DEFF Research Database (Denmark)
Lindholm Carlstrom, Eva; Saetre, Peter; Rosengren, Anders
2012-01-01
ABSTRACT: BACKGROUND: The serotonin (5-hydroxytryptamin; 5-HT) system has a central role in the circuitry of cognition and emotions. Multiple lines of evidence suggest that genetic variation in the serotonin transporter gene (SLC6A4; 5-HTT) is associated with schizophrenia and suicidal behavior. ...
Directory of Open Access Journals (Sweden)
Lindholm Carlström Eva
2012-05-01
Full Text Available Abstract Background The serotonin (5-hydroxytryptamin; 5-HT system has a central role in the circuitry of cognition and emotions. Multiple lines of evidence suggest that genetic variation in the serotonin transporter gene (SLC6A4; 5-HTT is associated with schizophrenia and suicidal behavior. In this study, we wanted to elucidate whether SLC6A4 variations is involved in attempted suicide among patients with schizophrenia in a Scandinavian case–control sample. Methods Patients diagnosed with schizophrenia from three Scandinavian samples were assessed for presence or absence of suicide attempts, based on record reviews and interview data. Seven SLC6A4 single nucleotide polymorphisms (SNPs were genotyped in 837 schizophrenia patients and 1,473 control individuals. Association analyses and statistical evaluations were performed with the program UNPHASED (version 3.0.9. Results We observed an allele association between the SNP rs16965628, located in intron one of SLC6A4, and attempted suicide (adjusted p-value 0.01, among patients with schizophrenia. No association was found to a diagnosis of schizophrenia, when patients were compared to healthy control individuals. Conclusion The gene SLC6A4 appears to be involved in suicidal ideation among patients with schizophrenia. Independent replication is needed before more firm conclusions can be drawn.
Directory of Open Access Journals (Sweden)
Sofia Blazevic
Full Text Available We tested the hypothesis that gestational diabetes mellitus (GDM alters the DNA methylation pattern of the fetal serotonin transporter gene (SLC6A4, and examined the functional relevance of DNA methylation for regulation of the SLC6A4 expression in the human placenta. The study included 50 mother-infant pairs. Eighteen mothers were diagnosed with GDM and 32 had normal glucose tolerance (NGT. All neonates were of normal birth weight and born at term by planned Cesarean section. DNA and RNA were isolated from samples of tissue collected from the fetal side of the placenta immediately after delivery. DNA methylation was quantified at 7 CpG sites within the SLC6A4 distal promoter region using PCR amplification of bisulfite treated DNA and subsequent DNA sequencing. SLC6A4 mRNA levels were measured by reverse transcription-quantitative PCR (RT-qPCR. Functional SLC6A4 polymorphisms (5HTTLPR, STin2, rs25531 were genotyped using standard PCR-based procedures. Average DNA methylation across the 7 analyzed loci was decreased in the GDM as compared to the NGT group (by 27.1%, p = 0.037 and negatively correlated, before and after adjustment for potential confounder/s, with maternal plasma glucose levels at the 24th to 28th week of gestation (p0.05. The results suggest that DNA methylation of the fetal SLC6A4 gene is sensitive to the maternal metabolic state in pregnancy. They also indicate a predominant role of epigenetic over genetic mechanisms in the regulation of SLC6A4 expression in the human placenta. Longitudinal studies in larger cohorts are needed to verify these results and determine to which degree placental SLC6A4 changes may contribute to long-term outcomes of infants exposed to GDM.
Association study of serotonin transporter SLC6A4 gene with Chinese Han irritable bowel syndrome.
Directory of Open Access Journals (Sweden)
Jing Yuan
Full Text Available OBJECTIVE: Irritable bowel syndrome (IBS is a common clinical gastrointestinal dysfunction disorders. 5-sertonon (5-hydroxytryptamine, 5-HT is a very important neurotransmitter, which is involved in gastrointestinal motion and sensation. Solute carrier family 6 member 4 (SLC6A4 gene encode serotonin transporter (SERT which function is to rapidly reuptake the most of 5-HT. Therefore, it is needed to explore the association between SLC6A4 gene polymorphisms and IBS. METHODS: 119 patients and 238 healthy controls were administrated to detect the SLC6A4 gene polymorphisms including 5-HT-transporter-gene-linked polymorphic region (5-HTTLPR, variable number of tandem repeats (VNTRs and three selected tag Single Nucleotide Polymorphisms (SNPs rs1042173, rs3794808, rs2020936 by using polymerase chain reaction (PCR and TaqMan® SNP Genotyping. RESULTS: There were significant difference for 5-HTTLPR between IBS and control groups (X2 = 106.168, P<0.0001. In control group, genotypes were mainly L/L (58.4%, however, the genotypes in IBS were S/S (37.8%. The significant difference was shown in D-IBS subjects when compared to the controls (X(2 = 50.850, P<0.0001 for 5-HTTLPR. For STin2 VNTR, rs1042173, rs3794808, and rs2020936 polymorphisms, there were no any significant differences between IBS and control groups. There were no statistical significantly haplotypes for 5-HTTLPR, VNTRs and the three SNPs between IBS and controls. CONCLUSION: The S allele in 5-HTTLPR was a susceptible allele with Chinese Han IBS, but other associations of VNTRs, three selected Tag SNPs and positive haplotype with IBS were not found. It is indicated that much research are needed to study the relationship between other polymorphisms in SLC6A4 gene and IBS.
Montirosso, Rosario; Provenzi, Livio; Fumagalli, Monica; Sirgiovanni, Ida; Giorda, Roberto; Pozzoli, Uberto; Beri, Silvana; Menozzi, Giorgia; Tronick, Ed; Morandi, Francesco; Mosca, Fabio; Borgatti, Renato
2016-01-01
Preterm birth and Neonatal Intensive Care Unit (NICU) stay are early adverse stressful experiences, which may result in an altered temperamental profile. The serotonin transporter gene ("SLC6A4"), which has been linked to infant temperament, is susceptible to epigenetic regulation associated with early stressful experience. This study…
Directory of Open Access Journals (Sweden)
Whitney eWeikum
2013-10-01
Full Text Available Prenatal exposure to serotonin reuptake inhibitor (SRI antidepressants and maternal depression may affect prefrontal cognitive skills (executive functions; EFs including self-control, working memory and cognitive flexibility. We examined long-term effects of prenatal SRI exposure on EFs to determine whether effects are moderated by maternal mood and/or genetic variations in SLC6A4 (a gene that codes for the serotonin transporter [5-HTT] central to the regulation of synaptic serotonin levels and behavior. Children who were exposed to SRIs prenatally (SRI-exposed N=26 and non-exposed (N=38 were studied at age 6 years (M=6.3 SD=0.5 using the Hearts & Flowers task (H&F to assess EFs. Maternal mood was measured during pregnancy (3rd trimester and when the child was age 6 years (Hamilton Depression Scale. Parent reports of child behavior were also obtained (MacArthur Health & Behavior Questionnaire. Parents of prenatally SRI-exposed children reported fewer child externalizing and inattentive (ADHD behaviors. Generalized estimate equation modeling showed a significant 3-way interaction between prenatal SRI exposure, SLC6A4 variant, and maternal mood at the 6-year time-point on H&F accuracy. For prenatally SRI-exposed children, regardless of maternal mood, the H&F accuracy of children with reduced 5HTT expression (a short [S] allele remained stable. Even with increasing maternal depressive symptoms (though all below clinical threshold, EFs of children with at least one short allele were comparable to children with the same genotype whose mothers reported few if any depressive symptoms – in this sense they showed resilience. Children with two long (L alleles were more sensitive to context. When their mothers had few depressive symptoms, LL children showed extremely good EF performance – better than any other group. When their mothers reported more depressive symptoms, LL children’s EF performance was worse than that of any other group.
Directory of Open Access Journals (Sweden)
Mignon Laurence
2010-02-01
Full Text Available Abstract Background Mental deficiency has been linked to abnormalities in cortical neuronal network connectivity and plasticity. These mechanisms are in part under the control of two interacting signalling pathways, the serotonergic and the brain-derived neurotrophic (BDNF pathways. The aim of the current paper is to determine whether particular alleles or genotypes of two crucial genes of these systems, the serotonin transporter gene (SLC6A4 and the brain-derived neurotrophic factor gene (BDNF, are associated with mental deficiency (MD. Methods We analyzed four functional polymorphisms (rs25531, 5-HTTLPR, VNTR, rs3813034 of the SLC6A4 gene and one functional polymorphism (Val66 Met of the BDNF gene in 98 patients with non-syndromic mental deficiency (NS-MD and in an ethnically matched control population of 251 individuals. Results We found no significant differences in allele and genotype frequencies in the five polymorphisms studied in the SLC6A4 and BDNF genes of NS-MD patients versus control patients. While the comparison of the patterns of linkage disequilibrium (D' in the control and NS-MD populations revealed a degree of variability it did not, however, reach significance. No significant differences in frequencies of haplotypes and genotypes for VNTR/rs3813034 and rs25531/5-HTTLPR were observed. Conclusion Altogether, results from the present study do not support a role for any of the five functional polymorphisms of SLC6A4 and BDNF genes in the aetiology of NS-RM. Moreover, they suggest no epistatic interaction in NS-MD between polymorphisms in BDNF and SLC6A4. However, we suggest that further studies on these two pathways in NS-MD remain necessary.
SLC6 Neurotransmitter Transporters: Structure, Function, and Regulation
DEFF Research Database (Denmark)
Kristensen, Anders S; Andersen, Jacob; Jørgensen, Trine N
2011-01-01
The neurotransmitter transporters (NTTs) belonging to the solute carrier 6 (SLC6) gene family (also referred to as the neurotransmitter-sodium-symporter family or Na(+)/Cl(-)-dependent transporters) comprise a group of nine sodium- and chloride-dependent plasma membrane transporters...... for the monoamine neurotransmitters serotonin (5-hydroxytryptamine), dopamine, and norepinephrine, and the amino acid neurotransmitters GABA and glycine. The SLC6 NTTs are widely expressed in the mammalian brain and play an essential role in regulating neurotransmitter signaling and homeostasis by mediating uptake...... of released neurotransmitters from the extracellular space into neurons and glial cells. The transporters are targets for a wide range of therapeutic drugs used in treatment of psychiatric diseases, including major depression, anxiety disorders, attention deficit hyperactivity disorder and epilepsy...
Ramos, Lucero Rengifo; Arias, Duverney Gaviria; Salazar, Liliana Salazar; Vélez, Juan Pablo; Pardo, Stella Lozano
2012-03-01
The indel polymorphisms in the promoting region and the 2(nd) intron polymorphisms in the serotonin transporter gene (SLC6A4) have been associated to bipolar disorder 1 (BD1) in several population studies. The objective was to analyze the genotypic and allelic frequencies in both gene regions in a study of cases and controls with individuals from Risaralda and Quindío (Colombia) so as to establish possible associations to BD1, and compare results with previous and similar studies. 133 patients and 120 controls were studied. L and S indel polymorphisms in the promoting region were analyzed by PCR, together with VNTR STin2.10 and STin 2.12 VNTRs polymorphisms in the 2(nd) intron of the SL-C6A4 gene Genotypic and allelic frequencies for the S and L polymorphisms were similar both in cases and controls. However, the LL genotype was significantly increased both in BD1 population (OR=1.89; CI95%=1.1-3.68), and when discriminated by gender. This particular genotype in general population is OR=2.22; IC95%=1.04-5.66 for women, and OR=1.62; IC 95%=0.71-4.39 for men. No significant genotypic and allelic differences were found for VNTR STin2.10 and STin 2.12. polymorphisms. No association was found between polymorphisms of 5-HTTLPR polymorphisms and the 2(nd) intron of the serotonin transporting gene in general patients with BD1, nor when compared by gender. Our results are similar to those reported for Caucasian populations and differ from those of Asian and Brazilian populations. Copyright © 2012 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.
Investigation of SLC6A4 gene expression in autism spectrum disorders
Directory of Open Access Journals (Sweden)
Elif Funda Şener
2015-06-01
Full Text Available Objective: Autism is defined as a complex neurodevelopmental disorder. Genetics plays a major role in the etiology of autism spectrum disorders (ASD. The role of the serotonin in the development of autism has been widely investigated. SLC6A4 gene (SERT or 5-HT has an important role reuptaking of serotonin. Because of this, our study examined the expression level of SLC6A4 gene in autism patients. Methods: Thirty-four patients (26 male, 8 female who diagnosed as autism firstly according to DSM-V criteria in the Department of child psychiatry, Erciyes University Medical Faculty and healthy 23 controls (16 male, 7 female were enrolled in this study. Total RNA was isolated from peripheral blood samples using TRIzol. Quantitative Real-time PCR (qRT-PCR was performed to detect SLC6A4 gene expression. Results: SLC6A4 gene expression was found statistically significant and low in autism group compared with controls (p=0,027. Conclusion: The low gene expression in the patient group implied that there is an abnormality of serotonin reuptake. According to our results, we suggest that much more studies may be planned with the expression and methylation profile of this gene combined with gene polymorphisms especially affecting the expression in larger sample sizes. J Clin Exp Invest 2015; 6 (2: 165-169
Looking on the bright side of serotonin transporter gene variation.
Homberg, J.R.; Lesch, K.P.
2011-01-01
Converging evidence indicates an association of the short (s), low-expressing variant of the repeat length polymorphism, serotonin transporter-linked polymorphic region (5-HTTLPR), in the human serotonin transporter gene (5-HTT, SERT, SLC6A4) with anxiety-related traits and increased risk for
Peralta-Leal, Valeria; Leal-Ugarte, Evelia; Meza-Espinoza, Juan P.; Dávalos-Rodríguez, Ingrid P.; Bocanegra-Alonso, Anabel; Acosta-González, Rosa I.; Gonzales, Enrique; Nair, Saraswathy; Durán-González, Jorge
2012-01-01
The serotonergic system has been hypothesized to contribute to the biological susceptibility to type 2 diabetes mellitus (T2DM) and body-mass index (BMI) categories. We investigate a possible association of 5-HTTLPR polymorphism (L and S alleles) in the promoter region of the serotonin transporter gene (SLC6A4) with the development of T2DM and/or higher BMI by analyzing a sample of 138 individuals diagnosed with T2DM and 172 unrelated controls from the Mexican general population. In the total sample genotypes were distributed according to Hardy-Weinberg equilibrium, and S allele frequency was 0.58. There was no statistical association between 5-HTTLPR polymorphism and the development of T2DM in this Mexican population sample (p = 0.12). Nevertheless, logistic regression analysis of the L allele and increased BMI disclosed an association, after adjusting for age, sex and T2DM (p = 0.02, OR 1.74, 95% CI: 1.079–2.808). PMID:23055796
Directory of Open Access Journals (Sweden)
Dongsha Wang
Full Text Available The main challenge in addressing the role of DNA methylation in human behaviour is the fact that the brain is inaccessible to epigenetic analysis in living humans. Using positron emission tomography (PET measures of brain serotonin (5-HT synthesis, we found in a longitudinal sample that adult males with high childhood-limited aggression (C-LHPA had lower in vivo 5-HT synthesis in the orbitofrontal cortex (OBFC. Here we hypothesized that 5-HT alterations associated with childhood aggression were linked to differential DNA methylation of critical genes in the 5-HT pathway and these changes were also detectable in peripheral white blood cells. Using pyrosequencing, we determined the state of DNA methylation of SLC6A4 promoter in T cells and monocytes isolated from blood of cohort members (N = 25 who underwent a PET scan, and we examined whether methylation status in the blood is associated with in vivo brain 5-HT synthesis. Higher levels of methylation were observed in both T cells and monocytes at specific CpG sites in the C-LHPA group. DNA methylation of SLC6A4 in monocytes appears to be associated more reliably with group membership than T cells. In both cell types the methylation state of these CpGs was associated with lower in vivo measures of brain 5-HT synthesis in the left and right lateral OBFC (N = 20 where lower 5-HT synthesis in C-LHPA group was observed. Furthermore, in vitro methylation of the SLC6A4 promoter in a luciferase reporter construct suppresses its transcriptional activity supporting a functional role of DNA methylation in SLC6A4 promoter regulation. These findings indicate that state of SLC6A4 promoter methylation is altered in peripheral white blood cells of individuals with physical aggression during childhood. This supports the relevance of peripheral DNA methylation for brain function and suggests that peripheral SLC6A4 DNA methylation could be a marker of central 5-HT function.
Hippocampal volume and serotonin transporter polymorphism in major depressive disorder
DEFF Research Database (Denmark)
Ahdidan, Jamila; Foldager, Leslie; Rosenberg, Raben
2013-01-01
Objective: The main aim of the present study was to replicate a previous finding in major depressive disorder (MDD) of association between reduced hippocampal volume and the long variant of the di- and triallelic serotonin transporter polymorphism in SLC6A4 on chromosome 17q11.2. Secondarily, we...... that we aimed to replicate, and no significant associations with the serotonin transporter polymorphism were found. Conclusions: The present quantitative and morphometric MRI study was not able to replicate the previous finding of association between reduced hippocampal volume in depressed patients...... and the serotonin transporter polymorphism....
DEFF Research Database (Denmark)
Keers, R.; Uher, R.; Huezo-Diaz, P.
2011-01-01
, and several polymorphisms in the serotonin transporter gene (SLC6A4) have been genotyped including the serotonin transporter-linked polymorphic region (5-HTTLPR). Stressful life events were shown to predict a significantly better response to escitalopram but had no effect on response to nortriptyline...
DEFF Research Database (Denmark)
Kniazeff, Julie; Loland, Claus Juul; Goldberg, Naomi
2005-01-01
The extracellular concentration of the neurotransmitters dopamine, serotonin, norepinephrine, GABA and glycine is tightly controlled by plasma membrane transporters belonging to the SLC6 gene family. A very large number of putative transport proteins with a remarkable homology to the SLC6...... proximity between TM 7 and 8 in the tertiary structure of TnaT as previously suggested for the mammalian counterparts. Furthermore, the inhibition of uptake upon cross-linking the two cysteines provides indirect support for a conserved conformational role of these transmembrane domains in the transport...
Directory of Open Access Journals (Sweden)
Aniruddha Basu
2015-01-01
Full Text Available Background & objectives: Genetic factors have potential of predicting response to antidepressants in patients with major depressive disorder (MDD. In this study, an attempt was made to find an association between response to escitalopram in patients with MDD, and serotonin transporter (SLC6A4 and receptor (5HTR1A, 5HTR2A polymorphisms. Methods: Fifty five patients diagnosed as suffering from MDD, were selected for the study. The patients were treated with escitalopram over a period of 6-8 wk. Severity of depression, response to treatment and side effects were assessed using standardised instruments. Genetic variations from HTR1A (rs6295, HTR2A (rs6311 and rs6313 and SLC6A4 (44 base-pair insertion/deletion at 5-HTTLPR were genotyped. The genetic data of the responders and non-responders were compared to assess the role of genetic variants in therapeutic outcome. Results: Thirty six (65.5% patients responded to treatment, and 19 (34.5% had complete remission. No association was observed for genotype and allelic frequencies of single nucleotide polymorphisms (SNPs among remitter/non-remitter and responder/non-responder groups, and six most common side-effects, except memory loss which was significantly associated with rs6311 ( p0 =0.03. Interpretation & conclusions: No significant association was found between the SNPs analysed and response to escitalopram in patients with MDD though a significant association was seen between the side effect of memory loss and rs6311. Studies with larger sample are required to find out genetic basis of antidepressant response in Indian patients.
[Role of Serotonin Transporter Gene in Eating Disorders].
Hernández-Muñoz, Sandra; Camarena-Medellin, Beatriz
2014-01-01
The serotoninergic system has been implicated in mood and appetite regulation, and the serotonin transporter gene (SLC6A4) is a commonly studied candidate gene for eating disorders. However, most studies have focused on a single polymorphism (5-HTTLPR) in SLC6A4. We present the studies published on the association between eating disorders (ED) and 5-HTTLPR polymorphism in anorexia nervosa (AN), bulimia nervosa (BN), and eating disorders not otherwise specified (EDNOS). Search of databases: MEDLINE, ISI, and PubMed for SLC6A4 and ED. From a review of 37 original articles, it was suggested that carriers of S allele is a risk factor for eating disorders, especially for AN. However, BN did not show any association. Also, BMI, impulsivity, anxiety, depression, and age of onset have been associated with S allele in ED patients. Copyright © 2013 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.
Upregulation of the Creatine Transporter Slc6A8 by Klotho
Directory of Open Access Journals (Sweden)
Ahmad Almilaji
2014-11-01
Full Text Available Background/Aims: The transmembrane Klotho protein contributes to inhibition of 1,25(OH2D3 formation. The extracellular domain of Klotho protein could function as an enzyme with e.g. β-glucuronidase activity, be cleaved off and be released into blood and cerebrospinal fluid. Klotho regulates several cellular transporters. Klotho protein deficiency accelerates the appearance of age related disorders including neurodegeneration and muscle wasting and eventually leads to premature death. The main site of Klotho protein expression is the kidney. Klotho protein is also appreciably expressed in other tissues including chorioid plexus. The present study explored the effect of Klotho protein on the creatine transporter CreaT (Slc6A8, which participates in the maintenance of neuronal function and survival. Methods: To this end cRNA encoding Slc6A8 was injected into Xenopus oocytes with and without additional injection of cRNA encoding Klotho protein. Creatine transporter CreaT (Slc6A8 activity was estimated from creatine induced current determined by two-electrode voltage-clamp. Results: Coexpression of Klotho protein significantly increased creatine-induced current in Slc6A8 expressing Xenopus oocytes. Coexpression of Klotho protein delayed the decline of creatine induced current following inhibition of carrier insertion into the cell membrane by brefeldin A (5 µM. The increase of creatine induced current by coexpression of Klotho protein in Slc6A8 expressing Xenopus oocytes was reversed by β-glucuronidase inhibitor (DSAL. Similarly, treatment of Slc6A8 expressing Xenopus oocytes with recombinant human alpha Klotho protein significantly increased creatine induced current. Conclusion: Klotho protein up-regulates the activity of creatine transporter CreaT (Slc6A8 by stabilizing the carrier protein in the cell membrane, an effect requiring β-glucuronidase activity of Klotho protein.
Regulators of Slc4 bicarbonate transporter activity
Directory of Open Access Journals (Sweden)
Ian M. Thornell
2015-06-01
Full Text Available The Slc4 family of transporters is comprised of anion exchangers (AE1-4, Na-coupled bicarbonate transporters (NCBTs including electrogenic Na/bicarbonate cotransporters (NBCe1 and NBCe2, electroneutral Na/bicarbonate cotransporters (NBCn1 and NBCn2, and the electroneutral Na-driven Cl-bicarbonate exchanger (NDCBE, as well as a borate transporter (BTR1. These transporters regulate intracellular pH (pHi and contribute to steady-state pHi, but are also involved in other physiological processes including CO2 carriage by red blood cells and solute secretion/reabsorption across epithelia. Acid-base transporters function as either acid extruders or acid loaders, with the Slc4 proteins moving HCO3– either into or out of cells. According to results from both molecular and functional studies, multiple Slc4 proteins and/or associated splice variants with similar expected effects on pHi are often found in the same tissue or cell. Such apparent redundancy is likely to be physiologically important. In addition to regulating pHi, a HCO3– transporter contributes to a cell’s ability to fine tune the intracellular regulation of the cotransported/exchanged ion(s (e.g., Na+ or Cl–. In addition, functionally similar transporters or splice variants with different regulatory profiles will optimize pH physiology and solute transport under various conditions or within subcellular domains. Such optimization will depend on activated signaling pathways and transporter expression profiles. In this review, we will summarize and discuss both classical and more recently identified regulators of the Slc4 proteins. Some of these regulators include traditional second messengers, lipids, binding proteins, autoregulatory domains, and less conventional regulators. The material presented will provide insight into the diversity and physiological significance of multiple members within the Slc4 gene family.
Identification of genetic modifiers of behavioral phenotypes in serotonin transporter knockout rats
Homberg, J.R.; Nijman, I.J.; Kuijpers, S.; Cuppen, E.
2010-01-01
BACKGROUND: Genetic variation in the regulatory region of the human serotonin transporter gene (SLC6A4) has been shown to affect brain functionality and personality. However, large heterogeneity in its biological effects is observed, which is at least partially due to genetic modifiers. To gain
SLC37A1 and SLC37A2 are phosphate-linked, glucose-6-phosphate antiporters.
Directory of Open Access Journals (Sweden)
Chi-Jiunn Pan
Full Text Available Blood glucose homeostasis between meals depends upon production of glucose within the endoplasmic reticulum (ER of the liver and kidney by hydrolysis of glucose-6-phosphate (G6P into glucose and phosphate (P(i. This reaction depends on coupling the G6P transporter (G6PT with glucose-6-phosphatase-α (G6Pase-α. Only one G6PT, also known as SLC37A4, has been characterized, and it acts as a P(i-linked G6P antiporter. The other three SLC37 family members, predicted to be sugar-phosphate:P(i exchangers, have not been characterized functionally. Using reconstituted proteoliposomes, we examine the antiporter activity of the other SLC37 members along with their ability to couple with G6Pase-α. G6PT- and mock-proteoliposomes are used as positive and negative controls, respectively. We show that SLC37A1 and SLC37A2 are ER-associated, P(i-linked antiporters, that can transport G6P. Unlike G6PT, neither is sensitive to chlorogenic acid, a competitive inhibitor of physiological ER G6P transport, and neither couples to G6Pase-α. We conclude that three of the four SLC37 family members are functional sugar-phosphate antiporters. However, only G6PT/SLC37A4 matches the characteristics of the physiological ER G6P transporter, suggesting the other SLC37 proteins have roles independent of blood glucose homeostasis.
Directory of Open Access Journals (Sweden)
Nabanita Chatterjee
2011-01-01
Full Text Available The SLC6 class of membrane transporters, known primarily as neurotransmitter transporters, is increasingly appreciated for its roles in nutritional uptake of amino acids and other developmentally specific functions. A Drosophila SLC6 gene, Neurotransmitter transporter-like (Ntl, is expressed only in the male germline. Mobilization of a transposon inserted near the 3' end of the Ntl coding region yields male-sterile mutants defining a single complementation group. Germline transformation with Ntl cDNAs under control of male germline-specific control elements restores Ntl/Ntl homozygotes to normal fertility, indicating that Ntl is required only in the germ cells. In mutant males, sperm morphogenesis appears normal, with elongated, individualized and coiled spermiogenic cysts accumulating at the base of the testes. However, no sperm are transferred to the seminal vesicle. The level of polyglycylation of Ntl mutant sperm tubulin appears to be significantly lower than that of wild type controls. Glycine transporters are the most closely related SLC6 transporters to Ntl, suggesting that Ntl functions as a glycine transporter in developing sperm, where augmentation of the cytosolic pool of glycine may be required for the polyglycylation of the massive amounts of tubulin in the fly's giant sperm. The male-sterile phenotype of Ntl mutants may provide a powerful genetic system for studying the function of an SLC6 transporter family in a model organism.
Fumeron, Frédéric; Betoulle, Dina; Nicaud, Viviane; Evans, Alun; Kee, Frank; Ruidavets, Jean-Bernard; Arveiler, Dominique; Luc, Gérald; Cambien, François
2002-06-25
Depression is a risk factor for myocardial infarction (MI). Selective serotonin reuptake inhibitors reduce this risk. The site of action is the serotonin transporter (SLC6A4), which is expressed in brain and blood cells. A functional polymorphism in the promoter region of the SLC6A4 gene has been described. This polymorphism may be associated with the risk of MI. The SLC6A4 polymorphism has been investigated by polymerase chain reaction in 671 male patients with MI and in 688 controls from the Etude Cas-Témoins de l'Infarctus du Myocarde (ECTIM) multicentric study. Percentages for LL, LS, and SS genotypes were 35.5%, 45.4%, and 19.1%, respectively, for cases versus 28.1%, 49.1%, and 22.8%, respectively, for controls. S allele frequency was 41.8% and 47.4% for cases and controls, respectively. After adjustment for age and center by using multivariable logistic regression, the odds ratio for MI associated with the LL genotype was 1.40 (95% CI 1.11 to 1.76, P=0.0047). The LL genotype of the SLC6A4 polymorphism is associated with a higher risk of MI. This could be attributable to the effect of the polymorphism on serotonin-mediated platelet activation or smooth muscle cell proliferation or on other risk factors, such as depression or response to stress.
Ross, Robert S; Medrano, Paolo; Boyle, Kaitlin; Smolen, Andrew; Curran, Tim; Nyhus, Erika
2015-11-01
Recognition memory is defined as the ability to recognize a previously encountered stimulus and has been associated with spatially and temporally distinct event-related potentials (ERPs). Allelic variations of the serotonin transporter gene (SLC6A4) have recently been shown to impact memory performance. Common variants of the serotonin transporter-linked polymorphic region (5HTTLPR) of the SLC6A4 gene result in long (l) and short (s) allelic variants with carriers of the s allele having lowered transcriptional efficiency. Thus, the current study examines the effects polymorphisms of the SLC6A4 gene have on performance and ERP amplitudes commonly associated with recognition memory. Electroencephalogram (EEG), genetic, and behavioral data were collected from sixty participants as they performed an item and source memory recognition task. In both tasks, participants studied and encoded 200 words, which were then mixed with 200 new words during retrieval. Participants were monitored with EEG during the retrieval portion of each memory task. EEG electrodes were grouped into four ROIs, left anterior superior, right anterior superior, left posterior superior, and right posterior superior. ERP mean amplitudes during hits in the item and source memory task were compared to correctly recognizing new items (correct rejections). Results show that s-carriers have decreased mean hit amplitudes in both the right anterior superior ROI 1000-1500ms post stimulus during the source memory task and the left anterior superior ROI 300-500ms post stimulus during the item memory task. These results suggest that individual differences due to genetic variation of the serotonin transporter gene influences recognition memory. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Hauser Michael A
2011-05-01
Full Text Available Abstract Background Serotonergic system dysfunction has been implicated in posttraumatic stress disorder (PTSD. Genetic polymorphisms associated with serotonin signaling may predict differences in brain circuitry involved in emotion processing and deficits associated with PTSD. In healthy individuals, common functional polymorphisms in the serotonin transporter gene (SLC6A4 have been shown to modulate amygdala and prefrontal cortex (PFC activity in response to salient emotional stimuli. Similar patterns of differential neural responses to emotional stimuli have been demonstrated in PTSD but genetic factors influencing these activations have yet to be examined. Methods We investigated whether SLC6A4 promoter polymorphisms (5-HTTLPR, rs25531 and several downstream single nucleotide polymorphisms (SNPs modulated activity of brain regions involved in the cognitive control of emotion in post-9/11 veterans with PTSD. We used functional MRI to examine neural activity in a PTSD group (n = 22 and a trauma-exposed control group (n = 20 in response to trauma-related images presented as task-irrelevant distractors during the active maintenance period of a delayed-response working memory task. Regions of interest were derived by contrasting activation for the most distracting and least distracting conditions across participants. Results In patients with PTSD, when compared to trauma-exposed controls, rs16965628 (associated with serotonin transporter gene expression modulated task-related ventrolateral PFC activation and 5-HTTLPR tended to modulate left amygdala activation. Subsequent to combat-related trauma, these SLC6A4 polymorphisms may bias serotonin signaling and the neural circuitry mediating cognitive control of emotion in patients with PTSD. Conclusions The SLC6A4 SNP rs16965628 and 5-HTTLPR are associated with a bias in neural responses to traumatic reminders and cognitive control of emotions in patients with PTSD. Functional MRI may help identify
DEFF Research Database (Denmark)
Christensen, Henriette L; Nguyen, An T; Pedersen, Fredrik D
2013-01-01
The choroid plexus epithelium (CPE) is located in the ventricular system of the brain, where it secretes the majority of the cerebrospinal fluid (CSF) that fills the ventricular system and surrounds the central nervous system. The CPE is a highly vascularized single layer of cuboidal cells....... Genetically modified mice targeting slc4a2, slc4a5, slc4a7, slc4a10, and slc9a1 have been generated. Deletion of slc4a5, 7 or 10, or slc9a1 has numerous impacts on CP function and structure in these mice. Removal of the transporters affects brain ventricle size (slc4a5 and slc4a10) and intracellular p...
Sulik, Michael J.; Eisenberg, Nancy; Lemery-Chalfant, Kathryn; Spinrad, Tracy L.; Silva, Kassondra M.; Eggum, Natalie D.; Betkowski, Jennifer A.; Kupfer, Anne; Smith, Cynthia L.; Gaertner, Bridget; Stover, Daryn A.; Verrelli, Brian C.
2012-01-01
The LPR and STin2 polymorphisms of the serotonin transporter gene (SLC6A4) were combined into haplotypes that, together with quality of maternal parenting, were used to predict initial levels and linear change in children's (N = 138) noncompliance and aggression from age 18-54 months. Quality of mothers' parenting behavior was observed when…
Shei, William; Liu, Jun; Htoon, Hla M; Aung, Tin; Vithana, Eranga N
2013-01-01
To characterize the relative expression levels of all the solute carrier 4 (Slc4) transporter family members (Slc4a1-Slc4a11) in murine corneal endothelium using real-time quantitative (qPCR), to identify further important members besides Slc4a11 and Slc4a4, and to explore how close to the baseline levels the gene expressions remain after cells have been subjected to expansion and culture. Descemet's membrane-endothelial layers of 8-10-week-old C57BL6 mice were stripped from corneas and used for both primary cell culture and direct RNA extraction. Total RNA (from uncultured cells as well as cultured cells at passages 2 and 7) was reverse transcribed, and the cDNA was used for real time qPCR using specific primers for all the Slc4 family members. The geNorm method was applied to determine the most stable housekeeping genes and normalization factor, which was calculated from multiple housekeeping genes for more accurate and robust quantification. qPCR analyses revealed that all Slc4 bicarbonate transporter family members were expressed in mouse corneal endothelium. Slc4a11 showed the highest expression, which was approximately three times higher than that of Slc4a4 (3.4±0.3; p=0.004). All Slc4 genes were also expressed in cultured cells, and interestingly, the expression of Slc4a11 in cultured cells was significantly reduced by approximately 20-fold (0.05±0.001; p=0.000001) in early passage and by approximately sevenfold (0.14±0.002; p=0.000002) in late passage cells. Given the known involvement of SLC4A4 and SLC4A11 in corneal dystrophies, we speculate that the other two highly expressed genes in the uncultured corneal endothelium, SLC4A2 and SLC4A7, are worthy of being considered as potential candidate genes for corneal endothelial diseases. Moreover, as cell culture can affect expression levels of Slc4 genes, caution and careful design of experiments are necessary when undertaking studies of Slc4-mediated ion transport in cultured cells.
Directory of Open Access Journals (Sweden)
Jukka S Alasaari
Full Text Available Shift-working nurses are exposed to a stressful work environment, which puts them at an increased risk for burnout and depression. We explored the effect of environmental stress on serotonin transporter gene (SLC6A4 promoter methylation among nurses from high and low work stress environments.Using bisulfite sequencing, we investigated the methylation status of five CpG residues of a CpG-rich region in the promoter of SLC6A4 by comparing female shift working nurses from a high work stress environment (n = 24 to low work stress environment (n = 25. We also analyzed the association of 5-HTTLPR polymorphism at 5' end of SLC6A4. Work stress was assessed by the Karasek's Model and possible signs of burnout or depression were measured by the Maslach Burnout Index General Survey and Beck Depression Index. Methylation levels were assessed by bisulfite sequencing of DNA extracted from peripheral blood leucocytes. Restriction enzyme treatment followed by standard PCR was used to identify 5-HTTLPR genotypes.We found that nurses in the high stress environment had significantly lower promoter methylation levels at all five CpG residues compared to nurses in the low stress environment (p<0.01. There was no significant interaction of 5-HTTLPR genotype and work stress with methylation (p = 0.58. In unadjusted (bivariate analysis, burnout was not significantly associated to methylation levels. However, when mutually adjusted for both, burnout and work stress were significant contributors (p = 0.038 and p<0.0001 respectively to methylation levels.Our findings show that environmental stress is concurrent with decreased methylation of the SLC6A4 promoter. This may lead to increased transcriptional activity of the gene, increased reuptake of serotonin from synaptic clefts, and termination of the activity of serotonin. This could present a possible coping mechanism for environmental stress in humans that could eventually increase risk for disturbed functional
Patriquin, Michelle A; Hamon, Sara C; Harding, Mark J; Nielsen, Ellen M; Newton, Thomas F; De La Garza, Richard; Nielsen, David A
2017-10-01
This study investigated variants of tryptophan hydroxylase (TPH)1, TPH2, and SLC6A4 in the moderation of the subjective effects of cocaine. Non-treatment-seeking cocaine-dependent individuals (N=66) were intravenously administered saline and cocaine (40 mg) in a randomized order. Participants self-reported subjective effects of cocaine using a visual analog scale starting before administration of saline or cocaine (-15 min) to up to 20 min after infusion. Self-report ratings on the visual analog scale ranged from 0 (no effect) to 100 (greatest effect). Participants were genotyped for the TPH1 rs1799913, TPH2 rs4290270, and SLC6A4 5-HTTLPR variants. Repeated-measures analysis of covariance was used to examine changes in subjective effect scores over time while controlling for population structure. Participants carrying the TPH1 rs1799913 A allele reported greater subjective response to cocaine for 'stimulated' and 'access' relative to the CC genotype group. Those carrying the TPH2 rs4290270 A allele reported higher 'good effect' and lower 'depressed' effect relative to the TT genotype group. Those carrying the SLC6A4 5-HTTLPR S' allele reported greater 'desire' and 'access' compared with the L'L' genotype group. These findings indicate that TPH1, TPH2, and SLC6A4 variants moderate the subjective effects of cocaine in non-treatment-seeking cocaine-dependent participants.
AVPR1a and SLC6A4 Gene Polymorphisms Are Associated with Creative Dance Performance.
Directory of Open Access Journals (Sweden)
2005-09-01
Full Text Available Dancing, which is integrally related to music, likely has its origins close to the birth of Homo sapiens, and throughout our history, dancing has been universally practiced in all societies. We hypothesized that there are differences among individuals in aptitude, propensity, and need for dancing that may partially be based on differences in common genetic polymorphisms. Identifying such differences may lead to an understanding of the neurobiological basis of one of mankind's most universal and appealing behavioral traits-dancing. In the current study, 85 current performing dancers and their parents were genotyped for the serotonin transporter (SLC6A4: promoter region HTTLPR and intron 2 VNTR and the arginine vasopressin receptor 1a (AVPR1a: promoter microsatellites RS1 and RS3. We also genotyped 91 competitive athletes and a group of nondancers/nonathletes (n = 872 subjects from 414 families. Dancers scored higher on the Tellegen Absorption Scale, a questionnaire that correlates positively with spirituality and altered states of consciousness, as well as the Reward Dependence factor in Cloninger's Tridimensional Personality Questionnaire, a measure of need for social contact and openness to communication. Highly significant differences in AVPR1a haplotype frequencies (RS1 and RS3, especially when conditional on both SLC6A4 polymorphisms (HTTLPR and VNTR, were observed between dancers and athletes using the UNPHASED program package (Cocaphase: likelihood ratio test [LRS] = 89.23, p = 0.000044. Similar results were obtained when dancers were compared to nondancers/nonathletes (Cocaphase: LRS = 92.76, p = 0.000024. These results were confirmed using a robust family-based test (Tdtphase: LRS = 46.64, p = 0.010. Association was also observed between Tellegen Absorption Scale scores and AVPR1a (Qtdtphase: global chi-square = 26.53, p = 0.047, SLC6A4 haplotypes (Qtdtphase: chi-square = 2.363, p = 0.018, and AVPR1a conditional on SCL6A4 (Tdtphase: LRS
AVPR1a and SLC6A4 gene polymorphisms are associated with creative dance performance.
Directory of Open Access Journals (Sweden)
Rachel Bachner-Melman
2005-09-01
Full Text Available Dancing, which is integrally related to music, likely has its origins close to the birth of Homo sapiens, and throughout our history, dancing has been universally practiced in all societies. We hypothesized that there are differences among individuals in aptitude, propensity, and need for dancing that may partially be based on differences in common genetic polymorphisms. Identifying such differences may lead to an understanding of the neurobiological basis of one of mankind's most universal and appealing behavioral traits--dancing. In the current study, 85 current performing dancers and their parents were genotyped for the serotonin transporter (SLC6A4: promoter region HTTLPR and intron 2 VNTR and the arginine vasopressin receptor 1a (AVPR1a: promoter microsatellites RS1 and RS3. We also genotyped 91 competitive athletes and a group of nondancers/nonathletes (n = 872 subjects from 414 families. Dancers scored higher on the Tellegen Absorption Scale, a questionnaire that correlates positively with spirituality and altered states of consciousness, as well as the Reward Dependence factor in Cloninger's Tridimensional Personality Questionnaire, a measure of need for social contact and openness to communication. Highly significant differences in AVPR1a haplotype frequencies (RS1 and RS3, especially when conditional on both SLC6A4 polymorphisms (HTTLPR and VNTR, were observed between dancers and athletes using the UNPHASED program package (Cocaphase: likelihood ratio test [LRS] = 89.23, p = 0.000044. Similar results were obtained when dancers were compared to nondancers/nonathletes (Cocaphase: LRS = 92.76, p = 0.000024. These results were confirmed using a robust family-based test (Tdtphase: LRS = 46.64, p = 0.010. Association was also observed between Tellegen Absorption Scale scores and AVPR1a (Qtdtphase: global chi-square = 26.53, p = 0.047, SLC6A4 haplotypes (Qtdtphase: chi-square = 2.363, p = 0.018, and AVPR1a conditional on SCL6A4 (Tdtphase: LRS
Mutations in the GABA Transporter SLC6A1 Cause Epilepsy with Myoclonic-Atonic Seizures
DEFF Research Database (Denmark)
Carvill, Gemma L; McMahon, Jacinta M; Schneider, Amy
2015-01-01
GAT-1, encoded by SLC6A1, is one of the major gamma-aminobutyric acid (GABA) transporters in the brain and is responsible for re-uptake of GABA from the synapse. In this study, targeted resequencing of 644 individuals with epileptic encephalopathies led to the identification of six SLC6A1 mutatio...
Mutations in the GABA Transporter SLC6A1 Cause Epilepsy with Myoclonic-Atonic Seizures
Carvill, Gemma L.; McMahon, Jacinta M.; Schneider, Amy; Zemel, Matthew; Myers, Candace T.; Saykally, Julia; Nguyen, John; Robbiano, Angela; Zara, Federico; Specchio, Nicola; Mecarelli, Oriano; Smith, Robert L.; Leventer, Richard J.; Møller, Rikke S.; Nikanorova, Marina; Dimova, Petia; Jordanova, Albena; Petrou, Steven; Helbig, Ingo; Striano, Pasquale; Weckhuysen, Sarah; Berkovic, Samuel F.; Scheffer, Ingrid E.; Mefford, Heather C.
2015-01-01
GAT-1, encoded by SLC6A1, is one of the major gamma-aminobutyric acid (GABA) transporters in the brain and is responsible for re-uptake of GABA from the synapse. In this study, targeted resequencing of 644 individuals with epileptic encephalopathies led to the identification of six SLC6A1 mutations in seven individuals, all of whom have epilepsy with myoclonic-atonic seizures (MAE). We describe two truncations and four missense alterations, all of which most likely lead to loss of function of GAT-1 and thus reduced GABA re-uptake from the synapse. These individuals share many of the electrophysiological properties of Gat1-deficient mice, including spontaneous spike-wave discharges. Overall, pathogenic mutations occurred in 6/160 individuals with MAE, accounting for ∼4% of unsolved MAE cases. PMID:25865495
Wolf, Sabine; Janzen, Annette; Vékony, Nicole; Martiné, Ursula; Strand, Dennis; Closs, Ellen I
2002-01-01
Member 4 of human solute carrier family 7 (SLC7A4) exhibits significant sequence homology with the SLC7 subfamily of human cationic amino acid transporters (hCATs) [Sperandeo, Borsani, Incerti, Zollo, Rossi, Zuffardi, Castaldo, Taglialatela, Andria and Sebastio (1998) Genomics 49, 230-236]. It is therefore often referred to as hCAT-4 even though no convincing transport activity has been shown for this protein. We expressed SLC7A4 in Xenopus laevis oocytes, but could not detect any transport a...
Kobayashi, Toshihiko; Shimabukuro-Demoto, Shiho; Yoshida-Sugitani, Reiko; Furuyama-Tanaka, Kaori; Karyu, Hitomi; Sugiura, Yuki; Shimizu, Yukiko; Hosaka, Toshiaki; Goto, Motohito; Kato, Norihiro; Okamura, Tadashi; Suematsu, Makoto; Yokoyama, Shigeyuki; Toyama-Sorimachi, Noriko
2014-09-18
SLC15A4 is a lysosome-resident, proton-coupled amino-acid transporter that moves histidine and oligopeptides from inside the lysosome to the cytosol of eukaryotic cells. SLC15A4 is required for Toll-like receptor 7 (TLR7)- and TLR9-mediated type I interferon (IFN-I) productions in plasmacytoid dendritic cells (pDCs) and is involved in the pathogenesis of certain diseases including lupus-like autoimmunity. How SLC15A4 contributes to diseases is largely unknown. Here we have shown that B cell SLC15A4 was crucial for TLR7-triggered IFN-I and autoantibody productions in a mouse lupus model. SLC15A4 loss disturbed the endolysosomal pH regulation and probably the v-ATPase integrity, and these changes were associated with disruption of the mTOR pathway, leading to failure of the IFN regulatory factor 7 (IRF7)-IFN-I regulatory circuit. Importantly, SLC15A4's transporter activity was necessary for the TLR-triggered cytokine production. Our findings revealed that SLC15A4-mediated optimization of the endolysosomal state is integral to a TLR7-triggered, mTOR-dependent IRF7-IFN-I circuit that leads to autoantibody production. Copyright © 2014 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Angela M Devlin
2010-08-01
Full Text Available Prenatal and early postnatal exposure to maternal depression may "program" childhood behavior via epigenetic processes such as DNA methylation. Methylenetetrahydro-folate reductase (MTHFR is an important enzyme in the generation of methyl groups for DNA methylation. The common MTHFR C677T variant is associated with depression in men and non-pregnant women, and with global changes in DNA methylation. This study investigated the effect of maternal MTHFR C677T genotype on antenatal maternal mood, and their impact on the gene-specific methylation in pregnant women and their newborn infants. The methylation status of SLC6A4, which encodes the transmembrane serotonin transporter, and BDNF, which encodes brain derived neurotrophic factor, were assessed because of their potential role in behaviour.Depressed mood was assessed by the Edinburgh Postnatal Depression Scale (EPDS and the Hamilton Rating Scale for Depression (HAM-D in women (n = 82, all taking folate during the 2(nd and 3(rd trimesters of pregnancy. The methylation status of SLC6A4 and BDNF were assessed in 3rd trimester maternal peripheral leukocytes and in umbilical cord leukocytes collected from their infants at birth. Women with the MTHFR 677TT genotype had greater 2(nd trimester depressed mood (p<0.05. Increased 2(nd trimester maternal depressed mood (EPDS scores was associated with decreased maternal and infant SLC6A4 promoter methylation (p<0.05, but had no effect on BDNF promoter methylation.These findings show that the MTHFR C677T variant is associated with greater depressed mood during pregnancy. We further showed that prenatal exposure to maternal depressed mood affects gene-specific DNA methylation patterns. These findings support the concept that alterations in epigenetic processes may contribute to developmental programming of behaviour by maternal depression.
Directory of Open Access Journals (Sweden)
Eduardo Tarazona-Santos
Full Text Available BACKGROUND: Glucose is an important source of energy for living organisms. In vertebrates it is ingested with the diet and transported into the cells by conserved mechanisms and molecules, such as the trans-membrane Glucose Transporters (GLUTs. Members of this family have tissue specific expression, biochemical properties and physiologic functions that together regulate glucose levels and distribution. GLUT4 -coded by SLC2A4 (17p13 is an insulin-sensitive transporter with a critical role in glucose homeostasis and diabetes pathogenesis, preferentially expressed in the adipose tissue, heart muscle and skeletal muscle. We tested the hypothesis that natural selection acted on SLC2A4. METHODOLOGY/PRINCIPAL FINDINGS: We re-sequenced SLC2A4 and genotyped 104 SNPs along a approximately 1 Mb region flanking this gene in 102 ethnically diverse individuals. Across the studied populations (African, European, Asian and Latin-American, all the eight common SNPs are concentrated in the N-terminal region upstream of exon 7 ( approximately 3700 bp, while the C-terminal region downstream of intron 6 ( approximately 2600 bp harbors only 6 singletons, a pattern that is not compatible with neutrality for this part of the gene. Tests of neutrality based on comparative genomics suggest that: (1 episodes of natural selection (likely a selective sweep predating the coalescent of human lineages, within the last 25 million years, account for the observed reduced diversity downstream of intron 6 and, (2 the target of natural selection may not be in the SLC2A4 coding sequence. CONCLUSIONS: We propose that the contrast in the pattern of genetic variation between the N-terminal and C-terminal regions are signatures of the action of natural selection and thus follow-up studies should investigate the functional importance of different regions of the SLC2A4 gene.
Characterization of SLC transporters in human skin
Directory of Open Access Journals (Sweden)
Marion Alriquet
2015-03-01
Full Text Available Most identified drug transporters belong to the ATP-binding Cassette (ABC and Solute Carrier (SLC families. Recent research indicates that some of these transporters play an important role in the absorption, distribution and excretion of drugs, and are involved in clinically relevant drug-drug interactions for systemic drugs. However, very little is known about the role of drug transporters in human skin in the disposition of topically applied drugs and their involvement in drug-drug interactions. The aim of this work was to compare the expression in human skin (vs human hepatocytes and kidney of SLC transporters included in the EMA guidance as the most likely clinical sources of drug interactions. The expression of SLC transporters in human tissues was analyzed by quantitative RT-PCR. Modulation of SLC47A1 and SLC47A2 (MATE1 and MATE2 expression was analyzed after treatment of human skin in organ-culture with rifampicin and UV irradiation. The expression of SLCO2B1 (OATPB, SLCO3A1 (OATPD, SLCO4A1 (OATPE, SLC47A1 and SLC47A2 (MATE1 and MATE2 was detected in human skin, OATPE and MATE1 being the most expressed. OATPE is about 70 times more expressed in human skin than in human hepatocytes. Moreover, the expression of SLC47A1 and SLC47A2 was down-regulated after treatment with rifampicin or after exposure to UV light. The present findings demonstrate that SLCO4A1 (OATPE and SLC47A1 (MATE1 are highly expressed in human skin and suggest the involvement of SLC transporters in the disposition of topically applied drugs.
Polymorphisms of the serotonin transporter and receptor genes: susceptibility to substance abuse
Directory of Open Access Journals (Sweden)
Herman AI
2012-06-01
Full Text Available Aryeh I Herman, Kornelia N BaloghDepartment of Psychiatry, VA Connecticut Healthcare/Yale University School of Medicine, West Haven, CT, USAAbstract: Serotonin (5-hydroxytryptamine [5-HT] is an important neurotransmitter implicated in regulating substance-use disorder (SUD acquisition, maintenance, and recovery. During the past several years, an abundance of research has begun discovering and describing specific 5-HT genetic polymorphisms associated with SUDs. Genetic variations in the 5-HT system, such as SLC6A4, HTR1B, HTR2A, HTR2C, HTR3 (HTR3A, HTR3B, HTR3C, HTR3D, and HTR3E, likely play a role contributing to SUD patient heterogeneity. The 5-HT transporter-linked polymorphic region S allele, located in SLC6A4, has now been modestly associated with alcohol dependence in two large meta-analyses. Additional 5-HT genes may also play a role but have not been extensively investigated. A limited number of SUD treatment studies have included 5-HT gene variation as moderating treatment outcomes, but the results have been equivocal. Future research on 5-HT addiction genetics should adopt whole-genome sequencing technology, utilize large study samples, and collect data from multiple ethnic groups. Together, these methods will build on the work already conducted with the aim of utilizing 5-HT genetics in SUD treatment settings.Keywords: serotonin, genetic, substance dependence, addiction, alcohol, drug
Structure of Bor1 supports an elevator transport mechanism for SLC4 anion exchangers.
Thurtle-Schmidt, Bryan H; Stroud, Robert M
2016-09-20
Boron is essential for plant growth because of its incorporation into plant cell walls; however, in excess it is toxic to plants. Boron transport and homeostasis in plants is regulated in part by the borate efflux transporter Bor1, a member of the solute carrier (SLC) 4 transporter family with homology to the human bicarbonate transporter Band 3. Here, we present the 4.1-Å resolution crystal structure of Arabidopsis thaliana Bor1. The structure displays a dimeric architecture in which dimerization is mediated by centralized Gate domains. Comparisons with a structure of Band 3 in an outward-open state reveal that the Core domains of Bor1 have rotated inwards to achieve an occluded state. Further structural comparisons with UapA, a xanthine transporter from the nucleobase-ascorbate transporter family, show that the downward pivoting of the Core domains relative to the Gate domains may access an inward-open state. These results suggest that the SLC4, SLC26, and nucleobase-ascorbate transporter families all share an elevator transport mechanism in which alternating access is provided by Core domains that carry substrates across a membrane.
Directory of Open Access Journals (Sweden)
Matsumoto Takayuki
2011-06-01
Full Text Available Abstract Background Although familial clustering of functional dyspepsia (FD has been reported, the role of genetics in the susceptibility to FD is still not well understood. In the present study, the association between serotonin transporter (SERT gene (SLC6A4 polymorphism and FD was explored. Methods Subjects were divided into either a postprandial distress syndrome (PDS group or an epigastric pain syndrome (EPS group according to the Rome III criteria. The healthy controls were those who had visited a hospital for an annual health check-up. The presence of the SLC6A4 promoter polymorphism, 5-hydroxytryptamin transporter gene linked polymorphic region (5-HTTLPR, was then evaluated, and logistic regression analysis was used to test all variables. Results The 5-HTTLPR genotype distribution was 448 SS, 174 SL, and 24 LL in controls and 30 SS, 20 SL, and 3 LL in FD subjects. No significant correlation was found between the 5-HTTLPR genotype and FD. When the genotypes and subtypes of FD were exploratory evaluated, the SL genotype was significantly associated with PDS [odds ratio (OR = 2.24, 95% confidence interval (CI; 1.16-4.32, P = 0.034 after Bonferroni correction] compared to the SS genotype adjusted for sex and age. Comparison of the SS genotype with the SL/LL genotype also showed a significant association of genotype with PDS (OR = 2.32, 95% CI; 1.23-4.37, P = 0.009. Conclusion The present results suggest that 5-HTTLPR L allele may influence the susceptibility to PDS.
Directory of Open Access Journals (Sweden)
Meeshanthini eVijayendran
2012-06-01
Full Text Available Altered regulation of the serotonin transporter (SLC6A4 is hypothesized to be a key event in many forms of neuropsychiatric illness, yet our understanding of the molecular mechanisms through which changes in gene function could lead to illness remains incomplete. In prior studies, we and others have demonstrated that methylation of CpG residues in the promoter associated CpG island alters SLC6A4 gene expression, that the extent of that DNA methylation in child abuse is genotype dependent, and that adverse childhood experiences such as child sex abuse are related to methylation. However, we have not examined whether these effects are splice variant specific, whether the association of methylation to gene expression varies as a function of genotype, and whether methylation in other SLC6A4 gene regions are more likely candidates for GxE effects. In the current investigation we measured methylation in lymphoblast DNA from 158 female subjects in the Iowa Adoption Studies at 16 CpG residues spread across the SLC6A4 locus, and analyzed their relationship to gene expression for two SLC6A4 splice variants. Methylation of two CpG residues in the shore of the CpG island (cg22584138 and cg05951817, a location immediately upstream from exon 1A, predicted gene expression for the splice variant containing Exon 1A + 1B. Methylation at two residues in the CpG island itself (cg 25769822 and cg05016953 was associated with total SLC6A4 expression. Examination of these four CpG residues indicated that methylation of cg22584138 was influenced by both genotype and sex abuse, whereas methylation of cg05016953 was influenced only by sex abuse history. Factors influencing methylation at other CpG dinucleotide pairs were not identified. We conclude that methylation effects on transcription may vary as a function of underlying gene motif and splice variant, and that the shore of CpG islands, upstream of TSS, may be of particular interest in examining environmental effects
Energy Technology Data Exchange (ETDEWEB)
Gelernter, J.; Kruger, S.D.; Pakstis, A.J. [Yale Univ., New Haven, CT (United States)]|[West Haven Veterans Affairs Medical Center, CT (United States)] [and others
1995-12-10
The dopamine transporter, the molecule responsible for presynaptic reuptake of dopamine and a major site of action of psychostimulant drugs, including cocaine, is encoded by locus SLC6A3 (alias DAT1). The protein`s actions and DAT`s specific localization to dopaminergic neurons make it a candidate gene for several psychiatric illnesses. SLC6A3 has been mapped to distal chromosome 5p, using physical methods. Genetic linkage methods were used to place SLC6A3 in the genetic linkage map. Four extended pedigrees (one of which overlaps with CEPH) were typed. Linkage with Tourette syndrome (TS) was also examined. SLC6A3 showed close linkage with several markers previously mapped to distal chromosome 5p, including D5S11 (Z{sub max} = 16.0, {theta}{sub M} = {theta}{sub F} = 0.03, results from four families) and D5S678 (Z{sub max} = 7.84, {theta}{sub M} = {theta}{sub F} = 0, results from two families). Observed crossovers established that SLC6A3 is a distal marker close to D5S10 and D5S678, but these three distal markers could not be ordered. Linkage between TS and SLC6A3 could be excluded independently in two branches of a large kindred segregating TS; the lod score in a third family was also negative, but not significant. Cumulative results show a lod score of -6.2 at {theta} = 0 and of -3.9 at {theta} = 0.05 (dominant model, narrow disease definition). SLC6A3 thus maps to distal chromosome 5p by linkage analysis, in agreement with previous physical mapping data. A mutation at SLC6A3 is not causative for TS in the two large families that generated significant negative lod scores (if the parameters of our analyses were correct) and is unlikely to be causative in the family that generated a negative lod score that did not reach significance. These results do not exclude a role for the dopamine transporter in influencing risk for TS in combination with other loci. 23 refs., 1 fig., 2 tabs.
Jutabha, Promsuk; Anzai, Naohiko; Kitamura, Kenichiro; Taniguchi, Atsuo; Kaneko, Shuji; Yan, Kunimasa; Yamada, Hideomi; Shimada, Hidetaka; Kimura, Toru; Katada, Tomohisa; Fukutomi, Toshiyuki; Tomita, Kimio; Urano, Wako; Yamanaka, Hisashi; Seki, George; Fujita, Toshiro; Moriyama, Yoshinori; Yamada, Akira; Uchida, Shunya; Wempe, Michael F.; Endou, Hitoshi; Sakurai, Hiroyuki
2010-01-01
The evolutionary loss of hepatic urate oxidase (uricase) has resulted in humans with elevated serum uric acid (urate). Uricase loss may have been beneficial to early primate survival. However, an elevated serum urate has predisposed man to hyperuricemia, a metabolic disturbance leading to gout, hypertension, and various cardiovascular diseases. Human serum urate levels are largely determined by urate reabsorption and secretion in the kidney. Renal urate reabsorption is controlled via two proximal tubular urate transporters: apical URAT1 (SLC22A12) and basolateral URATv1/GLUT9 (SLC2A9). In contrast, the molecular mechanism(s) for renal urate secretion remain unknown. In this report, we demonstrate that an orphan transporter hNPT4 (human sodium phosphate transporter 4; SLC17A3) was a multispecific organic anion efflux transporter expressed in the kidneys and liver. hNPT4 was localized at the apical side of renal tubules and functioned as a voltage-driven urate transporter. Furthermore, loop diuretics, such as furosemide and bumetanide, substantially interacted with hNPT4. Thus, this protein is likely to act as a common secretion route for both drugs and may play an important role in diuretics-induced hyperuricemia. The in vivo role of hNPT4 was suggested by two hyperuricemia patients with missense mutations in SLC17A3. These mutated versions of hNPT4 exhibited reduced urate efflux when they were expressed in Xenopus oocytes. Our findings will complete a model of urate secretion in the renal tubular cell, where intracellular urate taken up via OAT1 and/or OAT3 from the blood exits from the cell into the lumen via hNPT4. PMID:20810651
Kim, Yong-Ku; Hwang, Jung-A; Lee, Heon-Jeong; Yoon, Ho-Kyoung; Ko, Young-Hoon; Lee, Bun-Hee; Jung, Han-Yong; Hahn, Sang-Woo; Na, Kyoung-Sae
2014-04-01
Although several studies have investigated possible associations between norepinephrine neurotransmitter transporter gene (SLC6A2) polymorphisms and depression, few studies have examined associations between SLC6A2 polymorphisms and suicide. Three single-nucleotide polymorphisms (rs2242446, rs28386840, and rs5569) were measured in 550 patients: 201 with major depressive disorder (MDD) and suicide attempt/s, 160 with MDD without suicide attempts, and 189 healthy controls. Analysis of single-nucleotide polymorphisms (SNPs) and haplotype was conducted for the three groups. Subsequently, multivariate logistic regression analysis adjusting for age and gender was conducted to identify independent influences of each SNP. A possible association between suicide lethality and SLC6A2 polymorphisms was also investigated. In the genotype and allele frequency analysis, there were significant differences in rs28386840 between suicidal MDD patients and healthy controls. In the haplotype analysis, TAA (rs2242446-rs28386840-rs5569, from left to right) was associated with suicide attempts in MDD, although the significance (p=0.043) disappeared after Bonferroni correction. There were no relationships between lethality scores and SLC6A2 polymorphisms in suicidal MDD. Modest sample size and a single type of neurotransmitter analyzed (norepinephrine) are the primary limitations. Our results suggest that SLC6A2 polymorphisms were associated with suicide risk in patients with MDD. Future studies are warranted to elucidate possible mechanisms by which SLC6A2 polymorphisms influence suicide risk. Copyright © 2014 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Ana Victoria Valencia
2012-12-01
Full Text Available Introducción. El espectro autista constituye un grupo de trastornos graves del neurodesarrollo, conun fuerte componente genético. Se ha sugerido un papel importante del sistema serotoninérgico en el desarrollo de este grupo de trastornos, con base en los estudios de respuesta a medicamentos y la hiperserotoninemia, característica común en el autismo. Se han implicado múltiples moléculas en el metabolismo y la neurotransmisión de la serotonina; sin embargo, los resultados de los estudios hantenido poca congruencia entre diferentes poblaciones. Objetivos. Evaluar la relación entre el autismo y el polimorfismo de nucleótido simple (SingleNucleotide Polymorphism, SNP en los genes SLC6A4, HTR2A e ITGB3, en una muestra de la población antioqueña. Materiales y métodos. Se genotipificaron 42 núcleos familiares con autismo para 10 variantes enlos genes SLC6A4, ITGB3 y HTR2A. Se evaluó la asociación utilizando la prueba de desequilibrio enla transmisión. Se exploró el impacto de la interacción entre estos genes y el autismo, utilizando la reducción multidimensional. Resultados. Se encontró asociación de las variantes rs4583306 (OR=2,6, p=0,004 y rs2066713(OR=2,2 p=0,03, en el gen SLC6A4, y asociación de combinaciones genotípicas entre los genes SLC6A4 y HTR2A y el riesgo de autismo (p=0,0001. Conclusiones. Se encontró asociación significativa con variantes en el gen transportador de serotoninacon el autismo, al igual que interacción entre variantes en los genes HTR2A con SLC6A4. Estos resultados concuerdan con los de estudios previos en otras poblaciones y son pruebas a favor delpapel del sistema serotoninérgico en la etiología del espectro autista. doi: http://dx.doi.org/10.7705/biomedica.v32i4.593
Energy Technology Data Exchange (ETDEWEB)
Lundkvist, Camilla E-mail: Lundkvis@shfj.cea.fr; Loc' h, Christian; Halldin, Christer; Bottlaender, Michel; Ottaviani, Michele; Coulon, Christine; Fuseau, Chantal; Mathis, Chester; Farde, Lars; Maziere, Bernard
1999-07-01
The development of suitable radioligands for brain imaging of the serotonin transporter is of great importance for the study of depression and other affective disorders. The potent and selective serotonin transporter ligand, 5-iodo-6-nitro-2-piperazinylquinoline, has been labelled with iodine-123 and used as a radioligand for single photon emission computerized tomography. To evaluate the potential of the bromine-76-labelled analogue, 5-bromo-6-nitroquipazine, as a radioligand for positron emission tomography (PET), its brain distribution and binding characteristics were examined in rats. In vivo brain distribution and ex vivo autoradiography demonstrated that [{sup 76}Br]5-bromo-6-nitroquipazine enters the brain rapidly. The regional brain distribution of [{sup 76}Br]5-bromo-6-nitroquipazine was consistent with the known distribution of serotonin transporters in the midbrain, pons, thalamus, striatum, and neocortex. Specific binding was inhibited by the selective serotonin reuptake inhibitor citalopram. The peripheral metabolism in plasma was rapid, but more than 90% of the radioactivity in brain represented unchanged radioligand 2 h postinjection (p.i.). A preliminary PET study was also performed in a baboon. Following the intravenous injection of [{sup 76}Br]5-bromo-6-nitroquipazine in a baboon, there was a conspicuous accumulation of radioactivity in thalamus, striatum, and pons. The radioactivity in these brain regions was 1.5 times higher than in the cerebellum at 3 h and 2.5-4 times higher at 24 h. A rapid metabolism of the radioligand in plasma was observed (38% unchanged after 5 min). The results indicate that [{sup 76}Br]5-bromo-6-nitroquipazine has potential for PET imaging of the serotonin transporter.
Uchida, Yasuo; Ito, Katsuaki; Ohtsuki, Sumio; Kubo, Yoshiyuki; Suzuki, Takashi; Terasaki, Tetsuya
2015-07-01
The purpose of this study was to clarify the expression of Na(+) -dependent multivitamin transporter (SLC5A6/SMVT) and its contribution to the supply of biotin and pantothenic acid to the human brain via the blood-brain barrier. DNA microarray and immunohistochemical analyses confirmed that SLC5A6 is expressed in microvessels of human brain. The absolute expression levels of SLC5A6 protein in isolated human and monkey brain microvessels were 1.19 and 0.597 fmol/μg protein, respectively, as determined by a quantitative targeted absolute proteomics technique. Using an antibody-free method established by Kubo et al. (2015), we found that SLC5A6 was preferentially localized at the luminal membrane of brain capillary endothelium. Knock-down analysis using SLC5A6 siRNA showed that SLC5A6 accounts for 88.7% and 98.6% of total [(3) H]biotin and [(3) H]pantothenic acid uptakes, respectively, by human cerebral microvascular endothelial cell line hCMEC/D3. SLC5A6-mediated transport in hCMEC/D3 was markedly inhibited not only by biotin and pantothenic acid, but also by prostaglandin E2, lipoic acid, docosahexaenoic acid, indomethacin, ketoprofen, diclofenac, ibuprofen, phenylbutazone, and flurbiprofen. This study is the first to confirm expression of SLC5A6 in human brain microvessels and to provide evidence that SLC5A6 is a major contributor to luminal uptake of biotin and pantothenic acid at the human blood-brain barrier. In humans, it was unclear (not concluded) about what transport system at the blood-brain barrier (BBB) is responsible for the brain uptakes of two vitamins, biotin and pantothenic acid, which are necessary for brain proper function. This study clarified for the first time that the solute carrier 5A6/Na(+) -dependent multivitamin transporter SLC5A6/SMVT is responsible for the supplies of biotin and pantothenic acid into brain across the BBB in humans. DHA, docosahexaenoic acid; NSAID, non-steroidal anti-inflammatory drug; PGE2, prostaglandin E2. © 2015
The orphan transporter v7-3 (slc6a15) is a Na+-dependent neutral amino acid transporter (B0AT2)
DEFF Research Database (Denmark)
Bröer, Angelika; Tietze, Nadine; Kowalczuk, Sonja
2006-01-01
. The transporter is functionally and sequence related to B(0)AT1 (slc6a19) and was hence named B(0)AT2. Leucine, isoleucine, valine, proline and methionine were recognized by the transporter, with values of K(0.5) (half-saturation constant) ranging from 40 to 200 microM. Alanine, glutamine and phenylalanine were...
Reduced Slc6a15 in Nucleus Accumbens D2-Neurons Underlies Stress Susceptibility.
Chandra, Ramesh; Francis, T Chase; Nam, Hyungwoo; Riggs, Lace M; Engeln, Michel; Rudzinskas, Sarah; Konkalmatt, Prasad; Russo, Scott J; Turecki, Gustavo; Iniguez, Sergio D; Lobo, Mary Kay
2017-07-05
Previous research demonstrates that Slc6a15, a neutral amino acid transporter, is associated with depression susceptibility. However, no study examined Slc6a15 in the ventral striatum [nucleus accumbens (NAc)] in depression. Given our previous characterization of Slc6a15 as a striatal dopamine receptor 2 (D2)-neuron-enriched gene, we examined the role of Slc6a15 in NAc D2-neurons in mediating susceptibility to stress in male mice. First, we showed that Slc6a15 mRNA was reduced in NAc of mice susceptible to chronic social defeat stress (CSDS), a paradigm that produces behavioral and molecular adaptations that resemble clinical depression. Consistent with our preclinical data, we observed Slc6a15 mRNA reduction in NAc of individuals with major depressive disorder (MDD). The Slc6a15 reduction in NAc occurred selectively in D2-neurons. Next, we used Cre-inducible viruses combined with D2-Cre mice to reduce or overexpress Slc6a15 in NAc D2-neurons. Slc6a15 reduction in D2-neurons caused enhanced susceptibility to a subthreshold social defeat stress (SSDS) as observed by reduced social interaction, while a reduction in social interaction following CSDS was not observed when Slc6a15 expression in D2-neurons was restored. Finally, since both D2-medium spiny neurons (MSNs) and D2-expressing choline acetyltransferase (ChAT) interneurons express Slc6a15, we examined Slc6a15 protein in these interneurons after CSDS. Slc6a15 protein was unaltered in ChAT interneurons. Consistent with this, reducing Slc5a15 selectively in NAc D2-MSNs, using A2A-Cre mice that express Cre selectively in D2-MSNs, caused enhanced susceptibility to SSDS. Collectively, our data demonstrate that reduced Slc6a15 in NAc occurs in MDD individuals and that Slc6a15 reduction in NAc D2-neurons underlies stress susceptibility. SIGNIFICANCE STATEMENT Our study demonstrates a role for reduced Slc6a15, a neutral amino acid transporter, in nucleus accumbens (NAc) in depression and stress susceptibility. The
Action Potential Shortening and Impairment of Cardiac Function by Ablation of Slc26a6.
Sirish, Padmini; Ledford, Hannah A; Timofeyev, Valeriy; Thai, Phung N; Ren, Lu; Kim, Hyo Jeong; Park, Seojin; Lee, Jeong Han; Dai, Gu; Moshref, Maryam; Sihn, Choong-Ryoul; Chen, Wei Chun; Timofeyeva, Maria Valeryevna; Jian, Zhong; Shimkunas, Rafael; Izu, Leighton T; Chiamvimonvat, Nipavan; Chen-Izu, Ye; Yamoah, Ebenezer N; Zhang, Xiao-Dong
2017-10-01
Intracellular pH (pH i ) is critical to cardiac excitation and contraction; uncompensated changes in pH i impair cardiac function and trigger arrhythmia. Several ion transporters participate in cardiac pH i regulation. Our previous studies identified several isoforms of a solute carrier Slc26a6 to be highly expressed in cardiomyocytes. We show that Slc26a6 mediates electrogenic Cl - /HCO 3 - exchange activities in cardiomyocytes, suggesting the potential role of Slc26a6 in regulation of not only pH i , but also cardiac excitability. To test the mechanistic role of Slc26a6 in the heart, we took advantage of Slc26a6 knockout ( Slc26a6 -/ - ) mice using both in vivo and in vitro analyses. Consistent with our prediction of its electrogenic activities, ablation of Slc26a6 results in action potential shortening. There are reduced Ca 2+ transient and sarcoplasmic reticulum Ca 2+ load, together with decreased sarcomere shortening in Slc26a6 -/ - cardiomyocytes. These abnormalities translate into reduced fractional shortening and cardiac contractility at the in vivo level. Additionally, pH i is elevated in Slc26a6 -/ - cardiomyocytes with slower recovery kinetics from intracellular alkalization, consistent with the Cl - /HCO 3 - exchange activities of Slc26a6. Moreover, Slc26a6 -/ - mice show evidence of sinus bradycardia and fragmented QRS complex, supporting the critical role of Slc26a6 in cardiac conduction system. Our study provides mechanistic insights into Slc26a6, a unique cardiac electrogenic Cl - /HCO 3 - transporter in ventricular myocytes, linking the critical roles of Slc26a6 in regulation of pH i , excitability, and contractility. pH i is a critical regulator of other membrane and contractile proteins. Future studies are needed to investigate possible changes in these proteins in Slc26a6 -/ - mice. © 2017 American Heart Association, Inc.
Zhong, Xi Zoë; Cao, Qi; Sun, Xue
2016-01-01
Key points SLC17A9 proteins function as a lysosomal ATP transporter responsible for lysosomal ATP accumulation.P2X4 receptors act as lysosomal ion channels activated by luminal ATP.SLC17A9‐mediated ATP transport across the lysosomal membrane is suppressed by Bafilomycin A1, the V‐ATPase inhibitor.SLC17A9 mainly uses voltage gradient but not pH gradient generated by the V‐ATPase as the driving force to transport ATP into the lysosome to activate P2X4. Abstract The lysosome contains abundant ATP which plays important roles in lysosome functions and in cell signalling. Recently, solute carrier family 17 member 9 (SLC17A9, also known as VNUT for vesicular nucleotide transporter) proteins were suggested to function as a lysosomal ATP transporter responsible for lysosomal ATP accumulation, and P2X4 receptors were suggested to be lysosomal ion channels that are activated by luminal ATP. However, the molecular mechanism of SLC17A9 transporting ATP and the regulatory mechanism of lysosomal P2X4 are largely unknown. In this study, we report that SLC17A9‐mediated ATP transport across lysosomal membranes is suppressed by Bafilomycin A1, the V‐ATPase inhibitor. By measuring P2X4 activity, which is indicative of ATP transport across lysosomal membranes, we further demonstrated that SLC17A9 mainly uses voltage gradient but not pH gradient as the driving force to transport ATP into lysosomes. This study provides a molecular mechanism for lysosomal ATP transport mediated by SLC17A9. It also suggests a regulatory mechanism of lysosomal P2X4 by SLC17A9. PMID:27477609
Shang, Chi-Yung; Chiang, Huey-Ling; Gau, Susan Shur-Fen
2015-04-03
Attention-deficit/hyperactivity disorder (ADHD) is a common heritable childhood-onset psychiatric disorder with impaired visual memory. Based on the evidence from treatment effect of atomoxetine, which interacts directly with the norepinephrine transporter, on visual memory in children with ADHD, this study examined the linkage disequilibrium structure of the norepinephrine transporter gene (SLC6A2) and the association between SLC6A2 and ADHD and visual memory, a promising endophenotype for ADHD. This family-based association sample consisted of 382 probands with DSM-IV ADHD and their family members (n=1298 in total) of Han Chinese in Taiwan. Visual memory was assessed by the Pattern Recognition Memory (PRM) and Spatial Recognition Memory (SRM) tasks of the Cambridge Neuropsychological Test Automated Battery (CANTAB). We screened 21 polymorphisms across SLC6A2 and used the Family-Based Association Test (FBAT) to test the associations of SLC6A2 polymorphisms with ADHD and the PRM and SRM measures. In haplotype analyses, a haplotype rs36011 (T)/rs1566652 (G) was significantly associated with ADHD (minimal p=0.045) after adjustment for multiple testing. In quantitative analyses, this TG haplotype also demonstrated significant associations with visual memory measures, including mean latency of correct responses in PRM (minimal p=0.019), total correct responses in PRM (minimal p=0.018), and total correct responses in SRM (minimal p=0.015). Our novel finding of the haplotype rs36011 (T)/rs1566652 (G) as a novel genetic marker involved in both ADHD disease susceptibility and visual memory suggests that allelic variations in SLC6A2 could provide insight into the pathways leading from genotype to phenotype of ADHD. Copyright © 2014 Elsevier Inc. All rights reserved.
SLC6A1 Mutation and Ketogenic Diet in Epilepsy With Myoclonic-Atonic Seizures.
Palmer, Samantha; Towne, Meghan C; Pearl, Phillip L; Pelletier, Renee C; Genetti, Casie A; Shi, Jiahai; Beggs, Alan H; Agrawal, Pankaj B; Brownstein, Catherine A
2016-11-01
Epilepsy with myoclonic-atonic seizures, also known as myoclonic-astatic epilepsy or Doose syndrome, has been recently linked to variants in the SLC6A1 gene. Epilepsy with myoclonic-atonic seizures is often refractory to antiepileptic drugs, and the ketogenic diet is known for treating medically intractable seizures, although the mechanism of action is largely unknown. We report a novel SLC6A1 variant in a patient with epilepsy with myoclonic-atonic seizures, analyze its effects, and suggest a mechanism of action for the ketogenic diet. We describe a ten-year-old girl with epilepsy with myoclonic-atonic seizures and a de novo SLC6A1 mutation who responded well to the ketogenic diet. She carried a c.491G>A mutation predicted to cause p.Cys164Tyr amino acid change, which was identified using whole exome sequencing and confirmed by Sanger sequencing. High-resolution structural modeling was used to analyze the likely effects of the mutation. The SLC6A1 gene encodes a transporter that removes gamma-aminobutyric acid from the synaptic cleft. Mutations in SLC6A1 are known to disrupt the gamma-aminobutyric acid transporter protein 1, affecting gamma-aminobutyric acid levels and causing seizures. The p.Cys164Tyr variant found in our study has not been previously reported, expanding on the variants linked to epilepsy with myoclonic-atonic seizures. A 10-year-old girl with a novel SLC6A1 mutation and epilepsy with myoclonic-atonic seizures had an excellent clinical response to the ketogenic diet. An effect of the diet on gamma-aminobutyric acid reuptake mediated by gamma-aminobutyric acid transporter protein 1 is suggested. A personalized approach to epilepsy with myoclonic-atonic seizures patients carrying SLC6A1 mutation and a relationship between epilepsy with myoclonic-atonic seizures due to SLC6A1 mutations, GABAergic drugs, and the ketogenic diet warrants further exploration. Copyright © 2016 Elsevier Inc. All rights reserved.
Developmental expression of SLC26A4 (Pendrin) during amelogenesis in developing rodent teeth
Bronckers, Antonius LJJ; Guo, Jing; Zandieh-Doulabi, Behrouz; Bervoets, Theodore J; Lyaruu, Donacian M.; Li, Xiangming; Wangemann, Philine; DenBesten, Pamela
2012-01-01
Ameloblasts need to regulate pH during formation of enamel crystals, a process that generates protons. Solute carrier family 26A member 4 (SLC26A4, or pendrin) is an anion exchanger for chloride, bicarbonate, iodine and formate. It is expressed in apical membranes of ion-transporting epithelia in kidney, inner ear and thyroid where it regulates luminal pH and fluid transport. We hypothesized that maturation ameloblasts express SLC26A4 to neutralize acidification of enamel fluid in forming enamel. In rodents, secretory and maturation ameloblasts were immunopositive for SLC26A4. Staining was particularly strong in apical membranes of maturation ameloblasts facing forming enamel. RT-PCR confirmed the presence of mRNA transcripts for Slc26a4 in enamel organs. SLC26A4 immunostaining was also found in mineralizing connective tissues including odontoblasts, osteoblasts, osteocytes, osteoclasts, bone lining cells, cellular cementoblasts and cementocytes. However, Slc26a4-null mutant mice had no overt dental phenotype. The presence of SLC26A4 in apical plasma membranes of maturation ameloblasts is consistent with a potential function as pH regulator. SLC26A4 does not appear critical for ameloblast functioning and is likely compensated by other pH regulators. PMID:22243245
SLC2A9 is a high-capacity urate transporter in humans.
Directory of Open Access Journals (Sweden)
Mark J Caulfield
2008-10-01
Full Text Available Serum uric acid levels in humans are influenced by diet, cellular breakdown, and renal elimination, and correlate with blood pressure, metabolic syndrome, diabetes, gout, and cardiovascular disease. Recent genome-wide association scans have found common genetic variants of SLC2A9 to be associated with increased serum urate level and gout. The SLC2A9 gene encodes a facilitative glucose transporter, and it has two splice variants that are highly expressed in the proximal nephron, a key site for urate handling in the kidney. We investigated whether SLC2A9 is a functional urate transporter that contributes to the longstanding association between urate and blood pressure in man.We expressed both SLC2A9 splice variants in Xenopus laevis oocytes and found both isoforms mediate rapid urate fluxes at concentration ranges similar to physiological serum levels (200-500 microM. Because SLC2A9 is a known facilitative glucose transporter, we also tested whether glucose or fructose influenced urate transport. We found that urate is transported by SLC2A9 at rates 45- to 60-fold faster than glucose, and demonstrated that SLC2A9-mediated urate transport is facilitated by glucose and, to a lesser extent, fructose. In addition, transport is inhibited by the uricosuric benzbromarone in a dose-dependent manner (Ki = 27 microM. Furthermore, we found urate uptake was at least 2-fold greater in human embryonic kidney (HEK cells overexpressing SLC2A9 splice variants than nontransfected kidney cells. To confirm that our findings were due to SLC2A9, and not another urate transporter, we showed that urate transport was diminished by SLC2A9-targeted siRNA in a second mammalian cell line. In a cohort of men we showed that genetic variants of SLC2A9 are associated with reduced urinary urate clearance, which fits with common variation at SLC2A9 leading to increased serum urate. We found no evidence of association with hypertension (odds ratio 0.98, 95% confidence interval [CI
Directory of Open Access Journals (Sweden)
Sughondhabirom Atapol
2007-10-01
Full Text Available Abstract Background GABA transporter-1 (GAT-1; genetic locus SLC6A1 is emerging as a novel target for treatment of neuropsychiatric disorders. To understand how population differences might influence strategies for pharmacogenetic studies, we identified patterns of genetic variation and linkage disequilibrium (LD in SLC6A1 in five populations representing three continental groups. Results We resequenced 12.4 kb of SLC6A1, including the promoters, exons and flanking intronic regions in African-American, Thai, Hmong, Finnish, and European-American subjects (total n = 40. LD in SLC6A1 was examined by genotyping 16 SNPs in larger samples. Sixty-three variants were identified through resequencing. Common population-specific variants were found in African-Americans, including a novel 21-bp promoter region variable number tandem repeat (VNTR, but no such variants were found in any of the other populations studied. Low levels of LD and the absence of major LD blocks were characteristic of all five populations. African-Americans had the highest genetic diversity. European-Americans and Finns did not differ in genetic diversity or LD patterns. Although the Hmong had the highest level of LD, our results suggest that a strategy based on the use of tag SNPs would not translate to a major improvement in genotyping efficiency. Conclusion Owing to the low level of LD and presence of recombination hotspots, SLC6A1 may be an example of a problematic gene for association and haplotype tagging-based genetic studies. The 21-bp promoter region VNTR polymorphism is a putatively functional candidate allele for studies focusing on variation in GAT-1 function in the African-American population.
SEP-225289 serotonin and dopamine transporter occupancy: a PET study.
DeLorenzo, Christine; Lichenstein, Sarah; Schaefer, Karen; Dunn, Judith; Marshall, Randall; Organisak, Lisa; Kharidia, Jahnavi; Robertson, Brigitte; Mann, J John; Parsey, Ramin V
2011-07-01
SEP-225289 is a novel compound that, based on in vitro potencies for transporter function, potentially inhibits reuptake at dopamine, norepinephrine, and serotonin transporters. An open-label PET study was conducted during the development of SEP-225289 to investigate its dopamine and serotonin transporter occupancy. Different single doses of SEP-225289 were administered to healthy volunteers in 3 cohorts: 8 mg (n = 7), 12 mg (n = 5), and 16 mg (n = 7). PET was performed before and approximately 24 h after oral administration of SEP-225289, to assess occupancy at trough levels. Dopamine and serotonin transporter occupancies were estimated from PET using (11)C-N-(3-iodoprop-2E-enyl)-2β-carbomethoxy-3β-(4-methylphenyl)nortropane ((11)C-PE2I) and (11)C-N,N-dimethyl-2-(2-amino-4-cyanophenylthio)benzylamine ((11)C-DASB), respectively. Plasma concentration of SEP-225289 was assessed before ligand injection, and subjects were monitored for adverse events. Average dopamine and serotonin transporter occupancies increased with increasing doses of SEP-225289. Mean dopamine and serotonin transporter occupancies were 33% ± 11% and 2% ± 13%, respectively, for 8 mg; 44% ± 4% and 9% ± 10%, respectively, for 12 mg; and 49% ± 7% and 14% ± 15%, respectively, for 16 mg. On the basis of the relationship between occupancy and plasma concentration, dopamine transporter IC(50) (the plasma concentration of drug at 50% occupancy) was determined (4.5 ng/mL) and maximum dopamine transporter occupancy was extrapolated (85%); however, low serotonin transporter occupancy prevented similar serotonin transporter calculations. No serious adverse events were reported. At the doses evaluated, occupancy of the dopamine transporter was significantly higher than that of the serotonin transporter, despite similar in vitro potencies, confirming that, in addition to in vitro assays, PET occupancy studies can be instrumental to the drug development process by informing early decisions about
Directory of Open Access Journals (Sweden)
Scott F Stoltenberg
2011-06-01
Full Text Available The factors that influence individual differences in decision making are not yet fully characterized, but convergent evidence is accumulating that implicates serotonin (5-HT system function. Therefore, both genes and environments that influence serotonin function are good candidates for association with risky decision making. In the present study we examined associations between common polymorphisms in the serotonin transporter gene (SLC6A4; 5-HTTLPR and rs25531, the experience of childhood trauma and decision making on the Iowa Gambling Task (IGT in 391 (64.5% female healthy Caucasian adults. Homozygosity for the 5-HTTLPR L allele was associated with riskier decision making in the first block of 20 trials (i.e. decision making under ambiguity, p = .004. In addition, mean IGT performance was significantly worse in blocks 3-5 (i.e. decision making under risk, p≤ .05 for those participants who reported experiencing higher levels of childhood trauma. Our findings add to the growing evidence that genetic variation in the 5-HT system is associated with individual differences in decision making under ambiguity; and we report that the experience of childhood trauma is associated with relatively poor decision making under risk.
Exonal deletion of SLC24A4 causes hypomaturation amelogenesis imperfecta.
Seymen, F; Lee, K-E; Tran Le, C G; Yildirim, M; Gencay, K; Lee, Z H; Kim, J-W
2014-04-01
Amelogenesis imperfecta is a heterogeneous group of genetic conditions affecting enamel formation. Recently, mutations in solute carrier family 24 member 4 (SLC24A4) have been identified to cause autosomal recessive hypomaturation amelogenesis imperfecta. We recruited a consanguineous family with hypomaturation amelogenesis imperfecta with generalized brown discoloration. Sequencing of the candidate genes identified a 10-kb deletion, including exons 15, 16, and most of the last exon of the SLC24A4 gene. Interestingly, this deletion was caused by homologous recombination between two 354-bp-long homologous sequences located in intron 14 and the 3' UTR. This is the first report of exonal deletion in SLC24A4 providing confirmatory evidence that the function of SLC24A4 in calcium transport has a crucial role in the maturation stage of amelogenesis.
Plasma Membrane Na+-Coupled Citrate Transporter (SLC13A5 and Neonatal Epileptic Encephalopathy
Directory of Open Access Journals (Sweden)
Yangzom D. Bhutia
2017-02-01
Full Text Available SLC13A5 is a Na+-coupled transporter for citrate that is expressed in the plasma membrane of specific cell types in the liver, testis, and brain. It is an electrogenic transporter with a Na+:citrate3− stoichiometry of 4:1. In humans, the Michaelis constant for SLC13A5 to transport citrate is ~600 μM, which is physiologically relevant given that the normal concentration of citrate in plasma is in the range of 150–200 μM. Li+ stimulates the transport function of human SLC13A5 at concentrations that are in the therapeutic range in patients on lithium therapy. Human SLC13A5 differs from rodent Slc13a5 in two important aspects: the affinity of the human transporter for citrate is ~30-fold less than that of the rodent transporter, thus making human SLC13A5 a low-affinity/high-capacity transporter and the rodent Slc13a5 a high-affinity/low-capacity transporter. In the liver, SLC13A5 is expressed exclusively in the sinusoidal membrane of the hepatocytes, where it plays a role in the uptake of circulating citrate from the sinusoidal blood for metabolic use. In the testis, the transporter is expressed only in spermatozoa, which is also only in the mid piece where mitochondria are located; the likely function of the transporter in spermatozoa is to mediate the uptake of citrate present at high levels in the seminal fluid for subsequent metabolism in the sperm mitochondria to generate biological energy, thereby supporting sperm motility. In the brain, the transporter is expressed mostly in neurons. As astrocytes secrete citrate into extracellular medium, the potential function of SLC13A5 in neurons is to mediate the uptake of circulating citrate and astrocyte-released citrate for subsequent metabolism. Slc13a5-knockout mice have been generated; these mice do not have any overt phenotype but are resistant to experimentally induced metabolic syndrome. Recently however, loss-of-function mutations in human SLC13A5 have been found to cause severe epilepsy
NBCe1 (SLC4A4) a potential pH regulator in enamel organ cells during enamel development in the mouse
Jalali, R.; Guo, J.; Zandieh-Doulabi, B.; Bervoets, T.J.M.; Paine, M.L.; Boron, W.F.; Parker, M.D.; Bijvelds, M.J.C.; Medina, J.F.; DenBesten, P.K.; Bronckers, A.L.J.J.
2014-01-01
During the formation of dental enamel, maturation-stage ameloblasts express ion-transporting transmembrane proteins. The SLC4 family of ion-transporters regulates intra- and extracellular pH in eukaryotic cells by cotransporting HCO3 − with Na+. Mutation in SLC4A4 (coding for the sodium-bicarbonate
Zahavi, Arielle Y; Sabbagh, Mark A; Washburn, Dustin; Mazurka, Raegan; Bagby, R Michael; Strauss, John; Kennedy, James L; Ravindran, Arun; Harkness, Kate L
2016-01-01
Theory of mind-the ability to decode and reason about others' mental states-is a universal human skill and forms the basis of social cognition. Theory of mind accuracy is impaired in clinical conditions evidencing social impairment, including major depressive disorder. The current study is a preliminary investigation of the association of polymorphisms of the serotonin transporter (SLC6A4), dopamine transporter (DAT1), dopamine receptor D4 (DRD4), and catechol-O-methyl transferase (COMT) genes with theory of mind decoding in a sample of adults with major depression. Ninety-six young adults (38 depressed, 58 non-depressed) completed the 'Reading the Mind in the Eyes task' and a non-mentalistic control task. Genetic associations were only found for the depressed group. Specifically, superior accuracy in decoding mental states of a positive valence was seen in those homozygous for the long allele of the serotonin transporter gene, 9-allele carriers of DAT1, and long-allele carriers of DRD4. In contrast, superior accuracy in decoding mental states of a negative valence was seen in short-allele carriers of the serotonin transporter gene and 10/10 homozygotes of DAT1. Results are discussed in terms of their implications for integrating social cognitive and neurobiological models of etiology in major depression.
Directory of Open Access Journals (Sweden)
Arielle Y Zahavi
Full Text Available Theory of mind-the ability to decode and reason about others' mental states-is a universal human skill and forms the basis of social cognition. Theory of mind accuracy is impaired in clinical conditions evidencing social impairment, including major depressive disorder. The current study is a preliminary investigation of the association of polymorphisms of the serotonin transporter (SLC6A4, dopamine transporter (DAT1, dopamine receptor D4 (DRD4, and catechol-O-methyl transferase (COMT genes with theory of mind decoding in a sample of adults with major depression. Ninety-six young adults (38 depressed, 58 non-depressed completed the 'Reading the Mind in the Eyes task' and a non-mentalistic control task. Genetic associations were only found for the depressed group. Specifically, superior accuracy in decoding mental states of a positive valence was seen in those homozygous for the long allele of the serotonin transporter gene, 9-allele carriers of DAT1, and long-allele carriers of DRD4. In contrast, superior accuracy in decoding mental states of a negative valence was seen in short-allele carriers of the serotonin transporter gene and 10/10 homozygotes of DAT1. Results are discussed in terms of their implications for integrating social cognitive and neurobiological models of etiology in major depression.
Lapid, M I; Kung, S; Frye, M A; Biernacka, J M; Geske, J R; Drake, M T; Jankowski, M D; Clarke, B L
2017-08-22
The serotonin transporter-linked polymorphic region (5-HTTLPR) of the serotonin transporter gene (SLC6A4) S allele is linked to pathogenesis of depression and slower response to selective serotonin reuptake inhibitors (SSRIs); depression and SSRIs are independently associated with bone loss. We aimed to determine whether 5-HTTLPR was associated with bone loss. This cross-sectional study included psychiatric patients with both 5-HTTLPR analysis and bone mineral density (BMD) assessment (hip and spine Z-scores if age <50 years and T-scores if ⩾50 years). BMD association with 5-HTTLPR was evaluated under models with additive allele effects and dominant S allele effects using linear regression models. Patients were stratified by age (<50 and ⩾50 years) and sex. Of 3016 patients with 5-HTTLPR genotyping, 239 had BMD assessments. Among the younger patients, the S allele was associated with lower Z-scores at the hip (P=0.002, dominant S allele effects; P=0.004, additive allele effects) and spine (P=0.0006, dominant S allele effects; P=0.01, additive allele effects). In sex-stratified analyses, the association of the S allele with lower BMD in the younger patients was also significant in the subset of women (P⩽0.003 for both hip and spine BMD under the additive allele effect model). In the small group of men younger than 50 years, the S allele was marginally associated with higher spine BMD (P=0.05). BMD T-scores were not associated with 5-HTTLPR genotypes in patients 50 years or older. The 5-HTTLPR variants may modify serotonin effects on bone with sex-specific effects.
Deletion of Slc26a1 and Slc26a7 Delays Enamel Mineralization in Mice
Directory of Open Access Journals (Sweden)
Kaifeng Yin
2017-05-01
Full Text Available Amelogenesis features two major developmental stages—secretory and maturation. During maturation stage, hydroxyapatite deposition and matrix turnover require delicate pH regulatory mechanisms mediated by multiple ion transporters. Several members of the Slc26 gene family (Slc26a1, Slc26a3, Slc26a4, Slc26a6, and Slc26a7, which exhibit bicarbonate transport activities, have been suggested by previous studies to be involved in maturation-stage amelogenesis, especially the key process of pH regulation. However, details regarding the functional role of these genes in enamel formation are yet to be clarified, as none of the separate mutant animal lines demonstrates any discernible enamel defects. Continuing with our previous investigation of Slc26a1−/− and Slc26a7−/− animal models, we generated a double-mutant animal line with the absence of both Slc26a1 and Slc26a7. We showed in the present study that the double-mutant enamel density was significantly lower in the regions that represent late maturation-, maturation- and secretory-stage enamel development in wild-type mandibular incisors. However, the “maturation” and “secretory” enamel microstructures in double-mutant animals resembled those observed in wild-type secretory and/or pre-secretory stages. Elemental composition analysis revealed a lack of mineral deposition and an accumulation of carbon and chloride in double-mutant enamel. Deletion of Slc26a1 and Slc26a7 did not affect the stage-specific morphology of the enamel organ. Finally, compensatory expression of pH regulator genes and ion transporters was detected in maturation-stage enamel organs of double-mutant animals when compared to wild-type. Combined with the findings from our previous study, these data indicate the involvement of SLC26A1and SLC26A7 as key ion transporters in the pH regulatory network during enamel maturation.
Bronckers, Antonius L J J; Guo, Jing; Zandieh-Doulabi, Behrouz; Bervoets, Theodore J; Lyaruu, Donacian M; Li, Xiangming; Wangemann, Philine; DenBesten, Pamela
2011-12-01
Ameloblasts need to regulate pH during the formation of enamel crystals, a process that generates protons. Solute carrier family 26A member 4 (SLC26A4, or pendrin) is an anion exchanger for chloride, bicarbonate, iodine, and formate. It is expressed in apical membranes of ion-transporting epithelia in kidney, inner ear, and thyroid where it regulates luminal pH and fluid transport. We hypothesized that maturation ameloblasts express SLC26A4 to neutralize acidification of enamel fluid in forming enamel. In rodents, secretory and maturation ameloblasts were immunopositive for SLC26A4. Staining was particularly strong in apical membranes of maturation ameloblasts facing forming enamel. RT-PCR confirmed the presence of mRNA transcripts for Slc26a4 in enamel organs. SLC26A4 immunostaining was also found in mineralizing connective tissues, including odontoblasts, osteoblasts, osteocytes, osteoclasts, bone lining cells, cellular cementoblasts, and cementocytes. However, Slc26a4-null mutant mice had no overt dental phenotype. The presence of SLC26A4 in apical plasma membranes of maturation ameloblasts is consistent with a potential function as a pH regulator. SLC26A4 does not appear to be critical for ameloblast function and is probably compensated by other pH regulators. © 2011 Eur J Oral Sci.
Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando
2014-01-01
The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. PMID:25320081
Identification of genetic modifiers of behavioral phenotypes in serotonin transporter knockout rats
Directory of Open Access Journals (Sweden)
Nijman Isaäc J
2010-05-01
Full Text Available Abstract Background Genetic variation in the regulatory region of the human serotonin transporter gene (SLC6A4 has been shown to affect brain functionality and personality. However, large heterogeneity in its biological effects is observed, which is at least partially due to genetic modifiers. To gain insight into serotonin transporter (SERT-specific genetic modifiers, we studied an intercross between the Wistar SERT-/- rat and the behaviorally and genetically divergent Brown Norway rat, and performed a QTL analysis. Results In a cohort of >150 intercross SERT-/- and control (SERT+/+ rats we characterized 12 traits that were previously associated with SERT deficiency, including activity, exploratory pattern, cocaine-induced locomotor activity, and abdominal and subcutaneous fat. Using 325 genetic markers, 10 SERT-/--specific quantitative trait loci (QTLs for parameters related to activity and exploratory pattern (Chr.1,9,11,14, and cocaine-induced anxiety and locomotor activity (Chr.5,8 were identified. No significant QTLs were found for fat parameters. Using in silico approaches we explored potential causal genes within modifier QTL regions and found interesting candidates, amongst others, the 5-HT1D receptor (Chr. 5, dopamine D2 receptor (Chr. 8, cannabinoid receptor 2 (Chr. 5, and genes involved in fetal development and plasticity (across chromosomes. Conclusions We anticipate that the SERT-/--specific QTLs may lead to the identification of new modulators of serotonergic signaling, which may be targets for pharmacogenetic and therapeutic approaches.
Directory of Open Access Journals (Sweden)
Biederman Joseph
2009-02-01
Full Text Available Abstract Background Over the past decade pediatric bipolar disorder has gained recognition as a potentially more severe and heritable form of the disorder. In this report we test for association with genes coding brain-derived neurotrophic factor (BDNF, the serotonin transporter (SLC6A4, and catechol-O-methyltransferase (COMT. Methods Bipolar-I affected offspring triads (N = 173 were drawn from 522 individuals with 2 parents in 332 nuclear families recruited for genetic studies of pediatric psychopathology at the Clinical and Research Program in Pediatric Psychopharmacology and Adult ADHD at Massachusetts General Hospital. Results We failed to identify an association with the val66 allele in BDNF (OR = 1.23, p = 0.36, the COMT-l allele (OR = 1.27, p = 0.1, or the HTTLPR short allele (OR = 0.87, p = 0.38. Conclusion Our study suggests that the markers examined thus far in COMT and SLC6A4 are not associated with pediatric bipolar disorder and that if the val66met marker in BDNF is associated with pediatric bipolar disorder the magnitude of the association is much smaller than first reported.
Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando
2014-11-28
The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Neurosteroid Transport in the Brain: Role of ABC and SLC Transporters
Directory of Open Access Journals (Sweden)
Markus Grube
2018-04-01
Full Text Available Neurosteroids, comprising pregnane, androstane, and sulfated steroids can alter neuronal excitability through interaction with ligand-gated ion channels and other receptors and have therefore a therapeutic potential in several brain disorders. They can be formed in brain cells or are synthesized by an endocrine gland and reach the brain by penetrating the blood–brain barrier (BBB. Especially sulfated steroids such as pregnenolone sulfate (PregS and dehydroepiandrosterone sulfate (DHEAS depend on transporter proteins to cross membranes. In this review, we discuss the involvement of ATP-binding cassette (ABC- and solute carrier (SLC-type membrane proteins in the transport of these compounds at the BBB and in the choroid plexus (CP, but also in the secretion from neurons and glial cells. Among the ABC transporters, especially BCRP (ABCG2 and several MRP/ABCC subfamily members (MRP1, MRP4, MRP8 are expressed in the brain and known to efflux conjugated steroids. Furthermore, several SLC transporters have been shown to mediate cellular uptake of steroid sulfates. These include members of the OATP/SLCO subfamily, namely OATP1A2 and OATP2B1, as well as OAT3 (SLC22A3, which have been reported to be expressed at the BBB, in the CP and in part in neurons. Furthermore, a role of the organic solute transporter OSTα-OSTβ (SLC51A/B in brain DHEAS/PregS homeostasis has been proposed. This transporter was reported to be localized especially in steroidogenic cells of the cerebellum and hippocampus. To date, the impact of transporters on neurosteroid homeostasis is still poorly understood. Further insights are desirable also with regard to the therapeutic potential of these compounds.
Contreras, J; Hare, L; Camarena, B; Glahn, D; Dassori, A; Medina, R; Contreras, S; Ramirez, M; Armas, R; Munoz, R; Mendoza, R; Raventos, H; Ontiveros, A; Nicolini, H; Palmer, R; Escamilla, M
2009-02-01
Variation in the serotonin transporter gene (SLC6A4) promoter region has been shown to influence depression in persons who have been exposed to a number of stressful life events. We evaluated whether genetic variation in 5-HTTLPR, influences current depression, lifetime history of depression and quantitative measures of depression in persons with chronic psychotic disorders. This is an association study of a genetic variant with quantitative and categorical definitions of depression conducted in the southwest US, Mexico and Costa Rica. We analyzed 260 subjects with a history of psychosis, from a sample of 129 families. We found that persons carrying at least one short allele had a statistically significant increased lifetime risk for depressive syndromes (P depression during the course of their illness.
SLC4A11 Prevents Osmotic Imbalance Leading to Corneal Endothelial Dystrophy, Deafness, and Polyuria*
Gröger, Nicole; Fröhlich, Henning; Maier, Hannes; Olbrich, Andrea; Kostin, Sawa; Braun, Thomas; Boettger, Thomas
2010-01-01
Maintenance of ion concentration gradients is essential for the function of many organs, including the kidney, the cornea, and the inner ear. Ion concentrations and fluid content in the cornea are regulated by endothelial cells that separate the collagenous avascular corneal stroma from the anterior eye chamber. Failure to maintain correct ion concentrations leads to swelling and destruction of the cornea. In the inner ear, the stria vascularis is responsible for generating proper ion concentrations in the endolymph, which is essential for hearing. Mutations of SLC4A11 in humans lead to syndromes associated with corneal dystrophy and perceptive deafness. The molecular mechanisms underlying these symptoms are poorly understood, impeding therapeutic interventions. The ion transporter SLC4A11 mediates sodium-dependent transport of borate as well as flux of sodium and hydroxyl ions in vitro. Here, we show that SLC4A11 is expressed in the endothelial cells of the cornea where it prevents severe morphological changes of the cornea caused by increased sodium chloride concentrations in the stroma. In the inner ear, SLC4A11 is located in fibrocytes underlying the stria vascularis. Loss of SLC4A11 leads to morphological changes in the fibrocytes and deafness. We demonstrate that SLC4A11 is essential for the generation of the endocochlear potential but not for regulation of potassium concentrations in the endolymph. In the kidney, SLC4A11 is expressed in the thin descending limb of Henle loop. SLC4A11 is essential for urinary concentration, suggesting that SLC4A11 participates in the countercurrent multiplication that concentrates urine in the kidney medulla. PMID:20185830
Morgan, Barak; Kumsta, Robert; Fearon, Pasco; Moser, Dirk; Skeen, Sarah; Cooper, Peter; Murray, Lynne; Moran, Greg; Tomlinson, Mark
2017-02-01
Clear recognition of the damaging effects of poverty on early childhood development has fueled an interest in interventions aimed at mitigating these harmful consequences. Psychosocial interventions aimed at alleviating the negative impacts of poverty on children are frequently shown to be of benefit, but effect sizes are typically small to moderate. However, averaging outcomes over an entire sample, as is typically done, could underestimate efficacy because weaker effects on less susceptible individuals would dilute estimation of effects on those more disposed to respond. This study investigates whether a genetic polymorphism of the serotonin transporter gene moderates susceptibility to a psychosocial intervention. We reanalyzed data from a randomized controlled trial of a home-visiting program delivered by community health workers in a black, isiXhosa-speaking population in Khayelitsha, South Africa. The intervention, designed to enhance maternal-infant attachment, began in the third trimester and continued until 6 mo postpartum. Implemented between April 1999 and February 2003, the intervention comprised 16 home visits delivered to 220 mother-infant dyads by specially trained community health workers. A control group of 229 mother-infant dyads did not receive the intervention. Security of maternal-infant attachment was the main outcome measured at infant age 18 mo. Compared to controls, infants in the intervention group were significantly more likely to be securely attached to their primary caregiver (odds ratio [OR] = 1.7, p = 0.029, 95% CI [1.06, 2.76], d = 0.29). After the trial, 162 intervention and 172 control group children were reenrolled in a follow-up study at 13 y of age (December 2012-June 2014). At this time, DNA collected from 279 children (134 intervention and 145 control) was genotyped for a common serotonin transporter polymorphism. There were both genetic data and attachment security data for 220 children (110 intervention and 110 control), of
Directory of Open Access Journals (Sweden)
Barak Morgan
2017-02-01
Full Text Available Clear recognition of the damaging effects of poverty on early childhood development has fueled an interest in interventions aimed at mitigating these harmful consequences. Psychosocial interventions aimed at alleviating the negative impacts of poverty on children are frequently shown to be of benefit, but effect sizes are typically small to moderate. However, averaging outcomes over an entire sample, as is typically done, could underestimate efficacy because weaker effects on less susceptible individuals would dilute estimation of effects on those more disposed to respond. This study investigates whether a genetic polymorphism of the serotonin transporter gene moderates susceptibility to a psychosocial intervention.We reanalyzed data from a randomized controlled trial of a home-visiting program delivered by community health workers in a black, isiXhosa-speaking population in Khayelitsha, South Africa. The intervention, designed to enhance maternal-infant attachment, began in the third trimester and continued until 6 mo postpartum. Implemented between April 1999 and February 2003, the intervention comprised 16 home visits delivered to 220 mother-infant dyads by specially trained community health workers. A control group of 229 mother-infant dyads did not receive the intervention. Security of maternal-infant attachment was the main outcome measured at infant age 18 mo. Compared to controls, infants in the intervention group were significantly more likely to be securely attached to their primary caregiver (odds ratio [OR] = 1.7, p = 0.029, 95% CI [1.06, 2.76], d = 0.29. After the trial, 162 intervention and 172 control group children were reenrolled in a follow-up study at 13 y of age (December 2012-June 2014. At this time, DNA collected from 279 children (134 intervention and 145 control was genotyped for a common serotonin transporter polymorphism. There were both genetic data and attachment security data for 220 children (110 intervention and
Sodium-coupled neutral amino acid (System N/A) transporters of the SLC38 gene family.
Mackenzie, Bryan; Erickson, Jeffrey D
2004-02-01
The sodium-coupled neutral amino acid transporters (SNAT) of the SLC38 gene family resemble the classically-described System A and System N transport activities in terms of their functional properties and patterns of regulation. Transport of small, aliphatic amino acids by System A subtypes (SNAT1, SNAT2, and SNAT4) is rheogenic and pH sensitive. The System N subtypes SNAT3 and SNAT5 also countertransport H(+), which may be key to their operation in reverse, and have narrower substrate profiles than do the System A subtypes. Glutamine emerges as a favored substrate throughout the family, except for SNAT4. The SLC38 transporters undoubtedly play many physiological roles including the transfer of glutamine from astrocyte to neuron in the CNS, ammonia detoxification and gluconeogenesis in the liver, and the renal response to acidosis. Probing their regulation has revealed additional roles, and recent work has considered SLC38 transporters as therapeutic targets in neoplasia.
The renal urate transporter SLC17A1 locus: confirmation of association with gout.
Hollis-Moffatt, Jade E; Phipps-Green, Amanda J; Chapman, Brett; Jones, Gregory T; van Rij, Andre; Gow, Peter J; Harrison, Andrew A; Highton, John; Jones, Peter B; Montgomery, Grant W; Stamp, Lisa K; Dalbeth, Nicola; Merriman, Tony R
2012-04-27
Two major gout-causing genes have been identified, the urate transport genes SLC2A9 and ABCG2. Variation within the SLC17A1 locus, which encodes sodium-dependent phosphate transporter 1, a renal transporter of uric acid, has also been associated with serum urate concentration. However, evidence for association with gout is equivocal. We investigated the association of the SLC17A1 locus with gout in New Zealand sample sets. Five variants (rs1165196, rs1183201, rs9358890, rs3799344, rs12664474) were genotyped across a New Zealand sample set totaling 971 cases and 1,742 controls. Cases were ascertained according to American Rheumatism Association criteria. Two population groups were studied: Caucasian and Polynesian. At rs1183201 (SLC17A1), evidence for association with gout was observed in both the Caucasian (odds ratio (OR) = 0.67, P = 3.0 × 10-6) and Polynesian (OR = 0.74, P = 3.0 × 10-3) groups. Meta-analysis confirmed association of rs1183201 with gout at a genome-wide level of significance (OR = 0.70, P = 3.0 × 10-8). Haplotype analysis suggested the presence of a common protective haplotype. We confirm the SLC17A1 locus as the third associated with gout at a genome-wide level of significance.
Zhang, Zhengyu; Tachikawa, Masanori; Uchida, Yasuo; Terasaki, Tetsuya
2018-03-05
Although arachnoid mater epithelial cells form the blood-arachnoid barrier (BAB), acting as a blood-CSF interface, it has been generally considered that the BAB is impermeable to water-soluble substances and plays a largely passive role. Here, we aimed to clarify the function of transporters at the BAB in regulating CSF clearance of water-soluble organic anion drugs based on quantitative targeted absolute proteomics (QTAP) and in vivo analyses. Protein expression levels of 61 molecules, including 19 ATP-binding-cassette (ABC) transporters and 32 solute-carrier (SLC) transporters, were measured in plasma membrane fraction of rat leptomeninges using QTAP. Thirty-three proteins were detected; others were under the quantification limits. Expression levels of multidrug resistance protein 1 (Mdr1a/P-gp/Abcb1a) and breast cancer resistance protein (Bcrp/Abcg2) were 16.6 and 3.27 fmol/μg protein (51.9- and 9.82-fold greater than in choroid plexus, respectively). Among those organic anion transporters detected only at leptomeninges, not choroid plexus, organic anion transporter 1 (oat1/Slc22a6) showed the greatest expression (2.73 fmol/μg protein). On the other hand, the protein expression level of oat3 at leptomeninges was 6.65 fmol/μg protein, and the difference from choroid plexus was within two-fold. To investigate oat1's role, we injected para-aminohippuric acid (PAH) with or without oat1 inhibitors into cisterna magna (to minimize the contribution of choroid plexus function) of rats. A bulk flow marker, FITC-inulin, was not taken up from CSF up to 15 min, whereas uptake clearance of PAH was 26.5 μL/min. PAH uptake was completely blocked by 3 mM cephalothin (inhibits both oat1 and oat3), while 17% of PAH uptake was inhibited by 0.2 mM cephalothin (selectively inhibits oat3). These results indicate that oat1 and oat3 at the BAB provide a distinct clearance pathway of organic anion drugs from CSF independently of choroid plexus.
The Physiopathological Role of the Exchangers Belonging to the SLC37 Family
Directory of Open Access Journals (Sweden)
Anna Rita Cappello
2018-04-01
Full Text Available The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P antiporters, catalyzing both homologous (Pi/Pi and heterologous (G6P/Pi exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT, transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib, an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.
The Physiopathological Role of the Exchangers Belonging to the SLC37 Family
Cappello, Anna Rita; Curcio, Rosita; Lappano, Rosamaria; Maggiolini, Marcello; Dolce, Vincenza
2018-04-01
The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER) membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi) antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P) antiporters, catalyzing both homologous (Pi/Pi) and heterologous (G6P/Pi) exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT), transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α) or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib), an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.
Brain serotonin and dopamine transporter bindings in adults with high-functioning autism.
Nakamura, Kazuhiko; Sekine, Yoshimoto; Ouchi, Yasuomi; Tsujii, Masatsugu; Yoshikawa, Etsuji; Futatsubashi, Masami; Tsuchiya, Kenji J; Sugihara, Genichi; Iwata, Yasuhide; Suzuki, Katsuaki; Matsuzaki, Hideo; Suda, Shiro; Sugiyama, Toshiro; Takei, Nori; Mori, Norio
2010-01-01
Autism is a neurodevelopmental disorder that is characterized by repetitive and/or obsessive interests and behavior and by deficits in sociability and communication. Although its neurobiological underpinnings are postulated to lie in abnormalities of the serotoninergic and dopaminergic systems, the details remain unknown. To determine the occurrence of changes in the binding of serotonin and dopamine transporters, which are highly selective markers for their respective neuronal systems. Using positron emission tomography, we measured the binding of brain serotonin and dopamine transporters in each individual with the radioligands carbon 11 ((11)C)-labeled trans-1,2,3,5,6,10-beta-hexahydro-6-[4-(methylthio)phenyl]pyrrolo-[2,1-a]isoquinoline ([(11)C](+)McN-5652) and 2beta-carbomethoxy-3-beta-(4-fluorophenyl)tropane ([(11)C]WIN-35,428), respectively. Statistical parametric mapping was used for between-subject analysis and within-subject correlation analysis with respect to clinical variables. Participants recruited from the community. Twenty men (age range, 18-26 years; mean [SD] IQ, 99.3 [18.1]) with autism and 20 age- and IQ-matched control subjects. Serotonin transporter binding was significantly lower throughout the brain in autistic individuals compared with controls (P dopamine transporter binding was significantly higher in the orbitofrontal cortex of the autistic group (P dopamine transporter binding was significantly inversely correlated with serotonin transporter binding (r = -0.61; P = .004). The brains of autistic individuals have abnormalities in both serotonin transporter and dopamine transporter binding. The present findings indicate that the gross abnormalities in these neurotransmitter systems may underpin the neurophysiologic mechanism of autism. Our sample was not characteristic or representative of a typical sample of adults with autism in the community.
Park, Hae Jeong; Lee, Soojung; Ju, Eunji; Jones, Jayre A; Choi, Inyeong
2017-03-01
Genome-wide association studies have identified the single nucleotide polymorphism (SNP) rs3278 in the human SLC4A7 gene as one of the marker loci for addiction vulnerability. This marker is located in an intron of the gene, and its genomic role has been unknown. In this study, we examined rs3278 and three adjacent SNPs prevalent in alcoholics for their effects on an alternative promoter that would lead to the production of the NH 2 -terminally truncated protein NBCn1ΔN450, missing the first 450 amino acids. Analysis of the transcription start site database and a promoter prediction algorithm identified a cluster of three promoters in intron 7 and two short CpG-rich sites in intron 6. The promoter closest to rs3278 showed strong transcription activity in luciferase reporter gene assays. Major-to-minor allele substitution at rs3278 resulted in increased transcription activity. Equivalent substitutions at adjacent rs3772723 (intron 7) and rs13077400 (exon 8) had negligible effect; however, the substitution at nonsynonymous rs3755652 (exon 8) increased the activity by more than twofold. The concomitant substitution at rs3278/rs3755652 produced an additive effect. The rs3755652 had more profound effects on the promoter than the upstream regulatory CpG sites. The amino acid change E326K caused by rs3755652 had negligible effect on transporter function. In HEK 293 cells, NBCn1ΔN450 was expressed in plasma membranes, but at significantly lower levels than the nontruncated NBCn1-E. The pH change mediated by NBCn1ΔN450 was also low. We conclude that rs3278 and rs3755652 stimulate an alternative transcription of the SLC4A7 gene, increasing the production of a defective transporter. Copyright © 2017 the American Physiological Society.
Yang, Jiekun; Li, Ming D
2014-07-01
Previous studies have implicated genes encoding the 5-HT3AB receptors (HTR3A and HTR3B) and the serotonin transporter (SLC6A4), both independently and interactively, in alcohol (AD), cocaine (CD), and nicotine dependence (ND). However, whether these genetic effects also exist in subjects with comorbidities remains largely unknown. We used 1,136 African-American (AA) and 2,428 European-American (EA) subjects from the Study of Addiction: Genetics and Environment (SAGE) to determine associations between 88 genotyped or imputed variants within HTR3A, HTR3B, and SLC6A4 and three types of addictions, which were measured by DSM-IV diagnoses of AD, CD, and ND and the Fagerström Test for Nicotine Dependence (FTND), an independent measure of ND commonly used in tobacco research. Individual SNP-based association analysis revealed a significant association of rs2066713 in SLC6A4 with FTND in AA (β = -1.39; P = 1.6E - 04). Haplotype-based association analysis found one major haplotype formed by SNPs rs3891484 and rs3758987 in HTR3B that was significantly associated with AD in the AA sample, and another major haplotype T-T-G, formed by SNPs rs7118530, rs12221649, and rs2085421 in HTR3A, which showed significant association with FTND in the EA sample. Considering the biologic roles of the three genes and their functional relations, we used the GPU-based Generalized Multifactor Dimensionality Reduction (GMDR-GPU) program to test SNP-by-SNP interactions within the three genes and discovered two- to five-variant models that have significant impacts on AD, CD, ND, or FTND. Interestingly, most of the SNPs included in the genetic interaction model(s) for each addictive phenotype are either overlapped or in high linkage disequilibrium for both AA and EA samples, suggesting these detected variants in HTR3A, HTR3B, and SLC6A4 are interactively contributing to etiology of the three addictive phenotypes examined in this study.
Treatment of intractable epilepsy in a female with SLC6A8 deficiency
Mercimek-Mahmutoglu, S.; Connolly, M.B.; Poskitt, K.J.; Horvath, G.A.; Lowry, N.; Salomons, G.S.; Casey, B.; Sinclair, G.; Davis, C.; Jakobs, C.; Stockler-Ipsiroglu, S.
2010-01-01
A female heterozygous for a novel, disease causing, missense mutation in the X-linked cerebral creatine transporter (SLC6A8) gene (c.1067G > T, p.Gly356Val) presented with intractable epilepsy, mild intellectual disability and moderately reduced cerebral creatine levels. Treatment with creatine
The serotonin transporter knockout rat : A review
Olivier, Jocelien; Cools, Alexander; Ellenbroek, Bart A.; Cuppen, E.; Homberg, Judith; Kalueff, Allan V.; LaPorte, Justin L.
2010-01-01
This chapter dicusses the most recent data on the serotonin transporter knock-out rat, a unique rat model that has been generated by target-selected N-ethyl-N-nitrosourea (ENU) driven mutagenesis. The knock-out rat is the result of a premature stopcodon in the serotonin transporter gene, and the
Dias, Helena; Muc, Magdalena; Padez, Cristina; Manco, Licínio
2016-01-01
To investigate the association of polymorphisms in SLC6A4 and MAOA genes with overweight (including obesity). Young adults (n = 535) of Portuguese origin were genotyped for the SLC6A4 polymorphisms 5-HTTLPR and STin2 and a MAOA VNTR. BMI and body fat percentage were measured and a questionnaire was used to assess individual's sport practicing habits. In whole study sample, haplotype-based analysis revealed significant association with overweight/obesity for the individual 5-HTTLPR/Stin2 haplotype L10 (p = 0.04). In men, the MAOA 3R genotype was nominally associated with body fat (p = 0.04). In inactive individuals, overweight/obesity was found significantly associated with 5-HTTLPR L-allele (p = 0.01) and nominally associated with STin2 10-allele (p = 0.03). A significant association was also found testing for all haplotype effects (χ(2 )= 8.7; p = 0.03). We found some evidences for the association of SLC6A4 and MAOA genes with measures of obesity. Our results suggest physical inactivity accentuates the influence of SLC6A4 polymorphisms on obesity risk.
Genetic polymorphism of serotonin transporter 5-HTTLPR ...
Indian Academy of Sciences (India)
society (Centers for Disease Control and Prevention 2008). More than 98% of ... smoking addiction (Li 2006). It is well ... neurotransmitter transporter (SLC6) family (Saier 1999). ..... gested that the effects of genotype and treatment may vary.
Effects of ageing on serotonin transporters in healthy females
International Nuclear Information System (INIS)
Kuikka, J.T.; Tammela, L.; Karhunen, L.; Uusitupa, M.; Bergstroem, K.A.; Tiihonen, J.
2001-01-01
The effect of ageing on brain serotonin transporters was evaluated in 19 healthy female volunteers (age range 22-74 years) using single-photon emission tomography and [ 123 I] nor-β-CIT. The study subjects were scanned 0.3, 3, 6 and 23 h after injection of 185 MBq of [ 123 I] nor-β-CIT. The ratio of the distribution volume for tracer in the midbrain to that in the cerebellum minus 1 was used as an index for serotonin transporter binding. An age-related decline of 2% per decade (r=-0.47; P 123 I] nor-β-CIT binding in the serotonin transporter-rich area is much less than that in dopamine transporters in the striatum (6% per decade). (orig.)
Jacobsen, Jessie C; Wilson, Callum; Cunningham, Vicki; Glamuzina, Emma; Prosser, Debra O; Love, Donald R; Burgess, Trent; Taylor, Juliet; Swan, Brendan; Hill, Rosamund; Robertson, Stephen P; Snell, Russell G; Lehnert, Klaus
2016-03-01
Two male siblings from a consanguineous union presented in early infancy with marked truncal hypotonia, a general paucity of movement, extrapyramidal signs and cognitive delay. By mid-childhood they had made little developmental progress and remained severely hypotonic and bradykinetic. They developed epilepsy and had problems with autonomic dysfunction and oculogyric crises. They had a number of orthopaedic problems secondary to their hypotonia. Cerebrospinal fluid (CSF) neurotransmitters were initially normal, apart from mildly elevated 5-hydroxyindolacetic acid, and the children did not respond favourably to a trial of levodopa-carbidopa. The youngest died from respiratory complications at 10 years of age. Repeat CSF neurotransmitters in the older sibling at eight years of age showed slightly low homovanillic acid and 5-hydroxyindoleacetic acid levels. Whole-exome sequencing revealed a novel mutation homozygous in both children in the monoamine transporter gene SLC18A2 (p.Pro237His), resulting in brain dopamine-serotonin vesicular transport disease. This is the second family to be described with a mutation in this gene. Treatment with the dopamine agonist pramipexole in the surviving child resulted in mild improvements in alertness, communication, and eye movements. This case supports the identification of the causal mutation in the original case, expands the clinical phenotype of brain dopamine-serotonin vesicular transport disease and confirms that pramipexole treatment may lead to symptomatic improvement in affected individuals.
Directory of Open Access Journals (Sweden)
Marcelo Paschoalete Carlin
2013-01-01
Full Text Available Glycogen storage disease (GSD comprises a group of autosomal recessive disorders characterized by deficiency of the enzymes that regulate the synthesis or degradation of glycogen. Types Ia and Ib are the most prevalent; while the former is caused by deficiency of glucose-6-phosphatase (G6Pase, the latter is associated with impaired glucose-6-phosphate transporter, where the catalytic unit of G6Pase is located. Over 85 mutations have been reported since the cloning of G6PC and SLC37A4 genes. In this study, twelve unrelated patients with clinical symptoms suggestive of GSDIa and Ib were investigated by using genetic sequencing of G6PC and SLC37A4 genes, being three confirmed as having GSD Ia, and two with GSD Ib. In seven of these patients no mutations were detected in any of the genes. Five changes were detected in G6PC, including three known point mutations (p.G68R, p.R83C and p.Q347X and two neutral mutations (c.432G > A and c.1176T > C. Four changes were found in SLC37A4: a known point mutation (p.G149E, a novel frameshift insertion (c.1338_1339insT, and two neutral mutations (c.1287G > A and c.1076-28C > T. The frequency of mutations in our population was similar to that observed in the literature, in which the mutation p.R83C is also the most frequent one. Analysis of both genes should be considered in the investigation of this condition. An alternative explanation to the negative results in this molecular study is the possibility of a misdiagnosis. Even with a careful evaluation based on laboratory and clinical findings, overlap with other types of GSD is possible, and further molecular studies should be indicated.
González-Giraldo, Yeimy; Camargo, Andrés; López-León, Sandra; Forero, Diego A
2015-01-01
Background. Major depressive disorder (MDD) is the second cause of years lived with disability around the world. A large number of studies have been carried out to identify genetic risk factors for MDD and related endophenotypes, mainly in populations of European and Asian descent, with conflicting results. The main aim of the current study was to analyze the possible association of five candidate genes and depressive symptoms in a Colombian sample of healthy subjects. Methods and Materials. The Spanish adaptation of the Hospital Anxiety and Depression Scale (HADS) was applied to one hundred eighty-eight healthy Colombian subjects. Five functional polymorphisms were genotyped using PCR-based assays: BDNF-Val66Met (rs6265), COMT-Val158Met (rs4680), SLC6A4-HTTLPR (rs4795541), MAOA-uVNTR, and SLC6A3-VNTR (rs28363170). Result. We did not find significant associations with scores of depressive symptoms, derived from the HADS, for any of the five candidate genes (nominal p values >0.05). In addition, we did not find evidence of significant gene-gene interactions. Conclusion. This work is one of the first studies of candidate genes for depressive symptoms in a Latin American sample. Study of additional genetic and epigenetic variants, taking into account other pathophysiological theories, will help to identify novel candidates for MDD in populations around the world.
Felts, Bruce; Pramod, Akula Bala; Sandtner, Walter; Burbach, Nathan; Bulling, Simon; Sitte, Harald H; Henry, L Keith
2014-01-17
Neurotransmitter transporters of the SLC6 family of proteins, including the human serotonin transporter (hSERT), utilize Na(+), Cl(-), and K(+) gradients to induce conformational changes necessary for substrate translocation. Dysregulation of ion movement through monoamine transporters has been shown to impact neuronal firing potentials and could play a role in pathophysiologies, such as depression and anxiety. Despite multiple crystal structures of prokaryotic and eukaryotic SLC transporters indicating the location of both (or one) conserved Na(+)-binding sites (termed Na1 and Na2), much remains uncertain in regard to the movements and contributions of these cation-binding sites in the transport process. In this study, we utilize the unique properties of a mutation of hSERT at a single, highly conserved asparagine on TM1 (Asn-101) to provide several lines of evidence demonstrating mechanistically distinct roles for Na1 and Na2. Mutations at Asn-101 alter the cation dependence of the transporter, allowing Ca(2+) (but not other cations) to functionally replace Na(+) for driving transport and promoting 5-hydroxytryptamine (5-HT)-dependent conformational changes. Furthermore, in two-electrode voltage clamp studies in Xenopus oocytes, both Ca(2+) and Na(+) illicit 5-HT-induced currents in the Asn-101 mutants and reveal that, although Ca(2+) promotes substrate-induced current, it does not appear to be the charge carrier during 5-HT transport. These findings, in addition to functional evaluation of Na1 and Na2 site mutants, reveal separate roles for Na1 and Na2 and provide insight into initiation of the translocation process as well as a mechanism whereby the reported SERT stoichiometry can be obtained despite the presence of two putative Na(+)-binding sites.
Felts, Bruce; Pramod, Akula Bala; Sandtner, Walter; Burbach, Nathan; Bulling, Simon; Sitte, Harald H.; Henry, L. Keith
2014-01-01
Neurotransmitter transporters of the SLC6 family of proteins, including the human serotonin transporter (hSERT), utilize Na+, Cl−, and K+ gradients to induce conformational changes necessary for substrate translocation. Dysregulation of ion movement through monoamine transporters has been shown to impact neuronal firing potentials and could play a role in pathophysiologies, such as depression and anxiety. Despite multiple crystal structures of prokaryotic and eukaryotic SLC transporters indicating the location of both (or one) conserved Na+-binding sites (termed Na1 and Na2), much remains uncertain in regard to the movements and contributions of these cation-binding sites in the transport process. In this study, we utilize the unique properties of a mutation of hSERT at a single, highly conserved asparagine on TM1 (Asn-101) to provide several lines of evidence demonstrating mechanistically distinct roles for Na1 and Na2. Mutations at Asn-101 alter the cation dependence of the transporter, allowing Ca2+ (but not other cations) to functionally replace Na+ for driving transport and promoting 5-hydroxytryptamine (5-HT)-dependent conformational changes. Furthermore, in two-electrode voltage clamp studies in Xenopus oocytes, both Ca2+ and Na+ illicit 5-HT-induced currents in the Asn-101 mutants and reveal that, although Ca2+ promotes substrate-induced current, it does not appear to be the charge carrier during 5-HT transport. These findings, in addition to functional evaluation of Na1 and Na2 site mutants, reveal separate roles for Na1 and Na2 and provide insight into initiation of the translocation process as well as a mechanism whereby the reported SERT stoichiometry can be obtained despite the presence of two putative Na+-binding sites. PMID:24293367
Margolis, Kara Gross; Li, Zhishan; Stevanovic, Korey; Saurman, Virginia; Anderson, George M.; Snyder, Isaac; Blakely, Randy D.; Gershon, Michael D.
2016-01-01
Autism spectrum disorder (ASD) is an increasingly common behavioral condition that frequently presents with gastrointestinal (GI) disturbances. It is not clear, however, how gut dysfunction relates to core ASD features. Multiple, rare hyperfunctional coding variants of the serotonin (5-HT) transporter (SERT, encoded by SLC6A4) have been identified in ASD. Expression of the most common SERT variant (Ala56) in mice increases 5-HT clearance and causes ASD-like behaviors. Here, we demonstrated that Ala56-expressing mice display GI defects that resemble those seen in mice lacking neuronal 5-HT. These defects included enteric nervous system hypoplasia, slow GI transit, diminished peristaltic reflex activity, and proliferation of crypt epithelial cells. An opposite phenotype was seen in SERT-deficient mice and in progeny of WT dams given the SERT antagonist fluoxetine. The reciprocal phenotypes that resulted from increased or decreased SERT activity support the idea that 5-HT signaling regulates enteric neuronal development and can, when disturbed, cause long-lasting abnormalities of GI function. Administration of a 5-HT4 agonist to Ala56 mice during development prevented Ala56-associated GI perturbations, suggesting that excessive SERT activity leads to inadequate 5-HT4–mediated neurogenesis. We propose that deficient 5-HT signaling during development may contribute to GI and behavioral features of ASD. The consequences of therapies targeting SERT during pregnancy warrant further evaluation. PMID:27111230
Teixeira, Silvania Silva; Tamrakar, Akhilesh K.; Goulart-Silva, Francemilson; Serrano-Nascimento, Caroline; Klip, Amira
2012-01-01
Background Thyroid hormones (THs) act genomically to stimulate glucose transport by elevating glucose transporter (Slc2a) expression and glucose utilization by cells. However, nongenomic effects of THs are now emerging. Here, we assess how triiodothyronine (T3) acutely affects glucose transport and the content of GLUT4, GLUT1, and GLUT3 at the surface of muscle cells, and possible interactions between T3 and insulin action. Methods Differentiated L6 myotubes transfected with myc-tagged Slc2a4 (L6-GLUT4myc) or Slc2a1 (L6-GLUT1myc) and wild-type L6 myotubes were studied in the following conditions: control, hypothyroid (Tx), Tx plus T3, Tx plus insulin, and Tx plus insulin and T3. Results Glucose uptake and GLUT4 content at the cell surface decreased in the Tx group relative to controls. T3 treatment for 30 minutes increased glucose transport into L6-GLUT4myc cells without altering surface GLUT4 content, which increased only thereafter. The total amount of GLUT4 protein remained unchanged among the groups studied. The surface GLUT1 content of L6-GLUT1myc cells also remained unaltered after T3 treatment; however, in these cells glucose transport was not stimulated by T3. In wild-type L6 cells, although T3 treatment increased the total amount of GLUT3, it did not change the surface GLUT3 content. Moreover, within 30 minutes, T3 stimulation of glucose uptake was additive to that of insulin in L6-GLUT4myc cells. As expected, insulin elevated surface GLUT4 content and glucose uptake. However, interestingly, surface GLUT4 content remained unchanged or even dropped with T3 plus insulin. Conclusions These data reveal that T3 rapidly increases glucose uptake in L6-GLUT4myc cells, which, at least for 30 minutes, did not depend on an increment in GLUT4 at the cell surface yet potentiates insulin action. We propose that this rapid T3 effect involves activation of GLUT4 transporters at the cell surface, but cannot discount the involvement of an unknown GLUT. PMID:22663547
Yu, Dongke; Zhang, Han; Lionarons, Daniel A; Boyer, James L; Cai, Shi-Ying
2017-04-01
The Na + -dependent taurocholate cotransporting polypeptide (NTCP/SLC10A1) is a hepatocyte-specific solute carrier, which plays an important role in maintaining bile salt homeostasis in mammals. The absence of a hepatic Na + -dependent bile salt transport system in marine skate and rainbow trout raises a question regarding the function of the Slc10a1 gene in these species. Here, we have characterized the Slc10a1 gene in the marine skate, Leucoraja erinacea The transcript of skate Slc10a1 (skSlc10a1) encodes 319 amino acids and shares 46% identity to human NTCP (hNTCP) with similar topology to mammalian NTCP. SkSlc10a1 mRNA was mostly confined to the brain and testes with minimal expression in the liver. An FXR-bile salt reporter assay indicated that skSlc10a1 transported taurocholic acid (TCA) and scymnol sulfate, but not as effectively as hNTCP. An [ 3 H]TCA uptake assay revealed that skSlc10a1 functioned as a Na + -dependent transporter, but with low affinity for TCA ( K m = 92.4 µM) and scymnol sulfate ( K i = 31 µM), compared with hNTCP (TCA, K m = 5.4 µM; Scymnol sulfate, K i = 3.5 µM). In contrast, the bile salt concentration in skate plasma was 2 µM, similar to levels seen in mammals. Interestingly, skSlc10a1 demonstrated transport activity for the neurosteroids dehydroepiandrosterone sulfate and estrone-3-sulfate at physiological concentration, similar to hNTCP. Together, our findings indicate that skSlc10a1 is not a physiological bile salt transporter, providing a molecular explanation for the absence of a hepatic Na + -dependent bile salt uptake system in skate. We speculate that Slc10a1 is a neurosteroid transporter in skate that gained its substrate specificity for bile salts later in vertebrate evolution. Copyright © 2017 the American Physiological Society.
Battini, R; Chilosi, A M; Casarano, M; Moro, F; Comparini, A; Alessandrì, M G; Leuzzi, V; Tosetti, M; Cioni, G
2011-02-01
We describe the clinical and molecular features of a child harboring a novel mutation in SLC6A8 gene in association with a milder phenotype than other creatine transporter (CT1) deficient patients (OMIM 300352) [1-7]. The mutation c.757 G>C p.G253R in exon 4 of SLC6A8 was hemizygous in the child, aged 6 years and 6 months, who showed mild intellectual disability with severe speech and language delay. His carrier mother had borderline intellectual functioning. Although the neurochemical and biochemical parameters were fully consistent with those reported in the literature for subjects with CT1 deficit, in our patient within a general cognitive disability, a discrepancy between nonverbal and verbal skills was observed, confirming the peculiar vulnerability of language development under brain Cr depletion. Copyright © 2010 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Broberg, M. L.; Holm, Rasmus Koldborg; Tønsberg, H
2012-01-01
BACKGROUND AND PURPOSE: Intestinal absorption via membrane transporters may determine the pharmacokinetics of drug compounds. The hypothesis is that oral absorption of gaboxadol (4, 5, 6, 7-tetrahydroisoxazolo [5,4-c] pyridine-3-ol) in rats occurs via the proton-coupled amino acid transporter, r....... The intestinal expression of rSlc36a1 mRNA was measured by quantitative real-time PCR (q-RT-PCR). Furthermore, the hPAT1-/rPAT1-mediated transport of gaboxadol or L-proline was studied in hPAT1-expressing X. laevis oocytes, Caco-2 cell monolayers and excised segments of the rat intestine. KEY RESULTS......). The in vitro carrier-mediated uptake rate of L-proline in the excised intestinal segments was highest in the mid jejunum and low in the colon. The in vitro uptake and the in vivo absorption correlated with the expression of rSlc36a1 mRNA along the rat intestine. CONCLUSIONS AND IMPLICATIONS: The results...
International Nuclear Information System (INIS)
Humphreys, C.J.
1989-01-01
The plasmalemmal serotonin transporter uses transmembrane gradients of Na + , Cl - and K + to accumulate serotonin within blood platelets. Transport is competitively inhibited by the antidepressant imipramine. Like serotonin transport, imipramine binding requires Na + . Unlike serotonin, however, imipramine does not appear to be transported. To gain insight into the mechanism of serotonin transport the author have analyzed the influences of Na + and Cl - , the two ions cotransported with serotonin, on both serotonin transport and the interaction of imipramine and other antidepressant drugs with the plasmalemmal serotonin transporter of human platelets. Additionally, the author have synthesized, purified and characterized the binding of 2-iodoimipramine to the serotonin transporter. Finally, the author have conducted a preliminary study of the inhibition of serotonin transport and imipramine binding produced by dicyclohexylcarbodiimide. My results reveal many instances of positive heterotropic cooperativity in ligand binding to the serotonin transporter. Na + binding enhances the transporters affinity for imipramine and several other antidepressant drugs, and also increases the affinity for Cl - . Cl - enhances the transporters affinity for imipramine, as well as for Na + . At concentrations in the range of its K M for transport serotonin is a competitive inhibitor of imipramine binding. At much higher concentrations, however, serotonin also inhibits imipramines dissociation rate constant. This latter effect which is Na + -independent and species specific, is apparently produced by serotonin binding at a second, low affinity site on, or near, the transporter complex. Iodoimipramine competitively inhibit both [ 3 H]imipramine binding and [ 3 H]serotonin transport
An improved synthesis of 4-[18F]-ADAM, a potent serotonin transporter imaging agent
International Nuclear Information System (INIS)
Huang, Y.-Y.; Huang, W.-S.; Chu, T.-C.; Shiue, C.-Y.
2009-01-01
An improved synthesis of N,N-dimethyl-2-(2-amino-4-[ 18 F]fluorophenylthio)benzylamine (4-[ 18 F]-ADAM, 2) as a potent serotonin transporter (SERT) imaging agent is described. Molecular orbital (MO) calculation predicts that N,N-dimethyl-2- (2-nitro-4-trimethylammoniumtrifluoromethanesulfonylphenylthio)benzamide (8) is probably a better precursor than N,N-dimethyl-2-(2,4-dinitrophenylthio)benzylamine (1) for preparing 2. Radioligand 2 was synthesized by the reaction of either precursor 1 or precursor 8 with K[ 18 F]/K 2.2.2 at 120 deg. C followed by reduction with BH 3 at 80 deg. C. The radiochemical yield (EOB) of 2 synthesized from precursor 1 and 8 was 5.7±2.4% (n=6) and 14.8±4.0% (n=5), respectively, in a synthesis time of 120 min from EOB. The specific activity of 2 was 3 Ci/μmol or 111 GBq/μmol (EOB). Thus, this new synthetic method has significantly improved the radiochemical yield of 4-[ 18 F]-ADAM and makes this radioligand more accessible to PET Centers without a cyclotron.
The solute carrier 6 family of transporters
DEFF Research Database (Denmark)
Bröer, Stefan; Gether, Ulrik
2012-01-01
of these transporters is associated with a variety of diseases. Pharmacological inhibition of the neurotransmitter transporters in this family is an important strategy in the management of neurological and psychiatric disorders. This review provides an overview of the biochemical and pharmacological properties......The solute carrier 6 (SLC6) family of the human genome comprises transporters for neurotransmitters, amino acids, osmolytes and energy metabolites. Members of this family play critical roles in neurotransmission, cellular and whole body homeostasis. Malfunction or altered expression...... of the SLC6 family transporters....
Bröer, Angelika; Juelich, Torsten; Vanslambrouck, Jessica M; Tietze, Nadine; Solomon, Peter S; Holst, Jeff; Bailey, Charles G; Rasko, John E J; Bröer, Stefan
2011-07-29
Amino acid uptake in the intestine and kidney is mediated by a variety of amino acid transporters. To understand the role of epithelial neutral amino acid uptake in whole body homeostasis, we analyzed mice lacking the apical broad-spectrum neutral (0) amino acid transporter B(0)AT1 (Slc6a19). A general neutral aminoaciduria was observed similar to human Hartnup disorder which is caused by mutations in SLC6A19. Na(+)-dependent uptake of neutral amino acids into the intestine and renal brush-border membrane vesicles was abolished. No compensatory increase of peptide transport or other neutral amino acid transporters was detected. Mice lacking B(0)AT1 showed a reduced body weight. When adapted to a standard 20% protein diet, B(0)AT1-deficient mice lost body weight rapidly on diets containing 6 or 40% protein. Secretion of insulin in response to food ingestion after fasting was blunted. In the intestine, amino acid signaling to the mammalian target of rapamycin (mTOR) pathway was reduced, whereas the GCN2/ATF4 stress response pathway was activated, indicating amino acid deprivation in epithelial cells. The results demonstrate that epithelial amino acid uptake is essential for optimal growth and body weight regulation.
An AOP analysis of selective serotonin reuptake inhibitors (SSRIs) for fish.
McDonald, M Danielle
2017-07-01
Pharmaceuticals and personal care products (PPCPs) are found in measureable quantities within the aquatic environment. Selective serotonin reuptake inhibitor (SSRI) antidepressants are one class of pharmaceutical compound that has received a lot of attention. Consistent with most PPCPs, the pharmacokinetics and physiological impacts of SSRI treatment have been well-studied in small mammals and humans and this, combined with the evolutionary conservation of the serotonergic system across vertebrates, allows for the read-across of known SSRI effects in mammals to potential SSRI impacts on aquatic organisms. Using an Adverse Outcome Pathway (AOP) framework, this review examines the similarities and differences between the mammalian and teleost fish SSRI target, the serotonin transporter (SERT; SLC6A4), and the downstream impacts of elevated extracellular serotonin (5-HT; 5-hydroxytryptamine), the consequence of SERT inhibition, on organ systems and physiological processes within teleost fish. This review also intends to reveal potentially understudied endpoints for SSRI toxicity based on what is known to be controlled by 5-HT in fish. Copyright © 2017 Elsevier Inc. All rights reserved.
Brindley, Rebecca L; Bauer, Mary Beth; Blakely, Randy D; Currie, Kevin P M
2017-05-17
Serotonin (5-HT) is an important neurotransmitter in the central nervous system where it modulates circuits involved in mood, cognition, movement, arousal, and autonomic function. The 5-HT transporter (SERT; SLC6A4) is a key regulator of 5-HT signaling, and genetic variations in SERT are associated with various disorders including depression, anxiety, and autism. This review focuses on the role of SERT in the sympathetic nervous system. Autonomic/sympathetic dysfunction is evident in patients with depression, anxiety, and other diseases linked to serotonergic signaling. Experimentally, loss of SERT function (SERT knockout mice or chronic pharmacological block) has been reported to augment the sympathetic stress response. Alterations to serotonergic signaling in the CNS and thus central drive to the peripheral sympathetic nervous system are presumed to underlie this augmentation. Although less widely recognized, SERT is robustly expressed in chromaffin cells of the adrenal medulla, the neuroendocrine arm of the sympathetic nervous system. Adrenal chromaffin cells do not synthesize 5-HT but accumulate small amounts by SERT-mediated uptake. Recent evidence demonstrated that 5-HT 1A receptors inhibit catecholamine secretion from adrenal chromaffin cells via an atypical mechanism that does not involve modulation of cellular excitability or voltage-gated Ca 2+ channels. This raises the possibility that the adrenal medulla is a previously unrecognized peripheral hub for serotonergic control of the sympathetic stress response. As a framework for future investigation, a model is proposed in which stress-evoked adrenal catecholamine secretion is fine-tuned by SERT-modulated autocrine 5-HT signaling.
Directory of Open Access Journals (Sweden)
André Bordinassi Medina
2017-04-01
Full Text Available Solute carrier (SLC transporters are a diverse group of membrane transporter proteins that regulate the cellular flux and distribution of endogenous and xenobiotic compounds. Post-translational modifications (PTMs, such as ubiquitination, have recently emerged as one of the major regulatory mechanisms in protein function and localization. Previously, we showed that SLC amino acid transporters were on average 6-fold de-ubiquitinated and increased amino acid levels were detected in ρ0 cells (lacking mitochondrial DNA, mtDNA compared to parental cells. Here, we elucidated the altered functionality of SLC transporters and their dynamic ubiquitination status by measuring the uptake of several isotopically labeled amino acids in both human osteosarcoma 143B.TK- and ρ0 cells. Our pulse chase analysis indicated that de-ubiquitinated amino acid transporters in ρ0 cells were accompanied by an increased transport rate, which leads to higher levels of amino acids in the cell. Finding SLC transport enhancers is an aim of the pharmaceutical industry in order to compensate for loss of function mutations in these genes. Thus, the ubiquitination status of SLC transporters could be an indicator for their functionality, but evidence for a direct connection between de-ubiquitination and transporter activity has to be further elucidated.
Directory of Open Access Journals (Sweden)
Xin Wen
Full Text Available Slc4a4-null mice are a model of proximal renal tubular acidosis (pRTA. Slc4a4 encodes the electrogenic sodium base transporter NBCe1 that is involved in transcellular base transport and pH regulation during amelogenesis. Patients with mutations in the SLC4A4 gene and Slc4a4-null mice present with dysplastic enamel, amongst other pathologies. Loss of NBCe1 function leads to local abnormalities in enamel matrix pH regulation. Loss of NBCe1 function also results in systemic acidemic blood pH. Whether local changes in enamel pH and/or a decrease in systemic pH are the cause of the abnormal enamel phenotype is currently unknown. In the present study we addressed this question by explanting fetal wild-type and Slc4a4-null mandibles into healthy host kidney capsules to study enamel formation in the absence of systemic acidemia. Mandibular E11.5 explants from NBCe1-/- mice, maintained in host kidney capsules for 70 days, resulted in teeth with enamel and dentin with morphological and mineralization properties similar to cultured NBCe1+/+ mandibles grown under identical conditions. Ameloblasts express a number of proteins involved in dynamic changes in H+/base transport during amelogenesis. Despite the capacity of ameloblasts to dynamically modulate the local pH of the enamel matrix, at least in the NBCe1-/- mice, the systemic pH also appears to contribute to the enamel phenotype. Extrapolating these data to humans, our findings suggest that in patients with NBCe1 mutations, correction of the systemic metabolic acidosis at a sufficiently early time point may lead to amelioration of enamel abnormalities.
Aperecida da Silva, Maria; Cordeiro, Quirino; Louza, Mario; Vallada, Homero
2011-01-01
Objective: To investigate a possible association between a 3'UTR VNTR polymorphism of the dopamine transporter gene (SLC6A3) and ADHD in a Brazilian sample of adult patients. Method: Study Case-control with 102 ADHD adult outpatients ("DSM-IV" criteria) and 479 healthy controls. The primers' sequence used were: 3'UTR-Forward: 5' TGT GGT…
Correction of the first order beam transport of the SLC Arcs
International Nuclear Information System (INIS)
Walker, N.; Barklow, T.; Emma, P.; Krejcik, P.
1991-05-01
Correction of the first order transport of the SLC Arcs has been made possible by a technique which allows the full 4x4 transport matrix across any section of Arc to be experimentally determined. By the introduction of small closed bumps into each achromat, it is possible to substantially correct first order optical errors, and notably the cross plane coupling at the exit of the Arcs. 4 refs., 3 figs
Pera, Alejandra; Dossena, Silvia; Rodighiero, Simona; Gandía, Marta; Bottà, Guido; Meyer, Giuliano; Moreno, Felipe; Nofziger, Charity; Hernández-Chico, Concepción; Paulmichl, Markus
2008-01-01
Pendred syndrome is an autosomal recessive disorder characterized by sensorineural hearing loss, with malformations of the inner ear, ranging from enlarged vestibular aqueduct (EVA) to Mondini malformation, and deficient iodide organification in the thyroid gland. Nonsyndromic EVA (ns-EVA) is a separate type of sensorineural hearing loss showing normal thyroid function. Both Pendred syndrome and ns-EVA seem to be linked to the malfunction of pendrin (SLC26A4), a membrane transporter able to exchange anions between the cytosol and extracellular fluid. In the past, the pathogenicity of SLC26A4 missense mutations were assumed if the mutations fulfilled two criteria: low incidence of the mutation in the control population and substitution of evolutionary conserved amino acids. Here we show that these criteria are insufficient to make meaningful predictions about the effect of these SLC26A4 variants on the pendrin-induced ion transport. Furthermore, we functionally characterized 10 missense mutations within the SLC26A4 ORF, and consistently found that on the protein level, an addition or omission of a proline or a charged amino acid in the SLC26A4 sequence is detrimental to its function. These types of changes may be adequate for predicting SLC26A4 functionality in the absence of direct functional tests. PMID:19017801
Steinhauser, Chelsie B; Landers, McKinsey; Myatt, Louise; Burghardt, Robert C; Vallet, Jeffrey L; Bazer, Fuller W; Johnson, Greg A
2016-11-01
The fetal fluids and uterine flushings of pigs contain higher concentrations of fructose than glucose, but fructose is not detected in maternal blood. Fructose can be synthesized from glucose via enzymes of the polyol pathway, aldose reductase (AKR1B1) and sorbitol dehydrogenase (SORD), transported across cell membranes by solute carriers SLC2A5 and SLC2A8, and converted to fructose-1-phosphate by ketohexokinase (KHK). SLC2A8, SLC2A5, AKR1B1, SORD, and KHK mRNAs and proteins were analyzed using quantitative PCR and immunohistochemistry or in situ hybridization in endometria and placentae of cyclic and pregnant gilts, cyclic gilts injected with estrogen, and ovariectomized gilts injected with progesterone. Progesterone up-regulated SLC2A8 protein in uterine luminal (LE) and glandular epithelia during the peri-implantation period, and expression became exclusively placental, chorion and blood vessels, after Day 30. P4 up-regulated SLC2A5 mRNA in uterine LE and glandular epithelia after implantation, and the chorion expressed SLC2A5 between Days 30 and 85. AKR1B1 and SORD proteins localized to uterine LE during the peri-implantation period, but expression switched to chorion by Day 20 and was maintained through Day 85. Uterine expression of AKR1B1 mRNA was down-regulated by estrogen. KHK protein localized to trophectoderm/chorion throughout gestation. These results provide evidence that components for the conversion of glucose to fructose and for fructose transport are present at the uterine-placental interface of pigs. The shift in expression from LE to chorion during pregnancy suggests free-floating conceptuses are supported by fructose synthesized by the uterus, but after implantation, the chorion becomes self-sufficient for fructose synthesis and transport. © 2016 by the Society for the Study of Reproduction, Inc.
The emerging physiological roles of the SLC14A family of urea transporters
Stewart, Gavin
2011-01-01
In mammals, urea is the main nitrogenous breakdown product of protein catabolism and is produced in the liver. In certain tissues, the movement of urea across cell membranes is specifically mediated by a group of proteins known as the SLC14A family of facilitative urea transporters. These proteins are derived from two distinct genes, UT-A (SLC14A2) and UT-B (SLC14A1). Facilitative urea transporters play an important role in two major physiological processes – urinary concentration and urea nitrogen salvaging. Although UT-A and UT-B transporters both have a similar basic structure and mediate the transport of urea in a facilitative manner, there are a number of significant differences between them. UT-A transporters are mainly found in the kidney, are highly specific for urea, have relatively lower transport rates and are highly regulated at both gene expression and cellular localization levels. In contrast, UT-B transporters are more widespread in their tissue location, transport both urea and water, have a relatively high transport rate, are inhibited by mercurial compounds and currently appear to be less acutely regulated. This review details the fundamental research that has so far been performed to investigate the function and physiological significance of these two types of urea transporters. PMID:21449978
Price, G Dean; Howitt, Susan M
2011-04-01
The cyanobacterial Na+-dependent HCO3- transporter BicA is a member of the ubiquitous and important SulP/SLC26 family of anion transporters found in eukaryotes and prokaryotes. BicA is an important component of the cyanobacterial CO2 concentrating mechanism, an adaptation that contributes to cyanobacteria being able to achieve an estimated 25% of global primary productivity, largely in the oceans. The human SLC26 members are involved in a range of key cellular functions involving a diverse range of anion transport activities including Cl-/HCO3-, I-/HCO3-, and SO42-/HCO3- exchange; mutations in SLC26 members are known to be associated with debilitating diseases such as Pendred syndrome, chondrodysplasias, and congenital chloride diarrhoea. We have recently experimentally determined the membrane topology of BicA using the phoA-lacZ reporter system and here consider some of the extrapolated implications for topology of the human SLC26 family and the Sultr plant sulphate transporters.
Serotonin-induced down-regulation of cell surface serotonin transporter
DEFF Research Database (Denmark)
Jørgensen, Trine Nygaard; Christensen, Peter Møller; Gether, Ulrik
2014-01-01
The serotonin transporter (SERT) terminates serotonergic signaling and enables refilling of synaptic vesicles by mediating reuptake of serotonin (5-HT) released into the synaptic cleft. The molecular and cellular mechanisms controlling SERT activity and surface expression are not fully understood...
Binding-Induced Fluorescence of Serotonin Transporter Ligands
DEFF Research Database (Denmark)
Wilson, James; Ladefoged, Lucy Kate; Babinchak, Michael
2014-01-01
The binding-induced fluorescence of 4-(4-(dimethylamino)-phenyl)-1-methylpyridinium (APP(+)) and two new serotonin transporter (SERT)-binding fluorescent analogues, 1-butyl-4-[4-(1-dimethylamino)phenyl]-pyridinium bromide (BPP(+)) and 1-methyl-4-[4-(1-piperidinyl)phenyl]-pyridinium (PPP(+)), has...
Variants in SLC18A3, vesicular acetylcholine transporter, cause congenital myasthenic syndrome
O'Grady, Gina L.; Verschuuren, Corien; Yuen, Michaela; Webster, Richard; Menezes, Manoj; Fock, Johanna M.; Pride, Natalie; Best, Heather A.; Damm, Tatiana Benavides; Turner, Christian; Lek, Monkol; Engel, Andrew G.; North, Kathryn N.; Clarke, Nigel F.; MacArthur, Daniel G.; Kamsteeg, Erik-Jan; Cooper, Sandra T.
2016-01-01
Objective: To describe the clinical and genetic characteristics of presynaptic congenital myasthenic syndrome secondary to biallelic variants in SLC18A3. Methods: Individuals from 2 families were identified with biallelic variants in SLC18A3, the gene encoding the vesicular acetylcholine transporter
Energy Technology Data Exchange (ETDEWEB)
Carneiro, Ana [Vanderbilt University; Airey, David [University of Tennessee Health Science Center, Memphis; Thompson, Brent [Vanderbilt University; Zhu, C [Vanderbilt University; Rinchik, Eugene M [ORNL; Lu, Lu [University of Tennessee Health Science Center, Memphis; Chesler, Elissa J [ORNL; Erikson, Keith [University of North Carolina; Blakely, Randy [Vanderbilt University
2009-01-01
The human serotonin (5-hydroxytryptamine, 5-HT) transporter (hSERT, SLC6A4) figures prominently in the etiology or treatment of many prevalent neurobehavioral disorders including anxiety, alcoholism, depression, autism and obsessive-compulsive disorder (OCD). Here we utilize naturally occurring polymorphisms in recombinant inbred (RI) lines to identify novel phenotypes associated with altered SERT function. The widely used mouse strain C57BL/6J, harbors a SERT haplotype defined by two nonsynonymous coding variants (Gly39 and Lys152 (GK)). At these positions, many other mouse lines, including DBA/2J, encode Glu39 and Arg152 (ER haplotype), assignments found also in hSERT. Synaptosomal 5-HT transport studies revealed reduced uptake associated with the GK variant. Heterologous expression studies confirmed a reduced SERT turnover rate for the GK variant. Experimental and in silico approaches using RI lines (C57Bl/6J X DBA/2J=BXD) identifies multiple anatomical, biochemical and behavioral phenotypes specifically impacted by GK/ER variation. Among our findings are multiple traits associated with anxiety and alcohol consumption, as well as of the control of dopamine (DA) signaling. Further bioinformatic analysis of BXD phenotypes, combined with biochemical evaluation of SERT knockout mice, nominates SERT-dependent 5-HT signaling as a major determinant of midbrain iron homeostasis that, in turn, dictates ironregulated DA phenotypes. Our studies provide a novel example of the power of coordinated in vitro, in vivo and in silico approaches using murine RI lines to elucidate and quantify the system-level impact of gene variation.
Kato, Hidekazu; Miyake, Fuyu; Shimbo, Hiroko; Ohya, Makoto; Sugawara, Hidenori; Aida, Noriko; Anzai, Rie; Takagi, Mariko; Okuda, Mitsuko; Takano, Kyoko; Wada, Takahito; Iai, Mizue; Yamashita, Sumimasa; Osaka, Hitoshi
2014-08-01
Creatine transporter deficiency (CTD) is an example of X-linked intellectual disability syndromes, caused by mutations in SLC6A8 on Xq28. Although this is the second most frequent genetic cause of intellectual disabilities in Europe or America after Fragile X syndrome, information on the morbidity of this disease is limited in Japan. Using the HPLC screening method we have established recently, we examined samples of urine of 105 patients (73 males and 32 females) with developmental disabilities at our medical center. And we have found a family with three ID boys with a novel missense mutation in SLC6A8. This is the second report of a Japanese family case of CTD. A systematic diagnostic system of this syndrome should be established in Japan to enable us to estimate its frequency and treatment. Copyright © 2013 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.
Wu, Alex Man Lai; Dedina, Liana; Dalvi, Pooja; Yang, Mingdong; Leon-Cheon, John; Earl, Brian; Harper, Patricia A; Ito, Shinya
2016-04-01
While it is well recognized that riboflavin accumulates in breast milk as an essential vitamin for neonates, transport mechanisms for its milk excretion are not well characterized. The multidrug efflux transporter ABCG2 in the apical membrane of milk-producing mammary epithelial cells (MECs) is involved with riboflavin excretion. However, it is not clear whether MECs possess other riboflavin transport systems, which may facilitate its basolateral uptake into MECs. We report here that transcripts encoding the second (SLC52A2) and third (SLC52A3) member of the recently discovered family of SLC52A riboflavin uptake transporters are expressed in milk fat globules from human breast milk. Furthermore, Slc52a2 and Slc52a3 mRNA are upregulated in the mouse mammary gland during lactation. Importantly, the induction ofSlc52a2, which was the major Slc52a riboflavin transporter in the lactating mammary gland, was also observed at the protein level. Subcellular localization studies showed that green fluorescent protein-tagged mouse SLC52A2 mainly localized to the cell membrane, with no preferential distribution to the apical or basolateral membrane in polarized kidney MDCK cells. These results strongly implicate a potential role for SLC52A2 in riboflavin uptake by milk-producing MECs, a critical step in the transfer of riboflavin into breast milk. Copyright © 2016 the American Physiological Society.
Directory of Open Access Journals (Sweden)
Rune eJonassen
2012-02-01
Full Text Available Studies of populations at genetic risk have the potential to explore the underlying structural and functional mechanisms in the development of psychological disorders. The polymorphic region (5-HTTLPR in the serotonin transporter gene (SLC6A4 has been associated with major depression (Caspi et al., 2003. In healthy women, variation in the human brain white matter microstructure integrity in the uncinate fascicule (UF has been suggested as an endophenotypes in the development of major depression (MDD. Pacheco et al. (2009 found a unique effect of age and 5-HTTLPR within the left frontal UF. The present study examined whether these associations persist along the adult life span. Thirty-seven right-handed healthy women between 21 and 61 years of age were invited for a diffusion MRI study. The functional polymorphism 5-HTTLPR located in the promoter region of the SLC6A4 gene was genotyped using polymerase chain reaction (PCR. Fractional anisotropy (FA was generated for the UF based on Tract-Based Spatial Statistics (TBSS. Models of emotion regulation circuitry suggest that working memory is important in conscious emotion regulation (Price and Drevets, 2010. To explore if 5-HTTLPR is related to this aspects of emotion processing, a working memory pathway, the superior longitudinal fascicule (SLF was included. The results demonstrate that age may explain the hypothesized association between 5-HTTLPR and frontal uncinate fascicule white matter integrity in healthy adult women. Both white matter changes associated with the aging process and those associated with growth and development may explain why the earlier reported unique effects of genotype in frontal UF FA do not persist into adulthood.
SLC39A8 Deficiency: A Disorder of Manganese Transport and Glycosylation.
Park, Julien H; Hogrebe, Max; Grüneberg, Marianne; DuChesne, Ingrid; von der Heiden, Ava L; Reunert, Janine; Schlingmann, Karl P; Boycott, Kym M; Beaulieu, Chandree L; Mhanni, Aziz A; Innes, A Micheil; Hörtnagel, Konstanze; Biskup, Saskia; Gleixner, Eva M; Kurlemann, Gerhard; Fiedler, Barbara; Omran, Heymut; Rutsch, Frank; Wada, Yoshinao; Tsiakas, Konstantinos; Santer, René; Nebert, Daniel W; Rust, Stephan; Marquardt, Thorsten
2015-12-03
SLC39A8 is a membrane transporter responsible for manganese uptake into the cell. Via whole-exome sequencing, we studied a child that presented with cranial asymmetry, severe infantile spasms with hypsarrhythmia, and dysproportionate dwarfism. Analysis of transferrin glycosylation revealed severe dysglycosylation corresponding to a type II congenital disorder of glycosylation (CDG) and the blood manganese levels were below the detection limit. The variants c.112G>C (p.Gly38Arg) and c.1019T>A (p.Ile340Asn) were identified in SLC39A8. A second individual with the variants c.97G>A (p.Val33Met) and c.1004G>C (p.Ser335Thr) on the paternal allele and c.610G>T (p.Gly204Cys) on the maternal allele was identified among a group of unresolved case subjects with CDG. These data demonstrate that variants in SLC39A8 impair the function of manganese-dependent enzymes, most notably β-1,4-galactosyltransferase, a Golgi enzyme essential for biosynthesis of the carbohydrate part of glycoproteins. Impaired galactosylation leads to a severe disorder with deformed skull, severe seizures, short limbs, profound psychomotor retardation, and hearing loss. Oral galactose supplementation is a treatment option and results in complete normalization of glycosylation. SLC39A8 deficiency links a trace element deficiency with inherited glycosylation disorders. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Ito, Mikiko; Haito, Sakiko; Furumoto, Mari; Kawai, Yoshichika; Terao, Junji; Miyamoto, Ken-ichi
2005-11-01
Serotonin transporters (SERTs) are pre-synaptic proteins specialized for the clearance of serotonin following vesicular release at central nervous system (CNS) and enteric nervous system synapses. SERTs are high affinity targets in vivo for antidepressants such as serotonin selective reuptake inhibitors (SSRIs). These include 'medical' psychopharmacological agents such as analgesics and antihistamines, a plant extract called St John's Wort (Hypericum). Osteoclasts are the primary cells responsible for bone resorption. They arise by the differentiation of osteoclast precursors of the monocyte/macrophage lineage. The expression of SERTs was increased in RANKL-induced osteoclast-like cells. Using RANKL stimulation of RAW264.7 cells as a model system for osteoclast differentiation, we studied the direct effects of food factor on serotonin uptake. The SSRIs (fluoxetine and fluvoxamine) inhibited markedly (approximately 95%) in serotonin transport in differentiated osteoclast cells. The major components of St. John's Wort, hyperforin and hypericine were significantly decreased in serotonin transport activity. Thus, a new in vitro model using RANKL-induced osteoclast-like cells may be useful to analyze the regulation of SERT by food factors and SSRIs.
Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando
2014-01-01
The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation. PMID:24652292
Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando
2014-05-09
The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation.
Iqbal, Zafar; Willemsen, Marjolein H.; Papon, Marie-Amélie; Musante, Luciana; Benevento, Marco; Hu, Hao; Venselaar, Hanka; Wissink-Lindhout, Willemijn M.; Vulto-van Silfhout, Anneke T.; Vissers, Lisenka E.L.M.; de Brouwer, Arjan P.M.; Marouillat, Sylviane; Wienker, Thomas F.; Ropers, Hans Hilger; Kahrizi, Kimia
2015-01-01
We report on Dutch and Iranian families with affected individuals who present with moderate to severe intellectual disability and additional phenotypes including progressive tremor, speech impairment, and behavioral problems in certain individuals. A combination of exome sequencing and homozygosity mapping revealed homozygous mutations c.484G>A (p.Gly162Arg) and c.1898C>G (p.Pro633Arg) in SLC6A17. SLC6A17 is predominantly expressed in the brain, encodes a synaptic vesicular transporter of neu...
The serotonin transporter in psychiatric disorders
DEFF Research Database (Denmark)
Spies, Marie; Knudsen, Karen Birgitte Moos; Lanzenberger, Rupert
2015-01-01
Over the past 20 years, psychotropics affecting the serotonergic system have been used extensively in the treatment of psychiatric disorders. Molecular imaging, in particular PET, has allowed for elucidation of the essential contribution of the serotonin transporter to the pathophysiology...... of various psychiatric disorders and their treatment. We review studies that use PET to measure cerebral serotonin transporter activity in psychiatric disorders, focusing on major depressive disorder and antidepressant treatment. We also discuss opportunities and limitations in the application...... of this neuroimaging method in clinical practice. Although results from individual studies diverge, meta-analysis indicates a trend towards reduced serotonin transporter availability in patients with major depressive disorder. Inconsistencies in results might suggest symptom heterogeneity in major depressive disorder...
An improved synthesis of 4-[{sup 18}F]-ADAM, a potent serotonin transporter imaging agent
Energy Technology Data Exchange (ETDEWEB)
Huang, Y.-Y. [PET Center, Department of Nuclear Medicine, Tri-Service General Hospital 325 Section 2, Cheng-Kung Road, Neihu 114, Taipei, Taiwan (China); Department of Biomedical Engineering and Environmental Sciences, National Thising Hua University, 101, Section 2, Kuang-Fu Road, Hsinchu 30013, Taiwan (China); Huang, W.-S. [PET Center, Department of Nuclear Medicine, Tri-Service General Hospital 325 Section 2, Cheng-Kung Road, Neihu 114, Taipei, Taiwan (China); Chu, T.-C. [Department of Biomedical Engineering and Environmental Sciences, National Thising Hua University, 101, Section 2, Kuang-Fu Road, Hsinchu 30013, Taiwan (China); Shiue, C.-Y. [PET Center, Department of Nuclear Medicine, Tri-Service General Hospital 325 Section 2, Cheng-Kung Road, Neihu 114, Taipei, Taiwan (China)], E-mail: shiue@ndmctsgh.edu.tw
2009-06-15
An improved synthesis of N,N-dimethyl-2-(2-amino-4-[{sup 18}F]fluorophenylthio)benzylamine (4-[{sup 18}F]-ADAM, 2) as a potent serotonin transporter (SERT) imaging agent is described. Molecular orbital (MO) calculation predicts that N,N-dimethyl-2- (2-nitro-4-trimethylammoniumtrifluoromethanesulfonylphenylthio)benzamide (8) is probably a better precursor than N,N-dimethyl-2-(2,4-dinitrophenylthio)benzylamine (1) for preparing 2. Radioligand 2 was synthesized by the reaction of either precursor 1 or precursor 8 with K[{sup 18}F]/K{sub 2.2.2} at 120 deg. C followed by reduction with BH{sub 3} at 80 deg. C. The radiochemical yield (EOB) of 2 synthesized from precursor 1 and 8 was 5.7{+-}2.4% (n=6) and 14.8{+-}4.0% (n=5), respectively, in a synthesis time of 120 min from EOB. The specific activity of 2 was 3 Ci/{mu}mol or 111 GBq/{mu}mol (EOB). Thus, this new synthetic method has significantly improved the radiochemical yield of 4-[{sup 18}F]-ADAM and makes this radioligand more accessible to PET Centers without a cyclotron.
DEFF Research Database (Denmark)
Kristensen, Anders S; Larsen, Mads B; Johnsen, Laust B
2004-01-01
The serotonin transporter (SERT) belongs to a family of sodium-chloride-dependent transporters responsible for uptake of amino acids and biogenic amines from the extracellular space. SERT represents a major pharmacological target in the treatment of several clinical conditions, including depressi...
A current view of serotonin transporters [version 1; referees: 3 approved
Directory of Open Access Journals (Sweden)
Louis J. De Felice
2016-07-01
Full Text Available Serotonin transporters (SERTs are largely recognized for one aspect of their function—to transport serotonin back into the presynaptic terminal after its release. Another aspect of their function, however, may be to generate currents large enough to have physiological consequences. The standard model for electrogenic transport is the alternating access model, in which serotonin is transported with a fixed ratio of co-transported ions resulting in net charge per cycle. The alternating access model, however, cannot account for all the observed currents through SERT or other monoamine transporters. Furthermore, SERT agonists like ecstasy or antagonists like fluoxetine generate or suppress currents that the standard model cannot support. Here we survey evidence for a channel mode of transport in which transmitters and ions move through a pore. Available structures for dopamine and serotonin transporters, however, provide no evidence for a pore conformation, raising questions of whether the proposed channel mode actually exists or whether the structural data are perhaps missing a transient open state.
Characterization of an allosteric citalopram-binding site at the serotonin transporter
DEFF Research Database (Denmark)
Chen, Fenghua; Breum Larsen, Mads; Neubauer, Henrik Amtoft
2005-01-01
The serotonin transporter (SERT), which belongs to a family of sodium/chloride-dependent transporters, is the major pharmacological target in the treatment of several clinical disorders, including depression and anxiety. In the present study we show that the dissociation...... rate, of [3H]S-citalopram from human SERT, is retarded by the presence of serotonin, as well as by several antidepressants, when present in the dissociation buffer. Dissociation of [3H]S-citalopram from SERT is most potently inhibited by S-citalopram followed by R......-citalopram, sertraline, serotonin and paroxetine. EC50 values for S- and R-citalopram are 3.6 +/- 0.4 microm and 19.4 +/- 2.3 microm, respectively. Fluoxetine, venlafaxine and duloxetine have no significant effect on the dissociation of [3H]S-citalopram. Allosteric modulation of dissociation...
Boulet, Aren; Vest, Katherine E; Maynard, Margaret K; Gammon, Micah G; Russell, Antoinette C; Mathews, Alexander T; Cole, Shelbie E; Zhu, Xinyu; Phillips, Casey B; Kwong, Jennifer Q; Dodani, Sheel C; Leary, Scot C; Cobine, Paul A
2018-02-09
Copper is required for the activity of cytochrome c oxidase (COX), the terminal electron-accepting complex of the mitochondrial respiratory chain. The likely source of copper used for COX biogenesis is a labile pool found in the mitochondrial matrix. In mammals, the proteins that transport copper across the inner mitochondrial membrane remain unknown. We previously reported that the mitochondrial carrier family protein Pic2 in budding yeast is a copper importer. The closest Pic2 ortholog in mammalian cells is the mitochondrial phosphate carrier SLC25A3. Here, to investigate whether SLC25A3 also transports copper, we manipulated its expression in several murine and human cell lines. SLC25A3 knockdown or deletion consistently resulted in an isolated COX deficiency in these cells, and copper addition to the culture medium suppressed these biochemical defects. Consistent with a conserved role for SLC25A3 in copper transport, its heterologous expression in yeast complemented copper-specific defects observed upon deletion of PIC2 Additionally, assays in Lactococcus lactis and in reconstituted liposomes directly demonstrated that SLC25A3 functions as a copper transporter. Taken together, these data indicate that SLC25A3 can transport copper both in vitro and in vivo . © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Nakata, T; Matsui, T; Kobayashi, K; Kobayashi, Y; Anzai, N
2013-11-12
Organic cation transporters (OCTs) are expressed mainly in the kidney and liver. OCTs transport intrinsic organic cations, including monoamine, dopamine, serotonine and choline, across the plasma membrane. Here, we demonstrate that OCT2 (SLC22A2) is expressed in cholinergic neurons, motoneurons in the anterior horn of the spinal cord, and is implicated in acetylcholine (Ach) recycling in presynaptic terminals. Application of rabbit anti-peptide antibody revealed that OCT2 was expressed in the anterior horn of the spinal cord. Double immunostaining of muscle sections with anti-OCT2 and alpha-bungarotoxin (BTX) revealed that OCT2 was localized in the neuromuscular junctions (NMJs). Immunoelectron microscopy revealed that OCT2 was localized both in synaptic vesicles (SVs) in presynaptic terminals around the motoneurons (C-terminals) and in SVs in nerve terminals in NMJs. The similarity in the distribution of OCT2 in cholinergic neurons and that of vesicular acetyl choline transporter (VAchT), and the fact that OCT2 can transport choline suggest that OCT2 could work as a low-affinity and high-capacity choline transporter at presynaptic terminals in cholinergic neurons in a firing-dependent manner. Copyright © 2013 IBRO. Published by Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Bjerregaard, Henriette; Severinsen, Kasper; Said, Saida
2015-01-01
Serotonergic neurotransmission is modulated by the membrane-embedded serotonin transporter (SERT). SERT mediates the reuptake of serotonin into the presynaptic neurons. Conformational changes in SERT occur upon binding of ions and substrate and are crucial for translocation of serotonin across...... the membrane. Our understanding of these conformational changes is mainly based on crystal structures of a bacterial homolog in various conformations, derived homology models of eukaryotic neurotransmitter transporters, and substituted cysteine accessibility method of SERT. However, the dynamic changes...
Schneebauer, Gabriel; Mauracher, David; Fiechtner, Birgit; Pelster, Bernd
2018-04-01
The rate of glucose metabolism has been shown to be correlated to glucose uptake in swimbladder gas gland cells. Therefore, it is assumed that in the European eel silvering, i.e., the preparation of the eel for the spawning migration to the Sargasso Sea, coincides with an enhanced capacity for glucose uptake. To test this hypothesis expression of all known glucose transport proteins has been assessed at the transcript level in yellow and in silver eels, and we also included Anguillicola crassus infected swimbladders. Glucose uptake by rete mirabile endothelial cells could be crucial for the countercurrent exchange capacity of the rete. Therefore, this tissue was also included in our analysis. The results revealed expression of ten different members of the slc2 family of glucose transporters, of four slc5 family members, and of kiaa1919 in gas gland tissue. Glucose transporters of the slc2 family were expressed at very high level, and slc2a1b made up about 80% of all slc2 family members, irrespective of the developmental state or the infection status of the eel. Overall, the slc5 family contributed to only about 8% of all detected glucose transport transcripts in gas gland tissue, and the slc2 family to more than 85%. In rete capillaries, the contribution of sodium-dependent glucose transporters was significantly higher, leaving only 66% for the slc2 family of glucose transporters. Neither silvering nor the infection status had a significant effect on the expression of glucose transporters in swimbladder gas gland tissue, suggesting that glucose metabolism of eel gas gland cells may not be related to transcriptional changes of glucose transport proteins.
Huang, Shasha; Han, Dongyi; Yuan, Yongyi; Wang, Guojian; Kang, Dongyang; Zhang, Xin; Yan, Xiaofei; Meng, Xiaoxiao; Dong, Min; Dai, Pu
2011-09-30
Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter) or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity). The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged vestibular aqueduct (isolated Mondini deformity) in a Chinese population. In total, 144 patients with sensorineural hearing loss were included and subjected to high-resolution temporal bone CT. Among them, 28 patients with isolated Mondini dysplasia (MD group), 50 patients with enlarged vestibular aqueduct with Mondini dysplasia (EVA with MD group), 50 patients with enlarged vestibular aqueduct without Mondini dysplasia (EVA group), and 16 patients with other types of inner ear malformations (IEM group) were identified. The coding exons of SLC26A4 were analyzed in all subjects. DNA sequence analysis of SLC26A4 was performed in all 144 patients. In the different groups, the detection rate of the SLC26A4 mutation differed. In the isolated MD group, only one single allelic mutation in SLC26A4 was found in one patient (1/28, 3.6%). In the EVA with MD group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0%) and three patients (3/50, 6.0%), respectively. Also, in the EVA group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0%) and three patients (3/50, 6.0%), respectively. These percentages were identical to those in the EVA plus MD group. Only two patients carried monoallelic mutations of the SLC26A4 gene in the IEM group (2/16, 12.5%). There were significant differences in the frequency of SLC26A4 mutation among the groups (P0.5). Although mutations in the SLC26A4 gene were frequently found in Chinese EVA patients with and
Rasmussen, Rune Nørgaard; Lagunas, Candela; Plum, Jakob; Holm, René; Nielsen, Carsten Uhd
2016-01-20
The aim of the present study was to investigate if basic GABA-mimetics interact with the taurine transporter (TauT, Slc6a6), and to find a suitable cell based model that is robust towards extracellular changes in osmolality during uptake studies. Taurine uptake was measured in human Caco-2 cells, porcine LLC-PK1 cells, and rat SKPT cells using radiolabelled taurine. Hyperosmotic conditions were obtained by incubation with raffinose (final osmolality of 500mOsm) for 24h prior to the uptake experiments. Expression of the taurine transporter, TauT, was investigated at the mRNA level by real-time PCR. Uptake of the GABA-mimetics gaboxadol and vigabatrin was investigated in SKPT cells, and quantified by liquid scintillation or HPLC-MS/MS analysis, respectively. The uptake rate of [(3)H]-taurine was Na(+) and Cl(-) and concentration dependent with taurine with an apparent Vmax of 6.3±1.6pmolcm(-2)min(-1) and a Km of 24.9±15.0μM. β-alanine, nipecotic acid, gaboxadol, GABA, vigabatrin, δ-ALA and guvacine inhibited the taurine uptake rate in a concentration dependent manner. The order of affinity for TauT was β-alanine>GABA>nipecotic acid>guvacine>δ-ALA>vigabatrin>gaboxadol with IC50-values of 0.04, 1.07, 2.02, 4.19, 4.94, 31.4 and 39.9mM, respectively. In conclusion, GABA mimetics inhibited taurine uptake in hyperosmotic rat renal SKPT cells. SKPT cells, which seem to be a useful model for investigating taurine transport in the short-term presence of high concentrations of osmolytes. Furthermore, analogues of β-alanine appear to have higher affinities for TauT than GABA-analogues. Copyright © 2015 Elsevier B.V. All rights reserved.
Bernardinelli, Emanuele; Nofziger, Charity; Patsch, Wolfgang; Rasp, Gerd; Paulmichl, Markus; Dossena, Silvia
2018-01-01
The prevalence and spectrum of sequence alterations in the SLC26A4 gene, which codes for the anion exchanger pendrin, are population-specific and account for at least 50% of cases of non-syndromic hearing loss associated with an enlarged vestibular aqueduct. A cohort of nineteen patients from Austria with hearing loss and a radiological alteration of the vestibular aqueduct underwent Sanger sequencing of SLC26A4 and GJB2, coding for connexin 26. The pathogenicity of sequence alterations detected was assessed by determining ion transport and molecular features of the corresponding SLC26A4 protein variants. In this group, four uncharacterized sequence alterations within the SLC26A4 coding region were found. Three of these lead to protein variants with abnormal functional and molecular features, while one should be considered with no pathogenic potential. Pathogenic SLC26A4 sequence alterations were only found in 12% of patients. SLC26A4 sequence alterations commonly found in other Caucasian populations were not detected. This survey represents the first study on the prevalence and spectrum of SLC26A4 sequence alterations in an Austrian cohort and further suggests that genetic testing should always be integrated with functional characterization and determination of the molecular features of protein variants in order to unequivocally identify or exclude a causal link between genotype and phenotype. PMID:29320412
DEFF Research Database (Denmark)
Erritzoe, David; Frøkjær, Vibe; Holst, Klaus K
2011-01-01
Both hallucinogens and 3,4-methylenedioxymethamphetamine (MDMA or "ecstasy") have direct agonistic effects on postsynaptic serotonin(2A) receptors, the key site for hallucinogenic actions. In addition, MDMA is a potent releaser and reuptake inhibitor of presynaptic serotonin.......Both hallucinogens and 3,4-methylenedioxymethamphetamine (MDMA or "ecstasy") have direct agonistic effects on postsynaptic serotonin(2A) receptors, the key site for hallucinogenic actions. In addition, MDMA is a potent releaser and reuptake inhibitor of presynaptic serotonin....
Matondo, R.B.; Punt, C.J.A.; Homberg, J.R.; Toussaint, M.J.; Kisjes, R.; Korporaal, S.J.; Akkerman, J.W.; Cuppen, E.; Bruin, A. de
2009-01-01
The serotonin transporter is implicated in the uptake of the vasoconstrictor serotonin from the circulation into the platelets, where 95% of all blood serotonin is stored and released in response to vascular injury. In vivo studies indicated that platelet-derived serotonin mediates liver
Matondo, R.B.; Punt, C.; Homberg, J.R.; Toussaint, M.J.; Kisjes, R.; Korporaal, S.J.; Akkerman, J.W.; Cuppen, E.; de Bruin, A.
2009-01-01
The serotonin transporter is implicated in the uptake of the vasoconstrictor serotonin from the circulation into the platelets, where 95% of all blood serotonin is stored and released in response to vascular injury. In vivo studies indicated that platelet-derived serotonin mediates liver
DEFF Research Database (Denmark)
Erritzoe, David; Frokjaer, Vibe G.; Holst, Klaus K.
2011-01-01
Context: Both hallucinogens and 3,4-methylenedioxy-methamphetamine( MDMA or "ecstasy") have direct agonistic effects on postsynaptic serotonin(2A) receptors, the key site for hallucinogenic actions. In addition, MDMA is a potent releaser and reuptake inhibitor of presynaptic serotonin.Objective: ......Context: Both hallucinogens and 3,4-methylenedioxy-methamphetamine( MDMA or "ecstasy") have direct agonistic effects on postsynaptic serotonin(2A) receptors, the key site for hallucinogenic actions. In addition, MDMA is a potent releaser and reuptake inhibitor of presynaptic serotonin...
Riccardi, Keith; Li, Zhenhong; Brown, Janice A; Gorgoglione, Matthew F; Niosi, Mark; Gosset, James; Huard, Kim; Erion, Derek M; Di, Li
2016-10-01
Unbound partition coefficient (Kpuu) is important to an understanding of the asymmetric free drug distribution of a compound between cells and medium in vitro, as well as between tissue and plasma in vivo, especially for transporter-mediated processes. Kpuu was determined for a set of compounds from the SLC13A family that are inhibitors and substrates of transporters in hepatocytes and transporter-transfected cell lines. Enantioselectivity was observed, with (R)-enantiomers achieving much higher Kpuu (>4) than the (S)-enantiomers (<1) in human hepatocytes and SLC13A5-transfected human embryonic 293 cells. The intracellular free drug concentration correlated directly with in vitro pharmacological activity rather than the nominal concentration in the assay because of the high Kpuu mediated by SLC13A5 transporter uptake. Delivery of the diacid PF-06649298 directly or via hydrolysis of the ethyl ester prodrug PF-06757303 resulted in quite different Kpuu values in human hepatocytes (Kpuu of 3 for diacid versus 59 for prodrug), which was successfully modeled on the basis of passive diffusion, active uptake, and conversion rate from ester to diacid using a compartmental model. Kpuu values changed with drug concentrations; lower values were observed at higher concentrations possibly owing to a saturation of transporters. Michaelis-Menten constant (Km) of SLC13A5 was estimated to be 24 μM for PF-06649298 in human hepatocytes. In vitro Kpuu obtained from rat suspension hepatocytes supplemented with 4% fatty acid free bovine serum albumin showed good correlation with in vivo Kpuu of liver-to-plasma, illustrating the potential of this approach to predict in vivo Kpuu from in vitro systems. Copyright © 2016 by The American Society for Pharmacology and Experimental Therapeutics.
Directory of Open Access Journals (Sweden)
Yan Xiaofei
2011-09-01
Full Text Available Abstract Background Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity. The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged vestibular aqueduct (isolated Mondini deformity in a Chinese population. Methods In total, 144 patients with sensorineural hearing loss were included and subjected to high-resolution temporal bone CT. Among them, 28 patients with isolated Mondini dysplasia (MD group, 50 patients with enlarged vestibular aqueduct with Mondini dysplasia (EVA with MD group, 50 patients with enlarged vestibular aqueduct without Mondini dysplasia (EVA group, and 16 patients with other types of inner ear malformations (IEM group were identified. The coding exons of SLC26A4 were analyzed in all subjects. Results DNA sequence analysis of SLC26A4 was performed in all 144 patients. In the different groups, the detection rate of the SLC26A4 mutation differed. In the isolated MD group, only one single allelic mutation in SLC26A4 was found in one patient (1/28, 3.6%. In the EVA with MD group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0% and three patients (3/50, 6.0%, respectively. Also, in the EVA group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0% and three patients (3/50, 6.0%, respectively. These percentages were identical to those in the EVA plus MD group. Only two patients carried monoallelic mutations of the SLC26A4 gene in the IEM group (2/16, 12.5%. There were significant differences in the frequency of SLC26A4 mutation among the groups (P SLC26A4 mutation in the isolated MD group was
Haack, Tobias B; Makowski, Christine; Yao, Yoshiaki; Graf, Elisabeth; Hempel, Maja; Wieland, Thomas; Tauer, Ulrike; Ahting, Uwe; Mayr, Johannes A; Freisinger, Peter; Yoshimatsu, Hiroki; Inui, Ken; Strom, Tim M; Meitinger, Thomas; Yonezawa, Atsushi; Prokisch, Holger
2012-11-01
Brown-Vialetto-Van Laere syndrome (BVVLS [MIM 211530]) is a rare neurological disorder characterized by infancy onset sensorineural deafness and ponto-bulbar palsy. Mutations in SLC52A3 (formerly C20orf54), coding for riboflavin transporter 2 (hRFT2), have been identified as the molecular genetic correlate in several individuals with BVVLS. Exome sequencing of just one single case revealed that compound heterozygosity for two pathogenic mutations in the SLC52A2 gene coding for riboflavin transporter 3 (hRFT3), another member of the riboflavin transporter family, is also associated with BVVLS. Overexpression studies confirmed that the gene products of both mutant alleles have reduced riboflavin transport activities. While mutations in SLC52A3 cause decreased plasma riboflavin levels, concordant with a role of SLC52A3 in riboflavin uptake from food, the SLC52A2-mutant individual had normal plasma riboflavin concentrations, a finding in line with a postulated function of SLC52A2 in riboflavin uptake from blood into target cells. Our results contribute to the understanding of human riboflavin metabolism and underscore its role in the pathogenesis of BVVLS, thereby providing a rational basis for a high-dose riboflavin treatment.
Iqbal, Zafar; Willemsen, Marjolein H.; Papon, Marie-Amélie; Musante, Luciana; Benevento, Marco; Hu, Hao; Venselaar, Hanka; Wissink-Lindhout, Willemijn M.; Vulto-van Silfhout, Anneke T.; Vissers, Lisenka E.L.M.; de Brouwer, Arjan P.M.; Marouillat, Sylviane; Wienker, Thomas F.; Ropers, Hans Hilger; Kahrizi, Kimia; Nadif Kasri, Nael; Najmabadi, Hossein; Laumonnier, Frédéric; Kleefstra, Tjitske; van Bokhoven, Hans
2015-01-01
We report on Dutch and Iranian families with affected individuals who present with moderate to severe intellectual disability and additional phenotypes including progressive tremor, speech impairment, and behavioral problems in certain individuals. A combination of exome sequencing and homozygosity mapping revealed homozygous mutations c.484G>A (p.Gly162Arg) and c.1898C>G (p.Pro633Arg) in SLC6A17. SLC6A17 is predominantly expressed in the brain, encodes a synaptic vesicular transporter of neutral amino acids and glutamate, and plays an important role in the regulation of glutamatergic synapses. Prediction programs and 3D modeling suggest that the identified mutations are deleterious to protein function. To directly test the functional consequences, we investigated the neuronal subcellular localization of overexpressed wild-type and mutant variants in mouse primary hippocampal neuronal cells. Wild-type protein was present in soma, axons, dendrites, and dendritic spines. p.Pro633Arg altered SLC6A17 was found in soma and proximal dendrites but did not reach spines. p.Gly162Arg altered SLC6A17 showed a normal subcellular distribution but was associated with an abnormal neuronal morphology mainly characterized by the loss of dendritic spines. In summary, our genetic findings implicate homozygous SLC6A17 mutations in autosomal-recessive intellectual disability, and their pathogenic role is strengthened by genetic evidence and in silico and in vitro functional analyses. PMID:25704603
Interaction of antidepressants with the serotonin and norepinephrine transporters
DEFF Research Database (Denmark)
Sørensen, Lena; Andersen, Jacob; Thomsen, Mette
2012-01-01
The serotonin transporter (SERT) and the norepinephrine transporter (NET) are sodium-dependent neurotransmitter transporters responsible for reuptake of released serotonin and norepinephrine, respectively, into nerve terminals in the brain. A wide range of inhibitors of SERT and NET are used...
Bjerregaard, Henriette; Severinsen, Kasper; Said, Saida; Wiborg, Ove; Sinning, Steffen
2015-01-01
Serotonergic neurotransmission is modulated by the membrane-embedded serotonin transporter (SERT). SERT mediates the reuptake of serotonin into the presynaptic neurons. Conformational changes in SERT occur upon binding of ions and substrate and are crucial for translocation of serotonin across the membrane. Our understanding of these conformational changes is mainly based on crystal structures of a bacterial homolog in various conformations, derived homology models of eukaryotic neurotransmitter transporters, and substituted cysteine accessibility method of SERT. However, the dynamic changes that occur in the human SERT upon binding of ions, the translocation of substrate, and the role of cholesterol in this interplay are not fully elucidated. Here we show that serotonin induces a dualistic conformational response in SERT. We exploited the substituted cysteine scanning method under conditions that were sensitized to detect a more outward-facing conformation of SERT. We found a novel high affinity outward-facing conformational state of the human SERT induced by serotonin. The ionic requirements for this new conformational response to serotonin mirror the ionic requirements for translocation. Furthermore, we found that membrane cholesterol plays a role in the dualistic conformational response in SERT induced by serotonin. Our results indicate the existence of a subpopulation of SERT responding differently to serotonin binding than hitherto believed and that membrane cholesterol plays a role in this subpopulation of SERT. PMID:25614630
Directory of Open Access Journals (Sweden)
MyPhuong T Le
Full Text Available In the past few decades, consumption of added sugars has increased dramatically. Studies have linked high sugar intake with increased risk for a number of diseases. Importantly, fructose, a component of sugar, has been linked with the development of features of metabolic syndrome. This study determined if single nucleotide polymorphisms in genes involved in fructose transport (solute carrier family 2 facilitated glucose transporter, member 2 (SLC2A2 and solute carrier family 2 facilitated glucose/fructose transporter, member 5 (SLC2A5 and metabolism (ketohexokinase (KHK affect inter-individual variability in metabolic phenotypes, such as increased serum uric acid levels.The influence of SLC2A2, SLC2A5, and KHK SNPs on metabolic phenotypes was tested in 237 European Americans and 167 African Americans from the Pharmacogenomic Evaluation and Antihypertensive Responses (PEAR study. Using baseline untreated fasting data, associations were considered significant if p≤0.005. These SNPs were then evaluated for potential replication (p≤0.05 using data from the Genetic Epidemiology of Responses to Antihypertensives (GERA studies.SLC2A5 rs5438 was associated with an increase in serum uric acid in European American males. However, we were unable to replicate the association in GERA. The minor allele of SLC2A2 rs8192675 showed an association with lower high-density lipoproteins in European Americans (A/A: 51.0 mg/dL, A/G: 47.0 mg/dL, G/G: 41.5 mg/dL, p = 0.0034 in PEAR. The association between rs8192675 and lower high-density lipoproteins was replicated in the combined European American GERA study samples (A/A: 47.6 mg/dL, A/G: 48.6 mg/dL, G/G: 41.9 mg/dL, p = 0.0315.The association between SLC2A2 rs8192675 and high-density lipoproteins suggests the polymorphism may play a role in influencing high-density lipoproteins and thus metabolic risk of cardiovascular disease.
Pérez-Edgar, Koraly; Bar-Haim, Yair; McDermott, Jennifer Martin; Gorodetsky, Elena; Hodgkinson, Colin A; Goldman, David; Ernst, Monique; Pine, Daniel S; Fox, Nathan A
2010-03-01
Both attention biases to threat and a serotonin-transporter gene polymorphism (5-HTTLPR) have been linked to heightened neural activation to threat and the emergence of anxiety. The short allele of 5-HTTLPR may act via its effect on neurotransmitter availability, while attention biases shape broad patterns of cognitive processing. We examined individual differences in attention bias to emotion faces as a function of 5-HTTLPR genotype. Adolescents (N=117) were classified for presumed SLC6A4 expression based on 5-HTTLPR-low (SS, SL(G), or L(G)L(G)), intermediate (SL(A) or L(A)L(G)), or high (L(A)L(A)). Participants completed the dot-probe task, measuring attention biases toward or away from angry and happy faces. Biases for angry faces increased with the genotype-predicted neurotransmission levels (low>intermediate>high). The reverse pattern was evident for happy faces. The data indicate a linear relation between 5-HTTLPR allelic status and attention biases to emotion, demonstrating a genetic mechanism for biased attention using ecologically valid stimuli that target socioemotional adaptation. Copyright 2009 Elsevier B.V. All rights reserved.
Iqbal, Zafar; Willemsen, Marjolein H; Papon, Marie-Amélie; Musante, Luciana; Benevento, Marco; Hu, Hao; Venselaar, Hanka; Wissink-Lindhout, Willemijn M; Vulto-van Silfhout, Anneke T; Vissers, Lisenka E L M; de Brouwer, Arjan P M; Marouillat, Sylviane; Wienker, Thomas F; Ropers, Hans Hilger; Kahrizi, Kimia; Nadif Kasri, Nael; Najmabadi, Hossein; Laumonnier, Frédéric; Kleefstra, Tjitske; van Bokhoven, Hans
2015-03-05
We report on Dutch and Iranian families with affected individuals who present with moderate to severe intellectual disability and additional phenotypes including progressive tremor, speech impairment, and behavioral problems in certain individuals. A combination of exome sequencing and homozygosity mapping revealed homozygous mutations c.484G>A (p.Gly162Arg) and c.1898C>G (p.Pro633Arg) in SLC6A17. SLC6A17 is predominantly expressed in the brain, encodes a synaptic vesicular transporter of neutral amino acids and glutamate, and plays an important role in the regulation of glutamatergic synapses. Prediction programs and 3D modeling suggest that the identified mutations are deleterious to protein function. To directly test the functional consequences, we investigated the neuronal subcellular localization of overexpressed wild-type and mutant variants in mouse primary hippocampal neuronal cells. Wild-type protein was present in soma, axons, dendrites, and dendritic spines. p.Pro633Arg altered SLC6A17 was found in soma and proximal dendrites but did not reach spines. p.Gly162Arg altered SLC6A17 showed a normal subcellular distribution but was associated with an abnormal neuronal morphology mainly characterized by the loss of dendritic spines. In summary, our genetic findings implicate homozygous SLC6A17 mutations in autosomal-recessive intellectual disability, and their pathogenic role is strengthened by genetic evidence and in silico and in vitro functional analyses. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
K Miguita
2011-01-01
Full Text Available In the present paper, we investigated the 5HTTLPR and STin2 polymorphisms in the promoter region of the serotonin transporter gene (SLC6A4, the G861C polymorphism (rs6296 of the serotonin receptor 1D beta (HTR1B, the T102C (rs6113 and C516T (rs6305 polymorphisms of the serotonin receptor gene subtype 2A (HTR2A, the DAT UTR, DAT intron 8 and DAT intron 14 of the dopamine transporter gene (SLC6A3, the Val-158-Met (rs4680 polymorphism of the COMT and the silent mutation G1287A (rs5569 in the norepinephrine transporter gene (SLC6A2. We genotyped 41 obsessive-compulsive disorder (OCD outpatients, classified as good-responders (n=27 and poor-responders (n=14 to treatment with clomipramine according to the Yale Brown Obsessive-Compulsive Scale (YBOCS. Patients who achieved a reduction in symptoms of 40% or more in YBOCS after 14 weeks of treatment were considered good-responders. Genotypes and alleles distribution of the investigated polymorphisms were compared between both groups. We did not find association between the studied polymorphisms and clomipramine response in our sample.
Gholami, Khadijeh; Muniandy, Sekaran; Salleh, Naguib
2014-02-01
Oestrogen-induced uterine fluid sodium (Na(+)) and bicarbonate (HCO3(-)) secretion may involve SLC4A4. We hypothesized that uterine SLC4A4 expression changes under different sex-steroid influence, therefore may account for the fluctuation in uterine fluid Na(+) and HCO3(-) content throughout the oestrous cycle. The aim of this study is to investigate the differential effects of sex-steroids and oestrous cycle phases on uterine SLC4A4 expression. Adult female WKY rats were ovariectomised and treated with different doses of 17β-oestradiol (E2) (0.2, 2, 20 and 50 μg/ml/day) or progesterone (P4) (4 mg/ml/day) for three consecutive days and 3 days treatment with 0.2 μg/ml/day E2 followed by another 3 days with P4 to mimic the hormonal changes in early pregnancy. Oestrous cycle phases in intact, non-ovariectomised rats were determined by vaginal smear. The animals were then sacrificed and uteri were removed for protein and mRNA expression analyses by Western blotting and Real Time PCR, respectively. SLC4A4 distribution was observed by immunohistochemistry. Treatment with increasing E2 doses resulted in a dose-dependent increase in SLC4A4 protein expression. High SLC4A4 protein and mRNA expression can be seen at estrus. SLC4A4 is distributed mainly at the apical as well as basolateral membranes of the luminal and glandular epithelia following E2 treatment and at Es. Meanwhile, SLC4A4 expression was reduced following P4 treatment and was low at diestrus. High SLC4A4 expression under estrogen dominance may contribute to the increase in uterine fluid Na(+) and HCO3(-) content, while its low expression under P4 dominance may result in vice versa. Copyright © 2013 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Bergstroem, K.A.; Halldin, C.; Hall, H.; Lundkvist, C.; Ginovart, N.; Swahn, C.G.; Farde, L.
1997-01-01
Radiolabelled 2β-carbomethoxy-3β-(4-iodophenyl)tropane (β-CIT) has been used in clinical studies for the imaging of dopamine and serotonin transporters with single-photon emission tomography (SPET). 2β-Carbomethoxy-3β-(4-iodophenyl)nortropane (nor-β-CIT) is a des-methyl analogue of β-CIT, which in vitro has tenfold higher affinity (IC 50 =0.36 nM) to the serotonin transporter than β-CIT (IC 50 =4.2 nM). Nor-β-CIT may thus be a useful radioligand for imaging of the serotonin transporter. In the present study iodine-125 and carbon-11 labelled nor-β-CIT were prepared for in vitro autoradiographic studies on post-mortem human brain cryosections and for in vivo positron emission tomography (PET) studies in Cynomolgus monkeys. Whole hemisphere autoradiography with [ 125 I[nor-β-CIT demonstrated high binding in the striatum, the thalamus and cortical regions of the human brain. Addition of a high concentration (1 μM) of citalopram inhibited binding in the thalamus and the neocortex, but not in the striatum. In PET studies with [ 11 C[nor-β-CIT there was rapid uptake of radioactivity in the monkey brain (6% of injected dose at 15 min) and high accumulation of radioactivity in the striatum, thalamus and neocortex. Thalamus to cerebellum and cortex to cerebellum ratios were 2.5 and 1.8 at 60 min, respectively. The ratios obtained with [ 11 C[nor-β-CIT were 20%-40% higher than those previously obtained with [ 11 C[β-CIT. Radioactivity in the thalamus and the neocortex but not in the striatum was displaceable with citalopram (5 mg/kg). In conclusion, nor-β-CIT binds to the serotonin transporter in the primate brain in vitro and in vivo and has potential for PET and SPET imaging of the serotonin transporter in human brain. (orig.). With 4 figs
Vps35-deficiency impairs SLC4A11 trafficking and promotes corneal dystrophy.
Directory of Open Access Journals (Sweden)
Wei Liu
Full Text Available Vps35 (vacuolar protein sorting 35 is a major component of retromer that selectively promotes endosome-to-Golgi retrieval of transmembrane proteins. Dysfunction of retromer is a risk factor for the pathogenesis of Parkinson's disease (PD and Alzheimer's disease (AD. However, Vps35/retromer's function in the eye or the contribution of Vps35-deficiency to eye degenerative disorders remains to be explored. Here we provide evidence for a critical role of Vps35 in mouse corneal dystrophy. Vps35 is expressed in mouse and human cornea. Mouse cornea from Vps35 heterozygotes (Vps35+/- show features of dystrophy, such as loss of both endothelial and epithelial cell densities, disorganizations of endothelial, stroma, and epithelial cells, excrescences in the Descemet membrane, and corneal edema. Additionally, corneal epithelial cell proliferation was reduced in Vps35-deficient mice. Intriguingly, cell surface targeting of SLC4A11, a membrane transport protein (OH- /H+ /NH3 /H2O of corneal endothelium, whose mutations have been identified in patients with corneal dystrophy, was impaired in Vps35-deficient cells and cornea. Taken together, these results suggest that SLC4A11 appears to be a Vps35/retromer cargo, and Vps35-regulation of SLC4A11 trafficking may underlie Vps35/retromer regulation of corneal dystrophy.
Liu, Henry C; Goldenberg, Anne; Chen, Yuchen; Lun, Christina; Wu, Wei; Bush, Kevin T; Balac, Natasha; Rodriguez, Paul; Abagyan, Ruben; Nigam, Sanjay K
2016-10-01
Statistical analysis was performed on physicochemical descriptors of ∼250 drugs known to interact with one or more SLC22 "drug" transporters (i.e., SLC22A6 or OAT1, SLC22A8 or OAT3, SLC22A1 or OCT1, and SLC22A2 or OCT2), followed by application of machine-learning methods and wet laboratory testing of novel predictions. In addition to molecular charge, organic anion transporters (OATs) were found to prefer interacting with planar structures, whereas organic cation transporters (OCTs) interact with more three-dimensional structures (i.e., greater SP3 character). Moreover, compared with OAT1 ligands, OAT3 ligands possess more acyclic tetravalent bonds and have a more zwitterionic/cationic character. In contrast, OCT1 and OCT2 ligands were not clearly distinquishable form one another by the methods employed. Multiple pharmacophore models were generated on the basis of the drugs and, consistent with the machine-learning analyses, one unique pharmacophore created from ligands of OAT3 possessed cationic properties similar to OCT ligands; this was confirmed by quantitative atomic property field analysis. Virtual screening with this pharmacophore, followed by transport assays, identified several cationic drugs that selectively interact with OAT3 but not OAT1. Although the present analysis may be somewhat limited by the need to rely largely on inhibition data for modeling, wet laboratory/in vitro transport studies, as well as analysis of drug/metabolite handling in Oat and Oct knockout animals, support the general validity of the approach-which can also be applied to other SLC and ATP binding cassette drug transporters. This may make it possible to predict the molecular properties of a drug or metabolite necessary for interaction with the transporter(s), thereby enabling better prediction of drug-drug interactions and drug-metabolite interactions. Furthermore, understanding the overlapping specificities of OATs and OCTs in the context of dynamic transporter tissue
International Nuclear Information System (INIS)
Oya, Shunichi; Choi, Seok-Rye; Kung, Mei-Ping; Kung, Hank F.
2007-01-01
Two novel ligands with 4' substitution on the Phenyl Ring B of biphenylthiol, 5-chloro-2-(2'-((dimethylamino)methyl)-4'-iodophenylthio)benzenamine (7) and 2-(2'-((dimethylamino)methyl)-4'-methoxyphenylthio)-5-iodobenzenamine (8), were prepared and tested as potential serotonin transporter (SERT) imaging agents. The new ligands displayed extremely high binding affinities to SERT (K i =0.22±0.09 and 0.11±0.04 nM, respectively), with very low binding affinities to dopamine and norepinephrine transporters (K i >1000 nM). The corresponding [ 125 I]7 and [ 125 I]8 were successfully prepared from tri-n-butyltin derivatives. They showed good brain uptakes and prolonged retention after intravenous injection in rats (brain uptake was 1.77% and 0.98% dose/g for [ 125 I]7, and 0.92% and 0.29% dose/g for [ 125 I]8, at 2 and 120 min, respectively). Significantly, [ 125 I]7 showed excellent uptake and prolonged retention in the hypothalamus, where SERT concentration was highest. The hypothalamus/cerebellum (HY/CB) ratios (target/background ratios) were 4.24, 7.10, 8.24 and 12.6 at 2, 4, 6 and 12 h, respectively. The HY/CB ratios for [ 125 I]8 were 3.97, 5.57 and 5.06 at 1, 2 and 4 h, respectively. Adding the 4'-iodo group to the Phenyl Ring B of Compound (7) appeared to reduce the rate of clearance from the brain, and kinetics favored uptake and retention in the hypothalamus. The localization of [ 125 I]7 in the hypothalamus region in the rat brain could be blocked by pretreatment with (+)McN5652, escitalopram and ADAM (2), which are all selective SERT ligands (at 2 mg/kg iv, 5 min pretreatment). Ex vivo autoradiograms of rat brain sections (at 4 h after intravenous injection of [ 125 I]7) showed intense labeling in regions of the brain known to have high SERT density. The excellent selective uptake and retention in the hypothalamus region suggest that [ 123 I]7 is a potential lead compound for developing new imaging agents targeting SERT-binding sites with single
Dufay, J Noelia; Fernández-Murray, J Pedro; McMaster, Christopher R
2017-06-07
The SLC25 family member SLC25A38 (Hem25 in yeast) was recently identified as a mitochondrial glycine transporter that provides substrate to initiate heme/hemoglobin synthesis. Mutations in the human SLC25A38 gene cause congenital sideroblastic anemia. The full extent to which SLC25 family members coregulate heme synthesis with other mitochondrial functions is not clear. In this study, we surveyed 29 nonessential SLC25 family members in Saccharomyces cerevisiae for their ability to support growth in the presence and absence of HEM25 Six SLC25 family members were identified that were required for growth or for heme synthesis in cells lacking Hem25 function. Importantly, we determined that loss of function of the SLC25 family member Flx1, which imports FAD into mitochondria, together with loss of function of Hem25, resulted in inability to grow on media that required yeast cells to supply energy using mitochondrial respiration. We report that specific components of complexes of the electron transport chain are decreased in the absence of Flx1 and Hem25 function. In addition, we show that mitochondria from flx1 Δ hem25 Δ cells contain uncharacterized Cox2-containing high molecular weight aggregates. The functions of Flx1 and Hem25 provide a facile explanation for the decrease in heme level, and in specific electron transport chain complex components. Copyright © 2017 Dufay et al.
Directory of Open Access Journals (Sweden)
J. Noelia Dufay
2017-06-01
Full Text Available The SLC25 family member SLC25A38 (Hem25 in yeast was recently identified as a mitochondrial glycine transporter that provides substrate to initiate heme/hemoglobin synthesis. Mutations in the human SLC25A38 gene cause congenital sideroblastic anemia. The full extent to which SLC25 family members coregulate heme synthesis with other mitochondrial functions is not clear. In this study, we surveyed 29 nonessential SLC25 family members in Saccharomyces cerevisiae for their ability to support growth in the presence and absence of HEM25. Six SLC25 family members were identified that were required for growth or for heme synthesis in cells lacking Hem25 function. Importantly, we determined that loss of function of the SLC25 family member Flx1, which imports FAD into mitochondria, together with loss of function of Hem25, resulted in inability to grow on media that required yeast cells to supply energy using mitochondrial respiration. We report that specific components of complexes of the electron transport chain are decreased in the absence of Flx1 and Hem25 function. In addition, we show that mitochondria from flx1Δ hem25Δ cells contain uncharacterized Cox2-containing high molecular weight aggregates. The functions of Flx1 and Hem25 provide a facile explanation for the decrease in heme level, and in specific electron transport chain complex components.
Šerý, Omar; Paclt, Ivo; Drtílková, Ivana; Theiner, Pavel; Kopečková, Marta; Zvolský, Petr; Balcar, Vladimir J
2015-06-11
ADHD and alcoholism are psychiatric diseases with pathophysiology related to dopamine system. DAT1 belongs to the SLC6 family of transporters and is involved in the regulation of extracellular dopamine levels. A 40 bp variable number tandem repeat (VNTR) polymorphism in the 3'-untranslated region of DAT1/SLC6A3 gene was previously reported to be associated with various phenotypes involving disturbed regulation of dopaminergic neurotransmission. A total of 1312 subjects were included and genotyped for 40 bp VNTR polymorphism of DAT1/SLC6A3 gene in this study (441 alcoholics, 400 non-alcoholic controls, 218 ADHD children and 253 non ADHD children). Using miRBase software, we have performed a computer analysis of VNTR part of DAT1 gene for presence of miRNA binding sites. We have found significant relationships between ADHD and the 40 bp VNTR polymorphisms of DAT1/SLC6A3 gene (P VNTR polymorphism of DAT1/SLC6A3 gene has been detected. We have found an association between 40 bp VNTR polymorphism of DAT1/SLC6A3 gene and ADHD in the Czech population; in a broad agreement with studies in other population samples. Furthermore, we detected rare genotypes 8/10, 7/10 and 10/11 present in ADHD boys only and identified miRNAs that should be looked at as potential novel targets in the research on ADHD.
International Nuclear Information System (INIS)
Ross, M.
1993-04-01
The SLAC Linear Collider (SLC) is the forerunner of a new generation of high energy accelerators. As such, it incorporates many novel features that must be fully exploited to achieve optimum performance. In this paper we present an overview of the frontiers of collider performance at SLC. Recent developments have centered on polarization, intensity and emittance preservation issues. A polarized source and spin transport system were successfully commissioned in 1992 and operated with high reliability. Practical intensity limits associated with rapid growth ( S ) bunch length instabilities have been observed in the damping rings. Ring RF voltage manipulations are used to suppress the instabilities. Emittance preservation technique development has focused on controlling system-wide instabilities and improving feedback and tuning procedures. Control of instabilities of all time scales, pulse to pulse, fast and slow, is one of the most challenging aspects of the collider. The challenge is met with (1) very high level of control and automation required for general tuning and optimization, (2) real-time transport line optical correction and monitoring, (3) coupled, high level, trajectory and energy feedback, (4) high order multipole optical correction and monitoring, (5) feedback-based linac beam emittance preservation, and (6) interaction region luminosity optimization. The common thread beneath all of these is the SLC control system which must provide a level of control, diagnosis and feedback not required for simpler machines
Inhibition of serotonin transport by (+)McN5652 is noncompetitive
Energy Technology Data Exchange (ETDEWEB)
Hummerich, Rene [Biochemical Laboratory, Central Institute of Mental Health, 68159 Mannheim (Germany); Schulze, Oliver [Department of Nuclear Medicine, University Medical Center Hamburg-Eppendorf, D-20246 Hamburg (Germany); Raedler, Thomas [Department of Psychiatry and Psychotherapy, University Medical Center Hamburg-Eppendorf, D-20246 Hamburg (Germany); Mikecz, Pal [Department of Nuclear Medicine, University Medical Center Hamburg-Eppendorf, D-20246 Hamburg (Germany); Reimold, Matthias [Department of Nuclear Medicine, University Hospital Tuebingen, D-72076 Tuebingen (Germany); Brenner, Winfried [Department of Nuclear Medicine, University Medical Center Hamburg-Eppendorf, D-20246 Hamburg (Germany); Clausen, Malte [Department of Nuclear Medicine, University Medical Center Hamburg-Eppendorf, D-20246 Hamburg (Germany); Schloss, Patrick [Biochemical Laboratory, Central Institute of Mental Health, 68159 Mannheim (Germany); Buchert, Ralph [Department of Nuclear Medicine, University Medical Center Hamburg-Eppendorf, D-20246 Hamburg (Germany)]. E-mail: buchert@uke.uni-hamburg.de
2006-04-15
Introduction: Imaging of the serotonergic innervation of the brain using positron emission tomography (PET) with the serotonin transporter (SERT) ligand [{sup 11C}] (+)McN5652 might be affected by serotonin in the synaptic cleft if there is relevant interaction between [{sup 11}C] (+)McN5652 and serotonin at the SERT. The aim of the present study therefore was to pharmacologically characterize the interaction of [{sup 11}C] (+)McN5652 and serotonin at the SERT. Methods: In vitro saturation analyses of [{sup 3}H]serotonin uptake into HEK293 cells stably expressing the human SERT were performed in the absence and presence of unlabelled (+)McN5652. Data were evaluated assuming Michaelis-Menten kinetics. Results: Unlabelled (+)McN5652 significantly reduced the maximal rate of serotonin transport V {sub max} of SERT without affecting the Michaelis-Menten constant K {sub M}. Conclusions: This finding indicates that (+)McN5652 inhibits serotonin transport through the SERT in a noncompetitive manner. This might suggest that [{sup 11}C] (+)McN5652 PET is not significantly affected by endogenous serotonin.
Inhibition of serotonin transport by (+)McN5652 is noncompetitive
International Nuclear Information System (INIS)
Hummerich, Rene; Schulze, Oliver; Raedler, Thomas; Mikecz, Pal; Reimold, Matthias; Brenner, Winfried; Clausen, Malte; Schloss, Patrick; Buchert, Ralph
2006-01-01
Introduction: Imaging of the serotonergic innervation of the brain using positron emission tomography (PET) with the serotonin transporter (SERT) ligand [ 11C ] (+)McN5652 might be affected by serotonin in the synaptic cleft if there is relevant interaction between [ 11 C] (+)McN5652 and serotonin at the SERT. The aim of the present study therefore was to pharmacologically characterize the interaction of [ 11 C] (+)McN5652 and serotonin at the SERT. Methods: In vitro saturation analyses of [ 3 H]serotonin uptake into HEK293 cells stably expressing the human SERT were performed in the absence and presence of unlabelled (+)McN5652. Data were evaluated assuming Michaelis-Menten kinetics. Results: Unlabelled (+)McN5652 significantly reduced the maximal rate of serotonin transport V max of SERT without affecting the Michaelis-Menten constant K M . Conclusions: This finding indicates that (+)McN5652 inhibits serotonin transport through the SERT in a noncompetitive manner. This might suggest that [ 11 C] (+)McN5652 PET is not significantly affected by endogenous serotonin
Loss-of-function mutations in SLC30A8 protect against type 2 diabetes.
Flannick, Jason; Thorleifsson, Gudmar; Beer, Nicola L; Jacobs, Suzanne B R; Grarup, Niels; Burtt, Noël P; Mahajan, Anubha; Fuchsberger, Christian; Atzmon, Gil; Benediktsson, Rafn; Blangero, John; Bowden, Don W; Brandslund, Ivan; Brosnan, Julia; Burslem, Frank; Chambers, John; Cho, Yoon Shin; Christensen, Cramer; Douglas, Desirée A; Duggirala, Ravindranath; Dymek, Zachary; Farjoun, Yossi; Fennell, Timothy; Fontanillas, Pierre; Forsén, Tom; Gabriel, Stacey; Glaser, Benjamin; Gudbjartsson, Daniel F; Hanis, Craig; Hansen, Torben; Hreidarsson, Astradur B; Hveem, Kristian; Ingelsson, Erik; Isomaa, Bo; Johansson, Stefan; Jørgensen, Torben; Jørgensen, Marit Eika; Kathiresan, Sekar; Kong, Augustine; Kooner, Jaspal; Kravic, Jasmina; Laakso, Markku; Lee, Jong-Young; Lind, Lars; Lindgren, Cecilia M; Linneberg, Allan; Masson, Gisli; Meitinger, Thomas; Mohlke, Karen L; Molven, Anders; Morris, Andrew P; Potluri, Shobha; Rauramaa, Rainer; Ribel-Madsen, Rasmus; Richard, Ann-Marie; Rolph, Tim; Salomaa, Veikko; Segrè, Ayellet V; Skärstrand, Hanna; Steinthorsdottir, Valgerdur; Stringham, Heather M; Sulem, Patrick; Tai, E Shyong; Teo, Yik Ying; Teslovich, Tanya; Thorsteinsdottir, Unnur; Trimmer, Jeff K; Tuomi, Tiinamaija; Tuomilehto, Jaakko; Vaziri-Sani, Fariba; Voight, Benjamin F; Wilson, James G; Boehnke, Michael; McCarthy, Mark I; Njølstad, Pål R; Pedersen, Oluf; Groop, Leif; Cox, David R; Stefansson, Kari; Altshuler, David
2014-04-01
Loss-of-function mutations protective against human disease provide in vivo validation of therapeutic targets, but none have yet been described for type 2 diabetes (T2D). Through sequencing or genotyping of ~150,000 individuals across 5 ancestry groups, we identified 12 rare protein-truncating variants in SLC30A8, which encodes an islet zinc transporter (ZnT8) and harbors a common variant (p.Trp325Arg) associated with T2D risk and glucose and proinsulin levels. Collectively, carriers of protein-truncating variants had 65% reduced T2D risk (P = 1.7 × 10(-6)), and non-diabetic Icelandic carriers of a frameshift variant (p.Lys34Serfs*50) demonstrated reduced glucose levels (-0.17 s.d., P = 4.6 × 10(-4)). The two most common protein-truncating variants (p.Arg138* and p.Lys34Serfs*50) individually associate with T2D protection and encode unstable ZnT8 proteins. Previous functional study of SLC30A8 suggested that reduced zinc transport increases T2D risk, and phenotypic heterogeneity was observed in mouse Slc30a8 knockouts. In contrast, loss-of-function mutations in humans provide strong evidence that SLC30A8 haploinsufficiency protects against T2D, suggesting ZnT8 inhibition as a therapeutic strategy in T2D prevention.
Edwards, Noel; Anderson, Catriona M H; Gatfield, Kelly M; Jevons, Mark P; Ganapathy, Vadivel; Thwaites, David T
2011-01-01
The H(+)-coupled amino acid transporter PAT2 (SLC36A2) transports the amino acids proline, glycine, alanine and hydroxyproline. A physiological role played by PAT2 in amino acid reabsorption in the renal proximal tubule is demonstrated by mutations in SLC36A2 that lead to an iminoglycinuric phenotype (imino acid and glycine uria) in humans. A number of proline, GABA and tryptophan derivatives were examined to determine if they function either as transported substrates or non-transported inhibitors of PAT2. The compounds were investigated following heterologous expression of rat PAT2 in Xenopus laevis oocytes. PAT2 function was characterised by: radiotracer uptake and competition (cis-inhibition) studies; radiotracer efflux and trans-stimulation; and measurement of substrate-induced positive inward current by two-electrode voltage-clamp. In general, the proline derivatives appeared to be transported substrates and the relative ability to induce current flow was closely related to the inhibitory effects on PAT2-mediated l-[(3)H]proline uptake. In contrast, certain heterocyclic GABA derivatives (e.g. l-pipecolic acid) were translocated only slowly. Finally, the tryptophan derivatives inhibited PAT2 function but did not undergo transport. l-Proline uptake was inhibited by 5-hydroxy-l-tryptophan (IC(50) 1.6±0.4mM), α-methyl-d,l-tryptophan (3.5±1.5mM), l-tryptophan, 1-methyl-l-tryptophan and indole-3-propionic acid. Although neither 5-hydroxy-l-tryptophan nor α-methyl-d,l-tryptophan were able to elicit inward current in PAT2-expressing oocytes both reduced the current evoked by l-proline. 5-Hydroxy-l-tryptophan and α-methyl-d,l-tryptophan were unable to trans-stimulate l-proline efflux from PAT2-expressing oocytes, confirming that the two compounds act as non-transported blockers of PAT2. These two tryptophan derivatives should prove valuable experimental tools in future investigations of the physiological roles of PAT2. Copyright © 2010 Elsevier B.V. All rights
van Dalfsen, Jens H; Markus, C Rob
2018-05-23
The short (S) allele of a functional polymorphism (5-HTTLPR) within the promoter region of the serotonin transporter gene (SLC6A4) is found to predispose the risk for stress-related affective disorders relative to the long (L) allele. Evidence suggests that elevated stress reactivity of the hypothalamic-pituitary-adrenal (HPA) axis might underlie this association although there is little understanding about the origin of inconsistent findings. Since inadequate sleep is commonly known to promote HPA stress reactivity, it might well play an important modulating role. The present study tested this hypothesis by investigating whether sleep quality moderates the relationship between 5-HTTLPR and cortisol stress responsiveness. From a large 5-HTTLPR database (n = 771), a sample of healthy male and female participants homozygous for either the 5-HTTLPR S-allele (n = 25) or L-allele (n = 25) were assessed for sleep quality and salivary cortisol secretion during acute laboratory stress. Diminished sleep quality was found to exclusively potentiate cortisol stress reactivity in the homozygous L-allele genotype. Accounting for this 5-HTTLPR-dependent influence enhanced the predictive value of 5-HTTLPR on cortisol stress responsiveness, revealing greater HPA reactivity in S-allele relative to L-allele carriers. Current findings suggest that variations in sleep quality may serve as a confounding factor in the search for genetic differences in stress sensitivity and related affective disorders.
SLC26A4 mutations are associated with a specific inner ear malformation.
Fitoz, Suat; Sennaroğlu, Levent; Incesulu, Armağan; Cengiz, Filiz Başak; Koç, Yasemin; Tekin, Mustafa
2007-03-01
Inner ear anomalies have been reported in approximately 30% of children with early onset deafness. Identification of causative genetic factors in a large proportion of these patients was not successful. Mutations in the SLC26A4 gene have been detected in individuals with enlarged vestibular aqueduct (EVA) or Mondini dysplasia. We aimed to characterize the inner ear anomalies associated with SLC26A4 mutations. The SLC26A4 gene has been screened for mutations in 16 subjects from 14 unrelated Turkish families with a variety of inner ear anomalies ranging from Michel aplasia to incomplete partition-II and EVA. None of the patients was diagnosed to have a recognizable genetic syndrome. Additional four patients with Pendred syndrome from three families were included. Only one patient with EVA was found to have a heterozygous mutation (c.1586delT) in SLC26A4. All patients with Pendred syndrome had homozygous mutations and were noted to have either EVA or EVA associated with incomplete partition-II on the computed tomography of the temporal bone. SLC26A4 mutations are not associated with a large spectrum of inner ear anomalies. They, instead, result in a specific morphological appearance consistent with EVA or incomplete partition-II.
Directory of Open Access Journals (Sweden)
Quirino Cordeiro
2004-12-01
Full Text Available A role of dopaminergic dysfunction has been postulated in the aetiology of schizophrenia. We hypothesized that variations in the dopamine transporter gene (SLC6A3 may be associated with schizophrenia. We conducted case-control and family based analysis on the polymorphic SLC6A3 variable number tandem repeat (VNTR in a sample of 220 schizophrenic patients, 226 gender and ethnic matched controls, and 49 additional case-parent trios. No differences were found in allelic or genotypic distributions between cases and controls and no significant transmission distortions from heterozygous parents to schizophrenic offspring were detected. Thus, our results do not support an association of the SLC6A3 VNTR with schizophrenia in our sample.Genes do sistema dopaminérgico são de escolha para a pesquisa de susceptibilidade para a esquizofrenia. Desse modo, possível contribuição do polimorfismo do gene do transportador de dopamina (SLC6A3 no aumento da vulnerabilidade para a esquizofrenia foi investigada no presente estudo. Analisou-se a distribuição do sítio polimórfico do gene do transportador de dopamina (VNTR em uma população de 220 pacientes com esquizofrenia (critério diagnóstico: DSM-IV e comparou-se com a distribuição em uma população controle de 226 indivíduos pareados para sexo e etnia. Nenhuma diferença foi observada na distribuição dos alelos entre casos e controles. O mesmo polimorfismo também foi investigado em uma segunda amostra composta por 49 trios (pais e probando. O resultado também foi negativo. Tais dados não dão suporte para a participação do polimorfismo do gene do transportador de dopamina no aumento de susceptibilidade para esquizofrenia na amostra estudada.
Metformin Is a Substrate and Inhibitor of the Human Thiamine Transporter, THTR-2 (SLC19A3).
Liang, Xiaomin; Chien, Huan-Chieh; Yee, Sook Wah; Giacomini, Marilyn M; Chen, Eugene C; Piao, Meiling; Hao, Jia; Twelves, Jolyn; Lepist, Eve-Irene; Ray, Adrian S; Giacomini, Kathleen M
2015-12-07
The biguanide metformin is widely used as first-line therapy for the treatment of type 2 diabetes. Predominately a cation at physiological pH's, metformin is transported by membrane transporters, which play major roles in its absorption and disposition. Recently, our laboratory demonstrated that organic cation transporter 1, OCT1, the major hepatic uptake transporter for metformin, was also the primary hepatic uptake transporter for thiamine, vitamin B1. In this study, we tested the reverse, i.e., that metformin is a substrate of thiamine transporters (THTR-1, SLC19A2, and THTR-2, SLC19A3). Our study demonstrated that human THTR-2 (hTHTR-2), SLC19A3, which is highly expressed in the small intestine, but not hTHTR-1, transports metformin (Km = 1.15 ± 0.2 mM) and other cationic compounds (MPP(+) and famotidine). The uptake mechanism for hTHTR-2 was pH and electrochemical gradient sensitive. Furthermore, metformin as well as other drugs including phenformin, chloroquine, verapamil, famotidine, and amprolium inhibited hTHTR-2 mediated uptake of both thiamine and metformin. Species differences in the substrate specificity of THTR-2 between human and mouse orthologues were observed. Taken together, our data suggest that hTHTR-2 may play a role in the intestinal absorption and tissue distribution of metformin and other organic cations and that the transporter may be a target for drug-drug and drug-nutrient interactions.
Directory of Open Access Journals (Sweden)
Quirino Cordeiro
2010-10-01
Full Text Available Epidemiological studies have demonstrated that the genetic component is an important risk factor for the development of schizophrenia. The genes that codify the different compounds of the dopaminergic system have created interest for molecular investigations in patients with schizophrenia because the antipsychotic drugs, especially those of first generation, act on this cerebral system. Thus the aim of the present study was to investigate the possible association between a new single nucleotide polymorphism (rs6347 located in exon 9 of the protein transporter (SLC6A3 and schizophrenia. The distribution of the alleles and genotypes of the studied polymorphism was investigated in a sample of 235 patients and 834 controls matched by gender and age. There were statistical differences in the allelic (χ2=5.97, 1d.f. , p=0.01, OR=1.33-1.05Estudos epidemiológicos têm demonstrado que o componente genético é um importante fator de risco para a esquizofrenia. Os genes que codificam os diferentes componentes do sistema dopaminérgico passaram a despertar interesse para estudos moleculares em pacientes com esquizofrenia, pois os antipsicóticos, em especial os de primeira geração, exercem sua ação nesse sistema. Assim, o objetivo do presente estudo foi investigar a associação entre um novo polimorfismo de nucleotídeo único (rs6347 localizado no exon 9 do gene do transportador de dopamina (SLC6A3 e esquizofrenia. Um total de 235 pacientes e 834 controles pareados para sexo e idade foi selecionado para a investigação da distribuição dos alelos e genótipos do polimorfismo investigado entre os grupos de pacientes e controles. Houve diferenças estatisticamente significantes nas distribuições alélicas (χ2=5,97, 1d.f. , p=0,01, OR=1,33-1,05
SPECT imaging with the serotonin transporter radiotracer [123I]p ZIENT in nonhuman primate brain
International Nuclear Information System (INIS)
Cosgrove, Kelly P.; Staley, Julie K.; Baldwin, Ronald M.; Bois, Frederic; Plisson, Christophe; Al-Tikriti, Mohammed S.; Seibyl, John P.; Goodman, Mark M.; Tamagnan, Gilles D.
2010-01-01
Introduction: Serotonin dysfunction has been linked to a variety of psychiatric diseases; however, an adequate SPECT radioligand to probe the serotonin transporter system has not been successfully developed. The purpose of this study was to characterize and determine the in vivo selectivity of iodine-123-labeled 2β-carbomethoxy-3β-(4'-((Z)-2-iodoethenyl)phenyl)nortropane, [ 123 I]p ZIENT, in nonhuman primate brain. Methods: Two ovariohysterectomized female baboons participated in nine studies (one bolus and eight bolus to constant infusion at a ratio of 9.0 h) to evaluate [ 123 I]p ZIENT. To evaluate the selectivity of [ 123 I]p ZIENT, the serotonin transporter blockers fenfluramine (1.5, 2.5 mg/kg) and citalopram (5 mg/kg), the dopamine transporter blocker methylphenidate (0.5 mg/kg) and the norepinephrine transporter blocker nisoxetine (1 mg/kg) were given at 8 h post-radiotracer injection. Results: In the bolus to constant infusion studies, equilibrium was established by 4-8 h. [ 123 I]p ZIENT was 93% and 90% protein bound in the two baboons and there was no detection of lipophilic radiolabeled metabolites entering the brain. In the high-density serotonin transporter regions (diencephalon and brainstem), fenfluramine and citalopram resulted in 35-71% and 129-151% displacement, respectively, whereas methylphenidate and nisoxetine did not produce significant changes ( 123 I]p ZIENT is a favorable compound for in vivo SPECT imaging of serotonin transporters with negligible binding to norepinephrine and dopamine transporters.
Tóth, Lola; Fábos, Beáta; Farkas, Katalin; Sulák, Adrienn; Tripolszki, Kornélia; Széll, Márta; Nagy, Nikoletta
2017-03-15
Oculocutaneous albinism (OCA) is a clinically and genetically heterogenic group of pigmentation abnormalities. OCA type IV (OCA4, OMIM 606574) develops due to homozygous or compound heterozygous mutations in the solute carrier family 45, member 2 (SLC45A2) gene. This gene encodes a membrane-associated transport protein, which regulates tyrosinase activity and, thus, melanin content by changing melanosomal pH and disrupting the incorporation of copper into tyrosinase. Here we report two Hungarian siblings affected by an unusual OCA4 phenotype. After genomic DNA was isolated from peripheral blood of the patients, the coding regions of the SLC45A2 gene were sequenced. In silico tools were applied to identify the functional impact of the newly detected mutations. Direct sequencing of the SLC45A2 gene revealed two novel, heterozygous mutations, one missense (c.1226G > A, p.Gly409Asp) and one nonsense (c.1459C > T, p.Gln437*), which were present in both patients, suggesting the mutations were compound heterozygous. In silico tools suggest that these variations are disease causing mutations. The newly identified mutations may affect the transmembrane domains of the protein, and could impair transport function, resulting in decreases in both melanosomal pH and tyrosinase activity. Our study provides expands on the mutation spectrum of the SLC45A2 gene and the genetic background of OCA4.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC486 (Link to dictyBase) - - - Contig-U16480-1 SLC486E (Link... to Original site) - - - - - - SLC486E 451 Show SLC486 Library SL (Link to library) Clone ID SLC486 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC486Q.Seq.d/ Representative seq. ID SLC48...6E (Link to Original site) Representative DNA sequence >SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC486Q.Seq.d/ GTCAT...7Q.Seq.d/ 868 0.0 SLD427 (SLD427Q) /CSM/SL/SLD4-B/SLD427Q.Seq.d/ 868 0.0 SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC4
2014-01-01
The binding-induced fluorescence of 4-(4-(dimethylamino)-phenyl)-1-methylpyridinium (APP+) and two new serotonin transporter (SERT)-binding fluorescent analogues, 1-butyl-4-[4-(1-dimethylamino)phenyl]-pyridinium bromide (BPP+) and 1-methyl-4-[4-(1-piperidinyl)phenyl]-pyridinium (PPP+), has been investigated. Optical spectroscopy reveals that these probes are highly sensitive to their chemical microenvironment, responding to variations in polarity with changes in transition energies and responding to changes in viscosity or rotational freedom with emission enhancements. Molecular docking calculations reveal that the probes are able to access the nonpolar and conformationally restrictive binding pocket of SERT. As a result, the probes exhibit previously not identified binding-induced turn-on emission that is spectroscopically distinct from dyes that have accumulated intracellularly. Thus, binding and transport dynamics of SERT ligands can be resolved both spatially and spectroscopically. PMID:24460204
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC419 (Link to dictyBase) - - - Contig-U03801-1 SLC419Z (Link... to Original site) - - SLC419Z 335 - - - - Show SLC419 Library SL (Link to library) Clone ID SLC419 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC419Q.Seq.d/ Representative seq. ID SLC41...9Z (Link to Original site) Representative DNA sequence >SLC419 (SLC419Q) /CSM/SL/SLC4-A/SLC419Q.Seq.d/ XXXXX...I6-A/SSI602Q.Seq.d/ 490 e-138 SSD173 (SSD173Q) /CSM/SS/SSD1-D/SSD173Q.Seq.d/ 490 e-138 SLC419 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC456 (Link to dictyBase) - - - Contig-U16272-1 SLC456Z (Link... to Original site) - - SLC456Z 483 - - - - Show SLC456 Library SL (Link to library) Clone ID SLC456 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC456Q.Seq.d/ Representative seq. ID SLC45...6Z (Link to Original site) Representative DNA sequence >SLC456 (SLC456Q) /CSM/SL/SLC4-C/SLC456Q.Seq.d/ XXXXX...0 %: vacuolar 4.0 %: peroxisomal >> prediction for SLC456 is nuc 5' end seq. ID -
Energy Technology Data Exchange (ETDEWEB)
Bergstroem, K.A. [Karolinska Institutet, Department of Clinical Neuroscience, Psychiatry Section, Karolinska Hospital, S-17176 Stockholm (Sweden)]|[Kuopio University Hospital, Clinical Physiology, FIN-70210 Kuopio (Finland); Halldin, C. [Karolinska Institutet, Department of Clinical Neuroscience, Psychiatry Section, Karolinska Hospital, S-17176 Stockholm (Sweden); Hall, H. [Karolinska Institutet, Department of Clinical Neuroscience, Psychiatry Section, Karolinska Hospital, S-17176 Stockholm (Sweden); Lundkvist, C. [Karolinska Institutet, Department of Clinical Neuroscience, Psychiatry Section, Karolinska Hospital, S-17176 Stockholm (Sweden); Ginovart, N. [Karolinska Institutet, Department of Clinical Neuroscience, Psychiatry Section, Karolinska Hospital, S-17176 Stockholm (Sweden); Swahn, C.G. [Karolinska Institutet, Department of Clinical Neuroscience, Psychiatry Section, Karolinska Hospital, S-17176 Stockholm (Sweden); Farde, L. [Karolinska Institutet, Department of Clinical Neuroscience, Psychiatry Section, Karolinska Hospital, S-17176 Stockholm (Sweden)
1997-06-10
Radiolabelled 2{beta}-carbomethoxy-3{beta}-(4-iodophenyl)tropane ({beta}-CIT) has been used in clinical studies for the imaging of dopamine and serotonin transporters with single-photon emission tomography (SPET). 2{beta}-Carbomethoxy-3{beta}-(4-iodophenyl)nortropane (nor-{beta}-CIT) is a des-methyl analogue of {beta}-CIT, which in vitro has tenfold higher affinity (IC{sub 50}=0.36 nM) to the serotonin transporter than {beta}-CIT (IC{sub 50}=4.2 nM). Nor-{beta}-CIT may thus be a useful radioligand for imaging of the serotonin transporter. In the present study iodine-125 and carbon-11 labelled nor-{beta}-CIT were prepared for in vitro autoradiographic studies on post-mortem human brain cryosections and for in vivo positron emission tomography (PET) studies in Cynomolgus monkeys. Whole hemisphere autoradiography with [{sup 125}I]nor-{beta}-CIT demonstrated high binding in the striatum, the thalamus and cortical regions of the human brain. Addition of a high concentration (1 {mu}M) of citalopram inhibited binding in the thalamus and the neocortex, but not in the striatum. In PET studies with [{sup 11}C]nor-{beta}-CIT there was rapid uptake of radioactivity in the monkey brain (6% of injected dose at 15 min) and high accumulation of radioactivity in the striatum, thalamus and neocortex. Thalamus to cerebellum and cortex to cerebellum ratios were 2.5 and 1.8 at 60 min, respectively. The ratios obtained with [{sup 11}C]nor-{beta}-CIT were 20%-40% higher than those previously obtained with [{sup 11}C]{beta}-CIT. Radioactivity in the thalamus and the neocortex but not in the striatum was displaceable with citalopram (5 mg/kg). In conclusion, nor-{beta}-CIT binds to the serotonin transporter in the primate brain in vitro and in vivo and has potential for PET and SPET imaging of the serotonin transporter in human brain. (orig.). With 4 figs.
Directory of Open Access Journals (Sweden)
Armando R Irizarry
Full Text Available There has been growing recognition of the essential roles of citrate in biomechanical properties of mineralized tissues, including teeth and bone. However, the sources of citrate in these tissues have not been well defined, and the contribution of citrate to the regulation of odontogenesis and osteogenesis has not been examined. Here, tooth and bone phenotypes were examined in sodium-dependent citrate transporter (NaCT Slc13a5 deficient C57BL/6 mice at 13 and 32 weeks of age. Slc13a5 deficiency led to defective tooth development, characterized by absence of mature enamel, formation of aberrant enamel matrix, and dysplasia and hyperplasia of the enamel organ epithelium that progressed with age. These abnormalities were associated with fragile teeth with a possible predisposition to tooth abscesses. The lack of mature enamel was consistent with amelogenesis imperfecta. Furthermore, Slc13a5 deficiency led to decreased bone mineral density and impaired bone formation in 13-week-old mice but not in older mice. The findings revealed the potentially important role of citrate and Slc13a5 in the development and function of teeth and bone.
DEFF Research Database (Denmark)
Rasmussen, Rune Nørgaard; Lagunas, Candela; Plum, Jakob Munk
2016-01-01
The aim of the present study was to investigate if basic GABA-mimetics interact with the taurine transporter (TauT, Slc6a6), and to find a suitable cell based model that is robust towards extracellular changes in osmolality during uptake studies. Taurine uptake was measured in human Caco-2 cells....... Uptake of the GABA-mimetics gaboxadol and vigabatrin was investigated in SKPT cells, and quantified by liquid scintillation or HPLC-MS/MS analysis, respectively. The uptake rate of [(3)H]-taurine was Na(+) and Cl(-) and concentration dependent with taurine with an apparent Vmax of 6.3±1.6pmolcm(-2)min(-1......) and a Km of 24.9±15.0μM. β-alanine, nipecotic acid, gaboxadol, GABA, vigabatrin, δ-ALA and guvacine inhibited the taurine uptake rate in a concentration dependent manner. The order of affinity for TauT was β-alanine>GABA>nipecotic acid>guvacine>δ-ALA>vigabatrin>gaboxadol with IC50-values of 0.04, 1.07, 2...
Ruhé, Henricus G.; Ooteman, Wendy; Booij, Jan; Michel, Martin C.; Moeton, Martina; Baas, Frank; Schene, Aart H.
2009-01-01
BACKGROUND: In major depressive disorder, selective serotonin reuptake inhibitors target the serotonin transporter (SERT). Their response rates (30-50%) are modified by SERT promotor polymorphisms (5-HTTLPR). OBJECTIVES: To quantify the relationship between SERT occupancy and response, and whether
Abplanalp, Jeannette; Laczko, Endre; Philp, Nancy J.; Neidhardt, John; Zuercher, Jurian; Braun, Philipp; Schorderet, Daniel F.; Munier, Francis L.; Verrey, François; Berger, Wolfgang; Camargo, Simone M.R.; Kloeckener-Gruissem, Barbara
2013-01-01
Creatine transport has been assigned to creatine transporter 1 (CRT1), encoded by mental retardation associated SLC6A8. Here, we identified a second creatine transporter (CRT2) known as monocarboxylate transporter 12 (MCT12), encoded by the cataract and glucosuria associated gene SLC16A12. A non-synonymous alteration in MCT12 (p.G407S) found in a patient with age-related cataract (ARC) leads to a significant reduction of creatine transport. Furthermore, Slc16a12 knockout (KO) rats have elevated creatine levels in urine. Transport activity and expression characteristics of the two creatine transporters are distinct. CRT2 (MCT12)-mediated uptake of creatine was not sensitive to sodium and chloride ions or creatine biosynthesis precursors, breakdown product creatinine or creatine phosphate. Increasing pH correlated with increased creatine uptake. Michaelis–Menten kinetics yielded a Vmax of 838.8 pmol/h/oocyte and a Km of 567.4 µm. Relative expression in various human tissues supports the distinct mutation-associated phenotypes of the two transporters. SLC6A8 was predominantly found in brain, heart and muscle, while SLC16A12 was more abundant in kidney and retina. In the lens, the two transcripts were found at comparable levels. We discuss the distinct, but possibly synergistic functions of the two creatine transporters. Our findings infer potential preventive power of creatine supplementation against the most prominent age-related vision impaired condition. PMID:23578822
Effect of plasma membrane fluidity on serotonin transport by endothelial cells
International Nuclear Information System (INIS)
Block, E.R.; Edwards, D.
1987-01-01
To evaluate the effect of plasma membrane fluidity of lung endothelial cells on serotonin transport, porcine pulmonary artery endothelial cells were incubated for 3 h with either 0.1 mM cholesterol hemisuccinate, 0.1 mM cis-vaccenic acid, or vehicle (control), after which plasma membrane fluidity and serotinin transport were measured. Fluorescence spectroscopy was used to measure fluidity in the plasma membrane. Serotonin uptake was calculated from the disappearance of [ 14 C]-serotonin from the culture medium. Cholesterol decreased fluidity in the subpolar head group and central and midacyl side-chain regions of the plasma membrane and decreased serotonin transport, whereas cis-vaccenic acid increased fluidity in the central and midacyl side-chain regions of the plasma membrane and also increased serotonin transport. Cis-vaccenic acid had no effect of fluidity in the subpolar head group region of the plasma membrane. These results provide evidence that the physical state of the central and midacyl chains within the pulmonary artery endothelial cell plasma membrane lipid bilayer modulates transmembrane transport of serotonin by these cells
LENUS (Irish Health Repository)
Bull, S J
2009-12-01
Depression and fatigue are frequent side effects of interferon-alpha (IFN-alpha) treatment, and there is compelling evidence that the inflammatory response system (including interleukin-6, IL-6) and the serotonergic system is important in the pathophysiology of such symptoms. Functional polymorphisms in the promoter region of the IL-6 gene (rs1800795) and serotonin transporter gene (5-HTTLPR) have been identified as regulating these systems. The present study aimed to determine if these polymorphisms were associated with the development of depression and fatigue during IFN-alpha and ribavirin treatment. Ninety-eight Caucasian patients receiving pegylated IFN-alpha and ribavirin treatment for chronic hepatitis C virus at King\\'s College Hospital, London, and Emory University Hospital, Atlanta, participated in this prospective cohort study. Symptoms of depression and fatigue were measured before treatment and at weeks 4, 8, 12 and 24 during treatment. The \\'low IL-6\\' synthesizing genotype (CC) was associated with significantly fewer symptoms of depression (effect size = 0.7 at week 24; F = 9.4, d.f. = 436, P = 0.002). The \\'high transcription\\' serotonin transporter (5-HTT) genotype (LL) was also associated with significantly fewer symptoms of depression, but with a much smaller effect (effect size = 0.2 at week 24; F = 4.5, d.f. = 436, P = 0.03). Neither polymorphisms were associated with symptoms of fatigue (IL-6: F = 1.2, d.f. = 430, P = 0.2; 5-HTT: F = 0.5, d.f. = 430, P = 0.5). The smaller effects of the 5-HTT polymorphism on depression may be explained by an interaction between the genes (F = 5.0, d.f. = 434, P = 0.02): the \\'protective\\' effect of the 5-HTTLPR polymorphism was evident only in the presence of the \\'low IL-6\\' genotype (F = 5.4, d.f. = 64, P = 0.02), not in the presence of the \\'high IL-6\\' genotype (F = 2.2, d.f. = 369, P = 0.1). The association between the IL-6 polymorphism and reduced risk of depressive symptoms confirms the role
Directory of Open Access Journals (Sweden)
Clifford Jacobs
2014-06-01
Full Text Available Human organic cation transporter 1 is primarily expressed in hepatocytes and mediates the electrogenic transport of various endogenous and exogenous compounds, including clinically important drugs. Genetic polymorphisms in the gene coding for human organic cation transporter 1, SLC22A1, are increasingly being recognized as a possible mechanism explaining the variable response to clinical drugs, which are substrates for this transporter. The genotypic and allelic distributions of 19 nonsynonymous and one intronic SLC22A1 single nucleotide polymorphisms were determined in 148 healthy Xhosa participants from South Africa, using a SNAPshot® multiplex assay. In addition, haplotype structure for SLC22A1 was inferred from the genotypic data. The minor allele frequencies for S14F (rs34447885, P341L (rs2282143, V519F (rs78899680, and the intronic variant rs622342 were 1.7%, 8.4%, 3.0%, and 21.6%, respectively. None of the participants carried the variant allele for R61C (rs12208357, C88R (rs55918055, S189L (rs34104736, G220V (rs36103319, P283L (rs4646277, R287G (rs4646278, G401S (rs34130495, M440I (rs35956182, or G465R (rs34059508. In addition, no variant alleles were observed for A306T (COSM164365, A413V (rs144322387, M420V (rs142448543, I421F (rs139512541, C436F (rs139512541, V501E (rs143175763, or I542V (rs137928512 in the population. Eight haplotypes were inferred from the genotypic data. This study reports important genetic data that could be useful for future pharmacogenetic studies of drug transporters in the indigenous Sub-Saharan African populations.
Unifying Concept of Serotonin Transporter-associated Currents*
Schicker, Klaus; Uzelac, Zeljko; Gesmonde, Joan; Bulling, Simon; Stockner, Thomas; Freissmuth, Michael; Boehm, Stefan; Rudnick, Gary; Sitte, Harald H.; Sandtner, Walter
2012-01-01
Serotonin (5-HT) uptake by the human serotonin transporter (hSERT) is driven by ion gradients. The stoichiometry of transported 5-HT and ions is predicted to result in electroneutral charge movement. However, hSERT mediates a current when challenged with 5-HT. This discrepancy can be accounted for by an uncoupled ion flux. Here, we investigated the mechanistic basis of the uncoupled currents and its relation to the conformational cycle of hSERT. Our observations support the conclusion that the conducting state underlying the uncoupled ion flux is in equilibrium with an inward facing state of the transporter with K+ bound. We identified conditions associated with accumulation of the transporter in inward facing conformations. Manipulations that increased the abundance of inward facing states resulted in enhanced steady-state currents. We present a comprehensive kinetic model of the transport cycle, which recapitulates salient features of the recorded currents. This study provides a framework for exploring transporter-associated currents. PMID:22072712
Unifying concept of serotonin transporter-associated currents.
Schicker, Klaus; Uzelac, Zeljko; Gesmonde, Joan; Bulling, Simon; Stockner, Thomas; Freissmuth, Michael; Boehm, Stefan; Rudnick, Gary; Sitte, Harald H; Sandtner, Walter
2012-01-02
Serotonin (5-HT) uptake by the human serotonin transporter (hSERT) is driven by ion gradients. The stoichiometry of transported 5-HT and ions is predicted to result in electroneutral charge movement. However, hSERT mediates a current when challenged with 5-HT. This discrepancy can be accounted for by an uncoupled ion flux. Here, we investigated the mechanistic basis of the uncoupled currents and its relation to the conformational cycle of hSERT. Our observations support the conclusion that the conducting state underlying the uncoupled ion flux is in equilibrium with an inward facing state of the transporter with K+ bound. We identified conditions associated with accumulation of the transporter in inward facing conformations. Manipulations that increased the abundance of inward facing states resulted in enhanced steady-state currents. We present a comprehensive kinetic model of the transport cycle, which recapitulates salient features of the recorded currents. This study provides a framework for exploring transporter-associated currents.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC436 (Link to dictyBase) - - - Contig-U16460-1 SLC436Z (Link... to Original site) - - SLC436Z 344 - - - - Show SLC436 Library SL (Link to library) Clone ID SLC436 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC436Q.Seq.d/ Representative seq. ID SLC43...6Z (Link to Original site) Representative DNA sequence >SLC436 (SLC436Q) /CSM/SL/SLC4-B/SLC436Q.Seq.d/ XXXXX.../CSM/SL/SLE2-C/SLE258Q.Seq.d/ 470 e-132 SLC773 (SLC773Q) /CSM/SL/SLC7-D/SLC773Q.Seq.d/ 470 e-132 SLC4
Directory of Open Access Journals (Sweden)
Mychaleckyj Josyf C
2005-12-01
Full Text Available Abstract Background GLUT10 (gene symbol SLC2A10 is a facilitative glucose transporter within the type 2 diabetes (T2DM-linked region on chromosome 20q12-13.1. Therefore, we evaluated GLUT10 as a positional candidate gene for T2DM in Caucasian Americans. Methods Twenty SNPs including 4 coding, 10 intronic and 6 5' and 3' to the coding sequence were genotyped across a 100 kb region containing the SLC2A10 gene in DNAs from 300 T2DM cases and 310 controls using the Sequenom MassArray Genotyping System. Allelic association was evaluated, and linkage disequilibrium (LD and haplotype structure of SLC2A10 were also determined to assess whether any specific haplotypes were associated with T2DM. Results Of these variants, fifteen had heterozygosities greater than 0.80 and were analyzed further for association with T2DM. No evidence of significant association was observed for any variant with T2DM (all P ≥ 0.05, including Ala206Thr (rs2235491 which was previously reported to be associated with fasting insulin. Linkage disequilibrium analysis suggests that the SLC2A10 gene is contained in a single haplotype block of 14 kb. Haplotype association analysis with T2DM did not reveal any significant differences between haplotype frequencies in T2DM cases and controls. Conclusion From our findings, we can conclude that sequence variants in or near GLUT10 are unlikely to contribute significantly to T2DM in Caucasian Americans.
Moderation of antidepressant response by the serotonin transporter gene
DEFF Research Database (Denmark)
Huezo-Diaz, Patricia; Uher, Rudolf; Smith, Rebecca
2009-01-01
Background: There have been conflicting reports on whether the length polymorphism in the promoter of the serotonin transporter gene (5-HTTLPR) moderates the antidepressant effects of selective serotonin reuptake inhibitors (SSRIs). We hypothesised that the pharmacogenetic effect of 5-HTTLPR...... the serotonin transporter gene were genotyped in 795 adults with moderate-to-severe depression treated with escitalopram or nortriptyline in the Genome Based Therapeutic Drugs for Depression (GENDEP) project. Results: The 5-HTTLPR moderated the response to escitalopram, with long-allele carriers improving more...
Inhibitors of GLUT/SLC2A Enhance the Action of BCNU and Temozolomide against High-Grade Gliomas
Directory of Open Access Journals (Sweden)
Alberto Azzalin
2017-04-01
Full Text Available Glucose transport across glioblastoma membranes plays a crucial role in maintaining the enhanced glycolysis typical of high-grade gliomas and glioblastoma. We tested the ability of two inhibitors of the glucose transporters GLUT/SLC2A superfamily, indinavir (IDV and ritonavir (RTV, and of one inhibitor of the Na/glucose antiporter type 2 (SGLT2/SLC5A2 superfamily, phlorizin (PHZ, in decreasing glucose consumption and cell proliferation of human and murine glioblastoma cells. We found in vitro that RTV, active on at least three different GLUT/SLC2A transporters, was more effective than IDV, a specific inhibitor of GLUT4/SLC2A4, both in decreasing glucose consumption and lactate production and in inhibiting growth of U87MG and Hu197 human glioblastoma cell lines and primary cultures of human glioblastoma. PHZ was inactive on the same cells. Similar results were obtained when cells were grown in adherence or as 3D multicellular tumor spheroids. RTV treatment but not IDV treatment induced AMP-activated protein kinase (AMPKα phosphorylation that paralleled the decrease in glycolytic activity and cell growth. IDV, but not RTV, induced an increase in GLUT1/SLC2A1 whose activity could compensate for the inhibition of GLUT4/SLC2A4 by IDV. RTV and IDV pass poorly the blood brain barrier and are unlikely to reach sufficient liquoral concentrations in vivo to inhibit glioblastoma growth as single agents. Isobologram analysis of the association of RTV or IDV and 1,3-bis(2-chloroethyl-1-nitrosourea (BCNU or 4-methyl-5-oxo-2,3,4,6,8-pentazabicyclo[4.3.0]nona-2,7,9-triene-9-carboxamide (TMZ indicated synergy only with RTV on inhibition of glioblastoma cells. Finally, we tested in vivo the combination of RTV and BCNU on established GL261 tumors. This drug combination increased the overall survival and allowed a five-fold reduction in the dose of BCNU.
DesRoches, Caro-Lyne; Patel, Jaina; Wang, Peixiang; Minassian, Berge; Salomons, Gajja S; Marshall, Christian R; Mercimek-Mahmutoglu, Saadet
2015-07-10
Creatine transporter deficiency (CRTR-D) is an X-linked inherited disorder of creatine transport. All males and about 50% of females have intellectual disability or cognitive dysfunction. Creatine deficiency on brain proton magnetic resonance spectroscopy and elevated urinary creatine to creatinine ratio are important biomarkers. Mutations in the SLC6A8 gene occur de novo in 30% of males. Despite reports of high prevalence of CRTR-D in males with intellectual disability, there are no true prevalence studies in the general population. To determine carrier frequency of CRTR-D in the general population we studied the variants in the SLC6A8 gene reported in the Exome Variant Server database and performed functional characterization of missense variants. We also analyzed synonymous and intronic variants for their predicted pathogenicity using in silico analysis tools. Nine missense variants were functionally analyzed using transient transfection by site-directed mutagenesis with In-Fusion HD Cloning in HeLa cells. Creatine uptake was measured by liquid chromatography tandem mass spectrometry for creatine measurement. The c.1654G>T (p.Val552Leu) variant showed low residual creatine uptake activity of 35% of wild type transfected HeLa cells and was classified as pathogenic. Three variants (c.808G>A; p.Val270Met, c.942C>G; p.Phe314Leu and c.952G>A; p.Ala318Thr) were predicted to be pathogenic based on in silico analysis, but proved to be non-pathogenic by our functional analysis. The estimated carrier frequency of CRTR-D was 0.024% in females in the general population. We recommend functional studies for all novel missense variants by transient transfection followed by creatine uptake measurement by liquid chromatography tandem mass spectrometry as fast and cost effective method for the functional analysis of missense variants in the SLC6A8 gene. Crown Copyright © 2015. Published by Elsevier B.V. All rights reserved.
Heinz, Andreas; Smolka, Michael N; Braus, Dieter F; Wrase, Jana; Beck, Anne; Flor, Herta; Mann, Karl; Schumann, Gunter; Büchel, Christian; Hariri, Ahmad R; Weinberger, Daniel R
2007-04-15
A polymorphism of the human serotonin transporter gene (SCL6A4) has been associated with serotonin transporter expression and with processing of aversive stimuli in the amygdala. Functional imaging studies show that during the presentation of aversive versus neutral cues, healthy carriers of the short (s) allele showed stronger amygdala activation than long (l) carriers. However, a recent report suggested that this interaction is driven by amygdala deactivation during presentation of neutral stimuli in s carriers. Functional MRI was used to assess amygdala activation during the presentation of a fixation cross or affectively aversive or neutral visual stimuli in 29 healthy men. Amygdala activation was increased in s carriers during undefined states such as the presentation of a fixation cross compared with emotionally neutral conditions. This finding suggests that s carriers show stronger amygdala reactivity to stimuli and contexts that are relatively uncertain, which we propose are stressful.
Miller, Jeffrey M; Hesselgrave, Natalie; Ogden, R Todd; Sullivan, Gregory M; Oquendo, Maria A; Mann, J John; Parsey, Ramin V
2013-08-15
Several lines of evidence implicate abnormal serotonergic function in suicidal behavior and completed suicide, including low serotonin transporter binding in postmortem studies of completed suicide. We have also reported low in vivo serotonin transporter binding in major depressive disorder (MDD) during a major depressive episode using positron emission tomography (PET) with [(11)C]McN5652. We quantified regional brain serotonin transporter binding in vivo in depressed suicide attempters, depressed nonattempters, and healthy controls using PET and a superior radiotracer, [(11)C]DASB. Fifty-one subjects with DSM-IV current MDD, 15 of whom were past suicide attempters, and 32 healthy control subjects underwent PET scanning with [(11)C]DASB to quantify in vivo regional brain serotonin transporter binding. Metabolite-corrected arterial input functions and plasma free-fraction were acquired to improve quantification. Depressed suicide attempters had lower serotonin transporter binding in midbrain compared with depressed nonattempters (p = .031) and control subjects (p = .0093). There was no difference in serotonin transporter binding comparing all depressed subjects with healthy control subjects considering six a priori regions of interest simultaneously (p = .41). Low midbrain serotonin transporter binding appears to be related to the pathophysiology of suicidal behavior rather than of major depressive disorder. This is consistent with postmortem work showing low midbrain serotonin transporter binding capacity in depressed suicides and may partially explain discrepant in vivo findings quantifying serotonin transporter in depression. Future studies should investigate midbrain serotonin transporter binding as a predictor of suicidal behavior in MDD and determine the cause of low binding. Copyright © 2013 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.
Molecular imaging of serotonin degeneration in mild cognitive impairment.
Smith, Gwenn S; Barrett, Frederick S; Joo, Jin Hui; Nassery, Najlla; Savonenko, Alena; Sodums, Devin J; Marano, Christopher M; Munro, Cynthia A; Brandt, Jason; Kraut, Michael A; Zhou, Yun; Wong, Dean F; Workman, Clifford I
2017-09-01
Neuropathological and neuroimaging studies have consistently demonstrated degeneration of monoamine systems, especially the serotonin system, in normal aging and Alzheimer's disease. The evidence for degeneration of the serotonin system in mild cognitive impairment is limited. Thus, the goal of the present study was to measure the serotonin transporter in vivo in mild cognitive impairment and healthy controls. The serotonin transporter is a selective marker of serotonin terminals and of the integrity of serotonin projections to cortical, subcortical and limbic regions and is found in high concentrations in the serotonergic cell bodies of origin of these projections (raphe nuclei). Twenty-eight participants with mild cognitive impairment (age 66.6±6.9, 16 males) and 28 healthy, cognitively normal, demographically matched controls (age 66.2±7.1, 15 males) underwent magnetic resonance imaging for measurement of grey matter volumes and high-resolution positron emission tomography with well-established radiotracers for the serotonin transporter and regional cerebral blood flow. Beta-amyloid imaging was performed to evaluate, in combination with the neuropsychological testing, the likelihood of subsequent cognitive decline in the participants with mild cognitive impairment. The following hypotheses were tested: 1) the serotonin transporter would be lower in mild cognitive impairment compared to controls in cortical and limbic regions, 2) in mild cognitive impairment relative to controls, the serotonin transporter would be lower to a greater extent and observed in a more widespread pattern than lower grey matter volumes or lower regional cerebral blood flow and 3) lower cortical and limbic serotonin transporters would be correlated with greater deficits in auditory-verbal and visual-spatial memory in mild cognitive impairment, not in controls. Reduced serotonin transporter availability was observed in mild cognitive impairment compared to controls in cortical and limbic
Yahata, Masahiro; Chiba, Koji; Watanabe, Takao; Sugiyama, Yuichi
2017-09-01
Accurate prediction of target occupancy facilitates central nervous system drug development. In this review, we discuss the predictability of serotonin transporter (SERT) occupancy in human brain estimated from in vitro K i values for human SERT and plasma concentrations of unbound drug (C u,plasma ), as well as the impact of drug transporters in the blood-brain barrier. First, the geometric means of in vitro K i values were compared with the means of in vivo K i values (K i,u,plasma ) which were calculated as C u,plasma values at 50% occupancy of SERT obtained from previous clinical positron emission tomography/single photon emission computed tomography imaging studies for 6 selective serotonin transporter reuptake inhibitors and 3 serotonin norepinephrine reuptake inhibitors. The in vitro K i values for 7 drugs were comparable to their in vivo K i,u,plasma values within 3-fold difference. SERT occupancy was overestimated for 5 drugs (P-glycoprotein substrates) and underestimated for 2 drugs (presumably uptake transporter substrates, although no evidence exists as yet). In conclusion, prediction of human SERT occupancy from in vitro K i values and C u,plasma was successful for drugs that are not transporter substrates and will become possible in future even for transporter substrates, once the transporter activities will be accurately estimated from in vitro experiments. Copyright © 2017 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.
The serotonin transporter in rhesus monkey brain: comparison of DASB and citalopram binding sites
International Nuclear Information System (INIS)
Zeng Zhizhen; Chen, T.-B.; Miller, Patricia J.; Dean, Dennis; Tang, Y.S.; Sur, Cyrille; Williams, David L.
2006-01-01
We have characterized the interaction of the serotonin transporter ligand [ 3 H]-N,N-dimethyl-2-(2-amino-4-cyanophenylthio)-benzylamine (DASB) with rhesus monkey brain in vitro using tissue homogenate binding and autoradiographic mapping. [ 3 H]-DASB, a tritiated version of the widely used [ 11 C] positron emission tomography tracer, was found to selectively bind to a single population of sites with high affinity (K d =0.20±0.04 nM). The serotonin transporter density (B max ) obtained for rhesus frontal cortex was found to be 66±8 fmol/mg protein using [ 3 H]-DASB, similar to the B max value obtained using the reference radioligand [ 3 H]-citalopram, a well-characterized and highly selective serotonin reuptake inhibitor (83±22 fmol/mg protein). Specific binding sites of both [ 3 H]-DASB and [ 3 H]-citalopram were similarly and nonuniformly distributed throughout the rhesus central nervous system, in a pattern consistent with serotonin transporter localization reported for human brain. Regional serotonin transporter densities, estimated from optical densities of the autoradiographic images, were well correlated between the two radioligands. Finally, DASB and fluoxetine showed dose-dependent full inhibition of [ 3 H]-citalopram binding in a competition autoradiographic study, with K i values in close agreement with those obtained from rhesus brain homogenates. This side-by-side comparison of [ 3 H]-DASB and [ 3 H]-citalopram binding sites in rhesus tissue homogenates and in adjacent rhesus brain slices provides additional support for the use of [ 11 C]-DASB to assess the availability and distribution of serotonin transporters in nonhuman primates
Thangaraju, Muthusamy; Karunakaran, Senthil K.; Itagaki, Shiro; Gopal, Elangovan; Elangovan, Selvakumar; Prasad, Puttur D.; Ganapathy, Vadivel
2009-01-01
Background 3-Bromopyruvate is an alkylating agent with antitumor activity. It is currently believed that blockade of ATP production from glycolysis and mitochondria is the primary mechanism responsible for this antitumor effect. The present studies have uncovered a new and novel mechanism for the antitumor activity of 3-bromopyruvate. Methods Transport of 3-bromopyruvate via SLC5A8, a tumor suppressor and a Na+-coupled electrogenic transporter for short-chain monocarboxylates, was studied using a mammalian cell expression and the Xenopus laevis oocyte expression systems. The effect of 3-bromopyruvate on histone deacetylases (HDACs) was monitored using the lysate of the human breast cancer cell line MCF7 and human recombinant HDAC isoforms as the enzyme sources. Cell viability was monitored by FACS analysis and colony formation assay. Acetylation status of histone H4 was evaluated by Western blot. Results 3-Bromopyruvate is a transportable substrate for SLC5A8, with the transport process being Na+-coupled and electrogenic. MCF7 cells do not express SLC5A8 and are not affected by 3-bromopyruvate. However, when transfected with SLC5A8 or treated with inhibitors of DNA methylation, these cells undergo apoptosis in the presence of 3-bromopyruvate. This cell death is associated with inhibition of HDAC1/HDAC3. Studies with different isoforms of human recombinant HDACs identify HDAC1 and HDAC3 as the targets for 3-bromopyruvate. Conclusions 3-Bromopyruvate is transported into cells actively via the tumor suppressor SLC5A8 and the process is energized by an electrochemical Na+ gradient. Ectopic expression of the transporter in MCF7 cells leads to apoptosis, and the mechanism involves inhibition of HDAC1/HDAC3. PMID:19637353
Directory of Open Access Journals (Sweden)
Karina Villalba
2016-01-01
Full Text Available HIV-infected individuals continue to experience neurocognitive deterioration despite virologically successful treatments. While the cause remains unclear, evidence suggests that HIV-associated neurocognitive disorders (HAND may be associated with neurobehavioral dysfunction. Genetic variants have been explored to identify risk markers to determine neuropathogenesis of neurocognitive deterioration. Memory deficits and executive dysfunction are highly prevalent among HIV-infected adults. These conditions can affect their quality of life and HIV risk-taking behaviors. Single nucleotide polymorphisms in the SLC6A4, TPH2, and GALM genes may affect the activity of serotonin and increase the risk of HAND. The present study explored the relationship between SLC6A4, TPH2, and GALM genes and neurocognitive impairment in HIV-infected alcohol abusers. A total of 267 individuals were genotyped for polymorphisms in SLC6A4 5-HTTLPR, TPH2 rs4570625, and GALM rs6741892. To assess neurocognitive functions, the Short Category and the Auditory Verbal Learning Tests were used. TPH2 SNP rs4570625 showed a significant association with executive function in African American males (odds ratio 4.8, 95% CI, 1.5–14.8; P=0.005. Similarly, GALM SNP rs6741892 showed an increased risk with African American males (odds ratio 2.4, 95% CI, 1.2–4.9; P=0.02. This study suggests that TPH2 rs4570625 and GALM rs6741892 polymorphisms may be risk factors for HAND.
The role of the serotonergic system in suicidal behavior
Sadkowski, Marta; Dennis, Brittany; Clayden, Robert C; ElSheikh, Wala; Rangarajan, Sumathy; DeJesus, Jane; Samaan, Zainab
2013-01-01
Serotonin is a widely investigated neurotransmitter in several psychopathologies, including suicidal behavior (SB); however, its role extends to several physiological functions involving the nervous system, as well as the gastrointestinal and cardiovascular systems. This review summarizes recent research into ten serotonergic genes related to SB. These genes – TPH1, TPH2, SLC6A4, SLC18A2, HTR1A, HTR1B, HTR2A, DDC, MAOA, and MAOB – encode proteins that are vital to serotonergic function: tryptophan hydroxylase; the serotonin transporter 5-HTT; the vesicular transporter VMAT2; the HTR1A, HTR1B, and HTR2A receptors; the L-amino acid decarboxylase; and the monoamine oxidases. This review employed a systematic search strategy and a narrative research methodology to disseminate the current literature investigating the link between SB and serotonin. PMID:24235834
Directory of Open Access Journals (Sweden)
Karen M Vernau
Full Text Available Alaskan Husky Encephalopathy (AHE has been previously proposed as a mitochondrial encephalopathy based on neuropathological similarities with human Leigh Syndrome (LS. We studied 11 Alaskan Husky dogs with AHE, but found no abnormalities in respiratory chain enzyme activities in muscle and liver, or mutations in mitochondrial or nuclear genes that cause LS in people. A genome wide association study was performed using eight of the affected dogs and 20 related but unaffected control AHs using the Illumina canine HD array. SLC19A3 was identified as a positional candidate gene. This gene controls the uptake of thiamine in the CNS via expression of the thiamine transporter protein THTR2. Dogs have two copies of this gene located within the candidate interval (SLC19A3.2 - 43.36-43.38 Mb and SLC19A3.1 - 43.411-43.419 Mb on chromosome 25. Expression analysis in a normal dog revealed that one of the paralogs, SLC19A3.1, was expressed in the brain and spinal cord while the other was not. Subsequent exon sequencing of SLC19A3.1 revealed a 4bp insertion and SNP in the second exon that is predicted to result in a functional protein truncation of 279 amino acids (c.624 insTTGC, c.625 C>A. All dogs with AHE were homozygous for this mutation, 15/41 healthy AH control dogs were heterozygous carriers while 26/41 normal healthy AH dogs were wild type. Furthermore, this mutation was not detected in another 187 dogs of different breeds. These results suggest that this mutation in SLC19A3.1, encoding a thiamine transporter protein, plays a critical role in the pathogenesis of AHE.
Thangaraju, Muthusamy; Karunakaran, Senthil K; Itagaki, Shiro; Gopal, Elangovan; Elangovan, Selvakumar; Prasad, Puttur D; Ganapathy, Vadivel
2009-10-15
3-bromopyruvate is an alkylating agent with antitumor activity. It is currently believed that blockade of adenosine triphosphate production from glycolysis and mitochondria is the primary mechanism responsible for this antitumor effect. The current studies uncovered a new and novel mechanism for the antitumor activity of 3-bromopyruvate. The transport of 3-bromopyruvate by sodium-coupled monocarboxylate transporter SMCT1 (SLC5A8), a tumor suppressor and a sodium (Na+)-coupled, electrogenic transporter for short-chain monocarboxylates, was studied using a mammalian cell expression and the Xenopus laevis oocyte expression systems. The effect of 3-bromopyruvate on histone deacetylases (HDACs) was monitored using the lysate of the human breast cancer cell line MCF7 and human recombinant HDAC isoforms as the enzyme sources. Cell viability was monitored by fluorescence-activated cell-sorting analysis and colony-formation assay. The acetylation status of histone H4 was evaluated by Western blot analysis. 3-Bromopyruvate is a transportable substrate for SLC5A8, and that transport process is Na+-coupled and electrogenic. MCF7 cells did not express SLC5A8 and were not affected by 3-bromopyruvate. However, when transfected with SLC5A8 or treated with inhibitors of DNA methylation, these cells underwent apoptosis in the presence of 3-bromopyruvate. This cell death was associated with the inhibition of HDAC1/HDAC3. Studies with different isoforms of human recombinant HDACs identified HDAC1 and HDAC3 as the targets for 3-bromopyruvate. 3-Bromopyruvate was transported into cells actively through the tumor suppressor SLC5A8, and the process was energized by an electrochemical Na+ gradient. Ectopic expression of the transporter in MCF7 cells led to apoptosis, and the mechanism involved the inhibition of HDAC1/HDAC3. Copyright (c) 2009 American Cancer Society.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC466 (Link to dictyBase) - - - Contig-U16381-1 SLC466Z (Link... to Original site) - - SLC466Z 427 - - - - Show SLC466 Library SL (Link to library) Clone ID SLC466 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC466Q.Seq.d/ Representative seq. ID SLC46...6Z (Link to Original site) Representative DNA sequence >SLC466 (SLC466Q) /CSM/SL/SLC4-C/SLC466Q.Seq.d/ XXXXX... AU034556 ) Dictyostelium discoideum slug cDNA, clone SLC466. 176 2e-77 2 ( AU033496 ) Dictyostelium discoid
Energy Technology Data Exchange (ETDEWEB)
Cosgrove, Kelly P., E-mail: kelly.cosgrove@yale.ed [Yale University School of Medicine, VA Connecticut HCS (116A6), West Haven, CT 06516 (United States); Staley, Julie K.; Baldwin, Ronald M.; Bois, Frederic [Yale University School of Medicine, VA Connecticut HCS (116A6), West Haven, CT 06516 (United States); Plisson, Christophe [Emory University School of Medicine, Atlanta, GA 30322 (United States); Al-Tikriti, Mohammed S. [Yale University School of Medicine, VA Connecticut HCS (116A6), West Haven, CT 06516 (United States); Seibyl, John P. [Institute for Neurodegenerative Disorders, New Haven, CT 06510 (United States); Goodman, Mark M. [Emory University School of Medicine, Atlanta, GA 30322 (United States); Tamagnan, Gilles D. [Yale University School of Medicine, VA Connecticut HCS (116A6), West Haven, CT 06516 (United States); Institute for Neurodegenerative Disorders, New Haven, CT 06510 (United States)
2010-07-15
Introduction: Serotonin dysfunction has been linked to a variety of psychiatric diseases; however, an adequate SPECT radioligand to probe the serotonin transporter system has not been successfully developed. The purpose of this study was to characterize and determine the in vivo selectivity of iodine-123-labeled 2{beta}-carbomethoxy-3{beta}-(4'-((Z)-2-iodoethenyl)phenyl)nortropane, [{sup 123}I]p ZIENT, in nonhuman primate brain. Methods: Two ovariohysterectomized female baboons participated in nine studies (one bolus and eight bolus to constant infusion at a ratio of 9.0 h) to evaluate [{sup 123}I]p ZIENT. To evaluate the selectivity of [{sup 123}I]p ZIENT, the serotonin transporter blockers fenfluramine (1.5, 2.5 mg/kg) and citalopram (5 mg/kg), the dopamine transporter blocker methylphenidate (0.5 mg/kg) and the norepinephrine transporter blocker nisoxetine (1 mg/kg) were given at 8 h post-radiotracer injection. Results: In the bolus to constant infusion studies, equilibrium was established by 4-8 h. [{sup 123}I]p ZIENT was 93% and 90% protein bound in the two baboons and there was no detection of lipophilic radiolabeled metabolites entering the brain. In the high-density serotonin transporter regions (diencephalon and brainstem), fenfluramine and citalopram resulted in 35-71% and 129-151% displacement, respectively, whereas methylphenidate and nisoxetine did not produce significant changes (<10%). Conclusion: These findings suggest that [{sup 123}I]p ZIENT is a favorable compound for in vivo SPECT imaging of serotonin transporters with negligible binding to norepinephrine and dopamine transporters.
Directory of Open Access Journals (Sweden)
Wu Bailin
2008-11-01
Full Text Available Abstract Background The molecular etiology of hearing impairment in Chinese has not been thoroughly investigated. Study of GJB2 gene revealed that 30.4% of the patients with hearing loss in Inner Mongolia carried GJB2 mutations. The SLC26A4 gene mutations and relevant phenotype are analyzed in this study. Methods One hundred and thirty-five deaf patients were included. The coding exons of SLC26A4 gene were sequence analyzed in 111 patients, not including 22 patients carrying bi-allelic GJB2 mutations or one patient carrying a known GJB2 dominant mutation as well as one patient with mtDNA 1555A>G mutation. All patients with SLC26A4 mutations or variants were subjected to high resolution temporal bone CT scan and those with confirmed enlarged vestibular aqueduct and/or other inner ear malformation were then given further ultrasound scan of thyroid and thyroid hormone assays. Results Twenty-six patients (19.26%, 26/135 were found carrying SLC26A4 mutation. Among them, 17 patients with bi-allelic SLC26A4 mutations were all confirmed to have EVA or other inner ear malformation by CT scan. Nine patients were heterozygous for one SLC26A4 mutation, including 3 confirmed to be EVA or EVA and Mondini dysplasia by CT scan. The most common mutation, IVS7-2A>G, accounted for 58.14% (25/43 of all SLC26A4 mutant alleles. The shape and function of thyroid were confirmed to be normal by thyroid ultrasound scan and thyroid hormone assays in 19 of the 20 patients with EVA or other inner ear malformation except one who had cystoid change in the right side of thyroid. No Pendred syndrome was diagnosed. Conclusion In Inner Mongolia, China, mutations in SLC26A4 gene account for about 12.6% (17/135 of the patients with hearing loss. Together with GJB2 (23/135, SLC26A4 are the two most commonly mutated genes causing deafness in this region. Pendred syndrome is not detected in this deaf population. We established a new strategy that detects SLC26A4 mutations prior to the
Dai, Pu; Yuan, Yongyi; Huang, Deliang; Zhu, Xiuhui; Yu, Fei; Kang, Dongyang; Yuan, Huijun; Wu, Bailin; Han, Dongyi; Wong, Lee-Jun C
2008-01-01
Background The molecular etiology of hearing impairment in Chinese has not been thoroughly investigated. Study of GJB2 gene revealed that 30.4% of the patients with hearing loss in Inner Mongolia carried GJB2 mutations. The SLC26A4 gene mutations and relevant phenotype are analyzed in this study. Methods One hundred and thirty-five deaf patients were included. The coding exons of SLC26A4 gene were sequence analyzed in 111 patients, not including 22 patients carrying bi-allelic GJB2 mutations or one patient carrying a known GJB2 dominant mutation as well as one patient with mtDNA 1555A>G mutation. All patients with SLC26A4 mutations or variants were subjected to high resolution temporal bone CT scan and those with confirmed enlarged vestibular aqueduct and/or other inner ear malformation were then given further ultrasound scan of thyroid and thyroid hormone assays. Results Twenty-six patients (19.26%, 26/135) were found carrying SLC26A4 mutation. Among them, 17 patients with bi-allelic SLC26A4 mutations were all confirmed to have EVA or other inner ear malformation by CT scan. Nine patients were heterozygous for one SLC26A4 mutation, including 3 confirmed to be EVA or EVA and Mondini dysplasia by CT scan. The most common mutation, IVS7-2A>G, accounted for 58.14% (25/43) of all SLC26A4 mutant alleles. The shape and function of thyroid were confirmed to be normal by thyroid ultrasound scan and thyroid hormone assays in 19 of the 20 patients with EVA or other inner ear malformation except one who had cystoid change in the right side of thyroid. No Pendred syndrome was diagnosed. Conclusion In Inner Mongolia, China, mutations in SLC26A4 gene account for about 12.6% (17/135) of the patients with hearing loss. Together with GJB2 (23/135), SLC26A4 are the two most commonly mutated genes causing deafness in this region. Pendred syndrome is not detected in this deaf population. We established a new strategy that detects SLC26A4 mutations prior to the temporal bone CT scan to
Energy Technology Data Exchange (ETDEWEB)
Oya, Shunichi [Department of Radiology, University of Pennsylvania, Philadelphia, PA 19104 (United States); Choi, Seok-Rye [Department of Radiology, University of Pennsylvania, Philadelphia, PA 19104 (United States); Kung, Mei-Ping [Department of Radiology, University of Pennsylvania, Philadelphia, PA 19104 (United States); Kung, Hank F. [Department of Radiology, University of Pennsylvania, Philadelphia, PA 19104 (United States); Department of Pharmacology, University of Pennsylvania, Philadelphia, PA 19104 (United States)
2007-02-15
Two novel ligands with 4' substitution on the Phenyl Ring B of biphenylthiol, 5-chloro-2-(2'-((dimethylamino)methyl)-4'-iodophenylthio)benzenamine (7) and 2-(2'-((dimethylamino)methyl)-4'-methoxyphenylthio)-5-iodobenzenamine (8), were prepared and tested as potential serotonin transporter (SERT) imaging agents. The new ligands displayed extremely high binding affinities to SERT (K {sub i}=0.22{+-}0.09 and 0.11{+-}0.04 nM, respectively), with very low binding affinities to dopamine and norepinephrine transporters (K {sub i}>1000 nM). The corresponding [{sup 125}I]7 and [{sup 125}I]8 were successfully prepared from tri-n-butyltin derivatives. They showed good brain uptakes and prolonged retention after intravenous injection in rats (brain uptake was 1.77% and 0.98% dose/g for [{sup 125}I]7, and 0.92% and 0.29% dose/g for [{sup 125}I]8, at 2 and 120 min, respectively). Significantly, [{sup 125}I]7 showed excellent uptake and prolonged retention in the hypothalamus, where SERT concentration was highest. The hypothalamus/cerebellum (HY/CB) ratios (target/background ratios) were 4.24, 7.10, 8.24 and 12.6 at 2, 4, 6 and 12 h, respectively. The HY/CB ratios for [{sup 125}I]8 were 3.97, 5.57 and 5.06 at 1, 2 and 4 h, respectively. Adding the 4'-iodo group to the Phenyl Ring B of Compound (7) appeared to reduce the rate of clearance from the brain, and kinetics favored uptake and retention in the hypothalamus. The localization of [{sup 125}I]7 in the hypothalamus region in the rat brain could be blocked by pretreatment with (+)McN5652, escitalopram and ADAM (2), which are all selective SERT ligands (at 2 mg/kg iv, 5 min pretreatment). Ex vivo autoradiograms of rat brain sections (at 4 h after intravenous injection of [{sup 125}I]7) showed intense labeling in regions of the brain known to have high SERT density. The excellent selective uptake and retention in the hypothalamus region suggest that [{sup 123}I]7 is a potential lead compound for
The serotonin transporter in rhesus monkey brain: comparison of DASB and citalopram binding sites
Energy Technology Data Exchange (ETDEWEB)
Zeng Zhizhen [Imaging Department, Merck Research Laboratories, West Point, PA 19486 (United States)]. E-mail: zhizhen_zeng@merck.com; Chen, T.-B. [Imaging Department, Merck Research Laboratories, West Point, PA 19486 (United States); Miller, Patricia J. [Imaging Department, Merck Research Laboratories, West Point, PA 19486 (United States); Dean, Dennis [Labeled Compound Synthesis Group, Drug Metabolism, Merck Research Laboratories, Rahway, NJ 07065-0900 (United States); Tang, Y.S. [Labeled Compound Synthesis Group, Drug Metabolism, Merck Research Laboratories, Rahway, NJ 07065-0900 (United States); Sur, Cyrille [Imaging Department, Merck Research Laboratories, West Point, PA 19486 (United States); Williams, David L. [Imaging Department, Merck Research Laboratories, West Point, PA 19486 (United States)
2006-05-15
We have characterized the interaction of the serotonin transporter ligand [{sup 3}H]-N,N-dimethyl-2-(2-amino-4-cyanophenylthio)-benzylamine (DASB) with rhesus monkey brain in vitro using tissue homogenate binding and autoradiographic mapping. [{sup 3}H]-DASB, a tritiated version of the widely used [{sup 11}C] positron emission tomography tracer, was found to selectively bind to a single population of sites with high affinity (K {sub d}=0.20{+-}0.04 nM). The serotonin transporter density (B {sub max}) obtained for rhesus frontal cortex was found to be 66{+-}8 fmol/mg protein using [{sup 3}H]-DASB, similar to the B {sub max} value obtained using the reference radioligand [{sup 3}H]-citalopram, a well-characterized and highly selective serotonin reuptake inhibitor (83{+-}22 fmol/mg protein). Specific binding sites of both [{sup 3}H]-DASB and [{sup 3}H]-citalopram were similarly and nonuniformly distributed throughout the rhesus central nervous system, in a pattern consistent with serotonin transporter localization reported for human brain. Regional serotonin transporter densities, estimated from optical densities of the autoradiographic images, were well correlated between the two radioligands. Finally, DASB and fluoxetine showed dose-dependent full inhibition of [{sup 3}H]-citalopram binding in a competition autoradiographic study, with K {sub i} values in close agreement with those obtained from rhesus brain homogenates. This side-by-side comparison of [{sup 3}H]-DASB and [{sup 3}H]-citalopram binding sites in rhesus tissue homogenates and in adjacent rhesus brain slices provides additional support for the use of [{sup 11}C]-DASB to assess the availability and distribution of serotonin transporters in nonhuman primates.
Hearing loss associated with enlarged vestibular aqueduct and zero or one mutant allele of SLC26A4.
Rose, Jane; Muskett, Julie A; King, Kelly A; Zalewski, Christopher K; Chattaraj, Parna; Butman, John A; Kenna, Margaret A; Chien, Wade W; Brewer, Carmen C; Griffith, Andrew J
2017-07-01
To characterize the severity and natural history of hearing loss, and the prevalence of having a cochlear implant in a maturing cohort of individuals with enlarged vestibular aqueduct (EVA) and zero or one mutant allele of SLC26A4. Prospective cohort study of subjects ascertained between 1998 and 2015 at the National Institutes of Health Clinical Center. Study subjects were 127 individuals (median age, 8 years; range, 0-59 years) with EVA in at least one ear. Ears with EVA and zero or one mutant allele of SLC26A4 had mean 0.5/1/2/4-kHz pure-tone averages of 62.6 and 52.9 dB HL, respectively, in contrast to EVA ears with two mutant alleles of SLC26A4 (88.1 dB HL; P zero, one, and two mutant alleles, respectively (P = .00833). This association was not independent (P = .534) but reflected underlying correlations with age at time of first audiogram (P = .003) or severity of hearing loss (P = .000). Ears with EVA and zero or one mutant allele of SLC26A4 have less severe hearing loss, no difference in prevalence of fluctuation, and a lower prevalence of cochlear implantation in comparison to ears with two mutant alleles of SLC26A4. NA Laryngoscope, 127:E238-E243, 2017. © 2016 The American Laryngological, Rhinological and Otological Society, Inc.
Associations between genetic risk, functional brain network organization and neuroticism
Servaas, Michelle N.; Geerligs, Linda; Bastiaansen, Jojanneke A.; Renken, Remco J.; Marsman, Jan-Bernard C.; Nolte, Ilja M.; Ormel, Johan; Aleman, Andre; Riese, Harriette
2017-01-01
Neuroticism and genetic variation in the serotonin-transporter (SLC6A4) and catechol-O-methyltransferase (COMT) gene are risk factors for psychopathology. Alterations in the functional integration and segregation of neural circuits have recently been found in individuals scoring higher on
Tu, Hung-Pin; Chung, Chia-Min; Min-Shan Ko, Albert; Lee, Su-Shin; Lai, Han-Ming; Lee, Chien-Hung; Huang, Chung-Ming; Liu, Chiu-Shong; Ko, Ying-Chin
2016-09-01
The aim of the present study was to evaluate the contribution of urate transporter genes and alcohol use to the risk of gout/tophi. Eight variants of ABCG2, SLC2A9, SLC22A12, SLC22A11 and SLC17A3 were genotyped in male individuals in a case-control study with 157 gout (33% tophi), 106 asymptomatic hyperuricaemia and 295 control subjects from Taiwan. The multilocus profiles of the genetic risk scores for urate gene variants were used to evaluate the risk of asymptomatic hyperuricaemia, gout and tophi. ABCG2 Q141K (T), SLC2A9 rs1014290 (A) and SLC22A12 rs475688 (C) under an additive model and alcohol use independently predicted the risk of gout (respective odds ratio for each factor=2.48, 2.03, 1.95 and 2.48). The additive composite Q141K, rs1014290 and rs475688 scores of high-risk alleles were associated with gout risk (Pgout and tophi risk (P for interaction=0.0452, 0.0033). The synergistic effect of genetic urate score 5-6 and alcohol use indicates that these combined factors correlate with gout and tophi occurrence.
Baumann, Michael H; Bulling, Simon; Benaderet, Tova S; Saha, Kusumika; Ayestas, Mario A; Partilla, John S; Ali, Syed F; Stockner, Thomas; Rothman, Richard B; Sandtner, Walter; Sitte, Harald H
2014-05-01
Serotonin (5-HT) transporter (SERT) substrates like fenfluramine and 3,4-methylenedioxymethamphetamine cause long-term depletion of brain 5-HT, while certain other substrates do not. The 5-HT deficits produced by SERT substrates are dependent upon transporter proteins, but the exact mechanisms responsible are unclear. Here, we compared the pharmacology of several SERT substrates: fenfluramine, d-fenfluramine, 1-(m-chlorophenyl)piperazine (mCPP) and 1-(m-trifluoromethylphenyl)piperainze (TFMPP), to establish relationships between acute drug mechanisms and the propensity for long-term 5-HT depletions. In vivo microdialysis was carried out in rat nucleus accumbens to examine acute 5-HT release and long-term depletion in the same subjects. In vitro assays were performed to measure efflux of [(3)H]5-HT in rat brain synaptosomes and transporter-mediated ionic currents in SERT-expressing Xenopus oocytes. When administered repeatedly to rats (6 mg/kg, i.p., four doses), all drugs produce large sustained elevations in extracellular 5-HT (>5-fold) with minimal effects on dopamine. Importantly, 2 weeks after dosing, only rats exposed to fenfluramine and d-fenfluramine display depletion of brain 5-HT. All test drugs evoke fluoxetine-sensitive efflux of [(3)H]5-HT from synaptosomes, but d-fenfluramine and its bioactive metabolite d-norfenfluramine induce significantly greater SERT-mediated currents than phenylpiperazines. Our data confirm that drug-induced 5-HT release probably does not mediate 5-HT depletion. However, the magnitude of transporter-mediated inward current may be a critical factor in the cascade of events leading to 5-HT deficits. This hypothesis warrants further study, especially given the growing popularity of designer drugs that target SERT.
Nakhoul, Nazih L.; Hamm, L. Lee
2012-01-01
The mammalian Rh glycoproteins belong to the solute transporter family SLC42 and include RhAG, present in red blood cells, and two non-erythroid members RhBG and RhCG that are expressed in various tissues, including kidney, liver, skin and the GI tract. The Rh proteins in the red blood cell form an “Rh complex” made up of one D-subunit, one CE-subunit and two RhAG subunits. The Rh complex has a well-known antigenic effect but also contributes to the stability of the red cell membrane. RhBG and RhCG are related to the NH4+ transporters of the yeast and bacteria but their exact function is yet to be determined. This review describes the expression and molecular properties of these membrane proteins and their potential role as NH3/NH4+ and CO2 transporters. The likelihood that these proteins transport gases such as CO2 or NH3 is novel and significant. The review also describes the physiological importance of these proteins and their relevance to human disease. PMID:23506896
Rannversson, Hafsteinn; Wilson, Pamela; Kristensen, Kristina Birch; Sinning, Steffen; Kristensen, Anders Skov; Strømgaard, Kristian; Andersen, Jacob
2015-01-01
The serotonin transporter (SERT) terminates serotonergic neurotransmission by performing reuptake of released serotonin, and SERT is the primary target for antidepressants. SERT mediates the reuptake of serotonin through an alternating access mechanism, implying that a central substrate site is connected to both sides of the membrane by permeation pathways, of which only one is accessible at a time. The coordinated conformational changes in SERT associated with substrate translocation are not fully understood. Here, we have identified a Leu to Glu mutation at position 406 (L406E) in the extracellular loop 4 (EL4) of human SERT, which induced a remarkable gain-of-potency (up to >40-fold) for a range of SERT inhibitors. The effects were highly specific for L406E relative to six other mutations in the same position, including the closely related L406D mutation, showing that the effects induced by L406E are not simply charge-related effects. Leu406 is located >10 Å from the central inhibitor binding site indicating that the mutation affects inhibitor binding in an indirect manner. We found that L406E decreased accessibility to a residue in the cytoplasmic pathway. The shift in equilibrium to favor a more outward-facing conformation of SERT can explain the reduced turnover rate and increased association rate of inhibitor binding we found for L406E. Together, our findings show that EL4 allosterically can modulate inhibitor binding within the central binding site, and substantiates that EL4 has an important role in controlling the conformational equilibrium of human SERT. PMID:25903124
Udhayabanu, Tamilarasan; Subramanian, Veedamali S; Teafatiller, Trevor; Gowda, Vykuntaraju K; Raghavan, Varun S; Varalakshmi, Perumal; Said, Hamid M; Ashokkumar, Balasubramaniem
2016-11-01
Brown-Vialetto-Van Laere Syndrome (BVVLS), a rare neurological disorder characterized by bulbar palsies and sensorineural deafness, is mainly associated with defective riboflavin transporters encoded by the SLC52A2 and SLC52A3 genes. Here we present a 16-year-old BVVLS patient belonging to a five generation consanguineous family from Indian ethnicity with two homozygous missense mutations viz., c.421C>A [p.P141T] in SLC52A2 and c.62A>G [p.N21S] in SLC52A3. Functional characterization based on 3 H-riboflavin uptake assay and live-cell confocal imaging revealed that the effect of mutation c.421C>A [p.P141T] identified in SLC52A2 had a slight reduction in riboflavin uptake; on the other hand, the c.62A>G [p.N21S] identified in SLC52A3 showed a drastic reduction in riboflavin uptake, which appeared to be due to impaired trafficking and membrane targeting of the hRFVT-3 protein. This is the first report presenting mutations in both riboflavin transporters hRFVT-2 and hRFVT-3 in the same BVVLS patient. Also, c.62A>G [p.N21S] in SLC52A3 appears to contribute more to the disease phenotype in this patient than c.421C>A [p.P141T] in SLC52A2. Copyright © 2016 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Booij, J.; Knol, R.J.J.; Reneman, L.; De Bruin, K.; Van Royen, E.A.; Janssen, A.G.M.
1998-01-01
Iodine-123 labelled 2β-carbomethoxy-3β-(4-iodophenyl)nortropane (nor-β-CIT), a radioiodinated cocaine analogue, was evaluated as an agent for the in vivo labelling of serotonin transporters by biodistribution studies in rats. Intravenous injection of [ 123 I]nor-β-CIT resulted in high accumulation of radioactivity in brain areas with high densities of serotonin (hypothalamus) and dopamine transporters (striatum), although the binding was less pronounced in the hypothalamus. While binding of [ 123 I]nor-β-CIT in the hypothalamus was blocked significantly by fluvoxamine (a selective serotonin transporter blocker) but not by GBR12,909 (a selective dopamine transporter blocker), the opposite was observed in the striatum. The results of this study indicate that [ 123 I]nor-β-CIT, although not being a selective radioligand, binds specifically to serotonin transporters in the hypothalamus in vivo and thus suggest that [ 123 I]nor-β-CIT promises to be a suitable radioligand for single-photon emission tomography imaging of serotonin transporters in humans. (orig.)
Brons, A-K; Henthorn, P S; Raj, K; Fitzgerald, C A; Liu, J; Sewell, A C; Giger, U
2013-01-01
Cystinuria, one of the first recognized inborn errors of metabolism, has been reported in many dog breeds. To determine urinary cystine concentrations, inheritance, and mutations in the SLC3A1 and SLC7A9 genes associated with cystinuria in 3 breeds. Mixed and purebred Labrador Retrievers (n = 6), Australian Cattle Dogs (6), Miniature Pinschers (4), and 1 mixed breed dog with cystine urolithiasis, relatives and control dogs. Urinary cystinuria and aminoaciduria was assessed and exons of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA. In each breed, male and female dogs, independent of neuter status, were found to form calculi. A frameshift mutation in SLC3A1 (c.350delG) resulting in a premature stop codon was identified in autosomal-recessive (AR) cystinuria in Labrador Retrievers and mixed breed dogs. A 6 bp deletion (c.1095_1100del) removing 2 threonines in SLC3A1 was found in autosomal-dominant (AD) cystinuria with a more severe phenotype in homozygous than in heterozygous Australian Cattle Dogs. A missense mutation in SLC7A9 (c.964G>A) was discovered in AD cystinuria in Miniature Pinschers with only heterozygous affected dogs observed to date. Breed-specific DNA tests were developed, but the prevalence of each mutation remains unknown. These studies describe the first AD inheritance and the first putative SLC7A9 mutation to cause cystinuria in dogs and expand our understanding of this phenotypically and genetically heterogeneous disease, leading to a new classification system for canine cystinuria and better therapeutic management and genetic control in these breeds. Copyright © 2013 by the American College of Veterinary Internal Medicine.
Serotonin 6 receptor controls Alzheimer's disease and depression.
Yun, Hyung-Mun; Park, Kyung-Ran; Kim, Eun-Cheol; Kim, Sanghyeon; Hong, Jin Tae
2015-09-29
Alzheimer's disease (AD) and depression in late life are one of the most severe health problems in the world disorders. Serotonin 6 receptor (5-HT6R) has caused much interest for potential roles in AD and depression. However, a causative role of perturbed 5-HT6R function between two diseases was poorly defined. In the present study, we found that a 5-HT6R antagonist, SB271036 rescued memory impairment by attenuating the generation of Aβ via the inhibition of γ-secretase activity and the inactivation of astrocytes and microglia in the AD mouse model. It was found that the reduction of serotonin level was significantly recovered by SB271036, which was mediated by an indirect regulation of serotonergic neurons via GABA. Selective serotonin reuptake inhibitor (SSRI), fluoxetine significantly improved cognitive impairment and behavioral changes. In human brain of depression patients, we then identified the potential genes, amyloid beta (A4) precursor protein-binding, family A, member 2 (APBA2), well known AD modulators by integrating datasets from neuropathology, microarray, and RNA seq. studies with correlation analysis tools. And also, it was demonstrated in mouse models and patients of AD. These data indicate functional network of 5-HT6R between AD and depression.
Chen, Kaitian; Wang, Xianren; Sun, Liang; Jiang, Hongyan
2012-06-01
Bilateral nonsyndromic sensorineural hearing loss associated with inner ear malformation is closely related to genetics. SLC26A4 is considered to be the major involved gene. Recently, FOXI1 and KCNJ10 mutations have been linked to enlarged vestibular aqueducts and GJB2 mutations linked to temporal bone malformation. The authors aimed to investigate the mutation spectrums of these genes in Chinese patients with bilateral hearing impairment associated with inner ear malformation. Cross-sectional study. Affiliated hospital of the university. The authors analyzed the GJB2, SLC26A4, FOXI1, and KCNJ10 gene sequences in 43 patients presenting with bilateral hearing impairment associated with inner ear malformation using pyrosequencing and direct DNA sequencing. In total, 74.4% (32/43) of patients carried at least 1 of 14 pathogenic SLC26A4 mutations, including 6 novel mutations and 4 polymorphisms. Patients with enlarged vestibular aqueducts had a higher rate of SLC26A4 mutation than Mondini dysplasia patients. No FOXI1 or KCNJ10 potential pathogenic mutation was present, and GJB2 biallelic pathogenic mutations were uncommon (2.3%; 1/43). No significant correlation was observed between the genotype and phenotype of SLC26A4 mutations. SLC26A4 accounts for 74.4% of inner ear malformations in our cohort, whereas FOXI1, KCNJ10, and GJB2 mutations are not common. Other possible genes or external factors may contribute to this multibranch abnormality.
Directory of Open Access Journals (Sweden)
Ran eYe
2016-01-01
Full Text Available The neurotransmitter serotonin (5-hydroxytryptamine, 5-HT modulates many key brain functions including those subserving sensation, emotion, reward and cognition. Efficient clearance of 5-HT after release is achieved by the antidepressant-sensitive 5-HT transporter (SERT, SLC6A4. To identify novel SERT regulators, we pursued a proteomic analysis of mouse midbrain SERT complexes, evaluating findings in the context of prior studies that established a SERT-linked transcriptome. Remarkably, both efforts converged on a relationship of SERT with the synaptic adhesion protein neuroligin 2 (NLGN2, a postsynaptic partner for presynaptic neurexins, and a protein well known to organize inhibitory GABAergic synapses. Western blots of midbrain reciprocal immunoprecipitations confirmed SERT/NLGN2 associations, and also extended to other NLGN2 associated proteins (e.g. -neurexin (NRXN, gephyrin. Midbrain SERT/NLGN2 interactions were found to be Ca2+-independent, supporting cis versus trans-synaptic interactions, and were absent in hippocampal preparations, consistent with interactions arising in somatodendritic compartments. Dual color in situ hybridization confirmed co-expression of Tph2 and Nlgn2 mRNA in the dorsal raphe, with immunocytochemical studies confirming SERT:NLGN2 co-localization in raphe cell bodies but not axons. Consistent with correlative mRNA expression studies, loss of NLGN2 expression in Nlgn2 null mice produced significant reductions in midbrain and hippocampal SERT expression and function. Additionally, dorsal raphe 5-HT neurons from Nlgn2 null mice exhibit reduced excitability, a loss of GABAA receptor-mediated IPSCs, and increased 5-HT1A autoreceptor sensitivity. Finally, Nlgn2 null mice display significant changes in behaviors known to be responsive to SERT and/or 5-HT receptor manipulations. We discuss our findings in relation to the possible coordination of intrinsic and extrinsic regulation afforded by somatodendritic SERT:NLGN2
The role of the serotonergic system in suicidal behavior
Directory of Open Access Journals (Sweden)
Sadkowski M
2013-11-01
Full Text Available Marta Sadkowski,1,* Brittany Dennis,2–4,* Robert C Clayden,2 Wala ElSheikh,5 Sumathy Rangarajan,5 Jane DeJesus,5 Zainab Samaan3–6 1Arts and Sciences Program, 2Faculty of Health Sciences, 3Department of Clinical Epidemiology and Biostatistics, 4Population Genomics Program, McMaster University, Hamilton, ON, Canada; 5Population Health Research Institute, Hamilton, ON, Canada; 6Department of Psychiatry and Behavioral Neurosciences, McMaster University, Hamilton, ON, Canada *These authors contributed equally to this work Abstract: Serotonin is a widely investigated neurotransmitter in several psychopathologies, including suicidal behavior (SB; however, its role extends to several physiological functions involving the nervous system, as well as the gastrointestinal and cardiovascular systems. This review summarizes recent research into ten serotonergic genes related to SB. These genes – TPH1, TPH2, SLC6A4, SLC18A2, HTR1A, HTR1B, HTR2A, DDC, MAOA, and MAOB – encode proteins that are vital to serotonergic function: tryptophan hydroxylase; the serotonin transporter 5-HTT; the vesicular transporter VMAT2; the HTR1A, HTR1B, and HTR2A receptors; the L-amino acid decarboxylase; and the monoamine oxidases. This review employed a systematic search strategy and a narrative research methodology to disseminate the current literature investigating the link between SB and serotonin. Keywords: serotonin, suicide, genetic
DEFF Research Database (Denmark)
Tuominen, Lauri; Miettunen, Jouko; Cannon, Dara M
2017-01-01
scores from 91 healthy males and 56 healthy females. We specifically tested if the association between neuroticism and serotonin transporter is different in females and males. Results: We found that neuroticism and thalamic serotonin transporter binding potentials were associated in both males......). Conclusions: The finding is in agreement with recent studies showing that the serotonergic system is involved in affective disorders differently in males and females and suggests that contribution of thalamic serotonin transporter to the risk of affective disorders depends on sex....... and females, but with opposite directionality. Higher neuroticism associated with higher serotonin transporter binding potential in males (standardized beta 0.292, P=.008), whereas in females, higher neuroticism associated with lower serotonin transporter binding potential (standardized beta -0.288, P=.014...
Common Genetic Variation and Haplotypes of the Anion Exchanger SLC4A2 in Primary Biliary Cirrhosis
Juran, Brian D.; Atkinson, Elizabeth J.; Larson, Joseph J.; Schlicht, Erik M.; Lazaridis, Konstantinos N.
2010-01-01
Objectives Deficiencies of the anion exchanger SLC4A2 are thought to play a pathogenic role in primary biliary cirrhosis (PBC), evidenced by decreased expression and activity in PBC patients and development of disease features in SLC4A2 knockout mice. We hypothesized that genetic variation in SLC4A2 might influence this pathogenic contribution. Thus, we aimed to perform a comprehensive assessment of SLC4A2 genetic variation in PBC using a linkage disequilibrium (LD)-based haplotype-tagging approach. Methods Twelve single nucleotide polymorphisms (SNPs) across SLC4A2 were genotyped in 409 PBC patients and 300 controls and evaluated for association with disease, as well as with prior orthotopic liver transplant and antimitochondrial antibody (AMA) status among the PBC patients, both individually and as inferred haplotypes, using logistic regression. Results All SNPs were in Hardy–Weinberg equilibrium. No associations with disease or liver transplantation were detected, but two variants, rs2303929 and rs3793336, were associated with negativity for antimitochondrial antibodies among the PBC patients. Conclusions The common genetic variation of SLC4A2 does not directly affect the risk of PBC or its clinical outcome. Whether the deficiency of SLC4A2 expression and activity observed earlier in PBC patients is an acquired epiphenomenon of underlying disease or is because of heritable factors in unappreciated regulatory regions remains uncertain. Of note, two SLC4A2 variants appear to influence AMA status among PBC patients. The mechanisms behind this finding are unclear. PMID:19491853
Directory of Open Access Journals (Sweden)
Geeta A Thakur
Full Text Available Despite strong pharmacological evidence implicating the norepinephrine transporter in ADHD, genetic studies have yielded largely insignificant results. We tested the association between 30 tag SNPs within the SLC6A2 gene and ADHD, with stratification based on maternal smoking during pregnancy, an environmental factor strongly associated with ADHD.Children (6-12 years old diagnosed with ADHD according to DSM-IV criteria were comprehensively evaluated with regard to several behavioral and cognitive dimensions of ADHD as well as response to a fixed dose of methylphenidate (MPH using a double-blind placebo controlled crossover trial. Family-based association tests (FBAT, including categorical and quantitative trait analyses, were conducted in 377 nuclear families.A highly significant association was observed with rs36021 (and linked SNPs in the group where mothers smoked during pregnancy. Association was noted with categorical DSM-IV ADHD diagnosis (Z=3.74, P=0.0002, behavioral assessments by parents (CBCL, P=0.00008, as well as restless-impulsive subscale scores on Conners'-teachers (P=0.006 and parents (P=0.006. In this subgroup, significant association was also observed with cognitive deficits, more specifically sustained attention, spatial working memory, planning, and response inhibition. The risk allele was associated with significant improvement of behavior as measured by research staff (Z=3.28, P=0.001, parents (Z=2.62, P=0.009, as well as evaluation in the simulated academic environment (Z=3.58, P=0.0003.By using maternal smoking during pregnancy to index a putatively more homogeneous group of ADHD, highly significant associations were observed between tag SNPs within SLC6A2 and ADHD diagnosis, behavioral and cognitive measures relevant to ADHD and response to MPH. This comprehensive phenotype/genotype analysis may help to further understand this complex disorder and improve its treatment. Clinical trial registration information - Clinical
Zagórska, Agnieszka; Czopek, Anna; Pawłowski, Maciej; Dybała, Małgorzata; Siwek, Agata; Nowak, Gabriel
2012-11-01
Affinities of arylpiperazinylalkyl derivatives of imidazo[2,1-f]purine-2,4-dione and imidazolidine-2,4-dione for serotonin transporter and their acid-base properties were evaluated. The dissociation constant (pK(a)) of compounds 1-22 were determinated by potentiometric titration and calculated using pKalc 3.1 module of the Pallas system. The data from experimental methods and computational calculations were compared and suitable conclusions were reached.
Mayer, Felix P; Burchardt, Nadine V; Decker, Ann M; Partilla, John S; Li, Yang; McLaughlin, Gavin; Kavanagh, Pierce V; Sandtner, Walter; Blough, Bruce E; Brandt, Simon D; Baumann, Michael H; Sitte, Harald H
2018-05-15
A variety of new psychoactive substances (NPS) are appearing in recreational drug markets worldwide. NPS are compounds that target various receptors and transporters in the central nervous system to achieve their psychoactive effects. Chemical modifications of existing drugs can generate NPS that are not controlled by current legislation, thereby providing legal alternatives to controlled substances such as cocaine or amphetamine. Recently, 3-fluorophenmetrazine (3-FPM), a derivative of the anorectic compound phenmetrazine, appeared on the recreational drug market and adverse clinical effects have been reported. Phenmetrazine is known to elevate extracellular monoamine concentrations by an amphetamine-like mechanism. Here we tested 3-FPM and its positional isomers, 2-FPM and 4-FPM, for their abilities to interact with plasma membrane monoamine transporters for dopamine (DAT), norepinephrine (NET) and serotonin (SERT). We found that 2-, 3- and 4-FPM inhibit uptake mediated by DAT and NET in HEK293 cells with potencies comparable to cocaine (IC 50 values 80 μM). Experiments directed at identifying transporter-mediated reverse transport revealed that FPM isomers induce efflux via DAT, NET and SERT in HEK293 cells, and this effect is augmented by the Na + /H + ionophore monensin. Each FPM evoked concentration-dependent release of monoamines from rat brain synaptosomes. Hence, this study reports for the first time the mode of action for 2-, 3- and 4-FPM and identifies these NPS as monoamine releasers with marked potency at catecholamine transporters implicated in abuse and addiction. This article is part of the Special Issue entitled 'Designer Drugs and Legal Highs.' Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Polito, Letizia; Davin, Annalisa; Vaccaro, Roberta; Abbondanza, Simona; Govoni, Stefano; Racchi, Marco; Guaita, Antonio
2015-04-01
Previous studies have documented the involvement of the central nervous system serotonin in promoting wakefulness. There are few and conflicting results over whether there is an actual association between bearing the short allele of serotonin transporter promoter polymorphism (5-HTTLPR) and worse sleep quality. This study examined whether sleep onset latency complaint is associated with the 5-HTTLPR triallelic polymorphism in the SLC6A4 gene promoter and whether this polymorphism influences the relationship between sleep onset latency complaint and depressive symptoms in elderly people. A total of 1321 community-dwelling individuals aged 70-74 years were interviewed for sleep onset latency complaint and for sleep medication consumption. Participants' genomic DNA was typed for 5-HTTLPR and rs25531 polymorphisms. Depressive symptoms were evaluated with the Geriatric Depression Scale Short form and general medical comorbidity was assessed by the Cumulative Illness Rating Scale. The presence of a past history of depression was recorded. The S' allele of the 5-HTTLPR triallelic polymorphism was associated with sleep onset latency complaint. This association was maintained after adjusting for depressive symptoms, sex, age, history of depression and medical comorbidity. After stratification for 5-HTTLPR/rs25531, only in S'S' individuals high depressive symptoms were actually associated with sleep onset latency complaint. These data indicate that the low-expressing 5-HTTLPR triallelic polymorphism is an independent risk factor for sleep onset latency disturbance. Furthermore, the 5-HTTLPR genotype influences the association between depressive symptoms and sleep onset latency complaint. © 2014 European Sleep Research Society.
Rannversson, Hafsteinn; Wilson, Pamela; Kristensen, Kristina Birch; Sinning, Steffen; Kristensen, Anders Skov; Strømgaard, Kristian; Andersen, Jacob
2015-06-05
The serotonin transporter (SERT) terminates serotonergic neurotransmission by performing reuptake of released serotonin, and SERT is the primary target for antidepressants. SERT mediates the reuptake of serotonin through an alternating access mechanism, implying that a central substrate site is connected to both sides of the membrane by permeation pathways, of which only one is accessible at a time. The coordinated conformational changes in SERT associated with substrate translocation are not fully understood. Here, we have identified a Leu to Glu mutation at position 406 (L406E) in the extracellular loop 4 (EL4) of human SERT, which induced a remarkable gain-of-potency (up to >40-fold) for a range of SERT inhibitors. The effects were highly specific for L406E relative to six other mutations in the same position, including the closely related L406D mutation, showing that the effects induced by L406E are not simply charge-related effects. Leu(406) is located >10 Å from the central inhibitor binding site indicating that the mutation affects inhibitor binding in an indirect manner. We found that L406E decreased accessibility to a residue in the cytoplasmic pathway. The shift in equilibrium to favor a more outward-facing conformation of SERT can explain the reduced turnover rate and increased association rate of inhibitor binding we found for L406E. Together, our findings show that EL4 allosterically can modulate inhibitor binding within the central binding site, and substantiates that EL4 has an important role in controlling the conformational equilibrium of human SERT. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Energy Technology Data Exchange (ETDEWEB)
Booij, J.; Knol, R.J.J.; Reneman, L.; De Bruin, K.; Van Royen, E.A. [Dept. of Nuclear Medicine, Univ. of Amsterdam (Netherlands); Janssen, A.G.M. [Amersham Cygne and Eindhoven University of Technology (Netherlands)
1998-12-01
Iodine-123 labelled 2{beta}-carbomethoxy-3{beta}-(4-iodophenyl)nortropane (nor-{beta}-CIT), a radioiodinated cocaine analogue, was evaluated as an agent for the in vivo labelling of serotonin transporters by biodistribution studies in rats. Intravenous injection of [{sup 123}I]nor-{beta}-CIT resulted in high accumulation of radioactivity in brain areas with high densities of serotonin (hypothalamus) and dopamine transporters (striatum), although the binding was less pronounced in the hypothalamus. While binding of [{sup 123}I]nor-{beta}-CIT in the hypothalamus was blocked significantly by fluvoxamine (a selective serotonin transporter blocker) but not by GBR12,909 (a selective dopamine transporter blocker), the opposite was observed in the striatum. The results of this study indicate that [{sup 123}I]nor-{beta}-CIT, although not being a selective radioligand, binds specifically to serotonin transporters in the hypothalamus in vivo and thus suggest that [{sup 123}I]nor-{beta}-CIT promises to be a suitable radioligand for single-photon emission tomography imaging of serotonin transporters in humans. (orig.) With 1 fig., 2 tabs., 15 refs.
SLC26A4 Variations Among Graves’ Hyper-Functioning Thyroid Gland
Directory of Open Access Journals (Sweden)
Hassen Hadj-Kacem
2010-01-01
Full Text Available Deleterious mutations of SLC26A4 cause Pendred syndrome (PS, an autosomal recessive disorder comprising goitre and deafness with enlarged vestibular aqueducts (EVA, and nonsyndromic hearing loss (NSHL. However, the SLC26A4 hyperactivity was recently associated with the emergence of autoimmune thyroid diseases (AITD and asthma among human and mouse model. Here, by direct sequencing, we investigate the sequences of the 20 coding exons (2 to 21 of SLC26A4 and their flanking intron-exon junctions among patients affected with Graves' disease (GD hyperthyroidism. Ten mono-allelic variants were identified, seven of which are intronic and previously unreported. Two, c.898A>C (p.I300L and c.1061T>C (p.F354S, of the three exonic variants are non synonymous. The p.F354S variant is already described to be involved in PS or NSHL inheritances. The exploration by PCR-RFLP of p.I300L and p.F354S variants among 132 GD patients, 105 Hashimoto thyroiditis (HT, 206 Healthy subjects and 102 families with NSHL have shown the presence of both variants. The p.F354S variation was identified both among patients (1~HT and 3 GD and healthy subjects (n=5. Whereas, the p.I300L variant was identified only in GD patients (n=3. Our studies provide evidence of the importance of systematic analysis of SLC26A4 gene sequences on models other than deafness. This approach allows the identification of new variants and the review of the pathogenic effects of certain mono-allelic variants reported responsible for PS and NSHL development.
Directory of Open Access Journals (Sweden)
Zhao Jiandong
2012-05-01
Full Text Available Abstract Background Many patients with enlarged vestibular aqueduct (EVA have either only one allelic mutant of the SLC26A4 gene or lack any detectable mutation. In this study, multiplex ligation-dependent probe amplification (MLPA was used to screen for copy number variations (CNVs of SLC26A4 and to reveal the pathogenic mechanisms of non-syndromic EVA (NSEVA. Methods Between January 2003 and March 2010, 923 Chinese patients (481 males, 442 females with NSEVA were recruited. Among these, 68 patients (7.4% were found to carry only one mutant allele of SLC26A4 and 39 patients (4.2% lacked any detectable mutation in SLC26A4; these 107 patients without double mutant alleles were assigned to the patient group. Possible copy number variations in SLC26A4 were detected by SALSA MLPA. Results Using GeneMapper, no significant difference was observed between the groups, as compared with the standard probe provided in the assay. The results of the capillary electrophoresis showed no significant difference between the patients and controls. Conclusion Our results suggest that CNVs and the exon deletion in SLC26A4 are not important factors in NSEVA. However, it would be premature to conclude that CNVs have no role in EVA. Genome-wide studies to explore CNVs within non-coding regions of the SLC26A4 gene and neighboring regions are warranted, to elucidate their roles in NSEVA etiology.
Molecular Determinants for Substrate Interactions with the Glycine Transporter GlyT2.
Carland, Jane E; Thomas, Michael; Mostyn, Shannon N; Subramanian, Nandhitha; O'Mara, Megan L; Ryan, Renae M; Vandenberg, Robert J
2018-03-21
Transporters in the SLC6 family play key roles in regulating neurotransmission and are the targets for a wide range of therapeutics. Important insights into the transport mechanisms and the specificity of drug interactions of SLC6 transporters have been obtained from the crystal structures of a bacterial homologue of the family, LeuT Aa , and more recently the Drosophila dopamine transporter and the human serotonin transporter. However, there is disputed evidence that the bacterial leucine transporter, LeuT Aa , contains two substrate binding sites that work cooperatively in the mechanism of transport, with the binding of a second substrate being required for the release of the substrate from the primary site. An alternate proposal is that there may be low affinity binding sites that serve to direct the flow of substrates to the primary site. We have used a combination of molecular dynamics simulations of substrate interactions with a homology model of GlyT2, together with radiolabeled amino acid uptake assays and electrophysiological analysis of wild-type and mutant transporters, to provide evidence that substrate selectivity of GlyT2 is determined entirely by the primary substrate binding site and, furthermore, if a secondary site exists then it is a low affinity nonselective amino acid binding site.
Neumeister, Alexander; Young, Theresa; Stastny, Juergen
2004-08-01
Serotonin systems appear to play a key role in the pathophysiology of major depressive disorder. Consequently, ongoing research determines whether serotonin related genes account for the very robust differential behavioral and neural mechanisms that discriminate patients with depression from healthy controls. Serotonin type 1(A) receptors and the serotonin transporters are reduced in depression, and recent genetic research in animals and humans has implicated both in depression. Preclinical studies have utilized a variety of animal models that have been used to explain pathophysiological mechanisms in humans, although it is not clear at all whether these models constitute relevant models for depression in humans. However, data from preclinical studies can generate hypotheses that are tested in humans by combining genetic data with behavioral and physiological challenge paradigms and neuroimaging. These studies will enhance our understanding about combined influences from multiple interacting genes, as well as from environmental factors on brain circuits and their function, and about how these mechanisms may contribute to the pathophysiology of neuropsychiatric disorders.
A single base deletion in the SLC45A2 gene in a Bullmastiff with oculocutaneous albinism.
Caduff, M; Bauer, A; Jagannathan, V; Leeb, T
2017-10-01
Oculocutaneous albinism type 4 (OCA4) in humans and similar phenotypes in many animal species are caused by variants in the SLC45A2 gene, encoding a putative sugar transporter. In dog, two independent SLC45A2 variants are known that cause oculocutaneous albinism in Doberman Pinschers and several small dog breeds respectively. For the present study, we investigated a Bullmastiff with oculocutaneous albinism. The affected dog was highly inbred and resulted from the mating of a sire to its own grandmother. We obtained whole genome sequence data from the affected dog and searched specifically for variants in candidate genes known to cause albinism. We detected a single base deletion in exon 6 of the SLC45A2 gene (NM_001037947.1:c.1287delC) that has not been reported thus far. This deletion is predicted to result in an early premature stop codon. It was confirmed by Sanger sequencing and perfectly co-segregated with the phenotype in the available family members. We genotyped 174 unrelated dogs from diverse breeds, all of which were homozygous wildtype. We therefore suggest that SLC45A2:c.1287delC causes the observed oculocutaneous albinism in the affected Bullmastiff. © 2017 Stichting International Foundation for Animal Genetics.
Drosophila SLC5A11 Mediates Hunger by Regulating K(+) Channel Activity.
Park, Jin-Yong; Dus, Monica; Kim, Seonil; Abu, Farhan; Kanai, Makoto I; Rudy, Bernardo; Suh, Greg S B
2016-08-08
Hunger is a powerful drive that stimulates food intake. Yet, the mechanism that determines how the energy deficits that result in hunger are represented in the brain and promote feeding is not well understood. We previously described SLC5A11-a sodium/solute co-transporter-like-(or cupcake) in Drosophila melanogaster, which is required for the fly to select a nutritive sugar over a sweeter nonnutritive sugar after periods of food deprivation. SLC5A11 acts on approximately 12 pairs of ellipsoid body (EB) R4 neurons to trigger the selection of nutritive sugars, but the underlying mechanism is not understood. Here, we report that the excitability of SLC5A11-expressing EB R4 neurons increases dramatically during starvation and that this increase is abolished in the SLC5A11 mutation. Artificial activation of SLC5A11-expresssing neurons is sufficient to promote feeding and hunger-driven behaviors; silencing these neurons has the opposite effect. Notably, SLC5A11 transcript levels in the brain increase significantly when flies are starved and decrease shortly after starved flies are refed. Furthermore, expression of SLC5A11 is sufficient for promoting hunger-driven behaviors and enhancing the excitability of SLC5A11-expressing neurons. SLC5A11 inhibits the function of the Drosophila KCNQ potassium channel in a heterologous expression system. Accordingly, a knockdown of dKCNQ expression in SLC5A11-expressing neurons produces hunger-driven behaviors even in fed flies, mimicking the overexpression of SLC5A11. We propose that starvation increases SLC5A11 expression, which enhances the excitability of SLC5A11-expressing neurons by suppressing dKCNQ channels, thereby conferring the hunger state. Copyright © 2016 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Toshiyuki Fukada
Full Text Available BACKGROUND: Zinc (Zn is an essential trace element and it is abundant in connective tissues, however biological roles of Zn and its transporters in those tissues and cells remain unknown. METHODOLOGY/PRINCIPAL FINDINGS: Here we report that mice deficient in Zn transporter Slc39a13/Zip13 show changes in bone, teeth and connective tissue reminiscent of the clinical spectrum of human Ehlers-Danlos syndrome (EDS. The Slc39a13 knockout (Slc39a13-KO mice show defects in the maturation of osteoblasts, chondrocytes, odontoblasts, and fibroblasts. In the corresponding tissues and cells, impairment in bone morphogenic protein (BMP and TGF-beta signaling were observed. Homozygosity for a SLC39A13 loss of function mutation was detected in sibs affected by a unique variant of EDS that recapitulates the phenotype observed in Slc39a13-KO mice. CONCLUSIONS/SIGNIFICANCE: Hence, our results reveal a crucial role of SLC39A13/ZIP13 in connective tissue development at least in part due to its involvement in the BMP/TGF-beta signaling pathways. The Slc39a13-KO mouse represents a novel animal model linking zinc metabolism, BMP/TGF-beta signaling and connective tissue dysfunction.
SLC30A9 mutation affecting intracellular zinc homeostasis causes a novel cerebro-renal syndrome.
Perez, Yonatan; Shorer, Zamir; Liani-Leibson, Keren; Chabosseau, Pauline; Kadir, Rotem; Volodarsky, Michael; Halperin, Daniel; Barber-Zucker, Shiran; Shalev, Hanna; Schreiber, Ruth; Gradstein, Libe; Gurevich, Evgenia; Zarivach, Raz; Rutter, Guy A; Landau, Daniel; Birk, Ohad S
2017-04-01
A novel autosomal recessive cerebro-renal syndrome was identified in consanguineous Bedouin kindred: neurological deterioration was evident as of early age, progressing into severe intellectual disability, profound ataxia, camptocormia and oculomotor apraxia. Brain MRI was normal. Four of the six affected individuals also had early-onset nephropathy with features of tubulo-interstitial nephritis, hypertension and tendency for hyperkalemia, though none had rapid deterioration of renal function. Genome wide linkage analysis identified an ∼18 Mb disease-associated locus on chromosome 4 (maximal logarithm of odds score 4.4 at D4S2971; θ = 0). Whole exome sequencing identified a single mutation in SLC30A9 within this locus, segregating as expected within the kindred and not found in a homozygous state in 300 Bedouin controls. We showed that SLC30A9 (solute carrier family 30 member 9; also known as ZnT-9) is ubiquitously expressed with high levels in cerebellum, skeletal muscle, thymus and kidney. Confocal analysis of SH-SY5Y cells overexpressing SLC30A9 fused to enhanced green fluorescent protein demonstrated vesicular cytosolic localization associated with the endoplasmic reticulum, not co-localizing with endosomal or Golgi markers. SLC30A9 encodes a putative zinc transporter (by similarity) previously associated with Wnt signalling. However, using dual-luciferase reporter assay in SH-SY5Y cells we showed that Wnt signalling was not affected by the mutation. Based on protein modelling, the identified mutation is expected to affect SLC30A9's highly conserved cation efflux domain, putatively disrupting its transmembrane helix structure. Cytosolic Zn2+ measurements in HEK293 cells overexpressing wild-type and mutant SLC30A9 showed lower zinc concentration within mutant rather than wild-type SLC30A9 cells. This suggests that SLC30A9 has zinc transport properties affecting intracellular zinc homeostasis, and that the molecular mechanism of the disease is through
Sealover, Natalie R; Felts, Bruce; Kuntz, Charles P; Jarrard, Rachel E; Hockerman, Gregory H; Lamb, Patrick W; Barker, Eric L; Henry, L Keith
2016-11-15
The substituted amphetamine, 3,4-methylenedioxy-methamphetamine (MDMA, ecstasy), is a widely used drug of abuse that induces non-exocytotic release of serotonin, dopamine, and norepinephrine through their cognate transporters as well as blocking the reuptake of neurotransmitter by the same transporters. The resulting dramatic increase in volume transmission and signal duration of neurotransmitters leads to psychotropic, stimulant, and entactogenic effects. The mechanism by which amphetamines drive reverse transport of the monoamines remains largely enigmatic, however, promising outcomes for the therapeutic utility of MDMA for post-traumatic stress disorder and the long-time use of the dopaminergic and noradrenergic-directed amphetamines in treatment of attention-deficit hyperactivity disorder and narcolepsy increases the importance of understanding this phenomenon. Previously, we identified functional differences between the human and Drosophila melanogaster serotonin transporters (hSERT and dSERT, respectively) revealing that MDMA is an effective substrate for hSERT but not dSERT even though serotonin is a potent substrate for both transporters. Chimeric dSERT/hSERT transporters revealed that the molecular components necessary for recognition of MDMA as a substrate was linked to regions of the protein flanking transmembrane domains (TM) V through IX. Here, we performed species-scanning mutagenesis of hSERT, dSERT and C. elegans SERT (ceSERT) along with biochemical and electrophysiological analysis and identified a single amino acid in TM10 (Glu394, hSERT; Asn484, dSERT, Asp517, ceSERT) that is primarily responsible for the differences in MDMA recognition. Our findings reveal that an acidic residue is necessary at this position for MDMA recognition as a substrate and serotonin releaser. Copyright © 2016 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Frokjaer, Vibe G; Vinberg, Maj; Erritzoe, David
2009-01-01
at risk for developing depression. The aim of this study was to explore whether abnormalities in SERT might be present in healthy individuals with familial predisposition to mood disorder. Nine individuals at high familial risk (mean age 32.2+/-4.2 years) and 11 individuals at low risk (mean age 32......Mood disorders are elicited through a combination of genetic and environmental stress factors, and treatment with selective serotonin reuptake inhibitors ameliorates depressive symptoms. Changes in the serotonin transporter (SERT) binding may therefore occur in depressive patients and in subjects.......4+/-5.0 years) for developing mood disorder were included. The subjects were healthy twins with or without a co-twin history of mood disorder identified by linking information from the Danish Twin Register and the Danish Psychiatric Central Register. Regional in vivo brain serotonin transporter binding...
Khakipoor, Shokoufeh; Ophoven, Christian; Schrödl-Häußel, Magdalena; Feuerstein, Melanie; Heimrich, Bernd; Deitmer, Joachim W; Roussa, Eleni
2017-08-01
The electrogenic sodium bicarbonate cotransporter NBCe1 (SLC4A4) expressed in astrocytes regulates intracellular and extracellular pH. Here, we introduce transforming growth factor beta (TGF-β) as a novel regulator of NBCe1 transcription and functional expression. Using hippocampal slices and primary hippocampal and cortical astrocyte cultures, we investigated regulation of NBCe1 and elucidated the underlying signaling pathways by RT-PCR, immunoblotting, immunofluorescence, intracellular H( + ) recording using the H( + ) -sensitive dye 2',7'-bis-(carboxyethyl)-5-(and-6)-carboxyfluorescein, mink lung epithelial cell (MLEC) assay, and chromatin immunoprecipitation. Activation of TGF-β signaling significantly upregulated transcript, protein, and surface expression of NBCe1. These effects were TGF-β receptor-mediated and suppressed following inhibition of JNK and Smad signaling. Moreover, 4-aminopyridine (4AP)-dependent NBCe1 regulation requires TGF-β. TGF-β increased the rate and amplitude of intracellular H + changes upon challenging NBCe1 in wild-type astrocytes but not in cortical astrocytes from Slc4a4-deficient mice. A Smad4 binding sequence was identified in the NBCe1 promoter and Smad4 binding increased after activation of TGF-β signaling. The data show for the first time that NBCe1 is a direct target of TGF-β/Smad4 signaling. Through activation of the canonical pathway TGF-β acts directly on NBCe1 by binding of Smad4 to the NBCe1 promoter and regulating its transcription, followed by increased protein expression and transport activity. © 2017 The Authors GLIA Published by Wiley Periodicals, Inc.
Purification and fluorescent labeling of the human serotonin transporter
DEFF Research Database (Denmark)
Rasmussen, Søren G F; Gether, Ulrik
2005-01-01
To establish a purification procedure for the human serotonin transporter (hSERT) we expressed in Sf9 insect cells an epitope-tagged version of the transporter containing a FLAG epitope at the N-terminus and a polyhistidine tail at the C-terminus (FLAG-hSERT-12H). For purification, the transporter...
Elevated midbrain serotonin transporter availability in mixed mania: a case report
Directory of Open Access Journals (Sweden)
Kuikka Jyrki
2004-09-01
Full Text Available Abstract Background Results obtained from brain imaging studies indicate that serotonin transporter (SERT and dopamine transporter (DAT densities are altered in major depression. However, no such studies have been published on current mania or hypomania. Case presentation In this single photon emission computed tomography (SPECT study with [123I]nor-β-CIT we present a case with simultaneous symptoms of major depression and hypomania. She had an elevated serotonin transporter availability (SERT in the midbrain and elevated dopamine transporter availability (DAT in the striatum, which normalised in a one-year follow-up period during which she received eight months of psychodynamic psychotherapy. Conclusions To our knowledge, this is the first report on SERT and DAT associated with mania. In our case the availability of both SERT in the midbrain and DAT in the striatum were elevated at baseline and declined during psychotherapy, while the SERT and DAT of the depressed controls increased during psychotherapy. Symptoms of hypomania in the case were alleviated during psychotherapy. Clinical recovery was also reflected in the Hamilton Depression Rating Scale (HDRS scores.
Altered dopamine and serotonin metabolism in motorically asymptomatic R6/2 mice.
Directory of Open Access Journals (Sweden)
Fanny Mochel
Full Text Available The pattern of cerebral dopamine (DA abnormalities in Huntington disease (HD is complex, as reflected by the variable clinical benefit of both DA antagonists and agonists in treating HD symptoms. In addition, little is known about serotonin metabolism despite the early occurrence of anxiety and depression in HD. Post-mortem enzymatic changes are likely to interfere with the in vivo profile of biogenic amines. Hence, in order to reliably characterize the regional and chronological profile of brain neurotransmitters in a HD mouse model, we used a microwave fixation system that preserves in vivo concentrations of dopaminergic and serotoninergic amines. DA was decreased in the striatum of R6/2 mice at 8 and 12 weeks of age while DA metabolites, 3-methoxytyramine and homovanillic acid, were already significantly reduced in 4-week-old motorically asymptomatic R6/2 mice. In the striatum, hippocampus and frontal cortex of 4, 8 and 12-week-old R6/2 mice, serotonin and its metabolite 5-hydroxyindoleacetic acid were significantly decreased in association with a decreased turnover of serotonin. In addition, automated high-resolution behavioural analyses displayed stress-like behaviours such as jumping and grooming and altered spatial learning in R6/2 mice at age 4 and 6 weeks respectively. Therefore, we describe the earliest alterations of DA and serotonin metabolism in a HD murine model. Our findings likely underpin the neuropsychological symptoms at time of disease onset in HD.
Kalueff, A V; Fox, M A; Gallagher, P S; Murphy, D L
2007-06-01
Although mice with a targeted disruption of the serotonin transporter (SERT) have been studied extensively using various tests, their complex behavioral phenotype is not yet fully understood. Here we assess in detail the behavior of adult female SERT wild type (+/+), heterozygous (+/-) and knockout (-/-) mice on an isogenic C57BL/6J background subjected to a battery of behavioral paradigms. Overall, there were no differences in the ability to find food or a novel object, nest-building, self-grooming and its sequencing, and horizontal rod balancing, indicating unimpaired sensory functions, motor co-ordination and behavioral sequencing. In contrast, there were striking reductions in exploration and activity in novelty-based tests (novel object, sticky label and open field tests), accompanied by pronounced thigmotaxis, suggesting that combined hypolocomotion and anxiety (rather than purely anxiety) influence the SERT -/- behavioral phenotype. Social interaction behaviors were also markedly reduced. In addition, SERT -/- mice tended to move close to the ground, frequently displayed spontaneous Straub tail, tics, tremor and backward gait - a phenotype generally consistent with 'serotonin syndrome'-like behavior. In line with replicated evidence of much enhanced serotonin availability in SERT -/- mice, this serotonin syndrome-like state may represent a third factor contributing to their behavioral profile. An understanding of the emerging complexity of SERT -/- mouse behavior is crucial for a detailed dissection of their phenotype and for developing further neurobehavioral models using these mice.
Gagnon, Kenneth B; Delpire, Eric
2013-04-15
Among the over 300 members of the solute carrier (SLC) group of integral plasma membrane transport proteins are the nine electroneutral cation-chloride cotransporters belonging to the SLC12 gene family. Seven of these transporters have been functionally described as coupling the electrically silent movement of chloride with sodium and/or potassium. Although in silico analysis has identified two additional SLC12 family members, no physiological role has been ascribed to the proteins encoded by either the SLC12A8 or the SLC12A9 genes. Evolutionary conservation of this gene family from protists to humans confirms their importance. A wealth of physiological, immunohistochemical, and biochemical studies have revealed a great deal of information regarding the importance of this gene family to human health and disease. The sequencing of the human genome has provided investigators with the capability to link several human diseases with mutations in the genes encoding these plasma membrane proteins. The availability of bacterial artificial chromosomes, recombination engineering techniques, and the mouse genome sequence has simplified the creation of targeting constructs to manipulate the expression/function of these cation-chloride cotransporters in the mouse in an attempt to recapitulate some of these human pathologies. This review will summarize the three human disorders that have been linked to the mutation/dysfunction of the Na-Cl, Na-K-2Cl, and K-Cl cotransporters (i.e., Bartter's, Gitleman's, and Andermann's syndromes), examine some additional pathologies arising from genetically modified mouse models of these cotransporters including deafness, blood pressure, hyperexcitability, and epithelial transport deficit phenotypes.
Serretti, A; Macciardi, F; Di Bella, D; Catalano, M; Smeraldi, E
1998-08-17
Disturbances of the dopaminergic and serotoninergic neurotransmitter systems have been implicated in the pathogenesis of depressive symptoms. Associations have been reported between markers of the two neurotransmitter systems and the presence of illness or severity of depressive episodes, but no attention has been focused on the periods of remission. The present report focuses on a possible association of self-esteem in remitted mood disorder patients with the functional polymorphism located in the upstream regulatory region of the serotonin transporter gene (5-HTTLPR) and the dopamine receptor D4 (DRD4). Inpatients (N=162) affected by bipolar (n=103) and unipolar (n=59) disorder (DSM III-R) were assessed by the Self-Esteem Scale (SES, Rosenberg, 1965) and were typed for DRD4 and 5-HTTLPR (n=58 subjects) variants at the third exon using polymerase chain reaction (PCR) techniques. Neither DRD4 nor 5-HTTLPR variants were associated with SES scores, and consideration of possible stratification effects such as sex and psychiatric diagnosis did not reveal any association either. The serotonin transporter and dopamine receptor D4 genes do not, therefore, influence self-esteem in remitted mood disorder subjects.
Ma, Tiangang; Qu, Danhua; Yan, Bingdi; Zhang, Qinghua; Ren, Jin; Hu, Yanbing
2018-01-01
A mutation in the IIb sodium phosphate transporter SLC34A2 gene has recently been described in pulmonary alveolar microlithiasis (PAM) patients. Experiments in this study were aimed at confirming the role of the gene product in PAM by comparing phosphorylated products in extracellular fluid of alveolar epithelial cells overexpressing the SLC34A2 gene or its mutated version. Eukaryotic expression vectors were constructed and transfected into A549 human alveolar epithelial cells. There were three groups of cells including those transfected with empty vector plasmid pcDNA3.1(+) (plasmid control group), those transfected with normal SLC34A2 gene expressed from pcDNA3.1 (normal control group), and those transfected with a version of the PAM SLC34A2 gene linked to the pcDNA3.1(+) (PAM group). Transfection efficiencies were detected by reverse transcription-polymerase chain reaction (RT-PCR). At 48 h after transfection, the concentration of inorganic phosphorus in the culture medium was detected using an automatic biochemical analyzer. Our results showed the concentration of inorganic phosphorus in the supernatant of the normal control group was significantly lower than that in the plasmid control and PAM groups (PPAM group was significantly lower than that in the plasmid control group (PPAM patients, given that the function of the phosphate transporter seems to be affected and it is conceivable that it would lead to extracellular fluid alterations in vivo .
Molecular cloning, expression and characterization of a bovine serotonin transporter
DEFF Research Database (Denmark)
Mortensen, O V; Kristensen, A S; Rudnick, G
1999-01-01
The serotonin transporter (SERT) is a member of a highly homologous family of sodium/chloride dependent neurotransmitter transporters responsible for reuptake of biogenic amines from the extracellular fluid. SERT constitutes the pharmacological target of several clinically important antidepressan......-methylenedioxymethamphetamine (MDMA) was mainly unchanged. RT-PCR amplification of RNA from different tissues demonstrated expression of SERT in placenta, brain stem, bone marrow, kidney, lung, heart, adrenal gland, liver, parathyroid gland, thyroid gland, small intestine and pancreas....
Pybus, Marc; Andrews, Glen K.; Lalueza-Fox, Carles; Comas, David; Sekler, Israel; de la Rasilla, Marco; Rosas, Antonio; Stoneking, Mark; Valverde, Miguel A.; Vicente, Rubén; Bosch, Elena
2014-01-01
Extreme differences in allele frequency between West Africans and Eurasians were observed for a leucine-to-valine substitution (Leu372Val) in the human intestinal zinc uptake transporter, ZIP4, yet no further evidence was found for a selective sweep around the ZIP4 gene (SLC39A4). By interrogating allele frequencies in more than 100 diverse human populations and resequencing Neanderthal DNA, we confirmed the ancestral state of this locus and found a strong geographical gradient for the derived allele (Val372), with near fixation in West Africa. In extensive coalescent simulations, we show that the extreme differences in allele frequency, yet absence of a classical sweep signature, can be explained by the effect of a local recombination hotspot, together with directional selection favoring the Val372 allele in Sub-Saharan Africans. The possible functional effect of the Leu372Val substitution, together with two pathological mutations at the same codon (Leu372Pro and Leu372Arg) that cause acrodermatitis enteropathica (a disease phenotype characterized by extreme zinc deficiency), was investigated by transient overexpression of human ZIP4 protein in HeLa cells. Both acrodermatitis mutations cause absence of the ZIP4 transporter cell surface expression and nearly absent zinc uptake, while the Val372 variant displayed significantly reduced surface protein expression, reduced basal levels of intracellular zinc, and reduced zinc uptake in comparison with the Leu372 variant. We speculate that reduced zinc uptake by the ZIP4-derived Val372 isoform may act by starving certain pathogens of zinc, and hence may have been advantageous in Sub-Saharan Africa. Moreover, these functional results may indicate differences in zinc homeostasis among modern human populations with possible relevance for disease risk. PMID:24586184
Directory of Open Access Journals (Sweden)
Johannes Engelken
2014-02-01
Full Text Available Extreme differences in allele frequency between West Africans and Eurasians were observed for a leucine-to-valine substitution (Leu372Val in the human intestinal zinc uptake transporter, ZIP4, yet no further evidence was found for a selective sweep around the ZIP4 gene (SLC39A4. By interrogating allele frequencies in more than 100 diverse human populations and resequencing Neanderthal DNA, we confirmed the ancestral state of this locus and found a strong geographical gradient for the derived allele (Val372, with near fixation in West Africa. In extensive coalescent simulations, we show that the extreme differences in allele frequency, yet absence of a classical sweep signature, can be explained by the effect of a local recombination hotspot, together with directional selection favoring the Val372 allele in Sub-Saharan Africans. The possible functional effect of the Leu372Val substitution, together with two pathological mutations at the same codon (Leu372Pro and Leu372Arg that cause acrodermatitis enteropathica (a disease phenotype characterized by extreme zinc deficiency, was investigated by transient overexpression of human ZIP4 protein in HeLa cells. Both acrodermatitis mutations cause absence of the ZIP4 transporter cell surface expression and nearly absent zinc uptake, while the Val372 variant displayed significantly reduced surface protein expression, reduced basal levels of intracellular zinc, and reduced zinc uptake in comparison with the Leu372 variant. We speculate that reduced zinc uptake by the ZIP4-derived Val372 isoform may act by starving certain pathogens of zinc, and hence may have been advantageous in Sub-Saharan Africa. Moreover, these functional results may indicate differences in zinc homeostasis among modern human populations with possible relevance for disease risk.
SLC and SLD: Experimental experience with a linear collider
International Nuclear Information System (INIS)
Breidenbach, M.
1993-08-01
The SLAC Linear Collider (SLC) is the prototype e + e - linear collider. This talk will consist of an introduction to SLC, a description of the strategy for luminosity, a description of the systems for the transport and measurement of the polarized electrons, and a description of the present performance of the SLC and planned upgrades. The detector, SLD, and the status of the polarization asymmetry measurement A LR will be described
Haack, Tobias B.; Makowski, Christine; Yao, Yoshiaki; Graf, Elisabeth; Hempel, Maja; Wieland, Thomas; Tauer, Ulrike; Ahting, Uwe; Mayr, Johannes A.; Freisinger, Peter; Yoshimatsu, Hiroki; Inui, Ken; Strom, Tim M.; Meitinger, Thomas; Yonezawa, Atsushi
2012-01-01
Brown-Vialetto-Van Laere syndrome (BVVLS [MIM 211530]) is a rare neurological disorder characterized by infancy onset sensorineural deafness and ponto-bulbar palsy. Mutations in SLC52A3 (formerly C20orf54), coding for riboflavin transporter 2 (hRFT2), have been identified as the molecular genetic correlate in several individuals with BVVLS. Exome sequencing of just one single case revealed that compound heterozygosity for two pathogenic mutations in the SLC52A2 gene coding for riboflavin tran...
Elevated SLC26A4 gene promoter methylation is associated with the risk of presbycusis in men.
Xu, Jin; Zheng, Jiachen; Shen, Wanjing; Ma, Lili; Zhao, Ming; Wang, Xubo; Tang, Jiyuan; Yan, Jihong; Wu, Zhenhua; Zou, Zuquan; Bu, Shizhong; Xi, Yang
2017-07-01
Presbycusis affects approximately one-third of people over the age of 65 and is a worldwide health problem. In the current study, whether the methylation level of solute carrier family 26 member 4 (SLC26A4) predicted an increased risk of presbycusis was investigated. Peripheral blood samples from 102 patients with presbycusis and 104 controls were collected, and the methylation of the CpG sites of SLC26A4 was measured by applying pyrosequencing technology combined with sodium bisulfate DNA conversion chemistry. Within the SLC26A4 promoter region, one CpG site (CpG3) exhibited a significantly (Ppresbycusis (26.5±5.56%) compared with the controls (23.8±3.85%). Significantly different CpG3 methylation levels were observed between the patients with presbycusis and the controls among the male participants (P=0.0004). In addition, a significant decrease in the transcriptional level of SLC26A4 in peripheral blood was observed in the patients with presbycusis compared with the controls. Furthermore, analyses of the receiver operating characteristic (ROC) curves indicated that CpG3 methylation at the SLC26A4 promoter predicted the risk of presbycusis in the male participants (AUC=0.684, 95% CI=0.584‑0.784, P=0.001). The results demonstrated the significance of the CpG site methylation level of SLC26A4, and thus provides a potential marker for the diagnosis of presbycusis.
The Mechanistic Basis for Noncompetitive Ibogaine Inhibition of Serotonin and Dopamine Transporters*
Bulling, Simon; Schicker, Klaus; Zhang, Yuan-Wei; Steinkellner, Thomas; Stockner, Thomas; Gruber, Christian W.; Boehm, Stefan; Freissmuth, Michael; Rudnick, Gary; Sitte, Harald H.; Sandtner, Walter
2012-01-01
Ibogaine, a hallucinogenic alkaloid proposed as a treatment for opiate withdrawal, has been shown to inhibit serotonin transporter (SERT) noncompetitively, in contrast to all other known inhibitors, which are competitive with substrate. Ibogaine binding to SERT increases accessibility in the permeation pathway connecting the substrate-binding site with the cytoplasm. Because of the structural similarity between ibogaine and serotonin, it had been suggested that ibogaine binds to the substrate site of SERT. The results presented here show that ibogaine binds to a distinct site, accessible from the cell exterior, to inhibit both serotonin transport and serotonin-induced ionic currents. Ibogaine noncompetitively inhibited transport by both SERT and the homologous dopamine transporter (DAT). Ibogaine blocked substrate-induced currents also in DAT and increased accessibility of the DAT cytoplasmic permeation pathway. When present on the cell exterior, ibogaine inhibited SERT substrate-induced currents, but not when it was introduced into the cytoplasm through the patch electrode. Similar to noncompetitive transport inhibition, the current block was not reversed by increasing substrate concentration. The kinetics of inhibitor binding and dissociation, as determined by their effect on SERT currents, indicated that ibogaine does not inhibit by forming a long-lived complex with SERT, but rather binds directly to the transporter in an inward-open conformation. A kinetic model for transport describing the noncompetitive action of ibogaine and the competitive action of cocaine accounts well for the results of the present study. PMID:22451652
The mechanistic basis for noncompetitive ibogaine inhibition of serotonin and dopamine transporters.
Bulling, Simon; Schicker, Klaus; Zhang, Yuan-Wei; Steinkellner, Thomas; Stockner, Thomas; Gruber, Christian W; Boehm, Stefan; Freissmuth, Michael; Rudnick, Gary; Sitte, Harald H; Sandtner, Walter
2012-05-25
Ibogaine, a hallucinogenic alkaloid proposed as a treatment for opiate withdrawal, has been shown to inhibit serotonin transporter (SERT) noncompetitively, in contrast to all other known inhibitors, which are competitive with substrate. Ibogaine binding to SERT increases accessibility in the permeation pathway connecting the substrate-binding site with the cytoplasm. Because of the structural similarity between ibogaine and serotonin, it had been suggested that ibogaine binds to the substrate site of SERT. The results presented here show that ibogaine binds to a distinct site, accessible from the cell exterior, to inhibit both serotonin transport and serotonin-induced ionic currents. Ibogaine noncompetitively inhibited transport by both SERT and the homologous dopamine transporter (DAT). Ibogaine blocked substrate-induced currents also in DAT and increased accessibility of the DAT cytoplasmic permeation pathway. When present on the cell exterior, ibogaine inhibited SERT substrate-induced currents, but not when it was introduced into the cytoplasm through the patch electrode. Similar to noncompetitive transport inhibition, the current block was not reversed by increasing substrate concentration. The kinetics of inhibitor binding and dissociation, as determined by their effect on SERT currents, indicated that ibogaine does not inhibit by forming a long-lived complex with SERT, but rather binds directly to the transporter in an inward-open conformation. A kinetic model for transport describing the noncompetitive action of ibogaine and the competitive action of cocaine accounts well for the results of the present study.
Directory of Open Access Journals (Sweden)
Joseph Andronic
Full Text Available Swelling-activated pathways for myo-inositol, one of the most abundant organic osmolytes in mammalian cells, have not yet been identified. The present study explores the SLC5A3 protein as a possible transporter of myo-inositol in hyponically swollen HEK293 cells. To address this issue, we examined the relationship between the hypotonicity-induced changes in plasma membrane permeability to myo-inositol P ino [m/s] and expression/localization of SLC5A3. P ino values were determined by cell volumetry over a wide tonicity range (100-275 mOsm in myo-inositol-substituted solutions. While being negligible under mild hypotonicity (200-275 mOsm, P ino grew rapidly at osmolalities below 200 mOsm to reach a maximum of ∼ 3 nm/s at 100-125 mOsm, as indicated by fast cell swelling due to myo-inositol influx. The increase in P ino resulted most likely from the hypotonicity-mediated incorporation of cytosolic SLC5A3 into the plasma membrane, as revealed by confocal fluorescence microscopy of cells expressing EGFP-tagged SLC5A3 and super-resolution imaging of immunostained SLC5A3 by direct stochastic optical reconstruction microscopy (dSTORM. dSTORM in hypotonic cells revealed a surface density of membrane-associated SLC5A3 proteins of 200-2000 localizations/μm2. Assuming SLC5A3 to be the major path for myo-inositol, a turnover rate of 80-800 myo-inositol molecules per second for a single transporter protein was estimated from combined volumetric and dSTORM data. Hypotonic stress also caused a significant upregulation of SLC5A3 gene expression as detected by semiquantitative RT-PCR and Western blot analysis. In summary, our data provide first evidence for swelling-mediated activation of SLC5A3 thus suggesting a functional role of this transporter in hypotonic volume regulation of mammalian cells.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC413 (Link to dictyBase) - - - Contig-U15735-1 SLC413P (Link to Original site) SLC4...13F 686 SLC413Z 466 SLC413P 1152 - - Show SLC413 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC413Q.Seq.d/ Representative seq. ID SLC4...13P (Link to Original site) Representative DNA sequence >SLC413 (SLC413Q) /CSM/SL/SLC4-A/SLC4...iknkikkknikqkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC413 (SLC413Q) /CSM/SL/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC404 (Link to dictyBase) - G22406 DDB0190371 Contig-U03918-1 SLC4...04E (Link to Original site) - - - - - - SLC404E 229 Show SLC404 Library SL (Link to library) Clone ID SLC4...riginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC404Q.Seq.d/ ...Representative seq. ID SLC404E (Link to Original site) Representative DNA sequence >SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4...y vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC402 (Link to dictyBase) - - - Contig-U16327-1 SLC402E (Link to Original site) SLC4...02F 661 SLC402Z 395 SLC402P 1056 SLC402E 674 Show SLC402 Library SL (Link to library) Clone ID SLC4...inal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC402Q.Seq.d/ Representative seq. ID SLC4...02E (Link to Original site) Representative DNA sequence >SLC402 (SLC402Q) /CSM/SL/SLC4-A/SLC4...lignments: (bits) Value SSC554 (SSC554Q) /CSM/SS/SSC5-C/SSC554Q.Seq.d/ 1128 0.0 SLC402 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC489 (Link to dictyBase) - - - Contig-U16255-1 SLC489P (Link to Original site) SLC4...89F 628 SLC489Z 172 SLC489P 800 - - Show SLC489 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC489Q.Seq.d/ Representative seq. ID SLC4...89P (Link to Original site) Representative DNA sequence >SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4...SSD212Q.Seq.d/ 1001 0.0 SLE207 (SLE207Q) /CSM/SL/SLE2-A/SLE207Q.Seq.d/ 1001 0.0 SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4
Quantifying the relative contributions of different solute carriers to aggregate substrate transport
Taslimifar, Mehdi; Oparija, Lalita; Verrey, Francois; Kurtcuoglu, Vartan; Olgac, Ufuk; Makrides, Victoria
2017-01-01
Determining the contributions of different transporter species to overall cellular transport is fundamental for understanding the physiological regulation of solutes. We calculated the relative activities of Solute Carrier (SLC) transporters using the Michaelis-Menten equation and global fitting to estimate the normalized maximum transport rate for each transporter (Vmax). Data input were the normalized measured uptake of the essential neutral amino acid (AA) L-leucine (Leu) from concentration-dependence assays performed using Xenopus laevis oocytes. Our methodology was verified by calculating Leu and L-phenylalanine (Phe) data in the presence of competitive substrates and/or inhibitors. Among 9 potentially expressed endogenous X. laevis oocyte Leu transporter species, activities of only the uniporters SLC43A2/LAT4 (and/or SLC43A1/LAT3) and the sodium symporter SLC6A19/B0AT1 were required to account for total uptake. Furthermore, Leu and Phe uptake by heterologously expressed human SLC6A14/ATB0,+ and SLC43A2/LAT4 was accurately calculated. This versatile systems biology approach is useful for analyses where the kinetics of each active protein species can be represented by the Hill equation. Furthermore, its applicable even in the absence of protein expression data. It could potentially be applied, for example, to quantify drug transporter activities in target cells to improve specificity. PMID:28091567
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC405 (Link to dictyBase) - - - Contig-U11279-1 | Contig-U16243-1 SLC4...05P (Link to Original site) SLC405F 536 SLC405Z 439 SLC405P 975 - - Show SLC405 Library SL (Link to library) Clone ID SLC4...79-1 | Contig-U16243-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...05Q.Seq.d/ Representative seq. ID SLC405P (Link to Original site) Representative DNA sequence >SLC405 (SLC4...05Q) /CSM/SL/SLC4-A/SLC405Q.Seq.d/ ATAACTAATAAAATGTCATTCAATTCAAGAATTGAAACTATTTCTCGCCACTTAAGCACT
DEFF Research Database (Denmark)
Cloonan, Suzanne M.; Keating, John J.; Butler, Stephen G.
2009-01-01
The discovery that some serotonin reuptake transporter (SERT) ligands have the potential to act as pro-apoptotic agents in the treatment of cancer adds greatly to their diverse pharmacological application. 4-Methylthioamphetamine (MTA) is a selective ligand for SERT over other monoamine...
Effects of [123I]ADAM, a serotonin transporter radiopharmaceutical, on pregnant Sprague–Dawley rats
International Nuclear Information System (INIS)
Chang, K.W.; Lin, M.C.; Lee, S.Y.; Chen, H.Y.; Chen, C.C.; Fu, Y.K.
2012-01-01
Serotonin transport abnormalities are implicated in neuropsychiatric disorders. [ 123 I]ADAM ([ 123 I]-2-([2-({dimethylamino}methyl)phenyl]thio)-5-iodophenylamine) is a novel radiotracer that targets serotonin transporters. We assessed the toxicity of [ 123 I]ADAM (18.5 MBq) administered in early- and late-phases (8 and 14 day postfertilization, respectively) of pregnancy. The mortality, clinical status, and gross necropsy were measured in pregnant rats, and the fertility index was measured in rat offspring (weight, clinical observations). We found no dosing-related clinical signs. In conclusion, [ 123 I]ADAM was not toxic in an animal pregnancy model.
Wang, Li; Sweet, Douglas H
2012-10-15
Phenolic acids exert beneficial health effects such as anti-oxidant, anti-carcinogenic, and anti-inflammatory activities and show systemic exposure after consumption of common fruits, vegetables, and beverages. However, knowledge regarding which components convey therapeutic benefits and the mechanism(s) by which they cross cell membranes is extremely limited. Therefore, we determined the inhibitory effects of nine food-derived phenolic acids, p-coumaric acid, ferulic acid, gallic acid, gentisic acid, 4-hydroxybenzoic acid, protocatechuic acid, sinapinic acid, syringic acid, and vanillic acid, on human organic anion transporter 1 (hOAT1), hOAT3, and hOAT4. In the present study, inhibition of OAT-mediated transport of prototypical substrates (1 μM) by phenolic acids (100 μM) was examined in stably expressing cell lines. All compounds significantly inhibited hOAT3 transport, while just ferulic, gallic, protocatechuic, sinapinic, and vanillic acid significantly blocked hOAT1 activity. Only sinapinic acid inhibited hOAT4 (~35%). For compounds exhibiting inhibition > ~60%, known clinical plasma concentration levels and plasma protein binding in humans were examined to select compounds to evaluate further with dose-response curves (IC(50) values) and drug-drug interaction (DDI) index determinations. IC(50) values ranged from 1.24 to 18.08 μM for hOAT1 and from 7.35 to 87.36 μM for hOAT3. Maximum DDI indices for gallic and gentisic acid (≫0.1) indicated a very strong potential for DDIs on hOAT1 and/or hOAT3. This study indicates that gallic acid from foods or supplements, or gentisic acid from salicylate-based drug metabolism, may significantly alter the pharmacokinetics (efficacy and toxicity) of concomitant therapeutics that are hOAT1 and/or hOAT3 substrates. Copyright © 2012 Elsevier Inc. All rights reserved.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC424 (Link to dictyBase) - G01086 DDB0231665 Contig-U08784-1 SLC4...24P (Link to Original site) SLC424F 169 SLC424Z 538 SLC424P 707 - - Show SLC424 Library SL (Link to library) Clone ID SLC4...ontig-U08784-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...24Q.Seq.d/ Representative seq. ID SLC424P (Link to Original site) Representative DNA sequence >SLC424 (SLC424Q) /CSM/SL/SLC4...-A/SLC424Q.Seq.d/ GGATATTATAATTTCAAATTAAGTTTTATAAATTTGAAATAATATTGAAAAAAAAAAAAA ATAAAAAA
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC443 (Link to dictyBase) - - - Contig-U16518-1 SLC443P (Link to Original site) SLC4...43F 466 SLC443Z 304 SLC443P 770 - - Show SLC443 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC443Q.Seq.d/ Representative seq. ID SLC4...43P (Link to Original site) Representative DNA sequence >SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4...Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4
Orozco, Zenith Gaye A; Soma, Satoshi; Kaneko, Toyoji; Watanabe, Soichi
2017-01-01
The tissue distribution of slc15a1a, a gene that encodes an oligopeptide transporter, PepT1, and its response to fasting and refeeding were investigated in the intestinal epithelium of Mozambique tilapia for a better understanding of its role on nutrient absorption. The slc15a1a was predominantly expressed in the absorptive epithelia of the anterior part of the intestine, suggesting that digested oligopeptides are primarily absorbed in the anterior intestine. The response of slc15a1a to fasting was evaluated at 1, 2, 4, 7 and 14days after the last feeding. Fasting revealed a biphasic effect, where short-term fasting significantly upregulated slc15a1a expression and long-term fasting resulted in downregulation. The expression level continued to decrease and fell below the pre-fasted level from day 4 to 14. Proximal (the hepatic loop, HL) and distal parts (the proximal major coil, PMC) of the anterior intestine showed different magnitudes of responses to fasting; slc15a1a expression in the PMC showed greater upregulation and downregulation than that in the HL. Refeeding significantly stimulated slc15a1a expression at day 3, although the expression did not exceed the pre-fasted level. Observed responses of slc15a1a to fasting and refeeding suggest that the expression level of this gene can serve as a sensitive indicator of the changes that may occur in altering nutritional conditions. These findings contribute to a better understanding of the role of PepT1 in nutrition and of the complex mechanisms underlying the absorption of oligopeptides and amino acids in the intestine, and may lead to development of possible means to manipulate the absorption processes for the improvement of growth and other metabolic and physiological conditions in fish. Copyright © 2016. Published by Elsevier Inc.
DEFF Research Database (Denmark)
Said, Saida; Neubauer, Henrik Amtoft; Müller, Heidi Kaastrup
2015-01-01
The serotonin transporter (SERT) belongs to a family of transport proteins called the neurotransmitter:sodium symporters. The specialized members of this family transport different neurotransmitters across the cell membrane, thereby regulating signaling between neurons. Most of these transporters...
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC428 (Link to dictyBase) - - - Contig-U10963-1 SLC428P (Link to Original site) SLC4...28F 573 SLC428Z 307 SLC428P 880 - - Show SLC428 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC428Q.Seq.d/ Representative seq. ID SLC4...28P (Link to Original site) Representative DNA sequence >SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC4...nces producing significant alignments: (bits) Value SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC428Q.Seq.d/ 1526 0.0
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC495 (Link to dictyBase) - - - Contig-U03919-1 SLC495E (Link to Original site) SLC4...95F 337 SLC495Z 295 SLC495P 632 SLC495E 337 Show SLC495 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC495Q.Seq.d/ Representative seq. ID SLC4...95E (Link to Original site) Representative DNA sequence >SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC4...ficant alignments: (bits) Value SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC495Q.Seq.d/ 446 e-124 VSF494 (VSF494Q) /C
DEFF Research Database (Denmark)
Söderhielm, Pella C; Andersen, Jacob; Munro, Lachlan
2015-01-01
of TM6, Ala419 in the interface between TM8 and extracellular loop (EL) 4, and Leu481 in EL5. The reporter positions were used for time-resolved measurement of conformational changes during 5-HT transport and binding of cocaine and the selective serotonin reuptake inhibitors fluoxetine and escitalopram...... changes overall, which included movements within or around TM1b, EL4, and EL5. Taken together, our data lead us to suggest that competitive inhibitors stabilize hSERT in a state that is different from the apo outward-open conformation as well as inward-facing conformations....
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC469 (Link to dictyBase) - - - Contig-U16584-1 SLC469P (Link to Original site) SLC4...69F 676 SLC469Z 397 SLC469P 1073 - - Show SLC469 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC469Q.Seq.d/ Representative seq. ID SLC4...69P (Link to Original site) Representative DNA sequence >SLC469 (SLC469Q) /CSM/SL/SLC4-C/SLC4...sfflc sklvvik*ncynyp Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC469 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC452 (Link to dictyBase) - - - Contig-U08358-1 SLC452E (Link to Original site) SLC4...52F 537 SLC452Z 347 SLC452P 884 SLC452E 537 Show SLC452 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC452Q.Seq.d/ Representative seq. ID SLC4...52E (Link to Original site) Representative DNA sequence >SLC452 (SLC452Q) /CSM/SL/SLC4-C/SLC4...slvtpplffq*skk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC435 (Link to dictyBase) - - - Contig-U16260-1 SLC435E (Link... to Original site) - - - - - - SLC435E 373 Show SLC435 Library SL (Link to library) Clone ID SLC435 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC435Q.Seq.d/ Representative seq. ID SLC43...5E (Link to Original site) Representative DNA sequence >SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC435Q.Seq.d/ GGAGA...I815Q) /CSM/SL/SLI8-A/SLI815Q.Seq.d/ 694 0.0 SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC441 (Link to dictyBase) - - - Contig-U00414-1 SLC441P (Link to Original site) SLC4...41F 207 SLC441Z 473 SLC441P 680 - - Show SLC441 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC441Q.Seq.d/ Representative seq. ID SLC4...41P (Link to Original site) Representative DNA sequence >SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC4...Q) /CSM/SL/SLI1-C/SLI162Q.Seq.d/ 896 0.0 SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC441Q.Seq.d/ 896 0.0 AFK293 (AFK2
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC403 (Link to dictyBase) - - - Contig-U16252-1 SLC403Z (Link... to Original site) - - SLC403Z 492 - - - - Show SLC403 Library SL (Link to library) Clone ID SLC403 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC403Q.Seq.d/ Representative seq. ID SLC40...3Z (Link to Original site) Representative DNA sequence >SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ XXXXX...-B/SLE731Q.Seq.d/ 902 0.0 SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ 902 0.0 SLC241 (SLC241Q) /CSM/SL/SL
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC494 (Link to dictyBase) - - - Contig-U16260-1 SLC494Z (Link... to Original site) - - SLC494Z 451 - - - - Show SLC494 Library SL (Link to library) Clone ID SLC494 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC494Q.Seq.d/ Representative seq. ID SLC49...4Z (Link to Original site) Representative DNA sequence >SLC494 (SLC494Q) /CSM/SL/SLC4-D/SLC494Q.Seq.d/ XXXXX...a: 0.00 m3b: 0.00 m_ : 1.00 52.0 %: cytoplasmic 36.0 %: nuclear 8.0 %: cytoskeletal 4.0 %: mitochondrial >> prediction for SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC485 (Link to dictyBase) - - - Contig-U16358-1 SLC485Z (Link... to Original site) - - SLC485Z 452 - - - - Show SLC485 Library SL (Link to library) Clone ID SLC485 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC485Q.Seq.d/ Representative seq. ID SLC48...5Z (Link to Original site) Representative DNA sequence >SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC485Q.Seq.d/ XXXXX... 825 0.0 SLG820 (SLG820Q) /CSM/SL/SLG8-A/SLG820Q.Seq.d/ 825 0.0 SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC4
DEFF Research Database (Denmark)
Rasmussen, Trine Nygaard; Plenge, Per; Bay, Tina
2009-01-01
The human serotonin transporter (hSERT) is responsible for reuptake of serotonin (5-HT) from the synaptic cleft and is target for antidepressant medicine. Differential hSERT activity caused by genetic polymorphisms is believed to affect the risk of developing depression and, moreover, to affect t...
Serotonin transporter evolution and impact of polymorphic transcriptional regulation
DEFF Research Database (Denmark)
Søeby, Karen; Larsen, Svend Ask; Olsen, Line
2005-01-01
The serotonin transporter (SERT) is the primary drug target in the current antidepressant therapy. A functional polymorphism in the 2nd intron of the 5HTT gene encoding the SERT has been identified and associated with susceptibility to affective disorders and treatment response to antidepressants...... in the VNTRs of all mammalian SERT genes. The number of these putative binding sites varies proportionally to the length of the VNTR. We propose that the intronic VNTR have been selectively targeted through mammalian evolution to finetune transcriptional regulation of the serotonin expression....
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC492 (Link to dictyBase) - - - Contig-U10734-1 | Contig-U12865-1 SLC4...92P (Link to Original site) SLC492F 645 SLC492Z 550 SLC492P 1195 - - Show SLC492 Library SL (Link to library) Clone ID SLC4...734-1 | Contig-U12865-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...92Q.Seq.d/ Representative seq. ID SLC492P (Link to Original site) Representative DNA sequence >SLC492 (SLC4...92Q) /CSM/SL/SLC4-D/SLC492Q.Seq.d/ AAAAAAAAAATATACAAATAATGAATAAATTTTTAGCTTTGTTATTTGTTTTAGCTTTGT
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC432 (Link to dictyBase) - - - Contig-U09715-1 | Contig-U16382-1 SLC4...32P (Link to Original site) SLC432F 633 SLC432Z 188 SLC432P 821 - - Show SLC432 Library SL (Link to library) Clone ID SLC4...15-1 | Contig-U16382-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...32Q.Seq.d/ Representative seq. ID SLC432P (Link to Original site) Representative DNA sequence >SLC432 (SLC4...32Q) /CSM/SL/SLC4-B/SLC432Q.Seq.d/ ATTAAATTAAATAAAAAATAAAAATGGATGGTGAAGATGTTCAAGCTTTAGTTATTGATA
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC411 (Link to dictyBase) - - - Contig-U16272-1 SLC411Z (Link... to Original site) - - SLC411Z 486 - - - - Show SLC411 Library SL (Link to library) Clone ID SLC411 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC411Q.Seq.d/ Representative seq. ID SLC41...1Z (Link to Original site) Representative DNA sequence >SLC411 (SLC411Q) /CSM/SL/SLC4-A/SLC411Q.Seq.d/ XXXXX...vacuolar 4.0 %: peroxisomal >> prediction for SLC411 is nuc 5' end seq. ID - 5' e
Modeling serotonin uptake in the lung shows endothelial transporters dominate over cleft permeation
Bassingthwaighte, James B.
2013-01-01
A four-region (capillary plasma, endothelium, interstitial fluid, cell) multipath model was configured to describe the kinetics of blood-tissue exchange for small solutes in the lung, accounting for regional flow heterogeneity, permeation of cell membranes and through interendothelial clefts, and intracellular reactions. Serotonin uptake data from the Multiple indicator dilution “bolus sweep” experiments of Rickaby and coworkers (Rickaby DA, Linehan JH, Bronikowski TA, Dawson CA. J Appl Physiol 51: 405–414, 1981; Rickaby DA, Dawson CA, and Linehan JH. J Appl Physiol 56: 1170–1177, 1984) and Malcorps et al. (Malcorps CM, Dawson CA, Linehan JH, Bronikowski TA, Rickaby DA, Herman AG, Will JA. J Appl Physiol 57: 720–730, 1984) were analyzed to distinguish facilitated transport into the endothelial cells (EC) and the inhibition of tracer transport by nontracer serotonin in the bolus of injectate from the free uninhibited permeation through the clefts into the interstitial fluid space. The permeability-surface area products (PS) for serotonin via the inter-EC clefts were ∼0.3 ml·g−1·min−1, low compared with the transporter-mediated maximum PS of 13 ml·g−1·min−1 (with Km = ∼0.3 μM and Vmax = ∼4 nmol·g−1·min−1). The estimates of serotonin PS values for EC transporters from their multiple data sets were similar and were influenced only modestly by accounting for the cleft permeability in parallel. The cleft PS estimates in these Ringer-perfused lungs are less than half of those for anesthetized dogs (Yipintsoi T. Circ Res 39: 523–531, 1976) with normal hematocrits, but are compatible with passive noncarrier-mediated transport observed later in the same laboratory (Dawson CA, Linehan JH, Rickaby DA, Bronikowski TA. Ann Biomed Eng 15: 217–227, 1987; Peeters FAM, Bronikowski TA, Dawson CA, Linehan JH, Bult H, Herman AG. J Appl Physiol 66: 2328–2337, 1989) The identification and quantitation of the cleft pathway conductance from these
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC415 (Link to dictyBase) - - - Contig-U16521-1 SLC415E (Link... to Original site) - - - - - - SLC415E 210 Show SLC415 Library SL (Link to library) Clone ID SLC415 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC415Q.Seq.d/ Representative seq. ID SLC41...5E (Link to Original site) Representative DNA sequence >SLC415 (SLC415Q) /CSM/SL/SLC4-A/SLC415Q.Seq.d/ CCAAC...lkprdpskfqakkllpsk *iilfsl*k Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC415 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC434 (Link to dictyBase) - - - Contig-U15434-1 SLC434Z (Link... to Original site) - - SLC434Z 438 - - - - Show SLC434 Library SL (Link to library) Clone ID SLC434 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC434Q.Seq.d/ Representative seq. ID SLC43...4Z (Link to Original site) Representative DNA sequence >SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC434Q.Seq.d/ XXXXX...logy vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC4
Staud, Frantisek; Cerveny, Lukas; Ceckova, Martina
2012-11-01
Pharmacotherapy during pregnancy is often inevitable for medical treatment of the mother, the fetus or both. The knowledge of drug transport across placenta is, therefore, an important topic to bear in mind when deciding treatment in pregnant women. Several drug transporters of the ABC and SLC families have been discovered in the placenta, such as P-glycoprotein, breast cancer resistance protein, or organic anion/cation transporters. It is thus evident that the passage of drugs across the placenta can no longer be predicted simply on the basis of their physical-chemical properties. Functional expression of placental drug transporters in the trophoblast and the possibility of drug-drug interactions must be considered to optimize pharmacotherapy during pregnancy. In this review we summarize current knowledge on the expression and function of ABC and SLC transporters in the trophoblast. Furthermore, we put this data into context with medical conditions that require maternal and/or fetal treatment during pregnancy, such as gestational diabetes, HIV infection, fetal arrhythmias and epilepsy. Proper understanding of the role of placental transporters should be of great interest not only to clinicians but also to pharmaceutical industry for future drug design and development to control the degree of fetal exposure.
International Nuclear Information System (INIS)
Li, I-H.; Huang, W.-S.; Yeh, C.-B.; Liao, M.-H.; Chen, C.-C.; Shen, L.-H.; Liu, J.-C.; Ma, K.-H.
2009-01-01
Introduction: Parkinson's disease (PD) affects both dopaminergic and serotonergic systems. In this study, we simultaneously evaluated dopamine and serotonin transporters in primates using dual-isotope single-photon emission computed tomography (SPECT) imaging and compared the results with traditional single-isotope imaging. Methods: Four healthy and one 6-OHDA-induced PD monkeys were used for this study. SPECT was performed over 4 h after individual or simultaneous injection of [ 99m Tc]TRODAT-1 (a dopamine transporter imaging agent) and [ 123 I]ADAM (a serotonin transporter imaging agent). Results: The results showed that the image quality and uptake ratios in different brain regions were comparable between single- and dual-isotope studies. The striatal [ 99m Tc]TRODAT-1 uptake in the PD monkey was markedly lower than that in normal monkeys. The uptake of [ 123 I]ADAM in the midbrain of the PD monkey was comparable to that in the normal monkeys, but there were decreased uptakes in the thalamus and striatum of the PD monkey. Conclusions: Our results suggest that dual-isotope SPECT using [ 99m Tc]TRODAT-1 and [ 123 I]ADAM can simultaneously evaluate changes in dopaminergic and serotonergic systems in a PD model.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC407 (Link to dictyBase) - - - Contig-U16560-1 SLC407Z (Link... to Original site) - - SLC407Z 365 - - - - Show SLC407 Library SL (Link to library) Clone ID SLC407 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC407Q.Seq.d/ Representative seq. ID SLC40...7Z (Link to Original site) Representative DNA sequence >SLC407 (SLC407Q) /CSM/SL/SLC4-A/SLC407Q.Seq.d/ XXXXX...vvtkf*cqt e** Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC407 (SLC407Q) /CSM/SL/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC481 (Link to dictyBase) - - - Contig-U16358-1 SLC481Z (Link... to Original site) - - SLC481Z 393 - - - - Show SLC481 Library SL (Link to library) Clone ID SLC481 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC481Q.Seq.d/ Representative seq. ID SLC48...1Z (Link to Original site) Representative DNA sequence >SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ XXXXX...SL/SLG8-A/SLG820Q.Seq.d/ 708 0.0 SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ 708 0.0 SLC178 (SLC178Q) /CS
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC490 (Link to dictyBase) - - - Contig-U16444-1 SLC490Z (Link... to Original site) - - SLC490Z 427 - - - - Show SLC490 Library SL (Link to library) Clone ID SLC490 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC490Q.Seq.d/ Representative seq. ID SLC49...0Z (Link to Original site) Representative DNA sequence >SLC490 (SLC490Q) /CSM/SL/SLC4-D/SLC490Q.Seq.d/ XXXXX...itochondrial 24.0 %: cytoplasmic 24.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: plasma membrane 4.0 %: peroxisomal >> prediction for SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC484 (Link to dictyBase) - - - Contig-U15497-1 SLC484Z (Link... to Original site) - - SLC484Z 462 - - - - Show SLC484 Library SL (Link to library) Clone ID SLC484 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC484Q.Seq.d/ Representative seq. ID SLC48...4Z (Link to Original site) Representative DNA sequence >SLC484 (SLC484Q) /CSM/SL/SLC4-D/SLC484Q.Seq.d/ XXXXX...mic 32.0 %: mitochondrial 16.0 %: nuclear 4.0 %: peroxisomal 4.0 %: endoplasmic reticulum >> prediction for SLC4
Disruption of Slc52a3 gene causes neonatal lethality with riboflavin deficiency in mice
Yoshimatsu, Hiroki; Yonezawa, Atsushi; Yamanishi, Kaori; Yao, Yoshiaki; Sugano, Kumiko; Nakagawa, Shunsaku; Imai, Satoshi; Omura, Tomohiro; Nakagawa, Takayuki; Yano, Ikuko; Masuda, Satohiro; Inui, Ken-ichi; Matsubara, Kazuo
2016-01-01
Homeostasis of riboflavin should be maintained by transporters. Previous in vitro studies have elucidated basic information about riboflavin transporter RFVT3 encoded by SLC52A3 gene. However, the contribution of RFVT3 to the maintenance of riboflavin homeostasis and the significance in vivo remain unclear. Here, we investigated the physiological role of RFVT3 using Slc52a3 knockout (Slc52a3−/−) mice. Most Slc52a3−/− mice died with hyperlipidemia and hypoglycemia within 48 hr after birth. The...
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC418 (Link to dictyBase) - G01921 DDB0191271 Contig-U15820-1 SLC4...18E (Link to Original site) SLC418F 604 SLC418Z 554 SLC418P 1158 SLC418E 1076 Show SLC418 Library SL (L...ink to library) Clone ID SLC418 (Link to dictyBase) Atlas ID - NBRP ID G01921 dictyBase ID DDB0191271 Link t...o Contig Contig-U15820-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...18Q.Seq.d/ Representative seq. ID SLC418E (Link to Original site) Representative DNA sequence >SLC418 (SLC4
DEFF Research Database (Denmark)
Sørensen, Lena; Strømgaard, Kristian; Kristensen, Anders S
2014-01-01
In the central nervous system, synaptic levels of the monoamine neurotransmitter serotonin are mainly controlled by the serotonin transporter (SERT), and drugs used in the treatment of various psychiatric diseases have SERT as primary target. SERT is a phosphoprotein that undergoes phosphorylation....../dephosphorylation during transporter regulation by multiple pathways. In particular, activation and/or inhibition of kinases including PKC, PKG, p38MAPK, and CaMKII modulate SERT function and trafficking. The molecular mechanisms by which kinase activity is linked to SERT regulation are poorly understood, including...
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC442 (Link to dictyBase) - - - Contig-U16430-1 SLC442Z (Link... to Original site) - - SLC442Z 467 - - - - Show SLC442 Library SL (Link to library) Clone ID SLC442 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC442Q.Seq.d/ Representative seq. ID SLC44...2Z (Link to Original site) Representative DNA sequence >SLC442 (SLC442Q) /CSM/SL/SLC4-B/SLC442Q.Seq.d/ XXXXX... 4.0 %: extracellular, including cell wall 4.0 %: peroxisomal >> prediction for SLC4
DEFF Research Database (Denmark)
Nielsen, Kirsten; Brask, Dorthe; Knudsen, Gitte M.
2006-01-01
Tracking serotonergic pathways in the brain through immunodetection of serotonin has widely been used for the anatomical characterization of the serotonergic system. Immunostaining for serotonin is also frequently applied for the visualization of individual serotonin containing fibers...... and quantification of serotonin positive fibers has been widely used to detect changes in the serotonergic innervation. However, particularly in conditions with enhanced serotonin metabolism the detection level of serotonin may lead to an underestimation of the true number of serotonergic fibers. The serotonin...... immunostained for serotonin and SERT protein and colocalization was quantified in several brain areas by confocal microscopy. In comparison with untreated rats, MAO inhibitor treated rats had a significantly higher number (almost 200% increase) of serotonin immunopositive fibers whereas no difference...
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC465 (Link to dictyBase) - G01923 DDB0190872 Contig-U14177-1 SLC4...65P (Link to Original site) SLC465F 725 SLC465Z 393 SLC465P 1118 - - Show SLC465 Library SL (Link to library) Clone ID SLC4...Contig-U14177-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...65Q.Seq.d/ Representative seq. ID SLC465P (Link to Original site) Representative DNA sequence >SLC465 (SLC465Q) /CSM/SL/SLC4...-C/SLC465Q.Seq.d/ CGTTAACAGATTTTAATATTACTAATATTGTAGAAAATGATTTTAAATAAAGTAGCAAAA TGTTATG
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC426 (Link to dictyBase) - G01922 DDB0233225 Contig-U14991-1 SLC4...26E (Link to Original site) SLC426F 335 SLC426Z 320 SLC426P 655 SLC426E 335 Show SLC426 Library SL (Lin...Contig Contig-U14991-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...26Q.Seq.d/ Representative seq. ID SLC426E (Link to Original site) Representative DNA sequence >SLC426 (SLC4...26Q) /CSM/SL/SLC4-B/SLC426Q.Seq.d/ AAATAATAAATAGTAAATAATAAATAATAATAAATAATAATAATAATATTTNAAAATGGG
Garfield, Lauren D; Dixon, David; Nowotny, Petra; Lotrich, Francis E; Pollock, Bruce G; Kristjansson, Sean D; Doré, Peter M; Lenze, Eric J
2014-10-01
Antidepressant side effects are a significant public health issue, associated with poor adherence, premature treatment discontinuation, and, rarely, significant harm. Older adults assume the largest and most serious burden of medication side effects. We investigated the association between antidepressant side effects and genetic variation in the serotonin system in anxious, older adults participating in a randomized, placebo-controlled trial of the selective serotonin reuptake inhibitor (SSRI) escitalopram. Adults (N = 177) aged ≥ 60 years were randomized to active treatment or placebo for 12 weeks. Side effects were assessed using the Udvalg fur Kliniske Undersøgelser side-effect rating scale. Genetic polymorphisms were putative functional variants in the promoters of the serotonin transporter and 1A and 2A receptors (5-HTTLPR [L/S + rs25531], HTR1A rs6295, HTR2A rs6311, respectively). Four significant drug-placebo side-effect differences were found: increased duration of sleep, dry mouth, diarrhea, and diminished sexual desire. Analyses using putative high- versus low-transcription genotype groupings revealed six pharmacogenetic effects: greater dry mouth and decreased sexual desire for the low- and high-expressing serotonin transporter genotypes, respectively, and greater diarrhea with the 1A receptor low-transcription genotype. Diminished sexual desire was experienced significantly more by high-expressing genotypes in the serotonin transporter, 1A, or 2A receptors. There was not a significant relationship between drug concentration and side effects nor a mean difference in drug concentration between low- and high-expressing genotypes. Genetic variation in the serotonin system may predict who develops common SSRI side effects and why. More work is needed to further characterize this genetic modulation and to translate research findings into strategies useful for more personalized patient care. Published by Elsevier Inc.
DEFF Research Database (Denmark)
Mc Mahon, Brenda; Andersen, Sofie B.; Madsen, Martin K.
2016-01-01
controls with low seasonality scores and 17 patients diagnosed with seasonal affective disorder were scanned in both summer and winter to investigate differences in cerebral serotonin transporter binding across groups and across seasons. The two groups had similar cerebral serotonin transporter binding...... between summer and winter (Psex-(P = 0.02) and genotype-(P = 0.04) dependent. In the patients with seasonal affective disorder, the seasonal change in serotonin transporter binding was positively associated with change in depressive symptom...
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC451 (Link to dictyBase) - - - Contig-U16260-1 SLC451Z (Link... to Original site) - - SLC451Z 389 - - - - Show SLC451 Library SL (Link to library) Clone ID SLC451 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC451Q.Seq.d/ Representative seq. ID SLC45...1Z (Link to Original site) Representative DNA sequence >SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC451Q.Seq.d/ XXXXX... producing significant alignments: (bits) Value SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC474 (Link to dictyBase) - - - Contig-U01121-1 SLC474Z (Link... to Original site) - - SLC474Z 431 - - - - Show SLC474 Library SL (Link to library) Clone ID SLC474 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC474Q.Seq.d/ Representative seq. ID SLC47...4Z (Link to Original site) Representative DNA sequence >SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Seq.d/ XXXXX... Score E Sequences producing significant alignments: (bits) Value SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Se
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC425 (Link to dictyBase) - - - Contig-U16276-1 SLC425Z (Link... to Original site) - - SLC425Z 515 - - - - Show SLC425 Library SL (Link to library) Clone ID SLC425 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC425Q.Seq.d/ Representative seq. ID SLC42...5Z (Link to Original site) Representative DNA sequence >SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC425Q.Seq.d/ XXXXX...producing significant alignments: (bits) Value SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC4
Directory of Open Access Journals (Sweden)
Ram Jagannathan
2017-01-01
Full Text Available Rationale. Overall validity of existing genetic biomarkers in the diagnosis of obstructive sleep apnea (OSA remains unclear. The objective of this systematic genetic study is to identify “novel” biomarkers for OSA using systems biology approach. Methods. Candidate genes for OSA were extracted from PubMed, MEDLINE, and Embase search engines and DisGeNET database. The gene ontology (GO analyses and candidate genes prioritization were performed using Enrichr tool. Genes pertaining to the top 10 pathways were extracted and used for Ingenuity Pathway Analysis. Results. In total, we have identified 153 genes. The top 10 pathways associated with OSA include (i serotonin receptor interaction, (ii pathways in cancer, (iii AGE-RAGE signaling in diabetes, (iv infectious diseases, (v serotonergic synapse, (vi inflammatory bowel disease, (vii HIF-1 signaling pathway, (viii PI3-AKT signaling pathway, (ix regulation lipolysis in adipocytes, and (x rheumatoid arthritis. After removing the overlapping genes, we have identified 23 candidate genes, out of which >30% of the genes were related to the genes involved in the serotonin pathway. Among these 4 serotonin receptors SLC6A4, HTR2C, HTR2A, and HTR1B were strongly associated with OSA. Conclusions. This preliminary report identifies several potential candidate genes associated with OSA and also describes the possible regulatory mechanisms.
Finnema, Sjoerd J; Halldin, Christer; Bang-Andersen, Benny; Bundgaard, Christoffer; Farde, Lars
2015-11-01
A number of serotonin receptor positron emission tomography (PET) radioligands have been shown to be sensitive to changes in extracellular serotonin concentration, in a generalization of the well-known dopamine competition model. High doses of selective serotonin reuptake inhibitors (SSRIs) decrease serotonin receptor availability in monkey brain, consistent with increased serotonin concentrations. However, two recent studies on healthy human subjects, using a single, lower and clinically relevant SSRI dose, showed increased cortical serotonin receptor radioligand binding, suggesting potential decreases in serotonin concentration in projection regions when initiating treatment. The cross-species differential SSRI effect may be partly explained by serotonin transporter (SERT) occupancy in monkey brain being higher than is clinically relevant. We here determine SERT occupancy after single doses of escitalopram or citalopram by conducting PET measurements with [(11)C]MADAM in monkeys. Relationships between dose, plasma concentration and SERT occupancy were estimated by one-site binding analyses. Binding affinity was expressed as dose (ID50) or plasma concentration (K i) where 50 % SERT occupancy was achieved. Estimated ID50 and K i values were 0.020 mg/kg and 9.6 nmol/L for escitalopram and 0.059 mg/kg and 9.7 nmol/L for citalopram, respectively. Obtained K i values are comparable to values reported in humans. Escitalopram or citalopram doses nearly saturated SERT in previous monkey studies which examined serotonin sensitivity of receptor radioligands. PET-measured cross-species differential effects of SSRI on cortical serotonin concentration may thus be related to SSRI dose. Future monkey studies using SSRI doses inducing clinically relevant SERT occupancy may further illuminate the delayed onset of SSRI therapeutic effects.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC420 (Link to dictyBase) - G01085 DDB0205634 Contig-U01169-1 | Contig-U15736-1 SLC4...20P (Link to Original site) SLC420F 333 SLC420Z 423 SLC420P 756 - - Show SLC420 Libra...ry SL (Link to library) Clone ID SLC420 (Link to dictyBase) Atlas ID - NBRP ID G01085 dictyBase ID DDB020563...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC420Q.Seq.d/ Representative seq. ID SLC420P (Link to Original site) R...epresentative DNA sequence >SLC420 (SLC420Q) /CSM/SL/SLC4-A/SLC420Q.Seq.d/ GCTAGCACACACATAAATAATACATACACACAT
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC473 (Link to dictyBase) - - - Contig-U16054-1 SLC473F (Link to Original site) SLC4...73F 698 - - - - - - Show SLC473 Library SL (Link to library) Clone ID SLC473 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC473Q.Seq.d/ Representative seq. ID SLC47...3F (Link to Original site) Representative DNA sequence >SLC473 (SLC473Q) /CSM/SL/SLC4-D/SLC473Q.Seq.d/ AGAAA... CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC473 (SLC473Q) /CSM/SL/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC444 (Link to dictyBase) - - - Contig-U16368-1 SLC444Z (Link... to Original site) - - SLC444Z 462 - - - - Show SLC444 Library SL (Link to library) Clone ID SLC444 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC444Q.Seq.d/ Representative seq. ID SLC44...4Z (Link to Original site) Representative DNA sequence >SLC444 (SLC444Q) /CSM/SL/SLC4-B/SLC444Q.Seq.d/ XXXXX...tochondrial 8.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: cytoplasmic >> prediction for SLC444 is mit 5' end seq
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC409 (Link to dictyBase) - - - Contig-U14931-1 SLC409Z (Link... to Original site) - - SLC409Z 483 - - - - Show SLC409 Library SL (Link to library) Clone ID SLC409 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC409Q.Seq.d/ Representative seq. ID SLC40...9Z (Link to Original site) Representative DNA sequence >SLC409 (SLC409Q) /CSM/SL/SLC4-A/SLC409Q.Seq.d/ XXXXX... SLH501 (SLH501Q) /CSM/SL/SLH5-A/SLH501Q.Seq.d/ 858 0.0 SLF191 (SLF191Q) /CSM/SL/SLF1-D/SLF191Q.Seq.d/ 858 0.0 SLC409 (SLC4
Huang, Shasha; Han, Dongyi; Yuan, Yongyi; Wang, Guojian; Kang, Dongyang; Zhang, Xin; Yan, Xiaofei; Meng, Xiaoxiao; Dong, Min; Dai, Pu
2011-01-01
Abstract Background Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter) or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity). The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged ...
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC483 (Link to dictyBase) - - - Contig-U16486-1 SLC483F (Link to Original site) SLC4...83F 718 - - - - - - Show SLC483 Library SL (Link to library) Clone ID SLC483 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC483Q.Seq.d/ Representative seq. ID SLC48...3F (Link to Original site) Representative DNA sequence >SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ AAAAA...roducing significant alignments: (bits) Value SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ 1423 0.0 SLE651
Pagani, J H; Williams Avram, S K; Cui, Z; Song, J; Mezey, É; Senerth, J M; Baumann, M H; Young, W S
2015-02-01
Serotonin and oxytocin influence aggressive and anxiety-like behaviors, though it is unclear how the two may interact. That the oxytocin receptor is expressed in the serotonergic raphe nuclei suggests a mechanism by which the two neurotransmitters may cooperatively influence behavior. We hypothesized that oxytocin acts on raphe neurons to influence serotonergically mediated anxiety-like, aggressive and parental care behaviors. We eliminated expression of the oxytocin receptor in raphe neurons by crossing mice expressing Cre recombinase under control of the serotonin transporter promoter (Slc6a4) with our conditional oxytocin receptor knockout line. The knockout mice generated by this cross are normal across a range of behavioral measures: there are no effects for either sex on locomotion in an open-field, olfactory habituation/dishabituation or, surprisingly, anxiety-like behaviors in the elevated O and plus mazes. There was a profound deficit in male aggression: only one of 11 raphe oxytocin receptor knockouts showed any aggressive behavior, compared to 8 of 11 wildtypes. In contrast, female knockouts displayed no deficits in maternal behavior or aggression. Our results show that oxytocin, via its effects on raphe neurons, is a key regulator of resident-intruder aggression in males but not maternal aggression. Furthermore, this reduction in male aggression is quite different from the effects reported previously after forebrain or total elimination of oxytocin receptors. Finally, we conclude that when constitutively eliminated, oxytocin receptors expressed by serotonin cells do not contribute to baseline anxiety-like behaviors or maternal care. © 2015 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC448 (Link to dictyBase) - - - Contig-U15118-1 SLC448E (Link... to Original site) - - - - - - SLC448E 245 Show SLC448 Library SL (Link to library) Clone ID SLC448 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC448Q.Seq.d/ Representative seq. ID SLC44...8E (Link to Original site) Representative DNA sequence >SLC448 (SLC448Q) /CSM/SL/SLC4-B/SLC448Q.Seq.d/ GGTAA... %: nuclear 12.0 %: mitochondrial 8.0 %: cytoskeletal 4.0 %: endoplasmic reticulum >> prediction for SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC464 (Link to dictyBase) - - - Contig-U00917-1 SLC464Z (Link... to Original site) - - SLC464Z 406 - - - - Show SLC464 Library SL (Link to library) Clone ID SLC464 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC464Q.Seq.d/ Representative seq. ID SLC46...4Z (Link to Original site) Representative DNA sequence >SLC464 (SLC464Q) /CSM/SL/SLC4-C/SLC464Q.Seq.d/ XXXXX... Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC464 (SLC4
Directory of Open Access Journals (Sweden)
Mark J. McCann
2014-10-01
Full Text Available Inflammatory bowel disease (IBD is a chronic relapsing disease. Genetic predisposition to the disease reduces an individual’s capacity to respond appropriately to environmental challenges in the intestine leading to inappropriate inflammation. IBD patients often modify their diet to mitigate or reduce the severity of inflammation. Turmeric (Curcuma longa L., Zingiberaceae has historically been used in Chinese, Hindu, and Ayurvedic medicine over several centuries to treat inflammatory disorders. To understand how turmeric may influence the consequences of a genetic predisposition to inappropriate inflammation, we used HEK293 cells to examine the in vitro capacity of turmeric extract and fractions to affect the functionality of two gene variants, solute carrier protein 22 A4 (SLC22A4, rs1050152 and interleukin-10 (IL-10, rs1800896 associated with IBD. We found that a turmeric extract and several chromatographically separated fractions beneficially affected the variants of SLC22A4 and IL-10 associated with IBD, by reducing inappropriate epithelial cell transport (SLC22A4, 503F and increasing anti-inflammatory cytokine gene promoter activity (IL-10, −1082A. The effect of turmeric on the IL-10 variant was strongly associated with the curcumin content of the extract and its fractions.
McCann, Mark J; Johnston, Sarah; Reilly, Kerri; Men, Xuejing; Burgess, Elaine J; Perry, Nigel B; Roy, Nicole C
2014-10-13
Inflammatory bowel disease (IBD) is a chronic relapsing disease. Genetic predisposition to the disease reduces an individual's capacity to respond appropriately to environmental challenges in the intestine leading to inappropriate inflammation. IBD patients often modify their diet to mitigate or reduce the severity of inflammation. Turmeric (Curcuma longa L., Zingiberaceae) has historically been used in Chinese, Hindu, and Ayurvedic medicine over several centuries to treat inflammatory disorders. To understand how turmeric may influence the consequences of a genetic predisposition to inappropriate inflammation, we used HEK293 cells to examine the in vitro capacity of turmeric extract and fractions to affect the functionality of two gene variants, solute carrier protein 22 A4 (SLC22A4, rs1050152) and interleukin-10 (IL-10, rs1800896) associated with IBD. We found that a turmeric extract and several chromatographically separated fractions beneficially affected the variants of SLC22A4 and IL-10 associated with IBD, by reducing inappropriate epithelial cell transport (SLC22A4, 503F) and increasing anti-inflammatory cytokine gene promoter activity (IL-10, -1082A). The effect of turmeric on the IL-10 variant was strongly associated with the curcumin content of the extract and its fractions.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC470 (Link to dictyBase) - - - Contig-U15735-1 SLC470Z (Link... to Original site) - - SLC470Z 386 - - - - Show SLC470 Library SL (Link to library) Clone ID SLC470 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC470Q.Seq.d/ Representative seq. ID SLC47...0Z (Link to Original site) Representative DNA sequence >SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC470Q.Seq.d/ XXXXX...Seq.d/ 533 e-151 SLF229 (SLF229Q) /CSM/SL/SLF2-B/SLF229Q.Seq.d/ 533 e-151 SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC487 (Link to dictyBase) - - - Contig-U12865-1 SLC487Z (Link... to Original site) - - SLC487Z 404 - - - - Show SLC487 Library SL (Link to library) Clone ID SLC487 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC487Q.Seq.d/ Representative seq. ID SLC48...7Z (Link to Original site) Representative DNA sequence >SLC487 (SLC487Q) /CSM/SL/SLC4-D/SLC487Q.Seq.d/ XXXXX...1 0.0 SSF377 (SSF377Q) /CSM/SS/SSF3-D/SSF377Q.Seq.d/ 801 0.0 SLC492 (SLC492Q) /CSM/SL/SLC4-D/SLC4
Directory of Open Access Journals (Sweden)
Karen Miguita
2007-12-01
Full Text Available Family, twin and segregation analysis have provided evidences that genetic factors are implicated in the susceptibility for obsessive-compulsive disorder (OCD. Several lines of research suggest that the dopaminergic system may be involved in the pathophysiology of OCD. Thus, the aim of the present study was to investigate a possible association between a polymorphism located in intron 8 of the dopamine transporter gene (SLC6A3 and OCD in a Brazilian sample composed by 208 patients and 865 healthy controls. No statistically differences were observed in allelic and genotype distributions between cases and controls. No association was also observed when the sample was divided according to specific phenotypic features such as gender, presence of tic disorders co-morbidity and age at onset of obsessive-compulsive symptoms (OCS. Our results suggest that the intron 8 VNTR of the SLC6A3 investigated in this study is not related to the susceptibility for OCD in our Brazilian sample.Estudos de família, gêmeos e de segregação têm demonstrado que fatores genéticos estão envolvidos na susceptibilidade para o desenvolvimento do transtorno obsessivo-compulsivo (TOC. Várias linhas de pesquisa sugerem que o sistema dopaminérgico possa estar envolvido na fisiopatologia do TOC. Assim, o objetivo do presente estudo foi investigar uma possível associação entre o polimorfismo localizado no intron 8 do gene do transportador da dopamina (SLC6A3 e o TOC em uma amostra brasileira composta por 208 pacientes e 865 controles sadios. Nenhuma diferença estatisticamente significante foi observada nas distribuições alélicas e genotípicas entre os grupos de pacientes e controles. Nenhuma associação também foi observada quando as amostras foram divididas de acordo com características fenotípicas específicas, tais como gênero, presença de co-morbidade com tiques e idade de início dos sintomas obsessivo-compulsivo (SOC. Nossos resultados sugerem que o VNTR
Gonçalves, A C; Santos, R; O'Neill, A; Escada, P; Fialho, G; Caria, H
2016-06-01
Pendred syndrome (PS) is the second most common type of autosomal recessive syndromic hearing loss (HL). It is characterised by sensorineural HL and goiter with occasional hypothyroidism. These features are generally accompanied by malformations of the inner ear, as enlarged vestibular aqueduct (EVA). In about 50% of probands, mutations in the SLC26A4 gene are the cause of the disease. Here we report the case of a Portuguese female, aged 47, presenting with severe to profound HL and hypothyroidism. Her mother and sister, both deceased, had suffered from HL and goiter. By MRI and CT, an enlarged vestibular aqueduct and endolymphatic sac were observed. Molecular study of the patient included screening for GJB2 coding mutations and GJB6 common deletions followed by screening of all SLC26A4 exons, as well as intronic regions 8 and 14. Mutation c.918+2T>C was found for the first time in homozygosity in the intronic region 7 of the SLC26A4 gene. Whilst sequencing the control samples, a novel mutation c.821C>G was found in heterozygosity in the exon 7 of SLC26A4 gene and was predicted to be damaging. This study thus led to the finding of two novel SLC26A4 genotypes and provides new insight on the phenotypic features associated with PS. © Copyright by Società Italiana di Otorinolaringologia e Chirurgia Cervico-Facciale, Rome, Italy.
Conway, Christopher C.; Keenan-Miller, Danielle; Hammen, Constance; Lind, Penelope A.; Najman, Jake M.; Brennan, Patricia A.
2012-01-01
Despite consistent evidence that serotonin functioning affects stress reactivity and vulnerability to aggression, research on serotonin gene-stress interactions (G x E) in the development of aggression remains limited. The present study investigated variation in the promoter region of the serotonin transporter gene (5-HTTLPR) as a moderator of the…
Voltammetric and Mathematical Evidence for Dual Transport Mediation of Serotonin Clearance In Vivo
Wood, Kevin M.; Zeqja, Anisa; Nijhout, H. Frederik; Reed, Michael C.; Best, Janet; Hashemi, Parastoo
2014-01-01
The neurotransmitter serotonin underlies many of the brain’s functions. Understanding serotonin neurochemistry is important for improving treatments for neuropsychiatric disorders such as depression. Antidepressants commonly target serotonin clearance via serotonin transporters (SERTs) and have variable clinical effects. Adjunctive therapies, targeting other systems including serotonin autoreceptors, also vary clinically and carry adverse consequences. Fast scan cyclic voltammetry (FSCV) is particularly well suited for studying antidepressant effects on serotonin clearance and autoreceptors by providing real-time chemical information on serotonin kinetics in vivo. However, the complex nature of in vivo serotonin responses makes it difficult to interpret experimental data with established kinetic models. Here, we electrically stimulated the mouse medial forebrain bundle (MFB) to provoke and detect terminal serotonin in the substantia nigra reticulata (SNr). In response to MFB stimulation we found three dynamically distinct serotonin signals. To interpret these signals we developed a computational model that supports two independent serotonin reuptake mechanisms (high affinity, low efficiency reuptake mechanism and low affinity, high efficiency reuptake system) and bolsters an important inhibitory role for the serotonin autoreceptors. Our data and analysis, afforded by the powerful combination of voltammetric and theoretical methods, gives new understanding of the chemical heterogeneity of serotonin dynamics in the brain. This diverse serotonergic matrix likely contributes to clinical variability of antidepressants. PMID:24702305
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC429 (Link to dictyBase) - - - Contig-U09691-1 SLC429Z (Link... to Original site) - - SLC429Z 419 - - - - Show SLC429 Library SL (Link to library) Clone ID SLC429 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC429Q.Seq.d/ Representative seq. ID SLC42...9Z (Link to Original site) Representative DNA sequence >SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ XXXXX... significant alignments: (bits) Value SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ 708 0.0 SLC392 (SLC392Q
Serotonin transporter genotype, salivary cortisol, neuroticism and life events
DEFF Research Database (Denmark)
Vinberg, Maj; Miskowiak, Kamilla; Kessing, Lars Vedel
2014-01-01
OBJECTIVE: To investigate if cortisol alone or in interaction with other risk factors (familial risk, the serotonin transporter genotype, neuroticism and life events (LEs)) predicts onset of psychiatric disorder in healthy individuals at heritable risk. MATRIAL AND METHODS: In a high-risk study...
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC460 (Link to dictyBase) - - - - SLC460Z (Link to Original site) - - SLC4...60Z 333 - - - - Show SLC460 Library SL (Link to library) Clone ID SLC460 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...60Q.Seq.d/ Representative seq. ID SLC460Z (Link to Original site) R...epresentative DNA sequence >SLC460 (SLC460Q) /CSM/SL/SLC4-C/SLC460Q.Seq.d/ XXXXXXXXXXAATTATTATTGTGTAATTCCTGT
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC496 (Link to dictyBase) - - - - SLC496E (Link to Original site) - - - - - - SLC4...96E 443 Show SLC496 Library SL (Link to library) Clone ID SLC496 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...96Q.Seq.d/ Representative seq. ID SLC496E (Link to Original site) R...epresentative DNA sequence >SLC496 (SLC496Q) /CSM/SL/SLC4-D/SLC496Q.Seq.d/ AAGAAATTTGAATCACTCCAAATCATTATCCCA
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC449 (Link to dictyBase) - - - - SLC449Z (Link to Original site) - - SLC4...49Z 384 - - - - Show SLC449 Library SL (Link to library) Clone ID SLC449 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...49Q.Seq.d/ Representative seq. ID SLC449Z (Link to Original site) R...epresentative DNA sequence >SLC449 (SLC449Q) /CSM/SL/SLC4-C/SLC449Q.Seq.d/ XXXXXXXXXXGTAAAAAGGAACACCAAGCCACT
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC458 (Link to dictyBase) - - - Contig-U16279-1 SLC458Z (Link... to Original site) - - SLC458Z 508 - - - - Show SLC458 Library SL (Link to library) Clone ID SLC458 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC458Q.Seq.d/ Representative seq. ID SLC45...8Z (Link to Original site) Representative DNA sequence >SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ XXXXX...icant alignments: (bits) Value SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ 743
DEFF Research Database (Denmark)
Zhang, Peng; Jørgensen, Trine Nygaard; Løland, Claus Juul
2013-01-01
A novel fluorescent ligand was synthesized as a high-affinity, high specificity probe for visualizing the serotonin transporter (SERT). The rhodamine fluorophore was extended from an aniline substitution on the 5-position of the dihydroisobenzofuran ring of citalopram (2, 1-(3-(dimethylamino......)propyl)-1-(4-fluorophenyl)-1,3-dihydroisobenzofuran-5-carbonitrile), using an ethylamino linker. The resulting rhodamine-labeled ligand 8 inhibited [3H]5-HT uptake in COS-7 cells (Ki = 225 nM) with similar potency to the tropane-based JHC 1-064 (1), but with higher specificity towards the SERT relative...
Hollis-Moffatt, Jade E; Xu, Xin; Dalbeth, Nicola; Merriman, Marilyn E; Topless, Ruth; Waddell, Chloe; Gow, Peter J; Harrison, Andrew A; Highton, John; Jones, Peter B B; Stamp, Lisa K; Merriman, Tony R
2009-11-01
To examine the role of genetic variation in the renal urate transporter SLC2A9 in gout in New Zealand sample sets of Māori, Pacific Island, and Caucasian ancestry and to determine if the Māori and Pacific Island samples could be useful for fine-mapping. Patients (n= 56 Māori, 69 Pacific Island, and 131 Caucasian) were recruited from rheumatology outpatient clinics and satisfied the American College of Rheumatology criteria for gout. The control samples comprised 125 Māori subjects, 41 Pacific Island subjects, and 568 Caucasian subjects without arthritis. SLC2A9 single-nucleotide polymorphisms rs16890979 (V253I), rs5028843, rs11942223, and rs12510549 were genotyped (possible etiologic variants in Caucasians). Association of the major allele of rs16890979, rs11942223, and rs5028843 with gout was observed in all sample sets (P = 3.7 x 10(-7), 1.6 x 10(-6), and 7.6 x 10(-5) for rs11942223 in the Māori, Pacific Island, and Caucasian samples, respectively). One 4-marker haplotype (1/1/2/1; more prevalent in the Māori and Pacific Island control samples) was not observed in a single gout case. Our data confirm a role of SLC2A9 in gout susceptibility in a New Zealand Caucasian sample set, with the effect on risk (odds ratio >2.0) greater than previous estimates. We also demonstrate association of SLC2A9 with gout in samples of Māori and Pacific Island ancestry and a consistent pattern of haplotype association. The presence of both alleles of rs16890979 on susceptibility and protective haplotypes in the Māori and Pacific Island sample is evidence against a role for this nonsynonymous variant as the sole etiologic agent. More extensive linkage disequilibrium in Māori and Pacific Island samples suggests that Caucasian samples may be more useful for fine-mapping.
BDNF val66met association with serotonin transporter binding in healthy humans
DEFF Research Database (Denmark)
Fisher, P. M.; Ozenne, B.; Svarer, C.
2017-01-01
The serotonin transporter (5-HTT) is a key feature of the serotonin system, which is involved in behavior, cognition and personality and implicated in neuropsychiatric illnesses including depression. The brain-derived neurotrophic factor (BDNF) val66met and 5-HTTLPR polymorphisms have predicted......-carriers have increased subcortical 5-HTT binding. The small difference suggests limited statistical power may explain previously reported null effects. Our finding adds to emerging evidence that BDNF val66met contributes to differences in the human brain serotonin system, informing how variability in the 5-HTT...
Jaggumantri, Sravan; Dunbar, Mary; Edgar, Vanessa; Mignone, Cristina; Newlove, Theresa; Elango, Rajavel; Collet, Jean Paul; Sargent, Michael; Stockler-Ipsiroglu, Sylvia; van Karnebeek, Clara D M
2015-10-01
Creatine transporter (SLC6A8) deficiency is an X-linked inborn error of metabolism characterized by cerebral creatine deficiency, behavioral problems, seizures, hypotonia, and intellectual developmental disability. A third of patients are amenable to treatment with high-dose oral creatine, glycine, and L-arginine supplementation. Given the limited treatment response, we initiated an open-label observational study to evaluate the effect of adjunct S-adenosyl methionine to further enhance intracerebral creatine synthesis. Significant and reproducible issues with sleep and behavior were noted in both male patients on a dose of 50/mg/kg. One of the two patients stopped S-adenosyl methionine and did not come for any follow-up. A safe and tolerable dose (17 mg/kg/day) was identified in the other patient. On magnetic resonance spectroscopy, this 8-year-old male did not show an increase in intracerebral creatine. However, significant improvement in speech/language skills, muscle mass were observed as well as in personal outcomes as defined by the family in activities related to communication and decision making. Further research is needed to assess the potential of S-adenosyl methionine as an adjunctive therapy for creatine transporter deficiency patients and to define the optimal dose. Our study also illustrates the importance of pathophysiology-based treatment, individualized outcome assessment, and patient/family participation in rare diseases research. Copyright © 2015 Elsevier Inc. All rights reserved.
Sun, Baochun; Zhou, Chengyong; Dai, Zhiyao
2014-11-01
Explore the relationship between the pathogenic mutations of SLC26A4 gene and inner ear malformation, and analyze the feasibility of genetic testing to help current diagnosis in part of children with sensorineural hearing loss. 2094 cases of children were detected by SLC26A4 with the method of DNA sequence. CT phenotypes of those children were classified according to the method proposed by Sennaroglu. We analyzed the relationship between the pathogenic mutations of gene and the CT phenotypes. (1) 685 cases of inner ear malformations were found in 2094 cases of children with sensorineural hearing loss by CT examination (371 cases of cochlea malformation were consisted of the follow types of malformation. Michel deformity was 6 cases, cochlea aplasia was 8 cases, common cavity deformity was 12 cases, incomplete partition type I was 27 cases, cochlea hypoplasia was 30 cases and Mondini malformation was 288 cases); Vestibular aqueduct was 265 cases; Vestibular/semicircular canal/internal auditory canal were 49 cases, normal was 1409 cases. (2) The DNA sequence results revealed that 465 cases carried pathogenic mutations (Bi-allelic mutations) of SLC26A4 gene, among which 135 cases were homozygous, 330 cases were compound heterozygous. (3) Pathogenic mutations of SLC26A4 gene detected 100% (465/465) in the group related to vestibular aqueduct malformation. The results suggest that pathogenic mutation of SLC26A4 gene is closely related to the CT phenotype of vestibular aqueduct malformation. Detecting of pathogenic mutations for hearing loss is binging the possibility to identify children with inner malformations at an early stage. As a consequence, it will improve the current diagnosis and therapeutical option.
Jalali, Rozita; Lodder, Johannes C.; Zandieh-Doulabi, Behrouz; Micha, Dimitra; Melvin, James E.; Catalan, Marcelo A.; Mansvelder, Huibert D.; DenBesten, Pamela; Bronckers, Antonius
2017-01-01
Na+:K+:2Cl− cotransporters (NKCCs) belong to the SLC12A family of cation-coupled Cl− transporters. We investigated whether enamel-producing mouse ameloblasts express NKCCs. Transcripts for Nkcc1 were identified in the mouse dental epithelium by RT-qPCR and NKCC1 protein was immunolocalized in outer enamel epithelium and in the papillary layer but not the ameloblast layer. In incisors of Nkcc1-null mice late maturation ameloblasts were disorganized, shorter and the mineral density of the enamel was reduced by 10% compared to wild-type controls. Protein levels of gap junction protein connexin 43, Na+-dependent bicarbonate cotransporter e1 (NBCe1), and the Cl−-dependent bicarbonate exchangers SLC26A3 and SLC26A6 were upregulated in Nkcc1-null enamel organs while the level of NCKX4/SLC24A4, the major K+, Na+ dependent Ca2+ transporter in maturation ameloblasts, was slightly downregulated. Whole-cell voltage clamp studies on rat ameloblast-like HAT-7 cells indicated that bumetanide increased ion-channel activity conducting outward currents. Bumetanide also reduced cell volume of HAT-7 cells. We concluded that non-ameloblast dental epithelium expresses NKCC1 to regulate cell volume in enamel organ and provide ameloblasts with Na+, K+ and Cl− ions required for the transport of mineral- and bicarbonate-ions into enamel. Absence of functional Nkcc1 likely is compensated by other types of ion channels and ion transporters. The increased amount of Cx43 in enamel organ cells in Nkcc1-null mice suggests that these cells display a higher number of gap junctions to increase intercellular communication. PMID:29209227
Directory of Open Access Journals (Sweden)
Hassan Brim
Full Text Available Colon cancer is one of the leading causes of cancer related deaths. Its impact on African Americans (AAs is higher than in the general population both in the incidence and mortality from the disease. Colon cancer aggressiveness in AAs as well as non-frequent check-ups and follow up in this population have been proposed as ways to explain the observed discrepancies. These facts made the detection of early carcinogenesis markers in this population a priority.Here, we analyzed 50 colon adenomas from AA patients for both microsatellite instability (MSI and the methylation status of SLC5A8 gene. This gene's product is involved in the transport of butyrate that has anti-proliferative properties through its effects on histone acetylation and gene expression. A proteomic analysis to check the expressed histones in adenoma and normal tissues was also performed.The analyzed samples displayed 82% (n = 41 methylation level of SLC5A8 gene in adenomas. The MSI-H (high adenoma were about 18% (n = 9 while the rest were mostly MSS (microsatellite stable with few MSI-L (Low. No association was found between SLC5A8 methylation and the MSI status. Also, there was no association between SLC5A8 methylation and the sex and age of the patients. However, there were more right sided adenomas with SLC5A8 methylation than the left sided ones. The proteomic analysis revealed distinct histone expression profiles between normal and adenoma tissues.SLC5A8 is highly methylated in AA colon adenomas which points to its potential use as a marker for early detection. The MSI rate is similar to that found in colon cancer tumors in AAs. These findings suggest that both processes stem from the same epigenetic and genetic events occurring at an early stage in colon carcinogenesis in AAs.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC450 (Link to dictyBase) - - - Contig-U16382-1 SLC450Z (Link... to Original site) - - SLC450Z 416 - - - - Show SLC450 Library SL (Link to library) Clone ID SLC450 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC450Q.Seq.d/ Representative seq. ID SLC45...0Z (Link to Original site) Representative DNA sequence >SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ XXXXX...cant alignments: (bits) Value SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ 678 0.0 VFO858 (VFO858Q) /CSM/V
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC478 (Link to dictyBase) - - - Contig-U16419-1 SLC478Z (Link... to Original site) - - SLC478Z 400 - - - - Show SLC478 Library SL (Link to library) Clone ID SLC478 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC478Q.Seq.d/ Representative seq. ID SLC47...8Z (Link to Original site) Representative DNA sequence >SLC478 (SLC478Q) /CSM/SL/SLC4-D/SLC478Q.Seq.d/ XXXXX... %: cytoplasmic 28.0 %: nuclear 24.0 %: mitochondrial 12.0 %: cytoskeletal >> prediction for SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC455 (Link to dictyBase) - - - Contig-U16584-1 SLC455Z (Link... to Original site) - - SLC455Z 379 - - - - Show SLC455 Library SL (Link to library) Clone ID SLC455 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC455Q.Seq.d/ Representative seq. ID SLC45...5Z (Link to Original site) Representative DNA sequence >SLC455 (SLC455Q) /CSM/SL/SLC4-C/SLC455Q.Seq.d/ XXXXX...57 ) Dictyostelium discoideum slug cDNA, clone SLC469. 468 e-177 3 ( AU034549 ) Dictyostelium discoideum slug cDNA, clone SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC431 (Link to dictyBase) - - - Contig-U15865-1 SLC431Z (Link... to Original site) - - SLC431Z 405 - - - - Show SLC431 Library SL (Link to library) Clone ID SLC431 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC431Q.Seq.d/ Representative seq. ID SLC43...1Z (Link to Original site) Representative DNA sequence >SLC431 (SLC431Q) /CSM/SL/SLC4-B/SLC431Q.Seq.d/ XXXXX...omology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC431 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC477 (Link to dictyBase) - - - Contig-U16260-1 SLC477Z (Link... to Original site) - - SLC477Z 326 - - - - Show SLC477 Library SL (Link to library) Clone ID SLC477 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC477Q.Seq.d/ Representative seq. ID SLC47...7Z (Link to Original site) Representative DNA sequence >SLC477 (SLC477Q) /CSM/SL/SLC4-D/SLC477Q.Seq.d/ XXXXX...hfefsnivikskkkkkkkkkkkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC477 (SLC4
Ito, T; Nishio, A; Wangemann, P; Griffith, A J
2015-12-03
Hearing loss of patients with enlargement of the vestibular aqueduct (EVA) can fluctuate or progress, with overall downward progression. The most common detectable cause of EVA is mutations of SLC26A4. We previously described a transgenic Slc26a4-insufficient mouse model of EVA in which Slc26a4 expression is controlled by doxycycline administration. Mice that received doxycycline from conception until embryonic day 17.5 (DE17.5; doxycycline discontinued at embryonic day 17.5) had fluctuating hearing loss between 1 and 6 months of age with an overall downward progression after 6 months of age. In this study, we characterized the cochlear functional and structural changes underlying irreversible hearing loss in DE17.5 mice at 12 months of age. The endocochlear potential was decreased and inversely correlated with auditory brainstem response thresholds. The stria vascularis was thickened and edematous in ears with less severe hearing loss, and thinned and atrophic in ears with more severe hearing loss. There were pathologic changes in marginal cell morphology and gene expression that were not observed at 3 months. We conclude that strial dysfunction and degeneration are the primary causes of irreversible progressive hearing loss in our Slc26a4-insufficient mouse model of EVA. This model of primary strial atrophy may be used to explore the mechanisms of progressive hearing loss due to strial dysfunction. Published by Elsevier Ltd.
DEFF Research Database (Denmark)
Rahbek-Clemmensen, Troels; Bay, Tina; Eriksen, Jacob
2014-01-01
The serotonin transporter (SERT) plays a critical role in regulating serotonin signaling by mediating reuptake of serotonin from the extracellular space. The molecular and cellular mechanisms controlling SERT levels in the membrane remain poorly understood. To study trafficking of surface resident...... SERT, two functional epitope tagged variants were generated. Fusion of a FLAG-tagged one-transmembrane segment protein Tac to the SERT N-terminus generated a transporter with an extracellular epitope suited for trafficking studies (TacSERT). Likewise, a construct with an extracellular antibody epitope...
Annamalai, Balasubramaniam; Mannangatti, Padmanabhan; Arapulisamy, Obulakshmi; Shippenberg, Toni S.; Jayanthi, Lankupalle D.
2012-01-01
The serotonin (5-HT) transporter (SERT) regulates serotoninergic neurotransmission by clearing 5-HT released into the synaptic space. Phosphorylation of SERT on serine and threonine mediates SERT regulation. Whether tyrosine phosphorylation regulates SERT is unknown. Here, we tested the hypothesis that tyrosine-phosphorylation of SERT regulates 5-HT transport. In support of this, alkali-resistant 32P-labeled SERT was found in rat platelets, and Src-tyrosine kinase inhibitor 4-amino-5-(4-chlorophenyl)-7-(t-butyl)pyrazolo [3,4,d]pyrimidine (PP2) decreased platelet SERT function and expression. In human placental trophoblast cells expressing SERT, PP2 reduced transporter function, expression, and stability. Although siRNA silencing of Src expression decreased SERT function and expression, coexpression of Src resulted in PP2-sensitive increases in SERT function and expression. PP2 treatment markedly decreased SERT protein stability. Compared with WT-SERT, SERT tyrosine mutants Y47F and Y142F exhibited reduced 5-HT transport despite their higher total and cell surface expression levels. Moreover, Src-coexpression increased total and cell surface expression of Y47F and Y142F SERT mutants without affecting their 5-HT transport capacity. It is noteworthy that Y47F and Y142F mutants exhibited higher protein stability compared with WT-SERT. However, similar to WT-SERT, PP2 treatment decreased the stability of Y47F and Y142F mutants. Furthermore, compared with WT-SERT, Y47F and Y142F mutants exhibited lower basal tyrosine phosphorylation and no further enhancement of tyrosine phosphorylation in response to Src coexpression. These results provide the first evidence that SERT tyrosine phosphorylation supports transporter protein stability and 5HT transport. PMID:21992875
Directory of Open Access Journals (Sweden)
Thomas Lundåsen
Full Text Available Interruption of the enterohepatic circulation of bile acids increases cholesterol catabolism, thereby stimulating hepatic cholesterol synthesis from acetate. We hypothesized that such treatment should lower the hepatic acetate pool which may alter triglyceride and glucose metabolism. We explored this using mice deficient of the ileal sodium-dependent BA transporter (Slc10a2 and ob/ob mice treated with a specific inhibitor of Slc10a2. Plasma TG levels were reduced in Slc10a2-deficient mice, and when challenged with a sucrose-rich diet, they displayed a reduced response in hepatic TG production as observed from the mRNA levels of several key enzymes in fatty acid synthesis. This effect was paralleled by a diminished induction of mature sterol regulatory element-binding protein 1c (Srebp1c. Unexpectedly, the SR-diet induced intestinal fibroblast growth factor (FGF 15 mRNA and normalized bile acid synthesis in Slc10a2-/- mice. Pharmacologic inhibition of Slc10a2 in diabetic ob/ob mice reduced serum glucose, insulin and TGs, as well as hepatic mRNA levels of Srebp1c and its target genes. These responses are contrary to those reported following treatment of mice with a bile acid binding resin. Moreover, when key metabolic signal transduction pathways in the liver were investigated, those of Mek1/2-Erk1/2 and Akt were blunted after treatment of ob/ob mice with the Slc10a2 inhibitor. It is concluded that abrogation of Slc10a2 reduces hepatic Srebp1c activity and serum TGs, and in the diabetic ob/ob model it also reduces glucose and insulin levels. Hence, targeting of Slc10a2 may be a promising strategy to treat hypertriglyceridemia and diabetes.
Differential SLC1A2 Promoter Methylation in Bipolar Disorder With or Without Addiction
Directory of Open Access Journals (Sweden)
Yun-Fang Jia
2017-07-01
Full Text Available While downregulation of excitatory amino acid transporter 2 (EAAT2, the main transporter removing glutamate from the synapse, has been recognized in bipolar disorder (BD, the underlying mechanisms of downregulation have not been elucidated. BD is influenced by environmental factors, which may, via epigenetic modulation of gene expression, differentially affect illness presentation. This study thus focused on epigenetic DNA methylation regulation of SLC1A2, encoding for EAAT2, in BD with variable environmental influences of addiction. High resolution melting PCR (HRM-PCR and thymine–adenine (TA cloning with sequence analysis were conducted to examine methylation of the promoter region of the SLC1A2. DNA was isolated from blood samples drawn from BD patients (N = 150 with or without addiction to alcohol, nicotine, or food, defined as binge eating, and matched controls (N = 32. In comparison to controls, the SLC1A2 promoter region was hypermethylated in BD without addiction but was hypomethylated in BD with addiction. After adjusting for age and sex, the association of methylation levels with nicotine addiction (p = 0.0009 and binge eating (p = 0.0002 remained significant. Consistent with HRM-PCR, direct sequencing revealed increased methylation in CpG site 6 in BD, but decreased methylation in three CpG sites (6, 48, 156 in BD with alcohol and nicotine addictions. These results suggest that individual point methylation within the SLC1A2 promoter region may be modified by exogenous addiction and may have a potential for developing clinically valuable epigenetic biomarkers for BD diagnosis and monitoring.
DEFF Research Database (Denmark)
Madsen, Karine; Erritzøe, David Frederik; Mortensen, Erik Lykke
2011-01-01
Pharmacological manipulation of serotonergic neurotransmission in healthy volunteers impacts on cognitive test performance. Specifically, markers of serotonin function are associated with attention and executive functioning, long-term memory, and general cognitive ability. The serotonin transporter...
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC433 (Link to dictyBase) - - - Contig-U16397-1 SLC433Z (Link... to Original site) - - SLC433Z 613 - - - - Show SLC433 Library SL (Link to library) Clone ID SLC433 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC433Q.Seq.d/ Representative seq. ID SLC43...3Z (Link to Original site) Representative DNA sequence >SLC433 (SLC433Q) /CSM/SL/SLC4-B/SLC433Q.Seq.d/ XXXXX...tyostelium discoideum slug cDNA, clone SLH872. 1134 0.0 1 ( AU034279 ) Dictyostelium discoideum slug cDNA, clone SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC438 (Link to dictyBase) - - - Contig-U10771-1 SLC438Z (Link... to Original site) - - SLC438Z 549 - - - - Show SLC438 Library SL (Link to library) Clone ID SLC438 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC438Q.Seq.d/ Representative seq. ID SLC43...8Z (Link to Original site) Representative DNA sequence >SLC438 (SLC438Q) /CSM/SL/SLC4-B/SLC438Q.Seq.d/ XXXXX...es producing significant alignments: (bits) Value SSM825 (SSM825Q) /CSM/SS/SSM8-B/SSM825Q.Seq.d/ 948 0.0 SLC438 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC440 (Link to dictyBase) - G22407 DDB0231506 Contig-U13322-1 | Contig-U16512-1 SLC4...40P (Link to Original site) SLC440F 491 SLC440Z 449 SLC440P 940 - - Show SLC440 Libra...ry SL (Link to library) Clone ID SLC440 (Link to dictyBase) Atlas ID - NBRP ID G22407 dictyBase ID DDB023150...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC440Q.Seq.d/ Representative seq. ID SLC440P (Link to Original site) R...epresentative DNA sequence >SLC440 (SLC440Q) /CSM/SL/SLC4-B/SLC440Q.Seq.d/ GGAGATTTCACCACCACCAACAGAACAACACCA
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC480 (Link to dictyBase) - - - Contig-U13538-1 SLC480Z (Link... to Original site) - - SLC480Z 455 - - - - Show SLC480 Library SL (Link to library) Clone ID SLC480 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC480Q.Seq.d/ Representative seq. ID SLC48...0Z (Link to Original site) Representative DNA sequence >SLC480 (SLC480Q) /CSM/SL/SLC4-D/SLC480Q.Seq.d/ XXXXX...ial 8.0 %: peroxisomal >> prediction for SLC480 is nuc 5' end seq. ID - 5' end seq. - Length of 5' end seq. - 3' end seq. ID SLC4
The serotonin transporter and early life stress : Translational perspectives
Houwing, Danielle J; Buwalda, Bauke; Zee, van der Eddy; de Boer, Sietse F; Olivier, Jocelien D A
2017-01-01
The interaction between the serotonin transporter (SERT) linked polymorphic region (5-HTTLPR) and adverse early life stressing (ELS) events is associated with enhanced stress susceptibility and risk to develop mental disorders like major depression, anxiety, and aggressiveness. In particular, human
Energy Technology Data Exchange (ETDEWEB)
Li, I-H. [Graduate Institute of Medical Sciences, National Defense Medical Center, Taipei 114, Taiwan (China); Huang, W.-S. [Department of Nuclear Medicine, Tri-Service General Hospital, Taipei, 114, Taiwan (China); Yeh, C.-B. [Department of Psychiatry, Tri-Service General Hospital, Taipei, 114, Taiwan (China); Liao, M.-H.; Chen, C.-C.; Shen, L.-H. [Division of Isotope Application, Institute of Nuclear Energy Research, Taoyaun, 325 Taiwan (China); Liu, J.-C. [Department of Biology and Anatomy, National Defense Medical Center, Taipei 114, Taiwan (China); Ma, K.-H. [Department of Biology and Anatomy, National Defense Medical Center, Taipei 114, Taiwan (China)], E-mail: kuohsing91@yahoo.com.tw
2009-08-15
Introduction: Parkinson's disease (PD) affects both dopaminergic and serotonergic systems. In this study, we simultaneously evaluated dopamine and serotonin transporters in primates using dual-isotope single-photon emission computed tomography (SPECT) imaging and compared the results with traditional single-isotope imaging. Methods: Four healthy and one 6-OHDA-induced PD monkeys were used for this study. SPECT was performed over 4 h after individual or simultaneous injection of [{sup 99m}Tc]TRODAT-1 (a dopamine transporter imaging agent) and [{sup 123}I]ADAM (a serotonin transporter imaging agent). Results: The results showed that the image quality and uptake ratios in different brain regions were comparable between single- and dual-isotope studies. The striatal [{sup 99m}Tc]TRODAT-1 uptake in the PD monkey was markedly lower than that in normal monkeys. The uptake of [{sup 123}I]ADAM in the midbrain of the PD monkey was comparable to that in the normal monkeys, but there were decreased uptakes in the thalamus and striatum of the PD monkey. Conclusions: Our results suggest that dual-isotope SPECT using [{sup 99m}Tc]TRODAT-1 and [{sup 123}I]ADAM can simultaneously evaluate changes in dopaminergic and serotonergic systems in a PD model.
Genetic variations in the MCT1 (SLC16A1) gene in the Chinese population of Singapore.
Lean, Choo Bee; Lee, Edmund Jon Deoon
2009-01-01
MCT1(SLC16A1) is the first member of the monocarboxylate transporter (MCT) and its family is involved in the transportation of metabolically important monocarboxylates such as lactate, pyruvate, acetate and ketone bodies. This study identifies genetic variations in SLC16A1 in the ethnic Chinese group of the Singaporean population (n=95). The promoter, coding region and exon-intron junctions of the SLC16A1 gene encoding the MCT1 transporter were screened for genetic variation in the study population by DNA sequencing. Seven genetic variations of SLC16A1, including 4 novel ones, were found: 2 in the promoter region, 2 in the coding exons (both nonsynonymous variations), 2 in the 3' untranslated region (3'UTR) and 1 in the intron. Of the two mutations detected in the promoter region, the -363-855T>C is a novel mutation. The 1282G>A (Val(428)Ile) is a novel SNP and was found as heterozygotic in 4 subjects. The 1470T>A (Asp(490)Glu) was found to be a common polymorphism in this study. Lastly, IVS3-17A>C in intron 3 and 2258 (755)A>G in 3'UTR are novel mutations found to be common polymorphisms in the local Chinese population. To our knowledge, this is the first report of a comprehensive analysis on the MCT1 gene in any population.
Hurba, Olha; Mancikova, Andrea; Krylov, Vladimir; Pavlikova, Marketa; Pavelka, Karel; Stibůrková, Blanka
2014-01-01
Using European descent Czech populations, we performed a study of SLC2A9 and SLC22A12 genes previously identified as being associated with serum uric acid concentrations and gout. This is the first study of the impact of non-synonymous allelic variants on the function of GLUT9 except for patients suffering from renal hypouricemia type 2. The cohort consisted of 250 individuals (150 controls, 54 nonspecific hyperuricemics and 46 primary gout and/or hyperuricemia subjects). We analyzed 13 exons of SLC2A9 (GLUT9 variant 1 and GLUT9 variant 2) and 10 exons of SLC22A12 by PCR amplification and sequenced directly. Allelic variants were prepared and their urate uptake and subcellular localization were studied by Xenopus oocytes expression system. The functional studies were analyzed using the non-parametric Wilcoxon and Kruskall-Wallis tests; the association study used the Fisher exact test and linear regression approach. We identified a total of 52 sequence variants (12 unpublished). Eight non-synonymous allelic variants were found only in SLC2A9: rs6820230, rs2276961, rs144196049, rs112404957, rs73225891, rs16890979, rs3733591 and rs2280205. None of these variants showed any significant difference in the expression of GLUT9 and in urate transport. In the association study, eight variants showed a possible association with hyperuricemia. However, seven of these were in introns and the one exon located variant, rs7932775, did not show a statistically significant association with serum uric acid concentration. Our results did not confirm any effect of SLC22A12 and SLC2A9 variants on serum uric acid concentration. Our complex approach using association analysis together with functional and immunohistochemical characterization of non-synonymous allelic variants did not show any influence on expression, subcellular localization and urate uptake of GLUT9.
Rationality and emotionality: serotonin transporter genotype influences reasoning bias.
Stollstorff, Melanie; Bean, Stephanie E; Anderson, Lindsay M; Devaney, Joseph M; Vaidya, Chandan J
2013-04-01
Reasoning often occurs under emotionally charged, opinion-laden circumstances. The belief-bias effect indexes the extent to which reasoning is based upon beliefs rather than logical structure. We examined whether emotional content increases this effect, particularly for adults genetically predisposed to be more emotionally reactive. SS/SL(G) carriers of the serotonin transporter genotype (5-HTTLPR) were less accurate selectively for evaluating emotional relational reasoning problems with belief-logic conflict relative to L(A)L(A) carriers. Trait anxiety was positively associated with emotional belief-bias, and the 5-HTTLPR genotype significantly accounted for the variance in this association. Thus, deductive reasoning, a higher cognitive ability, is sensitive to differences in emotionality rooted in serotonin neurotransmitter function.
Central serotonin and dopamine transporters in overeating, obesity and insulin resistance
Koopman, K.E.M.
2014-01-01
The objectives of this thesis were to study cerebral serotonin transporters (SERT) in the diencephalon and striatal dopamine transporters (DAT) in humans in different metabolic conditions (i.e. lean, obese and insulin resistant state) in relation to feeding behavior and to investigate the early
DEFF Research Database (Denmark)
Cumming, Paul; Møller, Mette; Benda, Kjeld
2007-01-01
The psychostimulant 3,4-methylendioxymethamphetamine (MDMA, "ecstasy") evokes degeneration of telencephalic serotonin innervations in rodents, nonhuman primates, and human recreational drug users. However, there has been no alternative to nonhuman primates for studies of the cognitive and neuroch......The psychostimulant 3,4-methylendioxymethamphetamine (MDMA, "ecstasy") evokes degeneration of telencephalic serotonin innervations in rodents, nonhuman primates, and human recreational drug users. However, there has been no alternative to nonhuman primates for studies of the cognitive...... with MDMA (i.m.), administered at a range of doses. In parallel PET studies, [(11)C]WAY-100635 was used to map the distribution of serotonin 5HT(1A) receptors. The acute MDMA treatment in awake pigs evoked 1 degrees C of hyperthermia. MDMA at total doses greater than 20 mg/kg administered over 2-4 days...... reduced the binding potential (pB) of [(11)C]DASB for serotonin transporters in porcine brain. A mean total dose of 42 mg/kg MDMA in four animals evoked a mean 32% decrease in [(11)C]DASB pB in mesencephalon and diencephalon, and a mean 53% decrease in telencephalic structures. However, this depletion...
Brain serotonin 4 receptor binding is associated with the cortisol awakening response
DEFF Research Database (Denmark)
Jakobsen, Gustav R; Fisher, Patrick M; Dyssegaard, Agnete
2016-01-01
Serotonin signalling is considered critical for an appropriate and dynamic adaptation to stress. Previously, we have shown that prefrontal serotonin transporter (SERT) binding is positively associated with the cortisol awakening response (CAR) (Frokjaer et al., 2013), which is an index of hypotha...
Pang, Xiuhong; Chai, Yongchuan; He, Longxia; Chen, Penghui; Wang, Xiaowen; Li, Lei; Jia, Huan; Wu, Hao; Yang, Tao
2015-12-01
To investigate the genetic cause of the patients with non-syndromic enlarged vestibular aqueduct (EVA) but without bi-allelic SLC26A4 mutations. Presence of a homozygous genomic deletion was detected in a Chinese Han deaf patient (D1467-1) who failed to amplify the first three exons of SLC26A4. The breakpoints of the deletion were fine-mapped and revealed by PCR amplification and sequencing. This deletion was subsequently screened in 22 Chinese Han EVA probands with mono-allelic SLC26A4 mutations. The possible founder effect of the newly identified genomic deletion was evaluated by haplotype analysis. A homozygous c.-2071_307+3801del7666 deletion of SLC26A4 was identified in patient D1467-1. This novel genomic deletion was subsequently identified in 18% (4/22) of the Chinese Han EVA probands with mono-allelic SLC26A4 mutations. Haplotype analysis showed that this genomic deletion is likely a founder mutation in Chinese Hans. Our results suggested that the cryptic c.-2071_307+3801del7666 deletion of SLC26A4 is relatively frequent in Chinese Han non-syndromic EVA patients without bi-allelic SLC26A4 mutations. Screening of this genomic deletion should be incorporated into the routine DNA testing of SLC26A4 in Chinese Hans. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Ganaha, Akira; Kaname, Tadashi; Yanagi, Kumiko; Naritomi, Kenji; Tono, Tetsuya; Usami, Shin-ichi; Suzuki, Mikio
2013-05-24
Pendred syndrome (PS) and nonsyndromic hearing loss associated with enlarged vestibular aqueduct (EVA) are caused by SLC26A4 mutations. The Okinawa Islands are the southwestern-most islands of the Japanese archipelago. And ancestral differences have been reported between people from Okinawa Island and those from the main islands of Japan. To confirm the ethnic variation of the spectrum of SLC26A4 mutations, we investigated the frequencies of SLC26A4 mutations and clinical manifestations of patients with EVA or PS living in the Okinawa Islands. We examined 22 patients with EVA or PS from 21 unrelated families in Okinawa Islands. The patient's clinical history, findings of physical and otoscopic examinations, hearing test, and computed tomography (CT) scan of the temporal bones were recorded. To detect mutations, all 21 exons and the exon-intron junctions of SLC26A4 were sequenced for all subjects. Quantitative reverse-transcription polymerase chain reaction (qRT-PCR) for SLC26A4 and calculations using the comparative CT (2(-ΔΔCT)) method were used to determine the pathogenicity associated with gene substitutions. SLC26A4 mutations were identified in 21 of the 22 patients. We found a compound heterozygous mutation for IVS15 + 5G > A/H723R in nine patients (41%), a homozygous substitution of IVS15 + 5G > A in six patients (27%), and homozygous mutation for H723R in five patients (23%). The most prevalent types of SLC26A4 alleles were IVS15 + 5G > A and H723R, which both accounted for 15/22 (68%) of the patients. There were no significant correlations between the types of SLC26A4 mutation and clinical manifestations. Based on qRT-PCR results, expression of SLC26A4 was not identified in patients with the homozygous substitution of IVS15 + 5G > A. The substitution of IVS15 + 5G > A in SLC26A4 was the most common mutation in uniquely found in patients with PS and EVA in Okinawa Islands. This suggested that the spectrum of SLC26A4 mutation differed
Cation-Coupled Bicarbonate Transporters
Aalkjaer, Christian; Boedtkjer, Ebbe; Choi, Inyeong; Lee, Soojung
2014-01-01
Cation-coupled HCO3− transport was initially identified in the mid-1970s when pioneering studies showed that acid extrusion from cells is stimulated by CO2/HCO3− and associated with Na+ and Cl− movement. The first Na+-coupled bicarbonate transporter (NCBT) was expression-cloned in the late 1990s. There are currently five mammalian NCBTs in the SLC4-family: the electrogenic Na,HCO3-cotransporters NBCe1 and NBCe2 (SLC4A4 and SLC4A5 gene products); the electroneutral Na,HCO3-cotransporter NBCn1 ...
DEFF Research Database (Denmark)
Ziebell, Morten; Holm-Hansen, Signe; Thomsen, Gerda
2010-01-01
Current SPECT radioligands available for in vivo imaging of the dopamine transporter (DAT) also show affinity for monoamine transporters other than DAT, especially the serotonin transporter (SERT). The effect of this lack of selectivity for in vivo imaging is unknown. In this study, we compared...
DEFF Research Database (Denmark)
Benghezal, Mohammed; Roubaty, Carole; Veepuri, Vijayanath
2007-01-01
Phosphatidic acid is the intermediate, from which all glycerophospholipids are synthesized. In yeast, it is generated from lysophosphatidic acid, which is acylated by Slc1p, an sn-2-specific, acyl-coenzyme A-dependent 1-acylglycerol-3-phosphate O-acyltransferase. Deletion of SLC1 is not lethal...
Directory of Open Access Journals (Sweden)
Dale W Hailey
Full Text Available Mechanosensory hair cell death is a leading cause of hearing and balance disorders in the human population. Hair cells are remarkably sensitive to environmental insults such as excessive noise and exposure to some otherwise therapeutic drugs. However, individual responses to damaging agents can vary, in part due to genetic differences. We previously carried out a forward genetic screen using the zebrafish lateral line system to identify mutations that alter the response of larval hair cells to the antibiotic neomycin, one of a class of aminoglycoside compounds that cause hair cell death in humans. The persephone mutation confers resistance to aminoglycosides. 5 dpf homozygous persephone mutants are indistinguishable from wild-type siblings, but differ in their retention of lateral line hair cells upon exposure to neomycin. The mutation in persephone maps to the chloride/bicarbonate exchanger slc4a1b and introduces a single Ser-to-Phe substitution in zSlc4a1b. This mutation prevents delivery of the exchanger to the cell surface and abolishes the ability of the protein to import chloride across the plasma membrane. Loss of function of zSlc4a1b reduces hair cell death caused by exposure to the aminoglycosides neomycin, kanamycin, and gentamicin, and the chemotherapeutic drug cisplatin. Pharmacological block of anion transport with the disulfonic stilbene derivatives DIDS and SITS, or exposure to exogenous bicarbonate, also protects hair cells against damage. Both persephone mutant and DIDS-treated wild-type larvae show reduced uptake of labeled aminoglycosides. persephone mutants also show reduced FM1-43 uptake, indicating a potential impact on mechanotransduction-coupled activity in the mutant. We propose that tight regulation of the ionic environment of sensory hair cells, mediated by zSlc4a1b activity, is critical for their sensitivity to aminoglycoside antibiotics.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC461 (Link to dictyBase) - - - Contig-U16382-1 SLC461Z (Link... to Original site) - - SLC461Z 386 - - - - Show SLC461 Library SL (Link to library) Clone ID SLC461 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC461Q.Seq.d/ Representative seq. ID SLC46...1Z (Link to Original site) Representative DNA sequence >SLC461 (SLC461Q) /CSM/SL/SLC4-C/SLC461Q.Seq.d/ XXXXX...e-155 2 ( AU034553 ) Dictyostelium discoideum slug cDNA, clone SLC461. 531 e-155 2 ( AU052473 ) Dictyosteliu
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC437 (Link to dictyBase) - - - Contig-U16397-1 SLC437Z (Link... to Original site) - - SLC437Z 622 - - - - Show SLC437 Library SL (Link to library) Clone ID SLC437 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC437Q.Seq.d/ Representative seq. ID SLC43...7Z (Link to Original site) Representative DNA sequence >SLC437 (SLC437Q) /CSM/SL/SLC4-B/SLC437Q.Seq.d/ XXXXX...scoideum slug cDNA, clone SLC437. 1158 0.0 1 ( AU033994 ) Dictyostelium discoideum slug cDNA, clone SLB708.
Directory of Open Access Journals (Sweden)
Mizuno T
2015-07-01
Full Text Available Tomohiro Mizuno,1–3 Waichi Sato,2,3 Kazuhiro Ishikawa,4 Yuki Terao,1 Kazuo Takahashi,2 Yukihiro Noda,5 Yukio Yuzawa,2 Tadashi Nagamatsu1 1Department of Analytical Pharmacology, Meijo University Faculty of Pharmacy, Nagoya, 2Department of Nephrology, School of Medicine, Fujita Health University, Toyoake, 3Department of Nephrology, Nagoya University School of Medicine, Nagoya, 4Department of Neuropsychopharmacology and Hospital Pharmacy, Nagoya University Graduate School of Medicine, Nagoya, 5Division of Clinical Sciences and Neuropsychopharmacology, Meijo University Faculty of Pharmacy, Nagoya, Japan Background/aim: To elucidate the mechanism responsible for developing acute kidney injury in patients with diabetes mellitus, we also evaluated the issue of whether advanced glycation endproducts (AGEs influence the expressions of multi antimicrobial extrusion protein (MATE1/SLC47A1 in tubular cells. Materials and methods: To detect changing expression of MATE1/SLC47A1 in dose- and time-dependent manners, human proximal tubular epithelial cells were incubated with AGE-aggregated-human serum albumin. As a function assay for MATE1/SLC47A1, human proximal tubular epithelial cells were incubated with cisplatin or carboplatin. Results: On incubation with AGEs, the expressions of MATE1/SLC47A1 were decreased in tubular cells. In addition, the toxicities of cisplatin were increased in tubular cells that had been pretreated with AGEs. However, the toxicities of carboplatin were smaller than that of cisplatin in proximal tubular epithelial cells. Conclusion: The expression of the MATE1/SLC47A1 is decreased by AGEs, which increases the risk for proximal tubular injury. Keywords: advanced glycation endproducts, cisplatin, SLC47A1, diabetes mellitus, acute kidney injury
Serotonin transporter and dopamine transporter imaging in the canine brain
International Nuclear Information System (INIS)
Peremans, Kathelijne; Goethals, Ingeborg; De Vos, Filip; Dobbeleir, A.; Ham, Hamphrey; Van Bree, Henri; Heeringen, Cees van; Audenaert, Kurt
2006-01-01
The serotonergic and dopaminergic systems are involved in a wide range of emotional and behavioral aspects of animals and humans and are involved in many neuropsychiatric disorders. Selective serotonin (5-HT) reuptake inhibitors (SSRIs) are designed to block the 5-HT transporter (SERT), thereby increasing the available 5-HT in the brain. Functional imaging with specific SERT and dopamine transporter (DAT) ligands contributes to the study of the SSRI-transporter interaction. First, we evaluated the feasibility of a canine model in the study of the SERT and DAT with the radioligands [ 123 I]-β-CIT and [ 123 I]-FP-CIT as well as single-photon emission computed tomography imaging. Second, we studied the effect of SSRIs (sertraline, citalopram and escitalopram) on the SERT and DAT in two dogs. The position of the canine model in the study of the SERT and DAT is discussed and compared with other animal models
Kalaev, V N; Nechaeva, M S; Korneeva, O S; Cherenkov, D A
2015-11-01
The influence of polymorphism of the serotonin transporter and monoamine oxidase A genes, associated with man's aggressiveness on the psycho-emotional state and karyological status of single combat athletes. It was revealed that the carriers of less active ("short"), monoamine oxidase A gene variant have a high motivation to succeed and less rigidity and frustrated, compared to the carriers of more active ("long") version of the gene. Heterozygote carriers of less active ("short") variant of the serotonin transporter gene 5-HTTL had more physical aggression, guilt and were less frustrated compared with carriers of two long alleles. It has been revealed the association of studied genes with the karyological status of athletes. So fighters who are carriers of the short and long alleles of the serotonin transporter gene had more cells with nuclear abnormalities in the buccal epithelium than single combat athletes which both alleles were long.
Importance of high order momentum terms in SLC optics
International Nuclear Information System (INIS)
Kozanecki, W.
1985-01-01
The evaluation of background levels at the SLC relies, in several cases, on the proper representation of how low momentum electrons propagate through the Arcs and the Final Focus System (FFS). For example, beam - gas bremsstrahlung in the arcs causes electrons of up to 6% energy loss to be transported through to the IP; secondary showers on edges of masks and collimators yield debris with a very wide momentum spectrum. This note is a naive attempt at checking the validity of TRANSPORT and TURTLE calculations, by evaluating the contributions of the momentum terms to increasingly higher order, and checking the mutual consistency of the results produced by the two methods on a beam of wide momentum spread. 8 refs., 4 figs., 1 tab
Bad nature, bad nurture, and testimony regarding MAOA and SLC6A4 genotyping at murder trials.
Bernet, William; Vnencak-Jones, Cindy L; Farahany, Nita; Montgomery, Stephen A
2007-11-01
Recent research-in which subjects were studied longitudinally from childhood until adulthood-has started to clarify how a child's environment and genetic makeup interact to create a violent adolescent or adult. For example, male subjects who were born with a particular allele of the monoamine oxidase A gene and also were maltreated as children had a much greater likelihood of manifesting violent antisocial behavior as adolescents and adults. Also, individuals who were born with particular alleles of the serotonin transporter gene and also experienced multiple stressful life events were more likely to manifest serious depression and suicidality. This research raises the question of whether testimony regarding a defendant's genotype, exposure to child maltreatment, and experience of unusual stress is appropriate to present during the guilt or penalty phases of criminal trials, especially when capital punishment is a consideration. The authors present their experience in genotyping criminal defendants and presenting genetic information at criminal trials.
Directory of Open Access Journals (Sweden)
Mark W Neff
Full Text Available A crippling dwarfism was first described in the Miniature Poodle in Great Britain in 1956. Here, we resolve the genetic basis of this recessively inherited disorder. A case-control analysis (8:8 of genotype data from 173 k SNPs revealed a single associated locus on CFA14 (P(raw <10(-8. All affected dogs were homozygous for an ancestral haplotype consistent with a founder effect and an identical-by-descent mutation. Systematic failure of nine, nearly contiguous SNPs, was observed solely in affected dogs, suggesting a deletion was the causal mutation. A 130-kb deletion was confirmed both by fluorescence in situ hybridization (FISH analysis and by cloning the physical breakpoints. The mutation was perfectly associated in all cases and obligate heterozygotes. The deletion ablated all but the first exon of SLC13A1, a sodium/sulfate symporter responsible for regulating serum levels of inorganic sulfate. Our results corroborate earlier findings from an Slc13a1 mouse knockout, which resulted in hyposulfatemia and syndromic defects. Interestingly, the metabolic disorder in Miniature Poodles appears to share more clinical signs with a spectrum of human disorders caused by SLC26A2 than with the mouse Slc13a1 model. SLC26A2 is the primary sodium-independent sulfate transporter in cartilage and bone and is important for the sulfation of proteoglycans such as aggregan. We propose that disruption of SLC13A1 in the dog similarly causes undersulfation of proteoglycans in the extracellular matrix (ECM, which impacts the conversion of cartilage to bone. A co-dominant DNA test of the deletion was developed to enable breeders to avoid producing affected dogs and to selectively eliminate the mutation from the gene pool.
Chromatic correction in the SLC bunch length compressors
International Nuclear Information System (INIS)
Adolphsen, C.E.; Emma, P.J.; Fieguth, T.H.; Spence, W.L.
1991-06-01
The SLC Ring to Linac (RTL) transport lines employ intense bending and strong transverse focusing to produce the momentum compaction needed for bunch length compression prior to S-band acceleration. In the presence of the large rf induced energy spread needed for compression the consequent chromatic effects -- viz. the variation with energy of residual output dispersion and of the RTL transfer matrix, threaten to destroy the small emittances produced by the damping rings. We report on the tuning methods that have been developed and used to implement the sextupole based chromatic correction scheme. 6 refs., 4 figs
Homberg, Judith R; De Boer, Sietse F; Raasø, Halfdan S; Olivier, Jocelien D A; Verheul, Mark; Ronken, Eric; Cools, Alexander R; Ellenbroek, Bart A; Schoffelmeer, Anton N M; Vanderschuren, Louk J M J; De Vries, Taco J; Cuppen, Edwin
2008-01-01
RATIONALE: While individual differences in vulnerability to psychostimulants have been largely attributed to dopaminergic neurotransmission, the role of serotonin is not fully understood. OBJECTIVES: To study the rewarding and motivational properties of cocaine in the serotonin transporter knockout
Bowton, E; Saunders, C; Reddy, I A; Campbell, N G; Hamilton, P J; Henry, L K; Coon, H; Sakrikar, D; Veenstra-VanderWeele, J M; Blakely, R D; Sutcliffe, J; Matthies, H J G; Erreger, K; Galli, A
2014-10-14
Emerging evidence associates dysfunction in the dopamine (DA) transporter (DAT) with the pathophysiology of autism spectrum disorder (ASD). The human DAT (hDAT; SLC6A3) rare variant with an Ala to Val substitution at amino acid 559 (hDAT A559V) was previously reported in individuals with bipolar disorder or attention-deficit hyperactivity disorder (ADHD). We have demonstrated that this variant is hyper-phosphorylated at the amino (N)-terminal serine (Ser) residues and promotes an anomalous DA efflux phenotype. Here, we report the novel identification of hDAT A559V in two unrelated ASD subjects and provide the first mechanistic description of its impaired trafficking phenotype. DAT surface expression is dynamically regulated by DAT substrates including the psychostimulant amphetamine (AMPH), which causes hDAT trafficking away from the plasma membrane. The integrity of DAT trafficking directly impacts DA transport capacity and therefore dopaminergic neurotransmission. Here, we show that hDAT A559V is resistant to AMPH-induced cell surface redistribution. This unique trafficking phenotype is conferred by altered protein kinase C β (PKCβ) activity. Cells expressing hDAT A559V exhibit constitutively elevated PKCβ activity, inhibition of which restores the AMPH-induced hDAT A559V membrane redistribution. Mechanistically, we link the inability of hDAT A559V to traffic in response to AMPH to the phosphorylation of the five most distal DAT N-terminal Ser. Mutation of these N-terminal Ser to Ala restores AMPH-induced trafficking. Furthermore, hDAT A559V has a diminished ability to transport AMPH, and therefore lacks AMPH-induced DA efflux. Pharmacological inhibition of PKCβ or Ser to Ala substitution in the hDAT A559V background restores AMPH-induced DA efflux while promoting intracellular AMPH accumulation. Although hDAT A559V is a rare variant, it has been found in multiple probands with neuropsychiatric disorders associated with imbalances in DA neurotransmission
Erblich, J; Lerman, C; Self, D W; Diaz, G A; Bovbjerg, D H
2005-04-01
Cue-induced craving for addictive substances has long been known to contribute to the problem of persistent addiction in humans. Research in animals over the past decade has solidly established the central role of dopamine in cue-induced craving for addictive substances, including nicotine. Analogous studies in humans, however, are lacking, especially among African-American smokers, who have lower quit rates than Caucasian smokers. Based on the animal literature, the study's objective was to test the hypothesis that smokers carrying specific variants in dopamine-related genes previously associated with risk for addictive behaviors would exhibit heightened levels of cigarette craving following laboratory exposure to cues. To this end, cigarette craving was induced in healthy African-American smokers (n=88) through laboratory exposure to smoking cues. Smokers carrying either the DRD2 (D2 dopamine receptor gene) TaqI A1 RFLP or the SLC6A3 (dopamine transporter gene) 9-repeat VNTR polymorphisms had stronger cue-induced cravings than noncarriers (Ps cue-induced craving in humans, and suggest a possible genetic risk factor for persistent smoking behavior in African-American smokers.
de Raaf, Michiel Alexander; Kroeze, Yvet; Middelman, Anthonieke; de Man, Frances S.; de Jong, Helma; Vonk-Noordegraaf, Anton; de Korte, Chris; Voelkel, Norbert F.; Homberg, Judith; Bogaard, Harm Jan
2015-01-01
Increased serotonin serum levels have been proposed to play a key role in pulmonary arterial hypertension (PAH) by regulating vessel tone and vascular smooth muscle cell proliferation. An intact serotonin system, which critically depends on a normal function of the serotonin transporter (SERT), is
A deletion mutation in bovine SLC4A2 is associated with osteopetrosis in Red Angus cattle
Directory of Open Access Journals (Sweden)
Beever Jonathan E
2010-05-01
Full Text Available Abstract Background Osteopetrosis is a skeletal disorder of humans and animals characterized by the formation of overly dense bones, resulting from a deficiency in the number and/or function of bone-resorbing osteoclast cells. In cattle, osteopetrosis can either be induced during gestation by viral infection of the dam, or inherited as a recessive defect. Genetically affected calves are typically aborted late in gestation, display skull deformities and exhibit a marked reduction of osteoclasts. Although mutations in several genes are associated with osteopetrosis in humans and mice, the genetic basis of the cattle disorder was previously unknown. Results We have conducted a whole-genome association analysis to identify the mutation responsible for inherited osteopetrosis in Red Angus cattle. Analysis of >54,000 SNP genotypes for each of seven affected calves and nine control animals localized the defective gene to the telomeric end of bovine chromosome 4 (BTA4. Homozygosity analysis refined the interval to a 3.4-Mb region containing the SLC4A2 gene, encoding an anion exchanger protein necessary for proper osteoclast function. Examination of SLC4A2 from normal and affected animals revealed a ~2.8-kb deletion mutation in affected calves that encompasses exon 2 and nearly half of exon 3, predicted to prevent normal protein function. Analysis of RNA from a proven heterozygous individual confirmed the presence of transcripts lacking exons 2 and 3, in addition to normal transcripts. Genotyping of additional animals demonstrated complete concordance of the homozygous deletion genotype with the osteopetrosis phenotype. Histological examination of affected tissues revealed scarce, morphologically abnormal osteoclasts displaying evidence of apoptosis. Conclusions These results indicate that a deletion mutation within bovine SLC4A2 is associated with osteopetrosis in Red Angus cattle. Loss of SLC4A2 function appears to induce premature cell death, and
Characterization of an allosteric citalopram-binding site at the serotonin transporter
DEFF Research Database (Denmark)
Chen, Fenghua; Breum Larsen, Mads; Neubauer, Henrik Amtoft
2005-01-01
The serotonin transporter (SERT), which belongs to a family of sodium/chloride-dependent transporters, is the major pharmacological target in the treatment of several clinical disorders, including depression and anxiety. In the present study we show that the dissociation r...
Directory of Open Access Journals (Sweden)
Olha Hurba
Full Text Available OBJECTIVE: Using European descent Czech populations, we performed a study of SLC2A9 and SLC22A12 genes previously identified as being associated with serum uric acid concentrations and gout. This is the first study of the impact of non-synonymous allelic variants on the function of GLUT9 except for patients suffering from renal hypouricemia type 2. METHODS: The cohort consisted of 250 individuals (150 controls, 54 nonspecific hyperuricemics and 46 primary gout and/or hyperuricemia subjects. We analyzed 13 exons of SLC2A9 (GLUT9 variant 1 and GLUT9 variant 2 and 10 exons of SLC22A12 by PCR amplification and sequenced directly. Allelic variants were prepared and their urate uptake and subcellular localization were studied by Xenopus oocytes expression system. The functional studies were analyzed using the non-parametric Wilcoxon and Kruskall-Wallis tests; the association study used the Fisher exact test and linear regression approach. RESULTS: We identified a total of 52 sequence variants (12 unpublished. Eight non-synonymous allelic variants were found only in SLC2A9: rs6820230, rs2276961, rs144196049, rs112404957, rs73225891, rs16890979, rs3733591 and rs2280205. None of these variants showed any significant difference in the expression of GLUT9 and in urate transport. In the association study, eight variants showed a possible association with hyperuricemia. However, seven of these were in introns and the one exon located variant, rs7932775, did not show a statistically significant association with serum uric acid concentration. CONCLUSION: Our results did not confirm any effect of SLC22A12 and SLC2A9 variants on serum uric acid concentration. Our complex approach using association analysis together with functional and immunohistochemical characterization of non-synonymous allelic variants did not show any influence on expression, subcellular localization and urate uptake of GLUT9.
Serotonin transporter and dopamine transporter imaging in the canine brain
Energy Technology Data Exchange (ETDEWEB)
Peremans, Kathelijne [Department of Medical Imaging, Faculty of Veterinary Sciences, Ghent University, B-9000 Ghent (Belgium); Goethals, Ingeborg [Division of Nuclear Medicine, University Hospital Ghent, B-9000 Ghent (Belgium); De Vos, Filip [Laboratory of Radiopharmacy, Pharmaceutical Sciences, Ghent University, B-9000 Ghent (Belgium); Dobbeleir, A. [Department of Medical Imaging, Faculty of Veterinary Sciences, Ghent University, B-9000 Ghent (Belgium); Ham, Hamphrey [Division of Nuclear Medicine, University Hospital Ghent, B-9000 Ghent (Belgium); Van Bree, Henri [Department of Medical Imaging, Faculty of Veterinary Sciences, Ghent University, B-9000 Ghent (Belgium); Heeringen, Cees van [Department of Psychiatry and Medical Psychology, Faculty of Medical and Health Sciences, Ghent University, B-9000, Ghent (Belgium); Audenaert, Kurt [Division of Nuclear Medicine, University Hospital Ghent, B-9000 Ghent (Belgium) and Department of Psychiatry and Medical Psychology, Faculty of Medical and Health Sciences, Ghent University, B-9000, Ghent (Belgium)]. E-mail: kurt.audenaert@ugent.be
2006-10-15
The serotonergic and dopaminergic systems are involved in a wide range of emotional and behavioral aspects of animals and humans and are involved in many neuropsychiatric disorders. Selective serotonin (5-HT) reuptake inhibitors (SSRIs) are designed to block the 5-HT transporter (SERT), thereby increasing the available 5-HT in the brain. Functional imaging with specific SERT and dopamine transporter (DAT) ligands contributes to the study of the SSRI-transporter interaction. First, we evaluated the feasibility of a canine model in the study of the SERT and DAT with the radioligands [{sup 123}I]-{beta}-CIT and [{sup 123}I]-FP-CIT as well as single-photon emission computed tomography imaging. Second, we studied the effect of SSRIs (sertraline, citalopram and escitalopram) on the SERT and DAT in two dogs. The position of the canine model in the study of the SERT and DAT is discussed and compared with other animal models.
Cystinuria Associated with Different SLC7A9 Gene Variants in the Cat.
Directory of Open Access Journals (Sweden)
Keijiro Mizukami
Full Text Available Cystinuria is a classical inborn error of metabolism characterized by a selective proximal renal tubular defect affecting cystine, ornithine, lysine, and arginine (COLA reabsorption, which can lead to uroliths and urinary obstruction. In humans, dogs and mice, cystinuria is caused by variants in one of two genes, SLC3A1 and SLC7A9, which encode the rBAT and bo,+AT subunits of the bo,+ basic amino acid transporter system, respectively. In this study, exons and flanking regions of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA of cats (Felis catus with COLAuria and cystine calculi. Relative to the Felis catus-6.2 reference genome sequence, DNA sequences from these affected cats revealed 3 unique homozygous SLC7A9 missense variants: one in exon 5 (p.Asp236Asn from a non-purpose-bred medium-haired cat, one in exon 7 (p.Val294Glu in a Maine Coon and a Sphinx cat, and one in exon 10 (p.Thr392Met from a non-purpose-bred long-haired cat. A genotyping assay subsequently identified another cystinuric domestic medium-haired cat that was homozygous for the variant originally identified in the purebred cats. These missense variants result in deleterious amino acid substitutions of highly conserved residues in the bo,+AT protein. A limited population survey supported that the variants found were likely causative. The remaining 2 sequenced domestic short-haired cats had a heterozygous variant at a splice donor site in intron 10 and a homozygous single nucleotide variant at a branchpoint in intron 11 of SLC7A9, respectively. This study identifies the first SLC7A9 variants causing feline cystinuria and reveals that, as in humans and dogs, this disease is genetically heterogeneous in cats.
Tanegashima, Kosuke; Sato-Miyata, Yukiko; Funakoshi, Masabumi; Nishito, Yasumasa; Aigaki, Toshiro; Hara, Takahiko
2017-01-01
We carried out liquid chromatography-tandem mass spectrometry analysis of metabolites in mice. Those metabolome data showed that hepatic glucose content is reduced, but that brain glucose content is unaffected, during fasting, consistent with the priority given to brain glucose consumption during fasting. The molecular mechanisms for this preferential glucose supply to the brain are not fully understood. We also showed that the fasting-induced production of the ketone body β-hydroxybutyrate (β-OHB) enhances expression of the glucose transporter gene Slc2a1 (Glut1) via histone modification. Upon β-OHB treatment, Slc2a1 expression was up-regulated, with a concomitant increase in H3K9 acetylation at the critical cis-regulatory region of the Slc2a1 gene in brain microvascular endothelial cells and NB2a neuronal cells, shown by quantitative PCR analysis and chromatin immunoprecipitation assay. CRISPR/Cas9-mediated disruption of the Hdac2 gene increased Slc2a1 expression, suggesting that it is one of the responsible histone deacetylases (HDACs). These results confirm that β-OHB is a HDAC inhibitor and show that β-OHB plays an important role in fasting-induced epigenetic activation of a glucose transporter gene in the brain. © 2016 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.
SLC injector simulation and tuning for high charge transport
International Nuclear Information System (INIS)
Yeremian, A.D.; Miller, R.H.; Clendenin, J.E.; Early, R.A.; Ross, M.C.; Turner, J.L.; Wang, J.W.
1992-01-01
We have simulated the SLC injector from the thermionic gun through the first accelerating section and used the resulting parameters to tune the injector for optimum performance and high charge transport. Simulations are conducted using PARMELA, a three-dimensional space-charge model. The magnetic field profile due to the existing magnetic optics is calculated using POISSON, while SUPERFISH is used to calculate the space harmonics of the various bunchers and the accelerator cavities. The initial beam conditions in the PARMELA code are derived from the EGUN model of the gun. The resulting injector parameters from the PARMELA simulation are used to prescribe experimental settings of the injector components. The experimental results are in agreement with the results of the integrated injector model. (Author) 5 figs., 7 refs
DEFF Research Database (Denmark)
Steinkellner, Thomas; Montgomery, Therese R; Hofmaier, Tina
2015-01-01
Serotonergic neurotransmission is terminated by reuptake of extracellular serotonin (5-HT) by the high-affinity serotonin transporter (SERT). Selective 5-HT reuptake inhibitors (SSRIs) such as fluoxetine or escitalopram inhibit SERT and are currently the principal treatment for depression and anx...... and efflux at monoamine transporters are asymmetric processes that can be targeted separately. Ultimately, this may provide a molecular mechanism for putative drug developments to treat amphetamine addiction....
Kamaraj, Balu; Purohit, Rituraj
2016-11-01
Oculocutaneous albinism type IV (OCA4) is an autosomal recessive inherited disorder which is characterized by reduced biosynthesis of melanin pigmentation in skin, hair, and eyes and caused by the genetic mutations in the membrane-associated transporter protein (MATP) encoded by SLC45A2 gene. The MATP protein consists of 530 amino acids which contains 12 putative transmembrane domains and plays an important role in pigmentation and probably functions as a membrane transporter in melanosomes. We scrutinized the most OCA4 disease-associated mutation and their structural consequences on SLC45A2 gene. To understand the atomic arrangement in 3D space, the native and mutant structures were modeled. Further the structural behavior of native and mutant MATP protein was investigated by molecular dynamics simulation (MDS) approach in explicit lipid and water background. We found Y317C as the most deleterious and disease-associated SNP on SLC45A2 gene. In MDS, mutations in MATP protein showed loss of stability and became more flexible, which alter its structural conformation and function. This phenomenon has indicated a significant role in inducing OCA4. Our study explored the understanding of molecular mechanism of MATP protein upon mutation at atomic level and further helps in the field of pharmacogenomics to develop a personalized medicine for OCA4 disorder. J. Cell. Biochem. 117: 2608-2619, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
The Effects of Serotonin in Immune Cells
Herr, Nadine; Bode, Christoph; Duerschmied, Daniel
2017-01-01
Serotonin [5-hydroxytryptamine (5-HT)] plays an important role in many organs as a peripheral hormone. Most of the body’s serotonin is circulating in the bloodstream, transported by blood platelets and is released upon activation. The functions of serotonin are mediated by members of the 7 known mammalian serotonin receptor subtype classes (15 known subtypes), the serotonin transporter (SERT), and by covalent binding of serotonin to different effector proteins. Almost all immune cells express...
Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S
2014-01-10
Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first
Regional distribution of serotonin transporter protein in postmortem human brain
International Nuclear Information System (INIS)
Kish, Stephen J.; Furukawa, Yoshiaki; Chang Lijan; Tong Junchao; Ginovart, Nathalie; Wilson, Alan; Houle, Sylvain; Meyer, Jeffrey H.
2005-01-01
Introduction: The primary approach in assessing the status of brain serotonin neurons in human conditions such as major depression and exposure to the illicit drug ecstasy has been the use of neuroimaging procedures involving radiotracers that bind to the serotonin transporter (SERT). However, there has been no consistency in the selection of a 'SERT-free' reference region for the estimation of free and nonspecific binding, as occipital cortex, cerebellum and white matter have all been employed. Objective and Methods: To identify areas of human brain that might have very low SERT levels, we measured, by a semiquantitative Western blotting procedure, SERT protein immunoreactivity throughout the postmortem brain of seven normal adult subjects. Results: Serotonin transporter could be quantitated in all examined brain areas. However, the SERT concentration in cerebellar cortex and white matter were only at trace values, being approximately 20% of average cerebral cortex and 5% of average striatum values. Conclusion: Although none of the examined brain areas are completely free of SERT, human cerebellar cortex has low SERT binding as compared to other examined brain regions, with the exception of white matter. Since the cerebellar cortical SERT binding is not zero, this region will not be a suitable reference region for SERT radioligands with very low free and nonspecific binding. For SERT radioligands with reasonably high free and nonspecific binding, the cerebellar cortex should be a useful reference region, provided other necessary radioligand assumptions are met
Regional distribution of serotonin transporter protein in postmortem human brain
Energy Technology Data Exchange (ETDEWEB)
Kish, Stephen J. [Human Neurochemical Pathology Laboratory, Centre for Addiction and Mental Health, Toronto, ON, M5T 1R8 (Canada)]. E-mail: Stephen_Kish@CAMH.net; Furukawa, Yoshiaki [Human Neurochemical Pathology Laboratory, Centre for Addiction and Mental Health, Toronto, ON, M5T 1R8 (Canada); Chang Lijan [Human Neurochemical Pathology Laboratory, Centre for Addiction and Mental Health, Toronto, ON, M5T 1R8 (Canada); Tong Junchao [Human Neurochemical Pathology Laboratory, Centre for Addiction and Mental Health, Toronto, ON, M5T 1R8 (Canada); Ginovart, Nathalie [PET Centre, Centre for Addiction and Mental Health, Toronto, ON, M5T 1R8 (Canada); Wilson, Alan [PET Centre, Centre for Addiction and Mental Health, Toronto, ON, M5T 1R8 (Canada); Houle, Sylvain [PET Centre, Centre for Addiction and Mental Health, Toronto, ON, M5T 1R8 (Canada); Meyer, Jeffrey H. [PET Centre, Centre for Addiction and Mental Health, Toronto, ON, M5T 1R8 (Canada)
2005-02-01
Introduction: The primary approach in assessing the status of brain serotonin neurons in human conditions such as major depression and exposure to the illicit drug ecstasy has been the use of neuroimaging procedures involving radiotracers that bind to the serotonin transporter (SERT). However, there has been no consistency in the selection of a 'SERT-free' reference region for the estimation of free and nonspecific binding, as occipital cortex, cerebellum and white matter have all been employed. Objective and Methods: To identify areas of human brain that might have very low SERT levels, we measured, by a semiquantitative Western blotting procedure, SERT protein immunoreactivity throughout the postmortem brain of seven normal adult subjects. Results: Serotonin transporter could be quantitated in all examined brain areas. However, the SERT concentration in cerebellar cortex and white matter were only at trace values, being approximately 20% of average cerebral cortex and 5% of average striatum values. Conclusion: Although none of the examined brain areas are completely free of SERT, human cerebellar cortex has low SERT binding as compared to other examined brain regions, with the exception of white matter. Since the cerebellar cortical SERT binding is not zero, this region will not be a suitable reference region for SERT radioligands with very low free and nonspecific binding. For SERT radioligands with reasonably high free and nonspecific binding, the cerebellar cortex should be a useful reference region, provided other necessary radioligand assumptions are met.
Inhibition of SLC1A5 sensitizes colorectal cancer to cetuximab.
Ma, Huanrong; Wu, Zhenzhen; Peng, Jianjun; Li, Yang; Huang, Hongxiang; Liao, Yi; Zhou, Minyu; Sun, Li; Huang, Na; Shi, Min; Bin, Jianping; Liao, Yulin; Rao, Jinjun; Wang, Lin; Liao, Wangjun
2018-06-15
Cetuximab resistance is a key barrier in treating metastatic colorectal cancer (mCRC). Targeting of metabolic resources import could resensitize drug-resistant cancer cells to anticancer treatments. Here we showed that the expression of the glutamine transporter solute carrier 1 family member 5 (SLC1A5) in clinical CRC samples of patients resisted to cetuximab was significantly higher than in those of patients responded to cetuximab. Inhibition of SLC1A5 by shRNA-mediated gene silencing or pharmacological inhibitor significantly suppressed the growth of CRC. Moreover, inhibition of SLC1A5 significantly enhanced the inhibitory efficacy of cetuximab on CRC proliferation both in vitro and in vivo. Mechanistically, SLC1A5 inhibition facilitated EGFR degradation through the ubiquitin-proteasome pathway, and decreased the expression of nuclear EGFR, both of which might have contribution to the improved response to cetuximab. This study provides the metabolic molecule SLC1A5 as a potential therapeutic target to increase the efficacy of cetuximab on CRC. © 2018 UICC.
SLC injector simulation and tuning for high charge transport
International Nuclear Information System (INIS)
Yeremian, A.D.; Miller, R.H.; Clendenin, J.E.; Early, R.A.; Ross, M.C.; Turner, J.L.; Wang, J.W.
1992-08-01
We have simulated the SLC injector from the thermionic gun through the first accelerating section and used the resulting parameters to tune the injector for optimum performance and high charge transport. Simulations are conducted using PARMELA, a three-dimensional ray-trace code with a two-dimensional space-charge model. The magnetic field profile due to the existing magnetic optics is calculated using POISSON, while SUPERFISH is used to calculate the space harmonics of the various bunchers and the accelerator cavities. The initial beam conditions in the PARMELA code are derived from the EGUN model of the gun. The resulting injector parameters from the PARMELA simulation are used to prescribe experimental settings of the injector components. The experimental results are in agreement with the results of the integrated injector model
Directory of Open Access Journals (Sweden)
Fei Shen
Full Text Available Multimodal analgesia is designed to optimize pain relief by coadministering drugs with distinct mechanisms of action or by combining multiple pharmacologies within a single molecule. In clinical settings, combinations of monoamine reuptake inhibitors and opioid receptor agonists have been explored and one currently available analgesic, tapentadol, functions as both a µ-opioid receptor agonist and a norepinephrine transporter inhibitor. However, it is unclear whether the combination of selective norepinephrine reuptake inhibition and µ-receptor agonism achieves an optimal antinociceptive synergy. In this study, we assessed the pharmacodynamic interactions between morphine and monoamine reuptake inhibitors that possess different affinities and selectivities for norepinephrine and serotonin transporters. Using the rat formalin model, in conjunction with measurements of ex vivo transporter occupancy, we show that neither the norepinephrine-selective inhibitor, esreboxetine, nor the serotonin-selective reuptake inhibitor, fluoxetine, produce antinociceptive synergy with morphine. Atomoxetine, a monoamine reuptake inhibitor that achieves higher levels of norepinephrine than serotonin transporter occupancy, exhibited robust antinociceptive synergy with morphine. Similarly, a fixed-dose combination of esreboxetine and fluoxetine which achieves comparable levels of transporter occupancy potentiated the antinociceptive response to morphine. By contrast, duloxetine, a monoamine reuptake inhibitor that achieves higher serotonin than norepinephrine transporter occupancy, failed to potentiate the antinociceptive response to morphine. However, when duloxetine was coadministered with the 5-HT3 receptor antagonist, ondansetron, potentiation of the antinociceptive response to morphine was revealed. These results support the notion that inhibition of both serotonin and norepinephrine transporters is required for monoamine reuptake inhibitor and opioid
Directory of Open Access Journals (Sweden)
Saeki Tohru
2013-02-01
Full Text Available Abstract Background SLC10A2-mediated reabsorption of bile acids at the distal end of the ileum is the first step in enterohepatic circulation. Because bile acids act not only as detergents but also as signaling molecules in lipid metabolism and energy production, SLC10A2 is important as the key transporter for understanding the in vivo kinetics of bile acids. SLC10A family members and the homologous genes of various species share a highly conserved region corresponding to Gly104–Pro142 of SLC10A2. The functional importance of this region has not been fully elucidated. Results To elucidate the functional importance of this region, we previously performed mutational analysis of the uncharged polar residues and proline in the distal one-third (Thr130–Pro142 of the highly conserved region in mouse Slc10a2. In this study, proline and uncharged polar residues in the remaining two-thirds of this region in mouse Slc10a2 were subjected to mutational analysis, and taurocholic acid uptake and cell surface localization were examined. Cell surface localization of Slc10a2 is necessary for bile acid absorption. Mutants in which Asp or Leu were substituted for Pro107 (P107N or P107L were abundantly expressed, but their cell surface localization was impaired. The S126A mutant was completely impaired in cellular expression. The T110A and S128A mutants exhibited remarkably enhanced membrane expression. The S112A mutant was properly expressed at the cell surface but transport activity was completely lost. Replacement of Tyr117 with various amino acids resulted in reduced transport activity. The degree of reduction roughly depended on the van der Waals volume of the side chains. Conclusions The functional importance of proline and uncharged polar residues in the highly conserved region of mouse Slc10a2 was determined. This information will contribute to the design of bile acid-conjugated prodrugs for efficient drug delivery or SLC10A2 inhibitors for
Kogen, Hiroshi; Toda, Narihiro; Tago, Keiko; Marumoto, Shinji; Takami, Kazuko; Ori, Mayuko; Yamada, Naho; Koyama, Kazuo; Naruto, Shunji; Abe, Kazumi; Yamazaki, Reina; Hara, Takao; Aoyagi, Atsushi; Abe, Yasuyuki; Kaneko, Tsugio
2002-10-03
Highly efficient acetylcholinesterase (AChE) and serotonin transporter (SERT) dual inhibitors, (S)-4 and (R)-13 were designed and synthesized on the basis of the hypothetical model of AChE active site. Both compounds showed potent inhibitory activities against AChE and SERT. [structure: see text
Institute of Scientific and Technical Information of China (English)
谭钊安; 张建平; 曾彦英; 茆正红; 朱晓静; 张慧林; 朱进
2004-01-01
目的:探讨中国汉族人群SLC6A4基因启动子区基因多态性与反社会人格障碍的关系.方法:反社会人格障碍人群来自江苏省少年劳教所的被劳教人员,经人格诊断问卷(PDQ-4)筛查,符合美国精神病协会精神疾病诊断方法(DSM-Ⅳ)关于反社会人格障碍的诊断标准;对照组来自健康体检人群,经PDQ-4排除反社会人格障碍和重型精神病.全部对象取血液标本提取DNA,用PCR方法扩增SLC6A4基因(5-羟色氨转移蛋白基因,5-HTT)启动子区序列片断,部分PCR产物行测序验证.对等位基因频率和基因型频率进行对比分析.结果:符合DSM-Ⅳ反社会人格障碍诊断标准者共90例,对照组140例,PCR产物电泳及测序比对,共获得3种等位基因条带L、S和XL,片断长度各相差44个碱基,分别组成4种基因型LL、LS、SS和XLL.反社会人格障碍人群S等位基因频率和SS基因型频率分别为61.80%和37.08%,与对照组比较,差异有极显著性意义(P<0.005).结论:S等位基因频率和SS基因型频率与中国汉族人群反社会人格障碍的遗传易感性相关.
Stütz, Adrian M; Teran-Garcia, Margarita; Rao, D C; Rice, Treva; Bouchard, Claude; Rankinen, Tuomo
2009-11-01
The sodium bicarbonate cotransporter gene SLC4A5, associated earlier with cardiovascular phenotypes, was tested for associations in the HERITAGE Family Study, and possible mechanisms were investigated. Twelve tag-single nucleotide polymorphisms (SNPs) covering the SLC4A5 gene were analyzed in 276 Black and 503 White healthy, sedentary subjects. Associations were tested using a variance components-based (QTDT) method with data adjusted for age, sex and body size. In Whites, rs6731545 and rs7571842 were significantly associated with resting and submaximal exercise pulse pressure (PP) (0.0004 HERITAGE Family Study are likely due to neither variation in the promoter nor known coding SNPs of SLC4A5.
DEFF Research Database (Denmark)
Andersen, Jacob; Olsen, Lars; Hansen, Kasper B.
2010-01-01
The serotonin transporter (SERT) regulates extracellular levels of the neurotransmitter serotonin (5-hydroxytryptamine) in the brain by facilitating uptake of released 5-hydroxytryptamine into neuronal cells. SERT is the target for widely used antidepressant drugs, including imipramine, fluoxetine...
Zhou, Yun; Holmseth, Silvia; Guo, Caiying; Hassel, Bjørnar; Höfner, Georg; Huitfeldt, Henrik S.; Wanner, Klaus T.; Danbolt, Niels C.
2012-01-01
The GABA transporters (GAT1, GAT2, GAT3, and BGT1) have mostly been discussed in relation to their potential roles in controlling the action of transmitter GABA in the nervous system. We have generated the first mice lacking the GAT2 (slc6a13) gene. Deletion of GAT2 (both mRNA and protein) neither affected growth, fertility, nor life span under nonchallenging rearing conditions. Immunocytochemistry showed that the GAT2 protein was predominantly expressed in the plasma membranes of periportal hepatocytes and in the basolateral membranes of proximal tubules in the renal cortex. This was validated by processing tissue from wild-type and knockout mice in parallel. Deletion of GAT2 reduced liver taurine levels by 50%, without affecting the expression of the taurine transporter TAUT. These results suggest an important role for GAT2 in taurine uptake from portal blood into liver. In support of this notion, GAT2-transfected HEK293 cells transported [3H]taurine. Furthermore, most of the uptake of [3H]GABA by cultured rat hepatocytes was due to GAT2, and this uptake was inhibited by taurine. GAT2 was not detected in brain parenchyma proper, excluding a role in GABA inactivation. It was, however, expressed in the leptomeninges and in a subpopulation of brain blood vessels. Deletion of GAT2 increased brain taurine levels by 20%, suggesting a taurine-exporting role for GAT2 in the brain. PMID:22896705
Fumagalli, Monica; Provenzi, Livio; De Carli, Pietro; Dessimone, Francesca; Sirgiovanni, Ida; Giorda, Roberto; Cinnante, Claudia; Squarcina, Letizia; Pozzoli, Uberto; Triulzi, Fabio; Brambilla, Paolo; Borgatti, Renato; Mosca, Fabio; Montirosso, Rosario
2018-01-01
Very preterm (VPT) infants admitted to Neonatal Intensive Care Unit (NICU) are at risk for altered brain growth and less-than-optimal socio-emotional development. Recent research suggests that early NICU-related stress contributes to socio-emotional impairments in VPT infants at 3 months through epigenetic regulation (i.e., DNA methylation) of the serotonin transporter gene (SLC6A4). In the present longitudinal study we assessed: (a) the effects of NICU-related stress and SLC6A4 methylation variations from birth to discharge on brain development at term equivalent age (TEA); (b) the association between brain volume at TEA and socio-emotional development (i.e., Personal-Social scale of Griffith Mental Development Scales, GMDS) at 12 months corrected age (CA). Twenty-four infants had complete data at 12-month-age. SLC6A4 methylation was measured at a specific CpG previously associated with NICU-related stress and socio-emotional stress. Findings confirmed that higher NICU-related stress associated with greater increase of SLC6A4 methylation at NICU discharge. Moreover, higher SLC6A4 discharge methylation was associated with reduced anterior temporal lobe (ATL) volume at TEA, which in turn was significantly associated with less-than-optimal GMDS Personal-Social scale score at 12 months CA. The reduced ATL volume at TEA mediated the pathway linking stress-related increase in SLC6A4 methylation at NICU discharge and socio-emotional development at 12 months CA. These findings suggest that early adversity-related epigenetic changes might contribute to the long-lasting programming of socio-emotional development in VPT infants through epigenetic regulation and structural modifications of the developing brain.
Serotonin synthesis, release and reuptake in terminals: a mathematical model
Directory of Open Access Journals (Sweden)
Best Janet
2010-08-01
Full Text Available Abstract Background Serotonin is a neurotransmitter that has been linked to a wide variety of behaviors including feeding and body-weight regulation, social hierarchies, aggression and suicidality, obsessive compulsive disorder, alcoholism, anxiety, and affective disorders. Full understanding of serotonergic systems in the central nervous system involves genomics, neurochemistry, electrophysiology, and behavior. Though associations have been found between functions at these different levels, in most cases the causal mechanisms are unknown. The scientific issues are daunting but important for human health because of the use of selective serotonin reuptake inhibitors and other pharmacological agents to treat disorders in the serotonergic signaling system. Methods We construct a mathematical model of serotonin synthesis, release, and reuptake in a single serotonergic neuron terminal. The model includes the effects of autoreceptors, the transport of tryptophan into the terminal, and the metabolism of serotonin, as well as the dependence of release on the firing rate. The model is based on real physiology determined experimentally and is compared to experimental data. Results We compare the variations in serotonin and dopamine synthesis due to meals and find that dopamine synthesis is insensitive to the availability of tyrosine but serotonin synthesis is sensitive to the availability of tryptophan. We conduct in silico experiments on the clearance of extracellular serotonin, normally and in the presence of fluoxetine, and compare to experimental data. We study the effects of various polymorphisms in the genes for the serotonin transporter and for tryptophan hydroxylase on synthesis, release, and reuptake. We find that, because of the homeostatic feedback mechanisms of the autoreceptors, the polymorphisms have smaller effects than one expects. We compute the expected steady concentrations of serotonin transporter knockout mice and compare to
Review of lattice measurement techniques at the SLC
International Nuclear Information System (INIS)
Barklow, T.; Emma, P.; Krejcik, P.; Walker, N.
1991-11-01
A technique is described for reconstructing the first order transport matrix (R) for a given beam line. Emphasis is placed on the rigorous error analysis of the data, and the use of powerful statistical techniques to estimate unknown systematic errors. The application of the technique to the measurement and subsequent correction of the SLC Arcs is briefly described. 5 refs., 4 figs
A novel serotonin transporter ligand: (5-Iodo-2-(2-dimethylaminomethylphenoxy)-benzyl alcohol
Energy Technology Data Exchange (ETDEWEB)
Zhuang, Z.-P.; Choi, S.-R.; Hou, Catherine; Mu Mu; Kung, M.-P. E-mail: kunghf@sunmac.spect.upenn.edu; Acton, Paul D.; Kung, Hank F
2000-02-01
The serotonin transporters (SERT) are the primary binding sites for selective serotonin reuptake inhibitors, commonly used antidepressants such as fluoxetine, sertraline, and paroxetine. Imaging of SERT with positron emission tomography and single photon emission computed tomography in humans would provide a useful tool for understanding how alterations of this system are related to depressive illnesses and other psychiatric disorders. In this article the synthesis and characterization of [{sup 125}I]ODAM [(5-iodo-2-(2-dimethylaminomethylphenoxy)-benzyl alcohol, 9)] as an imaging agent in the evaluation of central nervous system SERT are reported. A new reaction scheme was developed for the preparation of compound 9, ODAM, and the corresponding tri-n-butyltin derivative 10. Upon reacting 10 with hydrogen peroxide and sodium[{sup 125}I]iodide, the radiolabeled [{sup 125}I]9 was obtained in good yield (94% yield, radiochemical purity >95%). In an initial binding study using cortical membrane homogenates of rat brain, ODAM displayed a good binding affinity with a value of K{sub i}=2.8{+-}0.88 nM. Using LLC-PK{sub 1} cells specifically expressing the individual transporter (i.e. dopamine [DAT], norepinephrine [NET], and SERT, respectively), ODAM showed a strong inhibition on SERT (K{sub i}=0.12{+-}0.02 nM). Inhibition constants for the other two transporters were lower (K{sub i}=3.9{+-}0.7 {mu}M and 20.0 {+-} 1.9 nM for DAT and NET, respectively). Initial biodistribution study in rats after an intravenous (IV) injection of [{sup 125}I]ODAM showed a rapid brain uptake and washout (2.03, 1.49, 0.79, 0.27, and 0.07% dose/organ at 2, 30, 60, 120, and 240 min, respectively). The hypothalamus region where the serotonin neurons are located exhibited a high specific uptake. Ratios of hypothalamus-cerebellum/cerebellum based on percent dose per gram of these two regions showed values of 0.35, 0.86, 0.86, 0.63, and 0.34 at 2, 30, 60, 120, and 240 min, post-IV injection
A novel serotonin transporter ligand: (5-Iodo-2-(2-dimethylaminomethylphenoxy)-benzyl alcohol
International Nuclear Information System (INIS)
Zhuang, Z.-P.; Choi, S.-R.; Hou, Catherine; Mu Mu; Kung, M.-P.; Acton, Paul D.; Kung, Hank F.
2000-01-01
The serotonin transporters (SERT) are the primary binding sites for selective serotonin reuptake inhibitors, commonly used antidepressants such as fluoxetine, sertraline, and paroxetine. Imaging of SERT with positron emission tomography and single photon emission computed tomography in humans would provide a useful tool for understanding how alterations of this system are related to depressive illnesses and other psychiatric disorders. In this article the synthesis and characterization of [ 125 I]ODAM [(5-iodo-2-(2-dimethylaminomethylphenoxy)-benzyl alcohol, 9)] as an imaging agent in the evaluation of central nervous system SERT are reported. A new reaction scheme was developed for the preparation of compound 9, ODAM, and the corresponding tri-n-butyltin derivative 10. Upon reacting 10 with hydrogen peroxide and sodium[ 125 I]iodide, the radiolabeled [ 125 I]9 was obtained in good yield (94% yield, radiochemical purity >95%). In an initial binding study using cortical membrane homogenates of rat brain, ODAM displayed a good binding affinity with a value of K i =2.8±0.88 nM. Using LLC-PK 1 cells specifically expressing the individual transporter (i.e. dopamine [DAT], norepinephrine [NET], and SERT, respectively), ODAM showed a strong inhibition on SERT (K i =0.12±0.02 nM). Inhibition constants for the other two transporters were lower (K i =3.9±0.7 μM and 20.0 ± 1.9 nM for DAT and NET, respectively). Initial biodistribution study in rats after an intravenous (IV) injection of [ 125 I]ODAM showed a rapid brain uptake and washout (2.03, 1.49, 0.79, 0.27, and 0.07% dose/organ at 2, 30, 60, 120, and 240 min, respectively). The hypothalamus region where the serotonin neurons are located exhibited a high specific uptake. Ratios of hypothalamus-cerebellum/cerebellum based on percent dose per gram of these two regions showed values of 0.35, 0.86, 0.86, 0.63, and 0.34 at 2, 30, 60, 120, and 240 min, post-IV injection, respectively. The specific uptake in hypothalamus
The role of SLC2A1 in early onset and childhood absence epilepsies
DEFF Research Database (Denmark)
Muhle, Hiltrud; Helbig, Ingo; Frøslev, Tobias Guldberg
2013-01-01
Early Onset Absence Epilepsy constitutes an Idiopathic Generalized Epilepsy with absences starting before the age of four years. Mutations in SLC2A1, encoding the glucose transporter, account for approximately 10% of EOAE cases. The role of SLC2A1 mutations in absence epilepsies with a later onset...
International Nuclear Information System (INIS)
Reimold, M.; Bares, R.; Reischl, G.; Solbach, C.; Machulla, H.-J.; Smolka, M.N.; Mann, K.; Schumann, G.; Zimmer, A.; Wrase, J.; Hu, X.-Z.; Goldman, D.; Heinz, A.
2007-01-01
Homozygote carriers of two long (L) alleles of the serotonin transporter (5-HTT) regulatory region displayed in vitro a twofold increase in 5-HTT expression compared with carriers of one or two short (S) alleles. However, in vivo imaging studies yielded contradictory results. Recently, an A > G exchange leading to differential transcriptional activation of 5-HTT mRNA in lymphobalstoid cell lines was discovered in the 5-HTT regulatory region. In vitro and in vivo evidence suggests that [ 11 C]DASB, a new 5-HTT ligand offers some advantages over the ligands used in previous studies in measuring 5-HTT density independent of synaptic levels of serotonin. We assessed 5-HTT binding potential (BP 2) in the midbrain of 19 healthy subjects with positron emission tomography and [ 11 C]DASB. Accounting for the hypothesized functional similarity of L G and S in driving 5-HTT transcription, we assessed whether L A L A homozygotes display increased midbrain BP 2 compared with carriers of at least one S allele. BP 2 in the midbrain was significantly increased in L A L A homozygotes compared with carriers of at least one S allele. Interestingly, the genotype effect on the midbrain was significantly different from that on the thalamus and the amygdala where no group differences were detected. This in vivo study provides further evidence that subjects homozygous for the L A allele display increased expression of 5-HTT in the midbrain, the origin of central serotonergic projections. (author)
Lee, Seong-Ki; Boron, Walter F; Parker, Mark D
2013-04-01
In the basolateral membrane of proximal-tubule cells, NBCe1-A (SLC4A4, variant A), operating with an apparent Na(+):HCO(3)(-) stoichiometry of 1:3, contributes to the reclamation of HCO(3)(-) from the glomerular filtrate, thereby preventing whole body acidosis. Others have reported that NBCe1-like activity in human, rabbit, and rat renal preparations is substantially influenced by lithium, sulfite, oxalate, and harmaline. These data were taken as evidence for the presence of distinct Na(+) and CO(3)(2-) binding sites in NBCe1-A, favoring a model of 1 Na(+):1 HCO(3)(-):1 CO(3)(2-). Here, we reexamine these findings by expressing human or rabbit NBCe1-A clones in Xenopus oocytes. In oocytes, NBCe1-A exhibits a 1:2 stoichiometry and could operate in one of five thermodynamically equivalent transport modes: 1) cotransport of Na(+) + 2 HCO(3)(-), 2) cotransport of Na(+) + CO(3)(2-), 3) transport of NaCO(3)(-), 4) exchange of Na(+) + HCO(3)(-) for H(+), or 5) HCO(3)(-)-activated exchange of Na(+) for 2 H(+). In contrast to the behavior of NBCe1-like activity in renal preparations, we find that cloned NBCe1-A is only slightly stimulated by Li(+), not at all influenced by sulfite or oxalate, and only weakly inhibited by harmaline. These negative data do not uniquely support any of the five models above. In addition, we find that NBCe1-A mediates a small amount of Na(+)-independent NO(3)(-) transport and that NBCe1-A is somewhat inhibited by extracellular benzamil. We suggest that the features of NBCe1-like activity in renal preparations are influenced by yet-to-be-identified renal factors. Thus the actual ionic substrates of NBCe1 remain to be identified.
Potential of [11C]DASB for measuring endogenous serotonin with PET: binding studies
International Nuclear Information System (INIS)
Lundquist, Pinelopi; Wilking, Helena; Hoeglund, A. Urban; Sandell, Johan; Bergstroem, Mats; Hartvig, Per; Langstroem, Bengt
2005-01-01
The serotonin transporter radioligand [ 11 C]-3-amino-4-(2-dimethylaminomethylphenylsulfanyl)-benzonitrile, or [ 11 C]DASB, was examined in order to assess its potential for measuring fluctuations in endogenous serotonin concentrations with positron emission tomography. Binding characteristics of [ 11 C]DASB and the propensity for serotonin to displace the tracer were explored in rat brain homogenates. Experiments showed that serotonin displaced [ 11 C]DASB in vitro. Ex vivo experiments performed after tranylcypromine injection (3 or 15 mg/kg) showed a dose-dependent trend in radioactivity uptake and suggested that serotonin may compete with [ 11 C]DASB for transporter binding
SLC-2000: A luminosity upgrade for the SLC
International Nuclear Information System (INIS)
Breidenbach, M.; Decker, F.-J.; Helm, R.; Napoly, O.; Phinney, N.; Raimondi, P.; Raubenheimer, T.O.; Siemann, R.; Zimmermann, F.; Hertzbach, S.
1996-01-01
We discuss a possible upgrade to the Stanford Linear Collider (SLC), whose objective is to increase the SLC luminosity by at least a factor 7, to an average Z production rate of more than 35,000 per week. The centerpiece of the upgrade is the installation of a new superconducting final doublet with a field gradient of 240 T/m, which will be placed at a distance of only 70 cm from the interaction point. In addition, several bending magnets in each final focus will be lengthened and two octupole correctors are added. A complementary upgrade of damping rings and bunch compressors will allow optimum use of the modified final focus and can deliver, or exceed, the targeted luminosity. The proposed upgrade will place the SLC physics program in a very competitive position, and will also enable it to pursue its pioneering role as the first and only linear collider. (author)
DEFF Research Database (Denmark)
Erritzoe, David; Holst, Klaus; Frokjaer, Vibe G.
2010-01-01
Serotonergic neurotransmission is involved in the regulation of physiological functions such as mood, sleep, memory, and appetite. Within the serotonin transmitter system, both the postsynaptically located serotonin 2A (5-HT2A) receptor and the presynaptic serotonin transporter (SERT) are sensitive...... tomography. Within each individual, a regional intercorrelation for the various brain regions was seen with both markers, most notably for 5-HT2A receptor binding. An inverted U-shaped relationship between the 5-HT2A receptor and the SERT binding was identified. The observed regional intercorrelation...
Margolis, Kara Gross
2017-10-01
Many disease conditions considered CNS-predominant harbor significant intestinal comorbidities. Serotonin (5-HT) and the serotonin reuptake transporter (SERT) have increasingly been shown to play important roles in both brain and intestinal development and long-term function. 5-HT and SERT may thus modulate critical functions in the development and perpetuation of brain-gut axis disease. We discuss the potential roles of 5-HT and SERT in the brain and intestinal manifestations of autism spectrum disorders and developmental antidepressant exposure. The potential therapeutic value of 5-HT 4 modulation in the subsequent treatment of these conditions is also addressed. Copyright © 2017 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Moffeit, K.C.
1987-01-01
The status and research possibilities of the Stanford Linear Collider (SLC) are reviewed. The physics program concentrates on production of Z 0 's and their decay. The SLC systems include a new injector and booster, two damping rings to provide the small beam emittance, a new positron source, the existing LINAC structure upgraded for higher energy and better beam control, beam transport arcs, a final focus section, and experimental halls are detectors. Energy spectrometers with an accuracy of ± 50 MeV/c 2 for pulse-to-pulse center of mass energy measurement are to be installed. Longitudinal polarized electrons are expected, and will allow more precise tests of the standard model
Rationality and emotionality: serotonin transporter genotype influences reasoning bias
Stollstorff, Melanie; Bean, Stephanie E.; Anderson, Lindsay M.; Devaney, Joseph M.; Vaidya, Chandan J.
2012-01-01
Reasoning often occurs under emotionally charged, opinion-laden circumstances. The belief-bias effect indexes the extent to which reasoning is based upon beliefs rather than logical structure. We examined whether emotional content increases this effect, particularly for adults genetically predisposed to be more emotionally reactive. SS/SLG carriers of the serotonin transporter genotype (5-HTTLPR) were less accurate selectively for evaluating emotional relational reasoning problems with belief...
Alteration of the platelet serotonin transporter in romantic love.
Marazziti, D; Akiskal, H S; Rossi, A; Cassano, G B
1999-05-01
The evolutionary consequences of love are so important that there must be some long-established biological process regulating it. Recent findings suggest that the serotonin (5-HT) transporter might be linked to both neuroticism and sexual behaviour as well as to obsessive-compulsive disorder (OCD). The similarities between an overvalued idea, such as that typical of subjects in the early phase of a love relationship, and obsession, prompted us to explore the possibility that the two conditions might share alterations at the level of the 5-HT transporter. Twenty subjects who had recently (within the previous 6 months) fallen in love, 20 unmedicated OCD patients and 20 normal controls, were included in the study. The 5-HT transporter was evaluated with the specific binding of 3H-paroxetine (3H-Par) to platelet membranes. The results showed that the density of 3H-Par binding sites was significantly lower in subjects who had recently fallen in love and in OCD patients than in controls. The main finding of the present study is that subjects who were in the early romantic phase of a love relationship were not different from OCD patients in terms of the density of the platelet 5-HT transporter, which proved to be significantly lower than in the normal controls. This would suggest common neurochemical changes involving the 5-HT system, linked to psychological dimensions shared by the two conditions, perhaps at an ideational level.
Garfield, Lauren D.; Dixon, David; Nowotny, Petra; Lotrich, Francis E.; Pollock, Bruce G.; Kristjansson, Sean D.; Doré, Peter M.; Lenze, Eric J.
2013-01-01
Objective Antidepressant side-effects are a significant public health issue, associated with poor adherence, premature treatment discontinuation and in rare cases significant harm. This is especially relevant for older adults, who assume the largest and most serious burden of medication side-effects. We investigated the association between antidepressant side-effects and genetic variation in the serotonin system in anxious, older adults participating in a randomized, placebo-controlled trial of the SSRI escitalopram. Method Adults (n=177) aged ≥ 60 years were randomized to active treatment or placebo for 12-weeks. Side-effects were assessed using the UKU side effect rating scale. Genetic polymorphisms were putative functional variants in the promoters of the serotonin transporter and 1A and 2A receptors (5-HTTLPR (L/S + rs25531), HTR1A rs6295, HTR2A rs6311, respectively). Results Four significant drug-placebo side-effect differences were found, including increased duration of sleep, dry mouth, diarrhea and diminished sexual desire. Analyses using putative high- vs low-transcription genotype groupings revealed 6 pharmacogenetic effects: greater dry mouth and decreased sexual desire for the low- and high-expressing genotypes of the serotonin transporter, respectively, and greater diarrhea with the low-transcription genotype of the 1A receptor. Diminished sexual desire was experienced significantly more in those with high-expressing genotype and either the serotonin transporter, 1A or 2A receptors. There was not a significant relationship between drug concentration and side-effects nor a mean difference in drug concentration between low- and high-expressing genotypes. Conclusion Genetic variation in the 5HT system may predict who develops common SSRI side-effects and why. More work is needed to further characterize this genetic modulation and to translate research findings into strategies useful for more personalized patient care. PMID:24021217
Zoccola, Didier
2015-06-04
The bicarbonate ion (HCO3−) is involved in two major physiological processes in corals, biomineralization and photosynthesis, yet no molecular data on bicarbonate transporters are available. Here, we characterized plasma membrane-type HCO3− transporters in the scleractinian coral Stylophora pistillata. Eight solute carrier (SLC) genes were found in the genome: five homologs of mammalian-type SLC4 family members, and three of mammalian-type SLC26 family members. Using relative expression analysis and immunostaining, we analyzed the cellular distribution of these transporters and conducted phylogenetic analyses to determine the extent of conservation among cnidarian model organisms. Our data suggest that the SLC4γ isoform is specific to scleractinian corals and responsible for supplying HCO3− to the site of calcification. Taken together, SLC4γ appears to be one of the key genes for skeleton building in corals, which bears profound implications for our understanding of coral biomineralization and the evolution of scleractinian corals within cnidarians.
Zoccola, Didier; Ganot, Philippe; Bertucci, Anthony; Caminiti-Segonds, Natacha; Techer, Nathalie; Voolstra, Christian R.; Aranda, Manuel; Tambutté , Eric; Allemand, Denis; Casey, Joseph R; Tambutté , Sylvie
2015-01-01
The bicarbonate ion (HCO3−) is involved in two major physiological processes in corals, biomineralization and photosynthesis, yet no molecular data on bicarbonate transporters are available. Here, we characterized plasma membrane-type HCO3− transporters in the scleractinian coral Stylophora pistillata. Eight solute carrier (SLC) genes were found in the genome: five homologs of mammalian-type SLC4 family members, and three of mammalian-type SLC26 family members. Using relative expression analysis and immunostaining, we analyzed the cellular distribution of these transporters and conducted phylogenetic analyses to determine the extent of conservation among cnidarian model organisms. Our data suggest that the SLC4γ isoform is specific to scleractinian corals and responsible for supplying HCO3− to the site of calcification. Taken together, SLC4γ appears to be one of the key genes for skeleton building in corals, which bears profound implications for our understanding of coral biomineralization and the evolution of scleractinian corals within cnidarians.
Antidepressant Specificity of Serotonin Transporter Suggested by Three LeuT-SSRI Structures
Energy Technology Data Exchange (ETDEWEB)
Zhou, Z.; Zhen, J; Karpowich, N; Law, C; Reith, M; Wang, D
2009-01-01
Sertraline and fluoxetine are selective serotonin re-uptake inhibitors (SSRIs) that are widely prescribed to treat depression. They exert their effects by inhibiting the presynaptic plasma membrane serotonin transporter (SERT). All SSRIs possess halogen atoms at specific positions, which are key determinants for the drugs' specificity for SERT. For the SERT protein, however, the structural basis of its specificity for SSRIs is poorly understood. Here we report the crystal structures of LeuT, a bacterial SERT homolog, in complex with sertraline, R-fluoxetine or S-fluoxetine. The SSRI halogens all bind to exactly the same pocket within LeuT. Mutation at this halogen-binding pocket (HBP) in SERT markedly reduces the transporter's affinity for SSRIs but not for tricyclic antidepressants. Conversely, when the only nonconserved HBP residue in both norepinephrine and dopamine transporters is mutated into that found in SERT, their affinities for all the three SSRIs increase uniformly. Thus, the specificity of SERT for SSRIs is dependent largely on interaction of the drug halogens with the protein's HBP.
Serotonin transporter (SERT gene polymorphism in Parkinson’s disease
Directory of Open Access Journals (Sweden)
Mahmut Özkaya
2004-06-01
Full Text Available Background: Parkinson disease (PD is the second most common neurodegenerative disorder with a prevalence of about 2% in persons older than 65 years of age. Neurodegenerative process in PD is not restricted to the dopaminergic neurons of the substantia nigra but also affects serotoninergic neurons. It has been shown that PD brains with Lewy bodies in the substantia nigra also had Lewy bodies in the raphe nuclei. The re-uptake of 5HT released into the synaptic cleft is mediated by the 5HT transporter (SERT. The SERT gene has been mapped to the chromosome of 17q11.1-q12 and has two main polymorphisms: intron two VNTR polymorphism and promoter region 44 bp insertion/deletion polymorphism. Objective: In this study we investigated whether two polymorphic regions in the serotonin transporter gene are associated with PD. Material and Method: After obtaining informed consent, blood samples were collected from 76 patients and 54 healthy volunteers. Genomic DNA was extracted from peripheral leucocytes using standard methods. The SERT gene genotypes were determined using polymerase chain reaction (PCR method. Results: Based on the intron 2 VNTR polymorphism of SERT gene, the distribution of 12/12, 12/10 and 10/10 genotypes were found as, 56.6 %, 35.5 %, 7.9 % in patients whereas this genotype distribution in control group was 40.7 %, 46.3 % and 13 %, respectively. According to 5-HTTLPR polymorphism, the distribution of L/L, L/S and S/S genotypes were found as 27.6 % 51.3 % and 21.1 % in patients whereas this genotype distribution in control group was 33.4 %, 50.0 % and 16.6 %, respectively. Despite the fact that the genotype distribution of SERT gene polymorphism in patients and control group seemed to be different from each other, this difference was not found to be statistically significant. Conclusion: This finding suggests that polymorphisms within the SERT gene do not play a major role in PD susceptibility in the Turkish population.
DEFF Research Database (Denmark)
Lehre, A C; Rowley, N M; Zhou, Y
2011-01-01
of the GAT1 by the clinically available anti-epileptic drug tiagabine has been an effective strategy for the treatment of some patients with partial seizures. Recently, the investigational drug EF1502, which inhibits both GAT1 and BGT1, was found to exert an anti-convulsant action synergistic...... to that of tiagabine, supposedly due to inhibition of BGT1. The present study addresses the role of BGT1 in seizure control and the effect of EF1502 by developing and exploring a new mouse line lacking exons 3-5 of the BGT1 (slc6a12) gene. The deletion of this sequence abolishes the expression of BGT1 mRNA. However......, homozygous BGT1-deficient mice have normal development and show seizure susceptibility indistinguishable from that in wild-type mice in a variety of seizure threshold models including: corneal kindling, the minimal clonic and minimal tonic extension seizure threshold tests, the 6Hz seizure threshold test...
Yuan, Fang-Fen; Gu, Xue; Huang, Xin; Zhong, Yan; Wu, Jing
2017-07-03
Attention-deficit/hyperactivity disorder (ADHD) is an early onset childhood neurodevelopmental disorder with an estimated heritability of approximately 76%. We conducted a case-control study to explore the role of the SLC6A1 gene in ADHD. The genotypes of eight variants were determined using Sequenom MassARRAY technology. The participants in the study were 302 children with ADHD and 411 controls. ADHD symptoms were assessed using the Conners Parent Symptom Questionnaire. In our study, rs2944366 was consistently shown to be associated with the ADHD risk in the dominant model (odds ratio [OR]=0.554, 95% confidence interval [CI]=0.404-0.760), and nominally associated with Hyperactive index score (P=0.027). In addition, rs1170695 has been found to be associated with the ADHD risk in the addictive model (OR=1.457, 95%CI=1.173-1.809), while rs9990174 was associated with the Hyperactive index score (P=0.010). Intriguingly, gene-environmental interactions analysis consistently revealed the potential interactions of rs1170695 with blood lead (P mul =0.044) to modify the ADHD risk. Expression quantitative trait loci analysis suggested that these positive single nucleotide polymorphisms (SNPs) may mediate SLC6A1 gene expression. Therefore, our results suggest that selected SLC6A1 gene variants may have a significant effect on the ADHD risk. Copyright © 2017 Elsevier Inc. All rights reserved.
The rise and fall of novel renal magnesium transporters.
Schäffers, Olivier J M; Hoenderop, Joost G J; Bindels, René J M; de Baaij, Jeroen H F
2018-06-01
Body Mg 2+ balance is finely regulated in the distal convoluted tubule (DCT), where a tight interplay among transcellular reabsorption, mitochondrial exchange, and basolateral extrusion takes place. In the last decades, several research groups have aimed to identify the molecular players in these processes. A multitude of proteins have been proposed to function as Mg 2+ transporter in eukaryotes based on phylogenetic analysis, differential gene expression, and overexpression studies. However, functional evidence for many of these proteins is lacking. The aim of this review is, therefore, to critically reconsider all putative Mg 2+ transporters and put their presumed function in context of the renal handling of Mg 2+ . Sufficient experimental evidence exists to acknowledge transient receptor potential melastatin (TRPM) 6 and TRPM7, solute carrier family 41 (SLC41) A1 and SLC41A3, and mitochondrial RNA splicing 2 (MRS2) as Mg 2+ transporters. TRPM6/7 facilitate Mg 2+ influx, SLC41A1 mediates Mg 2+ extrusion, and MRS2 and SLC41A3 are implicated in mitochondrial Mg 2+ homeostasis. These proteins are highly expressed in the DCT. The function of cyclin M (CNNM) proteins is still under debate. For the other proposed Mg 2+ transporters including Mg 2+ transporter subtype 1 (MagT1), nonimprinted in Prader-Willi/Angelman syndrome (NIPA), membrane Mg 2+ transport (MMgT), Huntingtin-interacting protein 14 (HIP14), and ATP13A4, functional evidence is limited, or functions alternative to Mg 2+ transport have been suggested. Additional characterization of their Mg 2+ transport proficiency should be provided before further claims about their role as Mg 2+ transporter can be made.
Directory of Open Access Journals (Sweden)
Raymond E. Lai
2018-04-01
Full Text Available Many drugs, hormones, components of herbal medicines, environmental pesticides and toxins are Solute Carrier family 22 (SLC22 substrates. The last twenty years has seen great progress in determining SLC22 tissue expression profiles, membrane localization, energetics, substrate profiles and biopharmaceutical significance. However, much still remains to be answered in terms of SLC22 family member's roles in ‘normal’ physiology as compared to pathophysiological states, as well as in drug interactions that impact pharmacokinetics, efficacy and toxicity. This review begins with a brief synopsis of SLC22 family discovery, function and tissue expression. Subsequent sections provide examples establishing a role for SLC22 transporters in food-drug, herbal supplement-drug, endogenous substrate-drug and drug–drug interactions. Keywords: Hepatic transport, Nephrotoxicity, Organic anion transporter, Organic cation transporter, Renal transport
Serotonin Transporter Genotype (5-HTTLPR) Predicts Utilitarian Moral Judgments
Marsh, Abigail A.; Crowe, Samantha L.; Yu, Henry H.; Gorodetsky, Elena K.; Goldman, David; Blair, R. J. R.
2011-01-01
Background The psychological and neurobiological processes underlying moral judgment have been the focus of extensive recent research. Here we show that serotonin transporter (5-HTTLPR) genotype predicts responses to moral dilemmas featuring foreseen harm to an innocent. Methodology/Principal Findings Participants in this study judged the acceptability of actions that would unintentionally or intentionally harm an innocent victim in order to save others' lives. An analysis of variance reveale...
FlipADAM: a potential new SPECT imaging agent for the serotonin transporter
Energy Technology Data Exchange (ETDEWEB)
Wang, Julie L.; Deutsch, Eric C. [Department of Pharmacology, University of Pennsylvania School of Medicine, Philadelphia, PA 19104 (United States); Oya, Shunichi [Department of Radiology, University of Pennsylvania School of Medicine, Philadelphia, PA 19104 (United States); Kung, Hank F., E-mail: kunghf@gmail.co [Department of Pharmacology, University of Pennsylvania School of Medicine, Philadelphia, PA 19104 (United States); Department of Radiology, University of Pennsylvania School of Medicine, Philadelphia, PA 19104 (United States)
2010-07-15
Introduction: Single photon emission computed tomography (SPECT) imaging of the serotonin transporter (SERT) in the brain is a useful tool for examining normal physiological functions and disease states involving the serotonergic system. The goal of this study was to develop an improved SPECT radiotracer with faster kinetics than the current leading SPECT tracer, [{sup 123}I]ADAM, for selective SERT imaging. Methods: The in vitro binding affinities of (2-(2'-((dimethylamino)methyl)-4'-iodophenylthio)benzenamine) (FlipADAM) (1c), were determined using Hampshire pig kidney cells stably overexpressing the serotonin, norepinephrine (NET) or dopamine transporter (DAT). Localization of [{sup 125}I]FlipADAM (1c) was evaluated through biodistribution and autoradiography in male Sprague Dawley rats, and the specificity of binding was assessed by injecting selective SERT or NET inhibitors prior to [{sup 125}I]FlipADAM (1c). Results: FlipADAM (1c) displayed a high binding affinity for SERT (K{sub i}=1.0 nM) and good selectivity over NET and DAT binding (43-fold and 257-fold, respectively). [{sup 125}I]FlipADAM (1c) successfully penetrated the blood brain barrier, as evidenced by the brain uptake at 2 min (1.75% dose/g). [{sup 125}I]FlipADAM(1c) also had a good target to non-target (hypothalamus/cerebellum) ratio of 3.35 at 60 min post-injection. In autoradiography studies, [{sup 125}I]FlipADAM (1c) showed selective localization in SERT-rich brain regions such as the thalamic nuclei, amygdala, dorsal raphe nuclei and other areas. Conclusion: [{sup 125}I]FlipADAM (1c) exhibited faster clearance from the brain and time to binding equilibrium when compared to [{sup 125}I]2-(2'-((dimethylamino)methyl)-phenylthio)-5-iodophenylamine [{sup 125}I]ADAM (1b) and a higher target to non-target ratio when compared to [{sup 125}I]5-iodo-2-(2'-((dimethylamino)methyl)-phenylthio)benzyl alcohol [{sup 125}I]IDAM (1a). Therefore, [{sup 123}I]FlipADAM (1c) may be an improved
Gildea, John J; Xu, Peng; Kemp, Brandon A; Carlson, Julia M; Tran, Hanh T; Bigler Wang, Dora; Langouët-Astrié, Christophe J; McGrath, Helen E; Carey, Robert M; Jose, Pedro A; Felder, Robin A
2018-01-01
Salt sensitivity of blood pressure affects >30% of the hypertensive and >15% of the normotensive population. Variants of the electrogenic sodium bicarbonate cotransporter NBCe2 gene, SLC4A5, are associated with increased blood pressure in several ethnic groups. SLC4A5 variants are also highly associated with salt sensitivity, independent of hypertension. However, little is known about how NBCe2 contributes to salt sensitivity, although NBCe2 regulates renal tubular sodium bicarbonate transport. We hypothesized that SLC4A5 rs10177833 and rs7571842 increase NBCe2 expression and human renal proximal tubule cell (hRPTC) sodium transport and may be a cause of salt sensitivity of blood pressure. To characterize the hRPTC ion transport of wild-type (WT) and homozygous variants (HV) of SLC4A5. The expressions of NBCe2 mRNA and protein were not different between hRPTCs carrying WT or HV SLC4A5 before or after dopaminergic or angiotensin (II and III) stimulation. However, luminal to basolateral sodium transport, NHE3 protein, and Cl-/HCO3- exchanger activity in hRPTCs were higher in HV than WT SLC4A5. Increasing intracellular sodium enhanced the apical location of NBCe2 in HV hRPTCs (4.24±0.35% to 11.06±1.72% (P<0.05, N = 3, 2-way ANOVA, Holm-Sidak test)) as determined by Total Internal Reflection Fluorescence Microscopy (TIRFM). In hRPTCs isolated from kidney tissue, increasing intracellular sodium enhanced bicarbonate-dependent pH recovery rate and increased NBCe2 mRNA and protein expressions to a greater extent in HV than WT SLC4A5 (+38.00±6.23% vs HV normal salt (P<0.01, N = 4, 2-way ANOVA, Holm-Sidak test)). In hRPTCs isolated from freshly voided urine, bicarbonate-dependent pH recovery was also faster in those from salt-sensitive and carriers of HV SLC4A5 than from salt-resistant and carriers of WT SLC4A5. The faster NBCe2-specific bicarbonate-dependent pH recovery rate in HV SCL4A5 was normalized by SLC4A5- but not SLC4A4-shRNA. The binding of purified hepatocyte
Blom, Rianne M.; Samuels, Jack F.; Riddle, Mark A.; Joseph Bienvenu, O.; Grados, Marco A.; Reti, Irving M.; Eaton, William W.; Liang, Kung-Yee; Nestadt, Gerald
2011-01-01
The serotonin transporter (SERT) polymorphism (5HTTLPR) has been reported to be associated with several psychiatric conditions. Specific personality disorders could be intermediate factors in the known relationship between 5HTTLPR and psychiatric disorders. This is the first study to test the
International Nuclear Information System (INIS)
Paul, S.M.; Rehavi, M.; Skolnick, P.; Ballenger, J.C.; Goodwin, F.K.
1981-01-01
The high-affinity tritiated (3H) imipramine binding sites are functionally (and perhaps structurally) associated with the presynaptic neuronal and platelet uptake sites for serotonin. Since there is an excellent correlation between the relative potencies of a series of antidepressants in displacing 3H-imipramine from binding sites in human brain and platelet, we have examined the binding of 3H-imipramine to platelets from 14 depressed patients and 28 age- and sex-matched controls. A highly significant decrease in the number of 3H-imipramine binding sites, with no significant change in the apparent affinity constants, was observed in platelets from the depressed patients compared with the controls. These results, coupled with previous studies showing a significant decrease in the maximal uptake of serotonin in platelets from depressed patients, suggest that an inherited or acquired deficiency of the serotonin transport protein or proteins may be involved in the pathogenesis of depression
Biodistribution and dosimetry of 123I-mZIENT: a novel ligand for imaging serotonin transporters
International Nuclear Information System (INIS)
Nicol, Alice; Krishnadas, Rajeev; Champion, Sue; Tamagnan, Gilles; Stehouwer, Jeffrey S.; Goodman, Mark M.; Hadley, Donald M.; Pimlott, Sally L.
2012-01-01
123 I-labelled mZIENT (2β-carbomethoxy-3β-(3'-((Z)-2-iodoethenyl)phenyl)nortropane) has been developed as a radioligand for the serotonin transporter. The aim of this preliminary study was to assess its whole-body biodistribution in humans and estimate dosimetry. Three healthy controls and three patients receiving selective serotonin reuptake inhibitor (SSRI) therapy for depression were included (two men, four women, age range 41-56 years). Whole-body imaging, brain SPECT imaging and blood and urine sampling were performed. Whole-body images were analysed using regions of interest (ROIs), time-activity curves were derived using compartmental analysis and dosimetry estimated using OLINDA software. Brain ROI analysis was performed to obtain specific-to-nonspecific binding ratios in the midbrain, thalamus and striatum. Initial high uptake in the lungs decreased in later images. Lower uptake was seen in the brain, liver and intestines. Excretion was primarily through the urinary system. The effective dose was estimated to be of the order of 0.03 mSv/MBq. The organ receiving the highest absorbed dose was the lower large intestine wall. Uptake in the brain was consistent with the known SERT distribution with higher specific-to-nonspecific binding in the midbrain, thalamus and striatum in healthy controls compared with patients receiving SSRI therapy. 123 I-mZIENT may be a promising radioligand for imaging the serotonin transporters in humans with acceptable dosimetry. (orig.)
Booij, J.; Knol, R. J.; Reneman, L.; de Bruin, K.; Janssen, A. G.; van Royen, E. A.
1998-01-01
Iodine-123 labelled 2beta-carbomethoxy-3beta-4-iodophenylnortropane (nor-beta-CIT), a radioiodinated cocaine analogue, was evaluated as an agent for the in vivo labelling of serotonin transporters by biodistribution studies in rats. Intravenous injection of [123I]nor-beta-CIT resulted in high
Zhang, Dandan; Li, Zhenli; Xu, Xiaohong; Zhou, Dan; Tang, Shunli; Yin, Xiaoyang; Xu, Fangying; Li, Hui; Zhou, Yuan; Zhu, Tao; Deng, Hong; Zhang, Shuai; Huang, Qiong; Wang, Jing; Yin, Wei; Zhu, Yimin; Lai, Maode
2017-10-26
Copy number variations (CNVs) contribute to the development of colorectal cancer (CRC). We conducted a two-stage association study to identify CNV risk loci for CRC. We performed a gene-based rare CNV study on 694 sporadic CRC and 1641 controls using Illumina Human-OmniExpress-12v1.0 BeadChips, and further replicated in 934 CRC cases and 2680 controls for risk CNVs by using TaqMan Copy Number Assay. Tumor buddings, cancer cells in the center of primary tumor and normal intestinal epithelial cells were captured using laser capture microdissection (LCM) and were assayed using AffymetrixGeneChip® Human Genome U133 Plus 2.0 Array. In addition, The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus data were assessed for the effects of risk CNVs. We found that germline deletions affecting the last six exons of SLC18A1 significantly associated with CRC with a combined P value of 6.4 × 10-5 by a two-stage analysis. Both in TCGA CRC RNA seq dataset and GDS4382, SLC18A1 was significantly down regulated in CRC tissues than in paired normal tissues (N = 32 and 17 pairs, P = 0.004 and 0.009, respectively). In LCM samples, similar observations were obtained that the expression levels of SLC18A1 in the tumor buddings, cancer cells in the center of primary tumor, and stroma of both tumor budding and cancer cells were lower than normal intestinal epithelial and stromal cells (fold change = 0.17-0.62, 0.12-0.57 and 0.37-0.68, respectively). In summary, the germline deletions at SLC18A1 contributed to the development of CRC. The role of SLC18A1 required further exploration. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Meta-analysis of the association of the SLC6A3 3'-UTR VNTR with cognition.
Ettinger, Ulrich; Merten, Natascha; Kambeitz, Joseph
2016-01-01
The gene coding for the dopamine transporter (DAT), SLC6A3, contains a 40-base pair variable number of tandem repeats (VNTR) polymorphism (rs28363170) in its 3' untranslated region. This VNTR has been associated with attention deficit hyperactivity disorder (ADHD) and has been investigated in relation to cognition and brain function. Here, we report the results of a comprehensive meta-analysis with meta-regression examining the association of the VNTR with different domains of cognition in healthy adults. We extracted data from 28 independent studies and carried out meta-analyses for associations with working memory (k=10 samples, N=1193 subjects), inhibition (k=8 samples, N=829 subjects), executive functions including inhibition (k=10 samples, N=984 subjects), attention (k=6 samples, N=742 subjects) and declarative long-term memory (k=5 samples, N=251 subjects). None of the investigated dimensions showed significant associations with the VNTR (all p>0.26). Meta-regression including year of publication, gender, age, ethnicity and percentage of 10R-homozygotes similarly did not attain significance. We conclude that there is no evidence that rs28363170 may be a significant predictor of cognitive function in healthy adults. Copyright © 2015 Elsevier Ltd. All rights reserved.
Serotonin: Is it a marker for the diagnosis of hepatocellular ...
African Journals Online (AJOL)
Impaired metabolic function in liver cirrhosis and slow uptake and storage of serotonin by the platelets is a sequelae of kinetic change of serotonin transport mechanisms or abnormal serotonin release from dense granules of activated platelets is a condition defined as ''platelet exhaustion'', contributes to elevated plasma ...
Slc3a2 Mediates Branched-Chain Amino-Acid-Dependent Maintenance of Regulatory T Cells
Directory of Open Access Journals (Sweden)
Kayo Ikeda
2017-11-01
Full Text Available Summary: Foxp3+ regulatory T (Treg cells, which suppress immune responses, are highly proliferative in vivo. However, it remains unclear how the active replication of Treg cells is maintained in vivo. Here, we show that branched-chain amino acids (BCAAs, including isoleucine, are required for maintenance of the proliferative state of Treg cells via the amino acid transporter Slc3a2-dependent metabolic reprogramming. Mice fed BCAA-reduced diets showed decreased numbers of Foxp3+ Treg cells with defective in vivo proliferative capacity. Mice lacking Slc3a2 specifically in Foxp3+ Treg cells showed impaired in vivo replication and decreased numbers of Treg cells. Slc3a2-deficient Treg cells showed impaired isoleucine-induced activation of the mTORC1 pathway and an altered metabolic state. Slc3a2 mutant mice did not show an isoleucine-induced increase of Treg cells in vivo and exhibited multi-organ inflammation. Taken together, these findings demonstrate that BCAA controls Treg cell maintenance via Slc3a2-dependent metabolic regulation. : Treg cells regulate excess immune responses and are highly proliferative in vivo. Ikeda et al. find that branched-chain amino acids (BCAAs are essentially required to maintain expansion and the suppressive capacity of Treg cells via Slc3a2 and mTORC1. Keywords: Treg cells, amino acids, immunometabolism, immune regulation, transporter
Bicarbonate Transport During Enamel Maturation.
Yin, Kaifeng; Paine, Michael L
2017-11-01
Amelogenesis (tooth enamel formation) is a biomineralization process consisting primarily of two stages (secretory stage and maturation stage) with unique features. During the secretory stage, the inner epithelium of the enamel organ (i.e., the ameloblast cells) synthesizes and secretes enamel matrix proteins (EMPs) into the enamel space. The protein-rich enamel matrix forms a highly organized architecture in a pH-neutral microenvironment. As amelogenesis transitions to maturation stage, EMPs are degraded and internalized by ameloblasts through endosomal-lysosomal pathways. Enamel crystallite formation is initiated early in the secretory stage, however, during maturation stage the more rapid deposition of calcium and phosphate into the enamel space results in a rapid expansion of crystallite length and mineral volume. During maturation-stage amelogenesis, the pH value of enamel varies considerably from slightly above neutral to acidic. Extracellular acid-base balance during enamel maturation is tightly controlled by ameloblast-mediated regulatory networks, which include significant synthesis and movement of bicarbonate ions from both the enamel papillary layer cells and ameloblasts. In this review we summarize the carbonic anhydrases and the carbonate transporters/exchangers involved in pH regulation in maturation-stage amelogenesis. Proteins that have been shown to be instrumental in this process include CA2, CA6, CFTR, AE2, NBCe1, SLC26A1/SAT1, SLC26A3/DRA, SLC26A4/PDS, SLC26A6/PAT1, and SLC26A7/SUT2. In addition, we discuss the association of miRNA regulation with bicarbonate transport in tooth enamel formation.
Cooper, Deborah S.; Yang, Han Soo; He, Peijian; Kim, Eunjin; Rajbhandari, Ira; Yun, Chris C.; Choi, Inyeong
2009-01-01
Growing evidence suggests that pharmacological inhibition of Na/H exchange and Na/HCO3 transport provides protection against damage or injury in cardiac ischemia. In this study, we examined the contribution of the sodium/bicarbonate cotransporter NBCn1 (slc4a7) to cytotoxicity in cultured hippocampal neurons of rats. In neurons exposed to extracellular pH (pHo) ranging from 6.2 to 8.3, NBCn1 protein expression increased by fivefold at pH < 6.5 compared to the expression at pHo 7.4. At pHo 6.5, the intracellular pH of neurons was ~1 unit lower than that at pH 7.4. Immunochemistry showed a marked increase in NBCn1 immunofluorescence in plasma membranes and cytosol of the soma as well as in dendrites, at pHo 6.5. NBCn1 expression also increased by 40% in a prolonged Mg2+-free incubation at normal pHo. Knockdown of NBCn1 in neurons had negligible effect on cell viability. The effect of NBCn1 knockdown on cytotoxicity was then determined by exposing neurons to 0.5 mM glutamate for 10 min and measuring lactate dehydrogenase (LDH) release from neurons. Compared to normal incubation (pHo 7.2 for 6 h) after glutamate exposure, acidic incubation (pHo 6.3 for 6 h) reduced cytotoxicity by 75% for control neurons and 78% for NBCn1-knockdown neurons. Thus, both controls and knockdown neurons showed acidic protection from cytotoxicity. However, in Mg2+-free incubation after glutamate exposure, NBCn1 knockdown progressively attenuated cytotoxicity. This attenuation was unaffected by acidic preincubation before glutamate exposure. We conclude that NBCn1 has a dynamic upregulation in low pHo and Mg2+ depletion. NBCn1 is not required for acidic protection, but increases cytotoxicity in Mg2+-free conditions. PMID:19170751
International Nuclear Information System (INIS)
Adolphsen, C.; Barklow, T.; Burke, D.; Decker, F.J.; Emma, P.; Hildreth, M.; Himel, T.; Krejcik, P.; Limberg, T.; Minty, M.
1993-01-01
The Stanford Linear Collider was designed to operate with round beams; horizontal and vertical emittance made equal in the damping rings. The main motivation was to facilitate the optical matching through beam lines with strong coupling elements like the solenoid spin rotator magnets and the SLC arcs. Tests in 1992 showed that open-quote flat close-quote beams with a vertical to horizontal emittance ratio of around 1/10 can be successfully delivered to the end of the linac. Techniques developed to measure and control the coupling of the SLC arcs allow These beams to be transported to the Interaction Point (IP). Before flat beams could be used for collisions with polarized electrons, a new method of rotating the electron spin orientation with vertical arc orbit bumps had to be developed. Early in the 1993 run, the SLC was switched to open-quote flat close-quote beam operation. Within a short time the peak luminosity of the previous running cycle was reached and then surpassed. The average daily luminosity is now a factor of about two higher than the best achieved last year. In the following the authors present an overview of the problems encountered and their solutions for different parts of the SLC
Homberg, J. R.; Olivier, J.D.A.; Smits, B. M. G.; Mul, J. D.; Mudde, J.; Verheul, M.; Nieuwenhuizen, O. F. M.; Cools, A. R.; Ronken, E; Cremers, Thomas; Schoffelmeere, A. N. M.; Ellenbroeik, B. A.; Cuppen, E.
2007-01-01
Serotonergic signaling is involved in many neurobiological processes and disturbed 5-HT homeostasis is implicated in a variety of psychiatric and addictive disorders. Here, we describe the functional characterization of the serotonin transporter (SERT) knockout rat model, that is generated by
Homberg, J.R.; Olivier, J.D.A.; Smits, B.M.; Mul, J.D.; Mudde, J.; Verheul, M.; Nieuwenhuizen, O.F.; Cools, A.R.; Ronken, E.; Cremers, T.; Schoffelmeer, A.N.; Ellenbroek, B.A.; Cuppen, E.
2007-01-01
Serotonergic signaling is involved in many neurobiological processes and disturbed 5-HT homeostasis is implicated in a variety of psychiatric and addictive disorders. Here, we describe the functional characterization of the serotonin transporter (SERT) knockout rat model, that is generated by
Gurav, Ashish; Sivaprakasam, Sathish; Bhutia, Yangzom D; Boettger, Thomas; Singh, Nagendra; Ganapathy, Vadivel
2015-07-15
Mammalian colon harbours trillions of bacteria under physiological conditions; this symbiosis is made possible because of a tolerized response from the mucosal immune system. The mechanisms underlying this tolerogenic phenomenon remain poorly understood. In the present study we show that Slc5a8 (solute carrier gene family 5a, member 8), a Na(+)-coupled high-affinity transporter in colon for the bacterial fermentation product butyrate, plays a critical role in this process. Among various immune cells in colon, dendritic cells (DCs) are unique not only in their accessibility to luminal contents but also in their ability to induce tolerogenic phenotype in T-cells. We found that DCs exposed to butyrate express the immunosuppressive enzymes indoleamine 2,3-dioxygenase 1 (IDO1) and aldehyde dehydrogenase 1A2 (Aldh1A2), promote conversion of naive T-cells into immunosuppressive forkhead box P3(+) (FoxP3(+)) Tregs (regulatory T-cells) and suppress conversion of naive T-cells into pro-inflammatory interferon (IFN)-γ-producing cells. Slc5a8-null DCs do not induce IDO1 and Aldh1A2 and do not generate Tregs or suppress IFN-γ-producing T-cells in response to butyrate. We also provide in vivo evidence for an obligatory role for Slc5a8 in suppression of IFN-γ-producing T-cells. Furthermore, Slc5a8 protects against colitis and colon cancer under conditions of low-fibre intake but not when dietary fibre intake is optimal. This agrees with the high-affinity nature of the transporter to mediate butyrate entry into cells. We conclude that Slc5a8 is an obligatory link between dietary fibre and mucosal immune system via the bacterial metabolite butyrate and that this transporter is a conditional tumour suppressor in colon linked to dietary fibre content. © 2015 Authors; published by Portland Press Limited.
Energy Technology Data Exchange (ETDEWEB)
Bruecke, T; Asenbaum, S; Frassine, H; Podreka, I [Vienna Univ. (Austria). Neurologische Klinik; Kornhuber, J [Wuerzburg Univ. (Germany); Angelberger, P [Oesterreichisches Forschungszentrum Seibersdorf GmbH (Austria)
1993-01-01
Single photon emission computerized tomography (SPECT) studies in non-human primates have previously shown that the cocaine derivative [[sup 123]I]-2-[beta]-carbomethoxy-3-[beta]-(4-iodophenyl)-tropane ([[sup 123]I][beta]-CIT) labels dopamine transporters in the striatum and serotonin transporters in the hypothalamus-midbrain area. Here, we report on the regional kinetic uptake of [[sup 123]I][beta]-CIT in the brain of 4 normal volunteers and 2 patients with Parkinson's disease. In healthy subjects striatal activity increased slowly to reach peak values at about 20 hours post injection. In the hypothalamus-midbrain area peak activities were observed at about 4 hours with a slow decrease thereafter. Low activity was observed in cortical and cerebellar areas. The striatal to cerebellar ratio was about 4 after 5 hours and 9 after 20 hours. In 2 patients with idiopathic Parkinson's disease striatal activity was markedly decreased while the activity in hypothalamus-midbrain areas was only diminished. Uptake into cortical and cerebellar areas appeared to be unchanged in Parkinson's disease. Consequently, in Parkinson's disease the striatal to cerebellar ratio was decreased to values around 2.5 after 20 hours. These preliminary methodological studies suggest that [[sup 123]I][beta]-CIT is a useful SPECT ligand for studying dopamine and possibly also serotonin transporters in the living human brain.
OCD candidate gene SLC1A1/EAAT3 impacts basal ganglia-mediated activity and stereotypic behavior.
Zike, Isaac D; Chohan, Muhammad O; Kopelman, Jared M; Krasnow, Emily N; Flicker, Daniel; Nautiyal, Katherine M; Bubser, Michael; Kellendonk, Christoph; Jones, Carrie K; Stanwood, Gregg; Tanaka, Kenji Fransis; Moore, Holly; Ahmari, Susanne E; Veenstra-VanderWeele, Jeremy
2017-05-30
Obsessive-compulsive disorder (OCD) is a chronic, disabling condition with inadequate treatment options that leave most patients with substantial residual symptoms. Structural, neurochemical, and behavioral findings point to a significant role for basal ganglia circuits and for the glutamate system in OCD. Genetic linkage and association studies in OCD point to SLC1A1 , which encodes the neuronal glutamate/aspartate/cysteine transporter excitatory amino acid transporter 3 (EAAT3)/excitatory amino acid transporter 1 (EAAC1). However, no previous studies have investigated EAAT3 in basal ganglia circuits or in relation to OCD-related behavior. Here, we report a model of Slc1a1 loss based on an excisable STOP cassette that yields successful ablation of EAAT3 expression and function. Using amphetamine as a probe, we found that EAAT3 loss prevents expected increases in ( i ) locomotor activity, ( ii ) stereotypy, and ( iii ) immediate early gene induction in the dorsal striatum following amphetamine administration. Further, Slc1a1 -STOP mice showed diminished grooming in an SKF-38393 challenge experiment, a pharmacologic model of OCD-like grooming behavior. This reduced grooming is accompanied by reduced dopamine D 1 receptor binding in the dorsal striatum of Slc1a1 -STOP mice. Slc1a1 -STOP mice also exhibit reduced extracellular dopamine concentrations in the dorsal striatum both at baseline and following amphetamine challenge. Viral-mediated restoration of Slc1a1 /EAAT3 expression in the midbrain but not in the striatum results in partial rescue of amphetamine-induced locomotion and stereotypy in Slc1a1 -STOP mice, consistent with an impact of EAAT3 loss on presynaptic dopaminergic function. Collectively, these findings indicate that the most consistently associated OCD candidate gene impacts basal ganglia-dependent repetitive behaviors.
Schipper, Pieter; Henckens, Marloes J A G; Lopresto, Dora; Kozicz, Tamas; Homberg, Judith R
2018-07-02
Life stress increases risk for developing post-traumatic stress disorder (PTSD), and more prominently so in short-allele carriers of the serotonin transporter linked polymorphic region (5-HTTLPR). Serotonin transporter knockout (5-HTT -/- ) rats show compromised extinction (recall) of conditioned fear, which might mediate the increased risk for PTSD and reduce the therapeutic efficacy of exposure therapy. Here, we assessed whether acute inescapable stress (IS) differentially affects fear extinction and extinction recall in 5-HTT -/- rats and wildtype controls. Surprisingly, IS experience improved fear extinction recall in 5-HTT -/- rats to the level of wildtype animals, while wildtypes were unaffected by this IS. Thus, whereas 5-HTT -/- rats evidently were more responsive to the stressor, the behavioral consequences presented themselves as adaptive. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Krogsgaard-Larsen, Niels; Jensen, Anders A.; Kehler, Jan
2010-01-01
Novel 7-phenylsulfanyl-1,2,3,4,10,10a-hexahydro-pyrazino[1,2-a]indoles are synthesized using a six-step protocol. Notably, the synthesis route make use of a new and improved ring-closing methodology for the assembly of the hexahydro-pyrazino[1,2-a]indole scaffold, which is based on intramolecular......-H insertion of a carbene. The compounds act as dual serotonin 5-HT2C- and 5-HT6-ligands....
Maswood, S; Truitt, W; Hotema, M; Caldarola-Pastuszka, M; Uphouse, L
1999-06-12
In vivo microdialysis was used to examine extracellular serotonin (5-HT) in the mediobasal hypothalamus (MBH) of male and female Fischer (CDF-344) rats. Females from the stages of diestrus, proestrus, and estrus were used. Additionally, ovariectomized rats, primed subcutaneously (s.c.) with estradiol benzoate or estradiol benzoate plus progesterone were examined. Extracellular 5-HT in the MBH varied with stage of the estrous cycle and with the light/dark cycle. Proestrous females had the highest microdialysate concentrations of 5-HT during the light portion of the light/dark cycle and lowest concentrations during the dark portion of the cycle. Diestrous females had the highest levels during the dark portion of the cycle, while males and estrous females showed little change between light and dark portions of the cycle. In ovariectomized rats, there was no effect of 2.5 microg or 25 microg estradiol benzoate (s.c.) on extracellular 5-HT; but the addition of 500 microg progesterone, 48 h after estrogen priming, reduced microdialysate 5-HT near the threshold for detection. In intact females and in males, reverse perfusion with 3 microM fluoxetine, a selective serotonin reuptake inhibitor (SSRI), or 2 microM methiothepin, a 5-HT receptor antagonist, increased microdialysate concentrations of 5-HT. Estrous females and males showed nearly a 4-fold increase in microdialysate 5-HT in response to fluoxetine while smaller responses were seen in diestrous and proestrous rats. In contrast, proestrous rats showed the largest response to methiothepin. Estrous females showed a delayed response to methiothepin, but there was no methiothepin-induced increase in extracellular 5-HT in males. These findings are discussed in reference to the suggestion that extracellular 5-HT in the MBH is regulated in a manner that is gender and estrous cycle dependent. The 5-HT terminal autoreceptor may exert a greater role in proestrous females; the serotonin transporter appears to play a more active
DEFF Research Database (Denmark)
Kjekshus, John K; Torp-Pedersen, Christian; Gullestad, Lars
2009-01-01
weeks up titration. The primary endpoint was LVEF measured by cardiac magnetic resonance imaging (MRI). Secondary endpoints were LV volumes, N-terminal pro-brain natriuretic peptide, norepinephrine, quality of life, and 6 min walk test. Piboserod significantly increased LVEF by 1.7% vs. placebo (CI 0.......3, 3.2, P = 0.020), primarily through reduced end-systolic volume from 165 to 158 mL (P = 0.060). There was a trend for greater increase in LVEF (2.7%, CI -1.1, 6.6, P = 0.15) in a small subset of patients not on chronic beta-blocker therapy. There was no significant effect on neurohormones, quality......AIMS: Myocardial 5-HT(4) serotonin (5-HT) receptors are increased and activated in heart failure (HF). Blockade of 5-HT(4) receptors reduced left ventricular (LV) remodelling in HF rats. We evaluated the effect of piboserod, a potent, selective, 5-HT(4) serotonin receptor antagonist, on LV function...
Wyant, Gregory A; Abu-Remaileh, Monther; Wolfson, Rachel L; Chen, Walter W; Freinkman, Elizaveta; Danai, Laura V; Vander Heiden, Matthew G; Sabatini, David M
2017-10-19
The mTORC1 kinase is a master growth regulator that senses many environmental cues, including amino acids. Activation of mTORC1 by arginine requires SLC38A9, a poorly understood lysosomal membrane protein with homology to amino acid transporters. Here, we validate that SLC38A9 is an arginine sensor for the mTORC1 pathway, and we uncover an unexpectedly central role for SLC38A9 in amino acid homeostasis. SLC38A9 mediates the transport, in an arginine-regulated fashion, of many essential amino acids out of lysosomes, including leucine, which mTORC1 senses through the cytosolic Sestrin proteins. SLC38A9 is necessary for leucine generated via lysosomal proteolysis to exit lysosomes and activate mTORC1. Pancreatic cancer cells, which use macropinocytosed protein as a nutrient source, require SLC38A9 to form tumors. Thus, through SLC38A9, arginine serves as a lysosomal messenger that couples mTORC1 activation to the release from lysosomes of the essential amino acids needed to drive cell growth. Copyright © 2017 Elsevier Inc. All rights reserved.
An association study of suicide and candidate genes in the serotonergic system
DEFF Research Database (Denmark)
Buttenschøn, Henriette N; Flint, Tracey J; Foldager, Leslie
2013-01-01
Introduction: Strong evidence demonstrates a genetic susceptibility to suicidal behaviour and a relationship between suicide and mental disorders. The aim of this study was to test for association between suicide and five selected genetic variants, which had shown association with suicide in other...... populations. Method: We performed a nationwide case-control study on all suicide cases sent for autopsy in Denmark between the years 2000 and 2007. The study comprised 572 cases and 1049 controls and is one of the largest genetic studies in completed suicide to date. The analysed markers were located within...... the Serotonin Transporter (SLC6A4), Monoamine Oxidase-A (MAOA) and the Ttyptophan Hydroxylase I and II (TPH1 and TPH2) genes. Results: None of the genetic markers within SLC6A4, MAOA, TPH1 and TPH2 were significantly associated with completed suicide or suicide method in the basic association tests. Exploratory...
DEFF Research Database (Denmark)
Chen, Neng; Tranebjærg, Lisbeth; Rendtorff, Nanna Dahl
2011-01-01
Pendred syndrome and DFNB4 (autosomal recessive nonsyndromic congenital deafness, locus 4) are associated with autosomal recessive congenital sensorineural hearing loss and mutations in the SLC26A4 gene. Extensive allelic heterogeneity, however, necessitates analysis of all exons and splice sites...
Nonkes, Lourens J. P.; van de Vondervoort, Ilse I. G. M.; de Leeuw, Mark J. C.; Wijlaars, Linda P.; Maes, Joseph H. R.; Homberg, Judith R.
2012-01-01
Behavioral flexibility is a cognitive process depending on prefrontal areas allowing adaptive responses to environmental changes. Serotonin transporter knockout (5-HTT[superscript -/-]) rodents show improved reversal learning in addition to orbitofrontal cortex changes. Another form of behavioral flexibility, extradimensional strategy set-shifting…
Preclinical pharmacological study on I-ADAM as a serotonin transporter ligand
International Nuclear Information System (INIS)
Wu Chunying; Lu Chunxiong; Jiang Quanfu; Zou Meifen; Chen Zhengping; Wang Songpei; Li Xiaomin; Zhang Tongxing; Zhu Junqing; Lin Xiangtong
2004-01-01
Objective: To evaluate the new ligand: I-2-( (22( (dimethylamino) methyl) phenyl) thio)-5- iodophenylamine (ADAM) as a serotonin imaging agent. Methods: Biological evaluations were performed in rats and mice. Results: Biodistribution studies in rats showed that the initial uptake of 131 I-ADAM in the brain was high (1.087%ID/organ at 2 min postinjection), and consistently displayed the highest binding (between 60-240 min postinjection) in hypothalamus, a region with the highest density of serotonin transporter (SERT). The specific binding [(TPCB)-1] of 131 I-ADAM in hypothalamus was 2.94, 3.03 and 3.09 at 60, 120 and 240 min postinjection, respectively. The (TPCB)-1 was significantly blocked by pretreatment with Paroxetine, which is known as a serotonin site reuptake inhibitor, while another nonselective competing drug, Ketanserin, showed no blocking effect. The rat brain autoradiography and analysis showed that there was high 131 I-ADAM uptake in hypothalamus, the ratio of hypothalamus/cerebellum was significantly reduced from 7.94 ± 0.39 to 1.30 ± 0.56 by pretreatment with Paroxetine at 60 min postinjection. Blood clearance kinetics was studied in rats, and the initial half-life of 13.79 min and late half-life of 357.14 min were obtained. The kinetic equation was: C=3.6147·e -0.0725t + 1.0413 e -0.0028t . The thyroid uptake was 0.009 and 1.421% ID/organ at 2 min and 120 min postinjection, respectively, suggesting that in vivo deiodination maybe the major route of metabolism. Toxicity trial showed that the dose per kilogram administered to mice was 1000 times greater than that to human beings, assuming a body-weight of 50 kg. Conclusion: These data suggest that 131 I-ADAM may be useful for SPECT imaging of SERT binding sits in the brain. (authors)
Expression analysis for inverted effects of serotonin transporter inactivation
International Nuclear Information System (INIS)
Ichikawa, Manabu; Okamura-Oho, Yuko; Shimokawa, Kazuro; Kondo, Shinji; Nakamura, Sakiko; Yokota, Hideo; Himeno, Ryutaro; Lesch, Klaus-Peter; Hayashizaki, Yoshihide
2008-01-01
Inactivation of serotonin transporter (HTT) by pharmacologically in the neonate or genetically increases risk for depression in adulthood, whereas pharmacological inhibition of HTT ameliorates symptoms in depressed patients. The differing role of HTT function during early development and in adult brain plasticity in causing or reversing depression remains an unexplained paradox. To address this we profiled the gene expression of adult Htt knockout (Htt KO) mice and HTT inhibitor-treated mice. Inverted profile changes between the two experimental conditions were seen in 30 genes. Consistent results of the upstream regulatory element search and the co-localization search of these genes indicated that the regulation may be executed by Pax5, Pax7 and Gata3, known to be involved in the survival, proliferation, and migration of serotonergic neurons in the developing brain, and these factors are supposed to keep functioning to regulate downstream genes related to serotonin system in the adult brain
Directory of Open Access Journals (Sweden)
Venkata Saroja eVoruganti
2013-12-01
Full Text Available Increased serum uric acid (SUA is a risk factor for gout and renal and cardiovascular disease. The purpose of this study was to identify genetic factors that affect the variation in SUA in 632 Mexican Americans participants of the San Antonio Family Heart Study (SAFHS. A genome-wide association analysis was performed using the Illumina Human Hap 550K single nucleotide polymorphism (SNP microarray. We used a linear regression-based association test under an additive model of allelic effect, while accounting for non-independence among family members via a kinship variance component. All analyses were performed in the software package SOLAR. SNPs rs6832439, rs13131257 and rs737267 in solute carrier protein 2 family, member 9 (SLC2A9 were associated with SUA at genome-wide significance (p <1.3×10-7. The minor alleles of these SNPs had frequencies of 36.2%, 36.2%, and 38.2 %, respectively, and were associated with decreasing SUA levels. All of these SNPs were located in introns 3-7 of SLC2A9, the location of the previously reported associations in European populations. When analyzed for association with cardiovascular-renal disease risk factors, conditional on SLC2A9 SNPs strongly associated with SUA, significant associations were found for SLC2A9 SNPs with BMI, body weight and waist circumference (p < 1.4 x 10-3 and suggestive associations with albumin-creatinine ratio and total antioxidant status. The SLC2A9 gene encodes an urate transporter that has considerable influence on variation in SUA. In addition to the primary association locus, suggestive evidence (p<1.9×10-6 for joint linkage/association was found at a previously-reported urate quantitative trait locus (Logarithm of odds score = 3.6 on 3p26.3. In summary, our GWAS extends and confirms the association of SLC2A9 with SUA for the first time in a Mexican American cohort and also shows for the first time its association with cardiovascular-renal disease risk factors.
DEFF Research Database (Denmark)
Rasmussen, Henrik B; Werge, Thomas M
2007-01-01
determination. After having developed a 5-HTTLPR genotyping assay, we examined all samples of DNA in two separate rounds of analyses and found complete agreement between the results from these two rounds. CONCLUSION: On the basis of simultaneous analysis of tandem repeat size variation and variation of single......BACKGROUND: The serotonin transporter, the target of a group of antidepressant drugs, is involved in the regulation of the availability and reuptake of serotonin. A variable number of tandem repeats in the promoter region of the serotonin transporter gene, designated 5-HTTLPR, affects...... for detailed genotyping of 5-HTTLPR based upon simultaneous analysis of tandem repeat size variation and single nucleotide variations. METHODS: We elaborated a list of all known 5-HTTLPR alleles to provide an overview of the allele repertoire at this polymorphic locus. Fragments of 5-HTTLPR were PCR...
Role of Serotonin Transporter Changes in Depressive Responses to Sex-Steroid Hormone Manipulation
DEFF Research Database (Denmark)
Frokjaer, Vibe Gedsoe; Pinborg, Anja; Holst, Klaus Kähler
2015-01-01
.6 ± 2.2) and at follow-up (16.2 ± 2.6 days after intervention start). RESULTS: Sex hormone manipulation with GnRHa significantly triggered subclinical depressive symptoms within-group (p = .003) and relative to placebo (p = .02), which were positively associated with net decreases in estradiol levels (p......BACKGROUND: An adverse response to acute and pronounced changes in sex-hormone levels during, for example, the perimenopausal or postpartum period appears to heighten risk for major depression in women. The underlying risk mechanisms remain elusive but may include transiently compromised...... serotonergic brain signaling. Here, we modeled a biphasic ovarian sex hormone fluctuation using a gonadotropin-releasing hormone agonist (GnRHa) and evaluated if emergence of depressive symptoms was associated with change in cerebral serotonin transporter (SERT) binding following intervention. METHODS...
Fujimoto, Yohei; Funao, Tomoharu; Suehiro, Koichi; Takahashi, Ryota; Mori, Takashi; Nishikawa, Kiyonobu
2015-01-01
Tramadol-induced seizures might be pathologically associated with serotonin syndrome. Here, the authors investigated the relationship between serotonin and the seizure-inducing potential of tramadol. Two groups of rats received pretreatment to modulate brain levels of serotonin and one group was treated as a sham control (n = 6 per group). Serotonin modulation groups received either para-chlorophenylalanine or benserazide + 5-hydroxytryptophan. Serotonin, dopamine, and histamine levels in the posterior hypothalamus were then measured by microdialysis, while simultaneously infusing tramadol until seizure onset. In another experiment, seizure threshold with tramadol was investigated in rats intracerebroventricularly administered with either a serotonin receptor antagonist (methysergide) or saline (n = 6). Pretreatment significantly affected seizure threshold and serotonin fluctuations. The threshold was lowered in para-chlorophenylalanine group and raised in benserazide + 5-hydroxytryptophan group (The mean ± SEM amount of tramadol needed to induce seizures; sham: 43.1 ± 4.2 mg/kg, para-chlorophenylalanine: 23.2 ± 2.8 mg/kg, benserazide + 5-hydroxytryptophan: 59.4 ± 16.5 mg/kg). Levels of serotonin at baseline, and their augmentation with tramadol infusion, were less in the para-chlorophenylalanine group and greater in the benserazide + 5-hydroxytryptophan group. Furthermore, seizure thresholds were negatively correlated with serotonin levels (correlation coefficient; 0.71, P seizure threshold (P seizures, and that serotonin concentrations were negatively associated with seizure thresholds. Moreover, serotonin receptor antagonism precipitated seizure manifestation, indicating that tramadol-induced seizures are distinct from serotonin syndrome.
Rotavirus and Serotonin Cross-Talk in Diarrhoea
Nordgren, Johan; Karlsson, Thommie; Sharma, Sumit; Magnusson, Karl-Eric; Svensson, Lennart
2016-01-01
Rotavirus (RV) has been shown to infect and stimulate secretion of serotonin from human enterochromaffin (EC) cells and to infect EC cells in the small intestine of mice. It remains to identify which intracellularly expressed viral protein(s) is responsible for this novel property and to further establish the clinical role of serotonin in RV infection. First, we found that siRNA specifically silencing NSP4 (siRNANSP4) significantly attenuated secretion of serotonin from Rhesus rotavirus (RRV) infected EC tumor cells compared to siRNAVP4, siRNAVP6 and siRNAVP7. Second, intracellular calcium mobilization and diarrhoeal capacity from virulent and avirulent porcine viruses correlated with the capacity to release serotonin from EC tumor cells. Third, following administration of serotonin, all (10/10) infants, but no (0/8) adult mice, responded with diarrhoea. Finally, blocking of serotonin receptors using Ondansetron significantly attenuated murine RV (strain EDIM) diarrhoea in infant mice (2.9 vs 4.5 days). Ondansetron-treated mice (n = 11) had significantly (p serotonin receptor antagonist significantly (p serotonin from human EC tumor cells and that serotonin participates in RV diarrhoea, which can be attenuated by Ondansetron. PMID:27459372
Directory of Open Access Journals (Sweden)
Li Wang
2012-01-01
Full Text Available Many active components of herbal products are small organic anions, and organic anion transporters were previously demonstrated to be a potential site of drug-drug interactions. In this study, we assessed the inhibitory effects of six hydrophilic components of the herbal medicine Danshen, lithospermic acid, protocatechuic acid, rosmarinic acid, salvianolic acid A, salvianolic acid B, and tanshinol, on the function of the murine organic anion transporters, mOat1 and mOat3. All of Danshen components significantly inhibited mOat1- and mOat3-mediated substrate uptake (<0.001 with lithospermic acid (LSA, protocatechuic acid, rosmarinic acid (RMA, and salvianolic acid A (SAA producing virtually complete inhibition under test conditions. Kinetic analysis demonstrated that LSA, RMA, and SAA were competitive inhibitors. As such, values were estimated as 14.9±4.9 μM for LSA, 5.5±2.2 μM for RMA, and 4.9±2.2 μM for SAA on mOat1-mediated transport, and as 31.1±7.0 μM for LSA, 4.3±0.2 μM for RMA, and 21.3±7.7 μM for SAA on mOat3-mediated transport. These data suggest that herb-drug interactions may occur in vivo on the human orthologs of these transporters in situations of polypharmacy involving Danshen and clinical therapeutics known to be organic anion transporter substrates.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC832 (Link to dictyBase) - - - Contig-U13922-1 SLC832Z (Link... to Original site) - - SLC832Z 638 - - - - Show SLC832 Library SL (Link to library) Clone ID SLC832 (Link to dic..._1( EU565733 |pid:none) Uncultured soil bacterium clone gl... 35 2.4 CP000010_276....1 AP009385_2728( AP009385 |pid:none) Burkholderia multivorans ATCC 1... 33 5.3 A... 20.0 %: nuclear 16.0 %: vesicles of secretory system 12.0 %: mitochondrial 8.0 %: Golgi 8.0 %: endoplasmic reticul
Energy Technology Data Exchange (ETDEWEB)
Nicol, Alice [NHS Greater Glasgow and Clyde, Department of Nuclear Medicine, Southern General Hospital, Glasgow (United Kingdom); Krishnadas, Rajeev [University of Glasgow, Sackler Institute of Psychobiological Research, Glasgow (United Kingdom); Champion, Sue [University of Glasgow, Institute of Neuroscience and Psychology, College of Medical, Veterinary and Life Sciences, Glasgow (United Kingdom); Tamagnan, Gilles [Institute for Neurodegenerative Disorders, New Haven, CT (United States); Stehouwer, Jeffrey S.; Goodman, Mark M. [Emory University, Department of Radiology and Imaging Sciences, Atlanta, GA (United States); Hadley, Donald M. [NHS Greater Glasgow and Clyde, Department of Neuro-Radiology, Institute of Neurological Sciences, Glasgow (United Kingdom); Pimlott, Sally L. [NHS Greater Glasgow and Clyde, West of Scotland Radionuclide Dispensary, Glasgow (United Kingdom)
2012-05-15
{sup 123}I-labelled mZIENT (2{beta}-carbomethoxy-3{beta}-(3'-((Z)-2-iodoethenyl)phenyl)nortropane) has been developed as a radioligand for the serotonin transporter. The aim of this preliminary study was to assess its whole-body biodistribution in humans and estimate dosimetry. Three healthy controls and three patients receiving selective serotonin reuptake inhibitor (SSRI) therapy for depression were included (two men, four women, age range 41-56 years). Whole-body imaging, brain SPECT imaging and blood and urine sampling were performed. Whole-body images were analysed using regions of interest (ROIs), time-activity curves were derived using compartmental analysis and dosimetry estimated using OLINDA software. Brain ROI analysis was performed to obtain specific-to-nonspecific binding ratios in the midbrain, thalamus and striatum. Initial high uptake in the lungs decreased in later images. Lower uptake was seen in the brain, liver and intestines. Excretion was primarily through the urinary system. The effective dose was estimated to be of the order of 0.03 mSv/MBq. The organ receiving the highest absorbed dose was the lower large intestine wall. Uptake in the brain was consistent with the known SERT distribution with higher specific-to-nonspecific binding in the midbrain, thalamus and striatum in healthy controls compared with patients receiving SSRI therapy. {sup 123}I-mZIENT may be a promising radioligand for imaging the serotonin transporters in humans with acceptable dosimetry. (orig.)
Serotonin transporter evolution and impact of polymorphic transcriptional regulation
DEFF Research Database (Denmark)
Søeby, Karen; Larsen, Svend Ask; Olsen, Line
2005-01-01
The serotonin transporter (SERT) is the primary drug target in the current antidepressant therapy. A functional polymorphism in the 2nd intron of the 5HTT gene encoding the SERT has been identified and associated with susceptibility to affective disorders and treatment response to antidepressants....... This study addresses the possible impact of the variable number of tandem repeats (VNTR) to behavior and disease by examining the evolutionary origin and mechanisms of differential transcriptional regulation of SERT. We trace the evolutionary origin of the VNTR and show that it is present and varies...
Nonkes, L.J.P.; Homberg, J.R.
2013-01-01
Environmental stimuli can influence behavior via the process of Pavlovian conditioning. Recent genetic research suggests that some individuals are more sensitive to environmental stimuli for behavioral guidance than others. One important mediator of this effect is serotonin transporter (5-HTT)
Ichikawa, Shoji; Tuchman, Shamir; Padgett, Leah R.; Gray, Amie K.; Baluarte, H. Jorge; Econs, Michael J.
2013-01-01
Hereditary hypophosphatemic rickets with hypercalciuria (HHRH) is a rare metabolic disorder, characterized by hypophosphatemia, variable degrees of rickets/osteomalacia, and hypercalciuria secondary to increased serum 1,25-dihydroxyvitamin D [1,25(OH)2D] levels. HHRH is caused by mutations in the SLC34A3 gene, which encodes sodium-phosphate co-transporter type IIc. A 6 ½-year-old female presented with a history of nephrolithiasis. Her metabolic evaluation revealed increased 24- hour urine calcium excretion with high serum calcium, low intact parathyroid hormone (PTH) levels, and elevated 1,25(OH)2D level. In addition, the patient had low to low-normal serum phosphorus with high urine phosphorus. The patient had normal stature; without rachitic or boney deformities or a history of fractures. Genetic analysis of SLC34A3 revealed the patient to be a compound heterozygote for a novel single base pair deletion in exon 12 (c.1304delG) and 30-base pair deletion in intron 6 (g.1440–1469del). The single-base pair mutation causes a frameshift, which results in premature stop codon. The intronic deletion is likely caused by misalignment of the 4-basepair homologous repeats and results in the truncation of an already small intron to 63 bp, which would impair proper RNA splicing of the intron. This is the fourth unique intronic deletion identified in patients with HHRH, suggesting the frequent occurrence of sequence misalignments in SLC34A3 and the importance of screening introns in patients with HHRH. PMID:24176905
Interaction of organic cation transporter 3 (SLC22A3) and amphetamine.
Zhu, Hao-Jie; Appel, David I; Gründemann, Dirk; Markowitz, John S
2010-07-01
The organic cation transporter (OCT) 3 is widely expressed in various organs in humans, and involved in the disposition of many exogenous and endogenous compounds. Several lines of evidence have suggested that OCT3 expressed in the brain plays an important role in the regulation of neurotransmission. Relative to wild-type (WT) animals, Oct3 knockout (KO) mice have displayed altered behavioral and neurochemical responses to psychostimulants such as amphetamine (AMPH) and methamphetamine. In the present study, both in vitro and in vivo approaches were utilized to explore potential mechanisms underlying the disparate neuropharmacological effects observed following AMPH exposure in Oct3 KO mice. In vitro uptake studies conducted in OCT3 transfected cells indicated that dextroamphetamine (d-AMPH) is not a substrate of OCT3. However, OCT3 was determined to be a high-capacity and low-affinity transporter for the neurotransmitters dopamine (DA), norepinephrine (NE), and serotonin (5-HT). Inhibition studies demonstrated that d-AMPH exerts relatively weak inhibitory effects on the OCT3-mediated uptake of DA, NE, 5-HT, and the model OCT3 substrate 4-(4-(dimethylamino)styryl)-N-methylpyridinium iodide. The IC(50) values were determined to be 41.5 +/- 7.5 and 24.1 +/- 7.0 microM for inhibiting DA and 5-HT uptake, respectively, while 50% inhibition of NE and 4-(4-(dimethylamino)styryl)-N-methylpyridinium iodide uptake was not achieved by even the highest concentration of d-AMPH applied (100 microM). Furthermore, the disposition of d-AMPH in various tissues including the brain, liver, heart, kidney, muscle, intestine, spleen, testis, uterus, and plasma were determined in both male and female Oct3 KO and WT mice. No significant difference was observed between either genotypes or sex in all tested organs and tissues. Our findings suggest that OCT3 is not a prominent factor influencing the disposition of d-AMPH. Additionally, based upon the inhibitory potency observed in vitro, d
Serotonin 6 receptor controls alzheimer?s disease and depression
Yun, Hyung-Mun; Park, Kyung-Ran; Kim, Eun-Cheol; Kim, Sanghyeon; Hong, Jin Tae
2015-01-01
Alzheimer?s disease (AD) and depression in late life are one of the most severe health problems in the world disorders. Serotonin 6 receptor (5-HT6R) has caused much interest for potential roles in AD and depression. However, a causative role of perturbed 5-HT6R function between two diseases was poorly defined. In the present study, we found that a 5-HT6R antagonist, SB271036 rescued memory impairment by attenuating the generation of A? via the inhibition of ?-secretase activity and the inact...
De Grandis, Elisa; Stagnaro, Michela; Biancheri, Roberta; Giannotta, Melania; Gobbi, Giuseppe; Traverso, Monica; Veneselli, Edvige; Zara, Federico
2013-07-01
Alternating hemiplegia of childhood is a rare, predominantly sporadic disorder. Diagnosis is clinical, and little is known about genetics. Glucose transporter 1 deficiency syndrome shares with alternating hemiplegia of childhood paroxysmal and nonparoxysmal symptoms. The aim of the study was to investigate glucose transporter 1 mutations in 30 Italian patients. Genetic material was analyzed by DNA amplification and glucose transporter 1 region sequencing. Mutational analysis findings of the SLC2A1 gene were negative in all patients. The pattern of movement disorders was reviewed. Interictal dystonia and multiple paroxysmal events were typical of alternating hemiplegia of childhood. In conclusion, alternating hemiplegia of childhood is a heterogeneous clinical condition, and although glucose transporter 1 deficiency can represent an undiagnosed cause of this disorder, mutational analysis is not routinely recommended. Alternatively, a careful clinical analysis and the 3-O-methyl-D-glucose uptake test can allow prompt identification of a subgroup of patients with alternating hemiplegia of childhood treatable with a ketogenic diet.
Dispersive effects of transverse displacements of SLC Arc magnets
International Nuclear Information System (INIS)
Murray, J.J.; Fieguth, T.; Kheifets, S.
1986-01-01
The SLC Arc magnets are subject to random displacements and field errors resulting in unpredictable transverse displacement of the central trajectory from that of the design. The chosen method of correcting this perturbed trajectory in the SLC Arcs utilizes mechanical movement of the combined function magnets which compose the Arc transport lines. Here we present the results of a recent investigation substantiating the earlier results which led to the adoption of this method
Boycott, Kym M.; Beaulieu, Chandree L.; Kernohan, Kristin D.; Gebril, Ola H.; Mhanni, Aziz; Chudley, Albert E.; Redl, David; Qin, Wen; Hampson, Sarah; Küry, Sébastien; Tetreault, Martine; Puffenberger, Erik G.; Scott, James N.; Bezieau, Stéphane; Reis, André; Uebe, Steffen; Schumacher, Johannes; Hegele, Robert A.; McLeod, D. Ross; Gálvez-Peralta, Marina; Majewski, Jacek; Ramaekers, Vincent T.; Nebert, Daniel W.; Innes, A. Micheil; Parboosingh, Jillian S.; Abou Jamra, Rami
2015-01-01
Manganese (Mn) and zinc (Zn) are essential divalent cations used by cells as protein cofactors; various human studies and animal models have demonstrated the importance of Mn and Zn for development. Here we describe an autosomal-recessive disorder in six individuals from the Hutterite community and in an unrelated Egyptian sibpair; the disorder is characterized by intellectual disability, developmental delay, hypotonia, strabismus, cerebellar atrophy, and variable short stature. Exome sequencing in one affected Hutterite individual and the Egyptian family identified the same homozygous variant, c.112G>C (p.Gly38Arg), affecting a conserved residue of SLC39A8. The affected Hutterite and Egyptian individuals did not share an extended common haplotype, suggesting that the mutation arose independently. SLC39A8 is a member of the solute carrier gene family known to import Mn, Zn, and other divalent cations across the plasma membrane. Evaluation of these two metal ions in the affected individuals revealed variably low levels of Mn and Zn in blood and elevated levels in urine, indicating renal wasting. Our findings identify a human Mn and Zn transporter deficiency syndrome linked to SLC39A8, providing insight into the roles of Mn and Zn homeostasis in human health and development. PMID:26637978
Bastiaansen, Jojanneke A.; Servaas, Michelle N.; Marsman, Jan-Bernard; Ormel, Johan; Nolte, Ilja M.; Riese, Harriette; Aleman, Andre
2014-01-01
The alleged association between the serotonin-transporter-linked polymorphic region (5-HTTLPR) and amygdala activation forms a cornerstone of the common view that carrying the short allele of this polymorphism is a potential risk factor for affective disorders. The authors of a recent meta-analysis
Bastiaansen, Jojanneke A.; Servaas, Michelle N.; Marsman, Jan-Bernard; Ormel, Johan; Nolte, Ilja M.; Riese, Harriette; Aleman, Andre
The alleged association between the serotonin-transporter-linked polymorphic region (5-HTTLPR) and amygdala activation forms a cornerstone of the common view that carrying the short allele of this polymorphism is a potential risk factor for affective disorders. The authors of a recent meta-analysis
Gao, Xiaoxue; Liu, Jinting; Gong, Pingyuan; Wang, Junhui; Fang, Wan; Yan, Hongming; Zhu, Lusha; Zhou, Xiaolin
2017-09-01
The framing effect refers the tendency to be risk-averse when options are presented positively but be risk-seeking when the same options are presented negatively during decision-making. This effect has been found to be modulated by the serotonin transporter gene (SLC6A4) and the catechol-o-methyltransferase gene (COMT) polymorphisms, which are on the dopaminergic and serotonergic pathways and which are associated with affective processing. The current study aimed to identify new genetic variations of genes on dopaminergic and serotonergic pathways that may contribute to individual differences in the susceptibility to framing. Using genome-wide association data and the gene-based principal components regression method, we examined genetic variations of 26 genes on the pathways in 1317 Chinese Han participants. Consistent with previous studies, we found that the genetic variations of the SLC6A4 gene and the COMT gene were associated with the framing effect. More importantly, we demonstrated that the genetic variations of the aromatic-L-amino-acid decarboxylase (DDC) gene, which is involved in the synthesis of both dopamine and serotonin, contributed to individual differences in the susceptibility to framing. Our findings shed light on the understanding of the genetic basis of affective decision-making. © The Author (2017). Published by Oxford University Press.
Gao, Xiaoxue; Liu, Jinting; Gong, Pingyuan; Wang, Junhui; Fang, Wan; Yan, Hongming; Zhu, Lusha
2017-01-01
Abstract The framing effect refers the tendency to be risk-averse when options are presented positively but be risk-seeking when the same options are presented negatively during decision-making. This effect has been found to be modulated by the serotonin transporter gene (SLC6A4) and the catechol-o-methyltransferase gene (COMT) polymorphisms, which are on the dopaminergic and serotonergic pathways and which are associated with affective processing. The current study aimed to identify new genetic variations of genes on dopaminergic and serotonergic pathways that may contribute to individual differences in the susceptibility to framing. Using genome-wide association data and the gene-based principal components regression method, we examined genetic variations of 26 genes on the pathways in 1317 Chinese Han participants. Consistent with previous studies, we found that the genetic variations of the SLC6A4 gene and the COMT gene were associated with the framing effect. More importantly, we demonstrated that the genetic variations of the aromatic-L-amino-acid decarboxylase (DDC) gene, which is involved in the synthesis of both dopamine and serotonin, contributed to individual differences in the susceptibility to framing. Our findings shed light on the understanding of the genetic basis of affective decision-making. PMID:28431168
Price, G Dean; Howitt, Susan M
2014-09-01
This mini-review addresses advances in understanding the transmembrane topologies of two unrelated, single-subunit bicarbonate transporters from cyanobacteria, namely BicA and SbtA. BicA is a Na(+)-dependent bicarbonate transporter that belongs to the SulP/SLC26 family that is widespread in both eukaryotes and prokaryotes. Topology mapping of BicA via the phoA/lacZ fusion reporter method identified 12 transmembrane helices with an unresolved hydrophobic region just beyond helix 8. Re-interpreting this data in the light of a recent topology study on rat prestin leads to a consensus topology of 14 transmembrane domains with a 7+7 inverted repeat structure. SbtA is also a Na(+)-dependent bicarbonate transporter, but of considerably higher affinity (Km 2-5 μM versus >100 μM for BicA). Whilst SbtA is widespread in cyanobacteria and a few bacteria, it appears to be absent from eukaryotes. Topology mapping of SbtA via the phoA/lacZ fusion reporter method identified 10 transmembrane helices. The topology consists of a 5+5 inverted repeat, with the two repeats separated by a large intracellular loop. The unusual location of the N and C-termini outside the cell raises the possibility that SbtA forms a novel fold, not so far identified by structural and topological studies on transport proteins.
Baas, Dominique C.; Ho, Lintje; Tanck, Michael W.T.; Fritsche, Lars G.; Merriam, Joanna E.; van het Slot, Ruben; Koeleman, Bobby P.C.; Gorgels, Theo G.M.F.; van Duijn, Cornelia M.; Uitterlinden, André G.; de Jong, Paulus T.V.M.; Hofman, Albert; ten Brink, Jacoline B.; Vingerling, Johannes R.; Klaver, Caroline C.W.; Dean, Michael; Weber, Bernhard H. F.; Allikmets, Rando; Hageman, Gregory S.
2012-01-01
Purpose Age-related macular degeneration (AMD) is a major cause of blindness in older adults and has a genetically complex background. This study examines the potential association between single nucleotide polymorphisms (SNPs) in the glucose transporter 1 (SLC2A1) gene and AMD. SLC2A1 regulates the bioavailability of glucose in the retinal pigment epithelium (RPE), which might influence oxidative stress–mediated AMD pathology. Methods Twenty-two SNPs spanning the SLC2A1 gene were genotyped in 375 cases and 199 controls from an initial discovery cohort (the Amsterdam-Rotterdam-Netherlands study). Replication testing was performed in The Rotterdam Study (the Netherlands) and study populations from Würzburg (Germany), the Age Related Eye Disease Study (AREDS; United States), Columbia University (United States), and Iowa University (United States). Subsequently, a meta-analysis of SNP association was performed. Results In the discovery cohort, significant genotypic association between three SNPs (rs3754219, rs4660687, and rs841853) and AMD was found. Replication in five large independent (Caucasian) cohorts (4,860 cases and 4,004 controls) did not yield consistent association results. The genotype frequencies for these SNPs were significantly different for the controls and/or cases among the six individual populations. Meta-analysis revealed significant heterogeneity of effect between the studies. Conclusions No overall association between SLC2A1 SNPs and AMD was demonstrated. Since the genotype frequencies for the three SLC2A1 SNPs were significantly different for the controls and/or cases between the six cohorts, this study corroborates previous evidence that population dependent genetic risk heterogeneity in AMD exists. PMID:22509097
The Serotonin Transporter Gene Polymorphisms and Risk of Ischemic Stroke
DEFF Research Database (Denmark)
Mortensen, Janne Kærgård; Kraglund, Kristian Lundsgaard; Johnsen, Søren Paaske
2018-01-01
may influence platelet activity, as they result in different levels of transporters and thereby different levels of serotonin in platelets. SERT gene polymorphisms have thus been associated with the risk of myocardial infarction. A similar association may exist between SERT gene polymorphisms...... and stroke. However, to our knowledge, this potential association has not previously been studied. We therefore aimed to investigate the association between polymorphisms in the SERT gene and the risk of ischemic stroke/transitory ischemic attack (TIA). MATERIALS AND METHODS: We conducted a case...
DEFF Research Database (Denmark)
Andersen, Jacob; Kristensen, Anders Skov; Bang-Andersen, Benny
2009-01-01
The biogenic monoamine transporters are integral membrane proteins that perform active transport of extracellular dopamine, serotonin and norepinephrine into cells. These transporters are targets for therapeutic agents such as antidepressants, as well as addictive substances such as cocaine...... and amphetamine. Seminal advances in the understanding of the structure and function of this transporter family have recently been accomplished by structural studies of a bacterial transporter, as well as medicinal chemistry and pharmacological studies of mammalian transporters. This feature article focuses...
Directory of Open Access Journals (Sweden)
Guilherme Rubino de Azevedo Focchi
2011-01-01
Full Text Available Objetivo: Avaliar a associação entre a resposta ao tratamento da dependência de nicotina com bupropiona e a presença do polimorfismo SLC6A3 3’UTR VNTR, localizado no gene que codifica o transportador dopaminérgico. Método: Foram acompanhados no Ambulatório de Tabagismo do Instituto de Psiquiatria da Faculdade de Medicina da USP 100 pacientes do sexo masculino com diagnóstico de dependência de nicotina, sem outras patologias. Todos receberam bupropiona até 300 mg ao dia por 12 semanas, associada à terapia cognitivo-comportamental em grupo. A Escala de Fagerström foi aplicada no início e no final do tratamento, e avaliou-se a parada do uso de cigarros na última semana de tratamento e um mês após. Os pacientes tiveram 10 ml de sangue colhidos e genotipados para a existência do polimorfismo SLC6A3 3’UTR VNTR. Resultados: Não foi encontrada associação entre cessação do uso de cigarro e presença do polimorfismo. Conclusão: São necessários mais estudos para avaliar se a presença do polimorfismo SLC6A3 3’UTR VNTR estaria relacionada à melhor resposta ao tratamento da dependência de nicotina.
Lamb, R J; Daws, L C
2013-10-01
Low serotonin function is associated with alcoholism, leading to speculation that increasing serotonin function could decrease ethanol consumption. Mice with one or two deletions of the serotonin transporter (SERT) gene have increased extracellular serotonin. To examine the relationship between SERT genotype and motivation for alcohol, we compared ethanol self-administration in mice with zero (knockout, KO), one (HET) or two copies (WT) of the SERT gene. All three genotypes learned to self-administer ethanol. The SSRI, fluvoxamine, decreased responding for ethanol in the HET and WT, but not the KO mice. When tested under a progressive ratio schedule, KO mice had lower breakpoints than HET or WT. As work requirements were increased across sessions, behavioral economic analysis of ethanol self-administration indicated that the decreased breakpoint in KO as compared to HET or WT mice was a result of lower levels of unconstrained demand, rather than differences in elasticity, i.e. the proportional decreases in ethanol earned with increasing work requirements were similar across genotypes. The difference in unconstrained demand was unlikely to result from motor or general motivational factors, as both WT and KO mice responded at high levels for a 50% condensed milk solution. As elasticity is hypothesized to measure essential value, these results indicate that KO value ethanol similarly to WT or HET mice despite having lower break points for ethanol. © 2013 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.
Bahadoran, Shahab; Dehghani Samani, Amir; Hassanpour, Hossein
2018-01-01
Heat stress is a problem in laying hens as it decreases egg quality by decreasing eggshell mineralization. Heat stress alters gene expression, hence our aim was to investigate effects of heat stress on gene expression of ion transport elements involving in uterine mineralization (TRPV6, CALB1, ITPR3, SCNN1G, SLC4A4, KCNJ15, SLC4A9, and CLCN2) by real time quantitative PCR. Forty 23-week-old White Leghorn laying hens were housed in two rooms. The control group (n = 20) was maintained at 21-23 °C, and the heat stress group (n = 20) was exposed to 36-38 °C for 8 weeks. All parameters of egg quality including egg weight, surface area, volume, and eggshell weight, thickness, ash weight, and calcium content were decreased in the heat stress group compared to the control group (by 26.9%, 32.7%, 44.1%, 38.4%, 31.7%, 39.4%, and 11.1%, respectively). Total plasma calcium was decreased by 13.4%. Levels of ITPR3, SLC4A4, and SLC4A9 transcripts in the uterine lining were decreased in the heat stress group compared to the control group (by 61.4%, 66.1%, and 66.1%, respectively). CALB1 transcript level was increased (by 34.2 fold) in the heat stress group of hens compared to controls. TRPV6, SCNN1G, KCNJ15, and CLCN2 transcript levels did not significantly differ between control and heat stress groups of laying hens. It is concluded that the down-expression of ITPR3, SLC4A4, and SLC4A9 genes may impair transportation of Cl - , HCO 3 - , and Na + in eggshell mineralization during heat stress. Increased CALB1 gene expression may increase resistance of uterine cells to detrimental effects of heat stress.
Effect of the 5-HT4 receptor and serotonin transporter on visceral hypersensitivity in rats
International Nuclear Information System (INIS)
Chi, Yan; Liu, Xin-Guang; Wang, Hua-Hong; Li, Jun-Xia; Li, Yi-Xuan
2012-01-01
Visceral hypersensitivity plays an important role in motor and sensory abnormalities associated with irritable bowel syndrome, but the underlying mechanisms are not fully understood. The present study was designed to evaluate the expression of the 5-HT 4 receptor and the serotonin transporter (SERT) as well as their roles in chronic visceral hypersensitivity using a rat model. Neonatal male Sprague-Dawley rats received intracolonic injections of 0.5% acetic acid (0.3-0.5 mL at different times) between postnatal days 8 and 21 to establish an animal model of visceral hypersensitivity. On day 43, the threshold intensity for a visually identifiable contraction of the abdominal wall and body arching were recorded during rectal distention. Histological evaluation and the myeloperoxidase activity assay were performed to determine the severity of inflammation. The 5-HT 4 receptor and SERT expression of the ascending colon were monitored using immunohistochemistry and Western blot analyses; the plasma 5-HT levels were measured using an ELISA method. As expected, transient colonic irritation at the neonatal stage led to visceral hypersensitivity, but no mucosal inflammation was later detected during adulthood. Using this model, we found reduced SERT expression (0.298 ± 0.038 vs 0.634 ± 0.200, P < 0.05) and increased 5-HT 4 receptor expression (0.308 ± 0.017 vs 0.298 ± 0.021, P < 0.05). Treatment with fluoxetine (10 mg·kg −1 ·day −1 , days 36-42), tegaserod (1 mg·kg −1 ·day −1 , day 43), or the combination of both, reduced visceral hypersensitivity and plasma 5-HT levels. Fluoxetine treatment increased 5-HT 4 receptor expression (0.322 ± 0.020 vs 0.308 ± 0.017, P < 0.01) but not SERT expression (0.219 ± 0.039 vs 0.298 ± 0.038, P = 0.654). These results indicate that both the 5-HT 4 receptor and SERT play a role in the pathogenesis of visceral hypersensitivity, and its mechanism may be involved in the local 5-HT level
Effect of the 5-HT4 receptor and serotonin transporter on visceral hypersensitivity in rats
Directory of Open Access Journals (Sweden)
Chi Yan
2012-10-01
Full Text Available Visceral hypersensitivity plays an important role in motor and sensory abnormalities associated with irritable bowel syndrome, but the underlying mechanisms are not fully understood. The present study was designed to evaluate the expression of the 5-HT4 receptor and the serotonin transporter (SERT as well as their roles in chronic visceral hypersensitivity using a rat model. Neonatal male Sprague-Dawley rats received intracolonic injections of 0.5% acetic acid (0.3-0.5 mL at different times between postnatal days 8 and 21 to establish an animal model of visceral hypersensitivity. On day 43, the threshold intensity for a visually identifiable contraction of the abdominal wall and body arching were recorded during rectal distention. Histological evaluation and the myeloperoxidase activity assay were performed to determine the severity of inflammation. The 5-HT4 receptor and SERT expression of the ascending colon were monitored using immunohistochemistry and Western blot analyses; the plasma 5-HT levels were measured using an ELISA method. As expected, transient colonic irritation at the neonatal stage led to visceral hypersensitivity, but no mucosal inflammation was later detected during adulthood. Using this model, we found reduced SERT expression (0.298 ± 0.038 vs 0.634 ± 0.200, P < 0.05 and increased 5-HT4 receptor expression (0.308 ± 0.017 vs 0.298 ± 0.021, P < 0.05. Treatment with fluoxetine (10 mg·kg-1·day-1, days 36-42, tegaserod (1 mg·kg-1·day-1, day 43, or the combination of both, reduced visceral hypersensitivity and plasma 5-HT levels. Fluoxetine treatment increased 5-HT4 receptor expression (0.322 ± 0.020 vs 0.308 ± 0.017, P < 0.01 but not SERT expression (0.219 ± 0.039 vs 0.298 ± 0.038, P = 0.654. These results indicate that both the 5-HT4 receptor and SERT play a role in the pathogenesis of visceral hypersensitivity, and its mechanism may be involved in the local 5-HT level.
Hernandez, L L
2017-12-01
The mammary gland regulates maternal metabolism during lactation. Numerous factors within the tissue send signals to shift nutrients to the mammary gland for milk synthesis. Serotonin is a monoamine that has been well documented to regulate several aspects of lactation among species. Maintenance of maternal calcium homeostasis during lactation is a highly evolved process that is elegantly regulated by the interaction of the mammary gland with the bone, gut, and kidney tissues. It is well documented that dietary calcium is insufficient to maintain maternal calcium concentrations during lactation, and mammals must rely on bone resorption to maintain normocalcemia. Our recent work focused on the ability of the mammary gland to function as an accessory parathyroid gland during lactation. It was demonstrated that serotonin acts to stimulate parathyroid hormone-related protein (PTHrP) in the mammary gland during lactation. The main role of mammary-derived PTHrP during mammalian lactation is to stimulate bone resorption to maintain maternal calcium homeostasis during lactation. In addition to regulating PTHrP, it was shown that serotonin appears to directly affect calcium transporters and pumps in the mammary gland. Our current working hypothesis regarding the control of calcium during lactation is as follows: serotonin directly stimulates PTHrP production in the mammary gland through interaction with the sonic hedgehog signaling pathway. Simultaneously, serotonin directly increases calcium movement into the mammary gland and, subsequently, milk. These 2 direct actions of serotonin combine to induce a transient maternal hypocalcemia required to further stimulate PTHrP production and calcium mobilization from bone. Through these 2 routes, serotonin is able to improve maternal calcium concentrations. Furthermore, we have shown that Holstein and Jersey cows appear to regulate calcium in different manners and also respond differently to serotonergic stimulation of the calcium
Wang, Tzu-Yun; Lee, Sheng-Yu; Chen, Shiou-Lan; Chang, Yun-Hsuan; Chen, Shih-Heng; Chu, Chun-Hsien; Huang, San-Yuan; Tzeng, Nian-Sheng; Wang, Chen-Lin; Lee, I Hui; Yeh, Tzung Lieh; Yang, Yen Kuang; Lu, Ru-Band
2012-07-11
Several studies have hypothesized that genes regulating the components of the serotonin system, including serotonin transporter (5-HTTLPR) and serotonin 1 B receptor (5-HT1B), may be associated with alcoholism, but their results are contradictory because of alcoholism's heterogeneity. Therefore, we examined whether the 5-HTTLPR gene and 5-HT1B gene G861C polymorphism are susceptibility factors for a specific subtype of alcoholism, antisocial alcoholism in Han Chinese in Taiwan. We recruited 273 Han Chinese male inmates with antisocial personality disorder (ASPD) [antisocial alcoholism (AS-ALC) group (n=120) and antisocial non-alcoholism (AS-N-ALC) group (n=153)] and 191 healthy male controls from the community. Genotyping was done using PCR-RFLP. There were no significant differences in the genotypic frequency of the 5-HT1B G861C polymorphism between the 3 groups. Although AS-ALC group members more frequently carried the 5-HTTLPR S/S, S/LG, and LG/LG genotypes than controls, the difference became non-significant after controlling for the covarying effects of age. However, the 5-HTTLPR S/S, S/LG, and LG/LG genotypes may have interacted with the 5-HT1B G861C C/C polymorphism and increased the risk of becoming antisocial alcoholism. Our study suggests that neither the 5-HTTLPR gene nor the 5-HT1B G861C polymorphism alone is a risk factor for antisocial alcoholism in Taiwan's Han Chinese population, but that the interaction between both genes may increase susceptibility to antisocial alcoholism.
Brody, Gene H; Beach, Steven R H; Chen, Yi-Fu; Obasi, Ezemenari; Philibert, Robert A; Kogan, Steven M; Simons, Ronald L
2011-05-01
This study examined the prospective relations of adolescents' perceptions of discrimination and their genetic status with increases in conduct problems. Participants were 461 African American youths residing in rural Georgia (Wave 1 mean age = 15.5 years) who provided three waves of data and a saliva sample from which a polymorphism in the SCL6A4 (serotonin transporter [5-HTT]) gene polymorphism known as the 5-HTT linked promoter region (5-HTTLPR) was genotyped. Data analyses using growth curve modeling indicated that perceived discrimination was significantly related to the slope of conduct problems. As hypothesized, interactions between perceived discrimination and genetic status emerged for male but not female youths. Compared with those carrying two copies of the long allele variant of 5-HTTLPR, male youths carrying one or two copies of its short allele variant evinced higher rates of conduct problems over time when they perceived high levels of racial discrimination. These findings are consistent with resilience and differential susceptibility propositions stating that genes can both foster sensitivity to adverse events and confer protection from those events.
DEFF Research Database (Denmark)
Andersen, Gitte; Rose, Christian Schack; Hamid, Yasmin Hassan
2003-01-01
The SLC2A10 gene encodes the GLUT10 facilitative glucose transporter, which is expressed in high amounts in liver and pancreas. The gene is mapped to chromosome 20q12-q13.1, a region that has been shown to be linked to type 2 diabetes. The gene was examined in 61 Danish type 2 diabetic patients......, and a total of six variants (-27C-->T, Ala206Thr, Ala272Ala, IVS2 + 10G-->A, IVS4 + 18T-->G, and IVS4 + 26G-->A) were identified and investigated in an association study, which included 503 type 2 diabetic patients and 510 glucose-tolerant control subjects. None of the variants were associated with type 2...... substantially to the pathogenesis of type 2 diabetes in the examined study population. However, the codon 206 polymorphism may be related to the interindividual variation in fasting and oral glucose-induced serum insulin levels....
Evolutionary relationships and functional diversity of plant sulfate transporters
Directory of Open Access Journals (Sweden)
Hideki eTakahashi
2012-01-01
Full Text Available Sulfate is an essential nutrient cycled in nature. Ion transporters that specifically facilitate the transport of sulfate across the membranes are found ubiquitously in living organisms. The phylogenetic analysis of known sulfate transporters and their homologous proteins from eukaryotic organisms indicate two evolutionarily distinct groups of sulfate transport systems. One major group named Tribe 1 represents yeast and fungal SUL, plant SULTR and animal SLC26 families. The evolutionary origin of SULTR family members in land plants and green algae is suggested to be common with yeast and fungal sulfate transporters (SUL and animal anion exchangers (SLC26. The lineage of plant SULTR family is expanded into four subfamilies (SULTR1 to SULTR4 in land plant species. By contrast, the putative SULTR homologues from Chlorophyte green algae are in two separate lineages; one with the subfamily of plant tonoplast-localized sulfate transporters (SULTR4, and the other diverged before the appearance of lineages for SUL, SULTR and SLC26. There also was a group of yet undefined members of putative sulfate transporters in yeast and fungi divergent from these major lineages in Tribe 1. The other distinct group is Tribe 2, primarily composed of animal sodium-dependent sulfate/carboxylate transporters (SLC13 and plant tonoplast-localized dicarboxylate transporters (TDT. The putative sulfur-sensing protein (SAC1 and SAC1-like transporters (SLT of Chlorophyte green algae, bryophyte and lycophyte show low degrees of sequence similarities with SLC13 and TDT. However, the phylogenetic relationship between SAC1/SLT and the other two families, SLC13 and TDT in Tribe 2, is not clearly supported. In addition, the SAC1/SLT family is completely absent in the angiosperm species analyzed. The present study suggests distinct evolutionary trajectories of sulfate transport systems for land plants and green algae.
Walderhaug, Espen; Herman, Aryeh Isaac; Magnusson, Andres; Morgan, Michael John; Landrø, Nils Inge
2010-01-01
Reduced serotonergic neurotransmission is implicated in impulsive behavior. We studied the triallelic system of the serotonin transporter gene linked polymorphic region (5-HTTLPR) and acute manipulation of serotonin together to further delineate the mechanisms by which serotonergic neurotransmission affects impulsivity. Fifty-two healthy participants (38 men and 14 women) underwent acute tryptophan depletion (ATD) or placebo in a randomized, double-blind, parallel group experiment. Impulsive ...
Berg, L. van den; Vos-Loohuis, M.; Schilder, M.B.H.; Oost, B.A. van; Hazewinkel, H.A.W.; Wade, C.M.; Karlsson, E.K.; Lindblad-Toh, K.; Liinamo, A.E.; Leegwater, P.A.J.
2008-01-01
Aggressive behavior displays a high heritability in our study group ofGolden Retriever dogs.Alterations in brain serotonin metabolism have been described in aggressive dogs before. Here, we evaluate whether four genes of the canine serotonergic system, coding for the serotonin receptors 1A, 1B,
Positive selection in the SLC11A1 gene in the family Equidae
DEFF Research Database (Denmark)
Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan
2016-01-01
Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes...... a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans...... and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence...
S113R mutation in SLC33A1 leads to neurodegeneration and augmented BMP signaling in a mouse model
Directory of Open Access Journals (Sweden)
Pingting Liu
2017-01-01
Full Text Available The S113R mutation (c.339T>G (MIM #603690.0001 in SLC33A1 (MIM #603690, an ER membrane acetyl-CoA transporter, has been previously identified in individuals with hereditary spastic paraplegia type 42 (SPG42; MIM #612539. SLC33A1 has also been shown to inhibit the bone morphogenetic protein (BMP signaling pathway in zebrafish. To better understand the function of SLC33A1, we generated and characterized Slc33a1S113R knock-in mice. Homozygous Slc33a1S113R mutant mice were embryonic lethal, whereas heterozygous Slc33a1 mutant mice (Slc33a1wt/mut exhibited behavioral abnormalities and central neurodegeneration, which is consistent with hereditary spastic paraplegia (HSP phenotypes. Importantly, we found an upregulation of BMP signaling in the nervous system and mouse embryonic fibroblasts of Slc33a1wt/mut mice. Using a sciatic nerve crush injury model in vivo and dorsal root ganglion (DRG culture in vitro we showed that injury-induced axonal regeneration in Slc33a1wt/mut mice was accelerated and mediated by upregulated BMP signaling. Exogenous addition of BMP signaling antagonist, noggin, could efficiently alleviate the accelerated injury-induced axonal regrowth. These results indicate that SLC33A1 can negatively regulate BMP signaling in mice, further supporting the notion that upregulation of BMP signaling is a common mechanism of a subset of hereditary spastic paraplegias.
Serotonin transporter genotype modulates social reward and punishment in rhesus macaques.
Directory of Open Access Journals (Sweden)
Karli K Watson
Full Text Available Serotonin signaling influences social behavior in both human and nonhuman primates. In humans, variation upstream of the promoter region of the serotonin transporter gene (5-HTTLPR has recently been shown to influence both behavioral measures of social anxiety and amygdala response to social threats. Here we show that length polymorphisms in 5-HTTLPR predict social reward and punishment in rhesus macaques, a species in which 5-HTTLPR variation is analogous to that of humans.In contrast to monkeys with two copies of the long allele (L/L, monkeys with one copy of the short allele of this gene (S/L spent less time gazing at face than non-face images, less time looking in the eye region of faces, and had larger pupil diameters when gazing at photos of a high versus low status male macaques. Moreover, in a novel primed gambling task, presentation of photos of high status male macaques promoted risk-aversion in S/L monkeys but promoted risk-seeking in L/L monkeys. Finally, as measured by a "pay-per-view" task, S/L monkeys required juice payment to view photos of high status males, whereas L/L monkeys sacrificed fluid to see the same photos.These data indicate that genetic variation in serotonin function contributes to social reward and punishment in rhesus macaques, and thus shapes social behavior in humans and rhesus macaques alike.
Serotonin metabolism in rat brain
International Nuclear Information System (INIS)
Schutte, H.H.
1976-01-01
The metabolism of serotonin in rat brain was studied by measuring specific activities of tryptophan in plasma and of serotonin, 5-hydroxyindole acetic acid and tryptophan in the brain after intravenous injection of tritiated tryptophan. For a detailed analysis of the specific activities, a computer simulation technique was used. It was found that only a minor part of serotonin in rat brain is synthesized from tryptophan rapidly transported from the blood. It is suggested that the brain tryptophan originates from brain proteins. It was also found that the serotonin in rat brain is divided into more than one metabolic compartment
Evolutionary relationships and functional diversity of plant sulfate transporters.
Takahashi, Hideki; Buchner, Peter; Yoshimoto, Naoko; Hawkesford, Malcolm J; Shiu, Shin-Han
2011-01-01
Sulfate is an essential nutrient cycled in nature. Ion transporters that specifically facilitate the transport of sulfate across the membranes are found ubiquitously in living organisms. The phylogenetic analysis of known sulfate transporters and their homologous proteins from eukaryotic organisms indicate two evolutionarily distinct groups of sulfate transport systems. One major group named Tribe 1 represents yeast and fungal SUL, plant SULTR, and animal SLC26 families. The evolutionary origin of SULTR family members in land plants and green algae is suggested to be common with yeast and fungal SUL and animal anion exchangers (SLC26). The lineage of plant SULTR family is expanded into four subfamilies (SULTR1-SULTR4) in land plant species. By contrast, the putative SULTR homologs from Chlorophyte green algae are in two separate lineages; one with the subfamily of plant tonoplast-localized sulfate transporters (SULTR4), and the other diverged before the appearance of lineages for SUL, SULTR, and SLC26. There also was a group of yet undefined members of putative sulfate transporters in yeast and fungi divergent from these major lineages in Tribe 1. The other distinct group is Tribe 2, primarily composed of animal sodium-dependent sulfate/carboxylate transporters (SLC13) and plant tonoplast-localized dicarboxylate transporters (TDT). The putative sulfur-sensing protein (SAC1) and SAC1-like transporters (SLT) of Chlorophyte green algae, bryophyte, and lycophyte show low degrees of sequence similarities with SLC13 and TDT. However, the phylogenetic relationship between SAC1/SLT and the other two families, SLC13 and TDT in Tribe 2, is not clearly supported. In addition, the SAC1/SLT family is absent in the angiosperm species analyzed. The present study suggests distinct evolutionary trajectories of sulfate transport systems for land plants and green algae.
Shen, Hong; Liu, Tongtong; Morse, Bridget L; Zhao, Yue; Zhang, Yueping; Qiu, Xi; Chen, Cliff; Lewin, Anne C; Wang, Xi-Tao; Liu, Guowen; Christopher, Lisa J; Marathe, Punit; Lai, Yurong
2015-07-01
The contribution of organic anion transporter OAT2 (SLC22A7) to the renal tubular secretion of creatinine and its exact localization in the kidney are reportedly controversial. In the present investigation, the transport of creatinine was assessed in human embryonic kidney (HEK) cells that stably expressed human OAT2 (OAT2-HEK) and isolated human renal proximal tubule cells (HRPTCs). The tubular localization of OAT2 in human, monkey, and rat kidney was characterized. The overexpression of OAT2 significantly enhanced the uptake of creatinine in OAT2-HEK cells. Under physiologic conditions (creatinine concentrations of 41.2 and 123.5 µM), the initial rate of OAT2-mediated creatinine transport was approximately 11-, 80-, and 80-fold higher than OCT2, multidrug and toxin extrusion protein (MATE)1, and MATE2K, respectively, resulting in approximately 37-, 1850-, and 80-fold increase of the intrinsic transport clearance when normalized to the transporter protein concentrations. Creatinine intracellular uptake and transcellular transport in HRPTCs were decreased in the presence of 50 µM bromosulfophthalein and 100 µM indomethacin, which inhibited OAT2 more potently than other known creatinine transporters, OCT2 and multidrug and toxin extrusion proteins MATE1 and MATE2K (IC50: 1.3 µM vs. > 100 µM and 2.1 µM vs. > 200 µM for bromosulfophthalein and indomethacin, respectively) Immunohistochemistry analysis showed that OAT2 protein was localized to both basolateral and apical membranes of human and cynomolgus monkey renal proximal tubules, but appeared only on the apical membrane of rat proximal tubules. Collectively, the findings revealed the important role of OAT2 in renal secretion and possible reabsorption of creatinine and suggested a molecular basis for potential species difference in the transporter handling of creatinine. Copyright © 2015 by The American Society for Pharmacology and Experimental Therapeutics.
Rao, Shitao; Leung, Cherry She Ting; Lam, Macro Hb; Wing, Yun Kwok; Waye, Mary Miu Yee; Tsui, Stephen Kwok Wing
2017-03-01
To date almost 200 genes were found to be associated with major depressive disorder (MDD) or suicide attempts (SA), but very few genes were reported for their molecular mechanisms. This study aimed to find out whether there were common or rare variants in three candidate genes altering the risk for MDD and SA in Chinese. Three candidate genes (HOMER1, SLC6A4 and TEF) were chosen for resequencing analysis and association studies as they were reported to be involved in the etiology of MDD and SA. Following that, bioinformatics analyses were applied on those variants of interest. After resequencing analysis and alignment for the amplicons, a total of 34 common or rare variants were found in the randomly selected 36 Hong Kong Chinese patients with both MDD and SA. Among those, seven variants show potentially deleterious features. Rs60029191 and a rare variant located in regulatory region of the HOMER1 gene may affect the promoter activities through interacting with predicted transcription factors. Two missense mutations existed in the SLC6A4 coding regions were firstly reported in Hong Kong Chinese MDD and SA patients, and both of them could affect the transport efficiency of SLC6A4 to serotonin. Moreover, a common variant rs6354 located in the untranslated region of this gene may affect the expression level or exonic splicing of serotonin transporter. In addition, both of a most studied polymorphism rs738499 and a low-frequency variant in the promoter region of the TEF gene were found to be located in potential transcription factor binding sites, which may let the two variants be able to influence the promoter activities of the gene. This study elucidated the potentially molecular mechanisms of the three candidate genes altering the risk for MDD and SA. These findings implied that not only common variants but rare variants could make contributions to the genetic susceptibility to MDD and SA in Chinese. Copyright © 2016 Elsevier B.V. All rights reserved.
X-Linked Creatine Transporter Deficiency Presenting as a Mitochondrial Disorder
Hathaway, S.C.; Friez, M.; Limbo, K.; Parker, C.; Salomons, G.S.; Vockley, J.; Wood, T.; Abdul-Rahman, O.A.
2010-01-01
X-linked creatine transporter defect is caused by mutations in SLC6A8 at Xq28, which encodes the sodium-dependent creatine transporter. Reduction in creatine uptake results in elevated urine creatine and CSF creatine deficiency, which can be detected on magnetic resonance spectroscopy. We report a
Directory of Open Access Journals (Sweden)
Desmond J Oathes
Full Text Available Serotonin transporter gene variants are known to interact with stressful life experiences to increase chances of developing affective symptoms, and these same variants have been shown to influence amygdala reactivity to affective stimuli in non-psychiatric populations. The impact of these gene variants on affective neurocircuitry in anxiety and mood disorders has been studied less extensively. Utilizing a triallelic assay (5-HTTLPR and rs25531 to assess genetic variation linked with altered serotonin signaling, this fMRI study investigated genetic influences on amygdala and anterior insula activity in 50 generalized anxiety disorder patients, 26 of whom also met DSM-IV criteria for social anxiety disorder and/or major depressive disorder, and 39 healthy comparison subjects. A Group x Genotype interaction was observed for both the amygdala and anterior insula in a paradigm designed to elicit responses in these brain areas during the anticipation of and response to aversive pictures. Patients who are S/L(G carriers showed less activity than their L(A/L(A counterparts in both regions and less activity than S/L(G healthy comparison subjects in the amygdala. Moreover, patients with greater insula responses reported higher levels of intolerance of uncertainty, an association that was particularly pronounced for patients with two LA alleles. A genotype effect was not established in healthy controls. These findings link the serotonin transporter gene to affective circuitry findings in anxiety and depression psychopathology and further suggest that its impact on patients may be different from effects typically observed in healthy populations.
DEFF Research Database (Denmark)
Chattaraj, Parna; Munjal, Tina; Honda, Keiji
2017-01-01
BACKGROUND: Enlargement of the vestibular aqueduct (EVA) is the most common radiological abnormality in children with sensorineural hearing loss. Mutations in coding regions and splice sites of the SLC26A4 gene are often detected in Caucasians with EVA. Approximately one-fourth of patients with E...