytic bacterium Herbaspirillum seropedicae found in sugarcane. The ptac-cry1Ac7 construct was introduced into the chromosome of P. fluorescens using the integration vector pJFF350 carrying the artificial interposon Omegon-Km. Western blot analysis showed that the expression levels of the integrated cry1Ac7 gene were much higher under the control of the tac promoter than under the control of its endogenous promoter. It was also determined that multicopy expression in P. fluorescens and H. seropedicae of ptac-cry1Ac7 carried on pKT240 caused plasmid instability with no detectable protein expression. In H. seropedicae, more Cry1Ac7 toxin was produced when the gene was cloned under the control of the Nmr promoter on pML122 than in the opposite orientation and bioassays showed that the former resulted in higher mortality of E. saccharina larvae than the latter. P. fluorescens 14::ptac-tox resulted in higher mortality of larvae than did P. fluorescens 14::tox. An increased toxic effect was observed when P. fluorescens 14::ptac-tox was combined with P. fluorescens carrying the Serratia marcescens chitinase gene chiA, under the control of the tac promoter, integrated into the chromosome. PMID:10877771

  4. Plant Growth-Promoting Endophyte Serratia marcescens AL2-16 Enhances the Growth of Achyranthes aspera L., a Medicinal Plant

    Directory of Open Access Journals (Sweden)

    Khaidem Aruna Devi


    Full Text Available An endophytic bacterium, AL2-16, was isolated from Achyranthes aspera L. It was characterized and identified as Serratia sp. AL2-16 and was experimented for the presence of plant growth-promoting properties. AL2-16 produced siderophore in iron-deficient conditions. The quantitative estimation of siderophore production unit of AL2-16 was maximum after 48 hours of incubation (83.488% in the presence of 1 μM of ferric chloride. The fructose followed by glucose and sucrose were proved to be the best carbon sources resulting in appreciable amount of siderophore production, i.e. 77.223%, 73.584%, and 65.363% respectively. AL2-16 also has the ability to produce indole acetic acid in medium supplemented with l-tryptophan. The highest amount of indole acetic acid, in the presence of 1.0% l-tryptophan, was 123.2 μg/mL after 144 hours. This isolate solubilized inorganic phosphate and also gave positive result for ammonia production. Colonization and pot trial experiments were conducted on A. aspera L. plant. The population of AL2-16 increased from 16.2 × 106 to 11.2 × 108 colony forming unit/g between 3rd and 5th days after inoculation. It significantly (p ≤ 0.05 increased shoot length by 95.52%, fresh shoot weight by 602.38%, fresh root weight by 438%, and area of leaves by 127.2% when inoculated with AL2-16, as compared with uninoculated control.

  5. Serratia Infections: from Military Experiments to Current Practice (United States)

    Mahlen, Steven D.


    Summary: Serratia species, in particular Serratia marcescens, are significant human pathogens. S. marcescens has a long and interesting taxonomic, medical experimentation, military experimentation, and human clinical infection history. The organisms in this genus, particularly S. marcescens, were long thought to be nonpathogenic. Because S. marcescens was thought to be a nonpathogen and is usually red pigmented, the U.S. military conducted experiments that attempted to ascertain the spread of this organism released over large areas. In the process, members of both the public and the military were exposed to S. marcescens, and this was uncovered by the press in the 1970s, leading to U.S. congressional hearings. S. marcescens was found to be a certain human pathogen by the mid-1960s. S. marcescens and S. liquefaciens have been isolated as causative agents of numerous outbreaks and opportunistic infections, and the association of these organisms with point sources such as medical devices and various solutions given to hospitalized patients is striking. Serratia species appear to be common environmental organisms, and this helps to explain the large number of nosocomial infections due to these bacteria. Since many nosocomial infections are caused by multiply antibiotic-resistant strains of S. marcescens, this increases the danger to hospitalized patients, and hospital personnel should be vigilant in preventing nosocomial outbreaks due to this organism. S. marcescens, and probably other species in the genus, carries several antibiotic resistance determinants and is also capable of acquiring resistance genes. S. marcescens and S. liquefaciens are usually identified well in the clinical laboratory, but the other species are rare enough that laboratory technologists may not recognize them. 16S rRNA gene sequencing may enable better identification of some of the less common Serratia species. PMID:21976608

  6. Amikacin treatment of Serratia septicemia in critically ill patients. (United States)

    Mosquera, J M; de Villota, E D; de la Serna, J L; Diez-Balda, V; Tomás, M I; Galdos, P; Rubio, J J


    Serratia marcescens septicemia represents a serious problem in high risk critical care patients. Treatment is difficult because Serratia is usually resistant to most antibiotics. Amikacin is at present the most effective antibiotic in vitro against gentamycin-resistant Serratia, although significant loss of activity may occur in vivo in the group of compromised patients, whose ultimate prognosis may depend eventually upon other associated conditions. In this Medical ICU, 15 patients with Serratia septicemia who were treated with in vitro effective antibiotics (14 were given amikacin) had a mortality of 60%, while 5 patients who received ineffective in vitro antibiotics had a mortality of 100%. In this ICU, 80% of the Serratia isolates were resistant to gentamycin, while only 2.8% were resistant to amikacin. Because amikacin-resistant strains of Serratia have already emerged, appropriate use of this antibiotic is essential in order not to promote the selection of amikacin-resistant strains.

  7. Scleral buckle infection by Serratia species

    Directory of Open Access Journals (Sweden)

    Ramesh Venkatesh


    Full Text Available We describe a rare case of scleral buckle (SB infection with Serratia species. A 48-year-old male with a history of retinal detachment repair with scleral buckling presented with redness, pain, and purulent discharge in the left eye for 4 days. Conjunctival erosion with exposure of the SB and scleral thinning was noted. The SB was removed and sent for culture. Blood and chocolate agar grew Gram-negative rod-shaped bacillus identified as Serratia marcescens. On the basis of the susceptibility test results, the patient was treated with oral and topical antibiotics. After 6 weeks of the treatment, his infection resolved.

  8. Scleral buckle infection by Serratia species. (United States)

    Venkatesh, Ramesh; Agarwal, Manisha; Singh, Shalini; Mayor, Rahul; Bansal, Aditya


    We describe a rare case of scleral buckle (SB) infection with Serratia species. A 48-year-old male with a history of retinal detachment repair with scleral buckling presented with redness, pain, and purulent discharge in the left eye for 4 days. Conjunctival erosion with exposure of the SB and scleral thinning was noted. The SB was removed and sent for culture. Blood and chocolate agar grew Gram-negative rod-shaped bacillus identified as Serratia marcescens . On the basis of the susceptibility test results, the patient was treated with oral and topical antibiotics. After 6 weeks of the treatment, his infection resolved.

  9. Influence of Temperature on the Physiology and Virulence of the Insect Pathogen Serratia sp. Strain SCBI (United States)

    Petersen, Lauren M.


    The physiology of a newly recognized Serratia species, termed South African Caenorhabditis briggsae Isolate (SCBI), which is both a nematode mutualist and an insect pathogen, was investigated and compared to that of Serratia marcescens Db11, a broad-host-range pathogen. The two Serratia strains had comparable levels of virulence for Manduca sexta and similar cytotoxic activity patterns, but motility and lipase and hemolytic activities differed significantly between them. PMID:23042169

  10. Influence of temperature on the physiology and virulence of the insect pathogen Serratia sp. Strain SCBI. (United States)

    Petersen, Lauren M; Tisa, Louis S


    The physiology of a newly recognized Serratia species, termed South African Caenorhabditis briggsae Isolate (SCBI), which is both a nematode mutualist and an insect pathogen, was investigated and compared to that of Serratia marcescens Db11, a broad-host-range pathogen. The two Serratia strains had comparable levels of virulence for Manduca sexta and similar cytotoxic activity patterns, but motility and lipase and hemolytic activities differed significantly between them.

  11. Serratia ureilytica sp. nov., a novel urea-utilizing species. (United States)

    Bhadra, Bhaskar; Roy, Pradosh; Chakraborty, Ranadhir


    A Gram-negative, rod-shaped, urea-dissolving and non-spore-forming bacterium, designated strain NiVa 51(T), was isolated from water of the River Torsa in Hasimara, Jalpaiguri district, West Bengal, India. On the basis of 16S rRNA gene sequence similarity, strain NiVa 51(T) was shown to belong to the gamma-Proteobacteria and to be related to Serratia marcescens subsp. sakuensis (98.35%) and S. marcescens subsp. marcescens (98.30%); however, strain NiVa 51(T) exhibited only 43.7% similarity to S. marcescens by DNA-DNA hybridization. The G+C content of the genomic DNA of the isolate was 60 mol%. Both biochemical characteristics and fatty acid analysis data supported the affiliation of strain NiVa 51(T) to the genus Serratia. Furthermore, strain NiVa 51(T) was found to utilize urea as nitrogen source. The results of DNA-DNA hybridization as well as physiological and biochemical tests allowed genotypic and phenotypic differentiation of strain NiVa 51(T) from recognized Serratia species. Strain NiVa 51(T) therefore represents a novel species, for which the name Serratia ureilytica sp. nov. is proposed, with type strain NiVa 51(T) (=LMG 22860(T)=CCUG 50595(T)).

  12. Brote de bacteriemia por Serratia marcescens en pacientes portadores de catéteres tunelizados en hemodiálisis secundario a colonización de la solución antiséptica. Experiencia en 4 centros

    Directory of Open Access Journals (Sweden)

    José L. Merino


    Conclusiones: Las bacteriemias por gérmenes no convencionales deben ponernos sobre aviso para investigar posibles brotes. La aplicación de una solución contaminada por S. marcescens en los catéteres en hemodiálisis fue la vía de bacteriemia. El tratamiento antibiótico intravenoso y el sellado de los catéteres permitió una excelente supervivencia tanto de los pacientes como de los catéteres.

  13. The Serratia gene cluster encoding biosynthesis of the red antibiotic, prodigiosin, shows species- and strain-dependent genome context variation

    DEFF Research Database (Denmark)

    Harris, Abigail K P; Williamson, Neil R; Slater, Holly


    The prodigiosin biosynthesis gene cluster (pig cluster) from two strains of Serratia (S. marcescens ATCC 274 and Serratia sp. ATCC 39006) has been cloned, sequenced and expressed in heterologous hosts. Sequence analysis of the respective pig clusters revealed 14 ORFs in S. marcescens ATCC 274...... and 15 ORFs in Serratia sp. ATCC 39006. In each Serratia species, predicted gene products showed similarity to polyketide synthases (PKSs), non-ribosomal peptide synthases (NRPSs) and the Red proteins of Streptomyces coelicolor A3(2). Comparisons between the two Serratia pig clusters and the red cluster...... from Str. coelicolor A3(2) revealed some important differences. A modified scheme for the biosynthesis of prodigiosin, based on the pathway recently suggested for the synthesis of undecylprodigiosin, is proposed. The distribution of the pig cluster within several Serratia sp. isolates is demonstrated...

  14. Serratia nematodiphila sp. nov., associated symbiotically with the entomopathogenic nematode Heterorhabditidoides chongmingensis (Rhabditida: Rhabditidae). (United States)

    Zhang, Chong-Xing; Yang, Shou-Yun; Xu, Ming-Xu; Sun, Jie; Liu, Huan; Liu, Jing-Rui; Liu, Hui; Kan, Fei; Sun, Jing; Lai, Ren; Zhang, Ke-Yun


    A novel red-pigmented, Gram-negative, motile, fluorescent, rod-shaped strain, DZ0503SBS1(T), with a single lateral flagellum, was isolated from the intestine of the nematode Heterorhabditidoides chongmingensis. Comparative 16S rRNA gene sequence analysis indicated that the strain is a member of the genus Serratia, sharing highest sequence similarities with Serratia marcescens subsp. sakuensis JCM 11315(T) (99.8 %), S. marcescens subsp. marcescens DSM 30121(T) (99.5 %) and Serratia ureilytica LMG 22860(T) (98.3 %). Similarities between the rpoB gene sequence of strain DZ0503SBS1(T) and those of S. marcescens subsp. sakuensis JCM 11315(T), S. marcescens subsp. marcescens DSM 30121(T) and S. ureilytica LMG 22860(T) were 98.0, 97.4 and 98.3 %, respectively. DNA-DNA hybridization values of strain DZ0503SBS1(T) with S. marcescens subsp. sakuensis JCM 11315(T), S. marcescens subsp. marcescens DSM 30121(T) and S. ureilytica LMG 22860(T) were 68.2, 65.1 and 53.0 %, respectively. The major isoprenoid quinone of strain DZ0503SBS1(T) was Q-8 and the predominant fatty acids were C(16 : 0) (34.76 %), cyclo-C(17 : 0) (20.03 %) and cyclo-C(19 : 0)omega8c (17.24 %). The cyclo-C(19 : 0)omega8c content (17.24 %) was significantly different from those found in S. marcescens subsp. sakuensis JCM 11315(T) and S. marcescens subsp. marcescens DSM 30121(T). Some characteristics of strain DZ0503SBS1(T), i.e. fluorescence and its symbiotic association with nematodes, have not been reported previously in any species of the genus Serratia. Phenotypic and biochemical characteristics and molecular data show that strain DZ0503SBS1(T) represents a novel species, for which the name Serratia nematodiphila sp. nov. is proposed; the type strain is DZ0503SBS1(T) (=KCTC 22130(T) =CGMCC 1.6853(T)).

  15. Production of Methioninase from Serratia Marcescens Isolated from ...

    African Journals Online (AJOL)


    Medicus, JournalSeek, Journal Citation Reports/Science Edition, Directory of Open Access Journals. (DOAJ), African .... mass was measured from the 11th day of tumor ..... 1272. 6. Organization for the economic cooperation and development.

  16. Infective endocarditis of a rare etiology: Serratia marcescens

    Directory of Open Access Journals (Sweden)

    Đokić Milomir


    Full Text Available Infective endocarditis (IE is a unique diagnostic and therapeutic challenge. It is a severe disease, fatal before penicillin discovery. Atypical presentations frequently led to delayed diagnosis and poor outcome. There was little information about the natural history of the vegetations during medical treatment or the relation of morphologic changes in vegetation to late complications. Application of a new diagnostic criteria and echocardiography, increased the number of definite diagnosis. Trans-thoracic and trans-esophageal echocardiography had an established role in the management of patients with IE. The evolution of vegetation size, its mobility, and consistency, the extent of the disease, and the severity of valvular regurgutation were related to late complications. With therapeutic options including modern antibiotic treatment and early surgical intervention IE turned out to be a curable disease. Reduction in mortality also depended on prevention. Antibiotic prophylaxis of IE was important, but low mortality was also the result of early treatment, especially in the event of early recognition of symptoms and signs of the disease.

  17. Rapid Magnetic Nanobiosensor for the detection of Serratia marcescen (United States)

    Aljabali, Alaa A. A.; Hussein, Emad; Aljumaili, Omar; Zoubi, Mazhar Al; Altrad, Bahaa; Albatayneh, Khaled; Al-razaq, Mutaz A. Abd


    The development of rapid, sensitive, accurate and reliable bacterial detection methods are of keen interest to ensure food safety and hospital security. Therefore, the development of a fast, specific, low-cost and trusted methods is in high demand. Magnetic nanoparticles with their unique material properties have been utilized as a tool for pathogen detection. Here, we present a novel iron oxide nanoparticles labeled with specific targeting antibodies to improve specificity and extend the use of nanoparticles as nanosensors. The results indicated that antibody labeled iron oxide platform that binds specifically to Serriata marcescenst in a straightforward method is very specific and sensitive. The system is capable of rapid and specific detection of various clinically relevant bacterial species, with sensitivity down to single bacteria. The generic platform could be used to identify pathogens for a variety of applications rapidly.

  18. Association of plant growth-promoting Serratia spp. with the root nodules of chickpea. (United States)

    Zaheer, Ahmad; Mirza, Babur S; Mclean, Joan E; Yasmin, Sumera; Shah, Tariq Mahmud; Malik, Kauser A; Mirza, M Sajjad


    Serratia species-affiliated DNA sequences have recently been discovered in the root nodules of two chickpea cultivars; however, little is known about their potential influence on chickpea plant growth. All Serratia-affiliated sequences (1136) could be grouped into two clusters at 98% DNA similarity. The major cluster, represented by 96% of sequences, was closely associated with Serratia marcescens sequences from GenBank. In the current study, we isolated two Serratia strains, 5D and RTL100, from root nodules of a field-grown Desi cultivar from Faisalabad and Thal areas, respectively. In vitro, strain 5D showed significantly higher phosphate (P) solubilization and lactic acid production than RTL100, whereas a comparable concentration of phytohormone was produced by both isolates. The application of Serratia strain 5D as an inoculum resulted in 25.55% and 30.85% increases in the grain yield of crops grown on fertile soil in irrigated areas and nutrient-deficient soil in rainfed areas, respectively, compared to the non-inoculated control. Results of plant inoculations indicated that Serratia sp. 5D and RTL100 can serve as effective microbial inoculants, particularly in nutrient-deficient soils in rainfed areas, where chickpea is the only major crop grown during the entire year. Copyright © 2016 Institut Pasteur. All rights reserved.

  19. Inactivation of the Major Hemolysin Gene Influences Expression of the Nonribosomal Peptide Synthetase Gene swrA in the Insect Pathogen Serratia sp. Strain SCBI. (United States)

    Petersen, Lauren M; LaCourse, Kaitlyn; Schöner, Tim A; Bode, Helge; Tisa, Louis S


    Hemolysins are important virulence factors for many bacterial pathogens, including Serratia marcescens The role of the major hemolysin gene in the insect pathogen Serratia sp. strain SCBI was investigated using both forward and reverse-genetics approaches. Introduction of the major hemolysin gene into Escherichia coli resulted in a gain of both virulence and hemolytic activity. Inactivation of this hemolysin in Serratia sp. SCBI resulted in a loss of hemolysis but did not attenuate insecticidal activity. Unexpectedly, inactivation of the hemolysin gene in Serratia sp. SCBI resulted in significantly increased motility and increased antimicrobial activity. Reverse transcription-quantitative PCR (qRT-PCR) analysis of mutants with a disrupted hemolysin gene showed a dramatic increase in mRNA levels of a nonribosomal peptide synthetase gene, swrA , which produces the surfactant serrawettin W2. Mutation of the swrA gene in Serratia sp. SCBI resulted in highly varied antibiotic activity, motility, virulence, and hemolysis phenotypes that were dependent on the site of disruption within this 17.75-kb gene. When introduced into E. coli , swrA increases rates of motility and confers antimicrobial activity. While it is unclear how inactivation of the major hemolysin gene influences the expression of swrA , these results suggest that swrA plays an important role in motility and antimicrobial activity in Serratia sp. SCBI. IMPORTANCE The opportunistic Gram-negative bacteria of the genus Serratia are widespread in the environment and can cause human illness. A comparative genomics analysis between Serratia marcescens and a new Serratia species from South Africa, termed Serratia sp. strain SCBI, shows that these two organisms are closely related but differ in pathogenesis. S. marcescens kills Caenorhabditis nematodes, while Serratia sp. SCBI is not harmful and forms a beneficial association with them. This distinction presented the opportunity to investigate potential differences

  20. The Genomic Basis of Intrinsic and Acquired Antibiotic Resistance in the Genus Serratia (United States)

    Sandner-Miranda, Luisa; Vinuesa, Pablo; Cravioto, Alejandro; Morales-Espinosa, Rosario


    Serratia marcescens, a member of the Enterobacteriaceae family, was long thought to be a non-pathogenic bacterium prevalent in environmental habitats. Together with other members of this genus, it has emerged in recent years as an opportunistic nosocomial pathogen causing various types of infections. One important feature of pathogens belonging to this genus is their intrinsic and acquired resistance to a variety of antibiotic families, including β-lactam, aminoglycosides, quinolones and polypeptide antibiotics. The aim of this study was to elucidate which genes participate in the intrinsic and acquired antibiotic resistance of this genus in order to determine the Serratia genus resistome. We performed phylogenomic and comparative genomic analyses using 32 Serratia spp. genomes deposited in the NCBI GenBank from strains isolated from different ecological niches and different lifestyles. S. marcescens strain SmUNAM836, which was previously isolated from a Mexican adult with obstructive pulmonary disease, was included in this study. The results show that most of the antibiotic resistance genes (ARGs) were found on the chromosome, and to a lesser degree, on plasmids and transposons acquired through horizontal gene transfer. Four strains contained the gyrA point mutation in codon Ser83 that confers quinolone resistance. Pathogenic and environmental isolates presented a high number of ARGs, especially genes associated with efflux systems. Pathogenic strains, specifically nosocomial strains, presented more acquired resistance genes than environmental isolates. We may conclude that the environment provides a natural reservoir for antibiotic resistance, which has been underestimated in the medical field.

  1. Genome sequence and comparative analysis of a putative entomopathogenic Serratia isolated from Caenorhabditis briggsae. (United States)

    Abebe-Akele, Feseha; Tisa, Louis S; Cooper, Vaughn S; Hatcher, Philip J; Abebe, Eyualem; Thomas, W Kelley


    Entomopathogenic associations between nematodes in the genera Steinernema and Heterorhabdus with their cognate bacteria from the bacterial genera Xenorhabdus and Photorhabdus, respectively, are extensively studied for their potential as biological control agents against invasive insect species. These two highly coevolved associations were results of convergent evolution. Given the natural abundance of bacteria, nematodes and insects, it is surprising that only these two associations with no intermediate forms are widely studied in the entomopathogenic context. Discovering analogous systems involving novel bacterial and nematode species would shed light on the evolutionary processes involved in the transition from free living organisms to obligatory partners in entomopathogenicity. We report the complete genome sequence of a new member of the enterobacterial genus Serratia that forms a putative entomopathogenic complex with Caenorhabditis briggsae. Analysis of the 5.04 MB chromosomal genome predicts 4599 protein coding genes, seven sets of ribosomal RNA genes, 84 tRNA genes and a 64.8 KB plasmid encoding 74 genes. Comparative genomic analysis with three of the previously sequenced Serratia species, S. marcescens DB11 and S. proteamaculans 568, and Serratia sp. AS12, revealed that these four representatives of the genus share a core set of ~3100 genes and extensive structural conservation. The newly identified species shares a more recent common ancestor with S. marcescens with 99% sequence identity in rDNA sequence and orthology across 85.6% of predicted genes. Of the 39 genes/operons implicated in the virulence, symbiosis, recolonization, immune evasion and bioconversion, 21 (53.8%) were present in Serratia while 33 (84.6%) and 35 (89%) were present in Xenorhabdus and Photorhabdus EPN bacteria respectively. The majority of unique sequences in Serratia sp. SCBI (South African Caenorhabditis briggsae Isolate) are found in ~29 genomic islands of 5 to 65 genes and are

  2. The Genomic Basis of Intrinsic and Acquired Antibiotic Resistance in the Genus Serratia

    Directory of Open Access Journals (Sweden)

    Luisa Sandner-Miranda


    Full Text Available Serratia marcescens, a member of the Enterobacteriaceae family, was long thought to be a non-pathogenic bacterium prevalent in environmental habitats. Together with other members of this genus, it has emerged in recent years as an opportunistic nosocomial pathogen causing various types of infections. One important feature of pathogens belonging to this genus is their intrinsic and acquired resistance to a variety of antibiotic families, including β-lactam, aminoglycosides, quinolones and polypeptide antibiotics. The aim of this study was to elucidate which genes participate in the intrinsic and acquired antibiotic resistance of this genus in order to determine the Serratia genus resistome. We performed phylogenomic and comparative genomic analyses using 32 Serratia spp. genomes deposited in the NCBI GenBank from strains isolated from different ecological niches and different lifestyles. S. marcescens strain SmUNAM836, which was previously isolated from a Mexican adult with obstructive pulmonary disease, was included in this study. The results show that most of the antibiotic resistance genes (ARGs were found on the chromosome, and to a lesser degree, on plasmids and transposons acquired through horizontal gene transfer. Four strains contained the gyrA point mutation in codon Ser83 that confers quinolone resistance. Pathogenic and environmental isolates presented a high number of ARGs, especially genes associated with efflux systems. Pathogenic strains, specifically nosocomial strains, presented more acquired resistance genes than environmental isolates. We may conclude that the environment provides a natural reservoir for antibiotic resistance, which has been underestimated in the medical field.

  3. Quorum-sensing-directed protein expression in Serratia proteamaculans B5a

    DEFF Research Database (Denmark)

    Christensen, Allan Beck; Riedel, Kathrin; Eberl, Leo


    N-Acyl-L-homoserine-lactone-producing Serratia species are frequently encountered in spoiling foods of vegetable and protein origin. The role of quorum sensing in the food spoiling properties of these bacteria is currently being investigated. A set of luxR luxI homologous genes encoding a putative...... quorum sensor was identified in the N-(3-oxo-hexanoyl)-L-homoserine lactone (3-oxo-C6-HSL)-producing Serratia proteamaculans strain B5a. The 3-oxo-C6-HSL synthase SprI showed 79% similarity with Esal from Pantoea stewartii and the putative regulatory protein SprR was 86% similar to the SpnR of Serratia...... marcescens. Proteome analysis suggested that the presence of at least 39 intracellular proteins was affected by the 3-oxo-C6-HSL-based quorum sensing system. The lipB-encoded secretion system was identified as one target gene of the quorum sensing system. LipB was required for the production of extracellular...

  4. Effect of Selected Monosaccharide on Growth and Putrescine Production of Serratia marcescens

    Czech Academy of Sciences Publication Activity Database

    Pleva, P.; Lazárková, Z.; Andresová, Adéla; Lorencová, E.; Buňka, F.; Buňková, L.


    Roč. 28, SI (2012) ISSN 0322-7340 Grant - others:UTB(CZ) IGA/FT/2012/027 Institutional support: RVO:67985858 Keywords : monosaccharides * chromatography * microbial metabilic activity Subject RIV: CF - Physical ; Theoretical Chemistry

  5. Selection of the Mutants with High Hydroquinone Degradation Ability of Serratia Marcesscen by Plasma Mutation

    International Nuclear Information System (INIS)

    Yao Risheng; You Qidong; He Weijing; Zhu Huixia


    In this study, an efficient way by plasma induced mutation was applied to improve the hydroquinone degradation capacity of Serratia marcescens AB 90027 (SM27). The results showed that combined with the selection of hydroquinone tolerance, the mutant with high hydroquinone degradation ability induced by plasma could be achieved. The best dose for plasma mutation was 15 s, which showed a 47.0% higher positive mutation ratio. Besides, the aimed mutant was markedly different from the parent strain (SM27) in colonial traits while cultivated on Kings media. Finally, the hydroquinone degradation ratio reached 70.5% using the induced mutant strain with 1500 mg/L hydroquinone (HQ) after 15 days of cultivation as the selective conditions; however, it was only 46.7% for SM27. The improvement of the degradation capacity by the induced mutant with a high concentration of HQ selection was attributed to its faster growth and higher hydroquinone tolerance compared with that of the parent strain.

  6. Diversity and antimicrobial susceptibility of oxytetracycline-resistant isolates of Stenotrophomonas sp. and Serratia sp. associated with Costa Rican crops. (United States)

    Rodríguez, C; Wachlin, A; Altendorf, K; García, F; Lipski, A


    To ameliorate the identification, evaluate the diversity, and determine the antimicrobial sensitivity of 19 oxytetracycline-resistant isolates of Stenotrophomonas sp. and Serratia sp. associated with Costa Rican crops. Phenotypical, chemotaxonomical, and molecular data allocated most isolates to the species Sten. maltophilia and Ser. marcescens. The API profiles, antimicrobial resistance patterns (ATB system), and BOX-polymerase chain reaction (PCR) genomic fingerprints of isolates of Stenotrophomonas sp. exhibited a higher degree of heterogeneity than those obtained for the isolates of Serratia sp. The former group of bacteria exhibited multiresistance to antimicrobials. In contrast, isolates of Serratia sp. were sensitive to the majority of the drugs tested. Changes in the results of the antibiograms throughout incubation, which indicate an induction of tolerance, were observed for isolates of both the species. Minimum inhibitory concentration of oxytetracycline, determined using E-test stripes, were rather elevated. The occurrence of two species of opportunistic pathogens in crop-associated materials poses a risk to consumers in the community. The phenotypic and genotypic data presented could support epidemiologist and physicians dealing with infections caused by environmental strains of these taxa.

  7. 21 CFR 866.3630 - Serratia spp. serological reagents. (United States)


    ... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3630 Serratia spp... antigens and antisera used in serological tests to identify Serratia spp. from cultured isolates. The...

  8. Isomaltulose production using free and immobilized Serratia ...

    African Journals Online (AJOL)

    Isomaltulose is a low cariogenic sweetener used as a substitute for sucrose in the food industry. In this study, isomaltulose production by Serratia plymuthica ATCC 15928 was performed using free and immobilized cells. Response Surface Methodology was employed to evaluate the influence of temperature, wet cell mass ...

  9. Visualization of the Serratia Type VI Secretion System Reveals Unprovoked Attacks and Dynamic Assembly

    Directory of Open Access Journals (Sweden)

    Amy J. Gerc


    Full Text Available The Type VI secretion system (T6SS is a bacterial nanomachine that fires toxic proteins into target cells. Deployment of the T6SS represents an efficient and widespread means by which bacteria attack competitors or interact with host organisms and may be triggered by contact from an attacking neighbor cell as a defensive strategy. Here, we use the opportunist pathogen Serratia marcescens and functional fluorescent fusions of key components of the T6SS to observe different subassemblies of the machinery simultaneously and on multiple timescales in vivo. We report that the localization and dynamic behavior of each of the components examined is distinct, revealing a multi-stage and dynamic assembly process for the T6SS machinery. We also show that the T6SS can assemble and fire without needing a cell contact trigger, defining an aggressive strategy that broadens target range and suggesting that activation of the T6SS is tailored to survival in specific niches.

  10. Visualization of the Serratia Type VI Secretion System Reveals Unprovoked Attacks and Dynamic Assembly (United States)

    Gerc, Amy J.; Diepold, Andreas; Trunk, Katharina; Porter, Michael; Rickman, Colin; Armitage, Judith P.; Stanley-Wall, Nicola R.; Coulthurst, Sarah J.


    Summary The Type VI secretion system (T6SS) is a bacterial nanomachine that fires toxic proteins into target cells. Deployment of the T6SS represents an efficient and widespread means by which bacteria attack competitors or interact with host organisms and may be triggered by contact from an attacking neighbor cell as a defensive strategy. Here, we use the opportunist pathogen Serratia marcescens and functional fluorescent fusions of key components of the T6SS to observe different subassemblies of the machinery simultaneously and on multiple timescales in vivo. We report that the localization and dynamic behavior of each of the components examined is distinct, revealing a multi-stage and dynamic assembly process for the T6SS machinery. We also show that the T6SS can assemble and fire without needing a cell contact trigger, defining an aggressive strategy that broadens target range and suggesting that activation of the T6SS is tailored to survival in specific niches. PMID:26387948

  11. Serratia myotis sp. nov. and Serratia vespertilionis sp. nov., isolated from bats hibernating in caves. (United States)

    García-Fraile, P; Chudíčková, M; Benada, O; Pikula, J; Kolařík, M


    During the study of bacteria associated with bats affected by white-nose syndrome hibernating in caves in the Czech Republic, we isolated two facultatively anaerobic, Gram-stain-negative bacteria, designated strains 12(T) and 52(T). Strains 12(T) and 52(T) were motile, rod-like bacteria (0.5-0.6 µm in diameter; 1-1.3 µm long), with optimal growth at 20-35 °C and pH 6-8. On the basis of the almost complete sequence of their 16S rRNA genes they should be classified within the genus Serratia; the closest relatives to strains 12(T) and 52(T) were Serratia quinivorans DSM 4597(T) (99.5 % similarity in 16S rRNA gene sequences) and Serratia ficaria DSM 4569(T) (99.5% similarity in 16S rRNA gene sequences), respectively. DNA-DNA relatedness between strain 12(T) and S. quinivorans DSM 4597(T) was only 37.1% and between strain 52(T) and S. ficaria DSM 4569(T) was only 56.2%. Both values are far below the 70% threshold value for species delineation. In view of these data, we propose the inclusion of the two isolates in the genus Serratia as representatives of Serratia myotis sp. nov. (type strain 12(T) =CECT 8594(T) =DSM 28726(T)) and Serratia vespertilionis sp. nov. (type strain 52(T) =CECT 8595(T) =DSM 28727(T)). © 2015 IUMS.

  12. First report of the cucurbit yellow vine disease caused by Serratia marcescens in watermelon and yellow squash in Alabama (United States)

    Symptoms typical of cucurbit yellow vine disease (CYVD) were first observed in a 2 ha watermelon field in Crawford, Russell County, Alabama on 8 June 2010. Watermelon plants, cv. 'Jubilee,' exhibited a yellow or chlorotic appearance and some plants were completely wilted. On 24 June plant samples ...

  13. Serratia aquatilis sp. nov., isolated from drinking water systems. (United States)

    Kämpfer, Peter; Glaeser, Stefanie P


    A cream-white-pigmented, oxidase-negative bacterium (strain 2015-2462-01T), isolated from a drinking water system, was investigated in detail to determine its taxonomic position. Cells of the isolate were rod-shaped and stained Gram-negative. A comparison of the 16S rRNA gene sequence of strain 2015-2462-01T with sequences of the type strains of closely related species of the genus Serratia revealed highest similarity to Serratia fonticola (98.4 %), Serratia proteamaculans (97.8 %), Serratia liquefaciens and Serratia grimesii (both 97.7 %). 16S rRNA gene sequence similarities to all other Serratia species were below 97.4 %. Multilocus sequence analysis (MLSA) on the basis of concatenated partial gyrB, rpoB, infB and atpD gene sequences showed a clear distinction of strain 2015-2462-01T from the type strains of the closest related Serratia species. The fatty acid profile of the strain consisted of C16 : 1 ω7c, C16 : 0; C14 : 0 and C14 : 0 3-OH/iso-C16 : 1 I as major components. DNA-DNA hybridizations between 2015-2462-01T and S. fonticola ATCC 29844T resulted in a relatedness value of 27 % (reciprocal 20 %). This DNA-DNA hybridization result in combination with the MLSA results and the differential biochemical properties indicated that strain 2015-2462-01T represents a novel species of the genus Serratia, for which the name Serratia aquatilis sp. nov. is proposed. The type strain is 2015-2462-01T ( = LMG 29119T = CCM 8626T).

  14. Reduction of Mo(VI) by the bacterium Serratia sp. strain DRY5. (United States)

    Rahman, M F A; Shukor, M Y; Suhaili, Z; Mustafa, S; Shamaan, N A; Syed, M A


    The need to isolate efficient heavy metal reducers for cost effective bioremediation strategy have resulted in the isolation of a potent molybdenum-reducing bacterium. The isolate was tentatively identified as Serratia sp. strain DRY5 based on the Biolog GN carbon utilization profiles and partial 16S rDNA molecular phylogeny. Strain DRY5 produced 2.3 times the amount of Mo-blue than S. marcescens strain Dr.Y6, 23 times more than E. coli K12 and 7 times more than E. cloacae strain 48. Strain DRY5 required 37 degrees C and pH 7.0 for optimum molybdenum reduction. Carbon sources such as sucrose, maltose, glucose and glycerol, supported cellular growth and molybdate reduction after 24 hr of static incubation. The most optimum carbon source that supported reduction was sucrose at 1.0% (w/v). Ammonium sulphate, ammonium chloride, glutamic acid, cysteine, and valine supported growth and molybdate reduction with ammonium sulphate as the optimum nitrogen source at 0. 2% (w/v). Molybdate reduction was optimally supported by 30 mM molybdate. The optimum concentration of phosphate for molybdate reduction was 5 mM when molybdate concentration was fixed at 30 mM and molybdate reduction was totally inhibited at 100 mM phosphate. Mo-blue produced by this strain shows a unique characteristic absorption profile with a maximum peak at 865 nm and a shoulder at 700 nm, Dialysis tubing experiment showed that 95.42% of Mo-blue was found in the dialysis tubing suggesting that the molybdate reduction seen in this bacterium was catalyzed by enzyme(s). The characteristics of isolate DRY5 suggest that it would be useful in the bioremediation ofmolybdenum-containing waste.

  15. Polyhydroxybutyrate accumulation by a Serratia sp. (United States)

    Lugg, Harriet; Sammons, Rachel L; Marquis, Peter M; Hewitt, Christopher J; Yong, Ping; Paterson-Beedle, Marion; Redwood, Mark D; Stamboulis, Artemis; Kashani, Mitra; Jenkins, Mike; Macaskie, Lynne E


    A strain of Serratia sp. showed intracellular electron-transparent inclusion bodies when incubated in the presence of citrate and glycerol 2-phosphate without nitrogen source following pre-growth under carbon-limitation in continuous culture. About 1.3 mmol citrate were consumed per 450 mg biomass, giving a calculated yield of maximally 55% of stored material per g of biomass dry wt. The inclusion bodies were stained with Sudan Black and Nile Red (NR), suggesting a lipid material, which was confirmed as polyhydroxybutyrate (PHB) by analysis of molecular fragments by GC and by FTIR spectroscopy of isolated bio-PHB in comparison with reference material. Multi-parameter flow cytometry in conjunction with NR fluorescence, and electron microscopy, showed that not all cells contained heavy PHB bodies, suggesting the potential for increasing the overall yield. The economic attractiveness is enhanced by the co-production of nanoscale hydroxyapatite (HA), a possible high-value precursor for bone replacement materials.

  16. Ammonia produced by bacterial colonies promotes growth of ampicillin-sensitive Serratia sp. by means of antibiotic inactivation. (United States)

    Cepl, Jaroslav; Blahůšková, Anna; Cvrčková, Fatima; Markoš, Anton


    Volatiles produced by bacterial cultures are known to induce regulatory and metabolic alterations in nearby con-specific or heterospecific bacteria, resulting in phenotypic changes including acquisition of antibiotic resistance. We observed unhindered growth of ampicillin-sensitive Serratia rubidaea and S. marcescens on ampicillin-containing media, when exposed to volatiles produced by dense bacterial growth. However, this phenomenon appeared to result from pH increase in the medium caused by bacterial volatiles rather than alterations in the properties of the bacterial cultures, as alkalization of ampicillin-containing culture media to pH 8.5 by ammonia or Tris exhibited the same effects, while pretreatment of bacterial cultures under the same conditions prior to antibiotic exposure did not increase ampicillin resistance. Ampicillin was readily inactivated at pH 8.5, suggesting that observed bacterial growth results from metabolic alteration of the medium, rather than an active change in the target bacterial population (i.e. induction of resistance or tolerance). However, even such seemingly simple mechanism may provide a biologically meaningful basis for protection against antibiotics in microbial communities growing on semi-solid media. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  17. Serratia oryzae sp. nov., isolated from rice stems. (United States)

    Zhang, Cai-Wen; Zhang, Jun; Zhao, Juan-Juan; Zhao, Xia; Zhao, Dong-Fang; Yin, Hua-Qun; Zhang, Xiao-Xia


    A novel endophytic bacterium, strain J11-6T, was isolated from rice stems. Its taxonomic position was investigated using a polyphasic approach. The novel strain was Gram-staining-negative, facultatively anaerobic, motile and rod-shaped. Although the results of phylogenetic analysis based on 16S rRNA gene sequences indicated that J11-6T represented a member of the genus Rahnella, multilocus sequence analysis (MLSA) on the basis of concatenated partial atpD, gyrB, rpoB and infB gene sequences showed a clear distinction of J11-6T from the type strains of species of the genus Rahnella but indicated that it lay within the clade of the genus Serratia. The phylogenetically closest species were Serratia fonticola and Serratia aquatilis on the basis of the results of the MLSA phylogenetic analysis. The predominant cellular fatty acids were C16 : 1ω7c (38.7 %) and C16 : 0 (25.0 %). The DNA G+C content was 53.2 mol%. The DNA-DNA relatedness was 17.4 % between J11-6T and Rahnella aquatilis CIP 78.65T, and 29.2 % between J11-6T and S. fonticola LMG 7882T which indicates that this strain represents a novel species of the genus Serratia. Characterization by genotypic and phenotypic analysis indicated that J11-6T (=ACCC 19934T=KCTC 52529T) represents a novel species of the genus Serratia, for which the name Serratia oryzae sp. nov. is proposed.

  18. An insect pathogenic symbiosis between a Caenorhabditis and Serratia (United States)

    Morrison, Julie; Cooper, Vaughn; Thomas, W. Kelley


    We described an association between a strain of the nematode Caenorhabditis briggsae, i.e. KT0001, and the bacteria Serratia sp. SCBI (South African Caenorhabditis briggsae isolate), which was able to kill the insect Galleria (G. mellonella). Here we show that the Serratia sp. SCBI lines the gut of the nematode, similar to the Heterorhabditis-Photorhabdus complex, indicating that the association is possibly internal. We also expand on the relevance of this tripartite, i.e. insect-nematode-bacteria, interaction in the broader evolutionary context and Caenorhabditis natural history. PMID:21389770

  19. Biosynthesis of the red antibiotic, prodigiosin, in Serratia

    DEFF Research Database (Denmark)

    Williamson, Neil R; Simonsen, Henrik Toft; Ahmed, Raef A A


    The biosynthetic pathway of the red-pigmented antibiotic, prodigiosin, produced by Serratia sp. is known to involve separate pathways for the production of the monopyrrole, 2-methyl-3-n-amyl-pyrrole (MAP) and the bipyrrole, 4-methoxy-2,2'-bipyrrole-5-carbaldehyde (MBC) which are then coupled...

  20. Genome sequencing and annotation of Serratia sp. strain TEL. (United States)

    Lephoto, Tiisetso E; Gray, Vincent M


    We present the annotation of the draft genome sequence of Serratia sp. strain TEL (GenBank accession number KP711410). This organism was isolated from entomopathogenic nematode Oscheius sp. strain TEL (GenBank accession number KM492926) collected from grassland soil and has a genome size of 5,000,541 bp and 542 subsystems. The genome sequence can be accessed at DDBJ/EMBL/GenBank under the accession number LDEG00000000.

  1. Genome sequencing and annotation of Serratia sp. strain TEL

    Directory of Open Access Journals (Sweden)

    Tiisetso E. Lephoto


    Full Text Available We present the annotation of the draft genome sequence of Serratia sp. strain TEL (GenBank accession number KP711410. This organism was isolated from entomopathogenic nematode Oscheius sp. strain TEL (GenBank accession number KM492926 collected from grassland soil and has a genome size of 5,000,541 bp and 542 subsystems. The genome sequence can be accessed at DDBJ/EMBL/GenBank under the accession number LDEG00000000.

  2. Genome sequencing and annotation of Serratia sp. strain TEL


    Lephoto, Tiisetso E.; Gray, Vincent M.


    We present the annotation of the draft genome sequence of Serratia sp. strain TEL (GenBank accession number KP711410). This organism was isolated from entomopathogenic nematode Oscheius sp. strain TEL (GenBank accession number KM492926) collected from grassland soil and has a genome size of 5,000,541 bp and 542 subsystems. The genome sequence can be accessed at DDBJ/EMBL/GenBank under the accession number LDEG00000000.

  3. Analysis of the Genome and Chromium Metabolism-Related Genes of Serratia sp. S2. (United States)

    Dong, Lanlan; Zhou, Simin; He, Yuan; Jia, Yan; Bai, Qunhua; Deng, Peng; Gao, Jieying; Li, Yingli; Xiao, Hong


    This study is to investigate the genome sequence of Serratia sp. S2. The genomic DNA of Serratia sp. S2 was extracted and the sequencing library was constructed. The sequencing was carried out by Illumina 2000 and complete genomic sequences were obtained. Gene function annotation and bioinformatics analysis were performed by comparing with the known databases. The genome size of Serratia sp. S2 was 5,604,115 bp and the G+C content was 57.61%. There were 5373 protein coding genes, and 3732, 3614, and 3942 genes were respectively annotated into the GO, KEGG, and COG databases. There were 12 genes related to chromium metabolism in the Serratia sp. S2 genome. The whole genome sequence of Serratia sp. S2 is submitted to the GenBank database with gene accession number of LNRP00000000. Our findings may provide theoretical basis for the subsequent development of new biotechnology to repair environmental chromium pollution.

  4. Serratia marcescens: A case history to illustrate the value of radiographer history taking in the face of poor health professional communication

    International Nuclear Information System (INIS)

    Hannah, Susan; McConnell, Jonathan


    The radiographer is often the only point of contact that a patient may have with the Medical Imaging team. Assessment of the patient by the radiographer is a role that has tacitly and historically occurred in most practice, though in this age of litigation and heavy workloads it is prudent to suggest that a formulated approach should be adopted. This may occur in undergraduate education and be developed in the postgraduate forum such that good imaging is performed and appropriate extra information reaches the radiologist that may often be lacking in the referral historical details. This case based article uses an unusual presentation of osteomyelitis to illustrate where radiographer patient assessment, communication and teamwork could have contributed to a more rapid and hence higher quality experience for one situation, and also demonstrates the difficulties of eliciting information locked in the memories of patients.

  5. Serratia marcescens: A case history to illustrate the value of radiographer history taking in the face of poor health professional communication

    Energy Technology Data Exchange (ETDEWEB)

    Hannah, Susan [Medical Imaging Department, The Townsville Hospital, 100 Angus Smith Dr, Douglas, QLD 4814 (Australia); McConnell, Jonathan [Department of Medical Imaging and Radiation Sciences, Monash University, Melbourne, VIC3800 (Australia)], E-mail:


    The radiographer is often the only point of contact that a patient may have with the Medical Imaging team. Assessment of the patient by the radiographer is a role that has tacitly and historically occurred in most practice, though in this age of litigation and heavy workloads it is prudent to suggest that a formulated approach should be adopted. This may occur in undergraduate education and be developed in the postgraduate forum such that good imaging is performed and appropriate extra information reaches the radiologist that may often be lacking in the referral historical details. This case based article uses an unusual presentation of osteomyelitis to illustrate where radiographer patient assessment, communication and teamwork could have contributed to a more rapid and hence higher quality experience for one situation, and also demonstrates the difficulties of eliciting information locked in the memories of patients.

  6. Comparative genomics of Serratia spp.: two paths towards endosymbiotic life.

    Directory of Open Access Journals (Sweden)

    Alejandro Manzano-Marín

    Full Text Available Symbiosis is a widespread phenomenon in nature, in which insects show a great number of these associations. Buchnera aphidicola, the obligate endosymbiont of aphids, coexists in some species with another intracellular bacterium, Serratia symbiotica. Of particular interest is the case of the cedar aphid Cinara cedri, where B. aphidicola BCc and S. symbiotica SCc need each other to fulfil their symbiotic role with the insect. Moreover, various features seem to indicate that S. symbiotica SCc is closer to an obligate endosymbiont than to other facultative S. symbiotica, such as the one described for the aphid Acirthosyphon pisum (S. symbiotica SAp. This work is based on the comparative genomics of five strains of Serratia, three free-living and two endosymbiotic ones (one facultative and one obligate which should allow us to dissect the genome reduction taking place in the adaptive process to an intracellular life-style. Using a pan-genome approach, we have identified shared and strain-specific genes from both endosymbiotic strains and gained insight into the different genetic reduction both S. symbiotica have undergone. We have identified both retained and reduced functional categories in S. symbiotica compared to the Free-Living Serratia (FLS that seem to be related with its endosymbiotic role in their specific host-symbiont systems. By means of a phylogenomic reconstruction we have solved the position of both endosymbionts with confidence, established the probable insect-pathogen origin of the symbiotic clade as well as the high amino-acid substitution rate in S. symbiotica SCc. Finally, we were able to quantify the minimal number of rearrangements suffered in the endosymbiotic lineages and reconstruct a minimal rearrangement phylogeny. All these findings provide important evidence for the existence of at least two distinctive S. symbiotica lineages that are characterized by different rearrangements, gene content, genome size and branch lengths.

  7. Complete genome sequence of Serratia plymuthica strain AS12

    Energy Technology Data Exchange (ETDEWEB)

    Neupane, Saraswoti [Uppsala University, Uppsala, Sweden; Finlay, Roger D. [Uppsala University, Uppsala, Sweden; Alstrom, Sadhna [Uppsala University, Uppsala, Sweden; Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Peters, Lin [U.S. Department of Energy, Joint Genome Institute; Ovchinnikova, Galina [U.S. Department of Energy, Joint Genome Institute; Chertkov, Olga [Los Alamos National Laboratory (LANL); Han, James [U.S. Department of Energy, Joint Genome Institute; Han, Cliff [Los Alamos National Laboratory (LANL); Tapia, Roxanne [Los Alamos National Laboratory (LANL); Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Pagani, Ioanna [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Hogberg, Nils [Uppsala University, Uppsala, Sweden


    A plant associated member of the family Enterobacteriaceae, Serratia plymuthica strain AS12 was isolated from rapeseed roots. It is of scientific interest due to its plant growth promoting and plant pathogen inhibiting ability. The genome of S. plymuthica AS12 comprises a 5,443,009 bp long circular chromosome, which consists of 4,952 protein-coding genes, 87 tRNA genes and 7 rRNA operons. This genome was sequenced within the 2010 DOE-JGI Community Sequencing Program (CSP2010) as part of the project entitled 'Genomics of four rapeseed plant growth promoting bacteria with antagonistic effect on plant pathogens'.

  8. Endophytic colonization and in planta nitrogen fixation by a diazotrophic Serratia sp. in rice. (United States)

    Sandhiya, G S; Sugitha, T C K; Balachandar, D; Kumar, K


    Nitrogen fixing endophytic Serratia sp. was isolated from rice and characterized. Re-colonization ability of Serratia sp. in the rice seedlings as endophyte was studied under laboratory condition. For detecting the re-colonization potential in the rice seedlings, Serratia sp. was marked with reporter genes (egfp and Kmr) using transposon mutagenesis. The conjugants were screened for re-colonization ability and presence of nif genes using PCR. Further, the influence of flavonoids and growth hormones on the endophytic colonization and in planta nitrogen fixation of Serratia was also investigated. The flavonoids, quercetin (3 microg/ml) and diadzein (2 microg/ml) significantly increased the re-colonization ability of the endophytic Serratia, whereas the growth hormones like IAA and NAA (5 microg/ml) reduced the endophytic colonization ability of Serratia sp. Similarly, the in planta nitrogen fixation by Serratia sp. in rice was significantly increased due to flavonoids. The inoculation of endophytic diazotrophs increased the plant biomass and biochemical constituents.

  9. Analysis and optimization of process parameters for production of polyhydroxyalkanoates along with wastewater treatment by Serratia sp. ISTVKR1. (United States)

    Gupta, Asmita; Kumar, Madan; Thakur, Indu Shekhar


    A previously reported biodegrading bacterial strain Serratia sp. ISTVKR1 was studied for polyhydroxyalkanoate (PHA) production along with wastewater contaminant removal. Nile red fluorescence, GC-MS, FT-IR, NMR and TEM confirmed the accumulation of homopolymer poly-3-hydroxyvalerate (PHV) within the bacterial cells. Analysis of culture after 72h of bacterial treatment showed maximum COD removal (8.4-fold), non-detection of organic contaminants such as 1H-Cyclopropa [a] naphthalene (R.T.=10.12) using GC-MS and increased proportion of elements like Cr, Mn, Fe, Ni, Cu, Cd and Pb in the bacterial cell pellets by SEM-EDX analysis. Optimization of process parameters for enhanced PHA production along with wastewater treatment done using Response Surface Methodology (RSM) showed 5% and 0.74% increase in the PHA production (0.3368±0.13gL -1 ) and % COD reduction (88.93±2.41) of wastewater, respectively. The study, thus established the production of PHA along with wastewater contaminant removal by Serratia sp. ISTVKR1. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Control of exoenzyme production, motility and cell differentiation in Serratia liquefaciens

    DEFF Research Database (Denmark)

    Givskov, Michael Christian; Eberl, Leo; Molin, Søren


    Serratia liquefaciens secretes a broad spectrum of hydrolytic enzymes to the surrounding medium and possesses the ability to differentiate into specialized swarmer cells capable of rapid surface motility. Control of exoenzyme production and swarming motility is governed by similar regulatory...

  11. Serratia sp. bacteremia in Canberra, Australia: a population-based study over 10 years. (United States)

    Engel, H J; Collignon, P J; Whiting, P T; Kennedy, K J


    The purpose of this paper was to determine the population incidence and clinical features of Serratia sp. bacteremia in Canberra, Australia. Demographic and clinical data were collected prospectively for episodes of Serratia sp. bacteremia over a 10-year period, and was confined to Canberra residents using residential postal codes. Thirty-eight episodes of Serratia sp. bacteremia occurred, with a yearly incidence of 1.03 per 100,000 population. The majority of episodes occurred in males (68%). The respiratory tract was the most common focus of infection (21%). Twenty-nine percent of episodes were community-associated. A further 18% of episodes had their onset in the community but were healthcare-associated. The 7-day and 6-month mortality rates were 5 and 37%, respectively. Antibiotic resistance to gentamicin (3%) and ciprofloxacin (0%) was low. Serratia sp. bacteremia is more common than generally appreciated, with a large proportion (47%) of episodes having their onset in the community.

  12. Draft Genome Sequence of Serratia sp. Strain DD3, Isolated from the Guts of Daphnia magna


    Poehlein, Anja; Freese, Heike M.; Daniel, Rolf; Simeonova, Diliana D.


    We report the draft genome sequence of Serratia sp. strain DD3, a gammaproteobacterium from the family Enterobacteriaceae. It was isolated from homogenized guts of Daphnia magna. The genome size is 5,274 Mb. peerReviewed

  13. Antimicrobial activity of Serratia sp isolated from the coralline red algae Amphiroa anceps

    Digital Repository Service at National Institute of Oceanography (India)

    Karthick, P.; Mohanraju, R.; Murthy, K.N.; Ramesh, Ch.; Mohandass, C.; Rajasabapathy, R.; Vellai, K.S.

    antibacterial activity was observed with Salmonella typhi, Enteropathogenic E.coli and Klebsiella pneumonia Identification based on morphological, biochemical and 16S rDNA sequencing showed that the strain AA1 was identified as Serratia sp (KC149511) Fractioned...

  14. Electiveness of photorepair, influence of dark-repair on shape of dose-response curves, and high-dose decline, in UV-induced colour mutations of Serratia

    International Nuclear Information System (INIS)

    Kaplan, R.W.


    Strain CV of Serratia marcescens mutates by UV with high frequency to 3 groups of mutants (w, h, s) differing in colour from the red wild-type. The mutational dose-response curve has a curvature corresponding to about 3 hits. It reaches a peak and declines at high doses. Inactivation curves have a broad shoulder and mostly, but not always, a break to a lesser slope at UV doses near the peak of mutations. Photo reactivation (PR) gives a dose reduction of about 2 for both inactivation and mutation including the break and peak. The dose curve with PR for w-mutations shows 1 hit-, the other types 2-hit curvature leading to a change of mutation spectrum with dose due to PR. The UV-sensitive mutant uvs21 of CV has a survival curve with a small shoulder and a long upward concavity without a break, and the mutation curve is of the one-hit type without a peak and decline. PR gives a dose reduction of 12 for inactivation and of 7.5 for mutation. The 3-hit mutation curve of CV is interpreted by assuming that 2 further hits are required to protect the 1-hit pre-mutations from being abolished by the repair lacking in uvs21. UV induction of SOS repair cannot be responsible for the 3-hit curvature because UVR of phages and induction of prophage are already saturated at rather low doses. As high-dose decline is not observed in uvs21, possibly the non-mutagenic repair lacking from uvs21 interferes with the mutation finishing processes at high doses in the repair-proficient strain CV. However, UV induction of this interference cannot be a one-hit process but requires a very large number of hits. (Auth.)

  15. Freqüência de Serratia sp em Infecções Urinárias de pacientes internados na Santa Casa de Misericórdia em Fortaleza Frequency of Serratia sp in urine infections of intern patients in the Santa Casa de Misericórdia in Fortaleza


    Everardo Albuquerque Menezes; Fabrizio Coelho Cezafar; Maria do Socorro de Sena Andrade; Maria Valdenir Abreu de Paula Rocha; Francisco Afrânio Cunha


    Atualmente a Serratia é considerada um importante patógeno humano, o qual tem sido encontrado como agente causal de infecções hospitalares principalmente infecções do trato urinário. Verificamos a freqüência da Serratia sp em amostras de urina, em pacientes internados. Foram estudadas 1197 amostras das quais 15 foram positivas para Serratia sp. As espécies encontradas foram: 7 Serratia liquefaciens (46,7%), 5 Serratia odorífera (33,3%) e 3 Serratia rubidaea (20%).In the present time the Serra...

  16. Draft genome sequence of Serratia sp. strain M24T3, isolated from pinewood disease nematode Bursaphelenchus xylophilus. (United States)

    Proença, Diogo Neves; Espírito Santo, Christophe; Grass, Gregor; Morais, Paula V


    Here we report the draft genome sequence of Serratia sp. strain M24T3, which is associated with pinewood nematode Bursaphelenchus xylophilus, the causative agent of pine wilt disease. Serratia sp. strain M24T3 has been identified as a bionematocide for B. xylophilus in vitro, and multiple genes potentially involved in virulence and nematotoxity were identified.

  17. Draft Genome Sequence of Serratia sp. Strain M24T3, Isolated from Pinewood Disease Nematode Bursaphelenchus xylophilus


    Proença, Diogo Neves; Espírito Santo, Christophe; Grass, Gregor; Morais, Paula V.


    Here we report the draft genome sequence of Serratia sp. strain M24T3, which is associated with pinewood nematode Bursaphelenchus xylophilus, the causative agent of pine wilt disease. Serratia sp. strain M24T3 has been identified as a bionematocide for B. xylophilus in vitro, and multiple genes potentially involved in virulence and nematotoxity were identified.

  18. The PhoBR two-component system regulates antibiotic biosynthesis in Serratia in response to phosphate (United States)


    Background Secondary metabolism in Serratia sp. ATCC 39006 (Serratia 39006) is controlled via a complex network of regulators, including a LuxIR-type (SmaIR) quorum sensing (QS) system. Here we investigate the molecular mechanism by which phosphate limitation controls biosynthesis of two antibiotic secondary metabolites, prodigiosin and carbapenem, in Serratia 39006. Results We demonstrate that a mutation in the high affinity phosphate transporter pstSCAB-phoU, believed to mimic low phosphate conditions, causes upregulation of secondary metabolism and QS in Serratia 39006, via the PhoBR two-component system. Phosphate limitation also activated secondary metabolism and QS in Serratia 39006. In addition, a pstS mutation resulted in upregulation of rap. Rap, a putative SlyA/MarR-family transcriptional regulator, shares similarity with the global regulator RovA (regulator of virulence) from Yersina spp. and is an activator of secondary metabolism in Serratia 39006. We demonstrate that expression of rap, pigA-O (encoding the prodigiosin biosynthetic operon) and smaI are controlled via PhoBR in Serratia 39006. Conclusion Phosphate limitation regulates secondary metabolism in Serratia 39006 via multiple inter-linked pathways, incorporating transcriptional control mediated by three important global regulators, PhoB, SmaR and Rap. PMID:19476633

  19. The PhoBR two-component system regulates antibiotic biosynthesis in Serratia in response to phosphate

    Directory of Open Access Journals (Sweden)

    Everson Lee


    Full Text Available Abstract Background Secondary metabolism in Serratia sp. ATCC 39006 (Serratia 39006 is controlled via a complex network of regulators, including a LuxIR-type (SmaIR quorum sensing (QS system. Here we investigate the molecular mechanism by which phosphate limitation controls biosynthesis of two antibiotic secondary metabolites, prodigiosin and carbapenem, in Serratia 39006. Results We demonstrate that a mutation in the high affinity phosphate transporter pstSCAB-phoU, believed to mimic low phosphate conditions, causes upregulation of secondary metabolism and QS in Serratia 39006, via the PhoBR two-component system. Phosphate limitation also activated secondary metabolism and QS in Serratia 39006. In addition, a pstS mutation resulted in upregulation of rap. Rap, a putative SlyA/MarR-family transcriptional regulator, shares similarity with the global regulator RovA (regulator of virulence from Yersina spp. and is an activator of secondary metabolism in Serratia 39006. We demonstrate that expression of rap, pigA-O (encoding the prodigiosin biosynthetic operon and smaI are controlled via PhoBR in Serratia 39006. Conclusion Phosphate limitation regulates secondary metabolism in Serratia 39006 via multiple inter-linked pathways, incorporating transcriptional control mediated by three important global regulators, PhoB, SmaR and Rap.

  20. Genome Sequence of Carbon Dioxide-Sequestering Serratia sp. Strain ISTD04 Isolated from Marble Mining Rocks


    Kumar, Manish; Gazara, Rajesh Kumar; Verma, Sandhya; Kumar, Madan; Verma, Praveen Kumar; Thakur, Indu Shekhar


    The Serratia sp. strain ISTD04 has been identified as a carbon dioxide (CO2)-sequestering bacterium isolated from marble mining rocks in the Umra area, Rajasthan, India. This strain grows chemolithotrophically on media that contain sodium bicarbonate (NaHCO3) as the sole carbon source. Here, we report the genome sequence of 5.07?Mb Serratia sp. ISTD04.

  1. Purification and properties of the dihydrofolate synthetase from Serratia indica

    International Nuclear Information System (INIS)

    Ikeda, Masamichi; Iwai, Kazuo


    The dihydrofolate synthetase (EC6.3.2.12) responsible for catalyzing the synthesis of dihydrofolic acid from dihydropteroic acid and L-glutamic acid was purified about 130-fold from extracts of Serratia indica IFO 3759 by ammonium sulfate fractionation, DEAE-Sephadex column chromatography, Sephadex G-200 gel filtration, and DEAE-cellulose column chromatography. The enzyme preparation obtained was shown to be homogeneous by DEAE-cellulose column chromatography and ultracentrifugal analysis. The sedimentation coefficient of this enzyme was 3.9 S, and the molecular weight was determined to be about 47,000 by Sephadex G-100. The optimum pH for the reaction was 9.0. The enzymatic reaction required dihydropteroate, L-glutamate and ATP as substrates, and Mg 2+ and K + as cofactors. γ-L-Glutamyl-L-glutamic acid cannot replace L-glutamic acid as the substrate. Neither pteroic acid nor tetrahydropteroic acid can be used as the substrate. ATP was partially replaced by ITP or GTP. The enzyme reaction was inhibited by the addition of ADP, but not by AMP. One mole of dihydrofolate, 1 mole of ADP and 1 mole of orthophosphate were produced from each 1 mole of dihydropteroic acid, L-glutamic acid, and ATP. These results suggest that the systematic name for the dihydrofolate synthetase is 7,8-dihydropteroate: L-glutamate ligase (ADP). (auth.)

  2. Complete genome sequence of Serratia sp. YD25 (KCTC 42987) presenting strong antagonistic activities to various pathogenic fungi and bacteria. (United States)

    Su, Chun; Liu, Yibo; Sun, Yan; Li, Zhi


    Serratia sp. YD25 (KCTC 42987) was originally isolated from rhizosphere soil in a continuous cropping tobacco-planting farm. Here, we show that its metabolites efficiently suppress the growth of various important pathogenic fungi and bacteria, causing infection in both plants and humans. In addition, Serratia sp. YD25 has a special trait of simultaneous production of both serrawettin W2 and prodigiosin, two important bioactive secondary metabolites produced by Serratia strains. Such co-production has not been reported in other Serratia strains. The complete genome sequence of Serratia sp. YD25 is presented, which is valuable for further exploration of its biotechnological applications in agriculture and medicine. The genome sequence reported here is also useful for understanding the unique regulatory mechanisms underlying biosynthesis of active compounds. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Draft Genome Sequence of a Chitinase-producing Biocontrol Bacterium Serratia sp. C-1

    Directory of Open Access Journals (Sweden)

    Seur Kee Park


    Full Text Available The chitinase-producing bacterial strain C-1 is one of the key chitinase-producing biocontrol agents used for effective bioformulations for biological control. These bioformulations are mixed cultures of various chitinolytic bacteria. However, the precise identification, biocontrol activity, and the underlying mechanisms of the strain C-1 have not been investigated so far. Therefore, we evaluated in planta biocontrol efficacies of C-1 and determined the draft genome sequence of the strain in this study. The bacterial C-1 strain was identified as a novel Serratia sp. by a phylogenic analysis of its 16S rRNA sequence. The Serratia sp. C-1 bacterial cultures showed strong in planta biocontrol efficacies against some major phytopathogenic fungal diseases. The draft genome sequence of Serratia sp. C-1 indicated that the C-1 strain is a novel strain harboring a subset of genes that may be involved in its biocontrol activities.

  4. Characterization of a chitinolytic enzyme from Serratia sp. KCK isolated from kimchi juice. (United States)

    Kim, Hyun-Soo; Timmis, Kenneth N; Golyshin, Peter N


    The novel chitinolytic bacterium Serratia sp. KCK, which was isolated from kimchi juice, produced chitinase A. The gene coding for the chitinolytic enzyme was cloned on the basis of sequencing of internal peptides, homology search, and design of degenerated primers. The cloned open reading frame of chiA encodes for deduced polypeptide of 563 amino acid residues with a calculated molecular mass of 61 kDa and appears to correspond to a molecular mass of about 57 kDa, which excluded the signal sequence. The deduced amino acid sequence showed high similarity to those of bacterial chitinases classified as family 18 of glycosyl hydrolases. The chitinase A is an exochitinase and exhibits a greater pH range (5.0-10.0), thermostability with a temperature optimum of 40 degrees C, and substrate range other than Serratia chitinases thus far described. These results suggested that Serratia sp. KCK chitinase A can be used for biotechnological applications with good potential.

  5. Characterization and role of a metalloprotease induced by chitin in Serratia sp. KCK. (United States)

    Kim, Hyun-Soo; Golyshin, Peter N; Timmis, Kenneth N


    A metalloprotease induced by chitin in a new chitinolytic bacterium Serratia sp. Strain KCK was purified and characterized. Compared with other Serratia enzymes, it exhibited a rather broad pH activity range (pH 5.0-8.0), and thermostability. The cognate ORF, mpr, was cloned and expressed. Its deduced amino acid sequence showed high similarity to those of bacterial zinc-binding metalloproteases and a well-conserved serralysin family motif. Pretreatment of chitin with the Mpr protein promoted chitin degradation by chitinase A, which suggests that Mpr participates in, and facilitates, chitin degradation by this microorganism.

  6. Main: AS1CAMV [PLACE

    Lifescience Database Archive (English)

    Full Text Available MV 35S promoter; from -85 to -58 (subdomain AI); Binding with ASF-1 (activation sequence factor 1) from pea ...and tobacco; Expression in root and leaf; CaMV 35S promoter; ASF-1; leaf; root; as-1; Cauliflower mosaic virus; CaMV; CCACTGACGTAAGGGATGACGCACAATCC ...

  7. Freqüência de Serratia sp em Infecções Urinárias de pacientes internados na Santa Casa de Misericórdia em Fortaleza Frequency of Serratia sp in urine infections of intern patients in the Santa Casa de Misericórdia in Fortaleza

    Directory of Open Access Journals (Sweden)

    Everardo Albuquerque Menezes


    Full Text Available Atualmente a Serratia é considerada um importante patógeno humano, o qual tem sido encontrado como agente causal de infecções hospitalares principalmente infecções do trato urinário. Verificamos a freqüência da Serratia sp em amostras de urina, em pacientes internados. Foram estudadas 1197 amostras das quais 15 foram positivas para Serratia sp. As espécies encontradas foram: 7 Serratia liquefaciens (46,7%, 5 Serratia odorífera (33,3% e 3 Serratia rubidaea (20%.In the present time the Serratia is considered an important human pathogen, which has been found as causal agent of nosocomial infections mainly urine infections. We verify the frequency of the Serratia sp in urine samples, in intern patients. Were studied 1197 urine samples, this study show 15 positive for the Serratia sp. The species found were: 7 Serratia liquefaciens (46,7%, 5 Serratia odorífera (33,3% and 3 Serratia rubidaea (20%.

  8. Quantitative Effects of Medium Hardness and Nutrient Availability on the Swarming Motility of Serratia liquefaciens

    DEFF Research Database (Denmark)

    Bees, Martin Alan; Andresen, Peter Ragnar; Mosekilde, Erik


    We report the first controlled measurements of expansion rates for swarming colonies of Serratia liquefaciens under different growth conditions, combined with qualitative observations of the organization of the colony into regions of differentiated cell types. Significantly, the results reveal th...... grow according to a power law or exponentially (for large times), as suggested by recent theoretical results....

  9. Uranium Biominerals Precipitated by an Environmental Isolate of Serratia under Anaerobic Conditions (United States)

    Newsome, Laura; Morris, Katherine; Lloyd, Jonathan. R.


    Stimulating the microbially-mediated precipitation of uranium biominerals may be used to treat groundwater contamination at nuclear sites. The majority of studies to date have focussed on the reductive precipitation of uranium as U(IV) by U(VI)- and Fe(III)-reducing bacteria such as Geobacter and Shewanella species, although other mechanisms of uranium removal from solution can occur, including the precipitation of uranyl phosphates via bacterial phosphatase activity. Here we present the results of uranium biomineralisation experiments using an isolate of Serratia obtained from a sediment sample representative of the Sellafield nuclear site, UK. When supplied with glycerol phosphate, this Serratia strain was able to precipitate 1 mM of soluble U(VI) as uranyl phosphate minerals from the autunite group, under anaerobic and fermentative conditions. Under phosphate-limited anaerobic conditions and with glycerol as the electron donor, non-growing Serratia cells could precipitate 0.5 mM of uranium supplied as soluble U(VI), via reduction to nano-crystalline U(IV) uraninite. Some evidence for the reduction of solid phase uranyl(VI) phosphate was also observed. This study highlights the potential for Serratia and related species to play a role in the bioremediation of uranium contamination, via a range of different metabolic pathways, dependent on culturing or in situ conditions. PMID:26132209

  10. Benzoate-mediated changes on expression profile of soluble proteins in Serratia sp. DS001. (United States)

    Pandeeti, E V P; Chinnaboina, M R; Siddavattam, D


    To assess differences in protein expression profile associated with shift in carbon source from succinate to benzoate in Serratia sp. DS001 using a proteomics approach. A basic proteome map was generated for the soluble proteins extracted from Serratia sp. DS001 grown in succinate and benzoate. The differently and differentially expressed proteins were identified using ImageMaster 2D Platinum software (GE Healthcare). The identity of the proteins was determined by employing MS or MS/MS. Important enzymes such as Catechol 1,2 dioxygenase and transcriptional regulators that belong to the LysR superfamily were identified. Nearly 70 proteins were found to be differentially expressed when benzoate was used as carbon source. Based on the protein identity and degradation products generated from benzoate it is found that ortho pathway is operational in Serratia sp. DS001. Expression profile of the soluble proteins associated with shift in carbon source was mapped. The study also elucidates degradation pathway of benzoate in Serratia sp. DS001 by correlating the proteomics data with the catabolites of benzoate.

  11. Serratia bozhouensis sp. nov., Isolated from Sewage Samples of a Dairy Farm. (United States)

    Shang, Fei; Xue, Ting; Wang, Man; Chen, Xiaolin; Yu, Li; Zhang, Ming


    A Gram-negative, rod-shaped, salt-tolerant, non-pigmented, and non-spore-forming bacterium, designated strain W1 T (type strain CICC 23797 = CGMCC1.14949), was isolated from sewage samples of a dairy farm in Bozhou, Anhui, China. Strain W1 was resistant to lincomycin, troleandomycin, rifamycin, and vancomycin. Sequence analysis of the 16S rDNA gene revealed that the strain showed sequence similarity of 98.2% with the closest related species Serratia quinivorans CP6a T . The genomic DNA G+C content of the isolate was 52.8 mol%. The biochemical characteristics of strain W1 T assessed by the API 20E and Biolog GEN III analysis were different from those of the members of the genus Serratia. On the basis of the phenotypic and genotypic differences, strain W1 was proposed to be a novel Serratia species, Serratia bozhouensis sp. nov W1 T .

  12. Identification of an entomopathogenic bacterium, Serratia sp. ANU101, and its hemolytic activity. (United States)

    Kim, Yonggyun; Kim, Keunseob; Seo, Jiae; Shrestha, Sony; Kim, Hosanna H; Nalini, Madanagopal; Yi, Youngkeun


    Four different bacterial colonies were isolated from an old stock of an entomopathogenic nematode, Steinernema monticolum. They all showed entomopathogenicity to final instar larvae of beet armyworm, Spodoptera exigua, by hemocoelic injection. However, they varied in colony form, susceptibility to antibiotics, and postmortem change of the infected host insects. Biolog microbial identification and 16S rDNA sequence analyses indicate that these are four different species classified into different bacterial genera. owing to high entomopathogenicity and a cadaver color of infected insect host, Serratia sp. was selected as a main symbiotic bacterial species and analyzed for its pathogenicity. Although no virulence of Serratia sp. was detected at oral administration, the bacteria gave significant synergistic pathogenicity to fifth instar S. exigua when it was treated along with a spore-forming entomopathogenic bacterium, Bacillus thuringiensis. The synergistic effect was explained by an immunosuppressive effect of Serratia sp. by its high cytotoxic effect on hemocytes of S. exigua, because Serratia sp. caused septicemia of S. exigua when the bacterial cells were injected into S. exigua hemocoel. The cytotoxic factor(s) was present in the culture medium because the sterilized culture broth possessed high potency in the cytotoxicity, which was specific to granular cells and plasmatocytes, two main immune-associated hemocytes in insects.

  13. Draft Genome Sequence of the Antagonistic Rhizosphere Bacterium Serratia plymuthica Strain PRI-2C

    NARCIS (Netherlands)

    Garbeva, P.; van Elsas, J.D.; de Boer, W.

    Serratia plymuthica strain PRI-2C is a rhizosphere bacterial strain with antagonistic activity against different plant pathogens. Here we present the 5.39-Mb (G+C content, 55.67%) draft genome sequence of S. plymuthica strain PRI-2C with the aim of providing insight into the genomic basis of its

  14. How Delisea pulchra furanones affect quorum sensing and swarming motility in Serratia liquefaciens MG1

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bovbjerg; Manefield, M.; Andersen, Jens Bo


    Halogenated furanones produced by the benthic marine macroalga Delisea pulchra inhibit swarming motility of Serratia liquefaciens MG1. This study demonstrates that exogenously added furanones control transcription of the quorum sensing regulated gene swrA in competition with the cognate signal...

  15. Two separate regulatory systems participate in control of swarming motility of Serratia liquefaciens MG1

    DEFF Research Database (Denmark)

    Givskov, M; Ostling, J; Eberl, L


    Swarming motility of Serratia liquefaciens MG1 requires the expression of two genetic loci, flhDC and swrI. Here we demonstrate that the products of the flhDC operon (the flagellar master regulator) and the swrI gene (the extracellular signal molecule N-butanoyl-L-homoserine lactone) are global...

  16. Effects of Au/Fe and Fe nanoparticles on Serratia bacterial growth and production of biosurfactant

    International Nuclear Information System (INIS)

    Liu, Jia; Vipulanandan, Cumaraswamy


    The overall objective of this study was to compare the effects of Au/Fe and Fe nanoparticles on the growth and performance of Serratia Jl0300. The nanoparticle effect was quantified not only by the bacterial growth on agar plate after 1 hour interaction with the nanoparticles, but also by its production of a biosurfactant from used vegetable oil. The nanoparticles were prepared using the foam method. The concentrations of the nanoparticles used for the bacterial interaction study were varied from 1 mg/L to 1 g/L. The test results showed that the effect of nanoparticles on the bacterial growth and biosurfactant production varied with nanoparticle type, concentrations, and interaction time with the bacteria. Au/Fe nanoparticles didn't show toxicity to Serratia after short time (1 h) exposure, while during 8 days fermentation Au/Fe nanoparticles inhibited the growth of Serratia as well as the biosurfactant production when the concentration of the nanoparticles was higher than 10 mg/L. Fe nanoparticles showed inhibition effects to bacterial growth both after short time and long time interaction with Serratia, as well as to biosurfactant production when its concentration was higher than 100 mg/L. Based on the trends observed in this study, analytical models have been developed to predict the bacterial growth and biosurfactant production with varying concentrations of nanoparticles. - Highlights: • Modeled the effect of nanoparticles on the bacterial growth and biosurfactant production. • Effects of Au/Fe nonoparticles on Serratia Bacterial Growth and Production of Biosurfactant. • Scanning Electron Micrograph of bacteria-nanoparticles interaction

  17. Effects of Au/Fe and Fe nanoparticles on Serratia bacterial growth and production of biosurfactant

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Jia; Vipulanandan, Cumaraswamy, E-mail:


    The overall objective of this study was to compare the effects of Au/Fe and Fe nanoparticles on the growth and performance of Serratia Jl0300. The nanoparticle effect was quantified not only by the bacterial growth on agar plate after 1 hour interaction with the nanoparticles, but also by its production of a biosurfactant from used vegetable oil. The nanoparticles were prepared using the foam method. The concentrations of the nanoparticles used for the bacterial interaction study were varied from 1 mg/L to 1 g/L. The test results showed that the effect of nanoparticles on the bacterial growth and biosurfactant production varied with nanoparticle type, concentrations, and interaction time with the bacteria. Au/Fe nanoparticles didn't show toxicity to Serratia after short time (1 h) exposure, while during 8 days fermentation Au/Fe nanoparticles inhibited the growth of Serratia as well as the biosurfactant production when the concentration of the nanoparticles was higher than 10 mg/L. Fe nanoparticles showed inhibition effects to bacterial growth both after short time and long time interaction with Serratia, as well as to biosurfactant production when its concentration was higher than 100 mg/L. Based on the trends observed in this study, analytical models have been developed to predict the bacterial growth and biosurfactant production with varying concentrations of nanoparticles. - Highlights: • Modeled the effect of nanoparticles on the bacterial growth and biosurfactant production. • Effects of Au/Fe nonoparticles on Serratia Bacterial Growth and Production of Biosurfactant. • Scanning Electron Micrograph of bacteria-nanoparticles interaction.

  18. Genome Sequence of Carbon Dioxide-Sequestering Serratia sp. Strain ISTD04 Isolated from Marble Mining Rocks. (United States)

    Kumar, Manish; Gazara, Rajesh Kumar; Verma, Sandhya; Kumar, Madan; Verma, Praveen Kumar; Thakur, Indu Shekhar


    The Serratia sp. strain ISTD04 has been identified as a carbon dioxide (CO 2 )-sequestering bacterium isolated from marble mining rocks in the Umra area, Rajasthan, India. This strain grows chemolithotrophically on media that contain sodium bicarbonate (NaHCO 3 ) as the sole carbon source. Here, we report the genome sequence of 5.07 Mb Serratia sp. ISTD04. Copyright © 2016 Kumar et al.

  19. Spaceflight and Simulated Microgravity Increases Virulence of the Known Bacterial Pathogen S. Marcescens (United States)

    Clemens-Grisham, Rachel Andrea; Bhattacharya, Sharmila; Wade, William


    After spaceflight, the number of immune cells is reduced in humans. In other research models, including Drosophila, not only is there a reduction in the number of plasmatocytes, but expression of immune-related genes is also changed after spaceflight. These observations suggest that the immune system is compromised after exposure to microgravity. It has also been reported that there is a change in virulence of some bacterial pathogens after spaceflight. We recently observed that samples of gram-negative S. marcescens retrieved from spaceflight is more virulent than ground controls, as determined by reduced survival and increased bacterial growth in the host. We were able to repeat this finding of increased virulence after exposure to simulated microgravity using the rotating wall vessel, a ground based analog to microgravity. With the ground and spaceflight samples, we looked at involvement of the Toll and Imd pathways in the Drosophila host in fighting infection by ground and spaceflight samples. We observed that Imd-pathway mutants were more susceptible to infection by the ground bacterial samples, which aligns with the known role of this pathway in fighting infections by gram-negative bacteria. When the Imd-pathway mutants were infected with the spaceflight sample, however, they exhibited the same susceptibility as seen with the ground control bacteria. Interestingly, all mutant flies show the same susceptibility to the spaceflight bacterial sample as do wild type flies. This suggests that neither humoral immunity pathway is effectively able to counter the increased pathogenicity of the space-flown S. marcescens bacteria.

  20. Discovery of antimicrobial lipodepsipeptides produced by a Serratia sp. within mosquito microbiomes. (United States)

    Ganley, Jack; Carr, Gavin; Ioerger, Thomas; Sacchettini, James; Clardy, Jon; Derbyshire, Emily


    The Anopheles mosquito that harbors the Plasmodium parasite contains a microbiota that can influence both the vector and parasite. In recent years, insect-associated microbes have highlighted the untapped potential of exploiting interspecies interactions to discover bioactive compounds. In this study, we report the discovery of nonribosomal lipodepsipeptides that are produced by a Serratia sp. within the midgut and salivary glands of A. stephensi mosquitoes. The lipodepsipeptides, stephensiolides A-K, have antibiotic activity and facilitate bacterial surface motility. Bioinformatic analyses indicate that the stephensiolides are ubiquitous in nature and are likely important for Serratia spp. colonization within mosquitoes, humans, and other ecological niches. Our results demonstrate the usefulness of probing insect-microbiome interactions, enhance our understanding of the chemical ecology within Anopheles mosquitoes, and provide a secondary metabolite scaffold to further investigate this complex relationship. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Complete genome sequence of the rapeseed plant-growth promoting Serratia plymuthica strain AS9

    Energy Technology Data Exchange (ETDEWEB)

    Neupane, Saraswoti [Uppsala University, Uppsala, Sweden; Hogberg, Nils [Uppsala University, Uppsala, Sweden; Alstrom, Sadhna [Uppsala University, Uppsala, Sweden; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Han, James [U.S. Department of Energy, Joint Genome Institute; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Peters, Lin [U.S. Department of Energy, Joint Genome Institute; Ovchinnikova, Galina [U.S. Department of Energy, Joint Genome Institute; Lu, Megan [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Fiebig, Anne [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Pagani, Ioanna [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Finlay, Roger D. [Uppsala University, Uppsala, Sweden


    Serratia plymuthica are plant-associated, plant beneficial species belonging to the family Enterobacteriaceae. The members of the genus Serratia are ubiquitous in nature and their life style varies from endophytic to free-living. S. plymuthica AS9 is of special interest for its ability to inhibit fungal pathogens of rapeseed and to promote plant growth. The genome of S. plymuthica AS9 comprises a 5,442,880 bp long circular chromosome that consists of 4,952 protein-coding genes, 87 tRNA genes and 7 rRNA operons. This genome is part of the project entitled Genomics of four rapeseed plant growth promoting bacteria with antagonistic effect on plant pathogens awarded through the 2010 DOE-JGI Community Sequencing Program (CSP2010).

  2. Oligopeptidase B from Serratia proteamaculans. III. Inhibition analysis. Specific interactions with metalloproteinase inhibitors. (United States)

    Mikhailova, A G; Khairullin, R F; Kolomijtseva, G Ya; Rumsh, L D


    Inhibition of the novel oligopeptidase B from Serratia proteamaculans (PSP) by basic pancreatic trypsin inhibitor, Zn2+ ions, and o- and m-phenanthroline was investigated. A pronounced effect of calcium ions on the interaction of PSP with inhibitors was demonstrated. Inversion voltamperometry and atomic absorption spectrometry revealed no zinc ions in the PSP molecule. Hydrophobic nature of the enzyme inhibition by o- and m-phenanthroline was established.

  3. Assessment of flhDC mRNA levels in Serratia liquefaciens swarm cells

    DEFF Research Database (Denmark)

    Tolker-Nielsen, Tim; Christensen, Allan Beck; Holmstrøm, K.


    We reported previously that artificial overexpression of the flhDC operon in liquid-grown Serratia liquefaciens resulted in the formation of filamentous, multinucleated, and hyperflagellated cells that were indistinguishable from surface-induced swarm cells (L. Eberl, G. Christiansen, S. Molin, a......, vegetative cells. This suggests that surface-induced S. liquefaciens swarm cell differentiation, although dependent on flhDC gene expression, does not occur through elevated flhDC mRNA levels....

  4. Serratia glossinae sp. nov., isolated from the midgut of the tsetse fly Glossina palpalis gambiensis. (United States)

    Geiger, A; Fardeau, M-L; Falsen, E; Ollivier, B; Cuny, G


    We report the isolation of a novel bacterium, strain C1(T), from the midgut of the tsetse fly Glossina palpalis gambiensis, one of the vector insects responsible for transmission of the trypanosomes that cause sleeping sickness in sub-Saharan African countries. Strain C1(T) is a motile, facultatively anaerobic, rod-like bacterium (0.8-1.0 microm in diameter; 2-6 microm long) that grows as single cells or in chains. Optimum growth occurred at 25-35 degrees C, at pH 6.7-8.4 and in medium containing 5-20 g NaCl l(-1). The bacterium hydrolysed urea and used L-lysine, L-ornithine, citrate, pyruvate, D-glucose, D-mannitol, inositol, D-sorbitol, melibiose, amygdalin, L-arabinose, arbutin, aesculin, D-fructose, D-galactose, glycerol, maltose, D-mannose, raffinose, trehalose and d-xylose; it produced acetoin, reduced nitrate to nitrite and was positive for beta-galactosidase and catalase. The DNA G+C content was 53.6 mol%. It was related phylogenetically to members of the genus Serratia, family Enterobacteriaceae, the type strain of Serratia fonticola being its closest relative (99 % similarity between 16S rRNA gene sequences). However, DNA-DNA relatedness between strain C1(T) and S. fonticola DSM 4576(T) was only 37.15 %. Therefore, on the basis of morphological, nutritional, physiological and fatty acid analysis and genetic criteria, strain C1(T) is proposed to be assigned to a novel Serratia species, Serratia glossinae sp. nov. (type strain C1(T) =DSM 22080(T) =CCUG 57457(T)).

  5. Isolation and characterization of a plant growth-promoting rhizobacterium, Serratia sp. SY5. (United States)

    Koo, So-Yeon; Cho, Kyung-Suk


    The role of plant growth-promoting rhizobacteria (PGPR) in the phytoremediation of heavy-metal-contaminated soils is important in overcoming its limitations for field application. A plant growth-promoting rhizobacterium, Serratia sp. SY5, was isolated from the rhizoplane of barnyard grass (Echinochloa crus-galli) grown in petroleum and heavy-metal-contaminated soil. This isolate has shown capacities for indole acetic acid production and siderophores synthesis. Compared with a non-inoculated control, the radicular root growth of Zea mays seedlings inoculated with SY5 can be increased by 27- or 15.4-fold in the presence of 15 mg-Cd/l or 15 mg-Cu/l, respectively. The results from hydroponic cultures showed that inoculation of Serratia sp. SY5 had a favorable influence on the initial shoot growth and biomass of Zea mays under noncontaminated conditions. However, under Cd-contaminated conditions, the inoculation of SY5 significantly increased the root biomass of Zea mays. These results indicate that Serratia sp. SY5 can serve as a promising microbial inoculant for increased plant growth in heavy-metal-contaminated soils to improve the phytoremediation efficiency.

  6. Quantitative and specific detection of the biocontrol agent, Serratia plymuthica, in plant extracts using a real-time TaqMan® assay

    NARCIS (Netherlands)

    Czajkowski, R.L.; Wolf, van der J.M.


    A Serratia plymuthica-specific TaqMan® assay was designed based on the consensus nucleotide sequence from the 3'- end of the luxS gene present in all S. plymuthica strains tested. The specificity of the assay was demonstrated by testing 21 Serratia spp. strains and 30 isolates belonging to various

  7. Quantitative and specific detection of the biocontrol agent, Serratia plymuthica, in plant extracts using a real-time TaqMan(A (R)) assay

    NARCIS (Netherlands)

    Czajkowski, R.L.; Van der Wolf, J.M.


    A Serratia plymuthica-specific TaqManA (R) assay was designed based on the consensus nucleotide sequence from the 3'- end of the luxS gene present in all S. plymuthica strains tested. The specificity of the assay was demonstrated by testing 21 Serratia spp. strains and 30 isolates belonging to

  8. Improved production of isomaltulose by a newly isolated mutant of Serratia sp. cells immobilized in calcium alginate. (United States)

    Kim, Yonghwan; Koo, Bong-Seong; Lee, Hyeon-Cheol; Yoon, Youngdae


    Isomaltulose, also known as palatinose, is produced by sucrose isomerase and has been highlighted as a sugar substitute due to a number of advantageous properties. For the massive production of isomaltulose, high resistance to sucrose and stability of sucrose isomerase as well as sucrose conversion yields would be critical factors. We describe a series of screening procedures to isolate the mutant strain of Serratia sp. possessing enhanced isomaltulose production with improved stability. The new Serratia sp. isolated from a series of screening procedures allowed us to produce isomaltulose from 60% sucrose solution, with over 90% conversion yield. Moreover, when this strain was immobilized in calcium alginate beads and placed in a medium containing 60% sucrose, it showed over 70% sucrose conversion yields for 30 cycles of repeated-batch reactions. Thus, improved conversion activity and stability of the newly isolated Serratia sp. strain in the present study would be highly valuable for industries related to isomaltulose production.

  9. Chromosome-Encoded Broad-Spectrum Ambler Class A β-Lactamase RUB-1 from Serratia rubidaea. (United States)

    Bonnin, Rémy A; Didi, Jennifer; Ergani, Ayla; Lima, Sandra; Naas, Thierry


    Whole-genome sequencing of Serratia rubidaea CIP 103234 T revealed a chromosomally located Ambler class A β-lactamase gene. The gene was cloned, and the β-lactamase, RUB-1, was characterized. RUB-1 displayed 74% and 73% amino acid sequence identity with the GIL-1 and TEM-1 penicillinases, respectively, and its substrate profile was similar to that of the latter β-lactamases. Analysis by 5' rapid amplification of cDNA ends revealed promoter sequences highly divergent from the Escherichia coli σ 70 consensus sequence. This work further illustrates the heterogeneity of β-lactamases among Serratia spp. Copyright © 2017 American Society for Microbiology.

  10. Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

    DEFF Research Database (Denmark)

    Eberl, L; Christiansen, Gunna; Molin, S


    The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate...

  11. Molecular identification and pathogenicity of Citrobacter and Serratia species isolated from cultured Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Manal I. El-Barbary


    Full Text Available This study aimed to isolate and characterize some pathogenic bacterial strains belonging to the family Enterobacteriaceae. They had been isolated from gills, liver, kidney and skin of naturally infected Oreochromis niloticus and had been identified by biochemical test and 16S rRNA gene using four universal primers. Additionally, the isolates were tested for antimicrobial susceptibility, histopathological alterations of liver, kidney and gills and the pathogenicity of the identified isolates for O. niloticus. The results of phylogenetic analysis placed the isolates in the family Enterobacteriaceae (genera Serratia and Citrobacter based on 99% homology. The primer pair (17F and 1390R is the most appropriate pair of universal primers employed for the identification of 16S rRNA gene as it covers as much as possible of the variable regions (Vs. V1 and V2 regions of 16S rRNA gene presented weak evidence of the diversity of the genera Serratia. The mortality rate was 40–60% after challenging O. niloticus by identified isolates, which revealed its sensitivity to ciprofloxacin and norfloxacin. Histological changes showed dilation in sinusoids with severe vacuolar degeneration in the liver, tubular degeneration and hemorrhage between renal tubules with pyknotic nuclei in the kidney, epithelial hyperplasia, aneurism and evident epithelium interstitial edema in gills of O. niloticus. This study concluded that these isolates should be considered as an opportunistic pathogen of O. niloticus. The study also states that the sequencing of 16S rRNA is an important tool for the identification of unknown bacterial species of fish pathogen. Keywords: Citrobacter sp., Serratia sp., Phylogenetic analysis, Histology, Antibiotic sensitivity, Oreochromis niloticus

  12. Effects of Psychrotrophic Bacteria, Serratia liquefaciens and Acinetobacter genomospecies 10 on Yogurt Quality (United States)

    Shin, Yong Kook; Oh, Nam Su; Lee, Hyun Ah; Choi, Jong-Woo


    The aim of this study was to evaluate the effect of proteolytic (Serratia liquefaciens, match %: 99.39) or lipolytic (Acinetobacter genomospecies 10, match %: 99.90) psychrotrophic bacteria (bacterial counts, analysis of free fatty acids (FFA) and analysis of free amino acids) on the microbial and chemical properties (yogurt composition), and sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) of yogurt during storage. Yogurts were prepared with raw milk preinoculated with each psychrotrophic bacteria. The total solid, fat, and protein content were not affected by preinoculation, but the pH of yogurt preinoculated with psychrotrophic bacteria was higher than in control. There was a dramatic increase in short chain free fatty acids among FFA in yogurt with Acinetobacter genomospecies 10. For 14 d of cold storage condition, SCFFA was 25.3 mg/kg to 34.4 mg/kg (1.36 times increased), MCFFA was 20.4 mg/kg to 25.7 mg/kg (1.26 times increased), and LCFFA was 240.2 mg/kg to 322.8 mg/kg (1.34 times increased). Serratia liquefaciens (match %: 99.39) in yogurt caused a greater accumulation of free amino acids (FAA), especially bitter peptides such as leucine, valine, arginine, and tyrosine, but SDS-PAGE showed that the inoculation of Serratia liquefaciens did not affect the degree of casein degradation during storage. Taken together, the excessive peptides and FFA in yogurt generated from psychrotrophic bacteria could develop off-flavors that degrade the quality of commercial yogurt products. PMID:26761293

  13. Mechanism of 2,3-butanediol stereoisomers formation in a newly isolated Serratia sp. T241. (United States)

    Zhang, Liaoyuan; Guo, Zewang; Chen, Jiebo; Xu, Quanming; Lin, Hui; Hu, Kaihui; Guan, Xiong; Shen, Yaling


    Serratia sp. T241, a newly isolated xylose-utilizing strain, produced three 2,3-butanediol (2,3-BD) stereoisomers. In this study, three 2,3-butanediol dehydrogenases (BDH1-3) and one glycerol dehydrogenase (GDH) involved in 2,3-BD isomers formation by Serratia sp. T241 were identified. In vitro conversion showed BDH1 and BDH2 could catalyzed (3S)-acetoin and (3R)-acetoin into (2S,3S)-2,3-BD and meso-2,3-BD, while BDH3 and GDH exhibited the activities from (3S)-acetoin and (3R)-acetoin to meso-2,3-BD and (2R,3R)-2,3-BD. Four encoding genes were assembled into E. coli with budA (acetolactate decarboxylase) and budB (acetolactate synthase), responsible for converting pyruvate into acetoin. E. coli expressing budAB-bdh1/2 produced meso-2,3-BD and (2S,3S)-2,3-BD. Correspondingly, (2R,3R)-2,3-BD and meso-2,3-BD were obtained by E. coli expressing budAB-bdh3/gdh. These results suggested four enzymes might contribute to 2,3-BD isomers formation. Mutants of four genes were developed in Serratia sp. T241. Δbdh1 led to reduced concentration of meso-2,3-BD and (2S,3S)-2,3-BD by 97.7% and 87.9%. (2R,3R)-2,3-BD with a loss of 73.3% was produced by Δbdh3. Enzyme activity assays showed the decrease of 98.4% and 22.4% by Δbdh1 and Δbdh3 compared with the wild strain. It suggested BDH1 and BDH3 played important roles in 2,3-BD formation, BDH2 and GDH have small effects on 2,3-BD production by Serratia sp. T241.

  14. Complete genome sequence of the plant-associated Serratia plymuthica strain AS13

    Energy Technology Data Exchange (ETDEWEB)

    Neupane, Saraswoti [Uppsala University, Uppsala, Sweden; Finlay, Roger D. [Uppsala University, Uppsala, Sweden; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Alstrom, Sadhna [Uppsala University, Uppsala, Sweden; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Han, James [U.S. Department of Energy, Joint Genome Institute; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Peters, Lin [U.S. Department of Energy, Joint Genome Institute; Ovchinnikova, Galina [U.S. Department of Energy, Joint Genome Institute; Held, Brittany [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Detter, J C [U.S. Department of Energy, Joint Genome Institute; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Hauser, Loren John [ORNL; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Pagani, Ioanna [U.S. Department of Energy, Joint Genome Institute; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Hogberg, Nils [Uppsala University, Uppsala, Sweden


    Serratia plymuthica AS13 is a plant-associated Gammaproteobacteria, isolated from rapeseed roots. It is of special interest because of its ability to inhibit fungal pathogens of rapeseed and to promote plant growth. The complete genome of S. plymuthica AS13 consists of a 5,442,549 bp circular chromosome. The chromosome contains 4,951 protein-coding genes, 87 tRNA genes and 7 rRNA operons. This genome was sequenced as part of the project enti- tled Genomics of four rapeseed plant growth promoting bacteria with antagonistic effect on plant pathogens within the 2010 DOE-JGI Community Sequencing Program (CSP2010).

  15. Biosorption and biotransformation of chromium by Serratia sp. isolated from tannery effluent. (United States)

    Srivastava, Shaili; Thakur, Indu Shekhar


    A bacterium isolated from soil and sediment ofa leather tanning mill's effluent was identified as Serratia sp. by the analysis of 16S rDNA. Scanning electron microscopy-energy dispersive X-ray analysis (SEM-EDX) and transmission electron microscopy (TEM) were used to assess morphological changes and confirm chromium biosorption in Serratia sp. both in a shake-flask culture containing chromium and in a tannery wastewater. The SEMEDX and the elemental analysis of the chromate-containing samples confirmed the binding of chromium with the bacterial biomass. The TEM exhibited chromium accumulation throughout the bacterial cell, with some granular deposits in the cell periphery and in the cytoplasm. X-ray diffraction analysis (XRD) was used to quantify the chromium and to determine the chemical nature of the metal-microbe interaction. The XRD data showed the crystalline character of the precipitates, which consisted of mainly calcium chromium oxide, chromium fluoride phosphate and related organo-Cr(III) complex crystals. The XRD data also revealed a strong involvement of cellular carboxyl and phosphate groups in chromium binding by the bacterial biomass. The results of the study indicated that a combined mechanism of ion-exchange, complexation, croprecipitation and immobilization was involved in the biosorption of chromium by bacterial cells in contaminated environments.

  16. Characterisation and sintering of nanophase hydroxyapatite synthesised by a species of Serratia (United States)

    LSammons, R.; Thackray, A. C.; Medina Ledo, H.; Marquis, P. M.; Jones, I. P.; Yong, P.; Macaskie, L. E.


    The bacterium Serratia sp. NCIMB40259, which grows as a biofilm on polymeric, glass and metal substrates, produces extracellular crystals of hydroxyapatite (HA) by enzymatic cleavage of β-glycerophosphate in the presence of calcium chloride. Following growth on polyurethane foam, biomineralisation and subsequent sintering, an HA scaffold is formed whose three-dimensional architecture replicates that of the foam and the biofilm. Serratia HA was characterised using X-ray diffraction (XRD), Fourier Transform Infra-Red Spectroscopy (FTIR), energy dispersive X-ray analysis (EDX) scanning electron microscopy (SEM), transmission electron microscopy (TEM) and electron diffraction (ED). The nascent, unsintered material consisted mainly of calcium-deficient HA (CDHA) with a Ca/P ratio of 1.61+/- 0.06 and crystal size (TEM) of 50 +/- 10nm length. ED of unsintered crystals and crystals sintered at 600° C showed resolvable ring (unsintered) or dot (600° C) patterns ascribed to (0002), (1122) and (0006) planes of crystalline HA. Material sintered at 1200° C consisted of needle-like crystals of length range 54-111nm (XRD) with lattice parameters of a = 9.441 Å and c = 6.875 Å, consistent with HA.

  17. Characterisation and sintering of nanophase hydroxyapatite synthesised by a species of Serratia

    International Nuclear Information System (INIS)

    LSammons, R; Thackray, A C; Ledo, H Medina; Marquis, P M; Jones, I P; Yong, P; Macaskie, L E


    The bacterium Serratia sp. NCIMB40259, which grows as a biofilm on polymeric, glass and metal substrates, produces extracellular crystals of hydroxyapatite (HA) by enzymatic cleavage of β-glycerophosphate in the presence of calcium chloride. Following growth on polyurethane foam, biomineralisation and subsequent sintering, an HA scaffold is formed whose three-dimensional architecture replicates that of the foam and the biofilm. Serratia HA was characterised using X-ray diffraction (XRD), Fourier Transform Infra-Red Spectroscopy (FTIR), energy dispersive X-ray analysis (EDX) scanning electron microscopy (SEM), transmission electron microscopy (TEM) and electron diffraction (ED). The nascent, unsintered material consisted mainly of calcium-deficient HA (CDHA) with a Ca/P ratio of 1.61+/- 0.06 and crystal size (TEM) of 50 +/- 10nm length. ED of unsintered crystals and crystals sintered at 600 0 C showed resolvable ring (unsintered) or dot (600 0 C) patterns ascribed to (0002), (1122) and (0006) planes of crystalline HA. Material sintered at 1200 0 C consisted of needle-like crystals of length range 54-111nm (XRD) with lattice parameters of a = 9.441 A and c = 6.875 A, consistent with HA

  18. Characterisation and sintering of nanophase hydroxyapatite synthesised by a species of Serratia

    Energy Technology Data Exchange (ETDEWEB)

    LSammons, R [University of Birmingham School of Dentistry, St Chad' s Queensway, Birmingham, B4 6NN (United Kingdom); Thackray, A C [University of Birmingham School of Dentistry, St Chad' s Queensway, Birmingham, B4 6NN (United Kingdom); Ledo, H Medina [University of Birmingham School of Engineering, Metallurgy and Materials, Birmingham B15 2TT (United Kingdom); Marquis, P M [University of Birmingham School of Dentistry, St Chad' s Queensway, Birmingham, B4 6NN (United Kingdom); Jones, I P [University of Birmingham School of Engineering, Metallurgy and Materials, Birmingham B15 2TT (United Kingdom); Yong, P [University of Birmingham, School of Biosciences, Birmingham B15 2TT (United Kingdom); Macaskie, L E [University of Birmingham, School of Biosciences, Birmingham B15 2TT (United Kingdom)


    The bacterium Serratia sp. NCIMB40259, which grows as a biofilm on polymeric, glass and metal substrates, produces extracellular crystals of hydroxyapatite (HA) by enzymatic cleavage of {beta}-glycerophosphate in the presence of calcium chloride. Following growth on polyurethane foam, biomineralisation and subsequent sintering, an HA scaffold is formed whose three-dimensional architecture replicates that of the foam and the biofilm. Serratia HA was characterised using X-ray diffraction (XRD), Fourier Transform Infra-Red Spectroscopy (FTIR), energy dispersive X-ray analysis (EDX) scanning electron microscopy (SEM), transmission electron microscopy (TEM) and electron diffraction (ED). The nascent, unsintered material consisted mainly of calcium-deficient HA (CDHA) with a Ca/P ratio of 1.61+/- 0.06 and crystal size (TEM) of 50 +/- 10nm length. ED of unsintered crystals and crystals sintered at 600{sup 0} C showed resolvable ring (unsintered) or dot (600{sup 0} C) patterns ascribed to (0002), (1122) and (0006) planes of crystalline HA. Material sintered at 1200{sup 0} C consisted of needle-like crystals of length range 54-111nm (XRD) with lattice parameters of a = 9.441 A and c = 6.875 A, consistent with HA.

  19. Proteomic analysis of carbon concentrating chemolithotrophic bacteria Serratia sp. for sequestration of carbon dioxide. (United States)

    Bharti, Randhir K; Srivastava, Shaili; Thakur, Indu Shekhar


    A chemolithotrophic bacterium enriched in the chemostat in presence of sodium bicarbonate as sole carbon source was identified as Serratia sp. by 16S rRNA sequencing. Carbon dioxide sequestering capacity of bacterium was detected by carbonic anhydrase enzyme and ribulose-1, 5- bisphosphate carboxylase/oxygenase (RuBisCO). The purified carbonic anhydrase showed molecular weight of 29 kDa. Molecular weight of RuBisCO was 550 kDa as determined by fast protein liquid chromatography (FPLC), however, sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) showed presence of two subunits whose molecular weights were 56 and 14 kDa. The Western blot analysis of the crude protein and purified sample cross reacted with RuBisCO large-subunit polypeptides antibodies showed strong band pattern at molecular weight around 56 kDa regions. Whole cell soluble proteins of Serratia sp. grown under autotrophic and heterotrophic conditions were resolved by two-dimensional gel electrophoresis and MALDI-TOF/MS for differential expression of proteins. In proteomic analysis of 63 protein spots, 48 spots were significantly up-regulated in the autotrophically grown cells; seven enzymes showed its utilization in autotrophic carbon fixation pathways and other metabolic activities of bacterium including lipid metabolisms indicated sequestration potency of carbon dioxide and production of biomaterials.

  20. Extraction of extracellular lipids from chemoautotrophic bacteria Serratia sp. ISTD04 for production of biodiesel. (United States)

    Bharti, Randhir K; Srivastava, Shaili; Thakur, Indu Shekhar


    A CO2 sequestering bacterial strain, Serratia sp. ISTD04, that produces a significant amount of extracellular lipids was isolated from marble mine rocks. (14)C labeling analysis revealed that the rate of assimilation of CO2 by the strain is 0.756×10(-9)μmolCO2fixedcell(-1)h(-1). It was found to produce 466mg/l of extracellular lipid which was characterized using (1)H NMR. After transesterification of lipids, the total saturated and unsaturated FAME was found to be 51% and 49% respectively. The major FAME contained in the biodiesel were palmitic acid methyl ester (C16:0), oleic acid methyl ester (C18:1) and 10-nonadecenoic acid methyl ester (C19:1). Biodiesel produced by Serratia sp. ISTD04 is balanced in terms of FAME composition of good quality. It also contained higher proportion of oleic acid (35%) which makes it suitable for utilization in existing engines. Thus, the strain can be harnessed commercially to sequester CO2 into biodiesel. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. Proteomic analysis of carbon concentrating chemolithotrophic bacteria Serratia sp. for sequestration of carbon dioxide.

    Directory of Open Access Journals (Sweden)

    Randhir K Bharti

    Full Text Available A chemolithotrophic bacterium enriched in the chemostat in presence of sodium bicarbonate as sole carbon source was identified as Serratia sp. by 16S rRNA sequencing. Carbon dioxide sequestering capacity of bacterium was detected by carbonic anhydrase enzyme and ribulose-1, 5- bisphosphate carboxylase/oxygenase (RuBisCO. The purified carbonic anhydrase showed molecular weight of 29 kDa. Molecular weight of RuBisCO was 550 kDa as determined by fast protein liquid chromatography (FPLC, however, sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE showed presence of two subunits whose molecular weights were 56 and 14 kDa. The Western blot analysis of the crude protein and purified sample cross reacted with RuBisCO large-subunit polypeptides antibodies showed strong band pattern at molecular weight around 56 kDa regions. Whole cell soluble proteins of Serratia sp. grown under autotrophic and heterotrophic conditions were resolved by two-dimensional gel electrophoresis and MALDI-TOF/MS for differential expression of proteins. In proteomic analysis of 63 protein spots, 48 spots were significantly up-regulated in the autotrophically grown cells; seven enzymes showed its utilization in autotrophic carbon fixation pathways and other metabolic activities of bacterium including lipid metabolisms indicated sequestration potency of carbon dioxide and production of biomaterials.

  2. Sulfate as a pivotal factor in regulation of Serratia sp. strain S2B pigment biosynthesis. (United States)

    Rastegari, Banafsheh; Karbalaei-Heidari, Hamid Reza


    In the present work, we investigated the prodiginine family as secondary metabolite members. Bacterial strain S2B, with the ability to produce red pigment, was isolated from the Sarcheshmeh copper mine in Iran. 16S rDNA gene sequencing revealed that the strain was placed in the Serratia genus. Pigment production was optimized using low-cost culture medium and the effects of various physicochemical factors were studied via statistical approaches. Purification of the produced pigment by silica gel column chromatography showed a strong red pigment fraction and a weaker orange band. Mass spectrometry, FT-IR spectroscopy and (1)H NMR analysis revealed that the red pigment was prodigiosin and the orange band was a prodigiosin-like analog, with molecular weights of 323 and 317 Da, respectively. Genotoxicity and cytotoxicity studies confirmed their membership in the prodiginine family. Analysis of the production pattern of the pigments in the presence of different concentrations of ammonium salts revealed the role of sulfate as an important factor in regulation of the pigment biosynthesis pathway. Overall, the data showed that regulation of the pigment biosynthesis pathway in Serratia sp. strain S2B was affected by inorganic micronutrients, particularly the sulfate ions. Copyright © 2016 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  3. Antiviral activity of the exopolysaccharide produced by Serratia sp. strain Gsm01 against Cucumber mosaic virus. (United States)

    Ipper, Nagesh S; Cho, Saeyoull; Lee, Seon Hwa; Cho, Jun Mo; Hur, Jang Hyun; Lim, Chun Keun


    The potential of the exopolysaccharide (EPS) from a Serratia sp. strain Gsm01 as an antiviral agent against a yellow strain of Cucumber mosaic virus (CMV-Y) was evaluated in tobacco plants (Nicotiana tabacum cv. Xanthi-nc). The spray treatment of plants using an EPS preparation, 72 before CMV-Y inoculation, protected them against symptom appearance. Fifteen days after challenge inoculation with CMVY, 33.33% of plants showed mosaic symptoms in EPS-treated plants compared with 100% in the control plants. The EPS-treated plants, which showed mosaic symptoms, appeared three days later than the controls. The enzyme-linked immunosorbent assay (ELISA) and reverse transcriptase polymerase chain reaction (RT-PCR) analyses of the leaves of the protected plants revealed that the EPS treatment affected virus accumulation in those plants. Analysis of phenylalanine ammonia lyase, peroxidase, and phenols in protected plants revealed enhanced accumulation of these substances. The pathogenesis-related (PR) genes expression represented by PR-1b was increased in EPS-treated plants. This is the first report of a systemic induction of protection triggered by EPS produced by Serratia sp. against CMV-Y.

  4. Draft Genome Sequence of the Biocontrol Strain Serratia plymuthica A30, Isolated from Rotting Potato Tuber Tissue

    NARCIS (Netherlands)

    Czajkowski, R.L.; Van der Wolf, J.M.


    Serratia plymuthica A30 is a Gram-negative bacterium expressing antagonistic activity toward blackleg- and soft rot-causing Dickeya sp. biovar 3 ("Dickeya solani"). Here, we present the draft genome sequence of strain A30, which has been isolated from rotten potato tuber tissue. [KEYWORDS: biovar 3

  5. Draft Genome Sequence of the Biocontrol Strain Serratia plymuthica A30, Isolated from Rotting Potato Tuber Tissue

    NARCIS (Netherlands)

    Czajkowski, R.L.; Wolf, van der J.M.


    Serratia plymuthica A30 is a Gram-negative bacterium expressing antagonistic activity toward blackleg- and soft rot-causing Dickeya sp. biovar 3 (“Dickeya solani”). Here, we present the draft genome sequence of strain A30, which has been isolated from rotten potato tuber tissue

  6. Molecular characterization of protease activity in Serratia sp. strain SCBI and its importance in cytotoxicity and virulence. (United States)

    Petersen, Lauren M; Tisa, Louis S


    A newly recognized Serratia species, termed South African Caenorhabditis briggsae isolate (SCBI), is both a mutualist of the nematode Caenorhabditis briggsae KT0001 and a pathogen of lepidopteran insects. Serratia sp. strain SCBI displays high proteolytic activity, and because secreted proteases are known virulence factors for many pathogens, the purpose of this study was to identify genes essential for extracellular protease activity in Serratia sp. strain SCBI and to determine what role proteases play in insect pathogenesis and cytotoxicity. A bank of 2,100 transposon mutants was generated, and six SCBI mutants with defective proteolytic activity were identified. These mutants were also defective in cytotoxicity. The mutants were found defective in genes encoding the following proteins: alkaline metalloprotease secretion protein AprE, a BglB family transcriptional antiterminator, an inosine/xanthosine triphosphatase, GidA, a methyl-accepting chemotaxis protein, and a PIN domain protein. Gene expression analysis on these six mutants showed significant downregulation in mRNA levels of several different types of predicted protease genes. In addition, transcriptome sequencing (RNA-seq) analysis provided insight into how inactivation of AprE, GidA, and a PIN domain protein influences motility and virulence, as well as protease activity. Using quantitative reverse transcription-PCR (qRT-PCR) to further characterize expression of predicted protease genes in wild-type Serratia sp. SCBI, the highest mRNA levels for the alkaline metalloprotease genes (termed prtA1 to prtA4) occurred following the death of an insect host, while two serine protease and two metalloprotease genes had their highest mRNA levels during active infection. Overall, these results indicate that proteolytic activity is essential for cytotoxicity in Serratia sp. SCBI and that its regulation appears to be highly complex. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  7. Draft Whole-Genome Sequence of Serratia sp. Strain TEL, Associated with Oscheius sp. TEL-2014 (Nematoda: Rhabditidae) Isolated from a Grassland in South Africa. (United States)

    Lephoto, Tiisetso E; Featherston, Jonathan; Gray, Vincent M


    Here, we report on the draft genome sequence of Serratia sp. strain TEL, associated with Oscheius sp. TEL-2014 (Nematoda: Rhabditidae, KM492926) isolated from a grassland in Suikerbosrand Nature Reserve near Johannesburg in South Africa. Serratia sp. strain TEL has a genome size of 5,000,541 bp with 4,647 genes and a G+C content of 59.1%. Copyright © 2015 Lephoto et al.

  8. Draft Whole-Genome Sequence of Serratia sp. Strain TEL, Associated with Oscheius sp. TEL-2014 (Nematoda: Rhabditidae) Isolated from a Grassland in South Africa


    Lephoto, Tiisetso E.; Featherston, Jonathan; Gray, Vincent M.


    Here, we report on the draft genome sequence of Serratia sp. strain TEL, associated with Oscheius sp. TEL-2014 (Nematoda: Rhabditidae, KM492926) isolated from a grassland in Suikerbosrand Nature Reserve near Johannesburg in South Africa. Serratia sp. strain TEL has a genome size of 5,000,541 bp with 4,647 genes and a G+C content of 59.1%.

  9. Comparative toxicity of heavy metal ions for some microorganisms. [Rhodotorula; Hansenula anormala; T. utilis; Serratia; Azotobacter; Pseudomonas; Escherichia coli; yeasts

    Energy Technology Data Exchange (ETDEWEB)

    Avakyan, Z A


    Polarographic study of Pb/sup 2 +/, Cd/sup 2 +/, Co/sup 2 +/, and Ni/sup 2 +/ concentration in different media has shown that at pH 6.0, Pb/sup 2 +/ is always precipitated by phosphates and cannot be determined polarographically. Cd, Co and Ni content is somewhat lower than that found in water solutions. The effect of Ag, Hg, Co, Ni, Pb, and Cd ions on the growth of 3 strains of Rhodotorula, Hansenula anomala and T. utilis, 6 strains of Serratia, 6 strains of Azotobacter, 12 strains of Pseudomonas and 2 strains of E. coli was studied. According to their toxicity for the microoganisms tested, heavy metals should be arranged in the following order: Ag>Hg>Cogreater than or equal toNi>Cd. Yeasts are the least sensitive to the action of heavy metals, cf. come serratia, Pseudomonas, Azotobacter and E. coli.

  10. Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

    DEFF Research Database (Denmark)

    Eberl, L; Winson, MK; Sternberg, C


    The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....

  11. Accumulation of zirconium phosphate by a Serratia sp.: a benign system for the removal of radionuclides from aqueous flows. (United States)

    Mennan, Claire; Paterson-Beedle, Marion; Macaskie, Lynne E


    Metal phosphate deposited enzymatically on Serratia sp. has been used successfully for the removal of radionuclides from aqueous flows. Previous studies using biogenic hydrogen uranyl phosphate (HUP) on Serratia sp. biofilm showed removal of 100% of (90)Sr, (137)Cs, and (60)Co via their intercalation into biogenic HUP crystals. Zirconium phosphates (ZrP) offer a potential non-toxic and non-radioactive alternative to HUP for water decontamination. A method was developed for biomanufacturing ZrP. Biogenic ZrP removed ca. 100% of Sr(2+) and Co(2+) (0.5 mM) from solutions to a molar ratio at saturation of ca. 1:0.6 for both Zr:Sr and Zr:Co. The potential for drinking water decontamination via bio-ZrP is discussed with respect to bio-HUP and also other commercially available materials.

  12. N-acyl-L-homoserine lactone-mediated regulation of the Lip secretion system in Serratia liquefaciens MG1

    DEFF Research Database (Denmark)

    Riedel, K.; Ohnesorg, T.; Krogfelt, K.A.


    The analysis of Serratia liquefaciens MG1 'luxAB insertion mutants that are responsive to N-butanoyl-L-homoserine lactone revealed that expression of lipB is controlled by the swr quorum-sensing system. LipB is part of the Lip exporter, a type I secretion system, which is responsible for the secr......The analysis of Serratia liquefaciens MG1 'luxAB insertion mutants that are responsive to N-butanoyl-L-homoserine lactone revealed that expression of lipB is controlled by the swr quorum-sensing system. LipB is part of the Lip exporter, a type I secretion system, which is responsible...

  13. Isolation and characterization of a chromium-resistant bacterium Serratia sp. Cr-10 from a chromate-contaminated site. (United States)

    Zhang, Kundi; Li, Fuli


    A novel bacterium, Cr-10, was isolated from a chromium-contaminated site and capable of removing toxic chromium species from solution by reducing hexavalent chromium to an insoluble precipitate. Sequence analysis of 16S rRNA gene of strain Cr-10 showed that it was most closely related to Serratia rubidaea JCM 1240(T) (97.68%). Physiological and chemotaxonomic data also supported that strain Cr-10 was identified as Serratia sp., a genus which was never specially reported chromate-resistant before. Serratia sp., Cr-10 was tolerant to a concentration of 1,500 mg Cr(VI) L(-1), which was the highest level reported until now. The optimum pH and temperature for reduction of Cr(VI) by Serratia sp. Cr-10 were found to be 7.0 and 37 °C, respectively. The Cr(VI) reduction was significantly influenced by additional carbon sources, and among them fructose and lactose offered maximum reduction, with a rate of 0.28 and 0.25 mg Cr(VI) L(-1) h(-1), respectively. The cell-free extracts and filtrate of the culture were able to reduce Cr(VI) while concentration of total chromium remained stable in the process, indicating that the enzyme-catalyzed mechanism was applied in Cr(VI) reduction by the isolate. Additionally, it was found that there was hardly any chromium on the cell surface of the strain, further supporting that reduction, rather than bioadsorption, plays a major role in the Cr(VI) removal.

  14. Isolation and characterization of a chromium-resistant bacterium Serratia sp. Cr-10 from a chromate-contaminated site

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Kundi; Li, Fuli [Chinese Academy of Sciences, Qingdao (China). Qingdao Inst. of Bioenergy and Bioprocess Technology


    A novel bacterium, Cr-10, was isolated from a chromium-contaminated site and capable of removing toxic chromium species from solution by reducing hexavalent chromium to an insoluble precipitate. Sequence analysis of 16S rRNA gene of strain Cr-10 showed that it was most closely related to Serratia rubidaea JCM 1240{sup T} (97.68%). Physiological and chemotaxonomic data also supported that strain Cr-10 was identified as Serratia sp., a genus which was never specially reported chromate-resistant before. Serratia sp., Cr-10 was tolerant to a concentration of 1,500 mg Cr(VI) L{sup -1}, which was the highest level reported until now. The optimum pH and temperature for reduction of Cr(VI) by Serratia sp. Cr-10 were found to be 7.0 and 37 C, respectively. The Cr(VI) reduction was significantly influenced by additional carbon sources, and among them fructose and lactose offered maximum reduction, with a rate of 0.28 and 0.25 mg Cr(VI) L{sup -1} h{sup -1}, respectively. The cell-free extracts and filtrate of the culture were able to reduce Cr(VI) while concentration of total chromium remained stable in the process, indicating that the enzyme-catalyzed mechanism was applied in Cr(VI) reduction by the isolate. Additionally, it was found that there was hardly any chromium on the cell surface of the strain, further supporting that reduction, rather than bioadsorption, plays a major role in the Cr(VI) removal. (orig.)

  15. Bio-mineralisation on the composites of silicon-based polymer and nanodiamond particles by a species of Serratia Bacteria

    International Nuclear Information System (INIS)

    Sammon, R.; Mitev, D.; Pramatarova, L.; Hikov, T.; Radeva, E.; Presker, R.


    Serratia sp. NCIMB 40259 is a non-pathogenic Gram-negative bacterium that is able to produce hydroxyapatite by a mechanism involving enzymic cleavage of organic phosphates. Serratia bacteria can attach and form a biofilm on glass, plastics, ceramics and metals and the method can be used to form three dimensional porous scaffolds and for coating 3D structures with hydroxyapatite. The production of calcium phosphate is driven by an acid phosphatase enzyme located in the bacterial cell wall, on fimbriae and within the bacterial extracellular polymeric matrix. Calcium phosphate ceramic may be obtained by two methods: In the first, crystals of calcium phosphate are formed extracellularly within the pre-formed bacterial biofilm grown on the substrata. In the second method, planktonic bacteria catalyse the formation of CaP in suspension and on solid substrata placed in the same container. Composite thin layer of silicon-based polymer and detonated nanodiamond (DND) particles was used as substrate for the process of biomineralization by a species of Serratia. The plasma polymerization (PP) method was chosen to obtain composites of silicon-based polymer, in which DND particles were incorporated. Over the past decades carbon-based nanostructures have been the focus of intense research due to their unique chemical and physical properties. Recently it was shown that the incorporation of the DND particles in a polymer matrix (an organosilicon polymer) changes their physico-chemical properties. The composite films are homogeneous, chemically resistant, thermally and mechanically stable, thus allowing a large amount of biological components to be loaded onto their surface and to be used in tissue engineering, regenerative medicine, implants, stents, biosensors and other medical and biological devices. The aim of this study was to investigate the process of biomineralisation by Serratia bacteria on various composites of silicon-based polymer and detonated nanodiamond particles

  16. Evaluation of insecticidal activity of a bacterial strain, Serratia sp. EML-SE1 against diamondback moth. (United States)

    Jeong, Hyung Uk; Mun, Hye Yeon; Oh, Hyung Keun; Kim, Seung Bum; Yang, Kwang Yeol; Kim, Iksoo; Lee, Hyang Burm


    To identify novel bioinsecticidal agents, a bacterial strain, Serratia sp. EML-SE1, was isolated from a dead larva of the lepidopteran diamondback moth (Plutella xylostella) collected from a cabbage field in Korea. In this study, the insecticidal activity of liquid cultures in Luria-Bertani broth (LBB) and nutrient broth (NB) of a bacterial strain, Serratia sp. EML-SE1 against thirty 3rd and 4th instar larvae of the diamondback moth was investigated on a Chinese cabbage leaf housed in a round plastic cage (Ø 10 x 6 cm). 72 h after spraying the cabbage leaf with LBB and NB cultures containing the bacterial strain, the mortalities of the larvae were determined to be 91.7% and 88.3%, respectively. In addition, the insecticidal activity on potted cabbage containing 14 leaves in a growth cage (165 x 83 x 124 cm) was found to be similar to that of the plastic cage experiment. The results of this study provided valuable information on the insecticidal activity of the liquid culture of a Serratia species against the diamondback moth.

  17. One step bioconversion of waste precious metals into Serratia biofilm-immobilized catalyst for Cr(VI) reduction. (United States)

    Yong, P; Liu, W; Zhang, Z; Beauregard, D; Johns, M L; Macaskie, L E


    For reduction of Cr(VI) the Pd-catalyst is excellent but costly. The objectives were to prove the robustness of a Serratia biofilm as a support for biogenic Pd-nanoparticles and to fabricate effective catalyst from precious metal waste. Nanoparticles (NPs) of palladium were immobilized on polyurethane reticulated foam and polypropylene supports via adhesive biofilm of a Serratia sp. The biofilm adhesion and cohesion strength were unaffected by palladization and catalytic biofilm integrity was also shown by magnetic resonance imaging. Biofilm-Pd and mixed precious metals on biofilm (biofilm-PM) reduced 5 mM Cr(VI) to Cr(III) when immobilized in a flow-through column reactor, at respective flow rates of 9 and 6 ml/h. The lower activity of the latter was attributed to fewer, larger, metal deposits on the bacteria. Activity was lost in each case at pH 7 but was restored by washing with 5 mM citrate solution or by exposure of columns to solution at pH 2, suggesting fouling by Cr(III) hydroxide product at neutral pH. A 'one pot' conversion of precious metal waste into new catalyst for waste decontamination was shown in a continuous flow system based on the use of Serratia biofilm to manufacture and support catalytic Pd-nanoparticles.

  18. Biodegradation of cyanide using Serratia sp. isolated from contaminated soil of gold mine in Takab

    Directory of Open Access Journals (Sweden)

    Mojtaba Mohseni


    Full Text Available   Introduction : Cyanide is a toxic and hazardous compound for all organisms which is produced enormously by human being and causes the environment pollution. Biodegradation is the best method for cyanide elimination in industrial wastewater. The aims of this study were isolation of cyanide degrading bacteria from contaminated soil and investigation of their ability for cyanide degradation.   Materials and methods: After soil samples collection, enrichment of cyanide degrading bacteria was performed in a minimal medium containing 0.5 mM potassium cyanide. The ability of isolated bacterium to utilize the cyanide as sole carbon and nitrogen source was investigated. Cyanide degradation and ammonium production was determined in growth medium using picric acid and Nessler’s regent methods. Toxicity effect of different cyanide compounds on bacterial growth was determined using minimum inhibitory concentration. In addition, the ability of the isolated bacterium to utilize different cyanide compounds was investigated . Identification of the isolate was undertaken using morphological, physiological and biochemical characteristics and molecular analysis .   Results : A bacterium with ability to degrade cyanide as sole carbon and nitrogen source was isolated from soil. This bacterium named as isolate MF1. MF1 degraded cyanide in growth medium in alkaline condition after 40 hours. Moreover this isolate tolerated more than 7 mM potassium cyanide. The results showed that there was a direct relation between decreasing of cyanide concentration, increasing of ammonia concentration and growth of MF1. In addition, the isolated bacterium demonstrated the ability to utilize different cyanide compounds as sole carbon and nitrogen source. The results of morphological and physiological characteristics showed that this bacterium belonged to the Serratia sp. Moreover, 16S rDNA sequencing and phylogenetic analyses exhibited that MF1 strain was similar to Serratia

  19. The genome and genetics of a high oxidative stress tolerant Serratia sp. LCN16 isolated from the plant parasitic nematode Bursaphelenchus xylophilus. (United States)

    Vicente, Claudia S L; Nascimento, Francisco X; Ikuyo, Yoriko; Cock, Peter J A; Mota, Manuel; Hasegawa, Koichi


    Pine wilt disease (PWD) is a worldwide threat to pine forests, and is caused by the pine wood nematode (PWN) Bursaphelenchus xylophilus. Bacteria are known to be associated with PWN and may have an important role in PWD. Serratia sp. LCN16 is a PWN-associated bacterium, highly resistant to oxidative stress in vitro, and which beneficially contributes to the PWN survival under these conditions. Oxidative stress is generated as a part of the basal defense mechanism used by plants to combat pathogenic invasion. Here, we studied the biology of Serratia sp. LCN16 through genome analyses, and further investigated, using reverse genetics, the role of two genes directly involved in the neutralization of H2O2, namely the H2O2 transcriptional factor oxyR; and the H2O2-targeting enzyme, catalase katA. Serratia sp. LCN16 is phylogenetically most closely related to the phytosphere group of Serratia, which includes S. proteamaculans, S. grimessi and S. liquefaciens. Likewise, Serratia sp. LCN16 shares many features with endophytes (plant-associated bacteria), such as genes coding for plant polymer degrading enzymes, iron uptake/transport, siderophore and phytohormone synthesis, aromatic compound degradation and detoxification enzymes. OxyR and KatA are directly involved in the high tolerance to H2O2 of Serratia sp. LCN16. Under oxidative stress, Serratia sp. LCN16 expresses katA independently of OxyR in contrast with katG which is under positive regulation of OxyR. Serratia sp. LCN16 mutants for oxyR (oxyR::int(614)) and katA (katA::int(808)) were sensitive to H2O2 in relation with wild-type, and both failed to protect the PWN from H2O2-stress exposure. Moreover, both mutants showed different phenotypes in terms of biofilm production and swimming/swarming behaviors. This study provides new insights into the biology of PWN-associated bacteria Serratia sp. LCN16 and its extreme resistance to oxidative stress conditions, encouraging further research on the potential role of this

  20. Analysis of the genomic sequences and metabolites of Serratia surfactantfaciens sp. nov. YD25T that simultaneously produces prodigiosin and serrawettin W2. (United States)

    Su, Chun; Xiang, Zhaoju; Liu, Yibo; Zhao, Xinqing; Sun, Yan; Li, Zhi; Li, Lijun; Chang, Fan; Chen, Tianjun; Wen, Xinrong; Zhou, Yidan; Zhao, Furong


    Gram-negative bacteria of the genus Serratia are potential producers of many useful secondary metabolites, such as prodigiosin and serrawettins, which have potential applications in environmental bioremediation or in the pharmaceutical industry. Several Serratia strains produce prodigiosin and serrawettin W1 as the main bioactive compounds, and the biosynthetic pathways are co-regulated by quorum sensing (QS). In contrast, the Serratia strain, which can simultaneously produce prodigiosin and serrawettin W2, has not been reported. This study focused on analyzing the genomic sequence of Serratia sp. strain YD25 T isolated from rhizosphere soil under continuously planted burley tobacco collected from Yongding, Fujian province, China, which is unique in producing both prodigiosin and serrawettin W2. A hybrid polyketide synthases (PKS)-non-ribosomal peptide synthetases (NRPS) gene cluster putatively involved in biosynthesis of antimicrobial serrawettin W2 was identified in the genome of YD25 T , and its biosynthesis pathway was proposed. We found potent antimicrobial activity of serrawettin W2 purified from YD25 T against various pathogenic bacteria and fungi as well as antitumor activity against Hela cells. Subsequently, comparative genomic analyses were performed among a total of 133 Serratia species. The prodigiosin biosynthesis gene cluster in YD25 T belongs to the type I pig cluster, which is the main form of pig-encoding genes existing in most of the pigmented Serratia species. In addition, a complete autoinducer-2 (AI-2) system (including luxS, lsrBACDEF, lsrGK, and lsrR) as a conserved bacterial operator is found in the genome of Serratia sp. strain YD25 T . Phylogenetic analysis based on concatenated Lsr and LuxS proteins revealed that YD25 T formed an independent branch and was clearly distant from the strains that solely produce either prodigiosin or serrawettin W2. The Fe (III) ion reduction assay confirmed that strain YD25 T could produce an AI-2 signal

  1. Serratia symbiotica from the aphid Cinara cedri: a missing link from facultative to obligate insect endosymbiont.

    Directory of Open Access Journals (Sweden)

    Araceli Lamelas


    Full Text Available The genome sequencing of Buchnera aphidicola BCc from the aphid Cinara cedri, which is the smallest known Buchnera genome, revealed that this bacterium had lost its symbiotic role, as it was not able to synthesize tryptophan and riboflavin. Moreover, the biosynthesis of tryptophan is shared with the endosymbiont Serratia symbiotica SCc, which coexists with B. aphidicola in this aphid. The whole-genome sequencing of S. symbiotica SCc reveals an endosymbiont in a stage of genome reduction that is closer to an obligate endosymbiont, such as B. aphidicola from Acyrthosiphon pisum, than to another S. symbiotica, which is a facultative endosymbiont in this aphid, and presents much less gene decay. The comparison between both S. symbiotica enables us to propose an evolutionary scenario of the transition from facultative to obligate endosymbiont. Metabolic inferences of B. aphidicola BCc and S. symbiotica SCc reveal that most of the functions carried out by B. aphidicola in A. pisum are now either conserved in B. aphidicola BCc or taken over by S. symbiotica. In addition, there are several cases of metabolic complementation giving functional stability to the whole consortium and evolutionary preservation of the actors involved.

  2. [Isolation, identification and characterization of a diethylstilbestrol-degrading bacterial strain Serratia sp]. (United States)

    Xu, Ran-Fang; Sun, Min-Xia; Liu, Juan; Wang, Hong; Li, Xin; Zhu, Xue-Zhu; Ling, Wan-Ting


    Utilizing the diethylstilbestrol (DES)-degrading bacteria to biodegrade DES is a most reliable technique for cleanup of DES pollutants from the environment. However, little information is available heretofore on the isolation of DES-degrading bacteria and their DES removal performance in the environment. A novel bacterium capable of degrading DES was isolated from the activated sludge of a wastewater treatment plant. According to its morphology, physiochemical characteristics, and 16S rDNA sequence analysis, this strain was identified as Serratia sp.. The strain was an aerobic bacterium, and it could degrade 68.3% of DES (50 mg x L(-1)) after culturing for 7 days at 30 degrees C, 150 r x min(-1) in shaking flasks. The optimal conditions for DES biodegradation by the obtained strain were 30 degrees C, 40-60 mg x L(-1) DES, pH 7.0, 5% of inoculation volume, 0 g x L(-1) of added NaCl, and 10 mL of liquid medium volume in 100 mL flask.

  3. Mixing and matching siderophore clusters: structure and biosynthesis of serratiochelins from Serratia sp. V4. (United States)

    Seyedsayamdost, Mohammad R; Cleto, Sara; Carr, Gavin; Vlamakis, Hera; João Vieira, Maria; Kolter, Roberto; Clardy, Jon


    Interrogation of the evolutionary history underlying the remarkable structures and biological activities of natural products has been complicated by not knowing the functions they have evolved to fulfill. Siderophores-soluble, low molecular weight compounds-have an easily understood and measured function: acquiring iron from the environment. Bacteria engage in a fierce competition to acquire iron, which rewards the production of siderophores that bind iron tightly and cannot be used or pirated by competitors. The structures and biosyntheses of "odd" siderophores can reveal the evolutionary strategy that led to their creation. We report a new Serratia strain that produces serratiochelin and an analog of serratiochelin. A genetic approach located the serratiochelin gene cluster, and targeted mutations in several genes implicated in serratiochelin biosynthesis were generated. Bioinformatic analyses and mutagenesis results demonstrate that genes from two well-known siderophore clusters, the Escherichia coli enterobactin cluster and the Vibrio cholera vibriobactin cluster, were shuffled to produce a new siderophore biosynthetic pathway. These results highlight how modular siderophore gene clusters can be mixed and matched during evolution to generate structural diversity in siderophores.

  4. Production and characterization of biodiesel from carbon dioxide concentrating chemolithotrophic bacteria, Serratia sp. ISTD04. (United States)

    Bharti, Randhir K; Srivastava, Shaili; Thakur, Indu Shekhar


    A chemolithotrophic bacterium, Serratia sp. ISTD04, enriched in the chemostat in presence of sodium bicarbonate as sole carbon source was evaluated for potential of carbon dioxide (CO2) sequestration and biofuel production. CO2 sequestration efficiency of the bacterium was determined by enzymatic activity of carbonic anhydrase and ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisCO). Further, Western blot analysis confirmed presence of RuBisCO. The bacterium produced 0.487 and 0.647mgmg(-1) per unit cell dry weight of hydrocarbons and lipids respectively. The hydrocarbons were within the range of C13-C24 making it equivalent to light oil. GC-MS analysis of lipids produced by the bacterium indicated presence of C15-C20 organic compounds that made it potential source of biodiesel after transesterification. GC-MS, FTIR and NMR spectroscopic characterization of the fatty acid methyl esters revealed the presence of 55% and 45% of unsaturated and saturated organic compounds respectively, thus making it a balanced biodiesel composition. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. Biodecolorization of Reactive Yellow-2 by Serratia sp. RN34 Isolated from Textile Wastewater. (United States)

    Najme, Rabia; Hussain, Sabir; Maqbool, Zahid; Imran, Muhammad; Mahmood, Faisal; Manzoor, Hamid; Yasmeen, Tahira; Shehzad, Tanvir


    Remediation of colored textile wastewaters is a matter of interest. In this study, 49 bacteria were isolated from the textile wastewater and tested for their ability to decolorize reactive yellow-2 (RY2) dye. The most efficient isolate, RN34, was identified through amplification, sequencing, and phylogenetic analysis of its 16S rDNA and was designated as Serratia sp. RN34. This bacterium was also found capable of decolorizing other related reactive azo-dyes, including reactive black-5, reactive red-120, and reactive orange-16 but at varying rates. The optimum pH for decolorization of RY2 by the strain RN34 was 7.5 using yeast extract as cosubstrate under static incubation at 30 °C. The strain RN34 also showed potential to decolorize RY2 in the presence of considerable amounts of hexavalent chromium and sodium chloride. A phytotoxicity study demonstrated relatively reduced toxicity of RY2 decolorized products on Vigna radiata plant as compared to the uninoculated RY2 solution.

  6. The endophytic bacterium Serratia sp. PW7 degrades pyrene in wheat. (United States)

    Zhu, Xuezhu; Wang, Wanqing; Crowley, David E; Sun, Kai; Hao, Shupeng; Waigi, Michael Gatheru; Gao, Yanzheng


    This research was conducted to isolate polycyclic aromatic hydrocarbon-degrading (PAH-degrading) endophytic bacteria and investigate their potential in protecting plants against PAH contamination. Pyrene-degrading endophytic bacteria were isolated from plants grown in PAH-contaminated soil. Among these endophytic bacteria, strain PW7 (Serratia sp.) isolated from Plantago asiatica was selected to investigate the suppression of pyrene accumulation in Triticum aestivum L. In the in vitro tests, strain PW7 degraded 51.2% of the pyrene in the media within 14 days. The optimal biodegradation conditions were pH 7.0, 30 °C, and MS medium supplemented with additional glucose, maltose, sucrose, and peptones. In the in vivo tests, strain PW7 successfully colonized the roots and shoots of inoculated (E + ) wheat plants, and its colonization decreased pyrene accumulation and pyrene transportation from roots to shoots. Remarkably, the concentration of pyrene in shoots decreased much more than that in roots, suggesting that strain PW7 has the potential for protecting wheat against pyrene contamination and mitigating the threat of pyrene to human health via food consumption.

  7. Characterization of carbon dioxide concentrating chemolithotrophic bacterium Serratia sp. ISTD04 for production of biodiesel. (United States)

    Kumar, Manish; Morya, Raj; Gnansounou, Edgard; Larroche, Christian; Thakur, Indu Shekhar


    Proteomics and metabolomics analysis has become a powerful tool for characterization of microbial ability for fixation of Carbon dioxide. Bacterial community of palaeoproterozoic metasediments was enriched in the shake flask culture in the presence of NaHCO 3 . One of the isolate showed resistance to NaHCO 3 (100mM) and was identified as Serratia sp. ISTD04 by 16S rRNA sequence analysis. Carbon dioxide fixing ability of the bacterium was established by carbonic anhydrase enzyme assay along with proteomic analysis by LC-MS/MS. In proteomic analysis 96 proteins were identified out of these 6 protein involved in carbon dioxide fixation, 11 in fatty acid metabolism, indicating the carbon dioxide fixing potency of bacterium along with production of biofuel. GC-MS analysis revealed that hydrocarbons and FAMEs produced by bacteria within the range of C 13 -C 24 and C 11 -C 19 respectively. Presence of 59% saturated and 41% unsaturated organic compounds, make it a better fuel composition. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Induction of phospholipase- and flagellar synthesis in Serratia liquefaciens is controlled by expression of the flagellar master operon flhD

    DEFF Research Database (Denmark)

    Givskov, M; Eberl, L; Christiansen, Gunna


    When a liquid culture of Serratia spp. reaches the last part of the logarithmic phase of growth it induces the synthesis of several extracellular hydrolytic enzymes. In this communication we show that synthesis and secretion of the extracellular phospholipase is coupled to expression of flagella....... Expression of flagella is demonstrated to follow a growth-phase-dependent pattern. Cloning, complementation studies and DNA-sequencing analysis has identified a genetic region in Serratia liquefaciens which exhibits extensive homology to the Escherichia coli flhD flagellar master operon. Interruption...

  9. Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

    DEFF Research Database (Denmark)

    Eberl, L; Winson, MK; Sternberg, C


    The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....

  10. Processing of poultry feathers by alkaline keratin hydrolyzing enzyme from Serratia sp. HPC 1383. (United States)

    Khardenavis, Anshuman A; Kapley, Atya; Purohit, Hemant J


    The present study describes the production and characterization of a feather hydrolyzing enzyme by Serratia sp. HPC 1383 isolated from tannery sludge, which was identified by the ability to form clear zones around colonies on milk agar plates. The proteolytic activity was expressed in terms of the micromoles of tyrosine released from substrate casein per ml per min (U/mL min). Induction of the inoculum with protein was essential to stimulate higher activity of the enzyme, with 0.03% feathermeal in the inoculum resulting in increased enzyme activity (45U/mL) that further increased to 90U/mL when 3d old inoculum was used. The highest enzyme activity, 130U/mL, was observed in the presence of 0.2% yeast extract. The optimum assay temperature and pH for the enzyme were found to be 60 degrees C and 10.0, respectively. The enzyme had a half-life of 10min at 60 degrees C, which improved slightly to 18min in presence of 1mM Ca(2+). Inhibition of the enzyme by phenylmethyl sulfonyl fluoride (PMSF) indicated that the enzyme was a serine protease. The enzyme was also partially inhibited (39%) by the reducing agent beta-mercaptoethanol and by divalent metal ions such as Zn(2+) (41% inhibition). However, Ca(2+) and Fe(2+) resulted in increases in enzyme activity of 15% and 26%, respectively. The kinetic constants of the keratinase were found to be 3.84 microM (K(m)) and 108.7 microM/mLmin (V(max)). These results suggest that this extracellular keratinase may be a useful alternative and eco-friendly route for handling the abundant amount of waste feathers or for applications in other industrial processes.

  11. Rhizostabilization of metals in soils using Lupinus luteus inoculated with the metal resistant rhizobacterium Serratia sp. MSMC541. (United States)

    El Aafi, N; Brhada, F; Dary, M; Maltouf, A Filali; Pajuelo, E


    The aim of this work was to test Lupinus luteus plants, inoculated with metal resistant rhizobacteria, in order to phytostabilise metals in contaminated soils. The resistance to heavy metals of strains isolated from nodules of Lupinus plants was evaluated. The strain MSMC541 showed multi-resistance to several metals (up to 13.3 mM As, 2.2 mM Cd, 2.3 mM Cu, 9 mM Pb and 30 mM Zn), and it was selected for further characterization. Furthermore, this strain was able to biosorb great amounts of metals in cell biomass. 16S rDNA sequencing positioned this strain within the genus Serratia. The presence of arsenic resistance genes was confirmed by southern blot and PCR amplification. A rhizoremediation pot experiment was conducted using Lupinus luteus grown on sand supplemented with heavy metals and inoculated with MSMC541. Plant growth parameters and metal accumulation were determined in inoculated vs. non-inoculated Lupinus luteus plants. The results showed that inoculation with MSMC541 improved the plant tolerance to metals. At the same time, metal translocation to the shoot was significantly reduced upon inoculation. These results suggest that Lupinus luteus plants, inoculated with the metal resistant strain Serratia sp. MSMC541, have a great potential for phytostabilization of metal contaminated soils.

  12. Influence of culture conditions and medium composition on the production of antibacterial compounds by marine Serratia sp. WPRA3. (United States)

    Jafarzade, Mahtab; Yahya, Nur Ain; Shayesteh, Fatemeh; Usup, Gires; Ahmad, Asmat


    This study was undertaken to investigate the influence of culture conditions and medium components on production of antibacterial compounds by Serratia sp. WPRA3 (JX020764) which was isolated from marine water of Port Dickson, Malaysia. Biochemical, morphological, and molecular characteristics suggested that the isolate is a new candidate of the Serratia sp. The isolate showed strong antimicrobial activity against fungi, Gram-negative and Gram-positive bacteria. This bacterium exhibited optimum antibacterial compounds production at 28°C, pH 7 and 200 rev/min aeration during 72 h of incubation period. Highest antibacterial activity was obtained when sodium chloride (2%), yeast extract (0.5%), and glucose concentration (0.75%) were used as salt, nitrogen, and carbon sources respectively. Different active fractions were obtained by Thin-Layer Chromatography (TLC) and Flash Column Chromatography (FCC) from ethyl acetate crude extracts namely OCE and RCE in different culture conditions, OCE (pH 5, 200 rev/min) and RCE (pH 7/without aeration). In conclusion, the results suggested different culture conditions have a significant impact on the types of secondary metabolites produced by the bacterium.

  13. Structure of a thermostable serralysin from Serratia sp. FS14 at 1.1 Å resolution. (United States)

    Wu, Dongxia; Ran, Tinting; Wang, Weiwu; Xu, Dongqing


    Serralysin is a well studied metalloprotease, and typical serralysins are not thermostable. The serralysin isolated from Serratia sp. FS14 was found to be thermostable, and in order to reveal the mechanism responsible for its thermostability, the crystal structure of serralysin from Serratia sp. FS14 was solved to a crystallographic R factor of 0.1619 at 1.10 Å resolution. Similar to its homologues, it mainly consists of two domains: an N-terminal catalytic domain and a `parallel β-roll' C-terminal domain. Comparative studies show that the shape of the catalytic active-site cavity is more open owing to the 189-198 loop, with a short 310-helix protruding further from the molecular surface, and that the β-sheets comprising the `parallel β-roll' are longer than those in its homologues. The formation of hydrogen bonds from one of the nonconserved residues (Asn200) to Lys27 may contribute to the thermostability.

  14. R-plasmic transfer from Serratia liquefaciens to Escherichia coli in vitro and in vivo in the digestive tract of gnotobiotic mice associated with human fecal flora.


    Duval-Iflah, Y; Raibaud, P; Tancrede, C; Rousseau, M


    It was shown that a strain of Serratia liquefaciens harbors a conjugative R-plasmid responsible for reistance to the following 14 antibiotics: ampicillin, carbenicillin, cephalothin, butirosin, neomycin, paramomycin, kanamycin, lividomycin, gentamicin, tobramycin, streptomycin, tetracycline, sulfonamide, and chloramphenicol, which belong to five families, the beta-lactamines, the aminoglycosides, the tetracyclines, the sulfonamides, and the phenicols. Resistance to th 14 antibiotics was cotra...

  15. N-Acyl-L-homoserine lactone autoinducers control production of an extracellular lipopeptide biosurfactant required for swarming motility of Serratia liquefaciens MG1

    DEFF Research Database (Denmark)

    Lindum, Peter Wurtz; Anthoni, U; Christophersen, Carsten


    A nonswarming Serratia liquefaciens mutant deficient in serrawettin W2 production was constructed by transposon mutagenesis. Sequence homology indicated that insertion had occurred in gene swrA, which encodes a putative peptide synthetase. Expression of swrA is controlled by quorum sensing....

  16. Studies on the interaction between the biocontrol agent, Serratia plymuthica A30, and blackleg-causing Dickeya sp. (biovar 3) in potato (Solanum tuberosum)

    NARCIS (Netherlands)

    Czajkowski, R.L.; Boer, de W.J.; Veen, van J.A.; Wolf, van der J.M.


    Interactions between Serratia plymuthica A30 and a blackleg-causing biovar 3 Dickeya sp. were examined. In a potato slice assay, S. plymuthica A30 inhibited tissue maceration caused by Dickeya sp. IPO2222 when co-inoculated at a density at least 10 times greater than that of the pathogen. In

  17. Studies on the interaction between the biocontrol agent, Serratia plymuthica A30, and blackleg-causing Dickeya sp (biovar 3) in potato (Solanum tuberosum)

    NARCIS (Netherlands)

    Czajkowski, R.L.; De Boer, W.J.; Van Veen, J.A.; Van der Wolf, J.M.


    Interactions between Serratia plymuthica A30 and a blackleg-causing biovar 3 Dickeya sp. were examined. In a potato slice assay, S. plymuthica A30 inhibited tissue maceration caused by Dickeya sp. IPO2222 when co-inoculated at a density at least 10 times greater than that of the pathogen. In

  18. Effects of simulated Mars conditions on the survival and growth of Escherichia coli and Serratia liquefaciens. (United States)

    Berry, Bonnie J; Jenkins, David G; Schuerger, Andrew C


    Escherichia coli and Serratia liquefaciens, two bacterial spacecraft contaminants known to replicate under low atmospheric pressures of 2.5 kPa, were tested for growth and survival under simulated Mars conditions. Environmental stresses of high salinity, low temperature, and low pressure were screened alone and in combination for effects on bacterial survival and replication, and then cells were tested in Mars analog soils under simulated Mars conditions. Survival and replication of E. coli and S. liquefaciens cells in liquid medium were evaluated for 7 days under low temperatures (5, 10, 20, or 30 degrees C) with increasing concentrations (0, 5, 10, or 20%) of three salts (MgCl(2), MgSO(4), NaCl) reported to be present on the surface of Mars. Moderate to high growth rates were observed for E. coli and S. liquefaciens at 30 or 20 degrees C and in solutions with 0 or 5% salts. In contrast, cell densities of both species generally did not increase above initial inoculum levels under the highest salt concentrations (10 and 20%) and the four temperatures tested, with the exception that moderately higher cell densities were observed for both species at 10% MgSO(4) maintained at 20 or 30 degrees C. Growth rates of E. coli and S. liquefaciens in low salt concentrations were robust under all pressures (2.5, 10, or 101.3 kPa), exhibiting a general increase of up to 2.5 orders of magnitude above the initial inoculum levels of the assays. Vegetative E. coli cells were maintained in a Mars analog soil for 7 days under simulated Mars conditions that included temperatures between 20 and -50 degrees C for a day/night diurnal period, UVC irradiation (200 to 280 nm) at 3.6 W m(-2) for daytime operations (8 h), pressures held at a constant 0.71 kPa, and a gas composition that included the top five gases found in the martian atmosphere. Cell densities of E. coli failed to increase under simulated Mars conditions, and survival was reduced 1 to 2 orders of magnitude by the interactive

  19. A study on a nascent entomopathogenic association between caenorhabditis briggsae and serratia sp.SCBI (United States)

    Abebe-Akele, Feseha

    Life is inconceivable in the absence of interactions which could be cooperative, antagonistic or neutral. Interactions are in constant flux because on one hand it is often difficult to demarcate where one form of interaction ends and the other begins on the other hand what is cooperative at one point in time could evolve into antagonistic or neutral or vice versa. Thus, organisms, as a consequence of mutation, adaptation and natural selection would inevitably enter into natural associations from which they emerge as mutual partners, inveterate enemies or passive cohabitants. Entomopathogenic nematode (EPN) partnerships are tripartite interactions where a nematode-bacteria symbiont duo attacks a third organism -an insect or insect larva-for the mutual benefit of the attacking partners and the detriment of the insect they invade. All three participants in the interaction---the nematode worms with their symbiont bacteria and the target insect host-are among the most ancient, diverse and abundant species on earth, however, these EPN partnerships are not as common as circumstances would suggest. EPN associations, which are arguably at the peak of evolutionary co adaptations, where two primitive forms of life cooperate to take advantage of a larger species are not only fascinating but immensely important for humans. The biological and molecular mechanisms underlying entomopathogenesis have been studied in great detail for decades for their potential as biological control agents against invasive insects. In spite of intense research in The EPN field, the evolutionary history of EPN associations are largely unknown because there are no known intermediate forms. In this thesis, a nascent EPN partnership is described between Caenorhabditid nematodes and Serratia sp. SCBI. Comparative analysis of this association with other EPNs suggests that crucial aspect of EPN associations may be the ability of partners to co-exist without killing each other and that the end results of

  20. Cloning and sequence analysis demonstrate the chromate reduction ability of a novel chromate reductase gene from Serratia sp. (United States)

    Deng, Peng; Tan, Xiaoqing; Wu, Ying; Bai, Qunhua; Jia, Yan; Xiao, Hong


    The ChrT gene encodes a chromate reductase enzyme which catalyzes the reduction of Cr(VI). The chromate reductase is also known as flavin mononucleotide (FMN) reductase (FMN_red). The aim of the present study was to clone the full-length ChrT DNA from Serratia sp. CQMUS2 and analyze the deduced amino acid sequence and three-dimensional structure. The putative ChrT gene fragment of Serratia sp. CQMUS2 was isolated by polymerase chain reaction (PCR), according to the known FMN_red gene sequence from Serratia sp. AS13. The flanking sequences of the ChrT gene were obtained by high efficiency TAIL-PCR, while the full-length gene of ChrT was cloned in Escherichia coli for subsequent sequencing. The nucleotide sequence of ChrT was submitted onto GenBank under the accession number, KF211434. Sequence analysis of the gene and amino acids was conducted using the Basic Local Alignment Search Tool, and open reading frame (ORF) analysis was performed using ORF Finder software. The ChrT gene was found to be an ORF of 567 bp that encodes a 188-amino acid enzyme with a calculated molecular weight of 20.4 kDa. In addition, the ChrT protein was hypothesized to be an NADPH-dependent FMN_red and a member of the flavodoxin-2 superfamily. The amino acid sequence of ChrT showed high sequence similarity to the FMN reductase genes of Klebsiella pneumonia and Raoultella ornithinolytica , which belong to the flavodoxin-2 superfamily. Furthermore, ChrT was shown to have a 85.6% similarity to the three-dimensional structure of Escherichia coli ChrR, sharing four common enzyme active sites for chromate reduction. Therefore, ChrT gene cloning and protein structure determination demonstrated the ability of the gene for chromate reduction. The results of the present study provide a basis for further studies on ChrT gene expression and protein function.

  1. Cloning and sequence analysis demonstrate the chromate reduction ability of a novel chromate reductase gene from Serratia sp (United States)



    The ChrT gene encodes a chromate reductase enzyme which catalyzes the reduction of Cr(VI). The chromate reductase is also known as flavin mononucleotide (FMN) reductase (FMN_red). The aim of the present study was to clone the full-length ChrT DNA from Serratia sp. CQMUS2 and analyze the deduced amino acid sequence and three-dimensional structure. The putative ChrT gene fragment of Serratia sp. CQMUS2 was isolated by polymerase chain reaction (PCR), according to the known FMN_red gene sequence from Serratia sp. AS13. The flanking sequences of the ChrT gene were obtained by high efficiency TAIL-PCR, while the full-length gene of ChrT was cloned in Escherichia coli for subsequent sequencing. The nucleotide sequence of ChrT was submitted onto GenBank under the accession number, KF211434. Sequence analysis of the gene and amino acids was conducted using the Basic Local Alignment Search Tool, and open reading frame (ORF) analysis was performed using ORF Finder software. The ChrT gene was found to be an ORF of 567 bp that encodes a 188-amino acid enzyme with a calculated molecular weight of 20.4 kDa. In addition, the ChrT protein was hypothesized to be an NADPH-dependent FMN_red and a member of the flavodoxin-2 superfamily. The amino acid sequence of ChrT showed high sequence similarity to the FMN reductase genes of Klebsiella pneumonia and Raoultella ornithinolytica, which belong to the flavodoxin-2 superfamily. Furthermore, ChrT was shown to have a 85.6% similarity to the three-dimensional structure of Escherichia coli ChrR, sharing four common enzyme active sites for chromate reduction. Therefore, ChrT gene cloning and protein structure determination demonstrated the ability of the gene for chromate reduction. The results of the present study provide a basis for further studies on ChrT gene expression and protein function. PMID:25667630

  2. Carbon Catabolite Repression Regulates the Production of the Unique Volatile Sodorifen of Serratia plymuthica 4Rx13

    Directory of Open Access Journals (Sweden)

    Nancy Magnus


    Full Text Available Microorganisms are capable of synthesizing a plethora of secondary metabolites including the long-overlooked volatile organic compounds. Little knowledge has been accumulated regarding the regulation of the biosynthesis of such mVOCs. The emission of the unique compound sodorifen of Serratia plymuthica isolates was significantly reduced in minimal medium with glucose, while succinate elevated sodorifen release. The hypothesis of carbon catabolite repression (CCR acting as a major control entity on the synthesis of mVOCs was proven by genetic evidence. Central components of the typical CCR of Gram-negative bacteria such as the adenylate cyclase (CYA, the cAMP binding receptor protein (CRP, and the catabolite responsive element (CRE were removed by insertional mutagenesis. CYA, CRP, CRE1 mutants revealed a lower sodorifen release. Moreover, the emission potential of other S. plymuthica isolates was also evaluated.

  3. Improvement in phytoremediation potential of Solanum nigrum under cadmium contamination through endophytic-assisted Serratia sp. RSC-14 inoculation. (United States)

    Khan, Abdur Rahim; Ullah, Ihsan; Khan, Abdul Latif; Park, Gun-Seok; Waqas, Muhammad; Hong, Sung-Jun; Jung, Byung Kwon; Kwak, Yunyoung; Lee, In-Jung; Shin, Jae-Ho


    The growth of hyperaccumulator plants is often compromised by increased toxicity of metals like cadmium (Cd). However, extraction of such metals from the soil can be enhanced by endophytic microbial association. Present study was aimed to elucidate the potential of microbe-assisted Cd phytoextraction in hyperaccumulator Solanum nigrum plants and their interactions under varied Cd concentrations. An endophytic bacteria Serratia sp. RSC-14 was isolated from the roots of S. nigrum. In addition to Cd tolerance up to 4 mM, the RSC-14 exhibited phosphate solubilization and secreted plant growth-promoting phytohormones such as indole-3-acetic acid (54 μg/mL). S. nigrum plants were inoculated with RSC-14 and were grown in different concentrations of Cd (0, 10, and 30 mg Cd kg(-1) sand). Results revealed that Cd treatment caused significant cessation in plant growth, biomass, and chlorophyll content, whereas significantly higher malondialdehyde (MDA) and electrolyte production in leaves were observed in a dose-dependent manner. Conversely, RSC-14 inoculation relived the toxic effects of Cd-induced stress by significantly increasing root/shoot growth, biomass production, and chlorophyll content and decreasing MDA and electrolytes contents. Ameliorative effects on host growth were also observed by the regulation of metal-induced oxidative stress enzymes such as catalase, peroxidase, and polyphenol peroxidase. Activities of these enzymes were significantly reduced in RSC-14 inoculated plants as compared to control plants under Cd treatments. The lower activities of stress responsive enzymes suggest modulation of Cd stress by RSC-14. The current findings support the beneficial uses of Serratia sp. RSC-14 in improving the phytoextraction abilities of S. nigrum plants in Cd contamination.

  4. Two types of phytases (histidine acid phytase and β-propeller phytase) in Serratia sp. TN49 from the gut of Batocera horsfieldi (coleoptera) larvae. (United States)

    Zhang, Rui; Yang, Peilong; Huang, Huoqing; Shi, Pengjun; Yuan, Tiezheng; Yao, Bin


    Microbial phytases play a major role in the mineralization of organic phosphorous, especially in symbiotic plants and animals. In this study, we identified two types of phytases in Serratia sp. TN49 that was harbored in the gut of Batocera horsfieldi (Coleoptera) larvae. The two phytases, an acidic histidine acid phosphatase (PhyH49) and an alkaline β-propeller phytase (PhyB49), shared low identities with known phytases (61% at most). PhyH49 and PhyB49 produced in Escherichia coli exhibited maximal activities at pH 5.0 (60°C) and pH 7.5-8.0 (45°C), respectively, and are complementary in phytate degradation over the pH range 2.0-9.0. Serratia sp. TN49 harboring both PhyH49 and PhyB49 might make it more adaptive to environment change, corresponding to the evolution trend of microorganism.

  5. Alkaline Fe(III) reduction by a novel alkali-tolerant Serratia sp. isolated from surface sediments close to Sellafield nuclear facility, UK. (United States)

    Thorpe, Clare L; Morris, Katherine; Boothman, Christopher; Lloyd, Jonathan R


    Extensive denitrification resulted in a dramatic increase in pH (from 6.8 to 9.5) in nitrate-impacted, acetate-amended sediment microcosms containing sediment representative of the Sellafield nuclear facility, UK. Denitrification was followed by Fe(III) reduction, indicating the presence of alkali-tolerant, metal-reducing bacteria. A close relative (99% 16S rRNA gene sequence homology) to Serratia liquefaciens dominated progressive enrichment cultures containing Fe(III)-citrate as the sole electron acceptor at pH 9 and was isolated aerobically using solid media. The optimum growth conditions for this facultatively anaerobic Serratia species were investigated, and it was capable of metabolizing a wide range of electron acceptors including oxygen, nitrate, FeGel, Fe-NTA and Fe-citrate and electron donors including acetate, lactate, formate, ethanol, glucose, glycerol and yeast extract at an optimum pH of c. 6.5 at 20 °C. The alkali tolerance of this strain extends the pH range of highly adaptable Fe(III)-reducing Serratia species from mildly acidic pH values associated with acid mine drainage conditions to alkali conditions representative of subsurface sediments stimulated for extensive denitrification and metal reduction. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  6. The Pathogenesis and Therapy of Combined Radiation Injury

    National Research Council Canada - National Science Library

    Boudagov, R. S; Oulianova, L. P; Tsyb, A. F


    .... Single injection of extract from Serratia marcescens (Imuvert) or synthetic trehalose dicorynomy-colate improved hematological status, enhanced the serum IL-6 levels, but did not promote survival in mice...

  7. The pink pigment prodigiosin: Vibrational spectroscopy and DFT calculations

    Czech Academy of Sciences Publication Activity Database

    Jehlička, J.; Němec, I.; Varnali, T.; Culka, A.; Svatoš, A.; Frank, Otakar; Oren, A.; Edwards, G.M.


    Roč. 134, NOV 2016 (2016), s. 234-243 ISSN 0143-7208 Institutional support: RVO:61388955 Keywords : prodigiosin * serratia marcescens * raman spectroscopy Subject RIV: CG - Electrochemistry Impact factor: 3.473, year: 2016

  8. Computational analysis of difenoconazole interaction with soil chitinases

    International Nuclear Information System (INIS)

    Vlǎdoiu, D L; Filimon, M N; Ostafe, V; Isvoran, A


    This study focusses on the investigation of the potential binding of the fungicide difenoconazole to soil chitinases using a computational approach. Computational characterization of the substrate binding sites of Serratia marcescens and Bacillus cereus chitinases using Fpocket tool reflects the role of hydrophobic residues for the substrate binding and the high local hydrophobic density of both sites. Molecular docking study reveals that difenoconazole is able to bind to Serratia marcescens and Bacillus cereus chitinases active sites, the binding energies being comparable

  9. Evaluation of antibacterial properties of some medicinal plants used in Iran. (United States)

    Bonjar, Shahidi


    Forty-five species of 29 plant families used in the traditional medicine by Iranian people, showed antibacterial activities against one or more of the bacterial species: Bacillus cereus, Bacillus pumilus, Bordetella bronchiseptica, Escherichia coli, Klebsiella pneumoniae, Micrococcus luteus, Pseudomonas aeruginosa, Pseudomonas fluorescens, Serratia marcescens, Staphylococcus aureus and Staphylococcus epidermidis. No plant showed activity against Serratia marcescens; Bordetella bronchiseptica being the most susceptible species. All extracts showed the same activity 18 months later.

  10. Molybdenum reduction to molybdenum blue in Serratia sp. Strain DRY5 is catalyzed by a novel molybdenum-reducing enzyme. (United States)

    Shukor, M Y; Halmi, M I E; Rahman, M F A; Shamaan, N A; Syed, M A


    The first purification of the Mo-reducing enzyme from Serratia sp. strain DRY5 that is responsible for molybdenum reduction to molybdenum blue in the bacterium is reported. The monomeric enzyme has an apparent molecular weight of 105 kDalton. The isoelectric point of this enzyme was 7.55. The enzyme has an optimum pH of 6.0 and maximum activity between 25 and 35°C. The Mo-reducing enzyme was extremely sensitive to temperatures above 50°C (between 54 and 70°C). A plot of initial rates against substrate concentrations at 15 mM 12-MP registered a V max for NADH at 12.0 nmole Mo blue/min/mg protein. The apparent K m for NADH was 0.79 mM. At 5 mM NADH, the apparent V max and apparent K m values for 12-MP of 12.05 nmole/min/mg protein and 3.87 mM, respectively, were obtained. The catalytic efficiency (k cat/K m ) of the Mo-reducing enzyme was 5.47 M(-1) s(-1). The purification of this enzyme could probably help to solve the phenomenon of molybdenum reduction to molybdenum blue first reported in 1896 and would be useful for the understanding of the underlying mechanism in molybdenum bioremediation involving bioreduction.

  11. Conversion and degradation of shellfish wastes by Serratia sp. TKU016 fermentation for the production of enzymes and bioactive materials. (United States)

    Wang, San-Lang; Chang, Tao-Jen; Liang, Tzu-Wen


    A chitosanase and a protease were purified from the culture supernatant of Serratia sp. TKU016 with shrimp shell as the sole carbon/nitrogen source. The molecular masses of the chitosanase and protease determined by SDS-PAGE were approximately 65 and 53 kDa, respectively. The chitosanase was inhibited completely by Mn2+, but the protease was enhanced by all of tested divalent metals. The optimum pH, optimum temperature, pH stability, and thermal stability of the chitosanase and protease were (pH 7, 50 degrees C, pH 6-7, <50 degrees C) and (pH 8-10, 40 degrees C, pH 5-10, <50 degrees C), respectively. SDS (2 mM) had stimulatory effect on TKU016 protease activity. The result demonstrates that TKU016 protease is SDS-resistant protease and probably has a rigid structure. Besides, TKU016 culture supernatant (2% SPP) incubated for 2 days has the highest antioxidant activity, the DPPH scavenging ability was about 76%. With this method, we have shown that shrimp shell wastes can be utilized and it's effective in the production of enzymes, antioxidants, peptide and reducing sugar, facilitating its potential use in biological applications and functional foods.

  12. Conversion of shrimp shell by using Serratia sp. TKU017 fermentation for the production of enzymes and antioxidants. (United States)

    Wang, San-Lang; Li, Jeng-Yu; Liang, Tzu-Wen; Hsieh, Jia-Lin; Tseng, Wan-Nine


    A chitinase (CHT), and a protease (PRO) were purified from the culture supernatant of Serratia sp. TKU017 with shrimp shell as the sole carbon/nitrogen source. The molecular masses of CHT and PRO determined by SDS-PAGE were approximately 65 kDa and 53 kDa, respectively. CHT was inhibited by Mn2+, Cu2+ and PRO was inhibited by most tested divalent metals, EDTA. The optimum pH, optimum temperature, pH stability, and thermal stability of CHT and PRO were (pH 5, 50 degrees , pH 5 degrees ) and (pH 9, 40 degrees , pH 5 degrees ), respectively. PRO retained 95% of its protease activity in the presence of 0.5 mM SDS. The result demonstrates that PRO is SDS-resistant protease and probably has a rigid structure. The 4th day supernatant showed the strongest antioxidant activity (70%, DPPH scavenging ability) and the highest total phenolic content (196+/-6.2 microng of gallic acid equival/mL). Significant associations between the antioxidant potency and the total phenolic content, as well as between the antioxidant potency and free amino groups, were found for the supernatant. With this method, we have shown that shrimp shell wastes can be utilized and it's effective in the production of enzymes and antioxidants, facilitating its potential use in industrial applications and functional foods.

  13. Molybdenum Reduction to Molybdenum Blue in Serratia sp. Strain DRY5 Is Catalyzed by a Novel Molybdenum-Reducing Enzyme

    Directory of Open Access Journals (Sweden)

    M. Y. Shukor


    Full Text Available The first purification of the Mo-reducing enzyme from Serratia sp. strain DRY5 that is responsible for molybdenum reduction to molybdenum blue in the bacterium is reported. The monomeric enzyme has an apparent molecular weight of 105 kDalton. The isoelectric point of this enzyme was 7.55. The enzyme has an optimum pH of 6.0 and maximum activity between 25 and 35°C. The Mo-reducing enzyme was extremely sensitive to temperatures above 50°C (between 54 and 70°C. A plot of initial rates against substrate concentrations at 15 mM 12-MP registered a Vmax for NADH at 12.0 nmole Mo blue/min/mg protein. The apparent Km for NADH was 0.79 mM. At 5 mM NADH, the apparent Vmax and apparent Km values for 12-MP of 12.05 nmole/min/mg protein and 3.87 mM, respectively, were obtained. The catalytic efficiency (kcat/Km of the Mo-reducing enzyme was 5.47 M-1 s-1. The purification of this enzyme could probably help to solve the phenomenon of molybdenum reduction to molybdenum blue first reported in 1896 and would be useful for the understanding of the underlying mechanism in molybdenum bioremediation involving bioreduction.

  14. Serratia sp. ZF03: an efficient radium biosorbent isolated from hot-spring waters in high background radiation areas. (United States)

    Zakeri, Farideh; Noghabi, Kambiz Akbari; Sadeghizadeh, Majid; Kardan, Mohammad Reza; Masoomi, Fatemeh; Farshidpour, Mohammad Reza; Atarilar, Ali


    The aim of this study is to isolate and characterize (226)Ra biosorbing indigenous bacterial strains from soils and hot-springs containing high concentrations of (226)Ra by using biochemical and molecular approaches. Fifteen bacteria were isolated and their phylogenetic affiliations were determined based on their 16S rRNA gene and the two most relevant hypervariable regions of this gene; V3 and V6 analysis. A pigmented Serratia sp. ZF03 strain isolated from the water with (226)Ra content of 50471 mBq l(-1), caused 70% removal of (226)Ra at a radioactivity level of 50 Bq ml(-1), after 5 min and 75-80% in equilibrium time of 1 h, depending on the particular biosorption system and experimental conditions studied. The biosorption equilibrium was described by Langmuir and Freundlich isotherm models. Kinetic studies indicated that the biosorption follows pseudo-second-order kinetics. Effect of different physico-chemical parameters on (226)Ra sorption, FTIR, SEM and TEM analysis were also investigated. 2010 Elsevier Ltd. All rights reserved.

  15. Bioaugmentation for treatment of full-scale diethylene glycol monobutyl ether (DGBE) wastewater by Serratia sp. BDG-2. (United States)

    Chen, Maoxia; Fan, Rong; Zou, Wenhui; Zhou, Houzhen; Tan, Zhouliang; Li, Xudong


    A novel bacterial strain BDG-2 was isolated and used to augment the treatment of silicon plate manufacturing wastewater that primarily contains diethylene glycol monobutyl ether (DGBE). BDG-2 was identified as a Serratia sp. Under the optimal conditions of 30 °C, pH 9 and DGBE concentration of 2000 mg L(-1), the bioaugmented system achieved 96.92% COD removal after 39.9h. Laboratory-scale technological matching results indicated that, in a biofilm process with the addition of 100 mg L(-1) ammonia and 5 mg L(-1) total phosphorus (TP), 70.61% COD removal efficiency could be obtained in 46 h. Addition of polyaluminium chloride (PAC) to the reactors during the suspension process enhanced the settleability of the BDG-2 culture. Subsequently, successful start-up and stable operation of a full-scale bioaugmented treatment facilities were accomplished, and the volumetric organic load in the plug-flow aeration tank was 2.17 ± 0.81 kg m(-3) d(-1). The effluent COD of the facilities was stable and always below 100 mg L(-1). Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Inoculating wheat (Triticum aestivum L.) with the endophytic bacterium Serratia sp. PW7 to reduce pyrene contamination. (United States)

    Zhu, Xuezhu; Wang, Wanqing; Sun, Kai; Lin, Xianghao; Li, Shuang; Waigi, Michael Gatheru; Ling, Wanting


    This research was conducted to find an optimal inoculation way for a pyrene-degrading endophytic Serratia sp. PW7 to colonize wheat for reducing pyrene contamination. Three inoculation ways, which are soaking seeds in inocula (TS), dipping roots of seedlings in inocula (TR), and spraying inocula on leaves of seedlings (TL), were used in this study. Inoculated seedlings and noninoculated seedlings (CK) were, respectively, cultivated in Hoagland solutions supplemented with pyrene in a growth chamber. The results showed that strain PW7 successfully colonized the inoculated seedlings in high numbers, and significantly promoted the growth of seedlings (TS and TR). More importantly, strain PW7 reduced pyrene levels in the seedlings and the Hoagland solutions. Compared to the noninoculated seedlings, the pyrene contents of the inoculated seedlings were decreased by 35.7-86.3% in the shoots and by 26.8-60.1% in the roots after 8-day cultivation. By comparing the efficiencies of decreasing pyrene residues, it can be concluded that TR was an optimal inoculation way for endophytic strains to colonize the inoculated plants and to reduce the pyrene contamination. Our findings provide an optimized inoculation way to reduce organic contamination in crops by inoculating plants with functional endophytic bacteria.

  17. Preliminary Studies on Microbial Degradation of Plastics Used in ...

    African Journals Online (AJOL)

    The most prolific organism, producing red pigment, was isolated and identified as Serratia marcescens marcescens. This organism was characterized as gram negative rod, reactivity with ß-gal, ß-glu, and urease was positive while indole production and H2S was negative. Fermentation test was positive for glucose, sucrose ...

  18. Induction of phospholipase- and flagellar synthesis in Serratia liquefaciens is controlled by expression of the flagellar master operon flhD

    DEFF Research Database (Denmark)

    Givskov, M; Eberl, L; Christiansen, Gunna


    . Expression of flagella is demonstrated to follow a growth-phase-dependent pattern. Cloning, complementation studies and DNA-sequencing analysis has identified a genetic region in Serratia liquefaciens which exhibits extensive homology to the Escherichia coli flhD flagellar master operon. Interruption...... of the chromosomal flhD operon in S. liquefaciens results in non-flagellated and phospholipase-negative cells, but the synthesis of other exoenzymes is not affected. By placing the flhD operon under the control of a foreign inducible promoter we have shown that increased transcription through the flhD operon leads...

  19. Bioaugmentation for treatment of full-scale diethylene glycol monobutyl ether (DGBE) wastewater by Serratia sp. BDG-2

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Maoxia; Fan, Rong; Zou, Wenhui; Zhou, Houzhen [Key Laboratory of Environmental and Applied Microbiology, Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu 610041 (China); Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu 610041 (China); Tan, Zhouliang, E-mail: [Key Laboratory of Environmental and Applied Microbiology, Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu 610041 (China); Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu 610041 (China); Li, Xudong [Key Laboratory of Environmental and Applied Microbiology, Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu 610041 (China); Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu 610041 (China)


    Highlights: • BDG-2 grew well at 30 °C, pH 9 and 2000 mg L{sup −1} of initial DGBE concentration. • It could obtain 96.92% of COD (generated by DGBE) removal efficiency in 39.9 h. • The technological matching was made based on the characteristics of DGBE wastewater and BDG-2. • Stable operation of bio-augmentation treatment facilities was finally accomplished. - Abstract: A novel bacterial strain BDG-2 was isolated and used to augment the treatment of silicon plate manufacturing wastewater that primarily contains diethylene glycol monobutyl ether (DGBE). BDG-2 was identified as a Serratia sp. Under the optimal conditions of 30 °C, pH 9 and DGBE concentration of 2000 mg L{sup −1}, the bioaugmented system achieved 96.92% COD removal after 39.9 h. Laboratory-scale technological matching results indicated that, in a biofilm process with the addition of 100 mg L{sup −1} ammonia and 5 mg L{sup −1} total phosphorus (TP), 70.61% COD removal efficiency could be obtained in 46 h. Addition of polyaluminium chloride (PAC) to the reactors during the suspension process enhanced the settleability of the BDG-2 culture. Subsequently, successful start-up and stable operation of a full-scale bioaugmented treatment facilities were accomplished, and the volumetric organic load in the plug-flow aeration tank was 2.17 ± 0.81 kg m{sup −3} d{sup −1}. The effluent COD of the facilities was stable and always below 100 mg L{sup −1}.

  20. Production, purification and characterization of fibrinolytic enzyme from Serratia sp. KG-2-1 using optimized media. (United States)

    Taneja, Kapila; Bajaj, Bijender Kumar; Kumar, Sandeep; Dilbaghi, Neeraj


    Intravascular thrombosis is one of the major causes of variety of cardiovascular disorders leading to high mortality worldwide. Fibrinolytic enzymes from microbial sources possess ability to dissolve these clots and help to circumvent these problems in more efficient and safer way. In the present study, fibrinolytic protease with higher fibrinolytic activity than plasmin was obtained from Serratia sp. KG-2-1 isolated from garbage dump soil. Response surface methodology was used to study the interactive effect of concentration of maltose, yeast extract + peptone (1:1), incubation time, and pH on enzyme production and biomass. Maximum enzyme production was achieved at 33 °C after 24 h at neutral pH in media containing 1.5% Maltose, 4.0% yeast extract + peptone and other trace elements resulting in 1.82 folds increased production. The enzyme was purified from crude extract using ammonium sulfate precipitation and DEAE-Sephadex chromatography resulting in 12.9 fold purification with 14.9% yield. The purified enzyme belongs to metalloprotease class and had optimal activity in conditions similar to physiological environment with temperature optima of 40 °C and pH optima of 8. The enzyme was found to be stable in various solvents and its activity was enhanced in presence of Na + , K + , Ba 2+ , Cu 2+ , Mn 2+ , Hg 2+ but inhibited by Ca 2+ and Fe 3+ . Hence, the obtained enzyme may be used as potential therapeutic agent in combating various thrombolytic disorders.

  1. Overproduction of individual gas vesicle proteins perturbs flotation, antibiotic production and cell division in the enterobacterium Serratia sp. ATCC 39006. (United States)

    Monson, Rita E; Tashiro, Yosuke; Salmond, George P C


    Gas vesicles are intracellular proteinaceous organelles that facilitate bacterial colonization of static water columns. In the enterobacterium Serratia sp. ATCC 39006, gas vesicle formation requires the proteins GvpA1, GvpF1, GvpG, GvpA2, GvpK, GvpA3, GvpF2 and GvpF3 and the three gas vesicle regulatory proteins GvrA, GvrB and GvrC. Deletion of gvpC alters gas vesicle robustness and deletion of gvpN or gvpV results in small bicone vesicles. In this work, we assessed the impacts on gas vesicle formation when each of these 14 essential proteins was overexpressed. Overproduction of GvpF1, GvpF2, GvrA, GvrB or GvrC all resulted in significantly reduced gas vesicle synthesis. Perturbations in gas vesicle formation were also observed when GvpV and GvpA3 were in excess. In addition to impacts on gas vesicle formation, overproduction of GvrA or GvrB led to elevated biosynthesis of the tripyrrole pigment, prodigiosin, a secondary metabolite of increasing medical interest due to its antimalarial and anticancer properties. Finally, when GvpG was overexpressed, gas vesicles were still produced, but the cells exhibited a growth defect. Further analysis showed that induction of GvpG arrested cell growth and caused a drop in viable count, suggesting a possible physiological role for this protein linking gas vesicle biogenesis and binary fission. These combined results demonstrate that the stoichiometry of individual gas vesicle proteins is crucially important for controlled organelle morphogenesis and flotation and provides evidence for the first link between gas vesicle assembly and cell division, to our knowledge.

  2. Bioaugmentation for treatment of full-scale diethylene glycol monobutyl ether (DGBE) wastewater by Serratia sp. BDG-2

    International Nuclear Information System (INIS)

    Chen, Maoxia; Fan, Rong; Zou, Wenhui; Zhou, Houzhen; Tan, Zhouliang; Li, Xudong


    Highlights: • BDG-2 grew well at 30 °C, pH 9 and 2000 mg L"−"1 of initial DGBE concentration. • It could obtain 96.92% of COD (generated by DGBE) removal efficiency in 39.9 h. • The technological matching was made based on the characteristics of DGBE wastewater and BDG-2. • Stable operation of bio-augmentation treatment facilities was finally accomplished. - Abstract: A novel bacterial strain BDG-2 was isolated and used to augment the treatment of silicon plate manufacturing wastewater that primarily contains diethylene glycol monobutyl ether (DGBE). BDG-2 was identified as a Serratia sp. Under the optimal conditions of 30 °C, pH 9 and DGBE concentration of 2000 mg L"−"1, the bioaugmented system achieved 96.92% COD removal after 39.9 h. Laboratory-scale technological matching results indicated that, in a biofilm process with the addition of 100 mg L"−"1 ammonia and 5 mg L"−"1 total phosphorus (TP), 70.61% COD removal efficiency could be obtained in 46 h. Addition of polyaluminium chloride (PAC) to the reactors during the suspension process enhanced the settleability of the BDG-2 culture. Subsequently, successful start-up and stable operation of a full-scale bioaugmented treatment facilities were accomplished, and the volumetric organic load in the plug-flow aeration tank was 2.17 ± 0.81 kg m"−"3 d"−"1. The effluent COD of the facilities was stable and always below 100 mg L"−"1.

  3. Biodegradation of Azure-B dye by Serratia liquefaciens and its validation by phytotoxicity, genotoxicity and cytotoxicity studies. (United States)

    Haq, Izharul; Raj, Abhay; Markandeya


    The azo dyes in textile industry are a major source of environmental pollution and cause serious threat to aquatic flora and fauna. The present study aims to evaluate the potential of previously isolated lignin peroxidase (LiP) enzyme producing Serratia liquefaciens in degradation of Azure-B (AB) dye. S. liquefaciens showed rapid decolourisation of AB dye (100 mg L -1 ) in mineral salt medium (MSM) supplemented with 0.2% glucose and yeast extract, and more than 90% dye decolourisation was observed at 48 h when incubated at 30 °C. Decolourisation conditions were optimized by Response Surface Methodology (RSM) using Box-Behnken Designs (BBD). The dye degradation was further confirmed by ATR-FTIR and GC-MS analysis. Toxicological studies of untreated (UT) and bacterial treated (BT) AB dye solutions were studied by using phytotoxicity, genotoxicity and cytotoxicity endpoints. Phytotoxicity assay using Vigna radiata indicated that bacterial treatment led to detoxification of AB dye. Genotoxicity assay with Allium cepa showed that pure AB dye solutions significantly reduced mitotic index (MI) and induced various chromosomal abnormalities (CAs) like c-mitosis, stickiness, chromosome break, anaphase bridges, vagrant chromosomes and binucleated and micronucleated cell in the root tip cells, whereas, bacterial treated solutions induced relatively less genotoxicity in nature. Improved cell survivability (%) was also noted in kidney cell line (NRK-52E) after S. liquefaciens treated dye solutions than the pure dye solutions. The findings suggest that S. liquefaciens could be a potential bacterium for azo dye degradation, as it is effective in lowering of toxic effects of AB dye. Copyright © 2018 Elsevier Ltd. All rights reserved.

  4. Inhibitory and Toxic Effects of Volatiles Emitted by Strains of Pseudomonas and Serratia on Growth and Survival of Selected Microorganisms, Caenorhabditis elegans, and Drosophila melanogaster

    Directory of Open Access Journals (Sweden)

    Alexandra A. Popova


    Full Text Available In previous research, volatile organic compounds (VOCs emitted by various bacteria into the chemosphere were suggested to play a significant role in the antagonistic interactions between microorganisms occupying the same ecological niche and between bacteria and target eukaryotes. Moreover, a number of volatiles released by bacteria were reported to suppress quorum-sensing cell-to-cell communication in bacteria, and to stimulate plant growth. Here, volatiles produced by Pseudomonas and Serratia strains isolated mainly from the soil or rhizosphere exhibited bacteriostatic action on phytopathogenic Agrobacterium tumefaciens and fungi and demonstrated a killing effect on cyanobacteria, flies (Drosophila melanogaster, and nematodes (Caenorhabditis elegans. VOCs emitted by the rhizospheric Pseudomonas chlororaphis strain 449 and by Serratia proteamaculans strain 94 isolated from spoiled meat were identified using gas chromatography-mass spectrometry analysis, and the effects of the main headspace compounds—ketones (2-nonanone, 2-heptanone, 2-undecanone and dimethyl disulfide—were inhibitory toward the tested microorganisms, nematodes, and flies. The data confirmed the role of bacterial volatiles as important compounds involved in interactions between organisms under natural ecological conditions.

  5. Isolation, pure culture and characterization of Serratia symbiotica sp. nov., the R-type of secondary endosymbiont of the black bean aphid Aphis fabae. (United States)

    Sabri, Ahmed; Leroy, Pascal; Haubruge, Eric; Hance, Thierry; Frère, Isabelle; Destain, Jacqueline; Thonart, Philippe


    An intracellular symbiotic bacterium was isolated from the flora of a natural clone of the black bean aphid Aphis fabae. The strain was able to grow freely in aerobic conditions on a rich medium containing 1 % of each of the following substrates: glucose, yeast extract and casein peptone. Pure culture was achieved through the use of solid-phase culture on the same medium and the strain was designated CWBI-2.3(T). 16S rRNA gene sequence analysis revealed that strain CWBI-2.3(T) was a member of the class Gammaproteobacteria, having high sequence similarity (>99 %) with 'Candidatus Serratia symbiotica', the R-type of secondary endosymbiont that is found in several aphid species. As strain CWBI-2.3(T) ( = LMG 25624(T) = DSM 23270(T)) was the first R-type symbiont to be isolated and characterized, it was designated as the type strain of Serratia symbiotica sp. nov.

  6. Gene cloning, expression, and characterization of a new carboxylesterase from Serratia sp. SES-01: comparison with Escherichia coli BioHe enzyme. (United States)

    Kwon, Min-A; Kim, Hyun Suk; Oh, Joon Young; Song, Bong Keun; Song, Jae Kwang


    The carboxylesterase-encoding gene (bioHs) of a newly isolated strain, Serratia sp. SES-01, was cloned from the genomic DNA library by detecting formation of transparent halo around the colony on LB-tributyrin agar plates. The amino acid sequence of BioHs was highly similar to the members of the BioH enzyme family involved in the biotin biosynthetic pathway; it showed the highest similarity (91%) with that of Serratia proteamaculans. To compare BioHs with other BioH enzymes, the relatively well-known bioHe gene of E. coli was cloned with PCR. After we achieved high-level expression of soluble BioHs and BioHe through the exploration of different culture conditions, the purified BioHs and BioHe enzymes were characterized in terms of specificity, activity, and stability. BioHe was generally more robust to a change in temperature and pH and an addition of organic solvents than BioHs. The two enzymes exhibited a strong preference for carboxylesterase rather than for thioesterase and were optimal at relatively low temperatures (20-40 degrees ) and alkaline pHs (7.5-9.0). The results in this study strongly suggested that both the BioHs and BioHe enzymes would be potential candidates for use as a carboxylesterase in many industrial applications.

  7. Cloning and expression of gamma carbonic anhydrase from Serratia sp. ISTD04 for sequestration of carbon dioxide and formation of calcite. (United States)

    Srivastava, Shaili; Bharti, Randhir Kumar; Verma, Praveen Kumar; Thakur, Indu Shekhar


    Bacterial strains isolated from marble mines rock and enriched in the chemostat culture with different concentrations of sodium bicarbonate. The enriched consortium had six bacterial isolates. One of bacterium isolate showed carbonic anhydrase (CA) activity by catalyzing the reversible hydration reaction of carbon dioxide to bicarbonate. The bacterium was identified as Serratia sp. by 16S rRNA sequence analysis. The carbonic anhydrase gene from Serratia sp. was found to be homologous with gamma carbonic anhydrase. The carbonic anhydrase gene was cloned in PET21b(+) and expressed it in recombinant Escherichia coli BL21 (DE3) with His-tag at the C-terminus. The recombinant protein was purified efficiently by using one-step nickel affinity chromatography. Expected size of carbonic anhydrase was approximately 29 kDa in SDS-PAGE gel. Recombinant carbonic anhydrase enzyme was used for biomineralization-based conversion of atmospheric CO2 into valuable calcite minerals. The calcification was confirmed by using XRD, FTIR, EDX and SEM analysis. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Characterisation of two quorum sensing systems in the endophytic Serratia plymuthica strain G3: differential control of motility and biofilm formation according to life-style. (United States)

    Liu, Xiaoguang; Jia, Jinli; Popat, Roman; Ortori, Catherine A; Li, Jun; Diggle, Stephen P; Gao, Kexiang; Cámara, Miguel


    N-acylhomoserine lactone (AHL)-based quorum sensing (QS) systems have been described in many plant-associated Gram-negative bacteria to control certain beneficial phenotypic traits, such as production of biocontrol factors and plant growth promotion. However, the role of AHL-mediated signalling in the endophytic strains of plant-associated Serratia is still poorly understood. An endophytic Serratia sp. G3 with biocontrol potential and high levels of AHL signal production was isolated from the stems of wheat and the role of QS in this isolate was determined. Strain G3 classified as Serratia plymuthica based on 16S rRNA was subjected to phylogenetic analysis. Using primers to conserved sequences of luxIR homologues from the Serratia genus, splIR and spsIR from the chromosome of strain G3 were cloned and sequenced. AHL profiles from strain G3 and Escherichia coli DH5α expressing splI or spsI from recombinant plasmids were identified by liquid chromatography-tandem mass spectrometry. This revealed that the most abundant AHL signals produced by SplI in E. coli were N-3-oxo-hexanoylhomoserine lactone (3-oxo-C6-HSL), N-3-oxo-heptanoylhomoserine lactone (3-oxo-C7-HSL), N-3-hydroxy-hexanoylhomoserine lactone (3-hydroxy-C6-HSL), N-hexanoylhomoserine lactone (C6-HSL), and N-heptanoyl homoserine lactone (C7-HSL); whereas SpsI was primarily responsible for the synthesis of N-butyrylhomoserine lactone (C4-HSL) and N-pentanoylhomoserine lactone (C5-HSL). Furthermore, a quorum quenching analysis by heterologous expression of the Bacillus A24 AiiA lactonase in strain G3 enabled the identification of the AHL-regulated biocontrol-related traits. Depletion of AHLs with this lactonase resulted in altered adhesion and biofilm formation using a microtiter plate assay and flow cells coupled with confocal laser scanning microscopy respectively. This was different from the closely related S. plymuthica strains HRO-C48 and RVH1, where biofilm formation for both strains is AHL

  9. Characterisation of two quorum sensing systems in the endophytic Serratia plymuthica strain G3: differential control of motility and biofilm formation according to life-style

    Directory of Open Access Journals (Sweden)

    Li Jun


    Full Text Available Abstract Background N-acylhomoserine lactone (AHL-based quorum sensing (QS systems have been described in many plant-associated Gram-negative bacteria to control certain beneficial phenotypic traits, such as production of biocontrol factors and plant growth promotion. However, the role of AHL-mediated signalling in the endophytic strains of plant-associated Serratia is still poorly understood. An endophytic Serratia sp. G3 with biocontrol potential and high levels of AHL signal production was isolated from the stems of wheat and the role of QS in this isolate was determined. Results Strain G3 classified as Serratia plymuthica based on 16S rRNA was subjected to phylogenetic analysis. Using primers to conserved sequences of luxIR homologues from the Serratia genus, splIR and spsIR from the chromosome of strain G3 were cloned and sequenced. AHL profiles from strain G3 and Escherichia coli DH5α expressing splI or spsI from recombinant plasmids were identified by liquid chromatography-tandem mass spectrometry. This revealed that the most abundant AHL signals produced by SplI in E. coli were N-3-oxo-hexanoylhomoserine lactone (3-oxo-C6-HSL, N-3-oxo-heptanoylhomoserine lactone (3-oxo-C7-HSL, N-3-hydroxy-hexanoylhomoserine lactone (3-hydroxy-C6-HSL, N-hexanoylhomoserine lactone (C6-HSL, and N-heptanoyl homoserine lactone (C7-HSL; whereas SpsI was primarily responsible for the synthesis of N-butyrylhomoserine lactone (C4-HSL and N-pentanoylhomoserine lactone (C5-HSL. Furthermore, a quorum quenching analysis by heterologous expression of the Bacillus A24 AiiA lactonase in strain G3 enabled the identification of the AHL-regulated biocontrol-related traits. Depletion of AHLs with this lactonase resulted in altered adhesion and biofilm formation using a microtiter plate assay and flow cells coupled with confocal laser scanning microscopy respectively. This was different from the closely related S. plymuthica strains HRO-C48 and RVH1, where biofilm formation

  10. Biodegradation of methyl parathion and p-nitrophenol: evidence for the presence of a p-nitrophenol 2-hydroxylase in a Gram-negative Serratia sp. strain DS001. (United States)

    Pakala, Suresh B; Gorla, Purushotham; Pinjari, Aleem Basha; Krovidi, Ravi Kumar; Baru, Rajasekhar; Yanamandra, Mahesh; Merrick, Mike; Siddavattam, Dayananda


    A soil bacterium capable of utilizing methyl parathion as sole carbon and energy source was isolated by selective enrichment on minimal medium containing methyl parathion. The strain was identified as belonging to the genus Serratia based on a phylogram constructed using the complete sequence of the 16S rRNA. Serratia sp. strain DS001 utilized methyl parathion, p-nitrophenol, 4-nitrocatechol, and 1,2,4-benzenetriol as sole carbon and energy sources but could not grow using hydroquinone as a source of carbon. p-Nitrophenol and dimethylthiophosphoric acid were found to be the major degradation products of methyl parathion. Growth on p-nitrophenol led to release of stoichiometric amounts of nitrite and to the formation of 4-nitrocatechol and benzenetriol. When these catabolic intermediates of p-nitrophenol were added to resting cells of Serratia sp. strain DS001 oxygen consumption was detected whereas no oxygen consumption was apparent when hydroquinone was added to the resting cells suggesting that it is not part of the p-nitrophenol degradation pathway. Key enzymes involved in degradation of methyl parathion and in conversion of p-nitrophenol to 4-nitrocatechol, namely parathion hydrolase and p-nitrophenol hydroxylase component "A" were detected in the proteomes of the methyl parathion and p-nitrophenol grown cultures, respectively. These studies report for the first time the existence of a p-nitrophenol hydroxylase component "A", typically found in Gram-positive bacteria, in a Gram-negative strain of the genus Serratia.


    Directory of Open Access Journals (Sweden)

    Luján Roca DA


    Full Text Available INFECTION - LIMA, PERU Introduction: Urinary tract infection (UTI is one of the most common infections in clinical practice. Gram negative bacteria as Klebsiella pneumoniae, Serratia spp. and Acinetobacter spp. can cause UTI. Objective: To study antibiotic resistance in K. pneumoniae, Serratia spp. and Acinetobacter spp. strains isolated from UTI Material and methods: Urine cultures were collected from January 2003 to December 2003. Identification of isolated bacteria included biochemical characteristics. Bauer-Kirby disc diffusion test was performed. Results: A total of 106 strains were evaluated (41 of K. pneumoniae, 28 of Serratia spp. and 37 of Acinetobacter spp.. Among K. pneumoniae isolates resistance to ampicillin (83% was remarkable. The Serratia spp. isolates displayed a high level of resistance to nalidixic acid (79% and gentamicin (75%. In Acinetobacter spp. isolates high resistance rates were observed against amikacin (81%, gentamicin (67% and trimethoprim/sulfamethoxazole(71%. Conclusions: In general, antibiotic resistance patterns were high. Acinetobacter spp. showed elevated resistance rates (>50% against antibiotics included.

  12. Characterization of a cold-active esterase from Serratia sp. and improvement of thermostability by directed evolution. (United States)

    Jiang, Huang; Zhang, Shaowei; Gao, Haofeng; Hu, Nan


    In recent years, cold-active esterases have received increased attention due to their attractive properties for some industrial applications such as high catalytic activity at low temperatures. An esterase-encoding gene (estS, 909 bp) from Serratia sp. was identified, cloned and expressed in Escherichia coli DE3 (BL21). The estS encoded a protein (EstS) of 302 amino acids with a predicted molecular weight of 32.5 kDa. It showed the highest activity at 10 °C and pH 8.5. EstS was cold active and retained ~92 % of its original activity at 0 °C. Thermal inactivation analysis showed that the T1/2 value of EstS was 50 min at 50 °C (residual activity 41.23 %) after 1 h incubation. EstS is also quite stable in high salt conditions and displayed better catalytic activity in the presence of 4 M NaCl. To improve the thermo-stability of EstS, variants of estS gene were created by error-prone PCR. A mutant 1-D5 (A43V, R116W, D147N) that showed higher thermo-stability than its wild type predecessor was selected. 1-D5 showed enhanced T1/2 of 70 min at 50 °C and retained 63.29 % of activity after incubation at 50 °C for 60 min, which were about 22 % higher than the wild type (WT). CD spectrum showed that the secondary structure of WT and 1-D5 are more or less similar, but an increase in β-sheets was recorded, which enhanced the thermostability of mutant protein. EstS was a novel cold-active and salt-tolerant esterase and half-life of mutant 1-D5 was enhanced by 1.4 times compared with WT. The features of EstS are interesting and can be exploited for commercial applications. The results have also provided useful information about the structure and function of Est protein.

  13. Phosphate solubilization and acid phosphatase activity of Serratia sp. isolated from mangrove soil of Mahanadi river delta, Odisha, India

    Directory of Open Access Journals (Sweden)

    B.C. Behera


    Full Text Available Phosphorus is an essential element for all life forms. Phosphate solubilizing bacteria are capable of converting phosphate into a bioavailable form through solubilization and mineralization processes. Hence in the present study a phosphate solubilizing bacterium, PSB-37, was isolated from mangrove soil of the Mahanadi river delta using NBRIP-agar and NBRIP-BPB broth containing tricalcium phosphate as the phosphate source. Based on phenotypic and molecular characterization, the strain was identified as Serratia sp. The maximum phosphate solubilizing activity of the strain was determined to be 44.84 μg/ml, accompanied by a decrease in pH of the growth medium from 7.0 to 3.15. During phosphate solubilization, various organic acids, such as malic acid (237 mg/l, lactic acid (599.5 mg/l and acetic acid (5.0 mg/l were also detected in the broth culture through HPLC analysis. Acid phosphatase activity was determined by performing p-nitrophenyl phosphate assay (pNPP of the bacterial broth culture. Optimum acid phosphatase activity was observed at 48 h of incubation (76.808 U/ml, temperature of 45 °C (77.87 U/ml, an agitation rate of 100 rpm (80.40 U/ml, pH 5.0 (80.66 U/ml and with glucose as a original carbon source (80.6 U/ml and ammonium sulphate as a original nitrogen source (80.92 U/ml. Characterization of the partially purified acid phosphatase showed maximum activity at pH 5.0 (85.6 U/ml, temperature of 45 °C (97.87 U/ml and substrate concentration of 2.5 mg/ml (92.7 U/ml. Hence the present phosphate solubilizing and acid phosphatase production activity of the bacterium may have probable use for future industrial, agricultural and biotechnological application.

  14. Differential effectiveness of Serratia plymuthica IC1270-induced systemic resistance against hemibiotrophic and necrotrophic leaf pathogens in rice

    Directory of Open Access Journals (Sweden)

    Höfte Monica M


    Full Text Available Abstract Background Induced resistance is a state of enhanced defensive capacity developed by a plant reacting to specific biotic or chemical stimuli. Over the years, several forms of induced resistance have been characterized, including systemic acquired resistance, which is induced upon localized infection by an avirulent necrotizing pathogen, and induced systemic resistance (ISR, which is elicited by selected strains of nonpathogenic rhizobacteria. However, contrary to the relative wealth of information on inducible defense responses in dicotyledoneous plants, our understanding of the molecular mechanisms underlying induced resistance phenomena in cereal crops is still in its infancy. Using a combined cytomolecular and pharmacological approach, we analyzed the host defense mechanisms associated with the establishment of ISR in rice by the rhizobacterium Serratia plymuthica IC1270. Results In a standardized soil-based assay, root treatment with IC1270 rendered foliar tissues more resistant to the hemibiotrophic pathogen Magnaporthe oryzae, causal agent of the devastating rice blast disease. Analysis of the cytological and biochemical alterations associated with restriction of fungal growth in IC1270-induced plants revealed that IC1270 primes rice for enhanced attacker-induced accumulation of reactive oxygen species (ROS and autofluorescent phenolic compounds in and near epidermal cells displaying dense cytoplasmic granulation. Similar, yet more abundant, phenotypes of hypersensitively dying cells in the vicinity of fungal hyphae were evident in a gene-for-gene interaction with an avirulent M. oryzae strain, suggesting that IC1270-inducible ISR and R protein conditioned effector-triggered immunity (ETI target similar defense mechanisms. Yet, this IC1270-inducible ISR response seems to act as a double-edged sword within the rice defense network as induced plants displayed an increased vulnerability to the necrotrophic pathogens Rhizoctonia

  15. Improving the Magnetic Damping of an AS-1 Seismometer (United States)

    Marton, F.; Echreshzadeh, M.; Tokman, T. L.; Palaric, K. D.; Filippone, N. V.; Balzarette, M.; Sivo, J.


    Last year, students working on the SeismoSTEM project at Bergen Community College in New Jersey successfully manufactured and assembled an AS-1 seismometer1. For 2016, our objective has been to improve the magnetic damping mechanism invented by Chris Chapman2. As the mass on the boom is displaced by seismic waves, the spring will cause the mass to oscillate, therefore, damping is required. To achieve this, a paddle-shaped piece of copper, along with steel plates holding strong neodymium magnets are used. A localized eddy current is then induced, which then creates an opposing magnetic field. The challenges we faced for the summer internship was the fact that there was either too much or too little damping to distinguish the waves of an earthquake. However, we resolved the issue by designing our own prototype for moving the steel plates away and toward the copper paddle, to achieve critical damping. This was successfully completed by attaching two L-shaped pieces of aluminum, along with a cylindrical piece, to form a yoke. We then drilled a hole through the cylindrical piece and a plastic block for a bolt to slide through. Finally, the head of the bolt would then be used as a knob to shift the two plates away from and toward the paddle simultaneously. Although this was our solution for moving the plates horizontally, we also needed to find a way to lock the plates in place once we found the correct amount of damping. We accomplished this task by drilling two slotted holes on two symmetrical sheets of aluminum, which will allow us to slide the plates, and finally, lock them into place to avoid wobbling. References: 1Tokman, T.L. et al., What's shaking? Manufacturing & assembling an AS-1 educational seismometer for undergraduate stem research, Geological Society of America Abstracts with Programs. Vol. 47, No. 7, p.524, 2015. 2

  16. Yeast Kluyveromyces lactis as host for expression of the bacterial lipase: cloning and adaptation of the new lipase gene from Serratia sp. (United States)

    Šiekštelė, Rimantas; Veteikytė, Aušra; Tvaska, Bronius; Matijošytė, Inga


    Many microbial lipases have been successfully expressed in yeasts, but not in industrially attractive Kluyveromyces lactis, which among other benefits can be cultivated on a medium supplemented with whey--cheap and easily available industrial waste. A new bacterial lipase from Serratia sp. was isolated and for the first time expressed into the yeast Kluyveromyces lactis by heterologous protein expression system based on a strong promoter of Kluyveromyces marxianus triosephosphate isomerase gene and signal peptide of Kluyveromyces marxianus endopolygalacturonase gene. In addition, the bacterial lipase gene was synthesized de novo by taking into account a codon usage bias optimal for K. lactis and was expressed into the yeast K. lactis also. Both resulting strains were characterized by high output level of the target protein secreted extracellularly. Secreted lipases were characterized for activity and stability.

  17. Production of extracellular polymeric substances (EPS) by Serratia sp.1 using wastewater sludge as raw material and flocculation activity of the EPS produced. (United States)

    Bezawada, J; Hoang, N V; More, T T; Yan, S; Tyagi, N; Tyagi, R D; Surampalli, R Y


    Growth profile and extracellular polymeric substances (EPS) production of Serratia sp.1 was studied in shake flask fermentation for 72 h using wastewater sludge as raw material. Maximum cell concentration of 6.7 × 10(9) cfu/mL was obtained at 48 h fermentation time. EPS dry weight, flocculation activity and dewaterability of different EPS (tightly bound or TB-EPS, loosely bound or LB-EPS and broth-EPS or B-EPS) were also measured. The highest concentration of LB-EPS (2.45 g/L) and TB-EPS (0.99 g/L) were attained at 48 h of fermentation. Maximum flocculation activity and dewaterability (ΔCST) of TB-EPS (76.4%, 14.5s and 76.5%, 15.5s), LB-EPS (67.8%, 8.1s and 64.7%, 7.6s) and broth EPS (61%, 6.1s and 70.4%, 6.8s) were obtained at 36 and 48 h of growth. Higher flocculation activity and dewaterability were achieved with TB-EPS than with the two other EPS. Characterization of TB-EPS and LB-EPS was done in terms of their protein and carbohydrate content. Protein content was much higher in TB-EPS where as carbohydrate content was only slightly higher in TB-EPS than LB-EPS. Morphology of the Serratia strain after fermentation in sludge and TSB was observed under a scanning electron microscope and the cell size was found to be bigger in the sludge medium than the TSB medium. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. Low nitrogen stress stimulating the indole-3-acetic acid biosynthesis of Serratia sp. ZM is vital for the survival of the bacterium and its plant growth-promoting characteristic. (United States)

    Ouyang, Liming; Pei, Haiyan; Xu, Zhaohui


    Serratia sp. ZM is a plant growth-promoting (PGP) bacterial strain isolated from the rhizospheric soil of Populus euphratica in northwestern China. In this study, low nitrogen supply significantly stimulated the production of indole-3-acetic acid (IAA) in Serratia sp.ZM. The inoculation of the bacterium to wheat seedlings improved plant growth compared with the uninoculated group, and the stimulating effect was more prominent under low nitrogen stress. Inactivation of the predicted key gene in the IAA biosynthesis pathway impaired IAA production and significantly hampered mutant growth in poor medium. Furthermore, the IAA-deficient mutant lost the PGP effect under either normal or low nitrogen conditions in plant experiments. This study revealed the significant impact of environmental nitrogen levels on IAA production in the PGP strain and the vital effect of IAA on resistance physiology of both the bacterium and host plant. The characteristics of Serratia sp. ZM also indicated its application potential as a biofertilizer for plants, especially those suffering from poor nitrogen soil.

  19. Effects of P limitation and molecules from peanut root exudates on pqqE gene expression and pqq promoter activity in the phosphate-solubilizing strain Serratia sp. S119. (United States)

    Ludueña, Liliana M; Anzuay, Maria S; Magallanes-Noguera, Cynthia; Tonelli, Maria L; Ibañez, Fernando J; Angelini, Jorge G; Fabra, Adriana; McIntosh, Matthew; Taurian, Tania


    The mineral phosphate-solubilizing phenotype in bacteria is attributed predominantly to secretion of gluconic acid produced by oxidation of glucose by the glucose dehydrogenase enzyme and its cofactor, pyrroloquinoline quinone. This study analyzes pqqE gene expression and pqq promoter activity in the native phosphate-solubilizing bacterium Serratia sp S119 growing under P-limitation, and in the presence of root exudates obtained from peanut plants, also growing under P-limitation. Results indicated that Serratia sp. S119 contains a pqq operon composed of six genes (pqqA,B,C,D,E,F) and two promoters, one upstream of pqqA and other between pqqA and pqqB. PqqE gene expression and pqq promoter activity increased under P-limiting growth conditions and not under N-deficient conditions. In the plant-bacteria interaction assay, the activity of the bacterial pqq promoter region varied depending on the concentration and type of root exudates and on the bacterial growth phase. Root exudates from peanut plants growing under P-available and P-limiting conditions showed differences in their composition. It is concluded from this study that the response of Serratia sp. S119 to phosphorus limitation involves an increase in expression of pqq genes, and that molecules exuded by peanut roots modify expression of these phosphate-solubilizing bacterial genes during plant-bacteria interactions. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  20. Chromium resistance characteristics of Cr(VI) resistance genes ChrA and ChrB in Serratia sp. S2. (United States)

    He, Yuan; Dong, Lanlan; Zhou, Simin; Jia, Yan; Gu, Ruijia; Bai, Qunhua; Gao, Jieying; Li, Yingli; Xiao, Hong


    To find an efficient chromium (VI) resistance system, with a highly efficient, economical, safe, and environmentally friendly chromium-removing strain, ChrA, ChrB, and ChrAB fragments of the chromium (VI) resistance gene in Serratia sp. S2 were cloned, and their prokaryotic expression vectors were constructed and transformed into E. coli BL21. The anti-chromium (VI) capacity and characteristics of engineered bacteria, role of ChrA and ChrB genes in the anti-chromium (VI) processes, and the mechanism of chromium metabolism, were explored. The PCR technique was used to amplify ChrA, ChrB, and ChrAB genes from the Serratia sp. S2 genome. ChrA, ChrB, and ChrAB genes were connected to the prokaryotic expression vector pET-28a and transferred into E. coli BL21 for prokaryotic expression. Cr-absorption and Cr-efflux ability of the engineered strains were determined. The effects of respiratory inhibitors and oxygenated anions on Cr-efflux of ChrA and ChrB engineered strains were explored. ChrA, ChrB, and ChrAB engineered strains were constructed successfully; there was no significant difference between the control strain and the ChrB engineered strain for Cr-metabolism (P > 0.05). Cr-absorption and Cr-efflux of ChrA and ChrAB engineered strains were significantly stronger than the control strain (P < 0.05). Oxyanions (sulfate and molybdate) and inhibitors (valinomycin and CN - ) could significantly inhibit the Cr-efflux capacities of ChrA and ChrAB engineered strains (P < 0.05), while NADPH could significantly promote such capacities (P < 0.05). The Cr-transporter, encoded by ChrA gene, confer the ability to pump out intracellular Cr on ChrA and ChrAB engineered strains. The ChrB gene plays a positive regulatory role in ChrA gene regulation. The Cr-metabolism ability of the ChrAB engineered strain is stronger than the ChrA engineered strain. ChrA and ChrAB genes in the Cr-resistance system may involve a variety of mechanisms, such as sulfate ion channel and

  1. Production and characterization of rhamnolipids produced by Serratia rubidaea SNAU02 under solid-state fermentation and its application as biocontrol agent. (United States)

    Nalini, S; Parthasarathi, R


    The present study aimed at exploring mahua (Madhuca indica) oil cake as a novel substrate for the production of biosurfactant by Serratia rubidaea SNAU02 under solid-state fermentation (SSF). Response surface methodology showed followings as the optimal conditions for the production of biosurfactant: mahua oil cake 7.48 g, 2.5 ml inoculum size (1×10(8) cells/ml), and pH 7.22 and 31 °C temperature. The characterization of the biosurfactant by TLC, FT-IR and GC-MS revealed the presence of rhamnolipid. The presence of rhamnosyl transferase gene responsible for biosynthesis of rhamnolipid was identified. The strain SNAU02 exhibited antifungal activity and demonstrated no toxicity against the seeds of Brassica oleracea and Artemia salina employed as a bio-indicator. The present findings indicated the potential of mahua oil cake as suitable substrate for the production of rhamnolipids in SSF by S. rubidaea SNAU02 and application potential of the biosurfactant produced as biocontrol agent against plant pathogens. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. Radiotolerance of phosphatases of a Serratia sp.: potential for the use of this organism in the biomineralization of wastes containing radionuclides. (United States)

    Paterson-Beedle, M; Jeong, B C; Lee, C H; Jee, K Y; Kim, W H; Renshaw, J C; Macaskie, L E


    Aqueous wastes from nuclear fuel reprocessing present special problems of radiotoxicity of the active species. Cells of Serratia sp. were found previously to accumulate high levels of hydrogen uranyl phosphate (HUP) via the activity of a phosphatase enzyme. Uranium is of relatively low radiotoxicity whereas radionuclide fission products such as (90)Sr and (137)Cs are highly radiotoxic. These radionuclides can be co-crystallized, held within the bio-HUP "host" lattice on the bacterial cells and thereby removed from contaminated solution, depending on continued phosphatase activity. Radiostability tests using a commercial (60)Co γ-source showed that while cell viability and activity of purified phosphatase were lost within a few hours on irradiation, whole-cell phosphatase retained 80% of the initial activity, even after loss of cell culturability, which was increased to 100% by the incorporation of mercaptoethanol as an example radioprotectant, beyond an accumulated dose of >1.3 MGy. Using this co-crystallization approach (without mercaptoethanol) (137)Cs(+) and (85)Sr(2+) were removed from a simulated waste selectively against a 33-fold excess of Na(+). Copyright © 2012 Wiley Periodicals, Inc.

  3. A novel nonionic surfactant- and solvent-stable alkaline serine protease from Serratia sp. SYBC H with duckweed as nitrogen source: production, purification, characteristics and application. (United States)

    Li, G Y; Cai, Y J; Liao, X R; Yin, J


    A novel nonionic surfactant- and hydrophilic solvent-stable alkaline serine protease was purified from the culture supernatant of Serratia sp. SYBC H with duckweed as nitrogen source. The molecular mass of the purified protease is about 59 kDa as assayed via SDS-PAGE. The protease is highly active over the pH range between 5.0 and 11.0, with the maximum activity at pH 8.0. It is also fairly active over the temperature range between 30 and 80°C, with the maximum activity at 40°C. The protease activity was substantially stimulated by Mn(2+) and Na(+) (5 mM), up to 837.9 and 134.5% at 40°C, respectively. In addition, Mn(2+) enhanced the thermostability of the protease significantly at 60°C. Over 90% of its initial activity remained even after incubating for 60 min at 40°C in 50% (v/v) hydrophilic organic solvents such as DMF, DMSO, acetone and MeOH. The protease retained 81.7, 83.6 and 76.2% of its initial activity in the presence of nonionic surfactants 20% (v/v) Tween 80, 25% (v/v) glycerol and Triton X-100, respectively. The protease is strongly inhibited by PMSF, suggesting that it is a serine protease. Washing experiments revealed that the protease has an excellent ability to remove blood stains.

  4. Comparative effectiveness of Pseudomonas and Serratia sp. containing ACC-deaminase for improving growth and yield of wheat (Triticum aestivum L.) under salt-stressed conditions. (United States)

    Zahir, Zahir Ahmad; Ghani, Usman; Naveed, Muhammad; Nadeem, Sajid Mahmood; Asghar, Hafiz Naeem


    Ethylene synthesis is accelerated in response to various environmental stresses like salinity. Ten rhizobacterial strains isolated from wheat rhizosphere taken from different salt affected areas were screened for growth promotion of wheat under axenic conditions at 1, 5, 10 and 15 dS m(-1). Three strains, i.e., Pseudomonas putida (N21), Pseudomonas aeruginosa (N39) and Serratia proteamaculans (M35) showing promising performance under axenic conditions were selected for a pot trial at 1.63 (original), 5, 10 and 15 dS m(-1). Results showed that inoculation was effective even in the presence of higher salinity levels. P. putida was the most efficient strain compared to the other strains and significantly increased the plant height, root length, grain yield, 100-grain weight and straw yield up to 52, 60, 76, 19 and 67%, respectively, over uninoculated control at 15 dS m(-1). Similarly, chlorophyll content and K(+)/Na(+) of leaves also increased by P. putida over control. It is highly likely that under salinity stress, 1-aminocyclopropane-1-carboxylic acid-deaminase activity of these microbial strains might have caused reduction in the synthesis of stress (salt)-induced inhibitory levels of ethylene. The results suggested that these strains could be employed for salinity tolerance in wheat; however, P. putida may have better prospects in stress alleviation/reduction.

  5. The stationary phase sigma factor, RpoS, regulates the production of a carbapenem antibiotic, a bioactive prodigiosin and virulence in the enterobacterial pathogen Serratia sp. ATCC 39006. (United States)

    Wilf, Nabil M; Salmond, George P C


    Serratia sp. ATCC 39006 (S39006) is a Gram-negative bacterium that is virulent in plant (potato) and invertebrate animal (Caenorhabditis elegans) models. It produces two secondary metabolite antibiotics, a prodigiosin and a carbapenem, and the exoenzymes pectate lyase and cellulase. We showed previously that deletion of the RNA chaperone Hfq abolished antibiotic production and attenuated virulence in both animal and plant hosts. Hfq and dependent small RNAs (sRNAs) are known to regulate the post-transcriptional expression of rpoS, which encodes σ(S), the stationary phase sigma factor subunit of RNA polymerase. An S39006 hfq deletion mutant showed decreased transcript levels of rpoS. Therefore, in this study we investigated whether the phenotypes regulated by Hfq were mediated through its control of rpoS. Whereas loss of Hfq abolished prodigiosin and carbapenem production and attenuated virulence in both C. elegans and potato, characterization of an S39006 rpoS mutant showed unexpectedly elevated prodigiosin and carbapenem production. Furthermore, the rpoS mutant exhibited attenuated animal pathogenesis, but not plant pathogenesis. Additionally, a homologue of the Hfq-dependent sRNA, RprA, was identified and shown to regulate prodigiosin production in a manner consistent with its role in positively regulating translation of rpoS mRNA. Combined, these results demonstrate that Hfq regulation of secondary metabolism and plant pathogenesis is independent of RpoS and establishes RpoS and RprA as regulators of antibiotic production.

  6. Isolation of high-salinity-tolerant bacterial strains, Enterobacter sp., Serratia sp., Yersinia sp., for nitrification and aerobic denitrification under cyanogenic conditions. (United States)

    Mpongwana, N; Ntwampe, S K O; Mekuto, L; Akinpelu, E A; Dyantyi, S; Mpentshu, Y


    Cyanides (CN(-)) and soluble salts could potentially inhibit biological processes in wastewater treatment plants (WWTPs), such as nitrification and denitrification. Cyanide in wastewater can alter metabolic functions of microbial populations in WWTPs, thus significantly inhibiting nitrifier and denitrifier metabolic processes, rendering the water treatment processes ineffective. In this study, bacterial isolates that are tolerant to high salinity conditions, which are capable of nitrification and aerobic denitrification under cyanogenic conditions, were isolated from a poultry slaughterhouse effluent. Three of the bacterial isolates were found to be able to oxidise NH(4)-N in the presence of 65.91 mg/L of free cyanide (CN(-)) under saline conditions, i.e. 4.5% (w/v) NaCl. The isolates I, H and G, were identified as Enterobacter sp., Yersinia sp. and Serratia sp., respectively. Results showed that 81% (I), 71% (G) and 75% (H) of 400 mg/L NH(4)-N was biodegraded (nitrification) within 72 h, with the rates of biodegradation being suitably described by first order reactions, with rate constants being: 4.19 h(-1) (I), 4.21 h(-1) (H) and 3.79 h(-1) (G), respectively, with correlation coefficients ranging between 0.82 and 0.89. Chemical oxygen demand (COD) removal rates were 38% (I), 42% (H) and 48% (G), over a period of 168 h with COD reduction being highest at near neutral pH.

  7. The RNA chaperone, Hfq, controls two luxR-type regulators and plays a key role in pathogenesis and production of antibiotics in Serratia sp. ATCC 39006. (United States)

    Wilf, Nabil M; Williamson, Neil R; Ramsay, Joshua P; Poulter, Simon; Bandyra, Kasia J; Salmond, George P C


    Serratia sp. ATCC 39006 (S39006) is a Gram-negative bacterium that is virulent in plant (potato) and animal (Caenorhabditis elegans) models. It produces two secondary metabolite antibiotics, a prodigiosin and a carbapenem, and the exoenzymes, pectate lyase and cellulase. A complex regulatory network that includes quorum sensing (QS) controls production of prodigiosin. While many aspects of the regulation of the metabolites and exoenzymes are well understood, the potential role in this network of the RNA chaperone Hfq and dependent small regulatory RNAs has not been characterized. Hfq is an RNA chaperone involved in post-transcriptional regulation that plays a key role in stress response and virulence in diverse bacterial species. To explore whether Hfq-dependent processes might contribute to the regulation of antibiotic production we constructed an S39006 Δhfq mutant. Production of prodigiosin and carbapenem was abolished in this mutant strain, while production of the QS signalling molecule, butanoyl homoserine lactone (BHL), was unaffected. Using transcriptional fusions, we found that Hfq regulates the QS response regulators, SmaR and CarR. Additionally, exoenzyme production and swimming motility were decreased in a Δhfq mutant, and virulence was attenuated in potato and C. elegans models. These results suggest that an Hfq-dependent pathway is involved in the regulation of virulence and secondary metabolite production in S39006. © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.

  8. Mechanism of chromatin degradation in thymocytes of irradiated rats

    International Nuclear Information System (INIS)

    Nikonova, L.V.; Nelipovich, P.A.; Umanskij, S.R.


    Chromatin digestion in isolated thymocyte nuclei with DNAase I, micrococcal nuclease and nuclease from Serratia marcescens was studied. It was shown that 3 h after irradiation (10 Gy), the kinetics of accumulation of acid soluble and salt soluble products of DNA degradation, caused by exogenous nucleases, remains unchanged. The administration of cycloheximide does not influence the sensitivity of chromatin to DNAase I and somewhat increases the rate of salt soluble products formation upon the nuclease from S, marcescens treatment

  9. Curvularia haloperoxidase: Antimicrobial activity and potential application as a surface disinfectant

    DEFF Research Database (Denmark)

    Hansen, E.H.; Albertsen, Line; Johansen, Charlotte


    , to antimicrobial compounds. The Curvularia haloperoxidase system caused several-log-unit reductions in counts of bacteria (Pseudomonas spp., Escherichia coli, Serratia marcescens, Aeromonas salmonicida, Shewanella putrefaciens, Staphylococcus epidermidis, and Listeria monocytogenes), yeasts (Candida sp....... and Rhodotorula sp.), and filamentous fungi (Aspergillus niger, Aspergillus tubigensis, Aspergillus versicolor, Fusarium oxysporum, Penicillium chrysogenum, and Penicillium paxilli) cultured in suspension. Also, bacteria adhering to the surfaces of contact lenses were killed. The numbers of S. marcescens and S...

  10. Treatment Outcomes in Infections Caused by "SPICE" (Serratia, Pseudomonas, Indole-positive Proteus, Citrobacter, and Enterobacter) Organisms: Carbapenem versus Noncarbapenem Regimens. (United States)

    Moy, Stanley; Sharma, Roopali


    Techniques used to identify AmpC β-lactamases in SPICE (Serratia, Pseudomonas, indole-positive Proteus, Citrobacter, and Enterobacter) organisms are not yet optimized for the clinical laboratory and are not routinely used. Clinicians are often left with an uncertainty on the choice of antibiotic when a SPICE organism is isolated. The purpose of this study was to evaluate the outcomes of carbapenem versus noncarbapenem regimens in treating bacteremia or urinary tract infection from a SPICE organism in clinical practice. This single-center, retrospective, cohort study analyzed data from adult patients who had clinical infection with a SPICE organism isolated from blood or urine cultures. Patients were assigned to a carbapenem- or noncarbapenem-treated group. The primary end point was clinical response, defined as a resolution of signs and symptoms of infection at the end of therapy. A total of 332 patients were assessed, and 145 patients met the inclusion criteria for the study. There were 20 patients who received a carbapenem, while 125 received a noncarbapenem regimen. The percentage of patients who were bacteremic was 46.2%. Clinical response overall was achieved in 80% of patients on a carbapenem versus 90.3% of patients on a noncarbapenem regimen (P = 0.24). The rate of microbiologic cure was 90% in patients on a carbapenem versus 91.2% in patients on a noncarbapenem regimen (P = 1). In this study in patients treated for infection with a SPICE organism in clinical practice, the rates of clinical response did not differ significantly between the carbapenem and noncarbapenem groups. Current CLSI breakpoints set for SPICE organisms may still be reliable and may not require additional testing for AmpC β-lactamases. Copyright © 2017 Elsevier HS Journals, Inc. All rights reserved.

  11. A novel low-temperature-active β-glucosidase from symbiotic Serratia sp. TN49 reveals four essential positions for substrate accommodation. (United States)

    Zhou, Junpei; Zhang, Rui; Shi, Pengjun; Huang, Huoqing; Meng, Kun; Yuan, Tiezheng; Yang, Peilong; Yao, Bin


    A 2,373-bp full-length gene (bglA49) encoding a 790-residue polypeptide (BglA49) with a calculated mass of 87.8 kDa was cloned from Serratia sp. TN49, a symbiotic bacterium isolated from the gut of longhorned beetle (Batocera horsfieldi) larvae. The deduced amino acid sequence of BglA49 showed the highest identities of 80.1% with a conceptually translated protein from Pantoea sp. At-9b (EEW02556), 38.3% with the identified glycoside hydrolase (GH) family 3 β-glucosidase from Clostridium stercorarium NCBI 11754 (CAB08072), and sp. G5 (ABL09836) and Paenibacillus sp. C7 (AAX35883). The recombinant enzyme (r-BglA49) was expressed in Escherichia coli and displayed the typical characteristics of low-temperature-active enzymes, such as low temperature optimum (showing apparent optimal activity at 35°C), activity at low temperatures (retaining approximately 60% of its maximum activity at 20°C and approximately 25% at 10°C). Compared with the thermophilic GH 3 β-glucosidase, r-BglA49 had fewer hydrogen bonds and salt bridges and less proline residues. These features might relate to the increased structure flexibility and higher catalytic activity at low temperatures of r-BglA49. The molecular docking study of four GH 3 β-glucosidases revealed five conserved positions contributing to substrate accommodation, among which four positions of r-BglA49 (R192, Y228, D260, and E449) were identified to be essential based on site-directed mutagenesis analysis.

  12. [Involvement of the global regulators GrrS, RpoS, and SplIR in formation of biofilms in Serratia plymuthica]. (United States)

    Zaĭtseva, Iu V; Voloshina, P V; Liu, X; Ovadis, M I; Berg, G; Chernin, L S; Khmel', I A


    Most bacteria exist in the natural environment as biofilms, multicellular communities attached to hard surfaces. Biofilms have a characteristic architecture and are enclosed in the exopolymer matrix. Bacterial cells in biofilms are extremely resistant to antibacterial factors. It was shown in this work that the GrrA/GrrS system of global regulators of gene expression and the sigma S subunit of RNA polymerase (RpoS) play a significant role in positive regulation of biofilm formation in the rhizospheric bacterium Serratia plymuthica IC1270. Inactivation of grrS and rpoS genes resulted in an up to six-to-sevenfold and four-to-fivefold reduction in biofilm formation, respectively. Mutations in the grrS gene decreased the capacity of the bacterium for swarming motility. The splIR Quorum Sensing (QS) system was shown to negatively influence the biofilm formation. Transfer of the recombinant plasmid containing cloned genes splI/splR of S. plymuthica HRO-C48 into S. plymuthica IC1270 cells led to a twofold decrease of their ability to form biofilms. Inactivation of the splI gene coding for the synthase of N-acyl-homoserine lactones in S. plymuthica HRO-C48 resulted in a 2-2.5-fold increase in the level of biofilm formation, whereas the inclusion of plasmid carrying the cloned splI/splR genes into these mutant cells restored the biofilm formation to the normal level. The results obtained demonstrate that the formation of biofilms in S. plymuthica is positively regulated by the GrrA/GrrS and RpoS global regulators and is negatively regulated by the SplIR QS system.

  13. Kinetics of biofilm formation and desiccation survival of Listeria monocytogenes in single and dual species biofilms with Pseudomonas fluorescens, Serratia proteamaculans or Shewanella baltica on food-grade stainless steel surfaces. (United States)

    Daneshvar Alavi, Hessam Edin; Truelstrup Hansen, Lisbeth


    This study investigated the dynamics of static biofilm formation (100% RH, 15 °C, 48-72 h) and desiccation survival (43% RH, 15 °C, 21 days) of Listeria monocytogenes, in dual species biofilms with the common spoilage bacteria, Pseudomonas fluorescens, Serratia proteamaculans and Shewanella baltica, on the surface of food grade stainless steel. The Gram-negative bacteria reduced the maximum biofilm population of L. monocytogenes in dual species biofilms and increased its inactivation during desiccation. However, due to the higher desiccation resistance of Listeria relative to P. fluorescens and S. baltica, the pathogen survived in greater final numbers. In contrast, S. proteamaculans outcompeted the pathogen during the biofilm formation and exhibited similar desiccation survival, causing the N21 days of Serratia to be ca 3 Log10(CFU cm(-2)) greater than that of Listeria in the dual species biofilm. Microscopy revealed biofilm morphologies with variable amounts of exopolymeric substance and the presence of separate microcolonies. Under these simulated food plant conditions, the fate of L. monocytogenes during formation of mixed biofilms and desiccation depended on the implicit characteristics of the co-cultured bacterium.

  14. Switch of SpnR function from activating to inhibiting quorum sensing by its exogenous addition

    Energy Technology Data Exchange (ETDEWEB)

    Takayama, Yuriko [Department of Innovation Systems Engineering, Graduate School of Engineering, Utsunomiya University, 7-1-2 Yoto, Utsunomiya, Tochigi 321-8585 (Japan); CREST, Japan Science and Technology Agency, 7-1-2 Yoto, Utsunomiya, Tochigi 321-8585 (Japan); Kato, Norihiro, E-mail: [CREST, Japan Science and Technology Agency, 7-1-2 Yoto, Utsunomiya, Tochigi 321-8585 (Japan); Department of Material and Environmental Chemistry, Graduate School of Engineering, Utsunomiya University, 7-1-2 Yoto, Utsunomiya, Tochigi 321-8585 (Japan)


    The opportunistic human pathogen Serratia marcescens AS-1 produces the N-hexanoylhomoserine lactone (C6HSL) receptor SpnR, a homologue of LuxR from Vibrio fischeri, which activates pig clusters to produce the antibacterial prodigiosin. In this study, we attempted to artificially regulate quorum sensing (QS) by changing the role of SpnR in N-acylhomoserine lactone (AHL)-mediated QS. SpnR was obtained as a fusion protein tagged with maltose-binding protein (MBP) from overexpression in Escherichia coli, and its specific affinity to C6HSL was demonstrated by quartz crystal microbalance analysis and AHL-bioassay with Chromobacterium violaceum CV026. Prodigiosin production was effectively inhibited by externally added MBP-SpnR in both wild-type AS-1 and the AHL synthase-defective mutant AS-1(ΔspnI). For the mutant, the induced amount of prodigiosin was drastically reduced to approximately 4% with the addition of 18 μM MBP-SpnR to the liquid medium, indicating 81% trapping of C6HSL. A system for inhibiting QS can be constructed by adding exogenous AHL receptor to the culture broth to keep the concentration of free AHL low, whereas intracellular SpnR naturally functions as the activator in response to QS. - Highlights: • Quorum sensing (QS) regulates the expression of some bacterial genes. • We added an AHL receptor to culture media to inhibit QS in Serratia marcescens AS-1. • The exogenous receptor effectively bound C6HSL and inhibited QS. • This approach can be used to artificially regulate AHL-mediated QS.

  15. Switch of SpnR function from activating to inhibiting quorum sensing by its exogenous addition

    International Nuclear Information System (INIS)

    Takayama, Yuriko; Kato, Norihiro


    The opportunistic human pathogen Serratia marcescens AS-1 produces the N-hexanoylhomoserine lactone (C6HSL) receptor SpnR, a homologue of LuxR from Vibrio fischeri, which activates pig clusters to produce the antibacterial prodigiosin. In this study, we attempted to artificially regulate quorum sensing (QS) by changing the role of SpnR in N-acylhomoserine lactone (AHL)-mediated QS. SpnR was obtained as a fusion protein tagged with maltose-binding protein (MBP) from overexpression in Escherichia coli, and its specific affinity to C6HSL was demonstrated by quartz crystal microbalance analysis and AHL-bioassay with Chromobacterium violaceum CV026. Prodigiosin production was effectively inhibited by externally added MBP-SpnR in both wild-type AS-1 and the AHL synthase-defective mutant AS-1(ΔspnI). For the mutant, the induced amount of prodigiosin was drastically reduced to approximately 4% with the addition of 18 μM MBP-SpnR to the liquid medium, indicating 81% trapping of C6HSL. A system for inhibiting QS can be constructed by adding exogenous AHL receptor to the culture broth to keep the concentration of free AHL low, whereas intracellular SpnR naturally functions as the activator in response to QS. - Highlights: • Quorum sensing (QS) regulates the expression of some bacterial genes. • We added an AHL receptor to culture media to inhibit QS in Serratia marcescens AS-1. • The exogenous receptor effectively bound C6HSL and inhibited QS. • This approach can be used to artificially regulate AHL-mediated QS.

  16. RNA-seq reveals the RNA binding proteins, Hfq and RsmA, play various roles in virulence, antibiotic production and genomic flux in Serratia sp. ATCC 39006. (United States)

    Wilf, Nabil M; Reid, Adam J; Ramsay, Joshua P; Williamson, Neil R; Croucher, Nicholas J; Gatto, Laurent; Hester, Svenja S; Goulding, David; Barquist, Lars; Lilley, Kathryn S; Kingsley, Robert A; Dougan, Gordon; Salmond, George Pc


    Serratia sp. ATCC 39006 (S39006) is a Gram-negative enterobacterium that is virulent in plant and animal models. It produces a red-pigmented trypyrrole secondary metabolite, prodigiosin (Pig), and a carbapenem antibiotic (Car), as well as the exoenzymes, pectate lyase and cellulase. Secondary metabolite production in this strain is controlled by a complex regulatory network involving quorum sensing (QS). Hfq and RsmA (two RNA binding proteins and major post-transcriptional regulators of gene expression) play opposing roles in the regulation of several key phenotypes within S39006. Prodigiosin and carbapenem production was abolished, and virulence attenuated, in an S39006 ∆hfq mutant, while the converse was observed in an S39006 rsmA transposon insertion mutant. In order to define the complete regulon of Hfq and RsmA, deep sequencing of cDNA libraries (RNA-seq) was used to analyse the whole transcriptome of S39006 ∆hfq and rsmA::Tn mutants. Moreover, we investigated global changes in the proteome using an LC-MS/MS approach. Analysis of differential gene expression showed that Hfq and RsmA directly or indirectly regulate (at the level of RNA) 4% and 19% of the genome, respectively, with some correlation between RNA and protein expression. Pathways affected include those involved in antibiotic regulation, virulence, flagella synthesis, and surfactant production. Although Hfq and RsmA are reported to activate flagellum production in E. coli and an adherent-invasive E. coli hfq mutant was shown to have no flagella by electron microscopy, we found that flagellar production was increased in the S39006 rsmA and hfq mutants. Additionally, deletion of rsmA resulted in greater genomic flux with increased activity of two mobile genetic elements. This was confirmed by qPCR and analysis of rsmA culture supernatant revealed the presence of prophage DNA and phage particles. Finally, expression of a hypothetical protein containing DUF364 increased prodigiosin production and was

  17. The LacI–Family Transcription Factor, RbsR, Is a Pleiotropic Regulator of Motility, Virulence, Siderophore and Antibiotic Production, Gas Vesicle Morphogenesis and Flotation in Serratia

    Directory of Open Access Journals (Sweden)

    Chin M. Lee


    Full Text Available Gas vesicles (GVs are proteinaceous, gas-filled organelles used by some bacteria to enable upward movement into favorable air/liquid interfaces in aquatic environments. Serratia sp. ATCC39006 (S39006 was the first enterobacterium discovered to produce GVs naturally. The regulation of GV assembly in this host is complex and part of a wider regulatory network affecting various phenotypes, including antibiotic biosynthesis. To identify new regulators of GVs, a comprehensive mutant library containing 71,000 insertion mutants was generated by random transposon mutagenesis and 311 putative GV-defective mutants identified. Three of these mutants were found to have a transposon inserted in a LacI family transcription regulator gene (rbsR of the putative ribose operon. Each of these rbsR mutants was GV-defective; no GVs were visible by phase contrast microscopy (PCM or transmission electron microscopy (TEM. GV deficiency was caused by the reduction of gvpA1 and gvrA transcription (the first genes of the two contiguous operons in the GV gene locus. Our results also showed that a mutation in rbsR was highly pleiotropic; the production of two secondary metabolites (carbapenem and prodigiosin antibiotics was abolished. Interestingly, the intrinsic resistance to the carbapenem antibiotic was not affected by the rbsR mutation. In addition, the production of a siderophore, cellulase and plant virulence was reduced in the mutant, whereas it exhibited increased swimming and swarming motility. The RbsR protein was predicted to bind to regions upstream of at least 18 genes in S39006 including rbsD (the first gene of the ribose operon and gvrA. Electrophoretic mobility shift assays (EMSA confirmed that RbsR bound to DNA sequences upstream of rbsD, but not gvrA. The results of this study indicate that RbsR is a global regulator that affects the modulation of GV biogenesis, but also with complex pleiotropic physiological impacts in S39006.

  18. The Long Non-Coding RNA RHPN1-AS1 Promotes Uveal Melanoma Progression

    Directory of Open Access Journals (Sweden)

    Linna Lu


    Full Text Available Increasing evidence suggests that aberrant long non-coding RNAs (lncRNAs are significantly correlated with the pathogenesis, development and metastasis of cancers. RHPN1 antisense RNA 1 (RHPN1-AS1 is a 2030-bp transcript originating from human chromosome 8q24. However, the role of RHPN1-AS1 in uveal melanoma (UM remains to be clarified. In this study, we aimed to elucidate the molecular function of RHPN1-AS1 in UM. The RNA levels of RHPN1-AS1 in UM cell lines were examined using the quantitative real-time polymerase chain reaction (qRT-PCR. Short interfering RNAs (siRNAs were designed to quench RHPN1-AS1 expression, and UM cells stably expressing short hairpin (sh RHPN1-AS1 were established. Next, the cell proliferation and migration abilities were determined using a colony formation assay and a transwell migration/invasion assay. A tumor xenograft model in nude mice was established to confirm the function of RHPN1-AS1 in vivo. RHPN1-AS1 was significantly upregulated in a number of UM cell lines compared with the normal human retinal pigment epithelium (RPE cell line. RHPN1-AS1 knockdown significantly inhibited UM cell proliferation and migration in vitro and in vivo. Our data suggest that RHPN1-AS1 could be an oncoRNA in UM, which may serve as a candidate prognostic biomarker and target for new therapies in malignant UM.

  19. H irradiation effects on the GaAs-like Raman modes in GaAs1-xNx/GaAs1-xNx:H planar heterostructures

    International Nuclear Information System (INIS)

    Giulotto, E.; Geddo, M.; Patrini, M.; Guizzetti, G.; Felici, M.; Capizzi, M.; Polimeni, A.; Martelli, F.; Rubini, S.


    The GaAs-like longitudinal optical phonon frequency in two hydrogenated GaAs 1-x N x /GaAs 1-x N x :H microwire heterostructures—with similar N concentration, but different H dose and implantation conditions—has been investigated by micro-Raman mapping. In the case of GaAs 0.991 N 0.009 wires embedded in barriers where GaAs-like properties are recovered through H irradiation, the phonon frequency in the barriers undergoes a blue shift with respect to the wires. In GaAs 0.992 N 0.008 wires embedded in less hydrogenated barriers, the phonon frequency exhibits an opposite behavior (red shift). Strain, disorder, phonon localization effects induced by H-irradiation on the GaAs-like phonon frequency are discussed and related to different types of N-H complexes formed in the hydrogenated barriers. It is shown that the red (blue) character of the frequency shift is related to the dominant N-2H (N-3H) type of complexes. Moreover, for specific experimental conditions, an all-optical determination of the uniaxial strain field is obtained. This may improve the design of recently presented devices that exploit the correlation between uniaxial stress and the degree of polarization of photoluminescence

  20. H irradiation effects on the GaAs-like Raman modes in GaAs1-xNx/GaAs1-xNx:H planar heterostructures (United States)

    Giulotto, E.; Geddo, M.; Patrini, M.; Guizzetti, G.; Felici, M.; Capizzi, M.; Polimeni, A.; Martelli, F.; Rubini, S.


    The GaAs-like longitudinal optical phonon frequency in two hydrogenated GaAs1-xNx/GaAs1-xNx:H microwire heterostructures—with similar N concentration, but different H dose and implantation conditions—has been investigated by micro-Raman mapping. In the case of GaAs0.991N0.009 wires embedded in barriers where GaAs-like properties are recovered through H irradiation, the phonon frequency in the barriers undergoes a blue shift with respect to the wires. In GaAs0.992N0.008 wires embedded in less hydrogenated barriers, the phonon frequency exhibits an opposite behavior (red shift). Strain, disorder, phonon localization effects induced by H-irradiation on the GaAs-like phonon frequency are discussed and related to different types of N-H complexes formed in the hydrogenated barriers. It is shown that the red (blue) character of the frequency shift is related to the dominant N-2H (N-3H) type of complexes. Moreover, for specific experimental conditions, an all-optical determination of the uniaxial strain field is obtained. This may improve the design of recently presented devices that exploit the correlation between uniaxial stress and the degree of polarization of photoluminescence.

  1. Antibacterial activity of root and leaf extracts of Jatropha zeyheri ...

    African Journals Online (AJOL)

    Acetone extract of the root exhibited minimal inhibitory concentration (MIC) of 0.39 mg/ml against Salmonella spp. followed by methanol and acetone extracts of the root (0.78 mg/ml) against Serratia marcescens. Methanol extract of the leaf exhibited MIC of 3.13 mg/ml against Staphylococcus aureus. This study validates the ...

  2. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Permanent link: Keywords. cost of mating; immune defence; male size; sexual conflict; Drosophila melanogaster; Serratia marcescens. Abstract. Mating has been widely reported to be a costly event for females. Studies indicate that female cost of mating in terms of ...

  3. Determination of cephalosporin acylase activity by biological and ...

    African Journals Online (AJOL)



    Dec 1, 2009 ... microorganisms with cephalosporin acylase activity was developed. The core part of cephalosporin was replaced by 6-amino penicillinic acid (6-APA) to generate new substrates glutaryl-6-APA and adipoyl-6-APA for screen- ing. Serratia marcescens that is sensitive to 6-APA and resistant to penicillin G, ...

  4. Bacterial Adhesion Forces to Ag-Impregnated Contact Lens Cases and Transmission to Contact Lenses

    NARCIS (Netherlands)

    Qu, Wenwen; Busscher, Henk J.; van der Mei, Henny C.; Hooymans, Johanna M. M.

    Purpose: To measure adhesion forces of Pseudomonas aeruginosa, Staphylococcus aureus, and Serratia marcescens to a rigid contact lens (CL), standard polypropylene, and Ag-impregnated lens cases using atomic force microscopy and determine bacterial transmission from lens case to CL. Methods: Adhesion

  5. Control of damping-off of organic and conventional cucumber with extracts from a plant-associated bacterium rivals a seed treatment pesticide (United States)

    Environmentally friendly control measures are needed for soilborne diseases of crops grown in organic and conventional production systems. We tested ethanol extracts from cultures of Serratia marcescens N4-5 and N2-4, Burkholderia cepacia BC-1 and BC-2, and B. ambifaria BC-F for control of damping-o...

  6. Author Details

    African Journals Online (AJOL)

    Narese, D. Vol 107, No 5 (2017) - Articles Correspondence: Serratia marcescens infection or hypoxic- ischaemic encephalopathy in neonates: Is magnetic resonance imaging a problem-solving tool? Abstract PDF. ISSN: 0256-95749. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians ...

  7. Immunocompetence in Drosophila: linking genetic to phenotypic ...

    Indian Academy of Sciences (India)


    ally infected with the gram-negative bacterium Serratia marcescens at different times of the day (morning or even- ing). The pathogen load was subsequently determined by crushing the flies followed by quantitative plating (colony count) at 7, 15, 26 and 39 h after infection. The results showed that line (second chromosome) ...

  8. Shahat et al., Afr J Tradit Complement Altern Med. (2017) 14(2):161 ...

    African Journals Online (AJOL)


    extracts, Serratia marcescens displayed inhibition zone ranged between 10-17 mm. The antimicrobial activity of plant extracts against bacteria was more effective than against fungi, which is similar to the results reported by Avato and Ertürk (Avato et al.,. 1997; Ertürk et al., 2003). Acknowledgments. The authors extend their ...

  9. Detection of Extended-Spectrum Β-Lactamases among Gram ...

    African Journals Online (AJOL)

    Biochemical tests confirmed the identity of the Gram-negative isolates to be members of the enterobactericeae, which included Klebsiella pneumoniae (60), Escherichia coli (98), Providencia Spp. (32), Morganella moganii (32), Shigella Spp. (14), Citrobacter freundii (14), Serratia marcescens (10), Salmonella paratyphi A ...

  10. Determination of alkylation of bacterial DNA as a rapid test for toxicological evaluation of alkylating xenobiotic agents

    Energy Technology Data Exchange (ETDEWEB)

    Botzenhart, K.; Waldner-Sander, S.; Schweinsberg, F.


    Alkylated purine bases from hydrolized DNA can be separated by HPLC and quantified with a fluorescence detector. We applied this method to bacterial DNA. 7-methylguanine was detected after treatment of Serratia marcescens with iodoacetamide, dimethyl sulfate and with polluted air.

  11. Use of a chiA probe for detection of chitinase genes in bacteria from the Chesapeake Bay

    Digital Repository Service at National Institute of Oceanography (India)

    Ramaiah, N.; Hill, R.T.; Chun, J.; Ravel, J.; Matte, M.H.; Straube, W.L.; Colwell, R.R.

    PCR primers specific for the chiA gene were designed by alignment and selection of highly conserved regions of chiA sequences from Serratia marcescens, Alteromonas sp., Bacillus circulans and Aeromonas caviae. These primers were used to amplify a...

  12. Biological control of Meloidogyne incognita by Trichoderma ...

    African Journals Online (AJOL)

    Biological control against the root-knot nematode, Meloidogyne incognita was proven to occur in tomato, Solanum lycopersicom, soil-drenched with different isolates of Trichoderma harzianum and a commercial suspension of Serratia marcescens (Nemaless). The potential of such biocontrol agents to trigger plant defense ...

  13. Sequence analysis of putative swrW gene required for surfactant ...

    African Journals Online (AJOL)

    Serratia marcescens produces biosurfactant serrawettin, essential for its population migration behavior. Serrawettin W1 was revealed to be an antibiotic serratamolide that makes it significant for deoxyribonucleic acid (DNA) and protein sequence analysis. Four nucleotide and amino-acid sequences from local strains ...

  14. Characterization of two novel bacterial type A exo-chitobiose hydrolases having C-terminal 5/12-type carbohydrate-binding modules

    DEFF Research Database (Denmark)

    Binti Jamek, Shariza; Nyffenegger, Christian; Muschiol, Jan


    "exo-chitobiose hydrolases." In this study, the chitinase type A from Serratia marcescens (SmaChiA) was used as a template for identifying two novel exo-chitobiose hydrolase type A enzymes, FbalChi18A and MvarChi18A, originating from the marine organisms Ferrimonas balearica and Microbulbifer...

  15. Implantation induced electrical isolation of sulphur doped GaN xAs1-x layers

    International Nuclear Information System (INIS)

    Ahmed, S.; Lin, J.; Haq, A.; Sealy, B.


    The study of III-N-V semiconductor alloys, especially GaN x As 1-x has been increasing in the last few years. The strong dependence of the band gap on the nitrogen content has made this material important for a variety of applications, including long wavelength optoelectronic devices and high efficiency solar cells. We report on the effects of sulphur doping implants on the achieved electrical isolation in GaN x As 1-x layers using proton bombardment. Sulphur ions were implanted in MOCVD-grown GaN x As 1-x layers (1.4 μm thick with nominal x = 1%) with multiple energies creating approximately uniform doping profiles in the range of about 1 x 10 18 -5 x 10 19 cm -3 . Several proton implants were performed in order to find the threshold dose (minimum dose to achieve maximum sheet resistivity) for the electrical isolation of n-type GaN x As 1-x layers. Results show that the sheet resistance of n-type layers can be increased by about five orders of magnitude by proton implantation and the threshold dose to convert a conductive layer to a highly resistive one depends on the original free carrier concentration. The study of annealing temperature dependence of sheet resistivity in proton-isolated GaN x As 1-x layers shows that the electrical isolation can be preserved up to 450 and 500 deg. C when the implantation is performed at RT and 77 K with threshold dose, respectively. These results for n-type GaN x As 1-x layers are novel and have ramifications for device engineers

  16. Effects of irradiation on red cells stored in CPDA-1 and CPD-ADSOL (AS-1)

    International Nuclear Information System (INIS)

    Jeter, E.K.; Gadsden, R.H.; Cate, J.


    Red blood cells (pRBC) collected in citrate, phosphate, dextrose, adenine-formula 1 (CPDA-1) and citrate, phosphate, dextrose-adenine, manitol saline solution (CPD-ADSOL [AS-1]) anticoagulants are increasingly being stored for variable periods in transfusion service inventories following irradiation. While anecdotal reports of increased K+ following irradiation and storage have recently appeared in the literature, concomitant in vitro biochemical changes resulting from differences in anticoagulants have not been reported. Utilizing two venipunctures, two units each of 225 mL of blood from five volunteers were collected in anticoagulant-adjusted CPDA-1 and AS-1 bags. Within two hours of collection, each unit was equally divided. One of each pair was irradiated (2000 rads). Samples were analyzed on Days 0, 1, 3, 7, and every seven days to expiration. Irradiation resulted in a 2.3 fold increase in K+ during the first seven days of storage for both anticoagulants, although significantly greater K+ levels were observed in the CPDA-1 pairs compared to the AS-1 pairs. Comparison of glucose utilization, plasma free hemoglobin, 2,3-diphosphoglycerate (2,3-DPG) and lactate dehydrogenase between control and irradiated CPDA-1 and AS-1 pairs and between anticoagulants were documented

  17. Induction of temperate cyanophage AS-1 by heavy metal – copper

    Directory of Open Access Journals (Sweden)

    Chu Tin-Chun


    Full Text Available Abstract Background It has been reported that some marine cyanophage are temperate and can be induced from a lysogenic phase to a lytic phase by different agents such as heavy metals. However, to date no significant reports have focused on the temperate nature of freshwater cyanophage/cyanobacteria. Previous experiments with cyanophage AS-1 and cyanobacteria Anacystis nidulans have provided some evidence that AS-1 may have a lysogenic life cycle in addition to the characterized lytic cycle. Results In this study, the possible temperate A. nidulans was treated with different concentrations of heavy metal-copper. CuSO4 with concentrations of 3.1 × 10-3 M, 3.1 × 10-4 M, 3.1 × 10-5 M and 3.1 × 10-6 M were used to detect the induction of AS-1 from A. nidulans. The population of the host, unicellular cyanobacteria Anacystis nidulans, was monitored by direct count and turbidity while the amount of virus produced was derived from plaque forming units (PFU by a direct plating method. The ratio of AS-1 release from A. nidulans was also determined. From these results it appears that AS-1 lysogenic phage can be induced by copper at concentrations from 3.1 × 10-6 M to 3.1 × 10-4 M. Maximal phage induction occurred at 6 hours after addition of copper, with an optimal concentration of 3.1 × 10-6 M. Conclusion Cu2+ is a significant inducer for lysogenic cyanobacterial cells and consequently would be a potential control agent in the cyanobacteria population in fresh water ecosystems.

  18. Housing a Raspberry Pi Connected AS-1 Seismometer in a Solar-Paneled Shed (United States)

    Marton, F.; Tokman, T. L.; Echreshzadeh, M.; Palaric, K. D.; Filippone, N. V.; Sivo, J.


    Last year, students working on the SeismoSTEM project at Bergen Community College successfully manufactured and assembled an AS-1 seismometer1. However, issues students encountered were not knowing where to place the TC-1 and AS-1 seismometers, nor how to configure the instruments with a computer for monitoring and measuring earthquakes. Our solution was to purchase a Raspberry Pi 3 model B, which has four USB ports and a Wi-Fi adapter. We then installed the Raspbian operating system that can run jAmaSeis, which allows for the collection and analysis of seismic data. In terms of the shed that was constructed last summer2, we installed roof shingles, as well as a ventilation system to prevent overheating. The seismometers will then be placed on a concrete slab. In the future, we plan on applying a wood varnish around the exterior of the shed, as well as gravel around the shed for water drainage as well as to make it more visually appealing. Moreover, we plan on mounting a 170-W solar panel on the roof to charge a 12-V deep cycle marine battery, which will provide electricity to the system. References: 1Tokman, T.L. et al., What's shaking? Manufacturing & assembling an AS-1 educational seismometer for undergraduate stem research, Geological Society of America Abstracts with Programs. Vol. 47, No. 7, p.524, 2015. 2Palaric, K.D., et al., Constructing a solar-powered seismic station for educational seismometers, Geological Society of America Abstracts with Programs. Vol. 47, No. 7, p.524, 2015.

  19. PigZ, a TetR/AcrR family repressor, modulates secondary metabolism via the expression of a putative four-component resistance-nodulation-cell-division efflux pump, ZrpADBC, in Serratia sp. ATCC 39006. (United States)

    Gristwood, Tamzin; Fineran, Peter C; Everson, Lee; Salmond, George P C


    The Gram-negative enterobacterium, Serratia sp. ATCC 39006 synthesizes several secondary metabolites, including prodigiosin (Pig) and a carbapenem antibiotic (Car). A complex hierarchical network of regulatory proteins control Pig and Car production. In this study we characterize a TetR family regulator, PigZ, which represses transcription of a divergently transcribed putative resistance-nodulation-cell-division (RND) efflux pump, encoded by zrp (PigZ repressed pump) ADBC, via direct binding to the zrpA-pigZ intergenic region. Unusually, this putative RND pump contains two predicted membrane fusion proteins (MFPs), ZrpA and ZrpD. A mutation in pigZ resulted in multiple phenotypic changes, including exoenzyme production, motility and differential regulation of Pig and Car production. A polar suppressor mutation, within zrpA, restored all tested phenotypes to parental strain levels, indicating that the changes observed are due to the increase in expression of ZrpADBC in the absence of the repressor, PigZ. Genomic deletions of zrpA and zrpD indicate that the MFP ZrpD, but not ZrpA, is essential for activity of the putative pump. Bioinformatic analysis revealed that putative RND efflux pumps encoding two MFP components are not uncommon, particularly among plant-associated, Gram-negative bacteria. In addition, based on phylogenetic analysis, we propose that these pairs of MFPs consist of two distinct subtypes.

  20. Crystal structure of the catalytic domain of PigE: a transaminase involved in the biosynthesis of 2-methyl-3-n-amyl-pyrrole (MAP) from Serratia sp. FS14. (United States)

    Lou, Xiangdi; Ran, Tingting; Han, Ning; Gao, Yanyan; He, Jianhua; Tang, Lin; Xu, Dongqing; Wang, Weiwu


    Prodigiosin, a tripyrrole red pigment synthesized by Serratia and some other microbes through a bifurcated biosynthesis pathway, MBC (4-methoxy-2,2'-bipyrrole-5-carbaldehyde) and MAP (2-methyl-3-n-amyl-pyrrole) are synthesized separately and then condensed by PigC to form prodigiosin. MAP is synthesized sequentially by PigD, PigE and PigB. PigE catalyzes the transamination of an amino group to the aldehyde group of 3-acetyloctanal, resulting in an aminoketone, which spontaneously cyclizes to form H2MAP. Here we report the crystal structure of the catalytic domain of PigE which involved in the biosynthesis of prodigiosin precursor MAP for the first time to a resolution of 2.3Å with a homodimer in the asymmetric unit. The monomer of PigE catalytic domain is composed of three domains with PLP as cofactor: a small N-terminal domain connecting the catalytic domain with the front part of PigE, a large PLP-binding domain and a C-terminal domain. The residues from both monomers build the PLP binding site at the interface of the dimer which resembles the other PLP-dependent enzymes. Structural comparison of PigE with Thermus thermophilus AcOAT showed a higher hydrophobic and smaller active site of PigE, these differences may be the reason for substrate specificity. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Investigating the compatibility of the biocontrol agent Clonostachys rosea IK726 with prodigiosin-producing Serratia rubidaea S55 and phenazine-producing Pseudomonas chlororaphis ToZa7. (United States)

    Kamou, Nathalie N; Dubey, Mukesh; Tzelepis, Georgios; Menexes, Georgios; Papadakis, Emmanouil N; Karlsson, Magnus; Lagopodi, Anastasia L; Jensen, Dan Funck


    This study was carried out to assess the compatibility of the biocontrol fungus Clonostachys rosea IK726 with the phenazine-producing Pseudomonas chlororaphis ToZa7 or with the prodigiosin-producing Serratia rubidaea S55 against Fusarium oxysporum f. sp. radicis-lycopersici. The pathogen was inhibited by both strains in vitro, whereas C. rosea displayed high tolerance to S. rubidaea but not to P. chlororaphis. We hypothesized that this could be attributed to the ATP-binding cassette (ABC) proteins. The results of the reverse transcription quantitative PCR showed an induction of seven genes (abcB1, abcB20, abcB26, abcC12, abcC12, abcG8 and abcG25) from subfamilies B, C and G. In planta experiments showed a significant reduction in foot and root rot on tomato plants inoculated with C. rosea and P. chlororaphis. This study demonstrates the potential for combining different biocontrol agents and suggests an involvement of ABC transporters in secondary metabolite tolerance in C. rosea.

  2. Construction and evaluation of a modular biofilm-forming chamber for microbial recovery of neodymium and semi-continuous biofilm preparation. Tolerance of Serratia sp.N14 on acidic conditions and neutralized aqua regia. (United States)

    Vavlekas, Dimitrios A


    Recovery of neodymium from liquid metallic wastes and scrap leachates is a crucial step for its recycling, which can take place through the immobilized biofilms of Serratia sp. N14. These biofilms are produced in a fermentor vessel with a turnaround time of 10-14 days, which is unacceptable from an economic point of view for an industrial process. This study proposes the construction and evaluation of a modular system, whereby a biofilm-forming chamber is inserted into the continuous biomass outflow of the main chemostat vessel, for an alternative semi-continuous and economic production of biofilm. The activity of the biofilm from the outflow chamber was found to be the same as the one from the main chamber, which was stored in a cold room (4°C), for 9-12 months, depending on a 24 h nucleation step.Moreover, the ability of the biofilm to function in the presence of a leaching agent (aqua regia) or in acidic conditions was also evaluated. The biofilm of the main chamber can remain active even at 50% neutralized aqua regia (pH 3.0), while at acidic conditions, phosphate release of the cells is reduced to 50%. This strain proves to be very tolerant in low pH or high salt concentration solutions. The biofilm produced from the outflow of the main fermentor vessel is of acceptable activity, rather than being disposed.

  3. Isolation and characteristics of minute plaque forming mutant of cyanophage AS-1

    International Nuclear Information System (INIS)

    Amla, D.V.


    Minute plaque forming mutant (m) of cyanophage AS-1 infecting unicellular blue-green algae was isolated spontaneously and after mutagenic treatment. Compared to wild type m mutant formed small plaques, adsorption rate was slow and the burst-size was significantly decreased with prolonged eclipse and latent period. The plaque forming ability of mutant phage was sensitive to pH, heat, EDTA shock, distilled water and photosensitisation with acriflavine whereas ultraviolet sensitivity of free and intracellular phage was identical to the parent. The spontaneous reversion frequencies of mutant phage to wild type were between 10 -5 to 10 -3 and appeared to be clonal property. Reversion studies suggested possibilities of frame-shift or base-pair substitution for m mutation. (author)

  4. Strong composition-dependent disorder in InAs1-xNx alloys

    International Nuclear Information System (INIS)

    Benaissa, H.; Zaoui, A.; Ferhat, M.


    We investigate the main causes of disorder in the InAs 1-x N x alloys (x = 0, 0.03125, 0.0625, 0.09375, 0.125, 0.25, 0.5, 0.75, 0.875, 0.90625, 0.9375, 0.96875 and 1). The calculation is based on the density-functional theory in the local-density approximation. We use a plane wave-expansion non-norm conserving ab initio Vanderbilt pseudopotentials. To avoid the difficulty of considering the huge number of atomic configurations, we use an appropriate strategy in which we consider four configurations for a given composition where the N atoms are not randomly distributed. We mainly show that the band gap decreases (increases) rapidly with increasing (decreasing) compositions of N. As a consequence the optical band gap bowing is found to be strong and composition dependent. The obtained compounds, from these alloys, may change from semi-conducting to metal (passing to a negative bowing) and could be useful for device applications, especially at certain composition.

  5. Surface morphology and electronic structure of halogen etched InAs (1 1 1)

    Energy Technology Data Exchange (ETDEWEB)

    Eassa, N., E-mail: [Department of Physics, Nelson Mandela Metropolitan University, P.O. Box 77000, Port Elizabeth 6031 (South Africa); Murape, D.M. [Department of Physics, Nelson Mandela Metropolitan University, P.O. Box 77000, Port Elizabeth 6031 (South Africa); Betz, R. [Department of Chemistry, Nelson Mandela Metropolitan University (South Africa); Neethling, J.H.; Venter, A.; Botha, J.R. [Department of Physics, Nelson Mandela Metropolitan University, P.O. Box 77000, Port Elizabeth 6031 (South Africa)


    The reaction of halogen-based etchants with n-InAs (1 1 1)A and the resulting surface morphology and surface electronic structure are investigated using field emission scanning electron microscopy and Raman spectroscopy. Using the intensity ratio of the unscreened longitudinal optical (LO) phonon to the transverse optical (TO) phonon in the Raman spectrum, a significant reduction in band bending is deduced after exposure of the InAs surface to HCl:H{sub 2}O, Br-methanol and I-ethanol for moderate times and concentrations. These procedures also lead to smooth and defect-free InAs surfaces. The improvements in surface properties are reversed, however, if the concentrations of the etchants are increased or the etch time is too long. In the worst cases, pit formation and inverted pyramids with {l_brace}1 1 1{r_brace} side facets are observed. The influence of the etchant concentration and etch time on the morphological and electronic properties of the etched surfaces is reported.

  6. Surface morphology and electronic structure of halogen etched InAs (1 1 1)

    International Nuclear Information System (INIS)

    Eassa, N.; Murape, D.M.; Betz, R.; Neethling, J.H.; Venter, A.; Botha, J.R.


    The reaction of halogen-based etchants with n-InAs (1 1 1)A and the resulting surface morphology and surface electronic structure are investigated using field emission scanning electron microscopy and Raman spectroscopy. Using the intensity ratio of the unscreened longitudinal optical (LO) phonon to the transverse optical (TO) phonon in the Raman spectrum, a significant reduction in band bending is deduced after exposure of the InAs surface to HCl:H 2 O, Br–methanol and I–ethanol for moderate times and concentrations. These procedures also lead to smooth and defect-free InAs surfaces. The improvements in surface properties are reversed, however, if the concentrations of the etchants are increased or the etch time is too long. In the worst cases, pit formation and inverted pyramids with {1 1 1} side facets are observed. The influence of the etchant concentration and etch time on the morphological and electronic properties of the etched surfaces is reported.

  7. Nanostructuring-induced modification of optical properties of p-GaAs (1 0 0) (United States)

    Naddaf, M.; Saloum, S.


    A pulsed anodic etching method has been utilized for nanostructuring of p-type GaAs (1 0 0) surface, using HCl-based solution as electrolyte. The resulting porous GaAs layer is characterized by atomic force microscopy (AFM), room temperature photoluminescence (PL), Raman spectroscopy and optical reflectance measurements. AFM imaging reveals that the porous GaAs layer is consisted of a pillar-like of few nm in width distributed between more-reduced size nanostructures. In addition to the “infrared” PL band of un-etched GaAs, a strong “green” PL band is observed in the etched sample. The broad visible PL band of a high-energy (3.82 eV) excitation is found to compose of two PL band attributed to excitons confinement in two different sizes distribution of GaAs nanocrystals. The quantum confinement effects in GaAs nanocrystallites is also evidenced from Raman spectroscopy through the pronounced appearance of the transverse optical (TO) phonon line in the spectra of the porous sample. Porosity-induced a significant reduction of the specular reflection, in the spectral range (400-800 nm), is also demonstrated.

  8. Bistable Si dopants in the GaAs (1 1 0) surface

    International Nuclear Information System (INIS)

    Smakman, E P; Koenraad, P M


    In this review, recent work is discussed on bistable Si dopants in the GaAs (1 1 0) surface, studied by scanning tunneling microscopy (STM). The bistability arises because the dopant atom can switch between a positive and a negative charge state, which are associated with two different lattice configurations. Manipulation of the Si atom charge configuration is achieved by tuning the local band bending with the STM tip. Furthermore, illuminating the sample with a laser also influences the charge state, allowing the operation of the dopant atom as an optical switch. The switching dynamics without illumination is investigated in detail as a function of temperature, lateral tip position, and applied tunneling conditions. A physical model is presented that independently describes the thermal and quantum tunneling contributions to the switching frequency and charge state occupation of a single Si atom. The basic functionality of a memory cell is demonstrated employing a single bistable Si dopant as the active element, using the STM tip as a gate to write and read the information. (topical review)

  9. Increased resistance of contact lens related bacterial biofilms to antimicrobial activity of soft contact lens care solutions (United States)

    Szczotka-Flynn, Loretta B.; Imamura, Yoshifumi; Chandra, Jyotsna; Yu, Changping; Mukherjee, Pranab K.; Pearlman, Eric; Ghannoum, Mahmoud A.


    PURPOSE To determine if clinical and reference strains of Pseudomonas aeruginosa, Serratia marcescens, and Staphylococcus aureus form biofilms on silicone hydrogel contact lenses, and ascertain antimicrobial activities of contact lens care solutions. METHODS Clinical and American Type Culture Collection (ATCC) reference strains of Pseudomonas aeruginosa, Serratia marcescens, and Staphylococcus aureus were incubated with lotrafilcon A lenses under conditions that facilitate biofilm formation. Biofilms were quantified by quantitative culturing (colony forming units, CFUs), and gross morphology and architecture were evaluated using scanning electron microscopy (SEM) and confocal microscopy. Susceptibilities of the planktonic and biofilm growth phases of the bacteria to five common multipurpose contact lens care solutions and one hydrogen peroxide care solution were assessed. RESULTS P. aeruginosa, S. marcescens, and S. aureus reference and clinical strains formed biofilms on lotrafilcon A silicone hydrogel contact lenses, as dense networks of cells arranged in multiple layers with visible extracellular matrix. The biofilms were resistant to commonly used biguanide preserved multipurpose care solutions. P. aeruginosa and S. aureus biofilms were susceptible to a hydrogen peroxide and a polyquaternium preserved care solution, whereas S. marcescens biofilm was resistant to a polyquaternium preserved care solution but susceptible to hydrogen peroxide disinfection. In contrast, the planktonic forms were always susceptible. CONCLUSIONS P. aeruginosa, S. marcescens, and S. aureus form biofilms on lotrafilcon A contact lenses, which in contrast to planktonic cells, are resistant to the antimicrobial activity of several soft contact lens care products. PMID:19654521

  10. The dual exo/endo-type mode and the effect of ionic strength on the mode of catalysis of chitinase 60 (CHI60) from Serratia sp. TU09 and its mutants. (United States)

    Kuttiyawong, K; Nakapong, S; Pichyangkura, R


    Mutations of the tryptophan residues in the tryptophan-track of the N-terminal domain (W33F/Y and W69F/Y) and in the catalytic domain (W245F/Y) of Serratia sp. TU09 Chitinase 60 (CHI60) were constructed, as single and double point substitutions to either phenylalanine or tyrosine. The enzyme-substrate interaction and mode of catalysis, exo/endo-type, of wild type CHI60 and mutant enzymes on soluble (partially N-acetylated chitin), amorphous (colloidal chitin), and crystalline (β-chitin) substrates were studied. All CHI60 mutants exhibited a reduced substrate binding activity on colloidal chitin. CHI60 possesses a dual mode of catalysis with both exo- and endo-type activities allowing the enzyme to work efficiently on various substrate types. CHI60 preferentially uses the endo-type mode on soluble and amorphous substrates and the exo-type mode on crystalline substrate. However, the prevalent mode of hydrolysis mediated by CHI60 is regulated by ionic strength. Slightly elevated ionic strength, 0.1-0.2M NaCl, which promotes enzyme-substrate interactions, enhances CHI60 hydrolytic activity on amorphous substrate and, interestingly, on partially N-acetylated chitin. High ionic strength, 0.5-2.0M NaCl, prevents the enzyme from dissociating from amorphous substrate, occupying the enzyme in an enzyme-substrate non-productive complex. However, on crystalline substrates, the activity of CHI60 was only inhibited approximately 50% at high ionic strength, suggesting that the enzyme hydrolyzes crystalline substrates with an exo-type mode processively while remaining tightly bound to the substrate. Moreover, substitution of Trp-33 to either phenylalanine or tyrosine reduced the activity of the enzyme at high ionic strength, suggesting an important role of Trp-33 on enzyme processivity.

  11. CRISPR-Cas gene-editing reveals RsmA and RsmC act through FlhDC to repress the SdhE flavinylation factor and control motility and prodigiosin production in Serratia. (United States)

    Hampton, Hannah G; McNeil, Matthew B; Paterson, Thomas J; Ney, Blair; Williamson, Neil R; Easingwood, Richard A; Bostina, Mihnea; Salmond, George P C; Fineran, Peter C


    SdhE is required for the flavinylation and activation of succinate dehydrogenase and fumarate reductase (FRD). In addition, SdhE is conserved in proteobacteria (α, β and γ) and eukaryotes. Although the function of this recently characterized family of proteins has been determined, almost nothing is known about how their genes are regulated. Here, the RsmA (CsrA) and RsmC (HexY) post-transcriptional and post-translational regulators have been identified and shown to repress sdhEygfX expression in Serratia sp. ATCC 39006. Conversely, the flagella master regulator complex, FlhDC, activated sdhEygfX transcription. To investigate the hierarchy of control, we developed a novel approach that utilized endogenous CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (CRISPR associated) genome-editing by a type I-F system to generate a chromosomal point mutation in flhC. Mutation of flhC alleviated the ability of RsmC to repress sdhEygfX expression, whereas RsmA acted in both an FlhDC-dependent and -independent manner to inhibit sdhEygfX. Mutation of rsmA or rsmC, or overexpression of FlhDC, led to increased prodigiosin, biosurfactant, swimming and swarming. Consistent with the modulation of sdhE by motility regulators, we have demonstrated that SdhE and FRD are required for maximal flagella-dependent swimming. Together, these results demonstrate that regulators of both metabolism and motility (RsmA, RsmC and FlhDC) control the transcription of the sdhEygfX operon.

  12. Long non-coding RNA AFAP1-AS1 facilitates tumor growth and promotes metastasis in colorectal cancer

    Directory of Open Access Journals (Sweden)

    Xu Han

    Full Text Available BACKGROUND AND OBJECTIVE: Long non-coding RNAs can regulate tumorigenesis of various cancers. Dys-regulation of lncRNA-AFAP1-AS1 has not been studied in colorectal carcinoma (CRC. This study was to examine the function involvement of AFAP1-AS1 in tumor growth and metastasis of CRC. METHODS: Relative expression of AFAP1-AS1 in CRC tissues and CRC cells lines was determined using quantitative real-time PCR (qRT-PCR. Functional involvement of AFAP1-AS1 in tumor proliferation and metastasis was evaluated in AFAP1-AS1-specific siRNA-treated CRC cells and in CRC cell xenograft. Expression of epithelial-mesenchymal transition (EMT-related gene expression was determined using western blot. RESULTS: Relative expression of AFAP1-AS1 was significantly elevated in CRC tissues and CRC HCT116 and SW480 cell lines. AFAP1-AS1 knock-down suppressed SW480 cell proliferation, colony formation, migration and invasion. Also AFAP1-AS1 knock-down inhibited tumor metastasis-associated genes expression in terms of EMT. This carcinostatic action by AFAP1-AS1 knock-down was further confirmed by suppression of tumor formation and hepatic metastasis of CRC cells in nude mice. CONCLUSION: lncRNA-AFAP1-AS1 knock-down exhibits antitumor effect on colorectal carcinoma in respects of suppression of cell proliferation and metastasis of cancer cells.

  13. Inducible xylitol dehydrogenases in enteric bacteria.


    Doten, R C; Mortlock, R P


    Morganella morganii ATCC 25829, Providencia stuartii ATCC 25827, Serratia marcescens ATCC 13880, and Erwinia sp. strain 4D2P were found to induce a xylitol dehydrogenase when grown on a xylitol-containing medium. The xylitol dehydrogenases were partially purified from the four strains, and those from M. morganii ATCC 25829, P. stuartii ATCC 25827, and S. marcescens ATCC 13880 were all found to oxidize xylitol to D-xylulose. These three enzymes had KmS for xylitol of 7.1 to 16.4 mM and molecul...

  14. Packed bed reactor for degradation of simulated cyanide-containing wastewater


    Kumar, Virender; Kumar, Vijay; Bhalla, Tek Chand


    The discharge of cyanide-containing effluents into the environment contaminates water bodies and soil. Effective methods of treatment which can detoxify cyanide are the need of the hour. The aim of the present study is to develop a bioreactor for complete degradation of cyanide using immobilized cells of Serratia marcescens RL2b. Alginate-entrapped cells of S. marcescens RL2b were used for complete degradation of cyanide in a packed bed reactor (PBR). Cells grown in minimal salt medium (pH 6....

  15. LncRNA-FEZF1-AS1 promotes tumor proliferation and metastasis in colorectal cancer by regulating PKM2 signaling. (United States)

    Bian, Zehua; Zhang, Jiwei; Li, Min; Feng, Yuyang; Wang, Xue; Zhang, Jia; Yao, Surui; Jin, Guoying; Du, Jun; Han, Weifeng; Yin, Yuan; Huang, Shenglin; Fei, Bojian; Zou, Jian; Huang, Zhaohui


    Long non-coding RNAs (lncRNAs) play key roles in human cancers. Here, FEZF1-AS1, a highly overexpressed lncRNA in colorectal cancer (CRC), was identified by lncRNA microarrays. We aimed to explore the roles and possible molecular mechanisms of FEZF1-AS1 in CRC. LncRNA expression in CRC tissues was measured by lncRNA microarray and qRT-PCR. The functional roles of FEZF1-AS1 in CRC were demonstrated by a series of in vitro and in vivo experiments. RNA pull-down, RNA immunoprecipitation and luciferase analyses were used to demonstrate the potential mechanisms of FEZF1-AS1. We identified a series of differentially expressed lncRNAs in CRC using lncRNA microarrays, and revealed that FEZF1-AS1 is one of the most overexpressed. Further validation in two expanded CRC cohorts confirmed the upregulation of FEZF1-AS1 in CRC, and revealed that increased FEZF1-AS1 expression is associated with poor survival. Functional assays revealed that FEZF1-AS1 promotes CRC cell proliferation and metastasis. Mechanistically, FEZF1-AS1 could bind and increase the stability of the pyruvate kinase 2 (PKM2) protein, resulting in increased cytoplasmic and nuclear PKM2 levels. Increased cytoplasmic PKM2 promoted pyruvate kinase activity and lactate production (aerobic glycolysis), whereas FEZF1-AS1-induced nuclear PKM2 upregulation further activated STAT3 signaling. In addition, PKM2 was upregulated in CRC tissues and correlated with FEZF1-AS1 expression and patient survival. Together, these data provide mechanistic insights into the regulation of FEZF1-AS1 on both STAT3 signaling and glycolysis by binding PKM2 and increasing its stability. Copyright ©2018, American Association for Cancer Research.

  16. The clinical significance and biological function of lncRNA RGMB-AS1 in hepatocellular carcinoma. (United States)

    Sheng, Nan; Li, Yannan; Qian, Ruikun; Li, Yichun


    LncRNA RGMB-AS1 has been suggested to play significant roles in lung cancer progression. However, it remains unknown whether lncRNA RGMB-AS1 is involved in the development and progression of hepatocellular carcinoma. In our results, lncRNA RGMB-AS1 was low-expressed in hepatocellular carcinoma tissues and cell lines, and associated with clinical stage, tumor size and metastasis. Survival analysis indicated that lncRNA RGMB-AS1 high was an independent favorable prognostic factor for hepatocellular carcinoma patients. Gain-of-function studies showed up-regulated lncRNA RGMB-AS1 expression suppressed hepatocellular carcinoma cells proliferation, migration and invasion, and promoted cells apoptosis. There was a positively association between lncRNA RGMB-AS1 and RGMB in hepatocellular carcinoma tissues, and up-regulated lncRNA RGMB-AS1 expression increased RGMB mRNA and protein expressions in hepatocellular carcinoma cells. In conclusion, lncRNA RGMB-AS1 serves an anti-oncogenic role in hepatocellular carcinoma. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  17. Degradation of 2,4-D herbicide by microorganisms isolated from Brazilian contaminated soil Degradação do herbicida 2,4-D por microrganismos isolados de solo contaminado do Brasil

    Directory of Open Access Journals (Sweden)

    Tatiane M. Silva


    Full Text Available The aim of this work was to isolate microorganisms from Brazilian soil contaminated with 2,4-D herbicide, and analyze the efficiency for 2,4D degradation, using high-performance liquid chromatography (HPLC. Serratia marcescens and Penicillium sp had never been reported as able to degrade 2,4-D. The isolated strains represent a great potential for bioremediation.O objetivo deste trabalho foi isolar microrganismos de solo brasileiro contaminado com o herbicida 2,4-D, e analisar a eficiência da degradação por cromatografia líquida de alta eficiência (HPLC. Serratia marcescens e Penicillium sp jamais haviam sido relatadas como degradadoras de 2,4-D. As linhagens isoladas representam um grande potencial em biorremediação.

  18. Biotransformations of Substituted Phenylethanols and Acetophenones by Environmental Bacteria

    Directory of Open Access Journals (Sweden)

    Edna Kagohara


    Full Text Available Whole cells of hydrocarbon-degrading bacteria, isolated from polluted sediments in the Santos Estuary (Baixada Santista, São Paulo, Brazil, were able to catalyse oxidoreduction reactions with various substituted phenylethanols and acetophenones as substrates. A number of substituted phenylethanols were formed with high (>99 % enantiomeric excess. The results of microbial oxidation of phenylethanols 2, 3, 5–7 by Acinetobacter sp. 6.4T and the reduction of acetophenones 1a–6a by Serratia marcescens 5.4T showed that the bacteria used as biocatalysts in this study present significant potential for exploitation in biotechnological processes. The reduction of prochiral acetophenones by Serratia marcescens 3.5T yielded optically active alcohols with 90–99 % enantiomeric excess, and Acinetobacter sp. 6.4T is a potential biocatalyst for the oxidation of alcohols.

  19. The Story of : Pathologic Risk Factors in Breast Implant Surgery

    Directory of Open Access Journals (Sweden)

    Caroline A Yao


    Full Text Available Serratia marcescens (S. marcescens emerged as an opportunist in the setting of immunodeficiency in the 1970s, when serious infections occurred in San Francisco hospitals after USA. Navy experiments had aerosolized the bacteria to study biologic warfare. We investigate the risks of S. marcescens in San Franciscans who undergo mastectomy with implant reconstruction. From 2007 to 2011, the senior author took breast capsule cultures for all patients at the time of tissue expander exchange/explant. Of the 142 women who had reconstruction, 23 had positive cultures. Only the two patients who were positive for S. marcescens developed clinical infections that required explantation. Both had postoperative chemotherapy with transient neutropenia, and both had close ties to San Francisco. Clinical signs of infection emerged for both patients months after initial surgery, despite having previously well healed incisions. Other patients were culture positive for Pseudomonas, Proteus, Enterococcus and MRSA and did not develop require explant. While the link between San Francisco and S. marcescens is controversial, a patient's geography is a simple screening tool when considering postoperative risks, especially in the immunocompromised. Closer monitoring for neutropenia during chemotherapy, and a lower threshold to administer S. marcescens targeted antibiotics may be warranted in these patients.

  20. IFNA-AS1 regulates CD4+ T cell activation in myasthenia gravis though HLA-DRB1. (United States)

    Luo, Mengchuan; Liu, Xiaofang; Meng, Huanyu; Xu, Liqun; Li, Yi; Li, Zhibin; Liu, Chang; Luo, Yue-Bei; Hu, Bo; Xue, Yuanyuan; Liu, Yu; Luo, Zhaohui; Yang, Huan


    Abnormal CD4 + T cell activation is known to play roles in the pathogenesis of myasthenia gravis (MG). However, little is known about the mechanisms underlying the roles of lncRNAs in regulating CD4 + T cell. In this study, we discovered that the lncRNA IFNG-AS1 is abnormally expressed in MG patients associated with quantitative myasthenia gravis (QMG) and the positive anti-AchR Ab levels patients. IFNG-AS1 influenced Th1/Treg cell proliferation and regulated the expression levels of their transcription factors in an experimental autoimmune myasthenia gravis (EAMG)model. IFNG-AS1 could reduce the expression of HLA-DRB and HLA-DOB and they had a negative correlation in MG. Furthermore IFNG-AS1 influenced the expression levels of CD40L and CD4 + T cells activation in MG patient partly depend on effecting the HLA-DRB1 expression. It suggests that IFNG-AS1 may be involved in CD4 + T cell-mediated immune responses in MG. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  1. Substances bioactives élaborées par des cyanobactéries isolées de ...

    African Journals Online (AJOL)

    Les substances extracellulaires produites par les cyanobactéries étudiées ont aussi une activité antibactérienne vis-à-vis de M. luteus, Bacillus subtilis, Serratia marcescens, B. cereus, Escherichia coli 0128B12 et Staphylococcus aureus. Le biotest souris a permis de montrer que certaines cyanobactéries étudiées ...

  2. Antibacterial activity of extracts of six macroalgae from the northeastern brazilian coast

    Directory of Open Access Journals (Sweden)

    Lima-Filho José Vitor M.


    Full Text Available Hexane, chloroform and ethanol extracts of six marine macroalgae (Rhodophyta and Chlorophyta from North Ceará coast (Northeast Brazil were evaluated for antibacterial activity by the single disk method. Best results were shown by the hexane extracts of Amansia multifida against enteric Gram-negative strains such as Enterobacter aerogenes, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhi, S. cholerae-suis, Serratia marcescens, Vibrio cholerae and the Gram-positive bacteria Bacillus subtilis and Staphylococcus aureus.

  3. Antibacterial activity of the Antarctic bacterium Janthinobacterium sp. SMN 33.6 against multi-resistant Gram-negative bacteria

    Directory of Open Access Journals (Sweden)

    Geraldine Asencio


    Conclusions: The ethanolic extract of Janthinobacterium sp. SMN 33.6 possesses antibacterial activity against a chromosomal AmpC beta-lactamase-producing strain of Serratia marcescens, an extended-spectrum beta-lactamase-producing Escherichia coli and also against carbapenemase-producing strains of Acinetobacter baumannii and Pseudomonas aeruginosa. This becomes a potential and interesting biotechnological tool for the control of bacteria with multi-resistance to commonly used antibiotics.

  4. Studies on the antimicrobial properties of colloidal silver nanoparticles stabilized by bovine serum albumin. (United States)

    Mathew, Thomas V; Kuriakose, Sunny


    Colloidal silver nanoparticles were synthesised using sol-gel method and these nanoparticles were stabilised by encapsulated into the scaffolds of bovine serum albumin. Silver nanoparticles and encapsulated products were characterised by FTIR, NMR, XRD, TG, SEM and TEM analyses. Silver nanoparticle encapsulated bovine serum albumin showed highly potent antibacterial activity towards the bacterial strains such as Staphylococcus aureus, Serratia marcescens, Pseudomonas aeruginosa, Escherichia coli and Klebsiella pneumoniae. Copyright © 2012 Elsevier B.V. All rights reserved.

  5. Lactoferrin release and interleukin-1, interleukin-6, and tumor necrosis factor production by human polymorphonuclear cells stimulated by various lipopolysaccharides: relationship to growth inhibition of Candida albicans.


    Palma, C; Cassone, A; Serbousek, D; Pearson, C A; Djeu, J Y


    Lipopolysaccharides (LPSs) from Escherichia coli, Serratia marcescens, and Salmonella typhimurium, at doses from 1 to 100 ng/ml, strongly enhanced growth inhibition of Candida albicans by human polymorphonuclear leukocytes (PMN) in vitro. Flow cytometry analysis demonstrated that LPS markedly augmented phagocytosis of Candida cells by increasing the number of yeasts ingested per neutrophil as well as the number of neutrophils capable of ingesting fungal cells. LPS activation caused augmented ...

  6. MBE growth and characterization of GaAs1-x Sb x epitaxial layers on Si (0 0 1) substrates

    International Nuclear Information System (INIS)

    Toda, T.; Nishino, F.; Kato, A.; Kambayashi, T.; Jinbo, Y.; Uchitomi, N.


    We investigated the growth of GaAs 1- x Sb x (x=1.0, 0.82, 0.69, 0.44, 0.0) layers on Si (0 0 1) substrates using AlSb as a buffer layer. Epilayers were grown as a function of As beam equivalent pressure (BEP) under a constant Sb BEP, and they were then characterized by atomic force microscopy (AFM), X-ray diffraction (XRD), and micro-Raman scattering analysis. We confirmed that GaAs 1- x Sb x layers have been successfully grown on Si substrates by introducing AlSb layers

  7. Supporting data for identification of biosurfactant-producing bacteria isolated from agro-food industrial effluent (United States)

    Fulazzaky, Mohamad Ali; Abdullah, Shakila; Salim, Mohd Razman


    The goal of this study was to identify the biosurfactant-producing bacteria isolated from agro-food industrial effluet. The identification of the potential bacterial strain using a polymerase chain reaction of the 16S rRNA gene analysis was closely related to Serratia marcescens with its recorded strain of SA30 “Fundamentals of mass transfer and kinetics for biosorption of oil and grease from agro-food industrial effluent by Serratia marcescens SA30” (Fulazzaky et al., 2015) [1]; however, many biochemical tests have not been published yet. The biochemical tests of biosurfactant production, haemolytic assay and cell surface hydrophobicity were performed to investigate the beneficial strain of biosurfactant-producing bacteria. Here we do share data collected from the biochemical tests to get a better understanding of the use of Serratia marcescens SA30 to degrade oil, which contributes the technical features of strengthening the biological treatment of oil-contaminated wastewater in tropical environments. PMID:27077083

  8. Supporting data for identification of biosurfactant-producing bacteria isolated from agro-food industrial effluent

    Directory of Open Access Journals (Sweden)

    Mohamad Ali Fulazzaky


    Full Text Available The goal of this study was to identify the biosurfactant-producing bacteria isolated from agro-food industrial effluet. The identification of the potential bacterial strain using a polymerase chain reaction of the 16S rRNA gene analysis was closely related to Serratia marcescens with its recorded strain of SA30 “Fundamentals of mass transfer and kinetics for biosorption of oil and grease from agro-food industrial effluent by Serratia marcescens SA30” (Fulazzaky et al., 2015 [1]; however, many biochemical tests have not been published yet. The biochemical tests of biosurfactant production, haemolytic assay and cell surface hydrophobicity were performed to investigate the beneficial strain of biosurfactant-producing bacteria. Here we do share data collected from the biochemical tests to get a better understanding of the use of Serratia marcescens SA30 to degrade oil, which contributes the technical features of strengthening the biological treatment of oil-contaminated wastewater in tropical environments.

  9. Bacterial membrane activity of a-peptide/b-peptoid chimeras: Influence of amino acid composition and chain length on the activity against different bacterial strains

    DEFF Research Database (Denmark)

    Hein-Kristensen, Line; Knapp, Kolja M; Franzyk, Henrik


    and subsequent killing is usually not tested. In this report, six α-peptide/β-peptoid chimeras were examined for the effect of amino acid/peptoid substitutions and chain length on the membrane perturbation and subsequent killing of food-borne and clinical bacterial isolates. RESULTS: All six AMP analogues...... acid only had a minor effect on MIC values, whereas chain length had a profound influence on activity. All chimeras were less active against Serratia marcescens (MICs above 46 μM). The chimeras were bactericidal and induced leakage of ATP from Staphylococcus aureus and S. marcescens with similar time...... of onset and reduction in the number of viable cells. EDTA pre-treatment of S. marcescens and E. coli followed by treatment with chimeras resulted in pronounced killing indicating that disintegration of the Gram-negative outer membrane eliminated innate differences in susceptibility. Chimera chain length...

  10. Isomaltulose production using free and immobilized Serratia ...

    African Journals Online (AJOL)



    May 18, 2016 ... After 2 h of reaction time in shake flasks, a high production of ... immobilized cells in calcium alginate was studied in a packed bed bioreactor during seven days in a .... cell biomass was obtained from fermentation in a 6.6 L bioreactor .... carbohydrates were analyzed comparing their retention times with.

  11. Isomaltulose production using free and immobilized Serratia ...

    African Journals Online (AJOL)



    May 18, 2016 ... enzymatic conversion of the glucosyl linkage from (1-2) fructoside to (1-6) ... The industrial production of isomaltulose is done by. Südzucker AG ... process of isomaltulose production and removes the residual P. rubrum ...

  12. Synchrotron photoemission spectroscopy study of ammonium hydroxide etching to prepare well-ordered GaAs(1 0 0) surfaces

    International Nuclear Information System (INIS)

    Lebedev, Mikhail V.; Ensling, David; Hunger, Ralf; Mayer, Thomas; Jaegermann, Wolfram


    Synchrotron-induced photoelectron spectroscopy was used to investigate the native-oxide-covered GaAs(1 0 0) surface and changes induced by etching with aqueous ammonia solution and by annealing in vacuum. The etching step removes arsenic and gallium oxides from the surface and the surface gets covered by elemental arsenic and tiny amounts of gallium suboxide. The surface oxygen content is reduced by an order of magnitude after etching, whereas the surface carbon content is somewhat increased. Annealing of this surface at 450 deg. C results in the disappearance of elemental arsenic and a considerable decrease in surface carbon and oxygen contents. The valence band spectra exhibit clear features typical for As-terminated GaAs(1 0 0) surfaces, as also obtained after As decapping

  13. Effect of rapid thermal annealing observed by photoluminescence measurement in GaAs1-xN x layers

    International Nuclear Information System (INIS)

    Bousbih, F.; Bouzid, S.B.; Hamdouni, A.; Chtourou, R.; Harmand, J.C.


    A set of GaAs 1-x N x samples with small nitrogen content were investigated by photoluminescence (PL) measurements as function of irradiance in order to investigate the effect of rapid thermal annealing (RTA) on photoluminescence (PL) properties. The analysis of PL spectra as function of irradiance and nitrogen content shows that the PL spectra associated to the GaAs 1- x N x layers are the result of the nitrogen localized state recombination. The results are examined as a consequence of a rapid thermal annealing (RTA). The variation of the emission band peak energy (E p ), at 10 K as a function of irradiance, is fitted by a theoretical model taking into account two types of nitrogen localized states. The variation of the PL intensity versus irradiance in the range from 1.59 to 159 W/cm 2 for different GaAs 1-x N x samples confirm that the PL spectra result from the nitrogen localized state recombination

  14. Spectroscopic ellipsometry analysis of GaAs1-xNx layers grown by molecular beam epitaxy

    International Nuclear Information System (INIS)

    Ben Sedrine, N.; Rihani, J.; Stehle, J.L.; Harmand, J.C.; Chtourou, R.


    In this work, we present the effect of nitrogen incorporation on the dielectric function of GaAsN samples, grown by molecular beam epitaxy (MBE) followed by a rapid thermal annealing (for 90 s at 680 deg. C). The GaAs 1-x N x samples with N content up to 1.5% (x = 0.0%, 0.1%, 0.5%, 1.5%), are investigated using room temperature spectroscopic ellipsometry (SE). The optical transitions in the spectral region around 3 eV are analyzed by fitting analytical critical point line shapes to the second derivative of the dielectric function. It was found that the features associated with E 1 and E 1 + Δ 1 transitions are blue-shifted and become less sharp with increasing nitrogen incorporation, in contrast to the case of E 0 transition energy in GaAs 1-x N x . An increase of the split-off Δ 1 energy with nitrogen content was also obtained, in agreement to results found with MOVPE GaAs 1-x N x grown samples

  15. First-principles investigations on structural, elastic and mechanical properties of BNxAs1‑x ternary alloys (United States)

    Zhang, Junqin; Ma, Huihui; Zhao, Bin; Wei, Qun; Yang, Yintang


    A systematic investigation of the structural optimization, elastic and mechanical properties of the BNxAs1‑x ternary alloys are reported in the present work using the density-functional theory with the generalized gradient approximation (GGA) of the exchange-correlation functional. Some of the constants which are used to analyze the properties including elastic constants and modulus, and some parameters describing the elastic anisotropy and Debye temperature are also calculated. Our calculations were performed to evaluate the equilibrium lattice constant and band structure compared with the available theoretical works. On the one hand, our results might be expected to provide a theoretical basis for future study of BNxAs1‑x alloys towards elastic or mechanical properties. On the other hand, we draw a conclusion that BNxAs1‑x alloys show direct bandgap when x equals 0.25, 0.5 or 0.75. We obtained the elastic modulus, Poisson’s ratio and universal anisotropic index which are used to demonstrate the elastic anisotropy of these alloys which is proved according to our calculations. Also, we calculated the Debye temperature to illustrate covalent interactions and obtained the lower limit of the thermal conductivity for further research.

  16. Possible measurements of gamma ray astronomy through the detection of EAS particles in Chacaltaya (5220 m a.s.1.)

    International Nuclear Information System (INIS)

    Morello, C.; Navarra, G.; Martinic, N.; Miranda, P.; Turtelli Junior, A.


    Since the beginning of August'82 an array for measurements of cosmic ray variations is operating at the Chacaltaya Laboratory (Bolivia, 5220 m a.s.1.). The possibility of using the same detector for measurements of high energy Gamma-Ray Astronomy from the Galactic Center and the sources PSR 0833-45 and Centaurus A is discussed. In one year of continuous operation a flux: S(E 0 >2.5x10 4 GeV) = 10 -11 Ph/cm 2 sec can be detected from a point source within a confidence level of 3 s.d. (Author) [pt

  17. A Transcriptional Regulatory Mechanism Finely Tunes the Firing of Type VI Secretion System in Response to Bacterial Enemies. (United States)

    Lazzaro, Martina; Feldman, Mario F; García Véscovi, Eleonora


    The ability to detect and measure danger from an environmental signal is paramount for bacteria to respond accordingly, deploying strategies that halt or counteract potential cellular injury and maximize survival chances. Type VI secretion systems (T6SSs) are complex bacterial contractile nanomachines able to target toxic effectors into neighboring bacteria competing for the same colonization niche. Previous studies support the concept that either T6SSs are constitutively active or they fire effectors in response to various stimuli, such as high bacterial density, cell-cell contact, nutrient depletion, or components from dead sibling cells. For Serratia marcescens , it has been proposed that its T6SS is stochastically expressed, with no distinction between harmless or aggressive competitors. In contrast, we demonstrate that the Rcs regulatory system is responsible for finely tuning Serratia T6SS expression levels, behaving as a transcriptional rheostat. When confronted with harmless bacteria, basal T6SS expression levels suffice for Serratia to eliminate the competitor. A moderate T6SS upregulation is triggered when, according to the aggressor-prey ratio, an unbalanced interplay between homologous and heterologous effectors and immunity proteins takes place. Higher T6SS expression levels are achieved when Serratia is challenged by a contender like Acinetobacter , which indiscriminately fires heterologous effectors able to exert lethal cellular harm, threatening the survival of the Serratia population. We also demonstrate that Serratia 's RcsB-dependent T6SS regulatory mechanism responds not to general stress signals but to the action of specific effectors from competitors, displaying an exquisite strategy to weigh risks and keep the balance between energy expenditure and fitness costs. IMPORTANCE Serratia marcescens is among the health-threatening pathogens categorized by the WHO as research priorities to develop alternative antimicrobial strategies, and it was

  18. Transcription factors AS1 and AS2 interact with LHP1 to repress KNOX genes in Arabidopsis. (United States)

    Li, Zhongfei; Li, Bin; Liu, Jian; Guo, Zhihao; Liu, Yuhao; Li, Yan; Shen, Wen-Hui; Huang, Ying; Huang, Hai; Zhang, Yijing; Dong, Aiwu


    Polycomb group proteins are important repressors of numerous genes in higher eukaryotes. However, the mechanism by which Polycomb group proteins are recruited to specific genes is poorly understood. In Arabidopsis, LIKE HETEROCHROMATIN PROTEIN 1 (LHP1), also known as TERMINAL FLOWER 2, was originally proposed as a subunit of polycomb repressive complex 1 (PRC1) that could bind the tri-methylated lysine 27 of histone H3 (H3K27me3) established by the PRC2. In this work, we show that LHP1 mainly functions with PRC2 to establish H3K27me3, but not with PRC1 to catalyze monoubiquitination at lysine 119 of histone H2A. Our results show that complexes of the transcription factors ASYMMETRIC LEAVES 1 (AS1) and AS2 could help to establish the H3K27me3 modification at the chromatin regions of Class-I KNOTTED1-like homeobox (KNOX) genes BREVIPEDICELLUS and KNAT2 via direct interactions with LHP1. Additionally, our transcriptome analysis indicated that there are probably more common target genes of AS1 and LHP1 besides Class-I KNOX genes during leaf development in Arabidopsis. © 2016 Institute of Botany, Chinese Academy of Sciences.

  19. Growth and electrical characterization of Zn-doped InAs and InAs1-xSbx

    International Nuclear Information System (INIS)

    Venter, A.; Shamba, P.; Botha, L.; Botha, J.R.


    The electrical properties of Zn doped InAs and InAsSb layers grown on semi-insulating GaAs by metal organic vapour phase epitaxy, using dimethyl zinc as the p-type dopant source, have been studied. The influence of dopant flow rate, V/III ratio and substrate orientation on the electrical properties of these InAs and InAs 1-x Sb x layers have been studied at a few appropriate growth temperatures. A promising group V source, tertiary butyl arsenic was used as an alternative to arsenic hydride in the case of InAs growth. The electrical properties of the InAs and InAs 1-x Sb x epitaxial layers were mainly studied by the Hall effect. However, surface accumulation in these materials results in deceptive Hall results being extracted. A two layer model (assuming the layer to consist of two parallel conducting paths viz. surface and bulk) has therefore been used to extract sensible transport properties. In addition, conventional Hall measurements ignores the high electron to hole mobility ratio in InAs and InAsSb leading to erroneous transport properties.

  20. Calculation of Nonlinear Thermoelectric Coefficients of InAs1-xSbx Using Monte Carlo Method

    Energy Technology Data Exchange (ETDEWEB)

    Sadeghian, RB; Bahk, JH; Bian, ZX; Shakouri, A


    It was found that the nonlinear Peltier effect could take place and increase the cooling power density when a lightly doped thermoelectric material is under a large electrical field. This effect is due to the Seebeck coefficient enhancement from an electron distribution far from equilibrium. In the nonequilibrium transport regime, the solution of the Boltzmann transport equation in the relaxation-time approximation ceases to apply. The Monte Carlo method, on the other hand, proves to be a capable tool for simulation of semiconductor devices at small scales as well as thermoelectric effects with local nonequilibrium charge distribution. InAs1-xSb is a favorable thermoelectric material for nonlinear operation owing to its high mobility inherited from the binary compounds InSb and InAs. In this work we report simulation results on the nonlinear Peltier power of InAs1-xSb at low doping levels, at room temperature and at low temperatures. The thermoelectric power factor in nonlinear operation is compared with the maximum value that can be achieved with optimal doping in the linear transport regime.